text
stringlengths
1.55k
332k
label
int64
0
8
a method for manufacturing a support member for supporting semiconductor device elements in accordance with an embodiment of the present invention is described below with reference to the accompanying drawings . fig1 is a cross - sectional view showing a step in a manufacturing process for a support member 100 for semiconductor devices in accordance with the present embodiment . the support member 100 for semiconductor device elements in accordance with the present embodiment preferably supports reflective type liquid crystal semiconductor device elements , and uses a conductive film 103 ( i . e . a tungsten metal film ) as a light reflective plate . a method for manufacturing support member 100 along with reflective type liquid crystal device elements is described below . fig1 is a cross - sectional view in which a conductive film 103 for trapping mobile ions , such as sodium ions , is formed over a silica glass base 101 . a support member 100 in accord with the present invention is formed in the following manner . a first silicon oxide film 102 , which is a first dielectric layer , is deposited on silica glass base 101 by using a cvd process ( chemical vapor deposition , or chemical vapor phase growth ). a tungsten film 103 , which is a conductive film , is then formed on oxide film 102 preferably by using a sputter method . a second silicon oxide film 104 , which constitutes a second dielectric film , is then formed on tungsten film 103 preferably by a cvd process . it is noted here that first silicon oxide film 102 has a preferred film thickness of 0 . 4 μm , tungsten film 103 has a preferred film thickness of 200 nm , and second silicon oxide film 104 has a preferred thickness of 200 nm . fig2 is a cross - sectional view showing a step in which a polycrystal silicon film 201 is formed on support member 100 . the polycrystal silicon film 201 is preferably formed by forming an amorphous silicon film , and then annealing the same . fig3 is a cross - sectional view showing a step in which the polycrystal silicon film 201 is selectively etched . to accomplish this , a resist layer 301 is first formed on polycrystal silicon film 201 . the resist 301 is then patterned using photolithography to configure resist 301 into a process mask . then , using resist 301 as a mask , the polycrystal silicon film 201 is etched to define areas where a transistor 302 ( see fig7 ) and a retention capacitor 303 ( see fig7 ) are to be constructed . as shown in fig4 , after removing resist mask 301 by ashing , a first plate of what will be retention capacitor 303 and source / drain regions 402 of what will be mos transistor 302 are formed . specifically , using as a mask a resist layer 401 , which has been patterned using a photolithography process , phosphorous ions are injected in exposed portions of polycrystal silicon film 201 to from source / drain regions 402 of mos transistor 302 and to form a conductive plate of retention capacitor 303 . fig5 is a cross - sectional view showing another process step in the construction of the mos transistor and the retention capacitor . the resist layer 401 of fig4 is removed by ashing , and then a silicon oxide film 501 is formed . silicon oxide film 501 is later patterned to form a gate oxide for mos transistor 302 and to form an inter - plate dielectric film for the capacitor 303 . a polycrystal silicon film 502 is then formed on silicon oxide film 501 . polycrystal silicon 502 is later patterned to form a control gate electrode over the gate oxide of mos transistor 302 , and to form a second conductive plate over the dielectric film of retention capacitor 303 . then , a resist mask 503 is formed on polycrystal silicon film 502 by patterning using photolithography . it is noted that the polycrystal silicon film 502 is preferably formed by forming an amorphous silicon film containing phosphorous , and annealing the same . fig6 is a cross - sectional view showing a step following an ashing step to remove resist mask 503 . using resist 503 as a mask , polycrystal silicon film 502 was etched , and after the etching was complete , the resist mask 503 was removed by ashing . at this point , a control gate 601 of mos transistor 302 and a plate electrode 602 of retention capacitor 303 are formed . fig7 is a cross - sectional view showing the construction of metal wiring layers . an interlayer dielectric film 701 composed of a silicon oxide film is formed by a cvd process , contact holes are then opened in specified portions of interlayer dielectric film 701 by photolithography . following this , an aluminum film preferably containing silicon and copper added therein is formed by a sputtering , a resist mask is then formed by photolithography , and selected regions of the aluminum film is removed as defined by the resist mask . this leaves specific areas of aluminum film , which form aluminum wiring 702 . the the resist mask is preferably removed by ashing . next , a method for driving the support member 100 with semiconductor device elements formed thereon is described with reference to fig7 . in fig7 , when the lowest potential that is applied to semiconductor device elements formed on support member 100 ( such as mos transistor 302 and retention capacitance 303 ) is 0v , a potential of − 3v is applied to tungsten film 103 , which is a constituent element of support member 100 , for driving the same . because a voltage that is lower than the lowest potential of 0v applied to the semiconductor device elements is applied to tungsten film 103 , alkaline metal ions ( such as sodium ions , that are mobile and positively charged and present in silica glass base 101 and silicon oxide films 102 and 104 ) migrate to tungsten film 103 ( which is maintained at a lower potential of − 3v ) and are trapped and fixed by the tungsten film 103 . because a method of drawing ( i . e . attracting ) and holding fixed ( i . e . trapping ) mobile ions by means of an electric field is used , mobile ions that are present not only adjacent to the tungsten film 103 that is used for trapping the mobile ions , but also mobile ions within a range in which electric lines of force of the tungsten film 103 reach can be attracted and trapped by the tungsten film 103 . therefore , operation of the semiconductor device elements can be made more stabile as compared to the prior art case using an insulating barrier to block the penetration of mobile ions and keep them fixed to a phosphorsilicate glass . also , the tungsten film 103 is conductive . for this reason , a capacitance region can be formed with the electrode 403 laminated through the silicon oxide film 104 deposited on the tungsten film 103 . in addition to the retention capacitor formed with the electrode 403 , the silicon oxide film 501 and the electrode 602 , a capacitor is also formed with electrode 403 , silicon oxide film 104 and tungsten film 103 , such that a greater retention capacitance value can be formed within a smaller area . in the case of the presently preferred embodiment where the silicon oxide film 104 is 200 nm in thickness and the silicon oxide film 501 is 100 nm in thickness , an area necessary for obtaining an equivalent capacitance can be achieved with about 70 % less area than is needed in the case where the tungsten film 103 is not present , such that the area necessary for construction a retention capacitor can be reduced . also , in accord with the present embodiment , mos transistor 302 and other semiconductor device elements on the support member 100 are electrically shielded . for this reason , even when electric noise infiltrates due to certain factors , malfunctions of mos transistor 302 can be effectively suppressed by the shielding effect of the tungsten film 103 . also , the tungsten film 103 is a light blocking material . accordingly , when the tungsten film 103 is present under mos transistor 302 , light infiltrating from the back surface of support member 100 is blocked , such that malfunctions of mos transistor 302 caused by light , in particular , an increase in the off current accompanied with generation of carriers in the semiconductor due to light irradiation , can be prevented . ( 1 ) because the tungsten film 103 , which is a metal film having light blocking properties is used , areas of semiconductor device elements ( including transistors ) are shielded from light . for this reason , a leakage current due to carriers caused by light , which poses a problem especially in an off state , can be suppressed . ( 2 ) because the silicon oxide film 102 having few mobile ions is formed by a cvd method as a buffer layer on the silica glass base 101 that contains many mobile ions such as sodium ions , operations of the semiconductor device elements can be further stabilized . ( 3 ) because the transparent dielectric layer 104 is formed on the tungsten film 103 , which is a metal of a high light - reflecting ability , a reflective type device can be readily formed . ( 4 ) because the tungsten film 103 , which is an electrical conductor , is used for attracting and trapping mobile ions , a function of a capacitive element ( such as a capacitor ) and a shielding function can be obtained in addition to a gettering function for mobile ions . ( 5 ) because mobile ions are attracted and fixed by applying a negative potential to the tungsten film 103 , the mobile ions can be trapped within a range defined by the reach of electric lines of force , such that mobile ions in a greater range can be attracted and trapped , as compared to the case where a phosphosilicate glass is used for blocking infiltration ( i . e . migration ) by mobile ions . instead of using the silicate glass base 101 as a base in the present embodiment , and forming the silicon oxide film 102 thereon by a cvd method , a metal or semiconductor material may be used as a base . in particular , by using a base having a soi ( silicon on insulator : silicon ( normally in single crystal ) on a dielectric ) structure , electrically excellent device characteristics can be obtained . instead of forming the silicon oxide film 102 as a first dielectric on the silica glass base 101 in the present embodiment , a tungsten film 103 ( which is a metal film ) may be formed without forming the silicon oxide film 102 . when the base is dielectric , the first dielectric film can be omitted . instead of forming a reflective type liquid crystal device by leaving the tungsten film 103 as a light reflecting film , the present embodiment can be applied to , for example , a light transmissive type liquid crystal device . specifically , this can be realized by forming a tungsten film 103 , and immediately thereafter , etching the tungsten film 103 in portions where liquid crystal elements are to be formed . in this instance , by etching the tungsten film 103 while leaving portions thereof where the mos transistor 302 and the retention capacitor 303 are present , mobile ions can be fixed , the capacitance of the retention capacitor 303 can be increased , and effects of light blocking mask can be obtained . instead of using the tungsten film 103 as a light reflecting film for fixing mobile ions in the present embodiment , or without limiting the subject matter to the application of tungsten for use as a light reflecting film , other metals , such as , for example , an aluminum film laminated in an upper layer can be used as a light reflecting film . instead of using the silicate glass base 101 as a base in accordance with the present embodiment , for example , a plastic material base can also be used . in this case , although the tungsten film 103 can be used for fixing mobile ions without a problem , a much softer metal such as aluminum may preferably be used . also , when a plastic material substrate is used , it may be difficult to perform a high temperature treatment at 800 ° c . or higher . accordingly , instead of using the polycrystal silicon film 201 as a semiconductor film , amorphous silicon may be used as a semiconductor film . to recap one operation of the present invention , when the lowest operating potential that is applied to semiconductor device elements ( such as transistor 302 and capacitor 303 ) on the support member 100 is 0v , a protective potential of − 3v may be applied to the tungsten film 103 , which is a constituent element of support member 100 . because the protective voltage applied to the tungsten film 103 is lower than the lowest operating potential of 0v applied to the semiconductor device elements , mobile and positively charged alkaline metal ions , such as sodium ions , present in the silica glass base 101 and in silicon oxide films 102 and 104 migrate to the tungsten film 103 due to the attractive force of the maintained lower potential , and are thereby trapped by and fixed to the tungsten film 103 . while the invention has been described in conjunction with several specific embodiments , it is evident to those skilled in the art that many further alternatives , modifications and variations will be apparent in light of the foregoing description . thus , the invention described herein is intended to embrace all such alternatives , modifications , applications and variations as may fall within the spirit and scope of the appended claims .
7
fig1 shows a simplified view of an inventive magnetic resonance facility 1 . the facility 1 includes a main magnet unit 2 , which defines a cylindrical patient accommodation region 3 , into which a patient 4 may be moved via a patient couch 5 for the magnetic resonance measurement . it may be seen that part of the internal surface of the patient accommodation region 3 is taken up by a display surface 6 of a display apparatus , on which animated clouds are shown as an image , conveying an impression of spatial depth for a patient 4 and also having a calming effect . the display apparatus may be implemented on different small display units , which are arranged in the manner of a matrix in rows , each arranged at an angle to one another . fig2 shows an embodiment based on a section through the main magnet unit 2 in the region of the patient accommodation region 3 . provided to enclose the patient accommodation region are a gradient coil arrangement 7 ( not shown in detail ) and , following the arrangement 7 in an inward direction , a high - frequency coil arrangement 8 , the support tube 9 of which is shown in detail . the display apparatus 10 in this case includes two display units 11 ( shown in cross section ), which are integrated in the support tube 9 or fastened in a recess and include organic light - emitting diodes ( not shown in detail ) disposed on a flexible substrate 12 . for protection , the display units 11 are also covered with a layer 13 of protective material , which may be for example glass , plexiglas or a thermoplastic carbonate . the substrate 12 may also be made of pet . the layer 13 is configured as scratch - resistant , biocompatible and high frequency - transparent , with the display units 11 overall also being configured to be as magnetic resonance - compatible as possible . data transmission and energy transmission to the display units 11 of the display apparatus 10 occur wirelessly in this instance but may occur in a wired manner . the display units 11 may not cover the entire length of the patient accommodation region 3 , but a number of the flexible oled display units 11 may be provided over the length . a matrix - type arrangement of a number of display units may therefore also be provided . the flexibility of the substrate 12 and therefore of the entire display unit 11 is such that the substrate 12 and the display unit 11 match the boundary of the magnetic resonance accommodation region 3 perfectly , with part of the cylinder of the internal surface of the patient accommodation region 3 being formed by the layer 13 , which is supplemented by suitable cladding elements 14 , which are shown as adjoining the display units 11 in a flush manner . the substrates 12 may be provided pre - shaped for the boundary of the magnetic resonance accommodation region 3 , this also being supported by oled technology . the support tube 9 may not be changed , and the display apparatus 10 may be fastened on the support tube 9 or on fully circumferential cladding 14 of the patient accommodation region 3 . the operation of the display apparatus 10 is controlled by a central control facility 15 of the magnetic resonance facility 1 , which therefore allows the desired information or images to be displayed . fig3 shows an example of a display on the display surface 6 of the display apparatus 10 during a standard magnetic resonance measurement . the background is formed by the image 16 , which in the present instance shows an animated sky . provided in the bottom right corner of the display surface 6 is a region 17 for patient information 18 relating to a current magnetic resonance measurement . in the present instance , the display surface 6 shows a percentage indicating how much of the examination has already been completed , both in numbers 19 and via a progress indicator 20 . other useful information may also be displayed , for example , the time , the remaining duration of the magnetic resonance measurement , the name of the patient and the like . a further region 21 , which is not always used , is reserved for breathing - related instructions 22 , e . g ., telling the patient to hold his / her breath . if a functional magnetic resonance measurement ( fmri ) is to be performed , the display surface 6 may also display visual stimuli for the patient 4 . it is to be understood that the elements and features recited in the appended claims may be combined in different ways to produce new claims that likewise fall within the scope of the present invention . thus , whereas the dependent claims appended below depend from only a single independent or dependent claim , it is to be understood that these dependent claims may , alternatively , be made to depend in the alternative from any preceding or following claim , whether independent or dependent , and that such new combinations are to be understood as forming a part of the present specification . while the present invention has been described above by reference to various embodiments , it should be understood that many changes and modifications may be made to the described embodiments . it is therefore intended that the foregoing description be regarded as illustrative rather than limiting , and that it be understood that all equivalents and / or combinations of embodiments are intended to be included in this description .
0
referring to fig1 , the system for moving a solar tracker in rotation 10 according to the invention comprises an arch 20 forming a circular arc whose centre is on the axis of rotation 63 . the arch 20 is fixed at each of its ends to a link part 30 making it possible to link the arch 20 to the framework of the solar tracker 60 . the link between each of the ends of the arch 20 with the link parts 30 is illustrated in detail in fig2 and 3 . each of the ends of the arch 20 has orifices passing through the arch 20 . here , there are two of these orifices . also , they are at right angles to a plane of the arch and come , when the arch 20 is mounted on the link parts 30 , to face equivalent orifices situated at an end of each of the link parts 30 . when the arch 20 is mounted on the link parts 30 , a screw 41 is introduced into each of the orifices passing through the arch 20 , then a first damping means 45 is positioned on each of the screws 41 , then the link part 30 is put in place on the two screws 41 so as to sandwich the first damping means 45 between the link part 30 and the arch 20 . then , each of the screws 41 has a second damping means 44 threaded onto it , followed by a washer 43 , the duly produced stack assembly then being tightened using a nut 42 screwed onto a threading situated at the end of each of the screws 41 . the first damping means 45 and the second damping means 44 are of “ silentbloc ” type . in particular , the first damping means 45 and the second damping means 44 take the form of washers or blocks made of elastomer of epdm ( ethylene - propylene - diene monomer ) type . the advantage of using an elastomer of epdm type is that it makes it possible to obtain first damping means 45 and second damping means 44 which withstand the outside conditions , that is to say , in particular , water and ultraviolet rays due to the solar radiation . once mounted , the link part 30 is , from the vibrational point of view , insulated from the arch 20 by the first 45 and second 44 damping means . other elastomers can be used for this purpose . in a variant embodiment , the first 45 and second 44 damping means form a single part so that , when mounting , the part is introduced through the orifice of the link parts 30 . other damping means can be used . referring to fig4 to 6 , there now follows a more detailed description of the arch 20 of the rotational movement system 10 according to the invention . the arch 20 comprises a profile member 21 . the profile member 21 is made of a metallic material , preferably of aluminium . in order to keep it as light as possible , the profile member 21 is hollow and has a rectangular section with the small sides respectively forming a radially outer periphery and a radially inner periphery of the arch 20 . the small sides are linked to one another by large sides forming flanks of the arch 20 . the profile member 21 is curved . one 210 of the flanks of the arch 20 comprises a gutter 29 delimited at the radially outer periphery and the radially inner periphery of the arch 20 by walls 23 extending facing one another and protruding from the flank 210 . furthermore , the walls 23 are inclined towards one another in order to form means for retaining a rack 22 in the gutter 29 . the teeth 22 are then added to the profile member 21 of the arch 20 by the insertion thereof into the gutter 29 . the rack 22 is produced in a plastic material possibly fibre - reinforced in order to form a composite plastic material . the rack 22 can be of a single piece . however , in a preferred embodiment , the rack 22 is made up of a series of plastic parts which are placed end to end in the gutter 29 . the rack 22 comprises , on one face , teeth 26 substantially at right angles to a longitudinal axis of the rack 22 . furthermore , the rack 22 comprises , on a face intended to be facing the flank 210 of the profile member 21 , a central rib 25 and lateral tabs 24 situated on either side of the central rib 25 . the tabs 24 extend laterally protruding from the rack 22 . the tabs 24 are continuous and extend along the rack 22 . in a variant , the tabs 24 are discontinuous . also , the tabs 24 have a beveled form arranged in such a way that , when one of the tabs 24 bears on the corresponding wall 23 of the gutter 29 , the beveled form of the tab 24 adopts the form of the inclined wall 23 . thus , when mounting the rack 22 in the gutter 29 of the profile member 21 of the arch 20 , the tabs cooperate with the lateral walls 23 of the gutter 29 so as to keep the rack 22 in the gutter 29 . in a first embodiment , the rack 22 is mounted to slide in the gutter 29 . such a mounting makes it possible to correctly position the rack 22 or the series of plastic parts forming the rack 22 on the arch 20 of the system for moving a solar tracker in rotation 10 according to the invention . once the rack is positioned , abutment - forming means 27 are positioned in the gutter 29 so as to block the rack 22 in position on the profile member 21 of the arch 20 . the abutments 27 are immobilized in position using fixing means 28 , here rivets . in a variant , the abutment - forming means 27 are arranged in such a way as to be retained by the lateral walls 23 of the gutter 29 . in a variant embodiment , the rack 22 or the series of plastic parts forming the rack 22 have lateral tabs 24 arranged in such a way as to allow the rack 22 to be clipped into the gutter 29 . other means for blocking the rack 22 in the gutter 29 are possible , such as riveting or screwing . when the abutment - forming means 27 are put in place , the rack 22 is compressed on itself between said abutment - forming means in such a way that one of the tabs 24 situated at the radially outer periphery of the arch 20 comes to bear on the corresponding wall 23 of the gutter 29 , the beveled form of the tab 24 ensuring , by cooperation with the corresponding wall 23 , that the rack 22 is kept immobile in the gutter 29 . referring to fig7 , the rotational movement system 10 according to the invention comprises means for driving the rack 22 of the arch 20 . these driving means comprise a cage 52 in which is formed a housing to receive a worm screw 50 . the worm screw 50 is received to move rotationally about its axis in said housing of the cage 52 and is driven by a shaft 51 in this rotational movement . once mounted to rotate in the cage 52 , the worm screw 50 , having an external threading , protrudes into an adjacent passage 55 . the passage 55 is u - shaped and open on a bottom part of the cage 52 . the passage 55 is intended to receive the arch 20 , in such a way that the rack 22 cooperates with the external threading of the worm screw 50 . in order to ensure this cooperation , the cage 52 has a cover 53 removably fixed to each of the ends 54 of the branches of the u delimiting the passage 55 . the cover 53 , once put in place on the cage 52 , makes it possible to avoid any disengagement of the teeth 26 of the rack 22 and of the threading of the worm screw 50 throughout the relative movement between the cage 52 and the arch 20 . in effect , before the disengagement occurs , the cover 53 comes to bear on the flank opposite the flank 210 of the profile member 21 , then ensuring the cooperation between the rack 22 of the arch 20 and the worm screw 50 . the worm screw 50 is made of stainless steel for example . the fact of using a rack made of plastic material coming into contact with a metal worm screw , in particular made of stainless steel , makes it possible to reduce the friction and therefore the vibrations which generate the screeching effects previously described while avoiding providing for greasing of the rack 22 and of the worm screw 50 . thus , any maintenance phases ( greasing ) are eliminated . however , the contact between the worm screw and the rack 22 does generate residual vibrations which are absorbed by the first 45 and second 44 damping means situated between the arch 20 and the parts 30 for mounting the arch on the solar tracker 60 . another advantage of mounting a rack made of plastic material in a gutter 29 formed on a flank 210 of the arch 20 is that it makes it possible to take up any mounting play , which can be significant , of the solar tracking device , like that illustrated in fig8 , comprising a system for moving a solar tracker in rotation 10 according to the invention . this allows for extremely simplified and rapid mounting and placement of the solar tracking device on its site s while ensuring optimum accuracy of the solar tracking during the operation of the solar tracking device comprising the system for moving a solar tracker in rotation 10 according to the invention . obviously , it is possible to add many modifications to the invention without in any way departing from the framework thereof . for example , the rack 22 can be positioned on an edge of the arch 20 , in particular on a radially outer peripheral edge .
5
aperiodic csi report is triggered for a 1 st set aperiodic csi report is triggered for a 2 nd set when a csi report is triggered by a csi request field , ue feeds back csi through pusch resources designated in the dci format 0 . here , what csi will be fed back is determined according to a reporting mode . for example , which one of a wideband cqi , a ue - selective cqi , and a higher layer configuration cqi will be fed back is determined according to a reporting mode . furthermore , what kind of a pmi will be fed back is also determined along with a cqi . a pusch reporting mode is semi - statically configured through a higher layer message , and an example thereof is listed in table 5 below . unlike aperiodic csi feedback transmitted only when it is triggered through a pdcch , periodic csi feedback is semi - statically configured through a higher layer message . the periodicity n pd and subframe offset n offset , cqt of periodic csi feedback are transferred to ue as a higher layer message ( e . g ., an rrc message ) through a parameter called ‘ cqi - pmi - configindex ’ ( i . e ., i cqi / pmi ). a relationship between the parameter i cqi / pmi and the periodicity and subframe offset is listed in table 6 in case of fdd and in table 7 in case of tdd . ue must measure the reference signal of a specific resource region in order to feed back csi , for example , cqi . resources that must be measured in order to generated cqi are called cqi reference resources . it is assuemd that ue feeds back cqi in a ul subframe n . here , a cqi reference resource is defined as a group of dl physical resource blocks corresponding to a frequency band which is related to a cqi value in the frequency domain and is defined as one dl subframe n − n cqi — ref in the time domain . in periodic cqi feedback , n cqi — ref is the smallest value from among 4 or more values corresponding to a valid dl subframe . in aperiodic cqi feedback , n cqi — ref indicates a valid dl subframe including a ul dci format includnig a relevant cqi request . that is , cqi reference resource is a valid dl subframe including a cqi request filed in aperiodic cqi feedback . in aperiodic cqi feedback , if the dl subframe n − n cqi — ref is received after a subframe including a cqi request included in a random access response grant , n cqi — ref is 4 , and the dl subframe n − n cqi — ref corresponds to a valid dl subframe . a dl subframe is considered as a valid dl subframe to a ue if it meets the following conditions . 1 . the dl subframe is configured for the ue , 2 . except for transmission mode 9 , the dl subframe is not a multicast - broadcast single frequency network ( mbsfn ) subframe , 3 . the dl subframe does not contain a dwpts field in case the length of dwpts field is 7680t , and less ( here , 307200ts = 10 ms ), 4 . the dl subframe should not correspond to a configured measurement gap for the ue . if a valid dl subframe for cqi reference resources does not exist , cqi feedback is omitted in ul subframe n . in the layer domain , cqi reference resources are defined by any ri and pmi value on which the cqi is conditioned . in cqi reference resources , ue is operated under the following assumption in order to derive a cqi index . 1 . in cqi reference resources , the first 3 ofdm symbols are occupied by a control signal . 2 . in cqi reference resources , there is no resource element used by a primary synchronization signal ( pss ), a secondary synchronization signal ( sss ), or a physical broadcast channel ( pbch ). 3 . in cqi reference resources , the cp length of a non - mbsfn subframe is assumed . table below shows the transmission modes of a pdsch assumed for cqi reference resources . in the transmission mode 9 and a feedback ( reporting ) mode thereof , ue performs channel measurement for calculating cqi based on only a csi - rs . in other transmission modes and relevant reporting modes , ue performs channel measurement for calculating cqi based on a cell - specific rs ( crs ). ue reports the highest cqi index value of cqi indices 1 to 15 shown in table below under a specific condition . the specific condition includes a modulation scheme corresponding to a cqi index and that a single pdsch transport block having a transport block size must be received within a 0 . 1 error probability when the single pdsch transport block occupies cqi reference resources . a cqi index fed back by ue and its meanings are listed in table below . in a multi - node system , a plurality of nodes or a node group may be allocated to ue , and different reference signals may be used in respective nodes or a node group . in this case , a bs may request aperiodic csi feedback ( reporting ) for a plurality of reference signals from ue . in response to the request , the ue may measure the plurality of reference signals and report csi ( e . g ., a cqi ) on each of the reference signals . fig1 illustrates a plurality of csi - rss that should be measured by one ue . referring to fig1 , a csi - rs # 0 and a csi - rs # 1 may be configured for ue . the csi - rs # 0 may be a csi - rs transmitted by a node # n , and the csi - rs # 1 may be a csi - rs transmitted by a node # m . the transmission periodicity of the csi - rs # 0 may be identical with the transmission periodicity of the csi - rs # 1 . for example , the csi - rs # 0 may be transmitted in a subframe n + 10m ( m is 0 or a natural number ). the csi - rs # 1 may be transmitted in a subframe n + 1 + 10m . as shown in fig1 , csi - rss transmitted in different subframes may be configured for the same ue , but not limited thereto . that is , a plurality of csi - rss transmitted in the same subframe may be configured for the same ue . fig1 shows an example in which a plurality of csi - rss transmitted in the same subframe is configured for the same ue . referring to fig1 , csi - rs # 0 and # 1 are transmitted in a subframe n . the csi - rs # 0 may be a csi - rs transmitted by a node # n , and the csi - rs # 1 may be a csi - rs transmitted by a node # m . as described above , a plurality of csi - rss may be configured for the same ue . here , if a bs requests aperiodic csi from the ue , the ue must send a csi request field ( e . g ., a cqi request field ) in each subframe in which the reference signal is transmitted , in a conventional method . if , as in a multiple node system , a plurality of reference signals is transmitted to ue in different subframes , inefficiency may occur and resources may be wasted in a conventional method because a csi request field must be repeatedly transmitted in each subframe . in order to solve the problems , the present invention provides a method of performing aperiodic csi feedback for a plurality of reference signals in such a manner that a bs triggers csi feedback by sending a csi request field to ue once . fig1 shows a method of ue sending csi according to an embodiment of the present invention . referring to fig1 , the ue receives reference signal configuration information corresponding to each node at step s 110 . the reference signal configuration information may be received through a higher layer signal , such as an rrc message , and it may inform that what reference signal is transmitted by each node . for example , the reference signal configuration information may inform the configuration of a csi - rs transmitted by each node . the ue receives a csi request field at step s 120 . the csi request field triggers aperiodic csi reporting for the ue . the existing csi request field includes a request for csi feedback for a specific cell or a specific carrier . in contrast , the csi request field according to the present invention may include a request for csi feedback for a plurality of reference signals . as shown in table 11 , if a value of the csi request field is ‘ 100 ’ or ‘ 101 ’, a csi report on a first or second set of reference signals may be triggered . the first set or the second set may denote a set of reference signals configured by a higher layer signal , and the reference signal may be a csi - rs transmitted by each node . for example , the first set may be a set of a plurality of reference signals transmitted in different subframes , as in the csi - rss # 0 and # 1 illustrated in fig1 . furthermore , the second set may be a set of a plurality of reference signals transmitted in the same subframe , as in the csi - rss # 0 and # 1 illustrated in fig1 . however , table 11 is only illustrative , and the first or second set may denote a combination of other reference signals or a combination of other nodes . for example , a csi request field may include 1 . a request for csi when only some of antenna ports in which a specific csi - rs is transmitted participate in pdsch transmission or 2 . a request for csi when all antenna ports in which a csi - rs is transmitted participate in pdsch transmission . from a viewpoint of ue , a csi request field may be included in dci and received through pdcchs . the dci including the csi request field may be pieces of dci for scheduling puschs , such as the dci format 0 and the dci format 4 . in some embodiments , the csi request field may be received through a higher layer signal , such as an rrc message . the ue measures a plurality of reference signals in response to the csi request field and generates csi on each of the reference signals at step s 130 . the csi may be a cqi , but not limited , and it is evident that the csi may include a rank indicator ( ri ), a precoding matrix indicator ( pmi ), etc . the ue sends the csi on each of the reference signals through pusch resources at step s 140 . the pusch resources may exist within one subframe or may exist within a plurality of subframes . a process in which ue generates csi in response to a csi request field and then sends the csi through pusch resources is described in detail below . in the present invention , a csi request field is not transmitted in all subframes whose reference signals must be measured in order to generate csi . that is , in the prior art , if a csi request field is included in a dci format including ul scheduling information , ue measures a reference signal in a valid dl subframe in which the csi request field has been received and generates csi based on the measurement . in contrast , in the present invention , if reference signals that must be measured by ue are placed in a plurality of subframes , a csi request field may be transmitted in only some of the plurality of subframes . ue may know that csi on what reference signal must be generated based on a value of a csi request field and also know the transmission cycle , subframe offset , pattern , etc . of each reference signal through a higher layer signal , such as an rrc message . accordingly , ue may know the position of a reference signal ( i . e ., csi reference resources ), that is , the subject of measurement through a csi request field and a higher layer signal . fig1 shows a method of transmitting a csi request field and feeding back csi according to an embodiment of the present invention . it is assumed that ue is requested to report aperiodic csi on csi - rss which are transmitted in subframes n and n + 1 . referring to fig1 , a bs sends a csi request field in the subframe n through dci including pusch scheduling information . furthermore , the bs sends the csi - rss in the subframe n and the subframe n + 1 . in this case , ue analyzes csi reference resources up to the subframe n + 1 without being limited to the subframe n . that is , the ue includes the valid dl subframe n + 1 , placed posterior to the subframe n including the csi request field , in the csi reference resources . fig1 shows another method of transmitting a csi request field and feeding back csi according to an embodiment of the present invention . it is assumed that ue is requested to report aperiodic csi on csi - rss which are transmitted in subframes n and n + 1 . referring to fig1 , a bs sends a csi request field through dci , including pusch scheduling information , in the subframe n + 1 . the ue includes the valid dl subframe n , placed anterior to the subframe n + 1 including the csi request field , in the csi reference resources . that is , in the prior art , csi on only a subframe in which a csi request field is transmitted is measured . in contrast , in the present invention , csi is measured with consideration taken of a subframe in which a csi request field is not transmitted , and the measured csi is reported . fig1 and 14 show examples in which ue sends csi on csi - rss received in a plurality of subframes through a single subframe , but not limited thereto . that is , ue may send csi through a plurality of subframes . in this case , dci including a csi request field may include pieces of pusch scheduling information for scheduling a plurality of pusch resources . in some embodiments , a plurality of pusch resources may be previously defined so that they are consecutively allocated physically or logically . in this case , a piece of pusch scheduling information and the number of allocated puschs may be informed so that the plurality of pusch resources can be scheduled . in the present invention , the multiple node system has been described as an example in order to help understanding of contents , but not limited thereto . that is , the present invention may be applied to any system in which multiple csi - rss are configured . furthermore , a cqi has been chiefly described as an example of csi , but an ri , a pmi , etc . may become an example of csi . fig1 is a block diagram showing a bs and ue . the bs 100 includes a processor 110 , memory 120 , and a radio frequency ( rf ) unit 130 . the processor 110 implements the proposed functions , processes , and methods . for example , the processor 110 may send reference signal configuration information , informing the configuration of reference signals allocated to each node , to ue . furthermore , the processor 110 may send a csi request field , but the csi request field is transmitted in only some of subframes in which a plurality of reference signals is transmitted . the memory 120 is coupled to the processor 110 and is configured to store various pieces of information for driving the processor 110 . the rf unit 130 is coupled to the processor 110 and is configured to send and / or receive radio signals . the rf unit 130 may be formed of a plurality of nodes coupled to the bs 100 in a wired manner . the ue 200 includes a processor 210 , memory 220 , and an rf unit 230 . the processor 210 performs the above - described functions and methods . for example , the processor 210 may receive reference signal configuration information and a csi request field from a bs or a node . the csi request field may be included in dci or received through a higher layer signal , such as an rrc message . the ue generates csi on a plurality of reference signals ( e . g ., csi - rss transmitted by respective nodes ) based on a value of a csi request field and sends the csi . in this case , the csi - rss may be received in a plurality of subframes or may be received in a single subframe . the generated csi may be transmitted through a single pusch or a plurality of puschs . the memory 220 is coupled to the processor 210 and is configured to store various pieces of information for driving the processor 210 . the rf unit 230 is coupled to the processor 210 and is configured to send and / or receive radio signals . the processor 110 , 210 may include application - specific integrated circuits ( asics ), other chipsets , logic circuits , or data processors and / or converters for mutually converting baseband signals and radio signals . the memory 120 , 220 may include read - only memory ( rom ), random access memory ( ram ), flash memory , memory cards , storage media and / or other storage devices . the rf unit 130 , 230 may include one or more antennas for transmitting and / or receiving radio signals . when an embodiment is implemented in software , the above - described scheme may be implemented using a module ( process or function ) that performs the above function . the module may be stored in the memory 120 , 220 and executed by the processor 110 , 210 . the memory 120 , 220 may be placed inside or outside the processor 110 , 210 and connected to the processor 110 , 210 using a variety of well - known means . the present invention may be implemented using hardware , software , or a combination of them . in hardware implementations , the present invention may be implemented using application specific integrated circuits ( asics ), digital signal processors ( dsps ), programmable logic devices ( plds ), field programmable gate arrays ( fpgas ), processors , controllers , microprocessors , other electronic units , or a combination of them , which are designed to perform the above function . in software implementations , the present invention may be implemented using a module performing the above function . the software may be stored in the memory and executed by the processor . the memory or the processor may adopt various means well known to those skilled in the art . although the preferred embodiments of the present invention have been described in detail , a person having ordinary skill in the art will appreciate that the present invention may be modified in various ways without departing from the spirit and scope of the present invention defined in the appended claims . accordingly , a change of future embodiments of the present invention may not deviate from the technology of the present invention .
7
it has been found that ec , a water - insoluble , hydrophobic cellulose ether , which is commonly used as a drug release retarding agent in barrier film coatings or hydrophobic non - disintegrating matrix tablets , can act as a synergistic tablet binder for rapidly disintegrating tablet formulations . ec , a non - hygroscopic , non - reactive tablet binder can readily be dry blended or co - processed ( for example by co - milling or through use of agglomeration techniques including but not limited to roller compaction and wet granulation ) with other formulation components to provide the combined attributes of fast disintegration ( less than 60 seconds and frequently less than 20 seconds ), relative inertness , near ph neutrality , ease of manufacturing by conventional direct compression tablet technology , and high tablet robustness as defined by low tablet friability ( less than 1 % and frequently less than 0 . 5 % friable by weight ). the invention also provides for tablet formulations with low hygroscopicity prior to compression into tablets and tablets also have very low hygroscopicity , not withstanding the fast dispersion in water . typical moisture uptake is less than 2 % ( on a dry weight basis ) at 50 % relative humidity and 25 ° c . ethylcellulose ( ec ) is a cellulose ether that is versatile with many uses . a preferred ec is described in u . s . pat . no . 6 , 592 , 901 , which is incorporated herein by reference in its entirety . the following grade types of ec are commercially available from hercules incorporated : types k , n , and t of ec are used in food and food contact applications . more specifically , k and t are used for food and contact such as paper or paperboard in contact with food . n types were used as a binder or coating in pharmaceutical applications . type x is used in inks and other industrial applications . while any grade of ec is of utility in this invention , the use of optimized direct compression grades such as high ethoxyl , low viscosity ec ( t10 ec pharm grade , available from aqualon division , a business unit of hercules incorporated ), is especially preferred . this ec type combines high compressibility with good powder flow characteristics . other commercially available grades of ec with lower ethoxyl and lower or higher viscosity ( such as n7 , n10 , n14 , n22 , n50 and n100 pharm grade ec , all available from aqualon division , a business unit of hercules incorporated ), while possibly less effective than t10 ec pharm grade , are also useful in the tablet formulations of the current invention . it is well known in the art how to make ec . normally , either chemical grade cotton linters or wood pulp is used to prepare ec . the sequence of chemical reactions is similar to that for methylation of cellulose . in commercial practice , sodium hydroxide concentrations of 50 % or higher are used to prepare the alkali cellulose . staged additions of solid sodium hydroxide during the reactions can be used to reduce side reactions . ethyl chloride is added to the alkali cellulose in nickel - clad reactors at 90 - 150 ° c . and 828 to 965 kpa ( 120 to 140 psi ) for 6 - 12 hours . diluents such as benzene or toluene can be used . at the end of the reaction , the volatiles such as ethyl chloride , diethyl ether , ethanol , and diluent are recovered and recycled . the ethylcellulose in solution is precipitated in the form of granules with further recovery of the carrier solvents . washing with water completes the processing . control of metallic impurities is important to achieve stability during storage . anitoxidants can also be incorporated to inhibit loss of viscosity . while any grade of ec is of utility in this invention , a preferred ec of use in the present invention has a higher ethoxyl content ( greater than 49 . 6 %) and simultaneously a low viscosity ( less than 53 cps ) and the average particle size is greater than 50 micrometers . the preferred ec of use in the present invention has an ethoxyl content lower limit of 49 . 6 %, preferably 49 . 8 %, and more preferably 50 . 0 %. the upper limit of the ethoxyl content of the ec is 54 . 88 %, preferably 53 . 0 % and more preferably and more preferably 52 . 0 %. the viscosity of the ec is less than 53 . 0 cps , preferably less than 25 cps and more preferably less than about 17 cps , with a lower limit of about 3 cps . the ec binder is co - formulated with typical disintegrants and other common tablet aids such as fillers and tablet lubricants and flow aids . typical disintegrants include and may be selected from the group consisting of cross - linked povidone , sodium cross carmellose ( cross - linked sodium carboxymethyl cellulose ), sodium starch glycollate , low substituted hydroxypropyl cellulose , and guar . low - substituted hydroxypropyl cellulose may be defined as having a hydroxypropoxyl content in the range of 5 . 0 to 16 . 0 % by weight and an apparent average degree of polymerization in the range of 350 to 700 . low - substituted hydroxypropyl cellulose is disclosed in u . s . pat . no . 6 , 380 , 381 , incorporated herein by reference . suitable fillers include sucrose , lactose , dextrose , mannitol , xylitol , sorbitol , lactiol , maltodexrin , isomalt , polydextrose , starch and microcrystalline cellulose . lubricants and flow aids include metal stearates , such as magnesium and calcium stearate , stearic acid , hydrogenated vegetable oils , poletheylene glycols , amino acids , stearyl fumarate , talc and colloidal silicone dioxide . other additives which are typically used in small amounts but are important for organoleptic enhancements include sweetners , flavors , tastemasking agents and colorants . examples of sweeteners include sucralose , sodium saccharin , acesulfame k and aspartame . examples of flavoring and tastemasking agents include peppermint , citrus and vanilla extracts , amino acid derivatives such as glutamic acid based derivatives . the above is not meant to be an exhaustive list of possible organoleptic enhancing aids . suitable use levels of ec are 1 - 20 %, more preferably 3 - 18 % and most preferably 5 - 15 %. suitable use levels for disintegrant are 2 - 15 %, more preferably 3 - 12 % and most preferably 5 - 10 %. suitable lubricant levels range from 0 . 1 % to 2 . 5 %. more preferably 0 . 25 to 2 . 0 % and most preferably 0 . 5 % to 1 . 5 %. while any grade of ec is of utility in this invention , the use of optimized direct compression grades such as high ethoxyl , low viscosity ec ( t10 ec pharm grade , available from aqualon division , a business unit of hercules incorporated ), is especially preferred . this ec type combines high compressibility with good powder flow characteristics . other commercially available grades of ec with lower ethoxyl and lower or higher viscosity ( such as n7 , n10 , n14 , n22 , n50 and n100 pharm grade ec , all available from aqualon division , a business unit of hercules incorporated ), while possibly less effective than t10 ec pharm grade , are also useful in the tablet formulations of the current invention . the rapidly disintegrating , low friable tablet formulation of the present invention also can be combined with an active pharmaceutical ingredient or medicaments to prepare a formulation suitable for tableting or pelletizing . one or more active pharmaceutical ingredients may be combined in a single dosage form , depending on the chemical compatibility of the combined active ingredients and the ability to obtain the desired release rate from the dosage form for each active ingredient . the determination of the effective amount of the medicament per dosage unit is easily determined by skilled clinicians . representative types of active pharmaceutical ingredients include antacids , anti - inflammatory substances , anti - infectives , psychotropics , antimanics , anti - parkinson &# 39 ; s agents , anti - alzheimer &# 39 ; s agents , anti - parkinson &# 39 ; s agents , anti - alzheimer &# 39 ; s agents , stimulants , antihistamines , laxatives , decongestants , nutritional supplements , gastrointestinal sedatives , antidiarrheal preparations , antianginal drugs , antiarrhythmics , antihypertensive drugs , vasoconstrictors and migraine treatments , anticoagulants and anti - thrombotic drugs , analgesics , anti - pyretics , hypnotics , sedatives , antiemetics , anti - nauseants , anticonvulsants , neuromuscular drugs , hyper - and hypoglycemic agents , thyroid and antithyroid preparations , diuretics , antispasmodics , uterine relaxants , mineral and nutritional additives , anti - obesity drugs , anabolic drugs , erythropoietic drugs , antiasthmatics , expectorants , cough suppressants , mucolytics , antiuricemic drugs , topical analgesics , local anesthetics , polypeptide drugs , anti - hiv drugs , anti - diabetic agents , chemotherapeutic and anti - neoplastic drugs . examples of specific active pharmaceutical ingredients include aluminum hydroxide , prednisolone , dexamethasone , aspirin , acetaminophen , ibuprofen , isosorbide dinitrate , nicotinic acid , tetracycline , ampicillin , dexbrompheniramine , chlorpheniramine , albuterol pseudoephedrine , loratadine , theophylline , ascorbic acid , tocopherol , pyridoxine , methoclopramide , magnesium hydroxide , verapamil , procainamide hydrochloride , propranolol , captopril , ergotamine , furazepam , diazepam , lithium carbonate , insulin , furosemide , hydrochlorothiazide , guaiphenesin , dextromethorphan , benzocaine , ondansetron , cetrizine , dimenhydrinate , diphenhydramine , vitamin b12 , famotidine , ranitidine , omerpazole , rabeprazole , esomeprazole , sildenafil , tadalafil , atorvastatin , simvastatin , valsartan , lorsartan , donepezil , galantamine , rivastigmine , carbidopa , levodopa , sertaline , pramipexole and ropinirole . it should be understood that any active pharmaceutical ingredients that is physically and chemically compatible with the ec of the present invention and other dosage form ingredients can be used in the present invention . in the below mentioned examples , a cross linked cmc level of 5 % by weight of the total formulation was found to be highly effective , yielding fast disintegration and low friability . it is however expected that depending on a formulation requirements e . g ., drug solubility , load and desired disintegration time , the disintegrant level may vary between 2 and 15 % by weight of the formulation . however , a distinguishing advantage of the current invention is that even though a formulation contains 25 % of a hydrophobic drug , dimenhydrinate , the tablet none the less disintegrates in about 15 seconds while only requiring 5 % by weight disintegrant — low levels of disintegrant in combination with a non - hygroscopic ec therefore decrease the hygroscopicity of the overall formulation . similarly , a t10 ec level of 5 - 10 % by weight was found to be highly effective in reducing tablet friability and maintaining low disintegration time . however it is understood that depending on formulation characteristics , especially compactibility characteristics and mechanical properties and dose of drug , the level of ec binder may vary from 1 to 20 % by weight of the total formulation . the following examples will serve to illustrate the invention , parts and percentages being by weight unless otherwise indicated . in accordance with astm d4794 , ethoxyl content was determined by a zeisel ( sealed ) tube method by reacting ec with hydriodic acid , liberating one mole of ethyl iodide for each mole of ethoxyl substitution on the cellulose chain . the ethyl iodide was then extracted with o - xylene and quantitated by gas chromatography using toluene as an internal standard . a typical set of apparatus , reagents and procedures for this test are listed below : 1 . gas chromatograph , perkin - elmer 900 , or equivalent equipped with thermal conductivity detector , chart recorder , and integrator . 2 . column 6 ′. times . ⅛ ″ stainless steel packed with 10 % sp - 2100 on 100 / 120 supelcoport , supelco , inc ., bellefonte , pa . upon receipt , columns were conditioned overnight at 200 ° c . 3 . reacti - vials , 5 ml , equipped with mininert valves . ( pierce chemical co ., # 13223 and # 10135 ). 4 . silli - therm heating module , 110 v , 19791 , pierce chemical co ., rockford , ill . 6 cover , stainless steel , fabricated to cover six ( 6 ) reacti - bar 21 units on the silli - therm heating module 7 dispenser 0 - 5 ml , labindustries repipet , or equivalent . syringe , 100 . mu . l , hamilton 710 n or equivalent . 9 micro - set pipet adjusted to deliver 2 . 0 ml ( lancer product # 8885 - 890007 ). 1 dried about 0 . 5 grams of sample in 105 ° c . oven for 1 hour . 3 into a tared 5 ml reacti - vial , weighed 0 . 05 - 0 . 08 gram of cooled sample . recorded weight to the nearest 0 . 0001 gram , samples were run in duplicate or triplicate . 4 added 2 ml of hydriodic acid using a transfer pipet . capped sample . 5 added 2 ml of internal standard solution using the repipet dispenser or equivalent . 6 immediately recapped vials with mininert valve tops and shook vials . monitored block temperature at 180 +/− 5 ° c . with a thermometer . 7 placed vials into block and replaced metal cover . kept samples behind safety shield while heating . 10 shook each sample vigorously and allowed to stand for about 20 minutes . 11 chromatographed 1 . 0 mu . l of the upper solvent layer of each sample on the gas chromatograph . viscosity was determined by preparing a 5 % solution of ec in a toluene : ethanol ( 80 : 20 ) solvent mixture . viscosity of the solution was measured using a hercules horizontal capillary viscometer ( following astm d914 - 00 , 33 . 1 ). the list of apparatus , reagents and procedures are described below . 6 . viscometer , hercules horizontal capillary viscometer — calibrated to give viscosity readings in centipoise . 1 . determined the temperature of the 80 : 20 solvent to be used . the temperature of the solvent must be between 20 and 30 ° c . if 111 . 8 ml . burette is to be used in this determination . 3 . measured 111 . 8 ml . of 80 : 20 solvent from burette ( the equivalent of 95 . 0 grams of solvent ) into an 8 - oz . bottle . added the sample to the solvent , making an effort to disperse the sample and avoid lumping . covered the neck of the bottle with a sheet of cellophane and applied the screw cap . 4 . placed the sample on a shaker and allowed it to shake until dissolution is complete . 5 . placed the bottle into a 25 ° c . bath for 30 minutes and the solution was free of air bubbles . 6 . with the viscometer in the raised position ( reservoir vertical ), filled the reservoir to the etched mark . made sure that no air remained trapped in the sample . placed a finger over the end of the capillary . released brace and carefully lowered the viscometer to horizontal . ( it was essential that the liquid was allowed to come to an equilibrium level before placing the finger over the end of the capillary and lowering it to the horizontal .) 7 . released the finger and measured the time for the liquid to flow from the first to the second mark in the capillary tube . reported as time t . 8 . calculated the viscosity as follows : n = td / d where : n = viscosity , cps . t = time of flow for the sample d = density of sample solution at 25 ° c . ( 0 . 86 ) d = density of the oil used for calibration of the viscometer . friability is measured by placing an accurately weighed sample of 20 tablets in the drum of a standard roche - type friabilator and rotating the drum for 250 rotations . % friability is then calculated as the % weight loss of the de - dusted tablets after rotation relative to the same sample of tablets prior to rotation in the friabilator . disintegration time is measured by placing 6 tablets into a standard usp disintegration apparatus without disc inserts . the tablets are then dipped and reciprocated in a ph 6 . 8 phosphate buffer solution ( as defined in the usp ) and carefully observed and timed . disintegration time is recorded as the time where no discernible tablet core remains and all the pieces of the disintegrated tablet have fallen through the mesh screen of the disintegration cell . the temperature of the test solution is 37 ° c .+/− 1 ° c . for all examples , the various formulation components , with exception of magnesium stearate and stearic acid , were first dry blended in a patterson - kelly v - type blender for 15 minutes . magnesium stearate and stearic acid were then added to the mixture through a 20 mesh screen , and the entire mass was then blended for another 3 minutes . tablets were then directly compressed at 37 rpm on an instrumented manesty beta press , equipped with ¼ ″ standard concave tooling , except where larger tooling is indicated . a target weight of 100 mg was set , except where a different weight is indicated . tablets were compressed at 5 kn and approximately 8 kn of compressive force for examples using ¼ ″ standard concave tooling . for larger tooling , 15 , 20 and 25 kn compressive force was used . for larger tooling 15 , 20 and 25 kn compressive force was used . tablet crushing strength was determined by diametrically compressing tablets using a key pharmatest ht500s hardness tester . a 500 gram batch of dry blended powder without ec was prepared and then tableted into 100 mg . tablets as a control formulation : table 1 . resultant crushing strength , friability and disintegration times for the control formulation in example 1 . tablets were made at 5 kn and 8 kn compression force using a rotary tablet press . the combination of mannitol and croscarmellose were able to provide relatively fast disintegration of a tablet comprising 25 % of a low soluble drug , dimenhydrinate . however , tablet friability was unacceptably high at 9 % weight loss . a 500 gram batch of dry blended powder was prepared as above , however a low viscosity water soluble binder klucel ® exf pharm hydroxypropyl cellulose , available from aqualon division , a business unit of hercules incorporated was added and tableted into 100 mg . tablets : table 2 . resultant crushing strength , friability and disintegration times for the control formulation in example 2 . tablets were made at 5 kn and 8 kn compression force using a rotary tablet press . a 500 gram batch of dry blended powder was prepared as above in comparative example 2 , however in place hydroxypropyl cellulose , water insoluble t10 pharm ec , available from aqualon division , a business unit of hercules incorporated , was substituted in the composition and tableted into 100 mg . tablets : table 3 . resultant crushing strength , friability and disintegration times for the control formulation in example 1 . tablets were made at 5 kn and 8 kn compression force using a rotary tablet press . substitution of hydroxypropyl cellulose with t10 pharm ec was effective in maintaining the low friability and improved tablet strength relative to control , and was also effective in maintaining a rapid disintegration time of less than 30 seconds . a 500 gram batch of dry blended powder was prepared as above in example 1 , however in place of 15 % water insoluble t10 pharm ec only 10 % of t10 pharm ec was included and tableted into 100 mg . tablets : table 4 . resultant crushing strength , friability and disintegration times for the control formulation in example 2 . tablets were made at 5 and 8 kn compression force using a rotary tablet press . reducing the ec component from 15 % to 10 % did not compromise low tablet friability while providing rapid disintegration times similar to those of the control . a 500 gram batch of dry blended powder was prepared as above in example 2 , however in place of 10 % water insoluble t10 pharm ec only 5 % of t10 pharm ec was included and tableted into 100 mg . tablets : table 5 . resultant crushing strength , friability and disintegration times for the control formulation in example 3 . tablets were made at 5 kn and 8 kn compression force using a rotary tablet press . reducing the ec component from 10 % to 5 % again allowed significant improvements in tablet friability relative to the control in comparative example 1 , while maintaining rapid disintegration times below 30 seconds . a 500 gram batch of dry blended powder was prepared as above in example 2 , however in place of dimenhydrinate , 25 % directly compressible ( pre - granulated ) acetaminophen granulation was included . the tablet weight was increased from 100 mg used in comparative examples 1 - 2 and examples 1 - 3 to 120 mg . : table 6 . resultant crushing strength , friability and disintegration times for the control formulation in example 2 . tablets were made at 5 kn , 8 kn and 15 kn compression force using a rotary tablet press . acetaminophen is commonly known as a poorly compressible drug . the data show that the formulation system is able to accommodate a series of different physico - chemical drug characteristics while maintaining low friability and rapid disintegration . a 500 gram batch of dry blended powder was prepared as above in example 4 , however in addition to granular mannitol , 10 % liquid sorbitol was added after initial dry blending of drug , ethylcellulose , mannitol , croscarmellose . the liquid sorbitol ( 70 % sorbitol in 30 % water ) was added gradually while mixing to form a homogenous , “ dry to the touch ”, free flowing powder . the amount of ethylcellulose and croscarmelose were also increased . after lubricant addition the 120 mg tablets were then compressed as in example 4 . a 500 gram batch of dry blended powder was prepared as above in example 5 , however in place of liquid sorbitol , 10 % spray dried sorbitol was used . the tablets were compressed using ⅝ ″ round troche tooling with circular elevation in the center of the punch face , such that the center of the tablet was thinner than the perimeter of the tablet . tablet target weight was 900 mg and tablets were compressed at 15 , 20 and 25 kn . examples 5 and 6 show the versatility of the system with regard to different tablet sizes and geometries , as well as inclusion of a diverse range of and physical forms of sugar alcohols and ingredients . it is not intended that the examples presented here should be construed to limit the invention , but rather they are submitted to illustrate some of the specific embodiments of the invention .
0
referring initially to fig1 an exemplary medical imaging apparatus suitable to practice the present invention includes an imaging source 10 which generates a series of temporally spaced image representations 12 . while the discussion above has focused on mr scans , those skilled in the art will appreciate that any source of imaging data ( e . g . x - rays ct , pet , spect and the like ) will function with equal efficacy where specific contrast agents are employed or tailored to the imaging modality used . the image representations are stored in an image memory 16 for subsequent processing and / or display . a perfusion processor 20 is in data communication with the memory 16 and includes four components : 1 ) a motion correcting algorithm 22 that applies a temporal correction , alignment or registration of the plurality of digital image representations , such as the pre - and post contrast images ; 2 ) a filtration algorithm 24 that spatially classifies or filters pixels in a region of interest on each of the digital image representations in spatial domain ; 3 ) a verification algorithm 26 which establishes regional correspondence between selected classified pixels over successive digital image representations in temporal domain ; and , 4 ) a quantification perfusion algorithm 28 where the statistical analysis of the filtered regions is performed and uptake curves of gad &# 39 ; s ability to perfuse in tissues are generated . with reference now to fig2 an object - process flowchart illustrates a functional relationship of the four components . following a brief description here of each of the components , a more detailed discussion is provided with components broken out separately . the motion correcting algorithm 22 corrects the images for motion induced during the collection of the temporally spaced image representations . this motion can be from any of a variety of sources such as respiration , muscle flex and the like . this motion correction can alternately be seen as image correction or image alignment where the images of the post gad contrast are registered with respect to the pre - contrast images / volume . a correction method uses the maximization of mutual information , while a registration process uses the multi - resolution approach for correction . generally , this approach iteratively shrinks or reduces the size along with smoothing of the images by half until the images are registered . details of these methods will be more fully discussed below . the output of the motion correcting algorithm 22 is the corrected temporal sequence 30 . the corrected temporal sequence 30 is provided to the filtration algorithm 24 that spatially classifies or filters pixels in a region of interest on each of the temporally spaced digital image representations . in other words , filtration algorithm 24 filters out the pixels which do not contribute to the image enhancement or which has not perfused in the tissue . this has the desirable effect of reducing image processing loading by ignoring pixels that are determined to be of little consequence to the contrast agent detection . these pixels are only searched in the region of interest as specified for all the temporal frames of the image sequence . the remaining or contributing pixels 32 are selected , converted to binary regions and passed for further processing such as region correspondence 26 and perfusion quantification 28 . with continued reference to fig2 the contributing pixels 32 are forwarded to the a verification algorithm 26 which establishes regional correspondence between the selected or contributing classified pixels over successive digital image representations . thus , the verification algorithm 26 takes binary regions as input from each of the temporal sequence images and computes textural properties 34 of the selected regions . the textural properties 34 of each of these regions are checked for consistency 36 such as a monotonic pattern or other closely related properties among sequential image representations and , if consistent are passed to the quantification perfusion algorithm 28 . if not consistent , the regions are fed back into the prior algorithms 22 , 24 and 26 until consistency is achieved . the verified regions are then provided to the quantification perfusion algorithm 28 where the statistical analysis of the filtered regions is performed and uptake curves of contrast agent are generated . here the mean , variance , standard deviation and slopes of the filtered regions are computed in the temporal sequence and lesions are characterized . with reference now to fig3 ( your fig . # 5 ), a detailed illustration of an embodiment of the motion correcting or temporal correction algorithm 22 is shown . the initial or reference data volume 40 undergoes smoothing 42 , followed by the optimization of the transformation parameters 44 . the optimization of the transformation parameters 44 is achieved given the initial transformation 46 , and two regions 48 from the reference image volumes . the output is a new transformation matrix t . an alignment algorithm 54 checks for the convergence by comparing the previous t with the new t ( over an average ) and if the convergence is achieved , the system exits and computes the new registered volume 56 . if convergence is not achieved , then the test volume undergoes the down sampling or image size reduction along with smoothing 58 and the process is repeated , until the convergence is achieved . more particularly , convergence is determined by minimizing the entropy or disorder among successively smaller sub - sets of image pixels . this is represented mathematically with the equation shown below of the entropy of a point in an image using the gaussian function g ψ . the probability density estimate given the parzen window estimate ψ is given as : p  ( x ) = 1 n a  ∑ xi ∈ a  g ψ  ( x i - x j ) where g ψ is defined as : g ψ  ( z i - z j ) = 1 2  ∏ ψ  exp  [ ( z i - z j )  2 ψ ] the expectation value is approximated by averaging over evaluation of p ( x ) by taking averaging over another set of random samples b of size n b . thus the entropy expression is given as : h  ( x ) = - 1 n b  ∑ xj ∈ b   log  [ p  ( xj ) ] substituting the value of p ( x ) in the above expression we get the entropy h ( z ) as : h  ( z ) = - 1 n b  ∑ xi ∈ b   log  [ 1 n a  ∑ xj ∈ a  g ψ  ( z i - z j ) ] where , g ψ is defined as : g ψ  ( z i - z j ) = 1 2  ∏ ψ  exp  [ ( z i - z j )  2 ψ ] image registration can also be accomplished through mutual information / entropy and stochastic gradient algorithms to register the post - contrast gad images . mutual information is defined mathematically as : where , h ( u ) and h ( v ) are the entropies of random variables u and v , while h ( u , v ) is the joint entropy . for estimating the best transformation , we need to find the rate of change of mutual information i . thus the equation for new transformation is given as : t i + 1 = t i + λ  (  i  t ) an expression of rate of change of mutual information di / dt is achieved by taking the derivative of h ( u ), h ( v ) and h ( u , v ) with respect to t , the transformation . since u is independent of t , the rate of change of h ( u )/ dt = 0 . the only components which contribute to the di / dt are the h ( v ) and h ( u , v ). we here show the expression of d ( h ( v ( t ( x )))/ dt and the same can be applied to d ( h ( u , v ( t ( x ))))/ dt . using the property of derivative of logarithm and exponentials d ( h ( u ( t ( x )))/ dt can be given as : ∂ ∂ t  h [ v ( t  ( x ) ] = - 1 n b  ∑ xj ∈ b  ∑ xi ∈ a  wv  ( vi , vj )   ( vj - vi ) ψ v  ∂ ∂ t  ( vj - vi ) performing a similar operation for the joint entropy h ( u , v ), we get the expression as : ∂ ∂ t   h [  w ( u , v  ( t  ( x ) ) ] = - 1 n b  ∑ xj ∈ b  ∑ xi ∈ a  w uv  ( w i , w j )   ( wj - wi ) ψ uv  ∂ ∂ t  ( v j - v i ) joining the above two terms and plugging in the derivative of mutual information , we get :  i  t = - 1 n b  ∑ xi ∈ b  ∑ xj ∈ a  ( vi - vj )  [ w v  ( vi , vj ) ψ v - w uv  ( w t , w j ) ψ uv ]   ( v i - v j )  t d / dt ( v i - v j ) an important component in the above equation is given as : d / dt ( v i - v j )=∇[ v (( t ( x i ))] x i t this expression is given as :  /  t  ( v i - v j ) =  /  t  ( v i ) -  /  t  ( v j )  =  /  t  ( v  [ t  ( x i ) ] ) -  /  t  ( v  [ t  ( x j ) ] ) = [ ∇ x  v i  ∇ x  v j 1 ] t  3 × 1  [ x i y i 1 ]  1 × 3 -  [ ∇ x  v j ∇ x  v j 1 ] t  3 × 1  [ x i y i 1 ]  1 × 3 accordingly , the convergence decision 54 is reached when the solution to the difference between the resulting 3 × 3 matrices does not change over a course of iterations . referring now to fig4 the registration is performed in a coarse - to - fine fashion on a hierarchy of images that are generated by successive smoothing 42 ( fig3 ) and reduction 58 ( fig3 ). smoothing is performed by convolving the binomial kernel { 1 , 4 , 6 , 4 , 1 } and subsequent reduction is accomplished by deleting alternating samples . this scheme generates an approximation to a ‘ gaussian pyramid ’ 62 representation of the data . for pyramid generation from the multi - resolution algorithm , the gaussian pyramid progression from coarse 66 to fine 68 is given as : gaussian filtration : the image is convolved with the 2 - d gossip filter ( so called blurring ). the filter [ 1 4 6 4 1 ] is convolved horizontally and then vertically . down sampling : the image is sampled by a factor of 2 to select the alternate pixels points and reduce the image . the multi - resolution temporal correction technique of the perfusion data has the following advantages : 1 ) it increases the capture range of the method : at the lower resolutions there is less tendency to become trapped in local minima , but the resulting accuracy is reduced ; 2 ) it saves time and memory since the images are small in size ; having done the motion correction , reference is now directed to fig5 where an exemplary object - process chart describes the filtration algorithm 24 or the spatial correction . here , the temporally corrected image 30 is classified on a pixel level . a classification algorithm 70 selects or sorts pixels in a region of interest 72 into a set of defined classes 74 based on tissue type or determinable criteria . those skilled in the art can now appreciate that the region of interest 72 can be manually input or developed from automated image analysis apparatus . the number of defined classes 74 is typically the same as the number of tissue types . however , recognizing that each pixel may belong to more than one class , a fuzzy membership function ( fcm ) 76 is used to associate each pixel in the image with a particular class 74 . there are several algorithms to compute the membership functions and one of the most efficient is the fcm 76 based on clustering techniques . because of the ease of implementation for spectral data , it is preferred over other pixel classification algorithms . the fcm algorithm 76 computes the measure of membership terms as a fuzzy membership function . for example , where the observed pixel intensities in a multi - spectral image at a pixel location “ j ” is given as : y j =[ y j1 y j2 . . . , y jn ] t where j took the pixel location and n were the total number of pixels in the data set . in fcm , the algorithm iterates between computing the fuzzy membership function and the centroid of each class . this membership function was pixel location and for each class ( tissue type ) and the value of the membership function lies between the range 0 and 1 . this membership function represents the degree of similarity between the pixel vector at a pixel location and the centroid of the class . for example , a membership function value close to 1 , indicates that the pixel at the pixel location is close to the centroid of the pixel vector for that particular class . the algorithm can be presented in the following four steps : if u jk ( p ) is the membership value at location j for class k at iteration p , such that σu jk = 1 . as defined above , y j is the observed pixel vector at location j , and v k ( p ) is the centroid of class k at iteration p , then the fcm steps for computing the fuzzy membership values are : ( i ) choose number of classes ( k ) 72 and the error threshold ( e th ) 78 and set the initial guess for centroids , v k ( 0 ) and set the iteration number p = 0 . u jk ( p ) =|| y j − v k ( p ) || − 2 / σ || y j − v ( p ) || − 2 v ( p + 1 ) ={ σ ( u jk ( p ) ) 2 y j }/ σ ( u jk ( p ) ) 2 ( iv ) check convergence by computing the error between the previous and current centroids , if the algorithm had converged , then exit , else , increment p and go to step ( ii ) for computing the fuzzy membership function again . the output of the fcm algorithm was k sets of fuzzy membership function again . thus if there were k classes , then we threw out k number of images and k number of matrices for the membership functions . following pixel classification 24 , the labeled pixels 32 are provided to generate a binary mask 80 . this binary mask will be used for regional correspondence and verification ( 26 , fig2 ). note that the binary mask generation process only takes place in the region of interest 72 . the binary mask of enhanced pixels is then provided to the verification algorithm 26 , more fully discussed below . additionally , once the fuzzy membership values are computed for each pixel / voxel location in the image , a contributing factor of each type for a given pixel / voxel is indicated . using statistical properties , an estimate of that pixel can be labeled in the process of enhancement process during the contrast uptake . thus , the output of the classifier is an enhancement labeling process . those familiar with the field of pixel classification will appreciate the major advantages of clustering over bayesian training models . the bayesian model yields a probability of a class being present when a sample pixel is observed , the so - called a posteriori probability . with reference now to fig6 an embodiment of the verification algorithm 26 which establishes correspondence among selected pixel areas over successive digital image representations is detailed . here , the binary gray scale regions 90 from each of the temporal sequence images are checked if the textural properties of each of these regions have monotonic or unvarying patterns or other closely related properties . specifically , the binary regions 90 from frame to frame carry textural information about the gad or contrast agent flow pattern . this flow information , in the form of texture energy gives a tool to establish a correspondence between successive frames in the temporal sequence . in a preferred embodiment a method of computing texture on binary images is based on the marginal probability of the region of interests having a set of textural features for classifying the images . texture properties are computed by first generating the co - occurrence matrix 92 of the gray scale image 90 given the binary mask 80 . it consists of two steps : step one consists of co - occurrence matrix generation 92 and step two consists of computing the textural properties 94 . the textural properties include computation of statistical properties such as marginal properties , correlation 96 and entropies 98 , recalling computation of the statistical properties on the perfused pixel are obtained from the pixel classification method as discussed above ( fig5 ). these perfused pixels are marked by the binary mask in the region of interest . since the number of pixels is small , this implementation can be done fast using the binary sequence of 1 &# 39 ; s and 0 &# 39 ; s as labels . the following texture features are useful measures for such images . if p ( i , j ) is the ( i , j )- th entry in a normalized gray tone spatial dependence matrix or co - occurrence matrix , given as p ( i , j )/ r and ng is the number of distinct gray levels in the quantified image , then the following properties are used for computing the texture features : it is the i - th entry in the marginal - probability matrix obtained by summing the rows of p ( i , j ). p x  ( i ) = ∑ j = 1 ng   p  ( i , j ) it is the i - th entry in the marginal probability matrix obtained by summing the rows of p ( i , j ): p y  ( i ) = ∑ j = 1 ng   p  ( i , j ) ( iii ) joint summed marginal probability of x and y p x + y ( i ): this is the joined added marginal probability of x and y . p x + y  ( k ) = ∑ i = 1 ng   ∑ j = 1 ng   p  ( i , j ) , k = 2 , 3 , …   2  ng   note   i + j = k ( iv ) joint subtracted marginal probability of x and y , p x − y ( i ): this is the joined subtracted marginal probability of x and y . p x - y  ( k ) = ∑ i = 1 ng   ∑ j = 1 ng   p  ( i , j ) , k = 2 , 3 , …   ng - 1 this is mathematically defined as : f = ∑ i   ∑ j   ( i , j )  p  ( i , j ) - μ x  μ y σ x  σ y where , μx , μy , σ x and σ y are the mean and standard deviation of p x and p y . e =− σ t σ j p ( i , j )[ log ( i , j ))] this is mathematically defined as : e s = - ∑ i = 0 ng - 1   p x - y  ( i )  log  [ p x - y  ( i ) ] this is mathematically defined as : e d = - ∑ i = 0 ng - 1   p x - y  ( i )  log  [ p x - y  ( i ) ] referring back now to fig2 with temporal correction 22 , spatial correction 24 and regional correspondence 26 complete , the algorithm checks for consistency 36 and develops perfusion curve data 38 if consistent . if the regional correspondence statistical properties 34 are not consistent , then the system checks the three algorithms 22 , 24 , 26 for any inconsistencies . this involves how close the transformation matrix was to the previous transformation matrix in the temporal correction block 22 or how good was the pixel classification in terms of the input error threshold 78 ( fig5 ). similarly , the statistical values are checked for closeness in the temporal domain 26 . if no abnormalities are encountered , then we go to the quantification stage 28 , were we compute the uptake curve and characterize the lesion . suitable processes of perfusion quantification includes statistical computations , such as mean and variance . if i i ( t ) is the pixel intensity at a location i in the vector of length t corresponding to the pixel location ( x , y ) for the temporal sequence “ t ” ( out of t frames ), we can compute the mean for the region of interest for a temporal frame “ t ”, mean of the region of interest over all the temporal frames and the standard deviation of the mean value as : μ roi  ( t ) =  1 n  ∑ i = 1 i = n   i t  ( t ) μ _ roi =  1 n  ∑ i = 1 i = n   μ roi  ( t ) σ roi =  ∑ t = 1 t = t   ( μ roi  ( t ) - μ _ roi )  ( μ roi  ( t ) - μ _ roi ) n having performed the quantification of perfusion data sets , we can also characterize the lesions in the roi . first , for simple image differencing , in the image subtraction mode , one can display plain subtraction , scaled subtraction , divided , and ratio images . to implement this operation , a user first selects a reference frame ( e . g . a ). the default frame , e . g . b , will be operated with respect to the reference frame a . mathematically , these four modes are given as : ( i ) straight subtraction : a − b , ( ii ) scaled subtraction : ( a − b ) * k 1 , ( iii ) division a / b * k 2 and ( iv ) ratio : ( a − b / b )* k 3 . here , k 1 , k 2 , k 3 are scaling factors usually chosen to be 100 , 1 , 000 , 10 , 000 . these four modes operate in a mutually exclusive mode or in a toggle mode . secondly , for image mapping velocity thresholding the percentage change of intensity values from one time frame to another time frame is determined . another way to interpret this is to calculate how rapidly the gad perfused in the breast when two time frame images were acquired . it is a very useful clinical tool to study the change in the contrast near or around the lesion . what percentage of gad flows near the lesion when moved from one time frame to the next time frame can be evaluated . since the rapidity of flow of the gad is measured between the two time frames , one therefore needs to decide how the gad flow rate is parameterized or mapped to visualize it . this mapping is achieved by setting at a user - specified threshold value , so - called the percentage velocity threshold . this threshold is then applied to the intensity of the first frame ( previous frame ) and the new intensity value is computed ( so - called , the threshold intensity value ). next , we compare this new intensity value with respect to the second frame &# 39 ; s intensity value . if the second frame intensity value is more than the threshold intensity value , then the pixel is given a color ( say blue ). this is done on a pixel - by - pixel basis for the entire image . on visualizing the velocity parametric mapped image , we see color pixels as those pixels that received more gad compared to the previous image by a threshold amount . this threshold is user - specified . a suitable threshold value is around 20 percent , which means the parametric image will show any change in the gad ( or contrast in pixels ) by 10 percent in the next image compared to the previous image . simplified , pixel change is inversely proportional to the threshold value . the higher the velocity threshold , the lower is the pixel change between the time frames of the images . this supports two types of methods for lesion characterizations . ( i ) maximum derivative , and ( ii ) steep slope . in the maximum derivative approach , we compute the image differences followed by maximum intensity selection . if the temporal sequence has “ t ” frames , one can compute t − 1 difference images . now for each pixel location ( x , y ), we compute the maximum intensity value which corresponds to the maximum derivative of the temporal sequence . this method is very similar to the well - known maximum intensity projection ( mip ) method , the only difference lies in its inclusion of the subtracted images before running the mip . in the steep slope method , one can compute the correct signal intensity , given the previous and next image frames . it is mathematically computed as : s ( previous )− s ( end )/{ t * s ( base )* c }, where s ( previous ) is the intensity value of the previous frame at ( x , y ) location , s ( end ) is the intensity value at the last frame at pixel location ( x , y ), t is the time difference , s ( base ) is the base or normalized intensity and c is the constant . the invention has been described with reference to the preferred embodiment . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .
6
fig1 shows a lead 18 having an electrode 20 electrically connected to a conductor coil 30 in two locations . the first connection 34 is at the distal end of electrode 20 , and the second connection 36 is at the proximal end . these connections can be welds , crimps , and the like , in any combination . the conductor coil 30 is in turn electrically connected to connector 32 for coupling with a pulse generator such as the type described in u . s . pat . no . 5 , 007 , 422 to pless et al ., which is assigned to the assignee of the present application . the lead body diameter is generally about 2 . 5 to 4 . 5 mm . fig2 shows a detail view of the distal connection of the lead 18 of fig1 . electrode 20 is shown to be constructed of many ( six ) electrode coils 24 helically wound around a flexible tubular supporting core 22 , which may be either electrically conductive or insulative , and may be extruded or molded . this structure has elastomeric material 28 , which also may be conductive or insulative , partially encapsulating the electrode coils . the many electrode coils increase conductivity and redundancy . one method of achieving this structure is to completely encapsulate the wrapped electrode coils , then abrade away the surface to partially expose the coils using the method of mar et al ., u . s . pat . no . 5 , 226 , 260 , which is assigned to the assignee of the present application and which is incorporated herein by reference . a conductor 30 extends through the lumen of core 22 , making connection 34 at the distal end of electrode 20 . conductor 30 is crimped to a sleeve 31 and to a pin 33 . the distal ends of electrode coils 24 are melted into balls 27 , which are then welded to sleeve 31 , forming an electrical connection to the conductor coil . this connection is also described in u . s . patent application ser . no . 08 / 126 , 291 , filed 24 sept . 1993 by mar , for a &# 34 ; defibrillation electrode connection &# 34 ; which is assigned to the assignee of the present application . the connection 34 is then covered by a protective cap 35 , which may be electrically conductive or insulative . protective cap 35 seals the electrode connection from body fluids . conductor coil 30 forms an inner lumen 38 through which a stylet may be placed to stiffen the lead during implantation . pin 33 serves both as a support for coil 30 and sleeve 31 for crimping , and as a stop for the stylet . fig3 shows that each electrode coil 24 is made from a helically wound metal wire 26 , which may be round or flat in cross section . this wire must be very strong , fatigue resistant , conductive , corrosion resistant , and biocompatible . platinum iridium is one example of such a material . electrode coil 24 is shown without an inner core ; however , a thin wire or plastic filament could be located within coil 24 to provide either increased electrical conductivity , mechanical redundancy , or both . the filament could be metal or nylon , for example . in order for the lead to be sufficiently thin to be transvenously implantable , electrode coils 24 should be between about 0 . 2 and 0 . 4 mm , and wire 26 should be about 0 . 05 to 0 . 10 mm in diameter . close winding of wire 26 into electrode coils 24 provides more exposed metal for charge transfer to tissue . however , space winding decreases the lengths of wire in the coils , decreasing end to end electrode resistance . additionally , space winding provides more surface for matrix material to mechanically stabilize coils and allows for a substantial volume of matrix material that can flex with the heart and body motion instead of pulling away from the coils . therefore , a certain amount of space is preferred , typically one - half to one wire diameter space between wires . similarly , electrode coils 24 can be close or space wound onto core 22 . the same general principles apply . the distal end of each electrode coil 24 is melted into a ball 27 , which provides more volume of material to form a strong and reliable crimp or weld . this melted ball structure works particularly well when made of a noble material such as a platinum iridium alloy . a hydrogen torch , also called a &# 34 ; water welder &# 34 ;, is one suitable means for melting the coil to form the ball . this device dissociates water into hydrogen and oxygen , then burns the hydrogen to form water again . this process burns cleanly , without incorporating byproducts into the melting coil , which is important for maintaining biocompatibility and material consistency for any subsequent welding . fig4 a and 4b illustrate the process by which electrode coils 24 are embedded in elastomeric material 28 , preferably silicone rubber . fig4 a shows electrode coil 24 as molded over by elastomeric material 28 . fig4 b shows the structure of fig4 a , after a portion of elastomeric material 28 has been abraded away to partially expose electrode coil 24 . the level of material removal is controllable . the more metal exposed , the greater the electrode surface area for defibrillation , but the less material for providing mechanical stability . fig5 shows a lead 18 &# 39 ; with a pacing electrode 44 , and lo electrode 20 which is used alternately for defibrillation and for sensing . pacing electrode 44 may be of any of the numerous constructions known in the art . a fixation mechanism 45 is shown as tines , but may be any known in the art , including a screw used for both pacing and fixation . pacing electrode 44 is electrically connected to a pacing conductor coil 40 , which is in turn connected to a pacing connector 43 . electrode 20 is electrically connected at connection 34 to conductor coil 30 , which is electrically connected to both defibrillation connector 32 and a sensing connector ring 39 . fig6 shows a detail view of the distal end of the lead of fig5 . electrode 20 is shown to be constructed of a plurality of electrode coils 24 helically wound around flexible tubular supporting core 22 . this structure has elastomeric material 28 partially encapsulating the electrode coils . conductor 30 extends through the lumen of core 22 , making connection 34 at the distal end of electrode 20 . conductor 30 is welded to the face of sleeve 29 , as described in u . s . patent application ser . no . 08 / 018 , 832 , filed feb . 18 , 1993 by bush et al ., for an &# 34 ; electrical connection for medical electrical stimulation electrodes &# 34 ; which is assigned to the assignee of the present application and which is incorporated herein by reference . the distal ends of electrode coils 24 are melted into balls 27 , and are then welded to sleeve 29 , forming electrical connection 34 to the conductor coil . a pacing conductor coil 40 extends through the lumen of tubular core 22 and is electrically insulated from conductor coil 30 by an insulator 42 . pacing conductor coil 40 is shown connected by a crimp connection to pacing electrode 44 and a crimp pin 41 ; this connection may alternatively be a weld . fig7 shows a detail view of electrical connection 34 . the distal end of conductor coil 30 has been welded to the face of sleeve 29 . electrode coils 24 have had their distal ends melted into balls 27 , then welded to the outside surface of sleeve 29 . fig8 shows a cross sectional view of the proximal end of electrode 20 . two groups of electrode coils 24 have their proximal ends melted into balls 27 &# 39 ; to provide electrical redundancy . molded electrode core tube 22 has two pockets 25 in its proximal end into which balls 27 &# 39 ; are placed prior to wrapping electrode coils 24 onto tube 22 . after elastomeric material 28 is applied , an electrical insulation 37 is joined to electrode 20 using a joining material 47 , for example silicone rubber . a mandrel is used to keep the lumen open during this process , so that the conductor can be passed through the joint and connected at the distal end of electrode 20 . fig9 shows one group of three electrode coils 24 with proximal ends melted into ball 27 &# 39 ;. this group of three electrode coils can be wound onto a tube such as core tube 22 of fig8 in several ways . the preferred method is to insert a mandrel into a molded core tube , place the mandrel into a lathe - type coil winder , insert one group of three electrode coils 24 into each of two pockets of the tube , then use the coil winder to wind the electrode coils 24 around the tube . after the electrode coils 24 are wound onto the core tube , elastomeric material may be compression molded over the coils and core . an alternative method is to embed electrode coils 24 into uncured elastomeric material that has been rolled into thin strips , then wrap the coil embedded strips of elastomeric material around a core tube , then cure the elastomeric material . a third alternative is to apply uncured elastomeric material to a cured core , then wind electrode coils 24 about the core , embedding them into the elastomeric material . yet a fourth alternative is to manufacture the core and elastomeric material portion simultaneously by putting uncured rubber onto a mandrel to form both portions ; electrode coils 24 are then embedded into the surface of the rubber , and the rubber is cured . fig1 shows a lead 18 &# 34 ; with two defibrillation electrodes , 20 &# 39 ; and 20 &# 34 ;, having opposite polarity , and a pacing electrode 44 as it is positioned within a patient &# 39 ; s heart . electrode 20 &# 39 ; acts alternately as a defibrillation electrode and as a sensing electrode . the lead is shown as situated in the heart , with pacing electrode 44 and distal defibrillation electrode 20 &# 39 ; in the right ventricle , and proximal defibrillation electrode 20 &# 34 ; located in the superior vena cava . fig1 shows a lead with a j shaped defibrillation electrode 20 and with screw in tip 44 &# 39 ;, for use in the right ventricle or atrium , for example . screw in tip 44 &# 39 ; can be used for pacing and fixation , or for fixation alone . the preferred method of manufacturing a j shaped lead is to start with a tubular core which has been molded in a j shape . the j shaped tubular core is then straightened by inserting a mandrel into it . then , electrode coils as described above are wound onto the straightened core . the tubular core and electrode coils are then reformed into the j shape by removing the straight mandrel , perhaps lo replacing it with a j shaped one . the tubular core with electrode coils is then molded over with elastomeric material , holding the electrode coils in their final j shape . fig1 shows a spiral electrode 20 , and means for deploying it . a stylet 52 is inserted through lead 18 &# 34 ;&# 39 ; and is used to push electrode 20 through an introducer sheath 56 . fig1 illustrates a lead with three electrodes 20 , intended for implantation subcutaneously on the left lateral part of the chest . they are of the same polarity , and are connected to a common node on conductor 30 . electrode coils 24 are connected at distal ends by melted balls 27 &# 39 ; and wound onto flexible cores 48 . flexible embedding material 50 partially covers electrode coils 24 . the proximal ends of electrode coils 24 are all connected by melting them into ball 27 &# 34 ;. ball 27 &# 34 ; is crimped into metal joining piece 58 . also crimped to metal joining piece 58 is crimp sleeve 31 and conductor coil 30 . a protective strain relief molding 60 encapsulates the entire connection . because the electrode coil wire is longer and thinner than the electrode elements of the prior art , the electrode of the present invention can be made with a certain amount of resistance along its length , say , 3 to 15 ohms . this property of the electrode can be used to direct defibrillation energy to selected regions of the heart by careful choice of connection locations of electrode to conductor . for example , if the electrode 20 of fig5 were placed with its distal end in the apex of the rv , current would be steered to the rv apex since that is where the conductor attaches to the electrode at connection 34 . on the other hand , because of the electrode connections 34 and 36 on either end of electrode 20 of fig1 the current distribution would be more even along the electrode length than in the electrode of fig5 since the potential is the same at either end , assuming a very low resistance conductor 30 . in this case , the end to end electrode resistance is also reduced , with the highest resistance being in the middle of the electrode . the connection could also be made in the middle of the electrode , instead of or in addition to the ends . with the electrode connected to the conductor in only the middle of the electrode and not the ends , current density would be more even since end effects would be reduced . several connections between the conductor and the electrode may be made along the length of one electrode . this is desirable for reducing overall resistance , particularly when the electrode is long , as in the lead of fig1 . the above has been offered for illustrative purposes only and is not intended to limit the scope of the invention of this application , which is as defined in the claims below .
0
the present invention will be described in detail with references to the attached drawings . as shown in fig1 and fig2 an ozone processing device 1 according to this example is equipped with a processing chamber 10 having a predetermined internal volume , a mounting base 20 disposed in the processing chamber 10 and upon the upper surface thereof a substrate k is mounted , and a gas supply head 30 disposed above the mounting base 20 . the processing chamber 10 is a case having a predetermined inner volume and closed by a cover 11 . the processing chamber 10 is formed so that gasses therein are discharged outside by an exhaust device 70 by way of exhaust pipes 71 , 72 , which are passed through and secured to side plates of the processing chamber 10 . the exhaust device 70 adjusts the internal pressure ( absolute pressure ) of the processing chamber 10 so that it is at least 7 kpa ( preferably at least 14 kpa ) and no more than the pressure of the ozone gas supply source . the mounting base 20 is equipped with internal heating means ( not shown ) formed from a heater or the like . this heating means ( not shown ) heats the substrate k mounted on the upper surface . the mounting base 20 can be raised and lowered by raising / lowering device 21 . this raising / lowering device 21 is equipped with a raising / lowering rod 22 that passes through the bottom surface of the processing chamber 10 . this raising / lowering rod 22 supports the mounting base 20 . the raising / lowering rod 22 supports the mounting base 20 . raising / lowering device 21 is formed from , for example , a pneumatic cylinder , and an electric cylinder . multiple support needles 23 formed with tapered ends are projected from the bottom surface of the processing chamber 10 , and the substrate k is loosely placed on the end surfaces . support needles 23 are inserted through through - holes ( not shown ) formed on the mounting base 20 when the mounting base 20 is at its lowermost position , so that the ends project upward from the upper surface of the mounting base 20 . when the mounting base 20 is at its uppermost position , the support needles 23 are pulled out from the through - holes ( not shown ). the substrate k is loosely placed on the support needles 23 when the mounting base 20 is at its lowermost position . then , the mounting base 20 is raised and the support needles 23 move down relative to the mounting base 20 so that the substrate k is mounted on the mounting base 20 . the gas supply head 30 is formed from a block - shaped main head unit 31 and multiple facing plates 40 disposed at a predetermined distance from the main head unit 31 and facing the substrate k on the mounting base 20 . the main head unit 31 is secured to the inner walls of the processing chamber 10 using securing members 12 . a cooling fluid flow path 32 passes through one side surface to the other side surface of he main head unit 31 . cooling fluid circulating device 50 shown in fig2 supplies cooling fluid to the cooling fluid flow path 32 , and this cooling fluid is circulated . cooling fluid circulating device 50 is formed from pipe fittings 56 , pipes 57 , pipe fittings 58 , pipes 59 , cooling fluid supplying device 51 , a pipe 52 , a pipe fitting 53 , a pipe 54 , and a pipe fitting 55 , for example . the pipe fittings 56 are connected to one end of the cooling fluid flow path 32 , and the pipe fitting 55 is connected to the other end of the cooling fluid flow path 32 . the cooling fluid circulation path is formed in this manner from the pipe fittings 56 , the pipes 57 , the pipe fittings 58 , the pipes 59 , cooling fluid supplying means 51 , the pipe 52 , the pipe fitting 53 , the pipe 54 , the pipe fitting 55 , and the cooling fluid flow path 32 . the cooling fluid 32 is supplied from cooling fluid supplying device 51 to the cooling fluid flow path 32 by way of the pipe 52 , the pipe fitting 53 , the pipe 54 , and the pipe fitting 55 , in that order . after it passes through the cooling fluid flow path 32 , the supplied cooling fluid is circulated back to cooling fluid supplying device 51 by way of the pipe fittings 56 , the pipes 57 , the pipe fittings 58 , and the pipe 59 , in that order . ozone gas flow path 33 is formed in the main head unit 31 opening to one of the side surfaces and gas conduction holes 34 opening to the lower surface and communicating with the ozone gas flow path 33 . the gas conduction holes 34 are equipped with through - holes 36 that extend from the upper surface to the lower surface and are connected to gas conduction pipes 35 extended toward the substrate k . each facing plate 40 can be formed in a rectangular shape and is disposed in a co - planar manner so that predetermined gaps 41 are formed between adjacent facing plates 40 . the facing plates 40 are secured with bolts to support members 37 , which are secured to the lower surface of the main head unit 31 . if bolts are used for securing , counterbore holes 42 are formed on the facing plates 40 to prevent the bolt heads from projecting from the lower surfaces of the facing plates 40 . examples of materials preferable for the facing plates 40 include fluorinated resin , zirconia , mica , ceramic , stainless steel , silicon , aluminum , titanium , glass , and quartz . through - holes 43 passing from the upper surface to the lower surface are formed on the facing plates 40 , and the lower ends of the gas conduction pipes 35 are fitted to the through - holes 43 . lower surface openings 43 a of the through - holes 43 serve , together with the lower openings 36 a of the gas conduction pipes 35 , as discharge openings for discharging ozone gas . ozone gas supplied from ozone gas supplying device 60 shown in fig2 to the ozone gas flow path 33 , the gas conduction holes 34 , and the through - holes 36 are discharged from these discharge openings 43 a ( 36 a ) to the substrate k . ozone gas supplying device 60 is formed from pipe fittings 65 connected to the ozone gas flow path 33 , pipes 64 connected to the pipe fittings 65 , pipe fittings 63 connected to the pipes 64 , pipes 62 connected to the pipe fittings 63 , an ozone gas generating device 61 connected to the pipes 62 , and the like . ozone gas ( processing gas ) having a predetermined concentration is supplied from the ozone gas generating device 61 to the ozone gas flow path 33 by way of the pipes 62 , the pipe fittings 63 , the pipes 64 , and the pipe fittings 65 , in that order . in the ozone processing device 1 described above , the substrate k is mounted on the support needles 23 using suitable means . at this point , the mounting base 20 is at its lowermost position . the cooling fluid is supplied by cooling fluid supplying device 51 and is circulated through the cooling fluid circulation path 32 of the main head unit 31 . the main head unit 31 is cooled by this cooling fluid . next , the pressure ( absolute pressure ) within the processing chamber 10 is adjusted by the exhaust device 70 to at least 7 kpa ( preferably at least 14 kpa ) and no more than the pressure of the gas supply source , and raising / lowering device 21 raises the mounting base 20 . when the mounting base 20 is raised , the support needles 23 are lowered relative to the mounting base 20 . the mounting plate k is mounted on the mounting base 20 and the mounting base 20 reaches its uppermost position . also , the substrate k mounted on the mounting base 20 is heated by heating device ( not shown ). then , ozone gas with a predetermined concentration is supplied from the ozone gas generating device 61 to the ozone gas flow path 33 of the main head unit 31 by way of the pipes 62 , the pipe fittings 63 , the pipes 64 , and the pipe fittings 65 , in that order . the gas passes through the gas conduction holes 34 and the through - holes 36 and is blown toward the substrate k from the discharge openings 43 a ( 36 a ) of the facing plates 40 . the ozone gas discharged in this manner collides with the substrate k and forms a flow along it . in this flow , the ozone ( o 3 ) is heated by the substrate k . this heating and the contact with the substrate k and the resist causes it to breaks down into oxygen ( o 2 ) and active oxygen ( o *). this active oxygen ( o *) forms an oxide film on the surface of the substrate k or improves the oxide film on the surface of the substrate k or removes the resist film formed on the surface of the substrate k through a thermochemical reaction . the ozone gas discharged from the discharge openings 43 a and flowing along the substrate k then collides with each other , forming a flow toward the gaps 41 . the gas flows from the gaps 41 to the back surfaces ( upper surfaces ) of the facing plates 41 , i . e ., is discharged from between the substrate k and the facing plates 40 . as a result , the ozone gas which has completed its processing operation is prevented from lingering around the surface of the substrate k to obstruct the flow of ozone gas discharged from the discharge openings 43 a ( 36 a ) to the surface of the substrate k . this allows the operations such as forming or improving oxide film or removing resist film to be performed effectively . the gaps 41 can be within the range of at least 0 . 5 mm and no more than 3 mm . if the gap 41 is less than 0 . 5 mm , the exhaust efficiency of the ozone gas is very poor and the processing effect of the ozone gas is reduced . if the gap exceeds 3 mm , unprocessed sections will remain at areas corresponding to the gaps 41 . by discharging the gas in the processing chamber 10 , the discharging from the gaps 41 can be performed smoothly . in this process , it is preferable for the pressure ( absolute pressure ) in the processing chamber 10 to be at least 7 kpa ( more preferably at least 14 kpa ) and no more than the pressure of the ozone gas supply source . if the pressure in the processing chamber 10 is less than 7 kpa , the discharging from the gaps 41 becomes too fast , shortening the time during which the ozone gas can linger between the facing plates 40 and the substrate k and reducing the effectiveness of the reaction . if the pressure within the processing chamber 10 exceeds the pressure of the ozone gas supply source , the discharge of the product gas generated by the processing does not take place smoothly . the facing plates 40 serve to control the thickness of the ozone gas flow layer flowing along the surface of the substrate k . from this perspective , it is preferable to have the facing plates 40 be as close as possible to the substrate k . by doing this , the thickness of the layer of ozone gas flow along the surface of the substrate k can be made thinner , allowing more ozone to contribute to the formation or improvement of the oxide film or the removal of resist film , thus improving the processing effectiveness . thus , the space between the substrate k and the facing plates 40 must be maintained in an appropriate manner but the facing plates 40 are heated by radiated heat from the heated substrate k and the mounting base 20 , resulting in a tendency to thermally deform . as a result , when a substrate with a large area is to be processed , forming the facing plate 40 from a single plate may lead to thermal deformation that prevents the distance from the substrate k to be maintained appropriately . in this example , the facing plates 40 are formed from multiple plates so that thermal deformation of each individual plate 40 can be kept very small . as a result , an effective distance from the substrate k can be used . in recent years , substrates are becoming larger and larger , but with this arrangement , surfaces can be processed uniformly even for a large substrate k exceeding 1100 mm × 1300 mm . taking thermal deformation into account , the thickness t for the facing plates 40 that allows an effective distance from the substrate k to be maintained is at least 0 . 1 mm , and more preferably at least 1 mm . taking into account the time required for thermal equilibrium to be achieved in the facing plates 40 , it would be preferable for the thickness t to be no more than 5 mm , more preferably no more than 2 mm . if the facing plates 40 all have the same size ( area ), the surface sections of the substrate k corresponding to the facing plates 40 can be processed without unevenness . also , the size of the facing plates 40 can be set to suit the required processing speed . the atmospheric temperature within the processing chamber 10 is increased by the heating performed by heating means ( not shown ). the main head unit 31 is heated in this high - temperature atmosphere , but since the main head unit 31 is cooled by the cooling fluid flowing through the cooling fluid flow path 32 , the ozone gas flowing through the ozone gas flow path 33 is cooled by the cooling fluid and the temperature thereof is kept within a fixed range . as a result , the thermal breakdown of ozone accompanying a rise in temperature is prevented and the lowering of the ozone concentration in the ozone gas is prevented . the heating temperature of the substrate can be in the range 200 °- 500 ° c . within this range , the operations described above can be performed while also vaporizing impurities contained in the substrate k . also , the ozone gas can contain at least 14 % by weight of ozone , or a mixed gas of ozone and teos ( tetraethyl orthosilicate , si ( c 2 h 5 5o ) 4 ). with the ozone processing device 1 described in detail above , the thickness of the layer of ozone gas flowing along the surface of the substrate k is controlled by multiple facing plates 40 and the ozone gas that has completed processing operations ( reactions ) is discharged from the gaps 41 between the facing plates 40 . this improves the reaction efficiency and the processing efficiency of the ozone gas and allows uniform processing of the entire surface even for a large substrate k exceeding 1100 mm × 1300 mm . the above description presents an embodiment of the present invention , but the implementations of the present invention are not restricted to this . for example , the shape of the facing plates 40 is not restricted to the rectangular shape described above . besides the rectangular shape , it is possible to have gaps 77 formed so that the facing plates 75 with discharge openings 76 are formed hexagonally . alternatively , as shown in fig5 gaps 82 can be formed so that the facing plates 80 with discharge openings 81 are formed with triangular shapes . also , facing plates with different shapes such as triangles and rectangles can be combined . as shown in fig6 an embodiment has multiple facing plates 40 formed from a single facing plate 85 , with slit - shaped through - holes 87 formed on the facing plate 85 to partition the surface into multiple regions , each region being formed with a discharge opening 86 . advantages similar to those described above can be obtained with this structure . in this case , taking into account the discharge efficiency of the through - holes 87 , it would be preferable for the slit width to be at least 0 . 5 mm and no more than 3 mm . the slit - shaped through - holes 87 can be replaced with multiple circular holes that are lined up . in this case , the inner diameter of each circular hole can be at least 0 . 5 mm and no more than 3 mm . as described above , the ozone processing device according to the present invention can be used effectively for forming oxide film on the surface of a substrate , e . g ., a semiconductor substrate or a liquid crystal substrate , or improving oxide film formed on the substrate surface , or removing resist film formed on the substrate surface . having described preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention as defined in the appended claims .
7
matrix formulation of active microbiocides in composite concrete tile and asphalt shingle roofing products is essential for durable algae inhibition . the in depth body of polymer stabilization technology including criteria for molecular compatibility , stability and non - volatility is precisely applicable for microbiocides of the present invention . composite protection via surface specific lethal concentration of matrix compatible microbiocides is both durable and controllable by internal diffusion and exudation in response to erosion losses . divalent metal cations complexed with select anionic organic ligands in the form of microbiocidal salts and chelates uniquely meet all the chemical and physical properties for this purpose . clearly , present commercial reliance on water soluble cationic salts released through weathering of passive sources suffers in this regard , particularly in shaded areas with relative high retained moisture and most prolific algae growth . in deference to site specific test decks , the observable growth patterns of both green and blue - green algae dictate evaluations encompassing widely ranging conditions as the basis of technical merit . prolific growth on concrete tile or asphalt shingle often masks the cohabitation of green algae . the persistent dark colored protective sheath of blue - green algae in the presence of active microbiocides is reported by george , et . al . u . s . pat . nos . 5 , 415 , 919 and 5 , 316 , 824 . sodium hypochlorite readily decolorizes the staining residue and under supporting growth conditions evidences the early reappearance of green algae . the vitality of green algae permits qualitative performance evaluation of active micobiocides not previously practiced in this application . tests involving re - colonization of sodium hypochlorite decolorized residential surfaces , confirm the relative toxicity of water soluble divalent salts of copper & gt ; zinc but more significant , the effectiveness of tin in meeting the objectives of the present invention . most surprising and very unexpected is the magnitude of superiority of complexed tin and copper versus free ions of commercial systems ; significantly advancing the state - of - the - art . a myriad of mono -, di - and poly - functional sulfates , sulfonates and carboxylates are available for sequestering and compatibilizing divalent cations for specific composite matrices . these microbiocides are readily prepared by mixing soluble inorganic divalent metal salts with appropriate organic anionic surfactants in aqueous media . cationic exchange in binding dissociation equilibria shifts to the less soluble divalent organometallic complexes ; ultimately to completion upon drying . these aqueous equilibrium reaction mixtures are used to advantage in processes which accommodate spray application and in - situ drying . alternatively , the microbiocides can be spray dried with nucleating agents as required to produce free flowing powders . a generally applicable microbiocide composition would employ an anionic organic ligand sequestered 3 to 1 ratio of divalent copper to tin matrix formulated at 0 . 25 % to 0 . 5 % by weight . while improved consolidation of concrete tiles has been achieved in extrusion processing , porosity and internal void volume remain as the source of effloresence and algae growth problems . applied sealants only marginally reduce algae growth versus glaze coatings which are short lived relative to concrete tile . in the present invention , weatherable acrlyate sealant is formulated with active microbiocide providing a composite matrix with durable algae inhibition . current extrusion lines , equipped for spray application of sealant and topical coatings , readily accommodate microbiocide incorporation . options include reformulated acrylate sealant , in - line premixing and / or two stage addition . sealing of uncured tile is made more effective by means of divalent metal cross linking to congeal the acrylate near the surface yielding a formulated matrix with interstitial contiguity . alkyl polycarboxylate , alkaryloxyethoxy sulfate and / or alkyl esther sulfonate ligand sequestered 3 to 1 equivalent ratio of divalent copper to tin prepared with an excess of divalent metal cation satisfy all the matrix formulation requirements . prepared as aqueous reaction mixtures , they can be incorporated directly as microbiocides and cross linking agents ; stiochometry must be experimentally determined for each specific polymer and substrate . the resulting composite tile saturated with matrix formulated microbiocide to a depth of several centimeters would provide durable protection for the duration of product life . with approximately 7 years life , topical coatings are counter productive in this service where the future of high end roofing must rely on maintenance free performance . in shingle manufacture , formulated molten asphalt used as binder for the base web and surfacing granules also serves as matrix for active microbiocide . the options for incorporation include molten asphalt formulation which necessitates separate stage drying of organometallic complexes . alternatively , pre - treatment of composite raw materials permits utilization of the aqueous reaction mixtures with accompanying process efficiencies and improved product performance . aryl -, alkiaryl - and / or alkyl - carboxylate , sulfate and sulfonate ligands satisfy both compatibility and thermal stability requirements ; difunctionality is employed where substantivity offers advantage . stiochometric equivalence of organic ligand with a 3 to 1 ratio of divalent copper to tin is preferred in composite shingles . the aqueous reaction mixture is suitable for direct application in treatment of calcium carbonate which is the predominate filler used to extend asphalt . treatment of mill feed insures uniform surface coverage toward negating nutrient value and with incremental increase in operating temperature , in - situ drying . the benefits accruing through treatment of surfacing granules in kiln processing include increased asphalt adhesion and elimination of finished product stains ; this by replacement of current water repellent and dedusting oil . the pretreatment of raw materials provides substantive surface coverage of composite particles and / or granules ; the excess or multi - molecular layers are dispersed in the molten asphalt matrix . all components must be thoroughly dry prior to processing at approximately 400 degrees farenheight . the inherent chemical stability and non - volatility of organometallic complex salts and chelates leaves compatibility as a system &# 39 ; s specific requirement . matrix formulation at 0 . 25 % to 0 . 5 % would provide algae protection during the life of the composite roofing product . in this regard , asphalt roofing systems are physically and chemically more fragile than tile . the gradual loss of surfacing granules , which provide the only protection of asphalt against uv catalyzed autoxidation , typically limits product life to 15 years in southern climates . it is significant and disconcerting for even topical maintenance treatments reported in u . s . pat . no . 5 , 599 , 586 to survive product &# 39 ; s terminal half life . with particular concern for the exposed shingle edge , incorporation of free radical scavengers and uv absorbers in matrix formulation could increase composite asphalt shingle life consistent with product claims . the invention is further illustrated by the following examples in which durable surface protection is established through state - of - the - art matrix formulation technology and molecular microbiocide design for controlled performance . widely ranging commercial product variations and environmental conditions dictate broadly applicable test protocols as basis of algae inhibition . residential surfaces exposed to sustained high moisture and indirect light evidence most aggressive growth patterns which in most cases represent cohabitation by blue - green and green algae . the more robust green algae recolonizes well in advance of blue - green algae following decolorizanion with sodium hypochlorite solution permitting evaluation of active microbiocide devoid of obscuring stains . comparative evaluations were made of water soluble divalent metal salts representing commercial systems and the complexed reaction mixtures of the present invention resulting from their exchange with stiochometric equivalents of monovalent cations of organic ligands . horizontal surfaces were used in all cases to nanimize dilution and / or drainage of chemicals which were spray applied at 0 . 25 % in aqueous media . treated surfaces were examined 3 times daily and tests were terminated in the event of rain or after 3 days / dew cycles . parallel tests were run on concrete and coated surfaces with confirming replications . the results tabulated below clearly indicate the relative toxicity of divalent zn & lt ; cu & lt ; sn , and most significantly an order of magnitude greater effectiveness of complexed tin , in addition to the lethal threshold concentrations for matrix formulation . it is precisely this surface protection that can be sustained during composite product life through matrix formulation of compatibilized divalent metallic chelates and salts of the present invention . the aqueous reaction mixtures offer broad flexibility in both composition and application with exchange equilibria ultimately yielding divalent metal chelates and salts upon drying . excess soluble divalent metal ions effectively cross link anionic polymers while stiochometric equivalence with difunctional ligands produces chelate oligomers . in addition to surface durability via matrix compatibility , these active microbiocides exhibit no measurable vapor pressure and exceptional chemical stability . the combination of cupric and stannous complexes for inhibition of both green and blue - green algae is clearly a preferred embodiment . the mono - and di - functional ligands used in these test were sodium salts of dioctylsulfosuccinate / emcol 4500 from witco chemical and dihexadecyldiphenyl oxide disulfonate / dowfax 8390 from dow chemical . they are but examples from among the numerous commercial offerings of anionic sulfonates , sulfates and / or carboxylates useful for matrix compatibilization and optimization of divalent metal microbiocides . the ultimate selections must be empirical and based on laboratory evaluation of specific matrix formulations . moisture intrusion in composite concrete is a common problem throughout industry . current technology to control residual porosity of roof tile centers on particle size distributions to minimize internal void volume and polymer sealants as a barrier against moisture penetration . despite advances achieved in extrusion processing , the technology has not been fully exploited with regard to copolymer acrylic sealants . the application of 50 % aqueous sealant to uncured tile extrudate evidences its facile penetration to internal pores with substantial surface area ; this in the absence of requisite surface saturation and interstitial contiguity . at line speeds in the range of 150 ft ./ min . and sealant application of 1 lb ./ 100 sq . ft . the process is amenable to accelerated coalescence to congeal polymer at the tile face . divalent metal cross - linking with a nominal excess of free divalent cations is an inherent provision of organometallic microbiocides for the purpose . notably , few crosslinks exhibit a substantial modification in rate of polyacrylate coalescence because of their exceptionally high average molecular weight . an incremental viscosity increase toward that of glaze coatings would also reduce sealant penetration . the rate of polymer coalescence and organometallic complex compatibility are laboratory determined for specific sealant and substrate . film clarity of formulated matrix at 0 . 5 % by weight microbiocide in the absence of surface blooming is qualifyng . ethoxylated alcohol half ester of disulfosuccinate / emcol 4300 from witco chemical polycarboxylate / tamol 850 from rohm & amp ; haas and nonylphenoxypolyetheroxy sulfate / triton xn - 45s from union carbide are preferred anionic ligands based on functionality and compatibility in copolymer acrylics . as formulated sealants , elastomeric and thermoplastic acrylic copolymers have proven weatherability and physical properties for durable composite polymer concrete . the microbiocide polymer matrix , formulated to advance coalescence provides effective sealant control and microbiocide performance . the filled asphalt matrix of composite roofing shingles incorporating 0 . 5 % divalent metal complexes would provide product life protection against algae discoloration . alkyl -, aryl - and alkaryl - calboxylate , sulfate and sulfonate ligands readily compatibilize divalent metal cations in the asphalt hydrocarbon mixures ; inherent non - volatility and chemical stability being instrumental for high temperature processing . formulation in molten asphalt requires that the active metal chelates and salts be devoid of moisture ; thus the aqueous reaction mixture is spray or disc dried with nucleating agent as needed for product handling properties . readily available dodecylbenzene -, c 14 - 16 olefin - and polynaththalene - sulfonate sodium salts exchanged with stiochometric equivalent of 3 to 1 ratio copper to tin is preferred . improved matrix formulation rheology and absence of surface film / blooming are ultimate determining factors . alternatively , with integrated raw material sourcing or custom production , manufacturers &# 39 ; have the option of pretreating asphalt fillers . using ligands similar to those described above , spray application of the aqueous cupric - stannous reaction mixture during grinding to approximately minus 200 mesh yields uniform surface coverage of newly formed particle surfaces and insitu drying with increased flue gas temperature in typical classifying mills . the surface activity of these microbiocide coatings improves dispersability of filler particles via hydrophobic wetting . at 0 . 5 % by weight of the matrix formulation , the applied coating will equilibrate providing a uniform concentration through out the asphalt and a retained monomolecular surface coating . the potential synergy in negating the nutrient value of calcium carbonate leverages this approach . because composite granules are only partially embedded , the microbiocide mixture can be tailored to both mineral surface substantivity and asphalt compatibility . monofunctional organic ligands yield divalent metal chelates and salts providing optimum adhesion to asphalt and effective in process granule dedusting . equally important , is the elimination of finished products stains encountered with hydrocarbon oil dedusting . partial incorporation of difunctional organic ligands would increase surface substantivity and durability via chelate oligmer formation ; sodium salts of dihexadecyl diphenyl oxide disulfonatetdowfax 8390 and ethoxylated alcohol half ester sulfosuccinate / emcol 4300 are exemplary . the release of microbiocide to molten asphalt during embedment with retained granule surface coating to promote adhesion offers durable algae resistance as well as needed process improvements . considering the relatively low granule surface area , spray application of 0 . 3 % coating using the aqueous reaction mixture at an effective concentration for uniform distribution and evaporative cooling of kiln furnace product would satisfy composite requirements .
4
the detailed description of the present invention is presented largely in terms of procedures , steps , logic blocks , processing , or other symbolic representations that directly or indirectly resemble the operations of devices or systems contemplated in the present invention . these descriptions and representations are typically used by those skilled in the art to most effectively convey the substance of their work to others skilled in the art . reference herein to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment can be included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments mutually exclusive of other embodiments . referring now to the drawings , in which like numerals refer to like parts throughout the several views . fig1 shows an exemplary temperature compensated frequency synthesizer 100 providing a substantially temperature compensated frequency output , f out , in accordance with the present invention . a reference frequency signal , f r , may be provided by a crystal oscillator or other oscillator . this reference frequency signal f r is used as a reference clock for a frequency locked circuit 110 that generates the required output frequency , f out , by using a corrected frequency control word , fcw_new , where where k is a scaling coefficient . depending on the scaling coefficient k and the corrected frequency control word , fcw_new , a desired timing clock signal can be obtained . one of the features , objectives and advantages in the present invention is that the frequency drift of the reference clock f r can be compensated by the corrected frequency control word , fcw_new , while k is used to scale up or down the corrected frequency . a frequency correction circuit 130 is provided to generate the corrected frequency control word , fcw_new , generally expressed in bits ( e . g ., 32 bits ), by compensating a frequency control word , fcw , which may be provided externally , with a temperature frequency correction word , tcw , where : according to one embodiment , a tcw successive approximation circuit 150 is provided to automatically track and lock the temperature frequency correction word tcw of any predetermined temperature t from an initial temperature frequency correction word tcw ( t 0 ) of the temperature t 0 by using a successive approximation method . in other words , the tcw successive approximation circuit 150 successively computes the temperature frequency correction word tcw of an internal temperature tx , which is increased or decreased by a temperature interval s every time , from the initial temperature frequency correction word tcw ( t 0 ) until the internal temperature tx is caught into a locked range of the predetermined temperature t . thus , the tcw successive approximation circuit 150 outputs the temperature frequency correction word , tcw of the predetermined temperature t . as used herein , a word does not necessarily mean 8 bits . it may mean data represented in a sequence of bits ( e . g ., 8 - bit , 16 - bit or 32 - bit ). the predetermined temperature t may be provided by a digital temperature sensor ( not shown ) which is used to sense an ambient temperature of the reference frequency source . for example , it is desired to generate a desired output frequency of 890 mhz , fcw may be a sequence of bits representing the desired frequency value , tcw may be a sequence of bits representing the temperature frequency compensation value . as a result , the frequency of 890 mhz outputted from the frequency locked circuit 110 may not change along with temperature drift any more . namely , the output frequency of 890 mhz is compensated by the corrected frequency control word , fcw_new . for another example , it is desired to generate a frequency modulated ( fm ) signal within a frequency range of 890 mhz ˜ 910 mhz , fcw is a sequence of bits representing the frequencies in the range , tcw is a sequence of bits representing the frequency compensation value . as a result , the exemplary temperature compensated frequency synthesizer 100 of fig1 functions as a fm generator with temperature compensated frequencies . fig4 shows a graph of frequency versus temperature characteristic curves for a reference frequency signal f r having a frequency stability of about ± 10 ppm over a temperature range from − 50 ° c . to 125 ° c . an uncompensated output curve , a compensation curve and a compensated output curve are all shown in fig4 . the compensation curve includes a plurality of discrete compensation points each corresponding to a compensated temperature point and a temperature frequency correction value . it shows that the frequency drift of the compensated output is greatly reduced in comparison with the uncompensated output . in the prior art , the temperature frequency correction / compensation values of each compensated temperature point shown in fig4 are stored in a look - up table . the temperature frequency correction / compensation word at each compensated temperature point is accurately measured during manufacturing or testing by comparing the output frequency f out and the actually expected frequency . the temperature frequency correction values between two compensated points , such as point a and b shown in fig4 , are estimated by using a linear interpolation logic . the more the compensated points stored in the look - up table , the more accurate the interpolated frequency correcting word will be . however , the hardware cost of the look - up table and the testing cost of the compensated points increases while the number of compensated points stored in the look - up table increases . referring back to fig1 , the tcw successive approximation circuit 150 comprises a temperature comparator 152 , a tcw computing circuit 154 , a memory 156 and a temperature approximation circuit 158 . the memory 156 is provided to store the temperature frequency correction word tcw ( t 0 ) of the initial temperature t 0 , a fixed step size value generally expressed in bits ( e . g ., 16 bits ) and a successive sign bit sequence . the successive sign bit sequence is a sequence consisting of a sign bit of each fixed step size value . the more the number of bits of the successive sign bit sequence has , the smaller a temperature interval s between two adjacent internal temperatures is . in one embodiment , when the sign bit is “ 1 ”, it represents a fixed step size value being positive , and when the sign bit is “ 0 ”, it represents the fixed step size value being negative . the initial temperature frequency correction word tcw ( t 0 ), the fixed step size value and the successive sign bit sequence are programmed into the memory 156 by using the input signal , data . the temperature comparator 152 is provided for comparing the predetermined temperature t with an internal temperature tx to output a comparative result , wherein the initial value of the internal temperature tx is t 0 . the comparative result comprises three different situations : the internal temperature tx being inside a locked range of the predetermined temperature t ; the internal temperature tx being outside the locked range of the predetermined temperature t and tx & lt ; t ; the internal temperature tx being outside the locked range of the predetermined temperature t and tx & gt ; t . when the comparative result is tx being outside the locked range of the predetermined temperature t and tx & lt ; t , the tcw computing circuit 154 is configured for reading one sign bit sb ( tx ) of the internal temperature tx from the successive sign bit sequence , assigning the read sign bit sb ( tx ) to the fixed step size value to get an actual step size of the internal temperature tx , and computing the temperature frequency correction word tcw ( tx + s ) of the internal temperature tx + s according to the temperature frequency correction word tcw ( tx ) and the actual step size of the internal temperature tx , wherein the initial value of the temperature frequency correction word tcw ( tx ) is tcw ( t 0 ) pre - stored in the memory 156 . subsequently , the temperature approximation circuit 158 is provided for increasing the internal temperature tx by the temperature interval s and outputting the new internal temperature tx to the temperature comparator 152 . thus , the internal temperature tx successively approximate to the predetermined temperature t . when the comparative result is tx being outside the locked range of t and tx & gt ; t , the tcw computing circuit 154 is configured for reading one sign bit sb ( tx − s ) of the internal temperature tx − s from the successive sign bit sequence , assigning the read sign bit sb ( tx − s ) to the fixed step size value to get the actual step size of the internal temperature tx − s , and computing the temperature frequency correction word tcw ( tx − s ) of the internal temperature tx − s according to the temperature frequency correction word tcw ( tx ) of the internal temperature tx and the actual step size of the internal temperature tx − s , wherein the initial value of the temperature frequency correction word tcw ( tx ) is tcw ( t 0 ) pre - stored in the memory 156 . subsequently , the temperature approximation circuit 158 is provided for decreasing the internal temperature tx by the temperature interval s and outputting the new internal temperature tx to the temperature comparator 152 . thus , the internal temperature tx successively approximate to the predetermined temperature t . simultaneously , the temperature frequency correction word tcw ( tx ) also approximate to the desired temperature frequency correction word tcw ( t ) of the predetermined temperature t . when the comparative result is tx being inside the locked range of the predetermined temperature t , the tcw computing circuit 154 computes the desired temperature frequency correction word tcw ( t ) of the predetermined temperature t according to the locked temperature frequency correction word tcw ( tx ) of the internal temperature tx . for each compensated temperature point , it only requires to store 1 - bit data as the sign bit of the fixed step size value . thus , more compensated temperature points with small temperature interval can be re - sampled for temperature frequency compensation , and the high accurate compensation and the minimum memory capacity can be achieved in one embodiment of the present invention . furthermore , a fully digital successive approximation solution is provided in the present invention to automatically track and lock the temperature frequency correction word tcw of any predetermined temperature t , thereby minimizing the memory capacity and increasing the compensation precision . fig2 is a block diagram showing a tcw computing circuit 154 in accordance with one embodiment of the present invention . the tcw computing circuit 154 comprises a forward approximation computing unit 202 for computing the temperature frequency correction word tcw ( tx + s ) of the internal temperature tx + s when tx being outside the locked range of t and tx & lt ; t , a backward approximation computing unit 204 for computing the temperature frequency correction word tcw ( tx − s ) of the internal temperature tx − s when tx being outside the locked range of t and tx & gt ; t , a tcw storing unit 206 for storing the temporary temperature frequency correction word , and an interpolation unit 208 for computing the temperature frequency correction tcw ( t ) of the predetermined temperature t with preferable interpolation based on the locked temperature frequency correction tcw ( tx ) of the internal temperature tx . fig3 is a flowchart of successively tracking and locking the temperature frequency correction word tcw of the predetermined temperature t in accordance with one embodiment of the present invention . the successive approximation method comprises following operations . at 301 , some parameters are initialized : tx = t 0 , tcw ( tx )= tcw ( t 0 ), wherein tx denotes the current internal temperature , tcw ( tx ) denotes the temperature frequency correction word tcw of the internal temperature tx , t 0 is the initial temperature , tcw ( t 0 ) is the temperature frequency correction word of the initial temperature t 0 pre - stored in the memory 156 shown in fig1 . at 303 , the current temperature t is read from external . the current temperature t may be provided from the digital temperature sensor and is also referred as the predetermined temperature or object temperature in the present invention . at 305 , the current temperature t is compared with the internal temperature tx , if tx is outside the locked range of t and tx & lt ; t , the process is taken to 307 , if tx is outside the locked range of t and tx & gt ; t , the process is taken to 313 , if tx is inside the locked range of t , the process is taken to 319 . at 307 , one sign bit sb ( tx ) of the internal temperature tx is read out from the successive sign bit sequence pre - stored in the memory 156 and assigned to the fixed step size value pre - stored in the memory 156 to get the actual step size of the internal temperature tx , wherein sb ( tx ) is the sign bit of the internal temperature tx in the successive sign bit sequence . at 309 , the temperature frequency correction word tcw ( tx + s ) of the internal temperature tx + s is computed according to the temperature frequency correction word tcw ( tx ) and the actual step size of the internal temperature tx , wherein s is the temperature interval mentioned above . at 311 , tx = tx + s and the process is returned to 303 . for eliminating the influence because of the changes of the current temperature t , the process is preferably returned to 303 , but not 305 . at 313 , one sign bit sb ( tx − s ) of the internal temperature tx − s is read out from the successive sign bit sequence pre - stored in the memory 156 and assigned to the fixed step size value pre - stored in the memory 156 to get the actual step size of the internal temperature tx − s . at 315 , the temperature frequency correction word tcw ( tx − s ) of the internal temperature tx − s is computed depending on the temperature frequency correction word tcw ( tx ) and the actual step size of the internal temperature tx − s . at 317 , tx = tx − s and the process is returned to 303 . for eliminating the influence because of the changes of the current temperature t , the process is preferably returned to 303 , but not 305 . at 319 , the desired temperature frequency correction word tcw ( t ) of the current temperature t is computed with preferable interpolation according to the temperature frequency correction word tcw ( tx ). at the same time , t is recoded as tlock . it should be explained that if the precision of the current temperature t is less than the temperature interval s , e . g . s = 0 . 2 ° c . and the precision of t is 0 . 1 ° c ., the interpolation is necessary for getting the desired temperature frequency correction word tcw ( t ). otherwise , the interpolation may not be necessary . furthermore , a variety of conventional interpolations such as linear interpolation , non - linear interpolation or parabolic interpolation etc . may be used for getting the desired temperature frequency correction word tcw ( t ) according to the locked temperature frequency correction word tcw ( tx ). in some embodiment , other adjacent temporary temperature frequency correction word such as tcw ( tx − s ), tcw ( tx + s ) may also be required for interpolation . at 321 , the current temperature t is read . at 323 , whether t is equal to tlock is determined , if yes , the process is returned to 321 , otherwise , the process is returned to 305 to repeat the temperature locking operation . as described above , the basic idea of the successive approximation solution is to successively adjust the internal temperature tx to be approximate the current temperature t by the temperature interval s , and compute the temperature frequency correction word tcw ( tx ) of the internal temperature tx simultaneously until the internal temperature tx is locked into the predetermined range of the current temperature t , thereby the locked temperature frequency correction word tcw ( tx ) can be calculated . subsequently , the desired temperature frequency correction word tcw ( t ) of the current temperature t can be computed with interpolation according to the locked temperature frequency correction word tcw ( tx ). the current temperature t is detected all the time , when detecting that the current temperature t is unlocked , the flow shown in fig3 begins new temperature tracking and locking operations again . in a first preferred embodiment , the memory 156 shown in fig1 further stores a difference tcwd ( t 0 ) of the temperature frequency correction word tcw ( t 0 ) of the initial temperature t 0 besides tcw ( t 0 ), the fixed step size value and the successive sign bit sequence . the difference of the temperature frequency correction word is the difference value between the temperature frequency correction words of two adjacent temperature points . the fixed step size value is the absolute value of the difference between the differences of the temperature frequency correction words of two adjacent temperature points . so , the fixed step size value can be also referred as the fixed difference step size value and denoted as tcwds . the initial temperature t 0 may be the minimum value of the temperature covering range ( such as from − 30 ° c . to 50 ° c .). the number of bits of the successive sign bit sequence is relative to the temperature interval s and the temperature covering range . for an example , provided that the temperature covering range is from − 30 ° c . to 50 ° c ., and the temperature interval s is 0 . 2 ° c ., the number of bits of the successive sign bit sequence will be ( 50 −(− 30 ))/ 0 . 2 − 1 = 400 − 1 ( the sign bit of the maximum temperature 50 ° c . is not defined and but also not used ). it should be noted that tcw ( t 0 ), tcwd ( t 0 ), tcwds and the successive sign bit sequence are programmed into the memory 156 by using the input line , data shown in fig1 . fig5 is a flowchart of successively tracking and locking the temperature frequency correction word tcw ( t ) of the current temperature t in the first preferred embodiment . the successive approximation technique comprises following operations . at 501 , some parameters are initialized : tx = t 0 , tcw ( tx )= tcw ( t 0 ), tcwd ( tx )= tcwd ( t 0 ). at 503 , the current temperature t is read from external . at 505 , whether the current temperature t is larger than or equal to the internal temperature tx + s is determined , if yes , the process is taken to 507 , otherwise , the process is taken to 513 . at 507 , one sign bit sb ( tx ) of the internal temperature tx is read out from the successive sign bit sequence and assigned to the fixed difference step size value tcwds to get the actual difference step size of the internal temperature tx . at 509 , the temperature frequency correction word tcw ( tx + s ) and the difference tcwd ( tx + s ) of the internal temperature tx + s are computed according to the temperature frequency correction word tcw ( tx ), the difference tcwd ( tx ) and the actual step size of the current internal temperature tx , wherein : at 511 , tx = tx + s and the process is returned to 503 . at 513 , whether the current temperature t is less than the internal temperature tx is determined , if yes , the process is taken to 515 , otherwise , the process is taken to 521 . at 515 , one sign bit sb ( tx − s ) of the internal temperature tx − s is read out from the successive sign bit sequence and assigned to the fixed difference step size value tcwds to get the actual difference step size of the internal temperature tx − s . at 517 , the temperature frequency correction word tcwd ( tx − s ) and difference the tcw ( tx − s ) of the internal temperature tx − s are computed according to the temperature frequency correction word tcw ( tx ), the difference tcwd ( tx ) and the actual step size of the current internal temperature tx − s , wherein : at 519 , tx = tx − s and the process is returned to 503 . at 521 , if tx = t , the temperature frequency correction word tcw ( tx ) is given as the temperature frequency correction word tcw ( t ) of the current temperature t ; if tx + s & gt ; t & gt ; tx , the temperature frequency correction word tcw ( t ) of the current temperature t is computed with preferable interpolation based on the temperature frequency correction word tcw ( tx ). at the same time , the current temperature t is recorded as tlock . in this embodiment , the locked range of the current temperature is tx + s & gt ; t ≧ tx . at 523 , the current temperature t is read . at 525 , whether t is equal to tlock is determined , if yes , the process is returned to 523 , otherwise , the process is returned to 505 to repeat the temperature locking operation . for an example , provided that the initial temperature t 0 is the minimum temperature − 30 ° c . of the temperature covering range , once the temperature compensated frequency synthesizer 100 shown as fig1 is activated , the digital temperature sensor provides the current temperature t such as 20 ° c . by sensing ambient temperature . thus , the process flow begin to continuously repeat operations of 503 - 511 so that the internal temperature tx is quickly approximate to 20 ° c . from − 30 ° c . finally , the process flow enters the operation of 523 , where the internal temperature tx is caught in the locked range of 20 ° c . ( e . g . from 20 ° c . to 20 . 2 ° c .). if the ambient temperature of the temperature compensated frequency synthesizer is suddenly changed , the process flow will enter the tracking and locking operations again immediately . fig6 is a graph of a temperature frequency characteristic curve of the reference frequency signal with obvious frequency changes in certain temperature ranges . because there are enough compensated temperature points to be used for temperature frequency compensation in the present invention , the temperature compensation solution of the present invention can follow the temperature frequency characteristic curve of the reference frequency shown in fig6 . thereby , even for the reference frequency signal with obvious frequency changes as shown as fig6 , an accurate compensation result of the present invention can be achieved . how to determine tcw ( t 0 ), tcwd ( t 0 ), tcwds and the successive sign bit sequence is described in detail hereafter . fig7 is a flowchart of determining tcw ( t 0 ), tcwd ( t 0 ) tcwds in accordance with the first preferred embodiment of the present invention . fig8 is a flowchart of determining the value of each sign bit in the successive sign bit sequence in accordance with the first preferred embodiment of the present invention . referring to fig7 , the method for determining tcw ( t 0 ), tcwd ( t 0 ), tcwds comprises the following operations . at 701 , the temperature versus frequency curve of the reference frequency signal f r is obtained . the curve can be obtained by a variety of conventional ways , which must keep the difference between the obtained curve and the actual curve as small as possible and keep the obtained curve smooth simultaneously . in one embodiment , when there is no obvious frequency jumps , bechamann curve generator can be used to generate the accurate temperature versus frequency curve by using only several temperature test points . at 703 , the frequency versus temperature curve is sampled at the temperature interval s to get frequency values of sampling temperature points . the sampling temperature interval s directly corresponds to the temperature interval s between the two adjacent compensated temperature points mentioned above . the sampling temperature points directly correspond to the compensated temperature point mentioned above accordingly . in one embodiment , the sampling temperature interval s may change according to the different temperature ranges . e . g . for the temperature ranges of 0 ° c .- 20 ° c . shown in fig6 , the sampling temperature interval s may be 0 . 2 ° c . ; for the other temperature ranges shown in fig6 , the sampling temperature interval s may be 0 . 25 ° c . in the prior art , the temperature frequency correction word tcw of each compensated temperature point requires to be accurately measured during manufacturing or testing . thus , the testing cost for each compensated temperature point is very high so that the number of the compensated temperature points is very limited . in the present invention , the compensated temperature points are obtained by sampling the temperature frequency curve , whereby the number of the compensated temperature points can be easily defined according to the required temperature - frequency compensation accuracy . at 705 , the ideal temperature frequency correction words tcw ideal ( tx ) of the sampling temperature points tx is computed based on the frequency values of the sampling temperature points tx according to a function relation between the frequency values and the temperature frequency correction words tcw of the sampling temperature points tx . herein , tx is the discrete sampling temperature points with the temperature interval s from the minimum ( tx ) to maximum ( tx ). the ideal temperature frequency correction words tcw ideal ( tx ) of the sampling temperature points tx is recorded to determine the value of each sign bit of the successive sign bit sequence . at 707 , the differences tcwd ideal ( tx ) of the ideal temperature frequency correction words tcw ideal ( tx ) of the sampling temperature points tx are computed , wherein at 709 , one sampling temperature point such as the minimum , maximum or intermediate value of tx is selected as the initial temperature t 0 , the ideal temperature frequency correction word of the selected sampling temperature point is selected as tcw ( t 0 ), and the difference of the ideal temperature frequency correction word of the selected sampling temperature point is selected as tcwd ( t 0 ), accordingly . at 711 , the second order differences tcwdd ideal ( tx ) of the ideal temperature frequency correction words tcw ideal ( tx ) of the sampling temperature points tx are computed , wherein at 713 , the maximal absolute value of the second order differences tcwdd ideal ( tx ) is selected as the fixed difference step value tcwds . thus , the fitting curve formed during temperature tracking and locking operations in fig5 can perfectly follow the ideal curve obtained at 701 . in other embodiment , the absolute value of the other second order differences tcwdd ideal ( tx ) may also be selected as the fixed difference step value tcwds . it can be seen that the data tcw ( t 0 ), tcwd ( t 0 ) and tcwds are measured through operations of 701 - 713 and will be used to determine the value of each sign bit of the successive sign bit sequence shown in fig8 . referring to fig8 , the method for determining the value of each sign bit of a successive sign bit sequence comprises the following operations . at 801 , some parameters are initialized : tx = t 0 + s ; ntcw ( tx − s )= tcw ( t 0 ); ntcwd ( tx − s )= tcwd ( t 0 , where tx is the current compensated temperature points herein , ntcw ( tx − s ) is the temperature frequency correction word of tx − s , ntcwd ( tx − s ) is the difference of the temperature frequency correction word ntcw ( tx − s ) of tx − s . it should be noted that the ideal temperature frequency correction words tcw ideal ( tx ) is different from the temperature frequency correction word ntcw ( tx ). in this embodiment , the minimum value of the temperature range is selected as the initial temperature t 0 . in other embodiment , if the maximum value of the temperature range is selected as the initial temperature t 0 , the initialization operation may be modified as : tx = t 0 − s ; ntcw ( tx + s )= tcw ( t 0 ); ntcwd ( tx + s )= tcwd ( t 0 ), the following operations may be modified correspondingly which is omitted here for clarity . at 803 , the temperature frequency correction word ntcw ( tx ) of the compensated temperature point tx is computed , wherein : at 805 , provided that the sign bit sb ( tx − s ) of the compensated temperature point tx − s is negative such as “ 0 ”, the first computing value ntcw 0 ( tx + s ) can be given as : ntcw0 ( tx + s )= ntcw ( tx )+ ntcwd ( tx )= ntcw ( tx − s )+ ntcwd ( tx − s )+ ntcwd ( tx − s )+ sb ( tx − s )* tcwds = ntcw ( tx − s )+ 2 * ntcwd ( tx − s )− tcwds . at 807 , the first absolute value dntcw 0 ( tx + s ) of the difference between the first computing value ntcw 0 ( tx + s ) and the ideal temperature frequency correction words tcw ideal ( tx + s ) is computed , wherein : at 809 , provided that the sign bit sb ( tx − s ) of the compensated temperature point tx − s is positive such as “ 1 ”, the second computing value ntcw 1 ( tx + s ) is computed , wherein : at 811 , the second absolute value dntcw 1 ( tx + s ) of the difference between the second computing value ntcw 1 ( tx + s ) and the ideal temperature frequency correction words tcw ideal ( tx + s ) is computed , wherein : at 813 , whether the first absolute value dntcw 0 ( tx + s ) is less than the second absolute value dntcw 1 ( tx + s ) is determined , if yes , the process is taken to 815 , otherwise , the process is taken to 817 . at 815 , the sign bit sb ( tx − s ) of the compensated temperature point tx − s in the successive sign bit sequence is determined as negative such as “ 0 ”, then the process enters 819 . at 817 , the sign bit sb ( tx − s ) of the compensated temperature point tx − s in the successive sign bit sequence is determined as positive such as “ 1 ”, then the process enters 821 . at 819 , the difference ntcwd ( tx ) of the temperature frequency correction word ntcw ( tx ) is computed , wherein : at 821 , the difference ntcwd ( tx ) of the temperature frequency correction word ntcw ( tx ) is computed , wherein : at 823 , tx = tx + s and the process is taken to 825 , where whether tx is less than or equal to max ( tx )− s , if no , the process exits ; otherwise , the process is returned to 803 . it can be seen that the value of each sign bit can be determined by operations of 801 - 825 . finally , the determined data tcw ( t 0 ), tcwd ( t 0 ), tcwds and the successive sign bit sequence are stored in the memory 156 shown in fig1 . in a second preferred embodiment , besides tcw ( t 0 ), the fixed step size value and the successive sign bit sequence , the memory further stores a difference tcwd ( t 0 ) of the temperature frequency correction word tcw ( t 0 ) at the initial temperature t 0 , a second order difference tcwdd ( t 0 ) of the temperature frequency correction word tcw ( t 0 ) of the initial temperature t 0 . the difference of the temperature frequency correction word is the difference value between the temperature frequency correction words of two adjacent temperature points . the second order difference of the temperature frequency correction word is the difference value between the differences of the temperature frequency correction words of two adjacent temperature points . the fixed step size value is the absolute value of the difference between the second order differences of the temperature frequency correction words of two adjacent temperature points . so , the fixed step size value can be also referred as the fixed second order difference step size value and denoted as tcwdds . the method for successively tracking and locking the temperature frequency correction word tcw ( t ) of the current temperature t in the second preferred embodiment is substantially identical with the method shown in fig5 except for operations of 509 and 517 . likewisely , the determining operations of the data tcw ( t 0 ), tcwd ( t 0 ), tcwdd ( t 0 ), tcwdds and the successive sign bit sequence in the second preferred embodiment may be made a little changes relative to the determining operations shown in fig7 and 8 . however , the basic ideas are identical , the specific changes is omitted here for claricity . in a third preferred embodiment , the memory only stores tcw ( t 0 ), the fixed step size value and the successive sign bit sequence . the fixed step size value is the absolute value of the difference between the temperature frequency correction words of two adjacent temperature points . the fixed step size value can be denoted as tcws . the method for successively tracking and locking the temperature frequency correction word tcw ( t ) of the current temperature t in the third preferred embodiment is substantially identical with the method shown in fig5 except for operations of 509 and 517 . likewisely , the determining operations of the data tcw ( t 0 ), tcws and the successive sign bit sequence in the third embodiment may also be made a little changes relative to the determining operations shown in fig7 and 8 . however , the basic ideas are identical , the specific changes is omitted here for clarity . in one embodiment , it has plural groups of initial data for different temperature covering ranges . for example , for the temperature ranges of 0 ° c .- 20 ° c . shown in fig6 , a first initial temperature t 01 such as 0 ° c . is determined , a first group of initial data comprising tcw ( t 01 ), tcwd ( t 01 ), tcwds 1 and the successive sign bit sequence are determined and stored in the memory 156 ; for the temperature ranges of − 30 ° c .- 0 ° c . shown in fig6 , a second initial temperature t 02 such as − 30 ° c . is determined , a second group of initial comprising tcw ( t 02 ), tcwd ( t 02 ), tcwds 2 and the successive sign bit sequence are determined and stored in the memory 156 ; for the temperature ranges of 20 ° c .- 80 ° c . shown in fig6 , a third initial temperature t 03 such as 20 ° c . is determined , a third group of initial comprising tcw ( t 03 ), tcwd ( t 03 ), tcwds 3 and the successive sign bit sequence are determined and stored in the memory 156 . as a result , the compensation result may be more accurate to compensate the frequency drift of a reference signal with obvious frequency jumps shown like fig6 . one of the features , objectives and advantages in the present invention is to successively track the current temperature t via decreasing or increasing the internal temperature tx by the temperature interval s , compute the temperature frequency correction word of the internal temperature tx by using corresponding sign bit and the initial data such as pre - stored in the memory until the internal temperature tx is locked into the locked range of the current temperature t . by the successive approximation solution of the present invention , the memory for the initial data is minimized while the number of the compensated temperature points is maximized . furthermore , the high compensation accuracy can be achieved . theoretically , the successive approximation solution of the present invention is not limited in use of obtaining the temperature frequency correction word . in fact , the successive approximation solution can be used to replace all conventional look - up table solution in any application fields . according to another aspect of the present invention , the successive approximation method and apparatus are provided for obtaining corresponding look - up word v according to a current look - up point p . referring to fig1 and 2 , the successive approximation apparatus for obtaining a look - up word v , corresponding to the tcw successive approximation circuit 150 , comprises a look - up point comparator , a look - up point approximation circuit , a look - up word locked circuit and a memory , wherein the look - up point p corresponds to the compensated temperature point t , and the look - up word v corresponds to the temperature frequency correction word tcw . substituting the look - up point p for the compensated temperature point t , and substituting the look - up word v for the temperature frequency correction word tcw , the successive approximation solution for obtaining corresponding look - up word v can be achieved according to the successive approximation solution for obtaining the temperature frequency correction word tcw described above . next , some specific substituting operations are described hereafter as examples . in the first preferred embodiment , the memory further stores a difference vd ( p 0 ) of the look - up value v ( p 0 ) of the initial look - up point p 0 besides v ( p 0 ), the fixed step size value and the successive sign bit sequence . the difference of the look - up value is the difference value between the look - up values of two adjacent look - up points . the fixed step size value is the absolute value of the difference between the differences of the look - up values of two adjacent look - up points . so , the fixed step size value can be also referred as the fixed difference step size value and denoted as vds . at 507 , one sign bit sb ( px ) of the internal look - up point px is read out from the successive sign bit sequence and assigned to the fixed difference step size value vds to get the actual difference step size of the internal look - up point px . at 509 , the look - up value v ( px + s ) and the difference vd ( px + s ) of the internal look - up point px + s are computed depending on the look - up value v ( px ), the difference vd ( px ) and the actual step size of the internal look - up point px , wherein : the present invention has been described in sufficient detail with a certain degree of particularity . it is understood to those skilled in the art that the present disclosure of embodiments has been made by way of examples only and that numerous changes in the arrangement and combination of parts may be resorted without departing from the spirit and scope of the invention as claimed . accordingly , the scope of the present invention is defined by the appended claims rather than the forgoing description of embodiments .
7
fig1 is a sectional view of an exemplary structure of a manhole 10 . the manhole 10 includes a bottom floor 12 , a barrel 16 above the bottom floor 12 , a cone 18 supported by the barrel 16 , and a plurality of adjusting rings 20 supported by the cone 18 . a casting frame 22 resides upon the upper most ring 20 and supports a lid 26 . the casting 22 is normally sealed to the top ring 20 . it is understood that one or more rings 20 may be used to adjust the height of the manhole 10 such that the lid 26 is substantially at the level of the pavement 66 surrounding the manhole 10 . also , while fig1 shows the cone 18 to have a concentric shape , it is understood that an eccentric cone can be utilized such that the manhole 10 has an asymmetrical cross - sectional appearance . fig1 also shows an optional run through 14 in the bottom floor 12 . while each manhole generally has unique size and shape , it is generally understood that the basic construction of the manhole 10 is similar in all manholes . although manholes comprise varying diameters d 1 , d 2 , d 3 , and d 4 along the height of the manholes , the manholes generally are narrower at the top section , or chimney , than at the bottom section . additionally , bricks 72 generally form the wall 24 of manholes . fig2 is a sectional view of the liner assembly 30 of the present invention positioned in a manhole 10 . the liner assembly 30 includes a bladder 32 , a manhole liner 42 , and a base 68 . the bladder 32 comprises a first end 34 attached to the base 68 near the opening 28 of the manhole 10 , a second end 36 positioned at the bottom 58 of the manhole , and a bladder body 38 there between . the first end 34 of the bladder 32 may be attached to the base 68 outside of the manhole 10 as well . the diameter 40 of the bladder 32 is preferably less than or equal to the smallest diameter d 1 of the manhole 10 . however , the bladder body 38 is stretchable such that it is able to press against a wall 24 of the manhole 10 when expanded . the manhole liner 42 is attached at the opening 28 of the manhole , and comprises a manhole liner body 44 that at least partially surrounds the bladder body 38 in the manhole 10 . the manhole liner body 44 is comprised of lining material substantially free of coating or intermediate layers of material impervious to the resinous material 48 . the resinous material 48 may be a thermoset resin , which saturates the liner and cures and hardens quicker in the presence of heat . however , it should be appreciated that other resinous materials may be used , on the condition that they are able to cure and harden . the manhole liner 42 is essentially a transport device , such that the resinous material 48 forms the structural properties of the liner when cured . the diameter 46 of the manhole liner 42 in one preferred form is sized substantially equal to the largest diameter d 1 of the manhole 10 . therefore , the manhole liner 42 does not need to be stretchable . after the manhole liner 42 has been impregnated with a resinous material 48 , the manhole liner 42 is positioned in the manhole 10 . the bladder 32 is then inserted into the manhole liner 42 . fig3 is a top sectional view of the manhole 10 of fig2 according to line 3 - 3 of fig2 . fig3 shows the bladder 32 and the manhole liner 42 positioned in the manhole 10 . as is seen in fig3 , the diameter 40 of the bladder 32 is less than the diameter 46 of the manhole liner 42 . as is also shown in fig3 , the original diameter 46 of the manhole liner 42 is substantially greater than the diameter d 3 of the manhole 10 at the adjusting rings 20 . because the diameter 46 of the manhole liner 42 is greater than the diameter d 3 of the adjusting rings 20 , the manhole liner will fold over itself and bunch up to fit within the top section 60 of the manhole 10 . in another preferred form , the diameter 46 of the manhole liner 42 is sized larger than the smallest diameter of the manhole 10 . here , the manhole liner will again fold over on itself and bunch up to fit the smaller diameter portions of the manhole 10 . fig4 is a sectional view similar to fig2 showing bladder 32 fully inflated in the manhole 10 . the bladder 32 is inflated with fluid pressure ( not shown ), such as air , introduced to the cavity 70 of the bladder body 38 . the increased pressure causes the stretchable bladder body 38 to expand circumferentially towards the wall 24 of the manhole 10 . the expanded bladder will press the manhole liner 42 against the wall 24 of the manhole 10 . this will create a layer 64 of resinous material 48 between the manhole liner 42 and the bladder body 38 . because the bladder 32 has stretched circumferentially against the manhole liner 32 , the bladder body 38 will have a smooth surface abutting the layer 64 of resinous material 48 . this ensures that the resulting manhole wall 24 will be smooth . fig5 shows a top sectional view of the manhole 10 of fig4 according to the line 5 - 5 of fig4 . fig5 is a sectional view of the manhole 10 near the top section 60 of the manhole 10 , where the diameter d 3 of the manhole is substantially smaller than the diameter d 1 of the bottom 58 of the manhole 10 . because the manhole liner 42 has been sized substantially equal to the diameter d 1 of the larger section of the manhole 10 , there will be excess manhole liner body 44 at this upper section . the excess manhole liner body 44 will fold over itself and bunch up to create folds 52 in the liner . however , because the manhole liner 42 does not contain a resin impermeable coating , the folds 52 will compress and resinous material 48 will form a manhole liner 42 in the same way as in the bottom section , where the manhole liner 42 is a single layer . the compression creates a layer 62 of resinous material 48 between the manhole liner 42 and the bladder 32 . the thickness of the layer 62 of resinous material may vary according to the number of folds 52 or bunches in the manhole liner 42 . however , because the bladder 32 was stretched to press the manhole liner 42 against the wall 24 of the manhole 10 , the bladder 32 will have a smooth surface 56 pressed against the varying layers of resinous material 48 . this will result in the resinous material having a smooth interior surface . because the folds 52 contain two or more layers of manhole liner 42 , the resinous material 48 will cure and harden to produce a thicker wall 24 of the manhole 10 at the top section 60 of the manhole . however , because the top section 60 , including the cone 18 and adjusting rings 20 ( the chimney ), of the manhole 10 undergoes the most stress and usually contains the most damage , the resulting thicker wall 24 will be stronger to help resist cracking due to freezing and thawing . fig6 is a sectional view of the manhole 10 after the resinous material 48 has cured and hardened and the bladder 32 has been removed from the manhole 10 . the bladder 32 may be removed by deflating the fluid from the cavity 70 , and then by pulling a rope ( not shown ) connected to the second end 36 of the bladder 32 . pulling the bladder 32 out by the bottom first causes the bladder 32 to peel away from the cured resinous material 48 . although peeling the bladder 32 requires the least amount of effort , it should be appreciated that the bladder 32 may also be pulled straight out of the manhole 10 from the first end 34 of the bladder 32 as well . after the manhole lid 26 is replaced on the casting frame 22 of the manhole , what remains is a manhole 10 having a repaired and structurally renewed wall 24 . as is shown in fig6 , the manhole liner 42 has compressed the impregnated resinous material 48 from the manhole liner body 44 , creating a cured resinous material layer 62 around the interior periphery of the manhole 10 . as stated above , the layer 62 will be thicker in the top portion 60 , or the chimney , of the manhole 10 because the manhole liner will have folded over itself . the thicker layer aids the section most affected by the elements , however . the folds 52 will occur in areas of the manhole 10 having a diameter less than the largest diameter d 1 of the manhole 10 . fig7 is a top sectional view of the manhole 10 of fig6 according to the line 7 - 7 of fig6 . fig7 shows that although the manhole liner 42 folded over itself , the manhole liner 42 was compressed against the smooth outer surface 56 of the bladder 32 , such that the interior periphery of the resinous material 48 cured into a smooth finish 50 . at the upper section of the manhole , the folds 52 of the manhole liner 42 will cause the cured resinous layer 62 to be thicker than at the bottom of the manhole 10 . however , because the bladder 32 is pressed against the manhole liner 42 with even pressure , the layer 62 of resinous material 48 will be substantially equal at a given height around the interior of the manhole 10 . the resinous material 48 will migrate from the liner to fill low areas of the liner , formed due to the folds , to create a resinous surface that is smooth about the interior periphery of the manhole 10 . the smooth finish 50 of the cured resinous material 48 allows the manhole to be used as it had previously before it required repair . the invention has been shown and described above with reference to preferred embodiments , and it is understood that modifications , substitutions , and additions may be made which are within the intended spirit and scope of the invention . the invention is only to be limited by claims appended hereto .
4
referring now to the drawings , where in like numerals designate corresponding parts throughout the several views , there is shown in fig1 - 3 , the connector device of the present invention generally designated at 10 . as previously discussed , the illustrated device 10 is used to distribute gas to two users from a common source of supply which is connected to the device 10 through a hose 12 of conventional construction . for this purpose , device 10 consists of a body 14 of suitable material such as an aluminum block into which may be drilled three bores 16 , 18 and 20 . each of the bores 16 through 20 are of sufficient diameter and depth so as to intersect to define the hollow chamber 22 within the body 14 so that each of the bores 16 , 18 and 20 will define openings in the body communicating with the chamber 22 . to facilitate cooperation with conventional breathing units , it is preferable that the gas supply be introduced to the chamber 22 through the bottom side 24 of the body 14 and that the primary user withdraw gas from the chamber 22 through the top side 26 whereby a hose ( not shown ) attached to the threaded connecting cylinder 28 may extend directly to the mask of the primary user without being subjected to any contortions or twisting . also , to facilitate connection by a secondary user , it is preferable to locate the connection means 30 of the secondary opening on the front face 32 of the body 14 . as will become apparent from the description of the operation of the device 10 , a manufacturer may easily modify the illustrated body 14 to accommodate two additional secondary users by , for example , drilling bores into sides 34 and 36 of the body 14 to an extent such that the bores will communicate with the chamber 22 and thus be in communication with the gas supplied through the hose 12 to the chamber 22 . additionally , it will be readily understood by those skilled in this art that the size of body 14 can be enlarged , for example , by extending the distance between sides 36 and 34 whereby any desired number of secondary openings can be formed simply by drilling bores similar to bore 20 into the front face 32 of the body . such devices would have particular use in underground mining operations where it is a normal circumstance to have several individuals working in a confined area which , in an emergency , could then be supplied by air from a single hose . as mentioned above , the bottom side 24 of the body 14 preferably has formed in it the bore 18 which is the opening through which gas from a source under pressure is supplied . for this purpose , a conical shoulder 38 is formed integrally with surface 24 and extends substantially perpendicularly therefrom . at one end of the shoulder 38 a retaining gasket 40 is positioned for the purpose of holding an interiorly threaded female connector 42 which is freely rotatable about the shoulder 38 between the gasket and an abutment as at 44 . a fluid - tight connection is established by threading a threaded male connector 46 into the female connector 42 until the male connector abuts the retaining gasket 40 . opposite the threaded end of the male connector 46 , there is secured , in a conventional manner at one end a rubber hose 12 . the other end of the rubber hose , as illustrated more clearly in fig6 is connected to the outlet of the regulating device of the breathing unit . turning now to a description of the primary opening for supplying air to the primary user , bore 16 has the upper portion thereof of wider diameter to provide a shoulder 48 . a cup member 50 is inserted into bore 16 so that the flange 52 of the cup rests on the shoulder 48 thus limiting the depth of insertion of the cup into the bore 16 . as a result , the bottom 54 of the cup 50 will be spaced a predetermined distance from the bottom of the bore 16 , whereby the gas or air coming from the bore 18 will be able to flow freely into bore 16 . suitably dimensioned o - rings or gaskets may be employed about the exterior of the cup 50 as at 56 to provide a fluid - tight seal between the exterior of the cup 50 and the bore 16 . the bottom 54 of the cup 50 carries the valve means , which , in a preferred embodiment , is in the form of a normally flat , flexible , rubber disc 58 which has a projection 60 fastened in an aperture 62 formed in the bottom 54 . also , the bottom 54 is provided with a plurality of radially spaced apertures as at 64 which serve as air passages and which are covered by the disc 58 when the disc is in its unflexed condition . in this embodiment , the dimensions of disc 58 are such that it completely occupies the bottom surface of the interior of the cup 50 . with this arrangement , gas flow is permitted to enter the cup 50 through the apertures when there is a pressure differential existing across the disc 58 which is the case when the primary user inhales creating a partial vacuum within the cup 50 which will cause the flexible disc 58 to move upwardly as viewed in fig3 off of the apertures 64 when air is being supplied to the chamber 32 from a source of supply . the cup 50 is retained in bore 16 by the threaded connecting cylinder 28 which is press fitted into the mouth of the bore 16 until it rests on the flange 52 of the cup 50 . the valve means for the secondary opening , bore 20 will now be described . as previously mentioned , bore 20 carries valve means for controlling the supply of air to the secondary user . to this end , bore 20 has a first valve means which , in a preferred embodiment , is identical to the valve means carried in bore 16 the elements of which are designated by the primed numerals in fig3 corresponding to the unprimed elements of the valve arrangement for bore 16 . specifically , bore 20 has a counter - bore at its mouth for the purposes of providing a shoulder 48 &# 39 ; on which rests the flange 52 &# 39 ; of a cup 50 &# 39 ;. the usual o - ring as at 56 &# 39 ; may be suitably interposed between the flange 52 &# 39 ; and the shoulder 48 &# 39 ; for the same purposes as described above . the bottom 54 &# 39 ; of the cup 50 &# 39 ; is identical to that described above and thus has the same dispositions of a central aperture 62 &# 39 ; and radially disposed air passage apertures 64 &# 39 ;. the flexible valve disc 58 &# 39 ; is similarly attached to the bottom through a projection 60 &# 39 ; disposed in apertures 62 &# 39 ;. thus , the flexible valve disc 58 &# 39 ; is capable of operating in the same manner as valve disc 58 when a differential pressure exists across the valve disc 58 &# 39 ;. in accordance with the present invention , connection means 30 differs from the threaded connecting cylinder 28 which is fitted into the mouth of bore 16 in that connection means 30 holds a second valve means 66 on a plate member 68 which is disposed between the flange 52 &# 39 ; and the bottom of the connection means 30 in the bore 20 . the plate member 68 serves the same functions as the bottoms of the cups 50 and 50 &# 39 ; in that it is formed with the plurality of apertures 70 which serve as air passages and a central aperture 72 which receives a projection 74 of a flexible disc member 76 which , preferably , is identical to the previously described flexible discs 58 and 58 &# 39 ;. preferably there are three apertures 70 formed in plate member 68 as shown in fig1 to facilitate insertion of a penetrating means described below . it will be noted that the flexible disc 76 is disposed on the interior of the connection means 30 and thus serves to prevent flow of gas out of the bore 20 in the event that gas passes valve disc 58 &# 39 ;. in the assembled condition , the tapered base 78 of connection means 30 is press fitted into the counter - bore of bore 20 to close off bore 20 . a suitable gasket ring 80 may be employed to serve as a seal between the lower face of the connection means 30 and the flange 52 &# 39 ; of cup 50 &# 39 ;. a second reduced diameter threaded portion 82 is provided on connection means 30 for the purposes of receiving a sealing cap ( not shown ) to close the mouth 84 of the connection means 30 as well as to establish connection with a threaded ring mounted on a hose and as described below . with reference now to fig4 and 5 , there is illustrated the manner in which a second user connects his air hose 86 to the connection means 30 of the second opening of body 14 . the end of hose 86 is provided with a penetrating means of which is in the form of a member having six fingers , one of which is indicated at 90 . the fingers 90 are of a size and shape to pass through the three apertures 70 in the plate member 68 . additionally , the fingers 90 are radially curved and extend a sufficient distance from their base 92 so that when ring member 94 is threaded onto the threads 82 of the connection means 30 , the fingers 90 will penetrate through the apertures 70 and bend the disc member 76 away from the apertures 70 . as a result , air or gas under pressure will be permitted to flow out of the cup 50 &# 39 ; assuming that there is a differential pressure existing across the first valve disc 58 &# 39 ; as explained above . preferably , each of the flexible discs 58 , 58 &# 39 ; and 76 are made of rubber , so that , due to the natural resiliency , these discs will tend to remain in a flat , planar condition . it will be clear then , that when the hose 86 is disconnected from the connection means 30 , the disc member 76 will unflex to close the aperture 70 and thus cut off flow of air out of the bore 20 . turning now to fig6 there is schematically illustrated a diagram of a conventional breathing apparatus wherein the original gaseous source is an air tank 96 . it should be understood that the term &# 34 ; gas &# 34 ; as used in the specification , is intended to describe both compressed air as well as oxygen or any mixture of breathable gases . the air tank 96 has the conventional supply valve and gauge 98 at its mouth from which air is passed through suitable tubing 100 to both a normal operation valve 102 or a by - pass valve 104 . the normal operation valve is conventionally a reduction valve which feeds to a reduction chamber 106 so that air passed to the diaphragm chamber 108 will be delivered at a substantially reduced pressure than that which exists in the tank 96 . conventionally , the gas in the tank 96 will be stored at pressures on the order of 2 , 000 p . s . i . whereas the air delivered to the diaphragm chamber is preferably at substantially atmospheric pressure . as is well known , the diaphragm chamber 108 is provided with a flexible partition dividing the chamber into two zones , one of which is exposed to atmospheric pressure external to the breathing unit while the other zone receives air from the reduction chamber 106 . through suitable tubing as at 110 , gas or air from the diaphragm chamber is presented to the connection device 10 of the present invention through the hose 12 . as shown in fig6 two face masks 112 for the primary user and 114 for the secondary user , are shown connected to the connection device 10 of this invention . all of the valves of the breathing unit of fig6 are conventionally manually operated so that a user can obtain air from the diaphragm regulator when valve 104 is closed and valve 102 open which is a demand type situation corresponding to normal atmospheric breathing . this is effected since the air in the diaphragm zone chamber 108 will be drawn off by a user by simply inhaling which will effect a partial collapse of the diaphragm . such collapsing will open a resupply valve 116 thus causing reinflation of the diaphragm chamber . under some circumstances , such as malfunction of the regulation system , it may be necessary or desirable to supply air to the user under a free flow or high pressure condition . this is effected by closing valve 102 and opening valve 104 whereby gas or air from the tank 96 substantially at the tank pressure will be delivered to the user . with the foregoing alternative methods of operating the conventional breathing unit in mind , the operation of the connection device 10 of the present invention will now be explained in connection with fig7 . referring to fig7 there is schematically illustrated the possible flow paths through the chamber 22 of the body 14 of the present invention . with valves 98 and 102 of the breathing unit of fig6 opened , gas at substantially atmospheric pressure will be delivered to chamber 22 through hose 12 . assuming the air in the tubing leading from the disc 58 to the mask is under atmospheric pressure , the disc 58 will remain in its flat condition thus closing off flow of gas from the chamber 22 to the mask 112 . however , when the user inhales there will be a pressure drop in the tubing between the mask and disc 58 so that the atmospheric air in chamber 22 will push against the disc 58 and move momentarily to the dotted line position as long as the user is inhaling . at the end of taking a breath , the disc will close in response to the user exhaling so that substantially no exhaled air will be moved into chamber 22 . however , as conventional , the masks are provided with normal exhaust valves as at 118 ( fig6 ). when free flow conditions are required , corresponding to the user closing valve 102 and opening valve 104 , air at superatmospheric pressure will exist in chamber 22 to maintain valve disc 58 open as long as the free flow condition persists or until the supply of air at aboveatmospheric pressure is expended . it will be noted , that with the present invention , where a second user is not connected to the device 10 and free flow conditions are being employed by the primary user , disc valve 76 will prevent escape of air through the secondary user &# 39 ; s connection means 30 since the superatmospheric pressure existing in chamber 22 will maintain the flexible disc 76 in a flat position closing the apertures in the plate member 68 . with this arrangement , it is unnecessary to use a sealing cap on the mouth of the connection means 30 so that the loss of air when a connection must be established through this opening is minimized by the elimination of the necessity of repeatedly threading and unthreading a cap . assuming valve 102 is open and valve 104 closed and a secondary user is connected as described above with connection means 30 valve disc 76 will be maintained off of the apertures 70 by the fingers 90 of the penetrating device 88 . thus valve disc 58 &# 39 ; will operate in the same manner as valve disc 58 and both of these valve discs will prevent either user from inhaling the exhaled air of the other . under free flow conditions , both valves 58 and 58 &# 39 ; will remain open due to the high pressure that will exist in chamber 22 yet also due to the high velocity flow , no exhaled air will be able to reach chamber 22 . it will be obvious to those skilled in this art that numerous modifications may be made in the details and arrangement of parts of this invention without departing from the spirit and scope thereof as defined in the appended claims .
0
in a first embodiment , the present invention provides a process for the preparation of compounds of formulae ( i ); wherein r 1 , r 2 , r 3 and r 4 are each independently selected from : or one of r 1 / r 2 and / or one of r 3 / r 4 is a hydrogen and the other of r 1 / r 2 and / or the other of r 3 / r 4 is selected from : ( a ) c ( o ) r 5 , where r 5 is c 1 - c 6 alkyl , optionally substituted with one or more substituents selected from aryl , substituted aryl , heteroaryl , or substituted heteroaryl ; ( b ) c ( o ) or 5 , where r 5 is as previously defined ; alternatively , r 1 , r 2 and / or r 3 , r 4 are taken together with the nitrogen atom to which they are attached to form wherein a and b are each independently hydrogen , a substituted or unsubstituted aliphatic group , a substituted or unsubstituted cyclic group , a substituted or unsubstituted heterocyclic group , a substituted or unsubstituted aryl group , a substituted or unsubstituted alicyclic group , or a substituted or unsubstituted heteroaryl group ; or a and b taken together with the carbon to which they are attached form a cyclic moiety selected from : aryl , substituted aryl , heterocyclic , substituted heterocyclic , alicyclic , or substituted alicyclic ; b ) n ═ c ( r 6 )( r 7 ), where r 6 and r 7 are each independently selected from a substituted or unsubstituted aliphatic group , a substituted or unsubstituted cyclic group , a substituted or unsubstituted heterocyclic group , a substituted or unsubstituted aryl group , a substituted or unsubstituted alicyclic group , or a substituted or unsubstituted heteroaryl group ; ( 1 ) halogenating 6 - hydroxymethyl - nicotinic acid methyl ester ( iii ) with a chlorinating reagent to form compounds of formulae ( iv ): ( 2 ) treating compound ( iv ) with compounds of formula r 1 r 2 noh wherein r 1 and r 2 are as previously defined in the presence of base to yield compounds of formulae ( v ): ( 3 ) reacting compound of formulae ( v ) with liquid ammonia or ammonia hydroxide to provide compound of formula ( vi ); ( 4 ) reacting compound of formulae ( vi ) with a thionating reagent to provide compound of formula ( vii ); ( 5 ) reacting compound of formulae ( vii ) with xch 2 conr 3 r 4 , where x is a leaving group , to provide a compound of formula ( i ); optionally , the process may further comprise the step of hydrolyzing the compound of formula i with a base or an acid in a protogenic organic solvent or aqueous solution , to yield a preferred compound of the invention , o -[ 5 -( 4 - amino - thiazol - 2 - yl )- pyridin - 2 - ylmethyl ]- hydroxylamine , having the formulae ( ia ): listed below are definitions of various terms used to describe this invention . these definitions apply to the terms as they are used throughout this specification and claims , unless otherwise limited in specific instances , either individually or as part of a larger group . an “ aliphatic group ” is non - aromatic moiety that may contain any combination of carbon atoms , hydrogen atoms , halogen atoms , oxygen , nitrogen or other atoms , and optionally contain one or more units of unsaturation , e . g ., double and / or triple bonds . an aliphatic group may be straight chained , branched or cyclic and preferably contains between about 1 and about 24 carbon atoms , more typically between about 1 and about 12 carbon atoms . in addition to aliphatic hydrocarbon groups , aliphatic groups include , for example , polyalkoxyalkyls , such as polyalkylene glycols , polyamines , and polyimines , for example . such aliphatic groups may be further substituted . suitable aliphatic or aromatic substituents include , but are not limited to , — f , — cl , — br , — i , — oh , protected hydroxy , aliphatic ethers , aromatic ethers , oxo , — no 2 , — cn , — c 1 - c 12 - alkyl optionally substituted with halogen ( such as perhaloalkyls ), c 2 - c 12 - alkenyl optionally substituted with halogen , — c 2 - c 12 - alkynyl optionally substituted with halogen , — nh 2 , protected amino , — nh — c 1 - c 12 - alkyl , — nh — c 2 - c 12 - alkenyl , — nh — c 2 - c 12 - alkenyl , — nh — c 3 - c 12 - cycloalkyl , — nh - aryl , — nh - heteroaryl , — nh - heterocycloalkyl , - dialkylamino , - diarylamino , - diheteroarylamino , — o — c 1 - c 12 - alkyl , — o — c 2 - c 12 - alkenyl , — o — c 2 - c 12 - alkynyl , — o — c 3 - c 12 - cycloalkyl , — o - aryl , — o - heteroaryl , — o - heterocycloalkyl , — c ( o )— c 1 - c 12 - alkyl , — c ( o )— c 2 - c 12 - alkenyl , — c ( o )— c 2 - c 12 - alkynyl , — c ( o )— c 3 - c 12 - cycloalkyl , — c ( o )- aryl , — c ( o )- heteroaryl , — c ( o )- heterocycloalkyl , — conh 2 , — conh — c 1 - c 12 - alkyl , — conh — c 2 - c 12 - alkenyl , — conh — c 2 - c 12 - alkynyl , — conh — c 3 - c 12 - cycloalkyl , — conh - aryl , — conh - heteroaryl , — conh - heterocycloalkyl , — co 2 — c 1 - c 12 - alkyl , — co 2 — c 2 - c 12 - alkenyl , — co 2 — c 2 - c 12 - alkynyl , — co 2 — c 3 - c 12 - cycloalkyl , — co 2 - aryl , — co 2 - heteroaryl , — co 2 - heterocycloalkyl , — oco 2 — c 1 - c 12 - alkyl , — oco 2 — c 2 - c 12 - alkenyl , — oco 2 — c 2 - c 12 - alkynyl , — oco 2 — c 3 - c 12 - cycloalkyl , — oco 2 - aryl , — oco 2 - heteroaryl , — oco 2 - heterocycloalkyl , — oconh 2 , — oconh — c 1 - c 12 - alkyl , — oconh — c 2 - c 12 - alkenyl , — oconh — c 2 - c 12 - alkynyl , — oconh — c 3 - c 12 - cycloalkyl , — oconh — aryl , — oconh - heteroaryl , — oconh — heterocycloalkyl , — nhc ( o )— c 1 - c 12 - alkyl , — nhc ( o )— c 2 - c 12 - alkenyl , — nhc ( o )— c 2 - c 12 - alkynyl , — nhc ( o )— c 3 - c 12 - cycloalkyl , — nhc ( o )- aryl , — nhc ( o )- heteroaryl , — nhc ( o )- heterocycloalkyl , — nhco 2 — c 1 - c 12 - alkyl , — nhco 2 — c 2 - c 12 - alkenyl , — nhco 2 — c 2 - c 12 - alkynyl , — nhco 2 — c 3 - c 12 - cycloalkyl , — nhco 2 — aryl , — nhco 2 — heteroaryl , — nhco 2 — heterocycloalkyl , — nhc ( o ) nh 2 , nhc ( o ) nh — c 1 - c 12 - alkyl , — nhc ( o ) nh — c 2 - c 12 - alkenyl , — nhc ( o ) nh — c 2 - c 12 - alkynyl , — nhc ( o ) nh — c 3 - c 12 - cycloalkyl , — nhc ( o ) nh - aryl , — nhc ( o ) nh - heteroaryl , — nhc ( o ) nh - heterocycloalkyl , nhc ( s ) nh 2 , nhc ( s ) nh — c 1 - c 12 - alkyl , — nhc ( s ) nh — c 2 - c 12 - alkenyl , — nhc ( s ) nh — c 2 - c 12 - alkynyl , — nhc ( s ) nh — c 3 - c 12 - cycloalkyl , — nhc ( s ) nh - aryl , — nhc ( s ) nh - heteroaryl , — nhc ( s ) nh - heterocycloalkyl , — nhc ( nh ) nh 2 , nhc ( nh ) nh — c 1 - c 12 - alkyl , — nhc ( nh ) nh — c 2 - c 12 - alkenyl , — nhc ( nh ) nh — c 2 - c 12 - alkynyl , — nhc ( nh ) nh — c 3 - c 12 - cycloalkyl , — nhc ( nh ) nh - aryl , — nhc ( nh ) nh - heteroaryl , — nhc ( nh ) nh - heterocycloalkyl , nhc ( nh )— c 1 - c 12 - alkyl , — nhc ( nh )— c 2 - c 12 - alkenyl , — nhc ( nh )— c 2 - c 12 - alkynyl , — nhc ( nh )— c 3 - c 12 - cycloalkyl , — nhc ( nh )- aryl , — nhc ( nh )- heteroaryl , — nhc ( nh )- heterocycloalkyl , — c ( nh ) nh — c 1 - c 12 - alkyl , — c ( nh ) nh — c 2 - c 12 - alkenyl , — c ( nh ) nh — c 2 - c 12 - alkynyl , — c ( nh ) nh — c 3 - c 12 - cycloalkyl , — c ( nh ) nh - aryl , — c ( nh ) nh - heteroaryl , — c ( nh ) nh - heterocycloalkyl , — s ( o )— c 1 - c 12 - alkyl , — s ( o )— c 2 - c 12 - alkenyl , — s ( o )— c 2 - c 12 - alkynyl , — s ( o )— c 3 - c 12 - cycloalkyl , — s ( o )- aryl , — s ( o )- heteroaryl , — s ( o )- heterocycloalkyl - so 2 nh 2 , — so 2 nh — c 1 - c 12 - alkyl , — so 2 nh — c 2 - c 12 - alkenyl , — so 2 nh — c 2 - c 12 - alkynyl , — so 2 nh — c 3 - c 12 - cycloalkyl , — so 2 nh — aryl , — so 2 nh — heteroaryl , — so 2 nh — heterocycloalkyl , — nhso 2 — c 1 - c 12 - alkyl , — nhso 2 — c 2 - c 12 - alkenyl , — nhso 2 — c 2 - c 12 - alkynyl , — nhso 2 — c 3 - c 12 - cycloalkyl , — nhso 2 - aryl , — nhso 2 - heteroaryl , — nhso 2 - heterocycloalkyl , — ch 2 nh 2 , — ch 2 so 2 ch 3 , - aryl , - arylalkyl , - heteroaryl , - heteroarylalkyl , - heterocycloalkyl , — c 3 - c 12 - cycloalkyl , polyalkoxyalkyl , polyalkoxy , - methoxymethoxy , - methoxyethoxy , — sh , — s — c 1 - c 12 - alkyl , — s — c 2 - c 12 - alkenyl , — s — c 2 - c 12 - alkynyl , — s — c 3 - c 12 - cycloalkyl , — s - aryl , — s - heteroaryl , — s - heterocycloalkyl , or methylthiomethyl . it is understood that the aryls , heteroaryls , alkyls and the like can be further substituted . the terms “ c 2 - c 12 alkenyl ” or “ c 2 - c 6 alkenyl ,” as used herein , denote a monovalent group derived from a hydrocarbon moiety containing from two to twelve or two to six carbon atoms having at least one carbon - carbon double bond by the removal of a single hydrogen atom . alkenyl groups include , but are not limited to , for example , ethenyl , propenyl , butenyl , 1 - methyl - 2 - buten - 1 - yl , alkadienes and the like . the term “ substituted alkenyl ,” as used herein , refers to a “ c 2 - c 12 alkenyl ” or “ c 2 - c 6 alkenyl ” group as previously defined , substituted by one , two , three or more aliphatic substituents . the terms “ c 2 - c 12 alkynyl ” or “ c 2 - c 6 alkynyl ,” as used herein , denote a monovalent group derived from a hydrocarbon moiety containing from two to twelve or two to six carbon atoms having at least one carbon - carbon triple bond by the removal of a single hydrogen atom . representative alkynyl groups include , but are not limited to , for example , ethynyl , 1 - propynyl , 1 - butynyl , and the like . the term “ substituted alkynyl ,” as used herein , refers to a “ c 2 - c 12 alkynyl ” or “ c 2 - c 6 alkynyl ” group as previously defined , substituted by one , two , three or more aliphatic substituents . the term “ c 1 - c 6 alkoxy ,” as used herein , refers to a c 1 - c 6 alkyl group , as previously defined , attached to the parent molecular moiety through an oxygen atom . examples of c 1 - c 6 - alkoxy include , but are not limited to , methoxy , ethoxy , propoxy , isopropoxy , n - butoxy , sec - butoxy , tert - butoxy , n - pentoxy , neopentoxy and n - hexoxy . the terms “ halo ” and “ halogen ,” as used herein , refer to an atom selected from fluorine , chlorine , bromine and iodine . the terms “ aryl ” or “ aromatic ” as used herein , refer to a mono - or bicyclic carbocyclic ring system having one or two aromatic rings including , but not limited to , phenyl , naphthyl , tetrahydronaphthyl , indanyl , idenyl and the like . the terms “ substituted aryl ” or “ substituted aromatic ,” as used herein , refer to an aryl or aromatic group substituted by one , two , three or more aromatic substituents . the term “ arylalkyl ,” as used herein , refers to an aryl group attached to the parent compound via a c 1 - c 3 alkyl or c 1 - c 6 alkyl residue . examples include , but are not limited to , benzyl , phenethyl and the like . the term “ substituted arylalkyl ,” as used herein , refers to an arylalkyl group , as previously defined , substituted by one , two , three or more aromatic substituents . the terms “ heteroaryl ” or “ heteroaromatic ,” as used herein , refer to a mono -, bi -, or tri - cyclic aromatic radical or ring having from five to ten ring atoms of which at least one ring atom is selected from s , o and n ; zero , one or two ring atoms are additional heteroatoms independently selected from s , o and n ; and the remaining ring atoms are carbon , wherein any n or s contained within the ring may be optionally oxidized . heteroaryl includes , but is not limited to , pyridinyl , pyrazinyl , pyrimidinyl , pyrrolyl , pyrazolyl , imidazolyl , thiazolyl , oxazolyl , isooxazolyl , thiadiazolyl , oxadiazolyl , thiophenyl , furanyl , quinolinyl , isoquinolinyl , benzimidazolyl , benzooxazolyl , quinoxalinyl , and the like . the heteroaromatic ring may be bonded to the chemical structure through a carbon or hetero atom . the terms “ substituted heteroaryl ” or “ substituted heteroaromatic ,” as used herein , refer to a heteroaryl or heteroaromatic group , substituted by one , two , three , or more aromatic substituents . the term “ alicyclic ,” as used herein , denotes a monovalent group derived from a monocyclic or bicyclic saturated carbocyclic ring compound by the removal of a single hydrogen atom . examples include , but not limited to , cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , bicyclo [ 2 . 2 . 1 ] heptyl , and bicyclo [ 2 . 2 . 2 ] octyl . the term “ substituted alicyclic ,” as used herein , refers to an alicyclic group substituted by one , two , three or more aliphatic substituents . the term “ heterocyclic ,” as used herein , refers to a non - aromatic 5 -, 6 - or 7 - membered ring or a bi - or tri - cyclic group fused system , where ( i ) each ring contains between one and three heteroatoms independently selected from oxygen , sulfur and nitrogen , ( ii ) each 5 - membered ring has 0 to 1 double bonds and each 6 - membered ring has 0 to 2 double bonds , ( iii ) the nitrogen and sulfur heteroatoms may optionally be oxidized , ( iv ) the nitrogen heteroatom may optionally be quaternized , ( v ) any of the above rings may be fused to a benzene ring , and ( vi ) the remaining ring atoms are carbon atoms which may be optionally oxo - substituted . representative heterocycloalkyl groups include , but are not limited to , [ 1 , 3 ] dioxolane , pyrrolidinyl , pyrazolinyl , pyrazolidinyl , imidazolinyl , imidazolidinyl , piperidinyl , piperazinyl , oxazolidinyl , isoxazolidinyl , morpholinyl , thiazolidinyl , isothiazolidinyl , quinoxalinyl , pyridazinonyl , and tetrahydrofuryl . the term “ substituted heterocyclic ,” as used herein , refers to a heterocyclic group , as previously defined , substituted by one , two , three or more aliphatic substituents . the term “ heteroarylalkyl ,” as used herein , to an heteroaryl group attached to the parent compound via a c 1 - c 3 alkyl or c 1 - c 6 alkyl residue . examples include , but are not limited to , pyridinylmethyl , pyrimidinylethyl and the like . the term “ substituted heteroarylalkyl ,” as used herein , refers to a heteroarylalkyl group , as previously defined , substituted by independent replacement of one , two , or three or more aromatic substituents . the term “ alkylamino ” refers to a group having the structure — nh ( c 1 - c 12 alkyl ). the term “ dialkylamino ” refers to a group having the structure — n ( c 1 - c 12 alkyl ) ( c 1 - c 12 alkyl ), where c 1 - c 12 alkyl is as previously defined . examples of dialkylamino are , but not limited to , dimethylamino , diethylamino , methylethylamino , piperidino , and the like . the term “ alkoxycarbonyl ” represents an ester group , i . e ., an alkoxy group , attached to the parent molecular moiety through a carbonyl group such as methoxycarbonyl , ethoxycarbonyl , and the like . the term “ carboxaldehyde ,” as used herein , refers to a group of formula — cho . the term “ carboxy ,” as used herein , refers to a group of formula — cooh . the term “ carboxamide ,” as used herein , refers to a group of formula — c ( o ) nh ( c 1 - c 12 alkyl ) or — c ( o ) n ( c 1 - c 12 alkyl ) ( c 1 - c 12 alkyl ), — c ( o ) nh 2 , nhc ( o )( c 1 - c 12 alkyl ), n ( c 1 - c 12 alkyl ) c ( o )( c 1 - c 12 alkyl ) and the like . the term “ hydroxy protecting group ,” as used herein , refers to a labile chemical moiety which is known in the art to protect a hydroxyl group against undesired reactions during synthetic procedures . after said synthetic procedure ( s ) the hydroxy protecting group as described herein may be selectively removed . hydroxy protecting groups as known in the are described generally in t . h . greene and p . g . m . wuts , protective groups in organic synthesis , 3rd edition , john wiley & amp ; sons , new york ( 1999 ). examples of hydroxyl protecting groups include benzyloxycarbonyl , 4 - nitrobenzyloxycarbonyl , 4 - bromobenzyloxycarbonyl , 4 - methoxybenzyloxycarbonyl , methoxycarbonyl , tert - butoxycarbonyl , isopropoxycarbonyl , diphenylmethoxycarbonyl , 2 , 2 , 2 - trichloroethoxycarbonyl , 2 -( trimethylsilyl ) ethoxycarbonyl , 2 - furfuryloxycarbonyl , allyloxycarbonyl , acetyl , formyl , chloroacetyl , trifluoroacetyl , methoxyacetyl , phenoxyacetyl , benzoyl , methyl , t - butyl , 2 , 2 , 2 - trichloroethyl , 2 - trimethylsilyl ethyl , 1 , 1 - dimethyl - 2 - propenyl , 3 - methyl - 3 - butenyl , allyl , benzyl , para - methoxybenzyldiphenylmethyl , triphenylmethyl ( trityl ), tetrahydrofuryl , methoxymethyl , methylthiomethyl , benzyloxymethyl , 2 , 2 , 2 - triehloroethoxymethyl , 2 -( trimethylsilyl ) ethoxymethyl , methanesulfonyl , para - toluenesulfonyl , trimethylsilyl , triethylsilyl , triisopropylsilyl , and the like . preferred hydroxyl protecting groups for the present invention are acetyl ( ac or — c ( o ) ch 3 ), benzoyl ( bz or — c ( o ) c 6 h 5 ), and trimethylsilyl ( tms or — si ( ch 3 ) 3 ). the term “ protected hydroxy ,” as used herein , refers to a hydroxy group protected with a hydroxy protecting group , as defined above , including benzyloxycarbonyl , 4 - nitrobenzyloxycarbonyl , 4 - bromobenzyloxycarbonyl , 4 - methoxybenzyloxycarbonyl , methoxycarbonyl , tert - butoxycarbonyl , isopropoxycarbonyl , diphenylmethoxycarbonyl , 2 , 2 , 2 - trichloroethoxycarbonyl , 2 -( trimethylsilyl ) ethoxycarbonyl , 2 - furfuryloxycarbonyl , allyloxycarbonyl , acetyl , formyl , chloroacetyl , trifluoroacetyl , methoxyacetyl , phenoxyacetyl , benzoyl , methyl , t - butyl , 2 , 2 , 2 - trichloroethyl , 2 - trimethylsilyl ethyl , 1 , 1 - dimethyl - 2 - propenyl , 3 - methyl - 3 - butenyl , allyl , benzyl , para - methoxybenzyldiphenylmethyl , triphenylmethyl ( trityl ), tetrahydrofuryl , methoxymethyl , methylthiomethyl , benzyloxymethyl , 2 , 2 , 2 - triehloroethoxymethyl , 2 -( trimethylsilyl ) ethoxymethyl , methanesulfonyl , para - toluenesulfonyl , trimethylsilyl , triethylsilyl , triisopropylsilyl , and the like . preferred hydroxyl protecting groups for the present invention are acetyl ( ac or — c ( o ) ch 3 ), benzoyl ( bz or — c ( o ) c 6 h 5 ), and trimethylsilyl ( tms or — si ( ch 3 ) 3 ). the term “ amino protecting group ,” as used herein , refers to a labile chemical moiety which is known in the art to protect an amino group against undesired reactions during synthetic procedures . after said synthetic procedure ( s ) the amino protecting group as described herein may be selectively removed . amino protecting groups as known in the are described generally in t . h . greene and p . g . m . wuts , protective groups in organic synthesis , 3rd edition , john wiley & amp ; sons , new york ( 1999 ). examples of amino protecting groups include , but are not limited to , t - butoxycarbonyl , 9 - fluorenylmethoxycarbonyl , benzyloxycarbonyl , and the like . the term “ protected amino ,” as used herein , refers to an amino group protected with an amino protecting group as defined above . the term “ acyl ” includes residues derived from acids , including but not limited to carboxylic acids , carbamic acids , carbonic acids , sulfonic acids , and phosphorous acids . examples include aliphatic carbonyls , aromatic carbonyls , aliphatic sulfonyls , aromatic sulfinyls , aliphatic sulfinyls , aromatic phosphates and aliphatic phosphates . the term “ aprotic solvent ,” as used herein , refers to a solvent that is relatively inert to proton activity , i . e ., not acting as a proton - donor . examples include , but are not limited to , hydrocarbons , such as hexane and toluene , for example , halogenated hydrocarbons , such as , for example , methylene chloride , ethylene chloride , chloroform , and the like , heterocyclic compounds , such as , for example , tetrahydrofuran and n - methylpyrrolidinone , and ethers such as diethyl ether , bis - methoxymethyl ether . such compounds are well known to those skilled in the art , and it will be obvious to those skilled in the art that individual solvents or mixtures thereof may be preferred for specific compounds and reaction conditions , depending upon such factors as the solubility of reagents , reactivity of reagents and preferred temperature ranges , for example . further discussions of aprotic solvents may be found in organic chemistry textbooks or in specialized monographs , for example : organic solvents physical properties and methods of purification , 4th ed ., edited by john a . riddick et al , vol . ii , in the techniques of chemistry series , john wiley & amp ; sons , ny , 1986 . the term “ protogenic organic solvent ,” as used herein , refers to a solvent that tends to provide protons , such as an alcohol , for example , methanol , ethanol , propanol , isopropanol , butanol , t - butanol , and the like . such solvents are well known to those skilled in the art , and it will be obvious to those skilled in the art that individual solvents or mixtures thereof may be preferred for specific compounds and reaction conditions , depending upon such factors as the solubility of reagents , reactivity of reagents and preferred temperature ranges , for example . further discussions of protogenic solvents may be found in organic chemistry textbooks or in specialized monographs , for example : organic solvents physical properties and methods of purification , 4th ed ., edited by john a . riddick et al ., vol . ii , in the techniques of chemistry series , john wiley & amp ; sons , ny , 1986 . the term “ oxidizing agent ( s ),” as used herein , refers to reagents useful for oxidizing the 3 - hydroxyl of the macrolide ring to the 3 - carbonyl . oxidizing agents suitable in the present process are either swern oxidation reagents ( dimethyl sulfoxide and an electrophilic compound selected from dicyclohexylcarbodiimide , acetic anhydride , trifluoroacetic anhydride , oxalyl chloride , or sulfur trioxide ), dess martin oxidation reagents , or corey - kim oxidation reagents . a preferred method of oxidation is the use of the corey - kim oxidation reagents n - chlorosuccinimide - dimethyl sulfide complex . the term “ leaving group ” means a functional group or atom which can be displaced by another functional group or atom in a substitution reaction , such as a nucleophilic substitution reaction . by way of example , representative leaving groups include chloro , bromo and iodo groups ; sulfonic ester groups , such as mesylate , tosylate , brosylate , nosylate and the like ; and acyloxy groups , such as acetoxy , trifluoroacetoxy and the like . combinations of substituents and variables envisioned by this invention are only those that result in the formation of stable compounds . the term “ stable ”, as used herein , refers to compounds which possess stability sufficient to allow manufacture and which maintains the integrity of the compound for a sufficient period of time to be useful for the purposes detailed herein . the synthesized compounds can be separated from a reaction mixture and further purified by a method such as column chromatography , high pressure liquid chromatography , or recrystallization . as can be appreciated by the skilled artisan , further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art . additionally , the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds . synthetic chemistry transformations and protecting group methodologies ( protection and deprotection ) useful in synthesizing the compounds described herein are known in the art and include , for example , those such as described in r . larock , comprehensive organic transformations , vch publishers ( 1989 ); t . w . greene and p . g . m . wuts , protective groups in organic synthesis , 2d . ed ., john wiley and sons ( 1991 ); l . fieser and m . fieser , fieser and fieser &# 39 ; s reagents for organic synthesis , john wiley and sons ( 1994 ); and l . paquette , ed ., encyclopedia of reagents for organic synthesis , john wiley and sons ( 1995 ). the compounds of this invention may be modified by appending appropriate functionalities to enhance selective biological properties . such modifications are known in the art and may include those which increase biological penetration into a given biological system ( e . g ., blood , lymphatic system , central nervous system ), increase oral availability , increase solubility to allow administration by injection , alter metabolism and alter rate of excretion . the compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers , diastereomers , and other stereoisomeric forms that may be defined , in terms of absolute stereochemistry , as ( r )- or ( s )-, or as ( d )- or ( l )- for amino acids . the present invention is meant to include all such possible isomers , as well as their racemic and optically pure forms . optical isomers may be prepared from their respective optically active precursors by the procedures described above , or by resolving the racemic mixtures . the resolution can be carried out in the presence of a resolving agent , by chromatography or by repeated crystallization or by some combination of these techniques which are known to those skilled in the art . further details regarding resolutions can be found in jacques , et al ., enantiomers , racemates , and resolutions ( john wiley & amp ; sons , 1981 ). when the compounds described herein contain olefinic double bonds , other unsaturation , or other centers of geometric asymmetry , and unless specified otherwise , it is intended that the compounds include both e and z geometric isomers or cis - and trans - isomers . likewise , all tautomeric forms are also intended to be included . the configuration of any carbon - carbon double bond appearing herein is selected for convenience only and is not intended to designate a particular configuration unless the text so states ; thus a carbon - carbon double bond or carbon - heteroatom double bond depicted arbitrarily herein as trans may be cis , trans , or a mixture of the two in any proportion . as used herein , the term “ pharmaceutically acceptable salt ” refers to those salts which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of humans and lower animals without undue toxicity , irritation , allergic response and the like , and are commensurate with a reasonable benefit / risk ratio . pharmaceutically acceptable salts are well known in the art . for example , s . m . berge , et al . describes pharmaceutically acceptable salts in detail in j . pharmaceutical sciences , 66 : 1 - 19 ( 1977 ). the salts can be prepared in situ during the final isolation and purification of the compounds of the invention , or separately by reacting the free base function with a suitable organic acid . examples of pharmaceutically acceptable include , but are not limited to , nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid , hydrobromic acid , phosphoric acid , sulfuric acid and perchloric acid or with organic acids such as acetic acid , maleic acid , tartaric acid , citric acid , succinic acid or malonic acid or by using other methods used in the art such as ion exchange . other pharmaceutically acceptable salts include , but are not limited to , adipate , alginate , ascorbate , aspartate , benzenesulfonate , benzoate , bisulfate , borate , butyrate , camphorate , camphorsulfonate , citrate , cyclopentanepropionate , digluconate , dodecylsulfate , ethanesulfonate , formate , fumarate , glucoheptonate , glycerophosphate , gluconate , hemisulfate , heptanoate , hexanoate , hydroiodide , 2 - hydroxy - ethanesulfonate , lactobionate , lactate , laurate , lauryl sulfate , malate , maleate , malonate , methanesulfonate , 2 - naphthalenesulfonate , nicotinate , nitrate , oleate , oxalate , palmitate , pamoate , pectinate , persulfate , 3 - phenylpropionate , phosphate , picrate , pivalate , propionate , stearate , succinate , sulfate , tartrate , thiocyanate , p - toluenesulfonate , undecanoate , valerate salts , and the like . representative alkali or alkaline earth metal salts include sodium , lithium , potassium , calcium , magnesium , and the like . further pharmaceutically acceptable salts include , when appropriate , nontoxic ammonium , quaternary ammonium , and amine cations formed using counterions such as halide , hydroxide , carboxylate , sulfate , phosphate , nitrate , alkyl having from 1 to 6 carbon atoms , sulfonate and aryl sulfonate . as used herein , the term “ pharmaceutically acceptable ester ” refers to esters which hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof . suitable ester groups include , for example , those derived from pharmaceutically acceptable aliphatic carboxylic acids , particularly alkanoic , alkenoic , cycloalkanoic and alkanedioic acids , in which each alkyl or alkenyl moiety advantageously has not more than 6 carbon atoms . examples of particular esters include , but are not limited to , formates , acetates , propionates , butyrates , acrylates and ethylsuccinates . the term “ pharmaceutically acceptable prodrugs ” as used herein refers to those prodrugs of the compounds of the present invention which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of humans and lower animals with undue toxicity , irritation , allergic response , and the like , commensurate with a reasonable benefit / risk ratio , and effective for their intended use , as well as the zwitterionic forms , where possible , of the compounds of the present invention . “ prodrug ”, as used herein means a compound which is convertible in vivo by metabolic means ( e . g . by hydrolysis ) to a compound of formula i . various forms of prodrugs are known in the art , for example , as discussed in bundgaard , ( ed . ), design of prodrugs , elsevier ( 1985 ); widder , et al . ( ed . ), methods in enzymology , vol . 4 , academic press ( 1985 ); krogsgaard - larsen , et al ., ( ed ). “ design and application of prodrugs , textbook of drug design and development , chapter 5 , 113 - 191 ( 1991 ); bundgaard , et al ., journal of drug deliver reviews , 8 : 1 - 38 ( 1992 ); bundgaard , j . of pharmaceutical sciences , 77 : 285 et seq . ( 1988 ); higuchi and stella ( eds .) prodrugs as novel drug delivery systems , american chemical society ( 1975 ); and bernard testa & amp ; joachim mayer , “ hydrolysis in drug and prodrug metabolism : chemistry , biochemistry and enzymology ,” john wiley and sons , ltd . ( 2002 ). prodrugs include compounds wherein an amino acid residue , or a polypeptide chain of two or more ( e . g ., two , three or four ) amino acid residues is covalently joined through an amide or ester bond to a free amino , hydroxy or carboxylic acid group of a bridged erythromycin or ketolide derivative synthesized using the reagents prepared in accordance with the invention . the amino acid residues include but are not limited to the 20 naturally occurring amino acids commonly designated by three letter symbols and also includes 4 - hydroxyproline , hydroxylysine , demosine , isodemosine , 3 - methylhistidine , norvalin , beta - alanine , gamma - aminobutyric acid , citrulline homocysteine , homoserine , ornithine and methionine sulfone . additional types of prodrugs are also encompassed . for instance , free carboxyl groups can be derivatized as amides or alkyl esters . free hydroxy groups may be derivatized using groups including but not limited to hemisuccinates , phosphate esters , dimethylaminoacetates , and phosphoryloxymethyloxycarbonyls , as outlined in advanced drug delivery reviews , 1996 , 19 , 115 . carbamate prodrugs of hydroxy and amino groups are also included , as are carbonate prodrugs , sulfonate esters and sulfate esters of hydroxy groups . derivatization of hydroxy groups as ( acyloxy ) methyl and ( acyloxy ) ethyl ethers wherein the acyl group may be an alkyl ester , optionally substituted with groups including but not limited to ether , amine and carboxylic acid functionalities , or where the acyl group is an amino acid ester as described above , are also encompassed . prodrugs of this type are described in j . med . chem . 1996 , 39 , 10 . free amines can also be derivatized as amides , sulfonamides or phosphonamides . all of these prodrug moieties may incorporate groups including but not limited to ether , amine and carboxylic acid functionalities . suitable concentrations of reactants used in the synthesis processes of the invention are 0 . 01m to 10m , typically 01m to 1m . suitable temperatures include − 10 ° c . to 250 ° c ., typically − 78 ° c . to 150 ° c ., more typically − 78 ° c . to 100 ° c ., still more typically 0 ° c . to 100 ° c . reaction vessels are preferably made of any material which does not substantial interfere with the reaction . examples include glass , plastic , and metal . the pressure of the reaction can advantageously be operated at atmospheric pressure . the atmospheres include , for example , air , for oxygen and water insensitive reactions , or nitrogen or argon , for oxygen or water sensitive reactions . the term “ in situ ,” as used herein , refers to use of an intermediate in the solvent or solvents in which the intermediate was prepared without removal of the solvent . unless otherwise defined , all technical and scientific terms used herein are accorded the meaning commonly known to one with ordinary skill in the art . all publications , patents , published patent applications , and other references mentioned herein are hereby incorporated by reference in their entirety . abbreviations which may be used in the descriptions of the scheme and the examples that follow are : all other abbreviations used herein , which are not specifically delineated above , shall be accorded the meaning which one of ordinary skill in the art would attach . the present invention will be better understood in connection with schemes 1 - 3 . it will be readily apparent to one of ordinary skill in the art that the process of the present invention can be practiced by substitution of the appropriate reactants and that the order of the steps themselves can be varied . as outlined in scheme 1 , step a , dimethylpyridine - 2 , 5 - dicarboxylate ( ii ) is prepared by double methylation from pyridine - 2 , 5 - dicarboxylic acid ( 1 - 1 ). the present conversion preferably takes place in the presence of an acid in methanol . a compound of formula ( iii ) is prepared , as illustrated in step b of scheme 1 , by selectively reducing 2 - methyl ester in compound ( ii ) with a reducing agent in the presence of an inorganic salt , such as calcium ( ii ) salt or other metal derivatives , in organic solvent , preferably in a mixed solvent . in a preferred embodiment of the reaction , the reaction temperature is between − 10 ° c . and 10 ° c . and the duration of the reaction is 1 to 24 hours . in a particularly preferred embodiment of the reaction , the reducing agent is sodium borohydride , the inorganic salt is calcium chloride and the solvent is a mixture of tetrahydrofuran , methanol and methylene chloride . as outlined in scheme 1 , step c , a compound of formula ( iv ) is prepared by reacting of compound ( iii ) with a chlorinating reagent . a compound of formula ( v ) is prepared by adding a compound of formula ( 1 - 2 ), to a compound of formula ( iv ), as illustrated in step d , wherein r 1 and r 2 are as previously defined . the present conversion preferably takes place in an aprotic solvent in the presence of a base . as outlined in scheme 1 , step e , a compound of formula ( vi ) is prepared by reacting of compound ( v ) with liquid ammonia or ammonia hydroxide . in a preferred embodiment of the reaction , the reaction temperature is between 10 ° c . and 80 ° c . and the duration of the reaction is 1 to 24 hours . as outlined in scheme 1 , step f , a compound of formula ( vii ) is prepared by reacting of compound ( vi ) with a thionating reagent , in organic solvent , preferably in an aprotic solvent . in a preferred embodiment of the reaction , the reaction temperature is between 10 ° c . and 80 ° c . and the duration of the reaction is 1 to 24 hours . in a particularly preferred embodiment of the reaction , the thionating reagent is phosphorus pentasulfide and the solvent is tetrahydrofuran . as illustrated in scheme 1 , step g , wherein r 1 , r 2 , r 3 and r 4 are as previously defined and x is a leaving group , a compound of formula ( i ) is prepared by reacting compound ( vii ) with a compound of formula ( 1 - 3 ) in organic solvent , preferably in an aprotic solvent . in a preferred embodiment of the reaction , the reaction temperature is between 20 ° c . and 120 ° c . and the duration of the reaction is 2 to 48 hours . in a particularly preferred embodiment of the reaction , the aprotic solvent is ethyl acetate . as outlined in scheme 1 , step h , a compound of formula ( ia ) is prepared by removal of the protecting group of r 1 , r 2 , r 3 and r 4 in the formula ( i ) under either basic or acidic conditions , depending on the nature of r 1 , r 2 , r 3 and r 4 , wherein r 1 , r 2 , r 3 and r 4 are as previously defined . all references cited herein , whether in print , electronic , computer readable storage media or other form , are expressly incorporated by reference in their entirety , including but not limited to , abstracts , articles , journals , publications , texts , treatises , internet web sites , databases , patents , and patent publications . the compounds and processes of the present invention will be better understood in connection with the following examples , which are intended as an illustration only and not limiting of the scope of the invention . various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art and such changes and modifications including , without limitation , those relating to the chemical structures , substituents , derivatives , formulations and / or methods of the invention may be made without departing from the spirit of the invention and the scope of the appended claims . sulfuric acid ( 95 - 98 %, 22 . 0 ml , 1 . 1 eq ) was added to a suspension of diacid ( 1 - 1 , 60 . 0 g ) in anhydrous methanol ( 600 ml ) at room temperature . the resulting mixture was refluxed for 16 - 20 hours and then cooled to room temperature ( product crystallized out ). the resulting suspension was poured into a stirring mixture of saturated aqueous sodium carbonate solution ( 200 ml ) and ice ( 100 g ). after stirring at room temperature for 3 - 5 hours , the insoluble was collected by filtration , washed with water ( 200 - 300 ml ), air dried overnight and then vacuum dried to afford the desired product ( 60 . 3 g , 86 %) as light yellow powder . ms - esi m / z 196 . 10 ( m + h ) + ; 1 h nmr ( cdcl 3 ) δ 9 . 31 ( d , j = 1 . 5 hz , 1h ), 8 . 46 ( dd , j = 2 and 8 hz , 1h ), 8 . 22 ( d , j = 8 hz , 1h ), 4 . 05 ( s , 3h ), 4 . 00 ( s , 3h ) ppm . dimethylpyridine - 2 , 5 - dicarboxylate ( ii , 3 . 6 g , 18 . 4 mmol ) was dissolved in thf / meoh / ch 2 cl 2 ( 1 : 2 : 1 v / v , 120 ml ). calcium chloride ( 7 . 0 g , 63 . 1 mmol , 3 . 4 eq ) was added in one portion . the resulting clear light yellow solution was cooled to 0 ° c . nabh 4 ( 0 . 85 g , 22 . 5 mmol , 1 . 2 eq ) was added portion wise . the mixture was stirred at 0 ° c . for 1 . 5 hours , at the end of which tlc ( ethyl acetate / hexanes 1 : 1 ) indicated completion of reaction . aqueous formaldehyde ( 37 wt %, 4 . 5 g , 55 . 5 mmol , 3 eq ) in 50 ml ice - water was added dropwise . the mixture was extracted with chcl 3 ( 3 × 150 ml ). the combined organic layers were dried over mgso 4 and filtered . the filtrate was concentrated in vacuo and then passed through a silica gel pad ( eluent 5 % meoh in ch 2 cl 2 ) to afford the desired product ( 2 . 95 g , 96 %) as a light yellow waxy solid . ms - esi m / z 168 . 12 ( m + h ) + ; 1 h nmr ( cdcl 3 ) δ 9 . 17 ( d , j = 1 hz , 1h ), 8 . 30 ( dd , j = 2 and 8 . 5 hz , 1h ), 7 . 37 ( d , j = 8 . 5 hz , 1h ), 4 . 84 ( d , j = 5 hz , 2h ), 3 . 96 ( s , 3h ), 3 . 63 ( t , j = 5 hz , 1h ) ppm . thionyl chloride ( 5 . 0 ml , 2 . 0 eq ) was added dropwise to a solution of alcohol ( iii , 5 . 7 g ) in anhydrous chloroform ( 50 ml ) cooling with a water bath . the resulting solution was stirred at room temperature for 2 hours . the reaction was quenched with saturated aqueous sodium bicarbonate solution followed by ch 2 cl 2 extractions . the combined organic layers were dried over mgso 4 and filtered . the filtrate was concentrated in vacuo and then passed through a silica gel pad ( eluent 5 % meoh in ch 2 cl 2 ) to afford the desired product ( 7 . 0 g , 90 %) as a off - white solid . ms - esi m / z 186 . 09 ( m + h ) + ; 1 h nmr ( cdcl 3 ) δ 9 . 18 ( d , j = 2 hz , 1h ), 8 . 35 ( dd , j = 2 and 8 . 5 hz , 1h ), 7 . 61 ( d , j = 8 . 5 hz , 1h ), 4 . 74 ( s , 2h ), 3 . 98 ( s , 3h ) ppm . potassium tert - butoxide ( 16 . 2 g , 140 mmol , 1 . 3 eq ) was added to a solution of n - boc - hydroxyamine ( 18 . 6 g , 140 mmol , 1 . 3 eq ) in thf ( 300 ml ) at room temperature with stirring . the mixture was cooled to 3 - 5 ° c ., and then a solution of chloride ( iv , 20 . 0 g , 107 . 7 mmol ) in thf ( 50 ml ) was added within 10 - 20 min . the reaction mixture was stirred at 3 - 5 ° c . for 1 hour and then stirred at room temperature for 5 hours . the reaction was quenched with ice - water ( 200 ml ) followed by extraction with etoac ( 3 × 200 ml ). the combined organic layers were washed with brine ( 200 ml ), dried over na 2 so 4 and concentrated in vacuo . the residue was vacuum dried to afford the desired product ( 30 g , 100 %), which was used in the next step without further purification . ms - esi m / z 283 . 18 ( m + h ) + ; 1 h nmr ( cdcl 3 ) δ 9 . 18 ( d , j = 1 . 5 hz , 1h ), 8 . 32 ( dd , j = 2 and 8 hz , 1h ), 7 . 59 ( s , 1h ), 7 . 57 ( d , j = 8 . 5 hz , 1h ), 5 . 08 ( s , 2h ), 3 . 96 ( s , 3h ), 1 . 48 ( s , 9h ) ppm . the ester ( vb , 1 . 23 g , 4 . 36 mmol ) was added to liquid ammonia ( 5 ml ) at − 78 ° c . the reaction flask was sealed and the reaction mixture was stirred at 50 ° c . for 24 hours . the reaction flask was cooled down to − 78 ° c . and opened . the reaction mixture was slowly warmed to room temperature with stirring and under a stream of nitrogen . etoac ( 15 ml ) was added and the mixture was stirred for 30 min . the insoluble was collected by filtration , washed with etoac and vacuum dried to afford the desired amide ( 1 . 0 g , 86 %) as an off - white powder . ms - esi m / z 268 . 13 ( m + h ) + ; 1 h nmr ( dmso - d 6 ) δ 8 . 97 ( d , j = 2 hz , 1h ), 8 . 23 ( dd , j = 2 and 8 hz , 1h ), 8 . 15 ( bs , 1h ), 7 . 59 ( d , j = 8 hz , 1h ), 7 . 58 ( bs , 1h ), 4 . 87 ( s , 2h ), 1 . 40 ( s , 9h ) ppm ; 13 c nmr ( dmso - d 6 ) δ 166 . 9 , 159 . 8 , 157 . 0 , 148 . 8 , 136 . 4 , 129 . 5 , 122 . 3 , 80 . 7 , 78 . 3 , 28 . 7 ppm . the amide ( vib , 505 mg , 1 . 89 mmol ) and p 4 s 10 ( 208 mg , 0 . 47 mmol , 0 . 25 eq ) were stirred in refluxing thf ( 15 ml ) for 1 hour . additional p 4 s 10 ( 82 mg , 0 . 18 mmol , 0 . 10 eq ) was added and the mixture was refluxed for another hour . the reaction mixture was cooled and filtered . the solid was washed with ethyl acetate . the combined filtrates were concentrated in vacuo and aqueous na 2 hpo 4 ( 500 mg in 10 ml water ) solution was added to the residue . the mixture was stirred at 0 ° c . for 1 hour and then filtered and washed with water . the solid was dried in vacuo to afford the desired product ( 325 mg , 61 %) as a yellow crystalline solid . ms - esi m / z 284 . 16 ( m + h ) + ; 1 h nmr ( dmso - d 6 ) δ 10 . 16 ( bs , 1h ), 10 . 06 ( bs , 1h ), 9 . 71 ( bs , 1h ), 8 . 95 ( d , j = 1 hz , 1h ), 8 . 23 ( dd , j = 2 . 5 and 7 . 5 hz , 1h ), 7 . 54 ( d , j = 8 . 5 hz , 1h ), 4 . 86 ( s , 2h ), 1 . 40 ( s , 9h ) ppm ; 13 c nmr ( dmso - d 6 ) δ 198 . 2 , 159 . 5 , 157 . 0 , 147 . 8 , 136 . 1 , 134 . 9 , 121 . 9 , 80 . 7 , 78 . 2 , 28 . 7 ppm . 2 - bromoacetylbromide ( 1 g , 5 . 0 mmol ) was dissolved in toluene ( 8 ml ). ammonia was bubbled in at room temperature . lots of white precipitate formed and reaction is exothermic . after the reaction was done ( monitored by 1 h nmr ), the solvent was removed and the residue was triturated with methylene chloride . removal of solvent afforded 2 - bromoactamide ( 0 . 55 g , 80 %). 2 - bromoacetamide ( 11 . 1 g , 80 mmol ) was suspended in ethylene dichloride ( 130 ml ) in a 250 - ml round - bottomed flask fitted with a magnetic stirrer , a thermometer , and a condenser with nitrogen flow . oxalyl chloride ( 9 . 76 ml , 112 mmol , 1 . 4 eq ) was added slowly to the solution at room temperature with stirring . the mixture was stirred at room temperature for 30 min , and then heated to reflux for 5 hours ( the suspension became a clear solution ). the condenser was replaced with a distillation system , and about 35 - 40 ml solvent was removed with stirring . the heating mantle was withdrawn and the reaction mixture was cooled with an ice bath to 0 - 5 ° c . a solution of tert - butanol ( 10 . 7 ml , 112 mmol , 1 . 4 eq ) in 10 ml dichloromethane was added slowly to maintain temperature below 15 ° c . and the mixture was stirred at 0 - 15 ° c . for 15 - 30 min . the reaction mixture was diluted with dichloromethane ( 220 ml ) and washed sequentially with aqueous saturated sodium bicarbonate solution ( 50 ml ) and water ( 3 × 80 ml ) ( the amount of unreacted 2 - bromoacetamide in organic layer should be controlled to & lt ; 1 % by 1 h nmr or hplc , otherwise , continue washing with water to meet this requirement ). the combined organic layers were concentrated under reduced pressure to remove about 200 - 250 ml solvent ( a slurry was formed ). heptane ( 110 ml ) was added and the mixture was concentrated to remove about 50 - 70 ml solvent at reduced pressure . heptane ( 110 ml ) was added and the mixture was heated to 50 ° c . for 30 min , and then cooled to room temperature . the mixture was stirred at room temperature for 1 hour and filtered and washed with heptane ( 30 ml ) to afford the desired product ( 15 . 5 g , 86 %) as a white crystalline solid . the thioamide ( viib , 430 mg , 1 . 52 mmol ) was dissolved in hot etoac ( 12 ml ) and ( 2 - bromo - acetyl )- carbamic acid tert - butyl ester ( 600 mg , 2 . 52 mmol , 1 . 66 eq ) was added . the mixture was stirred at room temperature for 18 hours . the insoluble was collected by filtration and washed with etoac / hex ( 1 : 2 ). the solid was dissolved in ch 2 cl 2 ( 8 ml ), washed with saturated aqueous sodium bicarbonate solution ( 8 ml ), dried over mgso 4 and filtered . solvent was removed and the residue was crystallized from etoac / hex ( 1 : 1 , 4 ml ) to afford the desired product ( 355 mg , 55 %) as an off - white crystalline solid . ms - esi m / z 423 . 29 ( m + h ) + ; 1 h nmr ( cdcl 3 ) δ 9 . 09 ( d , j = 1 . 5 hz , 1h ), 8 . 14 ( dd , j = 2 and 8 hz , 1h ), 7 . 68 ( bs , 1h ), 7 . 62 ( s , 1h ), 7 . 53 ( d , j = 8 . 5 hz , 1h ), 7 . 32 ( bs , 1h ), 5 . 06 ( s , 2h ), 1 . 54 ( s , 9h ), 1 . 49 ( s , 9h ) ppm ; 13 c nmr ( cdcl 3 ) δ 161 . 7 , 157 . 9 , 156 . 9 , 152 . 6 , 149 . 2 , 147 . 0 , 134 . 1 , 128 . 8 , 122 . 7 , 99 . 3 , 82 . 3 , 78 . 7 , 28 . 5 , 28 . 4 ppm . the starting material ( ib , 20 g , 47 . 3 mmol ) was suspended in methanol ( 120 ml ) and hcl in dioxane ( 4n , 70 ml , 280 mmol , 5 . 9 eq ) was added slowly . the resulting clear solution was stirred at room temperature for 18 hours . removal of solvent afforded the desired product as a yellow solid . ms - esi m / z 223 . 11 ( m + h ) + . although the invention has been described in detail with respect to various preferred embodiments it is not intended to be limited thereto , but rather those skilled in the art will recognize that variations and modifications may be made therein which are within the spirit of the invention and the scope of the appended claims . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .
2
[ 0057 ] fig1 shows an expansion device , broadly indicated by the reference numeral 10 , comprising a device for pre - conditioning comminuted tobacco material and an airflow dryer connected thereto , which is arranged beneath the pre - conditioning device 12 . cut tobacco particles ( lamina ) are fed into the substantially vertically arranged pre - conditioning device 12 via suitable conveyors , for example oscillating conveyor channels , and fed into the pressure proof chamber 3 of the device 12 via an upper , pressure differential proof , cellular wheel sluice 1 , the tobacco particles free - falling in said chamber . vertically , the chamber 3 expands conically downwardly in order to rule out a banking or jamming of tobacco particles . about half way down the chamber 3 , ring nozzles 2 ( see also fig2 ) are arranged flush with the inner surface area of the chamber 3 , in order to rule out catching edges which could impede the passing of the tobacco . in the embodiment shown , the discharge direction of the ring nozzles 2 is inclined downwards , to assist the conveying / flight movement of the tobacco . the discharge direction of the ring nozzles 2 may in principle , however , be directed horizontal or even upwards , against the flow of tobacco . the tobacco particles free - fall downwards in the tapered chamber 3 , and are introduced directly into the horizontal section of an airflow dryer 5 via a lower , similarly pressure differential proof , cellular wheel sluice 4 . as an alternative to the embodiment shown , a vertical flow drying section may also be used . in order to avoid build - up or jamming of tobacco in the chamber 3 , the lower cellular wheel sluice 4 , serving as a discharge sluice , is run at a slightly higher conveying volume than the upper feed sluice 1 ; this may be achieved , for example , via the speed of the sluices and / or a greater volume of the individual sluice chambers , as is evident from fig1 . as may be recognized in fig2 vapor is introduced into a ring chamber in the wall of the chamber 3 , from which the ring nozzles 2 , which are radially directed downwards into the interior of the chamber , are fed . even before tobacco particles begin to be fed to the chamber , the interior of the chamber 3 is placed under an absolutely measured pressure , by feeding saturated vapor in through the ring nozzles 2 . in this way , a pressure is built up in the interior of the chamber 3 which is dependent only on the temperature of the saturated vapor being fed in . due to the two pressure differential proof , cellular wheel sluices 1 , 4 , this pressure is maintain - ed during continuous running operation , such that extremely high dryer entry temperatures and moistness of the tobacco may be achieved , as compared with conventional methods . to avoid water vapor condensing on the inside wall of the chamber 3 , the chamber , formed as a pressure container , is provided with a heating jacket 6 , as may be recognized in fig3 and 4 . vapor of a slightly higher temperature than the temperature of the vapor sprayed in via the ring nozzles 2 is fed into the bottom of the heating jacket , and drawn off , out of the heating jacket , at the top . once it has passed through the pre - conditioning under superatomospheric pressure and thus at extremely high temperatures , the pre - heated and moistened tobacco particles fall downwards through the lower cellular wheel sluice 4 into the airflow dryer 5 , where they are swept along by the hot gas stream , and dried to the desired discharge or output moistness by the resting time in the dryer . the drying of the tobacco is characterized in the first stage by the quick vaporization , up until the cooling limit temperature is reached ; in this way , the vaporization energy is exclusively provided by the tobacco particles themselves . in the second section , the tobacco is dried by convectional exchange of material and heat . [ 0071 ] fig5 shows a diagrammatic representation of the conditioning of tobacco particles , which are introduced into a saturated vapor atmosphere in the pressurized chamber 3 at thermal equilibrium and with an entry temperature of 20 ° c . in this respect , the line marked by triangles indicates the change in moisture content of the tobacco particles having an entry moistness of 20 %, and the line marked by squares indicates the change in moisture content of the tobacco particles having an entry moistness of 18 %. as can be seen , the moisture content of tobacco particles after conditioning , expressed as a percentage , rises linearly in the range of saturated vapor temperature from 100 ° c . to 160 ° c ., such that at a saturated vapor temperature of 160 ° c ., for example , tobacco particles with an entry moistness of 18 % leave the pre - conditioning device with a discharge moistness of about 30 . 25 %. the achievable increase in filling capacity will now be explained by means of an example which compares pressurized pre - conditioning using the device according to fig3 for increasing tobacco temperature and moistness and subsequent airflow drying with pre - conditioning using water and vapor at normal air pressure . cut tobacco with a cut moistness after cutting of 18 % was accordingly conveyed cold through a conditioning drum ( without being conditioned ) at a tobacco mass flow rate of 200 kg / h , relative to the cut moistness of 18 %, and then driven at a vapor pressure of 5 bars through the device according to fig3 which had been pre - heated using superheated vapor at 5 bars (& gt ; 152 ° c .). in order to prevent moist cavities from forming , care must be taken that as little condensation as possible gets into the interior volume of the chamber 3 . the tobacco falling down the chamber 3 is brought up to the equilibrium temperature , which lies at about 152 ° c ., by the absorption of condensing vapor . this results in moisture absorption of about 27 % by mass . the falling time for covering a distance of about lm is only about 0 . 5 s . the tobacco thus conditioned , i . e . heated and moistened , is dried in the airflow dryer 5 to a discharge moistness of about 13 % by mass . by way of comparison with this method course in accordance with the invention , cut tobacco containing 18 % moisture was moistened to 27 % in a conventional conditioning drum and at normal ambient pressure using vapor and water , pre - heated to about 60 ° c ., and then conveyed at a rate of 200 kg / h through the device according to fig3 — without further conditioning — into the airflow dryer 5 . if the filling capacities of the tobacco from the two experiments are compared with each other at the outlet of the airflow dryer 5 , the pressure - conditioned tobacco shows an increase in filling capacity of 5 . 9 %, as compared with the comparative sample having passed through corresponding conditioning at ambient pressure in the conditioning drum . the results for filling capacity were corrected to 12 % by mass , in order to provide an exact comparability . corresponding experiments were carried out in the device according to fig3 at differing vapor pressures . the results obtained , expressed as percentage increases in filling capacity , are assembled in the following table , together with the accompanying process parameters . as a comparative sample for the given pressure conditioning as described above , 18 % moist cut tobacco and the corresponding tobacco moistness were conditioned to a tobacco temperature of 60 ° c . in a conditioning drum at ambient pressure using vapor and water , in order to ascertain the increase in filling capacity . pressure moistness equilibrium increase in in device ex device temperature filling capacity [ bar ] [% by mass ] [° c .] [%] 2 24 . 1 120 3 . 1 3 24 . 9 134 3 . 9 4 26 . 2 144 4 . 5 5 26 . 5 152 5 . 9 6 27 . 0 159 6 . 6 7 27 . 4 165 7 . 1 as can be seen , the equilibrium temperature increases as expected with the pressure in the chamber , and in turn results in a corresponding proportional increase in filling capacity . this series of experiments can , according to the quality of the cellular wheel sluices with respect to pressure and temperature , be continued in the direction of increasing pressures / temperatures . correspondingly higher equilibrium temperatures and increases in filling capacity are then to be expected . in the foregoing description preferred embodiments of the invention have been presented for the purpose of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments were chosen and described to provide the best illustration of the principals of the invention and its practical application , and to enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth they are fairly , legally , and equitably entitled .
0
the present invention is directed to method and systems for controlling and enhancing the handoff between access points of hotspots or the handoff from one type of wireless service to another type of wireless service . the present invention is directed to processes that allow for continuity of data transmission and reduces the inconvenience to the user from roaming between different access points . a general cellular telephone network is illustrated in fig1 . multiple cells 111 b , 112 b and 113 b are established through the use of antennas 111 a , 112 a and 113 a . devices 101 - 104 having access to the cellular telephone network are able to move from cell to cell and maintain communication with the network . each antenna 111 a - 113 a is connected , through a connection link 120 , with a service provider 130 . the service provider 130 controls access to the network and coordinates the handing - off of access as the devices pass between the cells . the service provider can identify each device and can route communication to the proper location of the particular device . commonly , the devices 101 - 104 may be cellular telephones , computers with wireless modems and other devices that exchange information with the service provider . an example of a general wireless hotspot installation is illustrated in fig2 . the hotspot can be controlled through an access point 200 , with the access point having an antenna 201 a to establish a wireless access zone 201 b . the wireless access may be made through an ieee 802 . 11 standard local area network ( lan ) or other type of wireless network . devices 210 - 212 within the hotspot are able to communicate with the larger network 230 through communication with the access point 200 . the access point 200 has a communication link 220 with the larger network 230 and the access point acts to enable communication between the devices 210 - 212 and the larger network and between the devices themselves . as examples , the devices 210 - 212 may be computers equipped with 802 . 11 access cards , personal digital assistants enabled for wireless access and cellular telephones having multiple means for wireless access . the larger network , for example , may be the internet or some private wide area network . fig3 illustrates one embodiment of the present invention . a wireless hotspot is illustrated , with the coverage of the hotspot set by the access point 300 through an antenna 301 a , the range of the hotspot is illustrated by the range 301 b . devices 310 and 311 within the range 301 b may potentially establish a connection with the hotspot . the access to the access point is controlled through the access controller 305 , that may be hardware , firmware , software or a combination thereof . a communication connection 315 is established between the access point 300 and the larger network 330 where that connection is modulated by a router 308 . also illustrated in fig3 is a wireless telephone service provider 340 . the service provider 340 contains a database 342 of users of the wireless telephone network . the wireless telephone service provider could provide services through an antenna 321 a , through a connection 320 , to provide a coverage area 321 b . the coverage area 321 b for the wireless telephone service may also include some or all of the wireless hotspot range 301 b . in another embodiment of the present invention , a third party could act as an agent for the service provider and would create the incentive for establishing the hotspot locations . in this embodiment , the service provider , such as a wireless telephone provider 350 would have account information for the user in its database 352 . the third party 340 could act as a go - between and would maintain its own records of users in its own database 342 . the benefit of the third party in this embodiment of the present invention is that the third party would provide the interface between the wireless hotspot and the service provider and would not require any direct interaction between the service provider and the wireless hotspot . another benefit of the third party embodiment is that users could supply account data for accounts they have with entities other than the wireless telephone service provider , such as a television cable company or an internet service provider . an illustration of an environment having multiple hotspots within a cellular network is provided in fig4 . two access points 401 and 402 provide overlapping coverage area 401 a and 402 a . the wireless devices 411 and 412 within those coverage areas can have access to the internet through a wireless connection to the access points . both access points 401 and 402 have connections 403 and 404 to an internet backbone . the wireless device 410 outside the hotspot coverage areas can still have access to the larger network through exchange of data through the cellular coverage area 421 a . the coverage area for the cellular network is defined by a cellular base station 421 connected to the cellular service provider 440 . also part of the cellular network are registers containing data about users of the cellular network , namely the home location register 420 and the visitor location register 430 . both registers can be used to set up calls on the cellular network and maintain data about the call , including the generation of detailed billing records . the present invention is concerned with handling and control of the handoff from a wireless device that passes between the different coverage areas . fig5 provides a general flowchart of an example of the login process for a wireless device on a hotspot according to one embodiment of the present invention . first , the wireless device searches or sniffs to determine whether the device is within the hotspot coverage area , in step 501 . if the hotspot is detected , the wireless device attempts to associate itself with the hotspot through the use of an attach request , in step 502 . queries are formulated and sent to the hotspot to gather necessary information , in step 503 . thereafter , public keys or other information are exchanged between the wireless device and the hotspot , in step 504 and account information is sent to a service provider to establish the billing process , in step 505 . in general , the wireless device initially sends and identifier and a public key to the wireless hotspot . the wireless hotspot utilizes the connection with a trusted party , such as the wireless telephone service provider , to verify whether the identifier and public key are correct . the identifier may be a wireless telephone number to provide proper authorization . the wireless hotspot may issue a challenge to the wireless device to seek further verification . the issuing of a challenge may be performed instead of seeking confirmation of authorization data from the trusted party . additionally , the wireless device may send a public key certificate , which is temporary , and thereafter use symmetric , exchanged keys to ensure proper encryption of data transferred between the wireless device and the wireless hotspot . returning to fig5 , the wireless device is authenticated for access to the wireless hotspot , in step 506 , and login and password data is sent to the hotspot to establish a session , in step 507 . as is illustrated in fig5 , the login and authentication process may require responses from the user based on prompts sent from the hotspot . this further illustrates the benefits of an efficient handoff between coverage ranges if the log in and authentication process need not be repeated . an example of a process of controlling and enhancing the handoff between access points is illustrated in fig6 . initially , a wireless device logs into a wireless hotspot , in step 601 . as the wireless device moves out of the hotspot coverage area , the access of the wireless device with the hotspot is dissociated , in step 602 . the authentication information for the prior session is stored in the access point of the hotspot or in a local register accessible to multiple hotspots , in step 603 . a common register that may be used to store the authentication data may be the visitor location register , discussed above . once the wireless device moves back into the coverage area for the hotspot , the authorization information is re - applied and the session recommences , in step 604 . the process of re - applying the information occurs at the associating step and the other steps of the log in and authentication process need not be repeated . usually , the authorization information in maintained for a period of time and can be purged at an appropriate time , such as when the register is updated . another embodiment of the present invention , illustrated in fig7 , is directed to transferring data for the handoff before the transition to another coverage area occurs . the movement of a logged on wireless device is monitored within the wireless hotspot coverage area , in step 701 . once it is determined that the wireless device is passing from the wireless hotspot coverage area to new coverage area , in step 702 , the session information is transferred to a controller of the new coverage area before the transition to the new coverage area is made , in step 703 . once the wireless device is in the new coverage area , no new log in is required because the prior authentication information for the prior session has been transferred , in step 704 . in addition to method for securing the handoff of authorization information between coverage areas , the present invention also provides for differing authorization levels that require different levels of prompting of the user , as illustrated in fig8 . an enterprise - wide level of authorization , a user can pass from coverage area to coverage area within the enterprise and not need to enter additional information . a change in the type of coverage level of authorization requires input from the user . such a change could occur when the wireless device switches from an ieee 802 . 11 wireless network to a gprs network where the data rate drops and the user would be queried to determine if access is to be maintained . with a street - level coverage , such as between several public wireless hotspots , a prompt is made for information for every handoff between coverage areas . according to another embodiment , data received at one access point of a hotspot can encapsulate packet data received for a wireless device that has moved to a different coverage area . such encapsulation would be temporary after the wireless device moves to the new coverage area and would be important for application that requires a high degree of data integrity . the process is illustrated in fig9 . a wireless device logs onto a first hotspot having a first coverage area , in step 901 . when the wireless device shifts from the first coverage area to a second coverage area of a second hotspot , the first access point , controlling the first hotspot , encapsulates packets received that are destined for the wireless device , in step 902 . the encapsulated packets are forwarded to the second hotspot , in step 903 . the received encapsulated packets are received by the second hotspot and are sent to the wireless device , in step 904 . after departure of the wireless device from the first coverage area for a fixed period of time , the encapsulation process is stopped , in step 905 . it is assumed that after the fixed period of time , the new routing of packets to the second hotspot could be achieved and the encapsulation of packets to achieve the proper routing may be stopped . the methods and systems of the present invention provide for control and enhancement of the handoff process between access points of hotspots or the handoff from one type of wireless service to another type of wireless service . the present invention also allows for continuity of data transmission and reduces the inconvenience to the user from roaming between different access points . it is noted that the present application is directed , at least in part , to wireless hotspots . the use of the term wireless hotspot or hotspot is applicable to any wireless access point . the term wireless hotspot or hotspot , as used in the specification and claims , should not be construed to be limited to a single type of locale or be construed as providing access according to only a particular wireless access format , such as the ieee 802 . 11 standard . it would also be within the scope of the invention to implement the disclosed elements of the invention in discrete electronic components , thereby taking advantage of the functional aspects of the invention . additionally , the present invention can be implemented totally or partially through software . although the invention has been described based upon these preferred embodiments , it would be apparent to those of skilled in the art that certain modifications , variations , and alternative constructions would be apparent , while remaining within the spirit and scope of the invention . in order to determine the metes and bounds of the invention , therefore , reference should be made to the appended claims .
7
[ 0025 ] fig1 is a bottom view of a rubber shoe outsole 1 molded according to an exemplary embodiment of the present invention . as depicted in fig1 the rubber shoe outsole 1 comprises a plurality of outsole detents 2 of rubber . in the exemplary embodiment of the invention , a plurality of integral support bridges 3 connect contiguous outsole detents 2 ( detents are also sometimes referred to herein as “ lugs ” 2 ). it will be understood by someone with ordinary skill in the art that the size , exterior contact surface shape , number and arrangement of lugs 2 depicted in fig1 through 7 c are exemplary to illustrate the invention ; the size , exterior contact surface shape , number and arrangement of the lugs can be varied without departing from the spirit of the invention . [ 0027 ] fig2 is a top view of a midsole mold 5 for receiving the rubber shoe outsole 1 ( see , e . g ., fig1 ) and for further receiving polyurethane , or other like midsole material , in the exemplary embodiment of the present invention . as depicted in fig2 the midsole mold 5 comprises a surface 13 and a plurality of indentations 4 that correspond in location , horizontal size and horizontal shape to the respective outsole detents 2 of the rubber shoe outsole 1 ( see , e . g ., fig1 ). it will be understood by someone with ordinary skill in the art that a midsole mold for receiving polyurethane may be made of metal or other materials . [ 0028 ] fig3 a is a side view of a portion of the rubber shoe outsole 1 fitted into the midsole mold 5 in the exemplary embodiment of the present invention . as depicted in fig3 a , each exemplary detent 2 comprises a tapered portion 7 and a relatively non - tapered portion 12 . in the exemplary embodiment of the invention , each indentation 4 in the midsole mole 5 has a depth 10 that is equal to or is less than the length 11 of the non - tapered portion of the corresponding detent 2 . it will be understood by someone with ordinary skill in the art that the interior shape and size of each detent / lug 2 can be varied . for example , as described below in connection with fig5 a through 7 c , detents can be shaped without a tapered portion and a non - tapered portion ; rather , ribs , flanges or other anchoring devices , can be provided to extend from the perimeter of each detent . as depicted in fig3 a , in order to make a shoe sole according to the exemplary embodiment of the present invention , the rubber shoe outsole 1 of the exemplary embodiment is placed in the midsole mold 5 so that the bottom surface 9 of the non - tapered portion 12 rests on the bottom surface 14 of the corresponding indentation 4 . when the rubber shoe outsole 1 is placed in the midsole mold 5 in this manner , the tapered portion 7 of each detent 2 extends above the surface 13 of the midsole mold 5 forming a pocket 8 for receiving midsole material , such as polyurethane . as depicted in fig3 a , in the exemplary embodiment of the present invention , one or more integral support bridges 3 connect upper edges 15 a and 15 b between two contiguous detents 2 . in an alternative exemplary embodiment of the present invention , the integral support bridges 3 connect contiguous detents 2 at some corresponding position of the tapered portion 7 of each detent 2 . returning for a moment to fig1 spaces 16 are formed between integral support bridges 3 connecting two detents 2 and between detents 2 . returning to fig3 a , in the exemplary embodiment of the invention , a plurality of pins 6 are used to stabilize the rubber shoe outsole 1 in its place in the midsole mold 5 . once the rubber shoe outsole 1 is in place in the midsole mold 5 and the plurality of pins are in place to stabilize the rubber shoe outsole 1 , midsole material , such as polyurethane , is poured into the midsole mold 5 . the midsole material that is poured into the midsole mold 5 flows through the spaces 16 ( fig1 ) into the pockets 8 . [ 0032 ] fig3 b is a cross - sectional side view along line a - a of fig4 of a midsole 17 that has been poured into the midsole mold 5 . as depicted in fig3 b , the poured midsole 17 mechanically imbeds in it the rubber shoe outsole i ( see fig1 ). the midsole 17 material surrounds the tapered portion 7 of each detent 2 ′, 2 ″ and 2 ″″ and underlies the integral support bridges 3 ′ ( e . g ., connecting detents 2 ″ and 2 ″″) so that the rubber shoe outsole 1 is anchored in and will not detach from its imbedded position within the midsole 17 . [ 0033 ] fig4 is a bottom view of a midsole 17 , from which the detents 2 of the rubber shoe outsole 1 extend . as depicted in fig4 the integral support bridges 3 are not exposed from the midsole 17 . in one alternative exemplary embodiment , integral support bridges 3 are not used . detents 2 ′, and 2 ″ depicted in fig3 b are shown imbedded in the poured midsole 17 ; no integral support bridges 3 connecting the detent 2 ′ to any other detent are depicted in fig3 b . the drawback of using a no - bridge approach is that each detent 2 ′ would need to be separately placed in its corresponding indentation 4 in the midsole mold 5 . even so , as described further below in connection with fig5 a through 7 c , detents / lugs 2 can be anchored in the midsole 17 using radial ribs 60 , flanges 61 , 70 ( see fig5 a through 7 c ) or other anchors . in one alternative exemplary embodiment , the rubber shoe outsole 1 ( see , e . g ., fig1 ) is only partially cured before it is placed in the midsole mold 5 ( see , e . g ., fig2 ). after the midsole material is poured into the midsole mold 5 ( see e . g ., fig2 ), the midsole material and the rubber shoe outsole 1 are cured together . in another alternative exemplary embodiment of the present invention , eva ( ethylvinylacetate ) is the material used to form the midsole 17 ( see , e . g ., fig3 a , 3 b ). as someone with ordinary skill in the art will understand , eva is not pourable as in the case of polyurethane . in this alternative exemplary embodiment , a first layer of eva ( ethylvinylacetate ) is placed in the midsole mold 5 , depicted as alternative layer 20 in fig3 a . in fig3 a , line b - b depicts a line between a first layer 20 of eva and a second layer 21 of eva . the first layer 20 of eva may be pre - shaped to conform to the shape of the midsole mold 5 or may extend beyond the edges of the midsole mold 5 to be later trimmed . the first layer 20 of eva is pre - cut ( such as die - cut ) to form holes corresponding in position , number , size and shape to the rubber outsole detents 2 . the rubber shoe outsole 1 is then placed detent side down on top of the first layer 20 of eva so that the bottom surface 9 of the non - tapered portion 12 of the detents 2 of the rubber shoe outsole 1 extend through the pre - cut holes in the first layer 20 of eva and rest on the bottom surface 14 of the corresponding indentation 4 of the midsole mold 5 . a second layer ( depicted as alternative element 21 in fig3 a ) of eva is then placed on top of the rubber shoe outsole 1 . the second layer 21 of eva is then compression molded to the first layer 20 of eva . any eva extending beyond the outer perimeter of the midsole mold 5 is trimmed , such as along line c - c depicted in fig3 a . in a variation of this alternative embodiment , instead of bonding a second layer 21 of eva to the bottom first layer 20 of eva , a bottom surface of a shoe is fastened , such as with glue , over the top of the rubber shoe outsole 1 to adhere to the rubber shoe outsole 1 and / or to the bottom first layer 20 of eva . in some embodiments of the invention , different types of rubber would be used for different detents / lugs 2 in a single shoe sole , e . g ., high - friction coefficient rubber for some lugs and natural rubber for other lugs . in one embodiment , every other lug ( alternating lugs ) would be made of different types of rubber , e . g ., high - friction coefficient rubber and natural rubber ; such a shoe would provide traction on both rock ( with the high - friction coefficient rubber ) and highly polished surfaces such as ice ( with natural rubber ). in another embodiment , the lugs on certain portions of the shoe would be made of one type of rubber ; the lugs on other portions of the shoe sole would be made of another type of rubber . for example , the lugs on the end - most portion of the toe of the shoe sole and the end - most portion of the heel of the shoe sole could be made , e . g ., of high - friction coefficient rubber ; the lugs on the rest of the sole could be made with natural rubber . someone with ordinary skill in the art will understand that the varied - rubber embodiments described above are exemplary , are described to illustrate the invention , and are not a limitation of the invention . rather , different types of rubber other than those described above could be used to form the lugs ; different arrangements of the lugs could be used without departing from the spirit of the present invention . in an alternative embodiment of the invention , instead of using integral support bridges 3 ( as were depicted , e . g ., in fig3 b , 4 ) to stabilize and anchor the lugs 2 in the midsole 17 , anchoring ribs , flanges or other anchors are provided radiating from the perimeter 52 of the detent 53 of a lug 2 , exemplars of which are depicted in fig5 a through 7 c . a first alternative exemplary embodiment of a lug 2 having ribs 50 radiating from the perimeter 52 of detent 53 of the lug 2 is depicted in fig5 a . fig5 b depicts the lug 2 and radiating ribs 50 from a bottom view . as will be understood by someone with ordinary skill in the art , the size , shape , number and arrangement of radiating ribs depicted and described are exemplary and illustrative of the invention , not a limitation of the invention . rather , the size , shape , number and arrangement of the radiating ribs may vary without departing from the spirit of the invention . each rib 50 may provide a knob 51 as depicted in fig5 c , or may have no knob as depicted in fig5 d . fig5 c is a cross - sectional side view along line d - d of fig5 a of a lug and a radial rib with a knob ; fig5 d is a cross - sectional side view along line d - d of fig5 a of a lug and a radial rib without any knob . in a further alternative embodiment , a raised ridged flange 60 , 61 surrounds the detent 53 of the lug 2 as depicted in fig7 a and 7 b . fig7 b is a cross - sectional side view of an exemplary lug 2 with a detent 53 and with a raised ridged flange 60 , 61 taken along line f - f of fig7 a . as depicted in fig7 a and 7 b , a flange 60 with a raised ridge 61 extends from the perimeter 52 of the detent 53 of the lug 2 . in a further alternative embodiment , as depicted in fig7 c , a flange 60 without any raised ridge could be used to anchor and stabilize a lug 2 in the midsole 17 without departing from the spirit of the invention . still further , a flange with an irregular shape ( not shown ), or a shape that extends in various dimensions ( not shown ) from the perimeter 52 of the detent 53 of the lug 2 could be used to anchor and stabilize a lug 2 in the midsole 17 ( see , e . g ., fig4 ) without departing from the spirit of the invention . [ 0044 ] fig6 a depicts a lug 2 with a perforated flange 70 extending from the perimeter 52 of the detent 53 of the lug 2 . fig6 b is a cross - sectional side view of this lug 2 with its perforated flange 70 , taken along line e - e of fig6 a . as depicted in fig6 a and 6 b , perforations 71 penetrate through the flange 70 . the midsole 17 ( see , e . g ., fig4 ) material would penetrate the perforations 71 to anchor and stabilize the lug in the midsole 17 ( see , e . g ., fig4 ). as will be understood by someone with ordinary skill in the art , the depicted number , size , shape and arrangement of the perforations 71 and the depicted size and shape of the flange 70 are exemplary to illustrate the invention , not a limitation of the invention . rather , the number , size , shape and arrangement of the perforations 71 and the size and shape of the flange 70 can be varied without departing from the spirit of the invention . in an alternative application of the present invention , a cylindrical rubber tire outer ( not shown ) is formed with tire tread detents similar to the detent / lugs 2 of the rubber shoe outer 1 . integral support bridges extend between the tire tread detent / lugs in a manner similar to that in which the integral support bridges 3 extend between the detent / lugs 2 of the rubber shoe outer 1 . the cylindrical rubber tire outer is placed in a cylindrical tire mold comprising indentations corresponding to the tire tread of the cylindrical rubber tire outer in a manner similar to the indentations 4 of the shoe midsole mold 5 . a second material , such as polyurethane , is then blown into the cylindrical rubber tire outer mold to form the non - tire tread rubber portion of the tire . as with the above - disclosed shoe sole lugs , integral support bridges 3 , radial ribs 52 , and flanges e . g ., 60 , 62 , 70 as depicted in fig5 a through 7 b , could be used to anchor tire lugs in a tire outer . although the present invention has been described in certain specific embodiments , many additional modifications and variations would be apparent to those skilled in the art . it is , therefore , to be understood that this invention may be practiced otherwise than as specifically described . thus , the embodiments of the present invention described herein should be considered in all respects as illustrative and not restrictive , the scope of the invention to be determined by the appended claims and their equivalents rather than the foregoing description .
1
paper is almost always produced in rolls at large mills remote from the location of next or final use . at the core is a tubular member which is used both to roll the paper at the mill and for mounting on a mandrel at the point of use . it is critical to maintain the symmetry of the core so that the roll can be used by the purchaser . for this reason , the rolls are shipped stacked vertically , i . e . with their long axis vertical . handling is done using a clamp truck , a fork lift type vehicle with curved arms which contacts the rolls with curved arms and can raise and rotate the roll to move it to storage or to a shipping vehicle . the rolls of paper can be shipped by rail car , container or truck . within the united states , most rolls of paper are shipped by railcar due to the high weight limits when compared to trucks . to take advantage of these weight limits , steps are taken to maximize the space utilisation within a railcar and avoid shipping air . the donut riser of this invention preferably a corrugated ring upon which rolls of paper may be placed . the donut riser has a diameter sized to support the rolls to prevent tipping during the sometimes violent movement of railcars during transport and especially in yards when being humped and switched . the height is chosen such that a valley formed between rows of raised rolls alternated with unraised rolls is sufficient to stabilise rolls laid horizontally above the unraised rolls . in such manner is the otherwise unutilised space in the railcar used and shipping costs reduced . fig1 shows a roll riser donut 1 resting on a floor and a paper roll 3 resting upon the donut riser . fig2 shows a paper roll 3 being set upon a roll riser donut 1 by a clamp truck 5 . fig3 shows a first embodiment of a roll riser donut 1 using “ a - flute ” corrugation and 26 or 33 lb . medium facing . fig4 a shows a second embodiment of a donut riser 1 using 0 . 5 in . super flute and 90 lb . liner singleface in plan view . fig4 b shows the riser of fig4 b in side elevation . the donut riser is formed from single face corrugated wrapped in multiple layers and held together with an adhesive , typically a hot melt adhesive . simple tooling such as a circular mold or a rotating mandrel sized to the riser id is used , but is not limiting of the invention . the inner diameter and outer diameter are chosen for the size and weight of the paper rolls . for most commercial rolls of kraft paper , a 32 in . inner diameter and an outer circumference of 48 in has been found to be optimal . the riser donut is formed from standard grades of corrugated . fig3 shows a donut made from 43 plies of a - flute ( 0 . 1875 in ) faced with 26 or 33 lb . medium . fig4 a & amp ; b shows the same size donut riser formed from 16 plies of 0 . 5 in . super flute faced with 90 lb . superface . the latter design is suitable for higher loads but costs more to manufacture . the use of the donut risers has been found to reduce the need for many chocks formerly needed to lock in place rolls of paper in railcars and trucks . the donut risers may be recycled either by returning the riser or by being shredded with other corrugated materials . use of corrugated for risers has many advantages over alternative materials . plastics work well but are more difficult to recycle and the costs for a single use are unacceptable wooden pallet - like designs have the disadvantage that they must be certified as fumigated when shipped to most international locations . this invention has been described in terms of its preferred embodiments . changes and adaptations of this disclosure are considered to be within the scope and spirit of the invention and encompassed within the description and claims hereinwith appended .
1
as pointed out above , the present invention is concerned with novel compositions and a method for the treatment of epidermal burns and wounds , particularly those infected with pseudomonas . the composition inhibits growth of the pseudomonas on the injured area , and promotes healing in burns and wounds . the composition of the present invention in its broadest embodiment comprises an aqueous solution of dextrose or dextrose metabolite , a buffering mixture of weak organic acids and / or alkali metal salts of weak organic acids , and a carrier , the solution being characterized as a relatively viscous solution having a ph ranging from about 3 . 0 to 6 . 5 . the most preferred composition may be characterized as containing the following formulation per liter of solution : this composition also contains about 600 to 1200 parts of water , and optionally about 5 to 100 parts of an alkali metal salt of acetic acid . preferably , the composition contains citric acid and an alkali metal salt of citric acid as important buffering components . the dextrose component of the composition is dextrose or a dextrose metabolite which is effective to provide antibacterial and antifungal properties to the composition when used in admixture with the other components . thus the dextrose or equivalent material is an important component in the composition . the buffering mixture is also an important ingredient of the composition . a sufficient amount of buffer should be present to provide a resulting solution having a ph of about 3 . 0 to 6 . 5 , most preferably in the range of 3 . 2 for antipruritic properties and 6 . 5 for wounds and burns . any buffer or mixture of buffers can be used for this purpose although mixtures of weak organic acids and alkali metal salts of organic acids are especially preferred . the amount of buffering agent present is also important since the total solution should contain about 7 to 15 weight percent of buffering agent for a suitable composition . the preferred buffering agents are polycarboxylic acids , phosphates , and the like which will provide the required ph range . the most preferred buffers , however , comprise a mixture of hydroxy polycarboxylic acids having about 3 to 8 carbon atoms and their alkali metal salts , or mixtures thereof . preferred organic acids include citric acid , malic acid , tartronic acid , tartaric acid , and mixtures thereof as well as the sodium and potassium salts of these acids . a highly preferred buffering system comprises a mixture of citric acid and sodium citrate . the composition optionally contains an alkali metal salt of acetic acid in an amount of about 1 to 4 parts by weight . the preferred alkali metal salt is sodium acetate , although any alkali metal salt of acetic acid may be used . the salt functions to increase the antifungal activity of the compound . this has also been shown to impart a longer shelf life to the composition . when the composition contains the alkali metal salt of acetic acid , the antifungal activity is improved so that it will not support the growth of bacteria or fungi . it is also preferred that the resulting solution be a viscous solution to inhibit drainage from the infected organs after topical application . thus , a carrier vehicle is included in the composition to increase the viscosity of the solution . suitable carriers include polyalkylene glycols , methyl cellulose and the like . the preferred carrier vehicle is a lower polyalkylene glycol such as glycerine . the carrier also provides the proper consistency to the composition so that the composition has sufficient viscosity for topical application . it also provides the necessary consistency to the solution so it can be used as a lubricant in the treatment of animals such as horses . a preferred formulation of the invention comprises the following components per liter of solution : ______________________________________ingredient parts by weight______________________________________dextrose 5 . 0 .- 5 . 0 .. 0 . hydroxy carboxylic acid 2 . 5 to 1 . 0 .. 0 . alkali metal salt of 2 . 5 to 1 . 0 .. 0 . hydroxy carboxylic acidcarrier 5 . 0 .- 15 . 0 . ______________________________________ in a more preferred aspect of the invention , the composition would also contain an alkali metal salt of acetic acid in an amount of about 5 to 100 parts per liter of solution . additionally , the remainder of the solution is preferably water . the most preferred composition for use in the present invention comprises the following components : ______________________________________ingredient amount______________________________________dextrose 5 . 0 .. 0 . gramscitric acid 1 . 0 .. 0 . gramssodium citrate 5 . 0 . gramsglycerine 1 . 0 .. 0 . ccsodium acetate 2 . 5 gramsdistilled water 9 . 0 .. 0 . cc______________________________________ the addition of sodium acetate in the most preferred embodiment increases the anti -- fungal activity of the compound . the sodium acetate containing compound was shown to have longer shelf life than the same compound without sodium acetate , since it will not support the growth of bacteria or fungi . the resulting composition is an aqueous solution with sufficient consistency to drain slowly . in use for treatment of contagious equine metritis , the composition is applied topically directly to the external genitalia of stallions and mares and preferably is used one time each day for at least two successive days . an effective amount is simply a thorough application of the viscous solution to the external genitalia manually . it has been found that this method will provide 100 % effectiveness in curing horses of the contagious equine metritis organism - caused disease . although the composition was originally developed for treatment of contagious equine metritis , it has been found that the composition is also effective against pseudomonas infections where the infection occurred on the external genitalia of the affected horses . this discovery led to the discovery of use of the composition of the invention for burn patients and patients with skin and muscle wounds infected with pseudomonas bacterias , particularly pseudomonas aeruginosa . when the composition was applied to accidental skin burns , it not only gave dramatic relief of pain , but also prevented the blistering of the epidermis as well as dramatically accelerating wound healing . the same results were obtained in several cases with skin burns from sun , steam , heat , friction and grease . the compound was also shown to accelerate the healing of contact ( allergenic ) dermatitis . when the compound was applied at the time of exposure to poison ivy , the skin lesions of poison ivy did not develop . when applied to early cases , the compound was shown to be antipruritic within a few minutes of application , and greatly accelerated the healing of the skin lesions . similar relief and reduction of swelling was observed in cases of insect - induced skin reactions . the composition is also useful in healing burns caused by friction , chemical and heat . in experiments involving skin and wound lesions of dogs , cats , cattle and horses , the composition of the invention was shown to greatly accelerate the healing of superficial and deep skin and muscle wounds . it not only prevented bacterial and fungal infections of the wound , but it dramatically hastened the healing of the wound and the new growth of skin thereover . in numerous cases of animal wounds involving cats , dogs , cattle and horses , the composition dramatically promoted complete wound healing after other &# 34 ; state of the art &# 34 ; medical treatments failed to produce satisfactory results . although the exact mechanism by which the composition works is not known , it was originally developed to enhance the normal bacteria flora of the skin to produce an anti - bacterial - like metabolite to inhibit the growth of the contagious equine metritis ( cem ) organism . in addition to the production of the antibacterial metabolite , it appears that the rapid healing of wounds caused by the composition of the invention provides an environment that discourages the growth of pathogenic bacteria and fungi . further , the composition has other beneficial properties and functions , including anti - pruritic properties , reduction of tissue fluids in epidermal vesicles and wound lesions , increased circulation to wound lesions and inhibition of bacterial and fungal growth in wounds . in preliminary tests on numerous cases of burns and naturally induced viral , bacterial , fungal , allergic and traumatic diseases of the eye , external ear , nose , oral mucosa , periodontal tissues , external genitalia , vagina , uterus , perianal and dermal tissue , and muscles affected with deep wound lesions , the composition was shown to dramatically accelerate the healing of lesions in the mucous membranes , epidermis , dermis and muscles . with the exception of neoplasia , the compound was effective on any type of lesion . the following examples are to illustrate the invention , but the invention is not to be considered as limited thereto . in the examples and throughout the specification , parts are by weight unless otherwise indicated . ______________________________________ingredient parts by weight______________________________________dextrose 25 . 0 . gramscitric acid 5 . 0 . gramssodium citrate 25 gramsglycerine 1 . 0 .. 0 . ccs . water 4 . 0 .. 0 . ccs . ______________________________________ the resulting composition was a viscous solution having a ph of 3 . 20 . to show the effectiveness of the compound on cem , twenty horses were selected for testing . each of the twenty horses was treated with a single treatment of the solution by manually applying topically directly to the external genitalia of the horses . from this test , 17 of the horses were found to be cured by the single treatment . the three horses which were not cured with the single treatment were then treated again with two successive treatments which were found to successfully cure the disease . accordingly , in the field it is recommended that the disease be treated one time per day with application of the composition on at least two successive days . ______________________________________ingredient parts by weight______________________________________distilled water 9 . 0 .. 0 . cc . glycerine 1 . 0 .. 0 . cc . dextrose 5 . 0 .. 0 . gramscitric acid 1 . 0 .. 0 . gramssodium citrate 5 . 0 . gramssodium acetate 2 . 5 grams______________________________________ the resulting composition is a viscous solution having a ph of 3 . 0 . the compound of the invention is topically applied to ten patients having second degree epidermal heat burns . in all ten cases , the patients experience dramatic relief of pain , and no blistering of the burn area occurs . further , the healing time of the burn is dramatically accelerated . in addition , none of the patients develop pseudomonas aeruginosa infections in the area of the burn . similar results are obtained in cases where the skin burns are caused from sun , steam , friction and grease . the invention has been described herein with reference to certain preferred embodiments . however , as obvious variations thereon will become apparent to those skilled in the art , the invention is not to be considered as limited thereto .
0
referring to fig1 reference numeral 1 designates a heating chamber 1 having segments 2 extending downward from the bottom thereof . these protruding segments are open at their extremities to permit passage of air through the chamber , as illustrated by the arrows . the roof of chamber 1 may be painted black as is well known in the solar heating art . when assembled , segments 2 extend through holes 3 in planar - shaped base 4 which may be fabricated from 4 &# 39 ;× 8 &# 39 ; sheets of 3 / 4 - inch exterior plywood nailed to a wooden framework in the prior art manner , e . g ., standard roof construction . a piece of rigid insulation 5 , e . g ., isocyanurate , may be sandwiched between the heating chamber and the base . as seen in fig1 a , which is a transverse cross - sectional view of the partially assembled kit , chamber 1 and insulation 5 may be held in place on base 4 by tie - down strips 6 along the chamber &# 39 ; s longitudinal edges . as further shown therein , chamber 1 may be fabricated from two pieces of sheet metal 30 and 31 crimped together along the chamber &# 39 ; s longitudinal edges , which is a wellknown technique in the sheet metal working art . referring again to fig1 the kit further includes guide strips 7 to be nailed or otherwise secured to base 4 to surround the perimeter of heating chamber 1 and to be covered by glazing supports 8 when the kit is assembled . the glazing supports may be fixed to the base by means of nails through lips 8a . preferably , guide strips 7 are secured to the base before holes 3 are cut therein and before the heating chamber is placed thereupon . guide strips 7 , which may be fabricated from one and one - half inch strips of half - inch plywood , constitute an important aspect of the invention . more specifically , once guide strips 7 are accurately secured to base 4 , it is a comparatively simple task to complete the remaining assembly of the kit . that is , glazing supports 8 are easily , snuggly fitted over the guide strips , due to the fact that the width of bottom slot 8b of each support is properly matched to the width of its respective guide strip . therefore , accurate placement of guide strips 7 automatically results in the glazing supports 8 being quickly and precisely positioned on base 4 . precise placement of the glazing supports is critical so that pre - cut glazing panes will properly seat in the framework created by the supports . the chance of an error in frame size in an apparatus of this type is especially pronounced when the kit incorporates a substantial number of glazing panes in a manner later described . the installation of a multi - pane kit without benefit of the guide strips 7 becomes a tedious , trial - and - error , overly expensive task not suitable for the do - it - yourselfer , because it is quite difficult to accurately position and secure the glazing supports in comparison to the smaller , lighter and therefore more easily handled guide strips . referring now to fig2 therein is shown an exploded view of a preferred embodiment of the heating chamber of the present invention . the chamber is composed of five sections 1a , 1b , 1c , 1d , and 1e . each section may be about eight feet long and about three feet wide so that practically any local sheet metal shop can fabricate same . sections 1a , 1b , and 1c include downwardly extending segments 2a , 2b , and 2c , respectively , to extend through respective holes in base 4 ( e . g ., see fig1 ). thus , there are two downwardly extending segments at opposite ends of the chamber , and a third segment at the half - way point of the chamber . during operation of the heating chamber of fig2 air enters the chamber through the openings at the extremities of protruding end segments 2a and 2b , and exits from the chamber through protruding center segment 2c . sections 1d and 1e of the chamber do not include downwardly extending segments , because these sections simply connect center section 1c to end sections 1a and 1b . fig3 illustrates the manner in which the sections of the preferred heating chamber may be joined together . that is , the roofs may be joined by pop rivets 9 , while the floors may be joined by adhesive caulking 10 . as illustrated in the close - up view of chamber section 1c in fig4 and 4a , each section is preferably made up of a plurality of side - by - side elongated channels 11 each of which are substantially closed except for the end thereof . in addition to being open at their ends , the parallel channels in section 1c are open at the half - way point of the channels to communicate with downwardly extending segment 2c . thus , in this embodiment segment 2c ( as well as the other downwardly extending segments 2a and 2b ) function as air manifolds for the channels 11 . as also shown in fig4 and 4a , each channel includes a plurality of transverse partitions 12 extending downward from the ceiling , which partially obstruct flow of air therethrough and thereby create turbulence which results in more intimate contact between the air and the heated ceiling . in addition , the fact that the partitions 12 are located in the ceiling causes them to become directly heated by solar energy , thereby providing more heating area for the air travelling through the chamber . referring now to fig5 therein is shown in cross - section a preferred embodiment of glazing support 8 . the supports are hollow and include an opening at the bottom thereof . preferably , they are manufactured in eight - foot lengths from extruded metal , e . g ., aluminum . as is well known in the greenhouse glazing art , each support may include end flanges ( not shown ) to permit joining one support to another by means of pop - riveting . it can further be seen from fig5 and 5a that the kit includes rigid insulation pieces 13 ( e . g ., isocyanurate ) inserted into the glazing supports . these pieces are sized ( i . e ., properly dimensioned ) to snuggly fit totally within each glazing support in a position recessed from the bottom thereof , so as to define a slot 14 keyed to the shape and size of guide strips 7 . in this manner , the glazing supports snuggly fit on top of , as well as along the sides of each guide strip 7 . referring now to fig6 therein is shown a top view of an embodiment of the present invention which accommodates a plurality of glazing panes 5 . the structure is approximately 40 feet long to accommodate the 40 foot chamber depicted in fig2 and each pane may be a standard piece of tempered glass , 1 / 8 × 34 × 76 inches . the perimeter of the chamber is surrounded by primary glazing supports 8 . in addition to said supports 8 , there are a plurality of intermediate supports 16 which extend between and are connected to parallel primary supports 8 . fig7 and 7a illustrate how the intermediate supports 16 in fig6 are connected to the primary supports 8 . referring thereto , a plurality of supporting arms 17 are pop - riveted or otherwise transversely attached to each of the parallel primary supports 8 at a plurality of predetermined and premarked points along such supports . the support arms are very short , e . g ., they are a small fraction of the length of intermediate supports 16 , usually about 11 / 2 inches long . after arms 17 are attached to supports 8 , each end of each intermediate support 16 is snuggly fitted over one of such arms , e . g ., supports 16 may be snap - fitted over arm 17 . each support 16 provides two ledges for holding glazing panes . it can be seen from fig7 a that support 16 rests on the ledge of support 8 , as well as on arm 17 , and that each support 16 is slightly shorter than the actual distance between parallel supports 8 , i . e ., see gap y . this differential in length provides for easy placement of the supports 16 between parallel primary supports 8 , and further provides for subsequent expansion and contraction of the overall structure . once the primary and intermediate supports are in place , glazing panes 15 may be secured to the structure in the prior art manner . for example , referring to fig8 an extruded aluminum bench 18 is attached , e . g ., glued , to the ledge 19 of primary supports 8 ( and to similar ledges on intermediate supports 16 ). each pane is edged with a rubber gasket 20 and placed on top of the benches . a caulking sealant 21 is beaded along the top of the gasket , and then the structure is capped with an elongated sheet metal cap 22 which is attached to the elongated supports by means of screws 23 . whenever adjacent metal cap members are joined to one another , they may be caulked for further sealing . after assembly of the kit , air ducts ( not shown ) are attached to the extremities of downwardly extendind segments 2a - c in the prior art manner , to establish communication between the heating chamber 1 and the house and / or heat storage ( e . g ., a bed of rocks ). fans , electrical sensors and other controls ( not shown ) may be incorporated into the system as will be obvious to those skilled in the art . while the preferred structure of the present invention has been described with specified materials and dimensions , it will be obvious to those skilled in the art that other materials and dimensions may be readily employed , and in fact other materials and dimensions may be more practical depending upon the location and requirements of the unit . furthermore , it will be apparent that the kit may include a plurality of side - by - side heating chambers .
5
the method of the present disclosure rearranges the image pixels based on a non - rectangular image convolution kernel shape to organize the pixels to alignment and contiguity of data access patterns so that general box filter convolution strategy can be applied for smoothing the input image without severe performance penalties during memory access . the method of the present disclosure uses two arrays to represent non - rectangular shaped convolution kernel in an orthogonal coordinate system so that a general box filter convolution strategy can be applied . the length of the two arrays is equal to the size of the convolution kernel &# 39 ; s vertical dimension ( the height ) and the contents of the two arrays define the convolution kernel &# 39 ; s horizontal dimension ( the width ). one of the two arrays carries the skip length of the kernel ( representing the number of pixels not in the convolution kernel ) and the other array carries the run length ( representing the number of pixels that are in the convolution kernel ). once the non - rectangular convolution kernel is presented in an orthogonal coordinate system , a general box filter convolution strategy can be applied to smooth the input image . this concept will be illustrated using a hexagonal shaped convolution kernel as an example . fig1 shows an input image 300 that is 11 pixels high by 22 pixels wide . in actual spect operation , an input image could be much larger than the example input image 300 shown here but for the purpose of this description , the example input image 300 is selected to have this limited size . the 242 pixels in the input image 300 are labeled using a row - major convention notation inside a pair of brackets , i . e . [ row , column ]. according to an aspect of the present disclosure , a non - rectangular shaped convolution kernel is applied to smooth the input image 300 , specifically a hexagonal shaped convolution kernel . for example , a hexagonal convolution kernel image h 1 is shown overlaid onto the input image 300 centered over the pixel [ 6 , 6 ]. the pixel [ 6 , 6 ] is the pixel in the input image 300 that will be smoothed by the hexagonal convolution kernel image h 1 and aligns with the center or the anchor pixel location of the hexagonal convolution kernel image h 1 . the hexagonal convolution kernel employed here has 11 × 11 pixel size and , thus , twelve kernel images h 1 through h 12 will be required to smooth the input image 300 . the twelve anchor pixels associated with the twelve kernel images h 1 through h 12 are shown with shading in fig1 . the twelve anchor pixels correspond to the pixels [ 6 , 6 ], [ 6 , 7 ], [ 6 , 8 ], [ 6 , 9 ], [ 6 , 10 ], [ 6 , 11 ], [ 6 , 12 ], [ 6 , 13 ], [ 6 , 14 ], [ 6 , 15 ], [ 6 , 16 ], and [ 6 , 17 ] of the input image 300 . for purposes of illustration , only three of the twelve convolution kernel images h 1 , h 2 and h 12 are shown in fig1 . thus , the particular number of convolution kernel images required to smooth an input image would depend on the size of the input image . for illustration purposes , only three of the twelve hexagonal convolution kernel images h 1 , h 2 and h 12 are identified in fig1 . fig2 a shows one hexagonal convolution kernel image 402 of the present example in a boundary box area 400 . the convolution kernel image 402 has a size that is defined by a 11 × 11 pixels boundary box area 400 . because the hexagonal convolution kernels is not box - shaped and does not occupy all of the pixels in the 11 × 11 boundary box area 400 , the shape of the convolution kernel inside the boundary box area 400 is defined with skip - length array 405 and run - length arrays 410 . the run - length array 410 contains the number of neighborhood pixels in each row , i . e . the pixels that are in the convolution kernel image . the skip - length array 405 contains values that represent half of the number of pixels in each row that are not the neighborhood pixels . for example , in the first row on top of the image shown in fig2 a , there are five neighborhood pixels in the center that are inside the convolution kernel image and , thus , the run - length value for the first row in the run - length array 410 is “ 5 ”. there are six pixels that are not the neighborhood pixels , three on each side of the five neighborhood pixels . thus , the skip - length value for the first row in the skip - length array 405 is “ 3 ”. the skip - length array and run - length array of the convolution kernel image is calculated once by the image processor 240 and stored in the data storage unit 220 during the initialization step before the image smoothing process is executed . the method of the present disclosure takes the non - rectangular shape of the convolution kernel image , remaps the convolution kernel image pixels from a hexagonal coordinate map to an orthogonal coordinate map using pre - calculated skip - length and run - length array information . the orthogonal coordinate map corresponds to the orthogonal coordinate system of the memory space in the data storage unit 220 . then , the pixels in the input image 300 is also rearranged using the hexagonal coordinate conversion described herein into an orthogonally aligned memory space based on the skip - length and run - length array information . this rearrangement and alignment of the input image pixel data into orthogonally aligned memory space allows the use of a general box filter convolution strategy for smoothing the input image 300 even when the filter kernel is non - rectangular . in other words , regardless of the particular shape of the non - rectangular filter kernel shape , a general box filter method can be used to smooth the input image . in order to explain the remapping of the convolution kernel image pixels from a hexagonal coordinate map to an orthogonal coordinate map of a memory space , fig2 b shows the hexagonal convolution kernel images defined in a hexagonal coordinate system . the hexagonal coordinate system is a non - orthogonal coordinate system defined by two axes a and b that form an angle of 120 ° with each other . in the example shown in fig2 b , two hexagonal kernel images are illustrated in the hexagonal coordinate system along with their respective group of 121 image pixels that define each kernel image &# 39 ; s boundary box area associated with their respective anchor pixels . the anchor pixels are marked in dark color and the periphery pixels outlining the hexagonal kernel shape are shown in cross - hatches . the pixels that correspond to the convolution kernel 402 are labeled using ( row , column ) convention denoting their eventual location in the orthogonal coordinate map of the memory space in the data storage unit 220 after being remapped . fig3 a shows the remapped convolution kernel 402 a . in the remapped convolution kernel 402 a , the pixels in the convolution kernel 402 in fig2 b have been remapped into an 11 × 11 orthogonal coordinate map of a memory space 500 . the pixels in the memory space 500 are labeled using a row - major convention in where the rows and columns refer to the rows and columns in the memory space 500 . this is not to be confused with the “[ row , column ]” labeling of the pixels in the input image 300 in fig1 . in order to distinguish the two , the row , column labeling of the memory space 500 are shown without the brackets “[ ]” in the figure and are referred to using parentheses “( row , column )” in this description . using the remapped convolution kernel 402 a as a remapping template , the input image 300 pixel data is remapped into the memory space &# 39 ; s orthogonal coordinate map of the memory space also . comparing the ( row , column ) labels in the remapped convolution kernel 402 a in fig3 a to those in the convolution kernel 402 in fig2 b , one can see that all of the pixel data in the convolution kernel 402 have been remapped into the remapped convolution kernel 402 a &# 39 ; s orthogonal grid . one can see that the 121 pixels in the convolution kernel have been rearranged from the parallelogram shaped arrangement in fig2 b to the square shaped arrangement of fig3 a . the remapping will be referred to herein as the “ hexagonal coordinate remapping .” the shaded pixels represent the neighborhood pixels associated with the anchor pixel ( 6 , 6 ) defined by the run - length array 410 and they contain a uniform value . each value in the run - length array 410 represents the number of pixels covered by the convolution kernel in each row . in order to ensure a valid operation when image boundary pixels are smoothed , an assumption is made that all referred neighborhood pixels necessary for the operation are available . the term “ image boundary pixels ” refer to the pixel locations near the edge of the image that are not in the image . for example , in fig2 b , if the hexagonal convolution kernel on the left side were the convolution kernel h 1 in fig1 , the pixel locations in the region c in fig2 b would be located outside the boundary of the input image 300 and not part of the actual input image 300 . for image smoothing calculation , these pixel locations are deemed to have null values . the image smoothing process of the present disclosure is further described in connection with fig3 b through 6 . the anchor pixel location ( 6 , 6 ) of the hexagonal convolution kernel h 1 is indexed at the first input image pixel [ 6 , 6 ] to be processed . ( see fig1 ). smoothing of the first input image pixel [ 6 , 6 ] is calculated first during the initialization procedure applying conventional convolution using the hexagonal kernel 402 . the smoothed output data for the input image &# 39 ; s first anchor pixel [ 6 , 6 ] is then stored in the result array r as the first output pixel so 1 . in order to complete the smoothing of the input image 300 , the remaining input image pixels [ 6 , 7 ] through [ 6 , 17 ] corresponding to the anchor pixels of the convolution kernels h 2 through h 12 need to be processed . the last pixel to be processed in the input image 300 is input image pixel [ 6 , 17 ] corresponding to the anchor pixel of the hexagonal filter kernel h 12 . the image smoothing process will be described from this point in terms of the input image data that has been remapped into the memory space via the hexagonal coordinate remapping and the pixel data locations will reference the coordinate in the memory space &# 39 ; s orthogonal map . referring to fig3 b , the neighborhood pixels of the anchor pixel ( 6 , 6 ) in the convolution kernel 402 can be conceptually separated into two sections , a top section 605 ( size 5 × 11 ) and a bottom section 610 ( size 6 × 11 ) in the memory space 500 . as discussed above , the neighborhood pixels are those defined by the run - length array 410 and are shown shaded in fig3 b . separating the hexagonal convolution kernel 402 into two sections reduces demand on data processing memory space ( usually a fast cache memory space ) especially when the convolution kernel and the input image are large . it should be noted here that the particular sizes of the convolution kernel 402 and the input image 300 being used here as examples are arbitrarily chosen to be not too large for simplification . thus , the method described herein is applicable to images that are smaller or larger than the examples . furthermore , one skilled in the art would appreciate that the hexagonal convolution kernel 402 can be divided into more than two sections in order to further reduce the demand on data processing memory space . as shown in fig4 a , the top section 605 and the bottom section 610 of each of the hexagonal filter kernel data in the memory space are further divided into two subsections based on the initially calculated run - length array data . fig4 a shows the top section 605 associated with the last anchor pixel ( 6 , 17 ) further divided into subsections 605 a and 605 b . the bottom section 610 associated with the first anchor pixel ( 6 , 6 ) is shown further divided into subsections 610 a and 610 b . the top subsection 605 a represents the neighborhood pixels in the kernel image associated with the last anchor pixel ( 6 , 17 ) in the top section of the remapped input image 300 , as represented in the memory space . in other words , as in fig3 b , the notation in each pixel shown in fig4 a represents the ( row , column ) location of the pixel data in the memory space of the data storage unit 220 . the top subsection 605 b represents the pixels that are outside the kernel image associated with the last anchor pixel ( 6 , 17 ) in the top section of the remapped input image 300 , as represented in the memory space . similarly , the bottom subsection 610 a represents the neighborhood pixels in the kernel image associated with the first anchor pixel ( 6 , 6 ) in the bottom section of the remapped input image 300 , as represented in the memory space . the subsection 610 b represents the pixels that are outside the kernel image associated with the first anchor pixel ( 6 , 6 ) in the bottom section of the remapped input image 300 , as represented in the memory space . the notation a 1 refers to the first anchor pixel at memory location ( 6 , 6 ) and a 12 refers to the twelfth anchor pixel at memory location ( 6 , 17 ). in order to carry out the image smoothing process of the present disclosure , each of the four subsections 605 a , 605 b , 610 a and 610 b need to be extended to cover all neighborhood pixels for all of the eleven remaining anchor pixels ( 6 , 7 ) to ( 6 , 17 ) in the remapped input image 300 a ( i . e ., the input image 300 after it has been remapped into the orthogonal coordinate map of the memory space as discussed above ). this is illustrated in fig4 b . there are eleven anchor pixels to be considered because the first image pixel [ 6 , 6 ], which is now located at memory space location ( 6 , 6 ), has already been smoothed during the initialization step as discussed above . when considering the input image 300 &# 39 ; s pixel data remapped into the memory space using the hexagonal coordinate remapping discussed above , the position of the twelve anchor pixels in the memory space &# 39 ; s orthogonal map are ( 6 , 6 ) to ( 6 , 17 ) in the memory space &# 39 ; s ( row , column ) convention . fig4 b ( a ) shows a schematic illustration of the remapped input image 300 a in which the extended top subsection 605 a is shown in dotted line and labeled as 605 a - extended . fig4 b ( b ) shows a schematic illustration of the remapped input image 300 a in which the extended top subsection 605 b is shown in dotted line and labeled as 605 a - extended . the 605 a - extended is aligned to the right side of the memory space or memory index decrement ( from right to left ) and the top subsection 605 b - extended is aligned to the left side of the memory space or memory index increment ( from left to right ). however , in order to apply the general box filter convolution , the subsection 605 b - extended need to be aligned to the right side of the memory space or memory index decrement , same as the subsection 605 a - extended . this can be realized by loading the non - aligned &# 39 ; pixel data for the subsection 605 b - extended from a main memory space ( such as the data storage unit 220 shown in fig7 ) location to a temporary cache memory ( which is generally smaller memory but has much faster access time ) and aligning the pixel data from the cache memory in order to same computation time . the cache memory can be provided as part of the data storage unit 220 or as a separate memory device . the two subsections 605 a - extended and 605 b - extended can have overlap of the memory space as shown . for reference , fig4 b ( a ) and ( b ) also show the outlines of the neighborhood pixels n ( 6 , 6 ) and n ( 6 , 17 ) under the convolution kernel ( per the calculated run - length array ) associated with the first anchor pixel ( 6 , 6 ) to be smoothed and the last anchor pixel ( 6 , 17 ) to be smoothed , respectively . fig5 shows both the top subsections 605 a - extended and 605 b - extended aligned to the right side of the memory space in the decremented order and ready for further processing . with both of the top subsections aligned in decremented order , we can calculate the convolution kernel values for the top portions of the neighborhood pixels associated with each of the eleven remaining anchor pixels efficiently . first , summation operations 705 and 710 are performed to sum the values of the pixels in each column in the top subsections 605 a - extended and in the top subsection 605 b - extended , respectively . the number of columns in each of the two top subsections 605 a - extended and 605 b - extended is same as the total number of anchor pixels in the input image 300 minus 1 , which in this case is 11 . then , the summed column values of the top subsection 605 b - extended are subtracted from the summed column values of the top subsection 605 a - extended and the subtraction results are placed in a temporary buffer array h top . the temporary buffer array h top holds eleven values , each value representing the difference in the kernel values for the top portion of the kernel between one kernel and the next kernel in the sequence . these differences represent the difference in the kernel values from one kernel to the next associated with the anchor pixels ( 6 , 7 ) to ( 6 , 17 ) if one were to perform convolution for each of the anchor pixels individually in sequence . for example , referring to the illustration in fig4 b ( a ), after a convolution is performed on the neighborhood pixels n ( 6 , 6 ) for the first kernel , in order to perform a convolution on the neighborhood pixels for the next kernel in sequence , i . e . n ( 6 , 7 ) , the kernel image is shifted one pixel to the right so that the kernel image is now centered over the next anchor pixel ( 6 , 7 ). shifting the kernel image one pixel to the right is same thing as adding a column of neighborhood pixels on the right side of the kernel image while subtracting a column of pixels on the left side of the kernel image . therefore , the effective change between the value of the first kernel to the next is effectively the difference between the column of neighborhood pixels added on the right side and the column of neighborhood pixels subtracted on the left side . thus , the values in the array h top represent the differences in the kernel values from one kernel to the next associated with the anchor pixels ( 6 , 7 ) to ( 6 , 17 ) if one were to perform convolution for each of the anchor pixels individually in sequence . the computation of the temporary buffer array h top is shown in equation 1 as follows : h top ⁡ [ i ] = ∑ k = 1 ( hex - 1 ) / 2 ⁢ topsection ⁢ ⁢ 1 ⁡ [ k ] ⁡ [ i ] - ∑ k = 1 ( hex - 1 ) / 2 ⁢ topsection ⁢ ⁢ 2 ⁡ [ k ] ⁡ [ i ] ( eq . ⁢ 1 ) where hex refers to hexagonal kernel size and i refers to a number of anchor pixels minus 1 , range from 17 to 7 ( i . e ., in decremental order from right to left starting from the position of the last of the twelve anchor pixels to the second anchor pixel in the input image 300 ). “ topsection1 ” refers to the top subsection 605 a - extended and “ topsection2 ” refers to the top sub - section 605 b - extended . similarly , the two bottom subsections 610 a - extended , 610 b - extended are aligned in the incremental order ( from left to right ) to facilitate implementing the box filter convolution . similar to the summing operations performed on the two top subsections 605 a - extended and 605 b - extended , the columns in each of the bottom subsections 610 a - extended , 610 b - extended are also summed . then , the summed column values of the bottom subsection 610 b - extended are subtracted from the summed column values of the bottom subsection 610 a - extended and the subtraction results are placed in a temporary buffer array h bot . the length of the array h bot is the total number of anchor pixels in the pixel row 6 in the input image 300 minus 1 . the computation of the temporary buffer h bot is shown in equation 2 as follows : h bot ⁡ [ i ] = ∑ k = 1 1 + ( hex - 1 ) / 2 ⁢ bottomsection ⁢ ⁢ 1 ⁡ [ k ] ⁡ [ i ] - ∑ k = 1 1 + ( hex - 1 ) / 2 ⁢ bottomsection ⁢ ⁢ 2 ⁡ [ k ] ⁡ [ i ] ( eq . ⁢ 2 ) where hex refers to hexagonal kernel size and i refers to the number of anchor pixels minus 1 , range from 7 to 17 ( i . e ., in incremental order from left to right starting from the second anchor pixel position to the last of the twelve anchor pixels in the input image 300 ). “ bottomsection1 ” refers to the bottom subsection 610 a - extended and “ bottomsection2 ” refers to the bottom subsection mob - extended . next , referring to fig6 , since the arrays h top and h bot contain the differences in the kernel values from one kernel to the next associated with the anchor pixels ( 6 , 7 ) to ( 6 , 17 ) for the top portion and the bottom portion of the input image data , the arrays h top and h bot are added together to obtain a temporary summed array h . thus , the array h contains the differences in the kernel values from one kernel to the next associated with the anchor pixels ( 6 , 7 ) to ( 6 , 17 ). this process can be shown in equation 3 as follows : where hex refers to hexagonal kernel size and r refers to the number of anchor pixels minus 1 , range from 7 to 17 . because the total number of anchor pixels in this example is 12 , the n − i indexing means that the h top is aligned from left to right when h bot is aligned from right to left , so array h top is flipped before being added to array h bot . the summed array h consists of elements h [ 7 ] through h [ 17 ]. once the array h is obtained , a box filter convolution strategy can be applied to complete the image smoothing . as mentioned above , smoothing of the input image &# 39 ; s first anchor pixel [ 6 , 6 ] was pre - calculated during the initialization step and already stored in the result array r as the first output pixel so 1 . such output pixel so 1 is the output image for the first kernel image h 1 . the value of the first smoothed output pixel so 1 is added to the first element h [ 7 ] of the summed array h to obtain the second smoothed output pixel so 2 , which is the output image for the second kernel image h 2 . the value of the second smoothed output pixel so 2 is then added to the second element h [ 8 ] to obtain the third smoothed output pixel so 3 , which is the output image for the third kernel image h 3 . this operation is repeated until all anchor pixels are smoothed , generating smoothed output pixels so 1 to so 12 for kernel images h 1 through h 12 corresponding to the anchor pixels [ 6 , 6 ] through [ 6 , 17 ] in the input image 300 . there are many ways to implement a box filter efficiently . for example , the image pixels of the hexagonal convolution kernel images h 1 . . . h 12 can be moved in the memory space from left to right by subtracting pixels at the left - most side in the column of the box kernel and adding pixels at the next column of the image at the right side of the kernel box . in general , the operations by subtraction and addition can be added up by a number of elements in the column ( kernel size ). if the box kernel size is k pixels , the total operations per output pixel is 2 * k without counting overhead . in other words , the output pixel is the weighted sum of neighboring input pixels . in contrast , the convolution takes k 2 operations ( multiply - additions ). by organizing pixel data elements into arrays and creating loop blocking by transforming the memory domain of misalignment into smaller chunks of aligned memory space to maximize data reuse , the performance for image smoothing can be improved for any shape of convolution kernel . given the box kernel size k , the total operation per output pixel is 2 *( k + 1 ) without counting overhead of rearranged pixels . the box filter is able to accelerate the performance of a geometric shape point - spread - function ( g - psf ) in the 3d iterative spect reconstruction . the rearranged image pixels can be applied to a general box filter convolution without substantial performance penalties during memory access . the box filter attenuates the high - spatial frequency components of an image and has little effect on the low - frequency components . the effect of passing an image through a low - pass filter is a slight blurring . referring to a schematic diagram of fig7 , the method of the present disclosure is envisioned as being carried out in a spect system by an image processor 240 of a spect system controller 200 . the spect system controller 200 is a computer that can comprise a central processor 210 for managing and executing various programs necessary for the operation of the spect system 100 , the image processor 240 for executing the image processing described here , and a data storage unit 220 . the data storage unit 220 can be a single component unit or , if appropriate , can comprise multiple components that collectively provide the data storage unit 220 the ability to store information permanently and / or temporarily as necessary . for example , the data storage unit 220 can include one or more suitable storage components for holding firmware and other programs required for the operation and management of the spect system 100 . the data storage unit 220 can also include fast access data storage hardware such as cache memory devices for temporarily holding data for purposes of performing convolution calculations on the data fast . in the present case , the image pixel data would be temporarily stored in the data storage unit 220 in order to perform the image convolution described in this disclosure . the data storage unit 220 can also include more permanent data storage devices for storing information . regardless , the data storage unit 220 can include any appropriate computer readable data storage medium in which a set of instructions ( e . g . a software program ) is tangibly embodied thereon . the set of instructions when executed by a computer processor such as the image processor 240 , the image processor performs the image smoothing method of the present disclosure . by implementing the method of the present disclosure , the image processor 240 is able to smooth the input image 300 using the non - rectangular convolution kernel 402 using a general box filter convolution strategy without substantial performance penalties during memory access . the spect system controller 200 receives a spect image data 80 from the spect system 100 , processes the image data 80 and the image processor 240 converts the image data into an input image 300 and can display the image on the display 150 . the input image 300 is stored in the data storage unit 220 . the image data may include one or more kernel images discussed above . the image smoothing method disclosed herein can be implemented in software , hardware , or a combination thereof as a set of instructions tangibly embodied in any computer readable storage medium such as the data storage unit 220 or other portable medium , e . g . compact disks , flash memory devices , etc ., provided external to the spect system controller 200 . when the image processor 240 executes the instructions , the image processor 240 performs the image processing method described herein . fig8 is a high - level flow diagram 1000 that illustrates the image smoothing process of the present disclosure referring to the exemplary input image 300 and the hexagonal filter kernel image 402 . the image processor 240 first determines a valid output image dimension based the input image 300 and the filter kernel image 402 . ( see box 1005 ). for example , a valid output image dimension for the input image 300 is 1 × 12 based on a 11 × 22 input image and an 11 × 11 kernel image . the image processor 240 calculates the skip - lengths and run - length values for each row of pixels in the convolution kernel image 402 for the skip - length array 405 and the run - length array 410 . ( see box 1010 ). the calculated skip - length array 405 and run - length array 410 data is stored as a data table in a suitable memory such as the data storage unit 220 accessible to the image processor 240 . as part of the initialization process , the image processor 240 performs convolution for the first anchor pixel in the input image using the convolution kernel 402 and stores the smoothed output pixel data in the result array r as smoothed output pixel so 1 . ( see box 1020 ). the convolution kernel 402 is remapped into the orthogonal coordinate map of a memory space using the hexagonal coordinate remapping described above to generate a remapping template . ( see box 1030 ). using the remapping template , the input image 300 pixel data is remapped into the orthogonal coordinate map of the memory space . ( see box 1040 ). next , the remapped convolution kernel in the memory space is defined into at least two sections , a top section 605 and a bottom section 610 so that operation on the convolution kernel can be conducted on one section at a time to reduce the demand on the memory space during computation . ( see block 1050 ). next , one of the two sections , the top section 605 or the bottom section 610 , is further defined into two subsections , grouping the pixels in each of the two sections into a first subsection that are inside the kernel image 402 and a second subsection that are not in the kernel image 402 . these subsections are then extended to subsections ( e . g . 605 a - extended , 605 b - extended , 610 a - extended , 610 b - extended ) to cover all neighborhood pixels corresponding to all of the anchor pixels in the remapped input image 300 a . ( see block 1060 ). next , the extended subsections are realigned within the memory space so that each pair of subsections ( i . e . 605 a - extended and 605 b - extended ; 610 a - extended and 610 b - extended ) in each of the top and bottom sections in the remapped input image 300 a are aligned in decremental order or incremental order . ( see block 1070 ). for each pair of extended subsections , the pixel values in each column are summed first and then the summed values from the extended subsection ( 605 b - extended , 610 b - extended ) representing the pixels that are outside the kernel image are subtracted from the summed values from the extended subsection ( 605 a - extended , 610 a - extended ) representing the pixels that are inside the kernel image , thus , generating an array ( one of h top or h bottom depending on which pair of subsections were processed ) representing the differences in the kernel values from one kernel to the next associated with the remaining anchor pixels ( i . e . all anchor pixels minus the first one for which the smoothed value has already been calculated ) for the corresponding top or bottom portion of the input image data . ( see block 1080 ). next , the steps in blocks 1060 , 1070 and 1080 are repeated for the second section ( 605 or 610 depending on which section was processed first ) generating a second array ( the other of h top or h bottom ). ( see block 1090 ). next , the arrays h top and h bottom are added together to obtain an array h which represents the differences in the kernel values from one kernel to the next associated with the anchor pixels ( 6 , 7 ) to ( 6 , 17 ), i . e . the remaining anchor pixels other than the first anchor pixel ( 6 , 6 ). ( see block 1100 ). now the box filter convolution strategy is applied to the array h to obtain the smoothed data for the remaining anchor pixels . the value of the first smoothed output pixel so 1 is added to the first element of the summed array h , representing the difference in the kernel value between the first kernel h 1 and the second kernel h 2 , and obtain the second smoothed output pixel so 2 . ( see block 1110 ). the value of the second smoothed output pixel so 2 is then added to the second element of the summed array h , representing the difference in the kernel value between the second kernel h 2 and the third kernel h 3 . ( see block 1120 ). this operation is repeated until the last smoothed output pixel data so 12 is processed by the step 1120 and the result is stored in the data storage unit 220 as the last smoothed output pixel data for the last anchor pixel , i . e . pixel ( 6 , 17 ). this process produces the results array r containing the smoothed output pixels so 1 to so 12 corresponding to the anchor pixels ( 6 , 6 ) to ( 6 , 17 ) for the hexagonal convolution kernel images h 1 to h 12 . ( see block 1130 ). it should be noted that any process descriptions or blocks in flowcharts should be understood as representing modules , segments , or portions of code which include one or more executable instructions for implementing specific logical functions or steps in the process . as would be understood by those of ordinary skill in the art of the software development , alternate embodiments are also included within the scope of the disclosure . in these alternate embodiments , functions may be executed out of order from that shown or discussed , including substantially concurrently or in reverse order , depending on the functionality involved . this description has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure to the precise forms disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments discussed , however , were chosen to illustrate the principles of the disclosure , and its practical application . the disclosure is thus intended to enable one of ordinary skill in the art to use the disclosure , in various embodiments and with various modifications , as are suited to the particular use contemplated . all such modifications and variation are within the scope of this disclosure , as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly and legally entitled .
6
the device of fig3 and 4 is a three - colour backlit lcd display device . the device comprises a planar backlight unit 20 and a planar lcd unit 21 . the backlight unit is located behind the lcd unit 21 in the viewing direction , so that in the emission direction light from the backlight can pass through any light transmissive pixels of the lcd unit and towards a viewer 22 ( fig4 ). the backlight is provided by an organic light - emissive device which has a plurality of parallel linear regions 23 - 27 of light - emissive material . each region is provided by one of three different emissive materials which emit correspondingly different colours of light . the materials alternate so that the regions are in groups of red , green and blue emissive materials , as indicated in fig3 and 4 by the initials r , g and b . the emissive regions are sandwiched between anode and cathode electrodes . the cathode electrode 29 is common to all the emissive regions . the anode electrode is patterned into distinct rows 30 - 34 which each overlie a respective one of the emissive regions , so that the emissive regions can be controlled independently . the anode is formed of a light transmissive material . the anode is deposited on a glass substrate 36 . the lcd unit is a normal passive - matrix lcd unit in which the pixels 50 - 59 are arranged on an orthogonal grid and are connected by row 60 - 64 and column 65 , 66 electrodes . the backlight is dimensioned and located relative to the lcd unit so that each row of pixels in the lcd unit is underlain by one red , green or blue emissive region of the backlight . in fig3 and 4 pixels 50 to 54 are underlain by regions 23 to 27 respectively , as are pixels 55 to 59 in fig3 only . the backlight unit and the lcd unit are connected to a control unit 45 . the control unit receives a video data feed at 46 , which defines the colour pattern to be shown on the display . the video feed could come from any suitable source , such as ( without limitation ) a television decoder , a personal computer or another electronic device . the pattern may represent a frame of a multi - frame moving image . in the normal way a separating unit 47 of the control unit separates the colour pattern into red , green and blue pattern components which can be displayed in turn to give a user a time - averaged impression of the desired full colour pattern . a driver unit 48 of the control unit then drives the pixels of the lcd device and , in synchronisation with the lcd device , the emissive regions of the backlight . first , a suitable voltage and current is applied between the cathode 29 and the anode electrode strip 30 which corresponds to red emissive region 23 . this causes that regions to emit red light . at the same time the pixels 50 , 55 of the lcd panel are controlled using electrodes 60 , 65 and 66 to allow transmission only where red light is to be emitted for the red component of the pattern . after a predetermined duration the driver unit turns off the red emissive region 23 . then a voltage and current to cause the green emissive regions 24 to emit light and at the same time the pixels 51 , 56 of the lcd panel are controlled to allow transmission only where green light is to be emitted for the green component of the pattern . after a predetermined duration has passed the driver unit turns off the green emissive region 24 and applies a voltage and current to cause the blue emissive region 25 to emit light at the same time as the pixels 52 , 57 of the lcd panel are controlled to allow transmission only where blue light is to be emitted for the blue component of the pattern . the rapid switching between colours gives a viewer an impression of a steady full - colour pattern . the process continues until all the rows of the display have been scanned in this way . after that the display controller causes the display to cycle through the rows again . to display a moving image that next cycle could show the pattern of the next frame . the device could use more or fewer than three emission colours , driven in a corresponding way to that described above . the duration of display of each colour could be the same or different . if the emissive regions for different colours differed in efficiency then the duration of display could be related to the efficiency so that the time - averaged intensity of emission of each colour was substantially the same . the frequency of cycling through all three colours could vary ; convenient frequencies are in the range from 50 to 120 hz but higher or lower frequencies could be used . the lcd device may have several thousand pixels . for instance , one typical size is 800 columns by 600 rows , giving a total of 480 , 000 pixels . a typical pixel size is 300 × 100 μm . the light - emissive regions could run parallel to the rows or , less preferably , the columns of the lcd unit . the backlight unit is manufactured taking as a first step a commercially available ito - coated glass substrate . the ito is then patterned in lines by a standard process such as photolithography to define the separate electrode regions 30 - 34 . additional lines of metallisation could be provided in contact with the ito , e . g . between the ito and the glass substrate , or in the plane of the ito , to help distribute charge in the ito . preferably the metallisation lines are at least in part located between the bank and the glass substrate . over the ito an insulating layer shown generally at 49 is deposited and then patterned to leave banks 70 of insulating material that lie between and overlap the edges of the anode strips 30 - 35 . the banks 70 define grooves in the gaps between adjacent banks . the banks may suitably be formed of polyimide or any other suitable insulating material such as sio 2 . to help the formation of the light - emissive region in the grooves between the banks , especially when the material that is to form the light - emissive region is deposited by ink - jet printing , a differential wetting bank formation may be used . the bank may be formed from two layers of material : one thin layer that is easily wettable by the material that is to form the light - emissive region , and over that a thicker layer that defines the upper walls of the groove and is not easily wettable by the material that is to form the light - emissive region . then when the material that is to form the light - emissive region is deposited in the region it tends to bead up at the base of the groove . the banks overlap the edges of the ito anode strips . this helps to define sharp edges to the light emission from the light - emissive regions . then the light - emissive material is deposited by ink - jet printing into the grooves that are defined between the banks . to deposit the light - emitting material by inkjet printing the material or a precursor of the material is sprayed into the appropriate groove through an ink jet printer spray head . a suitable spraying cycle is 14 , 400 drops per second , with a drop volume of 30 pl . the ink jet system could be a continuous stream system ( e . g . using electrostatic directional control of the stream ) or a drop - on - demand system using e . g . a piezoelectric or bubble - jet print head . some examples of suitable light - emissive materials are : for the red emissive regions a di - alkoxy ppv , for the green emissive regions ppv ( e . g . prepared by the precursor route ) and for the blue emissive regions a polyfluorene . other materials and other colours could , of course , be used . an alternative to using the grooves is to use a differential wetting process : the substrate on to which the emissive material is to be deposited could be treated with a wetting agent or a non - wetting agent to cause the ink jetted material to bead up into the desired formations over the anode strips . instead of ink - jet printing other selective deposition methods could be used , preferably methods that allow for easy patterning of the light - emissive regions into stripes . other selective deposition methods that may be suitable include screen printing ( which is especially appropriate for large - area displays ), masking techniques , off - set printing , screen printing , electrostatic printing , gravure printing and flexographic printing . finally the cathode layer 29 is deposited over the banks and the emissive layers . ppv . the cathode layer could be a thin layer of calcium adjacent to the emissive regions , topped by a thicker layer of aluminium . one or more charge carrier transport layers , for instance of pedot - pss or other materials could be located between the anode strips and the light - emissive regions and / or between the cathode and the light - emissive regions . these layers could help charge transport in the forward direction and / or help to block charge transport in the reverse direction . the same charge transport layer ( s ) could be used between the respective electrodes and all the emissive regions or specific charge transport layers could be used for each emissive material . especially where the same material is used for the charge transport layer for all the emissive regions it may be found that in many cases the device will perform acceptably if the charge transport layer is not patterned — thus a continuous transport layer may be used over the entire device . where a charge transport layer is to be patterned it may be deposited uniformly and then patterned or may be deposited in a patterned form , e . g . by ink jet printing . other layers could be present such as barrier layers to counteract degradation of the device during use , conducting layers to improve charge distribution over the area of the device , insulating layers to inhibit unwanted charge migration , or protection layers to prevent degradation of parts of the device during manufacture . instead of ( or in addition to ) the patterning of the anode into lines the cathode could be patterned into lines parallel to the rows of emissive material . where the “ top ” electrode ( i . e . the later of the electrodes to be deposited — the cathode in the example of fig3 and 4 ) is patterned it will be appreciated that the banks 70 can usefully serve to protect lower layers from damage from the process of patterning the top electrode , particularly by spacing active pixel edges laterally from the patterned edges of the top electrode regions . the cathode could be located in front of the emissive regions , with the anode behind them . in that case , the cathode should be of a light transmissive material . it may be desirable to sharpen spatially the emission from one or more of the emissive regions to improve the effect of the display . one efficient way to achieve this is by defining a resonant cavity within the device which can spatially and / or spectrally narrow the emission by means of interference and / or cavity effects . one particularly efficient way of implementing such a cavity is by integrating the emissive material itself into such a cavity , with ( for instance ) the spacing between the anode and cathode electrodes on either side of the emissive material defining the ends of the cavity . additional layers such as dielectric stacks could be provided to define some or all of the cavity . the cavity itself could be augmented by the thickness of the organic layers . the lcd unit is a conventional passive matrix lcd unit . any suitable type of lcd unit could be used , including ferroelectric , tn and stn types . it will be appreciated that liquid crystal displays are just one class of light - switching devices that could be used in relation to the present invention and that other suitable devices could be used instead . the present invention may include any feature or combination of features disclosed herein either implicitly or explicitly or any generalisation thereof , irrespective of whether it relates to the presently claimed invention . in view of the foregoing description it will be evident to a person skilled in the art that various modifications may be made within the scope of the invention .
6
radio frequency identification ( rfid ) labels can be intelligent or just respond with a simple identification ( id ) to radio frequency ( rf ) interrogations . the rfid label can contain memory . this memory can be loaded with data either via an interrogator , or directly by some integrated data gathering element of the rfid label , for example , an environmental sensor . this data is retrieved some time later . as shown in fig1 , an exemplary rfid label 10 includes an antenna 12 , transceiver 14 , microcontroller 16 , clock 17 , memory 18 , temperature sensor 20 and battery 22 . other rfid labels may include one or more other data detecting devices in place of , or in addition to , the temperature sensor 20 . the label 10 can include other data detecting devices that record other data such as , for example , pressure , humidity and so forth . in this example , the data detecting device is the temperature sensor 20 , which senses and transmits a time and temperature to memory 18 at a time programmed by an interrogator . when triggered by rf interrogation via transceiver 14 , microcontroller 16 fetches data ( i . e . temperature and time the temperature was recorded , along with the current time in the label 10 ) from memory 18 and sends it out to the interrogator as multiplexed data packets from transceiver 14 . in this manner , a historical temperature log stored in memory 18 in the rfid label 10 can be retrieved . data logging , such as temperature logging , is limited by the size of memory 18 and / or life of battery 22 . as shown in fig2 , an exemplary interrogator 50 includes an antenna 52 , transceiver 54 , memory 56 , clock 57 , central processing unit ( cpu ) 58 and optional user interface ( ui ) 60 . the rfid interrogator 50 performs time division multiplexing ( tdm ) with the transceiver 54 and antenna 52 . data ( e . g ., time and temperature ) downloaded from the rfid label 10 can be stored in memory 56 . the rfid interrogator 50 can be used to program the data detecting device ( e . g ., temperature sensor 20 ) of the rfid label 10 to record or log a time and temperature in memory 18 at one or more selected times . at a selected time the temperature sensor 20 of the rfid label 10 records a temperature and a time of the temperature recordation in memory 18 . the rfid interrogator 50 can download the recorded time and temperature from memory 18 to memory 56 . when the rfid label 10 is initialized by the rfid interrogator 50 , the time in the clock 17 in the rfid label 10 ( i . e ., referred to as label start time ) is set to time in the clock 57 in the rfid interrogator 50 ( i . e ., referred to as actual start time ). however , over a period of service , the time maintained in the clock 17 of the rfid label 10 can drift from the actual time maintained in the clock 57 of the rfid interrogator 50 . at the time the rfid interrogator 50 downloads the data from the rfid label 10 , the actual time in the rfid interrogator 50 is referred to as the actual stop time and the time in the label 10 referred to as the label stop time . and at the time the rfid interrogator 50 downloads the data from the label 10 , the interrogator 50 acquires the label stop time from the clock 17 in the rfid label 10 . if the actual stop time does not equal the label stop time , the time in the label 10 has drifted and the time at which the label 10 logged the temperature ( referred to label time ) is suspect . using the label time , actual stop time , actual start time , label stop time and label start time , the rfid interrogator 50 can compensate / adjust the label time to a time at which the label 10 actually recorded the data ( referred to as actual time ). more specifically , memory 56 includes a synch process 100 . synch process 100 compensates for any drift of time in the rfid label 10 and the actual time as found in the rfid interrogator 50 at the time the data is downloaded from the rfid label 10 . as described above , at initialization , the rfid interrogator 50 sends the rfid label 10 a time , so both the interrogator 50 and the label 10 have identical times . the rfid interrogator 50 loads the rfid label 10 with a time ( e . g ., two hours after start ) at which the rfid label 10 is to store / log data , e . g . temperature and time , in its memory 18 . at a subsequent interrogation of the label 10 by the interrogator 50 , the interrogator 50 knows the label time , the actual stop time , the actual start time , the label stop time and the label start time . from these times , synch process 100 calculates an actual time , i . e ., the actual time at which the label 10 recorded the data . as shown in fig3 , synch process 100 includes initializing ( 102 ) a rfid label with a label start time , which is the actual start time indicated by a clock in the interrogator , and a time to record data . process 100 subsequently interrogates and receives ( 104 ) a label stop time , a recorded label time and recorded data from the rfid label . the label stop time is the time indicated by the label clock at the time of interrogation . the label time is the time the label indicates it recorded the data . process 100 receives ( 106 ) the actual stop time from the clock in the rfid interrogator . process 100 calculates ( 108 ) an actual time at which the label recorded the data using the following : the actual time equals [ label time *( actual stop time − actual start time )]/( label stop time − label start time ). for example , if the label start time and the interrogator actual start time are 0000 hours , the label time 0200 hours , the label stop time 1200 hours and the interrogator stop time 0600 , the label thinks 12 hours ( 1200 hours − 0000 hours ) elapsed between the start and finish . however , the interrogator knows that only 6 hours elapsed between the start and finish ( 0600 hours − 0000 hours ). in this example , the time in the label is fast compared to the actual time as indicated in the interrogator . therefore , the label &# 39 ; s clock has drifted , and is fast . accordingly , the label time , i . e ., the time the label thinks it recorded the data , is wrong . synch process 100 calculates the actual time the data was recorded by the label as [ 200 *( 0600 − 0000 )]/( 1200 − 000 ), i . e ., 0100 hours . in another example , if the label start time and the interrogator actual start time are 0000 hours , the label time 0200 hours , the label stop time 0600 hours and the interrogator atop time 1200 , the label thinks 6 hours ( 0600 hours − 0000 hours ) elapsed between the start and finish . however , the interrogator knows that 12 hours elapsed between the start and finish ( 1200 hours − 0000 hours ). in this example , the time in the label is slow compared to the actual time as indicated in the interrogator . therefore , the label &# 39 ; s clock has drifted , and is slow . accordingly , the label time , i . e ., the time the label thinks it recorded the data , is wrong . synch process 100 calculates the actual time the data was recorded by the label as [ 200 *( 1200 − 0000 )]/( 0200 − 000 ), i . e ., 0400 hours . as shown above , the synch process 100 can compensate for any variation in time in the label by knowing the label time , actual stop time , actual start time , label stop time and label start time . embodiments of the invention can be implemented in digital electronic circuitry , or in computer hardware , firmware , software , or in combinations of them . embodiments of the invention can be implemented as a computer program product , i . e ., a computer program tangibly embodied in an information carrier , e . g ., in a machine readable storage device or in a propagated signal , for execution by , or to control the operation of , data processing apparatus , e . g ., a programmable processor , a computer , or multiple computers . a computer program can be written in any form of programming language , including compiled or interpreted languages , and it can be deployed in any form , including as a stand alone program or as a module , component , subroutine , or other unit suitable for use in a computing environment . a computer program can be deployed to be executed on one computer or on multiple computers at one site or distributed across multiple sites and interconnected by a communication network . method steps of embodiments of the invention can be performed by one or more programmable processors executing a computer program to perform functions of the invention by operating on input data and generating output . method steps can also be performed by , and apparatus of the invention can be implemented as , special purpose logic circuitry , e . g ., an fpga ( field programmable gate array ) or an asic ( application specific integrated circuit ). processors suitable for the execution of a computer program include , by way of example , both general and special purpose microprocessors , and any one or more processors of any kind of digital computer . generally , a processor will receive instructions and data from a read only memory or a random access memory or both . the essential elements of a computer are a processor for executing instructions and one or more memory devices for storing instructions and data . generally , a computer will also include , or be operatively coupled to receive data from or transfer data to , or both , one or more mass storage devices for storing data , e . g ., magnetic , magneto optical disks , or optical disks . information carriers suitable for embodying computer program instructions and data include all forms of non volatile memory , including by way of example semiconductor memory devices , e . g ., eprom , eeprom , and flash memory devices ; magnetic disks , e . g ., internal hard disks or removable disks ; magneto optical disks ; and cd rom and dvd - rom disks . the processor and the memory can be supplemented by , or incorporated in special purpose logic circuitry . it is to be understood that the foregoing description is intended to illustrate and not to limit the scope of the invention , which is defined by the scope of the appended claims . other embodiments are within the scope of the following claims .
7
various embodiments of the invention are discussed in detail below . while specific implementations are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the relevant art will recognize that other components and configurations may be used without parting from the spirit and scope of the invention . unlike suburban residential markets , the mdu market can benefit greatly from economies of scale . fig1 illustrates an example system architecture for provisioning service to multiple customer premises in an mdu . in this illustrated example , the mdu service is supported by central office 110 ( or other hub location ). although not shown , central office 110 is itself connected with other central offices and hubs through a broader communications network . in one embodiment , central office 110 is connected to mdu 120 via a high bandwidth connection between line terminal ( lt ) 112 in central office 110 and network unit ( nu ) 121 in mdu 120 . in one scenario , nu 121 is located in a basement of mdu 120 . in various implementations , link 114 can be embodied as a copper link , fiber optic link , etc . moreover , in one embodiment , lt 112 is positioned as a remote terminal in a location that is remote from central office 110 . nu 121 in mdu 120 can be configured to perform a media conversion . for example , nu 121 can perform a media conversion from fiber optic cabling to copper cabling . in the illustrated example , nu 121 can support multiple cpes in mdu 120 via a plurality of links 122 . in a typical high - rise building , the plurality of links can extend from the basement to customer premises 131 - 134 on various floors in mdu 120 . in one configuration , the connection between nu 121 and individual cpes is via a copper connection . in various embodiments , this copper connection can be based on standard ethernet , dsl , or the like . in various implementations , the copper dsl connection can be ethernet ( e . g ., 2base - tl and 10pass - ts ) or non - ethernet based . as illustrated , nu 121 also incorporates switching functionality that aggregates a plurality of links into a single uplink . nu 121 can also effect various network policies . for example , nu 121 can enforce various bandwidth limitations in accordance with service provisioning under a particular service level agreement ( sla ). in general , a cpe can be configured to perform media conversion , switching , security , provisioning , etc . as such , a cpe such as a dsl modem can be used to support multiple devices within a single customer premises . for example , a dsl modem can support such devices as a voip phone , a computer , a wireless access point , a television , etc . as illustrated in fig1 , nu 121 can have a dsl connection to cpe 142 in customer premises 134 . cpe 142 in turn supports various customer devices . as illustrated , cpe 142 supports voip phone 146 via ethernet connection 144 . one of the disadvantages of the provisioning example of fig1 is the expense of supporting the various links from nu 121 to each customer premises 131 - 134 . in a typical mdu , these links can extend well over 100 meters , thus creating a need for cpe components such as dsl modems . cpes represent the most significant component of the expense in supporting the links from nu 121 to customer premises 131 - 134 . fig2 illustrates a system architecture that enables a reduction of such costs . in the illustrated example , a high - bandwidth connection such as fiber - optic link 214 is supported by lt 212 in central office 210 and nu 221 in mdu 220 . unlike the previous system architecture , links from nu 221 to customer premises 231 - 234 are not supported by conventional cpes . rather , the conventional cpe such as a dsl modem is eliminated from the system architecture . instead , the links from nu 221 to customer premises 231 - 234 can be based on an ethernet cpe device such as voip phone 242 in customer premises 234 . in this arrangement , a voip phone can be configured to function as a voip cpe . as illustrated in fig2 , voip cpe 242 can therefore be used to support multiple customer devices ( cds ) 246 in customer premises 234 . examples of such cds are personal computers , wireless access points , televisions , hd receivers , etc . these cds can be coupled to voip cpe 242 via a separate link ( e . g ., ethernet ). in the system architecture of fig2 , each voip cpe can be coupled to nu 221 via a wall socket that supports an ethernet - type connection . as noted , one example of mdu 220 is a high - rise building . as would be appreciated , a link from nu 221 to a customer premises near the top of the high - rise building would require a link length that is far greater than 100 meters . conventional ethernet connections only support link spans up to 100 meters . accordingly , conventional ethernet connections cannot be used to support the lengthy link spans from nu 221 to customer premises 231 - 234 . for this reason , the connection between nu 221 and a customer premises can be based on a broad reach ethernet connection that can handle link spans as long as 500 meters and beyond . an example of such a broad reach ethernet transceiver is broadcom &# 39 ; s broadr - reach ™ transceivers . the broad reach connection enables frames to be carried natively in ethernet . this is advantageous because nu 221 can be based on a conventional enterprise switch box not a dsl box , and a frame format conversion such as that performed by a dsl modem at the cpe would not be required . moreover , the switch chips inside nu 221 are standard devices that can enjoy high volume efficiencies . in general , broad reach ethernet extends the physical transmission capabilities of ethernet but preserves the pcs , rs , mac and above as native ethernet . broad reach ethernet is also backwards compatible with standard ethernet . in general , the voip cpe can be built with functionality similar to personal computers . for example , a voip cpe can have a central processing unit ( cpu ), a switch , router , and software / firmware that can define its configuration and functionality . in one embodiment , the voip cpe is embedded with cpe functionality such as encryption , authentication , provisioning , packet inspection , router , network address translation , usb support , prioritization , audio / video bridging , etc . this embedded functionality would enable the voip cpe to operate in a capacity similar to a conventional cpe . fig3 illustrates an example of a voip cpe . as would be appreciated , various bus / bridge architectures ( e . g ., north / south bridge architectures ) can be used to connect the various components in the system . as illustrated , voip cpe can include conventional components such as cpu 311 , system memory 312 , and power 313 . as the voip cpe can be embodied as a voip phone , support for voip traffic is also included . here , the voip cpe would include display 314 , codec 315 , and keypad 316 . display 314 can be embodied as an lcd screen for dialing and other call control / notification functions . codec 315 supports the conversion of an audio signal from / to a digital bitstream in the downstream / upstream directions . as such , codec 315 can be coupled to an amplifier that supports a speaker and microphone for voip communication . finally , keypad 316 enables the user input of dialing instructions . in combination , display 314 , codec 315 , and keypad 316 would support the voip function of the voip cpe . as noted , a voip cpe can support multiple cds such as wireless access points , televisions , computers , hd receivers , etc . in fig3 , this support is enabled by switch 319 , router 318 , and network address translation ( nat ) 317 functionality . in combination , switch 319 , router 318 , and nat 317 enable the voip device to operate as a cpe for one or more cds . fig4 illustrates an example of such cpe functionality . as illustrated , voip cpe 400 includes wan port 412 for connection to an nu / sw , one or more lan ports 414 for connection to one or more cds , and internal port 418 . in one embodiment , wan port 412 and lan ports 414 are ethernet ports . in general , wan port 412 , lan port ( s ) 414 and internal port 418 support full duplex links such that traffic can be coming from either direction at the same time . traffic can also be switched to two ports simultaneously . for example , internal port 418 can add traffic to wan port 412 ( e . g ., voip traffic ) and lan port ( s ) 414 , or receive traffic from either or both of wan port 412 and lan port ( s ) 414 . wan port 412 , lan port ( s ) 414 , and internal port 418 are coupled together via switch 416 . in routing traffic from wan port 412 to lan port ( s ) 414 , voip cpe 400 would support a cpe switching functionality for the customer premises . voip cpe can be designed to support some form of authentication , privacy and security . authentication would indicate to the network that the voip cpe is a valid network device that can receive communication . by validating exactly what services ( e . g ., iptv , voip , data , etc .) are allowed to the voip cpe , the system can ensure that services are not stolen . privacy / security can be enabled by encryption ( e . g ., macsec ), which would ensure that transmitted data ( e . g ., voice data ) cannot be monitored by third parties . in general , authentication , privacy and security can be used to prevent unauthorized devices from accessing the link at other points . as described above , the voip cpe can be designed with a physical layer device ( phy ) that supports broad reach ethernet . in one embodiment , the voip cpe is configured with a standard ethernet phy . this configuration would be suitable for those applications where links less than 100 meters were used . this configuration can also be used for those applications where links are greater than 100 meters . in accordance with the present invention , a voip cpe with a standard ethernet phy can be coupled to a broad reach ethernet connection via a conversion device that converts standard ethernet to broad reach ethernet . fig5 illustrates such an embodiment , where voip cpe 530 having a standard ethernet phy is coupled to nu 520 via conversion device 5 10 . here , nu 520 supports a broad reach ethernet link that terminates on a broad reach phy in conversion device 5 10 . conversion device 510 then converts the broad reach ethernet link to a standard ethernet link for delivery to voip cpe 530 . in one embodiment , conversion device 510 is a dongle that is designed for insertion into voip cpe 530 . in another embodiment , conversion device 510 can be coupled to voip cpe 530 via an ethernet cable . an advantage of using an ethernet link ( conventional or broad reach ) between an nu and cpe is the elimination of reliance on local loop technologies such as dsl . this feature leads to simpler nu and cpe designs that leverage high volume ethernet components . specifically , the support of broad reach ethernet communication by the voip cpe either directly or through a conversion device obviates the need for dsl support by both the nu and cpe . this greatly reduces the complexity and cost of the nu . fig6 illustrates an embodiment of a conversion device , which operates as a media converter . as illustrated , conversion device 600 includes broad reach ethernet phy 610 and standard ethernet phy 620 operating back to back . here , broad reach ethernet phy 610 is coupled to the nu , while standard ethernet phy 620 is coupled to the wan port of the cpe . conversion device 600 can also include buffering and / or control logic 630 in between broad reach ethernet phy 610 and standard ethernet phy 620 . in one embodiment , conversion device can also include internal port 640 for management purposes . in one embodiment , the conversion device can be used to abstract the voip cpe from knowing the particular type of physical wan connection . the voip cpe can therefore be designed with a standard ethernet wan port , while relying on the conversion device to meet the particular application need . thus , the voip cpe having a standard ethernet wan port can be coupled to a conversion device that converts standard dsl , ethernet - based dsl ( e . g ., 2base - tl and 10pass - ts ), etc . to a standard ethernet connection . these and other aspects of the present invention will become apparent to those skilled in the art by a review of the preceding detailed description . although a number of salient features of the present invention have been described above , the invention is capable of other embodiments and of being practiced and carried out in various ways that would be apparent to one of ordinary skill in the art after reading the disclosed invention , therefore the above description should not be considered to be exclusive of these other embodiments . also , it is to be understood that the phraseology and terminology employed herein are for the purposes of description and should not be regarded as limiting .
7
embodiments of the invention relate to methods and systems for correcting borehole effects in induction tools having transverse or triaxial antennas . methods of the invention are applicable to both induction tools and propagation tools . because the distinction between an induction tool and a propagation tool is not germane to this invention , the term “ induction tool ” is used in this description to include both the induction and propagation tools . similarly , borehole effects and tool eccentering effects ( or eccentricity effects ) are used interchangeably in this description because the distinction between them is not germane . one of ordinary skill would appreciate that conductivity is an inverse of the resistivity , and , therefore , any reference to “ conductivity ” in this description is intended to include its inverse , the “ resistivity ,” and vice versa . as noted above , induction arrays with magnetic moments perpendicular ( i . e ., transverse ) to the axis of the borehole are more sensitive to the borehole effects . in addition , the sensitivity of a transverse coil to eccentricity is very different depending on whether the eccentricity is in the direction of the magnetic moment or perpendicular to the magnetic moment . in this description , a transverse array is used in a broad sense to include any array having a transverse component in its magnetic moment . for example , an array having a tilted coil ( i . e ., a coil not parallel or perpendicular to the axis of the tool ) will have a transverse component in its magnetic moment and , therefore , may be referred to as a transverse array in this description . similarly , a triaxial array is a subset of a transverse array . fig1 a illustrates that a logging tool may have its transverse or tilted magnetic dipole ( tmd ) antenna located at the center ( shown as 20 ) of the borehole 13 or eccentered in a parallel direction ( shown as 22 ) or a perpendicular direction ( shown as 21 ). the parallel or perpendicular direction is with respect to the direction of the magnetic dipole of the antenna . parallel eccentering 22 produces eddy currents up and down the borehole . however , due to the symmetry , no net current flows up or down the borehole . thus , a tool having its tmd antenna eccentered in the parallel direction 22 does not produce undesired effects more than a tool having its tmd antenna perfectly at the center of the borehole 20 does . in contrast , a tool having its tmd antenna eccentered in the perpendicular direction 21 induces eddy currents to flow up and down the borehole , but without the symmetry to cancel out the up and down currents . as a result , perpendicular eccentering 21 gives rise to significant borehole currents 23 , as shown in fig1 b . the current flow in the formation is also asymmetric in this case . the asymmetric current distribution produces a strong signal in a receiver 24 disposed on the resistivity instrument 10 . the perpendicular eccentering 21 and parallel eccentering 22 shown in fig1 a illustrate the extremes of tool displacements from the center of the borehole 20 . in a typical case , the eccentering would likely lie between these two extremes , i . e ., eccentering in a direction that is a combination of both the x and y directions . fig2 shows that the eccentricity effects of an induction tool . the curves shown are for a tool having an insulating sleeve disposed in a 7 . 9 ″ diameter borehole . the conductivity of the mud ( σ m ) is 5 . 1 s / m and the conductivity of the formation ( σ f ) is 0 . 061 s / m . as shown , curve xx represents eccentering of the tool in the x - direction ( the direction of the magnetic moment ). this situation is shown as 22 in fig1 a . as noted above , eccentering in the direction parallel with the direction of the magnetic moment produces minimal borehole effects , thus , curve xx is essentially flat as a function of the eccentricity . in contrast , curve yy , which depicts eccentering in the direction perpendicular to the direction of the magnetic moment ( shown as 21 in fig1 a ), is very sensitive to the eccentering distances . as shown in fig2 , the eccentering effects in the direction perpendicular to the direction of the magnetic moment of the coil ( curve yy ) can be up to two orders of magnitude stronger than that in the direction parallel with the magnetic moment ( curve xx ). the unusual sensitivity to the eccentricity in the direction perpendicular to the magnetic moment can be reduced by inclusion of a conductive member in the insulating sleeve , as disclosed in u . s . pat . no . 6 , 573 , 722 issued to rosthal , et al . however , inclusion of a conductive member in the insulating sleeve does not completely eliminate the differential effects . as shown in fig3 , the eccentric effects in the direction perpendicular to the direction of the magnetic moment ( curve yy ) are still more significant than the eccentricity effects in the direction parallel with the direction of the magnetic moment ( curve xx ), although they are on the same order of magnitude . the curves shown in fig3 are for a tool having a conductive mandrel disposed in a 7 . 9 ″ diameter borehole . the conductivity of the mud ( σ m ) is 5 . 1 s / m and the conductivity of the formation ( σ f ) is 0 . 061 s / m . the most common arrangement for an induction tool having transverse coils is a fully triaxial array , as shown in fig4 . fig4 shows that the triaxial array consists of a triad of transmitters mounted orthogonally and a triad of receivers at a spacing l m mounted in substantially the same orthogonal directions as the transmitter coils . in fig4 , the triad transmitters are shown as having magnetic moments , m x t , m y t , m z t , while the triad receivers are shown as having magnetic moments , m x m , m y m , m z m . such an arrangement is called a two - triad array . such an array is not useful in an actual logging operation because the direct couplings between the i - th transmitter and the i - th receiver ( i = 1 , 2 , 3 ) are much larger than any signal from the formation . the adverse effects from the mutual couplings can be mitigated , in a way similar to a conventional axial induction array , by mounting a triad of orthogonal receivers between the main receiver triad and the transmitter triad . this additional triad is referred to as a balancing triad ( or a bucking triad ). in fig4 , the balancing triad is shown at a distance l b from the transmitter triad , as having magnetic moments the number of turns in each coil of a balancing triad is adjusted so that , in air , the sum of the voltages detected by the main and balancing triads is zero . that is , is the voltage induced in the i - th main receiver by the i - th transmitter , and is the voltage induced on the i - th balancing receiver by the same i - th transmitter . the array shown in fig4 produces nine couplings . the voltages can be considered as a matrix v : v = [ v xx v xy v xz v yx v yy v yz v zx v zy v zz ] , ( 3 ) where v ij is the voltage detected by the i - th receiver from energizing the i - th transmitter . depending on the directions of eccentricity , each or some of these couplings may have associated eccentricity effects ( borehole effects ) that would need to be corrected . as an example , fig5 shows the eccentricity effects of the xz , zx , yz , and zy couplings . the curves shown are for a tool having a conductive sonde body , disposed in a 7 . 9 ″ diameter borehole , and eccentered in the x direction . the conductivity of the mud ( σ m ) is 5 . 1 s / m and the conductivity of the formation ( σ f ) is 0 . 061 s / m . when the tool is displaced along the x direction in a circular cylindrical borehole , there are only five non - zero couplings , i . e ., the matrix v has the form among the four couplings shown in fig5 , only xz and zx couplings are influenced by the borehole effects , because yz and zy couplings produce substantially zero signals , as illustrated in equation ( 4 ). on the other hand , if the eccentering is in the y direction , then the yz and zy couplings will have substantial borehole effects , while xz and zx couplings will have no borehole effects . in practice , the tool is likely eccentered in a direction that is a combination of the x and y directions . therefore , these four couplings are likely all influenced by the borehole effects . the relative magnitudes of the borehole effects among these four couplings depend on the actual eccentering direction . therefore , it should be possible to derive the eccentering direction of the tool from the borehole effects in these four couplings . a method for deriving the eccentering direction from these measurements will be described later . in addition , these couplings may be included in an inversion process to enable more sensitive determination of the eccentering direction . the borehole / eccentricity effect of each coupling of a triaxial array can be described as a parametric model in a similar manner to the axial coils described above . however , the model for the triaxial arrays will have additional parameters . first , because the borehole effects depend on the direction of tool eccentering , the model should include the standoff and its direction relative to the tool x - axis ( or y - axis ). in addition , the transverse arrays are sensitive to formation anisotropy . therefore , according to some embodiments of the invention , the formation conductivity in the model may include anisotropic components . in this case , the formation - borehole model for calibrating a triaxial array includes six parameters : □ m , □ fh , □ fh , r , s , and the eccentering direction □. a formation - bore - hole model including these six parameters are illustrated in fig6 . one of ordinary skill in the art would appreciate that a formation model for use in the calibration of a triaxial array may include more or less than six parameters . for example , a formation - borehole model for calibrating a triaxial array may further include dipping angles , if the formation includes dipping planes or the borehole is a deviated hole . similarly , the formation - borehole model for calibrating a triaxial array may include five parameters : □ m , □ f , r , s , and the eccentering direction □— if the formation is isotropic . a preferred triaxial induction tool my include a triaxial transmitter , several axial receiver arrays , and at least one triaxial receiver array . for example , fig7 illustrates one embodiment of a triaxial induction tool having a triaxial transmitter , 3 axial receiver arrays , and 6 triaxial receiver arrays . the data from each of the 3 axial arrays include the following couplings : each of the triaxial arrays on a tool shown in fig7 has 9 couplings as shown in equation ( 6 ). each or some of these couplings may include borehole / eccentering effects , which would need to be removed before deriving formation resistivity from these measurements . as noted above , a method for correcting borehole effects for an axial array is disclosed in u . s . pat . no . 5 , 041 , 975 issued to minerbo and miles . this patent is assigned to the assignee of the present invention and is incorporated by reference in its entirety . according to the method disclosed in this patent , a formation model includes four parameters : mud conductivity (□ m ), borehole radius ( r ), standoff distance ( s ), and the formation conductivity (□ f ). often , the mud conductivity (□ m ) and the standoff ( s ) are known . according to a method disclosed in this patent , measurements from the four shortest arrays are used in an inversion process to derive the parameters of the formation model . if this method is extended to a triaxial tool shown in fig7 , data from the 4 shortest arrays may be used to solve for borehole parameters . alternatively , data from other couplings may be selected for inclusion in the computation based on desired properties . for example , the xz and yz couplings are quite directional , and , therefore , their inclusion in an inversion scheme can provide useful information for determining the direction of eccentering (□). a method for determining the direction of eccentering (□) will be described later . similarly , the xx and yy couplings have good sensitivity to the vertical conductivity (□ fv ) and , therefore , they may be included in the inversion to provide a better estimate of the vertical conductivity (□ fv ). fig8 shows a method 80 in accordance with one embodiment of the invention . first , a formation - borehole model ( e . g ., that shown in fig6 ) is selected and the initial estimates of the parameters are determined ( step 81 ). some of the parameters may be known from other measurements . for example , the mud conductivity (□ m ) may be obtained from a mud sensor , and the borehole radius ( r ) may be obtained from caliper measurements . the method then computes array responses in the selected formation - borehole model ( step 82 ). the computation may be a direct solution of maxwell &# 39 ; s equations in this model , or it may be a table built from such a solution . a table would be built to include a sufficient range of all 6 parameters . in addition , interpolation techniques , such as the akima interpolation , may be used to estimate responses that fall between discrete parameter values . reference is made to the paper by hiroshi akima : “ bivariate interpolation and smooth surface fitting based on local procedures ,” ( algorithm 474 ), commun . acm 17 ( 1 ): 26 - 31 ( 1974 ). an inversion technique is then used to compare and match the computed results with the experimental results ( step 83 ). this step may use any inversion technique known in the art . the inversion finds a match between the computed responses and the actual tool responses by looking for parameters in the formation - borehole model that produce a minimum in the penalty function e t or reduce the penalty function e t below a selected criterion (∈). various penalty functions may be used for this purpose . equation ( 7 ) shows a least square penalty function that may be used with embodiments of the invention . e t ⁡ ( σ fh _ , σ fv _ ) = ∑ j = 1 4 ⁢ ∑ i = 1 n ⁢  σ meas ij - σ model ij ⁡ ( σ m , σ fh _ , σ fv _ , r , α , s )  2 ɛ ij , ( 7 ) where e t is the triaxial penalty function , □ m is the borehole ( mud ) conductivity ; □ fv and □ fh are the vertical and horizontal conductivities of the formation , respectively ; r is the borehole radius ; s is the standoff ; n is the eccentering direction relative to the tool coordinate system ; □ is the index for the directional couplings ; and j is the index for the arrays . e ij is the weight appropriate for each coupling . n is either 3 or 9 , depending on whether the receiver is axial or triaxial . note that the penalty function e t in equation ( 7 ) sums over 4 arrays ( j = 1 - 4 ), because data from 4 shortest arrays are used . one of ordinary skill in the art would appreciate that the precise number of summation depends on the measurement data used . as noted above , the hole size ( i . e ., borehole radius , r ) and borehole ( mud ) conductivity (□ m ) can be measured independently . for example , the borehole radius ( r ) may be determined using a caliper and the mud conductivity (□ m ) determined with a mud resistivity sensor . the other four variables (□ fh , □ fh , s , and □) can then be determined using the inversion technique and the data from the 4 shortest arrays . the inversion process optimizes the parameters to produce a minimum penalty function e t or to produce a penalty function e t below a selected criterion (∈). the optimization process ( step 87 ) is iterative : if the penalty function e t is not below the selected criterion ∈, then the parameters are adjusted ( step 84 ); the responses of the forward model is re - computed ( step 82 ); and the computed responses are compared with the determined responses ( step 83 ). these steps ( 84 , 82 , 83 ) are repeated until the penalty function e t is at a minimum or is below the selected criterion ∈. once the penalty function e t is at a minimum or is below the selected criterion ∈, then the estimated ( optimized ) parameters may be output and used to correct borehole effects in other arrays ( step 85 ). specifically , the optimized borehole parameters are used to compute borehole effects ( in terms of conductivity ) for each coupling in the remaining arrays . then , the borehole effects are subtracted from the actual measurements ( or conductivity derived from these measurements ) from each of these couplings / arrays to yield the corrected measurements ( or conductivities ). these optimized parameters may also be used to compute other parameters , such as tool standoffs in the x and y directions ( step 86 ). fig8 illustrates a method in accordance with one embodiment of the invention . one of ordinary skill in the art would appreciate that modifications of this method are possible without departing from the scope of the invention . for example , other penalty functions may be used . in addition , more or fewer parameters may be determined from other measurements and used in the computation described above . for example , the direction ( angle α ) of tool eccentering may be determined from the measurement data , which will be described later , and used in the computation to reduce the number of parameters to be estimated from the inversion . application of a method ( shown in fig8 ) in accordance with one embodiment of the invention is illustrated in fig9 . this example is based on an isotropic formation , i . e ., □ fv =□ fh . the graphs shown are receiver responses for a series of formation - borehole models with varying □ fh and □ m . fig9 a shows the expected homogeneous formation responses of an array in a 5 . 0 inch borehole . the tool standoff is 0 . 125 inch and the direction of the eccentering is 67 . 5 ° from the x - direction . fig9 b shows actual tool responses of this array in the borehole under the same conditions . a comparison between fig9 a and fig9 b shows that borehole effects are quite significant when the mud is conductive . fig9 c shows the corrected tool responses obtained by correcting the borehole effects in the responses shown in fig9 b . the borehole effect correction was performed using a method similar to that shown in fig8 , except that the formation model is isotropic (□ fv =□ fh ). the corrected data shown in fig9 c is substantially the same as the expected responses for the homogeneous formation shown in fig9 a , attesting to the effectiveness of the borehole effect correction in accordance with embodiments of the invention . as noted above , the tool eccentering angle α may be independently determined , leaving only three unknowns to be determined in equation ( 7 ). the direction of the displacement of the tool in the borehole can be determined from the measured triaxial data as follows . the matrix of voltages in equation ( 3 ) can be converted into apparent conductivities : σ _ _ appt = [ σ xx σ xy σ xz σ yx σ yy σ yz σ zx σ zy σ zz ] ( 8 ) by dividing the voltages v ij with the sensitivity factors k ij , i . e ., the diagonal sensitivity factors k xx , k yy , k zz are chosen so that , in a homogeneous isotropic medium with a low conductivity , the diagonal conductivities □ xx =□ yy =□ zz =□ hom , where □ hom is the conductivity of the homogeneous formation , i . e ., similarly , the off - diagonal sensitivity factors may be chosen to simplify rotation transformations , for example , k yx = k xy and k xx = k yy . for the special case of a rotation around the z axis , the rotation matrix is r = [ cos ⁢ ⁢ ϕ - sin ⁢ ⁢ ϕ 0 sin ⁢ ⁢ ϕ cos ⁢ ⁢ ϕ 0 0 0 1 ] ( 10 ) where □ is the rotation angle . the effect of this rotation on the apparent conductivity matrix may be written as : when the tool is eccentered in the x direction in a circular borehole , the apparent conductivity matrix has five non - zero components that can be computed by modeling : estimates of the angle □ can be obtained by comparing the matrix of measurements from each triaxial receiver pair to the theoretical matrix in equation ( 13 ). for example , comparison between □ xz and □ yz gives : note that measured conductivity components are used in equations ( 14 - 15 ). other estimates can be obtained from □ xx , □ xy , □ yx , and □ yy , in a similar fashion : ϕ = arctan ⁢ { σ xx - σ yy ± ( σ xz - σ yy ) 2 + 4 ⁢ σ xy ⁢ σ yz 2 ⁢ σ xy } , ( 16 ) equations ( 16 ) and ( 17 ) give four angles , but only two of these are physically distinct . note that □ in equations ( 10 , 13 - 17 ) is the same as □ in fig . ( 6 ). to take into account data from several triaxial receiver pairs , a least squares minimization may be performed on all □ ι values obtained in equations ( 14 - 17 ) to determine the angle □. after the angle □ is determined , the borehole corrections may then be applied to the data using the computed values in equation ( 12 ). the corrected matrix of apparent conductivities is then rotated back to the original tool coordinates , as follows : some embodiments of the invention relate to systems for performing the above - described methods for correcting borehole effects in triaxial arrays . a system in accordance with embodiments of the invention may be implemented on a stand alone computer or a downhole computer that is included on a tool . fig1 shows a general purpose computer that may be used with embodiments of the invention . as shown in fig1 , a general computer system may include a main unit 160 , a display 162 and input devices such as a keyboard 168 and a mouse . the main unit 160 may include a central processor unit 164 , a permanent memory ( e . g ., a hard disk ) 163 and a random access memory 166 . the memory 163 may include a program that includes instructions for performing the methods of the invention . a program may be embodied on any computer retrievable medium , such as a hard disk , a diskette , a cd - rom , or any other medium known or yet to be developed . the programming may be accomplished with any programming language and the instructions may be in a form of a source codes that may need compilation before the computer can execute the instructions or in a compiled ( binary ) or semi - compiled codes . the precise form and medium the program is on are not germane to the invention and should not limit the scope of the invention . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims .
6
the following definitions may help illuminate the topics of discussion that follow . pivot candidate : a single record that has the potential to be a selected pivot . this is a new term proposed by the author and is specific to this invention . in relation to quick sort &# 39 ; s median - of - three pivot selection routine , the three records that are compared to find a median could easily be termed pivot candidates , but no such distinction has been coined to the best of my knowledge . pivot or selected pivot : a special pivot candidate that has been selected to be a key in the partitioning phase . all figures and embodiments listed in this document concentrate on isolating pivot candidates at the end of the list for continuity and flow . this does not mean that the invention can not be implemented by placing candidates at the front of the list and partitioning around the later pivots first . also , the pseudocode used in the preferred embodiments section is meant as a guide for programmers and not as the absolute end algorithm . among the topics not covered in the presented pseudocode include building a min heap and a reverse max heap , handling skewed pivot lists with random generation of the number of pivots , and adjusting the pivotsort declaration to include a number of pivots parameter . however , all of these optimizations are detailed in the sections that follow . to sort a list of records , pivot sort first selects pivot candidates from the population . according to statistical theory , these candidates should be sampled at strategic locations in the population ( ie equidistant from each other in the array or equidistant pairs in the array ), but pivot sort will also work with contiguous candidate selection ( ie taking all pivot candidates from the front or rear of the list of records in a known random population .) after a selection policy is in place , pivot sort sorts this small list of pivot candidates with another sorting algorithm , one which has less overhead and works well on small lists . in theory , insertion sort is an excellent algorithm for sorting this small list of pivot candidates , but because of inherent flaws in the insertion sort algorithm , the size of the list of pivot candidates should not exceed 15 and should be an odd number . this forces pivot sort to use anywhere from two to seven pivots for effective and efficient partitioning . from extensive testing , five pivots have been shown to work most effectively . after the list of pivot candidates has been sorted with an algorithm like insertion sort , pivots are selected from the pivot candidate list by selecting the 2 nd element and every two elements after . because we are using odd numbers of candidates , this pivot selection method results in selecting pivots at locations that are guaranteed to have records between the pivots . this ideal is probabilistically sound and results in reliable partitioning by expanding on ideals of the median - of - three method commonly used in quick sort implementations . pivot sort is in many ways better than quick sort because it takes a larger sample size than quick sort which gives a much better chance of partitioning on a median value . if a list of pivot candidates is selected from equidistant locations in the list of records and pivots are selected as outlined earlier , the pivoting process is likely to produce better partitions . even though both m pivot sort and quick sort are based on the same partitioning principle that does not necessarily mean that they have the same optimal conditions . the odds that m pivot sort will partition the list identically to an optimal quick sort implementation are slim . m pivot sort &# 39 ; s optimal situation is either this one ( where performance is nearly identical to quick sort and the list is partitioned in halves for each pivot selected ) or a near perfect snapshot of the list is taken with the selection of pivot candidates . the latter results in m pivot sort dividing the list into equal length partitions and is the ideal situation , resulting in less recursion and less overall work , especially in data moves . the list is partitioned similarly to the method used in quick sort but around each of the pivots selected from the sorted list of candidates . in an ascending sort , all comparatively smaller records will be placed before the pivot and larger records will be placed after . however , unlike quick sort , pivot sort can handle duplicates by comparing pivots to each other . if two pivots are equal , then not only are those two pivots equal , but the pivot candidate that existed between them is equal . instead of wasting comparisons for comparatively smaller records , pivot sort searches the list for equal records and places them between the previous pivot and current pivot . no recursion needs be done on the final partition between the equal pivots . on lists with large numbers of duplicates , pivot sort becomes an o ( n ) sorting algorithm , and the overhead of comparing pivots for equality is negligible . after the partitioning process is complete , pivot sort is called recursively on those partitions that are not already sorted , resulting in a sorted list . of note , because pivot sort performs more partitions per level , pivot sort performs less recursion than quick sort or merge sort — two industry standard comparison - based sorting algorithms . this results in a sorting algorithm with better memory management and a system that does not use as much stack space on function calls . also , pivot sort can be tweaked to randomize the number of pivots ( preferably between 3 and 7 because of the limits of insertion sort ) if a worst case partition occurs , ie when a partition is skewed to one side ( way more elements on the left than on the right .) consequently , pivot sort is able to detect runtime problems , correct them , and proceed with partitioning . m pivot sort may be used in contiguous or queued schemes . as noted in the introduction , this pseudocode is meant as a guide to those who wish to implement aspects of this patent . the preferred embodiments listed here are not the only ways of implementing this algorithm , and this section is not intended to be complete and exhaustive . referring to claim 1 , a preferred embodiment is the following : pivotsort ( a , first , last ) 1 . create array p [ 0 .. m − 1 ] 2 . if first & lt ; last and first & gt ;= 0 3 . then if first & lt ; last − 13 4 . then choosepivots ( a , first , last , p ) 5 . insertionsort ( a , p [ 0 ]− 1 , last ) 6 . nextstart first 7 . for i 0 to m − 1 8 . do curpivot p [ i ] 9 . nextgreater nextstart 10 . nextgreater partition ( a , nextstart , nextgreater , curpivot ) 11 . exchange a [ nextgreater ] a [ curpivot ] 12 . exchange a [ nextgreater + 1 ] a [ curpivot + 1 ] 13 . if nextstart == first and p [ i ] & gt ; nextstart + 1 14 . then pivotsort ( a , nextstart , p [ i ]− 1 ) 15 . if nextstart != first and p [ i ] & gt ; p [ i − 1 ]+ 2 16 . then pivotsort ( a , p [ i − 1 ]+ 1 , p [ i ]+ 1 ) 17 . nextstart nextgreater + 2 18 . if last & gt ; p [ m − 1 ]+ 1 19 . then pivotsort ( a , p [ m − 1 ]+ 1 , last ) 20 . else insertionsort ( a , first , last ) referring to claim 3 and including the algorithm highlighted in claim 1 , the preferred embodiment is the following : pivotsort ( a , first , last ) 1 . create array p [ 0 .. m − 1 ] 2 . if first & lt ; last and first & gt ;= 0 3 . then if first & lt ; last − 13 4 . then choosepivots ( a , first , last , p ) 5 . insertionsort ( a , p [ 0 ]− 1 , last ) 6 . nextstart first 7 . for i 0 to m − 1 8 . do curpivot p [ i ] 9 nextgreater nextstart 10 . if nextstart != first and a [ p [ i − 1 ]] == a [ p [ i ]] 11 . then nextgreater pivotequalsleft ( a , nextstart , nextgreater , curpivot ) 12 . while i & lt ; m and a [ p [ i − 1 ] == a [ p [ i ]] 13 . do exchange a [ nextgreater ] a [ curpivot ] 14 . exchange a [ nextgreater + 1 ] a [ curpivot + 1 ] 15 . p [ i ] nextgreater 16 . nextstart nextgreater + 2 17 . i i + 1 18 . curpivot p [ i ] 19 . nextgreater nextstart 20 . i i − 1 21 . else 22 . then nextgreater pivotsmallerleft ( a , nextstart , nextgreater , curpivot ) 23 . p [ i ] nextgreater 24 . nextstart nextgreater + 2 25 . if nextstart == first and p [ i ] & gt ; nextstart + 1 26 . then pivotsort ( a , nextstart , p [ i ]− 1 ) 27 . if nextstart != first and p [ i ] & gt ; p [ i − 1 ]+ 2 28 . then pivotsort ( a , p [ i − 1 ]+ 1 , p [ i ]+ 1 ) 29 . nextstart nextgreater + 2 30 . if last & gt ; p [ m − 1 ]+ 1 31 . then pivotsort ( a , p [ m − 1 ]+ 1 , last ) 32 . else insertionsort ( a , first , last ) claim 2 can be implemented in many forms . however , checking for the conditions necessary to call on such a correction method is easy to describe . during the partition phase , code must be written that checks where the pivots end up . although a thorough system of checks may seem attractive , it is discouraged because it is unnecessary . instead , a check should only be made after the pivots reach their final destinations , and pivotsort should not be called recursively on the sorted partitions until after the check has been made . the latter means that instead of the above code which combines the partition and recursive calls to pivotsort , the partitioning phase would be clearly delineated between the following steps : 2 . check for a skewed pivot list . the worst case will be the last selected pivot ending up close to the front of the list ( say in the first quarter of the list ). a less dire worst case will be the first selected pivot ending up close to the end of the list , but in this case with 5 pivots used , at least 10 elements have been sorted on this level while only really requiring the work done on the first selected pivot . still , this is a worst case and o ( n 2 ) behavior , though a fraction of the worst case of algorithms like insertion sort , quick sort , bubble sort , etc . 3 . if the pivot list is not skewed , just partition the list . no problems have been encountered . however , if the list is skewed , either build a min heap and reverse max heap or either one of the two , or more preferably , change the number of pivots for the next level of partitioning . this is the easiest and best way to change the sampling and correct run time performance . if the number of pivots was five and now it is three , the algorithm is selecting pivot candidates from completely different areas of the list with no real overhead ( one random number generated with a modulus of the maximum number of pivots allowed , which is determined by the method used to sort the list of pivot candidates .) this is a sure way to beat any pattern that might have resulted in a worst case for the pivot sort algorithm , and in practice , results in an algorithm that does not go into exponential time .
6
the present invention will now be described in further detail in the following examples : in this example , surface treatment was carried out using the dc plasma nitriding apparatus shown in fig1 . this apparatus comprises a sealed vessel 10 , a vacuum system 12 with a rotary pump ( not shown ), a dc power supply and control unit 14 , a gas supply system 16 , a temperature measurement and control system 18 , and a work table 20 for supporting articles 22 to be treated . in this example , the articles to be treated were 316 type austenitic stainless steel discs 25 mm in diameter and 8 mm in thickness . the discs to be treated were placed on the table 20 inside the vessel 10 . the table 20 was connected as a cathode to the unit 14 , and the wall of the vessel 10 was connected to the dc source as the anode . the temperature of the discs 22 was measured by a thermocouple 24 inserted into a hole of 3 mm diameter drilled in one of the discs 22 or a dummy sample . after the sealed vessel 10 was tightly closed , the rotary pump was used to remove the residual air and thus reduce the pressure in the vessel . when the reduction in pressure reached 10 pa ( 0 . 1 mbar ) or below , a glow discharge was introduced between the article 22 . ( cathode ) and the vessel wall ( anode ) by applying a voltage of 400 volts to 900 volts between these two electrodes . a heating gas of hydrogen was at the same time introduced into the vessel 10 . the pressure of the hydrogen gas in the vessel 10 was increased gradually as the temperature of the articles 22 increased . no external or auxiliary heating was employed , and the articles 22 were heated by the glow discharge only . after the articles 22 were heated up to the prescribed temperature , a gas mixture of hydrogen and methane was introduced into the vessel 10 and the treatment step started . no additional sputter cleaning step was used in this example . treatment temperatures from 350 ° c . to 600 ° c . were employed for treatment times from 3 hours to 20 hours . the working pressure in the treatment step was 500 pa ( 5 . 0 mbar ) for all the experiments in this example . after the completion of the treatment step , the glow discharge was turned off and the articles 22 were allowed to cool in the vessel 10 in the treatment atmosphere down to room temperature before they were removed from the vessel . then , the articles 22 were subjected to x - ray diffraction analysis for phase identification , glow discharge spectrometry ( gds ) analysis for chemical composition determination , surface hardness measurements and metallography analysis of the cross section for thickness measurements and hardness profile measurements . the results are shown in table 1 and fig2 to 5 . it is thus confirmed that surface treatment at temperatures between 300 ° c . and 600 ° c . can produce a “ white ” ( corrosion resistant ) layer on 316type austenitic stainless steel . the layer is enriched with carbon , has a high surface hardness and a diffuse - type hardness profile , and comprises an expanded austenite with a possible nanocrystalline / amorphous structure . indentation , scratch and simple bending tests were conducted to assess the ductility and bonding strength of the hardened surface layer . no cracks or debonding of this layer were observed during these tests and the hardened layer was found to deform with the substrate , thus confirming that the layer has good ductility . the surface treatment conditions in example 2 were similar to those in example 1 . in example 2 , in addition to 316 steel , discs formed of other grades of austenitic stainless steel were used as articles to be treated . accordingly , discs of 25 mm in diameter and 8 mm in thickness were prepared from 304 , 321 and 316 austenitic stainless steels . following the process procedures outlined in example 1 , the articles were treated at 440 ° c . and 520 ° c . for 12 hours . after the treatment , the articles were analysed using the techniques outlined in example 1 . it was confirmed that hardened layer of expanded austenite enriched with carbon can be formed in all types of austenitic stainless steel . table 2 summarises the thickness and surface hardness values of the layers formed . discs formed of 316 type austenitic stainless steel were used as the articles to be treated in this example . two sets experiments were performed which were different from those in example 1 . firstly , various heating gases and gas mixtures were used in the heating step . these included hydrogen , argon , a mixture of hydrogen and argon and a mixture of hydrogen and methane . secondly , various carbon - containing treatment atmospheres were used in the treatment step , and these included a mixture of hydrogen and methane , a mixture of hydrogen , argon and methane , and a mixture of hydrogen and carbon dioxide ( co 2 ). following the process procedure outlined in example 1 , the articles were treated in these heating gases and treatment atmospheres at 500 ° c . for 3 hours . the obtained results are shown in table 3 in terms of layer thickness and surface hardness . it can be seen that a hardened layer can be formed in various combinations of heating gases and treatment atmospheres . in example 4 , the process conditions were similar to those used in example 1 , except that nitrogen gas was added to the treatment atmosphere in the treatment step . discs of 316type austenitic stainless steel were used as the articles to be treated in example 4 . the articles were treated at 450 ° and 500 ° c . for 3 hours . two levels of nitrogen gas were introduced to the treatment atmosphere , i . e . 2 . 0 % at 450 ° c . and 5 % at 500 ° c . the treated articles were analysed using the techniques used in example 1 . table 4 shows the thickness and hardness values of the layers produced . it was confirmed that the addition of nitrogen to the treatment atmosphere can also result in a thick and hard layer , which also appears “ white ” after etching . gds composition profile analysis revealed that both carbon and nitrogen were incorporated in the layer . in example 5 , wear testing and corrosion testing specimens made from 316 - type austenitic stainless steel were treated under conditions similar to those used in example 1 . table 5 lists the treatment conditions used and the resultant layer thickness . were testing was carried out using a pin - on - disc machine under unlubricated pure sliding conditions . a hardened bearing steel ball of 5 mm in diameter was used as the slider ( pin ). three different normal loads were used for the tests . the results are given in fig6 . which shows that surface treatment under a variety of different conditions can significantly improve the sliding wear resistance of the austenitic stainless steel by up to 20 times under the present testing conditions . in addition , the treated specimens showed a stable friction coefficient of 0 . 73 , whilst the untreated specimen showed a large scatter in friction coefficient which averaged 0 . 80 . corrosion testing was carried out using the electrochemical testing technique in 3 . 5 % sodium chloride ( nacl ) and 0 . 05 m na 2 so 4 solutions . the test results are presented in fig7 and 8 . for comparison purpose , the untreated article was also tested . it can be seen that , in the na 2 so 4 solution , both untreated and treated articles showed excellent corrosion resistance ; no significant difference in corrosion current density was observed between different samples ; however , the treated samples exhibited a shift of the corrosion potential towards the positive ( passive ) side , indicating improvement in corrosion behaviour . in the nacl solution , the treated articles showed a much improved corrosion behaviour , particularly pitting resistance . the untreated article was subjected to pitting corrosion when the potential reached 0 . 4 v / sce or above , resulting in a dramatic increase in current density . in the treated articles , no pitting has been observed even after testing up to 1 . 5 v / sce , indicating an improvement in pitting potential for at least 4 times . in this solution , the treated article exhibited a general corrosion behaviour , ie . the corrosion rate increases slowly with increasing potential . further corrosion testing was performed on the article treated at 500 ° c . for 5 hours after the surface hardened layer had been completely removed by grinding , with the purpose to assess the effect of surface treatment on the corrosion behaviour of the substrate . tests performed in both nacl and na 2 so 4 solutions indicated that the treatment has negligible influence on the corrosion behaviour of the substrate .
2
referring now to the drawings by reference characters , there is shown a pallet 7 having a load of boxes 9 thereon . the boxes 9 have a rectangular configuration and have been stacked to fit the pallet 7 . in accordance with the present invention , four corner elements , generally designated 11 , 13 , 15 , and 17 , are placed at the four corners of the loaded pallet and a flexible strap 19 is employed to hold the cornerboards together and maintain the pallet load in a desired configuration . although only a single strap 19 has been shown , in many instances two or even more straps might be used around the load . since each of the cornerboards is identical , only one will be described in detail . referring specifically to fig2 through 4 , each of the cornerboards consists of an upper section , generally designated 21 , and a lower section , generally designated 23 . the upper section is formed , preferably by bending , of a steel sheet so that one has the walls 25 and 27 held at substantially right angles to each other . preferably , a top cap 29 is provided which may be stamped of steel and welded onto the upper section 21 . each of the walls 25 and 27 has a series of tongues , generally designated 31 , formed at regular intervals along the wall . each of the tongues consists of a generally horizontal section 33 and a downwardly - extending tip 35 . the tip 35 is formed generally parallel to the wall 27 and the space between the tip 35 and an imaginary continuation of the wall 27 is slightly greater than the thickness of the wall 27 , assuming that both the upper and lower sections are made of the same gage of steel . the bottom section 23 is of the same general configuration , having the walls 37 and 39 and a bottom plate 41 of the same general configuration as the top plate 29 . the bottom section 23 is provided with a plurality of holes 43 , corresponding in placement and separation to the tongues 31 . in use , it is only necessary to place the two sections in proximity to each other and to bring the upper section into contact with the lower so that the tongues 31 extend through the holes 43 . now , if one pushes downwardly slightly on the upper member , the tongues will lock into place on the bottom section as is clearly shown in fig3 of the drawings . in the foregoing description , it has been assumed that the upper and lower sections would be fabricated in such a way that a considerable range of adjustment would be possible . in some instances , the cornerboards might be fabricated to fit a certain specific load in which case the large range of adjustment would not be necessary . in fact , in its simplest form , the top member might have a single pair of tongues set at right angles thereto while the bottom section might have only a single pair of mating slots for the reception of the tongues . however , it is preferred that a plurality of tongues be formed between each of the metal sections , both from the standpoint of increased strength when more than one set of tongues is used to lock the structure and also because of the desirability of providing the adjustable feature . many variations can be made in the exact structure shown without departing from the spirit of this invention .
1
fig6 to fig9 are schematic , cross - sectional diagrams showing a method for fabricating a solder pad structure on a circuit board in accordance with one preferred embodiment of this invention . first , as shown in fig6 , a surface wiring structure 10 a is provided on the surface of the circuit board 10 . the surface wiring structure 10 a may include but not limited to a plurality of copper pad structure 20 and fine traces 30 . it is to be understood that the circuit board 10 may be a single wiring layer circuit board , double wiring layer circuit board or multiple wiring layer circuit board . for the sake of simplicity , the conductive via holes or other inner layer interconnection inside the circuit board 10 are not shown in the figures . after the formation of the surface wiring structure 10 a , a non - conductive material layer 120 is coated on the surface of the circuit board 10 . the non - conductive material layer 120 comprises a dielectric matrix and laser - activable catalytic particles . the catalytic particles are evenly dispersed in the dielectric matrix . the aforesaid catalytic particles may be activated by laser energy and a conductive layer may be selectively deposited on the laser - activated traces on the non - conductive material layer 120 . according to the preferred embodiment of this invention , the dielectric matrix comprises polymer material such as epoxy resins , modified epoxy resins , polyesters , acrylate , fluoro - containing polymer , ( ppo ) polyphenylene oxide ( ppo ), polyimide , phenolic resins , polysulfone ( psf ), si - containing polymer , bt resins , polycyanate , polyethylene , polycarbonate , acrylonitrile - butadiene - styrene copolymer , polyethylene terephthalate ( pet ), polybutylene terephthalate ( pbt ), liquid crystal polymers ( lcp ), polyamide ( pa ), nylon 6 , nylonpolyoxymethylene ( pom )· polyphenylene sulfide ( pps ), coc or a combination thereof . according to the preferred embodiment of this invention , the catalytic particles described above may be nano - particles of metals or metal coordination compounds . for example , suitable metal coordination compounds may include metal oxides , metal nitrides , metal complexes and / or metal chelating compounds . in one embodiment of the present invention , the aforesaid metal may include but not limited to zinc , copper , silver , gold , nickel , palladium , platinum , cobalt , rhodium , iridium , indium , iron , manganese , aluminum , chromium , tungsten , vanadium , tantalum , and / or titanium . as shown in fig7 , a specific laser beam such as uv laser is directed to the top surface of the non - conductive material layer 120 to etch openings 120 a into the non - conductive material layer 120 . each of the opening 120 a exposes a portion of each of the copper pads 20 . optionally , a desmear process may be carried out to ensure removal of epoxy - smear or residuals from the exposed surface of the copper pad 20 . suitable desmear process may include but not limited to plasma or oxidation methods . for example , permanganate may be used as an oxidant in the desmear process . at this point , the catalytic particles inside the opening 120 a are activated by laser , thereby forming a laser activated layer 120 b on sidewall of each of the openings 120 a . as shown in fig8 , a chemical copper deposition or plating process is carried out to grow chemical copper 60 from the laser activated layer 120 b and from the exposed top surface of the copper pad 20 at the same time . since the chemical copper 60 is directly grown from the laser activated layer 120 b on the sidewall of the opening 120 a , a tight bonding between the chemical copper 60 and the non - conductive material layer 120 is created . optionally , the chemical copper 60 may continue to grow until it protrudes from the top surface of the non - conductive material layer 120 to thereby form a bump structure 70 , as shown in fig9 . the bump structure 70 and the copper pad structure 20 together constitute a solder pad structure 80 . the present invention comprises at least the following advantages . first , the laser method for forming the opening 120 a provides higher accuracy compared to the conventional photolithographic process . second , the production throughput is improved because the chemical copper 60 grows simultaneously from the laser activated layer 120 b on the sidewall of the opening 120 a and from the exposed top surface of the copper pad 20 . third , since the bump structure 70 is grown on the copper pad 20 , the poor yield due to conventional solder paste printing can be avoided . in addition , direct bonding between the chemical copper 60 or the bump structure 70 and the sidewall laser - activated layer 120 b improves the reliability of the solder pad structure 80 . fig1 to fig1 are schematic , cross - sectional diagrams showing a method for fabricating a solder pad structure on a circuit board in accordance with another preferred embodiment of this invention . as shown in fig1 , likewise , a surface wiring structure 10 a is provided on the surface of the circuit board 10 . the surface wiring structure 10 a may include but not limited to a plurality of copper pad structure 20 and fine traces 30 . for the sake of simplicity , the conductive via holes or other inner layer interconnection inside the circuit board 10 are not shown in the figures . after the formation of the surface wiring structure 10 a , a solder resist layer 220 is coated on the surface of the circuit board 10 . the solder resist layer 220 comprises a dielectric matrix and laser - activable catalytic particles . the catalytic particles are evenly dispersed in the dielectric matrix . the aforesaid catalytic particles may be activated by laser energy and a conductive layer may be selectively deposited on the laser - activated traces on the non - conductive material layer 120 . however , the solder resist layer 220 may be composed of photo - sensitive polymers or inks . the aforesaid dielectric matrix may comprise polymer material such as epoxy resins , modified epoxy resins , polyesters , acrylate , fluoro - containing polymer , ( ppo ) polyphenylene oxide ( ppo ), polyimide , phenolic resins , polysulfone ( psf ), si - containing polymer , bt resins , polycyanate , polyethylene , polycarbonate , acrylonitrile - butadiene - styrene copolymer , polyethylene terephthalate ( pet ), polybutylene terephthalate ( pbt ), liquid crystal polymers ( lcp ), polyamide ( pa ), nylon 6 , nylonpolyoxymethylene ( pom )· polyphenylene sulfide ( pps ), coc or a combination thereof . the aforesaid catalytic particles described above may be nano - particles of metals or metal coordination compounds . for example , suitable metal coordination compounds may include metal oxides , metal nitrides , metal complexes and / or metal chelating compounds . in one embodiment of the present invention , the aforesaid metal may include but not limited to zinc , copper , silver , gold , nickel , palladium , platinum , cobalt , rhodium , iridium , indium , iron , manganese , aluminum , chromium , tungsten , vanadium , tantalum , and / or titanium . as shown in fig1 , a peelable film 230 is formed on the solder resist layer 220 . for example , the peelable film 230 may be a polymer release film such as polyester film or the like . preferably , the peelable film 230 has a thickness of about 1 - 2 micrometers , but not limited thereto . as shown in fig1 , a specific laser beam such as uv laser is directed to the top surface of the peelable film 230 to etch openings 220 a into the peelable film 230 and the solder resist layer 220 . each of the opening 220 a exposes a portion of each of the copper pads 20 . optionally , a desmear process may be carried out to ensure removal of epoxy - smear or residuals from the exposed surface of the copper pad 20 . suitable desmear process may include but not limited to plasma or oxidation methods . for example , permanganate may be used as an oxidant in the desmear process . as shown in fig1 , a seed layer 240 , for example , pd , ti , w or the like , is conformally deposited on the interior sidewall of the openings 220 a , the exposed surface of the copper pad 20 and on the top surface of the peelable film 230 . notably , the seed layer 240 is conformally deposited on the circuit board 10 and does not fill up the openings 220 a . according to the preferred embodiment of this invention , the seed layer 240 may be an organic seed layer or an inorganic seed layer . as shown in fig1 , after the conformal deposition of the seed layer 240 , the peelable film 230 is peeled off from the surface of the solder resist layer 220 . a portion of the seed layer 240 that is situated on the peelable film 230 is also removed , thereby leaving the other portion of the seed layer 240 on the interior sidewall of the openings 220 a intact . as shown in fig1 , a chemical copper deposition or plating process is then carried out to fill the openings 220 a with chemical copper 260 . a top surface of the chemical copper 260 may be lower than the top surface of the solder resist layer 220 . in another case , the top surface of the chemical copper 260 may be higher than the top surface of the solder resist layer 220 . the production throughput is improved since the chemical copper 260 is grown from the seed layer 240 in different directions , for example , from the sidewall directions and from the top of the pad 20 at the same time . fig1 to fig1 are schematic , cross - sectional diagrams showing a method for fabricating a solder pad structure on a circuit board in accordance with still another preferred embodiment of this invention . as shown in fig1 , likewise , a surface wiring structure 10 a is provided on the surface of the circuit board 10 . the surface wiring structure 10 a may include but not limited to a plurality of copper pad structure 20 and fine traces 30 . for the sake of simplicity , the conductive via holes or other inner layer interconnection inside the circuit board 10 are not shown in the figures . after the formation of the surface wiring structure 10 a , a solder resist layer 320 is coated on the surface of the circuit board 10 . the solder resist layer 320 may be composed of photo - sensitive polymers or inks . subsequently , a protective layer 330 is coated on the surface of the solder resist layer 320 . the protective layer 330 may be coated by printing or spraying methods . preferably , the protective layer 330 has a thickness that is less than 2 micrometers . preferably , the protective layer 330 is composed of nano - coating or nano - paint comprising nano - scale particles . as shown in fig1 , a specific laser beam such as uv laser is directed to the top surface of the protective layer 330 to etch openings 320 a into the protective layer 330 and the solder resist layer 320 . each of the opening 320 a exposes a portion of each of the copper pads 20 . optionally , a desmear process may be carried out to ensure removal of epoxy - smear or residuals from the exposed surface of the copper pad 20 . suitable desmear process may include but not limited to plasma or oxidation methods . for example , permanganate may be used as an oxidant in the desmear process . as shown in fig1 , after the formation of the openings 320 a , a seed layer 340 , for example , pd , ti , w or the like , is selectively deposited on the interior sidewall of the openings 320 a , the exposed surface of the copper pad 20 but not deposited on the top surface of the protective layer 330 . the seed layer 340 is conformally deposited on the interior sidewall of the openings 320 a and does not fill up the openings 320 a . according to the preferred embodiment of this invention , the seed layer 340 may be an organic seed layer or an inorganic seed layer . as shown in fig1 , a chemical copper deposition or plating process is then carried out to fill the openings 320 a with chemical copper 360 . a top surface of the chemical copper 360 may be lower than the top surface of the protective layer 330 . in another case , the top surface of the chemical copper 360 may be higher than the top surface of the protective layer 330 . the production throughput is improved since the chemical copper 360 is grown from the seed layer 340 in different directions within the openings 320 a at the same time . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention .
1
one embodiment of the invention is illustrated in fig3 a ( right side view ) and fig3 b ( front view ) showing a typical laser system module outfitted aircraft , in this case a sikorsky s - 64 skycrane heavy lift helicopter 30 . fig3 c shows a bottom interior view of the laser system ( ls ) module illustrating its major subsystem components . fig3 d shows a photo , and fig3 e the components , of a module subsystem , a typical telescope beam director assembly 42 . this helicopter is now manufactured by erikson air - crane , inc ., portland , oreg . simplex aerospace , portland , oreg . outfits the craft for its conventional fire attack task , to drop or spray water or other chemicals from a holding tank ( as was seen in the photo 1 b ). to allow for interchange of this tank for other modules , allowing dual use capability of the aircraft , the tank 34 is quick - clamped by hydraulic fittings 36 in fig3 a and 3b . our embodiment uses this same holding method developed by simplex aerospace , thus allowing the dual use scheme they perfected for their chemical tank to be used for our laser system module chamber . note that just as in its normal water / chemical drop firefighting mode this laser enhanced system will be controlled from those in the cockpit 32 , usually a pilot that controls the craft and a co - pilot that controls the firefighting effort . the operational aspects of the backfire setting aircraft mode , shown here with an intense focused laser beam 38 impacting targets 40 such as treetops or ground foliage ( 40 l ) and resulting fire ( 40 r ), will be discussed later when we complete identification of the major laser system equipment elements . fig3 c shows a mockup of such a backfire being set along a timberline by our first embodiment laser module equipped sikorsky helicopter . fig3 b shows a frontal view of this sikorsky ch - 54 / s - 64 . the so - called “ air crane ” has extremely large payload weight ( about 10 , 000 kgs or 22 , 050 lbs ) and volume carrying capability . the latter is very large since it can even transport things like houses held from the helicopter &# 39 ; s cables . in the embodiment figures shown we have assumed the laser module box 34 to be about 5 m ( 16 . 4 ft ) in width , 2 m ( 6 . 6 ft ) in height , as seen in fig3 b , and 6 . 4 m length as seen in 3 a . as reference , the aircraft is 21 . 4 m in length and 5 . 67 m in height . its cruising speed is 169 km / hr . note that other helicopters with less or more capability may also serve to carry other laser system modules for the firefighting service we claim in this embodiment . with more payload / volume capability a more powerful laser system could be used and this would increase the rate of setting the backfire . alternatively , some of that higher weight capability could be used to increase aircraft fuel capability and hence the range and time in the air before needing to refuel . such trades between margins for the carrier and the laser system load are common for those familiar in the laser weapon systems trade ( ref . 14 ). below , as the laser subsystem assemblies are discussed , similar trades are encountered . ref . ( 15 ) discusses such state - of - art issues in his book beam control for laser systems . in the embodiment discussed here , 34 is the typical laser system ( ls ) module which will be more fully discussed below in fig3 d , fig3 e and fig3 f . note the rear protrusion 42 from the module , in fig3 a and 3d ) and the photo in fig3 e . this is the laser beam director assembly which contains the optics that directs the laser beam to the target area where the laser - induced backfire is to be set . while there are many commercial versions of such a subassembly , in this embodiment we use as an example the “ othela ” module ( ref . 12 ) manufactured by mza associates , corp ., in albuquerque , n . mex . this particular commercial unit 42 contains many components and subassemblies as seen in fig3 e and 3f . in fig3 f , following the laser beam 72 that unit 42 receives as input through its components is a convenient way to identify those components . after passing through the input window 74 , the beam enters the set of optical elements in the beam control assembly 76 . as its bca name implies , these optics precondition the optical beam for its path ahead so that is arrives with desired good focus and with little jitter and beam wander away from its desired point of impact on the treetop or foliage . since this electro - optic assemblage varies with the type of usage desired and its level of detail exceeds what is desired in this document , we consider it a “ undefined black box ” here . we will do this for other boxes seen in fig3 c as well , only providing functional information but not internal detail . there are many manufacturers like mza associates that sell such subassemblies designed to customer specifications . exiting the bca , the laser beam encounters 78 , the first of three successive coude ′ mirrors 78 , 80 , and 82 . then it is deflected by the yaw mirror 64 to hit the half - angle mirror 66 . this series of five mirrors accomplishes an important task , namely to keep the forward moving laser beam aligned with the turret axis , from whence it began , to now as it leaves mirror 66 , even as the turret assembly 42 is rotated about its axis using the rotational bearing assembly 70 . this turret rotation is the azimuthal angle , indicated as az in fig3 d and 3e . there is a second rotation angle el , the elevation angle also seen in the figures . this corresponds to the rotation of 68 the spherical shell that holds the telescope &# 39 ; s secondary mirror 62 and primary mirror 60 . in the figure the el angle is 0 degrees and the beam leaves the shell though its output window 44 moving along the turret axis . if the operator commands it to move 90 degrees , the beam would move orthogonally out of the plane of the figure . then on command of the operator for the turret to rotate by an az angle change of − 90 degrees , the beam would move orthogonal to the turret axis downward to the bottom of the figure . clearly the operator has a wide range of beam direction angles that are at his control by rotating the turret about its axis combined with a rotation of the telescope &# 39 ; s shell . however it is written into the controller &# 39 ; s real time control software , instructions for the laser beam to cease whenever an angular choice would have the beam strike the aircraft , its landing gear , or any other than the desired treetop or foliage . another aspect of the telescope is its ability to expand the beam &# 39 ; s diameter and to focus that expanded beam onto the distant target . it is an important design trade to choose as large of a diameter as is consistent with allowed telescope weight and volume in the laser system module since it &# 39 ; s diameter size sets the laser beam &# 39 ; s smallest focal spot size at the target . then , as the beam reflects from 66 , the half - angle mirror , it strikes the secondary mirror , 62 . this convex mirror reflects the beam into an expanding beam that just fills the primary mirror 60 . the primary is a concave focusing mirror . as the secondary mirror &# 39 ; s axial distance between it and the primary mirror is changed under control of the secondary , the telescope &# 39 ; s focal length is adjustable . this allows the real - time controller , either manually or under computer control , to focus the beam for maximum backfire setting effect on the target . moving now to fig3 c we examine the other elements of the laser system module 34 . the genesis of the laser beam is the high energy laser ( hel ) 48 . assembly 50 is the power system which , as stated earlier , provides controlled electric power for all system assemblies and also for the electric - driven laser . the waste heat control and cooling assembly 52 , maintains the desired temperatures throughout the system . nominal beam pointing control is provided through the unit 54 , the real - time fire control assembly . this electronic computer assembly uses pointing techniques that have matured mostly under military technology development . in the all and atl laser aircraft , “ joy stick ” beam pointing control was developed and successfully used . in the abl program we perfected the technique for computer controlled autonomous target acquisition and tracking . in the present embodiment , both joy stick and pre - planned computer autonomous track setting and gps - assisted execution will be provided . the tracking & amp ; imaging subassembly 56 provides imaging of the terrain and foliage in which the backfire is being set . techniques for tracking the hot spot &# 39 ; s path are similar to those we have developed for laser weapon systems . frequently 56 and 32 work together in this regard , for example an infrared image camera in 56 will see through the smoke and provide the joy stick operator located in the cockpit 32 with scene information needed to guide the laser “ hot spot ” backfire setting . completing the laser beam odyssey through the system module , the beam leaves the hel 48 and enters the beam transfer assembly 58 . this unit resizes the laser beam and cores it as needed to fit the requirements of the turret assembly . 58 also removes any beam walk and beam jitter that appears in the hel beam so that these effects are not present as the beam passes through the void region 46 and enters the turret as beam 72 . the 46 is a storage space left to withdraw the turret assembly 42 when the laser is not in use in order to protect it from debris during flight . a bird strike protective cover , not shown , might also be used to close the aperture input . the operational concept for this first embodiment is as follows . prior to the fire season , the helicopter is assumed to be outfitted at various times with differing modules for its many agriculture , power company , logging , and other tasks as has been done in the past . but when fire season approaches the craft would normally be outfitted with its water / chemical tank for traditional firefighting . alternatively , the new laser backfire option may be used by a quick and straightforward replacement of the tank with the laser system module . for this helicopter the rate of climb to altitude is 405 m / min , its cruise speed is 169 - 203 km / hr , and its range is 370 km . hence it should arrive at the early stages of the fire in order to start setting a backfire downwind of the conflagration so as to remove possible fuel for the fire &# 39 ; s spread . fig3 c was a mock - up of such a backfire activity . david leigh and zvika avni ( ref . 10 ) have suggested that removing the tree - top combustible material is an especially effective backfire technique . they suggest a generic airborne laser to do this but no design information . in contrast , this patent provides example airborne laser systems that can serve this purpose . in addition to the treetop backfires , more conventional ground level backfires may be set by the laser beam . as stated earlier , these backfires will be much quicker accomplished with the laser than by state - of - art non - laser system means . finally , if after all the desired backfires are set , the craft can go into a infrared search mode for other hot spots or needed additional backfires . alternatively it may return to base . there it may , if desired change out its laser system module for the water / chemical tank and return to fight the main conflagration using this conventional means . to illustrate that in addition to helicopter designs , there are also fixed wing aircraft laser system module designs , we consider those aircraft here . while those of us in the laser weapon system design field have considered pallet - loaded laser systems that could fit into large cargo aircraft like the lockheed martin c130j , the recent development of the previously discussed lightweight , smaller volume , higher efficiency and hence lower electric power and waste heat cooling requirements , reli - class lasers makes the fixed wing fighter concept discussed here certainly possible . previously , a fixed wing state - of - art water / chemical firefighter approach had been patented by edward c . herlik ( u . s . pat . no . 5 , 549 , 259 ) awarded 27 aug . 1996 . as seen therein , to illustrate this concept he used the fighter aircraft fairchild / northrop grumman a - 10 thunderbolt - ii shown in fig4 a . in its militarized configuration shown , it is an incredible craft . its overall length is 16 . 16 m ( 53 . 3 ft ) and height is 4 . 42 m ( 4 . 42 m ( 14 . 75 ft ); payload capacity is 7 , 257 kg ( 11 , 000 lbs ); maximum speed is mach 0 . 56 ( 420 mph ); and range 695 nautical miles ( 800 miles ). herlik de - militarized the a - 10 , as we will also assume , first modifying it by removing the 30 mm gau - 8 / a seven - barrel gatling gun 122 and its armament storage drum 94 , other military armor protection such as the cockpit armor 96 , the two wing fuel tanks 92 , and miscellaneous other military hardware not needed for firefighting . one or two new fuel cells were placed in the nose , using some space that was previously occupied by the gun . ( see also fig4 c for pictures showing this large gun 122 and access doors 124 .) we also assume such modifications in fig4 b , and the fuel cells to power 118 , our electric power and thermal control assembly for our laser system module . finally , we also assume the available envelope that herlik used for his firefighting water tanks and pumps , but in our case for the laser module subsystem assemblies as seen in fig4 b . that envelope is about 4 . 78 m ( 15 . 7 ft ) in length , having a maximum height of 3 . 38 m ( 11 . 1 ft ), and an average width ( normal to the plane of the drawing ) of 1 . 64 m ( 5 . 39 ft ). the volume of this envelope is about 5 . 7 m 3 . note that the u . s . defense advanced project agency ( darpa ) is nearing completion of its program to develop a 100 kw hellads laser system with a smaller total volume of 1 m × 1 m × 3 m = 3 m 3 . and since our baseline reli laser is being developed to have equivalent , or even lower volume and weight per unit output power , a 60 kw reli system should find the available volume of 5 . 7 m 3 more than adequate . this laser system module seen in fig4 b , enclosed in the shell 102 , contains the same major subsystems as were required previously in the first embodiment . 120 is the turret containing the telescope and beam control assembly , 108 is its recess for storage , 110 is the active tracking module , 106 is the beam transfer assembly , 112 the tracking and imaging module , and 116 is the high energy laser which rests on its vibration isolation bench , 104 . note that the craft is outfitted , as was the helicopter , with 114 , a real - time fire control assembly which includes ir imaging , allowing it to let the pilot to see through smoke and also to operate at night . note that as with the first embodiment , the turret 120 needs to be stowed and its recess volume 108 capped for protection whenever the craft is not setting backfires . this second embodiment has been described with reference to the a - 10 aircraft for illustrative purposes . it is apparent to those skilled in the art of fighting fires from the air that different craft may be used without departing from the spirit and scope of this invention or the associated methods as claimed here . these laser module systems may be attached to other craft to realize many of the same benefits . the purpose of showing the photos in fig4 c is to not only indicate the space available when the gatling gun is removed , but also the belly doors which provide access for laser system module installation , servicing , and replacement with a water / chemical tank or other module should it be desired to multi - task the aircraft beyond its laser backfiring service . in this water / retardant mode configuration the craft could for example , patrol day and night using its infrared sensitive camera capability to detect the infrared radiation emitted by even small fires as they start and then drop the retardant immediately . after alerting the fire control group of the fire &# 39 ; s location , the craft could then return quickly to base either for more retardant or , if desired , to make a quick exchange to convert to the laser system module which would allow it to fly out and begin backfire protection . as previously stated , early backfire setting may drastically reduce the ultimate size of the conflagration and its loss of life and property and cost to extinguish . this laser system module - assisted fixed wing firefighter will operate much as the helicopter . note that its telescope has a 360 degree ( 2π radian ) azimuthal angle coverage . although it needs a runway unlike the helicopter , its cruise speed of 360 mph would allow it to quickly get to the region where the backfire is to be set . the laser system module aircraft will fight fires as follows . it will fly to a known fire &# 39 ; s coordinates or locate the fire independently using its surveillance capabilities . of course these capabilities will allow it to identify and avoid flight hazards and to report such information to the fire controlling agency . approval to begin setting backfires may be given along with the desired paths or a more free - lance approval given . in either case the co - pilot fire manager aboard will enter the instructions into the laser beam pointing and tracking control system . joy stick operation or automatic operation will follow . this backfire operation will continue until the desired path is completed . if the craft needs refueling it will return to refueling base and then quickly return to complete the backfire task . finally , as stated above , at that point the fire control agency may order the craft to return to base to exchange its laser system module for a water / chemical tank to allow it to perform conventional retardant - drop firefighting . alternatively , the fire controller may order the craft to stay aloft in order to use its enhanced surveillance capabilities to look for new flare - ups or to identify flight hazards such as transmission lines , other aircraft , etc . the prior embodiments related to piloted aircraft . but the emergence of uavs , unmanned aerial vehicles , or so - called drones , offers interesting possible use for laser system module equipped uavs . ( more precisely , the international civil aviation organization refers to these craft as remotely piloted aircraft ( rpa ), i . e . aircraft without a human pilot aboard .) its flight is controlled either by on board computers with pre - scripted flight plans or by the remote control of a pilot on the ground or in another vehicle . ( ref . 16 ) discusses uav many uses , both military and civilian . among these is remote fire detection : “ another application of uavs is the prevention and early detection of forest fires . the possibility of constant flight , both day and night , makes the methods used until now ( helicopters , watchtowers , etc .) become obsolete . [ they may have ] cameras and sensors that provide real - time emergency services , including information about the location [ coordinates ] of the outbreak of fire as well as many factors ( wind speed , temperature , humidity , etc .) that are helpful for fire crews to conduct fire suppression .” while present day laser system modules for backfire use may appear to be too heavy , voluminous , and inefficient to be accommodated in present day unpiloted aircraft , developments in both uavs and in laser systems and our discoveries reported here should soon change this . examples of recent developments by a lockheed martin - kaman aircraft team , fig5 a to fig5 d , indicate this . the pilot - less lm k - max ( fig5 a ) has just completed a demonstration program in afghanistan . over the last few months , this new unmanned military version of k - max 130 has been flying in afghanistan , primarily to ferry meals ready to eat ( mres ) and other supplies between bases in order to keep manned ground vehicles from making the hazardous trips on the ied - infested roads . as seen in fig5 c , the craft is remotely piloted by a marine 138 using his “ joy stick ” 134 which provides a signal through the antennas 132 . since last december 2013 a lm k - max has flown five flights per day , delivering over 600 , 000 pounds of cargo to troops in the field , flying over hazardous enemies and terrain , with no failures and no unscheduled down time . this remarkable helicopter is based upon one designed by the chief engineer of those used by the german army in ww ii . as seen in fig5 a it uses two separate blade systems 126 which counter - rotate to avoid the gyroscopic instability of a single - bladed craft which usually must use a tail rotor to counter it . of course not only is the copter very stable but two blades gives it better lift capability even though it is a small craft . despite its small size , 15 . 8 m ( 51 ft ) length , 4 . 14 m ( 13 . 6 ft ) height , 14 . 7 m ( 48 . 25 ft ) rotor diameter , its payload capacity is 2 , 727 kg ( 6 , 000 lbs ). while this might appear to be too small to support a “ conventional ” 30 - 60 kw output power laser that we have discussed in previous embodiments , our further insight , as follows , will prove otherwise . foremost , we have no human aboard , and the safety risk tolerance can be markedly higher . as is well known for manned flight design , this dramatically lowers the weights ( and costs ) of safety features that had to be built into those aircraft we previously discussed . the same is true of the laser system module designs . but equally important , this allowable risk level also allows the remote uav operator to fly the uav much closer to the treetops or ground where the backfires are needed . since the laser power received on target decreases with the square of the range between laser and target , reducing the range from say a “ safe ” 1 km to 0 . 1 km would require 10 2 = 100 times less laser power to have the same fire - starting effect ! in addition , if therefore instead of a 30 kw laser only a 0 . 3 kw one were required , smaller scale optics and less sophisticated beam control , would result ! in brief , the laser system module volume , electric power , waste heat cooling and weight could dramatically decrease when it is used for backfire setting when mounted in a uav like the lm k - max . even the lower load capacity of 2 , 727 kg ( 6 , 000 lbs ) would then easily suffice . another simplification is also possible . the k - max nominally carries its load 140 on a cable , as seen in fig5 d . if the cable also carried electric power from the aircraft to a laser package at the cable &# 39 ; s lower terminus , then the target range might be made even smaller , say 0 . 01 km = 10 m , and a very small 100 - w - class laser output power might suffice for backfire ignition . but what must we assume for the design of this laser module package ? all of the subsystem elements that we have required in the prior embodiments must be present . note that the electric power could be provided by battery in the module or alternatively by an electric cable that is part of the support cabling . however the much lower laser powers required would allow smaller optics since their diameters scale downward with the square of the laser power handled . one issue of concern might be any sway of the module if it were held by cable rather attaching it to the underbelly of the craft . but there are remedies for this . first , the k - max cable - held payloads are much more stable than those suspended from other helicopter designs which suffer from the gyroscopic effect . secondly , kaman claims that the counter - rotating props provide much lower “ down - wash ” than conventional helicopters . finally , it should be noted that the military has developed gyroscopically controlled laser beam pointing systems to keep the beam on its intended target even if it is reflected off a mirror held on such a cable by a helicopter . turning now to the last uav photograph shown as fig5 e , the lockheed martin vector hawk is a just released mini - uav only a meter or so in width and length . this device has been constructed to allow its wing and tail sections to be folded under and above its fuselage , respectively . then it may be launched like a mortar out of a tube to the desired flight altitude where it unfolds and begins cruising . this ingenious protocol is used to conserve the onboard battery &# 39 ; s stored energy , which it would otherwise expend in gaining altitude . thus payload capability and flight time enhancements result . but in its present few kg payload capability limit , only very small designator lasers appear as possible laser payload . however even these could play an important role in firefighting by providing close - in directing of the illuminated aim points to be followed by a more powerful and distant laser system . of course such low power laser target designation is presently used to guide missiles and even bullets on the battlefield . another important firefighting role that such a uav could play is to provide infrared and optical surveillance . without the risk of life , such a craft could be allowed to fly into harm &# 39 ; s way , through smoke and darkness to obtain close - up infrared images . these could identify risks , or their absence , for follow - on manned aircraft . of course general surveillance for fire flare - ups , need for restarting some backfires that have died , etc . would all be important information for the fire control agency . vector hawk data link uses a high - bandwidth , software - defined radio . this would enable the transmission of these images and their gps coordinates . uavs have unique capabilities to provide to firefighting . not requiring pilots to prepare and come aboard , they are always ready to immediately take off for duty . this is an important issue to minimize a fire before it begins to spread . once aloft they can immediately use their ir thermal cameras , day or night or veiled in smog or smoke , their images of infrared emitting hot spots can be quickly sent to fire control headquarters . then , either under programed gps computer control , or being flown by a remote pilot , like fig5 c , at the control base on in another plane , to carry out the fight . with the ability to fly much closer to the target than a manned craft , their smaller , lower power laser system modules can be engaged to setting the optimum backfires . and the laser backfire ignition fire rate , being so much more rapid and effective than state of art methods , will be able to contain the fire to a smaller region , saving lives and property . when adequate backfires have been set , the uav may turn to other of its multiple tasks . for surveillance , it may or may not even remove its laser system module package . on the other hand , for chemical retardant release , as seen in fig5 b , it would release its laser module at a base and attach a chemical belly tank as shown in fig5 b or use a cable supported water bucket tank , supported as seen in fig5 d . this operation may be reversed should more backfire duty is again required . finally , the operational use of a mini - uv like the lm vector hawk , fig5 e , is to provide the fire control manager and the firefighting foot troops ir and white light images of the territory from high and very low vantage points . needing to know in the dark which way to advance for best firefighting , or which way to move to escape an advancing fire , the foot soldier can tube launch the uav and quickly decide on the course of action for his troops . of course this surveillance can also continue as the crew sleeps , automatically awakening them by an alarm when a fire is observed . finally , this uav can , with low cost and no risk of life , be launched to explore regions that are covered with smoke or darkness in order to identify obstacles that manned craft or foot fire fighters might encounter . although the description above contains much specificity , these should not be construed as limiting the scope of the embodiments but as merely providing illustrations of some of several embodiments . for example , the laser system module can have many shapes and various subassemblies which may be provided by many vendors , etc . thus the scope of the embodiments should be determined by the appended claims and their legal equivalents , rather than the examples given .
1
the objectives noted above , as well as other objectives , are addressed by the present invention , which provides a high efficiency amplifier architecture for efficiently handling high peak - to - average signal ratio applications while maintaining desirable am / pm characteristics . the amplifier does so , without complicated and expensive electronics . furthermore , the amplifier is viable with linearization schemes , including digital , analog , and hybrid pre - distortion , feed forward , and cross cancellation . furthermore , it is compatible with drain bias modulation schemes . the present invention provides a new , simple and relatively inexpensive device and method for a high efficiency power amplifier utilizing a signal delay scheme applicable to a doherty amplifier design . the invention decreases the change or variation in the am / pm characteristic as the input signal frequency is changed . while not completely eliminating the am / pm change , it does provide a measurable improvement that allows doherty amplification to be used in situations where it had previously been excluded . a brief explanation of a classic doherty circuit operation , which would be known to a person of ordinary skill in the art , is useful for understanding the operation of the present invention . generally , a simple doherty circuit 10 , as shown in fig1 , will combine the outputs of a main amplifier 20 , such as a carrier amplifier , and an auxiliary amplifier 22 , such as a peaking amplifier . an input signal 21 to the amplifiers 20 , 22 is split by an appropriate signal splitting circuit 24 , such as a hybrid coupler circuit . the other input port of the hybrid coupler may be terminated with an appropriate impedance 23 . the split input signals are directed to the carrier amplifier 20 and the peaking amplifier 22 . the output of the carrier amplifier 20 is combined through a signal combining network , such as a combiner / impedance transforming network 26 , with the output of the peaking amplifier 22 , and the combined outputs are present at the output 30 of network 26 . under a low input signal level drive condition , the peaking amplifier 22 is turned off and its high output impedance is assumed to not significantly load the output circuit . when the input signal 21 drive level is increased to where the carrier amplifier 20 reaches saturation , the peaking amplifier 22 is allowed to turn on , thus contributing current to the output network 26 . the additional current causes the network 26 output to increase which , in turn , results in a decreasing load impedance at the carrier amplifier &# 39 ; s output 31 . as the input signal level continues to rise , the carrier amplifier 20 is kept in a voltage - saturated condition , but the power level of that saturated condition increases due to the decreasing load impedance . at the same time , the peaking amplifier is contributing power to the output of the amplifier . at the highest input drive level , both the carrier and peaking amplifiers have their designated nominal load impedance , at their respective outputs , and are delivering their maximum rated power to the load that is coupled to output 30 . fig2 illustrates an am / pm characteristic for a typical doherty amplifier . while the characteristic displays a relatively constant phase with an increasing input signal level , as indicated at line 40 , at a specific transition point 42 , the am / pm characteristic deviates . specifically , the am / pm characteristic is dependent upon the deviation of the frequency of operation of the amplifier from the center frequency of the operational band for that amplifier . for example , an amplifier would generally be operated within an operational frequency band . that is , for the doherty amplifier design illustrated in fig1 , each of the main amplifier 20 and auxiliary amplifier 22 are operated at a specific operational frequency band . such a frequency band would have what is generally considered a center of frequency . in the present invention , reference to an operational frequency band is made , but it is not limited to any specific band . furthermore , when a center frequency is referred to , it is not limited to a specific or precise center frequency , but generally indicates a frequency approximately at the center of defined operational frequency band . returning now to the graph of fig2 , past the transition point 42 , the am / pm characteristic is affected by the frequency of operation of the amplifiers with respect to the deviation of that signal frequency from a center frequency . that is , it is affected by the frequency of the input signal as it deviates from the center frequency of the operational frequency band . generally , for those frequencies proximate the center of the band ( f mid ), as illustrated by the portion of the graph in fig2 indicated by reference numeral 44 , the signal phase remains generally consistent with an ever - increasing input signal level . however , there is a change in the am / pm characteristic as the frequency of operation deviates from the center frequency . specifically , the portion of the graph indicated by reference numeral 46 illustrates the am / pm characteristic for those high frequencies f high that deviate from the middle of the band f mid . similarly , as illustrated by the portion of the graph indicated by reference numeral 48 , the am / pm characteristic also changes as the frequency deviates to a frequency f low that is below the middle range f mid of frequencies for the operational frequency band . the variations or changes in the am / pm characteristic cause im distortion in an optimized doherty amplifier . such im distortion degrades as the frequency of operation increasingly deviates from the center frequency of the operational frequency band . as illustrated in fig2 , significant changes in the am / pm characteristic may cause significant im distortion . this , in turn , may cause an amplifier to fail a specification out at the band edge , far from the center frequency . furthermore , there may be a decreased margin with respect to an operational specification for the amplifier due to such im distortion from the varying am / pm characteristic . in accordance with one embodiment of the present invention , as illustrated in fig3 , the am / pm variation , as a function of the input frequency in the doherty amplifier , is reduced through the addition of a delay in the path of the auxiliary amplifier , or peaking amplifier . referring to fig3 , where like reference numerals as in fig1 are used , a delay element 50 is coupled in the path of the auxiliary amplifier . in the embodiment illustrated in fig3 , the delay element 50 is coupled to the input of the auxiliary amplifier 22 to introduce a delay to that input and ultimately to introduce a delay to the auxiliary amplifier path prior to the combiner / impedance transforming network 26 . the delay introduced by the delay element 50 has a value based on several criteria in accordance with the principles of the invention , and as discussed below . as the signal level of the input signal 21 increases , the increasing delay that occurs through the main amplifier 20 , or carrier amplifier , as discussed above , is compensated by the delay element 50 . more specifically , the decreasing delay through the main amplifier 20 is somewhat compensated by the addition at the output 30 of a signal from the auxiliary amplifier that has been delayed by the specific delay element selected 50 . this net effect is a reduction in the amount of variation in the amplifier delay as the level of the input signal 21 is increased . the net effect of a reduction in the amount of change in the amplifier delay as the level of the input signal is increased results in less of a variation in the am / pm characteristic as a function of the change in the input frequency of the amplifier . this , in turn , results in a reduction in the im distortion , as the frequency of the amplifier operation deviates from the center frequency of the operational frequency band for the amplifier . that is , there is less of an excursion of the signal phase from zero at various low and high frequency extremes associated with the operational frequency band . fig4 illustrates an am / pm characteristic for a doherty amplifier system utilizing the present invention . fig4 shows the reduced deviation of the am / pm characteristic with increased input signal level as the frequency deviates from the center frequency ( see , e . g ., fig2 ). the additional delay in the path of the auxiliary amplifier may be implemented in several ways . for example , the delay element 50 may include a co - axial cable element , or may include micro - strip or strip - line transmission line elements or other suitable physical implementations of an rf delay element . alternatively , commercially available surface mount delay lines might be utilized in the auxiliary amplifier path . at some point , dependent upon the bandwidth of interest and the magnitude of delay being compensated , further increases in the auxiliary amplifier path delay will result in degraded power performance at the amplifier band edges . the optimum delay is selected considering the system requirements and in accordance with the principles of the present invention . the delay presented by the delay element 50 cannot be just any delay , but rather will depend on the desired operation of the amplifier and the amount of reduction in the am / pm characteristic that is desirable . for example , while an increase in the delay in accordance with the principles of the invention will generally improve the am / pm characteristic , a delay that is too large will narrow the bandwidth . typically , the bandwidth narrowing will cause the efficiency improvement , normally provided by the doherty topology , to suffer at the band edges . therefore , the desire for am / pm improvement and bandwidth performance must be determined . in accordance with one aspect of the present invention , several criteria are utilized for the delay element in order to determine the proper delay for the particular doherty amplifier design . the amount of delay that should be added for enhanced performance will depend upon the specifics of the particular doherty amplifier design . more specifically , in the present invention , the delay introduced by the inventive delay element will depend upon how much the delay through the main amplifier &# 39 ; s output matching network changes with the changing additions of the load on its output . in accordance with the invention , this delay change is determined by measuring the delay through the entire doherty amplifier under two conditions . the first condition is when the output is driven to the rated pep of the doherty amplifier . the second condition is where the output is driven to a level significantly below ( at least 10 db ), the rated peak power or pep of the doherty amplifier . generally , the delay measured under the first condition will be less than the delay measured under the second condition , below peak power . this difference in delay is designated as δt . in one aspect , the delay to be added tc the auxiliary amplifier path through the delay element 50 , designated as t a will mostly be in the following range : however , a delay generally in the range of t a = around 1δt – around 6δt may also be suitable . in accordance with another criteria for the delay provided by delay element 50 of the invention , the t a has an additional restriction . that is , t a should generally be approximately an integer multiple of a wavelength at a frequency within the operational frequency band . more preferably , the delay should generally be an integer multiple of a wavelength at the center frequency within the operational band for the amplifier . as readily understood by a person of ordinary skill in the art , a delay indicated as being an integer multiple of a wavelength refers to a delay that is an integer multiple of the delay through a one ( 1 ) wavelength transmission line . such delay is expressed in units of time . this is equivalent to : t a ( nsec )= n / f ( ghz ), n = 1 , 2 , 3 equation 2 an example best illustrates the desired delay from delay element 50 . assume , for example , the measured difference in delay , δt , for the various output conditions described above was approximately 0 . 8 nsec , at a center frequency of around 2 ghz . from equation 1 above , we can pick one of the values of equation 2 that is also within the range set forth in equation 1 . from equation 1 , t a = 1 . 6 – 3 . 2 nsec ( or possibly 0 . 8 – 4 . 8 nsec ). from equation 2 , t a = 0 . 5 , 1 . 0 , 1 . 5 , 2 . 0 , 2 . 5 , 3 . 0 , 3 . 5 , 4 . 0 . . . nsec . therefore , the added delay meeting both these criteria would then be a t a of 2 . 0 , 2 . 5 , or 3 . 0 nsec . from these choices , the best choice would be determined experimentally . for example , the various am / pm characteristics as in fig4 might be determined to see which t a value yields the greatest reduction in the am / pm variation as a function of the operational frequency . typically , increasing the delay improves the am / pm characteristic . however , as noted above , if the delay is too large , then the bandwidth is undesirably narrowed , and gain and efficiency may suffer out at the band edges . a decision is made as to which criteria , that is , improvement in am / pm or bandwidth considerations , are more desirable . although the embodiment illustrated in fig3 shows a delay element 50 positioned at the input to the auxiliary amplifier 22 , the delay , according to the criteria of the invention , might also be placed elsewhere within the auxiliary amplifier path . fig5 illustrates an alternative embodiment . a delay element 60 may be incorporated at the input to the auxiliary amplifier , while another delay element 62 might be incorporated at the output . the total delay provided in the auxiliary amplifier path between elements 60 and 62 is determined according to the criteria set forth above . in still another alterative embodiment , as illustrated in fig6 , all the delay may be placed at the auxiliary amplifier output , such as by using a delay element 66 . it should be noted that although t a , or a portion of t a , may be placed at the auxiliary amplifier output , it is suspected that doing so will result in decreased bandwidth , relative to the case where all the t a is placed at the auxiliary amplifier input . accordingly , while the alternative embodiments shown in fig5 and 6 might be utilized , the embodiment of fig4 may be most preferable with respect to the desired bandwidth characteristics . in accordance with another aspect of the present invention , the t a added to the doherty amplifier , such as through a delay element 50 , is added to any inherent delay that already appears at the auxiliary amplifier input . for example , depending on the splitting / combining scheme chosen for the particular doherty amplifier , there may be an inherent short delay ( quarter wavelength , for example ) at the input of the auxiliary or peaking amplifier , to provide the proper phasing relationship outputs to achieve optimum power combining . in such a situation and in accordance with the principles of the present invention , the t a should be added to this already existing delay at the input to the auxiliary amplifier . while the present invention has been illustrated by a description of various embodiments and while these embodiments have been described in considerable detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . the invention in its broader aspects is therefore not limited to the specific details , representative apparatus and method , and illustrative examples shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of applicant &# 39 ; s general inventive concept .
7
fig1 ( prior art ) shows a conventional optical imaging system using a contact lens over an eye . object 15 is imaged through contact lens 25 , through the cornea 26 , the iris 27 , lens 28 , and the vitreous humor 29 onto the retina 30 . such a system creates a sharp , in - focus image at the retina 30 only if object 15 is located at or very close to the in - focus object plane . some accommodation is provided by the lens 28 . however , this lens hardens with age and loses its ability to refocus . if the distance from the back principal plane of lens 28 to retina 30 is d i , and the focal length of contact lens 25 is f , the distance from the front principal plane of lens 28 to object 15 , d 0 must be chosen such that : in order for the image at retina 30 to be in adequate focus . the depth of field of an optical system is the distance that the object can move away from the in - focus distance and still have the image be in focus . for a simple system like fig1 the depth of focus is very small , unless the light is bright and the iris is stopped down . prior attempts to solve this problem have used contact lenses and optical implants that have multiple ( usually two ) foci . one focus is correct for objects at infinity , and one is correct for objects at a close distance . this means that two images of an object at one of those locations are formed , one in focus , and one out of focus . fig2 shows this effect when imaging a point at infinity . rays 41 form a point image 50 at one of the foci of the combined system formed by contact lens , 25 , cornea 26 , and lens 28 . the second focus of the system forms a blurred image 52 . when the point object is at a reading distance , the previously blurred image 52 is in focus , and the image 50 becomes blurred . at other distances , neither image is in focus , and the degree of misfocus changes with object location . p ( x , y )= exp ( j (( α x 3 + βy 3 + γx 2 y + δxy 2 )), x 2 + y 2 ≦ 1 choice of the constants , α , β , γ , and δ allow phase functions that are rectangularly separable ( with γ = δ = 0 ) to systems whose modulation transfer functions ( mtf &# 39 ; s ) are circularly symmetric ( α = β = α 0 , γ = δ =− 3α 0 ). for simplicity we will use the symmetric rectangularly separable form , which is given by : p ( x , y )= exp ( j α ( x 3 + y 3 )), x 2 + y 2 ≦ 1 where α is a parameter used to adjust the depth of field increase . since this form is rectangularly separable , for most analyses its one - dimensional component can be considered : p ( x , y )= exp ( jαx 3 ), x 2 ≦ 1 as the absolute value of α increases , the depth of field increases . the image contrast before post - processing also decreases as α increases . this is because as α increases , the mtf slumps down . fig3 shows the effect of the edf - coding phase element on the rays that pass through the eye . rays 41 , which come from a point at infinity , pass through contact lens 65 , cornea 26 , and lens 28 , do not form a focus anywhere . phase coding might be applied by variations in the thickness of lens 65 ( exaggerated here for clarity ). an expanded view of the ray pattern near the retina 30 is shown in expanded view 70 where the retina is at plane 72 . this is unlike the ray pattern for an eye with a normal contact lens , it also is unlike the two - foci lens of fig2 . as the object point moves in from infinity , the ray pattern in the region of the retina , shown expanded in 70 , moves to the left , but the cross section of the ray pattern that falls on the retina does not change appreciably . this means that no matter where the object is , the same pattern will fall on the retina . when the object is not a point , the object distribution is convolved with the unchanging ray distribution ( the point spread function ). the brain can deconvolve the resulting coded image because the point spread function of the eye , modified with the edf - coding optics , does not change appreciably . this is in contrast to the changes that normally occur in the point spread function when there is misfocus . for large enough α , the mtf of a system using a cubic pm mask can be approximated by :  h    ( u , ψ ) ≈ π 3   α   u  ,  u ≠ 0 | h |( u , ψ )≈ 2 , u = 0 where u is the spatial frequency in the x direction and ψ is the degree of misfocus . thus , the cubic - pm mask is an example of a mask which modifies the optical system to have a near - constant mtf over a range of object distances . the particular range for which the mtf does not vary much is dependent on α . this range ( and thus the depth of field ) increases with α . however , the amount that the depth of field can be increased is practically limited by the fact that contrast decreases as α increases . however , for the human eye only moderate increases in depth of field are needed . fig4 shows an extended depth of field ( edf ) intraocular implant imaging system in accordance with the present invention where the edf - coding optical shape is on the implant lens 75 . the phase coding results in misfocus as shown in expanded view 70 of fig3 . fig5 shows an extended depth of field ( edf ) modified natural eye imaging system in accordance with the present invention where the edf - coding optical shape is on the cornea 85 . the cornea can be modified using laser surgery , e . g . phase coding is applied by variations in the thickness of cornea 85 ( exaggerated here for clarity ). the phase coding results in misfocus as shown in expanded view 70 of fig3 .
0
primary and secondary sample current waveforms of a flyback switching converter working in discontinuous mode are depicted in fig8 . it will be assumed that its pwm modulator uses a current mode control . the average output current i out is : where , i s is the secondary peak current , t onsec is the time during which the secondary current is flowing , and t is the switching - cycle period . by adding a dedicated circuit , able to estimate the ratio t onsec / t in the current mode ic controller , it is possible to calculate the i out value by the above formula . this approach may be applied to any current - mode - controlled switching converter with primary feedback . in order to better understand the gist of this technique , the functioning of an off - line all - primary - sensing switching regulator , disclosed in u . s . pat . nos . 5 , 729 , 443 and 6 , 590 , 789 ( which are incorporated by reference ) will be discussed . an equivalent high - level circuit scheme of the switching regulator disclosed in u . s . pat . no . 6 , 590 , 789 for regulating the output voltage is reproduced in fig9 . an accurate image of the output voltage is obtained by sampling the voltage on the auxiliary winding immediately at the end of transformer &# 39 ; s demagnetization phase , as illustrated in the graph of fig1 . the switch q 1 is turned on after the end of the demagnetization phase and then turned off by a comparator that monitors the source current of q 1 using a sense resistor r s . an equivalent high level circuit scheme of the switching regulator disclosed in u . s . pat . no . 5 , 729 , 443 for regulating the output current is reproduced in fig1 . the switch q 1 is operated by the pwm signal , set by the end of the demagnetization phase of the transformer , and reset by a comparator that monitors the source current of q 1 through the sense resistor r s . the voltage of an auxiliary winding is used by a demagnetization block demag through a protection resistor . the demagnetization block demag generates a logic flag eod that is high as long as the transformer delivers current to secondary side . waveforms of the currents in the primary side and in the secondary side of the regulator , of the logic flag eod , and of the current i c through the filter capacitor c during a switching period , are shown in fig1 . the logic flag eod is used to turn on and off a mosfet switch q 2 for discharging / charging the filter capacitor c . a resistor r in series with it absorbs a current u c / r , where u c is the voltage across the capacitor c . this capacitor c filters the charge current i ref and the discharge current ( i ref − u c / r ) so that u c is practically a dc voltage , that is applied to an input of the current mode comparator . at steady state , the average current i c is zero . if t onsec is the time during which the secondary current i s is flowing , it is : i ref · ( t - t onsec ) + ( i ref - u c r ) · t onsec = 0 , the voltage u c is then used to set the peak primary current i p : the average output current i out can be expressed as : thus it is possible to set the average output current of the switching regulator by fixing the reference current i ref and the resistances r and r s . it has been found that a signal proportional to the output current can be generated by using signals already available in the primary side of the converter . indeed , combining equations ( 1 ) and ( 3 ), leads to the following expression : hence the charge voltage of the filter capacitor contains information concerning the average output current , thus it can be used for compensating the voltage drop on the cable that connects a load to a flyback switching regulator . moreover , during the voltage regulation , the voltage control loop signal establishes the peak primary current i p = v cv r s ( 5 ) wherein v cv is the voltage generated by the error amplifier eav ( in the circuit of fig1 ) proportional to the difference between the reference voltage v ref and the output voltage v out generated by the controller . in the above formula all the signals are known except for the i out value . in the ic controller is inserted a dedicated cdc block for performing the division between the signals v cv and u c in order to obtain a signal proportional to the output current : in an embodiment , the cdc block is analog , as depicted in fig1 , and comprises an analog divider the output of which is multiplied by a constant k , a filter and an analog subtractor of the output of the filter and the reference voltage v ref . as an alternative , the cdc block could be digital , converting the signals v cv and u c in digital form , carrying out the division , subtracting the result from the voltage value v ref , and converting the result back into an analog signal . the next step is to adjust the voltage reference v ref by an amount depending on the output current , as explained previously . in fact , the cdc block is designed to implement the following transfer function : the cdc block , during the output voltage regulation , introduces a positive feedback that may compromise the stability of the primary loop . for this reason a low - pass filter is preferably added , as shown in fig1 . looking at fig1 it is possible to notice the analog divider , the output signal of which is multiplied by a constant k , the filter and the analog subtractor . fig1 shows the architecture of an embodiment of a voltage mode converter , that includes a cdc block in the primary loop for adjusting the voltage reference value ( v ref ) by an amount proportional to the output current . the new voltage loop reference is v ref ′. this allows to compensate the voltage drop along the output cable and , ideally , to achieve a zero load regulation . this technique may be applied even by modifying the feedback voltage on the capacitor c * instead of directly acting on v ref . a sample embodiment of this type is shown in fig1 , where the cdc block sinks a current proportional to the output current from the feedback resistor divider in order to modify the sampled value : another way to modify the voltage feedback signal value is to generate a voltage proportional to the output current : v cdc = v ref - k · 2 n · r s r · i ref · i out and to connect a resistor r cdc as shown in the fig1 . the resistor r cdc is an external component which gives the user the possibility to set the cdc gain depending on the application . its value is calculated by the following equation : r cdc = k · 2 n · n out n aux · r 1 r cable · r s r · i ref , where , n is the ratio between primary and secondary windings , n out is the number of the windings on the secondary , n aux is the number of the windings on the auxiliary , r cable is the cable resistance and r s is the sensing resistor connected to the power mosfet source . the use of that resistor is a possible way to set the cdc gain depending on the application . in fact , applying the previous embodiments , without r cdc , the same objective can be reached by trimming the constant k value . a signal proportional to the ratio t onsec / t may be generated by exploiting the logic control signal eod that flags the beginning and the end of magnetization phases , for example using the embodiment of the circuit depicted in fig1 . two pulse counters counter generate digital signals corresponding to the duration of the time intervals t onsec and t − t onsec by counting clock pulses while the signal eod and the inverted replica thereof are active , respectively , then a calculation block digital calculator generates a digital signal that represents the ratio t onsec / t , that is converted in a corresponding analog signal vratio by a digital - to - analog converter dac . if the cdc block can be input with digital signals , then the converter dac is not necessary . according to an alternative embodiment , a signal proportional to the ratio t onsec / t may be generated by the circuit of fig1 , that uses three monostable flip - flops for switching three capacitors c , c 1 and c 2 . in correspondence of the leading edge of the signal eod , the charge voltage of the capacitor c is sampled and held on the capacitor c 1 , and the capacitor c is discharged ( signal reset ). the capacitor c is charged again by the current generator iref and its charge voltage is sampled and held on the capacitor c 2 when the signal eod switches low ( that is at the end of each demagnetization phase ). therefore , the charge voltages vc 1 and vc 2 of the capacitors c 1 and c 2 represent the duration of a period and of the magnetization phase , respectively : a divider generates the signal vratio as the ratio v c2 / v c1 . the signal reset used for discharging the capacitor c is substantially a delayed replica of the pulse t , such to zero the charge voltage of the capacitor c substantially immediately after it has been held on the capacitor c 1 . according to an alternative embodiment , the voltage vratio may be generated by integrating the signal eod over a switching period t , as schematically depicted in fig1 . a cdc block suitable for using the voltage vratio for adjusting the reference voltage vref ′ is depicted in fig2 . this cdc block is similar to that depicted in fig1 , but it has an input multiplier instead of an input divider . an embodiment of a switching regulator that employs the cdc block of fig2 and a circuit for generating a voltage vratio proportional to the ratio t onsec / t , such as the circuits of fig1 to 19 , is shown in fig2 . the functioning of this switching regulator is evident in view of the description made referring to fig1 to 16 . furthermore , some to all of the components of the switching regulator of fig2 may be disposed on an integrated circuit ( ic ) die , and the regulated output voltage v out may provide power to a circuit , such as a controller processor , that is disposed on the same die or on a different die . naturally , in order to satisfy local and specific requirements , a person skilled in the art may apply to the solution described above many modifications and alterations . particularly , although the present disclosure has been described with a certain degree of particularity with reference to described embodiment ( s ) thereof , it should be understood that various omissions , substitutions and changes in the form and details as well as other embodiments are possible . moreover , it is expressly intended that specific elements and / or method steps described in connection with any disclosed embodiment of the disclosure may be incorporated in any other embodiment as a general matter of design choice .
7
fig1 illustrates very schematically a control unit which is embodiment in agreement with the principal idea of the invention . the control unit comprises two substrates embodied as printed circuit boards 1 and 2 . the upper printed board 1 is by means of springs 3 , 4 , 5 and 6 resiliently suspended above the printed circuit board 2 , which is installed at a fixed position . the upper printed board is , in a way not shown in detail , connected to the control or measuring handle 7 . furthermore the printed circuit board 1 comprises an only schematically indicated transmitting coil 8 , whereas the lower printed circuit board 2 comprises four receiving coils , which in the fig . are only partly visible and of which only one is indicated by 9 . it will be clear that an outer frame , for instance in the shape of a bin or box can be applied to install the printed circuit board 2 at a fixed position and to connect furthermore the other ends of the springs 3 , 4 , 5 and 6 . various possibilities are , however , conceivable for such a housing . to simplify the drawing and to make the drawing as clear as possible this frame is not indicated in the figures . although in the following description the word control handle will be used which implies that the whole unit is destined to function as control unit , it will be clear that it is also possible to use the unit as measuring unit , in which case the term measuring handle would be more appropriate . in a way , which will be described in more detail later on , the transmitting coil 8 is connected to an oscillator circuit such that by means of this transmitting coil 8 an electromagnetic field is generated . the presence of this field can be detected through the receiving coils 9 which for that purpose are connected to suitable detection circuits which will be described in more detail later on . in the following reference is made shortly to the left , right , front and back receiving coil , whereby in relation to these terms reference is made to the situation illustrated in fig1 . in fig1 furthermore the directions of an orthogonal system of axes is indicated based on which the movements or displacements of the control handle 7 and therewith of the upper printed circuit board 1 in relation to the lower printed circuit board 1 will be explained . in the neutral position the transmitting coil 8 generates an electromagnetic field resulting into an identical signal into each of the receiving coils 9 because the mutually identical receiving coils are all positioned at the same distance and in mutually comparable positions in relation to the transmitting coil . if the knob of the control handle 7 is displaced in x - direction , in other words if the printed circuit board 1 is tilted , taking into account the influence of the suspension springs , around the y - axis in relation to the neutral position indicated by means of a dash - and - dot line , in a way schematically illustrated in fig2 a , then taking into account the transmitting coil generates a constant electromagnetic field , the detection signal in the left hand receiving coil in fig2 a will increase whereas the detection signal in the right hand receiving coil will decrease , and furthermore the signals in both the front coil and the back coil will not or hardly change . if the control handle 7 is displaced in the y - direction , in other words is the printed circuit board 1 tilted around the x - axis , then in a similar way the signal from the front ( or back ) receiving coil will increase whereas the signal from the back ( or front ) receiving coil will decrease , and furthermore the signals in the left hand and right hand receiving coils will mainly remain the same . both during the tilting around y - axis as well as during the tilting around x - axis the four springs 3 , 4 , 5 and 6 take care that the actual tilting point is , at least approximately , not displaced from the neutral position . because of the suspension of the upper printed circuit board 1 by means of four springs as schematically indicated in fig1 it is furthermore possible to move the control handle 7 up and down in the z direction as is schematically indicated in fig2 b . during and upwards displacement of the control handle 7 from the neutral position , indicated by a dash - and - dot line in the figure , the distance between both printed circuit boards 1 and 2 will increase resulting into a decrease of the strength in all receiving coils 9 . a downwards displacement of the control handle 7 in relation to the neutral position will result into a decrease of the distance between both printed circuit boards 1 and 2 , so that the signal strength in all receiving coils 9 will increase proporationally . the suspension of the upper printed circuit 1 by means of a number of springs enables the rotation of the control handle 7 around his own central axis is schematically indicated in fig2 c . in this figure the upper printed circuit board 1 is rotated over an angle φ related to the neutral position which is indicated by a dash - and - dot line . to be able to detect such a rotation the transmitting coil to be embodied such that this rotation causes a change in the flux density in at least one of the receiving coils within the transmitted electromagnetic field . embodiments of such a transmitting coil will be discussed in detail hereinafter . with a correct embodiments of the transmitting coil a rotation will result into a detectable signal into at least one of the receiving coils . because printed circuit boards , one of which is resiliently suspended in relation to the other , are used to realize this joystick , the joystick has a large number of freedom degrees . the joystick is able to carry out rotations around each of the three axis and is furthermore able to make translational movement along the z - axis . in principle it is furthermore possible to carry out translational movements along the x - axis and along the y - axis , but because the user applies an excentrical force onto the control handle in relation to the centre of influence of all the suspension coils 3 , 4 , 5 and 6 the user should have to do his best to create a pure translational movement . however , it is certainly not impossible and such a translational movement falls , certainly in combination with other movements , within the application possibilities of the joystick according to the invention . in many cases the joystick will be used such that a combined movement is carried out , for instance a rotation around the x - axis , combined with a translation in the z - direction . in that case the receiving coils will generate signals which are dependent of the ultimately obtained position of the first printed circuit board in relation to the second printed circuit board . it is also possible to supply the signals , generated by the receiving coils , to a computer in which in the basis of the received signals the type of movements , carried out by the control handle , is determined . it is furthermore possible to embody the electronic circuit such that this circuit generates one or more output signals by means of which the movement , carried out by the control handle , can be identified in a correct way . however , it is also possible in a rather simple manner by adding a third printed circuit board to significantly decrease the necessary electronic circuits or the necessary computer capacity , or even almost completely eliminate the necessary circuits or necessary capacity . fig3 illustrates an embodiment of the control unit according to the invention comprising three printed circuit boards 11 , 12 and 13 . the control handle 14 is both connected to the upper printed circuit board 11 as well as connected to the lower printed circuit board 13 . in the central section of the middle printed circuit board 12 an opening is made , the dimensions of which are sufficient to be able to move the control handle without any disturbance . the upper printed circuit board 11 is resiliently suspended by means of four springs 15 , 16 , 17 and 18 . also the lower printed circuit board 13 is resiliently suspended by means of four springs 19 , 20 ( not visible ), 21 and 22 . it will be clear that instead of these eight separate springs also combined resilient suspension elements can be applied in a way , which will be discussed in more detail hereinafter . the upper printed circuit board 11 comprises a transmitting coil 23 and also the lower printed circuit board 13 comprises a transmitting coil 24 . the middle printed circuit board 12 comprises four receiving coils 25 , which are not all visible and of which only one is indicated by this reference number . both transmitting coils 23 and 24 can be powered such that these transmitting coils are generating oppositely directed fields . the result thereof is that in the neutral position of the configuration no signal is generated in any one of the receiving coils . a rotation of the control handle around the y - axis in a way similar to the rotation illustrated in fig2 a will result into a signal of the one polarity in the left hand receiving coil and the signal of the opposite polarity in the right hand receiving coil , whereas in principle the back and front receiving coil will not deliver any signal . if the control handle is tilted around the y - axis in the other direction then again the left hand and right hand receiving coil will deliver a signal , however , of reversed polarity . a similar combination of signals is obtained during tilting around the x - axis . a translational movement in the z - direction , for instance in the upwards direction , will result in signals of the one polarity from each of the four receiving coils , whereas a translational movement in the z - direction , in the downwards direction , will result into signals of the opposite polarity from all receiving coils . if desired a guiding mechanism can be installed into the opening in the middle fixed position board 12 to guide the control or measuring handle 14 . an example of such a mechanism is illustrated in fig3 a and comprises a spherical body 26 , set into an annular bearing 27 of which the inner wall is adapted to the spherical shape of the body 26 , such that the ball 26 is not able to leave the bearing 27 . the ball 26 comprises a passage in which the control or measuring handle is inserted . the ball 26 is movably contained within the bearing 27 and enables therewith the tilting movement in the x - and y - direction . furthermore the handle 14 is able to slide through the passage in the ball 26 , so that also a z - translational movement is possible . the other mentioned movements are with such a mechanisme rather restricted . on the other hand , however , the movement of the lower and upper board 11 and 13 in relation to the middle board 12 is now very defined . fig4 illustrates a further configuration in which also three printed circuit boards are used , i . e . the printed circuit boards 31 , 32 and 33 . in this case the upper and lower board 31 respectively 33 are installed at a fixed position and the middle printed circuit board 32 is connected to the control handle 34 . to give the control handle 34 the necessary freedom of movement an opening of sufficient dimensions is made in the central section of the upper printed circuit board 31 . the middle printed circuit board 32 is resiliently suspended by means of four springs 35 , 36 ( not visible ), 37 , 38 . the middle printed circuit board 32 comprises a transmitting coil and both the lower and upper printed circuit boards 31 respectively 33 each comprise four receiving coils . also without a detailed description it will be clear that from the signals delivered by the eight receiving coils sufficient data can be derived to draw uniform conclusions about the movement carried out by the control handle 34 . above in general transmitting coils and receiving coils are discussed without giving further information about the shape of these coils . in principle it is possible to embody the transmitting coil as a series circuit of four separate coils which are positioned directly about the separate receiving coils onto the fixed positioned other printed circuit board . therewith in fact four transformers are realized of which the primary windings are connected in series . fig . 5 illustrates at the right hand a top view on a printed circuit board 42 , comprising four pairs of receiving coils 43a , 43b , 44a , 44b , 45b , 46a , 46b . fig5 illustrates at the left hand side a top view on the printed circuit board 41 carrying the transmitting coil 47 . the receiving coils 43a , . . . 46b are in this embodiment shaped as approximately rectangular coils . of course the number of windings can be selected freely by the designer only dependent onto the space and the required field strength . also the shape of the coils is not restricted to the illustrated rectangular shape . the transmitting coil 47 is preferably embodied in the shape of a cross , whereby the larger part of the conductor pattern of each of the legs of this cross is in the operational condition positioned directly above corresponding sections of a pair of receiving coils . with such a non - rotation symmetrical embodiment of the transmitting coil it is possible to detect not only tilting movements around the x - and y - axis and a translational movement in the z - direction , but also a tilting around the z - axis in an unambiguous way . during rotation around the z - axis for instance in the clockwise direction the flux in all the coils 43a , 44a , 45a and 46a will decrease proportional with the rate of rotation , whereas the flux in the coils 43b , 44b , 45b and 46b will hardly or not change at all . in contrast therewith , during a rotation around the z - axis in the anti - clockwise direction the flux through the coils 43a , 44a , 45a and 46a will not or hardly change , whereas the flux through the coils 43b , 44b , 45b and 46b will decrease dependent on the rate of rotation . during a translational movement in the z - direction the flux through all the coils 43a , . . . 46b will increase or decrease in a similar way dependent on the direction of the movement . also translational movements in the x - and y - direction are very well detectable with such an embodiment of the coils . during a translation in the x - direction , for instance to the left in fig5 the flux through the coils 43a and 43b will decrease just as the flux through the coils 45a and 45b . the flux through the coils 4a and 44b will hardly not change whereas the flux through the couls 44b and 46a will decrease . a similar reasoning can be applied for a translational movement in the x - direction to the right and for the both possible translational movements in the y - direction . up to now it is postulated that the movable printed circuit board is suspended by means of four tension springs , which are connected to the four edges of the printed circuit board . however , it will be clear that this is only one of the possible solutions to create a resilient suspension of the printed circuit board . if four tension springs are applied in the way illustrated in fig4 and indicated by 3 , 4 , 5 and 6 , which springs all have the same tension strength , and are positioned such that the direction of the spring force runs through the point where the control handle 7 is connected to the printed circuit board 1 , then a tilting movement around the x - axis can be carried out with the same ease as a tilting movement around the y - axis . however , by selecting the direction of the springs in a different way the tilting or rotation around one of these axes can be made easier than the rotation or tilting around the respective other axis . also a variation in tension strength has influence onto the movement characteristic of the control handle . by a proper choice of the direction of the spring force , the point of attachment and the tension strength of each of the tension springs it is possible to exercise influence onto the movements to be carried out by the control handle . in case there are two movable printed circuit boards in the configuration , as in the case of the embodiment illustrated in fig3 it is furthermore possible to delete a number of the eight springs , illustrated in this embodiment , with the consequence that movements in certain directions will be enhanced , whereas movements in other direction are made more difficult . it will be clear that omitting for instance the springs 15 and 17 as well as 20 and 22 in fig3 will result into an other control behaviour than in case all springs are present . an other possibility to resiliently suspend a movable substrate ( or more movable substrates ) is illustrated schematically in fig6 . the movable printed circuit board 60 with the thereto connected control handle 61 is mounted at the upper end of an helical spring 62 of which the under end is mounted to the section 63 of the housing or frame of the measuring or control unit . this embodiment enables both rotational as well as translational movements , whereby dependent on the dimensions and the characteristics of the spring certain movements can be made easier and other movements can be made more difficult . the oscillator circuit for powering the transmitting coil is preferably installed onto the printed circuit board carrying also the transmitting coil itself . therefore , in the embodiment of fig1 the oscillator circuit is preferably installed onto the printed circuit board 1 and is connected through suitable conducting paths to the transmitting coil 8 . in the embodiment of fig3 for instance two separate , however , synchronized oscillator circuits may be present , one on the printed circuit board 11 connected to the coil 23 and one on the printed circuit board 13 connected to the coil 24 . the result thereof is a fixed configuration of the transmitter as a whole so that all eventual influences of moving parts on the transmitting frequency are eliminated . the oscillator circuit itself has to be powered through a separate multiline cable connected to a fixed positioned power supply source ( for instance a battery ). however , this connecting cable might be a cable of a very flexible type which in practice does not have any noticeable influence onto the movement characteristic of the control handle . if , however , for one reason or another the presence of such a connecting cable between the movable printed circuit board or printed circuit boards and a fixed position within the frame of the control unit meets objections , then it is also possible to realize the transmission of powering energy to the oscillator circuit through high frequency energy transmission from a fixed positioned oscillator unit to the transmitting coil through the air . an example of a movable printed circuit board 51 carrying the transmitting coil 57 and a corresponding printed circuit board 52 carrying the receiving coils 53 , 54 , 55 and 56 , installed at a fixed position , is schematically illustrated in fig7 . the transmitting and receiving coils are in this case embodied by means of one single winding . the fixed printed circuit board 52 carries a further coil 58 which in the operational condition is connected to an oscillator circuit , installed at the printed circuit board 52 itself or installed somewhere else within the housing of the control unit . the coil 58 , which can be considered as the primary winding of a transformer , cooperates in the operational position with a coil 59 carried by the movable printed circuit board 51 and to be considered as the secondary coil of the transformer . this coil 59 is connected to the oscillator circuit which is symbolized by one integrated circuit 60 installed onto the printed circuit board 51 . the output of the oscillator circuit is at his turn connected to the transmitting coil 57 . through the coils 58 and 59 high frequency powering energy is transmitted to the oscillator circuit 60 . the high frequency energy is rectified and the resulting dc voltage is used for powering the oscillator circuit 60 . preferably , although certainly not necessarily , the energy transfer from the fixed printed circuit board to the movable printed circuit board is carried out at a frequency different from the frequency used by the transmitting coil 57 to detect the control handle movements . it is also possible to install the oscillator circuit at the fixed printed circuit board 52 and to transfer the high frequency energy through the transformer 58 / 59 to the transmitting coil 57 , which in this case is directly connected to the transformer coil 59 , onto the same frequency as the frequency of the electromagnetic field generated by the transmitting coil 57 . in that case the configuration of the printed circuit board 51 can be simplified in a manner as illustrated in fig8 . at the right hand side in fig8 a substrate 70 is illustrated which in this case is not embodied as a printed circuit board but as embodied as a massive metal substrate , for instance made of aluminium . this substrate comprises five round openings , i . e . the centrally positioned opening 75 and four openings 71 , 72 , 73 and 74 surrounding said central opening . the openings 71 , 72 , 73 and 74 are through relatively narrow slots 76 , 77 , 78 and 79 connected to the central opening 75 . it will be clear that this board 70 can be fabricated from plate material in one single punch or blank operation . the control handle 80 might be embodied as is illustrated in fig9 . the control handle 80 , which is for instance fabricated from a suitable plastic material , comprises a relatively brought base section 75 . the edge of this base section is through a suitable adhesive adhered to the board 70 . both in fig8 as well as in fig9 the small passages 81 are indicated destined to snap in the tension springs by means of which the plate 70 is resiliently suspended at a distance of the fixed position substrate 82 , shown at the left hand side in fig8 . this substrate can be embodied in a usual manner as a printed circuit board comprising a number of annular conductors 83 , 84 , 85 and 86 operating as receiving coils as well as an annular conductor 87 operating as the primary transformer coil . the integrated circuit 88 symbolizes the receiving circuit which in a nonindicated way is connected to the receiving coils and the integrated circuit 89 symbolizes the oscillator circuit which in a nonindicated way is connected to the primary transformer coil . the primary transformer coil 87 cooperates with the secondary transformer coil 75 , embodied as the central opening in the board 70 . because the board 70 itself is not able to pass any electromagnetic field the whole flux will pass through the opening 75 . because the integrated connection of openings and slots in the plate 70 forms as a whole a short circuited winding surrounded by the material of the plate 70 , the sum of the fields through the five openings 71 and 75 should be equal to zero because the short circuited winding creates a counterfield counteracting the field generated by the coil 87 . that implies , that through each of the four openings 71 until 74 a passage will be guided in the direction opposite the flux direction through the central opening 75 , whereby the total flux through the central opening 75 will be divided into four sub - fluxes each running back through one of the four openings 71 until 74 . in this embodiments the transmitting coils ( s ), the secondary transformer coil and the substrate are integrated into one plate of a suitable material which can be brought into its ultimate shape by means of a very simple machining operation . furthermore all the necessary electronic circuits ( the transmitting oscillator , the receiving circuit and eventual further signal processing circuits and if necessary also the powering unit ) and the connection therebetween can be installed onto the fixed printed circuit board . that implies , that this unit can be fabricated with existing production methods in a very simple way which adds to a relatively low cost price of the measuring or control device . in the following embodiment of the transmitting circuit and the detection / receiving circuit will be discussed with reference to the fig1 until 12 . in said figures similar components are indicated by the same reference numbers . in fig1 the first substrate 90 carrying the transmitting coil 91 and a further coil 92 is illustrated at the left hand whereas at the right hand the second substrate 98 carrying the receiving coils 93 until 97 is illustrated . fig1 illustrates the circuit of a prior art three - points oscillator , comprising the transistor t , the capacitors c 1 , c 2 , the resistor r and the transmitting coil 91 , as well as the second coil 92 which is coupled to the transmitting coil 91 . in the fig1 and 11 the oscillator circuit is , apart from the coils , as one circuit indicated by the dash line 93 . for further details about this oscillator circuit the attention is drawn to the literature , for instance electronics vademecum , kluwer , page f5 . 4 , f2 . 1 . the oscillator circuit is powered through the connectors a and f with the power voltages + v and - v . the terminal d has to be connected to earth level . the coil 92 supplies through the terminals c , d and e two signals with opposite phase to the respective terminals c &# 39 ;, d &# 39 ; and e &# 39 ; of the receiver circuit which is illustrated in fig1 . it will be clear that in this embodiment a flexible five wire connection has to be present between the substrate 90 and the receiver circuit / power supply unit to supply the power voltages to the oscillator circuit and furthermore to receive said reference signals with opposite phase from the coil 92 . in fig1 a very schematic lay out of the receiving circuit is illustrated . the receiving circuit comprises three operational amplifiers a x , a y and a z respectively destined to supply signals corresponding to a rotation around the x - axis , a rotation around the y - axis and a translation in the z - direction . the coils 94 and 96 are in a serial connection with the resistor r 1 connected to one input of the amplifier a x . the coils 93 and 95 are in a serial connection with the resistor r 1 connected to the one input of the amplifier a y . the coil 97 , which is centrally positioned on the substrate 98 is in serial with the resistor r 1 connected to one input of the amplifier a z . each of said amplifiers comprises in a known way the resistors r 1 , r 2 and the capacitor c destined to define the amplification factor of each amplifying stage , i . e . the factor r 2 / r 1 . furthermore said one input of the amplifier a z is through a resistor r 3 connected to one of the power supply terminals . the mutually counterphased signals , derived from the coil 92 , are through the terminals c &# 39 ; and e &# 39 ; supplied to a first pair of diodes d 1 , d 2 , to a second pair of diodes d 3 , d 4 and to a third pair of diodes d 5 , d 6 . these counterphased signals will take care that half of the time the diodes for the x - direction are conducting whereas the other half of the time the diodes of the y - direction are conducting . if the diodes are conducting then the corresponding serial pair of detection coils 94 , 96 or 93 , 95 is connected to the related diode pair and through the coil 92 in a low resistance manner connected to earth level . the other side of said pair of coils delivers in such a case a dc component which is proportional to the ac voltage received through the related pair of coils . the amplitude of this ac voltage is equal to the sum of the ac voltages in both coils . if now one coil of each pair of coils is counterwinded then the sum of both voltages is in fact the difference between both voltages . that implies that in the neutral position , in which both voltages of each pair will receive the same signal , there is no voltage at the input of the related operational amplifier a x or a y . it will be clear that a rotation in the one direction will result into a positive dc voltage and a rotation in the other direction will result into a negative dc voltage at the input of the respective operational amplifier a x or a y . these dc voltage components are amplified by the related amplifier stage with a factor r 2 / r 1 . furthermore the voltage is filtered in these amplifier stages because of the presence of the capacitor c , the value of which is together with the value of the resistors r 2 and r 1 selected such that the frequency sensitivity of each stage is restricted to a desired range . if the unit is used as control unit , operated by a human operator , then for instance a restriction to ± 10 hz can be applied . if the unit is used as measuring unit then it will often be necessary to take into account much higher frequencies . the signal for detecting displacements in the z - direction are received by the coil 97 . because the z - translation does not have a zero reference point a resistor r 3 is necessary to subtract a predetermined dc current from the received signal . the resistor r 3 is therefore used to set the circuit at zero . if an embodiment is used with two receiving substrates , each at one side of the transmitting substrate 90 , then it is possible by means of the two coils 97 on each substrate to make a similar serial circuit as is illustrated in fig1 for both the x - and y - direction . in that case it is not necessary to apply the resistor r 3 . a suitable integrated circuit comprising four operational amplifiers in one single housing is for instance the lm348 . together with a relatively small number of further components which can be installed very easily onto the substrate 98 it is therefore possible to realize a complete receiver / detection circuit which delivers at the output x - out , y - out and z - out the desired output signals . an improvement in the functioning of the circuit can be obtained by adding a passive filter between the serially connected coils and the input of the corresponding operational amplifier stage . such a configuration is only indicated for the x - amplifier stage a x indicated in fig1 . a similar circuit can be used for the y - stage a y and for the z - stage axzx . as appears from fig1 a low pass filter comprising the resistor r 4 and the capacitor c 3 is inserted between the coil 96 and the input of the operational amplifier a x . the further resistor r 5 is operating as closing impedance with low resistance . in the circuits illustrated in the fig1 and 13 a one - sided rectification method using the diode pairs d1 , d2 , etc . is used . however , it is also possible to use double - sided rectification as is illustrated in the embodiment of fig1 . in fig1 only the circuit for the x - direction is illustrated . however , it will be clear that similar circuits can be used for the y - direction , in the circuit of fig1 four coils 94 , 96 , 96 &# 39 ; and ( 4 &# 39 ; are used . fig1 illustrates a possible pattern of conductors on the substrate 98 &# 39 ; to realize these coils . in principle use is made of the same configuration as is illustrated in fig1 at the right hand side thereof . the difference is that each coil comprises two windings , one at the upper surface of the substrate and one at the lower surface thereof , whereby both coils are connected in series . in fig1 only the coil 96 is illustrated comprising a winding 96 &# 34 ; at the upper surface of the substrate 98 &# 39 ; and a winding 96 &# 39 ; at the lower surface of the substrate . both coils are connected in series by means of a connection running through the substrate . a similar series circuit of a winding or part thereof at the upper surface of the substrate together with a winding or part thereof at the lower surface of the substrate can be applied of course in case one of the coils is embodied as is illustrated at the right hand side in fig5 to widen therewith the number of detection possibilities . the configuration around the operational amplifier a x is considered as known to the expert in this field . with this known circuit a double - sided rectifying phase - sensitive detector circuit is realized . if a through connection between the upper coil 96 &# 34 ; and the lower coil 96 &# 39 ; is used together with a separate terminal as is illustrated in fig1 then , certainly in case a very thin substrate 98 is used , the configuration of two identical coils will deliver two identical signals and is therefore very suited to be used in a circuit as illustrated in fig1 . by applying these identical coils the adjustment procedure for the detection circuit can be simplified . it will be clear that above only a number of embodiments of the invention are described . the scope of the adjoining claims is , however , not restricted to these embodiments .
6
[ 0013 ] fig1 shows the basic layout of the invention in the preferred embodiment . light sensors 14 are paired with corresponding light sources 12 . in the preferred embodiment the light sensors can be light sensing diodes while the light sources can be leds . preferably , the light sensors are arranged in a side - by - side manner , as shown in fig1 such that one manual scan of bar code 8 will produce three sequential readings , one in each of the light sensors . preferably the light sensors are evenly spaced apart by spacing 16 , which may vary . in the preferred embodiment , spacing 16 is approximately 2 mm . as scanner 10 is scanned over bar code 8 in direction 18 , light sensors 14 will detect light reflected from the light and dark areas of bar code 8 . light sources 12 are placed such that light sensors 14 will detect light primarily from the corresponding light source 12 . also , the field of view of sensors 14 is very narrow to avoid sensing extraneous light from sources other than the corresponding light source 12 . it is also conceivable to put a separating wall between sensors , so that reflected light can only be sensed by the corresponding sensor , not by an adjacent sensor . each of the light sources 12 is modulated at approximately 100 khz . therefore , each light source 12 acts like a light modulator at 100 khz . in an alternate embodiment , it is also possible to modulate each of the light sources at 100 khz , but at different phases . in other words , there is a phase difference between each led modulating signal . thus , light reflected from the bar code sensed by the sensor is synchronously demodulated at the same phase as the light source modulating signal . therefore , light reflected from the bar code from adjacent light sources does not interfere , because it is modulated at a different phase . this ensures proper operation even when the user operated the scanner improperly by not making good contact between the scanner and the bar code . in such a case , a narrow field of view cannot be assumed . in another alternate embodiment it is also possible , in lieu of modulating light sources 12 sequentially , to sample sensors 14 sequentially while leaving light sources 14 illuminated . this approach produces basically the same results . the signal level of the reflected signal received at the sensors 14 varies depending on whether it is reflected on black code bar or white bar code bar . if it is reflected on a white bar , its signal level will be relatively high . if it is reflected on black bar , the signal will be relatively low , or hardly any signal would be detected . the baseband bar code signal is generated by the reflected light beam on the surface of the bar code . the frequency of the baseband signal is a function of the manual scan speed and the spacing between the bars comprising bar code 8 . typically this bandwidth is less then 3 khz . light sources 12 are modulated at a much higher frequency than the bar code baseband signal frequency to allow for proper edge alignment correction . additionally , the sequential modulation of the light sources 12 avoids interference and background noise caused by ambient light . reflected light signal s ( t ) can be expressed mathematically as follows :. where a is the reflection coefficient of the bar code . a can vary between 0 ( no reflection at all ) and 1 ( fully reflected ). “ w ” is 2 f and f is the modulation frequency . a can be considered as a low frequency (& lt ; 3 khz ) binary signal generated as user scans scanner over the bar code . one possible circuit for this implementation is shown in fig2 . led driver 30 drives light sources 12 based on the frequency of oscillator 28 and controlled by microprocessor 38 . as sensors 14 sense the barcode baseband signal , the demodulation takes place using the same signal as was used to modulate light sources 12 , i . e ., that produced by oscillator 28 . this is possible because of an almost zero time delay between when the light is sent and the reflected light is sensed . the reflected signal received at the sensor is filtered by band pass filter 41 and then amplified by amplifier 39 . amplified signal s ( t ) is multiplied by modulation signal cos ( wt ) in mixer 32 . cos ( wt ) is same signal as the modulating signal for light sources 12 . thus , amplified signal s ( t ) can be synchronously demodulated . this process can be expressed mathematically as shown below . s  ( t ) × cos   wt = a   cos   wt × cos   wt = a / 2 × ( 1 + cos   2   wt ) = a / 2 + ( a   cos   2  w   t ) / 2 the output of mixer 32 consists of two signal components . one is a / 2 , which is the reflection coefficient and the base band signal . another is ½ a cos ( 2 wt ), which is twice the modulation frequency . this component can be easily filtered out by low pass filter 33 after mixer 32 . only base band signal a / 2 is fed to threshold detector 34 . threshold detector 34 is responsible for converting the demodulated baseband analog signal to a binary digital baseband signal . the demodulated baseband signal wave shape is not a clean binary digital signal due to analog signal processing . edges of the waveform will tend to be some what rounded . thus , threshold detector 34 reshapes the wave form into a binary digital wave form . the threshold can preferably be dynamically changed based on the average received signal level . as the scan is taking place , the demodulated and reshaped digital bits are stored in ram 36 . these digital bits have different bit lengths , because bar codes are not binary digital data . each bar code has a different duration . so , digital bits can be said to be pulse code modulated . the pulse code modulated bits have to be converted into true binary bits . thus , a wide width black bar can be converted into 00000000 , wherein the number of zeros corresponds to the width of black bar . a white bar between black bars can be converted into 11111111 , wherein the number of ones corresponds to the width of white bar ( note that a white bar is in reality a gap between black bars ). the converted binary data bits are stored in the buffer for further processing by the microprocessor . once the scan is complete , the data is retrieved from the buffer and two corrections are made thereto , resulting in code 40 . the first correction is a time alignment which needs to be performed due to the spacing 16 between light sensors 14 . because the scan is done sequentially , there will be a time offset between the reading of the bar code by each of the light sensors 14 . microprocessor 38 compares the sampled digital data stored in buffer ram 36 and makes the appropriate time alignment based on data correlation between the data from the three sensors . the second correction is edge correction . edge correction compensates for a non - constant scanning speed . because scanner 10 is a manual scanner , a constant scanning speed cannot be assumed , and the scan speed may vary even during a very short scan time . therefore , the edge transitions for each bit of the signal needs to be aligned by microprocessor 38 . the edge transition alignment is based on prior and after present data bit information . in other words , it is estimated based on the most likely spot of the transition . once the sample data is precisely time aligned and edge corrected , the final determination and correction of any read errors can be made via a bitwise majority vote . time and edge alignment mean that the number of 0 &# 39 ; s and 1 &# 39 ; s are properly corrected to represent the original bar codes . a wide black bar has more 0 &# 39 ; s than a thin black bar and vice versa for a white bar ( gap ). this process is shown in fig3 . in this example a group of 0 &# 39 ; s is represented as a single 0 for simple explanation of the concept , but in essence , it represents actual black bar width in digital form . in fig3 the output from the first sensor 60 shows a scan without read error . output from the second sensor 62 shows error 50 in the third bit , and output from the third sensor 64 shows error 52 in the sixth bit . a bitwise majority voting scheme is used to correct these errors and the corrected result is shown as 66 . corrected bits 54 and 56 reflect the results of the bitwise majority voting scheme . the result of the use of multiple scanning hardware producing multiple samples per scan , modulating the light sources or the sampling of the light sensors at a high frequency to produce the modulated signals , and the majority voting scheme results in a much more reliable barcode reader than in is available in the prior art . while the preferred embodiment of the invention has been discussed , the invention is not meant to be limited to specific components or parameters discussed herein . the scope of the invention is embodied in the claims which follow .
6
in both embodiments of the shallow trench decap structure and process of the invention , patterning of the active si islands is first conducted . here , the shallow trench isolation ( sti ) dielectric , e . g ., an oxide , nitride , oxynitride material or like materials of about 300 nm – 400 nm thick , provides isolation for the two contacts that need to bias the inner and outer electrode of the dt decap . preferably , the sti region comprises an oxide insulator such as low pressure teos ( tetraethylorthosilicate ), high density plasma ( hdp ) oxide or , like oxide . the sti oxide is also used as a hardmask to facilitate silicon trench etching of 2 μm – 3 μm . one concern of making the trench in sti is whether the resist mask would be robust enough to withstand the ( sti ) oxide rie and si rie processes . to circumvent this problem , a borosilicate glass ( bsg ) hardmask may be deposited according to like processes implemented in forming the edram trench . since the trench depth is reduced 2x – 3x , and since the sti dielectric ( oxide ) is also used as a hardmask , the maximum bsg thickness would need to be on the order of about 100 nm – 200 nm . in addition , the sti oxide should not be adversely impacted when the bsg is removed since etch selectivity of bsg to oxide is 200 : 1 . a first embodiment of the shallow trench decap structure 10 and process of the invention , is now described with respect to fig1 ( a )– 1 ( i ). this first process embodiment according to the invention includes the fabrication of the n - well electrode . as shown in fig1 ( a ), the process includes utilizing a process of record ( por ) to form an sti region 12 in a si - containing semiconductor substrate 20 . illustrative examples of si - containing materials that can be employed as the si - containing substrate 20 include , but are not limited to : si , sige , sic , sigec , and layered semiconductors such as si / sige , a silicon - on - insulator ( soi ) or a sige - on - insulator ( sgoi ). thus , as shown in fig1 ( a ), an sti region 12 is fabricated in a substrate 20 with two insulator regions 13 a , 13 b formed on either side of the sti 12 . in the embodiment described , the sti width may range between 0 . 3 μm – 0 . 6 μm and may range in depth from about 2500 å to 5000 å . the two insulator regions 13 a , 13 b are planarized with the surface of the sti and are typically comprised of a pad nitride ( e . g ., sin ) of 1000 å to 2000 å thick , and a thin oxide layer ( e . g ., 50 å to 100 å thick ). as shown in fig1 ( b ), the next step involves etching a trench within the formed sti structure 12 . thus , as shown in fig1 ( b ), a deep trench ( dt ) resist mask layer is first applied and patterned to form a mask 15 having a capacitor trench etch opening 16 formed over the sti region . optionally , under the resist mask layer 15 , a thin layer of bsg ( not shown ) or like material layer may first be deposited to serve as a hardmask . this bsg film would be much thinner than the one used for edram processing , e . g ., to a thickness ranging between 1 kå to 6 kå , and can be removed with a high degree of selectivity with respect to the sti dielectric ( e . g ., oxide ). then , a mask open etch process is applied to form a trench 26 within the sti 12 as shown in fig1 ( c ). while for illustrative purposes an etch having straight profiles is shown in fig1 ( c ), it is understood that a formed trench in the sti may have a taper . further , as shown in fig1 ( d ), a dt si reactive ion etch ( rie ) technique is applied to further extend the depth of the trench 26 below the sti bottom in the si substrate 20 to a target depth of , for example , 1 μm – 3 μm according to the invention . after the trench 26 is etched , as shown in fig1 ( e ), a node sin dielectric process may then be used , as in edram techniques , to fill the trench with the capacitor dielectric , i . e ., node fill , which may comprise sin or other oxide material layer . thus , as shown in fig1 ( e ), the dt resist and optional bsg hardmask layers are first stripped , and a node process implemented to deposit the decap dielectric material layer 32 such as a nitride material ( e . g ., sin ), oxynitride , or oxide material ( e . g ., hfo 2 , alo 2 ) that conforms to the bottom and sidewalls of the decap trench 26 . in the embodiment described herein , a sin node dielectric is deposited to a thickness of approximately 40 å or greater . it is understood that the decap dielectric layer thickness may vary depending upon the capacitance value , dielectric film material , trench depth , trench area , and other design considerations . for example , the depth of the trench may be reduced at a reduced cost , by depositing a high - epsilon ( k ) dielectric . for example , hfo 2 has 5 × the dielectric constant of the por oxynitride that is used in edram designs . if it is desired to have equivalent capacitance , the dt etch may be simply reduced to ⅕ the depth thereby making a 0 . 4 μm – 0 . 5 μm deep trench ), for example . then , as shown in fig1 ( f ), a highly doped n + polysilicon is deposited in the trench 26 and then recessed in the trench to form the decap structure inner electrode 35 . particularly , the deposited n + polysilicon material 35 is deposited within the trench 26 and then a chemical mechanical polish ( cmp ) step is applied to remove the formed node sin laying over the sti and pad sin regions adjacent the trench . the n + polysilicon fill ( polyfill ) 35 is then recessed within the trench so that a surface thereof is at the si active region surface 33 . the recessing of the n + polysilicon within the decap trench 26 is performed using a reactive ion etch process , for example , with the pad sin utilized as a polish stop . finally , after recessing the polyfill , as depicted in fig1 ( g ), the por pad film ( pad sin ) is stripped , for example by an ( hf - based ) nitride deglaze step followed by a hot phosphoric acid step to etch off the pad sin . a pad oxide may remain if a pad stack was provided . in the embodiment shown in fig1 ( g ), the dt decap implements a logic nw doping for the outer electrode 45 . thus , an n - well implant is provided by : forming a resist mask layer on the wafer , and , exposing and opening up the area in which the n - well implant is to be received . an ion implantation technique well known in the art is used to provide the n - well dopant species , e . g ., phosphorus , p , to a targeted depth below the sti level , using energies of up to 1 mev . since the projected range ( rp ) of the logic n - well ( nw ) is usually 1 mm or less , at least half the trench sidewall would be butting against p - type silicon . however , this scenario is actually good for obtaining high capacitance if the trench fill is positively biased ( e . g ., the n - well 45 would be held at ground ) as an n - type inversion layer would be created in the p - type silicon . since the n - doping level of the outer electrode is “ light ” ( e . g ., doping on the order of 1 × 10 17 – 1 × 10 18 / cm 3 ), and if the biasing of the outer plate is at ground , a large depletion region would be created in the nw field . this would require an nw — nw space of about 3 μm or , providing an isolation p - well around decaps as would be fabricated using known techniques . referring now to fig1 ( h ) and 1 ( i ), the formed outer electrode ( n - well ) 45 and inner electrode ( polyfill ) 35 of the dt decap need to be connected to the metal layers to be subsequently formed . as shown in fig1 ( h ), using regular cmos device processing , n + source or drain regions 47 a , 47 b , e . g ., for nfets , may be formed using ion implantation ( i / i ) techniques in the active si ( rx ) layer 20 . first , a resist layer is deposited , patterned , exposed and etched to form contact openings above the n + source or drain contact regions 47 a , 47 b , and above the inner decap electrode 35 . then , an anneal process is performed to form the silicide contact using any metal that is capable of reacting with silicon to form a metal silicide . examples of such metals include , but are not limited to : ti , ta , w , co , ni , pt , pd and alloys thereof . particularly , a metal such as cobalt or nickel is deposited to the exposed silicon , and then an anneal process is performed to form the metal silicide regions , e . g ., cobalt silicide or nickel silicide regions 46 . a thin layer of nitride e . g ., 500 å thick , is then deposited above the exposed n + source or drain regions and silicide regions . a deposition of a bpsg layer 52 is then conducted , patterned with a resist , and etched to open up contact areas 36 within the bpsg layer . the nitride layer above the silicide is etched , stopping on the silicide , so that only the silicide is exposed for the contact areas 36 . fig1 ( i ) illustrates the resulting structure formed after the process of depositing contacts 55 to the inner decap electrode ( to bias the polyfill inner electrode 35 ) as well as on the n + s / d diffusions adjacent to the trench decap ( to bias the outer electrode 45 ). particularly , using well known techniques , a contact material , typically a metal such as tungsten , is deposited in the etched contact areas 36 in the bpsg layer above the formed silicide contacts to form the wire level contacts 55 (“ plugs ”). as the diffusions and top of the trench is silicided , the connection to the decap has a very low resistance since there is no buried strap feature used in this process ( unlike edram where the connection to the trench capacitor is through a n + polysilicon buried strap ). interlevel and intralevel dielectrics and metal layers m 1 , m 2 , formed of tungsten , aluminum or copper are then wired to the plugs 55 using conventional mol and beol processing to contact respectively , the inner electrode 35 and outer electrodes 45 respectively of the decap 10 . in accordance with the first embodiment described herein with respect to fig1 ( a )– 1 ( i ), the only additional costs beyond the por cost is cost of the additional mask needed to form the decap trench and the cost of performing the associated process steps of opening the dt mask open etch , the dt rie step , the node process and the n + polyfill deposition , cmp and recess steps . because the n - well formed is lightly doped , under certain bias conditions , a depletion region may form that affects the performance of the device . for example , if the n - well ( forming the outer decap electrode ) is at ground and the inner decap electrode ( trench ) is at a positive voltage , a depletion region forms that may affect another device , e . g ., pfet area nearby , because of the depletion formed in the n - well . rather than enforcing a ground rule , which would increase the device area , the solution in accordance with the second embodiment is now described . in this second embodiment , the sidewalls of the trench decaps are doped which provides more flexibility in placing decaps within a circuit . in this scenario , it is envisioned that the n - well can be biased at vdd and the trench is at ground voltage . in this configuration , then n - wells can be merged together and one can place p - fets in these vdd - biased n - wells . thus , a substantial reduction in decap area would result as compared to the structure described in accordance with the first embodiment . thus , after the trench has been lithographically defined and etched as shown in process steps described herein with respect to fig1 ( a )– 1 ( d ) are performed , as shown in fig2 ( a )( i )– 2 ( a )( iii ), there are several ways that a thin , heavily - doped n - type diffusion layer may be provided in the “ shallow ” trench decaps . one method of doping the sidewalls of the trench is to perform an angled implant of dopant , e . g ., p or as . for example , as shown in fig2 ( a )( i ), dopant ions 60 may be implanted in the trench sidewalls 27 at an angle of incidence of , for example , 5 degrees or less angle from normal incidence , depending on the depth of the trench . a second method , as shown in fig2 ( a )( ii ), utilizes a gas - phase doping process whereby the open dt trench 26 is exposed to high concentration p or as gases 61 . a third method , as shown in fig2 ( a )( iii ) is to simply fill the trenches with a doped gas 62 , e . g ., asg ( arsenic silicate glass ) or psg ( phosphorus silicate glass ) material layers , and perform an anneal , i . e ., conduct a short high temperature outdiffusion step to outdiffuse the dopant from the silicate glass into the si substrate . in each of the methods described , the highly doped n - type trench diffusion layer 65 ( outdiffused plate ) shown in fig2 ( a )( i )– 2 ( a )( iii ) are formed to a thickness of approximately 500 å of less . since the active si diffusion islands are protected with pad sin , one could avoid many of the processes that are part of the buried plate process presently used in edram . these steps include : ( 1 ) a resist fill of the trench , ( 2 ) a chemical downstream etch ( cde ) of the resist to 1 μm below the si surface , ( 3 ) an oxide etch to remove the doped oxide from the upper region of the dt , ( 4 ) a wet clean of the resist , and , ( 5 ) an oxide capping layer . chosen methods for providing the outdiffused plate , according to the second embodiment , is the implant or gas phase doping procedure as these methods are the least costly . continuing , as shown in steps depicted in fig2 ( b ) through 2 ( f ), the n - well ( decap outer electrode ) is formed by ion implantation , and more particularly , the same exact process steps as described herein with respect to corresponding fig1 ( e ) to fig1 ( h ) are performed to result in a trench decap structure 10 , except for the presence of the outdiffused plate 65 . the presence of the high dopant outdiffuse plate 65 prevents depletion into the substrate , i . e ., thus reducing the device footprint . in accordance with the second embodiment described herein with respect to fig2 ( a )– 2 ( f ), the only additional costs beyond the por cost is cost of the additional mask needed to form the decap trench and the cost of performing the associated process steps of opening the dt mask open etch , the dt rie step , the node process and the n + polyfill deposition , cmp and recess steps and , the outdiffusion process steps which range depending upon the process step implemented . the approaches described herein , provide a very simple increase in decoupling capacitance available for logic based processing and provides a simple well isolation for improved n +/ p + space with no extract process cost . this synergy coupled with the low added process cost and growing need for on chip decoupling capacitance makes this approach very attractive for 9sf and 10sf applications and beyond . the low - cost decoupling capacitor according to further embodiments of the invention is now described herein with respect to fig3 and 4 . in the third embodiment , the trench decaps are made at a lower cost , exhibit higher frequency response while lowering the overall leakage of a decap design and lowering the area set aside for decaps and , are integrated into an silicon - on - insulator ( soi ) designs . there are two distinct “ low - cost ” trench decap structures and process variations described : a first variation described herein with respect to fig3 ( a )– 3 ( j ) depicts a process flow where the trench decap design is quickly and seamlessly integrated into an existing soi technology process . the process calls for an additional two ( 2 ) masks : a dt mask and a block - level n - well mask such that the outer plate of the trench decap can be contacted through existing substrate contacts for soi ( e . g ., doped poly contacts ). in the second variation process described herein with respect to fig4 ( a )– 4 ( j ), a different trench decap process and structure is described whereby metal contacts , such as tungsten ( w ), or other metal materials are used to contact the outer plate of the trench decap . this second unique structure may provide a faster capacitive decoupling response since the tungsten ( w ) resistance is significantly lower than doped substrate contact polysilicon . this second process also calls for the same aforementioned masks , the dt mask and the block - level n - well mask . the two processes share the common physical structure in that a decap trench of , approximately 2 μm – 3 μm deep , is processed . as the decap trench is to be formed to a depth of about 2 μm – 3 μm deep , the number of processes to fabricate the trench decap is greatly reduced compared to conventional edram capacitors . in the decap structure according to the third embodiment , described herein with respect to fig3 ( a )– 3 ( j ), the trench process is performed after the sti regions are physically patterned and filled . that is , this process is polar opposite to “ edram ” processing where the capacitors are formed prior to sti . the process flow described with respect to fig3 ( a ) illustrates the resulting structure of the sti process of record and particularly the formed sti regions 71 a – 71 c extending through to a box ( buried oxide layer ) layer 70 . the sti regions are first patterned and formed by etching through : a pad nitride or nitride stack 74 , the thin active silicon layer 72 and through the thin box layer 70 . etching of the box layer 70 is an optional step , and the sti may be formed to the top of the box layer , i . e ., etched through to the bottom of the silicon layer 72 . the width of the sti region may be about 0 . 3 im to 0 . 6 im , however , the depth may range up to 500 å to 1000 å , but may range up to a depth up to 2500 å . then , the sti is filled with an oxide , e . g ., lp - teos , and hdp oxide , as described herein . after the por sti module , the dt lithography , mask open , and si rie process is conducted . that is , as described herein with respect to fig1 and 2 herein , a resist mask 78 and / or an optional hardmask ( e . g ., bsg ) is applied , and patterned to expose the sti region 71 b and , a deep trench etch is performed through the sti opening in the mask 78 to a depth of 2 μm to 3 μm as shown in fig3 ( c ). subsequent to the formation of the decap trench 76 , the si substrate sidewalls and bottom of the trench 76 are doped to form an outdiffused portion of the outer electrode of the capacitor . this step implements an outdiffusion process and results in the formation of an outdiffused plate 85 forming a highly doped portion of the capacitor outer electrode beneath the buried oxide layer 70 . the trench sidewall doping can be accomplished by either of the following methods : 1 ) an n + type dopant 60 angled ion implantation as shown in fig3 ( d )( i ); 2 ) an n + gas - phase doping 61 of n type dopant , e . g ., p or as dopants , as shown in fig3 ( d )( ii ); and , 3 ) an n + doped glass deposition 62 and anneal as shown in fig3 ( d )( iii ). it is understood that , in alternative embodiments , the process steps for forming the outdiffused plate may be omitted . whether the outdiffused plate 85 is formed or not , the next step is the process of forming the thin capacitor dielectric layer 82 — that is , an oxide or a nitride , such as sin , that conforms to the trench sidewalls and bottom . thus , as shown in fig3 ( e ) and as described in detail herein with respect to fig1 and 2 , a resist strip is first performed and then the node process is performed . next , as shown in fig3 ( f ) and as described herein with respect to fig1 and 2 , a highly n doped polysilicon fill is performed to construct the decap inner electrode 75 . fig3 ( f ) shows the n + poly fill 75 in the decap trench 76 . it is understood that , as part of this process , a cmp is performed and a top portion of the polyfill is then recessed to the top surface of the active silicon layer 72 . then , as shown in fig3 ( g ), after the trench process , the process proceeds to form a bitline contact adjacent to the trench , which comprises steps of punching through an adjacent sti ( or insulator ) area ( s ) 71 a , 71 c and stopping the etch on the bottom substrate , i . e ., it only has to etch the thickness of the active silicon layer 72 and the box layer 70 . according to processes of record for bi module , the etched area ( s ) 83 is ( are ) typically filled with intrinsic ( undoped ) si 93 as shown in fig3 ( g ) and a cmp is performed to planarize and recess each of the filled i - si regions to the surface of the active si layer 72 . it is understood that the steps for recessing the n + polysilicon fill forming decap inner electrode 75 and the i - si may be performed in the same process step . then , as shown in fig3 ( h ), an n - well implant step to form decap outer electrode 95 is performed in the manner such as described herein with respect to fig1 and 2 . the substrate contacts ( plugs ) adjacent to the trench decap are to be used to bias the outer electrode of the trench decap . since the substrate contacts polysilicon plugs 93 are undoped , for the substrate contacts within the trench decap macro , these would necessarily need to be doped n - type . this can be accomplished by n + doping the source / drain regions in the active silicon layer 72 by ion implantation later in the process . however , within the n - well ion implant mask ( not shown ), the implants for the substrate contacts ( plugs ) may be further doped if the n + source / drain diffusions are insufficient to dope the entire poly plug . if necessary , n - type ion implants may then be targeted to depths below the active si layer 72 , e . g ., corresponding to the middle of the box , for example , to guarantee that the whole substrate contact is doped . this ion implantation may be performed during the following n - well ion implantation step or thereafter . thus , to connect the trenches and make them amenable to voltage biasing , the deep n - well implant — like the one used in edram processing , is performed . doses in the range of 10 13 / cm 2 – 10 14 / cm 2 , for example , should provide enough conduction to bias the outer plate ( e . g ., 100 ω / sq – 1000 ω / sq ). the projected range of the n - well implant would only need to be one that is on the order of the soi and box thickness ( e . g ., about 2000 å depth ). if phosphorus ( p ) is used as the n - well dopant , accelerating energies of 200 kev may be sufficient . since the n - well mask is unique to the trench decap macro , other than n - type dopants may be implanted into the substrate contacts 93 to make them more conductive . thus , as shown in the fig3 ( h ), after an oxide deglaze , pad sin etch process , and n - well ion implantation steps , the resulting structure 100 illustrates n + poly plugs 93 contacting the n - well implant 95 which is connected to the outdiffused portion 85 of the outer dt capacitor electrode . after the n - well process , fig3 ( i ) and 3 ( j ) illustrate the remaining processes to create the trench decap uses the por mol module . in fig3 ( i ), the substrate contacts 93 and decap inner electrode poly 75 are silicided 96 and contacted by plugs 98 of a metal material , e . g ., such as tungsten ( w ). the process includes the formation of respective contact holes 97 implementing a dielectric film deposition ( e . g ., a nitride or bpsg ) and a contact hole lithography patterning and etch as shown in fig3 ( i ). m 1 and m 2 metallurgy is then used to follow and finish up the macro as shown in fig3 ( j ). what is described in fig3 ( a )– 3 ( j ) depict the easiest method in that trench decaps 100 can be integrated into existing soi processing technology . in a further embodiment , described herein with respect to fig4 ( a )– 4 ( j ), the deep trench decap 200 can be processed before the sti ( standard ) processing , i . e ., does not require trench formation through sti . in the embodiment depicted in fig4 ( a ), there is formed by process of record a thin active silicon layer 112 atop a box layer 110 formed atop a si - containing substrate 20 . as shown in fig4 ( a ), a pad nitride layer or nitride stack 114 is deposited above the thin active si layer 112 . then , as shown in fig4 ( b )– 4 ( c ), a trench lithography , mask open , and si rie process is conducted . that is , as described herein with respect to fig1 and 2 herein , a resist mask 115 and / or an optional hardmask ( e . g ., bsg ), is patterned to expose a region 116 for forming a deep trench etch . subsequent to the formation of the decap opening 116 , an etch process is performed through the opening in the mask to form a trench 126 that extends through the pad layer 114 , thin active silicon layer 112 and through the thin box layer 110 to a depth of about 2 im to 3 im as shown in fig4 ( c ). subsequent to the formation of the decap trench 126 , the si substrate sidewalls and bottom of the trench are doped to form an outdiffused portion of the outer electrode of the capacitor . this step results in the formation of an outdiffused plate 135 beneath the buried oxide layer 110 forming a highly doped portion of the capacitor outer electrode and implements an outdiffusion process . the trench sidewall doping can be accomplished by either of the following methods : 1 ) an n + type dopant 60 angled ion implantation as shown in fig4 ( d )( i ); 2 ) an n + gas - phase doping 61 of n type dopant , e . g ., p or as dopants , as shown in fig4 ( d )( ii ); and , 3 ) an n + doped glass deposition 62 and anneal as shown in fig4 ( d )( iii ). it is understood that , in alternative embodiments , the process steps for forming the outdiffused plate may be omitted . whether the outdiffused plate 135 is formed or not , the next step is the process for forming the thin capacitor dielectric layer 142 — that is , an oxide or a nitride , such as sin , that conforms to the trench sidewalls and bottom . thus , as shown in fig4 ( e ) and as described in detail herein with respect to fig1 and 2 , any remaining resist strip is first performed and then the node process is performed . next , as shown in fig4 ( f ) and as described herein with respect to fig1 and 2 , a highly n + doped polysilicon fill is performed to construct the decap inner electrode 155 . fig4 ( f ) shows the n + poly fill 155 in the decap trench 126 . it is understood that , as part of this process , a cmp is performed and a top portion of the polyfill is then recessed to the top surface of the active silicon layer 112 . in the next steps in the process flow , shown in fig4 ( g ), a typical sti module process is performed to form two sti structures 131 a , 131 b located on either side of the decap inner electrode 155 . in the sti module process , each sti region is first patterned and formed by etching through a pad nitride or nitride stack 114 , the thin active silicon layer 112 and through the thin box layer 110 . etching of the box layer 110 is an optional step , and the sti may be formed at the top of the box layer , i . e ., etched through to the bottom of the silicon layer 112 . the width of each sti region may be about 0 . 3 im to 0 . 6 im , however , the depth may range up to 500 å to 1000 å , but may range up to a depth up to 2500 å . each sti opening is filled with an oxide , e . g ., lp - teos , and hdp oxide , as described herein . as shown in fig4 ( g ), after the por sti module and a pad nitride strip step ( not shown ), a deep n - well implant step similar to the one used in edram processing , is performed to form the n - well implant regions 145 under each sti region . then , as shown in fig4 ( h ), the bitline lithography , mask open , and si rie process is conducted to form respective openings 141 a , 141 b at each formed sti structure 131 a , 131 b respectively . the etched openings 141 a , 141 b are used to form the metal substrate poly contacts to the decap outer electrode . in fig4 ( i ), the resist 148 used to etch the sti regions in fig4 ( h ) is removed ( stripped ) and a silicide layer , e . g ., a metal silicide , is formed above the entire region of the trench capacitor and the adjacent active silicon regions 112 a , 112 b . silicide is additionally formed at the substrate contact regions ( openings ) 141 a , 141 b . then , a dielectric layer 150 , e . g ., an oxide , or bpsg , is deposited , planarized , lithography patterned and etched to open up the capacitor electrode contact holes 153 above the formed silicide regions 156 . then , in fig4 ( j ) all of the contact holes 153 are filled with tungsten or like conductive material to contact the si underneath the box . then normal beol ( back - end - of - the - line ) and mol processing is performed to connect the formed tungsten plugs to m 1 , m 2 metallurgy layers . advantageously , with tungsten metal contacts 163 formed as part of substrate contacts , the frequency response is higher than the decap structures created with the n + polyfill contacts in the previous embodiment depicted in fig3 ( g )– 3 ( j ). it should be understood that it is possible to eliminate the n - well if there is enough thermal budget such that the outdiffused plate can reach the substrate n + contact . additionally , it has been shown that phosphorus in high concentrations of arsenic dopant will greatly accelerate the phosphorus outdiffusion . an outer plate comprising of these two dopant materials ( p and as ) may be suitable to allow for the n - well elimination . it should be understood that for some applications , the polarity of the electrodes in the decap devices in the embodiments described herein may be reversed , i . e ., p - type dopants may be utilized in the process steps described , without much modification or undue experimentation . as a measure to further reduce costs , the decap 300 of the present invention is implemented in a base logic process consistent with and compatible with logic processing methods and tool set as now described with respect to fig5 ( a )– 5 ( h ). in the embodiment depicted in fig5 ( a )– 5 ( h ), the decap trench is formed in the same processing steps as the formation of the sti regions . that is , the only extra added steps is the patterning and developing a resist layer 302 having an opening 316 upon a formed hard mask oxide layer 313 , a pad oxide layer 310 and / or pad nitride surface layer 312 formed above the si substrate 320 as shown in fig5 ( a ), and then etching a shallow decap trench 326 into the si layer e . g ., below the surface as shown in fig5 ( b ). then the layer of resist is stripped and the base processing for forming the sti region is performed . according to the sti base processing , a new mask is formed by patterning and developing a resist layer 330 including an opening 336 that is about the same width of the sti region to be formed as shown in fig5 ( c ). then , a further etch process , such as a reactive ion etch ( rie ) is performed to etch the si substrate 320 to form sti trench region 340 . as a result of this processing , in the same sti etch step , the depth of decap trench is extended , i . e ., more si is being etched to a depth of about 2 – 3 μm to result in the decap trench structure 326 ′ as depicted in fig5 ( d ). the trench structure shown in fig5 ( d ) is then filled with a hd plasma oxide 327 or like dielectric material and planarized . depending upon a particular application , the resulting structure will form a decap for example , with the formation of an underlying n - well region 350 and provision of a highly doped n - band layer 355 as shown in the structure of fig5 ( e )( 1 ). advantageously , the provision of n - band layer 355 effectively increases the decap capacitance , thus obviating the need for the formation of a heavily doped outdiffused plate as in the other embodiments described herein . alternately , the structure may be used as an isolation region for isolating an n - well region 350 and a p - well region 360 shown in fig5 ( e )( 2 ). further to the forming of decap 300 of the present embodiment , the only other additional cost to the base logic processing is the addition of a second mask 370 as shown in fig5 ( f ) which provides an opening 375 enabling a straight etch , e . g ., rie , to remove the hdp oxide present in the trench while leaving the hdp oxide portions 342 , 343 of the formed sti . once the hdp oxide is removed from the trench , the standard technology for forming the thin decap dielectric layer 382 is performed concurrently with a surface gate oxidation process , e . g ., grown to a thickness ranging between 2 . 0 and 5 . 0 nm . then , a standard gate polysilicon deposition process providing a conformal fill 385 of the decap trench is performed concurrent with base logic standard gate polysilicon deposition and the polyfill is doped with n + material dopant ( as described herein ) to form the inner decap electrode . the resultant structure is shown in fig5 ( g ). preferably , this implantation of n + dopant is also part of the standard logic n + source and drain implant procedure . advantageously , depositing the same dielectric material , e . g ., an oxide , nitride , oxynitride , etc . used for the decap dielectric 382 at the time logic gate dielectric is deposited , incurs no additional cost as this is part of standard base processing . likewise , the polysilicon fill 385 is deposited at the same time logic gate polysilicon is deposited according to standard logic base processing thus , incurring no additional cost . then , in a subsequent processing step shown in fig5 ( h ), the decap polysilicon fill layer is patterned and portions removed by etching the poly over the thin oxide regions and corresponding insulating spacers 395 a , 395 b are formed over the sti regions 342 , 343 according to known techniques . finally , active diffusion regions ( e . g ., source / drain implants ) 390 a , 390 b , e . g ., having implanted n + material dopant materials are formed according to standard processing and concurrently dope the poly 385 that contact the n + doped n - band and n - well regions which form the outer decap electrode . fig5 ( i ) depicts a conceptual top view schematic of a resultant formed decap trenches 300 pointing downward into the silicon for about 2 μm – 3 μm deep forming a high capacitance structure in a small area 400 . it is understood that the amount of decoupling capacitance may be tailored according to number of trenches formed . for example , for a typical nitrided oxide dielectric of 2 . 2 nm in thickness , a trench that is 0 . 1 μm wide with a depth of 1 . 0 μm will result in approximately 25 ff / μm 2 of capacitance . additionally depicted is the formed polysilicon 385 , underlying n - well 350 , active silicon region 398 , and sti 340 regions separating the active silicon . it is understood that spacers separating the outer edges of the polysilicon layers as shown in fig5 ( h ) are omitted in fig5 ( i ). it is further understood that the process and resulting decap structure of the embodiment depicted in fig5 ( a )– 5 ( h ) may be formed in a substrate having an underlying box ( buried oxide ) layer , however , there would be no n - band and additionally , no need for well - to - well isolation with soi structure having a buried oxide . the embodiment of the invention depicted in fig5 ( a )– 5 ( h ) provides a very simple increase in decoupling capacitance available for logic based processing and provides a simple well isolation for improved n +/ p + with no extra process cost . this synergy coupled with the low added process cost and growing need for on chip decoupling capacitance makes the approach of the present invention very attractive for 65 nm node applications and beyond . while there has been shown and described what is considered to be preferred embodiments of the invention , it will , of course , be understood that various modifications and changes in form or detail could readily be made without departing from the spirit of the invention . it is therefore intended that the invention be not limited to the exact forms described and illustrated , but should be constructed to cover all modifications that may fall within the scope of the appended claims .
7
the invention proposes to use , in an integrated circuit , isolation trenches of reduced depth and dimensions so as to produce esd protection devices for the integrated circuit . such protection devices , made under the electronic components , are not detrimental to the integration density of the circuit and make it possible to ensure localized protection of these components . the terms implant and implanted area are equivalent throughout the following description . fig1 is a schematic plan view of a portion of an integrated circuit 9 fabricated on soi , in section at the level of ground planes and implants ( or implanted areas ). the integrated circuit 9 here comprises a cell comprising electronic components 1 and 2 . fig2 is a cross - sectional view of the cell . the electronic components 1 and 2 are produced in a layer of a semi - conducting material , termed the active layer , formed on an insulating layer 92 , this insulating layer 92 being formed plumb with a semi - conducting substrate 91 with doping of type p . in this instance the electronic components 1 and 2 are field - effect transistors of fdsoi type . the components 1 and 2 can also be feds ( for “ field - effect diode ”), fers ( for “ field - effect resistance ”), capacitors or z 2 - fets . the transistors 1 and 2 are for example pmos and nmos transistors respectively . the transistors are generally aligned in a row of cells each including an nmos transistor and a pmos transistor . the nmos transistors of the various cells are then aligned . the transistors 1 and 2 comprise a source , a drain and a channel , and a gate stack produced plumb with the channel . the source , the drain and the channel of the transistors 1 and 2 are made respectively in semi - conducting active layers 15 and 25 . the transistors 1 and 2 comprise respective gate stacks 16 and 26 disposed respectively on the semi - conducting active layers 15 and 25 , plumb with the channel . to simplify the drawings , the detailed structure of the active layers is not represented therein . the transistors of the active layer can comprise a channel of weakly doped semi - conducting material , with a concentration of dopants that is substantially equal to the concentration of dopants of the substrate 91 . the transistors 1 and 2 also comprise respective source and drain electrodes , not illustrated . semi - conducting ground planes 11 and 21 are formed respectively plumb with the transistors 1 and 2 , under the buried insulating layer 92 . the doping of the ground plane 11 is of type p , that of the ground plane 21 is of type n . the ground planes 11 and 21 are biased respectively by semi - conducting implants 14 and 24 . the implants 14 and 24 exhibit respective dopings of type p and n ( and preferably p +, n + dopings respectively ). the biasing of the ground planes 11 and 21 can be performed by way of a bias circuit , not represented here . the implants 14 and 24 are coplanar with the ground planes 11 and 21 . coplanar is understood to mean that it is possible to define a plane parallel to the layer 92 and passing through the zones concerned . semi - conducting wells 12 and 22 are formed respectively , plumb with the ground planes 11 and 21 . the dopings of the wells 12 and 22 are respectively of type n and of type p . the implants 14 and 24 are in contact respectively with the wells 12 and 22 . the implants 14 and 24 thus make it possible at one and the same time to bias the ground planes 11 and 21 , and to form inputs for a device for protection against the electrostatic discharges between two potentials . the wells 12 and 22 are biased respectively by semi - conducting implants 17 and 27 . the implants 17 and 27 exhibit respective dopings of type n and p ( and preferably n +, p + dopings respectively ). the biasing of the wells 12 and 22 can be performed by way of a bias circuit , not represented here . the transistor 1 is here disposed between the transistor 2 and the implants 14 and 17 . in a similar manner , the transistor 2 is here disposed between the transistor 1 and the implants 24 and 27 . a deeply buried well of type n can be made so as to form a separation between the wells 12 , 22 and the substrate 91 with doping of type p . the buried insulating layer 92 , in a manner known per se , electrically insulates the transistors 1 and 2 from their ground plane , from their well , and from the substrate 91 . the buried insulating layer 92 formed plumb with the transistors is here of utbox type (“ ultra - thin buried oxide layer ”). thus , the control of the bias of the ground planes 11 and 21 ( also called back gates ) makes it possible to modulate the respective threshold voltages of the transistors 1 and 2 . the insulating layer 92 exhibits for example a thickness of less than or equal to 60 nm , less than or equal to 50 nm , or indeed less than or equal to 20 nm . the insulating layer 92 can be produced in a manner known per se from silicon oxide . a contact for biasing the substrate 91 is illustrated here , to bias the substrate 91 for example to a ground voltage gnd . deep isolation trenches 61 and 63 are made at the periphery of each of the transistors 1 and 2 . the isolation trenches 61 and 63 extend depth - wise through the insulating layer 92 and into the respective wells 12 and 22 for the transistors 1 and 2 . a deep isolation trench 64 is here made so as to isolate the contact for biasing the substrate 91 . the transistors 1 and 2 furthermore comprise deep isolation trenches 62 . the isolation trenches 62 extend depth - wise through the insulating layer 92 and into the respective wells 12 and 22 for the transistors 1 and 2 , without reaching the substrate 91 . the wells 12 and 22 extend laterally plumb with the implants 14 , 17 and 24 , 27 respectively , and under the isolation trenches 62 . the isolation trenches 62 ensure insulation between the implants 14 , 17 and 24 , 27 respectively . the deep isolation trenches 61 to 64 here advantageously exhibit an identical depth . isolation trenches 13 and 23 are made plumb with the contact between the ground planes 11 , 21 and the implants 14 , 24 respectively . the isolation trenches 13 and 23 are not as deep as the isolation trenches 61 to 64 . the isolation trenches 13 and 23 do not extend as far as their respective wells 12 and 22 . the isolation trenches 13 and 23 here pass through the insulating layer 92 and therefore extend into their respective ground planes 11 and 21 . the isolation trenches 13 and 23 make it possible to improve the insulation between the transistors 1 and 2 and their implants 14 and 24 while enabling the regions 11 and 21 to be biased . the wells 12 and 22 can exhibit concentrations of dopants of between 10 16 cm − 3 and 10 18 cm − 3 . the ground planes 11 and 21 can exhibit concentrations of dopants of between 10 18 cm − 3 and 10 19 cm − 3 . the wells 12 and 22 can extend to a depth of less than 1 μm and , preferably , less than or equal to 700 nm . metallic contacts can be deposited after silicidation directly on each of the implants 14 , 17 , 24 , 27 , in order to allow electrical connection of each of them . advantageously , the implants 14 , 17 , 24 , 27 each exhibit a concentration of dopants at least fifty times , or a hundred times greater than the concentration of dopants of the wells 12 and 22 . for example , the implants 14 , 17 , 24 , 27 exhibit concentrations of dopants advantageously greater than or equal to 5 * 10 18 cm − 3 and , preferably , of between 10 19 cm − 3 and 10 21 cm − 3 . these concentrations of dopants are for example substantially equal to the concentrations of dopants of the source or of the drain of the transistors 1 and 2 . the implants 14 , 24 , 17 and 27 are here made laterally with respect to the transistors 1 and 2 . the implant 14 is biased to a first voltage level e 1 , the implant 24 is biased to a second voltage level e 2 , the implant 17 is biased to a third voltage level e 3 and the implant 27 is biased to a fourth voltage level e 4 . a device for protection against electrostatic discharges is included in the integrated circuit 9 , plumb with the transistors 1 and 2 . the protection against electrostatic discharges is aimed at ensuring protection against the discharges between the voltage levels e 1 and e 2 . this embodiment exhibits reduced sensitivity to accidental triggering ( designated by the term latchup ). fig3 is an electrical diagram of the protection device , of the scr ( for semiconductor controlled rectifier ) type . bipolar transistors b 1 and b 2 are formed . the bipolar transistor b 1 is a pnp transistor and the transistor b 2 is an npn transistor . the emitter is formed by the implant 14 , and is at the potential e 1 ; the base is formed by the well 12 , and is at the potential e 3 ; the collector is formed by the well 22 , and is at the potential e 4 . the emitter is formed by the implant 24 , and is at the potential e 2 ; the base is formed by the well 22 , and is at the potential e 4 ; the collector is formed by the well 12 , and is at the potential e 3 . a thyristor potentially having dual - control is thus formed , between the potentials e 1 and e 2 , the signals e 3 and e 4 being able to be applied to both controls of this thyristor . fig4 is an electrical diagram of an exemplary implementation of the first embodiment . the pmos transistor 1 is here a circuit having to be protected by the transistors b 1 and b 2 . the source of the transistor 1 and its ground plane 11 are connected to a power supply potential vdd of the integrated circuit 9 . the drain of the transistor 1 is connected to a potential of a signal sgn . the transistors b 1 and b 2 here ensure local protection of the pmos transistor 1 against electrostatic discharges between the power supply potential vdd and the signal sgn . vdd is thus applied as potential e 1 , sgn is applied as potential e 2 . a resistor r 1 is made between the collector of b 1 / the base of b 2 and the potential sgn . a resistor r 2 is made between the base of b 1 / the collector of b 2 and the potential vdd . the nmos transistor 2 is here a control circuit for the thyristor formed by the transistors b 1 and b 2 . the transistor 2 has its source connected to the potential sgn , its drain connected to the collector of b 2 , and its ground plane 21 connected to the potential sgn . a resistor r 3 is formed between the gate of the transistor 2 and the potential sgn . upon an electrostatic discharge between the potentials vdd and sgn , the thyristor formed of the transistors b 1 and b 2 is turned on by way of the transistor 2 . an electrostatic discharge between the potentials vdd and sgn is here short - circuited by the thyristor formed , thereby protecting the transistor 1 . the integrated circuit 9 can furthermore advantageously include an additional triggering circuit 3 . the additional triggering circuit 3 illustrated includes a capacitor and a zener diode connected in parallel , between the gate of the transistor 2 and the potential vdd . the values of the resistors r 1 and r 2 can be well resistances , defined in an appropriate manner , by adapting for example the depth of the isolation trenches 62 . the level of the voltages for maintaining the control signals of the thyristor formed can be defined by altering the distance separating the implants 17 and 24 . it will be possible for the resistor r 3 value to be defined by an additional element . fig5 is a cross - sectional view of a second embodiment of a cell for an integrated circuit according to a second embodiment . electronic components 1 and 2 are produced in a layer of a semi - conducting material , termed the active layer , formed on an insulating layer 92 , this insulating layer 92 being formed plumb with a semi - conducting substrate 91 with doping of type p . just as for the first embodiment , the electronic components 1 and 2 are here pmos and nmos transistors respectively , for example of fdsoi type . semi - conducting ground planes 11 and 21 are formed respectively plumb with the transistors 1 and 2 , under the buried insulating layer 92 . the doping of the ground plane 11 is of type p , that of the ground plane 21 is of type n . the ground planes 11 and 21 are biased respectively by semi - conducting implants 14 and 24 . the implants 14 and 24 exhibit respective dopings of type p and n ( and preferably p +, n + dopings respectively ). the implants 14 and 24 are coplanar with the ground planes 11 and 21 . semi - conducting wells 12 and 22 are formed respectively , plumb with the ground planes 11 and 21 . the dopings of the wells 12 and 22 are respectively of type n and of type p . the wells 12 and 22 are biased respectively by semi - conducting implants 17 and 27 . the implants 17 and 27 exhibit respective dopings of type n and p ( and preferably n +, p + dopings respectively ). the implants 14 , 24 , 17 and 27 are here made laterally with respect to the transistors 1 and 2 . the implants 14 and 17 are here made on either side of the transistor 1 . the implants 24 and 27 are here made on either side of the transistor 2 . a deeply buried well of type n can be made so as to form a separation between the wells 12 , 22 and the substrate 91 with doping of type p . deep isolation trenches 61 and 63 are made at the periphery of each of the transistors 1 and 2 . the isolation trenches 61 and 63 extend depth - wise through the insulating layer 92 and into the respective wells 12 and 22 for the transistors 1 and 2 . the transistors 1 and 2 furthermore comprise deep isolation trenches 62 . the isolation trenches 62 extend depth - wise through the insulating layer 92 and into the respective wells 12 and 22 for the transistors 1 and 2 , without reaching the substrate 91 . the wells 12 and 22 extend laterally plumb with the implants 14 , 17 and 24 , 27 respectively , and under the isolation trenches 62 . the isolation trenches 62 ensure insulation between the implants 14 , 17 and 24 , 27 respectively . the deep isolation trenches 61 to 63 here advantageously exhibit an identical depth . isolation trenches 13 and 23 are made plumb with the contact between the ground planes 11 , 21 and the implants 14 , 24 respectively . the isolation trenches 13 and 23 are not as deep as the isolation trenches 61 to 63 . the isolation trenches 13 and 23 do not extend as far as their respective wells 12 and 22 . the isolation trenches 13 and 23 here pass through the insulating layer 92 and therefore extend into their respective ground planes 11 and 21 . the isolation trenches 13 and 23 make it possible to improve the insulation between the transistors 1 and 2 and their implants 14 and 24 while enabling the regions 11 and 21 to be biased . the implant 14 is biased to a first voltage level e 1 , the implant 24 is biased to a second voltage level e 2 , the implant 17 is biased to a third voltage level e 3 and the implant 27 is biased to a fourth voltage level e 4 . just as in the first embodiment , a device for protection against electrostatic discharges is included in the integrated circuit 9 , plumb with the transistors 1 and 2 . the protection against electrostatic discharges is aimed at ensuring protection against the discharges between the voltage levels e 1 and e 2 . on account of the more reduced distance between the implants 14 and 24 , this embodiment exhibits increased sensitivity to electrostatic discharges . fig6 is an electrical diagram of an exemplary implementation of the second embodiment . the nmos transistor 2 is here a circuit having to be protected by the transistors b 1 and b 2 . the drain of the transistor 2 is connected to a potential of a signal sgn of the integrated circuit 9 . the source of the transistor 2 and its ground plane 21 are connected to a ground potential gnd . the transistors b 1 and b 2 here ensure local protection of the nmos transistor 2 against electrostatic discharges between the signal sgn and the potential gnd . sgn is thus applied as potential e 1 , gnd is applied as potential e 2 . a resistor r 1 is made between the collector of b 1 / the base of b 2 and the potential gnd . a resistor r 2 is made between the base of b 1 / the collector of b 2 and the potential sgn . the pmos transistor 1 is here a control circuit for the thyristor formed by the transistors b 1 and b 2 . the transistor 1 has its source connected to the potential sgn , its drain connected to the collector of b 1 , and its ground plane 11 connected to the potential sgn . a resistor r 4 is formed between the gate of the transistor 1 and the potential sgn . upon an electrostatic discharge between the potentials sgn and gnd , the thyristor formed of the transistors b 1 and b 2 is turned on by way of the transistor 1 . an electrostatic discharge between the potentials sgn and gnd is here short - circuited by the thyristor formed , thereby protecting the transistor 2 . the integrated circuit 9 can furthermore advantageously include an additional triggering circuit 4 . the additional triggering circuit 4 illustrated includes a capacitor and a zener diode connected in parallel , between the gate of the transistor 1 and the potential gnd . fig7 is an electrical diagram of another application of an integrated circuit according to the invention . in this embodiment , the transistors 1 and 2 are intended to control the transistors b 1 and b 2 formed , so as to ensure centralized protection for other components , between the potentials e 1 and e 2 . the transistor 2 repeats the detailed configuration with reference to fig3 . the transistor 1 repeats the detailed configuration with reference to fig6 . in this embodiment , the transistor 1 or the transistor 2 can apply a command turning on the thyristor formed . the electrical diagram illustrates additional triggering circuits 3 and 4 , such as detailed with reference to fig3 and 6 . fig8 is a cross - sectional view of a variant of the invention , here applied to the first embodiment . as a variant , a resumption of epitaxy can be performed on the implants 14 , 24 , 17 and 27 , to avoid the difference in altitude with the active layers 15 and 25 . in this example , the implants 14 and 24 extend more deeply than the layer 92 , and more deeply than the isolation trenches 13 and 23 . although , structurally , the thyristors formed and illustrated exhibit two control electrodes , the invention can also be implemented by forming a single control electrode . as a variant , an nmos can be produced on a p - doped ground plane , and / or a pmos can be produced on an n - doped ground plane .
7
traditionally the center of gravity in the head of a field hockey stick has been designed so that it is in line with or below the center of gravity of a field hockey ball , when both the head and the ball are resting on the same plane . the circumference of a field hockey ball is typically about 8 . 8125 to 9 . 25 inches , with a radius to its center of about 1 . 40 to 1 . 47 inches . therefore , the head of a traditional field hockey stick typically has a center of gravity within about 1 . 47 inches from the bottom of the head . as used herein , center of gravity refers to the point at which the entire weight of a body may be considered as concentrated so that , if supported at this point , the body would remain in equilibrium in any position . by raising the center of gravity of the head , the present invention changes the moment of impact on a ball and its resultant launch angle . the higher that the center of gravity of the head is above the center of gravity of the ball , the lower the launch angle on the ball will be . embodiments of the present invention raise the center of gravity in a field hockey stick head by one or more of the following methods : 1 ) removing material from a part of the head ; 2 ) adding material to a part of the head ; 3 ) repositioning or redistributing material in the stick , such as in the areas of the head and the throat ; 4 ) using two or more materials with different mass or density properties in the head ; and 5 ) combinations thereof . composite field hockey sticks are traditionally manufactured by a process referred to as bladder molding , which uses an air bladder , a two - part female mold , composite material , and resin . the bladder is inflated , thus creating pressure to force the composite and resin against the mold until it cures . this process results in a hollow hockey stick . according to an embodiment of the present invention , fig2 illustrates an example of how to raise the center of gravity of a composite field hockey stick head by taking advantage of the hollow area inside the head . by strategically placing contours in the molds , the present invention shifts where the composite fills the mold . thus , by not allowing the bottom portion of the head to fill with composite , the mass of the head is disposed higher on the head . to further enhance the reallocation of mass in the head , extra material , such as more resin , can also be added to the head before or after molding . as shown in the example of fig2 , one embodiment of the present invention provides a field hockey stick 200 having a head 206 with one or more depressions 203 in its surface . in this example , head 200 has three depressions 203 , which are generally oval in shape . the outside and inside ovals shown for each depression 203 indicate generally where each depression begins to descend ( outside line ) and then levels out somewhat ( inside line ) to form the base of the depression . fig3 illustrates a side view of field hockey stick 200 , showing the depression 203 nearest the toe 208 . the depressions could , of course , be formed in many different numbers and shapes , for example , having a single rectangular depression with planar sloping walls , instead of rounded walls . the depressions 203 in head 206 minimize the mass of the lower portion of head 200 , and therefore raise the center of gravity of head 206 to above the traditional center of gravity that is in line with the center of gravity of a field hockey ball . line 214 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 206 is disposed , according to an embodiment of the present invention . for example , with depressions 203 , the center of gravity of head 206 could be disposed at about 1 . 5 inches from the extreme end 209 of head 206 . the placement of depressions 203 raises the center of gravity of head 206 , such that the center of gravity of head 206 is higher in relation to a ball struck by head 206 , in comparison to traditional field hockey sticks . this higher center of gravity helps minimize the loft imparted on the ball . in one embodiment , depressions 203 are disposed within about 1 . 47 inches from end 209 . according to a particular implementation of the present invention , the center of gravity of head 206 is above a line drawn halfway between the highest point 210 of toe 208 and the extreme end 209 of head 206 opposite to point 210 , when the distance between end 209 and point 210 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 209 . fig4 illustrates another embodiment of the present invention in which the mass of the throat of a field hockey stick is reduced and shifted toward the upper portion of the head . as shown in this example , a field hockey stick 400 includes a depression 411 in the surface of its throat 404 . depression 411 can be disposed in throat 404 closer to head 406 than to a handle ( not shown ) attached to throat 404 . depression 411 can be disposed either in the flat playing side of throat 404 or , as shown in fig4 , in the round non - playing side of throat 404 . depression 411 could be oval - shaped as shown in the example of fig4 . the outside and inside oval - shaped lines shown for depression 411 indicate generally where depression 411 begins to descend ( outside line ) and then levels out somewhat ( inside line ) to form the base of the depression 411 . fig5 illustrates a side view of field hockey stick 400 , further showing the exemplary shape of depression 411 . depression 411 could , of course , be formed in many different numbers and shapes , for example , having multiple tear - shaped depressions . disposing depression 411 in throat 404 removes mass from throat 404 in the area just above the head 406 , and redistributes this removed mass to the upper portion of the head 406 . line 414 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 406 is disposed , according to an embodiment of the present invention . for example , with depression 411 , the center of gravity of head 406 could be disposed at about 1 . 5 inches from the extreme end 409 of head 406 . adding the mass to the top portion of head 406 raises the center of gravity of head 406 . consequently , head 406 can strike a ball with a higher center of gravity and minimize loft on the ball . according to a particular implementation of the present invention , the center of gravity of head 406 is above a line drawn halfway between the highest point 410 of toe 408 and the extreme end 409 of head 406 opposite to point 410 , when the distance between end 409 and point 410 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 409 . fig6 and 7 illustrate a further embodiment of the present invention in which a field hockey stick 600 has both a depression 611 in its throat 604 and also one or more depressions 603 in its head 606 . as discussed above in reference to fig2 - 5 , depression 611 and depressions 603 redistribute mass of the field hockey stick 600 to the upper portion of its head 606 . having mass redistributed by both depression 611 and depressions 603 accentuates the center of gravity situated in the upper portion of head 606 . fig8 - 9 illustrate alternative embodiments of the present invention having different numbers and shapes of depressions on the head of a field hockey stick . for example , fig8 illustrates a field hockey stick 800 having a head 806 with a single irregularly shaped depression 803 in its extreme end ( opposite to the handle , not shown ). as another example , fig9 illustrates a field hockey stick 900 having a head 906 with five roughly triangular depressions 903 . in a further alternative embodiment , instead of or in addition to removing and redistributing mass of a field hockey stick , mass could be added to the stick . for example , a metal ( e . g ., lead ), thermoplastic elastomer ( tpe ), or other material could be attached to the upper portion of the head of the stick . for example , a plug made of a second material could be embedded ( e . g ., by laying up the plug ) in the upper portion of the head . this additional material would raise the center of gravity of the head . fig1 illustrates an example of this embodiment , in which a field hockey stick 1000 has a head 1006 with a mass 1050 added to the upper portion of the head . line 1014 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 1006 is disposed , according to an embodiment of the present invention . for example , with mass 1050 added , the center of gravity of head 1006 could be disposed at about 1 . 5 inches from the extreme end 1009 of head 1006 . according to a particular implementation of the present invention , the center of gravity of head 1006 is above a line drawn halfway between the highest point 1010 of toe 1008 and the extreme end 1009 of head 1006 opposite to point 1010 , when the distance between end 1009 and point 1010 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 1009 . another alternative embodiment of the present invention provides a field hockey stick with perimeter weighting , while still raising the center of gravity of the head . this perimeter weighting can improve the feel and control of the stick . as an example , fig1 illustrates a field hockey stick head 1106 having a distal member 1102 and a depression 1104 . as described above , depression 1104 enables the redistribution of mass to the upper portion of head 1106 to raise the center of gravity . at the same time , distal member 1102 provides a mass at the end of head 1106 that affords a perimeter weighting for the field hockey stick . although fig1 shows distal member 1102 in one particular form , many different forms of perimeter weight could , of course , be used , such as flanges , ribs , rims , or plugs . plugs could be made , for example , of material heavier than the remaining material of the head . an embodiment of the present invention uses composite materials to construct a field hockey stick having a top weighted head . the composites enable a gradual redistribution of the mass of the field hockey stick , while still providing the requisite degree of strength in the areas from which mass is moved . for example , with the embodiment providing a depression in surface of the round throat back , the mass in the throat can be moved downward to the head with gradual , undulating shapes , leaving a relatively thin area where the mass is removed that is still structurally strong enough to withstand the rigors of the game . the gradual reshaping and redistributing of material also enable the provision of cross sectional dimensions that comply with the traditional two - inch ring test . although discussed primarily in the context of composite field hockey sticks , one of ordinary skill in the art would appreciate that the present invention could apply equally well to field hockey sticks made of other materials , such as wood . in such cases , the throat and head depression ( s ) would be formed as appropriate for the material . for example , depressions could be carved out of a traditional wood field hockey stick . a further embodiment of the present invention achieves a higher center of gravity by varying the material composition of the head . for example , the lower portion of a head could be made of a first material , and the upper portion of the head could made of a second material that is heavier than the first material . in this manner , the center of mass or gravity could be raised on the head without necessarily using depressions ( as in fig2 ) or adding a mass ( as in fig1 ). in the case of a composite stick , for example , lighter fibers could placed in the lower portion of the head , with heavier fibers located in the upper portion of the head . heavier materials could also be laid up within the fibers to provide areas of greater mass in the upper portion of the head . similarly , plugs made of heavier or lighter materials could be strategically positioned in the head to provide a raised center of gravity . thus , the top weighted field hockey sticks of the present invention provide a player with improved comfort , feel , and playability . in particular , the present invention raises the center of gravity of a field hockey stick head to minimize loft and impart an improved feel when striking a ball with the stick . the foregoing disclosure of embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many variations and modifications of the embodiments described herein will be apparent to one of ordinary skill in the art in light of the above disclosure . the scope of the invention is to be defined only by the claims , and by their equivalents . further , in describing representative embodiments of the present invention , the specification may have presented the method and / or process of the present invention as a particular sequence of steps . however , to the extent that the method or process does not rely on the particular order of steps set forth herein , the method or process should not be limited to the particular sequence of steps described . as one of ordinary skill in the art would appreciate , other sequences of steps may be possible . therefore , the particular order of the steps set forth in the specification should not be construed as limitations on the claims . in addition , the claims directed to the method and / or process of the present invention should not be limited to the performance of their steps in the order written , and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the present invention .
0
fig2 illustrates an igniter 12 used in the prior art . an electrical connector ( not shown ) is threaded onto threads 21 , and contains an electrical contact ( not shown ) which mates with the end 24 of electrode 27 . insulator 30 isolates electrode 27 from the shell 33 of the igniter 12 . end e of the igniter 12 is shown in fig3 and 4 . a very simplified explanation of the physics involved in plasma generation will be given . in operation , a high voltage is applied to the electrode 27 , thereby creating a voltage difference , or potential difference , v between points p 1 and p 2 in fig3 . the electric field in that region equals the potential difference v divided by the distance d between the points p 1 and p 2 . for example , if the voltage is 20 , 000 volts and the distance d is 10 millimeters , or 0 . 01 meter , then the electric field equals 20 , 000 / 0 . 01 , or 2 million volts per meter . the electric field is designed to exceed the dielectric breakdown strength of the material , or medium , lying between points p 1 and p 2 . that material is a mixture of air plus fuel . however , the field does not exceed the breakdown strength of insulator 30 , and that strength exceeds that of the air - fuel mixture . when breakdown occurs , the electric field strips electrons away from the atoms in the medium , producing positively charged ions and free electrons . the electric field drives the free electrons in a direction parallel with the electric field . however , during that movement , those temporarily free electrons will collide with other ions . also , thermal motion of the ions and electrons will also bring them together in collisions . in the collisions , the electrons will be captured by the ions , and will drop to a lower energy state , releasing heat and light , in the form of an electric arc which is called a plasma , which is indicated as lightning bolt 40 in fig4 . this process continues as long as the electric field is present . the inventors have observed one result of the operation just described . as indicated in fig5 , the insulator 30 becomes eroded from the phantom shape 50 to the curved shape 53 . in addition , the electrode 27 becomes eroded from the phantom shape 56 to the solid shape 59 . corners 33 a also become eroded . the inventors believe that one or more of the following agencies are responsible for the erosion . one agency is the corrosive nature of the plasma : free electrons are very reactive , and seek to bind to any available atoms or ions which are nearby . also , the generation of free electrons from oxygen , which is present in the air , creates ionized oxygen , which is also highly reactive . a third agency is that the plasma creates a high - temperature environment . a high temperature , by definition , represents agitated atoms and molecules with high velocities . high - velocity atoms and molecules react more readily with stationary objects when they collide with the objects . possibly a fourth agency is the fact that the plasma generates high - frequency photons , in the ultra - violet , uv , and perhaps into the x - ray regions of the spectrum . it is well known that uv and x - radiation can damage numerous types of material . irrespective of the precise causes of the erosion , the erosion illustrated in fig5 eventually causes the igniter 12 to eventually stop functioning . a primary reason is illustrated in fig6 . previously , prior to the erosion , voltage was applied between points p 1 and p 2 in fig6 . however , after the erosion , point p 2 has effectively moved to point p 3 . distance d has now become longer distance d 2 . the electric field , which causes the ionization and thus the plasma , is now weaker . continuing the example given above , if distance d 2 is 20 millimeters , then the electric field becomes 20 , 000 / 0 . 020 , or one million volts per meter , half its original value . eventually , distance d 2 becomes so great that the electric field does not reliably exceed the dielectric breakdown strength of the air - fuel mixture , and ionization ceases to occur . fig7 illustrates one form of the invention . an auxiliary electrode 72 is embedded in the insulator 75 . the tip 78 is covered by the insulator - material in region 81 , as indicated by the insert 84 . auxiliary electrode 72 may be connected to the shell 33 , as at region 90 . initially , current enters electrode 27 as indicated by arrow 84 , jumps to the shell 33 through the plasma 85 , and exits the shell 33 into the engine , through multiple paths , such as through its mounting threads , as indicated by arrow 86 . as erosion occurs , the insulator 75 departs from its initial shape indicated by phantom lines 92 in fig8 . tip 78 of the auxiliary electrode 72 now becomes exposed . now , when a high voltage is applied to the igniter , two paths exist for a plasma to follow . one is the usual path p 5 in fig9 . the other path is indicated as p 6 of fig9 , and runs from the central electrode 27 to the now - exposed auxiliary electrode 72 . restated , two current - return - paths are available to the central electrode 72 . path p 5 runs to the shell 33 , in the usual manner . path p 6 runs to the now - exposed auxiliary electrode 72 . eventually , further erosion will lengthen path p 5 , and cause plasma formation along that path to terminate . that is , path p 5 in fig9 initially can be represented by distance d in fig6 . after sufficient erosion , path p 5 in fig9 will be represented by distance d 2 in fig6 , and , as explained above , no plasma will be generated along path p 5 when distance d 2 becomes sufficiently large . however , auxiliary plasma path p 6 is still available in fig9 at this time . a plasma can still be generated , and the lifetime of the igniter has been increased . the preceding discussion presented the auxiliary electrode 72 in fig7 in the form of a rod . fig1 illustrates such a rod in perspective view , surrounded by insulator 75 . in an alternate embodiment , a cylinder is used . fig1 is a cut - away view of one embodiment . central electrode 27 is surrounded by an insulator 100 , which itself is surrounded by a conductive tube or cylinder 103 , which is then surrounded by another layer of insulator 105 . fig1 illustrates the system in cross - sectional view , with similar numbering . fig1 illustrates the insulator 100 in its initial configuration , after manufacture or just after installation . a tip 110 of central electrode 27 is exposed , and surrounded by the conical surface 113 of the insulator 100 . cylindrical auxiliary electrode 103 is embedded within the insulator 100 , and no tip or edge is exposed , as indicated by distance d 8 in fig1 . the preceding discussion stated that the auxiliary electrode 72 may be connected at region 90 in fig7 . in another embodiment , the auxiliary electrode 72 of fig1 is also connected to ground , but through a detector 150 . detector 150 looks for a current in auxiliary electrode 72 . current detectors are well known . if no current is detected , it is inferred that the auxiliary electrode 72 is still embedded within insulator 75 , as in fig7 , and is electrically isolated from central electrode 27 . in contrast , if a current is detected , it is inferred that the auxiliary electrode has become exposed through erosion , as in fig9 . the detected current is attributed to a plasma following path p 6 . when the current is detected , detector 150 issues a signal , sets a flag , or otherwise indicates the inference that erosion has exposed auxiliary electrode . a human technician at that time , or a prescribed time afterward , replaces the igniter . an alternate mode of detection is to remove the igniter and visually examine the end corresponding to end e in fig2 . if a smooth surface of the insulator 100 is seen , as in fig1 , then it is concluded that the igniter is still functional . however , if the auxiliary electrode 72 is seen , as in fig8 , then it is concluded that replacement may be required . in another embodiment , the auxiliary electrode is designed to become exposed , and then to erode rapidly . fig1 , viewed left - to - right , illustrates first a newly installed igniter 160 . after a period of usage , igniter 165 exposes its auxiliary electrode 72 . now a plasma p 6 extends to the auxiliary electrode 72 . however , as stated above , the auxiliary electrode 72 is designed to erode rapidly . for example , as insert 170 indicates , the auxiliary electrode 72 is fabricated with a pointed end . plasma 6 causes the pointed end to become rapidly eroded , as indicated by the small particles in frame 170 . this operation causes a specific sequence of two events . one is that , when the auxiliary electrode becomes first exposed , a current passes through the it . the current is detected , as by detector 150 in fig1 . next , after the auxiliary electrode fractures or erodes , no current passes through it . one reason for this sequence is illustrated in fig1 . initially , the voltage v spans distance d 9 , creating an electric field equal to v / d 9 . after fracture or erosion , the same voltage v spans distance d 10 . the electric field equals v / d 10 , a smaller value . the latter electric field is insufficient to create a plasma , while the former is . in one embodiment , the occurrence of the two events just described occurs prior to the termination of the lifetime of the igniter . thus , that termination is signalled by the occurrence of a current through the auxiliary electrode 72 , followed by a termination of that current . the onset of the current indicates the approach of the termination of the lifetime , but with time remaining to operate the engine . the subsequent termination of the current indicates that less time remains , and that replacement of the igniter becomes more important . fig1 illustrates one embodiment of the auxiliary electrode 72 . a neck , or groove , 190 is provided , which facilitates the breakage schematically illustrated in the insert 170 in fig1 . the groove 190 is a region of mechanical weakness intentionally built into the auxiliary electrode 72 . prior to the erosion indicated in fig8 , that weakness is not important , because mechanical support to the electrode is supplied by the insulator 75 . the discussion above stated that a high voltage is applied to electrode 27 . it is possible that a low voltage applied to the electrode 27 can accomplish the same function of generating a plasma . numerous substitutions and modifications can be undertaken without departing from the true spirit and scope of the invention . what is desired to be secured by letters patent is the invention as defined in the following claims .
7
the invention provides a device making it possible to indicate to the spectacle wearer that the distance to the close vision working plane is unsuitable . in the remainder of this description , the invention is described in a first application in which the invention discloses prescribing progressive lenses for children suffering from myopia . it also discloses , in this case , in order to ensure a correct close vision distance to the work , the provision of a telemetry device on the frame . as progressive lenses , unlike bifocal lenses , do not have a close vision region that is clearly identifiable by the wearer , the invention allows the spectacle wearer to know if the distance to the close vision working plane is correct , in other words if he is using the close vision region effectively for close vision work . fig1 shows , diagrammatically , a spectacle frame accorded to the invention . frame 1 has at least one progressive lens 2 or 3 , in other words a lens having a power that continuously varies between a power value that is adapted to far vision and a power value that is adapted to close vision . it additionally has telemetry means 5 for measuring the distance to the point the spectacle wearer is looking at , or the distance between the working plane and the lens in the frame . in the embodiment of fig1 the telemetry means comprise infra - red means and , more specifically , an infra - red emitting diode and a sensor sensitive to infra - red ; for the telemetry means one can employ a component such as the one sold by the japanese company sharp under reference gp2d05 . this component has a 2 - level output , supplying a voltage of a different value depending on whether the distance measured is greater or less than a reference value . this reference value can be adjusted by means of a potentiometer . one can also employ other telemetry means apart from the component specified ; the telemetry means can supply a signal that is representative of distance , and not a 2 - level signal ; they can also employ other types of measurement apart from infra - red for measurement in another range of wavelengths , measurement of pupil position , or yet again ultrasound measurement . fig1 additionally shows a housing 7 which is connected to the telemetry means and which , in the embodiment shown in the fig ., contains the power supply for the component used , as well as furnishing the clock signal applied to the imput of the component ; the said clock signal times the measurements done by the telemetry device . a frequency of 2 hz is suitable . the telemetry means can set off an alarm when the wearer is too close to the working plane . this alarm allows optimal use of the progressive lens , by inciting the spectacle wearer to return to a natural position , which is comfortable , for close vision . the alarm is advantageously set off when the distance measured by the telemetry means is less than a predetermined reference distance ; a value of 20 to 50 centimetres for the reference value is suitable . it is also possible to allow this distance to be adjusted , for example allowing adjustment by the optician who supplied the frame , as a function of the spectacle wearer &# 39 ; s age and morphology . the optician could , for example , set the value of the reference distance equal to the so - called harmon distance . this distance corresponds to the distance between the tip of the elbow and the index finger - thumb junction of the spectacle wearer . according to harmon , this distance is ideal for close vision work . in the embodiment of fig1 a potentiometer for adjusting the reference distance is provided in the housing 7 . the alarm can be of any nature , be it visual , audible , tactile or otherwise . in the preferred embodiment , a visual alarm is employed which has the advantage of being able to be used without being a nuisance in public , and for example in the classroom . this alarm can consist of two light - emitting diodes 9 and 10 arranged on the frame , so they can be readily seen by the spectacle wearer . these diodes can flash at the clock frequency , using a control device in the housing 7 . it is further advantageous to provide a time delay to avoid setting off the alarm when an object briefly passes between the frame and the working plane ; such a passage of an object can be detected by the telemetry means , leading to a distance being measured that is less than the reference distance mentioned above . in order to avoid setting off the alarm unnecessarily , it is possible to provide a time delay . in this way , the alarm is only set off when the distance measured remains below the reference value over a predetermined period . a duration of some three seconds is suitable and has proved to be greater than the habitual duration of a brief passage of an object between the frame and the working plane . fig2 is a circuit diagram of one embodiment of the invention . the diagram shows the component gpd05 , identified by reference 12 , having four terminals : the first terminal vin is connected to the output of an oscillator constituted by a logic gate 14 of the trigger or schmidt trigger ( hysteresis comparator ) type , by a capacitor 18 and a resistor 16 . the second terminal of component 12 is for power supply and is connected to the supply voltage vcc . the third terminal is the ground terminal gnd , and is connected to ground . the fourth terminal is the output terminal supplying the output signal . this is connected to the time delay system constituted by a resistor 20 and a capacitor 26 . the mid - point of these components feeds the input to two schmidt triggers acting as buffers , which supply the diodes . the operation of the circuit in fig2 is as follows . when the distance measured by the telemetry means is less than a reference distance , the fourth terminal provides an output signal which oscillates at the frequency of the signal applied to the first terminal , between supply voltage and zero volts . the diodes are not yet powered as the time delay system is operating ( charge on capacitor 26 ) . as long as capacitor 26 is not charged , the residual voltage from filtering does not enable triggering of the schmidt triggers , thereby not activating the diodes . when the capacitor is charged , the flip - flops are triggered , and the diodes flash . if the measured distance is greater than the reference distance , terminal 4 provides a continuous signal of value vcc . the output from the schmidt triggers is consequently a value equal to the ground voltage . in this case , the diodes are not powered . the invention consequently makes it possible , when a distance to the working plane is too small , to indicate , with the aid of the alarm , that the wearer should change position ; thus , when the spectacle wearer starts working in close vision , and comes too close to the working plane — a well - known tendency of myopia sufferers , he or she is alerted and can change position . in this way , in the example of a child who has been prescribed progressive lenses , the child is incited to utilize the close vision region of the progressive lens or progressive lenses . we shall now describe the prescription protocol according to the invention . as indicated above , the invention preferably applies to myopic children , around the age of six to eight , when the signs of acquired myopia start to appear . progressive lenses having a suitable correction are prescribed for the child . the spectacle wearer is supposed to wear the spectacles of the invention for close vision work , and notably for reading and writing . he is told that he should raise his head to utilize the lower portion of the lenses for all close vision work , and that an alarm will warn him when the distance is too short ; if appropriate , the optician will adjust the reference distance as a function of the child &# 39 ; s morphology , and he can for example base this on the harmon distance . the invention applies not only to the example described in detail above for prescribing progressive lenses for a child , but also to all situations in which it is appropriate to warn a spectacle wearer that the distance to the working plane in close vision is incorrect . it can be used with single - focus or bifocal lenses or , as in the above example , with progressive lenses . in all cases , unlike the prior art , the lenses employed in the invention are corrective lenses , the characteristics of which do not vary over the course of time . they can be organic or inorganic lenses . obviously , the present invention is not limited to the examples and embodiments described and illustrated , but may be the subject of numerous variations available to the person skilled in the art . thus , in the preferred embodiment , the telemetry means are fastened onto the frame . one can , more generally , render these means integral with the head of the spectacle wearer without necessarily mounting them on the frame ; thus , one can employ another support , for example an elastic headband or yet again provide releasable mounting means for the telemetry means on the frame . the invention can , in this case , comprise a kit or set of preassembled parts , with a frame , and telemetry means with an alarm . it is also possible to utilize components other than those described above ; all the telemetry , alarm , and electronic means can be integrated into a housing carried by the frame ; the power supply can be arranged on the frame , or alternatively be separate from the frame and electrically connected to the telemetry means .
6
[ 0027 ] fig1 shows a situation in which the invention can be utilized . a mobile telephone 1 is connected to a personal computer 2 , which is shown in the figure as a laptop computer , via a communications link 3 . the actual communication takes place between a transceiver 4 arranged on the mobile telephone 1 and a transceiver 5 arranged on the computer 2 . the type of the communications link 3 can be selected from several different types , such as a wired connection , a short - range radio link or an infrared link . in the following an infrared link implemented according to the well known irda ( infrared data association ) protocol stack will be used as an example , and thus in the example the transceivers 4 and 5 are optical transceivers . [ 0028 ] fig2 shows an example of the hardware configuration of the infrared transceiver 4 and its relating control circuitry 6 . the infrared transceiver 4 includes a transmitter diode 7 , which will typically be an infrared light emitting diode , and a receiver diode 8 , which will typically be a photo diode . the transceiver also contains a pulse encoder and a pulse decoder . the control circuitry 6 is normally implemented in an asic , which could also contain other control circuits for the mobile telephone 1 . one part of the control circuitry 6 is the ir block 9 . this block converts a byte stream into a pulse train for transmission via the pulse encoder and the transmitter diode 7 , and it also converts the pulses received via the receiver diode 8 and the pulse decoder into a byte stream . the data , i . e . the pulse train , from the ir block 9 to the transmitter diode 7 are transferred via the line tx , while data from the receiver diode 8 to the ir block are transferred via the line rx . power to the infrared transceiver 4 is supplied from a battery ( not shown ), and , as shown , power may be supplied separately to the receiver and transmitter parts of the transceiver . in the figure the power to the transmitter part is supplied through the switch 10 that may be controlled from the control circuitry 6 . in portable devices it is important to improve the standby time or operating time between each recharging of the battery , and thus it is also important to reduce the power consumption of the device . one way to do this is to reduce the power consumption of the infrared transceiver 4 , because typically it will be inactive for long periods . two power saving solutions are well known . one is by means of a shutdown ( sd ) signal from the ir block 9 to the infrared transceiver 4 . this signal can put the entire transceiver in a shutdown mode in which both the receiver and transmitter parts are disabled . when sd is active the transceiver is switched off and consumes almost no power . when sd is inactive the transceiver is operational , and it can receive and decode infrared light pulses . the other power saving solution is to switch off the power supply to the transmitter part by means of the switch 10 . in this way the transmitter part is switched off completely , while the receiver part can still be active , provided the sd signal is inactive . this means that the transmitter part only needs to be switched on when data are actually to be transmitted from the transmitter , and since the control circuitry 6 controls the data transmission as well as the power switch 10 , it is easy to switch off the transmitter part of the transceiver 4 as soon as it is not needed for transmission of data . however , this is not possible for the receiver part , because normally the control circuitry 6 does not have any knowledge of when data can be expected from the other transceiver 5 . therefore , the sd signal normally has to be inactive all the time to ensure that the receiver part of the transceiver is ready to receive data at any time , in case such data should arrive . as will be explained later , this is especially important because some types of data are only sent once . the fact that at least the receiver part of the transceiver must be switched on all the time means that the transceiver continuously has a certain power consumption . some typical figures are that virtually no current is drawn when sd is active , i . e . the whole transceiver is shut down , while a current in the range from 300 μa to 1 ma is drawn when the transmitter part as well as the receiver part are switched on . when only the receiver part is switched on , i . e . power to the transmitter switched off while sd is inactive , the current may be reduced by approximately 25 %, but still the remaining consumption is considerable . in the following the word transceiver will be used to describe not only the transceiver hardware described above , but also the software controlling the hardware . as mentioned above , the transceivers 4 and 5 in this example make use of the irda protocol , and the data are transmitted according to the serial infrared procedure irda - sir ( irda serial infrared ) of this protocol . according to this protocol a transceiver can be in a primary mode or in a secondary mode . in the primary mode the transceiver actively searches for other transceivers of the same type , normally because it has information to transmit . in the secondary mode a transceiver only listens for a transceiver in primary mode to contact it . normally , there are long periods with no data transmission , and both transceivers 4 , 5 will thus be in the secondary mode . if , for example , data are now going to be transmitted from the computer 2 to the mobile telephone 1 , the system will enter the irda discovery mode and the transceiver 5 will change to the primary mode , thus becoming a primary transceiver . the primary transceiver will search for a secondary transceiver by transmitting a series of discovery frames having start characters in front of them . in irda discovery mode the primary transceiver will repeat the series of discovery frames with an interval or period which is typically set to 3 seconds although other values are possible as well . in order to ensure that the secondary transceiver is able to detect the discovery frames , the discovery frame must include at least some bits which are different from the situation where no data are sent . normally , a binary “ 1 ” corresponds to “ no light transmitted ”, and a binary “ 0 ” corresponds to “ light transmitted ”, and thus the discovery frame must include at least some “ 0 ” bits . this is achieved in that the discovery frame starts with 10 xbof characters , which will be explained below . the discovery frames are sent with a bit rate of 9600 baud . in irda discovery mode a sequence of e . g . six , eight or 16 discovery frames , each starting with 10 xbof characters , is transmitted from the primary transceiver every period . however , this is not the case in another mode , i . e . the irda ultra mode , which is used for example when sending a so - called vcard ( business card ). this case is important because the information is only sent once , and there is no option for confirmation or retransmission . thus the 10 xbof characters must be detected the first time . otherwise , the frame format is the same as in irda discovery mode . in irda - sir 9600 the xbof character has the value 0xff , but some older devices use the value 0xc0 and to ensure compatibility with these devices this value should also be supported . when using sir the characters are transmitted in an asynchronous serial format with the parameters 1 start bit (“ 0 ”), 8 data bits , no parity bit and 1 stop bit (“ 1 ”), which is a total of 10 bits . the bits in the character are transmitted from the least significant bit ( lsb ) to the most significant bit ( msb ). thus the value 0xff is exchanged as 0 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , while the value 0xc0 is exchanged as 0 , 0 , 0 , 0 , 0 , 0 , 0 , 1 , 1 , 1 . note that the 0s result in light pulses while 1s do not . 1s can thus not be differentiated from silence , so the detection relies on the 0s . as mentioned , 10 xbof characters are sent before the actual data packet , and thus the actual bit stream for the xbof character 0xff looks like the sequence below , where it should be noted that the five initial 1s represent the end of the ( probably very long ) silence period before the first character in the discovery frame . the purpose of the start characters is to “ wake up ” the receiver to ensure that it will actually receive the following data packets . there is no information content as such in the start characters . thus according to the invention the receiver — when it is in the secondary mode waiting for another transceiver to send a discovery frame — is continuously switched on and off in order to save power . this means that the receiver is shut down for certain intervals . the receiver just has to be switched on often enough and long enough to be able to detect at least one of the zeros in the ten xbof characters . then if a zero , and thus a start character , is detected , the receiver is maintained on of course as long as data still arrive from the other end . at 9600 baud the duration of every bit is 1 / 9600 = 104 . 2 microseconds . thus an xbof character ( 10 bits ) takes 1 . 042 milliseconds , and at least one of these ten bits is a zero . 10 xbof characters take about 10 . 42 milliseconds to be transmitted . thus , theoretically , it is sufficient if in any period of 10 . 42 milliseconds the receiver is active in a period of 1 . 042 milliseconds . this period is called an eye period . in practice , however , it is more safe to take into account the possibility of enabling the receiver in the middle of a zero bit and thereby missing it . thus the eye period can be extended to 1 . 146 milliseconds ( 11 bits ), and similarly the repetition period can be reduced a little bit . practical tests have shown that a repetition period of 9 milliseconds with an eye period for the receiver of 1 . 4 milliseconds is completely secure , but values closer to the theoretical values mentioned above are probably possible . the principle is illustrated in the graph of fig5 . a illustrates the signal sd in the transceiver 4 when this transceiver is in the secondary mode waiting for the other transceiver 5 to contact it . it will be seen that in each period t p the signal sd is low ( i . e . not active ) only in the eye period t e . b correspondingly shows that the receiver part of the transceiver 4 is switched on , i . e . ready to receive incoming optical signals in the eye periods t e , while it is shut down in the rest of the period . c shows a discovery frame sent from the other transceiver 5 , and finally d shows what is actually received in the transceiver 4 . c and d correspond to fig3 i . e . the xbof character has the value 0xff and the zeros are represented by the black lines . the period t p is selected to be shorter than , but close to , the duration t x of the ten xbof characters , and the eye period t e selected to be longer than , but close to , the duration of one xbof character . at the time t l a discovery frame from the transceiver 5 begins , and in the shown example the first four zeros are not detected because the transceiver is shut down . however , at the time t 2 the sd signal becomes low and the receiver is again ready to receive for an eye period t e , i . e . until the time t 3 . the zero of the fifth xbof character lies in this eye period and is thus detected . although the sd signal was otherwise expected to be activated again at the time t 3 , as is shown with the dashed lines in a , it is now kept low and the receiver is ready to receive the remaining xbof characters and the following data . of course the receiver is now kept in the switched on state as long as data are exchanged between the two transceivers . a certain time after the exchange of data has been concluded , the receiver returns to the state in which it is only switched on in the eye periods . it will be seen that independent of the start time of the discovery frame at least one of the zeros in the ten xbof characters will be detected , and this is sufficient to ensure safe reception of the following data bytes . since the eye period can theoretically be close to one tenth of the repetition period , the power consumption of the receiver part of the transceiver in the discovery mode can also be reduced to close to one tenth of the normal power consumption . although in practice , as mentioned above , the eye period has to be a little bit longer and the repetition period a little bit shorter , the power consumption can still be reduced to maybe 12 or 15 % of the normal power consumption . when an infrared interface without this solution is implemented in a mobile telephone , the transceiver typically consumes about 10 % of the total stand - by current of the phone . therefore , the user will often prefer to switch the interface on and off manually to save power . with the solution implemented this value can be reduced to maybe 1 or 2 %, which means that the transceiver can now be switched on the whole time without affecting the stand - by time of the phone very much . when the transceiver can be switched on all the time , a user interface to switch it on and off is no longer needed , and it can thus be removed from the phone , which gives a simpler design of the phone user interface . it should be noted that the feature activates itself when there is no other transceiver in range , but also when another device has actually been found but does not contact the transceiver in which the solution is implemented . the fact that the transceiver is always on also means that it is always ready to receive an electronic business card that is beamed to the device . this is important because such a business card is only transmitted once . today an ir interface has to be enabled or switched on for some time before a business card can be received . the sd signal can be controlled from either hardware or software , and thus the solution itself can also be implemented in hardware as well as in software , dependent on what is most convenient in a given device . although a preferred embodiment of the present invention has been described and shown , the invention is not restricted to it , but may also be embodied in other ways within the scope of the subject - matter defined in the following claims . thus , the invention has been described above with relation to an infrared interface operated according to the irda protocol . however , it should be emphasized that any other protocol using a number of start characters as the beginning of a transmission can be used as well . further , it is clear that electrical signals on a wired connection or radio signals transmitted through a radio link , e . g . a short - range radio link , can easily be used instead of the optical signals without affecting the idea of the invention .
8
in fig1 reference numerals 10 and 11 identify two adjustable - stroke radial - piston pumps . each pump includes a rotor 12 or 13 and a stroke - establishing cam ring 14 or 15 . by changing the eccentricity of the cam ring 14 or 15 the stroke of the associated pump can be adjusted . provided in the rotors of the pumps are radial pistons which slide along the inner surfaces of the cam rings . the basic construction of adjustable - stroke radial - piston pumps of this type is very well known . each pump 10 or 11 is provided with its own pressure regulator 16 or 17 . the pressure regulators are disclosed in detail in commonly owned u . s . pat . no . 3 , 891 , 354 , the entire disclosure of which is incorporated herein by reference . for the purpose of explaining the present invention , it is sufficient to note that the output line of pump 10 is designated with numeral 27 , and the output line of pump 11 with numeral 28 . pump output conduits 27 , 28 having respective branches 33 , 34 lead into the associated regulators , for furnishing the regulators with information concerning the output pressure of the pumps . if the pressure fed back to regulator 16 via line 33 indicates that the pressure in pump output conduit 27 is greater or less than the preselected value , then the pressure regulator 16 effects a corresponding change in the fluid pressure supplied to hydraulic adjuster 52 , and the hydraulic adjuster will change the eccentricity of the cam ring 14 , and thereby the stroke of pump 10 , until the pump output pressure reassumes the preselected value . the operation of pressure regulator 17 is the same . each pressure regulator 16 , 17 is shown as having a further inlet at its bottom end . normally , pressure is not applied to this further inlet . however , when associated valve 26 or 24 is opened additional pressure is applied . the effect of this additional pressure is to alter the operation of the regulator in a sense causing the regulator to decrease the stroke of the associated pump . this is explained in considerable detail in the aforementioned patent . the purpose of valves 26 , 24 in the present invention will be described below . however , it should be noted here that if the output pressure of one of the pumps suddenly increases , and the associated value 26 or 24 is not open , then the associated pressure regulator 16 or 17 will simply restore the preselected pressure . however , if in addition the associated valve 26 or 24 is opened , the operation of the regulator will be altered in a sense causing the regulator to more quickly change the setting of the respective cam ring towards the minimum - stroke setting . the illustrated hydraulic system includes a pair of first transducers 18 , 21 respectively operative for furnishing via lines 19 and 22 first signals indicative of the eccentricity of respective ones of the cam rings 14 and 15 , and accordingly indicative of the strokes of the respective pumps . lines 19 and 22 feed into an electronic control device 20 , whose operation is described below . the pump rotors 12 and 13 are mounted on a common drive shaft 10 &# 39 ; driven by a common ( non - illustrated ) drive machine . it is clear that the rotary speeds of pump rotors 12 and 13 must always be the same . a rotary speed transducer 54 detects the rotary speed of the common drive shaft 10 &# 39 ; and furnishes a corresponding electrical signal to the electronic control device 20 . the rotary speed transducer 54 serves the purpose of an overload detector for the common drive machine . when the common drive machine , whether an engine or a motor , becomes overloaded , its speed will fall below a certain value , and this will be indicated by the signal from transducer 54 . it will be understood , however , that more sophisticated load - measuring transducers can be utilized , if desired . the electronic control device 20 has two electrical outputs 23 and 25 respectively leading to the control solenoids of valves 26 and 24 . the valves 26 and 24 constitute anti - overload override valves . when opened , they override or alter the normal operation of the associated pressure regulator in a sense causing the regulator to decrease the stroke of the respective pump towards minimum stroke . and they are activated for performing this override function under the control of the control device 20 , in a manner described below , when overloading of the common drive machine for the pumps is about to occur . the output conduits 27 , 28 of the pumps 10 , 11 are connected with each other by a conduit 29 containing a changeover valve 30 . branching away from the outlet of changeover valve 30 are two conduits 31 , 32 leading into the inlets of respective ones of the anti - overload override valves 26 , 24 . the effect of changeover valve 30 is to transmit to one or both of the pressure regulators 16 , 17 , via the valves 26 , 24 , the output pressure from that one of the two pumps having the higher output pressure . the illustrated hydraulic system is used to drive the left and right caterpillar tracks of an excavating shovel vehicle . the left and right caterpillar tracks are directly driven by hydraulic motors 45 and 47 . hydraulic motor 45 receives pressure fluid from pump outlet 28 via a conuit 42 , a slider valve 38 , and a conduit 44 . hydraulic motor 47 receives pressure fluid from pump outlet 27 via a conduit 43 , a slider valve 39 and a conduit 46 . the slider valves 38 , 39 are comprised of respective control slides 48 , 50 whose settings are indicated in the form of second signals generated by respective second transducers 49 , 51 . these second signals are fed to the electronic control device 20 . the settings of the slider valves 38 and 39 are selected by means of sellector handles 40 and 41 . if it is desired that the vehicle travel in a straight line , the two selector levers 40 , 41 will be turned to identical positions , causing the valves 38 , 39 to assume identical settings . during normal operation , i . e ., when the loads applied to the hydraulic drive motors 45 , 47 by the respective caterpillar tracks are substantially identical , the pressure regulators 16 , 17 will cause the cam rings 14 , 15 of the two pumps to assume identical settings , so that the speeds of rotation of the motors 45 , 47 and , accordingly the travel speeds of the left and right caterpillar tracks , will be identical . however , if now the load applied to one of the two motors suddenly increases , the associated pressure regulator will begin to decrease the stroke of the respective pump . accordingly , the eccentricity of the two cam rings 14 , 14 will become different ; more generally expressed , the relative settings of the two cam rings 14 , 15 will no longer correspond to the relative settings of the two control valves 38 , 39 . if not corrected , this action of the pressure regulator would cause the motors 45 and 47 to run at unequal speeds . the electronic control device 20 maintains the relative settings of the cam rings 14 , 15 in correspondence with the relative settings of the control valves 38 , 39 . it detects the relative values of the first signals in lines 19 and 22 , and it detects the relative values of the second signals from transducers 49 , 51 . if the relationship between the values of the first signals does not correspond to the relationship between the values of the second signals , one or the other of valves 26 , 24 is opened , to cause a decrease in the eccentricity of one of the two cam rings 14 , 15 until such time as the relationship between the settings of the cam rings comes again into correspondence with the relationship between the settings of the valves 38 , 39 . control device 20 can have any of many different forms . for example , it may be a ratio regulator operative for maintaining the ratio of the signals in lines 19 and 22 equal to the ratio of the signals from transducers 49 and 50 by automatically opening one or the other of valves 26 , 24 when the ratios become unequal . if the common drive machine for the two pumps 10 , 11 becomes overloaded , an overload signal is fed by transducer 54 to the control device 20 . this causes control device 20 to open one or both of valves 26 , 24 , in an attempt to counteract the overload more quickly than would occur under the normal operation of the pressure regulators . the control device 20 can be designed in any of a variety of ways to provide this quick anti - overload action . for example , in response to detection of drive machine overload it can simply open both the valves 26 and 24 . in the event that opening of both valves 26 , 24 in an overload situation should happen to cause the ratio of the signals in lines 19 , 22 to fall out of correspondence with the ratio of the signals from transducers 49 , 51 , then the control device 20 can be operative for closing one of the valves 26 , 24 , either uninterruptedly or else intermittently , to maintain the desired correspondence between the two ratios . whereas this would somewhat decrease the quickness of the quick anti - overload override action , unexpected sudden swerving of the vehicle will be prevented . in the embodiment of fig2 there is added to the arrangement of fig1 the controls for the excavating shovel of the machine . the control of the excavating shovel is effected by means of two control arrangements 60 , 61 of identical design . the manually activatable control levers 62 , 63 are mounted in a universal joint and are guided in mutually perpendicular guide slots 64 , 65 and 66 , 67 . the settings of the control levers 62 , 63 determine the settings of the control valves 70 , 71 and 72 , 73 . the valves 70 - 73 control the movements of the hydraulic cylinders ( e . e ., 74 ) for the derrick , the shovel stem , the shovel bottom flap and the turning means for the shovel . cooperating with the control lever 62 is a position transducer 75 , whereas the control lever 63 is provided with a position transducer 76 . these transducers furnish position - indicating signals to the control device 20 of fig2 . the output signals of transducers 75 , 76 are compared by the control device 20 against the signals indicative of the settings of the stroke - adjustment members of the pumps 10 and 11 . the control device 20 of fig2 in dependence upon the lack of correspondence between the two sets of signals , controls the solenoid valves 24 , 26 to cause the associated pressure regulators to prevent the pumps 10 , 11 from furnishing the working cylinders pressure fluid in excess of what is actually needed ; i . e ., corresponding to the setting of the control levers 62 , 63 . with this additional control action the output volumes of the pumps can be set in dependence upon the settings of the activated ones of control valves 70 - 73 . in this way , pressure fluid losses and power waste can be avoided . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in an excavating shovel machine having left and right caterpillar tracks driven by separate hydraulic motors and hydraulic drive pumps , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential charcteristics of the generic or specific aspects of this invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .
5
referring to fig1 - 3 , it will there be seen that the reference numeral 10 denotes an illustrative embodiment of the present invention . ambulator 10 includes a three - sided base 12 that is positioned in relatively closely spaced relation , such as a few inches , to a horizontal support surface 13 . base 12 includes first base rail 14 and second base rail 16 . first base rail 14 is supported by a pair of caster wheels denoted 18 , 20 . first wheel 18 is positioned near leading end 15 of first base rail 14 and second wheel 20 is positioned near trailing end 17 of said first base rail . tab 20 a that projects from rear wheel 20 activates a well - known braking means when stepped upon so that caster wheel 10 cannot roll and hence ambulator 10 cannot move when said braking means is activated . second base rail 16 is parallel to and transversely spaced apart from first base rail 14 . it is supported by a pair of caster wheels denoted 22 , 24 . first wheel 22 is positioned near the leading end of second base rail 16 and second wheel 24 is positioned near the trailing end of said second base rail . first support post 26 is mounted to first base rail 14 in upstanding relation thereto , about mid - length thereof . post 26 includes a lower housing 28 that telescopically receives tubular member 30 . lower housing 28 has a horizontal throughbore 29 formed therein and tubular member 30 has a plurality of vertically spaced apart throughbores formed therein , collectively denoted 31 . lock member 32 has a throughbore - engaging shaft 33 and a handle 34 as depicted and operates in a well - known way to hold tubular member 30 in a preselected position of adjustment relative to lower housing 28 . second support post 36 is mounted to second base rail 16 in upstanding relation thereto , about mid - length thereof . post 36 includes a lower housing 38 that telescopically receives tubular member 40 . lower housing 38 has a throughbore 39 formed therein and tubular member 40 has a plurality of vertically spaced apart throughbores formed therein , collectively denoted 41 . lock member 42 , not shown , has the same structure as lock member 32 , including a throughbore - engaging shaft 43 , not shown , and a handle 44 , not shown and operates in the same way as lock member 32 to hold tubular member 40 in a preselected position of adjustment relative to lower housing 38 . first arm support 46 is disposed in surmounting relation to first support post 26 and in parallel relation to first base rail 14 . second arm support 48 is disposed in surmounting relation to second support post 36 and in parallel relation to second base rail 16 . a first transversely disposed rod 50 is disposed in interconnecting relation between respective leading ends of said first and second arm supports 46 , 48 and defines a forward end of ambulator 10 . a second transversely disposed rod 52 is disposed in interconnecting relation between respective leading ends of the first and second base rails 14 , 16 . rod 52 is disposed in leading relation to first transversely disposed rod 50 so that the feet of an individual using ambulator 10 as a walking aid may travel beyond the forward end of the ambulator without hitting rod 52 . rod 52 includes a straight middle section 53 , a first end section 54 secured to a first end of said straight middle section , and a second end section 55 secured to a second end of straight middle section 53 . the first and second end sections are disposed at a common angle relative to straight middle section 53 . the first end section has a trailing end secured to a leading end of first base rail 14 and the second end section has a trailing end secured to a leading end of second base rail 16 . harness 60 is adapted to be worn by the individual requiring assistance . harness 60 includes a belt - like base 62 of adjustable length adapted to fit snugly around the individual &# 39 ; s waist . a first plurality of loop members 64 are secured to base 62 along its extent and a second plurality of loop members 66 are secured to first and second arm supports 46 , 48 a plurality of straps 68 interconnects harness 60 to ambulator 10 . more particularly , each strap has a first end releasably secured to a preselected loop member of said first plurality of loop members 64 and has a second end releasably secured to a preselected loop member of said second plurality of loop members 66 . each strap of the plurality of straps is adjustable in length and includes a locking and quick release unlocking means 67 . each strap of said plurality of straps is taut when an individual is using ambulator 10 so that movement of the individual simultaneously produces a corresponding movement of the ambulator . leg straps 62 a , 62 b depend from base 62 and include means , not shown , for securing said straps to the legs of the ambulator user . the full details of construction of harness 60 are provided in u . s . pat . no . 5 , 893 , 367 entitled therapeutic gait harness and pelvic support system , to the present inventor and others , which disclosure is hereby incorporated hereinto by reference . padding means 70 , 72 is secured to said arm supports 46 , 48 in overlying relation thereto , respectively , to increase the comfort of the individual using the ambulator . a padding means 74 is likewise secured to first transversely disposed rod 50 in overlying relation thereto to increase the comfort of the user . arm supports 46 , 48 are adjusted in height so that the forearms of the user are supported by padding 70 , 72 when the shoulders of the user are relaxed . a first brace means 80 includes first brace member 81 having a forward end 82 secured to first support post 26 at a preselected location in vertically spaced relation to a lowermost end of said first support post and a rearward end 83 secured to a trailing end of first base rail 14 . first brace means 80 further includes a second brace member 85 having a rearward end 86 secured to first support post 26 at a preselected location in vertically spaced relation to a lowermost end thereof and a forward end 87 secured to housing 89 that is mounted on a leading end of first base rail 14 in upstanding relation thereto . housing 89 receives the uppermost end of a bias means 104 , disclosed hereinafter . a second brace means 90 , not shown , has the same structure as brace means 80 but provides the function of supporting second support post 36 . it includes a first brace member , not shown , having a forward end secured to second support post 36 at a preselected location in vertically spaced relation to a lowermost end of said second support post and a rearward end secured to a trailing end of second base rail 16 . a second brace member , not shown , has a rearward end secured to second support post 36 at a preselected location in vertically spaced relation to a lowermost end of second support post and a forward end secured to a bias mean - receiving housing 99 mounted to the leading end of second base rail 16 in upstanding relation thereto . third transversely disposed rod 100 is disposed in interconnecting , detachable relation between respective trailing ends of the first and second arm supports 46 , 48 . third transversely disposed rod 100 defines a rearward or trailing end of ambulator 10 . padding means 102 is secured to rod 100 in overlying relation thereto to increase the comfort of the user . a first bias means 104 is disposed in biasing relation between the leading end of first base rail 14 and first forward wheel 18 and a second bias means 106 is disposed in biasing relation between the leading end of the second base rail 16 and second forward wheel 22 . the first and second bias means are under compression when the user applies weight to first transversely disposed rod 50 . rigid posts 108 , 110 are secured to middle section 53 of second transversely disposed rod 52 in transversely spaced apart relation to one another and in depending relation to said second transversely disposed rod . the rigid posts have a common preselected length that spaces respective lowermost ends of the rigid posts slightly above support surface 13 when the first and second bias means 104 , 106 , respectively , are in repose . posts 108 , 110 engage the support surface and prevent forward motion of ambulator 10 when first and second bias means 104 , 106 are compressed by the individual applying weight to first transversely disposed rod 50 . it will thus be seen that the objects set forth above , and those made apparent from the foregoing description , are efficiently attained . since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .
0
referring now to the sole figure , there is shown a circuit which reduces electromagnetic interference ( emi ) by frequency modulation of power converters . in the instant circuit , the dc - to - dc converter 15 is provided . this converter produces the output signal v out which is , of course , the output signal produced by the power conditioner . a portion of the output signal is also returned to the comparator 16 where it is compared against the reference signal ref . the reference signal is applied to the positive (+) terminal of the comparator 16 from any suitable reference source such as 5 v dc or the like . the output of the comparator 16 , viz ., the comparison of the output signal v out and the reference signal ref is supplied to the pulse width modulator 14 . the signal supplied to the pulse width modulator controls the duty ratio of the pwm 14 to regulate the dc / dc converter 15 output voltage v out . the modulator 14 is connected to receive a signal from the voltage controlled oscillator 13 . the modulator 14 is operative to vary the duty ratio of the signal which is produced by the vco 13 . the output signal from the vco 13 is also fed back to counter 10 which can be any suitable counter of any prescribed length . the output of the counter 10 is connected to the input of eprom 11 which can be any suitable kind of storage device . in the preferred embodiment , the eprom is suggested as a preferred method and apparatus for storing information . however , any suitable kind of rom is believed to be appropriate . the storage mechanism or rom 11 is used to store a pseudo - random ( pr ) code therein . consequently , when counter 10 produces an output signal , it selectively steps the prom ( or rom ) through its addressing routine in order to select the contents of a particular address . the contents of the prom 11 are stored in digital form . these digital signals are supplied to the digital - to - analog converter 12 . the d / a converter 12 supplies an analog signal to the vco 13 . the output of the vco 13 is supplied to the modulator 14 as described above and returned to counter 10 . thus , as the output signal produced by vco 13 varies in frequency , the counter 10 is caused to count at different rates . with counter 10 counting at different rates the eprom 11 is stepped or addressed at different rates . the content of the prom are , a noted , a pseudo random code in digital form . the digital signal from the prom 11 is converted to an analog signal by d / a converter 12 . this analog signal is then applied to vco 13 which produces an oscillating signal which has a frequency which is representative of the amplitude of the analog signal . the vco output signal is supplied to the pulse width modulator 14 which varies the chopping rate of the signal from the vco 13 while maintaining a constant duty ratio . in particular , the modulator 14 operates to provide a fixed duty ratio over a wide range of operating frequencies of the vco 13 . the dc - to - dc converter provides an output which is a function of duty ratio and not frequency . this technique produces independent means of varying the operating frequency in a psuedo random pattern without changing the output voltage and so forth . in the preferred embodiment , the circuit involved uses a chopping power supply with a dc - to - dc converter 15 which chops at a rate of greater than 1 mhz . this circuit then operates as a generator with pseudo random chopping frequency to provide a spread spectrum operation in order to spread the ripple over a relatively large bandwidth from 750 khz to 1 . 5 mhz . as the output signal v out varies , it is mixed with the reference signal ref which alters the operation of the pulsewidth modulator . the signal supplied to the pulsewidth modulator 14 by the vco 13 is also varying on a pseudo random basis , as described above . the pseudo - randon operation of the circuit which supplies the analog signal to the pulsewidth modulator 14 is also described . consequently , a pseudo - random frequency signal with a constant amplitude is supplied to the modulator which then produces a randomly varying ripple signal from the circuit . as a consequence , the output signal has been spread over a very wide spectrum . thus , there has been shown and described a unique power conditioning circuit which uses spread spectrum techniques as well as frequency hopping techniques to reduce ripple , noise and signature from an output signal . this is accomplished by preventing periodic noise from appearing in the output signal . more importantly , this operation is achieved without the addition of extensive filtration circuits at the output of the circuit involved . thus , electromagnetic interference is greatly reduced at the output signal of this system . this operation is especially useful in communication systems and permits smaller , lighter , more efficient power supplies at high frequencies . it is especially useful in areas where advantages are obtained when output filtration is minimized . in addition to communication systems , this type of power supply system can be very useful in many semiconductor applications wherein the semiconductor devices use lower and lower voltage and / or power . that is , by reducing the noise and ripple on the input signals , the operation of such semiconductor devices which have low voltage requirements , ( e . g . 2 . 5 volts ) is highly advantageous . this circuit is highly advantageous in removal of unwanted signals at the output . moreover , there is a decided improvement on the upper limits of the frequencies at which circuits of this type can operate without the unwanted signals at the output . in the preferred embodiment , specific components and arrangements are shown and described . however , those skilled in the art may conceive of different components in the overall circuit scheme or a different arrangement of the components as shown . however , any such modifications to the circuit which fall within the purview of this description are intended to be included therein as well . clearly , the description is not intended to be limitative of the invention but is , rather , illustrative only . the scope of the invention is not limited by this description but is limited only by the claims appended hereto .
7
the following discussion is directed to a graphical user interface system and methods that enable switching between a plurality of online media services from within a host application , such as a pc - based media player application . a user can switch to any one of a number of online services made available in a services menu and thereby make that service the active service . in addition , the currently active online service is given customization opportunities that permit the active service to customize regions of the gui in a host media player application or other application and / or operating system ( e . g ., active service provides a service information file that includes urls to web pages of the active service ). advantages of the described system and methods include providing online media services with an ability to control the way in which customers discover and purchase media from within the feature rich environment of various user applications such as a pc - based media player application . from a user &# 39 ; s perspective , the advantages include an uninterrupted media experience that can involve the entire process of discovering , purchasing and using a wide variety of media content all from within the feature rich environment of a media player application . fig1 illustrates an exemplary system environment 100 suitable for enabling switching between various online media services and allowing an active service to customize portions of an application on a computer 102 . the exemplary environment 100 includes computer 102 operatively coupled to a plurality of online services 104 and a web listing service 106 via a network 108 . network 108 can include both local and remote connections depending on the particular system configuration . thus , network 108 may include , for example , any one or a combination of a modem , a cable modem , a lan ( local area network ), a wan ( wide area network ), an intranet , the internet , or any other suitable communication link . computer 102 is typically implemented as a user &# 39 ; s primary computing device , such as a desktop personal computer ( pc ). computer 102 might also be implemented as other conventional computing devices generally configured to receive and render multi - media content ( e . g ., play back , burn to cd , transfer to portable playback device , etc .) from various online media services . an exemplary implementation of a computer 102 is depicted in fig1 and described in greater detail below in the exemplary computing environment section . online services 104 and web listing service 106 are typically implemented as one or more server computers such as a web server . thus , online services 104 and web listing service 106 may include a variety of general purpose computing devices such as workstation computers , and may be configured in a manner similar to an exemplary implementation of computer 102 such as described below in the exemplary computing environment referring to fig1 . online services 104 and web listing service 106 generally provide storage for electronic documents and information including multi - media content that is accessible to client computers such as computer 102 over network 108 . fig2 illustrates a block diagram representation of an exemplary computer 102 that is suitable for enabling switching between various online media services 104 and allowing an active service to customize portions of an application on a computer 102 . various components on computer 102 facilitate the retrieval and management of media content for the general purpose of rendering the content on computer 102 and / or synchronizing the content with a portable playback device . these components include , for example , an operating system 200 and its sub - components ( e . g ., the operating system &# 39 ; s folder system application , or “ shell ” 202 ), various applications 204 such as , specifically , a media player 206 , a media library 208 ( i . e ., a database that contains digital media files ), and a service switching and customization architecture 210 . although these components are illustrated separately on computer 102 , it is noted that any one or more of these components may be implemented on computer 102 as part of a multimedia software product , the operating system 200 , stand - alone components , and so on . an application 204 may be any of various applications and / or tools configured to perform various computing tasks such as emailing , word processing , financial analysis , and so on . an application 204 may also be an application or tool configured to receive and manipulate media content , such as from an online media service 104 or some other source . for example , application 204 may be an interactive tv service application that facilitates the recording of video ( e . g ., tv programming ) directly off of a cable and / or satellite feed , a video capture component to transfer home video footage from a digital video recorder onto computer 102 , a web browser application that facilitates downloading media over a network 108 , and so on . thus , applications 204 may supply various forms of media content to a media library 208 on computer 102 . media content stored in media library 208 may include , for example , audio files in the form of mp3 and wma files , video files in the form of avi and mov files , and image files in the form of gif and jpeg files , and so on . a specific example of an application 204 that is illustrated in fig2 is a media player application 206 . a media player application 206 is typically a desktop based media player that manages a broad range of multimedia related tasks regarding the discovery , acquisition and use of media content . for example , a media player application 206 may handle streaming audio and video , cd / dvd playback , mp3 and wma support , encoding , cd / dvd burning , transferring media to a portable playback device , internet radio , and the like . like some other applications 204 , a media player application 206 supplies various forms of media content ( e . g ., audio files , video files , image files , etc .) to media library 208 on computer 102 . although the media player application 206 and media library 208 are illustrated in fig2 and discussed herein as separate components on computer 102 , in other embodiments they may just as readily be a part of the operating system 200 itself . a service switching and customization architecture 210 is configured to be operatively interactive with any one or more of the components of computer 102 noted above for the general purpose of enabling switching between various online media services 104 and allowing an active service to customize portions of such components on computer 102 . thus , one or more applications 204 and / or components of computer 102 ( e . g ., operating system 200 , shell 202 ) may “ host ” the service switching and customization architecture 210 . for example , in one embodiment , the service switching and customization architecture 210 may be an integral component of , and / or operatively interactive with , the media player application 206 . accordingly , although the current embodiment of the service switching and customization architecture 210 will be discussed herein with specific reference to the media player application 206 as a host application , various aspects of service switching and customization may be hosted by and / or be generally applicable in similar ways to various components of computer 102 including , for example , the operating system 200 and its sub - components ( e . g ., shell 202 ), and various other applications 204 . the service switching and customization architecture 210 includes an online service manager component 212 , an all - services file 214 , and a number of service information files 216 . the online service manager 212 is generally configured to populate a service menu list within the media player 206 , and to manage switching between online services and to manage customizations made to the player that are provided by a currently active service . each time computer 102 is connected to the network 108 , the online service manager 212 fetches the all - services file 214 from a web service listing 106 . in the current embodiment , the all - services file 214 is an xml ( extended markup language ) file that is kept up - to - date on the web service listing 106 so that the online service manager 212 always has access to the latest list of valid online services 104 . the all - services file 214 includes a list of all valid online services 104 and any other information needed to populate a service menu list within the media player 206 . as discussed in more detail below , the online service manager 212 uses information in the all - services file 214 to determine where to retrieve a service information file 216 for each of the valid services identified in the all - services file 214 . when a valid all - services file 214 is retrieved from web service listing 106 , the service manager 212 populates the service menu list within the media player 206 with the list of valid online services from the file . prior to a new selection being made by a user from the service menu list , the last active service is present in all the customization points within the media player 206 . in general , a ui manager 218 component of the service switching and customization architecture 210 manages the display of a graphical user interface ( gui ) on a computer display device . the ui manager 218 manages the gui in conjunction with online service manager 212 and user input instructions entered through a user interface selection device ( e . g . a mouse ) that controls motions and selections of a pointer displayed on the gui . although the ui manager 218 is illustrated in fig2 as being part of the online service manager 212 , this is for illustrative purposes only and is not intended to be limiting . thus , the ui manager 218 may be configured differently , such as being a stand - alone component or a part of another component on computer 102 . fig3 a - 3 d illustrate examples of such a gui in the form of a command bar user interface . the command bar user interface provides access to functionality for both a host application ( e . g ., a media player application ) and a currently active media service being hosted by the host application . the command bar user interface enables switching between a plurality of online media services from within a host application . users can switch to any one of a number of online services made available by the command bar through a service list menu . a selected online service becomes the currently active service . the currently active online service is given customization opportunities that permit customization of different areas of the user interface within the host application . referring to fig3 a , the command bar user interface illustrates two regions or areas in which function buttons are displayed . a “ host application function area ” includes application function buttons c 1 - c 5 that are intended to illustrate functions of the host application that a user can activate through the user interface . for example , if the host application is a media player application , some of the functions represented by c 1 - c 5 might include a function for burning music onto a cd or a function for synchronizing content with a mobile device . furthermore , any of the buttons c 1 - c 5 could themselves be menus offering additional functionality related to the particular button . the number of application function buttons and the manner in which they are illustrated is shown in fig3 a - 3 d by way of example only , and is not intended to be limiting . thus , certain applications may have a greater or lesser number of application function buttons displayed in the host application function area of the command bar user interface . note that in practice , the application function buttons may not have superscript numbers designating their functions . rather , an application function associated with an application function button will likely be designated with a text description or a graphical representation ( e . g ., an icon or animation ) that indicates the function . another region of the command bar user interface is the “ service function area ”. the service function area includes service function buttons s 1 - 1 - s 1 - 3 that are intended to illustrate functions provided by a currently active online media service and are made accessible to a user through the user interface . the service function area also includes a “ service brand ” icon and a “ service menu ” button . the superscript numbers on the service function buttons indicate that a particular online service is the currently active service and that a number of functions are available for that service . for example , service function button s 1 - 1 is intended to designate a first function for the currently active online media service number 1 , indicated by the “ service 1 brand ” icon . likewise , service function button s 1 - 3 indicates a third function for the currently active online service number 1 . note that in practice , the service function buttons may not have superscript numbers designating their functions and a particular service . rather , service function buttons will likely be designated with a text description that indicates their function , and the currently active service may be identified by the “ service brand ” icon shown in the service function area ( e . g ., “ service 1 brand ”). the “ service menu ” button facilitates access to a list of valid online services as discussed more below with reference to fig3 c . referring still to fig3 a , the command bar user interface illustrates in the “ host application function area ” that a host application function has been activated by a user through the selection of application function button c 2 . when an application function button is active , the command bar user interface typically alters the appearance of the button to indicate its active state as shown in fig3 a . the change in appearance can be implemented in a variety of ways including , for example , by highlighting the application button , changing the color of the application button , adjusting the texture of the application button , and adjusting a background intensity level of the application button . fig3 b illustrates that a user has selected a service function button s 1 - 1 from the “ service function area ”. thus , the user intends to implement the function associated with the s 1 - 1 service button which , as noted above , corresponds to the currently active online service designated by the “ service 1 brand ”. as illustrated in fig3 b , when a service function button is selected by a user , it becomes active . the service button &# 39 ; s active state is indicated by a change in appearance to the button . furthermore , when an online service function is activated , the command bar interface also changes or shifts the appearance of the “ service function area ” to indicate the active state of the online service function to the user . thus , fig3 b illustrates a change in the appearance to both the service function button s 1 - 1 and to the service function area . the change in appearance to a service function button and the service function area can be implemented in a variety of ways including , for example , by highlighting them , changing their colors , adjusting their textures , and adjusting their background intensity levels . fig3 c illustrates use of the “ service menu ” to switch the currently active online service to a different online service . as noted in fig3 c , the service menu has been selected . selection of the service menu can be indicated by a change in appearance to the service menu button , similar to that just discussed above . when the service menu is selected , a list of valid online media services appears in a drop - down menu box . a user then has the opportunity to switch the currently active online service to a different online service based on the available services within the list of valid services . fig3 d illustrates the result of a selection made from the list of valid online media services appearing in the drop - down menu box of fig3 c . the selection the user made was “ service 2 ”, which is indicated by the “ service 2 brand ” icon now appearing in the service function area . in addition , the service function buttons changed to correspond with the newly active online service selected by the user . furthermore , although not illustrated in fig3 d , the appearance of the service function area may also change according to customizations provided by the newly active online service indicated by the “ service 2 brand ” icon . fig4 - 7 illustrate more specific examples of how the command bar user interface described with reference to fig3 a - 3 d might be implemented with respect to the graphical user interface of a media player 206 application . fig4 illustrates an example user interface for media player 206 as it might appear on a display of computer 102 . assuming an all - services file 214 has just been retrieved , customization points such as the menu task pane 400 and the service function button area 402 in the top level command bar are still controlled by the last active service . thus , the current service menu task pane 400 displays the html page associated with the last active service , which in the fig4 example is “ movielink ”, as indicated in the service function area 402 of the command bar by the “ movielink ” brand icon . a selection arrow is shown in fig4 hovering over a service list menu button 404 in the command bar . when a user “ selects ” the service list menu button 404 using a user interface selection device ( e . g ., a mouse ), a drop - down box will open up and reveal the list of valid online services from the all - services file 214 . fig5 illustrates an example of a list of valid online services 500 appearing in the drop - down box 502 after the service list menu button 404 has been “ clicked ” by a user . from the list of valid online services 500 , a user can select an online service to be the currently active service . only one service can be the active service at any one time , and the active service controls all of the customization opportunities within the media player 206 , such as the service menu task pane 400 , which in fig4 and 5 is controlled by the currently active “ movielink ” service . thus , a user is able to switch between the different online services 500 shown in the services drop - down box 502 and thereby change which service controls the customization points in the media player 206 . fig6 illustrates a selection of an online service being made that will switch the active service from the “ movielink ” online service to the “ music box ” online service . switching between these services will shift control of the customization points within media player 206 from the “ movielink ” service to the “ music box ” service . as shown in fig6 , the “ music box ” online service has been highlighted 600 for selection . fig7 illustrates the newly selected “ music box ” service as the active service . accordingly , customization points within the media player 206 have changed according to the new active “ music box ” service and the background under the active service buttons has changed . in fig7 , the apparent customization points that have changed are the text and icon in the service function button area 402 and the html page in the service menu task pane 400 . it is noted that the customization points discussed thus far are only examples of customization points , and that various other customization points also exist , some of which are discussed in greater detail below . for example , the several service function buttons 700 are customization points whose color and text descriptions can be customized by the currently active service . fig8 illustrates an example of an all - services file 214 . as noted above , the all - services file 214 is an xml ( extended markup language ) file that contains a list of valid online services and other information needed to populate a service menu list within the media player 206 . other important information included in the all - services file 214 is a url ( universal resource locator ) link to a service information file 216 for each of the services listed in the all - services file 214 . when a service is selected from the service menu list within the media player 206 , the url for the selected service is accessed and the service information file 216 for that service is retrieved . referring to fig8 , an all - services xml file 214 includes various elements that tell the media player 206 how to populate the initial service menu list and where to retrieve each service information file 216 . these elements include & lt ; services & gt ;, & lt ; default & gt ;, & lt ; browse & gt ;, & lt ; service & gt ;, & lt ; friendlyname & gt ;, and & lt ; image & gt ; elements . the & lt ; services & gt ; element includes an optional version attribute that indicates the version of the xml file . the & lt ; default & gt ; element includes a required key attribute that is used to set the initial default service in the player on the very first use of the player . the & lt ; browse & gt ; element includes a required url attribute that links to a “ browse all services ” page that matches the services that are listed in the all - services file 214 . selecting a “ browse all services . . . ” menu item will open the & lt ; servicetask 1 & gt ; ( discussed below ) and switch to a page that will list and promote partner online services . the & lt ; service & gt ; elements represent each service that is a valid service . each & lt ; service & gt ; element includes a required key attribute that is a service key representing the service , a required xmlurl attribute that is a fully qualified url to the service &# 39 ; s service information file 216 , an optional position attribute that indicates the initial position of the service in the service menu list , and an optional type attribute that represents whether the service can customize all customization points within the media player 206 or just the service panes within the media player 206 . the & lt ; friendlyname & gt ; element includes optional text that represents the name that is shown to the user for the service . if the & lt ; friendlyname & gt ; element is not specified , the & lt ; service & gt ; key attribute is used in the player 206 wherever the & lt ; friendlyname & gt ; element is needed . the & lt ; image & gt ; element includes an optional menuurl attribute that is a fully qualified url to a graphic image to use on the service menu list . as noted above , when a service is selected from the service menu list within the media player 206 , the url for the selected service is accessed and the service information file 216 for that service is retrieved . like the all - services file 214 discussed above , the service information file 216 is preferably an xml file . each valid online service in the all - services file 214 hosts it own service information file 216 and uses this file to manage the customization opportunities within the media player 206 . customization opportunities , or customization points , are places or areas within the media player 206 gui ( e . g ., service area of command bar , task panes , etc .) that the media player gives up control over so that the active service can customize them to its own preference . three main categories of customization can generally be described as music , video ( tv , movie ), and radio . referring to fig7 , these categories are represented by the three service function buttons 700 , whose color and text descriptions can be customized by the currently active service . an active / selected service provides an html page for display in task pane 400 for one or more service function buttons 700 . the html page typically provides access to a purchase experience . for example , an active music service may provide an html page that permits a user to search for a particular song or cd , after which the user can purchase and download the song or cd . a service can choose to include one or all of the three categories depending on the type of service . for example , a video service that offers only video products may only choose to use and customize the video category task tab and forego using the music and radio tabs . in addition to the three main service function buttons 700 , an active service also controls customization points regarding various media player functions ( i . e ., host application functions ), such as those represented by the application function buttons 702 on the left side of the media player command bar shown in fig7 . for example , the “ now playing ” function button displays videos in the task pane 400 when a video is being played on the media player 206 . however , when only audio ( e . g ., music ) is playing on the media player , the “ now playing ” function displays either visualizations ( i . e ., shapes , animations , etc .) or an infocenter view . the infocenter view is an html page provided by the active service that typically includes useful information regarding the music that is being played by the media player at the time , such as track listings , artists , etc . furthermore , the “ now playing ” function includes a “ buy media ” ( e . g ., “ buy cd ”, “ buy video ”) shortcut link to the corresponding service function button 700 that permits a user to directly initiate a purchase experience regarding the currently playing media . typically , the shortcut link will bypass intermediate steps such as searches , and proceed directly to a page that permits purchasing the media currently playing on the media player 206 . in addition to the “ now playing ” function as a customization opportunity for the currently active service , various other functions provide such customization opportunities within media player 206 . fig9 illustrates an example of a service information file 216 which includes examples of the various types of functions providing customization opportunities . each service information file 216 includes various elements that tell the media player 206 how to customize the customization points within the player . these elements include & lt ; serviceinfo & gt ;, & lt ; friendlyname & gt ;, & lt ; image & gt ;, & lt ; color & gt ;, & lt ; servicetask 1 & gt ;, & lt ; servicetask 2 & gt ;, & lt ; servicetask 3 & gt ;, & lt ; infocenter & gt ;, & lt ; albuminfo & gt ;, & lt ; buycd & gt ;, & lt ; install & gt ;, and & lt ; htmlview & gt ; elements . the & lt ; serviceinfo & gt ; element is required , and is the container element for the service information file 216 . the & lt ; serviceinfo & gt ; element includes an optional version attribute that indicates the version of the xml file , and a required key attribute that is used by the media player 206 to uniquely identify the particular service . the & lt ; friendlyname & gt ; element is a required element that includes text that will be used to represent the name of the service on the service menu list in the media player 206 . the & lt ; image & gt ; element is optional and it represents the graphical images that should be used to represent the service . the & lt ; image & gt ; element includes an optional menuurl attribute that is a fully qualified url to a 16 × 16 graphic image to use on the service menu list , an optional servicesmallurl that is a fully qualified url to a 30 × 30 graphic image to use in the chrome , and an optional servicelargeurl that is a fully qualified url to a 30 × 60 graphic image to use in the chrome . the file formats supported include . gif , . jpg , . bmp , and . png . png is the preferred file format as transparency is also supported and recommended . if the menuurl attribute isn &# 39 ; t specified , then no graphic is used on the menu . the servicelargeurl attribute for the chrome service image is used if both servicesmallurl and servicelargeurl are present . if the chrome images are wider than the image area ( 30 or 60 depending on which element ), then the image area is animated over the image area when the user selects the service . the & lt ; color & gt ; element is optional and is used to specify the service area button color and navigation bar color . the & lt ; color & gt ; element includes a required mediaplayer attribute of hex rgb value (# ffddcc ). the & lt ; servicetask 1 & gt ;, & lt ; servicetask 2 & gt ;, and & lt ; servicetask 3 & gt ; elements represent the three service function buttons 700 ( fig7 ) in the service function area of the command bar . the & lt ; servicetask 1 & gt ; element is required , while & lt ; servicetask 2 & gt ; and & lt ; servicetask 3 & gt ; are optional . each of the 3 elements includes a required url attribute that is a fully qualified url to an html page that will be loaded to the respective task pane when the user switches services and selects that pane , a required & lt ; buttontext & gt ; attribute that includes text that will be used as the button text for the task pane , and an optional & lt ; buffontip & gt ; attribute that includes text that will be displayed when the user hovers over the button for the task pane . the & lt ; servicetask 1 & gt ; element is required and is considered the primary commerce pane . the media player will launch into this pane when the user selects “ buy media ” within the player . as noted above , the three main categories of customization for these elements can generally be described as music , video ( tv , movie ), and radio . the & lt ; infocenter & gt ; element is optional and is used to specify a customization of the “ now playing ” infocenter view . the & lt ; infocenter & gt ; element includes a required url attribute that is a fully qualified url that refers to an html page . as noted above , the & lt ; infocenter & gt ; view html page provided by the active service typically includes useful information regarding the music that is currently being played by the media player , such as track listings , artists , etc . the & lt ; albuminfo & gt ; element is an optional element that is used to specify a customization of the album information windows in the burn to cd and media library panes . the & lt ; albuminfo & gt ; element includes a required url that is a fully qualified url that refers to an html page . the url will be loaded into the album information window with parameters as a query . the & lt ; buycd & gt ; element is an optional element that is used to specify a purchase experience from various buy links within the media player 206 . the & lt ; buycd & gt ; element includes a required mediaplayerurl , an optional mediacenterurl , and an optional browserurl that are each fully qualified urls that refer to an html page for buying a cd or dvd in the media player 206 . the “ now playing ” function includes a “ buy cd ” shortcut link to the active service web page that permits purchasing the media currently playing on the media player 206 . the & lt ; install & gt ; element is an optional element that is used by setup to install the default service code ( if any ) when setup is run online . the & lt ; install & gt ; element includes a required eulaurl that is a fully qualified url that points to a . txt file for the code that the service wants installed , and a codeurl that is a fully qualified url that points to a . cab file that will be installed during setup if the service is the default service . the & lt ; htmlview & gt ; element is an optional element that is used to allow radio . asx files to specify a trusted htmlview file so that the page can have access to the external . navigatetaskpane ulr function to link deeply into a service . the & lt ; htmlview & gt ; element includes a required baseurl that is a fully qualified url that points to the base url to use for any new htmlview to allow html access . example methods for enabling switching between various online media services and allowing an active service to customize portions of an application on a computer through a command bar user interface will now be described with primary reference to the flow diagrams of fig1 and 11 . the methods apply to the exemplary embodiments discussed above with respect to fig1 - 9 . while one or more methods are disclosed by means of flow diagrams and text associated with the blocks of the flow diagrams , it is to be understood that the elements of the described methods do not necessarily have to be performed in the order in which they are presented , and that alternative orders may result in similar advantages . furthermore , the methods are not exclusive and can be performed alone or in combination with one another . the elements of the described methods may be performed by any appropriate means including , for example , by hardware logic blocks on an asic or by the execution of processor - readable instructions defined on a processor - readable medium . a “ processor - readable medium ,” as used herein , can be any means that can contain , store , communicate , propagate , or transport instructions for use or execution by a processor . a processor - readable medium can be , without limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples of a processor - readable medium include , among others , an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic ), a random access memory ( ram ) ( magnetic ), a read - only memory ( rom ) ( magnetic ), an erasable programmable - read - only memory ( eprom or flash memory ), an optical fiber ( optical ), a rewritable compact disc ( cd - rw ) ( optical ), and a portable compact disc read - only memory ( cdrom ) ( optical ). referring to fig1 , at block 1002 of method 1000 , a list of online services is retrieved . an online service manager 212 related to an application 204 ( e . g ., a media player 206 ) executing on a computer , goes online via a network and accesses a web listing service . the online service manager 212 retrieves an all - services xml file containing a list of valid online services and additional information . one skilled in the art will readily recognize other ways in which a list of valid online services may be retrieved . for example , the list could be hardcoded on the computer by the oem and then retrieved by the online service manager 212 . the list could also be manually constructed by a user registering a media player for a web protocol such that when the user clicks on a special link in the web page of a service provider , the link is received by the player and the service is added to the service list . thus , other sources may be readily available from which the online service manager 212 can access the list of valid online services . at block 1004 , an online service is set as an initial active service based on the last active service previously chosen by the user . if the application has never run before , a default service specified by the all - services file is initially set as the active service . at block 1006 , the online service manager 212 enables the selection of one of the online services as an active service . a service menu within a media player 206 , for example , is populated with the list of online services . each online service is represented in the service menu with a friendly and a graphical image if the name and image have been included by the active service in the retrieved list of online services . selection of one of the online services includes accepting user input that identifies which online service the user desires to make the current active service within the media player . at block 1008 , customization points within the media player 206 ( or other application 204 , operating system 200 , etc .) are customized based on the active service . customization includes retrieving a service information file from the active service and customizing the customization points within the media player 206 ( and / or operating system shell 202 and applications 204 ) by enabling the active service , via the service information file , to control the content within the customization points . the customization points include , for example , task panes and task pane buttons within the media player . customizations within a media player 206 ( and / or operating system shell 202 and applications 204 ) can include a variety of content input and modifications made to parts of the software , including for example , identifying a name for service function button using text provided by the active service , displaying button tip text for the service function button when a selection tool hovers over the service function button , the button tip text being provided by the active service , displaying ( in a task pane ) an html page specified by the active service when a user selects the service function button . customizations can also include displaying an html page from the active service within a now playing function button of the media player , where the html page provides an infocenter view that includes information related to music that is currently being played by the media player . customizations can also include displaying an html page from the active service , where the html page provides album information in a burn - to - cd ( compact disc ) task pane and a media library task pane . customizing can also include displaying a “ buy cd ” link to a web page of the active service within a now playing task pane , where the web page permits purchasing the cd ( compact disc ) or dvd ( digital video disc ) that is currently playing on the media player . at block 1010 , a user input selection is received through the service menu for a different service from the available online services . at block 1012 , the online service manager 212 retrieves a service information file for the different service . at block 1014 , the online service manager 212 switches the active service to the different service based on the input selection made by the user . referring to fig1 , at block 1102 of method 1100 , a user interface is displayed . the user interface includes a command bar that has a host application region to control functions of a host application ( e . g ., a media player application ), and a service region to control functions of a currently active service provider . the application region includes application buttons to control functions of the application and the service region includes service buttons to control functions of the currently active media service . at block 1104 , the user interface provides access to a list of services through a service list menu . user input is received through a user interface selection device ( e . g ., a mouse ) indicating the selection of a service list menu button in the service region . the service list menu provides a drop - down box to display a list of valid services . at block 1106 , the user interface enables a switch from the currently active service to a newly active service . user input is received via the user interface selection device indicating a particular service has been selected from service list menu . in response to the user selection , the active service is switched from the currently active service to the particular / selected service , making it the newly active service . in addition , the appearance of the service region and service buttons within the service region is altered in accordance with customizations provided by the newly active service . for example , the service region branding icon is changed from one identifying the currently active service to one identifying the newly active service . at block 1108 , the appearance of the service region is altered when a service function is made active ( e . g ., by user input selection of the service function button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the service region . at block 1110 , the appearance of a service button is altered when a service button is made active ( e . g ., by user input selection of the service button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the service button . at block 1112 , the appearance of the application region is altered when an application function button is made active ( e . g ., by user input selection of the application function button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the application region . at block 1114 , the appearance of an application button is altered when the application button is made active ( e . g ., by user input selection of the application button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the application button . fig1 illustrates an exemplary computing environment for implementing a computer 102 suitable for enabling switching between various online media services and allowing an active service to customize portions of an application such as a media player as discussed above with reference to fig1 - 9 . although one specific configuration is shown in fig1 , a computer 102 may also be implemented in other computing configurations . the computing environment 1200 includes a general - purpose computing system in the form of a computer 1202 . the components of computer 1202 may include , but are not limited to , one or more processors or processing units 1204 , a system memory 1206 , and a system bus 1208 that couples various system components including the processor 1204 to the system memory 1206 . the system bus 1208 represents one or more of any of several types of bus structures , including a memory bus or memory controller , a peripheral bus , an accelerated graphics port , and a processor or local bus using any of a variety of bus architectures . an example of a system bus 1208 would be a peripheral component interconnects ( pci ) bus , also known as a mezzanine bus . computer 1202 includes a variety of computer - readable media . such media can be any available media that is accessible by computer 1202 and includes both volatile and non - volatile media , removable and non - removable media . the system memory 1206 includes computer readable media in the form of volatile memory , such as random access memory ( ram ) 1210 , and / or non - volatile memory , such as read only memory ( rom ) 1212 . a basic input / output system ( bios ) 1214 , containing the basic routines that help to transfer information between elements within computer 1202 , such as during start - up , is stored in rom 1212 . ram 1210 contains data and / or program modules that are immediately accessible to and / or presently operated on by the processing unit 1204 . computer 1202 may also include other removable / non - removable , volatile / non - volatile computer storage media . by way of example , fig1 illustrates a hard disk drive 1216 for reading from and writing to a non - removable , non - volatile magnetic media ( not shown ), a magnetic disk drive 1218 for reading from and writing to a removable , non - volatile magnetic disk 1220 ( e . g ., a “ floppy disk ”), and an optical disk drive 1222 for reading from and / or writing to a removable , non - volatile optical disk 1224 such as a cd - rom , dvd - rom , or other optical media . the hard disk drive 1216 , magnetic disk drive 1218 , and optical disk drive 1222 are each connected to the system bus 1208 by one or more data media interfaces 1225 . alternatively , the hard disk drive 1216 , magnetic disk drive 1218 , and optical disk drive 1222 may be connected to the system bus 1208 by a scsi interface ( not shown ). the disk drives and their associated computer - readable media provide non - volatile storage of computer readable instructions , data structures , program modules , and other data for computer 1202 . although the example illustrates a hard disk 1216 , a removable magnetic disk 1220 , and a removable optical disk 1224 , it is to be appreciated that other types of computer readable media which can store data that is accessible by a computer , such as magnetic cassettes or other magnetic storage devices , flash memory cards , cd - rom , digital versatile disks ( dvd ) or other optical storage , random access memories ( ram ), read only memories ( rom ), electrically erasable programmable read - only memory ( eeprom ), and the like , can also be utilized to implement the exemplary computing system and environment . any number of program modules can be stored on the hard disk 1216 , magnetic disk 1220 , optical disk 1224 , rom 1212 , and / or ram 1210 , including by way of example , an operating system 1226 , one or more application programs 1228 , other program modules 1230 , and program data 1232 . each of such operating system 1226 , one or more application programs 1228 , other program modules 1230 , and program data 1232 ( or some combination thereof ) may include an embodiment of a caching scheme for user network access information . computer 1202 can include a variety of computer / processor readable media identified as communication media . communication media embodies computer readable instructions , data structures , program modules , or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared , and other wireless media . combinations of any of the above are also included within the scope of computer readable media . a user can enter commands and information into computer system 1202 via input devices such as a keyboard 1234 and a pointing device 1236 ( e . g ., a “ mouse ”). other input devices 1238 ( not shown specifically ) may include a microphone , joystick , game pad , satellite dish , serial port , scanner , and / or the like . these and other input devices are connected to the processing unit 1204 via input / output interfaces 1240 that are coupled to the system bus 1208 , but may be connected by other interface and bus structures , such as a parallel port , game port , or a universal serial bus ( usb ). a monitor 1242 or other type of display device may also be connected to the system bus 1208 via an interface , such as a video adapter 1244 . in addition to the monitor 1242 , other output peripheral devices may include components such as speakers ( not shown ) and a printer 1246 which can be connected to computer 1202 via the input / output interfaces 1240 . computer 1202 may operate in a networked environment using logical connections to one or more remote computers , such as a remote computing device 1248 . by way of example , the remote computing device 1248 can be a personal computer , portable computer , a server , a router , a network computer , a peer device or other common network node , and the like . the remote computing device 1248 is illustrated as a portable computer that may include many or all of the elements and features described herein relative to computer system 1202 . logical connections between computer 1202 and the remote computer 1248 are depicted as a local area network ( lan ) 1250 and a general wide area network ( wan ) 1252 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets , and the internet . when implemented in a lan networking environment , the computer 1202 is connected to a local network 1250 via a network interface or adapter 1254 . when implemented in a wan networking environment , the computer 1202 includes a modem 1256 or other means for establishing communications over the wide network 1252 . the modem 1256 , which can be internal or external to computer 1202 , can be connected to the system bus 1208 via the input / output interfaces 1240 or other appropriate mechanisms . it is to be appreciated that the illustrated network connections are exemplary and that other means of establishing communication link ( s ) between the computers 1202 and 1248 can be employed . in a networked environment , such as that illustrated with computing environment 1200 , program modules depicted relative to the computer 1202 , or portions thereof , may be stored in a remote memory storage device . by way of example , remote application programs 1258 reside on a memory device of remote computer 1248 . for purposes of illustration , application programs and other executable program components , such as the operating system , are illustrated herein as discrete blocks , although it is recognized that such programs and components reside at various times in different storage components of the computer system 1202 , and are executed by the data processor ( s ) of the computer . although the invention has been described in language specific to structural features and / or methodological acts , it is to be understood that the invention defined in the appended claims is not necessarily limited to the specific features or acts described . rather , the specific features and acts are disclosed as exemplary forms of implementing the claimed invention .
6
fig1 illustrates a channel alignment circuit according to the present invention . as shown therein , the channel alignment circuit according to the present invention includes a cib detector 1 for detecting cib of 51 . 84 mbps of six channels which were descrambled and generating a 12 - bit channel number data , a control signal generator 2 for generating a 3 - bit channel alignment control signal by using a 3 - bit data among the channel number data from the cib detector 1 , and a channel alignment unit 3 for separating the data inputted thereinto six channels in accordance with a control signal from the control signal generator 2 . in the channel alignment circuit according to the present invention , the cib detector 1 detects a cib inputted , and generates a 12 - bit channel number data in accordance with the detected cib . the channel number data from the cib detector 1 are formed as follows : ______________________________________channel 1 ` 0000 0000 0000 ` channel 2 ` 0010 0100 1001 ` channel 3 ` 0100 1001 0010 ` channel 4 ` 1001 0010 0100 ` channel 5 ` 1011 1001 1101 ` channel 6 ` 1111 1111 1111 ` ______________________________________ the 12 - bit channel number data from the cib detector 1 are inputted into the control signal generator 2 . the control signal generator 2 generates a 3 - bit signals , for example , bit 2 ˜ bit 0 , bit 5 ˜ bit 3 , bit 8 ˜ bit 6 or bit 11 ˜ bit 9 , which are capable of separating a channel from the 12 - bit channel number data . the 3 - bit control signal generated by the control signal generator 2 is inputted into the channel alignment unit 3 , and the channel alignment unit 3 separates inputted channel data in accordance with a 3 - bit control signal . fig2 illustrates a control signal generator in the circuit of fig1 according to the present invention . as shown therein , the data b0 of the bit 0 from the cib detector is inputted into the input terminals of an and - gates and1 , and2 and and4 and an exclusive or - gate exor , respectively . the data b1 of the bit 1 is inputted into the input terminals of the smd - gates and3 and and4 , respectively . the data b2 of the bit 2 is inputted into the and - gate and1 and the exclusive or - gate exor , respectively , and the input terminals of the and - gates and2 and and3 through an inverter iv1 , respectively , so that a control signal s0 is outputted from the output terminal of the and - gate and1 . the output terminals of the and - gates and2 and adn3 are connected to the input terminal of an or - gate or1 , respectively , so that a control signal s1 is outputted from the output terminal of the or - gate or1 . the output terminals of the exclusive or - gate exor and an and - gate and4 are connected to the input terminal of the or - gate or2 , so that a control signal s2 is outputted from the output terminal of the or - gate or2 . as shown in fig3 a through 3c , in the control signal generator 2 , when the low level data b0 , b1 , and b2 of the bit 0 , bit 1 , and bit 2 are all inputted at a time t1 , the data b0 of the bit 0 is inputted into the input terminals of the and - gates and1 , and2 and and4 and the exclusive or - gate exor , respectively . in addition , the data b1 of the bit 1 is inputted into the input terminals of the and - gates and3 and and4 , respectively . the data b2 of the bit 2 is inputted into the and - gate and1 and the exclusive or - gate exor , respectively , and is inverted by the inverter iv1 as shown in fig3 d and then is inputted into the input terminals of the and - gates and2 and and3 . therefore , since a low level control signal s0 , as shown in fig3 e , is outputted from the and - gate and1 , and a low level signal is outputted from the and - gates and2 through and4 and the exclusive or - gate exor , the or - gates or1 and or2 output low level control signals s1 and s2 as shown in fig3 f and 3g . in addition , when the low level data b0 and b1 of the bit 0 and bit 1 are inputted at a time t2 , and the high level data b2 of the bit 2 is inputted , the and - gate and1 outputs a high level control signal s0 as shown in fig3 e , and the and - gates and2 through and4 output low level data , and the exclusive or - gate exor outputs a high level data . therefore , the or - gate or1 outputs a low level control signal s1 as shown in fig3 f , and the or - gate or2 outputs a high level control signal s2 . when the low level data b0 and b1 of the bit 0 and bit 2 are inputted at a time t3 , and a high level data b1 of the bit 1 is inputted , the and - gate and1 outputs a low level control signal s0 , and the and - gates and2 and and4 and the exclusive or - gate exor output low level data , and the and - gate and3 outputs a high level data . therefore , the or - gate or1 outputs a high level control signal s1 , and the or - gate or2 outputs a low level control signal s2 . when the high level data b0 of the bit 0 is inputted , and the low level data b1 and b2 of the bit 1 and bit 2 are inputted , respectively , at a time t4 , the and - gate and1 outputs a low level control signal s0 , and the and - gates and2 and and4 output low level data , and the and - gate and3 and the exclusive or - gate exor output high level data . therefore , the or - gates or1 and or2 output a high level control signals s2 , respectively . when the data b0 and b2 of the bit 0 and bit 2 are inputted , and the low level b1 of the bit 1 is inputted , respectively , at a time t5 , the and - gate and1 outputs a high level control signal s0 , and the and - gates and2 through and4 and the exclusive or - gate exor output low level data , so that the or - gates or1 and or2 output low level control signals s1 and s2 . when the high level data b0 through b3 of the bits 0 through 3 are inputted at a time t6 , the and - gate and1 outputs a high level control signal s0 , and the and - gates and2 and and3 and the exclusive or - gate exor output low level data , and the and - gate and4 outputs a high level data , so that the or - gate or1 outputs a low level control signal s1 , and the or - gate or2 outputs a high level control signal s2 . so far , the operations that the control signal generator 2 generated the control signals s0 through s2 in accordance with a low 3 - bit signal , namely , the bits 0 through 2 b0 through b2 , among the 12 - bit channel number data from the cib detector 1 were explained . in the present invention , the configuration of the control signal generator 2 may be changed based on the bits among the 12 - bit channel number data without departing from the scope and spirit of the present invention . fig4 illustrates a channel alignment unit in the circuit of fig1 according to the present invention . as shown therein , channel data signals di1 through di5 are inputted into the input terminals of flip - flop units 31 through 35 . the clock terminals ck of the flip - flop units 31 through 35 receive a clock signal clk , respectively . the output terminal q of the flip - flop unit 31 is connected to the input terminal i16 of a multiplexor 36 , and the output terminal q of the flip - flop unit 32 is connected to the input terminals i15 and i26 of the multiplexors 36 and 37 , respectively . the output terminal q of the flip - flop unit 33 is connected to the input terminals i14 , i25 and i36 of the multiplexors 36 through 38 , respectively . the output terminal q of the flip - flop unit 34 is connected to the input terminals i13 , i24 , i35 and i46 of the multiplexors 36 through 39 , respectively . in addition , the output terminal q of the flip - flop unit 35 is connected to the input terminals i12 , i23 , i34 , i45 and i56 of the multiplexors 36 through 40 . in addition , channel data signals di0 through di5 are inputted into input terminals i10 through i60 of the multiplexors 36 through 41 . the channel data signals di0 through di4 are inputted into input terminals i21 through i61 of multiplexors 37 through 41 . the channel data signals di0 through di3 are inputted into the input terminals i32 through i62 of the multiplexors 38 through 41 . the channel data signals di0 through di2 are inputted into input terminals i43 through i63 of the multiplexors 39 through 41 . in addition , the channel data signals di0 and di1 are inputted into input terminals i54 through i64 of the multiplexors 40 and 41 . the channel data signal di0 is inputted into input terminal i65 of the multiplexor 41 . the multiplexors 36 through 41 outputs channel data signals do0 through do5 in accordance with control signals s0 through s2 . in the channel alignment unit 3 according to the present invention , since the channel data signals di0 through di5 are inputted into the input terminals of the lip - flip units 31 through 35 , and the clock signal clk is inputted into the clock terminals ck of the flip - flop units 31 through 35 through the buffer 42 , the flip - flop units 31 through 35 delay the output signals , namely , the channel data signals di1 through di5 by one cycle in accordance with the clock signal clk . therefore , the data signal from the flip - flop unit 31 is inputted into the input terminal i16 of the multiplexor 36 . the output signal from the flip - flop unit 32 is inputted into the input terminals i15 and i26 , respectively , of the multiplexors 36 and 37 . the output signal from the flip - flop unit 33 is inputted into the input terminals i14 , i25 and i36 , respectively , of the multiplexors 36 through 38 . the output signal from the flip - flop unit 34 is inputted into the input terminals i13 , i24 , i35 and i46 , respectively , of the multiplexors 36 through 39 . the output signal from the flip - flop unit 35 is inputted into the input terminals i12 , i23 , i34 , i45 and i56 , respectively , of the multiplexors 36 through 40 . in addition , the channel data signals di0 through di5 are inputted into the input terminals i10 through i60 through the multiplexors 36 through 41 . the channel data signals di0 through d14 are inputted into the input terminals i21 through i61 of the multiplexors 37 through 41 . the channel data signals di0 through di3 are inputted into the input terminals i32 through i61 of the multiplexors 38 through 41 . the channel data signals di0 through di2 are inputted into the input terminals i43 through i63 of the multiplexors 39 through 41 . the channel data signals di0 and di1 are inputted into the input terminals i54 through i64 of the multiplexors 40 and 41 . the channel data signal di0 is inputted into the input terminal i65 of the multiplexor 41 . in the above - described state , when low level control signals s0 through s2 are all inputted , the multiplexors 36 through 41 select the signals from the input terminals i10 through i60 , and the multiplexors 36 through 41 output the channel data signals di0 through di5 which were not delayed . in addition , when low level control signals s0 and s1 are inputted , and a high level control signal s2 is inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i11 through i61 , and the multiplexors 37 through 41 select and output the channel data signals di0 through di4 which were not delayed , and the multiplexor 36 selects and outputs the channel data signal di5 which was delayed by the flip - flop unit 31 . when low level control signals s0 and s2 are inputted , and a high level control signals s1 is inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i12 through i62 . in addition , the multiplexors 38 through 41 select and output the channel data signals di0 through di3 which were not delayed . in addition , the multiplexors 36 and 37 select and output the channel data signals di4 and di5 delayed by the flip - flip units 31 and 32 . when a low level control signal s0 is inputted , and high level control signals s1 and s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i13 through i63 . the multiplexors 39 through 41 select and output the channel data signals di0 through di2 which were not delayed . in addition , the multiplexors 36 through 38 select and output the channel data signals di3 through di5 delayed by the flip - flop units 31 through 33 . when a high level control signal s0 is inputted , and low level control signals s1 and s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i14 through i64 . in addition , the multiplexors 40 and 41 select and output the channel data signals di0 and di1 which were not delayed . in addition , the multiplexors 36 through 39 select and output the channel data signals di2 through di5 delayed by the flip - flop units 31 through 34 . when high level control signals s0 through s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i15 through i65 . in addition , the multiplexor 41 selects and outputs the channel data signal di0 which was not delayed . in addition , the multiplexors 36 through 40 select and output the channel data signals di1 through di5 delayed by the flip - flop units 31 through 35 . as described above , the channel alignment circuit according to the present invention is directed to separating six channels , so that a user can variously select the channel by using several frames for the identical serial data . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as recited in the accompanying claims .
7
fig1 shows a ripper assembly , generally designated 10 , movably mounted on the rear of a crawler type tractor which is shown to have the rear plates 11 and 12 to which the assembly 10 is movably mounted for up - and - down movement , in the usual manner . the assembly 10 includes the ripper member 13 which has an upstanding shank portion 14 suitably attached to spaced - apart plates 16 which are secured to a hollow tool bar 17 forming a part of the assembly 10 . also , pivotally - mounted links 18 and 19 are included in the assembly 10 , and they are pivotally mounted on the tractor by means of pins 21 and 22 which are secured to the plate 12 , and one skilled in the art will readily understand that there are two plates 12 spaced apart at the rear of the tractor for securing the pins 21 and 22 as shown in fig1 . thus the assembly 10 also has a plate 23 which is suitably secured to the tool bar 17 , such as by welding or the like , and the rearward ends of the links 18 and 19 are pivotally attached to the plate 23 through the pivot pins 24 and 26 . as such , the pivotal mounting for the assembly 10 at the rear of the tractor 11 is in the nature of a parallelogram mounting , and thus the tool bar 17 can be moved up and down relative to the tractor 11 , and the movement is substantially in a vertical direction . a powered cylinder assembly 27 is also pivotally connected between the tractor 11 and the assembly plate 23 , and suitable power controls of a hydraulic nature are preferably connected with the assembly 27 for the usual extension and contraction of the assembly piston rod 28 to thereby induce the up - and - down movement in the ripper assembly 23 . accordingly , fig2 shows that the tool bar 17 is elongated and has the plates 16 and 23 affixed thereto at locations along the length of the tool bar 17 . as such , there would be two links 19 connecting to each pair of plates 23 , as seen in fig2 and of course there would also be two links 18 connected to the two pairs of plates 23 . fig2 further shows that there are pairs of plates 16 located at spaced - apart locations along the length of the tool bar 17 , and each pair of plates 16 receives the shank 14 of the ripper member so that a plurality of ripper members are mounted on the tool bar 17 at spaced - apart locations relative to the length or axis of the tool bar 17 . anyone skilled in the art should readily understand the arrangement of the tractor and the ripper assembly mentioned and described herein , and u . s . pat . no . 3 , 527 , 308 also shows an arrangement of a crawler type tractor and a ripper assembly at the rear thereof and having a horizontally - disposed tool bar and ripper members depending therebelow , and that prior art showing is incorporated in this description . however , it should be noted and fully understood that in the present invention the tool bar 17 is elongated and of a hollow configuration having an endless girth in the direction transverse to the longitudinal axis thereof , as shown in the sectional view in fig4 and that girth is of a general rectangular configuration . also , the ripper shanks 14 are attached to the tool bar 17 to be offset therefrom and fully exteriorly related to the hollow tool bar 17 , rather than passing through the tool bar and obstruct or impede the arrangement of the hollow interior of the tool bar 17 . as such , the ripper mounting plates 16 extend rearwardly of the tool bar 17 , as clearly shown in fig4 . therefore , it will be understood that the ripper shank 14 extends between the spaced - apart mounting plates 16 and to the upper edges 29 of the plates 16 , and the ripper shanks 14 are removable from between the plates 16 and pin openings 31 in each of the plates 16 are arranged to receive a pin which will secure the ripper shank 14 from between the plates 16 , in a desired arrangement . in the actual showings , all of the plates 16 are not identical in configuration so that the plate on each opposite end of the bar 17 is of one configuration , as shown in fig3 and the plate 16 which aligns with the plate 23 is of a somewhat different configuration , as also shown in fig3 and the plates 16 in the center of the tool bar 17 are of still a slightly different configuration , as seen in fig4 . however , for purposes of a succinct description thereof , the plates 16 are considered to be the spaced - apart pairs of plates for the mounting of the ripper shanks 14 , with each pair 16 receiving one shank 14 , and thus the plates are all designated 16 . also , in all instances of the plates 16 , they have forwardly extending portions which are shown to be welded to the tool bar 17 , and the plates 16 have rearwardly extending portions 32 which are offset from the tool bar 17 and which are the portions which actually engage the ripper shanks 14 in that offset arrangement . fig2 shows that there are two plates at the opposite ends of the tool bar 17 and these plates have the portions 32 and extend transverse to the longitudinal axis of the tool bar and completely around and beyond the girth thereof , as seen in fig3 . with the arrangement of the hollow tool bar 17 and the off - set plates 16 for mounting the tool or ripper member 13 , the tool bar 17 is available for receiving counterweights 33 which are of an elongated configuration and which have a transverse cross - section corresponding to the rectangular transverse cross - section of the tool bar 17 , as shown in fig1 and in fig5 and 6 . thus , the counterweight 33 fits snugly into the tool bar 17 for at least the length of the counterweight 33 , and that length would of course be something less than the total length of the tool bar 17 . therefore , there may be several counterweights 33 which can be readily slid into the tool bar 17 , depending upon the desired counterweight effect required and depending upon the particular weight of each counterweight 33 so that the operator can easily lift a counterweight and not find it too large or heavy . fig6 shows that the counterweight can take the configuration shown in that counterweight 34 where there is actually a laminated type of counterweight having weldments 36 , or there may be other means for attaching pieces of counterweight together to form one unitary counterweight 34 in a desired weight and overall size . in all instances , the counterweights 33 and 34 are of a desired and convenient length and they are of a cross - sectional shape to fit snugly within the girth of the tool bar 17 , and the operator can easily slide them into and out of the hollow tool bar 17 , especially when the tool bar 17 is in the lowered position to where it is closest to the ground . finally , the assembly 10 is arranged with a removable cover plate 37 on each end of the tool bar 17 to close off the ends of the tool bar 17 and thus conceal the counterweights and secure them within the tool bar 17 . while only one end and one cover plate 37 is shown , such as in fig1 it will be understood that there is a cover plate 37 on each end of the tool bar 17 , and each cover plate 37 is adjacent the respective end plate 16 which overlaps the cover plate . also , the cover plate 17 can be secured by holes 38 in openings 31 and 39 in end plates 16 so that the cover plates are removably affixed in the assembly 10 . further , each cover plate 37 has an access or inspection opening 39 extending therein , and the perator can therefore see whether or not there is any counterweight within the tool bar 17 , and he can also use a probe rod to either determine the presence of the counterweight within the tool bar or to slide the counterweight along the tool bar 17 either for positioning the counterweight or for removing it from the tool bar 17 and that can be accomplished without removing the utilized cover plates 37 at that time . with the arrangement of the assembly 10 as described in the foregoing , the counterweights of various length and mass can be readily and easily inserted into and removed from the hollow tool bar 17 and they are disposed at the optimum position rearwardly on the tractor assembly for maximum counterbalancing effect , all as desired . further , since the assembly 10 is at the rearmost position of the tractor and attachment arrangement , and since the assembly 10 moves up and down , the complete enclosing of the counterweights 33 and / or 34 within the tool bar 17 assures the effectiveness of the counterbalancing and the security of retaining the weights in the unit and not having them fall out or be repositioned inadvertently . also , when the assembly 10 is in the raised position , the tractor may be used for moving in a reverse direction which is actually toward the assembly 10 , and in that event if the assembly 10 engages an obstacle , the links and particularly the cylinder assembly 27 are retained in the position shown in fig1 and that is the raised position , by virtue of an abutment piece 41 affixed to the rear of the tractor 11 and extending with an abutment surface 42 which engages a matching abutment surface 43 on the link 18 . that is , raising the assembly 10 against the effect of the counterweights within the tool bar is guided to the position shown in fig1 where the abutting surfaces are engaged , and then if the assembly 10 is forced upon by an obstacle , the cylinder 27 is protected from damage by virtue of the abutments and limit stops described . that is , the cylinder 27 will still be under necessary pressure to support the counterweights and the entire assembly 10 , but the cylinder will not be damaged if the assembly 10 inadvertently hits an obstruction since fig1 shows the cylinder assembly 27 in a retracted position and the abutment surfaces 42 and 43 are engaged and thus prevent further cylinder retraction .
4
fig1 depicts an aerial view an aerial fire truck 19 that has just arrived at the scene of the fire . it is up to the driver to position the aerial fire truck so that the truck &# 39 ; s outriggers can be fully extended in order to safely operate the aerial device . left front outrigger 20 c and left rear outrigger 20 d are shown in the extended position . outriggers provide stabilization for the fire truck when the aerial apparatus is in operation , and particularly , when the aerial swings to a side of the fire truck chassis . mounted next to each outrigger are ultrasonic sensors shown as 22 c and 22 d on the left side of the fire truck . there are potential obstructions 24 a and 24 b located near the rear of the aerial fire truck 19 in potential conflict with the outrigger 20 c and 20 d from being extended . in the preferred embodiment , ultrasonic sensors are used . other sensor technologies , such as lasers , tactile sensors , and infrared sensors were also considered , but found to have limitations or unneeded complexity to accomplish the same task as the ultrasonic sensors . fig2 depicts the fire truck from the top . fire truck 19 is shown arriving at the scene of the fire / emergency . outriggers 20 a through 20 c are shown extended to provide support for the fire truck when the aerial is in operation . however , outrigger 20 d cannot be extended due to obstruction 24 b which prevents outrigger 20 d from fully extending . therefore , the fire truck needs to be repositions so that outrigger 20 d can be fully extended and not be obstructed by obstructions 20 a or 20 b . sensors 22 a through 22 d are shown carried by the fire truck and positions in close proximity to outriggers 22 a through 22 d . fig3 shows the top of the fire truck ( aerial apparatus not shown ) with the outriggers in a retracted position . sensor 22 a is able to determine whether there is an obstruction within outrigger zone 28 a . outrigger zone 28 a is an area defined by the space occupied by outrigger 20 a when outrigger 20 a is fully extended . as shown , there are no obstructions within outrigger zone 28 a preventing outrigger 22 a from being fully extended . therefore , sensor 22 a detects no obstructions in outrigger zone 28 a . similarly , sensors 22 b and 22 c are able to detect whether obstructions exist within outrigger zones 28 b and 28 c respectively . as shown , there are no obstructions within outrigger zones 28 b or 28 c . however , obstruction 24 b is contained within outrigger zone 28 d so that sensor 22 d detects that there is an obstruction within outrigger zone 28 d preventing outrigger 22 d from being full extended . it should be known that the sensor beams 18 a through 18 d need not cover the same area as outrigger zones 28 a through 28 d , respectively . rather , the outrigger zone need only be contained within the sensor beam and operatively configured to detect an obstruction within the outrigger zone . for example , ultrasonic sensors output is dependent on the comparison at the time taken for an echo to return . the distance to an object is proportional to the distance to the object . further , an ultrasonic proximity sensor has output whose intensity can be dependent on the distance of an object from the sensor . therefore , an ultrasonic sensor , including a transducer or proximity sensor , can determine whether an object is within a certain distance and therefore within the outrigger zone . referring to fig3 , sensors 22 c through 22 d may have sensing zones shown as 18 a through 18 d , respectively . however , the sensors can be configured to determine if an obstruction is within the outrigger zone , a zone smaller than the area of the sensing zone . fig4 is a schematic of the invention . sensors 22 a through 22 d are shown associated with outrigger zones 28 a through 28 d respectively . the sensors are connected to a power supply 20 and can have a switch 22 . warning panel 24 can have warning indicators 26 a through 26 d which can be connected to the sensors . warning indicators 26 a through 26 d are in communications with sensors 22 s through 22 d respectively so that when an obstruction is detected within the outrigger zone , the associated sensor signal is used to actuate the corresponding warning indicator on the warning panel . further , the warning panel can have a representation of a view of the fire truck approximating the location of the outriggers in relation to the fire truck chassis . the warning indicators can be located on the warning panel so that when actuated , the fire truck driver is provided with an indication of which outrigger zone contains the obstruction and therefore can reposition the fire truck accordingly . after the driver has been warned of the obstruction 24 d by actuated warning indicator 26 d , corrective action can be employed such as pull the aerial fire truck 19 forward until obstruction 24 b is not longer detected within outrigger zone 28 d . clearance of obstruction 24 d is completed when sensor 22 d no longer detects obstruction 24 b . warning indicator 26 d on warning panel 24 is no longer illuminated , providing a “ clear ” state to the driver . switch 22 can be operatively associated with the parking brake of the fire truck so that switch 22 is closed when the parking brake is applied . switch 22 can be operatively associated with the power system of the aerial apparatus so that when power is applied to the aerial apparatus , switch 22 is closed . a relay 30 can be included so that the sensor signals can be transmitted to relay 30 to actuate the corresponding warning indicator when the sensor detects an obstruction in the respective outrigger zone . computer readable instructions embodied in a computer readable medium as well as electrical circuitry can be operatively associated with the sensors so that when the sensor detects an object within its sensing zone , the computer readable instructions determine whether the object is within the outrigger zone and the corresponding warning indicator can be actuated indicating that an obstruction exists within the outrigger zone . fig5 shows a top view of the fire truck when the fire truck has been positions so that there are no obstructions in the outrigger zones 28 a through 28 d . when the warning panel indicates that there is an obstruction within an outrigger zone , the driver of the fire truck can reposition the fire truck until the previously actuated warning indicator no longer is actuated thereby representing that no obstructions re present in the outrigger zones 28 a through 28 d . ultrasonic sensors emit sound pulses through a diaphragm on the front of the sensor . the sound pulses emanate from the sensor in a predetermined pattern known as the sensor beam . when an object passes through the sensor beam , the sound pulses are reflected back to the sensor diaphragm . the sensor &# 39 ; s electronics monitor the pulse reflection to determine an object is obstructing the beam . when an obstruction is detected , the sensor sends a signal output to representing that the sensor has detected an object within the sensor beam . a relay can be used between sensors 22 a , 22 b , 22 c and 22 d and the warning indicators 28 a , 28 b , 28 c and 28 d . the relay is used to convert the low current sensor output to a high current signal output which can be used to actuate the warning indicators . fig6 illustrates a perspective view of an aerial fire truck showing the outriggers in the retracted position . in one embodiment , sensor 22 c is carried by the fire truck in close proximity to an outrigger plate 32 c . outrigger plate 32 c covers the outrigger assembly and is generally flush with the side of the fire truck when the outrigger is in the retracted position . in another embodiment , sensor 22 c is mounted on the outrigger place 32 c . therefore , the sensors can also be mounted in close proximity to the outrigger plate or on the outrigger plate itself . the actual location of outriggers may vary depending on the type and construction of the outrigger assembly employed on the aerial fire truck . further , in one embodiment , there may be only two outrigger assemblies on the aerial fire truck . referring to fig7 a , sensor 22 a can be mounted on a pivotal mount . by mounting the sensors on a pivoting mount , the sensors can be positioned so that the sensors sensing areas overlaps that of the outrigger zone . the sensors can be positioned so that the sensor beam path intersects the outermost point of the space occupied by the outrigger when fully extended . in one embodiment , base bracket 44 can be secured to the faire truck . rotating member 42 can be connected to base bracket 40 a and 40 b ( fig7 b ) so that the rotating member can be secured in place or allowed to rotate based upon tightening or loosening of screws 40 a and 40 b . swivel 46 allows the sensor to swivel and in combination with the movement allowed by the rotating member , the sensor can be positioned in two different planes . in one embodiment , base socket 50 is secured to the fire truck . ball joint 48 is received in the base socket and allows the sensor to be positioned in two different planes . swivel 46 can also be used to mount sensor 22 a to ball joint 48 to allow even further range of positions of the sensor . in one embodiment , the mount consists of a vehicle mounting bracket , sensor mount bracket and two locking nuts . the “ l ” shaped vehicle mounting bracket has curved slots on each face , with a hole on the face that mates to the surface of the fire truck 19 . the “ l ” shaped sensor mounting bracket has a round hole to accept the sensor on one face , with two through holes on the other face to mate to the vehicle mounting bracket . two locking nuts are positioned on the sensor 22 a , 22 b , 22 c and 22 d and on each side of the face with the through hole on the sensor mounting bracket . this configuration allows the sensor 22 a , 22 b , 22 c and 22 d to be positioned in 2 different planes , thereby achieving the ability to point the sensor 22 a , 22 b , 22 c and 22 d along the desired path . in one embodiment , this mount is affixed to the body via hardware , in close proximity to the outrigger assembly , and approximately 2 feet off the ground . the computer readable instructions can receive a signal from the sensors and then actuate the warning indicator . further , a parking brake can send a signal to the computer readable instructions so that the computer readable instructions will only actuate the warning indicator according to the sensor signal if the fire truck parking brake is engaged . the power system of the aerial truck can also be in communication with the computer readable instructions so that the warning indicator will only be actuated when power to the aerial apparatus is applied . further , the outrigger actuator can be in communications with the computer readable instructions so that the outrigger will not be extended if the sensor detects an obstruction in the outrigger zone . in one embodiment , sensors 22 a , 22 b , 22 c and 22 d can be calibrated to send a signal when an object is detected at a known point in space . in other words , the sensing distance can be set by calibrating the sensor . in operation , the fire truck operator maneuvers the aerial fire truck 19 into a setup position . power is applied to the sensors . in one embodiment , sensors , 22 a , 22 b , 22 c and 22 d start emitting sound pulses at each outrigger location . if an object is detected in any of the outrigger zones , the corresponding sensor will send a signal to a relay . the relay will switch to a normally closed position and send an output to the warning indicator 28 a , 28 b , 28 c or 28 d , informing the operator of an unsafe setup position . the vehicle can then be repositioned until no obstructions are detected . in one embodiment , programmable input / output module is used in place of the relay . the programmable i / o module provides power to the ultrasonic sensors 22 a , 22 b , 22 c and 22 d , controls inputs from the sensors , and provides outputs to the warning indicators 28 a , 28 b , 28 c and 28 d . the input / output module has built in circuit protection for each output . user defined parameters are programmed to control the switching logic . in operating , if an object is detected in any of the outrigger zones , the corresponding sensor will send a signal to the programmable input / output module . the programmable input / output module is programmed to send an output to the appropriate warning indicator 28 a , 28 b , 28 c and 28 d informing the operator of an unsafe setup position . while a preferred embodiment of the invention has been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the following claims .
1
deuterium ( d or 2 h ) is a stable , non - radioactive isotope of hydrogen and has an atomic weight of 2 . 0144 . hydrogen naturally occurs as a mixture of the isotopes 1 h ( hydrogen or protium ), d ( 2 h or deuterium ), and t ( 3 h or tritium ). the natural abundance of deuterium is 0 . 015 %. one of ordinary skill in the art recognizes that in all chemical compounds with a h atom , the h atom actually represents a mixture of h and d , with about 0 . 015 % being d . thus , compounds with a level of deuterium that has been enriched to be greater than its natural abundance of 0 . 015 %, should be considered unnatural and , as a result , novel over their non - enriched counterparts . all percentages given for the amount of deuterium present are mole percentages . it can be quite difficult in the laboratory to achieve 100 % deuteration at any one site of a lab scale amount of compound ( e . g ., milligram or greater ). when 100 % deuteration is recited or a deuterium atom is specifically shown in a structure , it is assumed that a small percentage of hydrogen may still be present . deuterium - enriched can be achieved by either exchanging protons with deuterium or by synthesizing the molecule with enriched starting materials . the present invention provides deuterium - enriched tirapazamine or a pharmaceutically acceptable salt thereof . there are six hydrogen atoms in the tirapazamine portion of tirapazamine as show by variables r 1 - r 6 in formula i below . the hydrogens present on tirapazamine have different capacities for exchange with deuterium . hydrogen atoms r 1 - r 2 are easily exchangeable under physiological conditions and , if replaced by deuterium atoms , it is expected that they will readily exchange for protons after administration to a patient . the remaining hydrogen atoms are not easily exchangeable for deuterium atoms . however , deuterium atoms at the remaining positions may be incorporated by the use of deuterated starting materials or intermediates during the construction of tirapazamine . the present invention is based on increasing the amount of deuterium present in tirapazamine above its natural abundance . this increasing is called enrichment or deuterium - enrichment . if not specifically noted , the percentage of enrichment refers to the percentage of deuterium present in the compound , mixture of compounds , or composition . examples of the amount of enrichment include from about 0 . 5 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 , 16 , 21 , 25 , 29 , 33 , 37 , 42 , 46 , 50 , 54 , 58 , 63 , 67 , 71 , 75 , 79 , 84 , 88 , 92 , 96 , to about 100 mol %. since there are 6 hydrogens in tirapazamine , replacement of a single hydrogen atom with deuterium would result in a molecule with about 17 % deuterium enrichment . in order to achieve enrichment less than about 17 %, but above the natural abundance , only partial deuteration of one site is required . thus , less than about 17 % enrichment would still refer to deuterium - enriched tirapazamine . with the natural abundance of deuterium being 0 . 015 %, one would expect that for approximately every 6 , 667 molecules of tirapazamine ( 1 / 0 . 00015 = 6 , 667 ), there is one naturally occurring molecule with one deuterium present . since tirapazamine has 6 positions , one would roughly expect that for approximately every 40 , 002 molecules of tirapazamine ( 6 × 6 , 667 ), all 6 different , naturally occurring , mono - deuterated tirapazamines would be present . this approximation is a rough estimate as it doesn &# 39 ; t take into account the different exchange rates of the hydrogen atoms on tirapazamine . for naturally occurring molecules with more than one deuterium , the numbers become vastly larger . in view of this natural abundance , the present invention , in an embodiment , relates to an amount of an deuterium enriched compound , whereby the enrichment recited will be more than naturally occurring deuterated molecules . in view of the natural abundance of deuterium - enriched tirapazamine , the present invention also relates to isolated or purified deuterium - enriched tirapazamine . the isolated or purified deuterium - enriched tirapazamine is a group of molecules whose deuterium levels are above the naturally occurring levels ( e . g ., 17 %). the isolated or purified deuterium - enriched tirapazamine can be obtained by techniques known to those of skill in the art ( e . g ., see the syntheses described below ). the present invention also relates to compositions comprising deuterium - enriched tirapazamine . the compositions require the presence of deuterium - enriched tirapazamine which is greater than its natural abundance . for example , the compositions of the present invention can comprise ( a ) a μg of a deuterium - enriched tirapazamine ; ( b ) a mg of a deuterium - enriched tirapazamine ; and , ( c ) a gram of a deuterium - enriched tirapazamine . in an embodiment , the present invention provides an amount of a novel deuterium - enriched tirapazamine . examples of amounts include , but are not limited to ( a ) at least 0 . 01 , 0 . 02 , 0 . 03 , 0 . 04 , 0 . 05 , 0 . 1 , 0 . 2 , 0 . 3 , 0 . 4 , 0 . 5 , to 1 mole , ( b ) at least 0 . 1 moles , and ( c ) at least 1 mole of the compound . the present amounts also cover lab - scale ( e . g ., gram scale ), kilo - lab scale ( e . g ., kilogram scale ), and industrial or commercial scale ( e . g ., multi - kilogram or above scale ) quantities as these will be more useful in the actual manufacture of a pharmaceutical . industrial / commercial scale refers to the amount of product that would be produced in a batch that was designed for clinical testing , formulation , sale / distribution to the public , etc . in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel mixture of deuterium enriched compounds of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel pharmaceutical compositions , comprising : a pharmaceutically acceptable carrier and a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides a novel method for treating cancer comprising : administering to a patient in need thereof a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides an amount of a deuterium - enriched compound of the present invention as described above for use in therapy . in another embodiment , the present invention provides the use of an amount of a deuterium - enriched compound of the present invention for the manufacture of a medicament ( e . g ., for the treatment of cancer ). the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . this invention encompasses all combinations of preferred aspects of the invention noted herein . it is understood that any and all embodiments of the present invention may be taken in conjunction with any other embodiment or embodiments to describe additional more preferred embodiments . it is also to be understood that each individual element of the preferred embodiments is intended to be taken individually as its own independent preferred embodiment . furthermore , any element of an embodiment is meant to be combined with any and all other elements from any embodiment to describe an additional embodiment . the examples provided in the definitions present in this application are non - inclusive unless otherwise stated . they include but are not limited to the recited examples . the compounds of the present invention may have asymmetric centers . compounds of the present invention containing an asymmetrically substituted atom may be isolated in optically active or racemic forms . it is well known in the art how to prepare optically active forms , such as by resolution of racemic forms or by synthesis from optically active starting materials . all processes used to prepare compounds of the present invention and intermediates made therein are considered to be part of the present invention . all tautomers of shown or described compounds are also considered to be part of the present invention . “ host ” preferably refers to a human . it also includes other mammals including the equine , porcine , bovine , feline , and canine families . “ treating ” or “ treatment ” covers the treatment of a disease - state in a mammal , and includes : ( a ) preventing the disease - state from occurring in a mammal , in particular , when such mammal is predisposed to the disease - state but has not yet been diagnosed as having it ; ( b ) inhibiting the disease - state , e . g ., arresting it development ; and / or ( c ) relieving the disease - state , e . g ., causing regression of the disease state until a desired endpoint is reached . treating also includes the amelioration of a symptom of a disease ( e . g ., lessen the pain or discomfort ), wherein such amelioration may or may not be directly affecting the disease ( e . g ., cause , transmission , expression , etc .). “ therapeutically effective amount ” includes an amount of a compound of the present invention that is effective when administered alone or in combination to treat the desired condition or disorder . “ therapeutically effective amount ” includes an amount of the combination of compounds claimed that is effective to treat the desired condition or disorder . the combination of compounds is preferably a synergistic combination . synergy , as described , for example , by chou and talalay , adv . enzyme regul . 1984 , 22 : 27 - 55 , occurs when the effect of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent . in general , a synergistic effect is most clearly demonstrated at sub - optimal concentrations of the compounds . synergy can be in terms of lower cytotoxicity , increased antiviral effect , or some other beneficial effect of the combination compared with the individual components . “ pharmaceutically acceptable salts ” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include , but are not limited to , mineral or organic acid salts of the basic residues . the pharmaceutically acceptable salts include the conventional quaternary ammonium salts of the parent compound formed , for example , from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include , but are not limited to , those derived from inorganic and organic acids selected from 1 , 2 - ethanedisulfonic , 2 - acetoxybenzoic , 2 - hydroxyethanesulfonic , acetic , ascorbic , benzenesulfonic , benzoic , bicarbonic , carbonic , citric , edetic , ethane disulfonic , ethane sulfonic , fumaric , glucoheptonic , gluconic , glutamic , glycolic , glycollyarsanilic , hexylresorcinic , hydrabamic , hydrobromic , hydrochloric , hydroiodide , hydroxymaleic , hydroxynaphthoic , isethionic , lactic , lactobionic , lauryl sulfonic , maleic , malic , mandelic , methanesulfonic , napsylic , nitric , oxalic , pamoic , pantothenic , phenylacetic , phosphoric , polygalacturonic , propionic , salicyclic , stearic , subacetic , succinic , sulfamic , sulfanilic , sulfuric , tannic , tartaric , and toluenesulfonic . table 1 provides compounds that are representative examples of the present invention . when one of r 1 - r 6 is present , it is selected from h or d . table 2 provides compounds that are representative examples of the present invention . where h is shown , it represents naturally abundant hydrogen . numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise that as specifically described herein .
2
in fig1 a server data processing apparatus 10 is connected to other server data processing apparatuses 12 and 13 via a network 11 , which could be , for example , the internet . the servers 10 , 12 and 13 interact which each other , in the preferred embodiment , to carry out the processing of transactions ( e . g ., updates to bank accounts ). server 10 has a processor 101 for controlling the operation of the server 10 , a ram volatile memory element 102 for temporarily storing data concerning the transactions that are being carried out , a non - volatile memory 103 for also storing such data so that the transactions can be recovered in case of a server failure , and a network connector 104 for use in interfacing the server 10 with the network 11 so that the server 10 can communicate with the other servers 12 and 13 in the processing of transactions . it should be noted that a network of servers is shown in the preferred embodiment but in other embodiments the server 10 could be operating alone in processing transactions without interacting with other servers . the structure of the transactions log file , stored in the non - volatile storage 103 , is shown in fig2 . the log file 20 is broken up into extent files 21 , 22 , 23 , which are of equal size in the preferred embodiment but which can be of different sizes in other embodiments . taking extent file 21 as an example , log records 21 a , 21 b and 21 c are stored in the extent file 21 as the server 10 processes transactions . should the server 10 experience a failure ( e . g ., a power loss ), upon recovering , the server 10 uses this log file 20 to recreate the transaction processing environment that existed prior to the failure , as was discussed above . the processor 101 , in the preferred embodiment , allocates extent files 21 , 22 to be used in storing log records in the log file 20 . the processor 101 first allocates a first extent file 21 and as the server 10 participates in the processing of transactions , log records 21 a , 21 b , 21 c etc . are stored in the first extent file 21 ( see step 31 of the flowchart of fig3 ). at step 32 , the processor 101 determines whether the presently allocated extent file 21 has been completely written with log records ( that is , is there further room for more log records to be written into the current extent file ). if the current extent file still has more room for further log records to be written , control flows back to step 31 where further log records are stored in extent file 21 . however , if it is determined that the current extent file 21 can not store any further log records , control flows to step 33 where the processor 101 allocates a new extent file 22 to be used in storing log records . then , control flows to step 34 where the processor 101 begins a key - point operation on the log file 20 , and after the key - point operation finishes , control flows back to step 31 where further log records are stored in the extent file 22 . a brief description of the key - pointing operation , in conjunction with the preferred embodiment of the present invention , will now be described with reference to fig4 . fig4 shows the extent file 22 of fig2 during the key - pointing operation which takes place at step 34 of fig3 . importantly , the key - pointing operation is taking place in a newly allocated extent file that is free to have log records written thereto . this should be contrasted with the prior art in which key - pointing took place within an extent file which is also used to hold log records that the key - pointing operation will act upon . in the preferred embodiment of the present invention , at the beginning of the key - pointing operation , a key - point start record 22 a is written as the first log record in the new extent file 22 . then , all of the active log records from extent file 21 are stored in the subsequent log records 22 b , 22 c up to 22 n − 1 . then , a key - point end record 22 n is written . then , control flows back to step 31 where the subsequent log records 22 n + 1 , 22 n + 2 , 22 n + 3 , etc ., are used to store additional data for transactions . once the key - pointing operation has been carried out , the extent file 21 can now be deleted since any active data in this extent file has been rewritten by the key - pointing operation into the new extent file 22 . this presents a considerable savings in log file space , since the entire extent file 21 can now be deleted and thus freed up for further use . also , a considerable savings in processor activity is realized by the present invention because the key - pointing operation occurs quite infrequently if the size of the extent file is large ( thus allowing the processor to spend its processing time on other things besides repetitive maintenance tasks such as key - pointing ). when an extent file becomes redundant as the result of a key - point operation , instead of deleting the extent file , the extent file could be converted into the cushion file in the event that the cushion file has already been used by the log . the key - point operation will now guarantee the removal of at least one extent file . thus , unless the size of da approaches the size of an extent file ( a condition that can be avoided by tuning the size of the extent files prior to server deployment ) it is now possible to continuously run the logger with enough space for only one extent file and one cushion file . clearly , if the size of da did approach the size of an extent file , the key - point operation may require more space than is available in the cushion file , thus causing the log to run out of space . it is assumed , in the preferred embodiment , that the size of the active data ( da ) associated with running transactions is considerably smaller than the size of an extent file . thus , once the key - pointing operation is carried out at step 34 in the new extent file 22 that was allocated at step 33 , there will still be room left for storing more log records when the control flows back to step 31 . however , if this assumption is not true and the key - pointing operation results in the entire new extent file 22 being used up by the rewriting of the active data da , then another extent file would be allocated by the processor 101 prior to control flowing back to step 31 . according to the preferred embodiment of the present invention as described above , the key - pointing operation at step 34 is triggered when a new extent file is allocated . however , in another embodiment , the key - pointing operation could be triggered when a first log record is written into the newly allocated extent file 22 . as a practical matter , however , the key - pointing operation is triggered as soon as possible after one of these two events occurs as the design of the code permits . thus , broadly stated , the key - pointing occurs when no further log records can be written into a current extent file .
6
in the polyamines of the invention , as described in the above structural formula , r 1 - r 6 may be alkyl , e . g ., methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl , sec - butyl , tert - butyl ; aryl , e . g ., phenyl , p - tolyl , 2 , 4 , 6 - trimethylphenyl ; aryl alkyl , e . g ., benzyl , α - phenethyl , β - phenethyl ; cycloalkyl , e . g ., cyclohexyl , cyclobutyl , cyclopentyl , cycloheptyl ; any of the foregoing wherein the alkyl chain is interrupted by etheric oxygen , e . g ., — ch 3 o ( ch 2 ) 2 —, ch 3 o ( ch 2 ) 2 o ( ch 2 ) 2 —, ch 3 o ( ch 2 ) 2 o ( ch 2 ) 2 o ( ch 2 ) 2 —; or hydrogen . except where r 1 - r 6 are hydrogen or etheric substituents , each are hydrocarbyl and may have from about 1 to about 12 carbon atoms , it being understood that the size of the substituents will be tailored in each case to ensure that the polyamine is capable of uptake by the target cell and , upon uptake , will competitively bind with the intracellular counter - anions as described above . the bridging groups a , b and c may be the same or different and may be alkylene having 1 - 8 carbon atoms , e . g ., methylene , trimethylene , tetramethylene , pentamethylene ; branched alkylene , e . g ., — ch ( ch 3 ) ch 2 ch 2 —, — ch 2 ch ( ch 3 ) ch 2 —, — ch ( ch 3 ) ch 2 ch 2 —, — ch 2 ch ( ch 3 ) ch 2 ch 2 —; arylalkylene , e . g ., — ch ( ph ) ch 2 ch 2 —, — ch 2 ch ( ph ) ch 2 —, — ch ( ph ) ch 2 ch 2 ch 2 —, — ch 2 ch ( ph ) ch 2 — ch 2 —; cycloalkylene , e . g ., cyclohexylene , cis - and trans - 1 , 3 - cyclohexylene , 1 , 4 - cyclohexylene , 1 , 3 - cyclopentylene ; heterocyclic groups which incorporate within the ring one of the nitrogen atoms of the polyamine [ e . g ., it being understood that the heterocyclic nitrogen group may be located at the terminal end ( s ) or within the interior of the polyamine . those skilled in the art will appreciate that it is only necessary that the bridging groups be selected so as to ensure uptake by the cell and competitive binding to the intracellular counter - anion as described above . particularly preferred polyamines are those set forth in tables 1 and 2 and in the examples , as well as those having the formula : wherein r 1 - r 6 have the meanings ascribed above and a and b may be the same or different and are integers from 2 to 8 . at physiological ph &# 39 ; s , the naturally occurring polyamines and the analogs of the present invention are largely in a protonated state [ bioorg . chem ., supra ]. at a cellular level , these polycations can bind to a collection of single unconnected anions or to anions tethered to a single biomolecule , e . g ., the phosphates on a nucleic acid . if there is any significance to the role of charge interaction in the biological properties of the polyamine analogs , alterations in the polyamine methylene backbone should have significant impact on the compound &# 39 ; s biological properties . in fact , the significance of charge and the length of the methylene bridges separating the cations in the biological properties of the polyamine analogs has been demonstrated . for example , although n 1 , n 12 - diethylspermine ( despm ) is quite active against a variety of tumors in cell culture , when the terminal ethyl groups are replaced by β , β , β - trifluoroethyl groups , the anti - neoplastic activity essentially disappears . the trifluoroethyl group substantially reduces the pk a of the terminal nitrogens and they are no longer protonated [ j . org . chem ., vol . 24 , “ fluorine containing nitrogen compounds — i trifluoroethylamines ,” bissel et al , pages 1256 - 1259 ( 1959 )]. even though the dimensions of bis - β , β , β - trifluoroethylspermine and diethylspermine are essentially the same , what was once a tetracationic spermine analog is now only a dication . on comparing the abilities of several polyamines and polyamine analogs to displace ethidium iodide from calf thymus dna , bis - β , β , β - trifluoroethylspermine ( btfespm ) was found to behave more like putrescine than spermine . the same phenomenon is observed when one acetylates a terminal nitrogen of spermine . the amide nitrogen is not protonated at physiological ph , and the compound has no anti - neoplastic properties and behaves very much like spermidine in displacing ethidium iodide from dna . perhaps the most impressive finding regarding the separation of charge is associated with s - acetyltransferase ( sat ), an enzyme responsible for the n - terminal acetylation of spermine and spermidine . it has been determined that very slight changes in the methylene backbone of the polyamine analogs have pronounced effects on up - regulating the production of this protein , diethylnorspermine ( denspm )& gt ; diethylspermine ( despm )& gt ; diethyl - homospermine ( dehspm ) [ proc . am . assoc . cancer res ., vol . 49 , “ differential induction of spermidine / spermine n 1 - acetyltransferase in human lung cancer cells by the bis ( ethyl ) polyamine analogues ,” casero et al , pages 3829 - 3833 ( 1989 ); proc . am . assoc . cancer res ., vol . 30 , “ potent induction of spermidine / spermine n 1 - acetyltransferase ( ssat ) activity and its relationship to inhibition of cell growth ,” libby et al , page 586 ( 1989 ); biochem . pharma ., vol . 38 , no . 9 , “ structure - function correlations of polyamine analog - induced increases in spermidine / spermine acetyltransferase activity ,” libby et al , pages 1435 - 1442 ( 1989 ); cancer res ., vol . 49 , basu et al , supra ; biochem . j ., vol . 268 , porter et al , supra ; biochem . j ., vol . 267 , pegg et al , supra ; arch . biochem . biophys ., vol . 284 , “ characterization of human spermidine / spermine n 1 - acetyltransferase purified from cultured melanoma cells , libby et al , pages 238 - 244 ( 1991 ); and cancer res ., vol . 51 , “ correlations between polyamine analog - induced increases in spermidine / spermine n 1 - acetyl - transferase activity and growth inhibition in human melanoma cell lines ,” porter et al , pages 3715 - 3720 ( 1991 )]. extracting a single methylene from each of the three methylene bridges of dehspm substantially increases the ability of the analog to stimulate sat up - regulation , dehspm has little impact on sat levels , while despm up - regulates the enzyme by a factor of 200 and denspm by 1 , 200 fold . although each of the tetraamines is a closely related linear tetracation at physiological ph , each provides a different signal to the cell . while dehspm has three 4 - methylene bridges and little sat - stimulating activity , despm which has a single central 4 - methylene bridge and two terminal 3 - methylene bridges is a more active sat - stimulating factor . denspm has three 3 - methylene bridges and is the most active sat stimulator . presumably , the cell then “ reads the charge distribution ” on the polyamines . this suggests that the key issue in the polyamine analogue &# 39 ; s activity is the distance between the charged centers and not the nature of the groups separating these centers , “ the insulators .” however , that this was indeed the case required proof . the total concentration of polyamines in cation equivalents , as well as the ratios of the various polyamines , is very tightly regulated and , when this equilibrium is disturbed , the cell acts quickly to re - adjust . for example , when polyamine analogs are incorporated , these dynamics are disrupted and the cell responds by either excreting polyamines in the free state or by first acetylating them , followed by excretion of the n 1 - acetyl compounds [ j . biol . chem ., vol . 264 , no . 20 , “ effect of n 1 , n 12 - bis ( ethyl ) spermine and related compounds on growth and polyamine acetylation , content and excretion in human colon tumor cell ,” pegg et al , pages 11744 - 11749 ( 1989 ); and cancer res ., vol . 51 , porter et al , supra ]. on analog incorporation , the cell disposes of the appropriate number of polyamine cation equivalents in order to maintain the total polyamine charge balance . the analogs appear to the cell as normal polyamines and provide many of the same regulatory messages that the natural polyamines do . as analog concentration increases in the cell , the following events ensue . polyamine biosynthesis is down - regulated , just as when cells are grown in exogenous polyamines . the levels of ornithine decarboxylase ( odc ) and s - adenosylmethionine decarboxylase ( adometdc ) are drastically reduced just as with the normal negative polyamine feedback control . analogs with aminopropyl groups cause a marked increase in s - acetyl transferase ( sat ). once again , the issues are how the cell reads the charge distribution on the polyamines and how does it translate this information into regulatory events . the answers to both of these questions will allow one to define the structural boundary conditions for the general design of polyamine anti - neoplastics . two fundamental issues needed to be addressed regarding the general structural requirements for anti - neoplastic polyamines : ( 1 ) are the cationic centers really key to the compound &# 39 ; s anti - neoplastic activity or are the nitrogen centers simply enough , and ( 2 ) what are the boundary conditions on the insulators , e . g ., bridging groups separating the nitrogen or cationic centers ? the first question can be answered by comparing two polyamines with essentially the same distance between the nitrogens , but with different pka values on spatially equivalent nitrogens . while the bis - β , β , β - trifluoroethyl analogue of n 1 , n 12 - diethylspermine strongly suggested that charge was significant in polyamine analogue activity , additional examples had to be developed . in particular , examples were utilized in which other than simple methylene insulators were employed . this experiment is typified by the compounds and their activities as set forth in table 1 . the results of table 1 clearly indicate that the nitrogen cationic centers are required for anti - neoplastic activity and not simply a nitrogen center . the pyridine compounds have their nitrogen separated by distances very similar to those in the corresponding piperidine systems . the major difference is , at physiological ph , the pyridine compounds are not substantially protonated at the pyridine nitrogens . this means that the piperidine compounds are tetracations at physiological ph , while the pyridines are dications . the dications , unlike the corresponding reduced and acyclic linear molecules , are not active against l1210 cells . whether the cations can be insulated from each other by other than a methylene bridge , e . g ., a more rigid cyclic backbone , while still maintaining the activity of the compound is a question important not only to an understanding of how cells process information on the polycations , but also to the design of improved therapeutics . if a variety of other aliphatic systems can be substituted for the methylene bridges in the polyamines , it is possible to alter not only the metabolic properties of the polyamine anti - neoplastics , but also their organ distribution and clearance properties . the data set forth in table 2 further indicates that simple linear insulators are not a strict requirement for polyamine analogue anti - neoplastic activity . the results suggest that the polyamine nitrogens can be incorporated into a cyclic backbone . this observation was further investigated to verify that nitrogen insulators could also be cyclic alkyl groups . table 2 clearly indicates that this is true . the cyclohexyl fragment works well in a variety of different arrangements as an insulator . the intention is that the cell should incorporate these compounds via the polyamine &# 39 ; s transport apparatus and that these analogues should find their way to the same subcellular distribution sites that the naturally occurring polyamines do , but once there , because of subtle alterations in the molecules , they should be unable to be further processed . the inability of the polyamines to be further processed is largely related to the fact that the terminal nitrogens in the active compounds are alkylated and unable to be acetylated by sat . previous synthetic methods [ j . org . chem ., vol . 45 , bergeron et al , supra ; synthesis , bergeron et al ( 1981 ), supra ; synthesis , bergeron et al ( 1982 ), supra ; synthesis , bergeron et al ( 1984 ), supra ; j . org . chem ., vol . 49 , bergeron et al , page 2997 ( 1984 ); accts . chem . res ., vol . 19 , bergeron , supra ; bioorg . chem ., vol . 14 , bergeron et al , supra ; j . org . chem ., vol . 53 , bergeron et al , supra ; j . org . chem ., vol . 52 , bergeron et al , supra ; j . org . chem ., vol . 56 , bergeron et al , supra ; and crc handbook on microbial iron chelates , bergeron et al , supra ] were not designed for polyamine bridge expansions , but for the introduction of different alkyl groups at different nitrogens in the triamines or tetraamines . however , it has been recently shown that many of the simple terminally dialkylated polyamine analogs of interest can be accessed via the appropriate tosylamide . for example , to synthesize despm , spermine is first tosylated and then monoalkylated at each terminal tosylamide by treatment with sodium hydride and ethyl iodide . the tosyl groups are then removed under conditions of dissolving metal reduction . the shortcomings of the procedure are three - fold : ( 1 ) the alkylation must be symmetrical , i . e ., the same alkyl group must be fixed to both terminal nitrogens , ( 2 ) the methylene insulators between the nitrogens are regulated by the availability of the starting polyamine , and ( 3 ) removal of the tosyl protecting group proceeds in low yield . a more satisfactory alternative involves formation of the appropriate tetramesitylenesulfonamides , which can be alkylated in high yields and the tetramesitylenesulfonyl ( mes ) protecting groups quantitatively removed by treatment with 30 % hbr in acetic acid and phenol ( fig1 ). this approach eliminates the low yield problem associated with removal of the tosyl protecting group under dissolving metal reduction conditions . the mes methodology has been extended to a symmetrical “ segmented synthesis ” which allows for the facile alteration of the methylene backbone ( fig2 ). the segmented approach to constructing polyamine analogs offers numerous advantages in terms of flexibility and high yields . the procedure begins with mesitylenesulfonation of a primary amine providing ( 1 ), followed by alkylation of ( 1 ) with an excess of the appropriate dihalide ( fig2 ). the resulting halosulfonamide ( 2 ) can then be utilized to alkylate the disulfonamides , e . g ., ( 3 ). the tetrasulfonamide ( 4 ) is treated with hbr / hoac / phoh to remove the mesitylenesulfonamide protecting groups . the resulting bromide is converted to the corresponding hcl salts . thus , the limitations associated with the availability of the starting tetraamine have been eliminated , as well as removal of the tosyl protecting group . in addition , the earlier method was limited to terminal primary alkyl groups because of poor yields when alkylating with secondary and tertiary halides . the above methodology has been successfully applied to the synthesis of , e . g ., trans - 1 , 4 - diaminocyclohexane despm analog ( fig3 ). the cyclic disulfonamide ( 2 ) which is obtained by sulfonation of trans - 1 , 4 - cyclohexanediamine ( 1 ) is alkylated with two equivalents of halosulfonamide ( 3 , n = 3 ). finally , the amine protecting groups of tetrasulfonamide ( 4 ) are easily removed by treatment with phenol and hbr as above to provide cyclic spermine analog ( 5 ). tetraamines in which the terminal nitrogens are incorporated into piperidine rings can also be prepared using mesitylenesulfonyl - protected segments , as shown in fig4 and 5 . 4 -( aminomethyl ) piperidine ( 1 ) was converted into bis - sulfonamide ( 2 ) which was alkylated with 1 , 4 - dibromobutane ( 0 . 5 equivalent )/ nah / dmf to complete the polyamine framework ( 3 ). reductive removal of the sulfonamide protecting groups in ( 3 ) was accomplished with 30 % hbr in hoac / phoh , generating bicyclic dehspm analog ( 4 ) ( fig4 ). the corresponding 5 - 4 - 5 bicyclic polyamine was synthesized from the inside out ( fig5 ). crystalline n , n ′- bis -( mesitylenesulfonyl ) putrescine ( 1 ) was alkylated at both ends with mesitylenesulfonate ( 2 ), a solid derived from 4 - piperidineethanol and mesitylenesulfonyl chloride ( messo 2 cl ) in pyridine . deprotection of sulfonamide ( 3 ) with hbr as usual gave the larger bicyclic spermine homolog ( 4 ). the development of a tri - protected diamine reagent ( fig6 ) permits the efficient synthesis of tetraamines which are unsymmetrical with respect to both their outer methylene chains and terminal alkyl substituents . this methodology eliminates the limitation in earlier routes that the terminal alkyl substituents must be identical . furthermore , terminal monoethyl polyamines ( fig8 ), which are useful as standards in studies of diethyl analog metabolism , can also be generated in a systematic way . n -( tert - butoxycarbonyl )- n - mesitylenesulfonylamide ( bocnhso 2 mes ) ( 1 ), a di - protected ammonia , was alkylated with 4 - chlorobutyronitrile ( nah / dmf ) to give ( 2 ). the cyano group of ( 2 ) was hydrogenated with raney nickel in methanolic ammonia , resulting in primary amine ( 3 ). both the tertbutoxycarbonyl and mesitylenesulfonyl amine protecting groups were stable to these reduction conditions . attachment of a second mesitylenesulfonyl functionality to amine ( 3 ) under bi - phasic conditions generated the reagent , n -( tert - butoxycarbonyl )- n , n ′- bis ( mesitylenesulfonyl ) putrescine ( 4 ). it is noteworthy that this route is flexible , as well , in that an ω - chloroalkanenitrile of any length can be employed in the alkylation of bocnhso 2 mes ( 1 ). applications of the tri - protected diamine reagent to unsymmetrical polyamine preparation are shown in fig7 and 8 . reagent ( 1 ) was deprotonated and alkylated with n -( ethylamino ) tetramethylene unit ( 2 ), providing ( 3 ) ( fig7 ). after removal of the tert - butoxycarbonyl group under mild acidic conditions ( tfa , ch 2 cl 2 ) to produce ( 4 ), the other nitrogen of the putrescine reagent was elaborated with n -( ethylamino ) trimethylene segment ( 5 ). unmasking of the amino groups of ( 6 ) generated tetraamine ( 7 ), in which the outer chains are unequal . n - ethyl trisulfonamide ( 3 ) ( fig8 ) was alkylated with n -( 4 - bromobutyl )- n -( tert - butyl ) mesitylenesulfonamide ( 2 ) to afford masked polyamine ( 4 ). treatment of ( 4 ) with hbr / hoac / phoh cleanly removed the tert - butyl group , as well as the sulfonamides , giving n 1 - ethylhomospermine ( 5 ), a polyamine analog metabolite . only the sulfonamides were cleaved using sodium and liquid ammonia to provide the unsymmetrically dialkylated homospermine derivative ( 6 ). a solution of 2 - mesitylenesulfonyl chloride ( 12 . 15 g , 55 . 0 mmol ) in 100 ml ch 2 cl 2 was slowly dripped into a solution of trans - 1 , 4 - diaminocyclohexane ( 2 . 92 g , 25 . 0 mmol ) in 100 ml 1 n naoh solution , which had been cooled to 0 ° c . the mixture was stirred at 0 ° c . for 30 min . and at room temperature overnight . the solid was filtered out and washed with water and ethanol , to give 10 g ( 2 a ) ( 82 %): mp & gt ; 300 ° c . ; nmr ( dmso - d 6 ) δ 0 . 97 - 1 . 23 ( m , 4h ), 1 . 40 - 1 . 63 ( m , 4h ), 2 . 20 ( s , 6h ), 2 . 50 ( s , 12h ), 2 . 63 - 2 . 83 ( m , 2h ). nah ( 0 . 792 g , 80 %, 26 . 4 mmol ) was added into a solution of n - ethyl -( 2 - mesitylenesulfonylamide ) ( 5 g , 22 . 0 mmol ) in 60 ml dmf , which had been cooled to 0 ° c . the mixture was stirred at 0 ° c . for 30 min ., and 1 , 4 - dibromobutane ( 31 . 5 ml , 261 . 4 mmol ) was added . the solution was warmed to room temperature for 30 min . and then heated to 80 ° c . overnight . the dmf was removed , and the residue was treated with 40 ml water , followed by the extraction with ch 2 cl 2 ( 50 ml × 4 ). the extractions were dried over anhydrous sodium sulfate , and the solvent was rotovapped . the crude oil was purified by silica gel column chromatography with 10 / 1 hexanes / etoac as an eluant , to provide 5 . 85 g ( 3 b ) ( 73 %) as an oil ; nmr ( cdcl 3 ) δ 1 . 07 ( t , j = 12 , 3h ), 1 . 60 - 1 . 83 ( m , 4h ), 2 . 27 ( s , 3h ), 2 . 57 ( s , 6h ), 3 . 07 - 3 . 37 ( m , 6h ), 6 . 90 ( s , 2h ). anal . calcd . for c 15 h 24 brno 2 : c - 49 . 73 ; h - 6 . 68 ; n - 3 . 87 . found : c - 49 . 78 ; h - 6 . 72 ; n - 3 . 88 . nah ( 206 . 6 mg , 80 %, 6 . 89 mmol ) was added into a solution of ( 2 a ) ( 1 . 5 g , 3 . 13 mmol ) in 40 ml dmf , which had been cooled to 0 ° c . the solution was stirred at 0 ° c . for 30 min ., and the solution of ( 3 b ) ( 2 . 5 g , 6 . 89 mmol ) in 20 ml dmf was slowly added at 0 ° c . then the mixture was stirred at 0 ° c . for 20 min ., room temperature for 30 min ., and 70 ° c . overnight , respectively , following the procedure of ( 3 b ) above , the residue of which was purified by column chromatography with 5 % ethanol in chloroform as an eluant , to give 0 . 93 g ( 4 a ) ( 29 %) as an oil ; nmr ( cdcl 3 ) 1 . 00 ( t , j = 12 , 6h ), 1 . 13 - 1 . 43 ( m , 4h ), 1 . 73 - 1 . 93 ( m , 4h ), 2 . 27 ( s , 12h ), 2 . 57 ( s , 24h ), 2 . 83 - 3 . 23 ( m , 12h ), 3 . 35 - 3 . 67 ( m , 2h ), 6 . 90 ( s , 8h ). anal . calcd . for c 52 h 76 n 4 o 8 s 4 : c - 61 . 63 , h - 7 . 56 , n - 5 . 53 . found : c - 61 . 72 , h - 7 . 59 , n - 5 . 56 . phenol ( 2 g , 21 . 3 mmol ) and 20 ml 30 % hbr — hoac were added into a solution of ( 4 a ) ( 720 mg , 0 . 69 mmol ) in 25 ml ch 2 cl 2 , and the solution was stirred at room temperature for 24 hours . the solution was diluted with 60 ml h 2 , and the ch 2 cl 2 layer was separated from the aqueous layer and the aqueous layer was washed by ch 2 cl 2 ( 40 ml × 5 ). the water was removed , and the residue was dissolved in 10 ml h 2 o , basified to ph & gt ; 12 by the naoh solution , extracted by chcl 3 ( 40 ml × 5 ) and dried over sodium sulfate . the salt was filtered out and the solvent was rotovapped . the oil was dissolved in 50 ml etoh , and 1 ml concentrated hcl acid was added . the etoh was removed and 320 mg crude solid was recrystallized from the mixture of h 2 o and etoh to produce 127 mg ( 5 a ) ( 40 %) as nice crystal . nmr ( d 2 o ) 1 . 30 ( t , j = 12 , 6h ), 1 . 50 - 1 . 67 ( m , 4h ), 1 . 67 - 1 . 97 ( m , 8h ), 2 . 07 - 2 . 40 ( m , 4h ), 2 . 90 - 3 . 40 ( m , 14h ). anal . calcd . for c 18 h 44 cl 4 n 4 : c - 47 . 17 , h - 9 . 68 , n - 12 . 22 . found : c - 47 . 01 , h - 9 . 67 , n - 12 . 13 . a solution of 2 - mesitylenesulfonyl chloride ( 19 . 49 g , 89 . 1 mmol ) in ch 2 cl 2 ( 100 ml ) was added to 4 -( aminomethyl )- piperidine ( 1 ) ( 5 . 15 g , 45 . 1 mmol ) in 1 n naoh ( 100 ml ) at 0 ° c . after the addition was complete , the biphasic mixture was stirred for 24 hours ( 0 ° c . to room temperature ). the layers were separated and the aqueous portion was extracted with chcl 3 ( 2 ×). the combined organic phase was washed with 0 . 5 n hcl ( 200 ml ) and h 2 o ( 100 ml ), dried with sodium sulfate and evaporated in vacuo . recrystallization from aqueous ethanol produced 18 . 72 g ( 88 %) of ( 2 ) as plates : mp 158 . 5 - 160 ° c . ; nmr ( cdcl 3 / tms ) δ 0 . 8 - 2 . 0 ( m , 5h ), 2 . 25 ( s , 6h ), 2 . 46 - 2 . 93 ( m + 2s , 16h ), 3 . 37 - 3 . 65 ( m , 2h ), 4 . 67 ( t , 1h , j = 6 ), 6 . 90 ( s , 4h ). anal . calcd . for c 24 h 34 n 2 o 4 s 2 : c - 60 . 22 , h - 7 . 16 , n - 5 . 85 . found : c - 60 . 31 , h - 7 . 19 , n - 5 . 86 . sodium hydride ( 80 % in oil , 1 . 411 g , 47 . 0 mmol ) was added to ( 2 ) ( 18 . 43 g , 38 . 5 mmol ) and nai ( 0 . 146 g , 0 . 97 mmol ) in dmf ( 165 ml ) at 0 ° c . the suspension was stirred for 1¾ hours at room temperature under nitrogen . 1 , 4 - dibromobutane ( 2 . 2 ml , 18 . 4 mmol ) was added by syringe , and the reaction mixture was heated at 84 ° c . for 19 hours . after cooling to 0 ° c ., h 2 o ( 200 ml ) was cautiously added to quench residual nah , followed by extraction with chcl 3 ( 300 ml , 2 × 100 ml ). the combined organic phase was washed with 1 % na 2 so 3 ( 100 ml ) and h 2 o ( 2 × 100 ml ), dried with sodium sulfate and evaporated under high vacuum . recrystallization from etoac / chcl 3 gave 13 . 00 g ( 70 %) of ( 3 ) as an amorphous solid : mp 202 - 203 . 5 ° c . ; nmr ( cdcl 3 / tms ) δ 0 . 75 - 1 . 90 ( m , 14h ), 2 . 25 ( s , 12h ), 2 . 40 - 3 . 18 ( m + 2s , 36h ), 3 . 3 - 3 . 6 ( m , 4h ), 6 . 87 ( s , 8h ). anal . calcd . for c 52 h 74 n 4 o 8 s 4 c - 61 . 75 , h - 7 . 37 , n - 5 . 54 . found : c - 61 . 49 , h - 7 . 39 , n - 5 . 43 . 30 % hbr in acetic acid ( 100 ml ) was added over 10 min . to a solution of ( 3 ) ( 5 . 34 g , 5 . 28 mmol ) and phenol ( 18 . 97 g , 0 . 202 mol ) in ch 2 cl 2 ( 75 ml ) at 0 ° c . the reaction was stirred for 24 hours ( 0 ° c . to room temperature ) and cooled to 0 ° c . distilled h 2 o ( 120 ml ) was added , followed by extraction with ch 2 cl 2 ( 3 × 100 ml ). the aqueous layer was evaporated under high vacuum . the residue was basified with 1 n naoh ( 12 ml ) and 50 % ( w / w ) naoh ( 20 ml ) with ice cooling , followed by extraction with chcl 3 ( 10 × 50 ml ), while adding nacl to salt out the aqueous layer . organic extracts were dried with sodium sulfate and evaporated . the residue was taken up in ethanol ( 200 ml ), acidified with concentrated hcl ( 3 . 5 ml ) and solvents were removed under vacuum . tetrahydrochloride salt was recrystallized with 7 % aqueous etoh to furnish 1 . 318 g ( 58 %) of ( 4 ) as a white solid . nmr ( d 2 o / tsp ) δ 1 . 19 - 2 . 23 ( m , 14h ), 2 . 8 - 3 . 6 ( m , 16h ). anal . calcd . for c 16 h 38 cl 4 n 4 : c - 44 . 87 , h - 8 . 94 , n - 13 . 08 . found : c - 44 . 77 , h - 9 . 00 , n - 13 . 00 . 2 - mesitylenesulfonyl chloride ( 54 . 40 g , 0 . 249 mol ) in ch 2 cl 2 ( 300 ml ) was added to 1 , 4 - diaminobutane ( 11 . 34 g , 0 . 129 mol ) in 1 n naoh ( 300 ml ) at 0 ° c ., and the biphasic mixture was stirred for 24 hours at room temperature . organic solvent was evaporated and 2 . 4 n hcl ( 250 ml ) was added to the combined portions . solid was filtered , washed with water ( 250 ml ) and recrystallized from aqueous ethanol to give 50 . 46 g ( 90 %) of ( 1 ) as needles : mp 156 . 5 - 157 . 5 ° c . ; nmr ( cdcl 3 / tms ) δ 1 . 36 - 1 . 60 ( m , 4h ), 2 . 27 ( s , 6h ), 2 . 57 ( s , 12h ), 2 . 69 - 2 . 96 ( m , 4h ), 4 . 65 ( t , 2h , j = 6 ), 6 . 89 ( s , 4h ). anal . calcd . for c 22 h 32 n 2 o 4 s 2 : c - 58 . 38 , h - 7 . 13 , n - 6 . 19 . found : c - 58 . 31 , h - 7 . 19 , n - 6 . 14 . 2 - mesitylenesulfonyl chloride ( 24 . 78 g , 0 . 113 mol ) in pyridine ( 60 ml ) was added all at once to 4 - piperidine - ethanol ( 5 . 58 g , 43 . 2 mmol ) in pyridine ( 25 ml ) at − 16 ° c . ; the temperature rose to − 11 ° c . the flask was stored in the refrigerator at 5 . 5 ° c . for 44 hours under argon . the reaction mixture was poured into ice ( 1 kg ) and after 3 hours , 16 . 00 g ( 75 %) of ( 2 ) as a yellow solid was filtered off : mp 93 . 5 - 94 ° c . ; nmr ( cdcl 3 / tms ) δ 1 . 4 - 2 . 1 ( m , 7h ), 2 . 27 ( s , 6h ), 2 . 44 - 2 . 96 ( m + s , 14h ), 3 . 37 - 3 . 69 ( m , 2h ), 3 . 97 ( t , 2h , j = 5 ), 6 . 90 and 6 . 93 ( 2s , 4h ). anal . calcd . for c 25 h 35 no 5 s 2 : c - 60 . 82 , h - 7 . 15 , n - 2 . 84 . found : c - 60 . 90 , h - 7 . 13 , n - 2 . 85 . sodium hydride ( 80 % in oil , 0 . 783 g , 26 . 1 mmol ) was added to ( 1 ) ( 5 . 15 g , 11 . 4 mmol ) and nai ( 0 . 376 g , 2 . 5 mmol ) in dmf ( 140 ml ) at 0 ° c . the suspension was stirred for 23 min . at room temperature , followed by the introduction of ( 2 ) ( 15 . 84 g , 32 . 1 mmol ). the reaction mixture was heated at 58 - 67 ° c . for 18 hours and then poured into h 2 o ( 300 ml ), followed by extraction with chcl 3 ( 4 × 100 ml ). the combined extracts were washed with saturated nahco 3 ( 100 ml ), 1 % nahso 3 ( 100 ml ) and h 2 o ( 100 ml ), dried with sodium sulfate and evaporated under high vacuum . column chromatography on silica gel eluting with 1 to 2 % ch 3 oh / chcl 3 furnished 10 . 03 g ( 85 %) of ( 3 ) as an amorphous solid : nmr ( cdc3 / tms ) δ 0 . 8 - 2 . 0 ( m , 18h ), 2 . 08 - 2 . 71 ( m + 3s , 40h ), 2 . 8 - 3 . 5 ( m , 12h ), 6 . 87 ( s , 8h ). anal . calcd . for c 54 h 78 n 4 o 8 s 4 . h 2 o : c - 61 . 33 , h - 7 . 62 , n - 5 . 30 . found : c - 61 . 50 , h - 7 . 44 , n - 5 . 33 . 30 % hbr in acetic acid ( 180 ml ) was added over 30 min . to a solution of ( 3 ) ( 9 . 83 g , 9 . 45 mmol ) and phenol ( 33 . 38 g , 0 . 355 mol ) in ch 2 cl 2 ( 135 ml ) at 0 ° c . the reaction was stirred for 24 hours ( 0 ° c . to room temperature ) and cooled to 0 ° c . distilled h 2 o ( 200 ml ) was added , followed by extraction with ch 2 cl 2 ( 2 × 100 ml ). the aqueous portion was evaporated under high vacuum . the residue was basified with 1 n naoh ( 50 ml ) and then 50 % ( w / w ) naoh ( 10 ml ) ( ice cooling ), followed by extraction with chcl 3 ( 10 ×), while adding nacl to salt out the aqueous layer . organic extracts were dried over sodium sulfate and evaporated . concentrated hcl ( 5 ml ) in ethanol ( 300 ml ) was added to the residue , and solvents were removed under vacuum . tetrahydrochloride salt was recrystallized in 3 % aqueous etoh to give 2 . 91 g ( 68 %) of ( 4 ) as a white solid : nmr ( d 2 o / tsp ) δ 1 . 15 - 2 . 09 ( m , 18h ), 2 . 75 - 3 . 59 ( m , 16h ). anal . calcd . for c 18 h 42 cl 4 n 4 : c - 47 . 37 , h - 9 . 28 , n - 12 . 28 . found : c - 47 . 25 , h - 9 . 35 , n - 12 . 17 .
0
when reference is made to the accompanying drawings , which are only used to illustrate some preferred embodiments of the present invention and shall therefore not be intended as limiting the scope thereof , it can by noticed that the basic peculiarity of the present invention lies essentially in the combination of two distinct measures , the first one of which consists in providing the injection mold 1 , in which the preforms are molded , with a plurality of cavities 2 that must be grouped into a number n of clusters , or sub - groups , namely the clusters of cavities belonging to and identified by the same line a , b . . . n containing preferably an identical number of cavities , as this is shown symbolically in fig1 . so far there would actually be nothing really new with respect to the prior art , since all cavities contained in a single mold can be divided into clusters or sub - groups , e . g . in a number of n , wherein each cluster is arranged to contain a smaller number of cavities , without on the other hand bringing about , by this mere fact , any actual invention and / or advantage of any kind . such a measure is advantageously and innovatorily completed by implementing a cool - down system , along with all related means and devices , inside the mold in such a manner as to enable it to cool down each one of said n clusters of cavities in a differentiated manner , as appropriately selected according to the needs , during the phase in which the molten resin cools down and solidifies in the mold cavities , in such a manner that , when the preforms are removed from their respective cavities of the respective mold , they exhibit a different temperature , as this is clearly induced by the dissimilarity in the cool - down temperature of each respective cavity , said temperature being of course the same for all preforms belonging to a same cluster , but varying from one cluster to the other ones . in both the preceding part and the following one of this description , “ mold ” is generally cited as a singular term , but it will of course be appreciated that any such mold is actually formed by two respective mold halves that must be opened in view of enabling the therein molded preforms to be removed . going now back to the moment in which the preforms are removed from a same mold these preforms are removed from there at the same time and exhibit , as this has already been stressed , a selectively differentiated temperature . the second one of the two aforementioned measures consists in moving the various clusters of the so obtained preforms through an orderly holding and forward conveyance sequence on a cluster - by - cluster basis , as this is described in greater detail below . with reference to fig2 it can be noticed that said clusters a , b . . . n of cavities produce corresponding clusters of preforms a p , b p . . . n p that are shown to be clearly identified by the same reference letters in the cited figure . said clusters of preforms are sent in an orderly sequence , e . g . first the whole cluster a p , then the whole cluster b p , and so on up to the cluster n p , to a common conditioning station 14 and , from here , according to the same initial sequence , to a common blow - molding station 20 . in practice , all preform clusters are removed from the mold at the same time and then queued in a holding phase of the cycle , waiting for being conditioned by successive clusters . it is therefore quite a natural fact that , during the holding time , such preforms are subject to cooling down in a differentiated manner according to the length of actual waiting time , so that the longer such a waiting time , the greater said cool - down effect , wherein it should be noticed in this connection that , during such a holding period , the preforms are exposed to the ambient air at ambient temperature . in view of obtaining the best possible qualitative result with said preforms , the conditioning phase must bring the final temperature of the same preforms to an exactly pre - determined , stable value , regardless of the clusters which each such preform comes from , and since said conditioning phase has constant characteristics , also the temperature of the preforms undergoing such conditioning should be appreciably constant , regardless of the cluster which they come from or the moment in which their conditioning actually starts . in order to obtain such a result , and considering the above remarks about the normally occurring differentiation in the cool - down of the preforms according to the actual length of the holding time , it is necessary for the temperatures of the preforms , as they are just removed from the mold , to be differentiated to such an extent that their subsequent normal cooling down , which depends on the length of the holding time corresponding to the particular cluster of preforms , is capable of bringing the final temperature of said preforms , i . e . the temperature of said preforms at the beginning of the conditioning phase , exactly to the constant value t o c that is required for all preforms of all clusters , regardless of the respective position in the conditioning sequence and , therefore , of the length of the respective holding and , as a result , cool - down time . as a result , the cooling down of the cavities must be aimed at enabling an appropriately differentiated temperature to be reached in the preforms when they are removed from the mold , and such a differentiation depends essentially on both the length of the holding time , during which said natural cool - down takes place , and the final temperature that must coincide with the initial temperature of the conditioning phase . the present invention is therefore based on the condition of such differentiated cool - down of the mold cavities ( and therefore a simultaneous removal of all preforms from the mold ) with said preforms being then sent sequentially , on a cluster - by - cluster basis , to the conditioning phase , wherein said differentiated cool - down of the mold cavities is regulated so as to enable each preform to reach the conditioning phase , at the beginning thereof , at the same temperature , keeping the holding time and the resulting natural cool - down of each preform into due account . to more effectively elucidate this aspect , let us now refer to the diagram illustrated in fig6 where the holding time t of each cluster of preforms between their removal from the mold and the beginning of the conditioning phase is indicated in the abscissa , while the temperature t o of the preform bodies upon their removal from the injection mold is indicated in the ordinate , t o c defines the temperature at which all preform clusters are when entering or beginning the conditioning phase , said conditioning process being of course equal for all preform clusters and equal being also the temperature at which said preform clusters enter the blow - molding stage of the process . the various curves in the above cited diagram shall be intended as representing the temperature pattern in the distinct preform clusters a p , b p , . . . n p , wherein for reason of greater simplicity said curves are identified by the same reference letters . since it is assumed that the temperature of the first preform cluster a p is exactly equal to the temperature t o c at which the same preform are required to be when entering the conditioning station , as this occurs in the traditional technique , then such first cluster a p does not need to go through any holding or waiting phase ; as a result , the related temperature curve is identified by the point a p located in correspondence of the initial time t 0 and the temperature t o c at which the preforms are required to enter the blow - molding station . the subsequent cluster of preforms b p must on the contrary undergo a holding phase for a time t b that is equivalent to the time needed by the cluster a p to go through the conditioning phase ; during such holding time , the related preforms undergo a natural cool - down and must therefore be removed from the injection mold at a higher temperature t b in such a manner that , at the end of the respective holding time t b , their temperature has steadied down at the same above defined level t o c required for the preforms to enter the blow - molding station . the same occurs for the subsequent preform clusters . . . n p , which , owing to their having to undergo holding phases through respectively and progressively longer periods . . . t n , must of course come out of their injection mold at corresponding , progressively increasing temperatures . . . t n , as this can be clearly inferred from the illustration in fig6 . in the course of this description , the term preform cluster or cluster of preforms has been used and defined in the assumption that such clusters actually comprise a plurality of preforms , such assumption being on the other hand a logical one for all operation ( i . e . mold unclamping , handling means , preform ejection / removal , transfer means and the like ) to be duly and completely operated . under the above cited circumstances , owing to the above mentioned facts , it clearly emerges that the conditioning / blow - molding apparatuses carry out two operating cycles in the same time in which the complete preform injection molding / cool - down / removal operation goes through a single cycle , while , owing to the differences in the duration of the cycles preformed by the various apparatuses , the conditioning and blow - molding ones remain particularly still and unused for half of the time . it will appreciated that such an arrangement may therefore be particularly suitable when bottles must be produced at quite low output rates . in such cases , in fact even a relative inefficiency brought about by the above cited downtime problems can be accepted , since it is generally compensated by a considerable simplification in the overall construction of the equipment and a marked saving effect on general costs . however , in order to eliminate such an inefficiency due to downtimes , the configuration illustrated in fig4 is advantageously proposed . such a configuration differs from the one illustrated in fig3 for the addition of a supplementary mold 16 that is fully similar to the afore described mold 1 , including the two clusters of cavities 17 and 18 , respectively , as well as for the addition of also two further holding sectors 17 a and 18 a , respectively , which are again fully similar to the afore described holding sectors 12 a and 13 a . thanks to the explanations given above , those skilled in the art will now be capable of readily appreciating that , in this case , the conditioning and blow - molding apparatuses are in fact fully saturated , since after having processed four successive clusters of preforms produced in a row by the two molds , they are immediately available for processing four further clusters of preforms produced in the meantime by said two molds in a subsequent injection - molding operation . such a configuration appears to be particularly advantageous since it combines a marked improvement in productivity with an unaltered simplicity in the construction of the equipment , considering that the output capability thereof can be practically doubled simply through the addition of said supplementary mold 16 , apart of course from the necessary adjustments and set - up requirements in connection with the related control and drive means . it will also be readily appreciated that the greatest extent to which use can actually be made of the present invention , i . e . the multiplication of the number of clusters per each mold while at the same time making use of several molds , finds its technical and economic limit in the increasing complexity and in the related costs of the quite complex molds required , in the filling and interchangeability thereof , and in the necessary control and drive means . in principle , however , the invention does not find any conceptual limit . as far as all the various control and drive means are concerned which are required to clamp and unclamp the molds , remove the preforms from said molds , convey and position the preforms of a same cluster in a handling means adapted to simultaneously transfer all such preforms to the conditioning and blow - molding stations , these are in all cases means that , although implementable in the most varied forms for operating according to the most varied principles , are fully within the capability of all those skilled in the art . as far as the manners are concerned in which the various zones of a same mold are selectively cooled down in a differentiated way , they do not per sé fall within the actual scope of the present invention , since they can be implemented in a number of ways , the most simple one of which consists in providing , inside the body of the mold , a plurality of conduits , so as to in particular surround each single cavity therewith , wherein a medium is caused to flow through said conduits which is appropriately tempered under thermostatic control in accordance with the actual temperature to which the cavities associated to said conduits must be cooled . in the course of extensive experiments on prototypes , it has however been found that the external variables , such as for instance the room temperature , the type of resin , the temperature at which such resin is injected in its molten state into the mold cavities , the thermal inertia of the mold and so on , can bring about a variation in the temperature of the preforms entering the conditioning station . with reference to fig5 such a drawback is therefore eliminated through a detection of the temperature of the preforms , before conditioning , by means of per sé known means 21 , 22 ; according to such a temperature being detected to fall within or to be outside preset limits , feedback - operated means are adapted to respond accordingly by generally acting on the cooling means that are associated to the cavities of those molds from which the preforms have been removed whose temperature has in such manner been detected to be outside said pre - set limits . in this manner , as soon as a deviation occurs in the temperature of the preforms from the accepted value , said means automatically intervene to modify the respective temperature accordingly . the precision of such a deviation range , i . e . the extent to which the temperature may be allowed to deviate from the pre - set values , can of course be kept within very strict limits and , in any case , within the tolerance range inside which the temperature of the preforms can vary without any risk of it actually affecting the final molding result . in order to improve the responsiveness to a deviation in the temperature of the preforms , as well as to enhance the uniformity in the temperature of the preforms belonging to a same cluster , it is advantageous for said means 21 , 22 provided to detect the temperature of the preforms before the conditioning stage to be so arranged as to be able to detect the temperature of those preforms that are thermally most “ spaced away ” from each other , i . e . of that pair of preforms included in the same cluster , which are supposed to exhibit the greatest difference in temperature as compared to any other pair in the same cluster . it is well within the capabilities of those skilled in the art to identify , even by means of simple measurements , the cavities and , therefore , the pairs of preforms that exhibit such a property . it will be appreciated that the invention can be implemented also with methods and apparatuses that differ from the above described ones , by complying substantially with the features and characteristics recited in the appended claims .
1
the present invention , an auger lock , shown generally as 10 in fig1 includes the following major sections , intake section 11 , auger section 12 , material plug section 14 , and exit section 16 . referring now to fig1 intake section 11 includes a cyclone 28 which also may be a hopper or a storage bin in which material 30 is entrained within a gas . intake section 11 further includes intake flange 27 which communicates with intake 26 which communicates with auger tube 18 . auger section 12 includes a cylindrical housing ; namely , auger tube 18 having mounted therein auger 20 having auger flights 22 . auger 20 which is mounted on drive shaft 24 which is mounted centrally and longitudinal along longitudinal axis 110 within auger tube 18 as shown in fig1 . by way of example only , auger tube 18 may have an outside diameter of five inches , wall thickness of { fraction ( 3 / 16 )} of an inch and houses an auger 20 having auger flights 22 having an outside diameter of four inches . auger flights 22 are preferably half pitch flights , meaning a four inch auger would have two inch pitch auger flights 22 . auger tube 18 has mounted thereon end cap 25 proximate intake section 11 . one end of drive shaft 24 emerges from end cap 25 and has mounted thereon drive pulley 27 . preferably drive pulley 27 is of the sprocket type , however , other drive arrangements known in the art can also be used including belt driven arrangements . not shown in fig1 is a motor and drive system connected to drive pulley 27 for rotating drive shaft 24 . auger flights 22 terminate at material plug section 14 wherein only drive shaft 24 and material 30 continue within auger tube 18 . in other words the auger flights 22 terminate and do not enter material plug section 14 . material 30 within material plug section 14 compacts together forming compacted material 32 within material plug section 14 . exit section 16 , which includes a means for discharging material 30 , includes plunger 34 , rubber seal 36 , agitator pins 38 , deflector cone 40 , two way dogs 44 , spring 46 , shaft bearing 42 , and mounting bracket 48 . fig1 shows plunger 34 in plunger open position 56 wherein two way dogs 44 are in engaged position 54 as shown in fig1 . in addition , seals 50 located between the inner diameter of deflector cone 40 and the outer diameter of drive shaft 24 , provide for a gas - tight seal between deflector cone 40 and drive shaft 24 . preferably seals 50 are of the o - ring type , however , brass bushing type seals and / or any other seals known in the art which allow deflector cone 40 to move slidably , longitudinally along drive shaft 24 are acceptable . plunger 34 has mounted thereon rubber seal 36 on the face which contacts the exit end 70 of auger tube 18 , in plunger closed position 58 shown in fig2 . exit section 16 which includes plunger 34 , rubber seal 36 , agitator pins 38 , deflector cone 40 , and two way dogs 44 move in unison slidably along drive shaft 24 between a plunger open position 56 shown in fig1 and a plunger closed position 58 shown in fig2 . in plunger closed position 58 shown in fig2 two way dogs 44 are in dog disengaged position 52 shown in fig2 . two way dogs 44 are the type known in the art and preferably are three - toothed dogs which cooperate wherein the engaged position 54 , the two way dogs 44 are meshed together thereby rotating plunger 34 , rubber seal 36 , agitator pins 38 , and deflector cone 40 in unison with drive shaft 24 . [ 0066 ] fig4 an alternate embodiment of auger lock 10 , schematically illustrates using engaging pins 114 and co - operating engaging pin holes 116 rather than two way dogs 44 . in addition , spring 112 is located exterior of the engaging mechanism . referring to fig1 through 3 in dogs disengaged position 52 the dog teeth no longer mesh and plunger 34 , rubber seal 36 , agitator pins 38 , and deflector cone 40 no longer rotate in unison with drive shaft 24 , but rather drive shaft 24 rotates freely with plunger 34 left stationary with rubber seal 36 of plunger 34 sealing and mating against exit end 70 of auger tube 18 . spring 46 biases plunger 34 against exit end 70 of auger tube 18 , and maintains plunger 34 in the normally plunger closed position 58 shown in fig2 . shaft bearing 42 supports the exit end of drive shaft 24 onto mounting bracket 48 of the type known in the art . not shown is a frame or other structure to which bracket 48 is mounted . referring now to fig6 and 7 which schematically illustrates an alternate embodiment of the present invention , an auger lock 10 , which has all of the same components as described above except for modification to auger tube 18 which is comprised of two sections ; namely , first auger tube section 130 and second auger tube section 132 , which is coupled together with coupling 134 . first and second auger tube sections 130 and 132 are dimensioned to co - operatively , telescopically slide one over the other in such a manner that the length of the auger tube can be adjusted by slidably urging second auger tube section 132 over first auger tube section 130 , and locking it into a desired position using coupling 134 . in this manner the volume and the length of material plug section 14 containing compacted material 32 can be adjusted by slidably urging second auger tube section 132 telescopically over , first auger tube section 130 . coupling 134 can be any type known in the art and , for example , a lorenze ™ standard coupling , which is described in u . s . pat . no . 4 , 193 , 173 and canadian patent 1 , 025 , 793 can suitably be used . in use auger lock 10 as shown in fig1 operates as will be described hereafter . material 30 , which is contained within cyclone 28 , settles to the bottom of cyclone 28 proximate intake flange 27 . material 30 flows through intake 26 and into auger tube 18 proximate intake section 11 . auger lock 10 will work with almost any type of dry or wet particulate or granular material and / or bulk solids such as plastic particles ( something called rubber regrind ), plastic pellets , grain , saw dust , cement dust , rubber powder , and other similar granular materials . preferably , the material 30 size ranges between 100 mesh and ¾ ″ in diameter in size . material 30 can be almost any type of material which is capable of being moved along through auger 20 mounted within auger tube 18 . the interior of cyclone 28 may be under negative and / or positive pressure , and in practice the unit has been tested to be functional between 80 inches of water column pressure and / or 80 inches of water column vacuum using plastic regrind material through the auger . higher pressures and vacuums are likely achievable . therefore , auger lock 10 can be utilized with either a negative pressure within cyclone 28 and / or a positive pressure within cyclone 28 . as material 30 is transported into auger tube 18 , rotating auger flights 22 of auger 20 move material 30 longitudinally from intake section 11 of auger tube 18 towards exit end 70 of auger tube 18 . typically drive shaft 24 rotates between 25 to 50 rpm as material 30 is moved into material plug section 14 , the auger flights 22 terminate and material 30 begins to accumulate and compact within material plug section 14 . spring 46 biases plunger 34 against exit end 70 of auger tube 18 preventing any material 30 and gas from exiting from exit end 70 of auger tube 18 . preferably , a rubber seal 36 mounted onto plunger 34 mates with and seals off exit end 70 of auger tube 18 , thereby , preventing material 30 and gas or air from flowing past plunger 34 during the start up of auger lock 10 . as auger flights 22 continue to rotate and move more and more material 30 into material plug section 14 , material 30 eventually becomes highly compacted forming compacted material 32 within material plug section 14 . compacted material 32 is also know as a “ material plug ” in the art . compacted material 32 is so highly compacted that it substantially prevents the flow of gases between cyclone 28 and exit end 70 of auger tube 18 . thereby pressure isolating any positive or negative pressures in cyclone 28 from the ambient pressure found at exit end 70 of auger tube 18 . as auger flights 22 continue to rotate , the pressure continually increases increasing the compaction of material 30 within material plug section 14 until the pressure is great enough to overcome the biasing action of spring 46 against plunger 34 . when the pressure of material plug 14 is sufficient to overcome the biasing force of spring 46 , compacted material 32 within material plug section 14 pushes against plunger 34 moving plunger 34 from the plunger closed position 58 to the plunger open position 56 , thereby engaging two way dogs 44 into the engaged position wherein plunger 34 begins rotating in unison with drive shaft 24 . during this entire process drive shaft 24 is being rotated by a motor or other means known in the art , via drive pulley 27 . it will be apparent to those skilled in the art that the power required to continually rotate drive shaft 24 will depend among others upon the size of auger tube 18 , and the type of material 30 transported within the auger lock 10 . with plunger 34 in the plunger open position 56 , rubber seal 36 no longer contacts exit end 70 of auger tube 18 , therefore breaking the seal between plunger 34 and exit end 70 of auger tube 18 . however , because compacted material 32 is so densely compacted it continues to substantially isolate the pressure and / or vacuum found in cyclone 28 from the ambient air pressure found at exit end 70 of auger tube 18 . as two way dogs 44 move into the engaged position 54 , plunger 34 begins to rotate which in turn rotates agitator pins 38 , which are rigidly connected to plunger 34 . agitator pins 38 are mounted longitudinally and parallel with auger tube 18 , and as depicted can be bolts and / or any rigid projections into the interior of auger tube 18 . the length of agitator pins 38 is selected depending upon material 30 consisting and size . by way of example only , finer material 30 requires longer pins , whereas , coarser material 30 requires shorter pins . as compact material 32 begins to move outwardly from exit end 70 it makes contact with rotating agitator pins 38 which breaks up compacted material 32 , allowing material 30 ( which is broken up ) to exit from exit end 70 of auger tube 18 . finally , deflector cone 40 , a cone - shaped deflector mounted on drive shaft 24 , directs material 30 radically outward away from drive shaft 24 , and towards the outer diameter of auger tube 18 and towards agitator pins 38 . in practice it has been found critical to have deflector cone 40 in place in order to provide additional compaction of material 30 as it approaches exit end 70 of auger tube 18 . deflector cone 40 has inclined deflecting surface 118 for deflecting material 30 radially outward . by deflecting and moving material radically outward away from the centre of drive shaft 24 and towards the outer diameter of auger tube 18 , additional compaction of material 30 occurs . this additional compaction as material 30 exits from exit end 70 of auger tube 18 is critical to ensure that a gas seal is maintained in material plug section 14 even though plunger 34 no longer seals with rubber seal 36 against exit end 70 of auger tube 18 . the angle theta 72 is the angle between the longitudinal axis 110 which runs parallel along the longitudinal length of drive shaft 24 , and the inclined deflecting surface 118 of deflector cone 40 . preferably the angle theta 72 is 30 degrees . in practice , angle theta 72 can range between 20 to 60 degrees , however , 30 to 45 degrees is more preferable . referring now to the alternate embodiment shown in fig6 and 7 , the volume and length of material plug section 14 can be adjusted by telescopically urging second auger tube section 132 over first auger tube section 130 , and locking the two auger sections in place with coupling 134 . this is particularly useful when different sized material 30 is fed through auger 20 . by way of example only , finer material 30 being fed through auger 20 requires a smaller material plug section 14 , and therefore , a smaller and shorter material plug . finer materials tend to compact more easily , and therefore , a more effective material plug can be achieved with finer materials . by reducing material plug section 14 the amount of horsepower required by auger lock 10 is reduced , and the efficiency of auger lock 10 is increased . conversely , as the material 30 becomes coarser in nature , a longer material plug section is required in order to provide for an efficient gas tight seal . therefore , the courser the material the longer the material plug section 14 would be , and therefore , second auger tube section 132 is urged outwardly extending the length of the auger tube in order to provide for a longer and larger material plug . in this way the operator can fine tune the operation of auger lock 10 by adjusting the length of material plug section 14 according to the size and the consistency of material 30 being fed through auger 20 . in all other aspects , auger lock 10 , as shown in fig6 and 7 , operates in an elegance fashion as auger lock 10 shown in fig1 through 5 as described here above . in a presently preferred embodiment of the invention , an auger lock shown generally as 210 in fig8 includes the following major sections . intake section 211 , drive section 233 , auger section 212 , material plug section 214 and exit section 216 . referring now to fig1 the intake section 211 includes a cyclone 228 which also may be a hopper or storage bin in which material 230 is entrained with a gas . intake section 211 further includes intake flange 227 which provides for communication between cyclone 228 and auger tube 218 . drive section 233 includes drive unit 235 mounted to auger tube 218 . drive unit 235 is driveably connected to drive end shaft 224 and auger shaft 282 which is connected to auger 220 for rotatably driving drive end shaft 224 and auger shaft 282 . drive unit 235 is a standard type of drive mechanism which can be purchased and is mechanically and / or hydraulically and / or pneumatically connected to drive end shaft 224 through gears , pulleys or belts or other means not shown in fig8 . the purpose of drive unit 235 is to rotate a drive end shaft 224 which is connected to auger shaft 282 which in turn rotates auger 220 with its auger flights 222 . the reader will note that drive end shaft 224 is hollow and houses therein an adjusting rod 272 connected at the shaft end 225 together with an adjusting nut 273 . adjusting rod 272 having at the other end a swivel 274 for connecting to one end of spring 245 . the other end of spring 245 is connected to connecting rod 270 which in turn is attached to exit shaft 280 . the tension on spring 245 can be adjusted by threadably turning adjusting nut 273 of adjusting rod 272 which is threaded . by turning adjusting nut 273 , adjusting rod 272 is urged along longitudinal axis 211 thereby selectively increasing or decreasing the tension on spring 245 . note that drive end shaft 224 is rigidly connected with auger shaft 282 , however , exit shaft 280 which is concentrically housed within auger shaft 282 moves freely and independently of auger shaft 282 and drive end shaft 224 , in the door closed position 292 shown in fig9 . exit shaft 280 also has mounted there through laterally a pin 286 which has portions on each side of the pin projecting beyond the diameter of exit shaft 280 . pin 286 is dimensioned to fit within slot 284 defined in auger shaft 282 for the purpose of driveably connecting auger shaft and drive end shaft with exit shaft 280 . auger lock 210 shown in fig8 is shown in the door open position 290 in which pin 286 has made engagement with slot 284 thereby drive end shaft 224 , auger shaft 282 and exit shaft 280 all rotate in unison due to the coupling of pin 286 with slot 284 . furthermore , seal 236 at the end of auger shaft 282 and near the drive unit 235 seals off material 230 from contaminating the mechanism found within drive end shaft 224 . [ 0096 ] fig9 shows auger lock 210 in the door closed position 292 in which the tension on spring 245 which is transmitted through exit shaft 280 forces exit door 234 closed against exit end 260 of auger tube 218 . in this position lateral pin 286 does not engage with slot 284 and therefore drive end shaft 224 and auger shaft 282 rotate in unison , however exit shaft 280 rigidly connected to exit door 234 does not rotate unless pin 286 engages with slot 284 . therefore , in the door closed position 292 exit door 234 does not rotate and agitator pins 238 do not impart any forces upon material 230 within auger tube 218 . in use , auger lock 210 operates as follows . material 230 drops out of cyclone 228 through intake flange 227 of intake 226 and into auger tube 218 whereby they encounter the rotating auger flights 222 of auger 220 . the spring tension on spring 245 is adjusted by adjusting nut 273 to impart enough force on exit shaft 280 which transfers this force to exit door 234 thereby keeping it closed and in the door closed position 292 against exit end 260 . therefore , initially only drive end shaft 224 and auger shaft 282 rotate leaving exit shaft 280 attached to exit door 234 stationary . auger flights 222 continually transport material 230 towards exit end 260 of auger tube 218 until a material plug of material is formed in material plug section 214 of auger tube 218 . a material plug is a conglomeration of material 230 within auger tube 218 . material 230 is compacted together in this material plug . once the material plug has obtained sufficient size , it begins imparting forces against exit door 234 thereby pushing open exit door 234 against the tension on spring 245 . once exit door 234 has opened a predetermined amount , pin 286 engages with slots 284 thereby beginning rotation of exit shaft 280 with exit door 234 attached . once exit door 234 begins to rotate , agitator pins 238 begin to grind away material 230 from material plug thereby dropping the material into a bin or a hopper below not shown . the size of the material plug and the amount that the exit door opens is depended upon the pretension placed on spring 245 and the tension characteristics of spring 245 as well as the amount the exit door must open prior to the engagement of pin 286 with slot 284 . thereby the characteristics and the size of the material plugs can be adjusted by adjusting the tension on spring 245 as well by selecting the distance between pin 286 and slot 284 in the door closed position 292 . the greater the distance between pin 286 and slot 284 in the door closed position 292 the longer the material plug will form prior to exit door 234 rotating and agitator pin 238 grinding away the material plug . referring now to fig1 , which is schematic representation of auger lock 210 showing fig8 and 9 , highlighting some aspects of auger lock 210 not shown in fig8 and 9 . preferably a linear bearing 320 would be mounted onto the end of exit shaft 280 as shown in fig1 in order to provide for support for exit shaft 280 . in addition , a bushing 322 is preferrably used at the shaft end 225 of drive end shaft 224 as shown in fig1 . preferably also double pitch flighting 324 on auger 220 would be mounted onto auger shaft 282 approximate the exit end of auger flights 222 . in addition to the arrangement shown in fig8 and 10 for auger lock 210 , additionally the auger tube 218 arrangement shown in fig6 and 7 for the previous embodiment apply equally well to the presently preferred embodiment namely auger lock 210 . clarity auger tube 218 could be constructed of two auger tubes sections similar to first auger tube section 130 and second auger tube section 132 shown in fig6 and 7 . a coupling 134 shown in fig7 and fig6 would also be used and this arrangement would enable one to adjust the total length of auger tube 218 , thereby providing very gross and course control of the material plug section 214 . for example by extending second auger tubes section 132 over first auger tube section 130 thereby lengthening the total length of auger tube 218 , one can in effect increase the length of new material plug section 214 thereby increase the length of the material plug which is formed . this is useful for example when very course materials are being fed through auger lock 210 in order to provide for a better gas type seal the material plug section 214 would be made greater . on the other hand should finer materials or materials be used which provide for better gas tightness in the material plug section , then first auger tube section 130 and second auger tube section 132 could be urged over each other thereby shortening material plug section 214 and in this matter increasing the efficiency of the operation of auger lock 210 . it should be apparent to persons skilled in the arts that various modifications and adaptation of this structure described above are possible without departure from the spirit of the invention the scope of which defined in the appended claim .
1
there is shown in fig1 , 2a , 3 , and 3a , a compressible thermal insulating blanket 10 having an inner layer 12 of a flexible and compressible insulating material and an outer layer 14 of a flexible material . the inner layer 12 may be composed of any suitable commercially available insulating material such as fiberglass , rockwool , or glasswool . the important requirements are that the inner layer 12 have a low coefficient of thermal conductivity and be flexible and resiliently compressible so that it may be substantially compressed for long periods of time without affecting its ability to return to its pre - compressed state when released . the outer layer 14 is arranged to completely envelop the inner layer on all sides and thereby retain within the interior any glass fibers or particles that may separate from the inner layer . this is a very important advantage of the present invention in that potentially harmful particles or fibers will not be permitted to enter the living space . the outer layer 14 is constructed from a relatively thin sheet of vinyl , polyurethane , plastic , or similar type of material . the thickness of the layer 14 is approximately 0 . 002 to 0 . 015 inches depending on the desired durability of the finished article . one surface 16 of the inner layer 12 is attached to an inside adjacent surface 18 of the outer layer 14 . this attachment may be effected by adhesive or any suitable bonding means . the entire surface 16 need not be attached . the only requirement is that there be attachment over a sufficient area so that the inner layer 12 will not shift with respect to the outer layer 14 . a series of vent holes 20 are formed through and spaced along portions of the edges 22 of the outer layer 14 as shown in fig1 . the vent holes 20 are of about one quarter inch in diameter , and spaced about eight inches apart . the diameter and spacing of the holes 20 , however , are not critical to the practice of the present invention provided that the vent holes 20 permit sufficient quantities of air to pass through the holes during compression and expansion of the blanket 10 as described below . the outer layer 14 may be constructed in any of several ways as shown in fig2 a , 3 , and 3a . fig2 shows a two piece structure having a bottom portion 30 and a top portion 32 . the bottom portion 30 is folded upwardly on four sides thereby forming the edges 22 and is folded over the top so that a flap 34 overlays the top portion 32 by a small amount . the corners where pairs of the edges 22 meet may be formed into a miter or pleat to minimize build - up of material at these points . the flap 34 may be attached to the overlaid edges of the top portion 32 by pressure sensitive tape , adhesive , or any suitable bonding or fusing means . a second embodiment of the present invention is depicted in fig2 a which shows a structure that is similar to that of fig2 except that a separate strip 36 having top and bottom flaps 37 and 38 respectively is utilized instead of folding the bottom portion 30 upwardly . in this embodiment of the invention the flaps 37 and 38 are attached to the top and bottom portions 32 and 30 respectively in a manner similar to that described for the flap 34 . a third embodiment of the present invention is shown in fig3 wherein the top and bottom portions 32 and 30 respectively form mutually adjacent flaps or flanges 40 which are attached together in a manner similar to that described for the flap 34 . a variation of this structure is shown in fig3 a where a flap of the top portion 32 is attached to an edge 42 that defines the periphery of the bottom portion 30 . as with the structures shown in fig1 , and 2a , a series of vent holes 20 are formed through and suitably spaced along the edges 22 of the embodiments shown in fig3 and 3a . one of the more important advantages of the thermal insulating blanket 10 is that it may be substantially compressed into a compact unit for storage . when preparing the thermal insulating blanket 10 for storage it is first positioned on a flat surface such as a table top or floor as shown in fig4 . one end 50 is then manually compressed and folded over to form the beginning of a tight roll 52 . the roll 52 is held tightly and caused to slowly roll to the right , as viewed in fig4 thereby expelling through the vent holes 20 a substantial quantity of the air contained within the interior of both the inner layer 12 and the outer layer 14 . this tight rolling of the roll 52 continues until the blanket 10 is completely and compactly rolled into a cylinder , the outer diameter of which is schematically represented by the circle a in fig4 . two or more ropes , belts , or suitable ties 56 are then tightly secured around the compact cylinder , as shown in fig5 to maintain the thermal insulating blanket 10 in a compressed and compact state . an alternative to the individual ropes or belts is a single long rope or belt , not shown , which is wrapped tightly around the compact cylinder in a helical pattern and secured in place . in either case , the thermal insulating blanket 10 , when in this compressed and compact state , may be placed into a storage bag , not shown , for convenience in transporting and handling . the thermal insulating blanket 10 , when in this compact state occupies a volume of about one - fourth of the volume occupied when in its uncompressed free state . that is , the diameter of the compactly rolled cylinder , schematically represented by the circle a in fig4 is one - half the diameter of a loosely rolled cylinder which is schematically represented by the circle b in fig4 . this represents the significant savings of about three - quarters of the space required for storing an insulating blanket that cannot be compressed . when it is desired to utilize the blanket 10 after it has been stored in its compressed state for a period of time , it is only necessary to release the ties 56 and unroll the blanket . as the natural resiliency inherent in the inner layer 12 causes the inner layer to expand , air from the room , that is ambient air , will pass through the vent holes 20 and into the interior of the inner layer . this will continue until the inner layer 12 has expanded to substantially its pre - compressed state . another important advantage of the thermal insulating blanket 10 is that it may be completely removed from the attic access openings , stairways , and ceiling openings during the warmer months of the year . this permits warm air that would normally accumulate near the ceiling to pass into the attic through any small openings that would normally be present between the stairway structure or fan housing and the frame of the opening . this significantly enhances the efficiency of airconditioning systems when operating in a room having such a ceiling opening . another important advantage of the thermal insulating blanket 10 is that potentially harmful or irritating particles or fibers which may separate from the fiberglass inner layer 12 are substantially contained within the interior of the blanket 10 . this greatly reduces the risk of such particles or fibers entering the living space during use of the blanket 10 as set forth herein . fig6 through 8 depict several applications in which use of the thermal blanket 10 is particularly advantagous . fig6 shows a partial cross sectional view of a stairway 100 leading to an unheated room or attic area 102 . a door 104 is shown separating the heated and unheatead areas . the thermal insulating blanket 10 is hung across the door opening 106 , as shown in fig6 so that the lower edge 108 of the blanket 10 is in light contact with the floor 110 . a rail 112 having a portion of the blanket 10 sandwiched between it and the wall 116 is fastened to the wall with nails , screws or other suitable fasteners . by this means the blanket 10 is fastened to the wall 116 across the top of the door opening only , leaving the sides and lower porton of the blanket hanging freely but in contact with the sides 118 of the door frame so that the door opening is thermally isolated from the unheated area 102 . in order for a person to pass through the door opening , the door is opened in the normal manner and the thermal insulating blanket 10 merely pushed aside . it will be understood by those skilled in the art that the door 104 and the blanket 10 may be arranged in positions opposite to those shown in fig6 and that such an arrangement is considered equivalent to that shown . further , in certain cases , the use of the blanket 10 obviates the need for the door 104 . a partial cross sectional view of a stairway 120 leading from an unheated area 102 to a heated area 103 that is below grade is shown in fig7 . this is a typical structure for an outside entranceway to a basement wherein a hinged door 122 , or in some cases a pair of mating doors , is arranged to cover the stairway 120 . such doors are highly ineffective in preventing infiltration of cold air into the heated area 103 . in accordance with the present invention a thermal insulating blanket 10 is hung across a passage opening 124 formed in the wall 116 in a manner similar to that for the door opening 106 of fig6 . a rail 112 is used to fasten the blanket 10 to the wall 116 above the passage opening 124 so that the blanket hangs freely and covers the passage opening as shown in fig7 . the blanket 10 may be pushed aside when one desires to pass through . a partial cross sectional view of a typical folding or &# 34 ; pull down &# 34 ; stairway 130 to an attic 139 is shown in fig8 . folding stairways of this type are installed in an opening formed in the ceiling specifically for this purpose . as will be appreciated by those skilled in the art , such folding stairways account for substantial heat loss into the attic area . this is due to many reasons . the ceiling surface area occupied by the folding stairway is relatively large , typically about twelve square feet or more . heat transfer through this large uninsulated surface area can be substantial . further , the folding stairway is arranged so that a specific amount of clearance space exists between the surface of the folding stairway and the sides of the opening . this clearance space is needed to assure proper operaton of the mechanism of the stairway , however , the space permits the flow therethrough of warm air from the heated space into the attic . attempts to seal this clearance space and provide other insulation to reduce the loss of heat into the attic have heretofore met with little success . some of the reasons for this lack of success appear to be inherent in the structure of the folding stairway . that is , a folding stairway necessarily includes a mechanical mechanism which is actuated when raising and lowering the stairs . there is usually a counterbalance mechanism and a hand rail that must retract or extend . the steps themselves are usually arranged in two or three hinged segments which interfold prior to or during retraction of the stairway up into the ceiling . all of these moving parts which must necessarily operate when the stairway is being extended or retracted make it difficult , if not impossible , to effectively place insulation within the stairway structure so that heat transfer from the heated room to the attic is within acceptable limts . these problems , however , are obviated by the present invention wherein the thermal insulating blanket 10 is simply draped across the stairway opening 132 as shown . the blanket 10 is substantially larger than the opening 132 permitting an overlap area 134 of approximately twenty - four inches . this overlap is sufficient so that the blanket 10 should , in most cases , contact at least two joists 136 on two sides of the opening 132 . when the folding stairway 130 is in its closed and fully retracted position , as shown by the phantom lines 140 in fig8 it may project somewhat above the top of the joists 136 . this will cause the thermal insulating blanket 10 to be displaced upwardly a small amount as shown by the phantom lines 142 in fig8 . this small upward displacement , however , will have no adverse affect on the functional performance of the blanket 10 because of the substantial overlap areas 134 . when the stairway 130 is opened to its fully extended position , as shown in fig8 the thermal insulating blanket 10 will sag somewhat within the opening 132 . the blanket 10 , being supported on four sides by the frame around the opening 132 , has sufficient rigidity so that it remains in place without falling through the opening . when one climbs the stairway 130 to enter the attic 139 , one end 144 of the blanket 10 is simply folded back to permit passage . since the thermal insulating blanket 10 is encased in an outer layer 14 , potentially harmful or irritating particles or fibers which may separate from the fiberglass inner layer 12 are substantially contained within the interior of the blanket 10 . another application of the thermal insulating blanket 10 is shown in fig9 . there , an attic fan 150 is disposed in a ceiling 152 in a manner that is well known in the art . the area above the fan 150 is typically an unheated attic 139 . as with the folding stairway 130 , the fan housing 154 may project above the joists 136 an amount as shown in fig9 causing the thermal insulating blanket 10 to be displaced upwardly by that amount directly over the fan . there are , however , substantial overlap areas 134 , of about twenty - four inches , helping to assure that the blanket 10 will contact at least two joists on two sides . as described above in the folding stairway application , potentially harmful particles or fibers which may separate from the fiberglass inner layer 12 are contained within the interior of the blanket 10 thereby reducing the risk of such particles or fibers falling through the fan housing and into the living space below . another application of the thermal insulating blanket 10 , similar to that of the attic fan 150 described above , is insulating the typical ceiling access way to an unheated attic 139 . such an application is depicted in fig1 wherein a hatch 160 is disposed in an opening 162 in a ceiling 152 in a manner that is well known in the art . the hatch 160 is usually a rectangularly shaped piece of wood that is retained within the opening by the molding pieces 164 . the molding pieces 164 are customarily fastened to the ceiling 152 so that they slightly overlap the opening 162 on all sides thereby providing a shoulder 166 upon which the hatch 160 may rest . the thermal insulating blanket 10 , as shown in fig1 , is draped across the opening 162 in a manner similar to that of the stairway opening 132 of fig8 . there are substantial overlap areas 134 , of about twenty - four inches , helping to assure that the blanket 10 will , in most cases , contact at least two joists 136 on two sides . as shown in fig1 , the blanket 10 will sag a small amount within the opening 162 , however , the blanket 10 is supported on four sides by the frame of the opening 162 . when one wishes to enter the attic 139 through the opening 162 , the hatch 160 is simply pushed upwardly , displacing the blanket 10 upwardly a small amount until the hatch clears the top 168 of the frame . the hatch 160 is then laterally displaced so that it completely clears the opening 162 and rests on top of the joists 136 in the usual manner that is well known in the art . as with the folding stairway application described above , one end 144 of the blanket 10 is simply folded back to permit passage . it will be understood that one of the more important advantages of the present invention is the ability of the thermal insulating blanket 10 to be substantially compressed and arranged in a compact unit for storing without adversely affecting its ability to functionally perform at a later time . this is due to its unique structure wherein an inherent resiliency urges it into an expanded state for maximum thermal insulating attributes and vent means which permits conforming the blanket 10 into a compressed state for convenient storage . the above described applications of the thermal insulating blanket 10 indicate its unique usefulness . upon reading the present disclosure additional beneficial uses of the thermal insulating blanket 10 will become apparent to those skilled in the art and such uses are considered to be within the spirit and scope of the following claims .
1
referring now to the figures of the drawings in detail and first , particularly , to fig1 thereof , there is shown a twin clutch 4 which is essentially formed of a clutch housing or clutch case 8 , two clutches 10 , 12 , which are connected to two transmission input shafts 14 , 20 , and an axial bearing 25 which is fastened , via a fastening element 26 , to the inner transmission input shaft 14 . fig1 illustrates schematically a motor vehicle which is only indicated by a dashed line . the motor vehicle has an internal combustion engine 1 having a crankshaft 2 and a crankshaft flange 3 , which represents the connection to the twin clutch 4 . for the sake of simplicity , only half of the twin clutch is illustrated here . a metal clutch drive plate 5 , which is fastened at one end to the crankshaft flange 3 and at the other end to the clutch with the aid of installation screws 6 , forms the connection between the crankshaft flange 3 and the twin clutch 4 . the fastening with the aid of the installation screws 6 takes place after the engine 1 and transmission 7 , which is not shown in detail , have been joined together . the twin clutch 4 includes the housing or cover 8 which connects a fixed pressure plate 9 of the one clutch 10 and a fixed pressure plate 11 of the other clutch 12 to each other and , through the use of the installation screws 6 , to the crankshaft 2 . the one clutch 10 is formed of the driver disc or carrier disc 13 which is connected in an axially displaceable manner on the one transmission input shaft 14 forming the inner transmission input shaft . the one clutch 10 additionally has a movable pressure plate 15 which , for its part , is mounted in an axially displaceable but torsionally fixed manner in the clutch housing 8 . through the use of a lever mechanism 16 , which is likewise mounted within the clutch housing 8 , a force 19 is transferred by an engaging mechanism via a bearing 18 to the movable pressure plate 15 . by closing the air gaps between the carrier disc 13 and the pressure plates 9 and 15 , and by the additional application of a pressure force between these components , a torque is applied between the twin clutch 4 and the transmission input shaft 14 . in the other clutch 12 , the same applies analogously as for the one clutch 10 . the clutch 12 is formed by the pressure plate 11 which is fixedly connected to the clutch housing 8 , by the carrier disc 13 ′ mounted displaceably on the other transmission input shaft 20 , which is configured as a hollow shaft , and by the pressure plate 21 which is mounted in an axially displaceable but rotationally fixed manner with respect to the clutch housing 8 . this movable pressure plate is , for its part , actuated via a further lever mechanism 22 . for this purpose , a disengaging mechanism exerts a force 24 via a bearing 23 on the lever mechanism 22 , as a result of which the clutch 12 is closed and a torque is transmitted by the clutch housing 8 onto the other transmission input shaft 20 . in this case , the disengaging mechanisms are supported on the transmission housing 17 . an additional axial bearing 25 , which is advantageously configured as a grease - lubricated bearing , is provided for preventing that the axial force , which is exerted on the twin clutch 4 by these disengaging mechanisms , is passed on to the crankshaft 2 . this axial bearing 25 is screwed fixedly to the inner transmission input shaft 14 . because of this axial bearing 25 , the forces introduced by the disengaging mechanisms are transferred to the inner transmission input shaft 14 . this shaft 14 , for its part , transmits the forces via an oil - lubricated shaft bearing 27 to the transmission housing 17 . the oil - lubricated shaft bearing 27 is situated within the transmission 7 , more specifically between the transmission input shafts 14 , 20 and the transmission housing 17 . as a result , a closed force flux is produced within the system unit that includes the transmission . however , a requirement for a satisfactory functioning of this support of the axial forces is that although the clutch drive plate 5 is torsion - proof , i . e . torsionally rigid , the clutch drive plate is configured to be elastic in the axial direction . if this clutch drive plate is made too stiff in the axial direction , then because of the tolerances which exist , clamping forces occur between the twin clutch 4 and the crankshaft 2 during the installation of the transmission 7 on the engine 1 . the embodiment illustrated in fig2 has a two - mass flywheel 36 . the flywheel mass is divided into a primary flywheel mass 33 and a secondary flywheel mass 34 . the primary flywheel mass 33 is fastened to the crankshaft 2 . the secondary flywheel mass 34 is provided on the clutch via a plug - in toothing 32 . a torsional damper formed by a bent helical spring 35 is fitted between the flywheel masses . torsional vibrations , which occur between the engine 1 and twin clutch 4 or transmission 7 , are compensated for by the torsional damping of the two - mass flywheel 36 via the spring 35 . the twin clutch 4 is mounted with respect to the transmission housing 17 via the clutch housing 8 having the axial bearing 37 , which is advantageously configured as an axial grooved ball bearing . two disengaging mechanisms 30 , 31 are provided on the transmission input shafts 14 , 20 and , when actuated hydraulically , disengage the clutches 10 , 12 via the diaphragm springs 28 , 29 . the disengaging mechanisms 30 , 31 have the disengaging bearings 38 , 38 ′, 39 , 39 ′. when the clutch is closed , the appropriate disengaging mechanism 30 , 31 rotates together with the transmission input shaft 14 , 20 , with the result that there is no stressing of the respective bearing 38 , 38 ′, 39 , 39 ′ due to speed . this , together with the support by the axial bearing 37 , brings about a significant improvement in the wear characteristic of the twin clutch with respect to wear on the engine and the transmission .
5
fig4 contains a simplified block diagram for an input / output cell 50 according to one embodiment of the invention . logic circuit 52 accepts two input signals s 0 and s 1 , and a mode signal mode . logic circuit 52 provides signals to the gates of four cmos transistor pairs : pair p 1 , n 1 ; pair p 2 , n 2 ; pair p 3 , n 3 ; and pair p 4 , n 4 . the two transistors of each pair are connected at their drains to a drain node — the drain nodes of pairs p 1 , n 1 and p 3 , n 3 connect to a first conductive pad 54 , and the drain nodes of pairs p 2 , n 2 and p 4 , n 4 connect to a second conductive pad 56 . the source of each n - channel transistor ( n 1 , n 2 , n 3 , n 4 ) couples to a reference or ground voltage vss . the source of each p - channel transistor ( p 1 , p 2 , p 3 , p 4 ) couples to a supply voltage vdd . p 1 and p 2 couple to vdd through a common current source 58 , placing pairs p 1 , n 1 and p 2 , n 2 in a differential configuration . although not necessary if the cell will be used only for signal output , cell 50 also includes two additional cmos transistor pairs , p 21 , n 21 and p 22 , n 22 . pair p 21 , n 21 inverts and drives the signal received on conductive pad 54 , producing an input signal c 1 . pair p 22 , n 22 inverts and drives the signal received on conductive pad 56 , producing an input signal c 2 . when mode is set to a first output mode , logic circuit 52 turns off pairs p 3 , n 3 and p 4 , n 4 , e . g ., by supplying vdd to the gates of p 3 and p 4 , and vss to the gates of n 3 and n 4 . s 0 is used in this mode to drive the gates of p 1 , p 2 , n 1 , and n 2 as a differential current - mode driver . for instance , when s 0 is at a logic low level , logic circuit 52 turns on p 1 and n 2 and turns off n 1 and p 2 , such that current i 0 flows out pad 54 and in pad 56 . and when s 0 transitions to a logic high level , logic circuit 52 reverses this on / off pattern , such that current i 0 flows out pad 56 and in pad 54 . s 0 could optionally be an analog output signal instead of a logic signal , in which case logic circuit 52 can create appropriate analog drive signals for pairs p 1 , n 1 and p 2 , n 2 . when mode is set to a second output mode , logic circuit 52 turns off pairs p 1 , n 1 and p 2 , n 2 , e . g ., by supplying vss to the gates of all four transistors and turning off current source 58 . s 0 is used in this mode to drive the gates of p 3 and n 3 as a single - ended voltage driver . in the second mode , logic circuit 52 can drive the gates of p 4 and n 4 as a second single - ended voltage driver . mode can of course have multiple sub - modes in which the mapping of signals s 0 and s 1 onto bonding pads 54 , 56 can be one of the following : s 0 , s 1 ; s 1 , s 0 ; s 0 , none ; s 1 , none ; none , s 0 ; or none , s 1 . note that if one of the pairs p 3 , n 3 and p 4 , n 4 is never used as a voltage driver , the logic circuit need not control the gates of that pair , and that pair can be configured as a conventional esd circuit by connecting the gates of that pair permanently to their respective voltage rails . for the embodiment shown in fig4 , mode can also be set to an input mode that turns off all output drivers , placing all in an esd mode . input signals can then be received on one or both of pads 54 and 56 , and passed to the integrated circuit as c 1 and c 2 . fig5 illustrates , in block diagram form , a specific input / output cell embodiment 100 . cell 100 interfaces on the integrated circuit side with core logic operating at 1 . 8 v . cell 100 itself operates at 3 . 3 v . in one mode , cell 100 outputs signaling compatible with reduced swing differential signaling ( rsds , a trademark of national semiconductor corp ., as described in rsds ™ specification , rev . 0 . 95 , may 2001 ). when driven into a 100 - ohm load placed across pad 0 and pad 1 , the differential voltage across the pads will be roughly 250 mv , with an offset voltage v off of approximately v ref = 1 . 3 v . in a second mode , cell 100 outputs either one or two cmos / ttl ( 3 . 3 v logic ) signals , one on pad 0 and the other on pad 1 . in a third mode , cell 100 receives either one or two cmos / ttl signals , one on pad 0 and the other on pad 1 . cell 100 contains four functional blocks . driver / esd circuit 200 produces output signals in the various output modes , and provides esd protection against spurious transients on pad 0 and pad 1 . driver logic circuit 300 receives 1 . 8 v signals from the circuit core , and converts these signals to control signals for driver / esd circuit 200 . receiver circuit 400 performs the signal input functions for pad 0 and pad 1 , providing corresponding 1 . 8 v signals to the circuit core on c 0 and c 1 . current reference 500 provides a biasing current reference iref for the differential circuitry of driver / esd circuit 200 . an implementation example for each block of cell 100 will now be described with reference to fig6 – 10 . fig6 contains a more detailed version of driver / esd circuit 200 of fig5 . the operation of that circuit will be described first for a differential output mode , then for a single - ended output mode , and finally for a single - ended input mode . in differential output mode , signal diffen is asserted ( and complementary signal diffen # is deasserted ) in order to activate the differential circuitry . signals diff + and diff − form the differential inputs used to control the differential driver transistor pairs p 1 , n 1 and p 2 , n 2 . signal iref provides a reference current i 0 for generating an appropriate rsds current level , and signal vref provides a reference voltage for generating an appropriate rsds bias voltage . the remaining control signals ( seap 0 , sean 0 , seap 1 , sean 1 , sebp 0 , sebn 0 , sebp 1 , and sebn 1 ) each control one of the single - ended output transistors ( respectively p 3 , n 3 , p 5 , n 5 , p 4 , n 4 , p 6 , and n 6 ). in differential mode , each se signal controlling a pmos transistor is driven high , and each se signal controlling an nmos transistor is driven low , placing the se transistors in an esd mode . gated current mirror 210 is off when diffen # is asserted , but otherwise replicates iref , supplying a reference current of magnitude i 0 to current mirrors 212 and 214 ( which use a common mirror transistor ). current mirror 212 in turn supplies a reference current of magnitude i 0 to current mirrors 216 and 218 ( which also use a common mirror transistor ). gated averaging circuit 220 is on when diffen is asserted . when on , averaging circuit 220 supplies a sample voltage vavg , representing the instantaneous average of the voltage on pad 0 and the voltage on pad 1 , to voltage error amplifier 230 . voltage error amplifier 230 compares vref with vavg . error amplifier 230 splits a reference current of magnitude 2 i 0 ( from current mirror 216 ), such that when vref and vavg are equal , a reference current of magnitude i 0 is supplied to current mirror 232 . but when vavg rises above vref , error amplifier 230 increases the reference current supplied to current mirror 232 ( up to a maximum value of 2 i 0 if necessary ). conversely , when vavg dips below vref , error amplifier 230 decreases the reference current supplied to current mirror 232 ( down to a minimum value of zero , if necessary ). current mirror 218 supplies a current of magnitude 26 i 0 to the coupled sources of differential driver transistors p 1 and p 2 when diffen is asserted . likewise , current mirrors 214 and 232 combine to drain a current of magnitude 26 i 0 ( 8 i 0 from mirror 232 and 18 i 0 from mirror 214 ) from the coupled sources of differential driver transistors n 1 and n 2 when diffen is asserted . in differential output mode signaling , one of diff + or diff − will be a logic high , and the other will be a logic low . gate 240 passes diff + to the gates of p 1 and n 1 ; diff − is supplied directly to the gates of p 2 and n 2 . thus when diff + is logic high , a current of magnitude 26 i 0 will flow through p 2 , out pad 1 through the differential load , back in pad 0 , and through n 1 . when diff + is logic low , this current will reverse , flowing through p 1 , out pad 0 and through the differential load in the opposite direction , back in pad 1 , and through n 2 . esd continuity circuits 242 , 244 , and 246 each contain transistors that are biased off , with sources tied to a voltage rail . the drains of the continuity circuit transistors connect to source / drain regions of differential circuit transistors that are not tied directly to a voltage rail and have their other source / drain region connected to a pad ( e . g ., p 1 , p 2 , n 1 , and n 2 ). in single - ended output mode , diffen is deasserted ( and diffen # is asserted ). this turns off gated current mirror 210 , which zeros all of the differential bias currents in driver / esd circuit 200 . rail - gated current mirrors 214 and 218 have their mirror connections opened , and their gates referenced instead to the voltage rail that biases those circuits off . averaging circuit 220 is also turned off . gate 240 disconnects diff + from p 1 and n 1 , instead connecting these transistors to vdd ( leaving p 1 off and n 1 on ). diff − is driven low , such that p 2 is on and n 2 is off . note that although n 1 and p 2 are technically on , each has its source coupled to a high impedance and thus the differential outputs are disabled . optionally , each of p 1 , p 2 , n 1 , and n 2 could be driven by a separate input , such that all four transistors can be turned off in single - ended mode . the se gate signals are potentially active in single - ended output mode . when a single - ended signal is driven on pad 0 , two drive strengths are available . one drive strength drives seap 0 and sebp 0 in synchronism , and sean 0 and sebn 0 in synchronism ( but complementary to seap 0 and sebp 0 ). a lesser drive strength drives only one p 0 and one n 0 transistor , leaving the others biased off . a second single - ended signal can also be driven concurrently on pad 1 using the remaining se gate signals in similar fashion . in single - ended input mode , the differential circuitry signals are set as in single - ended output mode . further , the se signals are set as in differential output mode . this setting places driver circuitry connected to a pad in a high - impedance state . fig7 illustrates further detail for the differential circuitry portions of driver / esd circuit 200 in one embodiment , with the esd continuity circuits and single - ended drivers removed for clarity . gated current mirror 210 comprises matched transistors p 7 and p 8 , with common sources tied to vdd and common gates . p 7 has its gate and drain shorted to a switch transistor p 9 that allows iref to flow through p 7 whenever diffen # is deasserted . thus in single - ended modes , current mirror 210 is off , and in differential mode , p 8 mirrors iref . current mirror 212 comprises matched transistors n 7 and n 8 , with common sources tied to vss and common gates . n 7 has its gate and drain shorted to the drain of p 8 , such that in differential mode , mirror 212 replicates iref at the n 8 drain node . current mirror 214 shares transistor n 7 with current mirror 212 . when diffen is asserted , switch transistor n 10 couples the gate of transistor n 9 to the gate of transistor n 7 . transistor n 9 has 18 parallel channels , each dimensionally identical to the single channel of n 7 , such that n 9 mirrors 18 times iref when on . note that when diffen is deasserted , not only is the gate of n 9 disconnected from the gate of n 7 , but the n 9 gate is biased to vss instead through switch transistor n 11 , which uses diffen # as a gate signal . current mirror 216 comprises transistors p 10 and p 14 , with common sources tied to vdd and common gates . p 10 has its gate and drain shorted to the drain of n 8 , such that in differential mode , mirror 216 is referenced to iref . transistor p 14 has two parallel channels , each dimensionally identical to the single channel of p 10 , such that p 14 mirrors twice iref when on . current mirror 218 shares transistor p 10 with current mirror 216 . when diffen # is deasserted , switch transistor p 12 couples the gate of transistor p 11 to the gate of transistor p 10 . transistor p 11 has 26 parallel channels , each dimensionally identical to the single channel of p 10 , such that p 11 mirrors 26 times iref when on . note that when diffen is deasserted , not only is the gate of p 11 disconnected from the gate of p 10 , but the p 11 gate is biased to vdd instead through switch transistor p 13 , which used diffen as a gate signal . voltage error amplifier 230 receives the 2 iref - magnitude current produced by mirror 216 , and apportions that current between two identical paths to vss . each path comprises a p - channel transistor with its source coupled to the drain of p 14 , and an n - channel transistor with its source coupled to vss , the drain of the p - channel transistor coupled to the drain and gate of the n - channel transistor . in one path , the p - channel transistor p 15 receives a gate signal vref , and in the other path , the p - channel transistor p 16 receives a gate signal vavg . it can be appreciated that when vavg == vref , a current of magnitude iref will flow through each path . when vavg is greater than vref , p 16 will carry less current than p 15 ; when vavg is less than vref , p 15 will carry less current than p 16 . the current that passes through p 15 also passes through n 15 . n 15 and n 24 share common source and gate nodes . transistor n 24 has eight parallel channels , each dimensionally identical to the single channel of n 15 , such that n 24 mirrors eight times the current passing through n 15 . gated averaging circuit 220 comprises the serial combination of transistor n 12 , two resistors of resistance r ( e . g ., r = 2 . 8 k ω ), and transistor n 13 , bridged between pad 0 and pad 1 . transistors n 12 and n 13 are identical switch transistors driven by a common gate signal diffen . n 12 has one source / drain node connected to pad 0 , and n 13 has one source / drain node connected to pad 1 . when diffen is asserted , the two series resistors are effectively connected across pad 0 and pad 1 . the voltage vavg , measured between the two resistors , thus represents a voltage midway between the pad 0 and the pad 1 voltage , no matter which of pad 0 or pad 1 is at a higher voltage . finally , gate 240 contains switch transistors p 17 and n 17 , each driven by a gate signal diffen . when diffen is asserted , n 17 is on , and diff + drives p 1 and n 1 . when diffen is deasserted , p 17 is on , and pulls the gates of p 1 and n 1 high . all p - channel transistors in fig6 and 7 have their n - wells referenced to vdd . fig8 shows one implementation for a driver logic circuit 300 . 1 . 8 v logic signals s 0 , s 1 , oen #, diffsel , and drvsel are inputs to logic circuit 300 . the input inverters identified with a “ c ” are conditioning inverters that accept a 1 . 8 v logic input and provide a 3 . 3 v logic output . the remaining single - ended control logic gates in circuit 300 operate as 3 . 3 v logic gates ( all of the differential control logic operates at 1 . 8 v ). the identifiers within those gates , ending in “ x ”, indicate the relative size of each gate . signal diffsel determines whether the differential driver circuitry will be enabled . diffsel is supplied to the enable ( e ) input of differential gate signal generator 310 . differential gate signal generator 310 accepts s 0 as a 1 . 8 v input signal in , and creates two 1 . 8 v output signals out + and out −. one embodiment for generator 310 uses two serial inverters to create out + from in , and three faster serial inverters to create out − from in with approximately the same timing but opposite phase . when e is deasserted , however , both out + and out − produce logic low signals regardless of the signal present at s 0 . the signals generated at out + and out − are buffered up to a higher drive strength ( but remain 1 . 8 v logic signals ) to form output signals diff + and diff −, respectively . signal oen # is asserted ( low ) whenever any output driver circuitry will be enabled . when asserted at the same time as diffsel , however , diffsel blocks the single - ended logic circuitry from responding to oen #. thus when oen # is logic high or diffsel is logic high , all single - ended outputs will be set to turn off their respective se driver transistors regardless of the state of s 0 and s 1 . when both oen # and diffsel are logic low , at least some of the single - ended outputs will respond to s 0 and s 1 . which single - ended outputs respond to s 0 and s 1 depends in part on the state of drvsel . in single - ended mode , all “ seaxy ” outputs respond to sy . further , when drvsel is set to logic high , all “ sebxy ” outputs respond to sy as well ; otherwise , the “ sebxy ” outputs continue to turn off their respective se driver transistors . note that in this embodiment , signal s 0 provides an input for a drive signal in both single - ended and differential output modes , and s 1 provides an input for a drive signal in single - ended mode . it is straightforward to modify circuit 300 to provide different behavior , e . g ., the ability to output one but not both s 0 and s 1 in a single - ended mode , the ability to use a separate input , even an analog input , for the differential channel , etc . fig9 illustrates one embodiment for receiver circuit 400 of fig5 . pad 0 connects through a resistance r 1 ( e . g ., 622 ω ) to the gates of transistors p 20 and n 20 ( which share a common drain node b 0 ), and to the drain of transistor n 25 ( which has a source connected to vss ). a transistor n 24 , connected between the source of n 20 and vss , determines whether n 20 can pull node b 0 low . when diffen # is low ( indicating differential output mode ), n 24 and n 25 are off , and circuit 400 presents a high impedance to the differential driver . when diffen # is high ( indicating either single - ended input or output mode ), n 24 and n 25 are on , allowing : pair p 20 , n 20 to produce at b 0 an inverted version of the signal present at pad 0 , when pad 0 is driven ; n 25 to pull pad 0 low through r 1 , when pad 0 is not driven . note that n 25 is a weak device , e . g ., a long - channel transistor , such that a drive transistor can easily dominate the signal at pad 0 despite the pulldown effect through n 25 . node b 0 drives the gates of p 22 and n 22 , which are connected in a conventional inverter configuration between vdd 1 and vss 1 ( e . g ., 1 . 8 v logic rails ), with an output at node c 0 . c 0 thus replicates the logical condition present at pad 0 , in 1 . 8 v logic , when pad 0 is not in differential mode . transistors p 21 , n 21 , p 23 , n 23 , n 26 , and n 27 perform a similar function ( for pad 1 ) to that just described for the transistors serving pad 0 . fig1 shows one possible implementation for current reference 500 of fig5 . signal diffsel turns on transistor n 30 when asserted , allowing reference 500 to generate reference current iref . mirror transistors p 31 and p 32 are identical . mirror transistor n 35 contains two parallel channel regions , each identical to the single channel of mirror transistor n 34 , and thus generates twice the current as n 34 . reference 500 is designed to produce a 50 μa current through n 34 ( and thus a 100 μa current iref ) when vdd − vss = 3 . 3 v . fig1 illustrates one application of an i / o cell embodiment in an integrated circuit , e . g ., an image processor circuit that manipulates input video and / or graphics signals ( not shown ) to produce signals appropriate for a display device . programmable timing controller ( tcon ) 620 accepts display data , e . g ., as n - bit - wide data words . microprocessor 610 configures tcon 620 , using bus signaling on bus 612 , in one of several possible output modes . for instance in one mode , tcon 620 could drive all n bits of a data word in parallel — through the n / 2 i / o cells 100 — on display port pads pad 0 through pad ( n − 1 ) in one output clock cycle as cmos / ttl single - ended outputs . in another mode , tcon 620 could drive n / 2 of the n bits in parallel in two consecutive output clock cycles — this time using each i / o cell 100 to drive one bit differentially — across two pads — during each clock cycle . or , in another mode tcon 620 could read an input word from the i / o cells and transmit the word to the microprocessor . in each mode , tcon 620 generates the appropriate drvsel , oen , and diffsel signals to each i / o cell 100 to configure the i / o cell in the appropriate mode . for comparison , a general - purpose i / o ( gpio ) interface 630 is also shown connected to bus 612 . gpio unit 630 connects to port a pads gp 0 to gp ( m − 1 ) through conventional i / o cells 640 . although not shown exactly to scale , the comparison is intended to represent that the multimode i / o cells 100 take up no more room , on a per - pad basis , than the conventional cells 640 . the multimode examples presented above are merely exemplary — for instance , the data word width and number of display port pads need not match , and the timing need not be as expressed . tcon 620 can use any of a variety of multiplexing schemes to drive data on the output pads . the illustrations are intended only to demonstrate the flexibility of such an integrated circuit in interfacing with different external display circuitry . one of ordinary skill in the art will recognize that the concepts taught herein can be tailored to a particular application in many other advantageous ways . for instance , although rsds signaling is shown , another signaling format , such as lvds ( low voltage differential signaling ) could be employed — or configurable voltage and current references could be used to supply signals in multiple programmable differential formats . in general , the voltages , currents , resistance values , transistor ratios and configurations , etc . disclosed herein merely demonstrate a few implementations , and can be readily adapted to other implementations . although a “ pad ” includes bonding pads such as typical in the industry , the exact mechanism used to interface the circuit with external circuitry is not critical to the invention , and thus a “ pad ” could include any such mechanism . such minor modifications are encompassed within the invention , and are intended to fall within the scope of the claims . the preceding embodiments are exemplary . although the specification may refer to “ an ”, “ one ”, “ another ”, or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is to the same embodiment ( s ), or that the feature only applies to a single embodiment .
7
a technical solution herein is elaborated below with reference to drawings and embodiments . a transaction system according to an embodiment herein , as shown in fig1 , mainly may include an online mall server , a physical store terminal , and a user terminal , among which information may be delivered through interaction channels . an online mall may include various virtual stores implementing business to business ( b2b ), business to customer ( b2c ), customer to customer ( c2c ), online to offline ( o2o ) buying and selling , and the like . compared with a virtual store , a physical store may be a conventional marketplace , a shopping center , a storefront , or a new experience store established by a virtual store . there may be multiple physical stores , each physical store may include a physical store terminal . the physical store terminal may be configured for maintaining information on the local physical store ( the physical store where the physical store terminal is arranged ). a user terminal may be a personal device for user shopping , and may be a mobile terminal , a pc , a laptop , and the like , or a combination thereof . an interaction channel may be configured for completing system information delivery . a physical bearer of an interaction channel may be a network of any type and / or form . such a bearer network may include any of a point to point network , a broadcast network , a wide area network , a local area network , a remote communication network , a data communication network , a computer network , an asynchronous transfer mode ( atm ) network , a synchronous optical network ( sonet ), a synchronous digital hierarchy ( sdh ) network , a wireless network , and a wired network . an interaction channel 1 may be that between a user terminal and an online mall server , for which a cellular wireless network may be selected as a bearer . through the interaction channel , a terminal user may log in to an online mall , browse and select a list of commodities as needed . the online mall server may acquire , according to the list of commodities , stored information on commodities in physical stores ; look for a proper physical store for the user according to a strategy , and transfer information on the name and location of the physical store and the like to the user terminal through the interaction channel . an interaction channel 2 may be that between a user terminal and a physical store terminal , for which a wifi network may be selected as a bearer . after arriving at the physical store , the user may acquire , through the interaction channel , a specific location of a commodity corresponding to the list of commodities in the physical store , such that the user may select or experience the commodity . the physical store terminal may also transfer other relevant information , such as broadcast information , to the user terminal through the interaction channel . an interaction channel 3 may be that between an online mall server and a physical store terminal , for which a wired network may be selected as a bearer . through the interaction channel , physical store information may be transferred to the online mall server . the physical store information may include information on the name of a physical store , the location of the physical store , a commodity in the physical store , and the like . the physical store information may further include information on the location of a commodity ( in the physical store , such as a floor , a shelf ), and the like . the online mall server may also initiate a requirement to a physical store terminal to report information dynamically as needed . in the transaction system , the online mall server may be configured for : managing physical store information ; receiving login by the user terminal ; searching , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selecting , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sending information on a name and a location of the selected physical store to the user terminal . the physical store terminal may be configured for : managing information on a local physical store ; reporting the information on the local physical store to the online mall server ; searching for information on a location of a commodity in the local physical store according to the list of commodities reported by the user terminal , and feeding the found information on the location of the commodity back to the user terminal . the user terminal may be configured for : logging in to the online mall server ; selecting commodities and submitting the selected list of commodities ; receiving the information on the name and the location of the physical store selected by the online mall server for the user terminal ; reporting the list of commodities to a physical store terminal of the physical store selected by the online mall server ; receiving information on a location of a commodity fed back by the physical store terminal of the selected physical store . the user terminal may be further configured for : finding the commodity in the selected physical store according to the received information on the location of the commodity , and paying for the commodity by interacting with the online mall server or the physical store terminal of the selected physical store . the physical store terminal may be further configured for : searching for a tag of the commodity corresponding to the list of commodities reported by the user terminal , and feeding the found tag of the commodity back to the user terminal . the user terminal may be further configured for : scanning the received tag of the commodity in a physical store , and checking the commodity according to a result of the scanning . a tag of a commodity may be one of a near field communication ( nfc ) tag , a wireless radio frequency identification ( rfid ) tag , and a quick response code . with the system , while being logged in to an online mall , a terminal user may browse commodities to be purchased , select and then submit a list of commodities ; an online mall server may acquire stored physical store information according to the list of commodities , select a physical store according to a strategy , and transfer information on the name and the location of the selected physical store to the user terminal . after arriving at the physical store , the user may acquire information on the specific location of the commodities in the physical store , select or experience a commodity ; network payment may be made through the online mall or on - site payment may be made directly at the physical store for a subsequent purchase , thereby greatly increasing means and experience of shopping . fig2 shows a diagram of internal structures of an online mall server , a physical store terminal , and a user terminal in a transaction system according to an embodiment herein . the online mall server may include a physical store managing module , a first terminal interaction module , and a first physical store interaction module . the physical store managing module may be configured for : managing physical store information ; receiving login by a user terminal ; searching , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selecting , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sending , through the first terminal interaction module , information on a name and a location of the selected physical store to the user terminal . the first terminal interaction module may be configured for : delivering information between the online mall server and the user terminal . the information delivered between the online mall server and the user terminal may include at least : information delivered during login of the user terminal , the selected list of commodities submitted by the user terminal received by the online mall server , and information delivered during commodity payment between the online mall server and the user terminal . the first physical store interaction module may be configured for : delivering information between the online mall server and a physical store terminal . the information delivered between the online mall server and the physical store terminal may include at least physical store information reported by the physical store terminal received by the online mall server . to increase processing efficiency , the physical store managing module may manage the physical store information by way of a database . the physical store terminal may include a commodity managing module , a second terminal interaction module , and a first network interaction module . the commodity managing module may be configured for : managing information on a local physical store ; searching for information on a location of a commodity corresponding to a list of commodities reported by a user terminal . the second terminal interaction module may be configured for : receiving the list of commodities reported by the user terminal , and feeding the found information on the location of the commodity back to the user terminal . the first network interaction module may be configured for : reporting the information on the local physical store to an online mall server . the second terminal interaction module may be further configured for interacting with the user terminal to complete commodity payment . the user terminal may include a shopping module , a second network interaction module , an information storing module , a second physical store interaction module , and a paying module . the shopping module may be configured for : logging in , through the second network interaction module , to an online mall server , selecting commodities and submitting a selected list of commodities . the second network interaction module may be configured for delivering information between the user terminal and the online mall server . the information storing module may be configured for : receiving and storing information on a name and a location of a physical store selected by the online mall server for the user terminal . the second physical store interaction module may be configured for : reporting the list of commodities to a physical store terminal of the physical store selected by the online mall server , and receiving information on a location of a commodity fed back by the physical store terminal of the selected physical store . the paying module may be configured for : paying for the commodity by interacting with the online mall server or the physical store terminal . the user terminal may further include a displaying module configured for information display and user interface interaction during shopping and paying . the user terminal may further include a navigation module configured for performing global positioning system ( gps ) navigation according to information on the location of a commodity fed back by a physical store terminal as well as information on the location of the user terminal . a transaction method implemented by a transaction system according to an embodiment herein , as shown in fig3 , mainly may include steps as follows . in step 301 , an online mall server manages physical store information ; receives login by a user terminal ; searches , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selects , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sends information on a name and a location of the selected physical store to the user terminal . in step 302 , the user terminal reports the list of commodities to a physical store terminal of the selected physical store . in step 303 , the physical store terminal searches for information on a location of a commodity corresponding to the list of commodities reported by the user terminal , and feeds the found information on the location of the commodity back to the user terminal . in step 304 , the user terminal finds the commodity in the physical store according to the received information on the location of the commodity , and pays for the commodity by interacting with the online mall server or the physical store terminal . the physical store terminal may search for a tag of the commodity corresponding to the list of commodities reported by the user terminal , and feed the found tag of the commodity back to the user terminal . the user terminal may scan the received tag of the commodity , and check the commodity according to a result of the scanning . a tag of a commodity may be one of an nfc tag , an rfid tag , and a quick response code . the physical store information may include information on a name of a physical store , a location of the physical store , and a commodity in the physical store . the physical store information may further include information on a location of the commodity in the physical store . the transaction method is further elaborated below with reference to an embodiment . in the embodiment , a terminal user plans to buy 3 commodities a , b , c in an online mall and wishes to experience the commodities and make payment at a nearby physical store . the user terminal supports gps navigation , wifi , and nfc . a physical store terminal regularly reports commodities relevant information to the online mall server . for precise management , each commodity may be provided with an nfc tag for user search and check . the transaction method mainly may include steps as follows . in step a , a terminal user may select a commodity in an online mall and form a selected list of commodities . in step b , a selecting strategy may include that based on nearby experience and that based on experience once for all ; the terminal user may select nearby experience , and input a current geographical location of the terminal user . in step c , an online mall server may traverse all physical stores having the commodity a , b , or c in the selected list of commodities , select a physical store m according to a nearby principle , transfer the address of the physical store m to the user terminal . of course , the online mall server may select multiple physical stores for the user , and it &# 39 ; s up to the user to select the physical store ( s ) where to shop . in step d , the user terminal may start a gps navigation system and arrive at the physical store m . in step e , the user terminal may transfer the list of commodities to a terminal of the physical store m through wifi in the physical store m . the list of commodities may include information on a , b , c . the list of commodities may of course include information on only one or at least one commodity the user desires to experience or purchase . in step f , the terminal of the physical store m may find information on the location of a commodity in the local physical store according to the received list of commodities , return the found information as well as an nfc tag thereof to the user terminal . in step g , the terminal user may find the commodity according to the received information on the location of the commodity . in step h , the user terminal may check the commodity by reading the nfc tag of the commodity . in step i , the terminal user may determine to purchase the commodity and form a payment list . in step j , nfc payment may be made in the physical store m using the user terminal . in step k , the user may pick up the commodity at the physical store m , completing the whole transaction . to sum up , with embodiments herein , online and offline resources of a virtual online mall and a physical store or an experience store can be combined , implementing search and selection among massive commodity information ; complementary advantages of virtual online shopping and of physical store shopping can be combined , greatly increasing user experience in shopping , ensuring shopping quality . what described are merely embodiments of the present disclosure and are not intended to limit the protection scope of the present disclosure .
6
an assembly for injecting a probe into a tire t is indicated generally by the numeral 10 in fig1 . tire t is shown in a mold m with the mold being surrounded by an enclosed steam dome d which forms a cavity that receives steam under pressure to heat the mold m . mold m is recessed to receive a generally cylindrical housing 11 which includes an annular flange 12 . a plurality of fasteners 13 extend through flange 12 and into the mold to hold housing 11 in place , with an o - ring seal 14 being provided between housing 11 and the mold . a portion of an internal diameter of flange 12 is threaded to receive a bearing gland 15 with o - ring 16 providing a seal between housing 11 and gland 15 . a hollow cylindrical - like movable member or piston , indicated generally by the numeral 18 , is slidably received within gland 15 with o - ring 19 providing a seal therebetween . piston 18 is formed with an internally projecting annular hub - like portion 20 which is threaded to receive and carry a probe assembly , indicated generally by the numeral 21 , which is locked in place by nut 22 so that it will move with piston 18 . an o - ring provides a seal between probe assembly 21 and hub 20 . probe assembly 21 includes the temperature sensitive probe 24 , itself , which is preferably a thermistor , but which may be any temperature sensitive device , a body portion 25 , and a conduit 26 extending from the rear of body portion 25 and through steam dome d with appropriate seals , not shown . conduit 26 thus carries the electrical signal out of the steam dome and , as will hereinafter be described , also enables a fluid input to pass into housing 11 for retracting the probe . the electronic signal from probe assembly 21 may thereafter be utilized by an electronic control device , such as that shown in smith u . s . pat . no . 4 , 022 , 555 , to which reference is made for whatever details are necessary to fully understand this invention , and the vulcanization of the tire is thereby controlled based on the temperature data sensed by probe 24 . housing 11 is provided with a bearing gland 28 and embossment 29 through which probe 24 extends with an appropriate o - ring seal 30 . probe 24 also extends through an insulating sleeve 31 in mold m which prevents the probe from picking up extraneous heat from the mold . a cylindrical stroke adjustment screw , indicated generally by the numeral 32 is adjustably threaded into piston 18 so as to be positioned with respect to piston 18 at varying locations . a lock nut 33 threads onto adjusting screw 32 so that once it is properly positioned with respect to piston 18 , lock nut 33 can be tightened to hold screw 32 in place . as shown in fig1 screw 32 is in a position to allow piston 18 to move its full stroke before screw 32 bottoms out against the end wall of housing 11 . adjusting screw 32 is also provided with a plurality of centering lugs 34 through which the body of probe 24 centrally passes . the operation of the device of fig1 should now be evident . usually it is desirable to insert probe 24 into the point of slowest cure of the tire usually located within the thick shoulder portion of the tire t . with that depth being known , adjusting screw 32 is set and locked accordingly by merely removing bearing gland 15 for access to screw 32 . fluid pressure , usually in the form of air from a pneumatic source ( not shown ) is then introduced through conduit 26 . the body portion 25 of probe assembly 21 is provided with an aperture which permits the air pressure to pass into chamber 35 within housing 11 thereby assuring that the tip of probe 24 is fully retracted by acting on the exposed surfaces of piston 18 . the tire is then loaded in the mold and the mold closed . shortly after this time steam is admitted into steam dome d to initiate heating the mold . although the injection of the probe could be essentially simultaneous with the admission of steam to the steam dome , usually after a predetermined small time delay the air is exhausted out of chamber 35 enabling the steam pressure to act on the exposed surfaces of piston 18 to inject probe 24 into tire t to the depth determined by adjusting screw 32 . the probe may now obtain temperature data from the shoulder portion of the tire and transmit the same for cure control purposes . near the end of the curing process the steam is released and thereafter , prior to opening the mold and removing the tire , chamber 35 may again be pressurized to retract the probe . the system would then stand ready for another cure cycle . an alternate assembly for injecting a probe into a tire t is indicated generally by the numeral 50 in fig2 . as in the fig1 embodiment , tire t is somewhat schematically shown in a mold m which is surrounded by a steam dome d . mold m is recessed to receive a housing or guide , indicated generally by the numeral 51 , and including a circular back plate 52 , a cylindrical member 53 bearing against back plate 52 , and an annular flange 54 welded to cylindrical member 53 . housing 51 is fastened to mold m by a plurality of screws 55 extending through flange 54 . o - ring 56 provides a seal between back plate 52 and mold m . prior to affixing housing 51 to mold m , a stationary cylinder head 58 is affixed to back plate 52 , as by screws 59 , with o - ring seal 60 therebetween . a hollow cylindrical - like movable member or piston , indicated generally by the numeral 61 , is slidably received within head 58 . the axially inner portion of piston 61 includes an interrupted flange formed of four segments 62 each extending approximately 45 ° of the circumference . the axially outer portion of head 58 has an interrupted flange of four similar segments 63 so that piston 61 may be inserted in head 58 by misaligning segments 62 with segments 63 . then a 45 ° rotation of piston 61 will cause the segments to interfere . the axially outer end of piston 61 is provided with a keyway to receive a key 64 to affix piston 61 to a movable head 65 . an o - ring 66 is provided between piston 61 and head 65 . key 64 is oriented such that segments 62 and 63 will be maintained interfering when locked in place . a clamp ring 68 is threaded onto movable head 65 and effectively holds all the movable members in place within housing 51 and stationary head 65 . a metallic bellows 69 is attached , as by soldering , to stationary head 58 and movable head 65 provides an effective area upon which the steam dome pressure acts to provide the driving force for probe insertion and effectively seals the operating mechanisms of the present invention to isolate the same from the steam in steam dome d . piston 61 is internally threaded at its axially outer end to receive and carry a probe assembly indicated generally by the numeral 70 and substantially identical to probe assembly 21 of fig1 . probe assembly 70 is locked to piston 61 by nut 71 and includes a temperature sensitive probe 72 , a body portion 73 , and a conduit 74 which extends through steam dome d with appropriate seals , not shown . conduit 74 thus carries the electrical signal out of the steam dome for processing , as previously described with respect to the fig1 embodiment and also provides a fluid input for head 58 and the interior of bellows 69 . an o - ring seal 75 is provided between body portion 73 of probe 71 and piston 61 . a cylindrical stroke adjustment screw 76 is adjustably threaded into the axially inner end of piston 61 so as to be positioned with respect to piston 61 at varying locations . a lock nut 78 also threads onto screw 76 so that once it is properly positioned with respect to piston 61 , lock nut 78 can be tightened to hold screw 76 in place . as shown in fig2 screw 76 is in a position to allow piston 76 to move its full stroke before bottoming out against stationary head 58 . as the piston does move , probe 72 passes through the apertured end 79 of head 58 , through an insulating sleeve 80 in mold m and on into tire t . the operation of the fig2 embodiment is substantially identical to that of fig1 and will be only summarized herein . adjusting screw 76 may be set for proper probe insertion depth by removing clamp ring 68 for access thereto . fluid pressure is introduced through conduit 74 and through an aperture in body portion 73 of probe assembly 70 to pressurize chamber 81 within stationary head 58 and bellows 69 , to fully retract the probe and expand bellows 69 to the position shown . introduction of steam into dome d and exhaustion of the fluid in chamber 81 enables the steam pressure to work essentially on the effective area of the bellows and other external surfaces to inject the probe . it should thus be evident that a probe injection system constructed and operated according to either embodiment disclosed herein will accomplish the objects of the present invention and otherwise substantially improve the cure control art .
1
fig2 shows a circuit which relates to the present invention . as described in prior art the circuit 200 comprises three inputs 202 , 204 and 206 for three signals 208 , 210 and 212 . the signal 208 may be an audio digital signal with a first type of sample rate such as a voice signal . the sample rate of such a signal is usually low . the signal 208 is a narrow band signal . this voice signal 208 relates to a phone call which the user receives on a mobile phone . a voice signal usually comprises a 13 - bits or 14 - bits coded structure . the signals 210 and 212 may be other audio digital signal with a second type of sample rate such as a music signal . the sample rate for this music signal is usually higher than a voice signal . the signals 210 and 212 are wide band signals . the combination of these two signals 210 and 212 represent a stereo music signal . these wide band signals 210 and 212 represent a music signal . a music signal usually comprises a 16 - bits ( or more ) coded structure . this means that 16 bits belong to one signal . a music signal relates for instance to a signal corresponding to an mp3 file already registered on storage means of the mobile phone for instance . the circuit 200 also comprises three corresponding serial parallel interface or interface module 214 for each signal . differing with the prior art , a multiplexing module 216 is located after the interface modules 214 . the multiplexing module 216 receives each signal coming either from interface modules 214 related to the first input 202 or related to the second and third input 204 and 206 or to all entries 202 , 204 and 206 in order to pass them to further digital analog converters 224 and 226 . a spi ( serial parallel interface ) bus register module 220 passes specific information to the multiplexing module 216 . the spi bus register module is a module which may be programmed in advance during the phone operation . this spi bus register module 220 carries out selecting functions and determining functions in order to send specific information to the multiplexing module 216 . this specific information relates to the number of the input signals . the spi bus register module 220 generates a number equal to one if there is only signal 208 as an input signal , a number equal to two if there are both input signals 210 and 212 ; and a number equal to three if there are input signals 208 , 210 and 212 . the spi bus register module 220 also transmits information relating to the type of the input signals i . e . voice type or music type . the spi bus register module 220 detects the sample rate of each input signal 208 , 210 or 212 . thus knowing these both pieces of information concerning the number of the signals and the type of the signals , the multiplexing module 216 is able to pass one or more input signals on one or more corresponding connection lines . then the multiplexing module 216 determines to which digital analog converters 224 and 226 to send the audio digital signals 208 , 210 , 212 using the connection lines 232 , 234 , 236 , 240 . also differing from the prior art , the circuit 200 comprises a combining module 228 . this combining module allows combining both audio digital stereo signals 210 and 212 into an audio digital mono signal 230 . this combining module 228 comprises a first function to add the instantaneous amplitudes of signal 210 and signal 212 and a second function to divide by two the total resulting amplitude in order to avoid an overflow of the component 300 which comprises a digital filter . this overflow relates to a hardware limitation of such a component . the combination of both functions addition and division provides a stereo to mono function . this means that the stereo input signal becomes a mono signal after the combination process . from the multiplexing module 216 to the digital analog converters 224 and 226 , the circuit 200 comprises different connection lines . connection line 232 connects the multiplexing module 216 and the digital analog converter 224 . connection line 232 refers to the conversion line for the voice signal 208 and also for one of the two stereo signals 210 and 212 as signal 210 for instance . connection line 234 connects the multiplexing module 216 and the combining module 228 . connection line 234 refers to the connection line for one of the two stereo signals 210 and 212 as signal 210 for instance . connection line 236 also connects the multiplexing module 216 and the combining module 228 . connection line 236 refers to the conversion line for the other of the two stereo signals 210 and 212 as signal 212 for instance . connection line 238 connects the combining module 228 to the digital to audio converter 226 and refers to the conversion line for the audio combined mono signal 230 . connection line 240 connects the multiplexing module 216 to the digital to audio converter 226 and refers to the other of the two stereo signals 210 and 212 as for instance signal 212 . the use of these different connection lines depends on the number and type of input signals the spi bus register module 220 sends to the multiplexing module 216 . this will now be explained in more detail . three situations may occur in the circuit 200 . as described in fig3 , the circuit 200 only processes a mono voice signal 208 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals register to one referring to signal 208 . in the same way the spi register module 200 sets the type of bandwidth to narrow band as the signal 208 is a voice signal . thus the multiplexing module 216 transmits the signal 208 to the digital analog converter 224 through the connection line 232 . in this situation there is one resulting analog signal 242 representing analog voice signal . as described in fig4 , another situation may occur where the circuit 200 only processes stereo signals 210 and 212 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals to two referring to signal 210 and 212 . in the same way , the spi register module 220 sets the type of bandwidth to wide band as both signals relate to a music signal . as the spi register module 220 does not select any other signal , the multiplexing module 216 determines that the connection line 232 is available . thus the multiplexing module 216 transmits signal 210 i . e . one of the two stereo signals to the digital analog converter 224 through the connection line 232 . the multiplexing module 216 sends the other stereo signal 212 to the digital to audio converter 226 through the connection line 240 . in this situation there are two resulting signals 244 and 246 representing analog stereo music signals . as described in fig5 , another situation may occur where the circuit 200 processes three signals 208 , 210 and 212 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals to three referring to signal 208 , 210 and 212 . in this situation , the spi register module 220 selects different types of bandwidth . the signal 208 has a narrow bandwidth and signals 210 and 212 have a wide bandwidth . in order to convert simultaneously the three different signals , the multiplexing module 216 transmits in a different way all these three signals . the multiplexing module 216 transmits the voice signal 208 to the digital audio converter 224 through connection line 232 . simultaneously the multiplexing module transmits the first stereo signal 210 to the combining module 228 through the connection line 234 and the second stereo signal 212 to the combining module 228 through the connection line 236 . the combining module 228 processes both signals 210 and 212 to provide a mono signal 230 . this mono signal uses connection line 238 to reach digital audio converter 226 . in this situation there are two resulting signals , 242 and 248 . the signal 242 represents the analog mono voice signal and the signal 248 represents the analog mono music signal resulting from the digital stereo - to - mono conversion of the signals 210 and 212 . digital analog converters 224 and 226 comprise the same elements . these elements are detailed on fig6 for dac 224 . the same description is valid for dac 226 . in fig6 , dac 224 comprises a digital filter 300 , a sigma delta modulator 302 , a d - to - a filter 304 and smoothing filter 306 . the components 300 and 302 process a digital transformation of the signal to be converted . the components 304 and 306 process an analog transformation of the signal . according to situations described in fig3 and in fig5 , the different components of the dac 224 have to be adaptive in order to manage and process both voice signal 208 and music signal 210 according to one of the three above mentioned situations that may occur in the whole circuit 200 . in case of a narrow band signal processing , the different components of the dac 224 are adapted in order to minimize the power consumption . in case of a wide band signal processing , the different components of the dac 224 are adapted in order to maximize the audio performances defined as signal - to - noise ratio and total harmonic distortion . the process of the combining module 228 as shown in fig5 will now be described . in the situation described for fig5 , three signals enter the circuit 200 . the multiplexing module 216 receives these threes signals and then as described above in the description it transmits two digital stereo signals having the same sample rate to the combining module 228 . this combining module 228 processes two transforming functions on the two signals 210 and 212 . the first function is to add both instantaneous amplitudes of the two signals to obtain resulting amplitude . the second function is to divide by two the resulting amplitude . so the amplitude of the resulting signal 230 is an average amplitude from the two signals 210 and 212 . the second function is mandatory to avoid an overflow of the digital filters 300 when both signals 210 and 212 have a full scale amplitude . additionally the signal 230 is now a mono digital signal . it will be appreciated the examples described above are just that . other alternatives may exist which fall within the scope of the present invention . in particular it will be appreciated that this invention can be implemented in software . also the invention can be adapted to occur with any number of input signals , with the objective of reducing the number of converters , to be less than the number of input signals .
7
reference will now be made in detail to an illustrative embodiment of the invention , which appears in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in one embodiment of the present invention , as shown in fig7 a , a damaged annulus 42 is repaired by use of surgical sutures 40 . one or more surgical sutures 40 are placed at about equal distances along the sides of a pathologic aperture 44 in the annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 so that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue ( e . g ., fibroblasts ) crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable may be utilized . additionally , to repair a weakened or thinned wall of a disc annulus 42 , a surgical incision is made along the weakened or thinned region of the annulus 42 and one or more surgical sutures 40 can be placed at about equal distances laterally from the incision . reapproximation or closure of the incision is accomplished by tying the sutures 40 so that the sides of the incision are drawn together . the reapproximation or closure of the incision enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable materials may be utilized . in an alternative embodiment as depicted in fig7 b , the method can be augmented by the placement of a patch of human muscle fascia or any other autograft , autograft or xenograft in and across the aperture 44 . the patch acts as a bridge in and across the aperture 44 , providing a platform for traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in a further embodiment , as shown in fig8 a – b a biocompatible membrane can be employed as an annulus stent 10 , being placed in and across the aperture 44 . the annulus stent 10 acts as a bridge in and across the aperture 44 , providing a platform for a traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in an illustrative embodiment , as shown in fig1 – 3 , the annulus stent 10 comprises a centralized vertical extension 12 , with an upper section 14 and a lower section 16 . the centralized vertical extension 12 can be trapezoid in shape through the width and may be from about 8 mm – 12 mm in length . additionally , the upper section 14 of the centralized vertical extension 12 may be any number of different shapes , as shown in fig4 a and 4b , with the sides of the upper section 14 being curved or with the upper section 14 being circular in shape . furthermore , the annulus stent 10 may contain a recess between the upper section 14 and the lower section 16 , enabling the annulus stent 10 to form a compatible fit with the edges of the aperture 44 . the upper section 14 of the centralized vertical extension 12 can comprise a slot 18 , where the slot 18 forms an orifice through the upper section 14 . the slot 18 is positioned within the upper section 14 such that it traverses the upper section &# 39 ; s 14 longitudinal axis . the slot 18 is of such a size and shape that sutures , tension bands , staples or any other type of fixation device known in the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . in an alternative embodiment , the upper section 14 of the centralized vertical extension 12 may be perforated . the perforated upper section 14 contains a plurality of holes that traverse the longitudinal axis of upper section 14 . the perforations are of such a size and shape that sutures , tension bands , staples or any other type of fixation device known the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . the lower section 16 of the centralized vertical extension 12 can comprise a pair of lateral extensions , a left lateral extension 20 and a right lateral extension 22 . the lateral extensions 20 and 22 comprise an inside edge 24 , an outside edge 26 , an upper surface 28 , and a lower surface 30 . the lateral extensions 20 and 22 can have an essentially constant thickness throughout . the inside edge 24 is attached to and is about the same length as the lower section 16 . the outside edge 26 can be about 8 mm – 16 mm in length . the inside edge 24 and the lower section 16 meet to form a horizontal plane , essentially perpendicular to the centralized vertical extension 12 . the upper surface 28 of the lateral extensions 20 and 22 can form an angle from about 0 °– 60 ° below the horizontal plane . the width of the annulus stent 10 may be from about 3 mm – 5 mm . additionally , the upper surface 28 of the lateral extensions 20 and 22 may be barbed for fixation to the inside surface of the disc annulus 42 and to resist expulsion through the aperture 44 . in an alternative embodiment , as shown in fig4 b , the lateral extensions 20 and 22 have a greater thickness at the inside edge 24 than at the outside edge 26 . in an illustrative embodiment , the annulus stent 10 is a solid unit , formed from one or more of the flexible resilient biocompatible or bioresorbable materials well know in the art . for example , the annulus stent 10 may be made from : a porous matrix or mesh of biocompatible and bioresorbable fibers acting as a scaffold to regenerate disc tissue and replace annulus fibrosus as disclosed in , for example , u . s . pat . no . 5 , 108 , 438 ( stone ) and u . s . pat . no . 5 , 258 , 043 ( stone ), a strong network of inert fibers intermingled with a bioresorbable ( or bioabsorable ) material which attracts tissue ingrowth as disclosed in , for example , u . s . pat . no . 4 , 904 , 260 ( ray et al . ); a biodegradable substrate as disclosed in , for example , u . s . pat . no . 5 , 964 , 807 ( gan at al . ); or an expandable polytetrafluoroethylene ( eptfe ), as used for conventional vascular grafts , such as those sold by w . l . gore and associates , inc . under the trademarks gore - tex and preclude , or by impra , inc . under the trademark impra . furthermore , the annulus stent 10 , may contain hygroscopic material for a controlled limited expansion of the annulus stent 10 to fill the evacuated disc space cavity . additionally , the annulus stent 10 may comprise materials to facilitate regeneration of disc tissue , such as bioactive silica - based materials that assist in regeneration of disc tissue as disclosed in u . s . pat . no . 5 , 849 , 331 ( ducheyne , et al . ), or other tissue growth factors well known in the art . in further embodiments , as shown in fig5 ab – 6 ab , the left and right lateral extensions 20 and 22 join to form a solid pyramid or cone . additionally , the left and right lateral extensions 20 and 22 may form a solid trapezoid , wedge , or bullet shape . the solid formation may be a solid biocompatible or bioresorbable flexible material , allowing the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall . alternatively , a compressible core may be attached to the lower surface 30 of the lateral extensions 20 and 22 , forming a pyramid , cone , trapezoid , wedge , or bullet shape . the compressible core may be made from one of the biocompatible or bioresorbable resilient foams well known in the art . the core can also comprise a fluid - expandable membrane , e . g ., a balloon . the compressible core allows the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall and to the cavity created by pathologic extrusion or surgical removal of the disc fragment . in an illustrative method of use , as shown in fig1 a – d , the lateral extensions 20 and 22 are compressed together for insertion into the aperture 44 of the disc annulus 42 . the annulus stent 10 is then inserted into the aperture 44 , where the lateral extensions 20 , 22 expand . in an expanded configuration , the upper surface 28 can substantially conform to the contour of the inside surface of the disc annulus 42 . the upper section 14 is positioned within the aperture 44 so that the annulus stent 10 may be secured to the disc annulus 42 , using means well known in the art . in an alternative method , where the length of the aperture 44 is less than the length of the outside edge 26 of the annulus stent 10 , the annulus stent 10 can be inserted laterally into the aperture 44 . the lateral extensions 20 and 22 are compressed , and the annulus stent 10 can then be laterally inserted into the aperture 44 . the annulus stent 10 can then be rotated inside the disc annulus 42 , such that the upper section 14 can be held back through the aperture 44 . the lateral extensions 20 and 22 are then allowed to expand , with the upper surface 28 contouring to the inside surface of the disc annulus 42 . the upper section 14 can be positioned within , or proximate to , the aperture 44 in the subannular space such that the annulus stent 10 may be secured to the disc annulus , using means well known in the art . in an alternative method of securing the annulus stent 10 in the aperture 44 , as shown in fig9 , a first surgical screw 50 and second surgical screw 52 , with eyeholes 53 located at the top of the screws 50 and 52 , are opposingly inserted into the adjacent vertebrae 54 and 56 below the annulus stent 10 . after insertion of the annulus stent 10 into the aperture 44 , a suture 40 is passed down though the disc annulus 42 , adjacent to the aperture 44 , through the eye hole 53 on the first screw 50 then back up through the disc annulus 42 and through the orifice 18 on the annulus stent 10 . this is repeated for the second screw 52 , after which the suture 40 is secured . one or more surgical sutures 40 are placed at about equal distances along the sides of the aperture 44 in the disc annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 in such a fashion that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable but permanent non - biodegradable forms may be utilized . this method should decrease the strain on the disc annulus 42 adjacent to the aperture 44 , precluding the tearing of the sutures through the disc annulus 42 . it is anticipated that fibroblasts will engage the fibers of the polymer or fabric of the intervertebral disc stent 10 , forming a strong wall duplicating the currently existing condition of healing seen in the normal reparative process . in an additional embodiment , as shown in fig1 a – b , a flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 . the flexible bladder 60 comprises an internal cavity 62 surrounded by a membrane 64 , where the membrane 64 is made from a thin flexible biocompatible material . the flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 in an unexpanded condition . the flexible bladder 60 is expanded by injecting a biocompatible fluid or expansive foam , as known in the art , into the internal cavity 62 . the exact size of the flexible bladder 60 can be varied for different individuals . the typical size of an adult nucleus is about 2 cm in the semi - minor axis , 4 cm in the semi - major axis , and 1 . 2 cm in thickness . in an alternative embodiment , the membrane 64 is made of a semi - permeable biocompatible material . in an illustrative embodiment , a hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . a hydrogel is a substance formed when an organic polymer ( natural or synthetic ) is cross - linked via , covalent , ionic , or hydrogen bonds to create a three - dimensional open - lattice structure , which entraps water molecules to form a gel . the hydrogel may be used in either the hydrated or dehydrated form . in a method of use , where the annulus stent 10 has been inserted into the aperture 44 , as has been previously described and shown in fig1 a – b , an injection instrument , as known in the art , such as a syringe , is used to inject the biocompatible fluid or expansive foam into the internal cavity 62 of the flexible bladder 60 . the biocompatible fluid or expansive foam is injected through the annulus stent 10 into the internal cavity 62 of the flexible bladder 60 . sufficient material is injected into the internal cavity 62 to expand the flexible bladder 60 to fill the void in the intervertebral disc cavity . the use of the flexible bladder 60 is particularly useful when it is required to remove all or part of the intervertebral disc nucleus . the surgical repair of an intervertebral disc may require the removal of the entire disc nucleus , being replaced with an implant , or the removal of a portion of the disc nucleus thereby leaving a void in the intervertebral disc cavity . the flexible bladder 60 allows for the removal of only the damaged section of the disc nucleus , with the expanded flexible bladder 60 filling the resultant void in the intervertebral disc cavity . a major advantage of the annulus stent 10 with the flexible bladder 60 is that the incision area in the annulus 42 can be reduced in size , as there is no need for the insertion of an implant into the intervertebral disc cavity . in an alternative method of use , a dehydrated hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . fluid , from the disc nucleus , passes through the semipermeable membrane 64 hydrating the dehydrated hydrogel . as the hydrogel absorbs the fluid the flexible bladder 60 expands , filling the void in the intervertebral disc cavity . all patents referred to or cited herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification , including ; u . s . pat . no . 5 , 108 , 438 ( stone ), u . s . pat . no . 5 , 258 , 043 ( stone ), u . s . pat . no . 4 , 904 , 260 ( ray et al . ), u . s . pat . no . 5 , 964 , 807 ( gan et al . ), u . s . pat . no . 5 , 849 , 331 ( ducheyne et al . ), u . s . pat . no . 5 , 122 , 154 ( rhodes ), u . s . pat . no . 5 , 204 , 106 ( schepers at al . ), u . s . pat . no . 5 , 888 , 220 ( felt et al .) and u . s . pat . no . 5 , 376 , 120 ( sarver et al .). it should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and preview of this application and the scope of the appended claims .
8
an installation according to the invention ( fig2 ) distinguishes itself over the state of the art due to the following features . it has an additional lower screen belt 16 . the lower screen belt 16 is located underneath the spreading devices 2a , 2b , 2c arranged immediately one after the other and in the preliminary press 5 on the forming belt 3 , which is returned downstream of the preliminary press 5 . the forming belt 3 can thereby be replaced by a sliding table . the lower screen belt 16 extends all the way through the main press 7 where it is located on the lower steel belt 8 . the preliminary press 5 and the main press 7 are arranged at a distance from each other . downstream of the preliminary press 5 and upstream of the main press 7 , under the screen belt 16 a lower spraying device 18 provided with a dosage device 17 is arranged . above the upper screen belt 6 running through the preliminary press 5 and the main press 7 , opposite to the lower spraying device 18 , there is a vacuum box 20 connected to a blower 19 . downstream thereof , also before the main press 7 , above the upper screen belt 6 , an upper spraying device 22 also provided with a dosage device 21 is arranged . underneath the lower screen belt 16 , opposite the upper spraying device 22 , there is a further vacuum box 24 connected with a blower 23 . by contrast to an installation of the state of the art as in fig1 the installation of the invention has no spraying devices 4a , 4b , 4c between the dispersion devices 2a , 2b , 2c and no additional press 14 . in operation in an installation with a production width of 2 , 500 mm and a belt speed of 15 m / min the following amounts are dosed into the dry mixer : ______________________________________gypsum hemihydrate ( plaster of paris ) 20 , 500 kg / hgypsum dihydrate ( milled ) 100 kg / hpaper fiber ( dry ) 4 , 200 kg . h______________________________________ each of the mixers 1a , 1b are supplied with 50 % of the dry mass of 24 , 800 kg / h . in addition 2 , 580 l / h of water , i . e . 20 . 8 % of the dry mass are supplied to the first mixer 1a , and to the second mixer 1a 2 , 880 l / h water , i . e . 23 . 2 % of the dry mass are introduced , with the proportions of retardants and accelerants adjusted to the gypsum . the mixture is spread on the forming belt 3 in three strata . the dispersed layer has a height of approximately 50 mm and is precompressed in the preliminary press 5 to a height of approximately 12 mm , i . e . to approximately 120 % of the plate thickness . it springs back to approximately 16 mm . after that with the spraying devices 18 , 22 the layer is sprayed first from underneath and subsequently from above each time with 2 , 280 l / h of water , i . e . a total of 18 % of the dry mass . during spraying the supplied water amount is adjusted based on differential measurements of the supplied and discharged water amounts . a total water amount representing approximately 40 % of the dry mass , i . e . approximately three times the stoichiometric water amount , is supplied . during spraying air is evacuated from the layer and from the screen belts 16 , 6 , by the vacuum boxes 20 , 24 [ sic ] arranged opposite to the spraying devices 18 , 22 . in the main press 7 the layer is compressed to a plate thickness of 10 . 3 mm . after setting the raw plate still contains 14 . 2 % residual wetness . after drying a plate is obtained with a density of 1 , 150 kg / m3 and a bending resistance of 8 . 0n / mm . in the installation of example 2 ( fig3 ), the upper screen belt 6 is guided only through the main press 7 . a second upper screen belt 25 extends through the preliminary press 5 , along the vacuum box 20 opposite the lower spraying device 18 and along a further transfer vacuum box 27 connected with a blower 26 . downstream of the transfer vacuum box 27 the upper screen belt 25 reverses its path . the upper spraying device 22 is arranged between the return point of the upper screen belt 25 and the main press 7 . the lower screen belt 16 runs through the preliminary press 5 , along the lower spraying device 18 and over one or more relief nozzles 29 connected with a blower . the relief nozzles 29 are arranged at the end of vacuum box 20 [ sic ]. the lower screen belt 16 projects up to the front edge -- considered in travel direction -- of the transfer vacuum box 27 and is returned from there . a further smooth , lower belt 30 starts at the rear edge of the transfer vacuum box 27 , extends underneath the upper spraying device 22 and is guided through the main press 7 . there is no vacuum box arranged correspondingly opposite the upper spraying device 22 . in operation the layer precompressed in the preliminary press 5 is first wetted on its bottom side by the spraying device 18 . subsequently the layer is detached from the lower screen belt 16 by blowing air through the detaching nozzles 29 and transferred to the smooth lower belt 30 with the assistance of the transfer vacuum box 27 . there the layer is wetted on its top side by the spraying device 22 and compressed to final plate thickness in the main press 7 . thereby the bottom side of the plate is smoothed by the smooth , lower belt 30 . the installation of the example 3 ( fig4 ) differs from that of example 2 in that the lower screen belt 16 , as in example 1 , is guided all the way through the main press 7 . correspondingly a vacuum box 24 with blower 23 is arranged opposite to the upper spraying device 22 located directly upstream of the main press 7 . the installation of example 3 differs from the one in example 2 also in its lower wetting device . the lower wetting device has a tray or trough 32 provided with a dosage device 31 . outer rollers 33 are arranged above each the front and rear edges of the tray 32 considered in travel direction . between the outer guide rollers 33 extends a box divided in two in the direction of travel with venting holes on its bottom side , on whose front half a suction blower 35 and on whose rear half a pressure blower 36 are connected . the bottom side of the box 34 projecting into the tray 32 is designed as a sliding surface , concavely curved in the travel direction . the curvature corresponds approximately to a radius of 5 to 15 m . thereby it is important that the outer guide rollers 33 and the box 34 be arranged so that screen belts 16 , 25 are guided downwards and back again at a small angle . the upper screen belt 25 is returned downstream of tray 32 . at this point the lower screen belt 16 is guided over a further roller 37 . in operation the layer precompressed in the preliminary press 5 is guided through tray 32 so that only the bottom side of the layer is wetted . from the top side next in a first zone air is evacuated from the layer and the screen belts 16 , 25 and subsequently in a second zone an overpressure is applied to the upper side of the layer . the respective pressures are adjustable . in the tray 32 a precisely metered water amount is introduced , which is absorbed by the layer . subsequently the top side of the layer is wetted by spraying devices 22 and finally the layer is compressed in the main press 7 to plate thickness . in the installation of example 4 ( fig5 ) the upper screen belt 6 and the lower screen belt 16 are guided through the preliminary press 5 , wherein the upper spraying device 22 is arranged , the lower wetting device and the main press 7 . thereby upper and lower pressure rollers 38 of the preliminary press 5 are arranged at a distance from each other . between the upper pressure rollers 38 there are nozzles 39 of the upper spraying device 22 . the lower wetting device consists of tray 32 provided with a dosage device 31 as described in example 3 . between the outer guide rollers 33 arranged above the edges of tray 32 , suction / pressure boxes 40 and further guide rollers 41 are alternately arranged in succession . the boxes 40 , four in this example , are connected via ducts 42 with the suction blower 35 and the pressure blower 36 . in the ducts 42 there are valves 43 , so that the blowers 35 , 36 can be connected selectively with the boxes 40 . the air pressure is adjustable . as in example 3 , the guide rollers 41 form a sliding surface concavely curved in the travel direction , along which the upper and the lower screen belts 25 , 16 are guided through the tray 32 . the dipping depth of the lower screen belt 16 is of the order of magnitude of the layer thickness . the extent of tray 32 in the travel direction corresponds approximately to that of the main press 7 , e . g . 3 to 5 m . it is wider than the layer on both sides by approximately 25 cm . its depth is about 10 times the plate thickness . underneath the lower screen belt 16 on the tray 32 , there are guiding devices 44 , 45 extending in the travel direction , with vertical and horizontal guide surfaces as is illustrated in fig7 . the lower screen belt 16 is wider than the upper screen belt 6 ( respectively upper screen belt 25 , ( fig4 ). its lateral edges are sealed with elastic plastic material 46 as is clearly shown in fig8 . the cover projects on both sides by about 5 cm into the area of the precompressed layer as is illustrated in a greater detail in fig8 . besides in the tray 32 the lower screen belt 16 is guided by its edges over rollers 47 . the rollers 47 are arranged so that the edges of the lower screen belt 16 are bent upwards . as is shown in a greater detail in fig6 tray 32 is provided with an inlet 48 at its front end . the inlet 48 is designed in the manner of a diffuser with an overflow ( not shown ), extending over the entire width of the vat . fig6 illustrates the dosage pump 31 generates a flow and 31 is connected to the inlet 48 via a flow meter 49 . in operation the dispersed layer is alternately compressed in the preliminary press 5 by pressure rollers 38 ( fig5 ) and sprayed in the area between the pressure rollers 38 . thereby the spring - back of the layer when it is no longer subjected to the load of the pressure rollers 38 results in an enhanced suction of the water in the layer . subsequently the precompressed layer arranged between the belts 16 seen in fig2 - 5 , 25 is guided through a water bath , namely through the vat 32 supplied with a metered amount of water , so that only the bottom side of the layer is wetted . this is insured by the upturned edges of the lower screen belt 16 which are sealed with the plastic material 46 . the layer is guided into the water bath and then back at a small angle , e . g . of 1 to 10 degrees seen in fig7 which is a front view of the trays illustrated in fig5 and 6 and is particularly well illustrated in fig8 which shows the guide roller 47 in a greater detail . due to the described self - regulating mechanism it absorbs exactly the apportioned amount of water . in this example the layer is alternately loaded and relieved by the guide rollers 38 , 41 ( fig5 and 6 ). the spring - back of the layer between the guide rollers 38 , 41 , enhances the wetting of the layer through aspiration of water as in the upper spraying device 22 of this example . this spring - back of the layer during wetting can also be achieved by guiding the layer in the water bath along a curved surface , whose radius increases constantly . by means of the suction / pressure boxes 40 ( fig5 and 6 ) between the guide rollers 41 the air is evacuated from the layer in a first zone , in order to remove the air from the layer and most of all from the lower screen belt 16 . then in a second zone at the rear box a certain air pressure from above is applied to the layer guided through the water bath . this applied air pressure counters the effect of uneven wetting of areas with variable density of the layer . the boxes 40 can also be operated in such a way that through the boxes 40 alternately in one zone air can be aspired by one box 40 , and by the next one in the following zone air can be applied , whereby in the first box 40 , i . e . in the first zone , air is always aspired . in an installation with a production width of 2 , 500 mm and a belt speed of 15 m / min the following dosed amounts are supplied to each of the mixers 1a and 1b : ______________________________________gypsum hemihydrate ( plaster of paris ; 5 . 9 % h2o ) 10 , 500 kg / hgypsum dihydrate ( milled ) 50 kg / hpaper fibers ( dry weight ) 2 , 000 kg / hwater ( contained in paper fibers ) 2 , 800 kg / h______________________________________ the paper fibers saturated with water are prepared in the paper treatment device 15 . the 30 , 700 kg / h of mixture of gypsum , fiber and water , whereby the water amount represents approximately 22 % of the dry mass , is spread in three strata . the dispersion height is about 45 mm . the layer is precompressed in the preliminary press 5 to a thickness of 11 . 5 mm , i . e . approximately 112 % of the plate thickness . it springs back to 15 mm . during precompression 2 , 400 l / h water are sprayed from above . in the vat the layer absorb from underneath also 2 , 400 l / h water . therefore during wetting a water amount representing 19 % of the dry mass is supplied . this way the total amount of water supplied represents approximately 41 % of the dry mass and approximately three times the stoichiometric water amount . in the main press 7 the layer is compressed to a plate thickness of 10 . 3 mm . after setting the raw plate still contains 14 . 2 % residual wetness . after drying a plate with a density of 1 , 170 kg / m3 and a bending resistance of 9 . 2n / mm is obtained .
1
before entering into a description of the embodiment , a prior art dram will be described with reference to fig1 to 4 . fig2 and 3 are sectional views of the conventional dram of fig1 taken along the lines ii -- ii and iii -- iii . fig4 shows the circuit structure of the device of fig1 . reference numeral 1 denotes a p type silicon substrate ; 2 an element isolation oxide film ; 3 a silicon dioxide ( sio 2 ) dielectric film ; 4 a capacitor electrode of a first polycrystalline silicon layer ; 5 an n + type region as one electrode of the capacitor ; 6 a gate oxide film ; 7 an sio 2 insulating film ; 8 ( 1 ), 8 ( 2 ), 8 ( 3 ), and 8 ( 4 ) address lines ( gate electrodes ) of a second polycrystalline silicon layer , respectively ; 9 an n + type drain region ; 10 a phosphosilicate glass ( psg ) insulating interlayer ; 11 a contact hole ; 12 a contact pad ; and 19 ( 1 ), 19 ( 2 ), 19 ( 3 ), and 19 ( 4 ) data lines of a single aluminum film . the transistor regions t , the capacitance region c , the word lines , and a bit line in fig1 are shown correspondingly in the circuit structure of fig4 . in the prior art dram shown in fig1 to 4 , the parallel data lines 19 ( 1 ) to 19 ( 4 ) are constituted by a single aluminum film . however , in the structure wherein the data lines 19 ( 1 ) to 19 ( 4 ) are constituted by the single wiring material layer , e . g ., the aluminum film in this example , the interval of the data lines 19 ( 1 ) to 19 ( 4 ) is decreased , and the width of each of the data lines 19 ( 1 ) to 19 ( 4 ) must be decreased accordingly upon further micropatterning of the memory cells . in the structure shown in fig1 to 4 , when the wiring pitch is given as 3 . 5 μm and a width of the contact pad 12 is increased to be larger by , for example , 0 . 5 μm than that of the wiring width , the wiring width and the wiring interval are given as 1 . 5 μm . this width has been used in conventional 256 kbit or 1 mbit dram &# 39 ; s . when the dram is highly integrated and the wiring pitch is decreased to about 2 . 0 to 1 . 5 μm , the wiring width and the wiring interval must be decreased to 0 . 75 to 0 . 5 μm when the margin of the contact pad is given as described above . a semiconductor memory device according to an embodiment of the present invention is illustrated in fig5 to 8 . fig5 is a plan view of a dram , and fig6 is a sectional view thereof taken along the line vi -- vi of fig5 . a wiring portion of the prior art dram and that of the dram of fig5 are illustrated in fig9 a and 9b . fig8 shows the circuit structure of the device of fig5 . fig9 shows a modification of the wiring pattern . referring to fig5 to 8 , reference numeral 1 denotes a p type silicon substrate ; 2 an element isolation oxide film ; 3 an sio 2 dielectric film ; 4 a capacitor electrode of a first polycrystalline silicon layer pa ; 5 an n + type region serving as one electrode of the capacitor ; 6 a gate oxide film ; 7 an sio 2 insulating film ; 8 ( 1 ), 8 ( 2 ), 8 ( 3 ), and 8 ( 4 ) gate electrodes serving as address lines made of a second polycrystalline silicon layer pb , respectively ; 9 an n + type drain region ; 10 a first psg insulating interlayer ; 13 a contact hole between a lower wiring layer and the drain region 9 ; 14 a second psg insulating interlayer ; and 15 a contact hole between the upper wiring layer and the drain region 9 . reference numerals 17 ( 2 ) and 17 ( 1 ) are lower data lines made of a lower aluminum film , respectively ; 18 ( 2 ) and 18 ( 1 ) are upper data lines made of an upper aluminum film . each memory cell includes one transistor t and one capacitor c as in the prior art device . in the dram shown in fig5 the plurality of parallel data lines sequentially constituted by a wiring layer of a single wiring material such as aluminum are alternately formed by the upper and lower aluminum films insulated through the second insulating interlayer 14 in an order of 17 ( 2 ), 18 ( 2 ), 17 ( 1 ), and 18 ( 1 ). further , the data lines 18 ( 2 ) and 18 ( 1 ) formed by the upper aluminum film overlap the adjacent data lines of the lower aluminum film , respectively . as shown in fig9 a , a prior art structure has data lines of a single layer . assume that parallel data lines 19 ( 1 ), 19 ( 2 ), . . . 19 ( 7 ) are formed in a wiring region at a wiring width of 1d and a wiring interval of 1d . however , as shown in fig9 b , the data lines 18 ( 1 ), 17 ( 2 ), 18 ( 2 ), 17 ( 3 ), 18 ( 3 ), 17 ( 4 ), and 18 ( 4 ) can be formed in the same wiring area as that of the conventional dram at a wiring width of 3d and a wiring interval of 1d . therefore , the wiring width of the data line of the dram of this embodiment can be increased to three times that of the prior art dram . as shown in fig1 , for example , recesses 16 may be formed in the lower data lines 17 ( 2 ) and 17 ( 3 ) to detour the contact hole 15 formed between the upper data lines 18 ( 2 ) and 18 ( 3 ). in this case , the width of the lower data lines 17 ( 2 ) and 17 ( 3 ) can be larger than that shown in fig5 up to that defined by a maximum interval defined by insulation and connection of the wirings of an identical layer . however , the upper data lines 18 ( 2 ) and 18 ( 3 ) do not have the limits described above , so the wiring interval can be maximized in association with a minimum wiring interval . a preferred circuit diagram applicable to the device according to the present invention in connection with sense amplifiers is shown in fig1 . the circuit arrangement shown in fig1 requires a slight modification of the layout structure of fig5 but has an advantage of a superior symmetrization of electrical characteristic between data line pair associated with a sense amplifier , which is desirable in drams . data lines dl 0 and dl 0 connected with the first sense amplifier are located in the upper layer . data lines dl 1 and dl 1 connected with the second sense amplifier are located in the lower layer . in the circuit arrangement of fig1 , where the data lines are divided into a first group of data lines dl and a second group of data lines dl , the characteristic of symmetry between the data lines is attained satisfactorily . the present invention is exemplified by a dram . however , the present invention can also be applied to other semiconductor memory devices such as static ram &# 39 ; s and static rom &# 39 ; s . the wiring material is not limited to aluminum , but can be extended to any other proper material .
7
fig1 is a block diagram showing a schematic configuration of an nmr instrument using a dds ( direct digital synthesizer ) according to the present invention . a casing 3 which accommodates high - frequency alternating current magnetic field means ( probe ) 4 to transmit an alternating current magnetic field is inserted into static magnetic field generation means 2 which generates a strong static magnetic field . the high - frequency alternating current magnetic field means 4 is connected to an external cable at an end of the casing 3 via a high - frequency adjustment circuit 5 by a high - frequency cable . at the time of measurement , a measurement sample 1 is first placed near the high - frequency alternating current magnetic field means 4 . upon start of measurement , a general controller 6 in the nmr instrument sends pulse sequence data to a pulse generator 7 which uses a dds . a pulse signal output from the pulse generator 7 is amplified by a high - frequency transmitter front end 8 and input to a transmit / receive switching circuit 9 . the high - frequency transmitter front end 8 also has a function of conducting up / down conversion on a frequency as occasion demands and a function of outputting a reference signal for receiving to a high - frequency receiver 10 . the transmit / receive switching circuit 9 has a function of connecting the high - frequency adjustment circuit 5 to the high - frequency transmitter front end 8 or the high - frequency receiver 10 . the connection state of the transmit / receive switching circuit 9 is controlled by control data output from the general controller 6 . first , the high - frequency adjustment circuit 5 is connected to the high - frequency transmitter front end 8 , and a pulse signal output from the high - frequency transmitter front end 8 is transmitted to the measurement sample 1 by the high - frequency alternating current magnetic field means 4 . a response of the sample is detected by the high - frequency alternating current magnetic field means 4 . in order to send a detected response signal to the high - frequency receiver 10 , the transmit / receive switching circuit 9 connects the high - frequency adjustment circuit 5 to the high - frequency receiver 10 . the response signal is subjected to receive processing in the high - frequency receiver 10 and provided to the user by the general controller 6 . fig3 is a block diagram showing a first embodiment of a dds according to the present invention . the dds receives inputs of an n - bit frequency tuning word ( ftw ) and a p - bit phase tuning word ( ptw ) from an upper system . the dds also receives an input of a reference clock signal clk which serves as a period signal for operating a digital circuit from the upper system . a feature of the present dds is present in a phase synthesis unit ( psu ) 20 . the psu 20 includes n pas , i . e ., pa ( 1 ) 21 - 1 to pa ( n ) 21 - n , where n corresponds to the number n of bits of the ftw . the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n operate with fixed phase increment values m ( 1 ) to m ( n ) represented by expression 1 . for example , the pa ( 2 ) 21 - 2 operates with the fixed phase increment m ( 2 )= 2 , and its output p ( 2 ) changes as represented by expression 2 every clk . t is an arbitrary number of time - s of clk . p ( 2 )= 0 , 2 , 4 , . . . , 2 × t , . . . , 2 ×( 2 n - 1 − 2 ), 2 ×( 2 n - 1 − 1 ), 0 , 2 , . . . ( expression 2 ) in general , an output p ( n , t ) of the pa ( n ) 21 - n at the number of times t of clk becomes as represented by expression 3 . p ( n , t )= mod ( m ( n )× t , 2 n ), m ( n )= 2 n - 1 ( expression 3 ) here , mod ( x , a ) is a function which returns a remainder value obtained by dividing x by a . outputs p ( 1 ) to p ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n are input to switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n , respectively . the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n are controlled by control data c ( 1 ) to c ( n ) output from a controller 22 , respectively . for example , the output of the switch sw ( 1 ) 23 - 1 becomes p ( 1 ) if the signal c ( 1 ) is in its high state , whereas it becomes 0 if the signal c ( 1 ) is in its low state . the switches sw ( 2 ) 23 - 2 to sw ( n ) 23 - n also operate in the same way as the switch sw ( 1 ) 23 - 1 . the outputs c ( 1 ) to c ( n ) of the controller 22 are determined by the ftw as hereafter described . first , an n - bit ftw input is retained in n registers included in the controller 22 so as to respectively correspond to the n bits . each of values b ( 1 ) to b ( n ) respectively stored in the n registers has a value of 0 or 1 , and it is a value of each of bits obtained when the ftw is represented by using a binary number . here , it is necessary to make c ( 1 ) to c ( n ) coincide with the values b ( 1 ) to b ( n ), respectively . hereafter , outputs of the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n will be described . for example , an output ps ( 2 , t ) of the switch sw ( 2 ) 23 - 2 at the number of times t of clk is determined by the output p ( 2 , t ) of the pa ( 2 ) 21 - 2 and the output c ( 2 ) of the controller 22 as represented by expression 5 . ps ( 2 , t )= b ( 2 ) mod ( 2 1 × t , 2 n ) ( expression 5 ) generalizing expression 5 , the output ps ( n , t ) of the switch sw ( n ) 23 - n becomes as represented by expression 6 . ps ( n , t )= b ( n ) mod ( 2 n - 1 × t , 2 n ) ( expression 6 ) an adder 24 adds up outputs ps ( 1 , t ) to ps ( n , t ) respectively of the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n . an output ph ( t ) of the adder 24 becomes as represented by expression 7 . since b ( n ) has only a value of 0 or 1 , expression 7 can be rewritten as represented by expression 8 . the output ph of the adder 24 is an output of the psu 20 . the output of the psu 20 is added to the ptw by a second adder 12 for phase modulation , and a resultant sum is input to a phase - amplitude conversion look up table ( pa - lut ) 13 . the function of the second adder 12 may be integrated into the pa - lut 13 . the output of the second adder 12 is p - bit data , where p ≦ n . only p most significant bits included in the n - bit ph are used , and n - p least significant bits are discarded in order to decrease the quantity of data stored in the pa - lut 13 . a technique for decreasing the quantity of data stored in the pa - lut 13 by utilizing the discarding and symmetry is disclosed in the non - patent document 2 . the pa - lut 13 retains input value − output value pairs , and outputs a - bit amplitude data corresponding to phase information input from the second adder 12 . the a - bit amplitude data is converted to an output signal out by a digital / analog converter ( d / a ) 14 , and the output signal out is output to the outside of the dds . the d / a 14 may be removed from the dds and a separate d / a device may be used . in the case where a separate d / a device is used , the output of the pa - lut 13 becomes the output of the dds . fig4 is a concept diagram of a digital phase wheel for explaining relations between the pa output and the dds output . an example of the pa ( 2 ) with n = 4 is shown . sixteen black points arranged on a circumference as shown in fig4 represent values 0 to 15 which can be output by the pas with n = 4 . since the phase increment of the pa ( 2 ) is m ( 2 )= 2 , the output p ( 2 ) of the pa ( 2 ) advances two points every time of clk . after 14 , p ( 2 ) returns to 0 again . the pa - lut 13 outputs a sine wave amplitude at 0 degree , 22 . 5 degrees , 45 degrees , . . . , 337 . 5 degrees in response to values 0 to 15 which can be output by the pas with n = 4 . in the example shown in fig4 , p ( 2 ) advances in phase by 45 degrees every time of clk . one period corresponds to eight times of clk . since a time period corresponding to one time of clk is dt = 1 / f clk , the digital phase wheel of pa ( 2 ) shown in fig4 generates a frequency of 1 /( 8dt )= f clk / 8 hz . generalizing the number of bits from 4 to n , the period of the output p ( 2 ) of the pa ( 2 ) is 2 n / m ( 2 )= 2 n - 1 clk , and a frequency of m ( 2 )* f clk / 2 n hz is generated . considering the number 8 which represents the output ph of the psu 20 , the output ph of the psu 20 generates a frequency of ftw * f clk / 2 n . this frequency becomes a frequency f out of the output signal out of the dds . what is to be noted is that the output frequency f out of the dds is changed according to the ftw , but the phase increments m ( 1 ) to m ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n shown in fig3 are fixed regardless of the ftw value . even if the ftw is changed , only the outputs c ( 1 ) to c ( n ) of the controller 22 change whereas p ( 1 ) to p ( n ) do not change . while the dds is operating , therefore , the outputs p ( 1 ) to p ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n can always maintain the phase coherency . the dds according to the present embodiment having the configuration shown in fig3 includes n pas , i . e ., pa ( 1 ) 21 - 1 to pa ( n ) 21 - n , one controller 22 , n switches 23 - 1 to 23 - n , and one adder 24 . as a result , frequencies corresponding to all values which can be expressed by the ftw can be output freely while maintaining the phase coherency . operation of the psu 20 in the first embodiment will now be described with reference to a simple example . if the number of bits of the ftw is n = 3 , the psu 20 includes three pas , i . e ., pa ( 1 ) 21 - 1 to pa ( 3 ) 21 - 3 as shown in fig5 . because of the configuration of n = 3 bits , each pa can represent a numerical value in the range of 0 to 7 . as for the phase increments m ( 1 ) to m ( 3 ) of each pa , m ( 1 )= 1 , m ( 2 )= 2 and m ( 3 )= 4 according to expression 1 . the pa ( 1 ) to pa ( 3 ) respectively outputs p ( 1 ) to p ( 3 ) shown in table 1 according to clk . regardless of the ftw tuning word change , p ( 1 ) to p ( 3 ) repetitively output numerical values in the range of 0 to 7 as clk number increases as shown in table 1 . it will now be exhibited by taking an example that phase coherency is maintained in frequency modulation conducted in the configuration in the first embodiment . a 3 - bit ftw tuning word can have a value in the range of 0 to 7 . the case where ftw tuning word = 3 and the case where ftw tuning word = 5 will now be considered as examples . the ftw tuning word = 3 is decomposed into bits { 0 , 1 , 1 } by the controller 22 . the control data c ( 1 ) to c ( 3 ) output to the three switches 23 - 1 to 23 - 3 by the controller 22 become 1 , 1 , and 0 , respectively . the switches 23 - 1 and 23 - 2 output p ( 1 ) and p ( 2 ) according to the control data c ( 1 )= 1 and c ( 2 )= 1 . the switch 23 - 3 outputs 0 . the adder 24 adds up outputs of the switches 23 - 1 to 23 - 3 , and outputs a least significant 3 - bit part of a resultant sum . therefore , the output of the adder 24 becomes as represented by expression 7 ( or expression 8 ). in the clk number , “ d ” represents a fixed delay between pa outputs and the adder output . in the adder output shown in table 2 , the phase increment = 5 and it coincides with the ftw tuning word . the case where the ftw tuning word = 5 will now be considered . the control data c ( 1 ) to c ( 3 ) output by the controller 22 become 1 , 0 , and 1 , respectively . the switches 23 - 1 and 23 - 3 output p ( 1 ) and p ( 3 ), respectively . the switch 23 - 2 outputs 0 . in the adder output , the phase increment = 5 and it also coincides with the ftw tuning word . finally , the case where the ftw tuning word = 3 at the start , the ftw tuning word = 5 at clk = 4 and the ftw tuning word = 3 is restored at clk = 8 will be considered as an example of frequency modulation . it is appreciated from table 4 that the phase increment of the adder output coincides with the changing ftw tuning word . the adder output has a different phase increment as a transition state between clk 3 and clk 4 and between clk 7 and clk 8 during which the ftw tuning word is changed over . since the clk period is typically several tens nanoseconds or less , however , there are no practical problems . it is apparent that the phase coherency is maintained , by comparing the adder output shown in table 4 with the adder outputs shown in table 2 and table 3 . the adder output shown in table 4 coincides with the adder output shown in table 2 during the time period when the ftw tuning word = 3 and coincides with the adder output shown in table 3 during the time period when the ftw tuning word = 5 . heretofore , the operation of the psu 20 in the first embodiment of the present invention has been described with reference to a simple example . the bit length n of the actually used ftw is at least eight . in that case as well , however , the phase coherency at the time of frequency modulation can be maintained by the same operation . fig6 is a block diagram showing a second embodiment of the present invention . in the second embodiment shown in fig6 , the frequency tuning word ftw is divided to a static frequency tuning word sftw which does not change during the transmission of the pulse sequence and a dynamic frequency tuning word dftw which changes during the transmission of the pulse sequence . the frequency which can be output by the dds is in the range of 0 hz to f clk / 2 hz according to expression 8 . since f clk used in the modern dds amounts to several hundreds mhz to several ghz , the output range of the dds becomes hundred mhz order . in many cases , however , the range of frequency used in the nmr pulse sequence is within several mhz . considering this point , the frequency range which needs to be set by the pulse sequence without limiting the degree of freedom of nmr experiments can be made smaller than the frequency range which can be output by the dds . reflecting this point , in the embodiment shown in fig6 , the sftw for setting all frequency tuning bits n of the dds and the dftw for setting l bits which need to be set in the pulse sequence are separated from each other . the sftw is set once before the pulse sequence transmission is started . after the pulse sequence transmission is started , only the dftw is set . the sftw sets pa ( 0 ) 25 which outputs a fixed frequency . an output p ( 0 ) of the pa ( 0 ) 25 always has a phase increment of the sftw . on the other hand , the l - bit dftw is converted to control data c ( 1 ) to c ( l ) by the controller 22 to control switches 23 - 1 to 23 - l in the same way as the ftw in the first embodiment . in the dds according to the second embodiment having the configuration shown in fig6 , the number of frequencies which can be output while maintaining the phase coherency is smaller as compared with the dds according to the first embodiment . however , the dds according to the second embodiment has an advantage that the time required for the frequency modulation becomes short because the number of bits in the dftw is small . furthermore , the dds according to the second embodiment also has an advantage that the circuit scale of the whole dds becomes small and the mounting area and power dissipation are reduced because the number of pas and the number of switches become smaller than those in the first embodiment . fig7 is a block diagram showing a third embodiment of the present invention . in the embodiment shown in fig7 , an output ph_ini of the psu 20 according to the present invention is used as an initial phase of another pa 26 . the ftw is set in both the psu 20 and the pa 26 . ph_cntrl is control data for setting whether to use the output ph_ini of the psu 20 as an initial phase of the pa 26 when the ftw is changed or use a phase possessed by the pa 26 at a clk immediately before the ftw is changed , as the initial phase . in the dds according to the present embodiment having the configuration shown in fig7 , the circuit scale becomes large because the number of pas is increased by one . however , the dds according to the present embodiment has an advantage that the output waveform obtained when the ftw is changed over can be made either of the waveforms b and c shown in fig2 . by the way , in fig7 , the configuration according to the first embodiment is utilized and the ftw and the psu 20 are used . alternatively , the present embodiment can also be applied to the configuration including the sftw , the dftw , the psu 20 ′ and the pa ( 0 ) 25 according to the second embodiment . the apparatus according to the present invention can be applied not only to nuclear magnetic resonance instruments but also to magnetic resonance imaging instruments ( mris ) or the like which change over the frequency at high speed and output signals while maintaining the phase coherency . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .
6
referring now to fig1 , in the illustrated practice a preliminary step preferably involves machining gears of ferrous alloy material or the like by operations such as hobbing and shaving so as to form a desired arrangement of protruding gear teeth . following the machining operation , the gears are thereafter subjected to a commercial heat treatment to increase hardness and wear resistance . during the heat treatment the gear may be carburized and / or carob - nitrided and / or subjected to other treatments as may be desired . upon completion of the heat treatment the gear is typically at least partially covered with a tenaciously adhering scale which must be removed prior to the application of any coating that may be desired . in order to efficiently and effectively remove the scale , the gear is preferably subjected to a multi - step cleaning process providing a combination of chemical and mechanical cleaning without damaging the gear substrate . as an initial step in the cleaning process the gear with adhered scale is subjected to an initial or primary chemical cleaning incorporating a galvanic or cathode cleaning as well as an acid etch to partially dissolve and effectively soften the scale . a block diagram setting forth an exemplary primary chemical cleaning procedure is set forth at fig2 . by way of example only , and not limitation , the primary chemical cleaning preferably involves soaking the gear in a standard alkaline soak cleaner for about fifteen minutes followed by rinsing in water . following soaking , the gear thereafter undergoes cathodic cleaning in a standard alkaline cleaning solution or the like for about sixty to ninety seconds . it has been found that an applied voltage in the range of about 4 to 6 volts during the cathodic cleaning provides good results . after the cathodic cleaning , the gear is thereafter rinsed in water and soaked in an acid solution of about sixty percent ( by volume ) hydrochloric acid solution for about 60 to 120 seconds . in one particularly preferred practice the acid solution is 60 % of 37 % reagent grade hydrochloric acid in water . however , other suitable acid solutions may be used if desired . the gear is thereafter rinsed in water and any remaining acid is neutralized by dipping the gear into the alkaline cathodic cleaning solution . the gear is thereafter rinsed and dried . after the initial chemical cleaning the gear with a greatly softened scale surface is subjected to a vapor blasting surface treatment . such a vapor blasting treatment involves accelerating a suspension of microscopic abrasive particles in water or other suitable fluid towards the treatment surface using compressed gas such as air to provide acceleration . during vapor blasting the particles of the suspension are dragged along the surface , removing a substantial portion of the soft residue on the surface . large asperities across the surface may also be knocked down thereby further improving surface finish . vapor blasting preferably should be done with particles that are softer than the softest constituent of the steel used for gear production . moreover , the air pressure used in accelerating the particles is preferably set at levels so as to avoid potential damage to the surface . by way of example only , and not limitation , it has been found that good results are achieved by vapor blasting using a suspension of pumice particles ( about 5 to 20 %) in water wherein the gears are vapor blasted tooth - by - tooth using air pressure of between 20 to 60 psi . it is believed that the combination of vapor blasting preceded by chemical cleaning substantially speeds up the vapor blasting process and improves its effectiveness . this improved effectiveness enables the use of such low hardness particles and low air pressures while still providing excellent scale removal performance . thus , the potential for damaging the substrate material is greatly reduced without sacrificing scale removal performance . the steps of chemical cleaning and vapor blasting can be repeated if desired . following the initial chemical cleaning and vapor blasting , the gear is thereafter preferably subjected to a secondary or final chemical cleaning procedure . during this final chemical cleaning the gear is preferably subjected to cathodic cleaning for about 60 seconds in a standard alkaline cleaning solution to remove any pumice residue . alternatively , after vapor blasting the gears may be immediately cleaned and dehydrated in anhydrous alcohol or a mixture of ethanol , 2 - propanol and methanol in an ultrasound bath . after the conclusion of vapor blasting and chemical cleaning the gear will normally retain only a thin oxide layer corresponding to the nascent oxide layer which forms on a clean metallic surface exposed to air . according to the potentially preferred practice , this oxide layer is removed by use of ion etching procedures under vacuum conditions . as will be appreciated , ion etching is a process in which accelerated ions are directed toward the substrate , strike it and remove small particles of the substrate . the thickness of material removed from the surface is very small and is normally in the order of nano - meters . thus , even a thin oxide layer may be removed effectively without substantial removal of underlying substrate material . by way of example only , according to one contemplated practice ion etching may be done for about 30 minutes in a vacuum chamber filled with argon to a pressure of 10 − 3 torr , in plasma ignited in the chamber . the gears are provided with a negative accelerating voltage of about − 400v with a small amount of cr ions is added to the plasma . following practice of the procedures as outlined above , the oxide layer remaining after vapor blasting was approximately six times thinner than the layer left after chemical etching and eight times thinner than the layer left after heat treatment . the remaining layer was thereafter substantially removed by ion etching . the gear teeth were sufficiently clean to permit the application and adhesion of a wear and fatigue resistant coating such as chromium nitride , titanium nitride or the like by vapor deposition or other suitable techniques . it is to be understood that while the present invention has been illustrated and described in relation to potentially preferred embodiments and procedures , that such embodiments and procedures are illustrative only and that the invention is in no event to be limited thereto . rather , it is contemplated that modifications and variations embodying the principles of the invention will no doubt occur to those of ordinary skill in the art . it is therefore contemplated and intended that the present invention shall extend to all such modifications and variations as may incorporate the broad aspects of the invention within the true spirit and scope thereof .
2
[ 0014 ] fig1 provides a block diagram of a fuel cell inverter circuit 100 , in accordance with the invention . as shown in fig1 a fuel cell 101 is coupled to the remainder of circuit 100 via a switch 110 that operates to disconnect fuel cell 101 from the remainder of circuit 100 . the input of a boost converter 103 is coupled to input filter 102 and it is also coupled to fuel cell 101 via switch 110 . a charge / discharge controller 113 and a battery 104 ( coupled in series to each other ) are coupled to the output of boost converter 103 . battery 104 is sized to produce a voltage greater than or equal to the maximum operating voltage of fuel cell 101 . a dc bus filter 112 and the input to a dc - to - ac inverter 105 are both coupled to the output side of boost converter 103 . the output of boost converter 103 , charge / discharge controller 113 , and the input of dc - to - ac inverter 105 are coupled to a dc bus 108 . dc bus 108 typically is designed to operate at voltages slightly above the voltage level of battery 104 . also , circuit 100 optionally can be coupled to a ground potential 109 . an optional isolation circuit 106 is coupled to the output of dc - to - ac inverter 105 . isolation circuit 106 also is coupled to an ac load 107 . ac load 107 may be any energy - consuming device ( e . g ., motor , lighting ) that can operate with ac current . ac load 107 may be an electrical power transmission grid ( as discussed with reference to fig3 ), or other ac voltage source . fuel cell 101 produces a low dc voltage at a high current . the voltage produced by fuel cell 101 varies with load and operating conditions . also , the requirements of ac load 107 tend to vary over time . the varying power required by ac load 107 tends to create a fluctuating voltage at the output of fuel cell 101 . however , boost converter 103 , charging / discharging controller 113 and battery 104 operate to provide a nearly constant bus voltage to dc bus 108 , despite the fluctuating voltage provided by fuel cell 101 . for example , when a positive load step change occurs ( e . g ., when ac load 107 draws a greater quantity of power ), battery 104 provides power to dc bus 108 ( through charge / discharge controller 113 ) equal to the step change until fuel cell 101 is able to support the entire quantity of load 107 . the amount of power provided by fuel cell 101 to dc bus 108 is determined by boost converter 103 , which allows full control of the power provided by fuel cell 101 . when the available power from fuel cell 101 begins to decrease ( e . g ., because of a lack of fuel supply ), boost converter 103 draws less power from fuel cell 101 and charge / discharge controller 113 draws additional power from battery 104 . boost converter 103 permits the power drawn from fuel cell 101 to be increased gradually as it becomes capable of providing the full power requirements of ac load 107 . when the available fuel cell power exceeds the load power ( plus power consumed by inefficiencies of the inverter ), the boost converter 103 is responsible for maintaining the voltage provided to dc bus 108 . if , however , the available fuel cell power is lower than the required load power , then the voltage on dc bus 108 is regulated by battery 104 and charge / discharge controller 113 . battery 104 operates to provide power both during load transients and during peak loads that exceed the rating of fuel cell 101 . when fuel cell 101 has enough reserve power to both charge battery 104 and to supply the power demanded by ac load 107 , fuel cell 101 provides power to dc bus 108 . in this case , charge / discharge controller 113 operates to stop the flow of current from battery 104 to dc bus 108 , and provide the flow of current from dc bus 108 to battery 104 . as a result , boost converter 103 operates to maintain a nearly constant voltage on dc bus 108 . dc - to - ac inverter 105 converts the dc voltage on dc bus 108 to an ac voltage , suitable for ac load 107 . dc - to - ac inverter 105 is designed to operate with a low voltage input , like that provided by fuel cell 101 . isolation device 106 provides electrical isolation between ac load 107 and dc - to - ac inverter 105 . therefore , fuel cell 101 and the remainder of circuit 100 may be protected from any electrically adverse conditions ( e . g ., power surges ) initiated on the load side of the system . the isolation device 106 also allows for the possibility of connecting battery 104 and fuel cell 101 to an earthed ground ( e . g ., for safety reasons ). [ 0020 ] fig2 provides an example of a component - level block diagram of fuel cell inverter circuit 100 , shown in fig1 . although fig2 provides specific components within the elements shown in fig1 it should be appreciated the components of fig2 are not exclusive , and other similar components may be used . as shown in fig2 input filter 102 includes a capacitor c 1 . charge / discharge controller 113 includes a small mosfet q 2 coupled in anti - parallel with a diode d 2 . it should be appreciated that diode d 2 can be the body diode of mosfet q 2 or a separate diode , like a schottky diode . use of a separate diode allows for battery discharge current to be much greater than battery charging current . mosfet q 2 operates to permit the flow of current from dc bus 108 to battery 104 ( i . e ., charging battery 104 ). diode d 2 operates to permit the flow of current from battery 104 to dc bus 108 ( i . e ., discharging battery 104 ). boost converter 103 includes a mosfet q 1 a diode d 1 , and an inductor l 1 . dc bus filter 112 includes a capacitor c 2 . dc - to - ac inverter 105 includes a combination of components that form an h - bridge inverter , and associated filtering components . in particular , one half of the h - bridge inverter includes mosfets q 3 and q 4 , inductor l 2 , and capacitor c 3 . mosfets q 3 and q 4 form one - half of the h - bridge , and inductor l 2 and capacitor c 3 provide filtering . the other half of the h - bridge inverter includes mosfets q 5 and q 6 , inductor l 3 , and capacitor c 4 . mosfets q 5 and q 6 form one - half of the h - bridge , and inductor l 3 and capacitor c 4 provide filtering . the output of the h - bridge inverter is coupled to isolation device 106 , which may be a transformer t 1 , for example . in this instance , transformer t 1 is coupled on its primary side to the h - bridge inverter , and on its secondary side to ac load 107 . in one embodiment , semiconductor switches q 1 , q 3 , q 4 , q 5 , and q 6 are 100 volt mosfets . as compared to other semiconductor devices that have a nearly constant voltage drop regardless of current flow , for example , insulated gate bipolar transistors ( igbts ), the mosfets are selected so as to reduce losses when the output load is a fraction of the inverter &# 39 ; s full - load rating . in operation , fuel cell 101 provides a low - voltage , high - current power source to the remainder of circuit 100 . the precise value of the available voltage and current from fuel cell 101 may be varied with the number of fuel cells stacked together , based upon the required demand of load 107 . the power generated by fuel cell 101 then passes through a closed switch 110 . capacitor c 1 acts as source of high - frequency current . although capacitor c 1 is shown separate from boost converter 103 , it should be appreciated that capacitor c 1 may be incorporated within boost converter 103 . because fuel cell 101 may not be able to satisfy the demand of ac load 107 at various times throughout the operation of circuit 100 , boost converter 103 operates to regulate power provided by fuel cell 101 . more specifically , diode d 2 operates to detect whether fuel cell 101 can meet the power demanded by ac load 107 . when the average power provided by fuel cell 101 can not meet the average required demand of ac load 107 , the voltage on dc bus 108 drops below the battery voltage and diode d 2 becomes forward biased . the forward biased diode d 2 permits current to flow from battery 104 to dc bus 108 . if , on the other hand , fuel cell 101 provides sufficient power on dc bus 108 to operate ac load 107 , and if battery 104 needs to be charged , mosfet q 2 can be operated in the active region to maintain a constant float voltage across battery 104 . using mosfet q 2 allows a constant current to flow into battery 104 by absorbing and preventing a ripple voltage present on dc bus 108 ( as discussed below with reference to dc - to - ac inverter 105 ) from appearing across battery 104 . notably , the dc bus voltage is nominally higher than the battery voltage , so that the voltage across mosfet q 2 is small ( e . g ., 1 to 5 v ). in effect , therefore , charge / discharge controller 113 operates to conduct the unregulated discharging flow of current from battery 104 to dc bus 108 using d 2 , while properly regulating the flow of charging current to battery 104 using q 2 . boost converter 103 operates to regulate the amount of power provided by fuel cell 101 . as a result , boost converter 103 permits battery 104 and fuel cell 101 to cooperate so as to maintain a substantially constant dc voltage on dc bus 108 . fuel cell 101 is protected from reverse current ( e . g ., current from dc bus 108 back to fuel cell 101 ) by diode d 1 in boost converter 103 . typically , for low voltage sources ( like fuel cell 101 ) that require reverse current protection , a series - connected diode &# 39 ; s voltage drop can introduce a significant loss , especially at partial loads . because of the operation of boost converter 103 , however , diode d 1 provides reverse current protection at a reduced current ( as compared to placing the diode directly in series with fuel cell 101 ), thus increasing the overall efficiency of the circuit . capacitor c 2 filters the high frequency current on the output of boost converter 103 , as well as filtering the ac current required by inverter 105 . inverter 105 uses an h - bridge inverter configuration to convert the voltage from dc provided by dc bus 108 to ac voltage that feeds ac load 107 . therefore , the h - bridge inverter facilitates controlled power flow between dc and ac circuits . the h - bridge inverter includes two half - bridges ( q 3 / q 4 and q 5 / q 6 ) and two corresponding filters ( l 2 / c 3 and l 3 / c 4 , respectively ). inverter 105 typically draws power from dc bus 108 at a frequency that is twice that of the inversion frequency . for example , power drawn from dc bus 108 will have a significant 120 hz ripple component if the inverter produces 60 hz power . dc bus 108 will therefore have a voltage with a 120 hz ripple component . as is well known to those skilled in the art , an inherent feature of the mosfet is that it acts as a diode ( i . e ., a “ body diode ”) for current flowing in the reverse direction . during normal operation , the load current flows through a mosfet in each half - bridge for a period of time , and a mosfet body - diode in each half - bridge for a period of time . notably , the period of time that the current flows through the body - diode will increase if the voltage on dc bus 108 increases above its minimum designed operating level . however , in order to obtain efficient operation during partial load situations , boost converter 103 and battery 104 in conjunction with charge / discharge controller 113 will operate to keep the voltage on dc bus 108 nearly constant ( as discussed above with reference to boost converter 103 ), so to beneficially minimize the duration of current flow through the body diodes . the h - bridge inverter converts the dc voltage from fuel cell 101 to ac voltage for ac load 107 by designing the filters ( l 2 / c 3 and l 3 / c 4 ) to pass the desired frequency of the line voltage ( e . g ., 60 hz or 50 hz ), while removing the high - frequency switching component ( e . g ., 20 khz ) of voltage . the mosfets are pulse width modulated to provide the respective half - bridge filter components with voltages that are 180 ° out of phase with each other , so as to create a sinewave across transformer t 1 . the voltages across c 3 and c 4 are sinewaves that are 180 ° out of phase with each other so that the sinewave applied to the primary of transformer t 1 has twice the amplitude of the sinusoidal voltage across either c 3 or c 4 . the filtering components create fluctuating voltage waves with a small amount of high - frequency ripple created by the pulse wave modulation . because the voltage between either leg of the primary on transformer t 1 and ground 109 has only a very small high - frequency voltage component , the emitted electromagnetic radiation is significantly reduced . transformer t 1 provides isolation between load 107 and circuit 100 . transformer t 1 also may be designed such that the sum total kva rating of its secondary windings is greater than the kva rating of its primary winding . such design accommodates the possibility that either secondary may carry the greater current at any particular time . therefore , transformer t 1 beneficially provides a method to power unbalanced loads without increasing the rating of the semiconductor switches . such capability is especially relevant for stand - alone split - phase loads ( e . g ., residential applications ). it should be noted that the circuit configuration shown in fig2 permits operation in grid - parallel and / or stand - alone mode . fig3 is a block diagram showing the use of circuit 100 coupled to a customer premise 301 ( i . e ., stand - alone mode ) and / or a power transmission network 303 ( i . e ., grid - parallel mode ). power transmission network 303 is a network of high - voltage transmission lines that connect producers of electric power to the end customer ( e . g ., customer premise 301 ). in the united states , there are ten regional networks or “ grids ” ( e . g ., mid - america interconnected network and western system coordinating council ) collectively serving the power needs in the united states . power transmission network 303 may receive power from at least one power generation source 302 , such as a nuclear power plant or hydroelectric power generation plant . when coupled to power transmission network 303 , the network causes a sinusoidal voltage to appear across filter capacitors c 3 and c 4 of dc - to - ac inverter 105 . pulse - width modulation may be used to control the half - bridges of circuit 100 to produce a substantially sinusoidal current through filter inductors l 2 and l 3 . the resulting substantially sinusoidal current may have a frequency substantially similar to the voltage of power transmission network 303 . when coupled to customer premise 301 , the voltage across filter capacitors c 3 and c 4 in circuit 100 may be monitored by a separate device ( not shown ) so as to maintain a sinusoidal voltage at the desired frequency of customer premise 301 ( e . g . 60 hz for residential premises ). furthermore , by monitoring the current entering the residence , it is possible to modify the current produced by inverter 100 to provide overall power factor correction and / or to prevent net power generation by the residence . the scope of protection of the following claims is not limited to the embodiments described above . those skilled in the art will recognize that modifications and variations of the specific embodiments disclosed herein will fall within the true spirit and scope of the invention . while the invention has been particularly shown and described with reference to the embodiments thereof , it will be understood by those skilled in the art that the invention is not limited to the embodiments specifically disclosed herein . for example , although the invention was described using certain electronic components with specific ratings , it should be appreciated that those components may be replace or rearranged without exceeding the scope of the invention . those skilled in the art will appreciate that various changes and adaptations of the invention may be made in the form and details of these embodiments without departing from the true spirit and scope of the invention as defined by the following claims .
7
the present invention is a differential pressure reservoir 10 for use with a hot water system equipped with a bridge conduit 96 across the remote ends of each pair of hot and cold water pipes , as disclosed in u . s . pat . no . 4 , 321 , 943 , incorporated herein by reference . the invention combines the functions of , and replaces , the water heater air pocket and separate pressure reducing means of the prior art system . referring to the figure , the differential pressure reservoir 10 is inserted between the cold water supply inlet 89 of a conventional water heater tank 90 and the cold water supply main 9 . while the differential pressure reservoir 10 is shown in a retrofit embodiment for installation outside of heater tank 90 , it is equally possible to install reservoir 10 without modification as original equipment inside of tank 90 between supply main 9 and inlet 89 . differential pressure reservoir 10 comprises a casing 11 preferably formed from opposing hemispherical shells 12 and 13 which enclose a first cold water chamber 42 and a second hot water chamber 43 , and a cylinder 14 . reservoir 10 preferably has a total water capacity of approximately 1 . 5 gallons . a covering of thermal insulation 19 such as styrofoam around the outside of casing 11 holds whatever heat enters the reservoir from the tank . shells 12 and 13 are preferably mated by fasteners such as bolts 15 , and sealed by an o - ring 16 . shell 12 has a port 22 connected to cold water supply main 9 , and shell 13 has a port 23 connected to heater tank intake 89 . a double - sided piston 31 slides up and down along axis 44 in cylinder 14 . the &# 34 ; effective &# 34 ; area of each side of piston 31 is that area normal to axis 44 and exposed to water . by any one of several arrangements , the piston &# 39 ; s effective area is greater on the side under pressure from water tank 90 than on the side under pressure from cold water main 9 . in the preferred embodiment , piston 31 has a semispherical portion with a first concave face 32 forming a movable wall of first chamber 42 and a second convex face 33 forming an opposing movable wall of second chambers 43 . the first piston face 32 also includes the outer side of the base of a frusto - conical member 34 which extends and converges towards a notched inner rim 35 holding a u - cup seal 36 . a hollow cylindrical sleeve 21 extends from the center of shell 12 part way along axis 44 and forms a sliding fit with u - cup seal 36 . the volume of air trapped inside conical section 34 and sleeve 21 serves as an air spring . in a plane normal to axis 44 , the effective area of first face 32 is less , by the area of the base 48 of sleeve 21 , than the effective area of second face 33 . piston 31 has a notched outer rim 37 holding a u - cup seal 38 to keep water from leaking between cold water chamber 42 and hot water chamber 43 , except when rim 37 is near the end of cylinder 14 adjacent grooves 17 . the grooves 17 serve as a valve means to permit passage of water from inlet 9 across the piston to outlet 23 whenever the second face 33 is urged to a position approaching outlet 23 . reservoir 10 is radially symmetrical around axis 44 of cylinder 14 , with the exception of port 22 being off - center , fasteners 15 , and cylinder wall grooves 17 . the outside walls of the casing may be tapered for convenience in manufacturing with injection molded plastic such as delrin ®, or other suitable material which will not corrode , scale , rust or pit , and which has a service temperature above 212 ° f . the cylinder walls should be non - abrasive to promote long seal life . when the hot water system is in a standby state and no water , or at least no hot water , is flowing , pressures on both sides of piston 31 are equal . in the preferred embodiment , because the effective area of second face 33 is greater than that of first face 32 , the total force on side 33 is greater and moves the piston to expand second chamber 43 until , at the top of the piston stroke , rim 37 abuts shoulder 39 . the shoulder 39 should be in a plane normal to axis 44 so that when the hot water outlet 93 is closed , the upward pressure on piston 31 will be distributed equally around shoulder 39 . when hot water outlet 93 is opened , hot water flows out of pipe 92 from tank 90 , reducing the pressure at tank intake 89 and in second chamber 43 relative to first chamber 42 . when the total force on second face 33 is less than that on first face 32 , hot water flows out , and second chamber 43 contracts . when piston 31 moves down to the level where rim 37 is adjacent cylinder wall grooves 17 , cold water from first chamber 42 flows through the grooves and on into tank 90 . grooves 17 serve as valve means to allow water to flow by without rolling u - cup seal 38 off of piston 31 . when hot water outlet 93 is closed , the slight flow of cold water through cross - over conduit 96 will raise the pressure in hot water pipe 91 to that of cold water pipe 9 . this changes the pressure differential to a force differential in the opposite direction , which pushes away piston 31 and enlarges second chamber 43 , as explained above . bridge conduit 96 contains a one - way flow - check valve 97 which prevents hot water from entering cold water pipe 9 . the bridge conduit 96 is connected between pipes adjacent outlet faucets 93 and 94 with clamp - on - copper - piercing needle valves 92 and 95 which can be adjusted to control the rate of back flow , and thus the rate at which the system functions . details have been disclosed to illustrate the invention in a preferred embodiment of which adaptations and modifications within the spirit and scope of the invention will occur to those skilled in the art . for example , the reservoir according to the invention could be mounted anywhere in the water line near the water heater , including on the outlet side of the water heater , to serve as a hot water recovery and storage mechanism . the scope of the invention is therefore limited only by the following claims .
8
the high sulfur crude oils to be treated in the process of the invention are petroleum crude oils containing from 0 . 5 % to 3 % sulfur , generally about 1 % sulfur . chlorinolysis is conducted at a low temperature below 120 ° c ., generally from 25 ° c . to 85 ° c . for at least 5 minutes and usually for less than 120 minutes . the ratio of water to crude oil should be at least 0 . 05 / l and no more than 0 . 5 / l . the water can be added as steam and separately bubbled through the crude . chlorine gas is introduced at a rate of from 1 to 100 grams of cl 2 / 100 grams oil / hr . a brown emulsion results . the chlorinated crude is then treated with at least an equal volume of water at ambient temperature or slightly heated to a temperature from 20 ° c . to 80 ° c . and the water separated . the crude oil is then washed with at least an equal volume of caustic such as sodium hydroxide having a molarity of from 0 . 1 to 2 . the carbon - sulfur ( sulfide ) and sulfur - sulfur ( disulfide ) bonds of the organic sulfur components of crude oil are highly reactive due to high steric accessibility and electron releasing and demanding nature of the sulfur atom . chlorine treatment in the presence of water brings about the scission of these bonds as follows : ## str1 ## where r and r &# 39 ; represent hydrocarbon groups . the resulting chlorinated organo - sulfur compounds are oxidized and hydrolyzed in the presence of chlorine and water at moderate temperature to produce sulfate compounds as follows : ## equ1 ## most of the sulfate compounds and chlorine compounds are removed by hydrolysis during the water and caustic washing steps . referring now to fig1 the desulfurization system generally includes a chlorinolysis unit 10 , water washing unit 12 and caustic washing unit 14 . water and crude oil are fed to the chlorinolysis unit 10 from lines 16 and 18 respectively in the desired ratio , usually 0 . 3 h 2 o / oil , by volume . the streams are at ambient or can be preheated to the desired temperature . stirrer 20 is started and chlorine is fed to fritted glass bubbler 22 at the bottom of the unit . at the end of the desired reaction period , valve 24 is closed , valve 26 is opened and the brown emulsion is pumped through line 28 by means of pump 30 into unit 12 . an excess amount of water , usually 4 / 1 water to oil is added to the emulsion through line 32 and removed through drain 34 and discarded after the supernatent oil has been transferred through line 35 into unit 14 . an excess amount of dilute caustic , usually 4 / 1 caustic ( 1 molar ) to oil at is then added to unit 14 through line 36 . desulfurized crude is recovered at 40 and spent caustic is discarded through drain 42 . referring now to fig2 the well - site system includes a recovery well 50 , chlorinolysis unit 52 , washing unit 54 , and steam generator 55 . crude oil recovered from the well 50 is delivered to chlorinolysis unit 52 . cl 2 is bubbled into the oil from a perforated ring bubbler 56 and steam is injected into the oil from line 58 . the chlorine treated oil is then delivered to washing unit 54 in which it is successively washed with water and caustic from lines 60 and 62 respectively . a portion of the desulfurized oil is then fed to the combustion section of steam generator 55 along with air and the combustion gases generate steam in tube bank 64 . the generated steam is recycled to chlorinolysis unit 52 and well 50 through lines 58 and 66 . a series of experiments were carried out at temperatures from 25 ° c . to 80 ° c . for periods from 0 to 120 minutes on a crude petroleum oil containing 1 % sulfur obtained from the brea - olinda field of union oil co . chlorine was introduced at a rate of 5 grams of cl 2 / 100 grams of oil / hour . the ratio of water to oil was 0 . 3 . in typical runs , about 230 grams of petroleum was stirred in a glass flask fitted with a stirrer and fritted gas bubbler . either at room temperature , or upon pre - heating to the stated temperature , a vigorous degree of stirring was initiated , and chlorine then introduced to the lowest portion of the flask for up to one hour . a brown emulsion resulted . this product was washed with a four - fold amount of water , and the water then separated . the oily layer showed very little fluidity decrease . thereafter the washed oil was further mixed and washed with a four - fold quantity of sodium hydroxide ( 1 molar ). the final oil was analyzed and fractionally distilled for characterization . significant desulfurization is experienced at treatment periods as little as 15 minutes with optimum treatment appearing to be at 60 minutes . epa requirement of 0 . 3 % sulfur is achieved at room temperature in 60 minutes , though more efficient desulfurization occurs at 50 ° c . the process of the invention provides low cost , efficient desulfurization readily adapted to the on - site generation of process heat or steam for eor from oil wells . it is to be understood that only preferred embodiments of the invention have been described and that numerous substitutions , modifications and alterations are permissible without departing from the spirit and scope of the invention as defined in the following claims .
4
fig1 illustrates an exemplary embodiment of a multiwell mea in an ansi / sbs - compliant format . the multiwell electrode interfaces with electronics to which it is attached to through bottom side contacts . the electronics amplify and process the raw data obtained from cellular cultures in the various wells and the data is reflected in a computer for data analysis and manipulation . fig1 illustrates an exemplary mea system 10 that has been designed to interface with a physical system such as a tissue specimen or a network of cells in a multiwell format , i . e . several wells 12 of electrodes ( 6 , 12 , 24 , 48 , 96 , 384 , and 768 with a total of 768 electrodes ). this physical system is in direct contact with the microelectrodes . the multiwell microelectrodes 20 plug into a signal processing and data management system 14 which collects and analyzes the data that is generated from the cells . the combination of the cells , microelectrodes and entire system connects to a computer 16 via a data cable 18 for real time software analysis and recording . at the top of fig1 is a constructed multiwell mea system 8 . fig2 a - b and 2 c - d illustrate top and side views , respectively , of post - processing on a printed circuit board . fig2 a and 2b illustrate microfabrication of the multiwell mea using a combination of a large area process like pcbs and post processing using microfabrication or mems techniques — top views of a pcb ( obtained from a commercial vendor ) and a single well of electrodes after post processing . fig2 c and 2d illustrate side views for the fabrication strategies for a multiwell mea with a large area process like pcb in combination with microfabrication techniques . fig2 a depicts the components of a planar mea . the active part of a planar mea comprises three components : ( 1 ) the electrodes or the active sites , ( 2 ) the topmost insulating layer , and ( 3 ) the micro - scale metal wiring traces . regardless of the manufacturing strategy , the microfabrication process must account for all these three components . for the development of multiwell mea devices , platinum black can be used for the electrodes , su - 8 or silicon dioxide ( sio 2 ) for the insulation layer , and gold for the wiring traces . the platinum black electrodes can be formed using a closed - loop electroplating process , which will produce robust electrodes with precisely matched electrical properties . the negative tone epoxy su - 8 , which acts as an insulating material , has several attractive properties such as chemical stability , photolithographic definition , thermal stability and coating uniformity . it has been used as an insulation layer in commercially available meas from ayanda biosystems . additionally , su - 8 has the added benefit of planarizing the relatively rough surfaces on pcbs substrates or flex - rigid circuits . su - 8 is an ideal material to act as an insulation layer for a polymer - substrate multiwell meas , which have low temperature processing requirement , though it can be used with glass or silicon substrate materials as well . silicon dioxide is a traditional insulation material that is used in combination with rigid substrates like glass . the advantages of silicon dioxide include well characterized microfabrication techniques , low dielectric constant and pin - hole free coatings even in a nanometer scale . although su - 8 has been used with both polymer and glass substrates for multiwell mea fabrication , sio 2 has been used exclusively with glass substrates ( fig5 and 6 ). with these materials in mind , provided herein are fabrication processes and strategies for a post - processing of pcb that include the minimum number of steps necessary to achieve the desired objectives , such as transparency . fig2 c depicts the side view of this fabrication approach . the mea traces and recording sites can be defined using a relatively thick layer of negative resist ( which will also account for the planarization of the metal on the flex circuit ) and uv lithography . a biocompatible metal stack ( titanium for adhesion and gold for the metal traces ) can be deposited using standard metal deposition techniques and the metal will be lifted off to define the finer metal lines . in order to passivate the mea and define the recording sites ( electrodes ), a thin layer of su - 8 is coated and the material is photo patterned . su - 8 is photopatterned to define the final insulation pattern . no other processing on top of this is necessary to define the insulation layer . this processing step may be followed by electrodeposition of platinum in order to reduce the impedance of the recording sites . the approach listed here has the advantage of a very simple post - processing strategy ( 2 mask process ) to achieve a functional mea . surface planarization ( for microfabrication ) on non - standard substrates may require a slightly modified approach to the process described above . one such modified approach is illustrated in fig2 d . su - 8 is an excellent material for surface planarization . spin coating a layer of su - 8 on relatively rough surface results in the reduction of surface non - uniformities . this may be used as an additional step in the beginning of the above processes to address potential problems in direct processing on pcbs . the rest of the process is same as the fabrication techniques detailed above . the additional complexity ( involving one more mask ) will not add significant time to the process development of multiwell microelectrode arrays . additionally , potential cytocompatibility problems due to insufficient pcb encapsulation are improved by the addition of an extra layer of su - 8 . fig3 depicts a lamination technique for transparent polymer lamination on pcbs that is compatible with standard adhesives used in the industry . acrylic - based adhesives are used to laminate kapton onto a printed circuit board for what are called “ flex - rigid ” or “ rigid - flex ” circuits since the kapton layer adds flexibility to what is a rigid substrate . the most common applications for flex - rigid circuits are in the fields of aerospace , military and biomedical . it offers increased reliability and reduced weight for the former two markets while offering the ability to bend and fold in tight places for biomedical applications like implants . kapton or polyimide is a suitable polymer for these circuits due to its mechanical stiffness , and compatibility with processes for drilling and metallization . polyethylene terephthalate ( pet ) is a transparent polymer ( light transmittance of 93 % for 3 mil thickness ; source dupont teijin films ) that could be utilized as an alternate to kapton utilizing an added step ( such as employing an adhesive or a mechanical operation as known to one skilled in the art ) to render it compatible with standard pcb processing . the temperature of the lamination process is lowered to accommodate the low temperature requirement of pet but the time of the process is increased to ensure the reflow of this thermally set acrylic adhesive . this reflow ensures that the adhesive remains intact for any future processing . this process has been demonstrated successfully on large area substrates ( eg , 12 inches by 18 inches ). several flex rigid circuits with the multiwell format can be fabricated on a single panel pcb making this process batch fabrication compatible . this batch fabrication results in lowering the cost of the pcb process with the primary cost shifting to the post processing , which is low to begin with since there are only two layers to creating the mea . referring now to fig4 a and 4b , design layouts for the pcb , fig4 a , and mems post processing , fig4 b , for a 12 well multiwell mea are illustrated . these designs can be rapidly modified to accommodate different well configurations . the circular configurations on the pcb design define holes in the fr - 4 substrate that allow for bottomside transparency . rapid design changes allow for the modification of the mems post processing masks , so that other well designs with electrodes can be achieved like 24 , 48 and 96 well counts . fig4 a depicts the layout for the pcb ( top side ) and the masks for post processing to create the multiwell meas using the fabrication process described in fig2 a - d . a major advantage is the flexibility of the design and fabrication processes . specifically , design changes can be implemented rather quickly once the fabrication process has been established . a design iteration only requires two different layouts ( pcb layout and mea mask layout for two layer fabrication ), and , by changing these two layouts , a wide variety of electrode counts can be fabricated . additionally the well locations can be made ansi / sbs - compliant by incorporating the well locations from standard documents into the designs . thus , a change from 1 × 768 ( one well with 768 electrodes ) to 96 × 8 ( 96 wells with 8 electrodes each ) or any combination in between can be constructed with little difficulty . the processes also lend to flexibility in terms of changes in electrode densities and geometries with changes only to the mea mask layout . furthermore , since the processes are primarily based on custom pcb / flex circuit fabrication , the integration of heaters , sensors , memory chips , and fluidic valve controls to the multi - well mea itself can be easily accomplished , thus providing additional functionality to the final product . fig5 a and 5b illustrate the concept of a packaging or flip - chip approach to a multiwell mea with side and top views , respectively . the multilayer pcb and the glass die can be fabricated separately using batch fabrication techniques and coupled together to complete the device in an ansi / sbs compliant format . fig5 a depicts a side view of the flip chip approach to multiwell meas . in this schematic , the two components of the multiwell mea are depicted : a recessed three layer printed circuit board ( standard rigid pcb ) 50 ; and a microfabricated glass chip that has metal traces defined and insulation coated 52 . the two components are connected together using a conductive epoxy or solder layer that is screen printed on the glass substrate . the completed device is in an ansi / sbs - compliant culture well format thereby enabling easy design changes from a 1 × 768 electrode format ( single well ) to a 96 × 8 electrode format ( up to 96 wells ). the glass substrate is fabricated in two steps : metal interconnection patterns are defined utilizing a standard metal lift - off process ; an insulation process which may include either an su - 8 layer defined using photolithography or an sio 2 layer defined using a photolithography step followed by an etch process . the rigid pcb is fabricated using a three - layer process with a bottom layer for connecting the electrodes to the multiwell electronics and two layers on top to accommodate the routing of all 768 electrodes . fig5 b depicts a top view of the flip chip approach to multiwell meas . fig6 a and 6b illustrate exemplary design of the pcb and glass substrate with top views of the layout for the pcb and the glass substrate , respectively , used in the flip chip process . these designs can be rapidly modified to accommodate different well configurations . the circular configurations on the pcb design define holes in the fr - 4 substrate that allow for bottomside transparency . rapid design changes allow for the modification of the mems post processing masks , so that other well designs with electrodes can be achieved , such as 24 , 48 and 96 well counts . fig6 a and 6b illustrate a sample routing scheme for 768 electrodes in a 12 - well format ( each well has 64 electrodes ). both the pcb design , fig6 a , and the glass plate design , fig6 b , are shown . the interconnection between the two substrates is achieved using metal pads defined at two of the corners of both the substrates . screen printing of a conductive material like conductive epoxy or solder is carried out utilizing standard stencil printing techniques . the glass substrate and the pcb are brought assembled together using a flip chip bonder and the entire assembly is cured to finish the flip chip process to achieve a multiwell mea in an ansi / sbs compliant format . fig7 a and 7b are optical microscopy images of neuronal cultures grown on the meas at 21 days , fig7 a , and 28 days , fig7 b , in - vitro . fig7 a - b depict optical microscopy images of neuronal cells from e18 cortices of rat brains cultured on a single well of the mea devices . e18 cortices are harvested from rat brains and cells from these cortices are plated on the mea as described in the examples section . these devices were placed in incubators and observed after 24 hours of plating cells , at 7 days , 21 and 28 days in - vitro . the observations were carried out utilizing inverted microscopy techniques . observations were made for neurite outgrowth and general health of the cells . at 28 days in - vitro , a live / dead assay was performed in accordance with the protocols developed by cullen et al . to access the viability of cells in the culture dish . images captured from this assay are also shown in fig7 a - b . in a multiwell embodiment of the same device , such data will be collected from all the wells simultaneously . the multiwell meas will ensure similar experimental conditions for such assays unlike the single well counterparts where these experiments have to be performed one at a time . this will enable a much higher throughput for applications like drug screening . fig8 a - b are graphical illustrations of evoked electrophysiological data recorded from microelectrodes within an individual culture well . in this example , microelectrodes were used to both stimulate and record from neural cortical cultures . in a multiwell format , such data is collected simultaneously in dozens to hundreds of wells , dramatically increasing the throughput of electrophysiological investigations for screening applications . extracellular electrophysiological data from excitable cells and tissues is used to perform a wide range of analyses , ranging from the collection network - level dose response curves and the identification of specific ion - channel behaviors to the quantification of neurotransmitter release . additionally , studies in plasticity , toxicity , learning and memory , and pharmacology are further enabled with the use of meas . an individual microelectrode can be used to perform multiple functions simultaneously , thus it is possible to both stimulate and record from individual microelectrodes . stimulation can be used to evoke electrical activity that would other - wise not occur under normal spontaneous conditions . in fig8 a , ( a ) cultured cortical recordings with ( b ) and without ( a ) the elimination of excess charge that builds up on the microelectrode during stimulation ( known as artifacts ) ( scale bars : 100 μv , 10 ms , stimulus ± 0 . 5v ). in fig8 b , neural recordings on both the stimulating and neighboring electrodes . arrows indicate superimposed evoked responses , and circles indicate secondary artifacts induced by crosstalk inside the recording electronics ( biphasic stimulus ± 0 . 5v ). without being limited by theory , it is believed that the devices provided herein allow for the measurement of characteristics ( eg , chemical , biological , biochemical or electrophysiological ) of certain samples ( eg , chemical or biological ) at sensitivities and / or throughput levels that cannot be achieved with currently available devices . accordingly , provided herein are microelectrode arrays ( meas ) which are compatible with equipment or machinery intended for use with an ansi / sbs - compliant plate , comprising a plate having one or more wells and a substrate comprising a printed circuit board ( pcb ), wherein said substrate further comprises one or more microelectrodes having a diameter of about 1 to about 500 microns , wherein the substrate is transparent in the vicinity of the microelectrodes and has an area of about 3 inches by about 3 inches or greater . currently available multiwell mea plates are restricted to electrodes that are several mm in dimension , precluding the ability to perform electrophysiological measurements , micro - stimulation , or high - resolution impedance analysis . in certain embodiments , the plate is comprised of a transparent material , such as glass or plastic . in certain embodiments , the plate is a multiwell plate . in particular embodiments , the multiwell plate has an area of about 3 inches by about 3 inches or greater . in other embodiments , the multiwell plate has an area of about 3 inches by about 5 inches or greater , about 3 inches by about 6 inches or greater , about 4 inches by about 4 inches or greater , about 4 inches by about 5 inches or greater , about 5 inches by about 5 inches or greater , about 5 inches by about 7 inches or greater or about 6 inches by about 6 inches or greater . in certain embodiments , the microelectrodes are integrated into one or more wells of the multiwell plate . in certain embodiments , the microelectrodes are adhered to or embedded into the substrate . in certain embodiments , the substrate is transparent in the vicinity of the microelectrodes , such that biological specimens can by analyzed using the mea in combination with inverted microscopy , inverted fluorescent microscopy , inverted environmental microscopy or inverted cell counting techniques . in certain embodiment , the entire substrate is transparent . in one embodiment , the wells of the multiwell plate are transparent . in another embodiment , the area of the plate in which the microelectrodes are integrated into or attached to is transparent . in particular embodiments , the substrate or plate is transparent such that it allows for about 90 %, about 92 %, about 94 %, about 96 %, about 98 %, about 99 %, about 99 . 9 % light transmittance through the substrate in one embodiment , one or more microelectrodes is itself transparent . transparency can be measured by methods known to one skilled in the art using a spectrophotometer . in certain embodiments , the microelectrode array comprises a multiwell plate having anywhere from 4 to 1536 wells , 4 to 384 wells or 4 to 96 wells . in specific embodiments , the multiwell microelectrode array comprises a multiwell plate having 4 , 96 , 384 or 1536 wells . in certain embodiments , the multiwell plate is of a size described by ansi / sbs ( ie , is ansi - sbs - compliant ). in certain embodiments , the multiwell plate is compatible with equipment or machinery intended for use with ansi / sbs - compliant plates . because it is possible that plate size could be altered without significantly affecting the utility of a microelectrode array , devices including a plate with a size outside of ansi / sbs standards are intended to be within the scope of the present disclosure . in certain embodiments , the multiwell plate comprises from 1 to 768 or from 1 to 384 electrodes per well . in certain embodiments , the multiwell plate comprises 384 electrodes per well in a 2 well configuration to 1 electrode per well in a 1536 well configuration . in certain embodiments , the multiwell plate has a length of about 127 . 76 mm ± 0 . 25 mm ( 5 . 0299 inches ± 0 . 0098 inches ), a width of about 85 . 48 mm ± 0 . 25 mm ( 3 . 3654 inches ± 0 . 0098 inches ) and a thickness of about 14 . 35 mm ± 0 . 25 mm ( 0 . 5650 inches ± 0 . 0098 inches ). in certain embodiments , the diameter of the microelectrodes is about 1 to about 500 microns , about 1 to about 450 microns , about 1 to about 400 microns , about 1 to about 350 microns , about 1 to about 300 microns , about 10 to about 300 microns , about 50 to about 300 microns or about 100 to about 200 microns . in certain embodiments , the microelectrodes have a length of about 1 to about 500 microns , about 1 to about 450 microns , about 1 to about 400 microns , about 1 to about 350 microns , about 1 to about 300 microns , about 10 to about 300 microns , about 50 to about 300 microns or about 100 to about 200 microns . in certain embodiments , the microelectrodes have a thickness of about 10 nanometers to 1 micron , about 50 nanometers to about 1 micron , about 100 nanometers to about 1 micron , about 200 nanometers to about 1 micron , about 300 nanometers to about 1 micron , about 400 nanometers to about 1 micron , about 500 nanometers to about 1 micron or about 750 nanometers to about 1 micron . in certain embodiments , neighboring microelectrodes have a spacing of about 10 microns to about 1 mm , about 20 microns to about 1 mm , about 50 microns to about 1 mm , about 100 microns to about 1 mm , about 200 microns to about 1 mm , about 300 microns to about 1 mm , about 400 microns to about 1 mm , about 500 microns to about 1 mm or about 750 microns to about 1 mm . in certain embodiments , the are made of titanium , chromium , titanium / gold , chromium / gold , platinum , indium tin oxide , rhodium , silver , palladium , nickel , copper , poly ( 3 , 4 - dioctyloxythiophene ) ( p - dot ) or a combination thereof . in certain embodiments , the pcb is laminated with a transparent polymer membrane . in certain embodiments , the polymer is polyethylene terephthalate ( pet ). in certain embodiments , the polymer membrane has a thickness of about 10 to about 100 microns ). in certain embodiments , the microelectrode arrays allow for the analysis of 4 to 1536 samples / experiment , 4 to 384 samples / experiment or 4 to 96 samples / experiment . in certain embodiments , the microelectrode arrays allow for high - sensitivity and high spatial resolution impedance - based assays . additionally , the use of multiple microelectrodes for impedance analysis provides redundancy , by improving the likelihood that cultures or tissues will adequately cover several electrodes , which may dramatically improve the yield and accuracy of impedance - based assays . in certain embodiments , the microelectrode arrays allow for micro - stimulation , for eliciting controlled , evoked responses from tissues and cultures under investigation . such stimulation can be applied simultaneously during the recording and acquisition of extracellular electrophysiological data . further , micro - stimulation can be used to evoke both field and action potentials as well as to perform a wide - range of threshold - based assays . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . in certain embodiments , the microelectrode arrays allow for concurrent access to both single - cell and network - level activity of a sample . in certain embodiments , the microelectrode arrays allow for the detection and / or monitoring of electrically active cellular networks . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . in certain embodiments , the total number of microelectrodes in an array is from 1 to 1536 , from 1 to 768 , from 1 to 384 or from 1 to 96 . in other embodiments , the total number of microelectrodes in an array is a multiple of 96 , 384 , 786 or 1536 , such as a multiple of a whole number between 1 and 5000 , between 1 and 4000 , between 1 and 3000 , between 1 and 2000 , between 1 and 1000 , between 1 and 500 , between 1 and 100 , between 1 and 50 or between 1 and 10 . further provided herein are methods for measuring in vitro or in vivo electrophysiological activity , impedance characteristics , extracellular network activity of a biological specimen ( eg , a cell , tissue and / or culture of the following varieties : vertebrate and invertebrate neural , muscle fibers , cardiac , pancreatic islet , osteoblasts , osteoclasts ) using a microelectrode array provided herein . specifically , provided herein are methods for measuring in vitro or in vivo electrophysiological activity , impedance characteristics or extracellular network activity of a cell or tissue , comprising contacting said cell or tissue with a mea provided herein . in certain embodiments , the biological specimen is placed or cultured in one or more wells of an mea provided herein and electrophysiological activity , impedance characteristics or extracellular network activity of the biological sample is detected and / or measured . further provided herein are methods for microscopy and / or cell counting using a microelectrode array provided herein . in particular embodiments , the microelectrode arrays provided herein are compatible with an optical plate reader . further provided herein are methods for in vitro or in vivo micro - stimulation of a biological specimen ( eg , a cell , tissue and / or culture of the following varieties : vertebrate and invertebrate neural , muscle fibers , cardiac , pancreatic islet , osteoblasts , osteoclasts ). in certain embodiments , provided herein are methods for eliciting controlled , evoked responses from a biological specimen . such stimulation can be applied simultaneously during the recording and acquisition of extracellular electrophysiological data . further provided herein are methods for micro - stimulation of a biological specimen and measuring ( including recording and / or acquiring ) a response ( eg , an extracellular electrophysiological response ). further , micro - stimulation can be used to evoke both field and action potentials as well as to perform a wide - range of threshold - based assays . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . specifically , provided herein are methods for micro - stimulating a cell or tissue comprising contacting said cell or tissue with a mea provided herein and exposing said cell or tissue to an electrical current originating from said mea . in another embodiment , such methods further comprise recording and / or acquiring extracellular electrophysiological data from said cell or tissue . in certain embodiments , the biological specimen is placed or cultured in one or more wells of an mea provided herein and the biological specimen is micro - stimulated by the mea ( eg , by exposing the biological specimen to an electrical current originating from the mea ). further provided herein are methods for manufacturing a microelectrode array provided herein . provided herein are methods for manufacturing a microelectrode array including the steps of : 1 . providing a pcb and a mask for microelectromechanical systems ( mems ) post processing ( wherein in certain embodiments , the pcb is a flex - rigid pcb , and in other embodiments , the pcb and mask are designed to be compatible with an ansi / sbs - compliant plate ); 2 . laminating the pcb with a transparent polymer membrane ( wherein in certain embodiments , the pcb is a flex - rigid pcb fabricated using a modified process for lamination of pet as described herein ); 3 . defining vias in the polymer membrane ( in certain embodiments , such that it becomes possible to create functional , electrical interconnections between the top - side of the polymer membrane , such as pet , and the underlying pcb ); and 4 . mems processing utilizing the pcb as a substrate to create microelectrodes ( such as in a multiwell fashion ). in certain embodiments , the first layer defines the metal traces on the flex - rigid board and the second layer defines the insulation on top of the defined metal . further provided herein are methods for manufacturing a microelectrode array including the steps of : 1 . defining or modifying a pcb ( such as a standard rigid pcb ) to allow for insertion of a multiwell glass plate ; 2 . providing a photolithography mask for processing a multiwell glass mea ( such as a mask designed to be compatible with an ansi / sbs - compliant multiwell glass plate ); 3 . optionally fabricating the pcb utilizing standard commercial techniques ; 4 . microfabricating the multiwell glass mea to provide at least two layers , wherein the first ( bottom ) layer defines metal traces and the second ( top ) layer defines the insulation ; and 5 . attaching the multiwell glass mea to the pcb utilizing integrated circuit ( ic ) packaging techniques , creating electrical connections between the pcb and glass mea . in exemplary embodiments , the disclosed fabrication techniques , devices and methods of use may comprise at least one of the following elements : i . the device : a multiwell mea device itself , may be any multiwell plate ( more than 4 wells ) with greater than 4 electrodes per well , with electrode sizes of 500 μm or less in diameter , with inter - electrode distances ( center - to - center ) of about 1 mm or less . currently available multiwell mea devices do not have the capability to define electrodes to the size disclosed in this invention . ii . the fabrication process : fabricating micro - scale electrodes on printed circuit board ( pcb ), kapton flex board , hybrid circuit board technology , flip chip techniques , multi - or single - layer glass technology ( i . e . micronit inc ). more specifically , using printed circuit boards ( of any kind ) or multilayer glass technology with vias as a substrate for single - well or multiwell meas . pcb substrate materials may include , but are not limited to , the following : fr - 4 , fr - 2 , kapton , polyimide , and teflon , and polyethylene terephthalate ( pet ). currently available multiwell mea devices in large - area ansi / sbs compliant formats do not utilize microfabrication technologies . iii . transparency : in most cell culture applications it is desirable to evaluate or observe the culture with an inverted microscope . thus , bottom - side transparency , the ability to see through the bottom of the device to observe the underside of the cells , is a desired feature . laminatable , translucent films such as kapton and transparent films such as pet ( among others ) pressed over a hole in the package / pcb substrate to enable inverted microscopy . such thin films can provide superior optical characteristics like a high degree of light transmittance through the substrate . glass substrates provide this advantage as well due to light transmission through the substrate . current multiwell configurations do not disclose this feature . iv . applications : using the multiwell mea as a high throughput instrument for the investigation of electrically active tissue ( including , but not limited to , neural and cardiac cells , cellular networks and tissue , spinal cultures and tissue , and muscle tissue ), which may have specific applications in drug discovery , basic science , epilepsy research , biosensing , high throughput network or tissue analysis . v . connectivity : the use of a pcb or glass substrate as a biochip packaging element and sensor substrate provides an avenue to create bottom side electrical contact pads for ‘ outside - world ’ connections or sockets . bottom side connectivity is made affordable because of via processing readily available in standard pcb and glass - via processes . additionally , bottom - side connector pads significantly reduce the size of the sensor array , as the connector / socket pads are now on a different plane than the electrodes and can lie directly under the sensor array ( outside the transparency region , if applicable ). bottom side metal patterning also creates an opportunity to create a metal heater surface just below the cell culture . a fully microfabricated , packaged and assembled multiwell mea is shown in fig1 ( right hand side ). the components of this system include a microfabricated mea that is constructed utilizing techniques described herein , such as a flip chip package including a glass die with a printed circuit board or a post processed pet - based pcb . this multiwell mea docks into a system that consists of electronics and signal processing units plus data management / software analysis functionalities . biological assays have been conducted using these meas to evaluate neuronal cytocompatibility . the various steps for these experiments are described below . 1 . to remove potential leachants from microfabrication , the devices were sequentially rinsed in sterile ethanol for 5 minutes , followed by rinsing in sterile di water for 5 minutes . the multiwell meas were then soaked in sterile di water for up to 72 hours ( with a change in di water every 24 hours ). the di water was then discarded and the meas were subjected to a rinse with sterile ethanol . this was followed by an 8 hour dehydration bake at 60 ° c . in an oven . this bake completed the steps for removing potential leachants from microfabrication and pcb manufacturing . 2 . before plating cells , the meas were subject to a 1 min oxygen plasma treatment . this process improves the adherence of cells to the meas . this was followed by the coating of 50 μg / ml poly - d - lysine for 2 hrs at 37 ° c . on the mea surfaces . neuronal cells from e18 cortices of rats were cultured on the meas with a density of 3 × 10 5 cells / cm 2 . cells were seeded at the appropriate density in 50 μl of neurobasal media directly on to the center of the mea devices . cells were allowed to attach for 30 min at 37 ° c ., then an additional 950 μl of neurobasal media was added to the device . devices with individual lids were placed inside petri dishes to minimize media evaporation . the devices with cells were studied using optical microscopy at 1 day , 4 days , 7 days and 21 days in - vitro for neurite outgrowth and general health of the culture . images of the cell cultures were captured . at 28 days in - vitro live / dead assays were performed in accordance with the procedures described by cullen et al . fig7 depicts optical and fluorescent microscopy images of cultures of neuronal cells in an individual well at 21 and 28 days in - vitro . the extracellular electrode activity from cultured neuronal cells is indicated in fig8 . this depicts activity from cells after stimulation was performed with and without the elimination of stimulus artifact .
8
a feedback control system is commonly used to control an output variable of a process or plant in the face of some disturbance . linear feedback control systems typically use combinations of proportional feedback control , integral feedback control , and derivative feedback control . feedback that is the sum of proportional plus integral plus derivative feedback is often referred to as pid control . the laplace transform of an output u ( s ) of a pid controller is given by : u  ( s ) = g  ( s )  e  ( s ) = [ k 1 + k 2 s + k 3  s ]  e  ( s ) ( 1 ) in the above equation , g ( s ) is the transfer function of the pid controller , e ( s ) is the controller input , u ( s ) is the controller output , k 1 is the coefficient for proportional feedback , k 2 is the coefficient for integral feedback , and k 3 is the coefficient for derivative feedback . the coefficients k i may be represented by a coefficient vector k , where k =[ k 1 , k 2 , k 3 ]. the vector k is commonly called a coefficient gain schedule ( cgs ). the values of the coefficients k used in the linear pid control system are based on a dynamic model of the plant . when the plant is unstable , nonlinear , and / or time - variant , then the coefficients in k are often controlled by an ai control system . fig1 shows a typical prior art ai control system 100 . an input y ( t ) of the control system 100 is provided to a plus input of an adder 104 and an output x ( t ) of a plant 110 is provided to a minus input of the adder 104 . an output of the adder 104 is provided as an error signal e ( t ) to an error signal input of a pid controller 106 . an output u ( t ) of the pid controller 106 is provided to a first input of an adder 108 and to a first input of a genetic algorithm ( ga ). a disturbance m ( t ) is provided to a second input of the adder 108 . an output u *( t ) of the adder 108 is provided to an input of the plant 110 . the plant 110 has a transfer function h ( s ) and an output x ( t ), where x ( t )⇄ x ( s ) ( where the symbol ⇄ denotes the laplace transform ) and x ( s )= g ( s ) u *( s ). an output of the genetic algorithm 116 is provided to an input of a fuzzy logic neural network ( fnn ) 118 and an output of the fuzzy neural network 118 is provided to a fuzzy controller ( fc ) 120 . an output of the fuzzy controller 120 is a set of coefficients k , which are provided to a coefficient input of the pid controller 106 . the combination of the genetic algorithm 216 and the entropy calculator 214 comprises a simulation system of control quality 215 . the combination of the fuzzy neural network 218 and the fuzzy controller 220 comprises a fuzzy logic classifier system flcs 219 . the combination of the plant 210 and the adder 208 comprises a disturbed plant model 213 . the disturbed plant signal u *( t )= u ( t )+ m ( t ), and the disturbance m ( t ) are typically unobservable . the error signal e ( t ) provided to the pid controller 106 is the difference between the desired plant output value y ( t ) and the actual plant output value x ( t ). the pid controller 106 is designed to minimize the error represented by e ( t ) ( the error being the difference between the desired and actual output signal signals ). the pid controller 106 minimizes the error e ( t ) by generating an output signal u ( t ) which will move the output signal x ( t ) from the plant 110 closer to the desired value . the genetic algorithm 116 , fuzzy neural network 118 , and fuzzy controller 120 monitor the error signal e ( t ) and modify the gain schedule k of the pid controller 106 in order to improve the operation of the pid controller 106 . the pid controller 106 constitutes a reverse model relative to the plant 110 . the genetic algorithm 116 evolves an output signal α based on a performance function ƒ . plural candidates for α are produced and these candidates are paired according to which plural chromosomes ( parents ) are produced . the chromosomes are evaluated and sorted from best to worst by using the performance function ƒ . after the evaluation for all parent chromosomes , good offspring chromosomes are selected from among the plural parent chromosomes , and some offspring chromosomes are randomly selected . the selected chromosomes are crossed so as to produce the parent chromosomes for the next generation . mutation may also be provided . the second - generation parent chromosomes are also evaluated ( sorted ) and go through the same evolutionary process to produce the next - generation ( i . e ., third - generation ) chromosomes . this evolutionary process is continued until it reaches a predetermined generation or the evaluation function ƒ finds a chromosome with a certain value . the outputs of the genetic algorithm are the chromosomes of the last generation . these chromosomes become input information a provided to the fuzzy neural network 118 . in the fuzzy neural network 118 , a fuzzy rule to be used in the fuzzy controller 120 is selected from a set of rules . the selected rule is determined based on the input information α from the genetic algorithm 116 . using the selected rule , the fuzzy controller 120 generates a gain schedule k for the pid controller 106 . the vector coefficient gain schedule k is provided to the pid controller 106 and thus adjusts the operation of the pid controller 106 so that the pid controller 106 is better able to minimize the error signal e ( t ). although the ai controller 100 is advantageous for accurate control in regions near linearized equilibrium points , the accuracy deteriorates in regions away from the linearized equilibrium points . moreover , the ai controller 100 is typically slow or even unable to catch up with changes in the environment surrounding the plant 110 . the pid controller 106 has a linear transfer function g ( s ) and thus is based upon a linearized equation of motion for the plant 110 . since the evaluation function ƒ used in the genetic algorithm 116 is only based on the information related to the input e ( t ) of the linear pid controller 106 , the controller 100 does not solve the problem of poor controllability typically seen in linearization models . furthermore , the output results , both in the gain schedule k and the output x ( t ) often fluctuate greatly , depending on the nature of the performance function ƒ used in the genetic algorithm 116 . the genetic algorithm 116 is a nonlinear optimizer that optimizes the performance function ƒ . as is the case with most optimizers , the success or failure of the optimization often ultimately depends on the selection of the performance function ƒ . the present invention solves these and other problems by providing a new ai control system 200 shown in fig2 . unlike prior ai control systems , the control system 200 is self - organizing and uses a new performance function ƒ which is based on the physical law of minimum entropy . an input y ( t ) of the control system 200 is provided to a plus input of an adder 204 and an output x ( t ) of a plant 210 is provided to a minus input of the adder 204 . an output of the adder 204 is provided as an error signal e ( t ) to an error signal input of a pid controller 206 and to an input of a fuzzy controller 220 . an output u ( t ) of the pid controller 206 is provided to a first input of an adder 208 and to a first input of an entropy calculator ( ec ) 214 . a disturbance m ( t ) is provided to a second input of the adder 208 . an output u *( t ) of the adder 208 is provided to an input of the plant 210 . the plant 210 has a transfer function h ( s ) and an output x ( t ), such that x ( s )= g ( s ) u *( s ), where x ( t )⇄ x ( s ). the output x ( t ) is provided to a second input of the entropy calculator 214 and to the minus input of the adder 204 . an output of the entropy calculator 214 is provided to an input of a genetic algorithm 216 and an output of the genetic algorithm 216 is provided to an input of a fuzzy logic neural network ( fnn ) 218 . an output of the fuzzy neural network 218 is provided to a rules selector input 222 of the fuzzy controller 220 . a coefficient gain schedule ( cgs ) output 212 of the fuzzy controller 222 is provided to a gain schedule input of the pid 206 . the error signal e ( t ) provided to the pid controller 206 is the difference between the desired plant output value y ( t ) and the actual plant output value x ( t ). the pid controller 206 is designed to minimize the error represented by e ( t ). the pid controller 206 minimizes the error e ( t ) by generating an output signal u ( t ) which will move the output signal x ( t ) from the plant 210 closer to the desired value . the fuzzy controller 220 monitors the error signal e ( t ) and modifies the gain schedule k of the pid controller 206 according to a fuzzy control rule selected by the fuzzy neural network 218 . the genetic algorithm 216 provides a teaching signal k t to the fuzzy neural network 218 . the teaching signal k t is a global optimum solution of a coefficient gain schedule k generated by the genetic algorithm 216 . the pid controller 206 constitutes a reverse model relative to the plant 210 . the genetic algorithm 216 evolves an output signal a based on a performance function ƒ . plural candidates for α are produced and these candidates are paired by which plural chromosomes ( parents ) are produced . the chromosomes are evaluated and sorted from best to worst by using the performance function ƒ . after the evaluation for all parent chromosomes , good offspring chromosomes are selected from among the plural parent chromosomes , and some offspring chromosomes are randomly selected . the selected chromosomes are crossed so as to produce the parent chromosomes for the next generation . mutation is also employed . the second - generation parent chromosomes are also evaluated ( sorted ) and go through the same evolutionary process to produce the next - generation ( i . e ., third - generation ) chromosomes . this evolutionary process is continued until it reaches a predetermined generation or the evaluation function ƒ finds a chromosome with a certain value . then , a component from a chromosome of the last generation becomes a last output , i . e ., input information α provided to the fuzzy neural network 218 . in the fuzzy neural network 218 , a fuzzy rule to be used in the fuzzy controller 220 is selected from a set of rules . the selected rule is determined based on the input information α from the genetic algorithm 216 . using the selected rule , the fury controller 220 generates a gain schedule k for the pid controller 206 . this is provided to the pid controller 206 and thus adjusts the operation of the pid controller 206 so that the pid controller 206 is better able to minimize the error signal e ( t ). the fitness function ƒ for the genetic algorithm is given by f = min    s  t ( 2 ) were  s  t = (  s c  t -  s u  t ) ( 3 ) the quantity ds u / dt represents the rate of entropy production in the output x ( t ) of the plant 210 . the quantity ds c / dt represents the rate of entropy production in the output u ( t ) of the pid controller 206 . dynamic stability properties of the plant 210 near an equilibrium point can be determined by use of lyapunov functions . let v ( x ) be a continuously differentiable scalar function defined in a domain d ⊂ r n that contains the origin . the function v ( x ) is said to be positive definite if v ( 0 )= 0 and v ( x )& gt ; 0 for x ≠ 0 . the function v ( x ) is said to be positive semidefinite if v ( x )≧ 0 for all x . a function v ( x ) is said to be negative definite or negative semidefinite if − v ( x ) is positive definite or positive semidefinite , respectively . the derivative of v along the trajectories { dot over ( x )}= ƒ ( x ) is given by : v  ( x ) = ∑ i = 1 n   ∂ v ∂ x i  x . i = ∂ v ∂ x  f  ( x ) ( 4 ) where ∂ v /∂ x is a row vector whose ith component is ∂ v /∂ x i and the components of the n - dimensional vector ƒ ( x ) are locally lipschitz functions of x , defined for all x in the domain d . the lyapunov stability theorem states that the origin is stable if there is a continuously differentiable positive definite function v ( x ) so that v ( x ) is negative definite . a function v ( x ) satisfying the conditions for stability is called a lyapunov function . calculation of the lyapunov dynamic stability and entropy production for a closed nonlinear mechanical system is demonstrated by using the holmes - rand ( duffing - van der pol ) nonlinear oscillator as an example . the holmes - rand oscillator is described by the equation : { umlaut over ( x )}+ ( α + β x 2 ) { dot over ( x )}− γx + x 3 = 0 ( 5 ) where α , β , and γ are constant parameters . a lyapunov function for the holmes - rand oscillator is given by : v = 1 2  x . 2 + u  ( x ) ,  where    u = 1 4  x 4 - 1 2  γ   x 2 ( 6 ) entropy production d i s / dt for the holmes - rand oscillator is given by the equation :  i  s  t = ( α + β   x 2 )  x . 2 ( 7 ) equation 5 can be rewritten as : x ¨ + ( α + β   x 2 )  x . + ∂ u ∂ x = 0 ( 8 ) after multiplying both sides of the above equation by { dot over ( x )}, then dv / dt can be calculated as :  v  t = x ¨  x . + ∂ u ∂ x  x . = - 1 t   i  s  t ( 9 ) an interrelation between a lyapunov function and the entropy production in an open dynamic system can be established by assuming a lyapunov function of the form v = 1 2  ∑ i = 1 6   ( q i 2 + s 2 ) ( 10 ) where s = s u − s c and q i =( α , γ , β , { dot over ( α )},{ dot over ( γ )},{ dot over ( β )}). it is possible to introduce the entropy function s in the lyapunov function v because entropy s is also a scalar function of time . differentiation of v with respect to time gives :  v  t = ∑ i = 1 6   q i  q . i + s  s . ( 11 ) in this case , q i = ψ i ( q i , τ , t ), s = s u − s c , { dot over ( s )}={ dot over ( s )} u −{ dot over ( s )} c and thus :  v  t = ∑ i = 1 6   q i  ϕ i  ( q i , τ , t ) + ( s u - s c )  (  s u  t -  s c  t ) ( 12 ) a special case occurs when β = 0 and the holmes - rand oscillator reduces to a force - free duffing oscillator , wherein :  i  s  t = - α   x . 2   ( duffing   oscillator ) ( 13 ) and the entropy production is given by :  i  s  t = 1 t  ( x 2 - 1 )  x . 2   ( van   der   pol   oscillator ) ( 15 ) for a micro - mobile robot in fluid , a mechanical model is given by : m 1  x ¨ 1 + c d  ρ 2  a 1   x . 1   x . 1 + k 1  ( x 1 - x 0 - l 1  θ 0 ) - k 2  ( x 2 - x 1 - l 2  θ 1 ) = 0 ( 16 ) m 2  x ¨ 2 + c d  ρ 2  a 2   x . 2   x . 2 + k 2  ( x 2 - x 1 - l 2  θ 1 ) - k 3  ( x 3 - x 2 - l 3  θ 2 ) = 0 ( 17 ) m 3  x ¨ 3 + c d  ρ 2  a 3   x . 3   x . 3 + k 3  ( x 3 - x 2 - l 3  θ 2 ) = 0 ( 18 ) where : θ n + 1 = - 1 2  θ n + 3 2  1 l n + 1  ( x n + 1 - x n ) ( 19 ) values for a particular micro - mobile robot are given in table 1 below . entropy production for the micro - mobile robot is given by the equation :  s i  t = ∑ n = 1 3   c d   ρ 2  a n   x . n   x . n 2 ( 20 ) and the lyapunov function is given by : v = ∑ i = 1 3   m i  x . i 2   ρ 2 + ∑ i = 1 3   k i  ( x i - x i - 1 - l i  θ i - 1 ) 2 2 + s 2 2 ( 21 ) where s = s i − s c and s c is the entropy of a controller with torque τ . the necessary and sufficient conditions for lyapunov stability of a plant is given by the relationship : ∑ i     q i  ϕ i  ( q i , τ , t ) & lt ; ( s u - s c )  (  s c  t -  s i  t ) ,  s c  t & gt ;  s i  t  u ( 22 ) according to the above equation , stability of a plant can be achieved with “ negentropy ” s c ( by brillouin &# 39 ; s terminology ) where a change of negentropy ds c / dt in the control system 206 is subtracted from a change of entropy dsi / dt in the motion of the plant 210 . the robust ai control system 200 provides improved control of mechanical systems in stochastic environments ( e . g ., active vibration control ), intelligent robotics and electro - mechanical systems ( e . g ., mobile robot navigation , manipulators , collective mobile robot control ), bio - mechanical systems ( e . g ., power assist systems , control of artificial replaced organs in medical systems as artificial lung ventilation ), micro electromechanical systems ( e . g ., micro robots in fluids ), etc . the genetic algorithm realizes the search of optimal controllers with a simple structure using the principle of minimum entropy production . the fuzzy neural network controller offers a more flexible structure of controllers with a smaller torque , and the learning process produces less entropy . the fuzzy neural network controller gives a more flexible structure to controllers with smaller torque and the learning process produces less entropy than a genetic analyzer alone . thus , an instinct mechanism produces less entropy than an intuition mechanism . however , necessary time for achieving an optimal control with learning process on fuzzy neural network ( instinct ) is larger than with the global search on genetic algorithm ( intuition ). realization of coordinated action between the look - up tables of the fuzzy controller 220 is accomplished by the genetic algorithm and the fuzzy neural network . in particular , the structure 200 provides a multimode fuzzy controller coupled with a linear or nonlinear neural network 218 . the control system 200 is a realization of a self - organizing ai control system with intuition and instinct . in the adaptive controller 200 , the feedback gains of the pid controller 210 are changed according to the quantum fuzzy logic , and approximate reasoning is provided by the use of nonlinear dynamic motion equations . the fuzzy tuning rules for the gains k i are shaped by the learning system in the fuzzy neural network 218 with acceleration of fuzzy rules on the basis of global inputs provided by the genetic algorithm 216 . the control system 200 is thus a hierarchical , two - level control system that is intelligent “ in small .” the lower ( execution ) level is provided by a traditional pid controller 206 , and the upper ( coordination ) level is provided by a kb ( with fuzzy inference module in the form of production rules with different model of fuzzy implication ) and fuzzification and de - fuzzification components , respectively . parallel soft computing for fuzzy control is preferably based on quantum computing . the genetic algorithm 216 simulates an intuition mechanism of choosing the optimal structure of the pid controller 206 by using the fitness function , which is the measure of the entropy production , and the evolution function , which in this case is entropy . one embodiment of the self - organizing control system 200 is advantageously used in the simulation of a robot unicycle 300 shown in fig3 and 4 . the unicycle 300 comprises a motor 304 driving a weighted yoke 302 . the motor 304 and a rate gyro sensor 306 are attached to a frame 318 . a right closing link mechanism 308 is attached between the frame 318 and an axle of a wheel 312 . a left closing link mechanism 316 is attached between the frame 318 and the axle of the wheel 312 . a motor 310 drives the right link mechanism 308 and a motor 314 drives the left link mechanism 316 . a unicycle is an inherently unstable nonlinear system and simultaneous control of both longitudinal and lateral stability is needed to maintain the unicycle &# 39 ; s postural stability . it is an unstable problem in three dimensions . however , a rider can achieve a postural stability on a unicycle , keep the wheel speed constant and change the unicycle &# 39 ; s posture in the yaw direction by using a flexible body , good sensory systems , skill and intelligence . thus , the unicycle is a reasonable testbed for the control system 200 . analysis of the control system 200 is based on a thermodynamic model representation of the dynamic equation of motion for the plant , described as an open dynamic system . accordingly , a mechanical model with dissipative processes for the plant in 210 for a unicycle is given by the equation : [ q ¨ λ ] = [ m  ( q ) - ∂ c ∂ q e  ( q ) 0 ] - 1   [ τ - b  ( q )  [ q . , q . ] - c  ( q )  [ q . 2 ] - d  ( q )  [ q . ] - g  ( q ) - f  ( q , q . ) ] ( 23 ) a thermodynamic description of the production of entropy in the control system 200 used in a unicycle can be expressed as : [  s u  t  sc  t  ] = [ m  ( q ) 0 1 0 ] - 1   [ τ d - b  ( q )  [ q . , q . ] - c  ( q )  [ q . 2 ] - d  ( q )  [ q . ] - g  ( q ) - f  ( q , q . ) ]  [ q . 0 ]  where τ =( τ 105 , 0 , 0 , 0 , 0 , τ θ2 , 0 , τ θ4 , τ n ) and ds c / dt is the rate of entropy production in the pid controller 206 and dsu / dt is the rate of entropy production of the plant 210 ( the unicycle ). e ( q ) is a 4 × 4 coefficient matrix for acceleration . f ( q ,{ dot over ( q )}) is a 4 dimensional vector containing coriolis and centrifugal terms . both e and f are determined from the constraint equations on a closed - link loop acceleration . the matrix ∂ c /∂ q is a 4 × 4 matrix determined by constraint equations of the two closed link loops . the quantity λ is a 4 - dimensional vector of lagrangian multipliers ; m ( q ) is a 9 × 9 matrix of masses ; b ( q ) is a 9 × 36 matrix of coriolis coefficients ; [{ dot over ( q )},{ dot over ( q )}] is a 36 × 1 vector of velocity products given by ({ dot over ( q )}, { dot over ( q )})=[{ dot over ( ψ )},{ dot over ( α )}, { dot over ( ψ )}{ dot over ( γ )}, . . . { dot over ( θ )} 4 { dot over ( η )}] t ; c ( q ) is a 9 × 9 matrix of centrifugal coefficients ; [{ dot over ( q )} 2 ] is a 9 × 1 vector given by ({ dot over ( ψ )} 2 ,{ dot over ( α )} 2 ,{ dot over ( γ )} 2 , { dot over ( β )} 2 ,{ dot over ( θ )} 1 2 ,{ dot over ( θ )} 2 2 ,{ dot over ( θ )} 3 2 ,{ dot over ( θ )} 4 2 , { dot over ( η )} 2 ) t ; d ( q ) is a 9 × 9 matrix of friction coefficients ; [{ dot over ( q )}]=({ dot over ( ψ )},{ dot over ( α )},{ dot over ( γ )}, { dot over ( β )},{ dot over ( θ )} 1 ,{ dot over ( θ )} 2 ,{ dot over ( θ )} 3 ,{ dot over ( θ )} 4 , { dot over ( η )}) t ; and g ( q ) is a 9 × 1 vector of gravity terms . the state vector q is defined as the vector [ q ]=( ψ , α , γ , β , θ 1 , θ 2 , θ 3 , θ 4 , η ) t . the vector τ d describes the dissipative parts of the control torque on the unicycle plant . stability analysis of the unicycle as a nonlinear plant 210 is accomplished , as before , by using asymptotic methods with lyapunov functions and methods of qualitative physics based on correlation between lyapunov and production entropy functions . the new approach for definition of the lyapunov function described above is used . a lyapunov function for the system is given by : v = 1 2  ( ∑ i = 1 n   q i 2 + s 2 ) ( 25 ) where s = s u − s c and q i is a generalized coordinate of the plant model . the input u * is a random signal produced by the sum of the control signal u and the disturbance ( noise ) m ( t ). calculation of entropy production performed in the entropy calculator 214 . the output of the entropy calculator is the full entropy production of the dynamic system , ds / dt , and the minimum of this function is used as a fitness function in the genetic algorithm 216 . the output of the genetic algorithm 216 is an optimal gain structure k t for the pid controller 206 . the structure k t is used as the teaching signal for the fuzzy neural network 218 in the flcs 219 . the flcs 219 comprises the fuzzy neural network 218 and the fuzzy controller 220 . the fuzzy neural network 218 generates a knowledge base ( kb ) comprising a look - up table of production rules by using a neural network learning process . the kb output of the fuzzy neural network 218 comprises a look - up table of fuzzy rules ( lptr ) as input for the fuzzy controller 220 . the kb provides for self - organization of the fuzzy controller 220 in the flcs 219 . the flcs 219 provides the adaptation process of an intelligent fuzzy controller 220 structure to the random disturbance m ( t ) in the control signal u *( t ). the output coefficient gain schedule ( cgs ) of the fuzzy controller is provided as an input to the pid - controller to program the coefficient gains k i in accordance . this approach differs from procedural design of fuzzy hybrid pid - type controllers . this design method provides new concepts of a robust structure controller 210 with optimal learning , with minimum entropy production in the control process , and self - organization of the kb structure of the fuzzy controller 220 . the genetic algorithm 216 is preferably a massy genetic algorithm with elite strategy . genetic operators have the following parameters . for the selection , a roulette method ( reduce rate = 5 ) is used . a reproduction operator replaces some chromosome generations . crossover ( with a probability of 0 . 64 ) and mutation ( with a probability of 0 . 08 ) determines , by random numbers , every chromosome &# 39 ; s bit ( i . e ., whether crossover and / or mutation occur ). genes encode each parameter from the interval [ 0 , 10000 ] and the number of used chromosomes is 100 . the fuzzy neural network 218 is preferably a feedforward structure network with four layers . the structure of the fuzzy neural network 218 is preferably similar to the structure of the fuzzy controller 220 . the first layer in the fuzzy neural network 218 is comparable to fuzzification in the fuzzy controller 220 . the second layer in the fuzzy neural network 218 is comparable to an “ if . . . ” part in the inference mechanism of the fuzzy controller 220 . the third layer in the fuzzy neural network is comparable to a “ then . . . ” part in the inference mechanism of the fuzzy controller 220 . finally , the fourth layer in the fuzzy neural network is comparable to a de - fuzzification operator structure in the fuzzy controller 220 . the structure of the fuzzy neural network 218 may use a max - min method for the fuzzy inference and the fuzzy production rules . the membership functions of the fuzzy neural network 218 are preferably optimized by the back - propagation method with minimum information entropy as the criteria of accuracy . in one embodiment used with a unicycle simulation , the fuzzy neural network 218 has 2 inputs , 2 hidden layers ( 14 units in the first layer and 49 units in the second layer ), 1 output , 7 linguistic terms for error and change of error , and 49 rules in the knowledge base . one aspect of the simulation is a comparison of results between the genetic algorithm 216 and the fuzzy neural network 218 for the torque and pid controller gains with minimum entropy production . fig5 is a graph 500 of angle ( in radians ) as a function of time ( in seconds ) for a simulated unicycle with an ai controller 200 . the graph 500 shows a curve 502 showing the angle of the rotor , a curve 504 showing the angle of the wheel , a curve 506 showing yaw of the unicycle , a curve 508 showing roll of the unicycle , and a curve 510 showing pitch of the unicycle . fig6 is a graph 600 of angular velocity ( in radians / second ) as a function of time ( in seconds ). the graph 600 shows a curve 602 showing the angle of the rotor , a curve 604 showing the angle of the wheel , a curve 606 showing yaw of the unicycle , a curve 608 showing roll of the unicycle , and a curve 610 showing pitch of the unicycle . fig7 is a graph showing a phase surface for the roll angle ( in radians ) and angular velocity ( in radians / second ) as a result of the simulation for the posture control performed by the robot unicycle in fig3 . fig8 is a graph showing a phase surface for the pitch angle ( in radians ) and angle speed ( in radians / second ) as a result of the simulation for the posture control performed by the robot unicycle in fig3 . fig9 is a graph 900 showing the time changes in angle ( in radians ) as a function of time ( in seconds ) for each part in the unicycle as a result of the simulation for the posture control using the methods in the prior art . the graph 900 includes a curve 902 showing the angle of the rotor , a curve 904 showing the angle of the wheel , a curve 906 showing yaw of the unicycle , a curve 908 showing roll of the unicycle , and a curve 910 showing pitch of the unicycle . fig1 is a graph showing the time changes in angular velocity ( in radians / second ) versus time ( in seconds ) for each part of the unicycle as a result of the simulation for the posture control in the prior art . the graph 1000 includes a curve 1002 showing the angle of the rotor , a curve 1004 showing the angle of the wheel , a curve 1006 showing yaw of the unicycle , a curve 1008 showing roll of the unicycle , and a curve 1010 showing pitch of the unicycle . fig1 is a graph showing a phase surface for the roll angle and angle speed as a result of the simulation for the posture control in the prior art which is performed by the robot unicycle in fig3 . fig1 is a graph 1200 illustrating a phase surface for the pitch angle and angle speed as a result of a simulation of the robot unicycle in fig3 using the posture control in the prior art . fig1 is a graph 1300 illustrating another example of the simulation for the posture control indicating the effect of the control method in the present invention . the graph 1300 is a plot of angle ( in radians ) versus time ( in seconds ). the graph 1300 includes a curve 1302 showing roll without control , a curve 1304 showing roll with control , a curve 1306 showing pitch without control , and a curve 1308 showing pitch with control . although the foregoing has been a description and illustration of specific embodiments of the invention , various modifications and changes can be made thereto by persons skilled in the art , without departing from the scope and spirit of the invention as defined by the following claims .
6
the method of the present invention may be separated into two general steps , the laminating step illustrated in fig1 and the roll forming step illustrated in fig2 . the laminated strip 10 comprised of a metal strip 11 and fabric strip 12 is shown in fig3 . the final rail product 13 is shown in fig4 . in the laminating step an adhesive material 14 is applied by a flow coating nozzle 15 to the metal strip 11 fed from a roll 16 . the bonding together of the metal strip and the fabric strip is effected by placing an adhesive material on the metal strip and feeding the fabric strip 12 into overlying relation to and between the laminating rollers 17 , 18 . the resulting laminated strip 10 is then temporarily stored on a take - up roll 19 . the rollers 17 , 18 , shown in fig2 are grooved to provide proper location of the fabric strip 12 on the metal strip 11 so that the fabric does not interfere with the subsequent formation of the rail . the groove in the upper laminating roller 17 has a width approximately the same as the width of the fabric strip 12 and a depth sufficient to accomodate the fabric . the fabric strip 12 , as shown in fig3 and various other figures , is located on the metal strip 11 between two reference lines x and y adjacent the location along which the metal strip is to be bent in forming interlocking u - shaped lockseam parts of the lockseam . the location of the fabric is important , as will become apparent in the description of the roll forming step . in the roll forming step , the laminated strip 10 is fed by feeding rollers 23 to a first set of roller dies 24 - 30 which gradually bend the laminated strip 10 into a circular but open tube . the ends of the rollers 23 are knurled and of a diameter to press against the upper and lower surfaces of the metal strip 11 outwardly of the reference lines x and y . the two knurled roller ends produce a knurling or roughening of the metal strip adjacent its right and left longitudinal edges 21 and 22 where the metal extends beyond the fabric strip 12 and is exposed . this roughening assists in producing a tight slip - free lockseam in the final lockseam forming step described below . fig6 - 12 illustrate the progression of the laminated strip 10 as it is roll formed into a circular open tube . in the progressive rolling of the laminated strip 10 , the longitudinally extending and exposed portions 31 and 32 of the metal strip adjacent the edges 21 and 22 are first both bent upwardly to form bends 33 and 34 adjacent the right and left edges 21 and 22 . it will be noticed from fig6 that the bend 34 is spaced at a distance further from the associated longitudinal edge 22 of the metal strip than is the bend 33 from its associated edge 21 . furthermore , the strip outwardly of the bend 34 is folded back along another bend 35 to form a step 36 . with reference to fig7 - 12 , it will be seen that the bend 33 is continued until a first u - shaped lockseam part 37 is formed . also , the opposite longitudinal portion 32 of the metal strip beyond the bend 34 is folded down to form a bend 39 and this bend 39 is continued until a second u - shaped lockseam part 40 is formed . as also noted from these fig7 - 12 , the first u - shaped lockseam part 37 faces inwardly of the rail , whereas the second u - shaped lockseam part 40 faces outwardly of the rail . also , as shown in fig1 , 12 and 13 , the lockseam part 40 is disposed laterally outwardly of the left edge 41 of the fabric with the fabric extending down the step 36 and the edge 41 lying along the bottom of the step . in contrast , the right edge 42 of the fabric extends to the bend 33 of the first lockseam part . as the laminated strip 10 is fed through the roller dies 24 - 30 , a compression of the laminated strip is performed in addition to the roll forming operation . in particular , the fabric 12 is gradually compressed and actually embossed into the metal strip 11 . this is shown in a greatly exagerated state in fig4 . the embossing is necessary to give the finished rail 13 a thickness dimension which will allow it to be used with existing metal rail hardware and processing equipment . in the presently preferred embodiment , the metal strip is approximately 0 . 018 &# 34 ; thick and the fabric approximately 0 . 055 &# 34 ; thick when glued together in the apparatus of fig1 . this forms a total assembly which is 0 . 080 &# 34 ; thick or greater . if this thickness is not subsequently reduced , it would not be able to be cut off or fabricated in standard processing equipment . therefore , the process of the present invention includes the step of thoroughly compressing the fabric so as to partly emboss it into the metal strip . the compressing is sufficient to actually emboss the heavier threads into the metal substrate and generally produce an overall laminate thickness of about 0 . 06 &# 34 ; as it exits from the rollers 24 and a final thickness of about 0 . 04 &# 34 ; or smaller as it exits from the rollers 30 . at the end of the roll forming and compression operations as performed by the first set of roller dies 24 - 30 , the open tube shape of the rail permits feeding of the rail over a mandrel 43 shown in fig1 . this mandrel is mounted at one end on the mandrel support 44 , shown in fig2 and extends inside the rail from just after the last roller die 30 , through a second set of roller dies 45 - 48 and then through a set of lockseam compression roller dies 49 - 52 . the mandrel 43 provides an anvil against which the lockseam roller dies 49 - 52 act to compress the lockseam to close it . in order to counteract friction between the mandrel 43 and the rail , wheels 43 &# 39 ; are provided . these wheels run against the top and bottom inside surfaces of the rail in opposition to the lockseam roller dies 49 - 52 . the lockseam parts are shown in fig1 as they appear just before being closed by the lockseam roller dies 49 - 52 . although , in the preferred embodiment , the edge 42 of the fabric should align at x ( fig3 ) in an area generally beginning at the point of the lockseam bend 33 , it can extend for as much as 45 degrees into the arc of this bend . in this regard , the initial positioning of the fabric strip 12 on the metal strip il is important . if the fabric extends significantly beyond points x then it will extend beyond the bend 33 and prevent a proper lockseam from being formed . if the fabric falls short of this point , particularly x , then metal will be exposed along the lockseam which would detract from the appearance of the rail . similarly , in the case of the edge 41 , it is very critical that it does not extend beyond the point y ( fig3 ). this edge should align with the bottom of the step 36 and be located inwardly of the second lockseam part 40 . this insures that the fabric does not enter the lockseam area at all and yet is positioned relative to the lockseam in a manner such as to minimize the probability of either frayed edges or exposed metal . a lockseam 53 is actually formed by the lockseam compression roller dies 49 - 51 by progressively closing the lockseam parts 37 and 40 as shown in fig1 , 15 and 16 . these views show the lockseam at the first and second of compression roller dies 49 and 50 while fig1 shows the rail at the subsequent tape applicator device 54 . the shape of the rail at the last roller die 52 of the lockseam roller dies is basically the same as at the tape applicator device 54 . in the presently preferred embodiment , the final construction of the lockseam 53 as shown in fig1 will have the edge 41 of the fabric at the bottom of the step 36 and the edge 42 of the fabric abutting the fabric disposed along the step . with this construction , no metal is exposed along the lockseam 53 . furthermore , with this positioning of the edges 41 and 42 of the fabric , the lockseam is formed with roughened metal to metal contact along three surfaces of the u - shaped lockseam parts 37 and 40 , and no fabric extends into the lockseam proper . after a closed tubular rail 55 is formed , adhesive tape 56 is applied and hot melted over the lockseam and to areas of the rail 55 which will be significantly bent in the final forming step . strip heaters 56 are included as part of the tape applicator device 54 to melt the adhesive and capture any fibers which might be frayed along the lockseam or become frayed or otherwise exposed in the final forming step or tend to pull away from the rail surface . more particularly , the adhesive tape 56 applied along the lockseam and the areas which will be subsequently formed into the sharply bent concave areas along the top and bottom of the rail where fabric might become frayed or loose because of the concave bends . this adhesive is , however , not discernible on the finished rail . in the final forming step , crushing roller dies 57 - 59 crush the closed tubular rail 55 into the final form 13 shown in fig4 . as here shown and as shown in fig1 , the final rail structure has convex sides and concave top and bottom with the lockseam located internally of the concave top also , the adhesive tape 56 is located within the concave top and bottom to keep the fabric in place . progressive cross - sections of the rail at roller dies 57 and 59 are shown in fig1 and 18 . after final forming , the rail 13 is cut to desired length by a cut - off machine 60 . in order to protect the appearance of the fabric the entire process must be performed without any external lubrication on the rail . in the absence of such lubrication the inherent slipperiness of the fabric strip 12 provides sufficient lubrication between the forming rollers and the rail . the rail 13 produced by this process has fabric 12 which completely surrounds the metal 11 leaving no seams which would detract from the appearance .
8
because of the intensive competition in the market , every internet service provider ( isp ) is looking for opportunities to enhance its service offerings to stay competitive . this invention discloses a service architecture that allows an isp to deploy enhanced information services for its customers without incurring high deployment cost . in this invention , the functions of an ivr system are split into two parts , i . e ., a front end and a back end . the front end is populated at the pops of an isp and the back end is located at anywhere in the internet . particularly , the invention lets an isp provide the functions of telephony ( e . g ., call handling and touch - tone detection ) and audio ( e . g ., playing audio files , voice recording , and text - to - speech conversion ) at every pop , and puts the software components ( which interact with users ) in the internet . a software component , called an interactive response agent ( ira ) located in the internet interacts with users . an ira has two roles : one is to interact with users who are using touch - tone phones , and the other is to interface with application servers such as e - mail servers , voicemail servers , web servers , database servers etc . on users behalf . if the information retrieved by an ira is in text format , it will be sent to the pop where the user called in , converted into synthesized speech by text - to - speech converters , and played back to users over telephone lines . if the retrieved information is an audio file , as in a phonemail system , the information will be sent to the pop , converted into a form for playing back over a phone line . the present invention not only telephone - enables application servers , it also provides a two - fold advantage to an isp &# 39 ; s corporate customers . on one hand , the corporate customers of an isp can easily enable their end users to access corporate information without buying expensive ivr units . on the other hand , corporations can have full control of iras which retrieve corporate information on behalf of end users . what a corporate customer needs is an ira that interfaces with the isp &# 39 ; s pop . in general , different application servers are accessed by different protocols , e . g . http for web servers .) the application - dependent ira can be provided by an isp , purchased from third party vendors , or developed by corporate i / s staff . for popular information servers such as lotus notes e - mail servers , microsoft exchange servers , and web servers , third party vendors can help to develop the corresponding ira components . for corporate proprietary database applications , the corporate has to develop its own ira which interfaces with isp &# 39 ; s pop . in order to make the components developed by various vendors interoperable , a set of api ( application programming interface ) between pops and iras can be standardized . fig2 shows a system diagram for the present invention which takes a user - oriented approach to distributed ivr systems . in fig2 , like reference numerals represent the same component as in fig1 . fig2 shows a telephone 105 connected to a pstn 110 which connects to a local point - of - presence ( pop ) 220 of an internet service provider ( isp ). the pop 220 includes a front end ( fe ) manager 222 which is a call handling routine , users profile 224 , connection functions 226 , audio functions 126 , and a telephony interface 128 for interfacing with the pstn 110 . the behavior of the fe manager 222 is controlled by a state machine 300 shown in fig3 a . one major component in the present invention is the users profile 224 which contains , among other things , authentication passwords and billing information , a table describing the service items that the user has subscribed to and the networic addresses of the interactive response agents providing those services for each subscriber of the isp . when a subscriber of the isp called a local pop 220 , the phone call will be answered by a front end ( fe ) manager 222 . after the caller is authenticated the caller will be able to specify the desired service item , and the fe manager 222 will establish a session and communicate with the corresponding ira through connection functions 226 over the internet 150 . in the present invention , each subscriber is able to maintain his / her profile and add / delete a pair of a service item and the corresponding network address of the ira handling that service . moreover , when the caller is done with a service , the session between the fe manager 222 and the ira manager 262 will be terminated and the caller will have an opportunity to select another service item in his / her profile . hence the front end at a pop is not statically tied with a particular ira during a phone call , i . e . a dynamically reconfigurable capability . the detailed algorithms of a fe manager and an ira manager to achieve this capability are described in fig3 a - 3c and 4 a - 4 b . the connection functions 226 are a set of api for the fe manager 222 to establish a session and have a two - way communication with ira managers , e . g . ira manager 262 and 272 . the connection functions 226 include api calls to send a session request , send dtmf a digit , send an audio file , receive a text message , receive an audio file , and terminate a session . the fe manager 222 is further interfaced with the internet 150 to which ira 260 , ira 270 , application server 280 and application server 290 are connected . the ira 260 and 270 are agents working between the fe manager and back end application servers such as e - mail servers , financial database servers , web servers , etc . an ira gives the caller the feeling of interacting with an ivr system . an ira can be specialized in interfacing with a specific type of servers . an ira can also implement multiple server interfaces for communicating with different types of application servers . for example , application server 280 can be a lotus notes server ; ira 270 has the api to communicate with it . application 290 can be a computer running web server , pop3 email server and news server ; ira 270 has the set of apis to communicate with multiple application servers . in a preferred embodiment , this ira 270 has a security profile as described in u . s . patent application ser . no . 09 / 239 , 322 to liu entitled “ security profile for web browser ” which is filed on the same day as this disclosure and is herein incorporated by reference in its entirety . in fig2 , ira 260 contains an ira manager 262 , connection functions 264 , and server interface 266 for interfacing with server 280 . the behavior of the ira manager 262 is controlled by a state machine 400 , to be detailed in fig4 a . the fe manager 222 interacts with the ira manager 262 by a set of api as defined in connection functions 226 and 264 over the internet 150 . the connection functions 264 are a set of api calls for the ira manager 262 to establish a session and have a two - way communication with fe manager 222 . the connection functions 264 include api calls to accept a session request , receive a dtmf digit , receive an audio file , send a text message , send an audio file , and send end - of - service request . fig3 a is the state transition diagram 300 of the fe manager 222 . the fe manager 222 has 3 possible states , namely the idle state 310 , the active state 320 , and the pass - through state 350 . initially the fe manager stays in the idle state 310 . when a new phone call is answered , the fe manager 222 moves to the active state 320 which is detailed by the flowchart in fig3 b . the fe manager 222 stays in the active state until either the phone call is hung up , at which point the fe manager goes back to the idle state 310 , or until a session is established with an ira , at which point the fe manager 222 moves to the pass - through state 350 , detailed in fig3 c . the fe manager 222 stays in the pass - through state until either the phone call is hung up , at which point it goes to the idle state 310 , or until the session with the ira is terminated , at which point it goes back to the active state 320 . a session between the fe manager 222 and the ira manager 262 is established after the ira manager 262 sends the fe manager 222 an acknowledgment in response to a request sent by the fe manager 222 . the session is terminated when the ira manager 262 sends an end - of - service request to the fe manager 222 . fig3 b shows a flowchart describing the fe manager 222 in the active state 320 . the fe manager 222 , starting at step 322 and authenticate the caller in step 324 , where the caller is prompted to supply the user id and personal identification number ( pin ) by pressing touch - tone pads on the phone . the user id and pin is checked against the users profile 224 in step 326 . if authentication is successful , the fe manager 222 will in step 328 obtain a service menu from the user &# 39 ; s profile stored in users profile 224 . if the authentication is not successful , the fe manager 222 will in step 329 obtain a service menu from the public profile stored in users profile 224 . the obtained service menu is then presented to the caller in step 330 . the fe manager 222 then obtains the service item chosen by the caller in step 332 , and finds the network address of the ira corresponding to the caller &# 39 ; s selection in step 334 . the fe manager 222 then tries to establish a session with the ira in step 336 and checks the successfulness in step 338 : if the session is successfully established , the fe manager 222 transits to the pass - through state 350 and enters step 352 ( see fig3 c .) if the session is not successfully established , fe manager 222 will report to the caller in step 340 that the chosen ira is not available , and go back to step 330 . it is possible that the fe manager 222 enters the active state 320 from the pass - through state 350 in step 342 . in such a case , the fe manager 222 will in step 344 inform the caller that he / she is back to the main service menu at the front end and go to step 330 . fig3 c shows a flowchart for the fe manager 222 in the pass - through state 350 where a session is already established with an ira . the fe manager 222 starts at step 352 and checks if it receives an end - of - service ( eos ) request from the ira in step 354 . if eos is received , the fe manager 222 will disconnect the session with the ira and goes to step 342 , an entry point to the flowchart of the active state in fig3 b . if no eos is received , the fe manager 222 will check if the telephony interface 128 receives dtmf tones from the caller in step 356 . if any dtmf tone is received , the fe manager 222 will send the dtmf digit , converted from tones by the telephony interface 128 , to the ira in step 358 . then the fe manager 222 will check if any data ( text or audio ) is received from the ira in step 360 . if there is data received from the ira , the fe manager 222 will invoke the appropriate converters , such as text - to - speech converters and audio layers , and present the information to the caller through the telephony interface 128 in step 362 . if no data is received from the ira in step 360 , the fe manager 222 will go back to step 354 . fig4 a is a state transition diagram 400 for an ira manager 262 . an ira manager 262 has 2 possible states , namely the idle state 410 and the active state 420 . initially ira manager 262 stays in the idle state 410 until it receives a request to establish a session from a fe manager , at which point it establishes a session with the requesting fe manager by sending back an acknowledgment and goes to the active state 420 , detailed in fig4 b . ira manager 262 will stay in the active state 420 until the caller wants to end the session , at which point the ira manager 262 will send end - of - service ( eos ) request to the fe manager 222 , terminate the session , and go back to the idle state 410 . fig4 b shows a flowchart describing the ira manager 262 in the active state 420 . the ira manager 262 starts at step 422 and establishes a session with the requesting fe manager 222 using connection functions 264 in step 424 . depending on whether the underlined service is public or personal , the ira manager 262 may authenticate the user in step 426 by prompting the user to supply user &# 39 ; s account number and password . for example , e - mail is a personal service . the ira manager 262 then enters a loop where it interacts with an application server such as the application server 280 to obtain the data that the user needs in step 428 using the application server interface 266 . the ira manager 262 then formats received application data , appends service menu for user &# 39 ; s next selection , and sends data to the fe manager 222 in step 430 . the ira manager 262 receives user &# 39 ; s selection from the fe manager 222 in step 432 and checks if the user &# 39 ; s selection correspond to ending the service in step 434 . if the user &# 39 ; s selection is not to end the service , the ira manager 262 goes back to step 428 to obtain application data . the ira manager 262 exits the loop at step 434 when it finds that the user selects to end the session . in such a case , the ira manager 262 sends an end - of - service ( eos ) request to the fe manager 222 in step 436 , tears down the session at step 438 , and proceeds to the idle state at step 410 . the present invention discloses a service architecture for isps to offer phone - enabled information services such as e - mail , stock quotes , weather information , travel information , personalized traffic information , personalized news services , financial services , sports information , professional services , ticket information , on - line shopping , etc . these many types of services can be provided by different iras supported by different vendors as long as users put the network addresses of the iras they have access to into their user profiles . simply by a local phone call to his local sp , the dynamically reconfigurable capability of the distributed ivr systems disclosed by this invention will allow a caller to visit multiple service providers &# 39 ; iras in the same phone call callers do not have to memorize multiple phone numbers , one for each service provider .
7
while the present invention will be described in the context of producing capillary laminate materials particularly suited for use in disposable absorbent articles , more particularly in the context of sanitary napkins , the present invention is in no way limited to such applications . to the contrary , the present invention may be practiced to great advantage whenever it is desired to produce capillary laminate materials not previously obtainable using prior art web forming processes . fig1 depicts a representative capillary laminate material 40 of the type described in the aforementioned langdon , et al . applications . capillary laminate material 40 is particularly well suited for use as a topsheet or acquisition layer in a sanitary napkin or other absorbent article . capillary laminate material 40 shown in fig1 comprises a first fluid pervious sheet or layer 42 and a second fluid pervious sheet or layer 46 . the fluid pervious nature of the first sheet 42 and the second sheet 46 is provided by apertures 43 and 47 , respectively . while the fluid pervious nature of the first and second sheets 42 and 46 is provided by apertures 43 and 47 , it would be obvious to one of ordinary skill in the art that there are other means of imparting a fluid pervious nature to a sheet , such as microporous materials , porous material , slits , etc . the first and second sheets are spaced apart from one another by a spacer . the spacer shown in fig1 comprises a plurality of generally cylindrical spacers 48 . spacers 48 also serve to connect or secure the first sheet 42 to the second sheet 46 . spacers 48 separate first sheet 42 from second sheet 46 such that a &# 34 ; capillary zone &# 34 ; 50 is created between the first sheet 42 and the second sheet 46 . as used herein , the term &# 34 ; capillary zone &# 34 ; refers to the space between two adjacent sheets not being occupied by a spacer . the material selected for the first sheet 42 and the second sheet 46 is preferably machinable and capable of being formed into a sheet . since the capillary laminate material 40 is to be used in consumer products which contact the human body , the capillary laminate material 40 is preferably soft and safe for epidermal or other human contact . preferred materials for the first sheet 42 and the second sheet 46 are polymeric materials including , but not limited to polyolefins , particularly polyethylenes , polypropylenes and copolymers having at least one olefinic constituent . other polymeric materials such as polyester , nylon , copolymers thereof and combinations of any of the foregoing may also be suitable . while first sheet 42 and second sheet 46 are shown as a film , the sheets may , if desired , be in the form of a nonwoven , microporous membrane , foam , etc . if desired , conventional amounts of agents may also be added to the polymeric matrix of the first sheet 42 and the second sheet 46 . it is often desired to add agents to increase the opacity of the sheets . whiteners , such as titanium dioxide and calcium carbonate may be used to opacity the first and second sheets , 42 and 46 , respectively . it may also be desired to add other agents such as surfactants to impart a hydrophilic nature to either the first sheet 42 or the second sheet 46 . degrees and amounts to which agents including whiteners and surfactants are added to the first sheet 42 and the second sheet 46 may be distinct from one another to provide varying effects such as hydrophilicity gradients and the ability to mask fluids within the absorbent article . the first sheet 42 and the second sheet 46 may themselves be multilayer polymeric films such as those disclosed in commonly assigned u . s . pat . no . 5 , 006 , 394 issued to baird on apr . 9 , 1991 and u . s . pat . no . 5 , 261 , 899 issued to visscher et al . on nov . 16 , 1993 , said patents being incorporated herein by reference . the spacers used to form the capillary laminate can be formed from a material which is added to the sheets or from one of the sheets themselves . examples of materials that can be added include , but are not limited to hot melt adhesives , pressure sensitive adhesives , thermoplastics with a melting point temperature lower than one or more of the sheets , etc . these additional materials can be applied by gravure printing , screen printing or any number of processes which are known to those skilled in the art . accordingly , the spacers 48 may be made from any material suitable for securing the first sheet 42 to the second sheet 46 . for example , spacers 48 may be made from a heat sealable hot melt adhesive such as eastobond a3 , manufactured by eastman chemical , or hl - 1412 , manufactured by fuller adhesive . the spacers 48 may also be made from a polymer material having a lower melting point temperature than the polymeric material used for either the first sheet 42 or the second sheet 46 . the spacers 48 are preferably applied to one of the sheets using a known technique such as gravure printing , screen printing , or transfer printing . when using a pressure sensitive adhesive sufficient pressure must be applied to achieve bonding or securement between the spacers and the respective sheets . when using a hot melt adhesive or a polymeric material having a lower melting point temperature than the materials used for either the first sheet or the second sheet , sufficient heat must be applied to heat the spacers to achieve bonding between the respective sheets . alternatively , the spacers 48 may be formed from one or more of the sheets themselves . this can be achieved by embossing , either hot or cold , casting or other processes known to those skilled in the art . the other sheet is then combined with the embossed or cast sheet to form the laminate material of the present invention . when used as a topsheet on an absorbent article , such as a topsheet on a sanitary napkin , the first sheet 42 becomes the wearer - contacting or body surface of the topsheet . the second sheet 46 becomes the garment facing or pad - contacting surface of the topsheet . accordingly , as fluid impinges capillary laminate material 40 it first contacts the wearer - contacting surface 42a of the first sheet 42 . fluid then proceeds through apertures 43 and into the capillary zone 50 . upon reaching capillary zone 50 fluid then moves within the capillary zone 50 under capillary pressure . the fluid moves throughout the capillary zone 50 in both the lateral and transverse directions . simultaneously , the fluid passes through apertures 47 in second sheet 42 and into the acquisition layer of a sanitary napkin . the dimensions of apertures 43 and 47 in first sheet 42 and second sheet 46 , respectively , may be substantially identical to one another or may be of different dimensions . for example , successively smaller apertures in adjacent sheets can be used to create a capillary driving force through the capillary laminate material in the direction of the smaller apertures . when used as a topsheet or an acquisition layer , it may be desirable to have apertures 43 slightly larger than apertures 47 to provide a capillary gradient within capillary laminate material 40 . it may also be desirable to vary the dimension of the apertures 43 and 47 within their respective sheets . for example , when used as a topsheet it may be desirable to have the apertures 43 in first sheet 42 which are located in the central region of the sanitary napkin , i . e ., the region surrounding the intersection of the longitudinal and transverse centerlines , larger than the apertures adjacent the periphery of the sanitary napkin . the difference in dimension may be easily defined from one region to the next , or may be indiscernible as the dimensions may change gradually from one region to the next region . in addition to varying the size of apertures 43 and 47 it is also possible to vary the frequency of apertures 43 and 47 . for example , when used as a topsheet it may be desirable to have a relatively high frequency of apertures near the central region as compared to the regions near the periphery of the absorbent article . in general , the fewer the apertures and the smaller the apertures the larger the capillary zone defined by the two sheets and the spacers . the dimension of the capillary zone 50 may be also be varied for particular uses . for example , if used as a topsheet on a disposable diaper , the dimension of capillary zone 50 may be smaller than if used as a topsheet on a sanitary napkin , due to the viscosity and density differences of urine and menses and / or blood . therefore , the capillary zone for a diaper topsheet will more than likely be smaller than the capillary zone of a sanitary napkin topsheet . the spacer elements used to both separate and secure the sheets of the capillary laminate material together can be a single spacer or a plurality of spacers having various geometric shapes . the height of the spacers will determine the gap between the sheets or the capillary zone . the capillary zone can be designed to optimally handle different fluids . for example , it has been determined that for blood or menses , the capillary zone should be less than about 0 . 006 inches ( 6 mils ), more preferably about 0 . 003 inches ( 3 mils ). water or urine is best transferred by a smaller capillary zone . the capillary zone may be varied throughout the capillary laminate material . variability of the capillary zone can be used to encourage fluid flow in the direction of decreasing capillary zone . the frequency , cross - sectional area , and height of spacers 48 determine to a substantial degree the dimension of the capillary zone 50 . the cross - sectional area of the spacers 48 is determined by taking the cross - sectional area of the spacers in a plane substantially parallel to the first and second sheets 42 and 46 , respectively , as is indicated by sectional lines a -- a in fig1 . spacers 48 are shown as having a circular cross - sectional shape , however , other cross - sectional shapes such as squares , rectangles , ovals , triangles , arcs , dog bone , etc . may also be used for spacers 48 . the sidewalls 49 of spacers 48 are shown as being substantially straight along their length in fig1 . however , sidewalls 49 may be concave or convex or any other shape such as sloped , curvilinear , etc . as may be desired . the spacers may also be used to divide the capillary zone into capillary channels . capillary channels can be utilized to direct flow within the capillary zone . the capillary channels can be linear , curvilinear or a combination of both . the capillary channels can be uniform in cross - sectional area or they can vary along their length . for example , a decreasing cross - sectional area of a capillary channel can promote fluid flow in the direction of decreasing cross - sectional area . within capillary zone 50 there is at least one and more preferably a multiplicity of capillary channels , generally designated as 60 . referring to fig1 as fluid moves between adjacent spacers 48 the shape of the capillary channel 60 between spacers 48 continually changes . accordingly , the capillary channels 60 have a non uniform shape along their length . the capillary channels within the capillary zone may take on any shape as desired . for example , the capillary channels may be straight along their entire length , straight along only a portion of their length , continuous along their entire length , discontinuous along their entire length , curvilinear , extend in a fan - like array , oval , hourglass , dog bone , asymmetric , etc . fig2 is an enlarged , partially segmented , perspective illustration of another preferred embodiment of the capillary laminate film of fig1 which has been formed into a macroscopically expanded , three - dimensional , fiber - like , apertured web 70 . the overall form / shape of the macroscopically expanded web 70 is generally in accordance with the teachings of commonly assigned u . s . pat . no . 4 , 342 , 314 , issued to radel et al . on aug . 3 , 1982 and hereby incorporated herein by reference . web 70 has been found suitable for use as a topsheet on a sanitary napkin . the term &# 34 ; macroscopically expanded &# 34 ;, when used to describe three - dimensional webs of the present invention , refers to webs , ribbons , and films which have been caused to conform to the surface of a three - dimensional forming structure so that both surfaces thereof exhibit a three - dimensional pattern of surface aberrations corresponding to the macroscopic cross - section of said forming structure . the surface aberrations comprising said pattern being individually discernible to the normal naked eye , i . e ., a normal naked eye having 20 / 20 vision unaided by any instrument that changes the apparent size or distance of an object or otherwise alters the visual powers of the eye , when the perpendicular distance between the viewer &# 39 ; s eye and the plane of the web is about 12 inches . the term &# 34 ; fiber - like &# 34 ; as utilized herein to describe the appearance of webs of the present invention , refers generally to any fine - scale pattern of apertures , random or non - random , reticulated or non - reticulated , which connotes an overall appearance and impression of a woven or non - woven fibrous web when viewed by the human eye . as can be seen in fig2 the webs fiber - like appearance is comprised of a continuum of fiber - like elements , the opposed ends of each of the fiber - like elements are interconnected to at least one other of the fiber - like elements . in the embodiment disclosed in fig2 the interconnected fiber - like elements form a pattern network of pentagonally shaped capillaries 72 . the web 70 , which exhibits a fiber - like appearance , embodies a three - dimensional microstructure extending from the web &# 39 ; s uppermost or wearer - contacting surface 75 in plane 76 to its lowermost or absorbent pad - contacting surface 78 in plane 79 to promote rapid fluid transport from the uppermost surface 75 to the lowermost surface 78 of the web without lateral transmission of fluid between adjacent capillaries 72 . as utilized herein , the term &# 34 ; microstructure &# 34 ; refers to a structure of such fine scale that its precise detail is readily perceived by the human eye only upon magnification by a microscope or other means well - known in the art . apertures 85 are formed by a multiplicity of intersecting fiber - like elements , e . g ., elements 86 , 87 , 88 , 89 and 90 , interconnected to one another in the first surface of the web . each fiber - like element comprises a base portion , e . g ., base portion 92 , located in plane 76 . each base portion has a sidewall portion , e . g ., sidewall portions 93 , attached to each edge thereof . the sidewall portions 93 extend generally in the direction of the second surface 78 of the web . the intersecting sidewall portions of the fiber - like elements are interconnected to one another intermediate the first and the second surfaces of the web and terminate substantially concurrently with one another in the plane 79 of the second surface . in a particularly preferred embodiment , the interconnected sidewall portions terminate substantially concurrently with one another in the plane of the second surface to form apertures in the second surface 78 of the web . the network of capillaries 72 formed by the interconnected sidewall portions allows for free transfer of fluid from the first surface of the web directly to the second surface of the web without lateral transmission of the fluid between the adjacent capillaries . in addition , small amounts of fluid are able to penetrate the apertures 43 in the first layer 42 of the capillary laminate material 40 . the first layer 42 is separated from and secured to the second layer 46 by spacers 48 to provide a capillary zone 50 between the first and second sheets . alter penetrating apertures 43 , fluid will then move through the capillary zone 50 toward the second surface of the web . upon reaching the second surface of the web , fluid will be removed from the capillary zone 50 and transmitted to the underlying layer . fluid may also enter apertures 47 in the second layer 46 . in fig3 there is shown another preferred embodiment of a capillary laminate material 40 of the present invention . capillary laminate material 40 comprises a first sheet 42 and a second sheet 46 secured together and spaced apart by a plurality of spacers 48 . first sheet 42 includes a plurality of apertures 343 . the second sheet 346 is substantially non - apertured , thus preventing fluids from transmitting therethrough . capillary laminate material 40 may be particularly useful as a macroscopically expanded topsheet such as that shown in fig2 where it is not desired or necessary to have fluid penetrate the second sheet 46 . alternatively , the capillary laminate material 40 may also be used as an absorbent core wherein the second sheet 46 is impervious to liquids and therefore may aid the backsheet in the protection against soiling of undergarments and clothing . fig4 is a simplified , schematic flow diagram of a process according to the present invention for producing capillary laminate materials , in particular , three - dimensional , macroscopically expanded capillary laminate materials . a web of substantially planar film 101 comprised of a polymeric material such as polyethylene is fed from supply roll 100 around idler roll 105 and onto the surface of forming drum 110 about which a forming structure 111 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 110 . the web 101 contains at least one spacer , and preferably contains a plurality of spacers , on the side facing away from forming drum 110 and is of the general configuration of sheet 46 as discussed above with regard to fig3 . forming structure 111 comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries , and is preferably constructed generally in accordance with the teachings of u . s . pat . no . 4 , 342 , 314 , issued to radel and thompson on aug . 3 , 1982 , the disclosure of which is hereby incorporated herein by reference . forming structure 111 is comprised of a plurality of individual photoetched lamina . the apertures in forming structure 111 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed in the aforementioned patent . a second web of substantially planar film 116 comprised of a polymeric material such as polyethylene is fed from supply roll 115 around idler roll 120 and onto the surface of forming drum 125 about which a forming structure 126 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 125 . forming structure 126 comprises a microapertured surface , such as a woven wire support member , which rotates about a stationary vacuum chamber 135 , generally in accordance with the teachings of u . s . pat . nos . 4 , 629 , 643 and 4 , 609 , 518 , the disclosures of which are hereby incorporated herein by reference . a high pressure liquid jet nozzle 130 is directed at the surface of the web 116 intermediate a pair of baffles ( not shown ) as the web traverses the vacuum chamber 135 . the high pressure , i . e ., preferably at least about 800 psig ., jet of liquid causes the web 116 to assume the general contour of the knuckle pattern of the woven wire support member 126 . in addition , because the interstices formed by the intersecting filaments are unsupported , the fluid jet causes rupture at those portions of web 116 coinciding with the interstices in the woven wire support structure 126 , thereby producing a &# 34 ; microapertured &# 34 ; web . this microapertured web exhibits a multiplicity of fine scale surface aberrations with microapertures coinciding with the point of maximum amplitude of the surface aberrations . the structure and formation of such microapertured webs is described in greater detail in the above - referenced and incorporated u . s . patents . after the microaperturing process is completed , the microapertured web is removed from forming structure 126 about an idler roll 140 , passed about an idler roll 145 , and applied to the outwardly - facing surface ( containing the spacers ) of the web 101 which was previously applied to the forming structure 111 . alternatively , the forming structures 110 and 125 may be positioned in closer proximity to one another , such that the idler rolls 140 and 145 may be omitted . the microapertured web , when produced by the above - described method , is preferably oriented such that the microscopic surface aberrations are oriented so as to face outwardly away from the forming structure 111 . the forming drum 110 preferably includes an internally located vacuum chamber 155 which is preferably stationary relative to the moving forming structure 111 . a pair of stationary baffles ( not shown ) approximately coinciding with the beginning and end of the vacuum chamber 155 are located adjacent the exterior surface of the forming structure . intermediate the stationary baffles there is preferably provided means for applying a fluid pressure differential to the laminate web 175 as it passes over the vacuum chamber . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 150 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 101 . examples of methods for the production of formed materials using a high - pressure liquid stream are disclosed in u . s . pat . nos . 4 , 695 , 422 , issued to curro et al . on sep . 22 , 1987 ; 4 , 778 , 644 , issued to curro et al . on oct . 18 , 1988 ; and 4 , 839 , 216 , issued to curro et al . on jun . 13 , 1989 , the disclosures of all of these patents being hereby incorporated herein by reference . the water jet causes the web 101 to conform to the forming structure 111 and apertures the web 101 in the areas coinciding with the capillaries in forming structure 111 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web 116 to form the laminate web 175 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . as an alternative embodiment , it may be desirable to provide an additional high - pressure liquid nozzle 165 and vacuum chamber 170 analogous to nozzle 150 and chamber 155 , respectively , to cause the incoming web 101 to conform to the surface of the forming structure 111 before the second incoming web 116 is applied . such an arrangement may improve the processability and quality of the finished laminate material by pre - forming the first web and reducing the force required to form the laminate as a whole . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 175 is removed from the surface of the forming structure 111 about an idler roll 160 in the condition shown in fig2 . the apertured laminate web 175 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 175 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 175 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fluid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . fig5 is a simplified schematic diagram of another preferred process according to the present invention for producing capillary laminate webs . a co - wound web of substantially planar film comprised of a polymeric material such as polyethylene , spacer element or elements , and microapertured planar film comprised of a polymeric material such as polyethylene , is fed from supply roll 200 around idler roll 205 and onto the surface of forming drum 210 about which a forming structure 211 continuously rotates at substantially the same speed as the incoming web . it may be desirable to pre - bond the first and second webs or sheets to one another before or during the pre - winding of the supply roll 200 . the web of film is driven by the forming drum 210 . the web 201 is oriented such that the microapertured web faces away from the forming structure 211 , and is of the general configuration of sheet 46 as discussed above with regard to fig3 . the microapertured web may be produced by the method described above with regard to fig4 or any other suitable method , and if produced as described above is preferably oriented with the microscopic surface aberrations facing away from the other film components and away from forming structure 211 . forming structure 211 is generally similar to the forming structure 111 shown in fig4 and comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries . as before , the apertures in forming structure 211 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed with regard to fig4 . the forming drum 210 preferably includes an internally located vacuum chamber 220 which is preferably stationary relative to the moving forming structure 211 . the structure and operation of the forming drum 210 is substantially as described above with regard to forming drum 110 depicted in fig4 . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 215 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 201 . the water jet causes the web 201 to conform to the forming structure 211 and apertures the laminate web 230 in the areas coinciding with the capillaries in forming structure 211 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web to form the laminate web 230 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 230 is removed from the surface of the forming structure 211 about an idler roll 225 . the apertured laminate web 230 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 230 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 230 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fluid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . fig6 is a simplified schematic diagram of another preferred process according to the present invention for producing capillary laminate webs . a web of substantially planar film comprised of a polymeric material such as polyethylene is fed from supply roll 300 around idler roll 305 and onto the surface of forming drum 310 about which a forming structure 311 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 310 . the web 301 contains at least one spacer , and preferably contains a plurality of spacers , on the side facing away from forming drum 310 and is of the general configuration of sheet 46 as discussed above with regard to fig3 . a second microapertured web of substantially planar film 316 comprised of a polymeric material such as polyethylene is fed from supply roll 315 around idler roll 320 and onto the surface of forming drum 310 . the microapertured web may be produced by the method described above with regard to fig4 or any other suitable method , and if produced as described above is preferably oriented with the microscopic surface aberrations facing away from the other film components and away from forming structure 311 . forming structure 311 is generally similar to the forming structure 111 shown in fig4 and comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries . as before , the apertures in forming structure 311 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed with regard to fig4 . the forming drum 310 preferably includes an internally located vacuum chamber 320 which is preferably stationary relative to the moving forming structure 311 . the structure and operation of the forming drum 310 is substantially as described above with regard to forming drum 110 depicted in fig4 . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 315 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 350 . the water jet causes the webs 301 and 316 to conform to the forming structure 311 and apertures the laminate web 350 in the areas coinciding with the capillaries in forming structure 311 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web to form the laminate web 350 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . as an alternative embodiment , it may be desirable to provide an additional high - pressure liquid nozzle 340 and vacuum chamber 345 analogous to nozzle 325 and chamber 330 , respectively , to cause the incoming web 301 to conform to the surface of the forming structure 311 before the second incoming web 316 is applied . such an arrangement may improve the processability and quality of the finished laminate material by pre - forming the first web and reducing the force required to form the laminate as a whole . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 350 is removed from the surface of the forming structure 311 about an idler roll 335 . the apertured laminate web 350 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 350 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 350 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fiuid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . although in the foregoing illustrative process descriptions spacers have been initially provided on the outwardly - facing surface of the web closest to the forming structure , it may be desirable under some circumstances to form or provide the spacers on the inwardly - facing side of the web farthest from the forming structure . it may also be desirable to provide spacers on both webs on their facing surfaces . in addition , the processes described herein may be adapted and expanded to produce capillary laminate materials having more than two sheets of material , in particular 3 or more sheets with a plurality of spacers between adjacent sheets , to form capillary laminate materials of the types generally described in the aforementioned langdon et al . u . s . patent applications . while particular embodiments of the present invention have been illustrated and described , it would be obvious to one skilled in the art that there is other changes and modifications that can be made without departing from the spirit and scope of the present invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .
8
the device illustrated in fig1 and 2 consists of an extruder 14 positioned above a tub 8 of water . the extruder 14 has a housing accommodating a screw 7 that rotates on a driveshaft 13 . a blend 2 enters the extruder from a hopper at the left , and the threads around screw 7 force the material constantly to the right . the housing has an inside diameter d2 that decreases to a diameter d1 at the output end in the vicinity of an outlet 9 . the blend 2 of granulated thermoplastic and 20 to 25 % ancillary pieces by weight in the form of slabs 2 . 5 mm thick and 5 to 10 mm long and wide of cotton - reinforced epoxide resin enters from the hopper at the left but can accordingly not travel through extruder 14 unaltered . it is exposed to thorough kneading , resulting in melting of the thermoplastic particles and thorough distribution , bonding , and wetting of the slabs as it travels through the device . the ratio of diameter d2 to diameter d1 is approximately 2 . 5 . the plastic leaving outlet 9 is accordingly in the form of an essentially homogeneous and viscous billet rotating and traveling toward the right with slabs embedded in it paralleling the direction of emergence . downstream and to the right of extruder 14 is a mold 4 in the form of a thin - walled metal cylinder . the mold is forced against the downstream end of the extruder by a pressure - generating device 16 the mold is coaxial with outlet 9 and screw 7 . it is mounted in a device 10 that secures not only mold 4 but other molds 4 . 1 to 4 . 3 as well and rotates around an axis 11 paralleling the axis of extruder 14 . the individual molds accordingly revolve past the outlet 9 from the extruder and can stop in front of it as desired . the molds in rotating device 10 are all columnar shaped and are charged concentrically with the axis from the left end . as long as this latter condition is ensured , they can also have different cross - sections . rotating device 10 is immersed in tub 8 with its axis 11 below the surface of the water . the water can be at room - temperature . above the tub 8 and next to the extruder 14 is a receptacle 15 for finished pieces 1 , which are in the present case expelled from occupied mold 4 . 3 by compressed air injected through a nozzle 17 into the mold &# 39 ; s right end ( in the direction indicated by the arrow 17 . 1 ) a stop 18 accurately positions the expelled pieces in receptacle 15 . the stop can then be pivoted down around its axis ( in the plane of projection ) to allow the intercepted piece to enter an assembling device 19 -- a shipping pallet or something similar . fig3 schematically illustrates how a billet 3 is introduced into a mold 4 . billet 3 arrives through the outlet 9 from extruder 14 rotating around its axis and moving forward toward the center of the downstream end of mold 4 , which is surrounded by a rigid inner surface and positioned in stationary relation to outlet 9 . billet 3 is in an easily deformable state and rests subject to gravity initially below outlet 9 against the inner surface of the mold 4 , where a certain mutual adhesion between it and the mold 4 occurs due to the billet &# 39 ; s adhesive properties . due to the pressure of additional constituents of the billet 3 as they arrive and revolve around its axis , a deposit will continue to occur along the circumference of the mold 4 , resulting in mutual adhesion with inner surface 6 and with the already deposited constituents of the billet 3 . the originally available space between the deposited constituents of the billet 3 and outlet 9 will accordingly become completely occupied , and the already deposited constituents will be displaced into still available spaces , creating the initial subsidiary section of the columnar piece . the embedded slabs will surprisingly now all extend parallel to one another and to the axis of piece 1 . the original adhesion against the inner surface 6 of mold 4 will simultaneously be destroyed , and , although new constituents of piece 1 will continually come into existence at the left , the right end of the piece will become increasingly displaced to the right , in the direction indicated by the outlined arrow inside mold 4 . this process will continue until mold 4 is completely charged and inner surface is continuously and uniformly covered with constituents of the billet 3 . the attainment of this state will be indicated by a sensor 16 that communicates electrically with a switch that , when said state is attained , interrupts the supply of billets and rotates the device 10 around its axis . hot and charged mold 4 enters the water in tub 8 , and charged mold 4 . 1 , which has already been cooled in the water , is positioned for discharging in front of receptacle 15 , while another mold , which has already been discharged , is positioned for charging . the extruder 14 can now be engaged again , and the mold 4 . 3 in the discharging position can be discharged with compressed air from the nozzle 17 , introducing the next cycle . fig4 through 7 illustrate different inner and outer cross - sections of columnar shaped pieces manufactured with the method and device in accordance with the invention . characteristic of all these pieces is that , in addition to an almost non - porous zone around the edge with an essentially constant width , they have almost a foam structure at the core . the slabs at the edge are surprisingly all comprised of the hard material and extend parallel to one another and to the axis of the piece . they have a relatively extensive surface and accordingly adhere satisfactorily to the plastic matrix around them even when the two materials are not ideally matched . the pieces are accordingly provided with a skeletal reinforcement by the slabs , which finally dictates their outstanding mechanical strength and satisfactory chemical resistance . the surface consists entirely of constituents of the plastic matrix . it can have any desired texture , which is a significant aesthetic advantage . it can easily be scored to imitate leather or wood . the cross - section can be rectangular , circular , or stellate . there has thus been shown and described a novel columnar shaped piece and method of manufacturing the same which fulfills all the objects and advantages sought therefor . many changes , modifications , variations and other uses and applications of the subject invention will , however , become apparent to those skilled in the art after considering this specification and the accompanying drawings which disclose the preferred embodiments thereof . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention , which is to be limited only by the claims which follow .
8
the embodiments of the present invention show that when a user of those service providers which cooperate with each other accesses the network , an authentication processing procedure is initiated to the authentication control device of each service provider at the same time based on the identifier information of the access user . accordingly , the user of different service providers which are in cooperation with each other in the network can finish , at one time , the access and authentication processing procedures of different service providers , thus guaranteeing the operating interest of each service provider adequately . in the method of the embodiments of the present invention , each service provider has their respective independent authentication control device , as shown in fig6 , and all the authentication control devices can configure their own aaa servers correspondingly . in the embodiments of the present invention , an authentication control device in the network connected directly to the external network is called master authentication control device , such as the authentication control device of service provider b in fig6 ; an authentication control device in other networks connected to the external network via the network connected directly to the external network is called slave authentication control device , such as the authentication control device of service provider a in fig6 . in the embodiments of the present invention , all authentication information of the users who have gained access to each master or slave authentication control device is stored in the master authentication server to which the master authentication control device corresponds , and the master authentication server is , for example , the aaa ( authentication , authorization , and accounting ) server and the corresponding rdius user authentication server of service provider b in fig6 ; alternatively , the authentication information may be stored in the slave authentication server to which each slave authentication control device corresponds , and the slave authentication server is , for example , the aaa ( authentication , authorization , and accounting ) server and the corresponding rdius user authentication server of service provider a in fig6 . taking the network architecture shown in fig6 as example , the embodiment of the method of the present invention is shown in detail in fig7 , including the following steps : step 71 : a user terminal sends a padi message to an authentication control device ( i . e . pppoe server ) of service provider a to start a pppoe access ; step 72 : after receiving the padi message , the authentication control device sends a pado message to the user terminal ; step 73 : the user terminal sends a padr request to the authentication control device according to the pado message responded by the authentication control device ; step 74 : the authentication control device generates a session id ( session identifier ), and sends it to the user terminal via a pads message ; step 75 : the user terminal and the authentication control device perform a ppp lcp ( link control protocol ) negotiation to establish link layer communication and synchronously negotiate for using the chap authentication mode ; step 76 : the authentication control device sends and provides a challenge of 128 bit to the authentication user terminal via a challenge message ; step 77 : after receiving the challenge message , the user terminal makes an md5 algorithm encryption for a password and the challenge message and then sends the encrypted challenge - password and challenge message in a response message to the authentication control device of service provider a ; the processing procedure for the user access from step 71 to step 76 is completely the same as the corresponding processing procedure in the prior art . step 78 : after receiving the authentication information , the authentication control device of service provider a sends the user identity information ( i . e . the authentication information ) such as a challenge , a challenge - password and the username to the authentication control device of service provider b , i . e . the master authentication control device ; step 79 : the authentication control device of service provider b sends the user identity information to the radius user authentication server of service provider b for authentication ; the radius user authentication server and the corresponding aaa server of service provider b are called master authentication server ; if the user identity information is stored in the aaa server of service provider b , the radius user authentication server of service provider b determines whether the user is legal according to the user identity information , and execute step 712 ; if the user identity information is stored in the aaa server of service provider a , execute step 710 . step 710 : the radius user authentication server of service provider b forwards the user information to the radius user authentication server of service provider a ; step 711 : the radius user authentication server of service provider a determines whether or not the user is legal according to the user information , and then responds with an authentication success / failure message ; if succeeds , carry the negotiation parameter and the user &# 39 ; s relevant service attribute to authorize the user ; step 712 : return the authentication success / failure message to the authentication control device of service provider b ; if skip from step 79 to this step , the radius user authentication server of service provider b determines whether or not the user is legal according to the user information , and then responds with the authentication success / failure message ; if succeeds , carry the negotiation parameter and the use &# 39 ; s relevant service attribute to authorize the user ; if skip from step 711 to this step , the radius user authentication server of service provider b forwards the message sent from the radius user authentication server of service provider a to the authentication control device of service provider b ; if the radius server of service provider b contains the user information , authenticate directly and return the result ; step 713 : after receiving the authentication success / failure message , if the user authorization is obtained successfully , the authentication control device of service provider b performs various control and management on the network of service provider b , and synchronously forwards the message to the authentication control device of service provider a ; for example , if the authentication is successful and the authorization is obtained , the authentication control device of service provider b can manage the user and the traffic which enter the network of service provider b ; however , if the authentication fails , the user can not enter the network of service provider b via the authentication control device of service provider b ; step 714 : after receiving the message , if the user authorization is obtained successfully , the authentication control device of service provider a performs various control and management on the network of service provider a , and synchronously , the authentication control device of service provider a returns the authentication result to the user terminal ; after the user terminal receives the message , if the authentication fails , the flow is ended here , or else continue to execute step 715 . step 715 : the user terminal conducts an ncp ( such as ipcp ) negotiation , and obtains , via the authentication control device of service provider a , the parameters such as the planning ip address etc . step 716 : if the ncp negotiation is successful , the authentication control device of service provider a initiates an accounting - start request to the authentication control device of service provider b , that is , sending the accounting information to the authentication control device ; step 717 : the authentication control device of service provider b forwards the request to the radius user accounting server of service provider b ; if service provider a needs no accounting information , execute step 720 directly , or else execute step 718 ; 95 step 718 : the radius user accounting server of service provider b forwards the request to the radius user accounting server of service provider a ; step 719 : the radius user accounting server of service provider a responds with an accounting - accept message to the radius user accounting server of service provider b ; step 720 : if skip from step 717 to this step , the radius user accounting server of service provider b responds with the accounting - accept message to the authentication control device of service provider b ; and if skip from step 719 to step 720 , forward the received accounting - accept message to the authentication control device of service provider b . step 721 : the authentication control device of service provider b forwards the accounting - accept message to the authentication control device of service provider a ; here , the access user passes the authentication , and obtains the legal access authority of service provider a , service provider b and the external network , and can launch its network service normally . in the embodiments of the present invention , when the user wants to terminate the network service , it can cut off the network connection also via pppoe server ( the authentication control device ), that is , sending the corresponding accounting - stop message according to the message format transmitted from step 716 to step 721 , so as to stop the corresponding accounting procedure . in the accounting procedure , the embodiments of the present invention also can adopt the accounting processing mode that the authentication control device of service provider a does not provide the accounting information and the accounting information is provided only by the authentication control device of service provider b . that is , step 716 and step 721 are omitted in fig7 . if the accounting is performed by only service provider b and service provider a trusts this , the accounting needs to be performed only once ; only in the distrust case , the accounting needs to be performed by both service providers a and b , and then to be checked . the embodiments of the present invention are applicable not only to pppoe , but also to all the other authentication modes . besides the radius , the aaa protocol may include diameter ( a new aaa protocol ) and tacacs ( terminal access controller access control system , an aaa protocol ) etc . because the authentication control device of service provider b is required to synchronize the authentication and accounting information with that of the authentication control device of service provider a , the authentication control device of service provider b must acquire the authentication information of the authentication control device of service provider a . currently , there are mainly two adoptable acquisition modes : one is the mode of detecting the data message which bears the authentication information , and another is the mode of setting the master authentication control device as a proxy server of the slave authentication control device . the following gives the explanation of these two modes : ( 1 ) the mode of detecting the data message : in this mode , it is required that the authentication request message ( such as radius request message ) initiated by the authentication control device of service provider a must be transmitted through the authentication control device of service provider b ; in this way , the authentication control device of service provider b can detect all the data message ; practically , it also can be configured to detect the specified message or the message of the specified aaa server ; generally , the detected message is stored at first , and then forwarded ; on the other hand , it also can be repackaged and then forwarded as required ; ( 2 ) the mode of setting the master authentication control device as a proxy server : the authentication control device of service provider a takes the authentication control device of service provider b as a radius server , and all the messages are sent directly to the radius port of the authentication control device of service provider b ; the authentication control device of service provider b functions as a standard radius proxy to receive , modify , and send the authentication message ; generally the radius proxy needs to repackage the message and then forward the repackaged message , but the radius proxy also can store the received message and forward the stored message directly . because the authentication control device of service provider b and the authentication control device of service provider a have synchronized the authentication and accounting information and all the user authentication and authorization information are stored in all the authentication control devices , the embodiments of the present invention enable the user to obtain the legal network authority of multiple service providers by inputting the username and the password only once . in the practical applications , the embodiments of the present invention can be extended to the interconnections among multiple service providers , so as to realize the synchronous authentication among multiple authentication control devices . the above is just the preferred embodiments of the present invention , and the scope of the present invention is not limited thereto . those skilled in the art shall appreciate that various changes or variations can be made within the scope of the present invention . thus , the scope of the present invention should be defined by the claims .
7
fig8 illustrates an element 1 representing a first and simplest embodiment of the invention . the element 1 comprises an electrically conducting layer 2 formed on a transparent substrate , such as glass or plastic . such a conducting layer 2 may be formed from any suitable conducting material , for example metallic materials such as aluminium or silver , using conventional techniques . the material typically does not cover the whole surface of the substrate i . e . the layer is not continuous but patterned into regions . regions covered in metal will substantially reflect light , whilst regions without will substantially transmit . as such , averaged across the area , the element overall will constitute a partial reflector for light . an expanded view of the layer 2 ( shown in dotted line ) illustrates regions 4 where the conductor is absent and regions 5 where the conductor is present . in this example the absent regions 4 are in the form of rectangles of random distributions with a side length 30 microns . this pattern is useful in avoiding both substantial diffraction effects and any moire interference effects with over regular structures in a display system . however , it should be understood that the invention is not limited to any particular pattern , although the conducting material should be electrically contiguous . such a conducting layer 2 may be formed for example by ; depositing aluminium by vacuum sputtering on the substrate ; overcoating the layer with a photoresist ; uv exposure of the resist through a suitable mask ; development of the resist ; etching of the exposed metal with a suitable acidic etchant ; removal of the remaining resist . such a method , and many other patterning techniques , are well known to those skilled in the art . a further overcoating of protective material ( not shown ) may be useful to limit oxidation which reduces reflectivity . the element 1 further comprises electrical connections 6 at it &# 39 ; s four corners in order to provide for touch sensing . such an element 1 can be combined with known touch capacitance measurement techniques to function as a touch sensor . an example of such measurement techniques is the method known as “ surface capacitance ” as illustrated in fig1 and described below . thus , the optical element 1 has a combined function as touch sensor and partial reflector . the transmittance ( t ) and reflectance ( r ) of the element 1 may be principally determined by the proportion of the surface area of layer 2 that is covered with the reflective conducting material ( regions 5 ). if the proportion of the area covered with the reflective conducting material is x and the reflectivity of the conducting material is r then ( ignoring reflection / absorption losses in the substrate ): reflectivities r of & gt ; 0 . 9 can be achieved for aluminium and & gt ; 0 . 95 for silver . both r and t may typically be in the range 0 . 2 - 0 . 8 for the element 1 , and more preferably in the range 0 . 4 - 0 . 6 . however , for many common applications values close to 0 . 5 are the most useful . fig9 illustrates an element 7 representing a second embodiment of the invention . this embodiment differs from the embodiment in fig8 in that the conducting layer 2 is split into discrete regions ( 9 and 11 for example ) which are electrically isolated from one another on the underlying substrate . each of the discrete regions 9 , 11 , etc . will each have their own electrical connection 13 , 15 , etc ., respectively . sub - patterning within each discrete region ( e . g ., as represented by the expanded view ) may have the random rectangle form of the embodiment of fig8 with regions 4 , 5 or any other form as previously described . such an arrangement of discrete regions 9 , 11 , etc . may be advantageous for use with alternate touch sensing methods such as the “ projected capacitance ” method illustrated in fig1 and described below . such a method may be advantageous as it is sensitive to close proximity rather than requiring relatively close contact for good operation . fig1 illustrates an element 17 representing a third embodiment of the invention . this embodiment differs from the embodiment in fig8 in that an alternative fine patterning is used for the conducting layer 2 . in this case such patterning includes an array of fine conducting lines ( representing reflective regions 19 ) with non - conducting gaps ( representing optically transparent regions 21 ) in between . the conducting material forming the regions 19 should be electrically contiguous , for example using an electrically conductive trace along an edge ( s ) of the element 17 ( e . g ., along the upper and lower edges of the array ). the pitch of such an array of fine conducting lines will typically be less than 1 micron and more typically of the order of 100 nm . such an array will have the property that it will reflect plane polarised light with a polarisation axis parallel to the array , and transmit light polarised orthogonal to it . as such the array constitutes a “ wire - grid ” polariser and may function as a reflective polariser as is known in the art . techniques for forming such a small - scale structure , such as laser interferometry , are also well known in the art . such an element 17 therefore constitutes a combined reflective polariser and touch sensor . it should be understood that such a pattern may equally be implemented with the macroscopic patterning into discrete isolated regions as previously described in the embodiment of fig9 . in this manner , the conducting layer 2 may be made up of an array of electrically isolated mini - grids each having an array of fine conducting lines 19 with non - conducting gaps 21 therebetween . fig1 illustrates a possible configuration of discrete regions within an element 7 , as in an expanded embodiment of fig9 , in order to provide a touch sensor . a number of discrete touch regions ( e . g ., 9 , 11 ) are represented by squares , with attached lines ( e . g ., 13 , 15 , respectively ) showing the electrical connections which lead to the perimeter for connection to measurement equipment . a finger brought near to this array will register the strongest signal on the regions close to it . comparison of signal strength at each of the attached lines may allow interpolation of position to an accuracy finer than the pitch of the array . therefore , such an array may be used to allow location of a touch in x and y directions . this can be useful in use as a 2d touchscreen for display applications . fig1 illustrates a further possible configuration of discrete regions ( e . g ., 25 , 27 , etc .) within an element in order to provide a touch sensor . this differs from the embodiment of fig1 in that discrete regions 25 , 27 , etc . are formed as rows and columns respectively on two separate optically transparent substrates ( or on opposite faces of one substrate ). one set of conductors in the form of regions 25 are for sensing in a y direction are formed on a first substrate , whilst a second set of regions 27 for sensing in an x direction are formed on a second substrate mounted below the first . such an arrangement may have advantages of simplicity of connection tracks compared to that shown in fig1 and therefore may allow a greater density of discrete regions and hence greater positional accuracy . again the regions 25 , 27 , etc . may each comprise a conducting layer 2 with a pattern of regions 4 , 5 as in fig8 and 9 ; regions 19 , 21 as in fig1 ; or any other suitable combination of electrically conductive and optically reflective regions , and optically transparent regions . fig1 illustrates an example of a touch sensor 30 according to the present invention . this example utilizes an optical element 1 of the type shown in fig8 , and a measurement technique commonly referred to “ surface capacitance ”. the optical element 1 including the conducting layer 2 which is electrically contiguous with electrical connections 6 at each corner . only one such connection 6 is shown for clarity . the method employs an ac source 31 which provides a drive signal to each corner . when a finger touches or comes in close contact with the conducting layer 2 it forms a capacitance allowing ac current to flow to ground . the resistance of the path between the finger and each corner of the element 1 will be proportional to the distance from that corner , so in general each resistance values 32 , 34 from respective corners will be different . the current drawn from each corner will be proportional to said resistance and this may be amplified by amplifier 36 and measured by associated controller 38 . the relative value of the four current measurements is used to determine the finger position . such a technique is most suitable when the finger can be in close contact with the conducting layer 2 . fig1 illustrates another example of a touch sensor 40 in accordance with the present invention . this example combines the basic electrical arrangement for a known measurement technique commonly called “ projected capacitance ” and an element 7 of the type shown in fig9 and 11 where the conductor is sub - divided into electrically isolated regions . for clarity just one such region 11 is illustrated , so it should be understood that multiple such regions may exist and each senses touch independently . an ac source 42 is used to charge up reference capacitor 44 . the conductor region 11 functions as a touch pad and forms some capacitance to ground represented by c touch 46 . if charging of the reference capacitor 44 is stopped then the voltage on it may be monitored whilst it discharges through c touch 46 . the value of said capacitance will determine the rate of discharge . the touch capacitor and the reference capacitor act as potential divider and the measured voltage is give by the following equation : v measured = v drive · c ref /( c ref + c touch ) if a finger is brought close to the touchpad , the value of c touch 46 will increase and this may be detected by a reduction in the measured voltage . other methods for measuring the change in capacitance produced by the presence of the finger are known to those skilled in the art . this may include techniques for improving accuracy and sensitivity and for reducing noise . such techniques have the advantage that a finger may be detected when it is in proximity but not touching the sensor , the signal increasing in strength as the finger approaches the sensor . this may be particular useful in systems where the physical arrangement of components restricts the ability to directly touch the sensor for example where the sensor is not located at or very close to the surface of the device . fig1 a and 15 b represent a touch sensor 48 in accordance with a fourth embodiment of the invention . the touch sensor 48 differs from the previously described touch sensor embodiments in that the conductors of the optical element are arranged to provide a resistive touch sensor . the optical element comprises optically transparent substrates 50 , at least the upper one of which is deformable by touch . the patterned conductors 25 and 27 are formed on opposing faces of each substrate 50 . they may typically have a pattern similar to that illustrated in fig1 to give an array of intersecting points in two directions , with sub - patterning to give a partial mirror as described in previous embodiments . the resistance is measured between each conductor on the top substrate and each conductor on the lower substrate . when the upper substrate is deformed by the presence of a finger or other pointing device , the upper conductor at that location is brought closer to the lower conductor and the resistance between them will reduce . if all such resistances are monitored then the position of the finger may be deduced . fig1 illustrates a display system 56 incorporating a touch sensor in accordance with an exemplary embodiment of the present invention . the display system 56 is an example of a known type of multiple image depth display , as illustrated in fig1 , incorporating an optical element as described in any previous embodiments of the invention . the system 56 includes , in order , an absorbing polariser 58 , reflective polariser 60 , quarter - wave plate 62 , partial mirror 64 , quarter - wave plate 66 , electrode 68 , liquid crystal cell 70 , exit polariser 72 , lcd 74 for forming an image , and entrance polariser 76 . the specific operation of the system 56 with the exception of the use of an optical element as described herein is otherwise known and thus will not be described in detail herein for sake of brevity . the system 56 is arranged to provide two different images from the lcd 74 in two different depth planes . typically the reflective polariser 60 may consist of a multiple layer polymer stack known as a dbef as is well known in the art . the partial mirror 64 is commonly a multiple layer thin film coating on glass or plastic . the properties of the film may be adjusted to give the required transmission and reflection properties . however , both these components are relatively expensive . in this embodiment , the reflective polariser 60 is instead formed by the use a patterned conductor layer . this patterning is arranged to be in the form of a “ wire grid ” array as described above in relation to optical element 17 in fig1 , and as such will function as a reflective polariser . the optical element represented in fig1 can be arranged to provide a polarised reflection function and a touch sensing function as described above . it is thus possible to achieve a multiple depth display with integrated touch function at reduced cost and thickness compared to separate components . any of the previously described measurement techniques to determine touch may be used , including surface capacitance , projected capacitance and resistive . fig1 illustrates a display system 80 incorporating an optical element and touch sensor in accordance with another embodiment of the invention . the display system 80 differs from that illustrated in fig1 in that the reflective polariser 60 may be achieved by any typical method such as a dbef . however , in this case an alternative form of the partial mirror 64 is used . in this case a patterned conductor , for example of the form of the optical element 7 in fig9 , is used to provide partial reflection and transmission . thus , the partial mirror 64 may also be used to function as a touch sensor according to any of the previously described methods ( e . g ., as a touch sensor 40 as shown in fig1 ). therefore , the system 80 provides a further method to achieve a multiple depth display with integrated touch function at reduced cost and thickness compared to separate components . because the partial mirror 64 is required to be some distance below the top of the system 80 ( in order to provide the depth effect ) then it may be advantageous to use the “ projected capacitance ” method ( e . g ., as shown in fig1 ) to achieve touch sensing as this does not require very close proximity of the finger . the presence of the ito electrode in the lc cell 70 may also be beneficial in providing shield from noise from the lcd 34 . a seventh embodiment of the invention comprises a variation of the known curved - appearance display illustrated in fig7 . the display system uses a partial mirror and reflective polariser in a manner similar to those described in the previous two embodiments . the reflective polariser may be replaced by a conductor patterned to form a wire grid polariser ( e . g ., an optical element 17 as in fig1 ) in a manner analogous to the embodiment of fig1 . alternatively the partial mirror may be replaced by a patterned conductor to provide partial reflection and transmission ( e . g ., an optical element 7 as in fig9 ) in a manner analogous to the embodiment of fig1 . it is thus possible to achieve a curved - appearance display with integrated touch function at reduced cost and thickness compared to separate components . an eighth embodiment of the invention comprises a variation of the known switchable mirror display illustrated in fig6 . this system uses a reflective polariser , which is typically realised by the use of a dbef . in this embodiment of the present invention , however , the reflective polariser is instead formed by the use a patterned conductor layer ( e . g ., as in fig1 ). this patterning is arranged to be in the form of a “ wire grid ” array as described above , and as such will function as a reflective polariser . the conductor may also be arranged to provide a touch sensing function as described in previous embodiments . it is thus possible to achieve a switchable mirror display with integrated touch function at reduced cost and thickness compared to separate components . fig1 illustrates a display system 90 constituting a ninth embodiment of the invention . it represents a standard lcd comprising substrates 92 , liquid crystal 94 and polarisers 96 and 98 . typically the polarisers would be formed from a stretched polymer containing a dichroic dye such as iodine . in this embodiment either of the polarisers 96 and 98 may be replaced by an element 17 as illustrated in fig1 which will function as a reflective polariser and touch sensor . as such this system 90 constitutes a display with integrated touch sensor . it may be particularly advantageous to arrange for such an element to form the lower polariser 98 . in ambient lighting conditions this system will naturally function as a reflective display with integrated touch sensor , with no further reflector required . in the case of illumination provided from a backlight behind the display , the incorrect polarised would be reflected back to the backlight and recycled , thus improving optical efficiency . thus a display with integrated touch sensor may be provided with reduced cost and thickness compared to an additional touch sensor . fig1 illustrates a display system 100 constituting a ninth embodiment of the invention . this embodiment differs from that in fig1 in that the one or more reflective polarisers 96 and 98 are formed in the inner surface of the substrate . this may be advantageous in simplifying the fabrication process . also , in the case that the lower polariser 98 is formed from such a touch sensor element as in fig1 , then the resulting reflective display may reduce image parallax artefacts . in all of the above embodiments the conducting layer 2 has been spatially patterned to provide partial reflection and partial transmission by virtue of the proportion of area covered by conductor . the thickness of the conducting layer 2 is such as to substantially reflect all of the light . alternatively a very thin conducting layer 2 may be used covering the whole substrate . for example , an aluminium layer of approximately 5 nm in thickness will transmit ˜ 50 % and reflect ˜ 50 %. the conducting layer 2 may be uniform across the underlying substrate as in the embodiments of fig8 and 13 , or divided into electrically isolated regions as in the embodiments of fig9 and 14 , for example . although the invention has been shown and described with respect to certain preferred embodiments , it is obvious that equivalents and modifications will occur to others skilled in the art upon the reading and understanding of the specification . for example , while the optical element as described above includes conductive regions which are reflective and non - conductive regions which are transparent , other embodiments may be used . in another embodiment , conductive regions may be transparent ( e . g ., through the use of indium - tin - oxide ( ito )) and non - conductive regions may be reflective ( e . g ., through the use of non - conducting reflective materials , conducting materials electrically isolated via an isolation layer , etc .) the present invention includes all such equivalents and modifications , and is limited only by the scope of the following claims .
6
fig1 shows a block diagram of part of a control circuit 10 for activating multiple injection in the event of failure of a knock control of a direct injection gasoline engine ( not shown ). control circuit 10 contains an and logic element 12 at whose one input an activation signal kr is applied and at whose other input a fault signal f is applied . activation signal kr and fault signal f are generated by a controller of the firing system . activation signal kr has the switch state logic one when the knock control is to be active . fault signal f has the switch state logic one when there is a disturbance in the knock control . and logic element 12 gates the values of the activation signal and the fault signal according to the logic and function and outputs a request signal hkss whose signal value of logic one causes switching over from single injection to double injection . the letter sequence hkss denotes homogeneous anti - knock safety setpoint . the method steps and components required for switching over the type of injection are not the object of the present invention and therefore will not be explained in greater detail . for example , the position of the throttle valve may be altered in switching over . in addition , the injection nozzles are actuated according to another scheme . if the switching over is performed successfully , the signal value of a control signal hks ( homogeneous anti - knock safety protection ) is switched to logic one . however , if the switching over cannot be performed , the signal value of control signal hks remains at the value of logic zero . for example , this is the case when the fault causing the failure of the knock control also prevents the system from switching over to double injection . fig2 shows the other part of control circuit 10 . control circuit 10 contains another and logic element 20 at whose one input is applied fault signal f and control signal hks at its other input . and logic element 20 gates the signal values applied to its inputs according to the logic and function . the output of and logic element 20 is connected to the input of a not element 22 which outputs at its output a signal value inverted relative to the signal value applied at its input . the output of not element 22 is connected to the switching over input of a switching unit 24 . depending on the signal at the switching input , switching unit 24 switches between two switch states 0 and 1 . control circuit 10 also contains an engine characteristics map unit 26 in which are stored various ignition characteristics maps for the double injection mode of operation . engine characteristics map unit 26 has a plurality of inputs , of which fig2 shows inputs for inputting an rotational speed signal nmot and a load signal rl ( relative air filling ). engine characteristics map unit 26 reads a value for the firing angle out of a memory unit ( not shown ), depending on the signal values of the rotational speed signal nmot and load signal rl , and outputs an engine characteristics map value kfw . engine characteristics map unit 26 may be either an analog or digital unit . then rotational speed signal nmot , load signal rl , and engine characteristics map value kfw are either analog or digital signals accordingly . engine characteristics map value kfw is applied to the one input of switching unit 24 and is output at the output of switching unit 24 in switch state 0 of switching unit 24 ( see output signal 28 ). the other input of switching unit 24 is connected to output signal sv of a knock control unit ( not shown ) for retardation , adjusting the firing angle in a regulating operation . output signal sv goes to the output of switching unit 24 in switch state 1 of switching unit 24 . control circuit 10 contains another switching unit 30 at whose switching input activation signal kr is applied . depending on the signal value of activation signal kr , switching unit 30 operates in two switch states 0 and 1 . signal value of logic zero is constantly applied at the one input of switching unit 30 . if control signal kr has the value logic zero , then in switch state 0 of switching unit 30 , value zero applied at the input is output at the output of the switching unit and is used as input signal dwkrz for a firing angle setpoint unit 32 . the other input of switching unit 30 is connected to the output of switching unit 24 , so that in switch state 1 of switching unit 30 , output signal 28 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 also has an input for a cylinder counting signal zzyl whose signal value indicates the cylinder in whose combustion chamber an ignition is to be executed . firing angle setpoint unit 32 outputs a firing angle signal 34 which specifies the firing angle for all cylinders of the engine in succession . the part of control circuit 10 shown in fig2 operates as follows with fully functional knock control . fault signal f and control signal hks have the signal value of logic zero . a logic signal 36 at the output of and logic element 20 therefore also has the signal value of logic zero . a switching signal 38 at the output of not element 22 has the signal value of logic one because of the inversion of logic signal 36 , so that switching unit 24 is switched to switch state 1 . output signal sv output by anti - knock regulating unit stipulates the course of output signal 28 . if activation signal kr has a value of logic zero , no knocking is detected and no knock control is necessary . in this case switching unit 30 has switch state 0 so that input signal dwkrz has the value of logic zero . firing angle setpoint unit 32 outputs a firing angle signal 34 , which is not corrected with regard to knock control . however , if activation signal kr has the value of logic one in the case of fully functional knock control because knocking is detected , then switching unit 30 operates in switch state 1 . in switch state 1 , output signal 28 of switching unit 24 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 therefore outputs a firing angle signal 34 which is corrected with the help of the firing angle specified by the knock control to counteract engine knocking . if there is a disturbance in the function of the knock control , then fault signal f first has a value of logic one and control signal hks has a value of logic zero . logic signal 36 therefore continues to have a value of logic zero . the operation of control unit 10 corresponds to the operation described above . however , if the signal value of control signal hks is switched to the value one on the basis of the processes illustrated above in fig1 then the value of logic signal 36 changes to the value of logic one . control signal hks has the value of logic one as soon as the system switches to double injection . the signal change in logic signal 36 results in a change in the signal value of switching signal 38 . switching signal 38 then has the value of logic zero so that switching unit 24 is switched to switch state 0 . engine characteristics map value kfw which depends on the current engine rotational speed ( see rotational speed signal nmot ) and on the current engine load ( see load signal rl ) then stipulates the value of output signal 28 . if no knocking of the engine is detected , activation signal kr has the value of logic zero and the firing angle setpoint unit does not perform a correction of the firing angle with regard to knock control . however , if knocking of the engine is detected , the activation signal kr has the value of logic one . switching unit 30 operates in switch state 1 and the course of output signal 28 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 corrects the firing angle so that knocking is counteracted . the engine characteristics map stored in engine characteristics map unit 26 for the double injection is used for correction . if engine knocking no longer occurs , then activation signal kr again has the value of logic zero and switching unit 30 switches back to switch state 0 . fault signal f and control signal hks remain at the value of logic one , however .
8
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig2 a through 2f illustrate a sequential loading status and processes , fig3 a through 3f illustrates levels of sensing signals sensed according to disk loading operation , and fig4 illustrates levels of sensing signal as a disk is jammed during a disk loading operation . in the method for checking a disk loading status in an optical disk driver in accordance with the present invention , the multi - stage disk loading status is discriminated as shown in fig2 a through 2f and fig3 a through 3f . in case that levels of sensing signals outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw are maintained for more than a predetermined time as shown in fig4 , the microcomputer 6 discriminates it as a disk jammed status . that is , after the disk is inserted , if no sensing signal indicating that clamping has been completed is detected from the loading switch for more than a predetermined time , it is discriminated that the disk has been jammed . in detail , as shown in fig3 a , in case that there is no optical disk mounted on the tray 1 , all of the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switching sw become high , while , as shown in fig3 b , in case of initial loading status that the optical disk 1 is mounted on the tray and let in , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become low , high and high , respectively . and , as shown in fig3 c through 3e , in case of a loading status that the disk is jammed , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become ‘ low , low , high ’, ‘ high , low , high ’ and ‘ low , low high ’, respectively , the status of which is detected for more than a predetermined time as shown in fig4 , whereas , as shown in fig3 f , in case that the led - in disk is completely clamped , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become ‘ low , low , low ’ respectively . accordingly , on the basis of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw , the microcomputer 6 segmented the current disk loading status into multiple loading stages to be discriminated . especially , as shown in fig4 , in case that the values of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw are maintained for more than a predetermined time , or in case that no sensing signal indicating completion of clamping is detected from the loading switch for more than a predetermined time after the disk is inserted , it is discriminated that the disk has been jammed and a disk - ejecting operation is performed . the disk - ejecting operation will now be described with reference to accompanying drawings . fig5 is a flow chart of a method for checking a disk loading status in an optical disk driver in accordance with one embodiment of the present invention . first , when the tray is opened to insert the optical disk 1 and closed ( s 20 ), a disk loading operation is performed that the tray on which the optical disk is mounted is inserted into the optical disk driver according to the driving of the loading mechanism . at this time , the microcomputer 6 receives and compares the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw ( s 21 ), and discriminates the loading status of the optical disk 1 as shown in fig3 a through 3f by multi - stage ( s 22 ). upon discrimination , the microcomputer 6 generates a corresponding mode sense data as previously defined ( s 23 ) and transmits the generated mode sense data to the host ( a personal computer ) connected through the interface unit 5 to report each disk loading status discriminated during the multiple loading stages of each disk . in this respect , in case that the interface unit 5 uses the typically used atapi bus for interfacing with the personal computer , the microcomputer generates a mode sense data in a 12 byte packet command format as defined by the atapi communication protocol and transmits each disk loading status discriminated by during the multiple loading stages of each disk for reporting . for example , as shown in fig6 , variable values recorded in a recording medium type code among header information of the previously defined mode sense parameter are recorded to be difference to each other according to the disk loading status , to be transmitted and reported to the host . namely , in case that the disk loading status of fig3 a and 3b are maintained for more than a predetermined time , the variable values are recorded in the recording medium type code field by “ h ′ 71 ” and “ h ′ 71 / h ′ f2 ′, respectively , and the current disk status is transmitted to the host . meanwhile , in case that a disk loading status of fig4 is maintained for more than a predetermined time , that is , a disk - jammed status is maintained , the variable value is recorded by “ h ′ f2 ” and the disk - jammed status is transmitted to be reported . thereafter , according to the transmission and report of the mode sense data corresponding to the disk loading status , in case that the microcomputer 6 receives an eject command requesting disk - ejection operation from the host , it drives the loading mechanism to perform the requested disk - ejection operation , so that the disk - jammed status is not maintained for more than a predetermined time . in this manner , in the optical disk driver adopted to the present invention , the disk loading status is discriminated during multiple loading stages and the corresponding mode sense data is transmitted to the host . and then , the disk - ejection operation is performed according to the eject command requested by the host , whereby the disk - ejection operation is automatically performed with the disk - jammed status . fig7 is a flow chart of a method for checking a disk loading status in an optical disk driver in accordance with another embodiment of the present invention . likewise in the former embodiment of the present invention , when the tray is opened to insert the optical disk 1 and closed ( s 30 ), a disk loading operation is performed that the tray on which the optical disk is mounted is inserted into the optical disk driver according to the driving of the loading mechanism . at this time , the microcomputer 6 receives and compares the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw ( s 31 ), and discriminates the loading status of the optical disk 1 as shown in fig3 a through 3f during multiple loading stages ( s 32 ). upon discrimination , in case that the disk has been jammed , the microcomputer 6 drives the load mechanism by itself to quickly perform a disk - ejecting operation ( s 33 ), generates a mode sense data for reporting the disk - ejection operation , and transmits it the host such as the personal computer connected through the interface unit 5 ( s 34 ). meanwhile , upon discrimination , in case that the disk is in a state of fig3 a , 3b and 3 f , the microcomputer generates a mode sense data having a corresponding variable value , and transmits it to the host . and then , the microcomputer receives a corresponding command from the host and performs a corresponding operation such as data reading . accordingly , in the optical disk driver adopted to the present invention , the disk loading status is discriminated during multiple loading stages and a corresponding mode sense data is transmitted to the host . in addition , when the disk is discriminated to have been jammed , the loading mechanism is driven by itself , thereby quickly performing the disk - ejection operation . as so far described , according to the method for checking disk loading status in an optical disk driver of the present invention , a loading status of an optical disk is segmented to be discriminated during multiple loading stages , and in case that a disk - jammed status is discriminated , corresponding information is transmitted to a host connected through an interface , so that a disk ejection command is outputted from the host or a disk ejection operation is performed by itself to thereby automatically perform the disk - ejection operation for the disk - jammed status . as the present invention may be embodied in several forms without departing from the spirit or essential characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its spirit and scope as defined in the appended claims , and therefore all changes and modifications that fall within the meets and bounds of the claims , or equivalence of such meets and bounds are therefore intended to be embraced by the appended claims .
6
note that in the description below , the term “ voltage ” is used to designate analog signals , and the term “ value ” is used to designate digital quantities . note also that in the description and the drawings a symbol without angle brackets is used to denote an analog quantity , and a symbol with angle brackets is used to denote a digital quantity . for example , the analog voltage of a calibration pulse is p , and its digitized equivalent is & lt ; p & gt ;. fig1 is a schematic illustration of a detector signal processing circuit 1 a with sequential calibration pulse injection . circuit 1 a includes a detector 10 which produces a detector response signal s - 10 representative of an energy e of an incident x - ray . in an embodiment herein presented , detector 10 includes a charge - sensitive pre - amplifier ( not shown ) which may be incorporated within the enclosure of detector 10 , and response signal s - 10 consists of a step in output voltage whose height is indicative of energy e . circuit 1 a also includes a pulser 12 which produces a calibration pulse signal s - 12 with a pulse amplitude p , and a switch 20 . optionally , the position of switch 20 is controlled by a calibration mode controller 21 receiving timing information from a clock 19 . calibration mode controller 21 may set switch 20 either to an operating mode in which detector response signal s - 10 is input into an amplifier 18 , or to a calibration mode in which calibration pulse signal s - 12 is input into amplifier 18 . it is to be understood that amplifier 18 may represent one or more signal amplification elements , including one or more pre - amplifiers , amplifiers or other amplification devices . amplifier 18 , having a gain g 1 , produces an amplified voltage s - 18 , which is equal to an amplified response signal voltage g 1 e when switch 20 selects detector response signal s - 10 , and is equal to an amplified pulse voltage g 1 p when switch 20 selects calibration pulse signal s - 12 . in practice , gain g 1 is not constant , but is a variable which may drift depending on the temperature of internal amplifier components , such as resistors . amplified voltage s - 18 is input into a processing analog - to - digital converter ( adc ) 22 , which is a fast adc capable of digitizing at high data rates . ideally the gain of processing adc 22 should be unity , meaning that its output should be the exact digital equivalent of its analog input . in practice , however , the gain of any adc is a variable which may change depending on various factors including the value of the reference voltage and the temperature of the adc components . in particular , a fast adc such as processing adc 22 is typically available only with relatively low resolution , such as 16 bits in an exemplary embodiment . the specification for gain drift for such an adc may be as large as 30 - 50 ppm . therefore , to ensure accuracy and reproducibility of the energy scale derived by circuit 1 a , it is essential that the calibration procedure should take account of any drift in the gain of processing adc 22 . if a gain of processing adc 22 is g 2 , then the digitized output from processing adc 22 is an amplified voltage value s - 22 , whose value depends on the product of the gain g 1 of amplifier 18 and the gain g 2 of processing adc 22 . the value of amplified voltage value s - 22 also depends on the position of switch 20 . when switch 20 selects detector response signal s - 10 , amplified voltage value s - 22 is equal to a response signal voltage value & lt ; g 1 g 2 e & gt ;. when switch 20 selects calibration pulse signal s - 12 , amplified voltage value s - 22 is equal to a pulse voltage value & lt ; g 1 g 2 p & gt ;. the quantity g 1 g 2 is hereinafter referred to as an overall gain g , where g = g 1 g 2 is the overall gain of the electronic system including both the amplification and the digitization components . circuit 1 a further includes a router 23 which is in communication with switch 20 via a signal s - 23 . router 23 is thereby able to route amplified voltage value s - 22 to an amplified calibration voltage value s - 22 a when switch 20 selects calibration pulse signal s - 12 , and to route amplified voltage value s - 22 to an amplified operating voltage value s - 22 b when switch 20 selects detector response signal s - 10 . amplified calibration voltage value s - 22 a is equal to & lt ; gp & gt ;, and amplified operating voltage value s - 22 b is equal to & lt ; ge & gt ;. calibration pulse signal s - 12 is also input into a reference adc 16 which outputs a digital reference pulse value s - 16 . digital reference pulse value s - 16 is equal to & lt ; p & gt ;, which is a digitized value of pulse amplitude p . reference adc 16 does not need to be a fast adc because it needs only to digitize reference pulses at relatively low rate . therefore reference adc 16 is chosen to be a high resolution adc with superior drift specifications . in an embodiment , reference adc 16 has 24 bit resolution and drift specification of less than 2 ppm . it should be noted that the amplitude of the pulses from pulser 12 is preferably chosen so that the pulse amplitude is approximately the same as an average detector response signal s - 10 . the frequency of pulses from pulser 12 is preferably chosen so that the pulse arrival time in calibration mode is approximately the same as the average arrival time of detector response signals s - 10 in operating mode . these conditions of pulse amplitude and frequency are chosen so that the calibration pulses most accurately mimic the gain and linearity performance of the overall electronic system including both the amplification and the digitization components . circuit 1 a also includes a single common reference voltage element 14 , which serves as the voltage reference for pulser 12 via a signal s - 14 a , as well as the reference for processing adc 22 via a signal s - 14 b and for reference adc 16 via a signal s - 14 c . it should be noted that one of the novel aspects of the design of circuit 1 a is that connections s - 14 a , s - 14 b and s - 14 c all share the same signal , which is reference voltage 14 . circuit 1 a further includes a calibration ratio calculator 24 providing a value of a calibration ratio . digital reference pulse value s - 16 and amplified calibration voltage value s - 22 a are used to calculate the calibration ratio , which is equal to amplified calibration voltage value s - 22 a ( equal to & lt ; gp & gt ;) divided by digital reference pulse value s - 16 ( equal to & lt ; p & gt ;). the calibration ratio may be calculated for many pulses during a calibration time , and an average value obtained . the result from calibration ratio calculator 24 is a gain value s - 24 , which is equal to a digital representation & lt ; g & gt ; of overall gain g . it should be noted that an important novel aspect of the present invention is the use of calibration ratio calculator 24 to calculate overall gain g of the entire electronic system including both amplification and digitization components . the calculation is based on comparison of digitized calibration pulses from pulser 12 obtained by two different electronic routes . the first route is by digitization of calibration pulse signal s - 12 using reference adc 16 without any amplification . the second route is when switch 20 selects calibration pulse signal s - 12 , and the calibration pulses are amplified by amplifier 18 and then digitized by processing adc 22 . importantly , processing adc 22 and reference adc 16 use the same reference voltage 14 , so that any drift in the reference voltage causes the same gain drift in both processing adc 22 and reference adc 16 , and the drift cancels out by division done by calibration ratio calculator 24 . moreover , reference adc 16 has much greater accuracy and much lower drift than processing adc 22 , so that its output may be used as a calibration reference for the gain of the overall electronic system . it should also be noted that the calculation done by calibration ratio calculator 24 may be made any time switch 20 is set to select calibration pulse signal s - 12 . calibration time may be any chosen value , which may be as short as 100 msec , and therefore calibration may be performed frequently with minimal interruption of useful operation of the x - ray instrument . during instrument measurement operation , when switch 20 is set to select detector response signal s - 10 , both gain value s - 24 and amplified operating voltage value s - 22 b are used by an energy scale corrector 26 to calculate a corrected energy value s - 26 . corrected energy value s - 26 is equal to amplified operating voltage value s - 22 b ( equal to & lt ; ge & gt ;) divided by gain value s - 24 ( equal to & lt ; g & gt ;). the result of this calculation is corrected energy value s - 26 , which is a corrected digital representation & lt ; e & gt ; of detector response signal s - 10 . corrected energy value s - 26 is calculated for each detector signal , corresponding to each incident x - ray , and is used to construct an energy spectrum , which is a plot of x - ray energy vs number of x - rays incident on the detector with that energy . corrected energy value s - 26 is a calibrated energy value which takes account of substantially all drift in the amplification and digitization electronics , and the calibration may be performed as frequently as desired by programming the operation of switch 20 using calibration mode controller 21 . operation of switch 20 can also be initiated manually by an operator actuating a button or virtual button , ( not shown in fig1 ), whenever a need for calibration is deemed fit . fig2 is a schematic illustration of an alternative detector signal processing circuit 1 b with simultaneous calibration pulse injection . circuit 1 b includes components equivalent to those in circuit 1 a shown in fig1 , with two notable exceptions . the first difference between circuits 1 a and 1 b is that switch 20 is absent in circuit 1 b . the second difference is that router 23 in circuit 1 a is replaced with a pulse discriminator 28 in circuit 1 b . in circuit 1 b , detector response signal s - 10 and calibration pulse signal s - 12 are both injected simultaneously and continuously into amplifier 18 . amplified voltage s - 18 therefore comprises a mixture of both amplified response signal voltage g 1 e and amplified pulse voltage g 1 p . similarly , amplified voltage value s - 22 comprises a mixture of response signal voltage value & lt ; g 1 g 2 e & gt ; and pulse voltage value & lt ; g 1 g 2 p & gt ;. amplified voltage value s - 22 is input into a pulse discriminator 28 whose function is to separate the response signal and pulse voltage values contained within amplified voltage value s - 22 . pulse voltage values are separated to a discriminated calibration value s - 28 a , and detector response signal values are separated to a discriminated response value s - 28 b . the method of operation of pulse discriminator 28 is described below in connection with fig3 . subsequent operation of circuit 1 b is the same as operation of circuit 1 a , namely calibration ratio calculator 24 provides calibration ratio s - 24 used for the calculation of corrected energy value s - 26 . however it should be noted that , in the case of circuit 1 b , calibration occurs continuously throughout every measurement operation , with no interruption or slowdown of the measurement operation . fig3 a , 3b and 3c illustrate the operation of pulse discriminator 28 . fig3 a shows a graph of amplified voltage value s - 22 , which includes a mixture of detector response and calibration values . in general , a detector response causes a rise in the value of amplified voltage value s - 22 , because detector 10 incorporates a charge sensitive pre - amplifier ( not shown ) in which charge from successive responses accumulates to cause rising voltage . on the other hand , calibration pulses originate from pulser 12 in which there is no charge sensitive amplifier , so that each calibration pulse causes an initial rise followed by a fall in the value of amplified voltage value s - 22 . fig3 a illustrates two calibration pulses , 36 and 38 , with initial rising values 36 a and 38 a respectively , flat regions 36 b and 38 b respectively , and falling values 36 c and 38 c respectively . pulse discriminator 28 may distinguish the calibration pulses by their falling values 36 c and 38 c which are not present in detector response values . alternatively , pulse discriminator 28 may distinguish the calibration pulses using timing signals obtained from pulser 12 ( not shown ). using either discrimination method , pulse discriminator 28 identifies calibration pulses 36 and 38 , and removes them to produce discriminated response value s - 28 b as shown in fig3 b . information from the removed calibration pulses is used to produce discriminated calibration value s - 28 a as shown in fig3 c . fig3 b illustrates how the discriminated response value s - 28 b is used to derive an amplified energy signal for each x - ray incident on detector 10 . the response to three incident x - rays can be identified in fig3 b by rising values 31 , 32 , and 33 . the magnitude of rising values 31 , 32 , and 33 corresponds to the quantities & lt ; ge & gt ; 1 , & lt ; ge & gt ; 2 and & lt ; ge & gt ; 3 respectively . these quantities are used by energy scale corrector 26 , together with knowledge of gain value s - 24 obtained from calibration ratio calculator 24 , in order to assign corrected energy value s - 26 to each of the three x - rays . the energy values of all incident x - rays are obtained in this way during the measurement , and counts are accumulated to obtain an energy spectrum . fig3 c illustrates discriminated calibration value s - 28 a , showing calibration pulses 36 and 38 . the amplitudes of pulses 36 and 38 correspond to the quantities & lt ; gp & gt ; 1 and & lt ; gp & gt ; 2 respectively . these quantities are used by calibration ratio calculator 24 together with reference pulse value s - 16 to calculate gain value s - 24 . different values of & lt ; gp & gt ; 1 and & lt ; gp & gt ; 2 may indicate that the overall gain & lt ; g & gt ; of the electronic system has changed , and correction may automatically occur at energy scale corrector 26 . alternatively , rather than applying correction to gain & lt ; g & gt ; at every successive calibration pulse , values of gain & lt ; g & gt ; may be averaged over an averaging time which includes many pulses before applying a correction at energy scale corrector 26 . such averaging may be advantageous to reduce noise in the measurement of gain & lt ; g & gt ; and is within the scope of the present disclosure . fig4 shows a schematic flow diagram of a sequential calibration process 40 according to the present disclosure . process 40 is described below with reference to fig4 and fig1 . process 40 starts at step 402 , and at step 404 an operator selection is made via calibration mode controller 21 as to whether calibration is to be performed after one or more measurements , or after a specified interval of operating time . if calibration after one or more measurements is selected , process 40 moves to step 410 . at step 412 , calibration mode controller 21 sets switch 20 to calibration mode and in step 414 calibration is performed . calibration of step 414 comprises calculation by calibration ratio calculator 24 of the calibration ratio , which may be averaged over many pulses . in a typical embodiment herein presented , the calibration pulse frequency may be 500 khz , and the averaging time in step 414 may be 100 msec . in this embodiment gain value s - 24 at the end of the calibration is an average value of about 50 , 000 pulses . gain value s - 24 is represented by the symbol & lt ; g & gt ;. at step 415 , calibration mode controller 21 sets switch 20 to operating mode and in step 416 the energy scale is corrected using the value of & lt ; g & gt ; derived in step 414 . in step 417 one or more measurements are performed with corrected energy scale , and upon completion of the specified number of measurements the system is ready for a new calibration at step 418 , and the process returns to step 404 . if at step 404 calibration after a specified interval of operating time is selected , process 40 moves to step 420 . at step 421 the operator , via calibration mode controller 21 , selects a time interval t between successive calibrations . at step 422 , calibration mode controller 21 sets switch 20 to calibration mode and in step 423 calibration is performed in the same manner as described above for step 414 . at step 424 , calibration mode controller 21 sets switch 20 to operating mode and in step 425 the energy scale is corrected using the value of & lt ; g & gt ; derived in step 423 . in step 426 the measurement is carried out until either clock 19 indicates that time t has expired or the measurement is complete , whichever occurs first . step 427 tests whether the measurement is complete , and if not the process returns to step 422 for a new calibration . if measurement is complete , the process returns to step 404 . it can be seen that selection of calibration after a specified interval of operating time , as described in steps 420 ˜ 428 allows one or more new calibrations to occur during the course of a single measurement . this may be useful for particularly long measurements . setting of time interval t depends on the degree to which there is a stable environmental temperature — the less stable the environment the shorter time interval t should be set . in a typical embodiment , time interval t might be set to 10 ˜ 100 seconds , and if calibration time is about 100 msec , there is no discernible interruption of instrument operation , even though calibration is occurring with sufficient frequency to avoid any risk of drift of the electronic gain . it can be appreciated that , for both embodiments of calibration by time interval or by measurement operations , calibration switching can be initiated either by an automatic trigger or by manual triggering by the operator . all of such variations of implementation are within the scope of the present disclosure . fig5 shows a schematic flow diagram of a simultaneous calibration process 50 according to the present disclosure . process 50 is described below with reference to fig5 and fig2 . process 50 starts at step 502 , and at step 504 pulser 12 is started in order to perform an initial calibration prior to beginning actual operation of the instrument . the initial calibration is performed for an initial calibration time which is sufficiently large to allow calibration ratio calculator 24 to calculate gain value s - 24 by averaging over a large number of pulses . in an embodiment , the initial calibration time may be 100 msec to 1 second . in step 506 , the measurement is started by activating the x - ray source and directing x - rays at a sample . in step 508 the measurement is continuing , so that both detector response signal s - 10 and calibration pulse signal s - 12 are input into amplifier 18 and subsequently to processing adc 22 and pulse discriminator 28 . in step 510 , pulse discriminator 28 separates calibration pulses and detector response into discriminated calibration value s - 28 a and discriminated response value s - 28 b respectively . in step 512 calibration ratio 24 is calculated and , after the averaging time , an updated gain value s - 24 , denoted by the symbol & lt ; g & gt ;, is provided to energy scale corrector 26 . energy scale corrector 26 updates the energy scale to its most recent updated value in step 514 , using the value of & lt ; g & gt ; derived in step 512 . in step 516 there is a check of whether the measurement is complete . if not , process 50 loops back to step 508 and the measurement continues uninterrupted . it should be noted that the time taken from step 508 to step 516 is almost entirely due to the averaging time which , in an embodiment , is about 100 msec as a result , the energy calibration is updated every 100 msec throughout the measurement . in an embodiment , the pulse frequency of pulser 12 may be 50 khz , which is 10 times lower than the pulse frequency used in process 40 as described in connection with fig4 . the reason for using a lower calibration pulse frequency in process 50 is that , since both calibration pulses and detector signals are processed simultaneously , there is a risk that a calibration pulse and detector signal are so closely coincident in time that neither may be distinguished . the probability of such close coincidence can be reduced by lowering the calibration pulse frequency . nevertheless , at a frequency of 50 khz , 5 , 000 pulses are averaged in 100 msec , which is sufficient to obtain reliable updated gain value s - 24 for use during the next 100 msec measurement interval . if the measurement is complete at step 516 , the instrument is ready for the next measurement at step 518 and the process loops back to the start at step 502 . it should be noted that the simultaneous calibration method of process 50 is particularly useful for measurements with low x - ray count rates . such measurements are lengthy and frequent calibration is essential to ensure that gain drift during the course of the measurement is taken into account . circuits 1 a and 1 b in fig1 and 2 and processes 40 and 50 in fig4 and 5 , as described above , all relate to calibration of the overall gain of the amplification and digitization electronics . however , no account is taken of non - linear effects . referring now to fig6 , and with continued reference to fig1 , there are shown in fig6 graphs illustrating the effect of non - linearity on an exemplary detector response signal 63 , in which an x - ray arrives at detector 10 at a time when the charge - sensitive pre - amplifier voltage is v 1 . the step - function increase in detector response signal s - 10 is representative of the energy e of the x - ray . on a graph of amplified voltage value s - 22 vs detector response signal s - 10 , the voltages of detector response signal s - 10 before and after arrival of the x - ray , v 1 and v 1 + e respectively , are shown by lines 64 and 65 respectively . a line 61 shows the behavior of a perfectly linear amplification and digitization electronic system , wherein the gain g is equal to the slope of the line as shown . however , if the gain is not linear , then the actual gain is represented by the slope of a line 62 , and although the slope of line 61 is the average of the slope of line 62 , the slope at any particular point on line 62 may be different from the slope of line 61 , and therefore the gain may be different . in a graph of gain vs detector response signal s - 10 shown at the top of fig6 , a line 66 is the slope of line 61 and represents the constant gain of a perfectly linear system , and a line 68 is the slope of line 62 and represents the varying gain of a non - linear system . line 66 is the average value of line 68 . the quantity & lt ; δg & gt ; represents the difference between the linear and non - linear gain , and it is to be understood that & lt ; δg & gt ; is a varying function of detector response signal s - 10 . it should be noted that , in order to clearly illustrate the effect of the non - linearity , the deviation of line 62 from linear gain line 61 and of line 68 from line 66 has been greatly exaggerated relative to actual non - linearity of available electronic systems . similarly , the size of step function e has been greatly exaggerated relative to the overall range of detector response signal s - 10 and amplified voltage value s - 22 . lines 64 and 65 , representing the change in detector response signal s - 10 due to detector response signal 63 , intersect line 61 at lines 64 b and 65 b respectively . lines 64 and 65 intersect line 62 at lines 64 a and 65 a respectively . if the electronic system gain is linear , corresponding to line 61 , then the change in amplified voltage value s - 22 is given by the difference between the values of lines 65 b and 64 b , represented by the symbol & lt ; ge & gt ; l . on the other hand , if the electronic system gain is non - linear , corresponding to line 62 , then the change in amplified voltage value s - 22 is given by the difference between the values of lines 65 a and 64 a , represented by the symbol & lt ; ge & gt ; nl . it can be seen that & lt ; ge & gt ; nl is less than & lt ; ge & gt ; l and this is because the slope of line 62 is less than the slope of line 61 in the relevant part of the graph . however , if output voltage v 1 is different , the slopes of lines 61 and 62 may be different , and in some circumstances & lt ; ge & gt ; nl may be greater than & lt ; ge & gt ; l . fig7 is a diagram illustrating a solution by use of calibration pulse signals for calibration of non - linearity effects . in order to calibrate for non - linearity effects , pulses are injected into the amplification and digitization system using a circuit 1 c which is described below in connection with fig8 . in a graph of calibration pulse signal s - 12 vs amplified voltage value s - 22 shown in fig7 , non - linear response line 62 is the same as in the graph of detector response signal s - 10 vs amplified voltage value s - 22 as shown in fig6 . this is because calibration pulses and detector response signals are injected into the same amplification and digitization system , and therefore non - linear gain effects are unchanged . fig7 shows two exemplary calibration pulses , 73 and 73 ′, which are injected into the amplification and digitization system at different times , t and t ′ respectively . pulses 73 and 73 ′ have , respectively , lower pulse voltages v 1 , v 1 ′ and upper pulse voltages v 2 , v 2 ′. pulses 73 and 73 ′ have the same pulse height p , meaning that v 2 − v 1 = v 2 ′− v 1 ′= p . lower voltages v 1 , v 1 ′ and upper voltages v 2 , v 2 ′ are represented , respectively , by lines 74 , 74 ′ and 75 , 75 ′ on the graph of calibration pulse signal s - 12 vs amplified voltage value s - 22 . lines 74 and 75 intersect line 62 at lines 74 a and 75 a respectively , and the change in amplified voltage value s - 22 due to pulse 73 is the difference between the values at lines 74 a and 75 a , represented by the symbol & lt ; gp & gt ;. lines 74 ′ and 75 ′ intersect line 62 at lines 74 a ′ and 75 a ′ respectively , and the change in amplified voltage value s - 22 due to pulse 73 ′ is the difference between the values at lines 74 a ′ and 74 b ′, represented by the symbol & lt ; g ′ p & gt ;. it should be noted that g is the gain of the amplification and digitization system at the voltages v 1 and v 2 of pulse 73 , and g ′ is the gain of the amplification and digitization system at the voltages v 1 ′ and v 2 ′ of pulse 73 ′, and that g and g ′ are different due to non - linearity of the system . note also that , in practice , pulse height p is very small relative to the overall range of detector response signal s - 10 and amplified voltage value s - 22 . it can therefore be assumed that line 62 is linear over such a small range , and therefore there is no change of gain between voltages v 1 and v 2 or between voltages v 1 ′ and v 2 ′. fig8 is a schematic illustration of a circuit 1 c , which is an alternative embodiment of circuit 1 a shown in fig1 , and which is used to perform a one - time calibration of non - linearity during a manufacturing calibration phase . this calibration of non - linearity deals with the intrinsic non - linearity exhibited by both amplifier 18 and adc 22 , and is done only once at the manufacturing level . it should be also noted that the description in fig6 - 10 of calibration for non - linearity is an improved calibration process which is independent of the on - board instrument gain calibration described in relation to fig1 - 5 . the result of the non - linearity calibration is preferably a look - up table ( described below ) which is specific to each instrument , and that can be used by each specific instrument throughout its life . fig8 shows that pulser 12 , which is the same pulser as that shown in fig1 and 2 , comprises a low - level digital - to - analog converter ( dac ) 82 , a high - level dac 84 , and a pulser switch 86 . a pulse voltage controller 87 produces a lower pulse voltage value & lt ; v 1 & gt ; and a higher pulse voltage value & lt ; v 2 & gt ;. lower pulse voltage value & lt ; v 1 & gt ; is input to low - level dac 82 , and , using reference voltage 14 as its reference via signal s - 14 a , dac 82 produces a lower pulse voltage v 1 at signal s - 82 . higher pulse voltage value & lt ; v 2 & gt ; is input to high - level dac 84 , and , using reference voltage 14 as its reference via signal s - 14 a , dac 84 produces a higher pulse voltage v 2 at signal s - 84 . signals s - 82 and s - 84 are input to pulser switch 86 which operates at an operator defined frequency to switch its output between signals s - 82 and s - 84 thereby producing pulses with lower pulse voltage v 1 and higher pulse voltage v 2 at signal s - 12 . signal s - 12 is the same as calibration pulse signal s - 12 which was discussed in relation to circuit 1 a in fig1 and circuit 1 b in fig2 . the remainder of circuit 1 c is operates in the same way as circuits 1 a and 1 b , namely calibration pulse signal s - 12 is input into amplifier 18 and processing adc 22 , and calibration pulse signal s - 12 is also input into reference adc 16 . a calibration ratio is calculated by calibration ratio calculator 24 and after an averaging time , gain value s - 24 is output , represented by symbol & lt ; g & gt ;, which is the gain corresponding to lower pulse voltage v 1 and higher pulse voltage v 2 . gain value s - 24 and the value of v 1 are input to a look - up table generator 88 . as explained below in connection with fig9 , pulse voltage controller 87 then changes the value of lower pulse voltage v 1 , and calibration ratio calculator 24 computes a new gain value s - 24 which may be different from the previous value due to non - linearity of the electronic gain . the new values of v 1 and gain value s - 24 are input to look - up table generator 88 . in this way , by changing values of v 1 and computing corresponding values of gain value s - 24 , look - up table generator 88 may build up a table of gain value s - 24 and corresponding values of v 1 which covers the complete range of amplified voltage value s - 22 and which contains as many calibration points as desired . when data acquisition for the desired calibration points has been completed , look - up table generator 88 computes an average gain value for all the calibration points , and converts the table to be a table of the difference , & lt ; δg & gt ;, between the gain value for each calibration point and the average gain value . therefore , the final product of look - up table generator 88 is a table comprising multiple values of & lt ; δg & gt ; and corresponding values of v 1 . it should be noted that circuit 1 c is equivalent to circuit 1 a with switch 20 set to calibration mode and with addition of pulse voltage controller 87 and look - up table generator 88 . circuit 1 c is also equivalent to circuit 1 b with omission of detector response signal s - 10 and addition of pulse voltage controller 87 and look - up table generator 88 . therefore , by adding pulse voltage controller 87 and look - up table generator 88 , circuit 1 c is available to perform calibration of non - linearity irrespective of whether an x - ray instrument is configured with circuit 1 a or with circuit 1 b . note that detector 10 is present in fig8 , but is not operative during the calibration of non - linearity . fig9 shows an embodiment of calibration pulse signal s - 12 , which is a series of pulse sequences produced by pulse voltage controller 87 and pulser 12 for use in calibration of non - linearity . a pulse sequence 92 comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 , higher pulse voltage v 2 and pulse height p . when pulse sequence 92 is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g & gt ; at lower pulse voltage v 1 . in an embodiment , calibration time to is 100 msec and the pulse frequency is 50 khz , so that pulse sequence 92 comprises 5 , 000 pulses . pulse sequence 92 is followed by a pulse sequence 92 ′ which comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 ′, higher pulse voltage v 2 ′ and pulse height p . when pulse sequence 92 ′ is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g ′& gt ; at lower pulse voltage v 1 ′. pulse sequence 92 ′ is followed by a pulse sequence 92 ″ which comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 ″, higher pulse voltage v 2 ″ and pulse height p . when pulse sequence 92 ″ is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g ″& gt ; at lower pulse voltage v 1 ″. gain values & lt ; g & gt ;, & lt ; g ′& gt ; and & lt ; g ″& gt ; are measurements of gain at different lower pulse voltage v 1 , v 1 ′ and v 1 ″ respectively , and these gain measurements therefore take into account the non - linearity of gain with respect to input voltage . gain values & lt ; g & gt ;, & lt ; g ′& gt ; and & lt ; g ″& gt ; and corresponding lower pulse voltage values & lt ; v 1 & gt ;, & lt ; v 1 ′& gt ; and & lt ; v 1 ″& gt ; are input to look - up table generator 88 as shown in fig8 . only three different lower voltages and corresponding gain values are shown in fig9 , but the number of corresponding lower voltages and gain values which can be obtained according to the invention is unlimited . by continuing to vary the lower pulse voltage in small increments over the full range of expected variation of detector response signal s - 10 , a calibration map is made of the non - linear gain characteristics of the amplification and digitization system . in effect , the calibration reproduces lines 62 and 68 as shown in fig6 and 7 over the full range of the instrument . in subsequent operation of the instrument with input from detector response signal s - 10 , the non - linearity due to differing output levels of the charge - sensitive pre - amplifier is taken into account by energy scale corrector 26 using the table from table generator 88 . referring to fig1 and 2 , it can be seen that gain value s - 24 , represented by symbol & lt ; g & gt ;, is not subject to non - linear variation because the lower pulse voltage of pulses from pulser 12 does not vary . however , the amplified voltage value s - 22 , represented by symbol & lt ; ge & gt ; is subject to non - linear variation depending on the output voltage of the charge sensitive pre - amplifier associated with detector 10 . energy scale corrector therefore corrects the energy & lt ; e & gt ; of an x - ray using the following modification of equation ( 2 ): where δg is derived from the table in table generator 88 according to the voltage v 1 of the charge sensitive preamplifier at the time the x - ray was received . pulse height p is kept constant in pulse sequences 92 , 92 ′ and 92 ″ shown in fig9 . however , as well as depending on the lower pulse voltage , the non - linear gain of the amplification and digitization system may also depend on the pulse height . fig1 shows an alternative embodiment of calibration pulse signal s - 12 , which comprises pulse sequences 96 , 97 and 98 , all with the same lower pulse voltage v 1 , but with differing pulse heights p 1 , p 2 and p 3 respectively . in an embodiment , p 1 may represent a pulse height near the bottom of the voltage range of expected detector response signal s - 10 , p 3 may represent a pulse height near the top of the voltage range of expected detector response signal s - 10 , and p 2 may represent a pulse height at approximately mid - range . pulse sequences 96 , 97 and 98 are followed by pulse sequences 96 ′, 97 ′ and 98 ′, all with the same lower pulse voltage v 1 ′, and with pulse heights p 1 , p 2 and p 3 respectively . in the same way as described in connection with fig9 , by continuing to vary the lower pulse voltage in small increments over the full range of expected variation of detector response signal s - 10 , a calibration map is made of the non - linear gain characteristics of the amplification and digitization system . however , for the pulse sequences of fig1 , for each value of lower pulse voltage there are three values of gain , one for each of low pulse height , mid pulse height and high pulse height . in effect , the calibration produces three version of lines 62 and 68 as shown in fig6 and 7 over the full range of the instrument , and the correct calibration for any pulse height may be determined by extrapolation between the measured calibration data for low -, mid - and high pulse height . in subsequent operation of the instrument with input from detector response signal s - 10 , non - linearity both due to differing output levels of the charge - sensitive pre - amplifier and due to differing x - ray energy are taken into account . it should be noted that because the non - linearity has weak dependence on temperature , only a one - time calibration of the instrument non - linearity is required . this calibration may be conveniently performed in the factory before shipment of the instrument to a customer . on the other hand , the actual gain of the instrument is subject to drift , and it is necessary to apply the gain calibration methods described herein in connection with fig1 ˜ 5 . referring to fig6 , the gain calibration methods of fig1 ˜ 5 are designed to correct the slope of line 61 or the level of line 66 , whereas the non - linearity calibration described in connection with fig6 ˜ 10 is a determination of the deviation of line 62 from line 61 or , equivalently , the deviation & lt ; δg & gt ; of line 68 from line 66 . it can be assumed with good accuracy that the deviation of line 62 from line 61 remains constant even as the slope of line 61 changes . when gain drift occurs during operation , line 62 pivots about the origin of the graph as the gain changes , but its shape does not change . similarly , it can be assumed with good accuracy that the deviation of line 68 from line 66 remains constant even as the level of line 66 changes . when gain drift occurs during operation , line 66 moves up and down the graph as the gain changes , but its shape does not change . the ability to calibrate the non - linearity of an amplification and digitization circuit as described in connection with fig6 ˜ 10 is an important novel aspect of the present invention . a further novel aspect is the combination of non - linearity calibration with automatic calibration of the system gain as described in connection with fig4 and 5 . yet a further novel aspect is use of single common reference voltage 14 as voltage reference for processing adc 22 , for reference adc 16 and for both low - level dac 82 and high - level dac 84 . although the present invention has been described in relation to particular embodiments thereof , it can be appreciated that various designs can be conceived based on the teachings of the present disclosure , and all are within the scope of the present disclosure .
6
the numerous innovative teachings of the present application will be described with particular reference to the presently preferred embodiment ( by way of example , and not of limitation ), in which : fig1 shows a sample electronic citation writing system ( cws ) according to the present invention . the intelligent cws includes a microprocessor ( μp ) or microcontroller ( μc ) 10 based design utilizing peripheral circuitry connected to a system bus 34 for dedicated functionality . peripheral circuitry will be used to control and operate all functional operations such as citation printing 28 , officer keypad / touchscreen input 26 , smart meter communication interface 30 , pc data / reprogramming interface 32 , liquid crystal display ( lcd ) operation 24 , diagnostic circuitry 16 , power supply circuitry 18 , real time clock ( rtc ) circuitry 14 , watchdog ( wdog ) circuitry 16 , data storage memory 20 , flash program memory 22 , and all other miscellaneous circuitry . utilizing the latest flash memory , application specific integrated circuit ( asic ), and field programmable gate array ( fpga ) technology will allow the manufacturer to change and upgrade the cws operation in the future as well as lower service costs . user interface software allows for permanent storage of cws data generated during daily operation . an offsite computer downloads citation data from the cws for use in judicial processing and debt collection . the offsite computer can also upload daily repeat violator data to the cws as well as reprogram the operation of the cws during upgrades . the core processing unit is composed of the main μp or μc 10 along with its associated support chips and components such as crystals , timing circuits , reset circuits , direct memory access ( dma ) support chips , etc . a large variety of processors presently exist from several manufacturers . everything from stand alone embedded μc to 64 bit risc processors are available for any application . the choice of controller often is greatly influenced by intangibles such as readily available and cost effective development tools , speed of operation desired , and compatible interfacing capabilities . all circuitry is preferably implemented using surface mount technology ( smt ). a sample embodiment utilizes a ds5000 . all μc and μp based circuits 10 have logic circuits connected to provide control signals for different system and component operations . these logic signals are often referred to as glue logic 12 since they often tie functional circuits together . these controls can be simple chip select signals , complex address decoding functions , or other registered outputs which are application specific . the choice of the appropriate logic circuit depends on the complexity of the overall design . simple gate arrays or complex fpgas may be required . a rtc 14 and its associated timing circuitry is included with the cws and connected to the μc or μp 10 . its primary purpose will be to provide accurate time stamping of events relating to the citation writing process . advantageously , the rtc can be a single off - the - shelf integrated circuit which also includes nonvolatile memory for long - term storage of system critical information as well as timer functions . furthermore , the possibility of error by the parking enforcement official as to the time of day the citation was issued is eliminated . a watch dog circuit 16 and its associated hold off functions is included in the cws and its operational firmware . the watch dog circuit 16 is a safety function connected to the μp or μc 10 that allows the system to reboot in the event it crashes or locks up for any reason . it is standard procedure to include such a module in any stand alone or embedded system . the μp or μc 10 is connected to a power supply 18 which includes a battery backup system for operation from a portable battery supply . the power supply 18 serves to regulate and supply the appropriate circuit voltages . additional functions of the power supply 18 include power supervision and μc or μp 10 notification during abnormal power conditions . the power supply 18 has an on board temporary power backup for data retention . the system is capable of going into temporary shutdown during inactivity to conserve battery life . the amount of data required per citation will influence the amount and type of memory used . the cws contains enough memory 20 to hold all daily citation log information as well as repeat violator information that will be used to determine whether a citation is issued or a vehicle is secured and towed . for example , each citation log might require the following information : the μc or μp 10 receives this information from either the smart meter or from the enforcement official and stores it in the on board memory 20 . several types of memory are now available . the cws memory 20 is preferably easily accessed with low power consumption to improve battery life . the currently used simm memories used in the latest computer motherboards represent a viable choice , however , the main processor used along with the support circuitry required may have an affect on this choice . the cws includes program memory 22 connected to the μc or μp 10 . although the application can be designed utilizing large eprom or masked rom technology , the recent advancements in flash memory offer an attractive alternative . flash memory now operates at acceptable speeds and provides for in circuit reprogrammability . this is advantageous for the cws since the system requires continuous application updates . the cws includes some type of visual display packaged with the unit . several types of character based and graphical lcds are now available with the associated control and driver circuitry . the lcd 24 preferably contains a built - in backlight for visual accuracy during low light or adverse weather conditions . if a touchscreen is to be used , the lcd 24 will be packaged with the overlaying touchscreen and its associated control circuitry . the local display 24 prompts the enforcement official for the correct information about the parking violation and displays information uploaded from an offsite computer concerning repeat parking violators . the cws provides a user interface for the input of field data from the police / parking enforcement official . a keyboard or a user interface touchscreen 26 can be used for data input . both a keyboard and a touchscreen require dedicated hardware for their control , and the use of a touchscreen requires additional firmware overhead for display and interpretation of input . the enforcement official can enter such information as the type of citation , vehicle make and model , color of the vehicle , license plate number , and the parking meter number . the cws has an on board printer 28 for hardcopies of citations . the printer 28 only needs to be capable of printing simple ascii characters without any graphics . several thermal printer manufacturers currently have printers available for bar code and other applications . these manufacturers include : zebra , nec , tec , intermec , datamax , sato , & amp ; boca systems . the cws also has the capability of interfacing to presently manufactured smart meters utilizing already developed interfaces and protocols . in addition , the cws is easily adaptable for new meter communication interfaces . in a preferred embodiment , the cws has an interchangeable probe that can be easily changed out for different meters and attached to the meter &# 39 ; s communication interface 50 . the most widely required probe utilizes an infrared interface between the smart meter and the cws . the cws design preferably includes all required communication hardware ( duarts , driver chips , etc .) on board the cws with the individual smart meter probe providing the custom hardware interface such as infrared , hard wired , or other wireless media . an example of sample connectors , both optical and contact interfaces , are given in pct application us96 / 06005 , filed apr . 24 , 1996 , which has now been filed in the u . s . as u . s . application ser . no . 08 / 847 , 428 , which is a continuation - in - part of u . s . pat . no . 5 , 614 , 892 , which is hereby incorporated by reference . this reference shows an infrared probe which may be inserted into a payment slot of the meter to provide communications . in an alternate embodiment shown , the probe is docked in a dimple in the meter housing to align it properly for communications with the meter . the μc or μp 10 sends commands to the parking meter through the smart meter communication interface 30 requesting information and / or instructing the meter to perform a diagnostic routine , and to send the results of the routine back to the μc or μp 10 during the citation writing process . the information received by the μc or μp 10 , such as the status of the meter , the last payment received by the meter , the type of payment received , time and date of payment received , and whether the meter returned to zero normally or was reset to zero ( whether manually or automatically by vehicle detector ), is then stored in the on board memory 20 . the cws preferably provides a standard rs232 interface 32 with a 9 or 25 pin d - sub connector and all required driver chips for communication to any offsite computer via a serial port . included in the operational firmware is the capability to download all citation and system related data for permanent storage as well as upload of repeat violator data for field background checks . this interface 32 will also be used to reprogram the on board flash memory 22 to upgrade the operational cws firmware . in addition , cellular links may be incorporated for real - time background checks with a central office . fig2 shows a sample electronic parking meter according to the present invention . the meter includes a microcontroller ( μc ) or microprocessor ( μp ) 40 ( e . g . an 8048 or 8051 ) connected to both a real time clock 42 and a power supply with a battery backup system 44 . a type of payment , such as coins or a debit card , is inserted into the meter through the coin or electronic input trigger 46 by the parking space user , or an automatic logging system ( similar to the systems presently used for &# 34 ; toll tags &# 34 ;) can trigger the purchase of time . the time and amount of the transaction is recorded by the μc or μp 40 in the memory 52 provided in the meter . the meter display 48 informs the user of the amount of time purchased , and whether the meter is functioning properly . when a parking enforcement official issues a citation for a parking violation , the citation writing system sends commands to the meter through the communication interface 50 , where they are received into the μc or μp 40 . the μc or μp 40 accesses the information requested in the memory 52 , and if requested , can also perform a diagnostic routine . this information , including the results of the diagnostic routine , is sent back to the citation writing system through the communication interface 50 in addition to a signal from the clock 42 indicating the time of day the information was sent . fig3 is a flow chart of a sample software routine for the electronic citation writing system . reference numbers have been included to correspond with each step in the process . reference letters show the interconnection between the steps . at the beginning of the day ( step 60 ), the parking enforcement official enters information ( step 62 ) into the citation device to enable the device and to simplify the citation writing process . various entries such as the name and id # of the enforcement official are entered only once at the beginning of the day to minimize errors and eliminate repetitious entries . subsequently , the enforcement official can upload from an offsite computer ( step 64 ) the names and license numbers of repeat parking violators , stolen vehicles , and other related offenses . when an unattended vehicle is parked in a metered parking space for longer than the purchased time , the meter displays an indication that the time has expired allowing the enforcement official to issue a citation for a parking violation . once the official determines that the meter is in violation ( step 66 ), the official can attach the citation device to the meter ( step 68 ), to download various information ( step 70 ), including , but not limited to , the meter id #, the last payment received by the meter , the type of payment received , the time and date of such payment , the status of the meter at the time of payment , the current status of the payment , whether the meter returned to zero normally or was reset , and the results of a diagnostic routine performed by the meter at the request of the citation device . this information can be transmitted to the citation writing system by numerous means including , but not limited to , infrared signal , radio frequency signal , magnetic stripe , or integrated circuit chip read / write method . the enforcement official then enters the citation information ( step 72 ), such as the license plate number , and vehicle information , into the citation device . the citation number can be entered by the official , or preferably , the citation device can be programmed to automatically print the appropriate citation number . the citation device searches the uploaded information ( step 74 ) to determine if the vehicle has previous violations ( step 76 ). if enough previous violations are discovered ( step 78 ), the usual procedure involves seizing and towing or booting the vehicle ( step 80 ). however , the specific enforcement process varies according to the jurisdiction . if the search does not reveal enough previous violation ( step 78 ), the citation device prints an appropriate citation and the enforcement official leaves a hardcopy on the vehicle ( step 82 ). the citation writing system then logs all of the information pertaining to the citation ( step 84 ), and preferably , the device generates a checksum ( step 84 ) to provide verification that the citation information entered and the information obtained from the meter were recorded at the same time . at the end of the day ( step 86 ), the parking enforcement official downloads ( step 88 ) all of the citation information to an offsite computer for permanent storage ( step 90 ). this process streamlines the enforcement process and provides a report which can be used in court to rebut defenses such as the amount of time purchased , the time of the violation , or the inoperability of the parking meter . fig4 is a flowchart which shows a sample embodiment of the entire parking citation issuing and enforcement process . reference numbers have been included to correspond with each step in the process . reference letters show the interconnection between the steps . this process begins ( step 100 ) when a parking citation is issued ( step 102 ) and entered into a citation database ( step 104 ). the owner of the vehicle that has committed the violation receives the hardcopy of the citation left on the vehicle , which instructs the defendant to pay a fine ( step 106 ) or request a hearing ( step 108 ) by a certain date . if the defendant does not respond to the violation within the time allotted ( step 110 ), a reminder letter is sent ( step 112 ) notifying the defendant of the date and time of the violation , the amount owed , and the date such amount is due . once again , the defendant has the option of paying the fine ( step 106 ) or requesting a hearing ( step 108 ), however , if no response is received by the due date ( step 110 ), a notice of hearing and summons will be mailed to the defendant ( step 114 ). at the hearing ( step 116 ), the defendant can assert a defense to the citation . such defenses include disputing the accuracy of the parking meters , or claiming that the meter returned to zero time remaining prematurely , and / or disputing information on the citation , such as the time of day the violation occurred . the court determines the validity of any defenses ( step 120 ) and has the option of upholding the validity of the citation and requiring the defendant to pay the fine ( step 122 ), or finding the citation invalid ( step 134 ). if the defendant does not appear at the hearing ( step 118 ), the citation is upheld ( step 124 ), and the court can issue a warrant for the arrest of the defendant ( step 128 ), considering any previous outstanding violations ( step 126 ). if the defendant commits another parking violation , the parking enforcement official can tow or boot the vehicle ( step 130 ) if a warrant has been issued ( step 128 ), or if several outstanding citations have been issued to the defendant ( step 126 ). however , if the defendant paid the fine ( step 106 ) or had the citation held invalid ( step 134 ), the parking enforcement official will only issue another citation ( step 132 ) that will be entered into the citation database to begin the process again ( step 104 ). fig5 shows a sample embodiment of the hardware utilized to implement the innovative system , including meter 180 , ticket writer 182 , and probe 184 , which together gather , store , and communicate the information necessary for effective enforcement . the innovative parking enforcement system described herein reduces the possibility of the court finding the citation invalid due to any of the defenses listed above by generating a report which contains the citation data entered by the enforcement official and the information obtained from the parking meter at the time the citation was issued . furthermore , this system enables the parking enforcement official to determine whether previous outstanding violations exist . this allows the official to tow or boot repeat offenders to ensure payment of existing citations . other benefits include assuring compliance with parking laws , simplifying the enforcement process , and deterring repeat violators . according to a disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive information from said parking meter , to store said information in said data storage circuitry , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data as well as said information received from said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , to cause said parking meter to initiate a diagnostic routine , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive the results of said diagnostic routine executed by said parking meter , store the results of said diagnostic routine in said data storage circuitry , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data and the results of said diagnostic routine performed on said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive information from said parking meter , to store said information in said data storage circuitry , to generate a checksum , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data , said checksum , and said information received from said parking meter at the time said citation data was entered into said module ; whereby electronic verification that said citation data and the results of said diagnostic routine were recorded at the same time is provided . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module using said data input subsystem ; ( c .) receiving information from said parking meter , using said microprocessor , storing said information in said data storage circuitry , and outputting , using said output circuitry , a complete citation record , said citation record including said citation data as well as said information received from said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module , using said data input subsystem , to cause said parking meter to initiate a diagnostic routine ; ( c .) receiving the results of said diagnostic routine executed by said parking meter , using said microprocessor , storing the results of said diagnostic routine in said data storage circuitry , and outputting , using said output circuitry , a complete citation record , said citation record including the results of said diagnostic routine performed on said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module using said data input subsystem ; ( c .) receiving information from said parking meter , storing said information in said data storage circuitry , and generating a checksum , using said microprocessor ; and ( d .) outputting a complete citation record , using said output circuitry , said citation record including said citation data , said checksum , and said information received from said parking meter at the time said citation data was entered ; whereby electronic verification that said citation data and the results of said diagnostic routine were recorded at the same time is provided . as will be recognized by those skilled in the art , the innovative concepts described in the present application can be modified and varied over a tremendous range of applications , and accordingly the scope of patented subject matter is not limited by any of the specific exemplary teachings given . for example , it should be noted that the disclosed innovative ideas are not limited only to systems based on an ds5000 microprocessor , but can also be implemented in systems using 680 × 0 , risc , or other processor architectures . it should also be noted that the disclosed innovative ideas are not by any means limited to systems using a single - processor cpu , but can also be implemented in a cws using multiprocessor architectures . additional information , not mentioned in the sample embodiments can also be included in the information stored in the cws . one example is useful in conjunction with electronic meters which have vehicle presence detectors , which enable the meter to &# 34 ; know &# 34 ; whether or not a vehicle is present in the parking space , and even to reset the time to zero if the vehicle leaves before the time has expired . information regarding the times vehicles enter or leave a space can be stored in a cws , as well as notations that the meter was reset when a vehicle left . in addition , the nonvolatile memory of the rtc can be eeprom , battery backed sram , or flash .
6
the heart of the present invention is the frequency ratio generator ( frg ). the basic principle of operation of the frg relies on the fact that output frequency ( oscillator fosc ) and input frequency ( reference clock fref ) always have a rational relationship , i . e . the ratio of the two can always be represented as a ratio of two integer numbers , p and q , as shown in equation ( 6 ): alternatively , fosc / fref ratio can be expressed as a combination of two fractions , per eq . ( 6a ): if the ratio p / q can be realized in hardware , such that a frequency equal to fref * p / q is generated , then all what it would take to realize eq . ( 6 ) would be to use a pll and phase lock the oscillator to this frequency . the manner in which the frg accomplishes this goal is described below . it is well known in the science of mathematics that any rational number p / q can be expanded into various equivalent fractions . the equivalent fractions take a form of a series of divided , multiplied , added or subtracted terms , each term being a rational number itself . a simple example of such expansion is 3 / 2 = 1 + ½ . there are numerous possible fraction expansions , but here we are interested in those expansions which are most suitable for implementation in hardware . examining the four arithmetic operations and the feasibility to implement them in hardware , and keeping in mind that the variable which is being operated upon is frequency , the following can be found : addition : addition of two frequencies f 1 + f 2 requires a single side band ( ssb ) mixing , where upper sideband ( usb ) is used . it is well known in the art of frequency conversion that the ssb mixing of two frequencies produces only one dominant frequency , equal to either the sum or the difference of the two frequencies , depending upon which sideband ( upper or lower ) is produced . for ssb mixing , quadrature signals ( 0 ° and 90 ° phase signals ) of both f 1 and f 2 frequencies is required . this requirement poses some constraints , which will be reviewed later in the discussion on implementation details . alternatively , a double sideband ( dsb ) mixing followed by a band pass filter tuned to a desired sideband ( and rejecting the unwanted one ) can be used , however this approach is not suitable for integration in integrated circuits , primarily because of a need for external filters . subtraction : difference of two frequencies f 1 – f 2 can be obtained by ssb mixing , where lower sideband ( lsb ) is used . multiplication : multiplication of one frequency by an integer — there is no easy way to accomplish this in hardware ( a separate pll with dividers in the loop , or a harmonically locked injection - locked oscillator may be needed to accomplish this function ). multiplication by a factor of 2 is somewhat easier to implement directly , but in general , fraction expansions requiring multiplication are not preferred . division : division of a frequency by an integer — well known dividers or counters can be used for this function . it follows that expansions using addition , subtraction and division are preferred , and clearly those having fewer number of terms ( minimum expansion length ) are favored . one preferred type of fraction expansion that meets the above criteria is expressed in equations ( 7 ): where qi , i = 1 , 2 , 3 , . . . , n are also positive integer numbers . further types of preferred expansions include expansion of both fosc and fref frequencies , per eq . 6a , where both p1 / q1 and p2 / q2 are rational fractions , and each can be expanded into fractions like one in eq . ( 7 ) or eq . ( 8 ). a combination of the above equations , where part of the desired signals is synthesized per eq . ( 7 ) and part per eq . ( 8 ) is yet another preferred fraction expansion . the manner in which equations ( 7 ) and ( 8 ) are realized in hardware in the frg of the present invention is illustrated in fig2 . and fig3 . respectively . realization of other equations per above , or the combinations of , can be obtained in a similar fashion . key building blocks in hardware realization are the ssb mixers , for frequency addition / subtraction , and dividers for frequency division . each of the inputs to ssb mixers contains two signals — in phase and quadrature ( not shown in the figures for simplicity ). to obtain the quadrature signals , either a deilay line having a delay equal to 90 ° phase shift at the operating frequency ( which is not inherently broad - band , since a phase shift of a delay line will vary with frequency of the signal ), or a divide - by - two divider circuit can be used , as shown later in one of the embodiments of this invention . this requirement will put a constraint on the coefficients pi or qi in the fraction expansion , namely , the coefficients would need to be even numbers , i . e . divisible by two . the block diagrams in the fig2 and 3 can be directly constructed by following the formulas in eq . ( 7 ) and ( 8 ), respectively , with the addition of a loop filter and an oscillator , to complete a pll circuit . the mechanism for frequency acquisition of the pll is not shown in the figures , since the acquisition is not the focus of this invention . however , should assistance for frequency acquisition be needed , some of the well known techniques in the art , such as a frequency discriminator , which is turned - off upon phase acquisition , or frequency sweeping , or frequency pre - tuning can be used . as an example , frequency pre - tuning , where a separate tuning signal , which is summed together with that of the loop amplifier , can be used to pre - tune the oscillator and bring it &# 39 ; s frequency close enough to the target frequency , i . e . tune it within the lock - in range of the pll , so that the pll can acquire a lock . for any given fraction p / q , there may be multiple solutions for set of coefficients pi and qi ( i = 1 , 2 , 3 , . . . , n ) in eq . ( 7 ) and ( 8 ). multiple solutions provide additional freedom in the design choices . the computation of coefficients pi and qi is iterative in nature , and can be accomplished by various available mathematical and engineering tools . if q is not a prime number , it can be factored into a product of constituent terms , each of which is a prime number raised to an integer exponent . all coefficients pi and qi will contain some combination of products of these factors . the more factors q has , in general , there will be more possible solutions for pi or qi . given fosc and it &# 39 ; s required increment ( fstep ), the choice of fref will directly determine the q ( as shown in eq . ( 10 )). this indicates that for any specific range and step size requirement for the oscillator frequency , an optimum frequency fref can be found , such that a fraction expansion results in an optimum hardware implementation and performance . for each new frequency , corresponding to a new value of p , in general , a computation of new coefficients pi or qi is required . even for increments of p by 1 , the computation may result in completely different values of these coefficients . the ratio p / q , being equal to fosc / fref , represents the minimum possible multiplication ratio , and is therefore equal to the theoretical lower bound of the noise multiplication factor in the loop . for this reason , it can be stated that the frg is approaching theoretical lowest limit regarding noise multiplication factor occurring in the loop . since p is an integer with minimum increment of 1 , the minimum available frequency increment is : the fstep is the lowest frequency existing in the system ( any other frequency in the system is an integer multiple of this frequency ). conversely , 1 / fstep represents the common periodicity of the system , i . e . it is the longest period of any waveform or signal in the system , and therefore the closest distance between any two spectral components of any signal in the system is equal to fstep . for a given reference frequency fref and frequency increment fstep , q can be computed from eq . ( 9 ): individual terms in eq . ( 7 ) have frequencies equal to fref / pi , i = 1 , 2 , 3 , . . . , n . however , because of the digital nature , each of these signals will contain harmonics , and the output spectrum will contain numerous frequencies , as a consequence of spectral convolution of all signals present in the processing . spectral analysis is necessary for each of the synthesized frequencies , to make sure that the spectral purity around the desired output frequency is acceptable . to obtain the spectrum of the output waveform , first a time domain pulse waveform of the signal must be obtained , and fft computed . the time domain waveform can be obtained by computing the waveform over one full cycle equal to system periodicity ( which is equal to 1 / fstep , per eq . ( 9 )) for each of the internal nodes , or only for specific nodes of interest , as the signals are being processed and / or generated in various building blocks of the synthesizer . performing fft will yield the spectral purity information . the minimum frequency spacing between any two spectral lines can not be less than the frequency of fstep and depending on the particular values of coefficients pi or qi , there may or may not be any energy around the desired signal at separation equal to fstep or multiples of it . if the spectral purity is not satisfactory , a new fraction expansion solution should be found , and spectral analysis repeated . if a satisfactory solution can not be found with any fraction expansion , an option to employ external filtering of one or more internal signals can be considered . this would require a signal to exit the ic for external filtering , pass through a filter ( the signal will at this point become an analog signal ) and re - entry into the ic through some type of a comparator which will convert the analog signal back to digital . as an example of such comparator , a single gate , with dc feedback ( through a resistor ) from output back to input can be used . to illustrate the design process in the present invention , an example of fraction expansion and signal synthesis per eq . ( 7 ) is provided : 1 . given fref = 72 mhz , 2 . synthesize fosc = 75 . 63125 mhz 3 . first , find the greatest common factor for the two frequencies ( or alternatively , least common periodicity of the periods of the two signals ). a frequency of 6 . 25 khz is found ( 72 mhz = 11 , 520 * 6 . 25 khz and 75 . 63125 mhz = 12 , 101 * 6 . 25 khz ). note that 12 , 101 is a prime number , whereas 11 , 520 can be factored as 11 , 520 = 2 8 * 3 2 * 5 4 . form a ratio fosc / fref = p / q == 12 , 101 / 11 , 520 5 . expand the ratio per eq . ( 7 ): 12 , 101 / 11 , 520 = 1 + 1 / 20 + 1 / 2304 ( note : 20 = 4 * 5 = 2 2 * 5 and 2304 = 2 8 * 3 2 , i . e . each term is a product of subsets of factors of 11 , 520 ) 6 . implement per fig2 , with the following specific values : p1 division ratio = 20 ( resulting frequency is 72 mhz / 20 = 3 . 6 mhz ) p2 division ratio = 2304 ( resulting frequency is 72 mhz / 2304 = 31 . 25 khz ) first ssb mixer uses usb second ssb mixer uses usb 7 . compute in time domain the output waveform and perform the fft ; examine the spectrum in the vicinity of desired output frequency ( 75 . 63125 mhz ) and , based on the spectral content maximum , determine the loop bandwidth for the required sideband purity of the oscillator signal . while the lowest fractional frequency in item 6 . above is 31 . 25 khz ( which is a 5 th harmonic of 6 . 25 khz ), by spectral analysis of the output waveform it is found that the spectrum contains a 12 . 5 khz term ( 2 nd harmonic of 6 . 25 khz ) offset from the main signal at 75 . 63125 mhz , at a level about 50 db below the main signal . this signal would be converted in a phase detector down to 12 . 5 khz baseband frequency . for instance , for sideband purity of 70 db of the output oscillator , the maximum loop bandwidth of a third order loop could be about 6 khz , since it will provide about 20 db rejection at 12 . 5 khz . 8 . if necessary , obtain a different fraction expansion solution , e . g . : 12 , 101 / 11 , 520 = 1 + ¼ *( 1 / 5 + 1 / 9 )− 1 / 8 * 1 / 4 *( 1 − 1 / 8 ) and repeat the process . by spectral analysis in this case , it was found that a lowest frequency term of 31 . 25 khz will exist at the output of the phase detector , at about − 40 db . in this case , a third order loop with lbw of about 10 khz can be used , for the same 70 db purity of the output signal . the noise multiplication figure in the loop is only 20 log ( 75 . 63125 / 72 )= 0 . 4 db . for a step size of 6 . 25 khz , the prior art pll of a dual modulus type would have 20 log ( 12 , 101 )= 81 . 6 db of noise gain . this example illustrates a dramatic improvement that can be achieved with the present invention . detailed description of the preferred embodiments of the present invention is presented below . the first preferred embodiment of the present invention is shown in fig4 a . the rational synthesizer in this example has been designed to synthesize a frequency of 969 . 9875 mhz , which is used as a local oscillator in a catv upconverter . the upconverter is of a dual conversion type , where this signal is used as a local oscillator lo 1 in the first upconversion stage . this frequency is offset by 12 . 5 khz from a 970 mhz frequency . the offset of 12 . 5 khz is required by fcc regulation for some channels , as discussed earlier . for some other channels , which require an offset of 25 khz , this synthesizer can be tuned to a frequency of 969 . 975 mhz . for all other channels which do not require offsets , the synthesizer can be tuned to 970 mhz frequency . we &# 39 ; ll focus the discussion to a 12 . 5 khz offset case , i . e . fosc = 969 . 9875 mhz since the fosc frequency exceeds the maximum clock rate of the digital ic ( asic ) selected for this application ( which has about 200 mhz maximum clock rate ), an external divider of a division ratio of 8 had to be used . a system clock frequency of 72 mhz was chosen . the choice of this frequency was based on several considerations , the first being the factorization of this frequency in respect to 12 . 5 khz . other considerations included the design aspects of a crystal oscillator used as a physical source . to utilize the full benefit of the asic &# 39 ; s speed , a 72 mhz clock was doubled - up to a 144 mhz clock , for use as a reference frequency fref . the doubling was accomplished within the same asic ( the doubler is not shown in fig4 a , since a standard technique with gate delays and xor gates , well known in the art was used ). both fosc and fref are integer multiples of 12 . 5 khz . the rational expansion was chosen per the combination of eq . ( 7 ) and ( 8 ): to check the computation in terms of frequencies , substituting 144 mhz for fref in eq . ( 11 ): each of the terms in eq . ( 11 ) represents some physical frequency . the sequence of arithmetic operations in the above formula will affect which physical frequencies are generated ( i . e . by commutating the arithmetic operations , different frequencies will be generated ). the sequence of the arithmetic operations and the actual frequencies in this embodiment can be found in fig4 a . to shift the oscillator frequency to 960 mhz , an rf quadrature modulator circuit ic , operated as an ssb mixer is used . the quadrature modulator is fed , on one side by the output signal of the oscillator , serving as a local oscillator ( lo ) in the quadrature modulator , and on the other side by a signal of frequency fm = 9 . 9875 mhz serving as a modulation signal supplied by the asic . the lo signal is internally in the ic split in quadrature , whereby 0 ° and − 90 ° components provide the lo drive to their respective mixers in the quadrature modulator . the fm signal is also split in quadrature , in the asic . the output of the quadrature modulator will contain only one sideband , either lower sideband ( lsb ) or upper sideband ( usb ), depending upon the phase of the quadrature component of fm . if this component lags by 90 °, an lsb signal will be generated . if this component leads by 90 °, an usb sideband will be generated . the phasing is chosen for lsb , so that output of the quadrature modulator will be at frequency fosc − fm = 960 mhz . this signal is presented to the divide - by - 8 prescaler / divider , which produces the frequency of 120 mhz at it &# 39 ; s output . this frequency is compared in a phase detector with another 120 mhz signal , generated from 144 mhz reference clock signal with the frg inside the asic . this frequency is generated by dividing 144 mhz by 6 , where 24 mhz quadrature signals are produced , and mixing this signal in an lsb mixer ( such as one in fig6 b ) with 144 mhz ( the 144 mhz quadrature signal is obtained with a precise delay through several gates ), to produce 120 mhz . the output of the phase detector is supplied to a loop filter , which drives the tuning line of the oscillator and closes the pll circuit , so that a phase lock of the oscillator is established . returning back to considerations regarding spectral purity implications as a result of practical limitations in the performance of the quadrature modulator , it is not difficult to find that in addition to the desired sideband , the output spectrum will contain other , undesired terms , caused by imbalances in the in - phase and quadrature signal paths . in addition to a desired fosc − fm term , there will also be undesired terms , which will at minimum include the lo leakage at fosc frequency , the other sideband at fosc + fm frequency , as well as the direct leakage of the modulation signal at fm frequency . in addition , it is likely that numerous other sidebands caused by harmonics of modulation frequency fm will exist . all these terms must be regarded as spurious components , and each of those can potentially degrade the spectral purity , if it falls within or close to the lbw after being processed in the synthesizer . the relative power of these terms at the output of the quadrature modulator will depend upon the amount of imbalance and amount of direct leakage around the circuit . with the typical quadrature modulator ic in a reasonably well designed application circuit , the level of undesired signals of no less than − 30 dbc could be expected . since the fm signal in the first preferred embodiment of the invention is a digital signal , it will contain harmonics of the fundamental frequency fm , where the level of specific harmonics will depend upon the duty cycle , as well as on the rise time of the pulses . if the duty cycle is close to 50 %, predominantly odd order harmonics of fm will be present ( 3 fm , 5 fm , etc . ), and with fast rise time of the pulses , the third harmonic could reach as high as − 10 dbc levels . a spectrum of such digital signal is displayed in fig9 a , normalized to a frequency of 1 hz , for clarity . when such a complex spectrum is presented to the input of a prescler or divider , the first effect that will occur is the limiting of the signal on the strongest tone . the limiting will convert any am that may be present into pm , which will result in a bi - level signal ( i . e . the limiting will effectively convert an analog signal into digital ). next , a so called capture effect similar to the one known in fm systems will occur , where the divider will lock on and divide the frequency of the strongest tone ( which is the fosc − fm in this case ), while other terms will appear as pm modulation on this tone . the pm modulation terms will produce sidebands that are spread around the fosc − fm signal at the distance equal to the integer multiples of fm . in the division process , only the frequency of fosc − fm will be divided down , while the pm terms , being the modulation sidebands will remain at the same distance from the main tone after division , only the levels of those terms will be reduced by a division factor , which is consistent with the pm or fm modulation index scaling phenomena associated with a process of division , where only the sideband level , not the frequency distance , gets reduced by a factor equal to the division ratio . however , reduced spur levels through the division process will offer no relief to the spectral purity conditions , since all the terms appearing in the vicinity of the lbw at the output of phase - frequency detector will be multiplied back by the pll loop by the ( exact same amount equal to the division ratio . after the entire division process in this example , the spectral content of the signal presented to the phase - frequency detector will include the main tone at 120 mhz , surrounded by other terms at 9 . 9875 mhz spacing . the negative frequencies ( if any , depending on the division ratio ) will fold back around dc to positive ones . a 120 mhz signal applied to the other side of the phase detector contains it &# 39 ; s own sidebands . the phase - frequency detector will perform the operation of multiplication of the two signals ( in time domain , which is equivalent to the operation of mixing in the frequency domain ), which will produce the spectrum equal to the convolution of the spectrums of the two signals . in the mixing process , all spectral components present around 120 mhz and it &# 39 ; s harmonics will translate to spectral components around dc at the output of the phase detector . the distance of these components from dc will be equal to the distance of the original components from the main signal . in real implementation in a digital asic , there may be a case of adverse ( undesired ) coupling of the signals through internal structures of the ic ( such as substrate , bond wires , etc .) that in general can degrade spectral purity and produce spectral components which are not expected per the results of computations or simulations . to minimize such effects , it is beneficial to use differential ( complementary ) signals wherever possible , in order to utilize well known benefits of reduced coupling and cross - talk of such signals , as well as to optimize internal layout of the ic . the frequency fm = 9 . 9875 mhz in eq . ( 12 ), is generated by a circuit shown in fig4 b . note : in this , and other figures , a letter φ is used to indicates that division produces quadrature components , i . e . that it has two outputs − 0 ° and 90 °. the manner in which this signal is generated follows directly from eq . ( 11 ). first , 144 mhz reference signal is split in two signals , one divided by 2 in quadrature ( using a circuit of fig8 ) and another divided by 45 , also in qudrature . the dividers used for division by 45 are similar in nature to that of fig8 , except that the quadrature signals are not exactly 90 ° apart ( 88 ° in this example , as indicated in fig4 b .). in general , division by non - binary numbers can not produce exact quadrature , however with a proper choice of division sequence , choice of triggering ( either on the raising edge or on the falling edge ) and choice of signal polarity , the quadrature conditions can be approached close enough , so that degradation of the ssb signal ( i . e . reduced rejection of the unwanted sideband or signal feed - through ) is acceptable . the two signals are next applied to an usb mixer , such as one shown in fig6 a ., to produce a 75 . 2 mhz signal , which is further divided by two , to a 37 . 6 mhz frequency , which is in turn mixed in another usb mixer with it &# 39 ; s version divided by 8 , to finally produce a signal at 9 . 9875 mhz . to illustrate spectral conditions at the output of a digital ssb mixer ( with normalized frequencies down to a few hz for clarity ), in fig9 c a spectrum of a digital signal with dominant energy at 8 hz , as a result of usb mixing of the signals in fig9 a and 9 b , using the circuit of fig6 a is shown . as another illustration of a spectrum at the output of a digital ssb mixer , in fig9 d a spectrum of a digital signal with dominant energy at 6 hz , as a result of lsb mixing of the signals in fig9 a and 9 b , using the circuit of fig6 b is shown . to illustrate the spectral conditions at the output of a digital divider when dividing an ssb signal , in fig1 a a spectrum of a digital signal as a result of a divide - by - 4 of the usb digital signal of fig9 c , with dominant energy at 8 / 4 = 2 hz is shown . as another illustration of the spectrum at a digital divider when dividing an ssb signal , in fig1 b a spectrum of a digital signal as a result of a divide - by - 4 of the lsb digital signal of fig9 d with dominant energy at 6 / 4 = 1 . 5 hz is shown . the spectral plots in the figures above were obtained by computing time domain waveforms and applying fft transform . a block diagram of a wide range tunable synthesizer , operating in 1 ghz to 2 ghz frequency range , with 1 mhz step resolution is shown in fig5 a . the application of this synthesizer is in the same catv upconverter , except this signal is used as a local oscillator l 02 in the second upconversion stage . the circuit uses an external digital divide - by - two circuit followed by an analog ( rf ) quadrature modulator ic operated in ssb mode to provide a translation of the local oscillator frequency , further followed by a fixed digital divide - by - 8 ic in order to scale the frequency down to about 130 mhz and below , which is within the operating range of a chosen digital asic ( or fpga ). the fraction expansion can be performed in a similar manner as in the previous example . as a result of such expansion , various frequencies internally needed in the frg , in order to synthesize all required oscillator frequencies can be computed . the embodiment of the fraction expansion and the generation of all required frequencies is shown in fig5 b and fig5 c . all frequencies shown in these figures are derived from 144 mhz reference signal , in a similar manner as in the first example , using similar circuits for the division and ssb mixing process . an embodiment of an improved phase detector over the prior art is shown in fig1 . this phase detector employs ssb mixing of the two compared frequencies , where each frequency has quadrature signals ( i = 0 ° in phase and q = 90 ′ quadrature signal ). the circuit in fig1 is similar to a quadrature modulator circuit , except the phasing is somewhat different . the mixers are of analog type . compared with a detector of the prior art , this phase detector has a higher gain by a factor of two , since full converted power is contributing to the detection of phase , and a 3 db better noise figure . the prior art phase detector uses one mixer only , where half the power ( the power in the upper sideband ) is not used to contribute to the detection of phase difference of two signals . an embodiment of the ssb phase comparator with digital circuits is possible , where analog mixers are replaced with xor gates , and the i and q signals at the output of the xor gates are summed together by a resistive network . an embodiment of a digital phase - shift circuit , which provides phase control capability is shown in the block diagram in fig1 . an example of 45 . 75 mhz signal is shown , where full 360 degrees phase control with 1 . 25 ° step resolution is available . this signal ( or a signal of different frequency constructed in a similar way ), can be added / subtracted to another signal by ssb mixing and so obtaining a phase controlled signal at any desired frequency . through ssb mixing , the phase control range and step size will remain unchanged , since the ssb mixing is an additive process , both for frequency and phase .
7
the general arrangement of the elements is shown most clearly in fig1 . this shows a towable power plant 100 including a frame 102 with a drawbar 104 and a hitch 106 . a pair of wheels 108 is coupled to the frame 102 either with or without suspension . an enclosure 110 houses an engine 202 . the engine 202 may be fixedly secured to the frame 102 . a light tower 300 may be coupled to the drawbar 104 . the light tower 300 may be coupled to the drawbar 104 with mechanical fasteners , by welding or any other process . a portion of the light tower 300 is moveable between a towable position and a working position . in the towable position , the moveable portion of the light tower may be secured to a coupling 144 secured to the enclosure 110 . in the working position the light tower is preferably coupled only to the frame 102 and does not contact the housing 110 . as shown in fig2 the engine 202 is coupled to a starter 204 , an alternator 206 , and an air compressor 208 . alternatively , the engine 202 may drive an electric generator , a water pump , or a hydraulic pump . the engine 202 may use any fuel including , but not limited to , gasoline , diesel , and natural gas . the compressor 208 may be coupled to a storage tank 210 in known fashion . the output of the compressor 208 or the tank 210 may be used to drive pneumatic tools such as a jackhammer . the alternator 206 may be used to recharge an energy storage device , for example a battery 212 . the battery 212 may be coupled to the starter 204 through a series of switches or actuators and a relay coil 220 that may be arranged in a variety of different ways . an ignition switch 214 may be manually operable with a key or any other means to make or break electrical connection with the battery 212 . the ignition switch is preferably a momentary switch . an optional air pressure switch 216 may also be used to make or break electrical connection with the battery 212 . the air switch may break connection with the battery if the air pressure in the tank 210 exceeds a predetermined value . a manually operable switch , for example a toggle switch 218 may also be used to make or break electrical connection with the battery 212 . the toggle switch is preferably a maintained switch . a socket 230 may also be electrically coupled to the battery 212 through a fuse 234 and a relay contact 232 . the relay contact may be used to control the on / off status of the lamp 320 and may have an actuator that extends through an opening in the enclosure 110 . the socket may be mechanically coupled to the housing 110 of the towable power plant 100 . fig3 shows the light tower assembly 300 . the light tower assembly includes a first support member 302 rotatably coupled to a second support member 304 about a pivot pin 306 . the first member 302 is moveable between a towable position ( as shown in fig3 ) and a working position ( as shown in fig1 ). the second member 304 is coupleable to a draw bar 104 of a towable trailer with mechanical fasteners 308 and clamps 310 . alternative fastening methods including welding shall be considered part of the present invention . the first member 302 may be mechanically secured to the second member 304 in the working position with a pin 332 . a lamp 320 , for example a 100 - watt incandescent lamp , may be coupled to a light - mounting bracket 322 that is couple to a light - rotating shaft 324 . preferably , a plurality of lamp may be coupled to the light - mounting bracket 322 . the light - rotating shaft 324 is capable of being manually rotated about the longitudinal axis of the first member 302 with a handle 326 . the light - rotating shaft 324 may extend through a series of aligned opening in plates extending from the first member 302 . knob 340 may be used to resist rotational motion of the shaft 324 . a retainer 342 and collar 344 may be used to prevent removal of the shaft 324 along the longitudinal axis of support member 302 . a winch 326 with a handle 348 is coupled to the second member 304 with suitable fasteners or by welding . a first end of a cable 350 may be connected to the winch 326 and then extends around a guide or pulley 328 and the second end is coupled to the first member 302 near an end opposite the lamp 320 . the pulley 328 may be secured to the second member 304 with a bracket 330 . a lanyard 334 may be used to secure locking pin 30 and a leaf spring 336 may be used to aid in lowering upper support 302 from vertical position . a wire clip 338 may be used to secure cable assembly to upper support 302 . fig4 shows a wiring assembly 400 with a plug 402 coupled at a first end of a length of cable 404 and at least one lamp electrically coupled to a second end . connectors 406 may be used to allow for removal of the lamp . the connector 406 may be coupled to lamp 320 . a portion of the wiring assembly 400 may be secured to the outside of the first member 302 or alternatively it has to be housed inside of the first member . the plug 402 is matable with the socket 230 . alternatively a wiring assembly 400 may have alligator style clips secured at the first end in place of the plug 402 to allow for connection to the positive terminal of battery 212 and the negative terminal of the battery or a convenient grounding point . the cable 404 may enter the enclosure through an existing opening or through one of the enclosure doors . it should be understood that , while the present invention has been described in detail herein , the invention can be embodied otherwise without departing from the principles thereof , and such other embodiments are meant to come within the scope of the present invention as defined in the following claims :
1
those of ordinary skill in the art will realize that the following description of the present invention is illustrative only and not in any way limiting . other embodiments of the invention will readily suggest themselves to such skilled persons having the benefit of this disclosure . in accordance with a presently preferred embodiment of the present invention , the components , process steps , and / or data structures may be implemented using various types of operating systems , computing platforms , computer programs , and / or general purpose machines . in addition , those of ordinary skill in the art will readily recognize that devices of a less general purpose nature , such as hardwired devices , or the like , may also be used without departing from the scope and spirit of the inventive concepts disclosed herein . the present invention relates to a method to determine the constellation type for modulation of a received signal . the method may be used in a receiver of a communications system employing different types of modulations . examples of such systems include , but are not limited to , multiple data rate systems , adaptive data rate systems and multi - resolution modulation systems . these can be found in satellite , microwave , terrestrial and cable communication systems along with broadcast channels , digital subscriber loops and various size networks . the method may also be used in universal types of receivers designed to operate for multiple applications . such receivers may be reconfigured according to the modulation system employed . examples of such universal receiver systems are those used in television set - top boxes that can receive vsb , m - qam and m - psk depending on the transmission medium and communication standard used . the method may be used in conjunction with any form of timing and carrier synchronization . it may also be used with equalization used in channel receivers . the inventive method may ascertain the modulation without the need for recovery of carrier identification . the channel intersymbol interference may be treated as additive white gaussian noise , irrespective of the channel noise level . the symbol timing is assumed to be recovered and the data available at the symbol rate . the waveform series s m ( nt ) for m = 1 , 2 , . . . , m may be characterized by an average voltage s . the series of these signal waveform may be expressed as an expected value function of its average e (| s |) representing an aggregate absolute voltage of the received signals . the function e may also signify the equivalent low pass filtering operation of the waveforms . the power of the signal may be expressed as a second order moment of the waveform . for the power , the expected value function e ( s 2 ) may be taken for the series of the square of the waveform . the variance of signal power may be expressed as a fourth order moment of the waveform . for the signal power variance , the expected value function e ( s 4 ) may be taken for the series of the fourth power of the waveform . by dividing the variance function by the power function , a moment ratio r may be expressed by the following relation : r = e  ( s  ( nt ) 4 ) e  ( s  ( nt ) 2 ) signals arranged in an m - psk constellation have a constant envelope , i . e ., identical distance or moment d of the constellation points from the signal space origin . since the waveform average s may be replaced the combined or average absolute distance | d |, the resulting expected value function e (| d |) may be treated as proportional to a constant d c . consequently , m - psk signals have the same second and fourth order moments irrespective of the number of constellation points m . this allows a psk moment ratio to be reduced to r = d c 4 / d c 2 = d c 2 . signals such as qam , pam and vsb may exhibit different second and fourth order moment characteristics for increasing numbers of constellation points . as m increases , points may disperse on the signal grid . for example , points for 8 - qam may be located at ± 1 ± j and ± 3 ± j . due to the differing distances from the origin , the points in these constellations have non - uniform second order moments , and by extension non - uniform fourth order moments . power and variance functions may vary from one point to another within a constellation . consequently , as the number of points m within a constellation expands , the e functions monotonically increase for these modulated signals . the moment ratio r may thus be treated as a unique value for each m - qam and m - pam constellation , and distinguished from the psk values of r . a comparison of expected value functions and the moment ratio for selected modulations is shown in table 1 . each constellation type includes the number of constellation points m and modulation technique . the constellation type is described by point distances from the origin , the expected value function of that distance , the function with respect to the square of the distance , the function with respect to the fourth power of the distance , and the moment ratio . calculation of the moment ratio r may distinguish between modulation by constellation types . the moment ratio may also distinguish m levels within a constellation type ( except psk ). an algorithm may include comparing the moment ratio to a threshold for distinguishing between two types of constellations . alternatively , the thresholding operation may be generalized by comparing the moment ratio to a series of threshold values to identify the constellation type and / or its level among several candidates . fig4 shows a block diagram for the algorithm to determine the constellation type according to a first specific embodiment of the present invention . the algorithm 30 receives an incoming signal 32 into an amplifier 34 . the amplified signal may be digitized in an analog - digital converter ( adc ) 36 . the digital signal may be separately input into a second order power ( or squaring ) function 38 and a fourth order power function 40 . the second and fourth order power functions 38 and 40 may be considered equivalent to a first low pass filter ( lpf ) to perform the expected value function . the squared value from the function 38 may be input to a ratio - inverter 42 ( taken to the − 1 power ). the smoothed fourth order and inverted squared values may then be input to a multiplier 44 to produce a moment ratio r in a ratio store 46 . a threshold value t may be provided in a threshold store 48 . the moment ratio r and threshold t may be input to a logical comparer 50 . if the moment ratio r is lower than the threshold t , the comparer 50 may indicate a first constellation condition 52 . by contrast , if r is higher than t , the comparer 50 may indicate a second constellation condition 54 . a concatenated series of threshold values may be compared with the moment ratio in order to distinguish between several constellation types . the procedure of determining the constellation type may be further simplified in a second embodiment of the present invention . by employing an automatic gain control , the power level ( represented by the expected value function of the square of the point distance or moment ) may be normalized to the highest power value among the expected modulation techniques . from the constellation list in table 1 , the highest power level is 170 , corresponding to 256 - qam . the point distance d for each constellation type may be multiplied by a coefficient a in order to normalize each power function e ( d 2 ) to a value of 170 . this normalizing operation may be performed by automatic gain control ( agc ). the agc system for a multi - constellation type receiver may adjust the incoming signal power and adc input range irrespective of signal modulation type . thus , the incoming signal power may be uniform regardless of the input constellation . a comparison of expected value functions and the moment ratio for selected modulations is shown in table 2 . each constellation type includes the number of constellation points m and modulation technique . the constellation type is described by coefficient a , the expected value function of the coefficient and distance product , the function with respect to the square of the product , the unction with respect to the fourth power of the product , and the moment ratio . the multiplication of power normalizing coefficient a by the distance d may produce a factored moment . the incorporation of the factored moment in the expected value function may eliminate the division of the fourth order function by the second order function , since the latter may be normalized as a constant value . a comparison to a threshold may be made either to the fourth order function , or to a moment ratio composed of the fourth order function divided by a constant power value . consequently , the complexity of the algorithm for determining the constellation type in the second specific embodiment may be reduced from the first specific embodiment . fig5 shows a block diagram for the algorithm to determine the constellation type according to the second specific embodiment of the present invention . the algorithm 60 receives an incoming signal 62 into a normalizing amplifier 64 . the amplified signal may be digitized in an adc 66 . the digital signal may be input into a fourth order power function 68 ( such as an lpf ) to produce a value 70 that may be termed a moment ratio . a threshold value t may be provided in a threshold store 72 . the moment ratio r and threshold t may be input to a logical comparer 74 . if the value 70 is lower than the threshold t , the comparer 74 will indicate a first constellation condition 76 . by contrast , if the value 70 is higher than t , the comparer 74 may indicate a second constellation condition 78 . a concatenated series of threshold values 72 may be used to compare with the value 70 in order to distinguish between several constellation types . the normalized moment ratio may be readily segregated by constellation type . the moment ratio for m - psk in table 2 is 170 . the moment ratio for m - qam in table 2 lies between 220 and 240 . the moment ratio for m - pam in table 2 lies between 270 and 310 . the moment ratio may be compared to a threshold to distinguish between two types of constellations . for example , a first threshold value of 200 ± 20 may be employed for deciding between psk and qam constellations , with values below the first threshold corresponding to psk and values above being either qam or pam . alternatively , a second threshold value of 260 ± 10 may be considered to distinguish qam and pam constellations , with values above the second threshold corresponding to pam . the thresholding operation may be generalized by comparing the moment ratio to a series of threshold values to identify the constellation type among several modulation candidates . the m number of points may be determined by further thresholding for narrower differences between threshold values . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art having the benefit of this application that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims .
7
below , the invention will be described in more detail on the basis of the figures , with only the features required for understanding the invention being depicted . the following reference signs are used in the figures : 1 : tof camera ; 2 : x - ray tube ; 2 . 1 : telescope and articulation system ; 3 : x - ray detector / flat - panel detector ; 3 . 1 : telescope and articulation system ; 4 : rail system ; 6 : housing ; 7 : c - arm ; 8 : patient couch ; 9 : computer unit ; g : wire model ; o : organ system ; p : patient ; s : skeleton / bony skeleton ; v : venous and arterial system ; prg 1 - prgn : software / programs . referring now to the figures of the drawings in detail and first , particularly to fig1 thereof , there is shown an exemplary radiography system according to the invention , by which projective x - ray recordings of patients can be generated . such a radiography system contains a patient positioning system , in this case in the form of a patient couch or table 8 , which is embodied in a manner adjustable both in terms of the height thereof and in terms of at least one horizontal direction . if the patient is born on the patient couch , it is possible to set both an x - ray tube 2 and a digital flat - panel detector 3 to have any spatial locations and any alignments with the aid of a telescope and articulation systems 2 . 1 and 3 . 1 thereof . in the present example , both telescope and articulation systems 2 . 1 and 3 . 1 are connected in a horizontally displaceable manner to a ceiling of the room by way of a rail system 4 . what should be observed in each case for an x - ray recording is that a coordinated alignment between the x - ray tube 2 and the flat - panel detector 3 is brought about in such a way that , first , in respect of the desired active recording region thereof , the detector 3 is covered by the x - ray radiation and , second , the x - ray radiation should where possible not extend beyond the recording region such that there is no unnecessary exposure of the patient to radiation . moreover , the alignment of the x - ray radiation and the recording region of the detector 3 must be set in such a way that as few perspective distortions as possible are created . this already is not a trivial problem for the operating staff , particularly in the case of x - ray tubes and detectors that are freely movable relative to one another . finally , in order to avoid unnecessary exposure to radiation , it is also necessary to set the x - ray radiation as exactly as possible onto the recording region on the patient that is required for making findings , for example for recording a specific region of the skeleton , a predetermined organ or an organ system containing a plurality of organs . to this end , the operating staff requires well - founded anatomical knowledge . however , despite intensive training , there are repeated occurrences where the undertaken settings are insufficient and hence regions that are too large are irradiated unnecessarily or it is necessary to carry out correction recordings as the first recording did not completely cover the desired region . therefore , according to the invention , use is made of a time - of - flight camera 1 and the patient p is scanned in respect of his contours using the tof camera 1 , which in this case is assembled on the x - ray tube 2 . from knowledge about the contour of the patient , it is then possible to calculate a wire model of the skeleton with typical joint locations . corresponding computer programs for generating such a wire model — registered / adapted to the contour of the patient — are well known and also made freely available by the manufacturers of the tof cameras as software development kit ( sdk ). if the wire model with its typical joint locations and distances between the joint locations is available , it is possible to register a previously established general model of anatomical structures on the established wire model such that a display of anatomical structures adapted to the proportions of the patient is made possible and the structures in turn can be projected directly onto the patient with the aid of a projector , or it is possible to superpose onto an image recording of the patient the established virtual anatomical structure on a monitor . in the present example , such an image projector should be integrated directly into the housing of the tof camera 1 . the above - described establishment of the wire model and also the adaptation of the virtual anatomical structures can take place on the computer system 9 with the aid of the programs prg 1 - prgn that are stored therein and executed during operation . instead of projecting the organic structures onto the patient , it is possible to display a superposition of the virtual structures and an optical recording of the patient on the monitor of the computer system . if the operating staff now has the anatomical structure of the patient to be examined optically in view relative to said patient , it is possible to control the alignment of x - ray tube 2 and detector 3 substantially more exactly than previously . additionally , reference is made to the fact that the way that the patient is borne shown here is merely intended to be exemplary . by way of example , the bearing aids according to the invention can also be used for instances of patient positioning in which the patient is imaged in a standing position for a recording of the lungs or in which the patient is examined in a seated position . the embodiment of an x - ray system according to the invention can also be brought about in conjunction with a c - arm system , as shown in fig2 in an exemplary manner . this c - arm system typically likewise contains an x - ray tube 2 and a digital flat - panel detector 3 , wherein , however , these two units are securely connected and aligned relative to one another by way of a swivelable and rotatable c - arm 7 . the c - arm 7 is moved by an appropriate mechanism , which is situated in the housing 6 and the control of which is carried out by the computer system 9 with the aid of appropriate programs prg 1 - prgn . in the shown embodiment , the tof camera 1 is once again fastened to the x - ray tube 2 . in order to elucidate the invention , a wire model g is also shown on the patient p , which wire model is created according to the invention with the aid of the tof camera 1 and appropriate software in the computer system 9 and which wire model is adapted to the proportions of the patient currently situated on the patient couch 8 . fig3 to 7 once again elucidate the procedure according to the invention for assisting a correct alignment of x - ray recordings in the case of a projective x - ray system . fig3 shows the contours of a patient p on a patient couch , as are recorded by a tof camera . by applying appropriate , currently freely available sdks , it is possible to create a wire model g of the patient p , as depicted in fig4 , from this contour and with optionally the movements of the patient being taken into account . such a wire model g has nodes — depicted by the plotted solid black circles — at which the wire model is movable . the distances between the wire points in this case are embodied in a manner specific to the patient , i . e . adapted or registered or scaled to the proportions visible in the contour of the patient . by means of appropriate statistical examinations of subjects with the aid of ct and / or mri recordings , it is possible to determine mean or typical anatomical structures registered to the wire model . in this case , it is particularly advantageous if , additionally , standardizations or subdivisions according to sex , height , weight , etc . are also undertaken . on the basis of the statistical material obtained thus , it is now possible to align and register the desired anatomical structure s , v or o on the basis of the wire model g . in fig5 to 7 , an adapted skeleton s , an adapted venous and arterial system v and an adapted organ system o are depicted as anatomical structures in an exemplary manner . according to the invention , the respective virtual anatomical structure s , v and o obtained thus is projected onto the patient situated on the patient couch , or it is shown on a monitor with the patient , for aligning x - ray tube and detector . as a result , the correct alignment of the recording system becomes substantially easier and it becomes permanently more precise . thus , overall , this invention shows an x - ray recording system , in which the contour of a patient is established with the aid of a tof camera and , in a manner scaled to the contour , a wire model is generated in the form of a much - simplified skeleton with the essential joint and endpoints and the connections thereof . representations of anatomical structures are then scaled to this wire model and depicted visually together with the patient . thereupon , the operating staff is able to set the desired recording region for the x - ray recording in a very precise and accurate manner , supported by the visual representation of the anatomical structure together with the patient . even though the invention was illustrated more closely and described in detail by the preferred exemplary embodiment , the invention is not restricted by the disclosed examples and other variations can be derived herefrom by a person skilled in the art , without departing from the scope of protection of the invention . the following is a summary list of reference numerals and the corresponding structure used in the above description of the invention : 1 tof camera 2 x - ray tube 2 . 1 telescope and articulation system 3 x - ray detector / flat - panel detector 3 . 1 telescope and articulation system 4 rail system 6 housing 7 c - arm 8 patient couch 9 computer unit g wire model o organ system p patient s skeleton / bony skeleton v venous and arterial system prg 1 - prgn software / programs
0
referring to the drawing , a playing board 11 is provided which may be made of any suitable material and may be foldable in two or more sections . a square central area 12 is defined by coordinate boundary lines 13 . the central area 12 is surrounded by spaced coordinately extending lines 14 , 15 defining contiguous squares 16 which are located in columns surrounding the central area 12 . randomly arranged ones , i . e . 17 , of the squares 16 are progressively numbered around the board in a clockwise direction from &# 34 ; 1 &# 34 ; to &# 34 ; 21 &# 34 ;, and each is marked by heavy lines 18 to form a cell which is open at one side as indicated at 20 . such openings 20 also extend in different randomly arranged directions . a starting row 21 of squares 16 is located at the lower left hand corner of the board and such squares are differently colored to receive similar differently colored playing pieces 22 . the squares of the starting row 21 are located in the columns of squares passing along the left hand side of the central area 12 , and the right hand end of the starting row 21 is defined by a heavy finish line 19 which extends to the central area 12 and forms the left hand wall of the highest numbered cell , i . e . &# 34 ; 21 &# 34 ;. a register device 23 is provided comprising a block of wood or similar material having a row of holes 24 formed therein equal in number to the number of cells on the board 11 . such holes are identified by indicia 25 , identifying each hole with a corresponding numbered cell . a marker in the form of a pin , pencil or the like may be inserted into any one of the holes 24 to indicate the highest numbered cell to which any player has advanced as will appear presently . fig3 illustrates a conventional die cube 26 having different numbers of spots 27 on its various sides , ranging in number from one to six . such die forms a selection device for randomly selecting the number of squares each playing piece is to be advanced . however , other well known types of random selection devices may be used wherein a value from &# 34 ; 1 &# 34 ; to &# 34 ; 6 &# 34 ; may be obtained by chance . in playing the game , the players select respective playing pieces 22 and locate them on the correspondingly colored starting squares 21 . the die 26 is then rolled to indicate the number of squares the player having the first or leftmost playing piece 22 is to advance his piece . the object of each player is to land his playing piece 22 in a cell 17 which can only be entered through its opening 20 . the piece 22 can be stepped in any direction , except diagonally , but cannot step on the same square 16 more than once during each advance . the die 26 is then rolled to indicate the number of squares the next player can advance , etc ., until one of the players scores by landing his piece exactly in a cell 17 . a marker such as a pin , pencil , etc ., is then placed in the hole 24 corresponding in number to the numbered cell , i . e . &# 34 ; 1 &# 34 ;, on which the player has landed and the player also receives a chip 28 or the like to represent his score . this procedure is repeated around the board by the players advancing to successively higher numbered cells until one of the players has accumulated a prescribed number of chips , for example 10 , which determines that he has won the game . however , when one player has scored on a particular cell 17 , no other player can score on that cell or on any lower numbered cell but must advance to another higher numbered cell in order to score . in the event that no player has accumulated the required number of chips to win the game by the time one player has scored by entering the highest numbered cell 17 , i . e . &# 34 ; 21 &# 34 ;, the game continues and as one of the players passes across the finish line 19 , he continues to again step through the originally traversed columns of squares , aiming toward the cell number &# 34 ; 1 &# 34 ; or a higher numbered cell . at this point , the marker is removed from the block 23 and is subsequently placed in the hole corresponding to that cell reached by one of the players . the playing process continues as noted hereinabove until one of the players accumulates the required number of chips 28 . many other rules may be imposed on the game . for example , a player must go around a cell 17 unless he wishes to enter it . he must also go around any square which is already occupied by the playing piece of a player . also , when a player &# 39 ; s piece is in a cell waiting for a next advance and is blocked by another player &# 39 ; s piece lying directly in front of the opening , the first player loses his turn . further , if a player &# 39 ; s piece 22 is in a cell and a second player enters his piece in the same cell , the first player must give up a chip to the second player . it will be obvious to those skilled in the art that many variations may be made in the exact construction shown without departing from the spirit of this invention .
0
fig1 shows a gas turbine power generator system 1 embodying the present invention , and this power generator system 1 comprises a gas turbine engine 2 , a fuel supply valve 3 for supplying fuel to the gas turbine engine 2 , an alternator 4 ( power generator ) driven by the gas turbine engine 2 , a battery system 5 for storing the electric power generated by the alternator 4 , a power control unit 7 for controlling the alternator 4 and battery system 5 according to the state of a user system 6 and an engine control unit 8 for controlling the mode of operation of the gas turbine engine 2 . the gas turbine engine 2 is provided with an air temperature sensor 9 for detecting the air temperature t 0 at the inlet end of the combustion chamber , an atmospheric pressure sensor 10 for detecting the atmospheric pressure p 0 , an inlet temperature sensor 11 a for detecting an inlet temperature tit of the turbine of the engine and an outlet temperature sensor 11 b for detecting the outlet temperature tet of the turbine , and the outputs of these sensors 9 to 11 are forwarded to the engine control unit 8 . the alternator 4 is provided with a rotational speed sensor 12 for detecting the rotational speed of the alternator 4 and hence the rotational speed of the gas turbine engine 2 , and the output of this rotational speed sensor 14 is also forwarded to the engine control unit 8 along with the output og of the alternator 4 . the illustrated gas turbine engine generator system 1 is also provided with a warning device 13 for providing an audible and / or visible alarm to an operator according to a command from the engine control unit 8 . the power control unit 7 is designed to control the output of the alternator 4 , and comprises a converter unit for converting the ac output of the alternator 4 into dc power and an inverter unit for converting this dc power and / or the dc power stored in the battery system 5 into commercial ac power . the engine control unit 8 comprises a microcomputer , rom , ram , peripheral circuits , input / output interfaces and various driver circuits , and is configured to control the fuel supply valve 3 and the power control unit 7 according to various control programs stored in the rom . during the operation of the gas turbine power generator system 1 , the power control unit 7 and the engine control unit 8 carry out the following control process . first of all , in step s 1 , the engine control unit 8 corrects an engine operation map by using a degradation correction coefficient which is described hereinafter . the engine operation map shown in fig4 gives an engine operation curve ( or a relationship between the rotational speed ne and the output of the engine or the output og of the alternator 4 ) which enables the engine to operate in such a manner that at least one of the internal temperatures ( turbine inlet temperature tit and turbine outlet temperature tet ) is equal to the corresponding limit temperature . as the degradation of the engine 2 progresses in time , the rotational speed ne for producing a given output rises , and the engine operation curve shifts rightward in fig4 . as shown in fig4 , the engine operation curve is determined by the turbine outlet temperature tet in a low to intermediate output region , and by the turbine inlet temperature tit in a high output region . in fig4 , the engine operation curve when the engine is new ( nominal engine operation curve ) is indicated by 0 % and that when the degradation has reached a limit ( maintenance warning ) is indicated by 100 %. the engine control unit 8 then determines , in step s 2 , a target rotational speed net of the gas turbine engine 2 according to the inlet state of the gas turbine engine 2 ( atmospheric temperature and atmospheric pressure detected by the atmospheric temperature sensor 9 and atmospheric pressure sensor 10 ) and the target output ogt by using the engine operation map which was corrected in step s 1 . the engine control unit 8 generates a rotational speed command cne which corresponds to the target rotational speed net , and forwards it to the fuel control unit in step s 3 . the engine control unit 8 further controls the supply of fuel via the fuel control valve 3 such that the rotational speed ne comes to match the rotational speed command cne , and forwards a corresponding fuel command cgf to the fuel supply valve 3 in step s 4 . thereby , the gas turbine engine 2 operates at a prescribed rotational speed net , and the alternator 4 generates electric power by an amount corresponding to the alternator target output ogt . the engine control unit 8 determines if the gas turbine engine 2 is operating under a steady state condition or not according to the changes in the turbine inlet temperature tit , turbine outlet temperature tet , rotational speed ne and alternator output ogt in step s 5 . if not , the engine control unit 8 returns to the starting point of the control process , and repeats the above described control process because the engine is in a transient state which is not suitable for estimating the degradation level of the gas turbine engine 2 . when the gas turbine engine has continued to be in a steady state operation for more than a prescribed period of time ( a few minutes , for instance ) or the determination result of step s 5 is yes , the engine control unit 8 determines a degradation level by using a degradation level determining unit in steps s 6 and s 7 . in other words , the engine control unit 8 conducts a feedback control in step s 6 so that the turbine outlet temperature tet detected by the outlet temperature sensor 11 b may be kept constant , and estimates the current advance in the degradation level δld of the gas turbine engine 2 according to a deviation of the target temperature obtained from the current rotational speed ne and alternator output og from the actual turbine outlet temperature tet . the engine control unit 8 determines the current degradation level by adding the current advance in the degradation level δld to the previous degradation level ld . the engine control unit stores the current degradation level ld in non - volatile memory such as eeprom so that the determination of the degradation level can be continued even when the gas turbine engine generator system 1 is shut down and restarted from time to time . the engine control unit 8 then determines if the current degradation level ld has reached a prescribed maintenance warning level ldmax in step s 8 , and if this determination result is yes , forwards a warning command to the warning device 13 in step s 9 . irrespective of issuing a warning or not , when the degradation level is determined , the engine control unit 8 updates the degradation correction coefficient kd corresponding to the current degradation level ld by using the correction coefficient determining unit in step s 110 . thereby , the correction of the engine operation map can be conducted at a high precision , and the efficiency of the gas turbine engine 2 can be improved . the engine control unit 8 stores the current degradation correction coefficient cd in non - volatile memory such as eeprom so that the engine operation map may be properly corrected even when the gas turbine engine generator system 1 is shut down and restarted from time to time . in the foregoing embodiment , only the turbine outlet temperature tet was monitored if it has reached a limit temperature or not because the engine operation map is substantially dictated by the turbine outlet temperature tet . however , it is also possible and more preferable to monitor the turbine inlet temperature tit as well , and define the engine operation map such that both the turbine outlet temperature tet and the turbine inlet temperature tit remain below the corresponding limit values . fig5 is a diagram showing how one of the turbine inlet temperature tit and turbine outlet temperature tet may be selected over the other when determining the engine operation map . a first target rotational speed is looked up from the engine operation map based on the limit temperature of the turbine outlet temperature tet , and a second first target rotational speed is looked up from the engine operation map based on the limit temperature of the turbine inlet temperature tit . of the first and second target rotational speeds , the higher one is selected and incorporated into the rotational speed command cne . thereby , both the turbine inlet temperature tit and turbine outlet temperature tet are kept within the limit temperatures , and the engine operation curve can be selected in an optimum fashion at all times . although the present invention has been described in terms of preferred embodiments thereof , it is obvious to a person skilled in the art that various alterations and modifications are possible without departing from the scope of the present invention which is set forth in the appended claims . for instance , although the gas turbine engine was used to power an electric generator in the foregoing embodiment , the present invention can also be applied to gas turbine engines for other purposes as well . the contents of the original japanese patent application on which the paris convention priority claim is made for the present application are incorporated in this application by reference .
5
fig1 illustrates the logical blocks of the implementation of the method of the prior art . this method is for controlling job execution in a target external system ( 120 ), such as a sap system , where these jobs have been scheduled from another external source system ( 110 ). the method may be implemented as a control program ( 100 ) such as a computer program or other data processing system that interfaces with the target system through a standard external system programming interfaces ( 130 ) such as xbp 2 . 0 with sap . a person skilled in the art can adapt this solution to the use by the control program of different user interfaces according to the ability of the target external system . these interfaces may be remote ( programming interfaces , web user interface ) or local ( command lines , graphical user interface ). this is why the control program may be executed on a remote server or on the same server than the external source or target systems . as explained in more detail in relation with fig2 , the control program suspends and releases jobs waiting for execution in the target system . through the interface , the control program collects the following information : query list of jobs running on target external system ; query list of jobs which can be suspended or released in the target external system ; read the number of batch processes in the target external system ; read total number of running jobs on the target system ; read any required resource on target system that is needed to run a job ; release / resume an enqueued job in the target system ; and track the status of running jobs ( running , complete ) on the target executing system . fig2 illustrates the control program logical blocks and system environment according to the method of the prior art . in this method , the control program ( 100 ) takes control of jobs ( job 1 , job 2 . . . job 8 ) which have been concurrently scheduled by the source system ( 110 ) for execution in the target system . the control program takes control of the jobs once they have been queued in the waiting queue ( 140 ) of the target system before execution . a single job scheduled can create spawned jobs in the target system . for example , job 1 and job 4 have generated respectively 2 jobs and 3 jobs for execution in the target system . using the api of the target system , the control program intercepts the job in the waiting queue , suspends the job and enqueues it in a local queue ( 150 ). to intercept jobs in sap , for example , the sap xbp2 . 0 api is used . according to customizable policies , spawned jobs can be suspended until an external program such as the control program resumes it . the control program uses different policies to resume suspended jobs such as : resume as many jobs as the total number of batch processes in the sap system ; and resume as many jobs as the number of free batch processes in the sap system ; these policies can be associated to criteria needed to prioritize suspended jobs : jobs with higher priority must be resumed first ; and jobs spawned by the same parent job must be resumed first . it is possible to extend and customize these policies to adapt the control program to the needs of the workload systems . fig3 illustrates the control program logical blocks and system environment according to the method of the preferred embodiment . in order to optimize the resources available in the target system , the algorithm of prior art can adapt the number of jobs to be released in the target system to the number of free batch processes in the target system . for example , the control program can release as many jobs as the number of free batch processes in the target system . however , in the preferred embodiment a solution is provided which goes over the best choice of policy to release jobs in the target system . the method is to add a control on the source system . using the interface capabilities of the source system , it is possible to add a second level throttling mechanism in order take the best advantage of the resources in the target system to execute jobs . a new component is added in the control program for making a computation of the maximum of jobs to be concurrently scheduled from the source system to take the best advantage of the resources available in the target system . in the example of fig3 , a maximum of 4 jobs can be scheduled by the source system . this limit is computed by the control program and imposed through the available api of the source system . the control of the maximum of jobs concurrently scheduled by the source system is done using available interfaces of the source system . in the preferred embodiment an application programming interface ( 300 ) is used . this limit adaptation ( decrease or increase ) can thus be done by a program automatically at given points in the general algorithm describing the control program as illustrated in the flowchart of fig4 . as with the interface of the target system , any other interface available in the source system and supported by the operating system of the server on which the control program is running can be used . as detailed in reference to fig5 , the computation of the limit of number of jobs to be scheduled depends on the resource available in the target system to executed batch jobs at a given t time and on the value of parameters . the parameter values can be read by the control program from a configuration file ( 310 ) if they are user defined or can be automatically evaluated by a statistical analysis system , which monitors job execution throughput and adjusts the configuration to get the best performance . it is noted that the computed limit at a given t time is based on the number of resources available for batch job execution at this given time . for example , the number free batch processes b ( t ) in sap target systems at this given time as explained in more detail in reference to fig5 . fig4 is the general flowchart of the method of the preferred embodiment . in the initialization step ( 400 ) of fig4 , the program controlling both the jobs to be executed in the target executing system and the jobs scheduled from the source scheduling system is started . the controlling program communicates with the external systems using the available interfaces so that the program is dependent on the type of external systems it communicates with . the person skilled in the art can imagine extending the capability of the program to many types of external systems and even to more than one interface when they are available on a same target system . for simplification of the description , the detailed description of the preferred embodiment is focusing on one originating source external system which schedules job into one target execution external system . a first part of the flowchart ( 410 , 415 , 425 , 430 , 435 , 440 ), corresponds to the control existing in prior art on jobs scheduled in the target system performed by an external control program . with this first control , jobs scheduled in the target system are enqueued in a queue local to the control program and released when the program determines that the resources in the target system are available . three new steps ( 420 , 445 , 450 ) of the preferred embodiment are added . they bring a second control by the control program which applies to the jobs scheduled by the source scheduling system . periodically , with a time period , the program checks ( 410 ) if new jobs have been submitted in the target system . this is done by reading the queue of submitted jobs in the target system . for example , while using the sap xbp2 . 0 api , the interface macros bapi_xbp_job_select and bapi_xbp_confirm_job are used to look into the sap job queue and find new submitted jobs . by getting sap job details , it is possible to find out whether the job has been spawned by one other job or not . new jobs ( answer yes to test 410 ) are candidate to be controlled by the program if they can be suspended ( 415 ). in sap , this checking is done using the macro bapi_xbp_get_intercepted_jobs . however , some jobs cannot be suspended . those jobs are submitted from external schedulers or those jobs not are matching the interception criteria stated in sap table tbcicpt1 . if jobs in the scheduling queue of the target system can be suspended ( answer yes to test 415 ), the program dequeues the jobs from the scheduling queue of the target external system and enqueues them in a queue local to the control program . if no job can be suspended among the new jobs scheduled in the target external system ( answer no to test 415 ), then the program cannot delay the scheduling for execution of this job , but performs a second level of control at the level of the source scheduling system . the control program changes in the target system the system parameter limiting ( 420 ) the number of jobs scheduled in the target system . this step comprises a computation of the best limit to put in place according to the number of jobs currently executing and the resources available in the target system ( number of ‘ free processes ’ in the example of sap ). the computation is described in fig5 . the program tests if the local queue has jobs to release ( 430 ). this step is also performed if there is no new jobs ( answer no to test 410 ) which have been submitted in the target system . if there are jobs to be released from the local queue of the control program ( answer yes to test 430 ), the program checks if there are resources available in the target system ( 435 ). this is done , for example , by using customizable policies such as provided with the sap xbp2 . 0 api . spawned jobs can be suspended until an external program ( like the control program described here ) resumes them . as described in relation with description of fig2 , different policies to resume suspended jobs can be used . if there is enough resource ( answer yes to test 435 ) then the jobs are released ( 440 ) or otherwise transmitted from the local queue and re - included in the waiting queue of the target system . in sap , this is possible using the macro bapi_xbp_job_start_asap . when there are no more jobs to control in the target external system ( 445 ) ( end of step 440 , answer no to test 435 and answer no to test 430 ) the program changes , in the target system , the system parameter adapting ( 450 ) the number of jobs to be scheduled in the target system . as in step 420 , this step comprises a computation of the best limit representing the maximum of jobs to be submitted by the source system in the target system . this computation is done knowing the resources available for batch job execution in the target system . in sap , the maximum number of concurrent jobs is equal to the number of “ sap background processes ”. in this second execution of computation of limit in the flowchart of the method of the preferred embodiment , as there are resources available , the limit will be increased compared to the result of step 220 which reduces the limit . the computation is described in detail in relation with fig5 . if the program is not stopped ( answer yes to test 455 ) the process goes on by checking ( 410 ) if new jobs have been scheduled by the originating external system in the target system . if not ( answer no to test 455 ) the program ends . in sap only jobs that have been internally submitted or any spawned jobs can be intercepted by an external control program . externally submitted jobs cannot be intercepted . so , when sap is the target system , the control program intercepts internally submitted jobs and spawned jobs and enqueues them in the local queue . but this is not the general case and the solution of the preferred embodiment considers the case where any job waiting for execution in the target system can be intercepted and enqueued in the local queue of the control program . fig5 is a detailed flowchart of the method of the preferred embodiment . the steps of this detailed flowchart are executed when the number of jobs to be scheduled in the target system is set to a certain limit . these steps are executed when a new job to be executed in the target system cannot be suspended by the control system ( 420 ) and the limit must be decreased to avoid overloading of the target system . these steps are also executed when a job is released by the control program for execution in the target system ( 450 ) and the limit must be increased to have a better use in the target system of all available resources to execute jobs . the first step ( 500 ) is performed by the control program to check how many free batch processes b ( t ) are available in the target system at this t time . then , the control program reads ( 515 ) in a configuration file ( 310 ) parameters for preparing computation ( 520 ) of a formula to provide or otherwise transmit ( 525 ) the maximum number of jobs to be scheduled , prior to returning ( 530 ) processing to steps 420 or 455 , knowing the value of these parameters at this t time and the number of free batch processes b ( t ) which are available in the target system . the number of concurrent jobs that can be submitted into the sap system at time t is given by limit ( t ) α is a positive or negative constant representing the minimum limit level ( if positive ) or a fixed negative bias ( if negative ), β is the multiplying factor that translates the number of concurrent sap jobs into concurrent external jobs , γ is a positive or negative constant representing a reserved number of batch processes that must be left always free ( if negative ) or an additional bias to overload batch ( if positive ), and b ( t ) is the number of sap free batch process available at time t , and f ( x ) is a function such as : given configuration parameters α , β , γ and using the simple moving average of length ν , the computed limit value at time t will be : parameters α , β , γ and ν can be defined in a configuration setting or , optionally , they can evaluated by collecting statistical data on job execution . if there are many jobs starting and finishing very quickly , then a slow update of the limit could be better to follow the actual average of the running jobs by ignoring unuseful fluctuations . on the opposite , if there are few slow jobs , then it could be better to change the limit with the same rate as the background processes . regardless the adopted tuning parameters , the solution of the preferred embodiment is able to synchronize the scheduling among source and target systems and is also able to avoid that the target system could get overloaded . if the configuration parameter values are the best ones , then the solution is used at its best capability . for α = 0 , β = 1 , γ = 0 , ν = 1 , the limit will be equal to the number of free batch processes : for α = 0 , β = 2 , γ = 0 , ν = 1 , the limit will be twice to the number of free batch processes : for α = 1 , β = 1 , γ = 0 , ν = 1 , the limit will be equal to the number of free batch processes plus one so , even if the number of free batch process is zero , the limit is for α = 0 , β = 1 , γ =− 1 , ν = 1 , a batch process is always left free and the limit will be equal to the number of free batch processes less one : even if the solution of the preferred embodiment has been described has been described when one source system schedules batch jobs for execution in one target system , the person skilled in the art can easily adapt the control program to control in the same way one source system scheduling batch jobs for execution in more than one target system . for example , one adaptation could be managing one local queue per each couple ( source system , target system ). the preferred embodiment implements a double level of synchronization because the external system is updated for any change in the target execution system and will not submit an overloading number jobs , and the target execution system will have an execution queue that does not exceed the maximum number of executable jobs . the preferred embodiment allows optimizing resource utilization and throughput of job execution in external systems such as application container systems . the preferred embodiment is based on a double level mechanism that allows a fine grained optimization by manual customization or automatic adaptive tuning . the double level job throttling mechanism of the preferred embodiment includes a first level to control children jobs spawned by other running jobs and a second level . the preferred embodiment is “ resource ” based . it measures the number of background processes available at a given time instant . the principle is one independent entity polling schedulers of the external systems without staying in between mediating data . this entity acts tuning the two schedulers &# 39 ; behaviors by limiting job scheduling on the target execution system and controlling release of jobs sent for execution on the target execution system . the preferred embodiment provides the following advantages . first , it does not require changes in the two schedulers only the standard apis provided by the external systems are used . second , it does not require any change of the connection between the originating external system and the target execution system . third , it is stateless as it does not need historical data or statistics , but it can benefit from statistics data for an automatic tuning . the preferred embodiment starts from an existing control program which can define an interception rule that can suspend batch jobs scheduled by a source system before their actual execution in a target system at fixed time intervals . the preferred embodiment retrieves the list of suspended jobs and , accordingly to user - defined policies , resumes them . the preferred embodiment is enhanced by adding a second level throttling system to optimize use of resources for batch execution in the target system . at a fixed time interval , the preferred embodiment checks the number of free batch processes in the target system . this value is used to calculate the maximum number (“ limit ”) of jobs that can be concurrently submitted into the target system . since batch jobs can spawn children jobs during their execution , the combination of the above three actions ( to limit concurrent job submission , to define suspension rules , to resume suspended jobs ) can be tuned to optimize job execution throughput . all the configuration parameters used in this preferred embodiment can be manually defined or can be automatically evaluated by a statistical analysis system , which monitors job execution throughput and adjusts the configuration to get the best performance .
6
fig3 is a block diagram of the fsk demodulator of the invention . where the parts function in a similar manner to those of fig1 the same numerals are used . the mark filter 11 and space filter 12 are conventional except that each has an extra output . in this case there are quadruature - related sine and cosine outputs for each filter . each of the four filter outputs is full wave rectified in rectifiers 19 - 22 . the sine and cosine rectified outputs from filter 11 are combined in summer 23 which drives low pass filter 15 . similarly , the outputs of sine rectifier 21 and cosine rectifier 22 are combined in summer 24 which drives low pass filter 16 . fig4 is a graph showing the outputs of summers 23 and 24 . the signal has been normalized at unity by dividing it by 1 . 414 . comparison of the waveforms of fig2 and 4 indicates that in the prior art circuit the first harmonic which must be removed is one octave above the fundamental frequency of the carrier . in the circuit of the invention the first harmonic which must be removed is two octaves above the fundamental . this doubling of frequency of this noise component results in more attenuation of this noise component than would be achieved with the prior art circuit . this reduction complements the previously mentioned harmonic signal reduction of the invention . the following description shows a cmos form of circuit construction of the invention . since the various elements are well known in the art their details will not be enlarged upon . it is to be understood that other forms of ic construction could be employed . fig5 is a filter circuit for performing the mark filter 11 and space filter 12 functions . input terminals 25 and 26 represent the noninverting and inverting filter inputs respectively . the filter is designed using a well known &# 34 ; biquadratic &# 34 ; topology . output terminal 27 provides a sine output while output terminal 28 provides a cosine output . the switched filter circuit uses input transmission gate switches 29 and 30 which are alternately clocked by θ1 and θ2 respectively to drive a capacitor t network 31 . op amp 32 is converted to an integrator by capacitor 33 and in conjunction with clocked transmission gates 34 - 37 develops a sine output at terminal 27 . capacitor t 38 has its input coupled to the output of capacitor t 31 and drives node 39 which is the junction of transmission gates 36 and 37 . capacitors 41 and 42 respectively couple the outputs of capacitor t 31 and capacitor t 38 to nodes 40 and 41 . op amp 43 is converted to an integrator by capacitor 44 . transmission gates 45 - 48 operate with op amp 43 to produce a cosine wave signal output at terminal 28 . fig6 is a graph showing the waveforms of θ1 and θ2 as employed in the circuit of fig5 . the pulses are made non - overlapping by the t 1 time increment . the clock pulses have a period of t 2 . θ1 and θ2 alternatively switch the n channel transistors on while θ1 and θ2 alternately switch the p channel transistors on . the pulse period t 2 is made small with respect to the period of the fsk or data signals . fig7 is a schematic diagram of a rectifier circuit suitable for performing the function of blocks 19 - 33 of fig3 . input terminal 50 receives a signal from one of the mark or space filters ( 11 or 12 ). comparator 51 senses whether the input is above or below ground . switches 52 and 53 will be in the positions shown ( up ) when the input voltage is above ground . when the input goes below ground , comparator 51 will drive switches 52 and 53 to their lower positions . transmission gates 54 and 55 are operated sequentially by θ1 and θ2 and their drive sense is controlled by the polarity of the input signal . capacitor 56 couples the node between transmission gates 54 and 55 to the node between transmission gates 57 and 58 which are operated sequentially by θ1 and θ2 . thus , for positive input cycles , transmission gats 54 and 57 ( and also 55 and 58 ) are operated in synchronism . however , for negative input half cycles the operating phases of transmission gates 54 and 55 is reversed so the negative half cycle inputs appear at terminal 59 inverted . thus , the output at terminal 59 is the full wave rectified input signal from the related mark or space filter output . two of the fig7 circuits will have their output terminals coupled to input terminal 60 of fig8 which therefore acts as a summer . the circuit shown further includes a low pass filter of the well known &# 34 ; sallen key &# 34 ; topology . transmission gates 61 and 62 are operated conventionally by the θ1 and θ2 clock signals and their common node is coupled via capacitor 65 to the common node of transmission gates 63 and 64 . output capacitor 69 is made relatively large so that its charge can only vary slowly . in effect , a relatively large number of incremental charges from capacitor 65 will be needed to vary the charge on capacitor 69 . capacitor 66 provides positive feedback coupling isolated by unity gain buffer 67 . the summed and filtered inputs appear at output terminal 68 . the outputs of the two low pass filters are coupled to a conventional comparator ( 17 of fig3 ). this comparator will produce a digital output , logic one or zero , depending upon which of the mark or space signals dominates . the circuit of fig3 was constructed using the schematic diagrams of fig5 and 8 . conventional cmos ic construction was employed . the following capacitors in 1 / 2 pf values were employed . ______________________________________capacitor mark filter 11 space filter 12______________________________________31a 1 131b 1 131c 4 . 3 4 . 938a 1 138b 1 138c 2 . 2 2 . 641 2 242 2 233 17 . 6 1644 17 . 6 16______________________________________capacitor rectifier and low pass filter______________________________________56 0 . 565 0 . 566 5559 12 . 5______________________________________ four rectifier circuits of the fig7 variety were employed , two each for mark filter 11 and space filter 12 . two fig8 summer and low pass filter circuits were used to combine and filter the rectified signals . the rectifier and low pass filter circuits were operated at a clock frequency that was 1 / 4 of the clock frequency of the filters . the clock frequencies were 28 khz and 112 khz respectively which provides a low pass filter corner frequency of 240 hz . the low pass filter outputs were coupled to a comparator , the output of which indicated whether a mark or space signal was present . the circuit performed in accordance with the above - mentioned &# 34 ; bell 103 &# 34 ; standard . it was useful in detecting a 300 baud data signal and had a 14 db greater signal to noise ratio compared with the prior art circuit . the total area of capacitors 66 and 69 ( two of each ) which dominate the topology , was about 675 mils 2 ( 0 . 435 mm 2 ). using the approach of the prior art , the equivalent chip area would have been about 1000 mils 2 ( 0 . 645 mm 2 ). the invention has been described and a working example given . when a person skilled in the art reads the foregoing description , alternatives and equivalents , within the spirit and intent of the invention , will be apparent . accordingly , it is intended that the scope of the invention be limited only by the claims that follow .
7
referring to fig1 showing an automatic chopper blade operating timing regulator in a preferred embodiment according to the present invention in combination with a portion of a chopper - type folding device pertinent to the present invention , a driven gear 51 interlocked with a chopper blade 41 is in engagement with one of the helical gears 52a and 52b , i . e ., the helical gear 52a in fig1 of a double helical gear 52 supported for rotation and axial movement . a driving gear 53 is in engagement with the other helical gear 52b of the double helical gear 52 . the chopper blade 41 is operated by the driving gear 53 through the double helical gear 52 and the driven gear 51 . the double helical gear 52 is moved axially to change the phase of the driven gear 51 relative to the driving gear 53 to change the timing of operation of the chopper blade 41 . a threaded portion 54 formed in the shaft of the double helical gear 52 is in engagement with an internally threaded member 55 journaled on a frame 56 so that the internally threaded member 55 is unable to move axially . a gear 55a is formed integrally with the internally threaded member 55 . the gear 55a is in engagement with a pinion 58 mounted on the output shaft of a stepping motor 57 . the stepping motor 57 rotates the internally threaded member 55 through the pinion 58 and the gear 55a to move the double helical gear 52 axially by the screw jack action of the internally threaded member 55 and the threaded portion 54 of the shaft of the double helical gear 52 . a slit disk 57a is mounted on the output shaft of the stepping motor 57 , and a pulse generator 59 is associated with the slit disk 57a to detect the phase of the slit disk 57a . a timing regulating mechanism comprises , as principal components , the driven gear 51 , the double helical gear 52 having the threaded portion 54 , the internally threaded member 55 integrally provided with the gear 55a , the pinion 58 and the stepping motor 57 . a piezoelectric acceleration sensor 60 , i . e ., impulsive force detecting means , is provided on a locating plate 34 to detect an impulsive force applied by a signature to the locating plate 34 . detection signals provided by the acceleration sensor 60 are applied to a charge amplifier 61 , the charge amplifier 61 provides an acceleration signal stream . a signal processing unit 62 receives the acceleration signal stream , averages the acceleration signal stream to obtain an average acceleration signal and gives the average acceleration signal to a comparator 63 . a desired acceleration setting unit 64 , i . e ., desired impulsive force setting means , for setting an optimum acceleration according to the condition of the signature gives a signal to the comparator 63 . the desired acceleration setting unit 64 is provided with a set acceleration calculating circuit 67 which sets a desired acceleration on the basis of data given thereto from an impulsive force setting device 65 and a signature mass calculating circuit 66 for calculating the mass of a signature , and gives a signal representing the desired acceleration to the comparator 63 . the impulsive force setting device 65 gives a signal representing an optimum impulsive force f to the set acceleration calculating circuit 67 . a sheet width w ( mm ), a basis weight s ( g / mm 2 ) and a web number n , i . e ., the number of webs to be used , are given to the signature mass calculating circuit 66 respectively from a sheet width setting device 68 , a signature mass setting device 68 and a web number setting device 70 . then , the sheet weight calculating circuit 66 calculates the mass m of the signature by operating those data given thereto by using : the set acceleration calculating circuit 67 receives the mass m of the signature and the desired impulsive force f , and gives a desired acceleration a ( a = f / m ) to the comparator 63 . the comparator 63 compares the acceleration signal received from the signal processing unit 62 and the desired acceleration a received from the set acceleration calculating circuit 67 , and gives a signal representing the deviation of the acceleration signal from the desired acceleration a through an amplifier 71 to a control unit 72 . then , the control unit 72 gives a driving signal through a pulse oscillator 73 and a driver 74 to the stepping motor 57 . the pulse oscillator 73 provides a clockwise driving pulse signal cw for driving the stepping motor 57 for rotation in a clockwise direction or a counterclockwise driving pulse signal ccw for driving the stepping motor 57 for rotation in a counterclockwise direction . when the deviation determined by the comparator 63 is a positive value , namely , when the actual acceleration of the signature is lower than a reference acceleration , the stepping motor 57 is driven so as to delay the timing of operation of the chopper blade 41 . when the deviation is a negative value , namely , when the actual acceleration of the signature is higher than the reference acceleration , the stepping motor 57 is driven so as to advance the timing of operation of the chopper blade 41 . the location of the double helical gear 52 at a zero - position is detected by a zero - position switch 75 , an upper limit switch 76 gives a signal to the control unit 72 at the upper limit of travel of the double helical gear 52 , and a lower limit switch 77 gives a signal to the control unit 72 at the lower limit of travel of the double helical gear 52 . the signal generated by the pulse generator 59 is applied also to the control unit 72 . a chopper blade operating timing regulating method to be carried out by the automatic chopper blade operating timing regulator will be described hereinafter . the chopper blade 41 is driven through the double helical gear 52 and the driven gear 51 by the driving gear 53 . the acceleration sensor 60 detects an impulsive force ( acceleration ) applied by a signature to the locating plate 34 . an acceleration signal representing the impulsive force , provided by the acceleration sensor 60 is transferred through the charge amplifier 61 and the signal processing unit 62 to the comparator 63 . the desired acceleration setting device 64 sets the desired acceleration a on the basis of data provided by the impulsive force setting device 65 and the signature mass calculating circuit 66 . the comparator 63 compares the acceleration signal and the desired acceleration a , and then the comparator 63 gives a deviation signal representing the deviation of the acceleration signal from the desired acceleration a through the amplifier 71 to the control unit 72 . the control unit 72 gives a drive command signal corresponding to the deviation to the driver 74 , and then driver 74 applies a drive signal to the stepping motor 57 to drive the stepping motor 57 . then , the stepping motor 57 rotates the internally threaded member 55 through the driving gear 58 and the gear 55a to shift the double helical gear 52 axially according to the drive command signal so that the phase of the driven gear 51 relative to the driving gear 53 is changed accordingly to change the operating timing of the chopper blade 41 is changed accordingly . if the deviation determined by the comparator 63 is a positive value , namely , when the actual acceleration of the signature is lower than the reference acceleration , the operating timing of the chopper blade 41 must be delayed to reduce the deviation to zero . therefore , a drive command signal to delay the operating timing of the chopper blade 41 is given to the driver 74 so that the stepping motor 57 rotates the driven gear 51 in a direction for delaying the operating timing of the chopper blade 41 . if the deviation determined by the comparator 63 is a negative value , namely , when the actual acceleration of the signature is higher than the reference acceleration , the operating timing of the chopper blade 41 must be advanced to reduce the deviation to zero . therefore , a drive command signal to advance the operating timing of the chopper blade 41 is give to the driver 74 so that the stepping motor 57 rotates the driven gear 51 in a direction for advancing the operating timing of the chopper blade 41 . thus , the operating timing of the chopper blade 41 is regulated automatically so that the acceleration of the signature at the impact of the same on the locating plate 34 is constant regardless of the signature conveying speed corresponding to the printing speed . the automatic chopper blade operating timing regulator is capable of automatically regulating the chopper blade operating timing so that the impact of the signature on the locating plate 34 is constant regardless of the printing speed and , consequently , the signature can satisfactorily be folded by the chopper blade 41 in an accurate quarto sheet in an accurate squareness . since the operator is required only to enter data of the signature , the quality of the folded sheet is not dependent on the degree of skill of the operator . although the invention has been described in its preferred form with a certain degree of particularity , obviously many changes and variations are possible therein . it is therefore to be understood that the present invention may be practiced otherwise than as specifically described herein without departing from the scope and spirit thereof .
1
while the specification concludes with claims which particularly point out and distinctly claim the invention , it is believed the present invention will be better understood from the following description . all weights , measurements and concentrations herein are measured at 25 ° c . on the composition in its entirety , unless otherwise specified . unless otherwise indicated , all percentages of compositions referred to herein are weight percentages of the total composition ( i . e . the sum of all components present ) and all ratios are weight ratios . unless otherwise indicated , the content of all literature sources referred to within this text are incorporated herein in full by reference . except where specific examples of actual measured values are presented , numerical values referred to herein should be considered to be qualified by the word “ about ”. as has been discussed , a limitation of traditional aerosol spray head configurations is that they may produce an uneven distribution of product on the target site . in addition , the viscosity of the product to be sprayed may be practically constrained to remain below a certain level . by introducing instability into the fluid flow at an early stage it is possible to atomize products with greater viscosities and , at the same time , improve the product distribution on the target site . the replacement of a single spray outlet by multiple outlets may assist in introducing that instability , because , for a given volume flow of product , the size of the shear interface ( i . e . the total outlet perimeter size ) is greater for multiple outlets than for a single outlet . without wishing to be bound by theory , it is believed that this measure may prevent the formation of a smooth film structure just outside the outlet where the product commences its trajectory to the target site . the disadvantage of a smooth film structure is that it may propagate a relatively coarse atomization in the final stage before the product reaches the target site , with the drops at the center of the spray being larger than those near the periphery . it is in the final stage of the spray formation where an instability in the system may help disintegrate the product into ligaments and then further into drops to form a highly atomised spray and an improved drop distribution . in addition , in a multi - outlet system , it is observed that , following the split in the flow to channel fluid to the separate orifices , changes to the separate flows may occur such that there may be differences , for example , in viscosity or other parameters , between what is sprayed from one outlet and what is sprayed from the other or others . if there are differences between the individual sprays immediately after they leave their respective spray outlets , then that may translate into differences in product distribution at the target site . without wishing to be bound by theory , it is believed that these changes may be brought about by manufacturing limitations . in other words , it is very difficult to ensure that the ducts along which the separate flows travel are identical . to counter this , it has been found to be beneficial to locate the point at which the flow splits to travel to the two or more separate spray outlets close to the spray outlets such that most of the flow within the spray head occurs prior to the split . to be more specific and as set out above , it has been found that it is beneficial to design the spray head ( 1 ) such that the ratio , l 1 / l 2 , for each spray outlet ( 3 ), of the distance ( l 1 ) between the conduit outlet means and the spray outlet ( 3 ) to the distance between the inlet means ( 5 ) and the spray outlet ( 3 ) is from 0 . 01 to 0 . 6 , preferably from 0 . 015 to 0 . 4 and more preferably from 0 . 02 to 0 . 4 . in the event that the conduit and / or ducts leading to the spray outlets have a non - constant cross - sectional area such that either or both of l 1 and l 2 may vary depending on the line of measurement , then the measurements must be made along the centre line connecting the centres of the inlet means ( 5 ), the conduit outlet means and the respective spray outlet ( 3 ). in one preferred embodiment , at least one of the spray outlets has a ratio l 1 / l 2 which is different from the other or others . in another preferred embodiment , all the spray outlets have the same ratio l 1 / l 2 . advantageously , at least one of the spray outlets and preferably all of the spray outlets are non - circular . employing non - circular spray outlets may additionally assist in introducing early instability into the flow , thereby improving distribution at the target site . as used herein , the term “ circle ” means a closed plane curve every point of which is equidistant from a fixed point within the curve and the word “ circular ” shall be interpreted accordingly . with reference to fig3 , the spray outlets ( 3 ) may have any non - circular shape , but advantageously have a cross - sectional shape selected from the group consisting of polygonal , semi - circular , crescent , stellate and mixtures thereof . if polygonal , then each polygonal cross - sectional shape may advantageously be selected from the group consisting of polygons having from three to ten sides . preferably , the polygons are selected from the group consisting of triangular , rectangular , pentagonal , hexagonal and mixtures thereof . the spray head ( 1 ) according to the invention may have any number of spray outlets ( 3 ) above two , but preferably has from 2 to 36 and more preferably from 3 to 12 spray outlets ( 3 ). according to a second aspect of the invention , an aerosol spray unit ( 10 ) is provided comprising a pressurised product to be dispensed and having a spray head ( 1 ) according to the first aspect of the invention . as used herein , the term “ spray unit ” means a pressurised aerosol canister , comprising a valve , the valve stem of which extends from the canister , typically at the top . such canisters typically have a volume up to 1000 ml , though more typically below 200 ml and are typically pressurised at 103 kpa to 552 kpa ( 15 to 80 psi ), more typically less than 414 kpa ( 60 psi ). as used herein , the term “ product ” means all components of the composition or mixture contained within the spray unit , including all active agents , all carrier materials and all propellant . preferably , the product to be dispensed is a cosmetic product , more preferably it is selected from the group consisting of antiperspirants , deodorants and mixtures thereof . if the product to be dispensed is an antiperspirant , then it may comprise antiperspirant active particulates and a carrier such that the antiperspirant active particulates are not soluble in the carrier . alternatively , the antiperspirant active may be solubilised in the carrier . according to a third aspect of the invention , a portable aerosol spray unit ( 10 ) is provided comprising a pressurised product to be dispensed and a spray head ( 1 ) according to the first aspect of the invention . as used herein , the term “ portable ” used in relation to an aerosol spray unit means that it may readily be transported in one hand by a single adult person of ordinary strength . according to a fourth aspect of the invention , a process for spraying a pressurised product is provided comprising the steps of spraying said product through a spray head having at least two separate spray outlets ( 3 ), wherein at least one of the spray outlets ( 3 ) has a non - circular cross - section , such that the product has a reynolds number of at least 3000 as it leaves said spray outlets ( 3 ). all documents cited in the detailed description of the invention are , in relevant part , incorporated herein by reference ; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention . to the extent that any meaning or definition of a term in this written document conflicts with any meaning or definition of the term in a document incorporated by reference , the meaning or definition assigned to the term in this written document shall govern . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .
2
with reference to fig1 one embodiment of the pre - cast concrete traffic barrier element 10 according to the present invention includes an elongated block of pre - cast concrete having a top surface 12 , a bottom surface 14 and two sides 16 and 18 . one side 18 preferably has a cross - sectional new jersey profile for deflecting or redirecting a moving vehicle back towards the traffic surface 90 . the new jersey profile includes an upper inclined surface 20 extending from the top surface 12 and sloping downwardly at a first acute angle with respect to a vertical plane . an intermediate inclined surface 22 extends from the upper inclined surface 20 and slopes downwardly at a second acute angle which is greater than the first angle . a lower inclined surface 24 extends between the intermediate inclined surface 22 and the bottom surface 14 . the lower inclined surface 24 slopes downwardly at a third acute angle which is less than the second angle and more than the first angle . this profile is well reported in the literature . a relatively unprofiled side 16 , opposite from the profiled side 18 , provides an ornamental aspect to the traffic barrier . the relatively unprofiled side has an upper vertical surface 26 extending from the top surface 20 and sloping downward at a vertical angle . an intermediate inclined surface 28 extends from the upper vertical surface 26 and slopes downwardly at an acute angle with respect to a vertical plane . an intermediate vertical surface 30 extends from the intermediate inclined surface 28 to a horizontal surface 32 . the horizontal surface 32 extends from the intermediate vertical surface 30 to the lower vertical surface 34 . a lower vertical surface 34 extends from the horizontal surface 32 to the chamfer surface 35 . the chamfer surface 35 extends between the lower vertical surface 34 and the bottom surface 14 . the bottom surface 14 of the pre - cast traffic barrier has a longitudinally extending channel 36 therein . the channel 36 has a significant depth d of approximately 15 inches but can vary from 4 inches to 48 inches depending on the specific requirements . preferably , the channel 36 has a trapezoidal configuration with an internal face 46 which is parallel to the bottom surface 14 . two sidewalls 42 , 44 of the channel 36 extend from the internal face 46 to the bottom surface 14 . preferably , the outer sidewall 42 diverges downwardly in a direction away from the profiled side 18 and the inner sidewall 44 diverges downwardly in an opposite direction away from the unprofiled side 16 . as shown , the channel 36 is broader at the bottom for easy engagement . the channel 36 divides the lower section of the concrete pre - cast traffic barrier into two lips 38 and 40 . the outer lip 38 is defined by the concrete between the lower vertical surface 34 of the unprofiled side 16 and the outer sidewall 42 of the channel 36 . the inner lip 40 is defined by the concrete between the lower inclined surface 24 of the profiled side 18 and the inner sidewall 44 of the channel 36 . the two lips flank the channel 36 for the full length of the barrier . embedded throughout the pre - cast traffic barrier 10 is reinforcing welded wire fabric 52 to resist directly applied stresses to the pre - cast concrete traffic barrier . the welded wire fabric 52 has an outer vertical section 54 embedded within the concrete adjacent to the unprofiled side 16 and an inner section 56 embedded within the concrete adjacent to the profiled side 18 . the inner section 56 follows the slopes of the profiled side 18 at the upper inclined surface 20 , intermediate inclined surface 22 , and also the lower inclined surface 24 . also embedded in the concrete barrier 10 are u - shaped reinforcing anchoring rods 58 to resist applied stresses at the channel 36 . the u - shape opens upwardly . an upper u - shaped anchoring rod 58 has an inner inclined section 60 embedded within the concrete adjacent to the profiled side 18 and an outer vertical section 62 embedded within the concrete adjacent to the unprofiled side 16 . the upper u - shaped anchoring rod 58 extends into the channel 36 to form an eyelet cooperative with a similar eyelet 64 with a lower u - shaped anchoring rod 66 . the lower u - shaped anchoring rods 66 are embedded in the retaining wall 88 . this u - shape opens downwardly . preferably , there are a plurality of upper u - shaped anchoring rods 58 and a matching plurality of lower u - shaped anchoring rods 66 spaced evenly throughout the length of the barrier . thus , the open channel encloses alternating eyelets ; fig1 shows the eyelets inscribing a large area for a lock to be described . viewing the channel 36 prior to filling with grout , an elongate rebar lock member is inserted from the end ; that is , several rebars 70 form a lock equal to the barrier in length . the rebars 70 are formed into a beam by plural , spaced u - shaped cross bars 73 . the beam is inserted into the channel 36 , passes through every eyelet and fastens the barrier 10 to the supporting wall 88 . inlet fill holes 72 extend from the intermediate inclined surface 22 of the profiled side 18 to the empty channel 36 . the inlet fill holes 72 are used to pump cast - in - place concrete , grout , mortar or similar material into the channel 36 to fill the channel along this length of the barrier 10 . separately installed sealing material at 48 and 50 prevent the pumped in cast - in - place concrete , grout , mortar or similar material from escaping from the channel 36 during the pumping process . the sealing material 48 and 50 ideally is impregnated asphalt board , however alternative materials , including but not limited to elastiomeric material , precompressed foam sealant or foam backup rods , may be used . the sealing material keeps the traffic barrier 10 from directly contacting the retaining wall 88 . in assembly , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming alternating eyelets 64 and 68 in the longitudinal channel 36 . sealing material 48 and 50 is put in place . the traffic barrier 10 is then lowered onto the sealing material 48 and 50 to form a seal between the traffic barrier 10 and the retaining wall 88 . a locking beam is then inserted through the loops . the traffic barrier 10 is thus locked to the retaining wall 88 . then , a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the inlet holes 72 into the channel 36 . the openings at either end of the channel 36 allow the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 allowing the channel to be completely filled with the mixture . it should be noted that once the concrete hardens , the strength of the joint formed by the anchoring eyelets is increased . after the concrete hardens the roadway surface 90 is built up in the conventional fashion . with reference to fig2 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . each traffic barrier element 10 has a length of 10 feet but can vary from 4 feet to 40 feet depending on the specific requirements of the roadway 90 and retaining wall 88 . a roadway 90 is supported by frictionally stabilized earth 94 . the outer surface 16 of the traffic barrier 10 is for ornamental purposes and could be left plain or decorated with different architectural designs . the pre - cast traffic barrier 92 restrains a moving vehicle on an elevated traffic surface 90 from travelling over the edge of the wall face of the earth 94 . with reference to fig3 another embodiment of the pre - cast traffic barrier 10 is cast with a longitudinal slot 150 and end sections 152 . embedded in the pre - cast traffic barrier 10 is reinforcing welded wire fabric 52 to resist directly applied stresses to the pre - cast concrete traffic barrier 10 . the welded wire fabric 52 has an outer vertical section 54 embedded within the concrete adjacent to the unprofiled side 16 and an inner section 56 embedded within the concrete adjacent to the profiled side 18 . the inner section 56 follows the slopes of the profiled side &# 39 ; s 18 upper inclined surface 20 , intermediate inclined surface 22 , and part of the lower inclined surface 24 . with reference to fig4 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . the roadway surface 90 is shown partially removed 96 to reveal the longitudinal slot 150 . the slot 150 allows the cast - in - place concrete , grout , mortar or similar material to be pumped directly to the channel 36 encasing the interlocking anchor rods 58 , 66 and locking welded wire fabric 68 of fig3 . the end sections 152 contain the cast - in - place concrete , grout , mortar or similar material in the channel 36 during pumping operations . the end sections 152 also balance the traffic barrier 10 during construction , keeping the traffic barrier 10 from tipping over towards the roadway surface 90 . in operation , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming a closed oval 64 in the longitudinal channel 36 . sealing material 48 , 50 is placed over the retaining wall 88 . the traffic barrier 10 is then lowered onto the sealing material 48 , 50 forming a seal between the traffic barrier 10 and the retaining wall 88 . a locking u - shaped welded wire fabric 68 is then inserted through the closed loop 64 . the traffic barrier 10 is thus locked to the retaining wall 88 by the u - shaped welded wire fabric 68 . a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the longitudinal slot 150 into the channel 36 . the openings at either end of the channel 36 allow the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 allowing the channel to be completely filled with the mixture . it should be noted that once the cast - in - place concrete , grout , mortar or similar material mixture hardens the strength of the joint formed by the anchoring bars 58 , 66 and locking welded wire fabric 68 is increased . after the cast - in - place concrete , grout , mortar or similar material mixture hardens the roadway surface 90 is built up to a point at the top of the lower inclined surface 24 . with reference to fig5 another embodiment of the pre - cast traffic barrier 10 is cast with the chamfer surface 35 extending between the lower vertical surface 34 and the bottom surface 14 . the bottom surface 14 extends from the chamfer surface 35 to an inner vertical surface 37 . the inner vertical surface 37 slopes upwardly at a vertical angle to an inner horizontal surface 39 . the inner vertical surface 37 extends for a length e of 3 inches , but this length e may vary from 1 inch to 24 inches . the greater the length e , the greater camming effect is created which counteracts any force applied which tends to tip the traffic barrier 10 over the retaining wall 88 . also , the greater the length e , the more adjustment is possible when aligning each barrier element 10 with the adjacent barrier elements . the inner horizontal surface 39 slopes at a horizontal angle to the sidewall 42 of the longitudinal channel 36 . the sidewall 42 slopes upwardly to an internal face 46 . the internal face 46 slopes upwardly at an angle of approximately 10 degrees but can vary from 0 degrees to 70 degrees . the internal face 46 extends from sidewall 42 to sidewall 44 . the sidewall 44 slopes downwardly from the internal face 46 to the bottom surface 14 . the length of sidewall 44 from the inner face 46 to the bottom surface 14 is less than the length of sidewall 42 from the inner face 46 to the bottom surface 14 . sidewall 44 is shown being 4 inches longer than sidewall 42 , but sidewall 44 can be cast to be from 1 inch to 36 inches longer than sidewall 42 . the longitudinal channel 36 of the pre - cast traffic barrier 10 has an upper u - shaped reinforcing anchoring rod 58 extending into the longitudinal channel 36 to form a closed oval 64 with a lower u - shaped reinforcing anchoring rod 66 . reinforcing rods 69 for interlocking the upper u - shaped anchoring rod 58 with the lower u - shaped anchoring rod 66 are inserted through the oval 64 the length of the longitudinal channel 36 to transfer stresses from the pre - cast concrete traffic barrier 10 to the retaining wall 88 . the reinforcing rods 69 use 4 separate rods , one at each corner stress point of the oval 64 , to transfer the stress , but can vary from 1 rod to 12 rods . the sealing material 48 , 50 supports the traffic barrier 10 and keeps the traffic barrier 10 from directly contacting the retaining wall 88 . sealing material 48 also prevents the pumped in cast - in - place concrete , grout , mortar or similar material from escaping from the longitudinal channel 36 down the retaining wall 88 . the sealing material 48 , 50 may also be used to shim a traffic barrier element 10 into alignment with adjacent traffic barrier elements . with reference to fig6 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . the roadway surface 90 is shown partially removed 96 to reveal the end sections 174 . the end sections 174 , 175 are cast a distance of 2 feet 33 / 4 inches from the ends 176 , 177 of the traffic barrier 10 , but this distance can vary from 0 inches to 4 feet . this inset distance lessens the possibility that the end sections 174 , 175 will be damaged in storage or transportation to the construction site . the end sections 174 , 175 also balance the traffic barrier 10 , keeping the traffic barrier from tipping over towards the graded roadway surface 91 . an inner longitudinal slot 170 extends from end section 174 to end section 175 . outer longitudinal slots 172 extend from end 176 to end section 174 and from end 177 to end section 177 . the longitudinal slots 170 , 172 allow cast - in - place concrete , grout , mortar or similar material to be poured into the longitudinal channel 36 . in operation , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming a closed oval 64 in the longitudinal channel 36 . sealing material 48 , 50 is placed on the retaining wall 88 and the graded roadway surface 91 at a level flush with the top of the retaining wall 88 . the traffic barrier 10 is then lowered onto the sealing material 48 , 50 forming a tight seal between the traffic barrier 10 and the retaining wall 88 and graded roadway surface 91 . if the plurality of traffic barriers 10 are not level with respect to each other , shims may be inserted in place of or with the sealing material 48 , 50 to ensure a level alignment between the traffic barriers . locking reinforcing rods 69 are then inserted through the closed loop 64 . the traffic barrier 10 is thus locked to the retaining wall 88 by the locking reinforcing rods 69 . a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the longitudinal slots 170 , 172 into the channel 36 . the inclined internal face 46 of the channel 36 allows the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 , thereby allowing the channel to be completely filled with the mixture . it should be noted that once the cast - in - place concrete , grout , mortar or similar material mixture hardens the strength of the joint formed by the anchoring bars 58 , 66 and locking reinforcing rods 69 is increased . after the cast - in - place concrete , grout , mortar or similar material mixture hardens the graded roadway surface 91 is built up to a point at the top of the lower inclined surface 24 . when a vehicle driving along the roadway 90 strikes the barrier 10 , the profiled inner face 18 will direct the vehicle &# 39 ; s wheel upward so as to prevent damage to the vehicle &# 39 ; s body . this will also slow the movement of a vehicle down so that the driver will be able to regain control of his vehicle and steer it back onto the roadway 90 . the force applied by the vehicle &# 39 ; s impact would otherwise tend to tip the barrier 10 over the retaining wall 88 , but this tipping force is overcome by the unique camming , interlocking eyelet arrangement , and the cemented channel features of this invention . the camming effect of the inner vertical surface 37 takes part of the tipping force and redirects it against the retaining wall 88 . the interlocking bar arrangement ; the upper u - shaped rods 64 , the lower u - shaped rods 66 , and locking bars 69 , cemented in place throughout the longitudinal channel 36 , takes the rest of the tipping force and absorbs it and redirects it into the retaining wall 88 . this cemented locking bar arrangement and camming effect will thus allow the construction of a traffic barrier on top of a retaining wall without the need for concrete and steel anchors under the roadway surface or other external structural support . this in turn reduces the cost and time required to build a retaining wall . the tongue and groove construction avoids lateral shifting of the barricade . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limiting sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the invention , will become apparent to persons skilled in the art upon reference to the description of the invention . it is therefore contemplated that the appended claims will cover such modifications that fall within the true scope of the invention .
4
the preferred embodiment herein described is not intended to be exhaustive or to limit the invention to the precise form disclosed . it is chosen and described in order to explain the principles of the invention and its application and practical use to enable others skilled in the art to utilize the invention . as is illustrated in the figures , air diffuser 10 , which in the preferred embodiment is formed from sheet metal , includes a wall or ceiling mounting ring 12 having a plurality of spaced mounting holes 14 to accommodate screws or similar fasteners . diffuser 10 further includes annular air diffuser rings 16 and 18 which in the preferred embodiment are coaxially displaced relative to mounting ring 12 , with the outer circumference of ring 18 being smaller than ring 16 . an outermost diffuser ring 20 having a centrally located hole 24 is positioned coaxially spaced from rings 16 , 18 . part 20 has a smaller circumference then ring 18 . the mounting ring 12 and each of the diffuser rings 16 , 18 , 20 have substantially uninterrupted outer edges . as illustrated in the figures , rings 16 , 18 and 20 are maintained in a spaced relationship by a plurality of radial inwordly offset links 26 which extend integrally between the rings at an acute angle relative to the diffuser rings in the direction of decresing size of the diffuser rings . each link includes an innermost and an outermost end , the outermost end of each link being connected to the next adjacent outer diffuser ring , the innermost end being solely connected to a slotted intermediate portion of the next adjacent inner diffuser ring or mounting member as the case maybe . although the figures illustrate three links extending between adjacent diffuser rings , it should be understood that any number of links may be used . air diffuser 10 is formed from a single piece of metal by a series of progressive stamping operations . it should be understood that although an annular air diffuser is illustrated in the drawings , the concept of a one piece air diffuser is equally as applicable to a multitude of shapes and dimensions , such as with square diffuser sections , and of various numbers of diffuser sections . it is further to be understood that the invention herein described is not to be limited by the details given above , but may be modified within the scope of the appended claims .
5
although it is previously known that certain lipophilic drugs may benefit from administering the drug in connection with food intake , the strength of the effect of food intake upon the ospemifene bioavailability obtained in the present investigations was very surprising . particularly compared to the behaviour of other serms , the food effect on ospemifene is remarkable . it was found ( anttila m ., 1997 ) that the intake of food did not have any positive effect on the bioavailability of toremifene , which like ospemifene also has a low aqueous solubility . it was observed that food intake in fact retarded the absorption of toremifene . it has also been reported that the administration of raloxifene , another serm , together with a standardized high - fat meal increases the absorption of raloxifene slightly , but that it does not lead to clinically meaningful changes in systemic exposure . while food intake causes only a 20 % increase of raloxifene absorption , the effect on ospemifene absorption is a 2 - 3 fold increase . the term “ food ” shall be understood to cover any edible foodstuff having a nutritional value as an energy supplier . thus the food can be solid , semisolid or liquid substance comprising one or more of the basic ingredients carbohydrates , fats and proteins . surprisingly , a high percentage of fats or a high energy value in the food intake is not crucial for obtaining a high bioavailability for ospemifene . neither is the amount of food intake crucial for the beneficial effect . it is believed that the secretion of bile acids may play an important role in the improved bioavailability , and therefore any foodstuff being capable of causing secretion of bile acids is expected to work . the drug is considered to be administered in connection with the intake of food if the drug is administered at a time point shortly before the start of the food intake , during the food intake or in a relatively short time after the food intake is completed . a preferable time range is defined to begin 1 hour before starting the food intake and to end 2 hours after starting the food intake . more preferably , the drug is administered at a time point which is in the range defined to begin at a time point during the food intake and to end 1 hour after the food intake was started . most preferably , the drug is administered during the food intake or at a time point which is no later than 0 . 5 hour after starting the food intake . the method of enhancing the bioavailability of ospemifene and related compounds according to this invention is particularly useful when treating women during or after the menopause . however , the method according to this invention is not restricted to women in this age group . the term “ metabolite ” shall be understood to cover any ospemifene or ( deaminohydroxy ) toremifene metabolite already discovered or to be discovered . as examples of such metabolites can be mentioned the oxidation metabolites mentioned in kangas ( 1990 ) on page 9 ( tore vi , tore vii , tore xviii , tore viii , tore xiii ), especially tore vi and tore xviii , and other metabolites of the compound . the most important metabolite of ospemifene 4 - hydroxyospemifene , which has the formula the use of mixtures of isomers of compound ( i ) shall also be included in this invention . the method of enhancing bioavailability is useful in any application of ospemifene , especially when the compound is used for treatment or prevention of osteoporosis or for treatment or prevention of symptoms related to skin atrophy , or to epithelial or mucosal atrophy . a particular form of atrophy which can be inhibited by administering of ospemifene is urogenital atrophy . symptoms related to urogenital atrophy can be divided in two subgroups : urinary symptoms and vaginal symptoms . as examples of urinary symptoms can be mentioned micturation disorders , dysuria , hematuria , urinary frequency , sensation of urgency , urinary tract infections , urinary tract inflammation , nocturia , urinary incontinence , urge incontinence and involuntary urinary leakage . as examples of vaginal symptoms can be mentioned irritation , itching , burning , maladorous discharge , infection , leukorrhea , vulvar pruritus , feeling of pressure and postcoital bleeding . according to previous data , the optimal clinical dose of ospemifene is expected to be higher than 25 mg daily and lower than 100 mg daily . a particularly preferable daily dose has been suggested in the range 30 to 90 mg . at the higher doses ( 100 and 200 mg daily ), ospemifene shows properties more similar to those of tamoxifen and toremifene . due to the enhanced bioavailability according to the method of this invention , it can be predicted that the same therapeutical effect can be achieved with doses lower those recommended earlier . the invention will be disclosed more in detail in the following non - restrictive experimental section . two clinical studies were carried out in order to assess the bioavailability of ospemifene in healthy male subjects after intake of high caloric content ( 860 kcal ) and high - fat breakfast compared to bioavailability of ospemifene administered in fasted condition ( study a ). in a separate study ( study b ), the bioavailability of ospemifene after intake of low caloric content ( 300 kcal ), low - fat breakfast was assessed and the results were compared to those obtained in study a ( i . e . ospemifene bioavailability after intake of high caloric , high - fat breakfast or after ospemifene administering in fasted condition ). in study a , 24 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 8 kg / m 2 ) received single oral doses of 60 mg ospemifene , once under fed condition after consuming a standardised high - fat , high caloric breakfast , and once after an overnight fast . blood samples for pharmacokinetic assessments were drawn during 72 hours at each study period . a washout period between the two treatments was at least 2 weeks . the breakfast consisted of the following ingredients : two eggs fried in butter ( 50 g ), two strips of bacon ( 34 g ), two slices of toast with butter ( 50 g ), 60 g hash brown potatoes and 240 ml of whole milk ( pecentage of fat = 3 . 5 %). the meal provided approximately 150 , 170 and 540 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . following an overnight fast of at least 10 hours at the study site , the subjects were given one ospemifene tablet ( 60 mg ) with 240 ml of water . no food was allowed for at least 4 hours after the ospemifene dose . a substantial effect of food intake was observed on the bioavailability of ospemifene and its main metabolite 4 - hydroxy - ospemifene . fig1 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ) and after a high caloric , high - fat meal ( filled circles ). the results of this study showed clearly that the ospemifene bioavailability was enhanced by concomitant ingestion of ospemifene and a meal . due to the surprising and promising results of this study it was decided to carry out a second study ( study b below ) to find out the effect of a low caloric , low - fat meal on the bioavailability of ospemifene . in study b , 12 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 3 kg / m 2 ) of the 24 subjects in study a were subjected to ospemifene administering in combination with the intake of a low caloric , low - fat meal . the results were compared to those obtained in study a for the same individuals . the composition of the light breakfast ( approximately 300 kcal ) was as follows : two slices of toast with margarine ( 5 g , fat content 60 %), 6 slices ( 30 g ) of cucumber , 240 ml skimmed ( non - fat ) milk and 100 ml orange juice . the test meal provided approximately 50 , 180 and 70 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . fig2 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ; data obtained from study a ); after a high caloric , high - fat meal ( filled circles ; data obtained from study a ) and after a low caloric , low - fat meal ( stars ). fig3 shows the mean serum concentration of the ospemifene metabolite 4 - hydroxy - ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open triangles ; data obtained from study a ); after a high caloric , high - fat meal ( filled triangles ; data obtained from study a ) and after a low caloric , low - fat meal ( crosses ). the results of this study showed clearly that the bioavailability of ospemifene was also enhanced by concomitant ingestion of ospemifene and a low caloric , low - fat meal . although the fat content of the low - fat meal was much lower than that of the high - fat meal , the bioavailabity of ospemifene was only slightly lower for the low - fat meal . therefore it can be concluded that the effect of food on the ospemifene bioavailability is not dependent on the fat content of the meal ingested . instead , stimulation of bile flow due to meal ingestion may enhance the solubilisation of ospemifene . it will be appreciated that the methods of the present invention can be incorporated in the form of a variety of embodiments , only a few of which are disclosed herein . it will be apparent for the expert skilled in the field that other embodiments exist and do not depart from the spirit of the invention . thus , the described embodiments are illustrative and should not be construed as restrictive . anttila m . effect of food on the pharmacokinetics of toremifene . eur j cancer , 1997 ; 33 , suppl 8 : 1144 , 1997 . kangas l . biochemical and pharmacological effects of toremifene metabolites . cancer chemother pharmacol 27 : 8 - 12 , 1990 . kauffman r f , bryant h u . selective estrogen receptor modulators . drug news perspect 8 : 531 - 539 , 1995 .
0
an embodiment of the present disclosure will be described hereinafter with reference to the drawings . in the drawings , reference numerals having the same last two digits designate the same or similar elements . fig1 is a block diagram illustrating an example configuration of a stream processor according to an embodiment of the present disclosure . a stream processor 100 illustrated in fig1 includes stream processing sections 12 , 14 , 16 , and 18 and an access controller 30 . the processing sections 12 , 14 , 16 , and 18 include priority information calculators 22 , 24 , 26 , and 28 , respectively . the access controller 30 includes an access arbiter 32 . the stream processing sections 12 , 14 , 16 , and 18 receive streams st 1 , st 2 , st 3 , and st 4 , respectively . the stream processing sections 12 , 14 , 16 , and 18 perform menu decoding a , subtitle decoding b , menu decoding c , and subtitle decoding d , respectively . the priority information calculator 22 extracts time stamp information on a menu to be displayed , from the stream st 1 . examples of the time stamp include a presentation time stamp ( pts ) and a decoding time stamp ( dts ). the priority information calculator 22 calculates the difference between the extracted time stamp and a reference time rt , and outputs the obtained difference to a main memory 42 as an access priority . in this calculation , the priority information calculator 22 subtracts the reference time rt from the extracted time stamp , for example . the reference time rt is , for example , a system time clock ( stc ), and input from a cpu ( not shown ). the stream processing section 12 adds the priority obtained by the priority information calculator 22 to an access request to the main memory 42 , and outputs the resulting access request to the access controller 30 . similarly , the priority information calculators 24 and 28 acquire time stamps of subtitles to be displayed , from the streams st 2 and st 4 , respectively . the priority information calculator 26 acquires a time stamp of a menu to be displayed , from the stream st 3 . each of the priority information calculators 24 , 26 , and 28 calculates the difference between the acquired time stamp and the reference time rt , and outputs the obtained difference as priority information of access to the main memory 42 . the priority increases as the value of the priority information decreases . each of the stream processing sections 14 , 16 , and 18 adds the priority information obtained by an associated one of the priority information calculators 24 , 26 , and 28 to the access request to the main memory 42 , and outputs the resulting priority information to the access controller 30 . the access arbiter 32 determines which one of the stream processing sections 12 , 14 , 16 , and 18 is to receive access permission , based on the priority information from the stream processing sections 12 , 14 , 16 , and 18 . specifically , for example , the access arbiter 32 determines that access permission should be granted to the stream processing section 12 having the highest priority ( i . e ., having the smallest value of priority information ), and grants access permission to the stream processing section 12 . the stream processing section 12 that has received the access permission accesses the main memory 42 . then , after the processing of the stream processing section 12 that received the access permission has terminated , the access arbiter 32 grants access permission to a stream processing section ( e . g ., the stream processing section 14 ) having the next highest priority ( the second smallest value of priority information ) after the stream processing section 12 that has finished its processing . the stream processing section 14 that has received the access permission accesses the main memory 42 . subsequently , after the processing of the stream processing section that received the access permission has terminated , the access arbiter 32 grants access permission to a stream processing section having the next highest priority after the stream processing section that has finished its processing , and this process is repeatedly performed . in this manner , the access arbiter 32 makes determination based on the priority order , and thereby , a plurality of streams can be processed with dynamic determination of streams to be processed by priority . fig2 is a timing chart showing an example of transfer to a main memory by using a conventional stream processor . fig3 is a timing chart showing an example of transfer to the main memory by using the stream processor 100 illustrated in fig1 . in fig2 and 3 , the vertical broken lines indicate timings when the main memory 42 is accessed by the whole stream processor . the distance between the broken lines corresponds to the main memory bandwidth ( the transfer bandwidth to the main memory 42 ) allocated to the whole stream processor . the timing charts show that the time stamp ( ts ) of the menu decoding a should be performed as soon as possible . in this case , the time stamp is considered to coincide with , for example , the reference time rt . the time stamps of the subtitle decoding b , the menu decoding c , and the subtitle decoding d are also shown in the timing charts . in the menu decoding a , the subtitle decoding b , the menu decoding c , and the subtitle decoding d , transfer to the main memory 42 needs to be performed three times , twice , three times , and four times , respectively . the same holds for the timing charts that will be referred to later . the process of fig2 employs a round robin scheduling as an arbitration technique . in this case , transfer for the menu decoding a that needs to be finished earliest is completed after transfer for the subtitle decoding b . that is , in typical arbitration in direct memory access ( dma ) such as a round robin , the relationship between a completion required time indicated by a time stamp and an actual completion time is not necessarily rational . on the other hand , in the case of fig3 , the transfer for the menu decoding a is finished earliest , and thus , the relationship between the completion required time and the actual completion time is rational . accordingly , the stream processor 100 illustrated in fig1 can achieve predetermined performance even with a small available main memory bandwidth . fig4 is a block diagram illustrating a variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 200 illustrated in fig4 has the same configuration as that of the stream processor 100 except for including an access controller 230 instead of the access controller 30 . the access controller 230 includes an access arbiter 232 and a rate setup section 234 . the rate setup section 234 receives , from , e . g ., a cpu , a bandwidth bw of the main memory 42 with respect to each of the stream processing sections 12 , 14 , 16 , and 18 . the bandwidth bw is a bandwidth necessary for processing streams to be input to each of the stream processing sections 12 , 14 , 16 , and 18 . the rate setup section 234 outputs the received bandwidth bw to the access arbiter 232 . the access arbiter 232 grants access permission based on the bandwidth from the rate setup section 234 in addition to priority information from the stream processing sections 12 , 14 , 16 , and 18 . fig5 is a timing chart showing an example of transfer to the main memory by using the stream processor 200 illustrated in fig4 . specifically , the access arbiter 232 reduces uneven temporal distribution of access in a case where the bandwidth from the rate setup section 234 is satisfied without transfer at every broken line in fig5 . the access arbiter 232 grants access permission to the stream processing section 18 once for every second or third broken line in fig5 , as in the case of subtitle decoding d in fig5 . in fig3 , access to the main memory is continuously performed until completion of transfer for the subtitle decoding d in a case where a plurality of stream processings conflict with one another . on the other hand , in fig5 , while conditions of the completion time required for each stream processing are satisfied , access to the main memory is not issued at some times . in this manner , in the stream processor 200 , at times when the stream processing sections 12 , 14 , 16 , and 18 do not perform transfer , the main memory 42 can be accessed by another circuit such as a cpu , thereby enhancing performance of the entire system . fig6 is a block diagram illustrating another variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 300 illustrated in fig6 has the same configuration as that of the stream processor 100 except for including an access controller 330 instead of the access controller 30 . the access controller 330 includes an access arbiter 332 and an offset setup section 334 . the offset setup section 334 receives , from , e . g ., a cpu , an offset fs for the priority of each of the stream processing sections 12 , 14 , 16 , and 18 . the offset setup section 334 outputs the received offset fs to the access arbiter 332 . the access arbiter 332 grants access permission based on the offset from the offset setup section 334 in addition to the priority information from the stream processing sections 12 , 14 , 16 , and 18 . at this time , the access arbiter 332 uses priority information that has been changed based on the offset fs input to the offset setup section 334 . specifically , for example , the access arbiter 332 adds the offset fs to the priority information of the stream processing section 12 , 14 , 16 or 18 , and uses the resulting information . the stream processor 300 enables adjustment of the priority for each stream depending on operating characteristics of , for example , a cpu or a drawing engine at a subsequent stage . fig7 is a block diagram illustrating still another variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 400 illustrated in fig7 has the same configuration as that of the stream processor 100 except for including stream processing sections 412 , 414 , 416 , and 418 instead of the stream processing sections 12 , 14 , 16 , and 18 , and including an access controller 430 instead of the access controller 30 . the access controller 430 includes an access arbiter 432 and a clock controller 434 . the stream processing sections 412 , 414 , 416 , and 418 perform clock gating control therein based on received clock control signals cc 1 , cc 2 , cc 3 , and cc 4 . the other part of the configuration is similar to that of the stream processing sections 12 , 14 , 16 , and 18 of fig1 . the access arbiter 432 notifies the clock controller 434 of which one of the stream processing sections 412 , 414 , 416 , and 418 access permission is granted to . the other part of the configuration of the access arbiter 432 is similar to that of the access arbiter 32 of fig1 . the clock controller 434 outputs the clock control signal cc 1 , cc 2 , cc 3 , or cc 4 instructing each one of the stream processing sections 412 , 414 , 416 , and 418 to which no access permission is granted to stop a clock while no access permission is being granted . the stream processing section 412 , 414 , 416 , or 418 that has been instructed to stop a clock based on the clock control signal cc 1 , cc 2 , cc 3 , or cc 4 stops at least one of the clocks that are being used in the stream processing section 412 , 414 , 416 , or 418 . in this manner , dynamic clock gating control is performed on the stream processing section that does not receive access permission , thereby reducing power consumption . the stream processor 200 or 300 illustrated in fig4 or 6 may include the clock controller 434 to control clocks in the same manner . fig8 is a timing chart showing an example of clock control by the stream processor 400 illustrated in fig7 . each of the stream processing sections is supplied with clocks from when decoding is started in response to access permission to when transfer is finished . the timing chart of fig8 shows that a period in which clocks are supplied is shorter and power consumption is reduced more greatly in the case of fig8 than in the case of fig2 . this is because until transfer for one processing is finished , a clock of the stream processing section that is in charge of this processing cannot be stopped . in the foregoing embodiment , the stream processor includes four stream processing sections . alternatively , the number of stream processing sections is not limited to the above example . each of the stream processing sections may process video streams and / or audio streams . instead of the main memory , access to another memory may be controlled in a manner similar to that described above . each functional block herein can be typically implemented as hardware . for example , each functional block may be implemented on a semiconductor substrate as a part of an integrated circuit ( ic ). here , an ic includes a large - scale integrated circuit ( lsi ), an application - specific integrated circuit ( asic ), a gate array , a field programmable gate array ( fpga ), etc . alternatively , a part or the entire part of each functional block may be implemented as software . for example , such a functional block may be implemented by a processor and a program that can be executed on the processor . in other words , each functional block herein may be implemented as hardware , software , or any combination of hardware and software . the many features and advantages of the present disclosure are apparent from the detailed specification and , thus , it is intended by the appended claims to cover all such features and advantages of the present disclosure which fall within the true spirit and scope of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the present disclosure to the exact construction and operation illustrated and described , and accordingly all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . as described above , according to the present disclosure , a memory bandwidth can be used efficiently in processing a plurality of streams , and thus , the present disclosure is useful for , for example , stream processors .
8
detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the invention that may be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the invention are intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features may be exaggerated to show details of particular components . in addition , any measurements , specifications and the like shown in the figures are intended to be illustrative , and not restrictive . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . the term “ purpose - built medical inhalation device ” means : a device designed and manufactured for medical use as a method of administering therapeutic doses of cannabis in the form of an inhaled vapor . the term “ medical cannabis ” means : a form of the plant genus cannabis , in the form of ground plant material comprising bud , leaf , and stem materials of the cannabis genus , or any combination thereof . the term “ authorized ” means : an individual or use that is approved for a medical cannabis therapy by a recommending physician or other legally or administratively authorized provider . the term “ measured ” means : marked by due proportion or precise weights and measures . the term “ sterile ” means : treated with any of a number of recognized sterilization methods that leave the sample free from living organisms and especially microorganisms . the term “ sanitary ” means : free from living , esp pathogenic , microorganisms , and detrius associated therewith , for example insect parts , spores , etc . the term “ sterilizable ” means : capable of being rendered sterile multiple times . the term “ tamper - evident ” means : a form of packaging or presentation that renders improper and unauthorized use obvious to inspection ( for example , visual , machine , or electronic inspection ). the term “ dosage form ” means : a formulation that presents or administers a medicine or therapy in a single , measured , clinically - appropriate unit . the term “ verifying ” means : to confirm proper or authorized use or identification . the term “ patient ” means : an individual awaiting or under medical care and treatment . the term “ single dose cycle ” means : the time and steps required to administer one dose of medicine . the term “ delivering ” means : to bring or transport to the proper place or recipient ; to distribute or administer . the term “ recording ” means : the act or process of making a record ; a record . the term “ wherein the patient is identified with a prescription ” means : pertaining to a patient who has received a prescription or recommendation from a qualified physician . the term “ biometrically identified ” means : the verification of identity via physical characteristics , such as fingerprints , dna , or retinal patterns . the term “ prescription ” means : a written order , especially by a physician , for the preparation and administration of a medicine or other treatment ; a recommendation of a medicine or other treatment from a physician . the term “ without combustion ” means : with no burning ; the absence of fire , smoke and the byproducts of burning . with respect to medical cannabis , “ without combustion ” means heating cannabis to a cannabis material temperature of between 180 and 200 c , thereby vaporizing the cannabinoids that reside on the trichomes on the surface of cannabis flowers and leaves , while avoiding combustion ( which occurs at 230 c and above ) and attendant smoke toxins . the term “ locking out ” means : denying access ; disabling a mechanism or feature ; prohibiting an activity . the term “ frequency of use of the machine ” means : the number of times the device is used ; the intensity of usage . the term “ exceeds a given set point ” means : anything that surpasses a predetermined limit or benchmark . the term “ has been tampered with ” means : has been subject to improper or unauthorized use ; evidencing damage to the form of packaging or presentation . the term “ the delivery temperature of the dose of medical cannabis ” means : the temperature at which a single unit of cannabis - based therapy is administered to a patient . the term “ the dosage form is not accessible until biometric authorization is obtained ” means : the single unit of therapy is not available for administration without physical verification of identity or authorization . the term “ selective acceptance of the dosage form into the medical inhalation device ” means : accommodating insertion of a unit of therapy only in a pre - determined manner . the term “ disposable ” means : designed to be replaced and discarded after use . the term “ heat of combustion ” means : the heat at which combustion occurs for a given substance — for example , approximately 230 c and above for medical cannabis . the term “ availability of the dose is confirmed ” means that a database or other verifying means confirms that a particular purpose - built machine / person is authorized to utilize a dose . the term “ one - way sanitary vapor valve ” means : a valve that only allows the flow of vapor in a single direction . the term “ consumption data ” means data related to the location , use , frequency of use , identity of user , and identity of product used with respect to a purpose - built vaporizer / dose combination “ legally qualified for use ” means that a given purpose - built vaporizer / dosage form / individual is authorized for use or using a given medical cannabis dose . fig1 depicts an embodiment of a medical cannabis vaporizer and recording system . removable vaporizer tube 1 is in communication with outflow vapor source 14 which receives vapor from the stabilizing chamber 15 . vapor flow is in the direction of the arrows indicated . exhaust temperature and data sensors 2 , 16 , measure the temperature and other physical / chemical characteristics of the vapor . this data is optionally transmitted to exhaust sensor data connections 3 , 17 . the vapor itself is generated from heated air originating from intake ports 23 , heated by a heating element 12 , and passing through a medical dose 4 of a vaporizable substance ( in one embodiment , cannabis ) held in place and surrounded by a dose suspension screen 5 itself contained within a medical dose cartridge 6 . vapor collects in the dose vaporizing chamber 24 . data recognition means ( in one embodiment , an infrared - scannable barcode 7 ) may be located on the medical dose cartridge 6 so as to tracking and / or verifying use and user of the medical dose 4 through a dose - recognition switch 18 , and may , in one embodiment , be readable by medical dose / data connections 8 , 19 . separate intake temperature sensor data recorders 9 and data connections 10 may also be utilized . an insulation heat sink 11 absorbs excess heat and keeps the starting temperature of the heated air utilized to generate the vapor fairly constant . an intake temperature sensor and data recorder 20 associated with an intake temperature measuring device monitors the temperature of the heated air utilized to generate the vapor . in one embodiment , the air may itself be heated by a heat element 22 and driven through the machine by an air flow fan 13 . fig1 a depicts an embodiment of a dose vaporizer similar to that shown in fig1 , with the added differences of a hot air flow restriction baffle 13 , and air flow carburetor holes 12 . in another embodiment , the dose vaporizing chamber 6 is removable and / or separately packaged and salable , and can be attached and used with any other commercially available vaporizer and / or heat source by use of an adapter . fig2 depicts an embodiment of the invention with a dose cartridge inserted . in one embodiment , the dose cartridge 108 includes a medical dose of a material between two metal screens that has not been previously vaporized or subject to other extraction or processing steps . dose cartridge data 105 may , in one embodiment , be imprinted on the dose cartridge 108 . the dose cartridge slot 104 holds a dosage cartridge 108 so that its wire mesh section is held within the dosage cartridge vaporizing chamber 106 . temperature regulated airflow 113 flows through the dosage , and its presence is measured utilizing a vapor temperature sensor 122 . vapor flows in the direction of the arrows shown 123 . vapor temperature sensor , data recording , and data connection means 102 , 103 , 120 , 121 measure vapor temperature and chemical characteristics , while — upstream of the medical dose — temperature sensor , data recording and data connection means 111 , 112 , 114 , 115 measure the temperature and / or other characteristics of the incoming air stream . the medical dose recognition switch 117 optionally allows operation of the machine only when an authorized dose / dose size is placed in the apparatus , and an optional data connection 116 allows connection to an outside computer and / or outside entity . similar structures are provided at 109 , 110 . fig3 is a side view of an embodiment of the dose cartridge , dose cartridge slot and dose vaporization chamber of the instant invention . the medical dose cartridge 201 includes a finger grip 202 for easy insertion and removal . the vaporization chamber slot 203 may be optionally designed so as only to accept a medical dose cartridge 204 of a particular configuration — thus “ locking out ” use of the apparatus to any potential user not utilizing a particularly configured medical dose cartridge . the cartridge is comprised of micro screens 205 , 206 which hold a dose within the dose vaporization chamber 207 . cartridge and medical dose recognition and data connection means 209 - 210 and 212 - 213 optionally provide a mechanism to ensure that only a pre - approved , pre - measured particular dose of a medical herb or other substance is administered by matching the dose and cartridge identifying information . fig4 is a top view of an embodiment of the dose cartridge , dose cartridge slot and dose vaporization chamber of the instant invention . the medical dose 301 is placed between microscreen layers 302 , 306 . the vaporization chamber slot 303 may be optionally designed so as only to accept a medical dose cartridge of a particular configuration — thus “ locking out ” use of the apparatus to any potential user not utilizing a particularly configured medical dose cartridge . the dose is positioned within a temperature regulated air flow 308 passing through an air flow hole 307 so as to ensure optimum efficiency in vaporization of the medical dose . fig5 a and 5b depicts an embodiment of the medical dose vaporization cartridge itself . the dose cartridge 401 includes a finger grip 402 and may optionally include a means for storing / transmitting product and / or cartridge specific data 403 . an optional bar code 404 provides an additional means for identification / tracking . the dose housing 405 , in one embodiment , wholly encapsulates a medical 407 dose between two screens 406 in a manner that allows for placement of a dose that is small enough to essentially prevent combustion ; and thin and / or well - distributed enough to ensure consistent vaporization of relevant dose components throughout the vaporization process . a recognition switch 408 individually identifies the dose . fig6 a , 6 b , and 6 c depict an embodiment of consumer packaging utilized for the medical dose vaporization cartridges of the instant invention . in one embodiment , a plurality of cartridges are stored in a sterile airtight box . in another embodiment , the plurality of cartridges within the sterile airtight box are individually wrapped so as to ensure sterility when the box is repeatedly opened for dose access . in another embodiment , the consumer packaging is equipped with monitoring means so as , for example , to monitor the rate at which individual dose cartridges are removed from the box ; the total number of cartridges removed from the box ; and whether any dose cartridges removed and / or replaced within the box maintain sterility and / or are in a pre - vaporization state . in one embodiment , both the box and the individual cartridges may have individual monitoring and / or tracking means , including but not limited to computer chip , barcode and / or radiofrequency identification ( rfid ) tracking / monitoring / data transmission means . fig7 depicts an embodiment of a cannabis dose cartridge assembly process . in one embodiment , this assembly process is carried out by the commercial provider of the medical dose . in another embodiment , this assembly process is carried out by a licensed physician / nurse / pharmacist or other authorized third party . in one embodiment , a screen is forged 501 , so as to create a depression in the screen . the medical dose is placed 502 in the screen depression , and optionally tamped down 503 . the medical dose is then encapsulated between screens 504 . once the dose is encapsulated between screens , the encapsulated dose may then be cut out 505 and inserted into a dose cartridge for commercial use 506 . fig8 a and 8b depict an embodiment of a maintenance and sterilization kit for use with the dose vaporizer of the instant invention . a heat shield sterilization safety cap 601 may be placed over the openings of the vaporization chamber 602 to prevent contamination between uses . means for flushing the system are also provided 604 . fig9 depicts an embodiment of a dose vaporizer of the instant invention . an on / off switch 711 governs provision of power to the unit . visual and digital data may be displayed , and a maintenance control 712 is also provided for optional control of vaporization parameters . a dose cartridge slot 704 is configured to only accept a particularly configured ( physically and / or electronically or informationally ) dose cartridge , and is further configured so as to place the medical dose contained within the dose cartridge in optimal contact with the heated air coming from the heat source so as to create a vapor stream . a dose location 703 is configured so as to maximize efficiency and efficacy of dose vaporization . a control data collection system 709 and usb data port ( s ) 708 permit recordation and / or monitoring of dose vaporizer utilization . fig1 is a variant of the dose vaporizer of fig9 , wherein the flexible tube 814 and mouthpiece 815 are differently configured . in one embodiment , the flexible tube and mouthpiece of fig1 have an internal diameter substantially similar to that of the dose vaporization chamber . fig1 depicts an alternative embodiment of a dose vaporizer . removable vaporizer tube consists of disposable mouthpiece 901 ; disposable flexible hose 902 ; disposable expandable vapor reservoir 903 ; disposable one - way sanitary vapor valve 904 : a dose 905 housed within a cartridge vaporization chamber 906 . the cartridge may contain an rfid chip or other notification means ( for example radio transmitter ) and may also contain a means for detecting tampering with the cartridge 908 . a heat source 909 heats up and vaporizes the dose 905 contained within the dose cartridge 908 . insulation 910 may optionally be used to isolate the heat source 909 from surrounding structures . an air pump 911 pushes air in the direction of the arrows indicated . exhaust temperature and data sensors 912 measure the temperature and other physical / chemical characteristics of the vapor . the vapor itself is generated from heated air passing through a medical dose 905 of a vaporizable substance ( in one embodiment , cannabis ) held in place and surrounded by a dose suspension screen itself contained within a medical dose cartridge . data recognition means ( in one embodiment , an infrared - scannable barcode ) may be located on the medical dose cartridge 906 so as to tracking and / or verifying use and user of the medical dose , and may , in one embodiment , be readable by medical dose / data connections . separate intake temperature sensor data recorders and data connections may also be utilized , as well as a processor circuit board 914 ; led display 915 ; data display keys 916 ; usb data port 917 ; and for warm - up switch 918 . an insulation heat sink absorbs excess heat and keeps the starting temperature of the heated air utilized to generate the vapor fairly constant . in one embodiment , the air may itself be heated by a heat element and driven through the machine by an air flow fan . fig1 depicts an alternative embodiment of a comprehensive medical solution comprised of purpose - built subsystems . the three subsystems may include a dose cartridge vaporizing system ; a disposable safety / sterility system ; and a clinical monitoring system . physicians may gather information from a variety of sources ( including the patient themselves ) to determine whether the patient would benefit from a particular dosage of a product .) 1001 . subsequent to a physician determination , data related to the patient &# 39 ; s individually identifiable information , condition , and prescribed use of a substance ( in one example , cannabis ) may be provided 1002 to any of a hospital database , pharmacy database , hospice database , research database , law enforcement database , etc . separately , dose cartridges containing a dose of a substance ( in one embodiment , cannabis ) may be produced 1003 and “ tagged ” with any of a number of differing types of data , including identity of the dose ; prescribed individual corresponding to the dose ; batch and lot number of the dose ; expiration date of the dose ; usage of the dose ; etc . doses may be prescribed and / or distributed to a patient , and data related to machine usage ; dose usage ; patient usage , etc . may be stored in a database or provided in varying forms to any matter of healthcare provision , regulatory oversight , tax collection and / or law enforcement entities . 1004 . in another embodiment , any portion of the instant invention — including , but not limited to , the flexible tube , dose cartridge and / or mouthpiece — may be made disposable , individually sterilizable , separable from the main apparatus of the invention and / or reusable and / or returnable . in one embodiment , the dose vaporizer provides a mild , non - noxious , and non - irritating vapor so as to facilitate administration of medical dose ( in one embodiment , cannabis ) vapors with a reduced incidence and / or risk of concomitant administration of carcinogens . in another embodiment , the dose vaporizer provides a vapor dose that utilizes substantially all of the active ingredients within a particular medical ( in one example , cannabis ) sample , thus increasing efficiency of delivery of cannabis active ingredients . in another embodiment , the instant dose vaporizer permits physicians to record and control frequency , time and date of use while enabling treatment to the dose - response curve of individual patients ( a critical healthcare benefit ). doctors can deliver improved care due to patient ability to self - administer consistent doses with maximum efficiency ( little waste ) and efficacy ( greater absorption of active ingredients ). tamper - resistant packaging and digital record - keeping offer states and law enforcement authorities new tools to help ensure accountability , control and transparency throughout the medical cannabis supply chain . in another embodiment , the amount of material vaporized is not alterable by the end user . in another embodiment , the flexible tube / mouthpiece may be removed while in operation , resulting in use of the dose vaporizer in a manner that provides the vaporizer stream into a given physical space , for example , a room of a house . in another embodiment , the instant invention is designed exclusively for use by legally approved patients . in another embodiment , the instant invention is designed for home use bedside or on any or all flat table top like surfaces that are suitable for such a device and able to withstand the level of heat that may be generated by sustained use . in another the instant invention is designed for portable use , for example , as a backpack unit ; a wheeled unit ; a battery or liquid - fuel - powered unit . in another embodiment , the instant invention is designed to be set at the specific temperature by the factory or the legally approved provider and or doctor or caregiver that is required to vaporize medical cannabis or a single specific temperature that is required to vaporize any and all other medications that have been legally prescribed . in another embodiment , the instant invention is designed to be set to deliver any of a number of vaporizable medicines / alternative compounds , including but not limited to aromatherapy compounds and / or substrates . in another embodiment , the instant invention is designed to have one and only one temperature setting activatable by the user . in another embodiment , the instant invention is not designed to be used with more than one medical product . in another embodiment , the temperature , time and air velocity settings of the instant invention are not variable . in another embodiment , the instant invention is designed to have a baffle that will block the heat source and prevent the combustion of the material to be vaporized . in another embodiment , the baffle system is designed to be set at a single temperature by the factory . in another embodiment , the baffle system is designed to be activated by a time period set by the factory or controlled by the doctor . in another embodiment , the baffle system is designed to be activated by a temperature set by the factory or controlled by the doctor . in another embodiment , the heating element is designed to be activated by a time period set by the factory or controlled by the doctor . in another embodiment , the heating element is designed to be activated by a temperature set by the factory or controlled by the doctor . in another embodiment , the baffle is designed to be activated by a time or temperature set by the factory or controlled by the doctor so as to optimize heating and / or inhalation periods ( for example in order to optimize extraction of the vapors from the sample ) and / or for the purpose of avoiding combustion and / or control total amount of vapor / active ingredient taken in by the patient . in one embodiment , the baffle system is designed and intended to provide a vaporizing heat stream at a temperature approximately 10 degrees below the combustion point of medical cannabis . in another embodiment , the vaporizer is designed to deliver vapor to the lungs of legally approved patients via oral inhalation through a simple tube made from easily cleaned and sterilized materials such as plastic , glass , ceramics or low heat conducting metal . in another embodiment , the instant invention &# 39 ; s vaporizer carbureting holes are designed to allow cool air to rush into the delivery tube , behind the heated vapor at the time the baffles block off the heat source . in another embodiment , the carbureting holes are designed to use cool air to push the heat created vapors deep into the patients &# 39 ; lungs for more effective absorption of the intended compounds of the vaporized material . in another embodiment , the carbureting holes are designed to insure that the vapors cannot reach the patients body / lungs at temperatures that would create discomfort . in another embodiment , the instant invention vaporizer is designed to only accept medical cannabis and any legally prescribed material that is packaged by a licensed provider in proprietary dose cartridges . in another embodiment , use of standardized , optimized dose cartridges may facilitate consistent dosing amounts and efficacy by minimizing human error in the preparation and use of doses prepared by the user from “ loose ” or unprocessed vaporizable substances . in another embodiment , the vaporizer is designed to record proper use and illegal misuse or abuse with a data storage system . in another embodiment , the vaporizer is designed to be used by one and only one legally approved patient at a time . in another embodiment , the vaporizer is designed to be very simple to use by patients that have limiting or debilitating conditions . in another embodiment , the vaporizer is designed to be impossible to use incorrectly with automatic “ lockout ” cutoff if misuse , dangerous temperature levels , illegal use and any or all unintended use is detected . in one embodiment , a lockout is tied to use of a purpose - built machine in the wrong location , which may be ascertained , for example , by use of gps geolocation . in another embodiment , a lockout is tied to use of the machine at an improper temperature . in another embodiment , a lockout is tied to use of the machine at an improper frequency of use . in another embodiment , a lockout is tied to use of the machine utilizing an improper dose . in another embodiment , a lockout is tied to use of the machine by an improper person . in another embodiment , a lockout is tied to use of the machine with an improper material . in another embodiment , the vaporizer is designed to eliminate the need for a legally approved patient to handle , come on contact with or otherwise contaminate , subdivide or transfer the material to be vaporized . in another embodiment , the vaporizer is designed to electronically alert law enforcement , care givers , insurance providers and any or all legally authorized interested parties of both proper use and illegal misuse via the internet , wi - fi , blue tooth , cellular phone , land line telephone , telegraph and or other means . in another embodiment , the vaporizer is designed to fully extract the intended compounds of the material to be vaporized by proper and exact temp settings and controlling the volume of heated air that is allowed to pass through the material to be vaporized . in another embodiment , the vaporizer is designed to “ present ” the proprietary dose cartridge to the heat source in the optimal way to insure complete vaporization of the material . in another embodiment , the vaporizer is designed to completely vaporize each dose cartridge in a single patient use and record each used dose in a simple data collection system . in another embodiment , the vaporizer is designed to detect the identity of the legally authorized user through methods that can include fingerprint sensors , retinal scanning , proprietary passwords and electric confirmation from the recommending physician , legally authorized care giver in another embodiment , the vaporizer is designed to work only with single - use dose cartridges , and will not accept a cartridge more than once even if the sample contained within is not fully vaporized . in another embodiment , the instant invention is designed to avoid unintentional combustion through use of any or all of a smaller sample ; limited temperature ; limited airflow ; and / or limited air intake . in another embodiment , the heat source is programmed to maintain a precise temperature below the maximum temperature . in the event of a malfunction temp . sensors between the heat source and the dose cartridge electronically trigger a baffle that blocks heat from substance before it exceeds the minimum temp necessary for the combustion of cannabis . in another embodiment , the medical inhalation device includes a disposable vaporizer tube . in another embodiment , the medical inhalation device includes a sterilizable vaporizer tube . in another embodiment , the medical inhalation device includes a sterile vaporizer tube . in another embodiment , the medical inhalation device further includes a one - way sanitary vapor valve . in one embodiment , the dose vaporizer cartridge is a new device that delivers a single dose of medicine ( in one embodiment , cannabis ) that has been produced for medicinal uses . in another embodiment , the dose is encapsulated between two heat - resistant screens . in another embodiment , the dose may be encapsulated between / wrapped within any available substrate , such as paper , plastic , mesh , metal , etc . in another embodiment , the two heat - resistant screens are designed so as to assist in delivering equivalent heat to the entirety of the encapsulated sample when exposed to heated air and / or convection processes . in another embodiment , the dose vaporizer cartridge is adapted and sized so as to be precisely fit into a dose vaporizer so as to provide for optimal vaporization of medical product encapsulated within the heat resistant screens . in one embodiment , the dose vaporizer cartridges are refillable . in another embodiment , the dose vaporizer cartridges are reusable . in another embodiment , the dose vaporizer cartridges are tamper - resistant , and will not work when refilled by the end user . in another embodiment , the dose vaporizer cartridges are tamper - resistant , and will work only when refilled by an authorized dispenser , who may , without limitation , be a health - care provider . in another embodiment , the dose cartridge allows physicians and / or third parties to create specific and / or customizable measured doses of medical cannabis that may be supplied within the dose cartridges . in one embodiment , such specific , controlled , measured doses of medical cannabis may include specific measured blends of multiple strains of cannabis that are combined for the treatment of specific conditions and / or the packaging of measured amounts of a single strain of medical cannabis . in one embodiment , the dose cartridge is designed to deliver a specific amount of the chemicals in medical cannabis to the patient . in one embodiment , the dose cartridge encapsulates cannabis or any and all other substances to be delivered through vaporization between two screens , pieces of mesh or otherwise suitable material . in another embodiment , the dose cartridge is tamper evident and designed to clearly record and / or visually indicate misuse or attempted misuse . in another embodiment , the cartridge is also labeled for easy identification by pharmacists , doctors patients and all caregivers . the cartridge is designed to be easily handled by patients and caregivers . in another embodiment , the cartridge is designed to only be used in a proprietary vaporizing delivery system . in another embodiment , the dose cartridges are designed to be compatible with and / or usable with a variety of brands and models of vaporizers that are available and / or may become available in the marketplace . in another embodiment , the cartridge is designed to be packaged in sterile easily identifiable boxes that can be distributed by pharmacies , doctors and any and all properly licensed caregivers or dispensaries whether traditional or automated . in another embodiment , the cartridge facilitates use of a medical product ( in one instance , cannabis ) without requiring expensive and time - consuming pretreatment of the medical product by , for example , solubilizing , heating or otherwise transforming the medical product . in another embodiment , the dose consists of sterilized cannabis or other material , for example through use of heat , ultraviolet , or gamma - ray sterilization . in one embodiment , the instant invention is designed to track and control medical cannabis and other controlled substances or drugs that can be vaporized from their growth or production through packaging and until final consumption by the legally intended patient . in one embodiment , such tracking can be facilitated by use of any of a number of available technologies , such as rfid ; internet access ; wireless access ; usb device monitoring ; smartphone application ; internet connection ; social media ; etc . in another embodiment , the instant invention is designed to collect , organize , analyze and provide accurate and precise information about the use of medical cannabis by legally authorized patients to legally authorized interested parties including , without limitation , doctors , medical researchers , patient advocates , politicians , patients , insurance providers , state governments , and government agencies . in another embodiment , the instant invention is designed to detect any or all illegal use , abuse , subdivision , and unauthorized redistribution of the materials packaged in proprietary dose cartridges for use in a proprietary vaporizer . the instant invention is designed to create and utilize a single dose / single use package for medical cannabis . in another embodiment , the instant invention is designed to record the precise time and location that a legally authorized patient ingests medical cannabis utilizing simple data recording software and / or a gps location device ; and cross - verifying barcode / rfid using an available database or other reporting / recording methods described above . in another embodiment , the instant invention is designed to rapidly and efficiently deliver the beneficial effects of medical cannabis to legally authorized patients . in another embodiment , the instant invention is designed to completely utilize and eliminate the waste of the materials including medical cannabis that is packaged in a proprietary dose cartridge and vaporized with a proprietary vaporizer . in another embodiment , the instant invention is designed to eliminate direct contact by legally authorized patients with the material packaged in proprietary dose cartridges . in another embodiment , the instant invention is designed to track a plurality of individually - packaged doses , including tracking the identity of the person utilizing the dose ; receiving the dose ; purchasing the dose ; ascertaining whether the dose was completely administered ; and ascertaining whether the dose cartridge was tampered with and / or refilled . in another embodiment , the instant invention is usable for tracking individual acquisition and use of doses , regardless of whether the individuals are located within a healthcare facility . in another embodiment , the instant invention is capable of tracking dispensation and use of a product through its full life cycle ; e . g . assessing when the relevant active ingredients have been substantially vaporized and delivered from the dose cartridge . in another embodiment , the instant invention assesses use of a dose through non - visual means . in another embodiment , such non - visible means are , for example , through use of test strips and / or chemical assays . in another embodiment , such non - visible means are indirect measurements , for example , the measurement of heat setpoint obtained and duration of heat setpoint obtained at the mouthpiece ( downstream of vaporization ) as a method of indirectly measuring extent of vaporization and incidence of combustion of the medical sample . while a number of embodiments of the present invention have been described , it is understood that these embodiments are illustrative only , and not restrictive , and that many modifications and / or alternative embodiments may become apparent to those of ordinary skill in the art . for example , any steps may be performed in any desired order ( and any desired steps may be added and / or any desired steps may be deleted ). therefore , it will be understood that the appended claims are intended to cover all such modifications and embodiments that come within the spirit and scope of the present invention .
0
fig1 is a sectional view schematically illustrating the construction of a semiconductor device according to one embodiment of the present invention . the semiconductor device is of a so - called fcbga ( flip chip ball grid array ) structure , and includes a thin wiring board 1 such as of a ceramic , a polyimide resin or a glass epoxy resin . the wiring board 1 has a wiring pattern ( not shown ) such as formed by copper plating . a thin semiconductor chip 2 , for example , having a thickness of not greater than 200 μm is bonded to a surface 11 of the wiring board 1 with its face down . more specifically , the thin semiconductor chip 2 is bonded to the board 1 and electrically connected to the wiring pattern formed on the board 1 via bumps 3 formed of an electrically conductive material such as gold so that an active surface 21 thereof including an active surface region formed with devices such as a transistor is opposed to the board surface 11 . a plurality of solder balls 4 are provided as terminals for external connection on a rear surface 12 of the wiring board 1 opposite from the surface 11 to which the semiconductor chip 2 is bonded . a frame - like stiffener 5 of a synthetic resin material such as an epoxy resin is provided around the semiconductor chip 2 . the stiffener 5 serves to strengthen the periphery of the thin wiring board 1 and to keep the planarity of the wiring board 1 . a surface 51 of the stiffener 5 opposite from the wiring board 1 is generally flush with a non - active surface 22 of the semiconductor chip 2 opposite from the active surface 21 . as required , a heatsink plate 6 for dissipating heat from the semiconductor chip 2 is provided on the semiconductor chip 2 and the stiffener 5 as indicated by a phantom line in fig1 . if there was a height difference between the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 in this case , it would be difficult to attach the heatsink plate 6 in contact with both the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 . in this embodiment , however , the non - active surface 22 of the semiconductor chip 2 is generally flush with the surface 51 of the stiffener 5 , so that the heatsink plate 6 can easily be provided in contact with both the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 . further , a production serial number and the like can be inscribed across the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 , since the non - active surface 22 of the semiconductor chip 2 is generally flush with the surface 51 of the stiffener 5 . even if the semiconductor chip 2 has a small size as viewed in plan , a sufficient space can be provided for the inscription . a space d is provided between the semiconductor chip 2 and the stiffener 5 . even if the semiconductor device is exposed to a high temperature , a difference in thermal expansion between the semiconductor chip 2 and the stiffener 5 can be accommodated by the space d . therefore , the warp of the semiconductor device can be prevented which may otherwise occur due to the thermal expansion . a low elasticity filler 7 such as of a synthetic resin material ( e . g ., a polyimide resin ) having a lower elasticity than the stiffener 5 is filled in a space defined between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 . thus , the active surface 21 of the semiconductor chip 2 can be protected , and stresses exerted on the bumps 3 can be alleviated . the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 are preferably mirror surfaces finished by a chemical polishing process . when the semiconductor device is mounted on a mounting board under monitoring with a camera , for example , the camera can recognize the semiconductor device with an improved accuracy because diffused light reflection on the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 is suppressed . therefore , the semiconductor device can accurately be positioned at a desired mounting position on the mounting board . the mirror - finished non - active surface 22 and surface 51 each have an increased surface strength , so that the warp of the semiconductor device can more effectively be prevented which may otherwise occur due to the thermal expansion . fig2 ( a ) to 2 ( d ) are sectional views illustrating a process sequence for fabrication of the semiconductor device shown in fig1 . fig2 ( a ) illustrates a chip bonding step . in the chip bonding step , a semiconductor chip 2 is face - down bonded to a surface 11 of a wiring board 1 formed with a wiring pattern with an active surface 21 thereof being opposed to the surface 11 . at this time , the semiconductor chip 2 bonded to the wiring board 1 has a relatively great thickness , for example , on the order of 300 μm to 650 μm . thereafter , a material for a low elasticity filler 7 is injected into a space defined between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 , whereby the space between the surface 11 and the active surface 21 is sealed with the low elasticity filler 7 . fig2 ( b ) illustrates a resin providing step to be performed after the chip bonding step . in the resin providing step , a liquid thermo - setting resin as a material for a stiffener 5 is applied on the surface 11 of the wiring board 1 mounted with the semiconductor chip 2 to surround the periphery of the semiconductor chip 2 . then , the resulting board is subjected to a heat treatment , whereby the thermo - setting resin provided around the semiconductor chip 2 is hardened for formation of the stiffener 5 . after the hardening of the thermo - setting resin , a planarization step ( polishing step ) is performed as shown in fig2 ( c ). in the planarization step , the semiconductor chip 2 and the stiffener 5 are simultaneously ground by means of a grinder . at this time , the simultaneous grinding of the semiconductor chip 2 and the stiffener 5 can alleviate a stress exerted on the semiconductor chip 2 during the grinding . thus , the warp and chipping of the semiconductor chip 2 can be prevented . the simultaneous grinding of the semiconductor chip 2 and the stiffener 5 is carried out until the thickness of the semiconductor chip 2 and the stiffener 5 reaches a target thickness level t as indicated by a two - dot - and - dash line in fig2 ( b ). the target thickness level t is set , for example , so that the thickness of the semiconductor chip after the polishing is not greater than 200 μm . where a non - active surface 22 of the semiconductor chip 2 and a surface 51 of the stiffener 5 are to be mirror - finished , a chemical polishing process with the use of a chemical agent or a cmp ( chemical mechanical polishing ) process is performed after the planarization step . as required , a heatsink plate 6 ( see fig1 ) is attached onto the semiconductor chip 2 and the stiffener 5 . then , a plurality of solder balls 4 are provided on a rear surface 12 of the wiring board 1 as shown in fig2 ( d ). thus , the semiconductor device having the aforesaid construction is fabricated . the step of injecting the material for the low elasticity filler 7 into the space between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 may be performed after the resin provision step or after the planarization step . while the embodiment of the present invention has thus been described , the invention may be embodied in any other ways . the planarization for making the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 generally flush with each other is achieved by the grinding with the use of the grinder in the embodiment described above , but may be achieved by a chemical polishing process or a cmp process . further , the stiffener 5 is formed of the synthetic resin material in the embodiment described above , but may be formed of a metal material . in this case , a metal stiffener 5 is provided on the surface 11 of the wiring board 1 , and then the semiconductor chip 2 and the metal stiffener 5 are simultaneously planarized . although the aforesaid embodiment is directed to the semiconductor device of the fcbga structure having the ball - shaped terminals for external connection , the present invention may be applied to semiconductor devices of a flip chip bonding structure which have pin - shaped or land - shaped lead terminals . further , the invention may be applied not only to the semiconductor devices of the flip chip bonding structure but also to semiconductor devices of a chip - on - chip structure in which semiconductor chips are bonded to each other with active surfaces thereof being opposed to each other . while the present invention has been described in detail by way of the embodiment thereof , it should be understood that the foregoing disclosure is merely illustrative of the technical principles of the present invention but not limitative of the same . the spirit and scope of the present invention are to be limited only by the appended claims . this application corresponds to japanese patent application no . 2000 - 322814 filed to the japanese patent office on oct . 23 , 2000 , the disclosure thereof being incorporated herein by reference .
7
the polymers used in the preferred embodiments of the present invention are prepared by the polycondensation of dimethyl terephthalate , dimer acid , or preferably its diisopropyl ester and a polymethylene diol ( n = 4 to 8 , and preferably 4 ). ## str7 ## the preferred parent dimer acid of the diisopropyl ester utilized in the polymerizations is derived from high purity oleic acid and is formed by a clay catalyzed high pressure dimerization of the oleic acid in the presence of water . the mechanism of formation of the dimer acid is probably free radical in nature and the product is believed to consist of a mixture of acyclic unsaturated c 36 acids . the unsaturated materials are then hydrogenated and the dimer ester used in the present polymerizations possesses a slight degree of unsaturation as evidenced by an iodine number of 5 . in addition to the c 36 acids that make up the dimer acid there is present some monofunctional acid ( iso - stearic ) and a certain quantity of trifunctionality in terms of a &# 34 ; trimer ( c 54 ) acid .&# 34 ; the former may act as a chain terminator and the latter as crosslinking agent . detailed structures of the c 36 components of the dimer acid have not been elucidated as yet and the diacid is sometimes represented graphically as shown below ( with four almost equal branches ). ## str8 ## the reaction may be run in the absence or preferably in the presence of stabilizers taken from the types of hindered phenols or secondary aromatic amines . an example of the former is irganox 1098 sold by ciba - geigy [ n , n &# 39 ;- hexamethylene bis ( 3 , 5 - ditert - butyl - 4 - hydroxy hydrocinnamide )] and an example of the latter is naugard 445 sold by uniroyal [ 4 , 4 &# 39 ;- bis ( α , α - dimethylbenzyl ) diphenyl amine )]. oxides and alkoxides of numerous polyvalent metals may be employed as catalysts . a preferred catalyst for the polymerization is a mixture of 0 . 1 % tetrabutyl orthotitanate and 0 . 005 % magnesium acetate ( percentages based on total charge weight ). if a dyed end product is desired a compatible dye such as , for instance , d & amp ; c green # 6 can be added in suitable concentrations based on expected polymer yield . the polymerization is run in two stages . in the first stage , run under nitrogen at temperatures ranging from 160 ° to 250 ° c ., polycondensation via transesterification and esterification occurs resulting in oligomeric chains . these are converted to materials having a high degree of polymerization in the subsequent step run at 240 ° to 255 ° c ., at pressures of less than 1 mm of mercury . the resulting polymers exhibit inherent viscosities ( measured in hexafluoroisopropyl alcohol ) of 0 . 6 to 1 . 3 . the tm of the polymers , depending on composition , varies from 190 ° to 210 ° c . apparent viscosities at suitable extrusion temperatures vary from 2 × 10 3 to 9 × 10 3 poise . a summary of polymer properties is given in table i . the polymers may readily be extruded in a ram type extruder , such as , an instron capillary rheometer , at temperatures usually exceeding the polymer tm by 10 ° to 50 ° c . the resulting extrudate may be drawn , usually in a two - stage process using either two consecutive heated glycerine baths or a hot shoe followed by a subsequent glycerine bath . the draw ratio may vary from about 400 to 700 %. the oriented fibers exhibit properties that are quite unexpected . size 3 / 0 strands possess knot tensiles in the 35 - 40 × 10 3 psi range , straight tensiles in the 60 - 80 × 10 3 psi range and a young &# 39 ; s modulus of less than 150 × 10 3 psi . elongations range from 35 to 50 %. in summary , the polymers described lend themselves to ready extrusion and drawing to strong and supple fibers which are useful as flexible monofilament sutures . both stabilized and unstabilized fibers , upon co 60 sterilization ( 2 . 5 megarads ) suffer practically no losses in physical properties as judged by a comparison of inherent viscosities and tensile strength before and after sterilization . the unexpected retention of physical properties revealed by the unstabilized fibers presents a distinct advantage of the present invention over prior art . the desired amounts of dimethyl terephthalate , diisopropyl dimerate ( obtained from emery industries as emerest 2349 ), a 1 . 3 to 2 . 0 molar excess of a polymethylene diol and a given stabilizer are placed under nitrogen into a dry reactor fitted with an efficient mechanical stirrer , a gas inlet tube and a takeoff head for distillation . the system is heated under nitrogen to 160 ° and stirring is begun . to the homogeneous stirred solution the required amount of catalyst is added . the mixture is stirred and heated under nitrogen for given time periods at 190 ° c . ( 2 - 4 hours ) and 220 ° c . ( 1 - 3 hours ). the temperature is subsequently raised to 250 ° to 255 ° c . and over a period of 0 . 4 - 0 . 7 hours , the pressure is reduced in the system to below 1 mm / hg ( preferably in the range of 0 . 05 mm to 0 . 1 mm ). stirring and heating under the above conditions is continued to the completion of the polymerization . the endpoint is determined by either ( a ) estimating visually the attainment of maximum melt viscosity , ( b ) measuring inherent viscosity or melt indices of samples removed from the reaction vessel at intermediate time periods , and ( c ) using a calibrated torquemeter immersed into the mixture . in practice , depending on the terephthalate / dimerate ratio , in vacuo reaction times vary from 2 to 13 hours . at the end of the polymerization cycle the hot mixture is equilibrated with nitrogen and allowed to cool slowly . the reaction product is isolated , chilled in liquid nitrogen and ground . the ground chips are dried at 80 ° to 110 ° c . for 8 to 16 hours under vacuum of 1 mm or less and subsequently submitted for extrusion . extrusion through the instron rheometer is geared towards producing an extrudate which upon drawing ( 5 × to 7 × ratio ) yields a fiber in the 8 - 10 mil diameter range ( size 3 / 0 suture ). the polymers are packed at 110 ° to 130 ° c . in the extrusion chamber and extruded after a dwell time of 9 to 15 minutes through a 40 mil die . the ram speed is 2 cm / minute . extrusion temperatures depends both on the polymer tm and on the melt viscosity of the material at a given temperature ; usually extrusion proceeds at temperatures of 10 ° to 50 ° c . above the tm . die swells of up to 40 % are experienced by usually are much smaller ( 5 - 20 %); the extrudate is taken up at a speed of 18 feet per minute . the extrudate ( diameter range , 19 - 22 mm ) is passed through rollers at an input speed of four feet per minute onto a hot shoe or into a draw bath varied from 50 ° to 100 ° c . draw ratio in this first stage of operation vary from 5 × to 6 ×. the drawn fibers are placed over another set of rollers into a glycerine annealing bath ( second stage ) kept at temperatures ranging from 70 ° to 95 ° c . draw ratios for the second stage operation vary from 1 . 1 × to 1 . 25 ×. finally , the fiber is passed through a water wash bath and taken up on a spool . in the following examples inherent viscosity ( ninh ) is obtained for polymer solutions in hexafluoro - 2 - propanol ( hfip ) ( 1 g ./ 1 ). the infrared spectra are obtained for polymer films cast from chcl 3 or hfip . the nmr spectra are recorded for polymer samples in solution in 60 / 40 hexafluoroacetone sesquideuterium oxide . the glass transition ( tg ), crystallization ( tc ) and melting ( tm ) temperatures of the polymers in nitrogen are recorded , using a d . s . c . ( differential scanning calorimetry ) apparatus . the percent crystallinity is determined by x - ray . a hot - stage microscope is used to determine the melting behaviour of the polymers . fiber tensile properties are measured on an instron , model no . 1122 . steel faced jaws are used throughout . for the measurement of the young &# 39 ; s modulus , line contact jaws are applied . for straight tensile and moduli measurements a speed of 100 mm / min ., a chart speed of 200 mm / min . and a gauge length of 12 cm is employed . for knot tensiles the above parameters are 100 mm / min ., 100 mm / min . and 5 cm , respectively . the following materials are placed in a nitrogen glove box into a flamed , vacuum dried two - necked round bottom flask fitted with a stainless steel paddle shaped stirrer : the open neck is fitted with a rubber septum , the flask and stirrer assembly is removed from the glove box , attached to an efficient mechanical stirrer and placed into an oil bath heated at 160 ° c . after several minutes , the reaction mixture liquifies and mechanical stirring is started . the catalyst ( 1 . 0 ml ) consisting of 0 . 1 % tetrabutyl orthotitanate and 0 . 005 % magnesium acetate ( percentages based on total charge weight ) dissolved in a mixture of methanol and butanol is added through the septum to the reaction via a syringe . the septum is replaced by a short distilling head fitted with a receiver and a nitrogen inlet nozzle . the reaction mixture is heated under nitrogen at 190 ° c . for 3 hours and at 220 ° c . for 2 hours . as the methanol distillation ceases , the reaction temperature is increased to 250 ° c ., the receiver containing the distillate is replaced by an empty flask and gradually , over a period of 30 minutes , the pressure in the reaction setup is reduced to 0 . 08 mm . the mixture is heated at this pressure and at 250 ° c . for 4 hours . the hot viscous mass is equilibrated with nitrogen and allowed to cool to room temperature . the polymer is isolated , chilled and then ground . the polymer chips are dried for 8 hours under a good vacuum and a temperature of 80 ° c . properties of the polymer and of others prepared by similar reaction schemes are shown in table i ( see sample # 6 for above - described polymer ). the procedure of example i is followed , in all respects with the one exception that a like quantity of dimethyl isophthalate is substituted in place of the dimethyl terephthalate used in the initial reaction mixture . the final product is a poly ( tetramethylene dimerate coisophthalate ) polymer . the procedure of example i is followed in all respects , with the one exception that 52 . 4 g . of dimethyl cyclohexane - 1 , 4 - dicarboxylate is substituted in place of the 50 . 8 g . of the dimethyl terephthalate used in the initial reaction mixture . the final product is a poly ( tetramethylene dimerate co - cyclohexane - 1 , 4 - dicarboxylate ) polymer . ten grams of the copolymer described in example i are packed at 150 ° c . into the extrusion chamber of an instron rheometer and after 15 minutes of dwell time the sample is extruded at a ram speed of 2 cm / min ., a shear rate of 212 . 6 sec - 1 and a temperature of 250 ° c . the resulting melt viscosity is found to be 6178 poise . the takeup speed of the extrudate is 18 ft / min . and the extrudate is quenched in ice water . the diameter of extrudate is 21 . 0 mils . the extrudate is drawn at 5 × over a hot shoe held at a temperature of 99 ° c . and at 1 . 2 × through a glycerine bath kept at 95 ° c . the fiber is pulled through a water bath ( room temperature ) to remove the glycerine and taken up on a spool . the draw tension for both the first drawing stage is 420 g . and for the second stage 380 g . ; the total draw ratio is 6 . 0 ×. tensile data for fibers obtained in this and other runs are shown in table ii . fibers prepared from polymer # 9 ( table i ) are strung under a tension of 50 g . on an adjustable annealing rack . the adjustable bar is lowered about 10 % to allow the fibers to relax freely . after 16 hours the adjustable bar is raised to a height which is sufficient to straighten the fibers without imparting any tension ( 0 % relaxation ). the fibers are subjected to one hour of heating at 110 ° c . and then cut off the annealing rack . fibers annealed in this manner , upon exposure to free shrinkage ( 60 ° c ./ 2 . 5 hours ) shrink 2 . 3 % as opposed to 15 . 6 % for unannealed strands . copolymer x , which is the poly ( tetramethylene dimerate - co - terephthalate ) of example i of the hoeschele u . s . pat . no . 3 , 954 , 689 was prepared , the molar monomer ratio [ dimerate / terephthalate ] being 15 : 725 / 84 : 275 and the poly . ninh at 25 ° c . in hfip being 1 . 32 . in addition , homopolymer y , which comprises poly ( tetramethylene terephthalate ) [ pbt ] was prepared , the polyninh at 25 ° c . in hfip being 1 . 52 . polymers x and y were subjected to extrusion in the same manner as indicated in example iv , but the extrusion and orientation conditions were as follows : a 40 mil . die was used and the shear rate was 212 . 6 sec - 1 ______________________________________ copolymer x homopolymer y______________________________________1 . extrusion conditions temperature 240 ° c . 250 ° c . αapp ., sec . sup .- 1 212 . 6 212 . 6 ηapp ., poise 10 , 207 8 , 2732 . draw ratio 4 × at 72 ° c . 4 × at 71 ° c . 1 . 2 × at 90 ° c . 1 . 25 at 90 ° c . 3 . tensile properties tensile strength 71 , 657 psi 70 , 011 psi knot strength 28 , 427 psi 64 , 958 psi elongation 62 % 32 % young &# 39 ; s modulus 36 , 266 psi 398 , 953 psi______________________________________ table i__________________________________________________________________________synthesisand properties of poly ( tetramethylene dimerate co terephthalate ) polymers polymerizationmonomer % d & amp ; c reaction scheme poly . ηinhsample ratio * stabilizer green # 6 temp . pressure time at 25 ° c . m . p . ° c . no . d / t type ** ( by wt .) ° c . mm hg hours in hfip ( microscopy ) tm ° c . __________________________________________________________________________1 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 90 not not ( 1 %) 190 &# 34 ; 3 . 0 available available 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 5 . 02 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 98 195 - 197 196 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 2 . 03 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 90 195 - 196 195 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 2 . 04 13 / 87 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 17 197 - 199 194 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 4 . 05 12 / 88 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 0 . 96 197 - 198 199 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 05 13 . 06 12 / 88 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 21 197 - 198 199 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 05 4 . 07 12 / 88 naugard 445 0 160 atm . n . sub . 2 0 . 2 1 . 00 198 - 200 203 ( 1 %) 190 &# 34 ; 2 . 5 220 &# 34 ; 3 . 0 250 0 . 05 8 . 08 11 / 89 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 63 203 - 208 204 ( 1 %) 190 &# 34 ; 3 . 5 220 &# 34 ; 1 . 8 250 &# 34 ; 1 . 5 250 0 . 05 5 . 39 10 / 90 naugard 445 0 160 atm . n . sub . 2 0 . 2 1 . 15 not not ( 1 %) 190 &# 34 ; 3 . 0 available available 220 &# 34 ; 2 . 0 250 0 . 05 7 . 510 10 / 90 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 06 202 203 ( 1 %) 190 &# 34 ; 3 . 0 200 &# 34 ; 2 . 0 250 0 . 05 5 . 011 10 / 90 none 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 08 202 - 203 202 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 08 4 . 012 10 / 90 irganox 1098 0 . 3 conditions same as in 1 . 24 202 - 203 205 ( 0 . 25 %) sample 11 . __________________________________________________________________________ * d = dimerate moiety ; t = terephthalate moiety . ** naugard 445 : 4 , 4 &# 39 ; bis ( α , dimethylbenzyl ) diphenyl amine irganox 1098 n , n &# 39 ;-- hexamethylene bis ( 3 , 5ditert - butyl - 4 - hydroxyhydrocinnamide ) table ii__________________________________________________________________________extrusion and drawing conditions andultimate tensile properties for fiber derived from dimerate co terephthalate ) polymersextrusion drawing conditions tensile propertiesconditions ratio t ° c . knot straight % y . m . sample ηapp 1st 2nd 1st 2nd dia . ( psi × ( psi × elong - ( psi × no . t ° c . ( poise ) stage stage stage stage ( mil ) 10 . sup .- 3 ) 10 . sup .- 3 ) ation 10 . sup .- 3 ) __________________________________________________________________________1 215 5587 5 × 1 . 3 × 52 75 9 . 2 35 . 1 69 . 8 49 79 . 62 210 5050 6 × 1 . 08 × 85 92 8 . 6 32 . 5 74 . 0 47 79 . 23 210 5050 6 × 1 . 08 × 85 92 8 . 6 35 . 3 67 . 0 42 82 . 34 230 7682 5 × 1 . 1 × 96 95 9 . 5 36 . 3 75 . 8 43 108 . 55 225 6124 5 × 1 . 2 × 99 95 9 . 7 35 . 5 71 . 2 55 60 . 06 250 6178 5 × 1 . 2 × 99 95 9 . 0 40 . 6 81 . 4 41 117 . 27 215 7198 5 × 1 . 15 × 85 92 9 . 1 41 . 2 70 . 9 40 134 . 28 215 1128 6 × 1 . 17 × 52 72 8 . 2 37 . 3 66 . 7 35 141 . 29 220 9616 5 × 1 . 2 × 85 90 9 . 1 38 . 7 82 . 1 42 147 . 710 215 6285 5 × 1 . 25 × 79 79 9 . 2 43 . 8 70 . 3 40 162 . 211 210 7735 5 × 1 . 25 × 82 79 9 . 4 39 . 9 57 . 3 37 125 . 812 235 8541 5 × -- 91 -- 9 . 8 41 . 1 62 . 6 48 138 . 9__________________________________________________________________________ the poly ( polymethylene terephthalate , isophthalate or cyclohexane - 1 , 4 - dicarboxylate - co - dimerate ) used in accordance with the present invention may be spun as multifilament yarn and woven or knitted to form sponges or gauze , ( or nonwoven sheets may be prepared ) or used in conjunction with other compressive structures as prosthetic devices within the body of a human or animal where it is desirable that the structure have high tensile strength and desirable levels of compliance and / or ductility . useful embodiments include tubes , including branched tubes , for artery , vein or intestinal repair , nerve splicing , tendon splicing , sheets for tying up and supporting damaged kidney , liver and other abdominal organs , protecting damaged surface areas such as abrasions , particularly major abrasions , or areas where the skin and underlying tissues are damaged or surgically removed . in more detail , the surgical and medical uses of the filaments of the present invention include , but are not necessarily limited to :
0
the present invention is based on the discovery that adeno - associated virus - derived vectors efficiently transduce primate pluripotent hemopoietic stem cells . adeno - associated virus has not been reported to transduce pluripotent hemopoietic stem cells of primates and aav - derived vectors have not been shown to transduce hemopoietic cells with in vivo repopulating ability , in addition , it is surprising that the vector integrates with high efficiency into p - phsc , even though most of the p - phsc are not actively dividing at the time of infection . this is surprising , since it has been established that raav integration in dividing cells occurs 200 times more efficiently in dividing , as opposed to nondividing cells [ 38 ]. also , it was reported that primary cells are much less efficiently transduced by raav than immortalized cell lines [ 47 ]. in addition , it was reported that orf 6 from adenovirus e4 - region stimulates transduction by recombinant aav [ 48 ]. in a gene therapy setting , it is undesirable to have functionally active adenovirus present due to toxicity problems caused by the virus directly or the immune system of the patient . at the keystone symposium on molecular and cellular siology , taos , n . mex . feb . 4 - 10 , 1996 , prof . a . nienhuis presented a paper stating that they transduced rhesus monkey cd34 + cells and , subsequently , autologously transplanted the infected cells [ 49 ]. analysis of the peripheral blood cells circulating in blood with a polymerase chain reaction specific for the raav revealed that cells carrying the raav were only detected up until 7 days post transplantation [ 49 ], i . e . p - phsc were not transduced by raav in their experiment . nonetheless , the present invention demonstrates that an adeno - associated virus - derived vector may be used to deliver exogenous dna efficiently to cells of the hemopoietic system with long term repopulating ability . the current perception of aav - integration into the cellular host chromosome is that the pre - integration complex is stable in cells . although integration occurs more efficiently in dividing cells , the pre - integration complex is stable in non - dividing cells and integrates when the cell is triggered to undergo cell cycling [ 38 , 60 ]. the primate - derived hemopoietic stem cells and committed progenitor cells upon autologous transplantation into an irradiated recipient are triggered into cycle to repopulate the destroyed hemopoietic system . for this reason , it is generally believed that the hemopoietic cells need not be triggered in vitro . for this reason , protocols to transduce hemopoietic progenitor cells with raav do not involve culturing the cells in the presence of hemopoietic growth factors . although this reasoning is very plausible with the current information , we devised experiments to investigate the effect of in vitro culture of hemopoietic stem cells and the in vitro stimulation with hemopoietic growth factors . as used herein , the term “ recombinant aav vector ” means a dna sequence flanked at each end by an aav - itr or functional equivalent or part thereof . the recombinant aav vector can be used directly or be packaged into a complex before use , as used herein , the term “ complex ” is defined as a combination of two or more components physically linked to each other through hydrophobic , hydrophilic or electrostatic interactions or covalent bonds , whereby one component of the complex at least is a recombinant aav molecule . other components of the complex can comprise , but are not limited to , one or a combination of liposomes , calcium phosphate precipitate , polylysine , adenovirus , adenovirus proteins , rep78 , rep68 , aav capsids or the aav capsid proteins vp1 , vp2 or vp3 . in a preferred embodiment the complex consists of the recombinant aav vector and the aav capsid proteins . this complex can be , but is not limited to , the form of an intact virion or particle where the recombinant aav vector is packaged inside an aav capsid or functional analogs thereof . as used herein , the term “ functional analogs ” refers to the same activity in kind , but not in amount or degree , i . e . not quantitatively . when the recombinant aav is packaged into aav particles , the size of the dna sequence will be limited by the size constraints for packaging into aav particles which , with the current state of the technology , is about 5 kb . the dna fragment preferably does not contain sequences functionally analogous to the terminal resolution site in the aav - itr as this might interfere with the stability of the recombinant vector . the dna sequence can be any sequence with therapeutic properties when introduced into hemopoietic stem cells , but the dna sequence preferably encodes one or more proteins or rna with therapeutic properties when expressed in hemopoietic cells . non - limiting examples of such sequences are the human β - globin gene operably linked to cis - acting sequences for erythroid specific physiological expression , the human lysosomal glucocerebrosidase gene ( e . c3 . 2 . 1 . 45 ), the α1 - antitrypsin gene , a dna sequence encoding an rna or protein with anti - viral activity or the multidrug resistance gene i ( mdri ). aav - itr sequences may be obtained from aav serotypes 1 , 2 , 3 , 4 or 5 . alternatively , mutant or recombinant itr sequences can be used , which retain the essential properties of the aav - itr prototype , examples of which are described in lefebvre et al , [ 50 ]. packaging of raav into aav - virions can be achieved using a variety of different methods . all methods are based on bringing the necessary proteins and raav - containing dna in an environment that supports the replication and packaging of raav , one method relies on the transfection of adenovirus 5 infected human cells with a plasmid carrying the raav - dna together with a plasmid containing expression cassettes for the aav - genes rep and cap . upon continued culture of the manipulated cells , raav is replicated and packaged . after three days , the cells are harvested and the accumulated recombinant virions are released from the cells [ 15 - 19 ]. a variation on the packaging system described above is the use of packaging cells that carry all or part of the relevant sequences stably integrated in their genome ( i . e . the recombinant aav vector , the rep - gene , the cap - gene , and the relevant protein coding domains of the helper virus ). when only partial packaging cells are used , the missing packaging functions have to be supplied externally via transtections of plasmids carrying the functions or virus infection . the helper virus functions are required for efficient packaging of recombinant aav . for most applications , the helper virus is inactivated or separated physically from the recombinant aav virions before using the recombinant aav virions for the transduction of cells [ 15 - 19 ]. recombinant aav vectors can be packaged by adding the recombinant aav - dna to protein extracts or mixtures of protein extracts of cells that expressed all or part of the relevant proteins for the replication and packaging of recombinant aav . when protein extracts are used from cells expressing only some of the relevant proteins for packaging of recombinant aav , the missing proteins can be supplied externally in purified form . the rep - gene can be derived from aav serotypes 1 - 5 or functional analogues thereof either obtained through non - essential mutations in the rep - genes or through the isolation of genes with similar capabilities such as the human herpesvirus 6 aav - 2 rep gene homologue [ 58 ]. the cap - gene can be derived from aav serotypes 1 - 5 or functional analogues thereof obtained through non - essential mutations in the cap - genes . alternatively , the cap - gene sequences can be altered through the replacement or addition of sequences rendering the produced virion new or altered target cell specificities . recombinant aav virions produced by the methods described above can be purified and concentrated using biological , physical or chemical separation techniques such as , but not limited to , antibody affinity purification , density gradient centrifugation or ion exchange chromatography . alternatively , the virions produced can be used in an unpurified form . as used herein , pluripotent hemopoietic stem cells from primates ( p - phsc ) are functionally defined as cells from primates with the capability to form and maintain an entire hemopoietic system , ranging from mature t - cells , b - cells , macrophages or erythrocytes to new p - phsc . p - phsc display this capability in unmanipulated primates or upon their autologous transplantation . sources of p - phsc are the bone marrow , the peripheral blood or cord blood . p - phsc can be collected from unmanipulated primates or from primates treated with compounds such as , but not limited to , cytostatic drugs or hemopoiatic growth factors to activate , recruit or otherwise potentiate the p - phsc . transduction of p - phsc is preferably performed ex vivo , following harvesting of the p - phsc from a suitable source , and after the transduction the transduced cells are autologously transplanted . in a preferred embodiment of the invention , the p - phsc are cultured during their ex vivo transduction , where it is most preferred that during this culture the p - phsc are stimulated with at least one hemopoietic growth factor , such as , e . g ., interleukin - 3 . alternatively , p - phsc transduction is performed in vivo when suitable methods have been developed to target the recombinant aav vector in vivo to p - phsc . table 1 key properties of adeno - associated virus vectors and amphotropic retrovirus vectors . table 2 characterization of recombinant aav preparations useful for the transduction of primate phsc . fig1 a recombinant aav - vectors useful for the transduction of primate phsc . lcr = core sequences from hypersensitive sites 4 , 3 and 2 from the β - globin locus control region . − 103 = human β - globin gene promoter fragment extending − 103 upstream of the transcription start site . − 265 = human β - globin gene promoter fragment extending − 265 upstream of the transcription start site . β - globin = human β - globin gene with modified intron 2 ( see text and 21 ). tkprom = herpes simplex virus thymidine kinase gene promoter ( approx . 500 bp nari - bgiii fragment ) pa = polyadenylation signal from herpes simplex virus thymidine kinase gene λapprox . 500 bp smai - nari fragment ). β *- globin = human β - globin gene with in the 5 ′ untranslated region three point mutations that generate two restriction enzyme sites ( see fig1 b ). δmo + pyf101 a moloney murine leukemia virus long terminal repeat fragment in which the moloney enhancer is replaced by an enhancer from a mutant polyoma virus that was selected to grow on embryonal carcinoma cells [ 2 , 51 , 52 , 53 ]. fig1 b nucleotide sequence of the 5 ′ untranslated region ( utr ) of the normal ( β ) and the marked ( β *) human β - globin gene . fig2 detection of recombinant aav in rhesus monkey peripheral blood cells . blood cells were collected as described in the text . peripheral blood mononuclear cells ( wbc ) were separated from the granulocytes ( gran ) and a neospecific nested pcr was performed on the dna of both cell types . dna from the nested pcr was analyzed on agarose gels and compared to positive and negative control samples . the sensitivity of the nested pcr was such that approximately one raav - vector could be detected in a background of 10 5 negative cells . (+) indicates the presence of a neo - specific band and (−) the absence of a neo - specific band in the agarose gel . fig3 a - 3b graphic representation of direct and nested neo - specitic pcr data from monkeys bb94 and a94 ( fig3 a ) and monkeys 9128 en 9170 ( fig3 b ). the data on the latter two monkeys shown in fig2 are included in fig3 as well . for clarity , negative pcr - results were not included in the graphs . closed circles ( pbmc ) and closed squares ( granulocytes ) indicate the time - points after transplantation at which the vector was detected . arrows in fig3 b indicate the time - points at which docetaxel ( taxotere ) was administered . fig4 detection of neo - specific sequences in hemopoietic cells from rh bb94 at 16 months post transplantation . bm ( bone marrow ) , pbmc ( peripheral blood mononuclear cells ), gran ( granulocytes ). fig5 detection of vector specific globin sequences in rhesus monkey peripheral blood cells ( samples from 2 months ( a94 ) and 6 months ( bb94 ) post - transplantation ) with this pcr , the two vectors ig - cft and ig - cft * are discriminated since the size of the ig - cft * fragment is approximately 150 pb . longer than the fragment specific for ig - cft . ligation of recombinant aav vectors containing the human β - globin gene and / or the neo r gene in order to determine whether recombinant aav could transduce p - phsc , it was necessary to generate appropriate vectors . we generated three different recombinant aav - vectors , which are schematically represented in fig1 a . the ligation of the vector ig - cft containing a human β - globin gene together with sequences from the β - globin locus control region and the neo r - gene is described in [ 21 ], ig - cft * differs from ig - cft in the size of the human β - globin promoter and in the presence of three point mutations in the 5 ′ untranslated region ( utr ) of the human β - globin gene , in ig - cft *, the promoter driving β - globin expression extends 265 bp upstream of the transcription start site instead of the 103 bp in ig - cft . in ig - cft *, three point mutations in the 5 ′ utr of the human β - globin gene created two new restriction sites , one for xbai and one for hindiii , see also fig1 b . ig - δmoneo ( depicted in fig1 a ) contains the raav - backbone ( xbai - fragment ) from psub201 [ 51 ], the nhei - smai promoter - fragment from the δmo + pyf101 ltr [ 53 ], the bglii - smai fragment from the tn5 - derived neo r - gene followed by the smai - nari poly - adenylation signal from herpes simplex virus ( hsv ) thymidine kinase ( tk ) gene [ 54 ]. the elements were linked together using the polylinker from pbluescript sk + ( stratagene ). the 293 cell line [ 55 ], which is a human embryonic kidney cell line transformed with ads dna , the a549 cell line , which is a human bronchial carcinoma cell line , and the c88 cell line [ 56 ], which is a murine erythroleukemia ( mel ) cell line , were maintained in dmem ( gibco - brl ) containing 10 % fetal calf serum ( fcs ), 100 μg / ml streptomycin and 100 u / ml penicillin . recombinant aav was produced by transfecting a raav packaging plasmid and a vector plasmid into approx . 90 % confluent permissive 293 cells . the cells were made permissive for aav - replication by transfecting them with a plasmid capable of expressing all the relevant early genes from adenovirus but not the late genes or by infecting them with adenovirus ts149 with a multiplicity of infection of 20 . the packaging plasmid was either paav / ad [ 15 ] or pim45 , which contains sequences 146 to 4493 from wtaav2 in the polylinker of pbluescript , the ratio of vector plasmid dna to packaging plasmid dna was 1 : 10 to accommodate the fact that the recombinant aav vector upon expression from the packaging plasmid replicates , whereas the packaging plasmid does not replicate . for crude virus stocks , the cells were harvested in their own culture medium after two to three days and subjected to three freeze / thaw cycles . the latter was performed by intermittent freezing and thawing in liquid nitrogen and a 37 ° c . water bath . cell debri was subsequently pelleted . ( 10 min , 200 g ) and the supernatant was incubated at 56 ° c . for 1 hour to inactivate residual adenovirus . concentrated high titer recombinant aav stocks were prepared by harvesting the cells in there own culture medium , and washing in pbs ( max . 10 7 cells / ml ). the virus was released from the cells by 3 freeze / thaw cycles and / or 30 sonication pulses of 1 second on ice to prevent warming . cell debri was spun down and the supernatant was made a density of 1 . 4 by adding solid cscl . after o / n centrifugation ( 50 . 000 r . p . m ., 20 ° c ., using a vti ti65 . 1 rotor in a beckman ultracentrifuge ), fractions were collected and raav was determined . fractions containing raav were pooled and further concentrated in a centricon concentrator ( amicon ) according to manufacturer &# 39 ; s specifications . after concentration , the medium containing the virus was changed by two successive washes in the centricon concentrator , using optimem culture medium ( gibco - brl ). to determine the effect of the different methods of virus preparation and the different processing steps on the quality of the various raav - batches , we characterized them for 5 parameters : 1 ) the capacity to deliver the desired dna to the nucleus of the target cell by means of a replication center assay ( rca ) described below , 2 ) the capacity to stably transduce cells and express the neo r - gene by means of a limiting dilution on mel cells followed by g418 selection , 3 ) the wild - type aav titer in the batches by a rca without added wtaav , 4 ) the amount of replication proficient adenovirus in each preparation , and 5 ) the concentration of cscl in the raav preparations that were purified using cscl radients ( see table 2 ). the replication center assay ( rca ) takes advantage of the fact that in a lytic infection of aav up to 10 6 aav , genomes are produced inside a cell . this amount of dna is sufficient for the radioactive detection of infected cells . to accomplish this , 293 cells were seeded in a flat bottom 96 wells plate such that they reached near confluence the following day . for a titration of recombinant aav , the cells were infected with dilutions of recombinant virus stock , adenovirus ts149 ( m . o . i . 20 ) and wtaav - 2 ( m . o . i . 2 ). for a titration of the wild type aav , the cells were infected with dilutions of recombinant virus stock and adenovirus ts149 ( m . o . i . 20 ). the cells were subsequently incubated at 39 ° c . the next day , after 24 hours , the medium was replaced by ice - cold pbs containing 5 mm edta . after 5 to 20 min . on ice , a single cell suspension was made by rigorous pipetting . the cells were diluted in 5 ml pbs and sucked onto hybond n + filter circles ( pore size 0 . 22 μm ) of 3 . 6 cm diameter . filters were incubated for 5 min in denaturation solution ( 0 . 4 m naoh ; 0 . 6 m nacl ) and 5 min in renaturation buffer ( 1 , 5 m nacl ; 1 m tris - hcl , ph 7 ). filters were washed and stored in 5xsspe until hybridization . filters were hybridized with a recombinant aav specific probe for the determination of the recombinant aav titer and hybridized with a wild type aav specific probe for the determination of the wild - type aav titer . 1 . 5 × 10 5 mel cells were seeded in 2 ml culture medium per well ( 24 wells plate , falcon ) and the appropriate dilution of raav virus was added . the cells were collected the next day and reseeded in 30 ml culture medium in a 75 cm 2 flask ( falcon ) . after three days , the medium was replaced by selection medium by spinning down the cells ( 200 g , rt ) and resuspending the cells in fresh medium containing 1 mg / ml ( dry weight ) g418 ( gibco ). medium was replaced every three to four days . after fourteen days , the cultures were scored . when the cells had grown to confluency , the cultures were scored positive since the specific virus dilution contained raav capable of stably transducing mel cells . specific virus dilutions were scored negative when , after fourteen days , confluency had not been reached . adenovirus was determined by serial dilutions of the aav virus stock on a549 ( human bronchial carcinoma ) cells . dilutions were scored positive when cytopathic effect was visible after 6 days . wild - type adenovirus 5 stocks with a known titer were used as positive controls . cscl concentrations in the aav preparations were determined by flame photometry . a summary of the characterization is given in table 2 . the infectious particle ( ip ) concentration , i , e . the capacity - to deliver raav - dna to the nucleus of target cells determined in the pca varied considerably among the different batches . also the transducing particle ( tp ) concentration and the amount of wild - type aav contamination varied considerably . three batches had a ip to tp ratio of 10 4 , the 248 crude batch had a much lower ratio of 200 . the animals used for transplantation were 3 - 5 kg rhesus monkeys ( macaca mulatta ), bred at the biomedical primate research centre ( bprc ), rijswijk , the netherlands . three weeks before transplantation , the animals were transferred to a laminar flow unit and selectively decontaminated in the digestive tract by treatment with metronidazole ( 40 mg / kg / day ), during 5 days , followed by daily oral administration of ciprofloxacin ( 6 . 5 mg / kg / day ), polymixin b ( 10 mg / kg / day ) and nystatin ( 40 ku / monkey / day ). a94 and bb94 received one administration of ivermectine 200 μg / kg anti - worm treatment approximately two weeks prior to transplantation . the monkeys were kept under barrier nursing and antimicrobial treatment until leukocyte counts exceeded a value of 1 × 10 9 / liter . the day before transplantation , the monkeys received 5 gy total - body x - ray irradiation . for this purpose , the animals were placed in a cylindrical polycarbonate cage which rotated 6 rpm around its vertical axis during irradiation from two opposing beams ( physical parameters : 300 kv , 7 ma , 0 . 26 gy / min dose rate , 0 . 80 m average focus - to - skin distance ). bone - marrow grafts were infused into a peripheral vein in a volume of 7 . 5 ml 0 . 9 % nacl . supportive care after transplantation included blood transfusions of 15 gray - irradiated thrombocytes when thrombocyte counts were below 40 × 10 9 / liter , subcutaneous fluid upon indicationl , and red blood cell transfusions when hematocrit levels dropped below 0 . 2 l / l . monkey 9128 was administered daily baytrill s . c . for 2 weeks , 9 months after transplantation , as treatment of a salmionella infection . monkeys bb94 and a94 were treated for streptococci septis and received cefamandolnafaat 50 mg / kg / day and tobramycine 3 mg / kg / day . a94 was additionally treated for streptococci sepsis with amoxiline 9 mg / kg / day , clavulanic acid 2 . 5 mg / kg / day and ceftriaxone 50 mg / kg / day and with amphotericin b 8 mg / kg / day for a yeast infection . selective decontamination was stopped a few days after hemopoietic repopulation of the monkeys . sepsis treatment was stopped 4 days after the body temperature had returned to normal and serum cultures were found to be sterile . docetaxel ( taxotere ®) treatment was given to monkeys rh9128 and rh9170 at indicated times ( fig3 ) at a dose of 50 mg / m 2 . in monkey rh9128 , around 14 months post transplantation 4 docetaxel doses were given of 10 mg / m 2 . the appropriate amount of docetaxel was diluted in 50 ml pbs - glucose ( nppi , the netherlands ) and was administered by iv injection at a rate of 1 ml / min . 40 ml of bone marrow aspirate was obtained by puncturing both femoral shafts under total anesthesia . bone marrow cells were collected in hanks &# 39 ; basic salt solution containing heparin at 100 units per ml and deoxyribonuclease - i and subjected to ficoll - hypaque ( sigma ) cenitrifugation . cd34 + selection was performed using a smallscale ceprate lc column ( cellpro , bothell , wash .). from 5 × 10 4 to 50 × 10 4 cells were incubated at 4 ° c . for 30 min in 0 . 1 ml pbs and 1 % bovine serum albumin ( bsa ) with 5 ml of a phycoerythrin - conjugated anti - cd34 antibody ( 563 . f ) or unconjugated anti - cd34 antibody ( 566 ). cells incubated with the antibody 566 were washed ( pbs , 0 . 1 * bsa ) and further incubated with percp conjugated rabbit anti - mouse igg1 ( becton - dickinson , cat no . 340272 ). after washing , cells were acquired on a facsort ( becton - dickinson ) flow cytometer . cells were analyzed with the lysis ii software program . the percentage of cd34 + cells was calculated as the ratio of cd34 + cells to total number of cells and multiplied by 100 . for rhesus monkeys 9128 and 9170 , the enriched cd34 + cells were immediately processed for transduction . for rhesus monkeys a94 and bb94 the enriched cd34 + cells were split into two equal fractions and stored in liquid nitrogen . transduction of cd34 + cells was done as described below . a summary of the experimental conditions is given in table 3 . rhesus monkey 9129 and 9170 : four days prior to transplantation the cds34 + enriched cells were split in two equal fractions and cultured at a density of 10 6 cells per ml in low density bmc culture medium supplemented with recombinant rhesus monkey interleukin - 3 ( rhil - 3 ; burger et al ., 1990 ) as described in [ 57 ], on day 2 and day 3 , one fraction of cultured cd34 + cells was exposed to the crude raav preparation of ig - cft and the other fraction was exposed to a crude raav - preparation of ig - δmoneo by adding an equal volume of virus preparation to the medium of the cultured cd34 + cells . after three to five hours , the cells were collected by centrifugation ( 7 min , 200 g ) and resuspended into fresh rhil - 3 supplemented low density bmc culture medium in the same volume as the culture was started in . on day four , the cells were collected by centrifugation ( 7 min , 200 g ) and resuspended in an equal volume of 0 . 9 % nacl and separately transplanted into autologous rhesus monkeys by iv injection . rhesus monkey a94 and bb94 : four days prior to transplantation , one fraction of the frozen cd34 + enriched cells was thawed and subsequently washed with hanks balanced salt solution . live cells were collected by ficoll - hypaque ( sigma ) centrifugation and cultured at a density of 10 6 cells per ml in iscove &# 39 ; s modified eagles medium ( imdm , gibco - brl ) supplemented with fetal calf &# 39 ; s serum ( fcs , 10 %) and recombinant rhesus monkey interleukin - 3 ( rhil - 3 ; burger et al ., 1990 ). on day 2 and day 3 , cells were collected by centrifugation ( 7 min , 200 g ) and resuspended in 10 to 200 μl of imdm + 10 % fcs and rhil - 3 and subsequently exposed to a purified raav preparation of ig - cft ( monkey a94 ) or ig - cft * ( monkey b994 ). after two hours , the cells were washed with imdm + 10 % fcs and reseeded in imdm + 10 % fcs and rh - il - 3 . at day four , the cells were collected by centrifugation and suspended in 0 . 9 % nacl . also , on day four , the other fraction of cd34 + cells was thawed and washed with hanks balanced salt solution . live cells were collected by ficoll - hypaque ( sigma ) centrifugation , resuspended in 10 to 200 μl of imdm + 10 % fcs and rhil - 3 and subsequently exposed to a purified raav - preparation of ig - cft ( monkey bb94 ) or ig - cft * ( monkey a94 ). after two hours , the cells were collected by centrifugation and suspended in 0 . 9 % nacl . after collection in nacl ( 0 . 9 %), the cells were separately transplanted into autologous irradiated rhesus monkeys by iv injection . daily observation of clinical signs . weekly complete physical examination and determination of body weight . blood chemistry analysis was performed before and after x - ray irradiation . hematology was performed weekly . bone marrow samples were punctured from the femoral shafts under total anesthesia . heparine blood samples were taken weekly for pcr analysis . pbmc and granulocytes were isolated from peripheral blood samples , as described previously by ficoll hypaque centrifugation ( van seusechem et al ., 1992 ). circulating t - and b - cells were purified from pbmc by sorting cd2 and cd20 positive cells , respectively . fitc labeled cd2 ( clone s 5 . 2 ; becton - dickinson , california ) or cd20 ( clone l27 ; becton - dickinson , california ) antibodies were incubated with pbmc according to the manufacturers protocols . labeled cells were separated using the macs ® column and anti - fitc beads ( miltenyi , germany ) according to the manufacturers protocol . re - analyses of the sorted cells on facs ® ( becton - dickinson , usa ) showed that the sorted cells were more then 95 % pure populations . rh912b and rh9170 hemopoietic cells were plated in duplicate at 5 × 10 3 / ml ( cd34 + selected ) or 1 × 10 5 / ml ( post - ficoll ) in 1 ml methylcellulose medium , as described in [ 57 ], supplemented with 30 ng / ml rhil - 3 and 25 ng / ml gm - csf . rh a94 and bb94 hemopoietic cells were seeded for colony formation in methylcellulose medium containing 50 ng / ml scf , 10 ng / ml gm - csf , 10 ng / ml il - 3 and 3 u / ml epo ( methocult gf h4434 , stemcell technologies inc , vancouver , canada ). for cell lysis , pellets were incubated ( 10 7 cells / ml ) in nonionic detergent lysis buffer ( 0 . 5 % np40 , 0 . 5 % tween 20 , 10 mm tris ph 8 . 3 , 50 mm kcl , 0 . 01 % gelatin , 2 . 5 mm mgcl 2 ) containing proteinase k ( 60 mg / ml ) at 56 ° c . for 1 hour , lysates were then heated at 95 ° c . for 10 min to inactivate the proteinase k . two different pcr detections were performed . one was a nested neo r - specific pcr and one was a β - globin specific pcr . the protocol for the neo r - specific pcr will be described first . the first amplification was performed on 10 μl lysates in a total volume of 50 μl with 2 u of supertaq polymerase ( ht biotechnology , cambridge , england ) in a reaction mix ( final concentration : 200 mm each of 2 ′- deoxyadenosine - 5 ′- triphosphate , 2 ′- deoxycytidine - 5 ′- triphosphate , 2 ′- deoxyguanosine - 5 ′- triphosphate , 2 ′- deoxythymidine - 5 ′- triphosphate ( pharmacia , roosendaal , the netherlands ), 0 . 2 μm each of 5 ′ neo - 1 and the antisense primer 3 ′ neo - 2 and the reaction buffer supplied by the manufacturer ( ht biotechnology , cambridge , england ). the nested amplification was performed on 5 μl of the first reaction in a total volume of 50 μl with 2 u of supertaq polymerase ( ht biotechnology , cambridge , england ) in a reaction mix ( final concentration ; 200 mm each of 2 ′- deoxyadenosine - 5 ′- triphosphate , 2 ′- deoxycytidine - 5 ′- triphosphate , 2 ′- deoxyguanosine - 5 ′- triphosphate , 2 ′- deoxythymidine - 5 ′- triphosphate ( pharmacia , roosendaal , the netherlands ), 0 . 2 μm each of 5 ′ neo - 2 and the antisense primer 3 ′ neo - 1 and the reaction buffer supplied by the manufacturer ( ht biotechnology , cambridge , england ). primers were chosen to selectively amplify the neo r gene . amplification conditions were the same for the first and the nested amplification and were performed in a trio thermocycler ( biometra , göttingen , germany ) temperature cycling apparatus , the conditions chosen were : 95 ° c . for 5 minutes , then 30 cycles of 94 ° c . for 30 seconds , 55 ° c . for 30 seconds , 72 ° c . for 1 minute , followed by extension at 72 ° c . for 10 minutes . five to ten microliters of the nested reaction were separated on 2 % agarose gel ( pronarose , hispanagar , burgos , spain ). each assay included titrations of a murine erythroid leukemia cell line c88 - c1 , containing a single provirus integration of ig - cft [ 21 ] and / or a titration of a pool of g418 selected mel cells infected with ig - cft *. for practical reasons , we developed an alternative pcr method to detect the neo - cassette in the raav - vectors ig - cft , ig - cft * and ig - δmo + neo . the sequences of the primers were as follows ; neo - 1s : 5 ′- tagcgttggctacccgtgat - 3 ′ ( seq id no5 ), and neo - 4as : 5 ′- tgccgtcatagcgcgggtt - 3 ′ ( seq id no . 6 ). reaction mixtures were prepared as described above and the reaction temperature was 95 ° c . for 3 minutes followed by 30 cycles of 95 ° c . for 30 seconds , 65 ° c . for 30 seconds and 72 ° c . for 1 minute . the completion of the 30 cycles was followed by an extension of 5 minutes at 72 ° c . five to ten microliter of the pcr - reaction was run on a 2 % agarose gel , blotted and hybridized to a 157 bp . specific probe isolated from a bstbi - smai digest of ig - cft . the β - globin specific pcr was carried out in essentially the same way as the first reaction of the neo r - specific pcr . but instead of the neo r - primers , the primers listed below , specific . for the 3 ′ part of the hs - 2 fragment and β - globin intron i , were added . the sequences of the primers are : the temperatures for the cycling were : 95 ° c . for 3 minutes and then 30 cycles of 95 ° c . for 30 seconds , 55 ° c . for 30 seconds , 72 ° c . for 30 seconds . following the 30 cycles , an extension at 72 ° c . for 5 minutes was performed . samples were run on 2 % agarose gels , which were blotted and hybridized to a ncoi - clai β - globin promoter specific probe using standard techniques . the survival and the selection of the purification and transduction procedure of cd34 + rhesus monkey bone marrow cells was controlled by determining the number of cfu - c present at different stages in the procedure . the cd34 selection for rh9128 and rh9170resulted in a 13 - 19 fold enrichment of cfu - c resp . for a94 and bb94 , the enrichment for cfu - c was 37 - 92 fold resp . ( table 4 ). the number of cfu - c did not vary by more then a factor of 2 during culture or upon transduction , with the exception of monkey bb94 where the decrease in the number of cfu - c was considerable upon culture and infection with ig - cft . this was due to a direct toxicity of the cscl purified ig - cft batch , as determined by a titration of the batch on human cord blood post ficoll bone marrow which resulted in a dilution factor dependent toxicity on cfu - c ( not shown ). since it is known that cscl is a very toxic substance , we determined the cscl concentration in the two cscl purified raav preparations . both contained considerable amounts of cscl , enough to account for the observed toxicity ( table 2 ). due to the observed toxicity on cfu - c in this experiment the two grafts that rh - bb94 received were very different in size . whereas the cultured graft wasostill considerable , the graft - size for the short transduction protocol was very small ( table 4 ). however , since stem cells are not measured in a cfu - c assay and are indeed more resistant to a large variety of drugs and agents , it is possible that many of them survived the high concentration of cscl . to determine whether the engrafted cells had been transduced by the recombinant aav vectors , approx . 3 ml of blood was collected each week from every monkey . granulocytes and mononuclear cells were purified , as described in ( 57 ), and the dna was released and analyzed by pcr for the presence of raav - sequences . two different pcr reactions - were performed . on the samples from all four monkeys , pcr reactions specific for the neo r - gene were performed . the neo r - gene is present in all the vectors , so this pcr detects all recombinant aav - genomes present in the cells . on the samples from monkeys rh - a94 and rh - bb94 , also a β - globin specific pcr was performed . this pcr utilizes the size difference in the β - globin promoter in vectors ig - cft and ig - cft *. these vectors were used to transduce the p - phsc via two different protocols , the effect of the two different protocols can thus be read out by the prevalence of one of the two vectors in the peripheral blood cells of the monkeys . the results of the neo - pcr are depicted in fig2 and 3 . all monkeys were negative for raav before transplantation and became positive for raav after transplantation . the presence of the vector varied from week to week . some samples were positive for the vector , others were negative , indicating that the frequency of transduced cells averaged around the detection limit of the pcr - reaction which was determined to be at 1 copy in 10 5 nucleated cells for the neo - specific pcr . monkey bb94 was positive in all samples immediately after transplantation and regeneration of the hemopoietic system , indicating a more efficient transduction of early progenitors during the ex vivo handling of the cells . in monkeys bb94 and 9128 , vector containing cells could be detected for at least more then one year after transplantation . bone marrow samples taken from these animals at 2 and 6 months ( 9128 ) or 14 months ( bb94 ) post transplantation also contained vector transduced cells . in bb94 , the vector was detected in pbmc , granulocytes , bone marrow and purified populations of b - and t - cells ( fig4 ). this result demonstrated the transduction of stem cells which had repopulated both the myeloid lineage ( granulocytes ) and the lymphoid lineage ( t - and b - cells ). the granulocytes , t cells , and b cells were still pcr positive more than 15 months post - transplantation , indicating the transduction of cells with extensive self - renewal capacity , the transduction of primate cells with ( 1 ) an extremely long - term in vivo stability after transplantation , and ( 2 ) the capability of multiple - lineage repopulation long after transplantation , provides strong evidence for transduction of p - phsc . rhesus monkey 9128 received treatments with taxotere , a cytostatic drug , to ablate the mature cells in the circulation , inducing periodic regrowth from immature hemopoietic cells residing in the bone marrow . recombinant aav transduced cells were detected in circulating cells fter a series of treatments with taxotere , over a period of 14 months post transplantation . the persistence of transduced cells in peripheral blood cells and the resistance to taxotere treatment provides convincing evidence of the transduction of p - phsc . the experiment with monkeys bb94 and a94 was designed to quantify the success of two different transduction protocols . for each monkey , the transplant was split in two equal fractions and each fraction was transduced in a different way . to be able to discriminate which protocol resulted in a better transduction , we used a different vector for each transduction . we compared the efficiency of transduction of cultured p - phsc versus that of non - cultured p - phsc . for the transduction of p - phsc from monkey bb94 , we used the purified virus ig - gft for the non - cultured p - phsc and the purified virus ig - cft * for the cultured p - phsc . to exclude a possible role of quality differences between the virus batches , we switched the two virus batches for the transduction protocols for monkey a94 ; we used ig - gft for its cultured p - phsc and ig - gft * for its non - cultured p - phsc . following transplantation and repopulation of the . hemopoietic system of the monkeys , we performed the β - globin specific pcr to determine which transduction procedure resulted in the highest frequency of gene modified circulating cells . for both monkeys , we were able to detect only the virus used to transduce the cultured p - phsc , i . e ., ig - gft * for monkey bb94 and ig - gft for monkey a94 ( fig5 ). thus , in vitro stimulation of p - phsc results in a more efficient transduction with recombinant aav vectors . this result was not expected . it is generally accepted that culture of p - phsc promotes progressive loss of the grafting potential of the p - phsc , presumably due to differentiation . hence , if both procedures resulted in similar p - phsc transduction efficiencies , we would expect the progeny of the non - cultured p - phsc co prevail among the circulating blood cells due to grafting advantages . since we observed the opposite , the stable transduction efficiency of the cultured p - phsc must be significantly higher than that of the noncultured p - phsc . it is known that aav - vectors integrate with higher efficiency in cycling cells then in non - cycling cells ( 38 ) however , in non - cycling cells the vector remains in the nucleus and retains its ability to integrate when the cell is triggered into cycle ( 60 ). once transplanted , the p - phsc start to divide and repopulate the ablated hemopoietic system . considering the enormous amount of cells that need to be produced in a short time , it is presumed that the p - phsc start to divide within a couple of days once inside the body . therefore , a difference in transducibility of cultured versus non - cultured cells is not expected when only replication of the target cells is the enhancing factor . we infer that culture and exposure to hemopoietic growth factors such as il - 3 could in other ways potentiate the transduction with recombinant aav . one possible explanation is the up - regulation or activation of receptors for the virus on the surface of the p - phsc . another is the induction of proteins inside the p - phsc that enhance for instance nuclear transport and / or other rate limiting steps for stable transduction . 1 . einerhand m p w , valerio d : gene transfer into hematopoietic stem cells : prospects for human gene therapy , in muller - sieberg c , visser j w m , torock - storb b , storb r ( eds ): stem cells in hematopoiesis : animal models and human transplantation . curr . top . in microbiol . and immunol ., berlin - heidelberg , springer - verlag gmbh & amp ; co kg , 1992 , p . 217 - 235 2 . einerhand m p w , bakx t a , kukler a , valerio d : factors affecting the transduction of pluripotent hemopoietic stem cells : long term expression of a human adenosine deaminase gene in mice . blood 81 : 254 - 263 , 1993 3 . van beusachem v , valerio d : gene transfer into hematopoietic stem cells of non human primates . hum . gene ther . 7 : in press , 1996 4 . dunbar c , cottler - fox m , o &# 39 ; shaughnessy j , doren s , carter c , berenson r , brown s , moen r , greenblatt j , stewart f , leitman s , wilson w , cowan k , young n , nienhuis a : retrovirally marked cd34 - enriched peripheral blood and bone marrow cells contribute to long - term engraftment after autologous transplantation . blood 85 : 3048 - 3057 , 1995 5 . deisseroth a , zu z , claxton d , hanania e , fu s , ellerson d : genetic marking shows that ph + cells present in autologous transplants of chronic myelogenous leukemia ( cml ) contribute to relapse after autologous bone marrow in cml . blood 83 : 3068 - 3076 , 1994 6 . brenner m k , rill d r , holladay m s , heslop h e , moen r c , buschle m , krance r a , santana v m , anderson w f , ihle j n : gene marking to determine whether autologous marrow infusion restores long - term haemopoiesis in cancer patients . lancet 342 : 1134 - 1137 , 1993 7 . cornetta k , srour e , moore a , davidson a , broun e , hromas a , r c m , morgan r , rubin l , anderson w . hoffman r , tricot g : retroviral gene transfer in autologous bone marrow transplantation for adult acute leukemia . hum . gene ther . 7 ; 1323 - 1329 , 1996 8 . fritsch e , temin h : inhibition of viral dna synthesis in stationary chicken embryo fibroblasts infected with avian retroviruses . j . virol . 24 : 461 - 469 , 1977 9 . harel j , rassart e , jolicoeur p ; cell cycle dependence 5 of synthesis of unintegrated dna in mouse cells newly infected with murine leukemia virus . virology 110 : 202 - 207 , 1981 10 . miller d g , adam m a , miller a d : gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection . mol cell biol 10 : 4239 - 4242 , 1990 11 . springett g , moen r , anderson s , blaese r , anderson w : infection efficiency of t lymphocytes with amphotropic retroviral vectors is cell cycle dependent . j . virol . 63 : 3865 - 3869 , 1989 12 . berns k i , rose j a : evidence for a single - stranded adeno - associated virus genome ; isolation and separation of complementary single strands . j . virol . 5 ; 693 - 699 , 1970 13 . berns k i , adler s : separation of two types of adeno - associated virus particles containing complementary polynucleotide chains . virology 9 : 394 - 396 , 1972 14 . lusby e , fife k h , berns k i : nucleotide sequence of the inverted terminal repetition in adeno - associated virus dna . j . virol . 34 : 402 - 409 , 1980 15 . samulski r j , chang l , shenk t : helper - free stocks of recombinant adeno - associated viruses : normal integration does not require viral gene expression . j . virol . 63 : 3822 - 3828 , 1969 16 . tratschin j d , miller i l , smith m g , carter b j : adeno - associated virus vector for high - frequency integration , expression , and rescue of genes in mammalian cells . mol . cell . biol . 5 ; 3251 - 3260 , 1985 17 . hermonat p l , muzyczka n . use of adeno - associated virus as a mammalian dna cloning vector : transduction of neomycin resistance into mammalian tissue culture cells , proc . natl . acad . sci , usa 81 ; 6466 - 6470 , 1984 18 . mclaughlin s k , collis p . hermonat p l , muzyczka n : adeno - associated virus general transduction vectors : analysis of proviral structures . j . virol . 62 : 1963 - 1973 , 1988 19 . lebkowski j s , mcnally m m , okarma t b , lerch l b : adeno - associated virus ; a vector system for efficient introduction and integration of dna into a variety of mammalian cell types . mol . cell . biol . 8 : 3988 - 3996 , 1988 20 . walsh c e , liu j m , xiao x , young n s , nienhuis a w , samulski r j : regulated high level expression of a human γ - globin gene introduced into erythroid cells by an adeno - associated virus vector . proc . natl . acad . sci . usa 89 : 7257 - 7261 , 1992 21 . einerhand m , antoniou m , zolotukhin s , muzyczka n , berns k , grosveld f , valerio d : regulated high - level β - globin gene expression in erythroid cells following recombinant adeno - associated virus - mediated gene transfer . gene ther . 2 : 336 - 343 , 1995 22 . collis p , antoniou m , grosveld f : definition of the minimal requirements within the human β - globin gene and the dominant control region for high level expression . embo j . 9 : 233 - 240 , 1990 23 . mclvor r s , johnson m j , miller a d , pitts s , williams s r , valerio d , martin jr . d w , verma i m : human purine nucleoside phosphorylase and adenosine deaminase : gene transfer into cultured cells and murine hematopoietic stem cells by using recombinant amphotropic retroviruses . mol . cell . biol . 7 : 839 - 846 , 1987 24 . berns k i : parvovirus replication . microbiol . rev . 54 : 316 - 329 , 1990 25 . kotin r m , siniscalco m , samulski r j , zhu x , hunter l , laughlin s , muzyczka n , rocchi m , berns k i : site - specific integration by adeno - associated virus . proc . natl . acad . sci . usa 87 : 2211 - 2215 , 1990 26 . samulski r j , zhu x , xiao x , brook j d , housman d e , epstein n . hunter l a : targeted integration of adeno - associated virus ( aav ) into human chromosotne 19 . embo j . 10 : 3941 - 3950 , 1991 27 . chiorini j a , weitzman m d , owens r a , urcelay e , safer b , kotin r m : biologically active rep proteins of adeno - associated virus type 2 produced as fusion proteins in escherichia coli . j . virol . 68 : 797 - 804 , 1994 28 . berns k i : parvoviridae and their replication , in chanock r m , hirsch m s , melnick j l , monath t p , roizman b ( eds ): virology , new york , raven press , 1990 , p . 1743 - 1763 29 . flotte t r , solow r , owens r a , afione s , zeitlin p l , carter e j : gene expression from adeno - associated virus vectors in airway epithelial cells . am . j . respir . cell mol . biol . 7 : 349 - 356 , 1992 30 . flotte t r , afione s a , conrad c , mcgrath s a , solow r , oka h , zeitlin p l , gugginoa w b , carter b j : stable in vivo expression of the cystic fibrosis transmembrane conductance regulator with an adeno - associated virus vector . proc . natl . acad . sci . usa 90 : 10613 - 1 - 617 , 1993 31 . egan m , flotte t , afione s . solow r , zeitlin p l , carter b j , guggino w b : defective regulation of outwardly rectifying cl - channels by protein kinase a corrected by insertion of cftr . nature 358 : 581 - 584 , 1992 32 . lapace d , hermonat p , wakeland e , peck a : gene transfer into hemopoietic progenitor cells mediated by an adeno - associated virus vector . virol . 162 : 483 - 486 , 1988 33 . zhou s z , broxmeyer h e , cooper s , harrington m a , srivastava a : adeno - associated virus 2 - mediated gene transfer into murine hematopoietic progenitor cells . exp hematol . 21 : 928 - 933 , 1993 34 . zhou s z , cooper s . kang l y , ruggierri l , heimfeld s , srivastava a , broxineyer h e : adeno - associated virus 2 - mediated high efficiency gene transfer into immiature and mature subsets of hematopoietic progenitor cells in human ukmbilical cord blood . j . exp . med . 179 : 1867 - 1875 , 1994 35 goodman s , xiao x , donahue r e , moulton a , miller j , walsh c , young n s , samulski r j , nienhuis a w : recombinant adeno - associated virus - mediated gene transfer into hematopoietic progenitor cells . blood b4 : 1492 - 1500 , 1994 36 . chatteryee s , johnson p r , wong k k : dual - target inhibition of hiv - 1 in vitro by means of an adeno - associated virus antisense vector . science 258 : 1485 - 1488 , 1992 37 . luhovy m , mccune s , dong j y , prchal j f , townes t m , prchal j t : stable transduction of recombinant adeno - associated virus into hematopoietic stem cells from normal and sickle cell patients . biol . of blood and marrow transpl . 2 ; 24 - 30 , 1996 38 . russell d w , miller a d , alexander i e ; adeno - associated virus vectors preferentially transduce cells in s phase . proc . natl . acad . sci . usa 91 ; 8915 - 8919 , 1994 39 . wintrobe m m , lee g r , boggs d r , bithell t c , foerster j , athens j w , lukens j n : glinical hematology : 869 - 903 , 1981 40 . rodgers g p , dover g j , noguchi c t , schlechter a n : hematologic responses of patients with sickle cell disease to treatment with hydroxyurea . n . engl . j . med . 322 ; 1037 - 1045 , 1990 41 . anderson w f : prospects for human gene therapy . science 226 : 401 - 409 , 1984 42 . evans t , felsenfeld g , reitman m : control of globin gene transcription . ann . rev . cell biol . 6 : 95 - 124 , 1990 43 . grosveld f . blom van assendelft g , greaves d r , kollias g : position - independent , high - level expression of the human β - globin gene in transgenic mice . cell 51 : 975 - 985 , 1987 44 , talbot d , collis p , antoniou m , vidal m , grosveld f , greaves d r : a dominant control region from the human β - globin locus conferring integration site independent gene expression . nature 338 : 352 - 355 , 1989 45 . miller j l , walsh c e , ney p a , samulski r j , nienhuis a w : single - copy transduction and expression of human γ - globin in k562 erythroleukemia cells using recombinant adeno - associated virus vectors : the effect of mutations in nf - e2 and gata - 1 binding motifs within the hypersensitivity site 2 enhancer , blood 82 : 1900 - 1906 , 1993 46 . einerhand m p w , valerio d : viral vector systetns tor bone marrow gene therapy , in levitt , mertelsmann ( eds ): hematopoietic stem cells ; biology and therapeutic applications , new york , marcel dekker , inc , 1995 , p 275 - 295 47 . halbert c l , alexander i e , wolgamot g m , miller a d : adeno - associated virus vectors transduce primary cells much less efficient than immortalized cells . j . virol . 69 : 1473 - 1479 , 1995 48 . ferrari f k , samulski t , shenk t , samulski r j : second strand synthesis is a rate limiting step for efficient transduction by recombinant adeno - associated virus vectors . j . virol . 70 : 3227 - 3234 , 1996 49 . nienhuis a : gene therapy for hematopoietic stem cells in genetic disease and cancer . keystone symposia on molecular and cellular biology , taos , n . mex . peb . 4 - 10 , 1996 50 , lefebvre r b , riva s , berns k i : conformation takes precedence over sequence in adeno - associated virus dna replication , mol . cell biol . 4 : 1416 - 1419 , 1984 51 . van beusechem v w , kukler a , einerhand m p w , bakx t a , van der eb a j , van bekkum d w , valerio d : expression of human adenosine deaminase in mice transplanted with hemopoietic stem cells infected with amphotropic retroviruses . j . exp . med . 172 : 729 - 736 , 1990 52 . valerio d , einerhand m p w , wamsley p m , bakx t a , li c l , verma i m : retrovirus - mediated gene transfer into eibryonal carcinoma cells and hemopoietic stem cells : expression from a hybrid long terminal repeat . gene 84 : 419 - 427 , 1989 53 . linney e , davis b , overhauser j , chao e , fan h : non - function of a moloney murine leukemia virus regulatory sequence in f9 embryonal carcinoma cells . nature 308 ; 470 - 472 , 1984 54 . mcknight s : the nuceotide sequence and transcript map of the herpes simplex thymidine kinase gene . nucl . acids res . 8 : 5949 - 5964 , 1980 55 . graham f l , smiley j , russell w c , naiva r : characteristics of a human cell line transformed by dna from aderiovirus type 5 . j . gen . virol . 36 : 59 - 72 , 1977 56 . deisseroth a , hendrick d : human β - globin gene expression following chromosomal dependent gene transfer into mouse erythroleukemia cells . cell 15 : 55 - 63 , 1978 57 . van beusechem v w , kukler a , heidt p j , valerio d : long - term expression of human adenosine deaminase in rhesus monkeys transplanted with retrovirus - infected bone - marrow cells . proc . natl , acad . sci . usa 89 : 7640 - 7644 , 1992 58 . thomson b j , weindler f w , gray d , schwaab v , heilbronn : human herpesvirus 6 ( hhv - 6 ) is a helpervirus for adeno - associated virus type 2 ( aav - 2 ) and the aav - 2 rep gene homologue in hhv - 6 can mediate aav - 2 dna replication and regulate gene expression . virol . 204 : 304 - 411 , 1994 59 . fischer - adams g , wong jr k k , podsakoff g , forman s j , chatterjee s : integration of adeno - associated virus vectors in cd34 + human hemopoietic progenitor cells after transduction . blood 88 : 492 - 504 , 1996 60 . podsakoff g , wong jr k k , chatterjee s : efficient gene transfer into nondividing cells by adeno - associated virus - based vectors . j virol 68 : 5656 - 5666 , 1994 properties of adeno - associated virus and amphotropic retrovirus vectors . * calculated number per replication cycle . aav is replicated via cellular dna - polymerases which have proof reading activity . the error frequency of these polymerases is 10 − 6 implying 1 point mutation per 200 recombinant aav genomes . retroviruses are replicated via rna - polymerase ii and reverse transcriptase ( rt ). the known error frequency of rt is 10 − 4 . not # much is known about the mutation rate of rna - polymerase ii . based on the error frequency of rt one can expect one point mutation per retroviral genome of 10 kb . a [ srivastava , 1993 ]; b [ joyner , 1983 ]; c [ einerhand , 1992 # 109 ]; d [ chatteryee , 1992 ]; e [ nolta , 1992 ]; f [ brenner , 1993 ]; g [ walsh , 1992 ]; h [ miller , 1992 ]; i [ flotte , 1993 ];
0
referring to fig1 there is shown in perspective view a boat hull frame , partially planked , comprised of fiber - reinforced plastic . the frame is constructed of a longitudinal or keel member 10 and a plurality of transverse or rib members 12 . they are attached either by allowing the members to cure in contact to form a plastic or self bond or by preventing such contact during the curing process and later bonding the cured members with an adhesive such as epoxy . in the embodiment illustrated , the rib members overlap the keel member , but the positions may be reversed . in either case , precise positioning for bonding after curing is assured by the interlocking nature of the design and optionally , alignment indicators such as marks , small holes , or impressions which may be added during the molding process . other structural members may be added according to the stress demands which will be placed on the frame . the include additional stringers or longitudinal supports , seat supports , and in general all structural elements common to boat hull design . the frame , when assembled , can be planked with any suitable material , preferrably thin strips of wood 14 which bend easily to the configuration of the hull . the wood may be attached by adhesives , such as epoxy , eliminating the need for nails or screws which deteriorate through electrolysis . fig3 is a cross - sectional representation of an alternative shape for rib members . the fiber - reinforced plastic 16 is molded in a step configuration to produce a finished hull of lap - strake construction when planks 18 are layed over and affixed to the ribs in the manner described above . step molding provides the additional advantage of acting as a fix or locator for each plank simplifying the overall construction . referring next to fig2 mold apparatus used in the method of constructing the above described frame is illustrated . the hull to be reproduced may be a complete boat hull , for example a classic shape such as a cat boat or friendship sloop available as a complete boat in drydock , or a design which is built up for the purpose . the model or original hull , not shown , becomes the plug over which a support mold 20 is formed , typically of a fiberglass material . the interior 22 of the support mold thus exactly reproduces the shape of the exterior of the original hull to be reproduced . however , the interior of the support mold need not be finely finished as is the case when producing molds for conventional fiberglass shell boat hulls . channels 24 for the specific structural members are attached to the interior of the support mold by adhesives or counter - sunk nuts and bolts or other means as would be appropriate . the channels are placed wherever a longitudinal or transverse structural member is desired and are constructed of any suitable material , preferrably a flexible plastic which will conform and bend to the shape of the support mold , one which is not degraded by polyester or plastic resins , nor one to which these resins will bind . plastics appropriate for the purpose include polyethylene , polypropylene , and polyvinyl chloride . these ae commonly available in standard extuded profiles and can be used with little or no modification . the number , size and spacing of the channels may be varied at will to provide structural reinforcement wherever desired . once the support mold and frame member channel molds are combined into an assembly , strips of uncured fiber - reinforced plastic are layed in the channels and allowed to cure . where a self bond is desired , the uncured members are allowed to contact one another . where no bond is desired and it is intended that the members be attached after removal from the mold , a thin membrane of plastic abhorent material such as polyethylene or polyvinyl alcohol is inserted between the strips . such a practice allows the frame to be shipped in kit form to be assembled at the destination . as mentioned , the channels themselves are plastic abhorent or are covered with such a material . a number of plastics or more precisely resin - catalyst promoter systems may be used in combination with glass , nylon , carbon or polypropylene fibers to mold the frames . these include polyester and epoxy resins . for normal gel times of approximately an hour , cobalt promoted methyl ethyl ketone peroxide catalyzed resins may be used . where a short gel time is desired for quick - setting structural fillers , benzoyl peroxide catalyst may be used . for long gel times , an unpromoted resin catalyst system can be employed , requiring in addition the application of heat to produce curing . other combinations of material fitting into the fiber - reinfoced plastic category may be employed , as would be obvious to those skilled in the art . in constructing any particular hull frame configuration , care must be taken not to mold the frames such that the cured assembly locks up in the support mold . this is accomplished , when necessitated by the frame design , by making some or all of the frame members removable from the frame after molding ; that is , by preventing self of plastic bonds by inserting contact preventing membranes as described above . also a multipiece or sectional support mold duplicating separate portions of the hull can be used , assembling such sections to form a complete mold and disassembling them to free the frame . an additional technique which may be used to add structural members and prevent lock up is illustrated by the apparatus of fig4 , and 6 . shown in perspective view is a demountable support assembly which may be used to add additional structure to the frame , a seat or deck support for example . support mold 20 , employing like members from previous figures for clarity , serves to shape and contain mold channel 24 . removable support block 26 is held up against removable spacer blocks 28 by bolts 30 and wing nuts 32 . blocks 26 and 28 are comprised of or covered with a plastic abhorent material in the manner previously described . a strip of uncured fiber - reinforced plastic 34 may now be placed along block 26 in contact with an additional transverse strip in channel 24 to form the desired component . after curing , the blocks are removed to free the frame components from the mold . as before , depending upon the hull design , additional structural members may be cured together in contact or prevented from contact and later bonded by adhesives . as will be obvious , the concept of the invention encompasses an extensive range of frame configurations and fiber - reinforced plastic materials to produce a unitized frame of the type described above . accordingly , the scope of the invention is defined by the following claims .
1
referring initially to fig1 a , 1b , 2 and 6 of the drawings , in a preferred embodiment a typical moveable saw carriage of this invention is illustrated by reference numeral 20 and a fixed carriage by numeral 20a ; in a typical installation , multiple moveable saw carriages 20 , and a single fixed saw carriage 20 a as illustrated in fig1 a and 1b , are aligned adjacent to respective stem loaders 45 of selected design and typically having loading arms 46 to receive the stems 100 in sequence from stem loaders 45 and load them on the moveable saw carriages 20 and the fixed saw carriage 20a . a loading conveyor 85 typically transfers the stems 100 from a stem conveyor 82 , where the stems are initially scanned by a scanner 102 and diverted from the stem conveyor 82 to the loading conveyor 85 , mounted on a loading frame 47 , by means of a stem diverter 87 , typically as described in my u . s . pat . no . 5 , 579 , 671 and as illustrated in fig1 a and 1b . each of the movable saw carriages 20 is characterized by a carriage frame 21 , and with the exception of the single , end - located fixed saw carriage 20a , as described in my patent and as further illustrated in fig1 b , the movable saw carriages 20 are fitted with a pair of flanged wheels 23 that roll on corresponding rails 22 , mounted on a supporting surface 50 . the flanged wheels 23 are designed to engage and traverse the rails 22 in a linearly - controlled manner , as further illustrated in fig2 . a wheel shaft 24 connects the respective pairs of flanged wheels 23 to facilitate traversal of the carriage frame 21 of the movable saw carriages 20 in both directions , parallel to the stem loaders 45 , as further hereinafter described . a horizontal cutting platform 25 is located on each of the carriage frames 21 and receives a pair of shaped cutting rollers 26 , each mounted on a rotatable roller shaft 26a , and designed to receive each stem 100 from the stem loaders 45 , as further hereinafter described . each of the roller shafts 26a is provided with a roll drive 39 , operated by a solenoid valve 13 , electrically linked to the programmable logic controller 104 by suitable wiring ( not illustrated ) wired into the junction boxes 15 and connected to the programmable logic controller 104 by additional electric wiring 14 . the roll drives 39 automatically drive the respective cutting rollers 26 and shift each incoming stem 100 against a butt plate 49 , mounted on the butt plate positioning cylinder piston 49b of a butt plate positioning cylinder 49a , as illustrated in fig1 b . the butt plate positioning cylinder 49a is typically mounted on the carriage frame 21 of the fixed saw carriage 20a by means of a cylinder mount plate 16 . each of the cutting rollers 26 is fitted with multiple , radially - shaped roller plates 27 for seating each stem 100 in sequence on the cutting rollers 26 , as illustrated in fig1 . a sawdust chute 28 is mounted on the carriage frame 21 beneath the cutting platform 25 to receive and channel sawdust from the cut logs , poles and other segments and divert the sawdust to a sawdust conveyor or other apparatus ( not illustrated ). as illustrated in fig1 and 6 of the drawings , a pair of segment ejectors 93 is provided in each one of the movable saw carriages 20 and the fixed saw carriage 20a , and each segment ejector 93 includes an ejection cylinder 94 , attached to the carriage frame 21 of each of the movable saw carriages 20 and the fixed saw carriage 20a . each ejection cylinder 94 receives an ejection cylinder piston 95 , designed for extension and retraction inside the ejection cylinder 94 . a segment - engaging head 96 is secured to the extending end of each ejection cylinder piston 95 , for engaging each of the cut segments ( not illustrated ) from the stem 100 at the proper time determined by the programmable logic controller 104 , and ejecting the segments in concert from the cutting rollers 26 and cutting platform 25 of each of the carriage frames 21 , typically to a segment conveyor 75 of suitable design , illustrated in fig1 a , for removing the cut segments of the stems 100 from the cutting rollers 26 . referring again to fig1 and 6 of the drawings , a pair of stem clamps 66 is provided on the carriage frame 21 of each of the movable saw carriages 20 and the fixed saw carriage 20a above the respective cutting platforms 25 and are each characterized by a clamp arm 67 , pivotally secured to a vertical support member of the carriage frame 21 by means of a clamp arm pivot pin 69 . each clamp arm 67 is fitted with arm teeth 68 and is pivotally raised and lowered on the clamp arm pivot pin 69 by means of a clamp arm positioning cylinder 70 , pivotally connected by means of a cylinder pivot pin 54a to a cylinder mount plate 16 , fixed to the carriage frame 21 . a clamp arm positioning cylinder piston 71 is attached to a piston mount plate 19 , welded to the clamp arm 67 and is extendible and retractable in each clamp arm positioning cylinder 70 . accordingly , the respective clamp arm positioning cylinders 70 can be operated in concert by the programmable logic controller 104 as hereinafter described , to timely extend and retract the corresponding clamp arm positioning cylinder pistons 71 , initially raise the clamp arms 67 to the position illustrated in fig1 to receive a stem 100 and then pivot the clamp arms 67 in a downward direction at the proper time to clamp and stabilize the stem 100 in position on the cutting rollers 26 above the cutting platform 25 of each of the carriage frames 21 . referring again to fig1 , 3 , 4 and 6 of the drawings , in a most preferred embodiment of the invention an encoder assembly 40 is mounted on the carriage frame 21 above the flanged wheels 23 and rails 22 of each movable saw carriage 20 and is operably connected to the programmable logic controller 104 ( illustrated in fig2 and 6 ) by suitable electrical wiring ( not illustrated ) extending to the junction boxes 15 , illustrated in fig2 . each encoder assembly 40 includes a carriage location encoder 41 , which is fitted with an encoder sprocket 42 , connected to a driven spur gear shaft 31a by means of a driven spur gear shaft sprocket 31b and an encoder drive chain 43 , for measuring the travel of the saw carriages 20 on the rails 22 . a horizontal gear rack 29 , fitted with rack teeth 29a , is fixed to the supporting surface 50 between and parallel to the rails 22 and extends throughout the length of travel of the respective movable saw carriages 20 on the corresponding rails 22 . as further illustrated in fig3 and 4 , a module drive assembly 10 includes a drive spur gear 30 , mounted on a drive spur gear shaft 30a , extending from a gear reducer 11 , which mounts a hydraulic motor 8 , wherein the gear reducer 11 is mounted on the carriage frame 21 . a driven spur gear 31 is positioned on a driven spur gear shaft 31a , extending from a spur gear bearing 33 and the driven spur gear 31 is positioned in vertical alignment with the drive spur gear 30 , such that the respective spur gear teeth 32 of the drive spur gear 30 and driven spur gear 31 mesh . operation of the hydraulic motor 8 thus effects rotation of the drive spur gear 30 and driven spur gear 31 at a speed determined by the gear reducer 11 , for linearly adjusting each movable saw carriage 20 on the rails 22 . as described above and illustrated in fig3 and 4 , the driven spur gear shaft 31a is connected to the encoder shaft 44 of the carriage location encoder 41 . moreover , as illustrated in fig2 and as further heretofore described , the programmable logic controller 104 is connected to the junction boxes 15 by electric wiring 14 . accordingly , operation of the respective hydraulic motors 8 on the corresponding gear reducers 11 and the corresponding carriage location encoders 41 in the various movable saw carriages 20 responsive to the commands of the programmable logic controller 104 ( in semi - automatic or automatic mode ), causes each of the movable saw carriages 20 to linearly traverse the rails 22 in increments monitored by the carriage location encoders 41 and determined by the programmable logic controller 104 . the programmable logic controller 104 receives pulse signals from the respective carriage location encoders 41 to locate the corresponding movable saw carriages 20 in a precise position with respect to the fixed saw carriage 20a , for cutting each stem 100 into segments of optimum length , responsive to information determined from the scanner 102 and evaluated by the computer 103 , as hereinafter further described . referring again to fig1 and 2 of the drawings , a blade assembly 52 is provided in each of the movable saw carriages 20 and the fixed saw carriage 20a ; which blade assembly 52 includes an elongated blade ladder 53 , pivotally attached to the carriage frame 21 by means of a ladder pivot shaft 63 . each of the blade ladders 53 further includes a saw positioning cylinder 54 and one end of the saw positioning cylinder 54 is pivotally secured to a cylinder mount plate 16 on the carriage frame 21 of each of the saw carriages 20 and the fixed saw carriage 20a , by means of a cylinder pivot pin 54a . the opposite end of the saw positioning cylinder 54 extensibly and retractably receives a saw positioning cylinder piston 55 , the extending end of which is pivotally attached to a piston mount plate 19 , welded to the blade ladder 53 , as illustrated . a circular saw blade 56 is rotatably secured to the lower end of the blade ladder 53 by means of a blade arbor 56a , on a blade shaft 57 , rotatably secured in the blade ladder 53 . each saw blade 56 is driven by operation of a blade pulley 61 , mounted in the blade end of the blade ladder 53 on a rotatable blade shaft 57 and fitted in driven relationship with a middle shaft pulley 65 , mounted on a middle shaft 64 , journalled for rotation in the blade ladder 53 . a blade belt 61a connects the blade pulley 61 and the middle shaft pulley 65 . a motor pulley 60 , attached to the motor shaft 60a of a blade drive motor 58 , is attached to a middle shaft drive pulley 65a , on the middle shaft 64 , by means of a drive belt 62 . the blade drive motor 58 is electrically coupled by suitable wiring not illustrated to the junction boxes 15 and from there by means of electric wiring 14 to the programmable logic controller 104 for automatic operation and is attached to a motor mount bracket 59 , mounted on the carriage frame 21 near the top end of the blade ladder 53 . accordingly , it will be appreciated that the blade ladder 53 and thus , the blade in each of the movable saw carriages 20 and the fixed saw carriage 20a , can be pivoted on each of the ladder pivot shafts 63 in concert by simultaneous operation of each of the saw positioning cylinders 54 , to extend the corresponding saw positioning cylinder pistons 55 , position the saw blades 56 in concert and simultaneously cut the stem 100 into multiple segments of optimum length , as further hereinafter described . as illustrated in fig1 and 5 of the drawings , in a most preferred embodiment of the invention each of the operating elements on the linearly - adjustable moveable saw carriage 20a and the fixed saw carriages 20 are hydraulically operated by means of the pump motor 12 , hydraulic fluid pump 5 and other components of the hydraulic system 3 . hydraulic fluid is pumped from the hydraulic fluid reservoir 9 or the accumulator 4 to the hydraulic fluid manifold 37 , where it is selectively dispensed and returned by operation of the programmable logic controller 104 through respective solenoid valves 13 , the fixed hydraulic fluid lines 1 , mounted on the carriage frame 21 , and the corresponding flexible hydraulic fluid hoses 7 , to the respective roll drives 39 , clamp arm positioning cylinders 70 and ejection cylinders 94 . the solenoid valves 13 are electrically connected to the programmable logic controller 104 for orchestration of the roll drives 39 , clamp arm positioning cylinders 70 and the ejection cylinders 94 , as hereinafter described . similarly , a set of servo valves 6 is mounted on the fluid manifold 37 and are hydraulically connected by means of the fixed hydraulic lines 1 and flexible hydraulic fluid hoses 7 to the butt plate positioning cylinder 49a , the saw positioning cylinder 54 and the hydraulic motor 8 , respectively , for supplying hydraulic fluid to these elements . the servo valves 6 are also electrically connected to the programmable logic controller 104 for orchestration of the butt plate positioning cylinder 49a , saw positioning cylinder 54 and hydraulic motor 8 , as further heretofore described . in automatic operation , the moveable saw carriages 20 and the fixed saw carriage 20a sequentially cut segments of optimum length from incoming stems 100 , as follows . the stems 100 are typically delivered in linear sequence to the saw carriage area on a stem conveyor 82 , as illustrated in fig1 a , where they are initially scanned by the scanner 102 and the physical characteristics of each of the stems 100 are transferred by the scanner 102 to the computer 103 and the desired cutting pattern from the computer 103 to the programmable logic controller 104 , as illustrated in fig6 . for purposes of this application , the term &# 34 ; physical characteristics &# 34 ; shall mean and include , but not be limited to , the location of limbs , the location of rotten spots , the degree of linearity or straightness , length , cuts , gashes , and other observable characteristics well known to those of ordinary skill in the art . the carriage location encoders 41 continually update the programmable logic controller 104 on the relative positions of the movable saw carriages 20 on the fixed rails 22 . accordingly , when the physical characteristics of each stem 100 are assimilated by the computer 103 and the desired cutting pattern transferred from the computer 103 to the programmable logic controller 104 , the system operates as follows : the module drive assembly 10 , including the drive spur gear 30 and driven spur gear 31 , operate to precisely position the respective movable saw carriages 20 and thus , the saw blades 56 in each of the movable saw carriages 20 , responsive to an electric signal from the programmable logic controller 104 and opening of the servo valve 6 which controls the hydraulic motor 8 . while selected ones or all of the movable saw carriages 20 are in the process of independent linear adjustment by traversal of the rails 22 responsive to operation of the hydraulic module drive assembly 10 , including the drive spur gear 30 and driven spur gear 31 , another stem 100 passes in sequence by the scanner 102 and is then typically diverted in sequence by the stem diverters 87 from the stem conveyor 82 to the loading conveyor 85 and then to the fixed stem loaders 45 . this diversion is typically accomplished under command of the programmable logic controller 104 . loading of each stem 100 from the stem loaders 46 to the now - still and pre - prepositioned movable saw carriages 20 also occurs by command of the programmable logic controller 104 . the loading arms 46 roll the stems 100 in sequence onto the respective cutting rollers 26 located above the corresponding cutting platforms 25 of each of the moveable saw carriages 20 and the fixed saw carriage 20a ; with the butt end of the stem 100 resting against or near the butt plate 49 , as further illustrated in fig1 b . if the butt end of the stem 100 is not resting against the butt plate 49 when the stem 100 is loaded on the cutting rollers 26 , the respective roll drives 39 are automatically operated by the programmable logic controller 104 and the respective connecting solenoid valves 13 to supply hydraulic fluid to the roll drives 39 , rotate the corresponding roller shafts 26a and cutting rollers 26 , shift the stem 100 laterally and seat the butt end of the stem 100 against the butt plate 49 . each butt plate 49 is initially positioned to receive the butt end of the stem 100 by extension of the corresponding butt plate positioning cylinder piston 49b from the butt plate positioning cylinder 49a by operation of a corresponding servo valve 6 upon demand by the programmable logic controller 104 . the several movable saw , and carriage 20 single fixed saw carriages 20a are now positioned such that the respective saw blades 56 are nearly ready to cut the stem 100 into segments of optimum length . when each stem 100 is seated on the cutting rollers 26 and adjusted to engage the butt plate 49 , the respective solenoid valves 13 on the corresponding manifolds 37 which hydraulically connect to the clamp arm positioning cylinders 70 are opened by operation of the programmable logic controller 104 . this action extends the respective clamp arm cylinder positioning pistons 71 from the corresponding clamp arm positioning cylinders 70 and pivots the corresponding clamp arms 67 on the clamp arm pivot pin 69 , such that the arm teeth 68 securely engaged the stem 100 and stabilize the stem 100 for cutting , as illustrated in fig1 . when the stem 100 is securely clamped in place on the cutting rollers 26 , the butt plate positioning cylinder piston 49b is retracted into the butt plate positioning cylinder 49a by operation of the corresponding servo valve 6 and the programmable logic controller 104 , to disengage the butt plate 49 from the butt end of the stem 100 . the respective blade drive motors 58 are continuously operated and the saw positioning cylinders 54 are activated by electrical actuation of the corresponding servo valves 6 , hydraulically connected to the positioning cylinders 54 , responsive to command from the programmable logic controller 104 , to extend the saw positioning cylinder pistons 55 in concert and cause the blade ladders 53 and the corresponding rotating saw blades 56 to pivot forwardly , such that each blade 56 engages and cuts the stem 100 in concert with the remaining saw blades 56 , at the precise locations previously determined by the computer 103 and marked by the respective carriage location encoders 41 , as heretofore described . when the stem 100 has been cut into multiple segments , the saw positioning cylinders 54 are reversed in concert by retraction of the saw positioning cylinder pistons 55 responsive to operation of the connecting servo valves 6 and the programmable logic controller 104 , and the saw blades 56 are reoriented together into the &# 34 ; ready &# 34 ; position . the clamp arm positioning cylinders 70 are likewise operated to pivot the clamp arms 67 on the clamp arm pivot pin 69 back into the stem loading configuration . the two ejection cylinders 94 in each of the respective moveable saw carriages 20 and the fixed saw carriage 20a are then activated by operation of the corresponding hydraulically - connected solenoid valves 13 responsive to command from the programmable logic controller 104 , to extend the corresponding ejection cylinder pistons 95 and the segment - engaging heads 96 , contact the respective segments and force the segments from the cutting platform 25 , where they typically drop onto a segment conveyor 75 , for transport to other areas of the mill for further processing . the segment - engaging heads are retracted by reversing the procedure outlined above and the respective movable saw carriages 20 are now in configuration for repositioning by the respective drive spur gear 30 and driven spur gear 31 in the corresponding module drive assembly 10 , according to signals from the programmable logic controller 104 , to process the next successive stem 100 , which was scanned by the scanner 102 while the first stem 100 was being cut into segments . the process is thus repeated , with the entire stem scanning , loading , adjusting , clamping , cutting and log - ejecting steps repeated in sequence . referring again to the drawings , as heretofore described , each of the carriage location encoders 41 in the movable saw carriages 20 is designed to signal the programmable logic controller 104 and facilitate independent location of selected ones or all of the respective movable saw carriages 20 throughout the travel of the movable saw carriages 20 on the rails 22 as the respective driven spur gears 31 traverse the corresponding gear racks 29 . it will be appreciated that the movable saw carriages 20 can be moved in either direction on the rails 22 , since the carriage encoders 41 and the hydraulic motors 8 which operate the respective drive spur gears 30 are reversible , to reverse the corresponding operation of the driven spur gears 31 , depending upon the precisely desired location of each of the respective saw blades 56 with respect to the stem 100 to be cut . furthermore , the movable saw carriages 20 are designed to overlap in travel , such that each movable saw carriage 20 may move partially into the adjacent movable saw carriage 20 position if the latter is incapacited or is not needed for the cutting pattern selected . the computer 103 may be instructed to eliminate any cutting sequence requiring operation of a disabled movable saw carriage 20 and the programmable logic controller 104 executes these instructions in orchestrating operation of the remaining moveable saw carriages 20 . it is understood that the respective butt plate positioning cylinders 49a , clamp arm positioning cylinders 70 , ejection cylinders 94 , saw positioning cylinders 54 , roll drives 39 , hydraulic motors 8 and blade drive motors 58 may be operated by hydraulic , electric or pneumatic equipment , using conventional hoses , couplings , fittings , valves , motors , accessories and the like ( not illustrated ), according to the knowledge of those skilled in the art . however , in a most preferred embodiment of the invention , these components , with the exception of the blade drive motors 58 , are hydraulically operated , as illustrated in the drawings and described herein . moreover , it is further understood that the hydraulic fluid pumps 5 and pump motors 12 can be located off the respective moveable saw carriages 20 and the fixed saw carriage 20a and one or more hydraulic fluid pumps 5 and pump motors 12 may be fitted with inlet and outlet hydraulic fluid hoses 7 that connect to the respective hydraulic fluid reservoirs 9 and accumulators 4 on the moveable saw carriages 20 , and the fixed saw carriage 20a to circulate hydraulic fluid and enable the movable saw carriage 20 operating functions described above . it will be appreciated by those skilled in the art that the saw carriages 20 and the fixed saw carriage 20a of this invention are characterized by versatility in the number of modules that can be used , as well as the module spacing and range of movement , to customize the system for a specific job . furthermore , the moveable saw carriages 20 and the fixed saw carriage 20a considerably speed the processing and cutting of incoming stems 100 by minimizing the movement of the stems during the cutting process , to optimize cutting of the stems into logs , poles and other segments of optimum length , using a computerized scanning system . accordingly , substantially any number of rail - mounted movable saw carriages 20 can be used , depending upon the size and character of the operation envisioned , with each of the movable saw carriages 20 having a carriage location encoder 41 that signals the programmable logic controller 104 , electronically connected to the computer 103 . in a typical installation multiple moveable saw carriages 20 , and one fixed saw carriage 20a , are aligned as illustrated in fig1 a and 1b and any number or all of these saw carriages can be implemented in any desired cutting sequence . for example , if only a butt cut is required , only the blade assembly 52 on the fixed saw carriage 20a is activated to effect this cut . furthermore , if a stem 100 is to be cut into 3 segments of selected length , the butt cut may be made , if necessary , by the fixed saw carriage 20a in combination with activation of two of the remaining five moveable saw carriages 20 to effect the necessary dual cuts in the stem 100 . furthermore , the scanner 102 , or the laser camera , electronic or alternative optical scanning device , the computer 103 , programmable logic controller 104 and carriage location encoders 41 , as well as the servo valves 6 and solenoid valves 13 attached to the hydraulic fluid manifold 37 and hydraulically connected to the respective butt plate positioning cylinders 49a , hydraulic motors 8 , saw positioning cylinders 54 , roll drives 39 , clamp arm positioning cylinders 70 and ejection cylinders 94 , respectively , may be of any desired design , according to the knowledge of those skilled in the art and operate in conventional fashion to achieve the intended result . moreover , a control console or remote control of selected design may be used to initiate manual , semiautomatic and automatic operation of the moveable saw carriages 20 and the fixed saw carriage 20a , according to the knowledge of those skilled in the art . referring again to fig1 b and 2 of the drawings , it will be further understood as described above that the saw blade 56 mounted in the fixed saw carriage 20a located on one end of the carriage line is known as the &# 34 ; butt - cut saw &# 34 ; and is fixed and designed to precisely remove that portion of the butt end of the stem 100 resting against the butt plate 49 , which cut is necessary to insure that the remaining segments are of optimum length and size . accordingly , this fixed saw carriage 20a includes only one cutting roller 26 , stem clamp 66 and segment ejector 93 . the remaining saw blades 56 serve to cut the stem 100 into the respective segments which are transferred , typically by means of a segment conveyor 75 , to a debarking or other processing area of the mill , as described in my copending patent application and mentioned above . as described above , it will also be appreciated by those skilled in the art that the moveable saw carriages 20 and the fixed saw carriage 20a can be manually operated by use of a control panel or remote control device as described above , by eliminating the functions of the scanner 102 , computer 103 , programmable logic controller 104 and carriage location encoders 41 , as desired . the stems 100 can thus be visually evaluated , the movable saw carriages 20 linearly - adjusted on the rails 22 by an appropriate control system and the stems cut as evaluated . alternatively , any desired function of the moveable saw carriages 20 and the fixed saw carriage 20a can be performed semiautomatically , using the scanner 102 and the programmable controller 104 , or bypassing the scanner 102 and utilizing pre - programmed cutting sequences in the programmable controller 104 , as desired . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications may be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .
8
the magnetic field generated by the current in the exciter coil 1 has an axial course 2 in the coil itself , as shown in fig1 . at the end face 3 , 3 a of the coil , the field then transitions into a radial course 4 , 4 a , and is partitioned on the outside onto the claw poles 5 , 5 a , and is again guided into these claw poles in the axial direction 6 , from where it overflows radially 7 into the magnet gap 8 . it passes through the stator 9 to the adjacent rotor claw pole 5 a of opposite polarity , and from there , analogously , back to the core 10 of the exciter coil 1 via the leg 3 a . because of this multiple axial - radial field diversion , the field - guiding iron parts of the magnet wheel , that is , the coil core 10 , face plates 3 , 3 a and claw poles 5 , 5 a , are produced from solid iron . this is not a problem for the exciter field , which , at most , changes slowly over time . this field is , however , rapidly modulated on the claw - pole jacket surfaces 11 through the use of the stator , so eddy losses occur in the solid claw poles . to limit these losses , the magnet gap 8 between the magnet wheel and the stator must be larger than would be desirable from the standpoint of capacity . in accordance with the invention , the iron losses dictated by the field pulsation in the magnet gap can be significantly reduced in the solid claw poles if only the interior of the claw poles is solid , i . e ., the cores , and the poles are equipped in the outer region with metal sheets . fig2 and 3 show a detailed longitudinal section and cross - section , respectively , of this measure in a claw pole 5 . the claw pole is solid in the cross - hatched region , and its jacket and side surfaces are encompassed by approximately u - shaped sheets 12 , which , as stamped sheets , can be combined into a stack as a pole end prior to being secured to the claw pole . the claw poles have a uniform width over their axial length . the magnet gap 8 separates the stator 9 , with the stator working winding 21 , from the sheet 12 and the claw pole 5 . the sheets extend claw - like around the solid claw - pole core , so the sheets cannot follow the centrifugal forces . they can also be welded to the claw - pole core by their ends 13 . in addition , the sheets are later glued to each other and the claw - pole core through dripping or saturation . one or more recesses 14 can be stamped into the sheet segment extending along the circumference . this allows a better adaptation of the inside sheet contour to the claw poles , but most importantly , it permits a prevention of the armature field . it is possible to reduce the magnet gap by about half with the reduction in eddy losses attained with the sheet arrangement in the outer claw - pole region . the parallel - flank arrangement of the claw poles , which otherwise usually mesh in a roughly sinusoidally - pointed manner , assures a reduction in the iron losses in the stator 9 , because the magnetic axial flux in the stator that occurs with axially “ pointed ” poles is avoided . the resulting non - sinusoidal course over time of the induced voltage in the stator winding is a further functional advantage with an open circuit of the winding and subsequent rectification . because of this , and because of the reduced magnet gap , the magnet - gap field itself and the counter - inductances , and therefore the desired generator current , are increased . efficiently increases significantly . of course , the stamping tool can also shape the outside jacket contour of the sheet stack to produce a “ sinus pole ,” that is , an expansion of the magnet gap to the tangential pole sides , effecting a sinusoidal voltage . fig4 shows the combination of the aforementioned features with a supportive permanent - magnet excitation by means of tangentially - acting permanent magnets 15 between the parallel - flank claw poles . the permanent magnets are inserted between the side flanks of the u - sheets 12 . they are secured through adhesion ( for example , along with the gluing of the sheets ). the permanent magnets are secured in the radial direction by the catches 16 . the permanent magnets prevent the side ends of the u - sheets from bending laterally due to the centrifugal force . if the desired pole - gap width no longer matches the ( tangential ) magnet thickness , the outside sheet contour must be appropriately adapted . a shoulder is preferably provided in the contour . a “ sinus - pole ” embodiment is also possible . similarly to the standard claw - pole embodiment , an embodiment that has no slip ring and includes idle exciter coils is possible . in this case , however , both claw - pole - finger systems must be supplied with their magnetic field via an idle , annular - cylinder - type conductor piece and two additional magnet gaps . support by permanent magnets of the aforementioned type is especially worthwhile here . because , as mentioned at the outset , the magnetically axially - acting exciting coil encompasses the entire exciter useful flux and the scatter flux of all p rotor poles of a claw side at higher powers , the exciter yoke passing axially through the exciter coil must have a minimum diameter , as stipulated by the magnetic saturation , which severely narrows the radial space for the exciter coil if a transition is not made to a larger rotor diameter . a larger diameter necessitates a higher number of pole pairs . at a given rpm , this leads to an increased remagnetization frequency and greater losses . in a further embodiment of the invention , this problem can be circumvented by exciting the claw poles in a different manner . to this end , two similar claw - pole - finger systems ( one delivers p north poles , the other p south poles ) are no longer allowed to mesh with the pole fingers , alternatingly forming north and south poles in the circumferential direction within the bore of the stator - sheet stack ; instead , a claw - pole toothed wheel 5 having p pole teeth is disposed axially in the plane of the stator - sheet stack 9 , with a claw - pole - finger system 3 , 3 a that has { fraction ( p / 2 + l )} fingers alternatingly extending into the gaps axially from both sides . the corresponding arrangement is shown in fig5 . exciter coils 1 , 1 a are provided on the axial end faces of the { fraction ( p / 2 + l )} claw - pole toothed wheel ; the exciter yoke 18 , 18 a of these coils only has to guide the flux from the { fraction ( p / 2 + l )} poles of the adjacent , adjoining claw - pole - finger system . consequently , the sheet - stack length of the stator can be increased considerably with a predetermined diameter , with advantageous effects for the radial space required for a desirable power and the remagnetization losses . the magnetic excitations of the coils counteract one another , so the claw - pole toothed wheel lying in the center has p north poles , and the two claw - pole - finger systems together deliver p south poles in the gaps of the claw - pole toothed wheel 5 . it is critical that the magnetic resistances in the outer yokes of the claw poles 3 , 3 a not differ too greatly from those in the claw - pole toothed wheel 5 . this principle of axial flux partitioning can be expanded beyond two adjacent units seated on the same shaft . the claw - pole wheel runs in bearings 17 , 17 a , with the end shields 19 , 19 a supporting the stator - sheet stack 9 . the conventional slip rings 20 are provided for current supply .
7
nomenclature of protected and unprotected natural and unnatural amino acids according to the definition in the novabiochem catalogue 2000 under “ useful information , nomenclature , abbreviation ”, page x et seq . and pages a3 - a13 . tks tachykinins sp substance p , neuropeptide of the sequence h - arg - pro - lys - pro - gln - gln - phe - phe - gly - leu - met - nh 2 . nka neurokinin a cgrp calcitonin gene - related peptide bzl benzyl bn benzyl bip biphenyl alanine fmoc - bip - oh cas #: [ 199110 - 64 - 0 ] bpa benzophenone alanine collidine 2 , 4 , 6 - trimethyl pyridine dipea diisopropyl ethyl amine dppa diphenyl phosphoryl acid equiv equivalents esi electron spray ionisation hatu [ o -( 7 - azabenzotriazol - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium hexafluorophosphate ] hoat 1 - hydroxy - 7 - azabenzotriazol ivdde 1 -( 4 , 4 - dimethyl - 2 , 6 - dioxo - cyclohexylidene ) 3 - methyl butyl mtt 3 -( 4 , 5 - dimethyl - 2 - thiazolyl )- 2 , 5 - diphenyltetrazolium bromide nmp n - methyl pyrrolidone odmab 4 { n -[ 1 -( 4 , 4 - dimethyl - 2 , 6 - dioxo - cyclohexylidene )- 3 - methyl butyl ]- amino } benzyloxy tcp - resin : tritylchloropolystyrene resin tlc : thin layer chromatography trt trityl gaba 4 - aminobutyric acid tempo 2 , 2 , 6 , 6 - tetramethylpiperidine - 1 - oxyl hfip hexafluoroisopropanol dcm dichloromethane hplc high performance liquid chromatography xtt ( 2 , 3 - bis -( 2 - methoxy - 4 - nitro - 5 - sulfophenyl )- 2h - tetrazolium - 5 - carboxanilide , disodium salt ) nle norleucine β - z 3 - amino - 3 - deoxy - n - 9 - fluorenylmethoxycarbonyl - 1 , 2 - isopropylidene - α - d - ribofuranose acid γ - z 3 - amino - 3 - deoxy - n - 9 - fluorenylmethoxycarbonyl - 1 , 2 - isopropylidene - α - d - allofuranose acid tentagel trichlorotrityl resin fmoc 9 - fluorenyloxy carbonyl boc t - butyloxycarbonyl lys lysine trp tryptophan tyr tyrosine tyr ( me ) tyrosine methyl ether tyr ( bzl ) tyrosine benzyl ether thr threonine thr ( bzl ) threonine benzyl ether bta l - 3 - benzothienyl alanine ( l - form : cas #: 72120 - 71 - 9 ) bip l - biphenyl alanine ( l - form : cas #: 155760 - 02 - 4 ) dip l - diphenyl alanine ( l - form : cas #: 1495997 - 92 - 2 ) bpa 1 - benzophenone alanine 1 - nal 1 - naphthyl alanine 2 - nal 2 - naphthyl alanine o - fluoro - phe o - fluorophenyl alanine m - fluoro - phe m - fluorophenyl alanine p - fluoro - phe p - fluorophenyl alanine 2 , 3 - difluoro - phe 2 , 3 - difluorophenyl alanine 2 , 4 - difluoro - phe 2 , 4 - difluorophenyl alanine 2 , 5 - difluoro - phe 2 , 5 - difluorophenyl alanine phe ( f 5 ) pentafluorophenyl alanine o - chloro - phe o - chlorophenyl alanine m - chloro - phe m - chlorophenyl alanine p - chloro - phe p - chlorophenyl alanine 2 , 3 - dichloro - phe 2 , 3 - dichlorophenyl alanine 2 , 4 - dichloro - phe 2 , 4 - dichlorophenyl alanine 2 , 5 - dichloro - phe 2 , 5 - dichlorophenyl alanine phe ( cl 5 ) pentachlorophenyl alanine 3 - pal 3 - pyridinyl alanine 4 - pal 4 - pyridinyl alanine phg phenyl glycine thr ( ar ) aryl ether or arylalkyl ether of threonine hphe homo - phenyl alanine ( l - form : cas #: 943 - 73 - 7 ) htyr homo - tyrosine igl indanyl glycine phe ( 4 - no 2 ) 4 - nitrophenyl alanine phe ( 4 - nh - 2clz ) 4 -(( 2 - chlorobenzyl ) oxycarbonyl - amino )- phenyl alanine phe ( 4 - nhz ) 4 -( benzyloxycarbonyl - amino ) phenyl alanine pra propargyl glycine dmf n , n - dimethyl formamide esi - ms electron spray ionisation mass spectroscopy mb methylene blue mtt 3 -( 4 , 5 - dimethyl - 2 - thiazolyl )- 2 , 5 - diphenyltetrazolium bromide xtt ( 2 , 3 - bis -( 2 - methoxy - 4 - nitro - 5 - sulfophenyl )- 2h - tetrazolium - 5 - carboxanilide , disodium salt ) bpa 4 - benzophenyl alanine fmoc - bpa - oh cas # 11766696 - 3 fmoc - d - 1 - nal - oh [ 138774 - 93 - 3 ] fmoc - 1 - nal - oh fmoc - 1 - naphthyl alanine [ 96402 - 49 - 2 ] fmoc - 2 - nal - oh fmoc - 2 - naphthyl alanine [ 136774 - 94 - 4 ] acoet ethyl acetate fc flash chromatography , chromatography at increased pressure edta ethylenediiaminetetraacetic acid dfo desferrioxamine - b dads diamidedithiol alkyl within the meaning of the present invention is a branched , unbranched or cyclic alkyl group . lower alkyl groups having 1 to 10 carbon atoms are preferred ; those having 1 to 6 carbon atoms are particularly preferred . special mention may be made of the radicals methyl , ethyl , propyl , iso - propyl , n - butyl , sec - butyl , tert - butyl , n - pentyl , neo - pentyl , 1 - methyl butyl , 2 - methyl butyl , 3 - methyl butyl , cyclo - pentyl , n - hexyl , 1 - methyl pentyl , 2 - methyl pentyl , 3 - methyl pentyl , 4 - methyl pentyl , 1 - ethyl butyl , 2 - ethyl butyl , 3 - ethyl butyl and cyclo - hexyl . alkenyl within the meaning of the present invention is a branched , unbranched or cyclic hydrocarbon group comprising one or more unsaturated carbon - carbon bonds . these unsaturated carbon - carbon bonds do not form an aromatic system . alkenyl groups having 2 to 10 carbon atoms are preferred ; those having 2 to 6 carbon atoms are especially preferred . the unsaturated bond may be present at any position within the alkenyl group . special mention may be made of the radicals ethenyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 - pentenyl , 2 - pentenyl , 3 - pentenyl , 4 - pentenyl , 1 - hexenyl , 2 - hexenyl , 3 - hexenyl , 4 - hexenyl , 5 - hexenyl , 1 - methyl ethenyl , 1 - methyl - 1 - propenyl , 1 - methyl - 2 - propenyl , 1 - methyl - 1 - butenyl , 1 - methyl - 2 - butenyl , 1 - methyl - 3 - butenyl , 2 - methyl - 1 - butenyl , 2 - methyl - 2 - butenyl , 2 - methyl - 3 - butenyl , 3 - methyl - 2 - butenyl , 1 - methyl - 1 - pentenyl , 1 - methyl - 2 - pentenyl , 1 - methyl - 3 - pentenyl , 1 - methyl - 4 - pentenyl , 2 - methyl - 1 - pentenyl , 2 - methyl - 2 - pentenyl , 2 - methyl - 3 - pentenyl , 2 - methyl - 4 - pentenyl , 3 - methyl - 1 - pentenyl , 3 - methyl - 2 - pentenyl , 3 - methyl - 3 - pentenyl , 3 - methyl - 4 - pentenyl , 4 - methyl - 1 - pentenyl , 4 - methyl - 2 - pentenyl , 4 - methyl - 3 - pentenyl , 4 - methyl - 4 - pentenyl . alkinyl within the meaning of this invention is a branched , unbranched or cyclic hydrocarbon group having one or more di - unsaturated carbon - carbon bonds . alkinyl groups having 2 to 10 carbon atoms are preferred ; those having 2 to 6 carbon atoms are especially preferred . the di - unsaturated bond may be present at any position within the alkinyl group . special mention may be made of the radicals ethinyl , 1 - propinyl , 2 - propinyl , 1 - butinyl , 2 - butinyl , 3 - butinyl , 1 - pentinyl , 2 - pentinyl , 3 - pentinyl , 4 - pentinyl , 1 - hexinyl , 2 - hexinyl , 3 - hexinyl , 4 - hexinyl , 5 - hexinyl , 1 - methyl - 2 - propinyl , 1 - methyl - 2 - butinyl , 1 - methyl - 3 - butinyl , 2 - methyl - 3 - butinyl , 3 - methyl - 1 - butinyl , 1 - methyl - 2 - pentinyl , 1 - methyl - 3 - pentinyl , 1 - methyl - 4 - pentinyl , 2 - methyl - 3 - pentinyl , 2 - methyl - 4 - pentinyl , 3 - methyl - 4 - pentinyl , 3 - methyl - 1 - pentinyl , 4 - methyl - 1 - pentinyl und 4 - methyl - 2 - pentinyl . aryl within the meaning of this invention is a cyclic aromatic group . the aryl group optionally contains one or more heteroatoms selected from the group consisting of n , s , o so that heteroaryl groups also fall under the term “ aryl group ” within the meaning of this invention . aryl groups having 4 to 16 carbon atoms are preferred ; benzyl , naphthyl , anthracyl , fluorenyl , pyridyl , pyrazinyl , pyrrolyl , imidazolyl , furanyl , thienyl and indolyl groups are especially preferred . arylalkyl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by an alkyl group . the preferred groups listed for this group are also preferred in the present case . alkylaryl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an aryl group . the preferred groups listed for this group are also preferred in the present case . alkoxy within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . alkenyloxy within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . aryloxy within the meaning of the present invention is an aryl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . arylalkoxy within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . alkylaryloxy within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . thioalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . thioalkenyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . thioaryl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . selenoalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a selenium atom . the preferred groups listed for this group are also preferred in the present case . selenoaryl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a selenium atom . the preferred groups listed for this group are also preferred in the present case . alkanoyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkenoyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkinoyl within the meaning of the present invention is an alkinyl group linked to the remainder of the molecule by a c ( o ) group . the preferred groups listed for this group are also preferred in the present case . aroyl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . arylalkanoyl within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkylaroyl within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . amidoalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an amide linkage . the preferred groups listed for this group are also preferred in the present case . amidoalkenyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by an amide linkage . the preferred groups listed for this group are also preferred in the present case . amidoalkinyl within the meaning of the present invention is an alkinyl group linked to the remainder of the molecule by an amide group . the preferred groups listed for this group are also preferred in the present case . arylalkanoyloxy within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by an ester group . the preferred groups listed for this group are also preferred in the present case . alkylaroyloxy within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by an ester group . the preferred groups listed for this group are also preferred in the present case . aminocarboxylic acid within the meaning of the present invention is an α -, β -, or γ - aminocarboxylic acid . alpha - aminocarboxylic acids occurring in nature are preferred . unless explicitly defined , all stereo isomers of optically active aminocarboxylic acids are included , especially the d - and l - forms of α - aminocarboxylic acids occurring in nature . aliphatic side chains within the meaning of the present invention mean a side chain of an aminocarboxylic acid which is an alkyl group . the side chains of the amino carboxylic acids alanine , valine , leucine , norleucine and isoleucine are preferred . optionally , the side chain may bear one or more substituents selected from the group consisting of f , cl , br , i , alkoxy , alkylthio , alkylseleno . an aromatic side chain within the meaning of the present invention is a side chain of an aminocarboxylic acid comprising at least one aromatic ring . this ring may be a pure carbocycle or include one or more heteroatoms selected from the group consisting of n , s and o . the aromatic ring may be substituted . it may be linked to the peptide backbone directly or by an alkylene group . preferred aromatic side chains are the side chains of phenyl alanine , 1 - and 2 - naphthyl alanine , tyrosine , tryptophan , biphenyl alanine , mono -, di -, tri -, tetra -, and pentahalogenated phenyl alanine , substituted and unsubstituted , especially mono -, di -, tri -, tetra -, and pentahalogenated homophenyl alanine , methylphenyl alanine , nitrophenyl alanine , alkyl tyrosine , phosphotyrosine , mono -, di -, tri -, and tetrahalogenated tyrosyl , substituted and unsubstituted , especially mono -, di -, tri -, and tetrahalogenated and alkylated homotyrosyl , substituted and unsubstituted , especially halogenated 4 - biphenyl alanine , diphenyl glycine , 2 - indanyl glycine , diphenyl alanine , 4 - benzoyl phenyl alanine , 3 - benzothienyl alanine . an amino group within the meaning of the present invention is a group selected from nh 2 , nhr ′ and nr ′ r ″ wherein the r ′ and r ″ groups are selected independently from alkyl , alkenyl , and aryl , preferably c 1 - c 4 alkyl , c 2 - c 6 alkenyl and c 6 - c 14 aryl . nh 2 , dimethyl amine and diethyl amine are especially preferred . acid groups in the side chain within the meaning of the present invention are groups of which at least 5 % are present in a deprotonated state in an aqueous solution at a ph value of 7 . basic groups in the side chain within the meaning of the present invention are groups of which at least 5 % are present in a protonated state in an aqueous solution at a ph value of 7 . a side chain is a basic side chain if at least one basic group is contained . polyfunctional side chains are defined as basic side chains within the meaning of the present invention if they bear more basic groups than acidic groups . the peptides of the present invention are represented by the general formulae 1 to 6 . the groups a , b , c , d , and z are radicals derived from aminocarboxylic acids linked to each other by a peptide linkage . n and m represent 0 or 1 and n + m represents 1 or 2 . accordingly , the formulae 1 to 6 represent tetra - or pentapeptides . the linear peptides of the formulae 1 to 5 may be derived from the cyclic peptide of the formula 6 by cleaving any binding site among the peptide linkages and by saturating the free valences with the terminal groups y 1 and y 2 . wherein the substituents q 1 , q 2 , q 3 , q 4 , q 5 , q 6 , q 7 , q 1 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 and x have the following meaning : x is selected from o , s , se , nr 9 , pr 8 and cr 9 r 10 , preferably o and nh , wherein r 9 , r 10 are independently selected from h , oh , sh , f , cl , br , i , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkoxy , alkenyloxy , aryloxy , thioalkyl , thioaryl , selenoalkyl , selenoaryl which may optionally be substituted with one or more of the substituents selected from f , oh , sh , seh , an amino group , an oxo group and a carboxy group . h , alkyl , aryl and oh are preferred . q 1 and q 2 are independently selected from a single bond , ch 2 , ch ( oh ), ch ( or 1 ), chr 1 and cr 1 r 2 , wherein r 1 and r 2 are independently selected from alkyl , alkenyl , aryl , arylalkyl , alkylaryl , which may optionally be substituted with f , oh , an amino group or a carboxy group . preferred groups q 1 and q 2 are a single bond , ch ( oh ) and ch ( o benzyl ), especially mono -, di -, tri -, tetra - and pentahalogenated benzyl ether , fluorinated benzyl ether , alkylated benzyl ether , arylbenzyl ether , hydroxy benzyl ether and alkoxy benzyl ether . q 3 bis q 8 are independently selected from a single bond , o , s , se , n 2 , nr 9 , po 3 . r 3 bis r 8 are independently selected from the group consisting of h , oh , sh , n 3 , cn , nc , scn , f , cl , br , i , so 3 , no 2 , pr 11 r 12 , coor 11 , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkanoyl , alkenoyl , alkinoyl , aroyl , arylalkanoyl , alkylaroyl , which may optionally be substituted with one or more substituents selected from f , oh , sh , seh , an amino group , an oxo group or a carboxy group . r 11 and r 12 are independently selected from h , oh , sh , f , cl , br , i , cn , nc , scn , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkoxy , alkenyloxy , aryloxy , thioalkyl , thioalkenyl , thioaryl , selenoalkyl , selenoalkenyl , selenoaryl , amidoalkyl , amidoalkenyl , amidoalkinyl , arylalkanoyloxy , alkylaroyloxy , arylalkoxy , alkylaryloxy , which may optionally be substituted with one or more of the substituents selected from f , oh , sh , seh , an amino group , an oxo group or a carboxy group . optionally , two substituents r i and r j , with i , j = 3 to 8 , are linked , forming a 5 - or 6 - membered ring , wherein optionally one or more of the ring atoms are independently substituted with one or more groups , independently selected from alkyl , alkenyl and aryl . typical representatives of this group are spiro compounds , aryl ketals , alkylaryl ketals , alkyl acetals , aryl acetals , arylthio ketals , alkylarylthio ketals , alkylthio acetals , arylthio acetals , aryl aminals , alkylaryl aminals , alkyl aminals and aryl aminals each of which may be substituted or unsubstituted , branched or unbranched . alkyl ketals , aryl ketals , alkylaryl ketals , alkyl acetals or aryl acetals are preferred . the ketal of acetone and the ketal of substituted or unsubstituted benzophenone are especially preferred . preferred substituents - q i - r i and - q j - r j , with i , j = 3 to 8 , are h , alkyl , alkenyl , aryl , arylalkyl , alkylaryl , alkoxy , aryloxy , aroyloxy and alkanoyloxy . especially preferred are h , methoxy , benzyloxy , allyloxy and — o — c ( ch 3 ) 2 — o —. it is also especially preferred to select the substituents - q i - r i with i 3 to 8 , in such a manner that each of the ring atoms in formula ( 7 ) except x bears a hydrogen atom and a substituent other than hydrogen . this criterion is met by most of the monosaccharides occurring in nature . the use of such molecules as starting materials provides the advantage that the groups z with a defined stereochemistry may be obtained at low cost . preferred regioisomers of group z are characterised in that the groups - q 1 - nh — and - q 2 - c ( o )— are linked to adjacent carbon atoms of the ring in formula ( 7 ). z groups wherein the groups - q 1 - nh — and - q 2 - c ( o )— are linked to the two carbon atoms of the ring in formula ( 7 ) which are adjacent to x are also preferrred . the structural formulae for preferred representatives of group z are shown in the following . in each case , the free amino carboxylic acids are shown . in the peptide of the invention , peptide linkages are present at the positions of the amino group and of the carboxyl group . the substituents r , r ′ and r ″ shown in the following structural images have the same meaning as the substituents - q i - r i , wherein i = 3 to 8 , defined above and in the claims . group a is an α -, β - or γ - amino carboxylic acid radical having an aromatic side chain or an aliphatic side chain . c 6 - c 14 aryl groups , which may optionally be substituted with oh or i and wherein a carbon atom may be isosterically replaced by nitrogen or sulfur , and c 1 - c 10 alkyl groups are preferred . it is also preferred if the side chain of the amino carboxylic radical a is a c 1 - c 4 alkyl - c 6 - c 14 aryl group wherein the aryl group is optionally substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur . the amino carboxylic acid radicals of valine , tyrosine , the methyl ether of tyrosine and of phenyl alanine are particularly preferred . also preferred is d - asp incorporated as a β - amino acid wherein the side chain is amidically linked to benzyl amine or 1 - naphthyl amine via an amide linkage . also preferred are β - phe , β - tyr and β - val wherein the side - chain may be located in the 2 - or 3 - position . with regard to the nomenclature and synthesis of β - amino carboxylic acids reference is made to the works of d . seebach : helv . chim . acta 1998 , 81 , 2141 ; angewandte chemie 1999 , 111 , 1302 ; helv . chim . acta 2000 , 83 , 16 ; helv . chim . acta 1998 , 81 , 187 ; helv . chim . acta 1998 , 81 , 983 ; helv . chim . acta 1998 , 81 , 2093 ; helv . chim . acta 1999 , 82 , 1150 ; liebigs ann . chem . 1995 , 1217 ; helv . chim . acta 2000 , 83 , 3139 ; helv . chim . acta 1996 , 79 , 913 ; helv . chim . acta 1996 , 79 , 2043 ; helv . chim . acta 1997 , 80 , 2033 ; helv . chim . acta 1998 ; 81 ; 2218 ; chimia 1998 , 52 , 734 . b is an α -, β - or γ - amino carboxylic acid radical having an aromatic side chain . side chains having a c 6 - c 14 aryl group or a c 1 - c 4 alkyl - c 6 - c 14 aryl group which may optionally be substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur are preferred . especially preferred are the amino carboxylic acid radicals of 1 - naphthyl alanine , 2 - naphthyl alanine , bta and tryptophan . in each of these cases , the d - and l - forms of the radicals are preferred . c is an α -, β - or γ - amino carboxylic acid radical having a basic side chain or an aliphatic side chain . preferably , the side chain is a c 1 - c 10 alkyl group which may be substituted with one or more groups selected from amino , acetyl , trifluoroacetyl and alkyl amide groups . especially preferred are side chains having a c 3 - c 5 alkyl group or a c 3 - c 5 amino alkyl group . especially preferred representatives of group c are the radicals of the amino carboxylic acids lysine , acetal protected lysine and norleucine . d is an α -, β - or γ - amino carboxylic acid radical which does not have acidic groups or basic groups in the side chain . side chains having a c 6 - c 14 aryl group or a c 1 - c 4 alkyl - c 6 - c 14 aryl group which may optionally be substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur are preferred . also preferred are radicals wherein the side chain is a c 1 - c 6 alkyl group which may optionally be substituted with one or more groups selected from oh , c 1 - c 10 alkoxy , c 6 - c 20 aryl - c 1 - c 4 alkoxy , and c 6 - c 20 aryloxy . preferred representatives of this group are the radicals of the amino carboxylic acids bip , bpa , dip , 1 - nal , 2 - nal and threonine . especially preferred are the radicals of the threonine ethers and tyrosine ethers where the ether is formed from threonine or tyrosine and an aromatic group or an arylalkyl group . preferred representatives of this group are trityl ether , benzyl ether and the phe ( f 5 ) ether of threonine and the trityl ether , benzyl ether and the phe ( f 5 ) ether of tyrosine . also preferred are side chains where an aryl group or an aralkyl group is linked to the backbone of the peptide by an amide linkage . preferred representatives are d - and l - asp incorporated as a β - or α - amino acid which is peptidically linked to aminopyrene , 1 - naphthyl amine , benzyl amine , anthraquinone amine via the second acidic group . in addition , the linear peptides comprise the end groups y 1 and y 2 . y 1 is linked to the amino group of the corresponding amino carboxylic acid and is selected from h , ch 3 ( ch 2 ) r co , with r = 0 to 6 , butoxy carbonyl and 9 - fluorenyl methoxy carbonyl . preferred groups are acetyl and trifluoro acetyl . y 2 is linked to the carboxy group of the corresponding amino carboxylic acid and is selected from h , nh 2 , alkoxy , aryloxy , alkyl , aryl , alkenyl , alkinyl , f , cl , br , i , cn , nc , scn , thioalkyl , thioaryl . preferred groups are nh 2 , methoxy , ethoxy and benzyloxy . each of n and m represent the integers 0 or 1 , such that m + n is 1 or 2 : cyclo [- phe - trp - lys - z -], cyclo [- phe - d - trp - lys - z -], cyclo [- phe - trp - nle - z -], cyclo [- phe - d - trp - nle - z -], cyclo [- tyr - trp - lys - z -], cyclo [- tyr - d - trp - lys - z -], cyclo [- tyr - trp - nle - z -], cyclo [- tyr - d - trp - nle - z -], cyclo [- phe - bta - lys - z -], cyclo [- phe - d - bta - lys - z -], cyclo [- phe - bta - nle - z -], cyclo [- phe - d - bta - nle - z -], cyclo [- tyr - bta - lys - z -], cyclo [- tyr - d - bta - lys - z -], cyclo [- tyr - bta - nle - z -], cyclo [- tyr - d - bta - nle - z -], cyclo [- phe - 1 - nal - lys - z -], cyclo [- phe - d - 1 - nal - lys - z -], cyclo [- phe - 1 - nal - nle - z -], cyclo [- phe - d - 1 - nal - nle - z -], cyclo [- tyr - 1 - nal - lys - z -], cyclo [- tyr - d - 1 - nal - lys - z -], cyclo [- tyr - 1 - nal - nle - z -], cyclo [- tyr - d - 1 - nal - nle - z -], cyclo [- phe - 2 - nal - lys - z -], cyclo [- phe - d - 2 - nal - lys - z -], cyclo [- phe - 2 - nal - nle - z -], cyclo [- phe - d - 2 - nal - nle - z -], cyclo [- tyr - 2 - nal - lys - z -], cyclo [- tyr - d - 2 - nal - lys - z -], cyclo [- tyr - 2 - nal - nle - z -], cyclo [- tyr - d - 2 - nal - nle - z -], cyclo [- tyr ( bzl )- bta - lys - z -], cyclo [- tyr ( bzl )- d - bta - lys - z -], cyclo [- tyr ( bzl )- bta - nle - z -], cyclo [- tyr ( bzl )- d - bta - nle - z -], cyclo [- tyr ( bzl )- 1 - nal - lys - z -], cyclo [- tyr ( bzl )- d - 1 - nal - lys - z -], cyclo [- tyr ( bzl )- 1 - nal - nle - z -], cyclo [- tyr ( bzl )- d - 1 - nal - nle - z -], cyclo [- tyr ( bzl )- 2 - nal - lys - z -], cyclo [- tyr ( bzl )- d - 2 - nal - lys - z -], cyclo [- tyr ( bzl )- 2 - nal - nle - z -], cyclo [- tyr ( bzl )- d - 2 - nal - nle - z -], cyclo [- phe - trp - lys - phe - z -], cyclo [- phe - d - trp - lys - phe - z -], cyclo [- tyr - trp - lys - phe - z -], cyclo [- tyr - d - trp - lys - phe - z -], cyclo [- tyr ( me )- trp - lys - phe - z -], cyclo [- tyr ( me )- d - trp - lys - phe - z -], cyclo [- phe - trp - lys - thr - z -], cyclo [- phe - d - trp - lys - thr - z -], cyclo [- phe - trp - lys - tyr ( bzl )- z -], cyclo [- phe - d - trp - lys - tyr ( bzl )- z -], cyclo [- phe - trp - lys - bip - z -], cyclo [- phe - d - trp - lys - bip - z -], cyclo [- phe - trp - lys - dip - z -], cyclo [- phe - d - trp - lys - dip - z -], cyclo [- phe - trp - lys - bpa - z -], cyclo [- phe - d - trp - lys - bpa - z -], cyclo [- phe - trp - lys - 1 - nal - z -], cyclo [- phe - d - trp - lys - 1 - nal - z -], cyclo [- phe - t r - lys - 2 - nal - z -], cyclo [- phe - d - trp - lys - 2 - nal - z -], cyclo [- phe - trp - lys - p - fluoro - phe - z -], cyclo [- phe - d - trp - lys - p - fluoro - phe - z -], cyclo [- phe - trp - lys - phe ( f5 )- z -], cyclo [- phe - d - trp - lys - phe ( f5 )- z -], cyclo [- phe - trp - lys - o - fluoro - phe - z -], cyclo [- phe - d - trp - lys - o - fluoro - phe - z -], cyclo [- phe - trp - lys - m - fluoro - phe - z -], cyclo [- phe - d - trp - lys - m - fluoro - phe - z -], cyclo [- phe - trp - lys - thr ( ar )- z -], cyclo [- phe - d - trp - lys - thr ( ar )- z -], cyclo [- phe - trp - lys - thr ( bn )- z -], cyclo [- phe - d - trp - lys - thr ( bn )- z -], cyclo [- phe - trp - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - trp - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - trp - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - trp - lys - p - chloro - phe - z -], cyclo [- phe - d - trp - lys - p - chloro - phe - z -], cyclo [- phe - trp - lys - phe ( c15 )- z -], cyclo [- phe - d - trp - lys - phe ( c15 )- z -], cyclo [- phe - trp - lys - o - chloro - phe - z -], cyclo [- phe - d - trp - lys - o - chloro - phe - z -], cyclo [- phe - trp - lys - m - chloro - phe - z -], cyclo [- phe - d - trp - lys - m - chloro - phe - z -], cyclo [- phe - trp - lys - thr ( ar )- z -], cyclo [- phe - trp - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - trp - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 5 - dichloro - phe - z -], cyclo [ phe - trp - nle - phe - z ], cyclo [- phe - d - trp - nle - phe - z -], cyclo [- tyr - trp - nle - phe - z -], cyclo [- tyr - d - trp - nle - phe - z -], cyclo [- tyr ( me )- trp - nle - phe - z -], cyclo [- tyr ( me )- d - trp - nle - phe - z -], cyclo [- phe - trp - nle - thr - z -], cyclo [- phe - d - trp - nle - thr - z -], cyclo [- phe - trp - nle - bip - z -], cyclo [- phe - d - trp - nle - bip - z -], cyclo [- phe - trp - nle - dip - z -], cyclo [- phe - d - trp - nle - dip - z -], cyclo [- phe - trp - nle - bpa - z -], cyclo [- phe - d - trp - nle - bpa - z -], cyclo [- phe - trp - nle - 1 - nal - z -], cyclo [- phe - d - trp - nle - 1 - nal - z -], cyclo [- phe - trp - nle - 2 - nal - z -], cyclo [- phe - d - trp - nle - 2 - nal - z -], cyclo [- phe - trp - nle - p - fluoro - phe - z -], cyclo [- phe - d - trp - nle - p - fluoro - phe - z -], cyclo [- phe - trp - nle - phe ( f5 )- z -], cyclo [- phe - d - trp - nle - phe ( f5 )- z -], cyclo [- phe - trp - nle - o - fluoro - phe - z -], cyclo [- phe - d - trp - nle - o - fluoro - phe - z -], cyclo [- phe - trp - nle - m - fluoro - phe - z -], cyclo [- phe - d - trp - nle - m - fluoro - phe - z -], cyclo [- phe - trp - nle - thr ( ar )- z -], cyclo [- phe - d - trp - nle - thr ( ar )- z -], cyclo [- phe - trp - nle - thr ( bn )- z -], cyclo [- phe - d - trp nle - thr ( bn )- z -], cyclo [- phe - trp - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 4 - difluoro - phe - z ], cyclo [- phe - trp - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - trp - nle 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - trp - nle - p - chloro - phe - z -], cyclo [- phe - d - trp - nle - p - chloro - phe - z -], cyclo [- phe - trp - nle - phe ( c15 )- z -], cyclo [- phe - d - trp - nle - phe ( c15 )- z -], cyclo [- phe - trp - nle - o - chloro - phe - z -], cyclo [- phe - d - trp - nle - o - chloro - phe - z -], cyclo [- phe - trp - nle - m - chloro - phe - z -], cyclo [- phe - d - trp - nle - m - chloro - phe - z -], cyclo [- phe - trp - nle - thr ( ar )- z -], cyclo [- phe - trp - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - trp - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - trp - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - trp nle - nle ( 6 - obzl )- z -], cyclo [- tyr - trp - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - trp - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- trp - nle - nle ( 6 - obzl )- z -], cyclo [- phe - trp - nle - 3 - pal - z -], cyclo [- phe - d - trp - nle - 3 - pal - z -], cyclo [- tyr - trp - nle - 3 - pal - z -], cyclo [- tyr - d - trp - nle - 3 - pal - z -], cyclo [- tyr ( me )- trp - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - trp - nle - 3 - pal - z -], cyclo [- phe - trp - nle - 4 - pal - z -], cyclo [- phe - d - trp - nle - 4 - pal - z -], cyclo [- tyr - trp - nle - 4 - pal - z -], cyclo [- tyr - d - trp - nle - 4 - pal - z -], cyclo [- tyr ( me )- trp - nle - 4 - pal - z -], cyclo [- phe - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - trp - nle - phg - z -], cyclo [- phe - d - trp - nle - phg - z -], cyclo [- tyr - trp - nle - phg - z -], cyclo [- tyr - d - trp - nle - phg - z -], cyclo [- tyr ( me )- trp - nle - phg - z -], cyclo [- phe - trp - nle - phe - z -], cyclo [- phe - d - trp - nle - hphe - z -], cyclo [- tyr - trp - nle - hphe - z -], cyclo [- tyr - d - trp - nle - hphe - z -], cyclo [- tyr ( me )- trp - nle - hphe - z -], cyclo [- phe - trp - nle - igl - z -], cyclo [- phe - d - trp - nle - igl - z -], cyclo [- tyr - trp - nle - igl - z -], cyclo [- tyr - d - trp - nle - igl - z -], cyclo [- tyr ( me )- trp - nle - igl - z -], cyclo [- phe - trp - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - no2 )& gt ; z -], cyclo [- tyr - trp - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - no2 )- z -], cyclo [- phe - trp - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - nhz )- z -], cyclo [- phe - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - trp - nle - htyr - z -], cyclo [- phe - d - trp - nle - htyr - z -], cyclo [- tyr - trp - nle - htyr - z -], cyclo [- tyr - d - trp - nle - htyr - z -], cyclo [- tyr ( me )- trp - nle - htyr - z -], cyclo [- phe - trp - nle - pra - z -], cyclo [- phe - d - trp - nle - pra - z -], cyclo [- tyr - trp - nle - pra - z -], cyclo [- tyr - d - trp - nle - pra - z -], cyclo [- tyr ( me )- trp - nle - pra - z -], cyclo [- phe - 1 - nal - nle - phe - z -], cyclo [- phe - d - 1 - nal - nle - phe - z -], cyclo [- tyr - 1 - nal - nle - phe - z -], cyclo [- tyr - d - 1 - nal - nle - phe - z -], cyclo [- tyr ( me )- 1 - nal - nle - phe - z -], cyclo [- tyr ( me )- d - 1 - nal - nle - phe - z -], cyclo [- phe - 1 - nal - nle - thr - z -], cyclo [- phe - d - 1 - nal - nle - thr - z -], cyclo [- phe - 1 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - d - 1 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - 1 - nal - nle - bip - z -], cyclo [- phe - d - 1 - nal - nle - bip - z -], cyclo [- phe - 1 - nal - nile - dip - z -], cyclo [ phe - d - 1 nal - nle - dip - z -], cyclo [- phe - 1 - nal - nle - bpa - z -], cyclo [- phe - d - 1 - nal - nle - bpa - z -], cyclo [- phe - 1 - nal - nle - 1 - nal - z -], cyclo [- phe - d - 1 - nal - nle - 1 - nal - z -], cyclo [- phe - 1 - nal - nle - 2 - nal - z -], cyclo [- phe - d - 1 - nal - nle - 2 - nal - z -], cyclo [- phe - 1 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - phe ( f5 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( f5 )- z -], cyclo [- phe - 1 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - d - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - 1 - nal - nle - thr ( bn )- z -], cyclo [- phe - d - 1 - nal - nle - thr ( bn )- z -], cyclo [- phe - 1 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - p - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - p - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - phe ( c15 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( c15 )- z -], cyclo [- phe - 1 - nal - nle - o - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - o - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - m - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - m - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - 1 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 - pal - z -], cyclo [- phe - d - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr - d - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- 1 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - 1 - nal - nle - 3 - pal - z -], cyclo [- phe - 1 - nal - nle - 4 - pal - z -], cyclo [- phe - d - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr - d - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr ( me )- 1 - nal - nle - 4 - pal - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - phg - z -], cyclo [- phe - d - 1 - nal - nle - phg - z -], cyclo [ tyr - 1 - nal - nle - phg - z -], cyclo [- tyr - d - 1 - nal - nle - phg - z -], cyclo [- tyr ( me )- 1 - nal - nle - phg - z -], cyclo [- phe - 1 - nal - nle - hphe - z -], cyclo [- phe - d - 1 - nal - nle - hphe - z -], cyclo [- tyr - 1 - nal - nle - hphe - z -], cyclo [- tyr - d - 1 - nal - nle - hphe - z -], cyclo [- tyr ( me )- 1 - nal - nle - hphe - z -], cyclo [- phe - 1 - nal - nle - igl - z -], cyclo [- phe - d - 1 - nal - nle - igl - z -], cyclo [- tyr - 1 - nal - nle - igl - z -], cyclo [- tyr - d - 1 - nal - nle - igl - z -], cyclo [- tyr ( me )- 1 - nal - nle - igl - z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 1 - nal - nle - htyr - z -], cyclo [- phe - d - 1 - nal - nle - htyr - z -], cyclo [- tyr - 1 - nal - nle - htyr - z -], cyclo [- tyr - d - 1 - nal - nle - htyr - z -], cyclo [- tyr ( me )- 1 - nal - nle - htyr - z -], cyclo [- phe - 1 - nal - nle - pra - z -], cyclo [- phe - d - 1 - nal - nle - pra - z -], cyclo [- tyr - 1 - nal - nle - pra - z -], cyclo [- tyr - d - 1 - nal - nle - pra - z -], cyclo [- tyr ( me )- 1 - nal - nle - pra - z -] cyclo [- phe - 2 - nal - nle - phe - z -], cyclo [- phe - d - 2 - nal - nle - phe - z -], cyclo [- tyr - 2 - nal - nle - phe - z -], cyclo [- tyr - d - 2 - nal - nle - phe - z -], cyclo [- tyr ( me )- 2 - nal - nle - phe - z -], cyclo [- tyr ( me )- d - 2 - nal - nle - phe - z -], cyclo [- phe - 2 - nal - nle - thr - z -], cyclo [- phe - d - 2 - nal - nle - thr - z -], cyclo [- phe - 2 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - d - 2 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - 2 - nal - nle - bip - z -], cyclo [- phe - d - 2 - nal - nle - bip - z -], cyclo [- phe - 2 - nal - nle - dip - z -], cyclo [- phe - d - 2 - nal - nle - dip - z -], cyclo [- phe - 2 - nal - nle - bpa - z -], cyclo [- phe - d - 2 - nal - nle - bpa - z -], cyclo [- phe - 2 - nal - nle - 2 - nal - z -], cyclo [- phe - d - 2 - nal - nle - 2 - nal - z -], cyclo [- phe - 2 - nal - nle - 1 - nal - z -], cyclo [- phe - d - 2 - nal - nle - 1 - nal - z -], cyclo [- phe - 2 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - phe ( f5 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( f5 )- z -], cyclo [- phe - 2 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - d - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - 2 - nal - nle - thr ( bn )- z -], cyclo [- phe - d - 2 - nal - nle - thr ( bn )- z -], cyclo [- phe - 2 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - p - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - p - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - phe ( c15 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( c15 )- z -], cyclo [- phe - 2 - nal - nle - o - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - m - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - m - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - 2 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 - pal - z -], cyclo [- phe - d - 2 - nal - nle - 3 - pal - z -], cyclo [- tyr - 2 - nal - nle - 3 - pal - z -], cyclo [ tyr - d - 2 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- 2 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - 2 - nal - nle - 3 - pal - z -], cyclo [- phe - 2 - nal - nle - 4 - pal - z -], cyclo [- phe - d - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr - d - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr ( me )- 2 - nal - nle - 4 - pal - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - phg - z -], cyclo [- phe - d - 2 - nal - nle - phg - z -], cyclo [- tyr - 2 - nal - nle - phg - z -], cyclo [ tyr - d - 2 - nal - nle - phg - z -], cyclo [- tyr ( me )- 2 - nal - nle - phg - z -], cyclo [- phe - 2 - nal - nle - hphe - z -], cyclo [- phe - d - 2 - nal - nle - hphe - z -], cyclo [- tyr - 2 - nal - nle - hphe - z -], cyclo [- tyr - d - 2 - nal - nle - hphe - z -], cyclo [- tyr ( me )- 2 - nal - nle - hphe - z -], cyclo [- phe - 2 - nal - nle - igl - z -], cyclo [- phe - d - 2 - nal - nle - igl - z -], cyclo [- tyr - 2 - nal - nle - igl - z -], cyclo [- tyr - d - 2 - nal - nle - igl - z -], cyclo [- tyr ( me )- 2 - nal - nle - igl - z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [ tyr - d - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [ tyr ( me )- 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [ tyr - d - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 2 - nal - nle - htyr - z -], cyclo [- phe - d - 2 - nal - nle - htyr - z -], cyclo [- tyr - 2 - nal - nle - htyr - z -], cyclo [- tyr - d - 2 - nal - nle - htyr - z -], cyclo [- tyr ( me )- 2 - nal - nle - htyr - z -], cyclo [- phe - 2 - nal - nle - pra - z -], cyclo [- phe - d - 2 - nal - nle - pra - z -], cyclo [- tyr - 2 - nal - nle - pra - z -], cyclo [- tyr - d - 2 - nal - nle - pra - z -], cyclo [- tyr ( me )- 2 - nal - nle - pra - z -], cyclo [- phe - bta - nle - phe - z -], cyclo [- phe - d - bta - nle - phe - z -], cyclo [- tyr - bta - nle - phe - z -], cyclo [- tyr - d - bta - nle - phe - z -], cyclo [- tyr ( me )- bta - nle - phe - z -], cyclo [- tyr ( me )- d - bta - nle - phe - z -], cyclo [- phe - bta - nle - thr - z -], cyclo [- phe - d - bta - nle - thr - z -], cyclo [- phe - bta - nle - tyr ( bzl )- z -], cyclo [- phe - d - bta - nle - tyr ( bzl )- z -], cyclo [- phe - bta - nle - bip - z -], cyclo [- phe - d - bta - nle - bip - z -], cyclo [- phe - bta - nle - dip - z -], cyclo [- phe - d - bta - nle - dip - z -], cyclo [- phe - bta - nle - bpa - z -], cyclo [- phe - d - bta - nle - bpa - z -], cyclo [- phe - bta - nle - b - nal - z -], cyclo [- phe - d - bta - nle - 1 - nal - z -], cyclo [- phe - bta - nle - 2 - nal - z -], cyclo [- phe - d - bta - nle - 2 - nal - z -], cyclo [- phe - bta - nle - p - fluoro - phe - z -], cyclo [- phe - d - bta - nle - p - fluoro - phe - z -], cyclo [- phe - bta - nle - phe ( f5 )- z -], cyclo [- phe - d - bta - nle - phe ( f5 )- z -], cyclo [- phe - bta - nle - o - fluoro - phe - z ], cyclo [- phe - d - bta - nle - o - fluoro - phe - z -], cyclo [- phe - bta - nle - m - fluoro - phe - z -], cyclo [- phe - d - bta - nle - m - fluoro - phe - z -], cyclo [- phe - bta - nle - thr ( ar )- z -], cyclo [- phe - d - bta - nle - thr ( ar )- z -], cyclo [- phe - bta - nle - thr ( bn )- z -], cyclo [- phe - d - bta - nle - thr ( bn )- z -], cyclo [- phe - bta - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - bta - nle - p - chloro - phe - z -], cyclo [- phe - d - bta - nle - p - chloro - phe - z -], cyclo [- phe - bta - nle - phe ( c15 )- z -], cyclo [- phe - d - bta - nle - phe ( c15 )- z -], cyclo [- phe - bta - nle - o - chloro - phe - z -], cyclo [- phe - d - bta - nle - o - chloro - phe - z -], cyclo [- phe - bta - nle - m - chloro - phe - z -], cyclo [- phe - d - bta - nle - m - chloro - phe - z -], cyclo [- phe - bta - nle - thr ( ar )- z -], cyclo [- phe - bta - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- phe - bta - nle - 3 - pal - z -], cyclo [- phe - d - bta - nle - 3 - pal - z -], cyclo [- tyr - bta - nle - 3 - pal - z -], cyclo [- tyr - d - bta - nle - 3 - pal - z -], cyclo [- tyr ( me )- bta - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - bta - nle - 3 - pal - z -], cyclo [- phe - bta - nle - 4 - pal - z -], cyclo [- phe - d - bta - nle - 4 - pal - z -], cyclo [- tyr - bta - nle - 4 - pal - z -], cyclo [- tyr - d - bta - nle - 4 - pal - z -], cyclo [- tyr ( me )- bta - nle - 4 - pal - z -], cyclo [- phe - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - phg - z -], cyclo [- phe - d - bta - nle - phg - z -], cyclo [- tyr - bta - nle - phg - z -], cyclo [- tyr - d - bta - nle - phg - z -], cyclo [- tyr ( me )- bta - nle - phg - z -], cyclo [- phe - bta - nle - hphe - z -], cyclo [- phe - d - bta - nle - hphe - z -], cyclo [- tyr - bta - nle - hphe - z -], cyclo [- tyr - d - bta - nle - hphe - z -], cyclo [- tyr ( me )- bta - nle - hphe - z -], cyclo [- phe - bta - nle - igl - z -], cyclo [- phe - d - bta - nle - igl - z -], cyclo [- tyr - bta - nle - igl - z -], cyclo [- tyr - d - bta - nle - igl - z -], cyclo [- tyr ( me )- bta - nle - igl - z -], cyclo [- phe - bta - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - no2 )- z -], cyclo [- phe - bta - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - nhz )- z -], cyclo [- phe - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - bta - nle - htyr - z -], cyclo [- phe - d - bta - nle - htyr - z -], cyclo [- tyr - bta - nle - htyr - z -], cyclo [- tyr - d - bta - nle - htyr - z -], cyclo [- tyr ( me )- bta - nle - htyr - z -], cyclo [- phe - bta - nle - pra - z -], cyclo [- phe - d - bta - nle - pra - z -], cyclo [- tyr - bta - nle - pra - z -], cyclo [- tyr - d - bta - nle - pra - z ], cyclo [- phe - trp - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - trp - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - trp - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - trp lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- trp - lys - nle ( 6 - obzl )- z -], cyclo [- phe - trp - lys - 3 - pal - z -], cyclo [- phe - d - trp - lys - 3 - pal - z -], cyclo [- tyr - trp - lys - 3 - pal - z -], cyclo [- tyr - d - trp - lys - 3 - pal - z -], cyclo [- tyr ( me )- trp - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - trp - lys - 3 - pal - z -], cyclo [- phe - trp - lys - 4 - pal - z -], cyclo [- phe - d - trp - lys - 4 - pal - z -], cyclo [- tyr - trp - lys - 4 - pal - z -], cyclo [- tyr - d - trp - lys - 4 - pal - z -], cyclo [- tyr ( me )- trp - lys - 4 - pal - z -], cyclo [- phe - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - trp - lys - phg - z -], cyclo [- phe - d - trp - lys - phg - z -], cyclo [- tyr - trp - lys - phg - z -], cyclo [- tyr - d - trp - lys - phg - z -], cyclo [- tyr ( me )- trp - lys - phg - z -], cyclo [- phe - trp - lys - hphe - z -], cyclo [- phe - d - trp - lys - hphe - z -], cyclo [- tyr - trp - lys - hphe - z -], cyclo [- tyr - d - trp - lys - hphe - z -], cyclo [- tyr ( me )- trp ,- lys - hphe - z -], cyclo [- phe - trp - lys - igl - z -], cyclo [- phe - d - trp - lys - igl - z -], cyclo [- tyr - trp - lys - igl - z -], cyclo [- tyr - d - trp - lys - igl - z -], cyclo [- tyr ( me )- trp - lys - igl - z -], cyclo [- phe - trp - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - no2 )- z -], cyclo [- phe - trp - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - nhz )- z -], cyclo [- phe - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - trp - lys - htyr - z -], cyclo [- phe - d - trp - lys - htyr - z -], cyclo [- tyr - trp - lys - htyr - z -], cyclo [- tyr - d - trp - lys - htyr - z -], cyclo [- tyr ( me )- trp - lys - htyr - z -], cyclo [- phe - trp - lys - pra - z -], cyclo [- phe - d - trp - lys - pra - z -], cyclo [- tyr - trp - lys - pra - z -], cyclo [- tyr - d - trp - lys - pra - z -], cyclo [- tyr ( me )- trp - lys - pra - z -], cyclo [- phe - 1 - nal - lys - phe - z -], cyclo [- phe - d - 1 - nal - lys - phe - z -], cyclo [- tyr - 1 - nal - lys - phe - z -], cyclo [- tyr - d - 1 - nal - lys - phe - z -], cyclo [- tyr ( me )- 1 - nal - lys - phe - z -], cyclo [- tyr ( me )- d - 1 - nal - lys - phe - z -], cyclo [- phe - 1 - nal - lys - thr - z -], cyclo [- phe - d - 1 - nal - lys - thr - z -], cyclo [- phe - 1 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - d - 1 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - 1 - nal - lys - bip - z -], cyclo [- phe - d - 1 - nal - lys - bip - z -], cyclo [- phe - 1 - nal - lys - dip - z -], cyclo [- phe - d - 1 - nal - lys - dip - z -], cyclo [- phe - 1 - nal - lys - bpa - z -], cyclo [- phe - d - 1 - nal - lys - bpa - z -], cyclo [- phe - 1 - nal - lys - 1 - nal - z -], cyclo [- phe - d - 1 - nal - lys - 1 - nal - z -], cyclo [- phe - 1 - nal - lys - 2 - nal - z -], cyclo [- phe - d - 1 - nal - lys - 2 - nal - z -], cyclo [- phe - 1 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - phe ( f5 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( f5 )- z -], cyclo [- phe - 1 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - d - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - 1 - nal - lys - thr ( bn )- z -], cyclo [- phe - d - 1 - nal - lys - thr ( bn )- z -], cyclo [- phe - 1 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - p - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - p - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - phe ( c15 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( c15 )- z -], cyclo [- phe - 1 - nal - lys - o - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - o - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - m - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - m - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - 1 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - na - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [ phe - d - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 - pal - z -], cyclo [- phe - d - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr - d - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- 1 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - 1 - nal - lys - 3 - pal - z -], cyclo [- phe - 1 - nal - lys - 4 - pal - z -], cyclo [- phe - d - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr - d - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr ( me )- 1 - nal - lys - 4 - pal - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - phg - z -], cyclo [- phe - d - 1 - nal - lys - phg - z -], cyclo [- tyr - 1 - nal - lys - phg - z -], cyclo [- tyr - d - 1 - nal - lys - phg - z -], cyclo [- tyr ( me )- 1 - nal - lys - phg - z -], cyclo [- phe - 1 - nal - lys - hphe - z -], cyclo [- phe - d - 1 - nal - lys - hphe - z -], cyclo [- tyr - 1 - nal - lys - hphe - z -], cyclo [- tyr - d - 1 - nal - lys - hphe - z -], cyclo [- tyr ( me )- 1 - nal - lys - hphe - z -], cyclo [- phe - 1 - nal - lys - igl - z -], cyclo [- phe - d - 1 - nal - lys - igl - z -], cyclo [- tyr - 1 - nal - lys - igl - z -], cyclo [- tyr - d - 1 - nal - lys - igl - z -], cyclo [- tyr ( me )- 1 - nal - lys - igl - z ], cyclo [- phe - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me ) 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 1 - nal - lys - htyr - z -], cyclo [- phe - d - 1 - nal - lys - htyr - z -], cyclo [- tyr - 1 - nal - lys - htyr - z -], cyclo [- tyr - d - 1 - nal - lys - htyr - z -], cyclo [- tyr ( me )- 1 - nal - lys - htyr - z -], cyclo [- phe - 1 - nal - lys - pra - z -], cyclo [- phe - d - 1 - nal - lys - pra - z -], cyclo [- tyr - 1 - nal - lys - pra - z -], cyclo [- tyr - d - 1 - nal - lys - pra - z -], cyclo [- tyr ( me )- 1 - nal - lys - pra - z -] cyclo [- phe - 2 - nal - lys - phe - z -], cyclo [- phe - d - 2 - nal - lys - phe - z -], cyclo [- tyr - 2 - nal - lys - phe - z -], cyclo [- tyr - d - 2 - nal - lys - phe - z -], cyclo [- tyr ( me )- 2 - nal - lys - phe - z -], cyclo [- tyr ( me )- d - 2 - nal - lys - phe - z -], cyclo [- phe - 2 - nal - lys - thr - z -], cyclo [- phe - d - 2 - nal - lys - thr - z -], cyclo [- phe - 2 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - d - 2 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - 2 - nal - lys - bip - z -], cyclo [- phe - d - 2 - nal - lys - bip - z -], cyclo [- phe - 2 - nal - lys - dip - z -], cyclo [- phe - d - 2 - nal - lys - dip - z -], cyclo [- phe - 2 - nal - lys - bpa - z -], cyclo [- phe - d - 2 - nal - lys - bpa - z -], cyclo [- phe - 2 - nal - lys - 2 - nal - z -], cyclo [- phe - d - 2 - nal - lys - 2 - nal - z -], cyclo [- phe - 2 - nal - lys - 1 - nal - z -], cyclo [ phe - d - 2 - nal - lys - 1 - nal - z -], cyclo [- phe - 2 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - phe ( f5 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( f5 )- z -], cyclo [- phe - 2 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - d - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - 2 - nal - lys - thr ( bn )- z -], cyclo [- phe - d - 2 - nal - lys - thr ( bn )- z -], cyclo [- phe - 2 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - p - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - p - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - phe ( c15 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( c15 )- z -], cyclo [- phe - 2 - nal - lys - o - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - o - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - m - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - m - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - 2 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 - pal - z -], cyclo [- phe - d - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr - d - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- 2 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - 2 - nal - lys - 3 - pal - z -], cyclo [- phe - 2 - nal - lys - 4 - pal - z -], cyclo [- phe - d - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr - d - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr ( me )- 2 - nal - lys - 4 - pal - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - phg - z -], cyclo [- phe - d - 2 - nal - lys - phg - z -], cyclo [- tyr - 2 - nal - lys - phg - z -], cyclo [- tyr - d - 2 - nal - lys - phg - z -], cyclo [- tyr ( me )- 2 - nal - lys - phg - z -], cyclo [- phe - 2 - nal - lys - hphe - z -], cyclo [- phe - d - 2 - nal - lys - hphe - z -], cyclo [- tyr - 2 - nal - lys - hphe - z -], cyclo [- tyr - d - 2 - nal - lys - hphe - z -], cyclo [- tyr ( me )- 2 - nal - lys - hphe - z -], cyclo [- phe - 2 - nal - lys - igl - z -], cyclo [- phe - d - 2 - nal - lys - igl - z -], cyclo [- tyr - 2 - nal - lys - igl - z -], cyclo [- tyr - d - 2 - nal - lys - igl - z -], cyclo [- tyr ( me )- 2 - nal - lys - igl - z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 2 - nal - lys - htyr - z -], cyclo [- phe - d - 2 - nal - lys - htyr - z -], cyclo [- tyr - 2 - nal - lys - htyr - z -], cyclo [- tyr - d - 2 - nal - lys - htyr - z -], cyclo [- tyr ( me )- 2 - nal - lys - htyr - z -], cyclo [- phe - 2 - nal - lys - pra - z -], cyclo [- phe - d - 2 - nal - lys - pra - z -], cyclo [- tyr - 2 - nal - lys - pra - z -], cyclo [- tyr - d - 2 - nal - lys - pra - z -], cyclo [- tyr ( me )- 2 - nal - lys - pra - z -], cyclo [- phe - bta - lys - phe - z -], cyclo [- phe - d - bta - lys - phe - z -], cyclo [ tyr - bta - lys - phe - z -], cyclo [- tyr - d - bta - lys - phe - z -], cyclo [- tyr ( me )- bta - lys - phe - z -], cyclo [- tyr ( me )- d - bta - lys - phe - z -], cyclo [- phe - bta - lys - thr - z -], cyclo [- phe - d - bta - lys - thr - z -], cyclo [- phe - bta - lys - tyr ( bzl )- z -], cyclo [- phe - d - bta - lys - tyr ( bzl )- z -], cyclo [ phe - bta - lys - bip - z -], cyclo [- phe - d - bta - lys - bip - z -], cyclo [- phe - bta - lys - dip - z -], cyclo [- phe - d - bta - lys - dip - z -], cyclo [- phe - bta - lys - bpa - z -], cyclo [- phe - d - bta - lys - bpa - z -], cyclo [- phe - bta - lys - 1 - nal - z -], cyclo [- phe - d - bta - lys - 1 - nal - z -], cyclo [- phe - bta - lys - 2 - nal - z -], cyclo [- phe - d - bta - lys - 2 - nal - z -], cyclo [- phe - bta - lys - p - fluoro - phe - z -], cyclo [- phe - d - bta - lys - p - fluoro - phe - z -], cyclo [- phe - bta - lys - phe ( f5 )- z -], cyclo [- phe - d - bta - lys - phe ( f5 )- z -], cyclo [- phe - bta - lys - o - fluoro - phe - z -], cyclo [- phe - d - bta - lys - o - fluoro - phe - z -], cyclo [- phe - bta - lys - m - fluoro - phe - z -], cyclo [- phe - d - bta - lys - m - fluoro - phe - z -], cyclo [- phe - bta - lys - thr ( ar )- z -], cyclo [- phe - d - bta - lys - thr ( ar )- z -], cyclo [- phe - bta - lys - thr ( bn )- z -], cyclo [- phe - d - bta - lys - thr ( bn )- z -], cyclo [- phe - bta - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - bta - lys - p - chloro - phe - z -], cyclo [- phe - d - bta - lys - p - chloro - phe - z -], cyclo [- phe - bta - lys - phe ( c15 )- z -], cyclo [- phe - d - bta - lys - phe ( c15 )- z -], cyclo [- phe - bta - lys - o - chloro - phe - z -], cyclo [- phe - d - bta - lys - o - chloro - phe - z -], cyclo [- phe - bta - lys - m - chloro - phe - z -], cyclo [- phe - d - bta - lys - m - chloro - phe - z -], cyclo [- phe - bta - lys - thr ( ar )- z -], cyclo [- phe - bta - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- phe - bta - lys - 3 - pal - z -], cyclo [- phe - d - bta - lys - 3 - pal - z -], cyclo [- tyr - bta - lys - 3 - pal - z -], cyclo [- tyr - d - bta - lys - 3 - pal - z ], cyclo [- tyr ( me )- bta - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - bta - lys - 3 - pal - z -], cyclo [- phe - bta - lys - 4 - pal - z -], cyclo [- phe - d - bta - lys - 4 - pal - z -], cyclo [- tyr - bta - lys - 4 - pal - z -], cyclo [- tyr - d - bta - lys - 4 - pal - z -], cyclo [- tyr ( me )- bta - lys - 4 - pal - z -], cyclo [- phe - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - phg - z -], cyclo [- phe - d - bta - lys - phg - z -], cyclo [- tyr - bta - lys - phg - z -], cyclo [- tyr - d - bta - lys - phg - z -], cyclo [- tyr ( me )- bta - lys - phg - z -], cyclo [- phe - bta - lys - hphe - z -], cyclo [- phe - d - bta - lys - hphe - z -], cyclo [- tyr - bta - lys - hphe - z -], cyclo [- tyr - d - bta - lys - hphe - z -], cyclo [- tyr ( me )- bta - lys - hphe - z -], cyclo [- phe - bta - lys - igl - z -], cyclo [- phe - d - bta - lys - igl - z -], cyclo [- tyr - bta - lys - igl - z -], cyclo [- tyr - d - bta - lys - igl - z -], cyclo [- tyr ( me )- bta - lys - igl - z -], cyclo [- phe - bta - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - no2 )- z -], cyclo [- phe - bta - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - nhz )- z -], cyclo [- phe - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - bta - lys - htyr - z -], cyclo [- phe - d - bta - lys - htyr - z -], cyclo [- tyr - bta - lys - htyr - z -], cyclo [- tyr - d - bta - lys - htyr - z -], cyclo [- tyr ( me )- bta - lys - htyr - z -], cyclo [- phe - bta - lys - pra - z -], cyclo [- phe - d - bta - lys - pra - z -], cyclo [- tyr - bta - lys - pra - z -], cyclo [- tyr - d - bta - lys - pra - z ], cyclo [- phe - d - trp - nle - tyr ( bzl )- z -], cyclo [- phe - trp - nle - tyr ( bzl )- z -], cyclo [- tyr - d - trp - nle - tyr ( bzl )- z -], cyclo [- tyr - trp - nle - tyr ( bzl )- z -], cyclo [- phe - d - bta - nle - tyr ( bzl )- z -], cyclo [- phe - bta - nle - tyr ( bzl )- z -], cyclo [- tyr - d - bta - nle - tyr ( bzl )- z -], cyclo [- tyr - btqa - nle - tyr ( bzl )- z -], and cyclo [- tyr ( me )- bta - lys - pra - z -]. also preferred are all the linear peptides which may be derived by replacing a peptide linkage in the above - mentioned sequences with the terminal groups y 1 and y 2 . a few representatives of the peptides of the invention are graphically shown in the following : the general synthesis of the z groups and of the peptide of the invention are described below . a ) tf 2 o , py , − 10 ° c ., ch 2 cl 2 ; b ) nan 3 , bu 4 ncl ( cat ), 50 ° c ., dmf ; c ) 77 % hoac , 3 h , 65 ° c . ; d ) naio 4 , 5 h , 10 ° c ., meoh ; e ) kmno 4 , 50 % hoac , rt ; f ) h 2 , pd / c , meoh , fmoccl , nahco 3 , ph 8 - 9 , thf , meoh , rt , 90 %; g ) naocl , tempo ( cat ), kbr , ch 2 cl 2 , sat . aq nahco 3 , bu 4 ncl , 62 %. scheme 1 shows the synthesis of two fmoc - protected z groups ( 1 and 2 ). both are synthesised using the azides 6 and 7 . the decisive step is acidolysis of diacetone glucose activated over triflate ester . the use of nan 3 and of catalytic amounts of tetrabutylammonium chloride ( bu 4 ncl ) is preferred . the azide 6 may be obtained after 3 to 5 hours by reacting triflyl - activated diacetone glucose with 1 . 8 to 2 . 5 , preferably 1 . 8 to 2 . 2 equivalents of nan 3 in dmf at 30 to 90 ° c ., preferably 40 to 60 ° c . the use of two equivalents at 50 ° c . yields optimum results . catalytic amounts of bu 4 ncl are used to suppress the elimination reaction and to increase the solubiltiy of nan 3 . this affords yields of about 70 %. azidolysis is followed by deprotection of the exocyclic hydroxyl groups . this may be carried out at quantitative yields by means of acetic acid at a temperature of 20 to 120 ° c ., preferably 70 to 115 ° c . (( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 , 1983 ; 2126 - 2131 1983 , 53 , 1917 ). in order to obtain the fmoc - protected compound 1 , the diol 7 is cleaved oxidatively with naio 4 and then kmno 4 . these reagents are used in a relative amount of 1 . 1 to 2 . 5 , preferably 1 . 5 to 2 . 2 . suitable reaction temperatures are in the range of 10 to 30 ° c ., preferably 20 to 25 ° c . in a one - pot reaction , the - azide 8 is simultaneously reduced with a yield of 70 % and fmoc - protected to obtain 1 . with stirring , a solution of the azide in meoh / h 2 o ( 2 : 1 , 0 , 15 mol / l ) is adjusted to a ph of 8 with saturated nahco 3 . for this purpose , a solution of fmoc - cl ( 1 . 0 bis 1 . 5 equiv ., preferably 1 . 1 equiv .) in thf ( 0 . 1 bis 0 . 2 mol / l , preferably 0 . 16 mol / l ) is added , followed by the addition of the catalyst ( pd / c , 10 wt .-%, wet 49 . 7 wt -.% h 2 o , eg . degussa e 101 ; 1 g of catalyst per 1 g of azide ). the suspension is washed with h 2 several times . in general , the reaction is completed in 18 to 24 hrs . ( control via thin - layer chromatography ). the solvents are removed at reduced pressure . the residue is suspended in water and adjusted to a ph of 8 to 9 with saturated nahco 3 and the aqueous phase extracted three times with ethyl acetate . the combined organic phases are washed three times with aqueous nahco 3 solution . the aqueous phase is adjusted to a ph of 1 with mol / l hcl and then extracted three times with ethyl acetate . the combined organic phases are washed with a saturated aqueous nacl solution dried over mgso 4 and concentrated under reduced pressure . in order to prepare 2 , the azide 7 is reduced in a one - pot reaction under similar conditions as for 8 and fmoc - protected . after that , the primary alcohol of the product 9 is selectively oxidised with 2 , 2 , 6 , 6 - tetramethylpiperidine - 1 - oxyl ( tempo ), sodium hypochlorite und kbr to yield 2 . for this purpose , relative amounts of 0 . 005 to 0 . 2 parts of tempo , 1 to 5 parts of sodium hypochlorite and 0 . 5 to 5 kbr , in each case based on 100 mol equivalents of compound 9 , are suitable . in order to avoid decarboxylation during oxidation , it is essential to maintain the ph between 8 . 5 and 9 . 5 and the temperature below 0 ° c . preferred reaction temperatures are in the range of − 10 to 0 ° c . other z groups may be prepared by the following methods described in literature : t . k . chakraborty , s . gosh , s . jayaprakash , j . a . r . p . sharma , v . ravikanth , p . v . diwan , r . nagaraj , a . c . kunwar , j . org . chem . 2000 , 65 ; m . d . smith , d . d . long , a . martin , d . g . marquess , t . d . e . claridge , g . w . j . fleet , tetrahedron lett . 1999 , 40 , 2191 ; t . d . w . claridge , d . d . long , n . l . hungerford , r . t . aplin , m . d . smith , d . g . marquess , g . w . j . fleet , tetrahedron lett . 1999 , 40 , 2199 ; m . shiozaki , n . ishida , s . sato , bull . chem . soc . jpn . 1989 , 62 , 3950 . in addition , suitable z groups may also be prepared according to wo 95 / 07022 a , ep 0 538 691 a , ep 0 538 692 a , yaoxue xuebao 1985 , 20 ( 3 ), 214 - 218 ; j . nat . sci . math . 1983 , 23 ( 1 ), 107 - 112 ; russ . j . bioorg . chem . 2000 , 26 ( 11 ), 774 - 783 ; phytochemistry 2000 , 53 ( 2 ), 231 - 237 ; left . pept . sci . 1995 , 2 ( 3 / 4 ), 253 - 258 ; jp 46025379 b ; seikagaku 1968 , 40 ( 11 ), 823 - 837 ; liver res ., trans . int . symp . 3rd , tokyo , kyoto 1967 , meeting date 1966 , 321 - 330 ; j . chem . 1967 , 20 ( 12 ), 2701 - 2713 ; aust . j . chem . 1967 , 20 ( 7 ), 1493 - 1509 ; nippon yakuzaishikai zasshi 1966 , 62 , 297 - 306 ; hsueh pao [ acta pharmaceutica sinica ] 1985 , 20 ( 3 ), 214 - 218 . peptide synthesis is carried out according to standard procedures on the solid phase or in solution . reference is made to g . b . fields , r . l . nobel , int . j . pept . protein res . 1990 , 35 , 161 - 214 and to the following general operating instructions “ beladung von tcp - harz ” ( loading of tcp resin ) and “ abspaltbedingungen für peptide von tcp - harz ” ( cleaving conditions for peptides of tcp resins ), form sheets by pepchem , goldhammer & amp ; clausen , im winkelrain 73 , d - 72076 tübingen , germany ; fax ++ 49 70 71 600 393 ; tel . : ++ 49 - 7071 - 600384 ; novabiochem catalog 2000 : “ useful information , nomenclature , abbreviations ” pages x - xi . and “ synthesis notes ” edited by b . dörner & amp ; p . white ; pages i - ii , i1 - i16 , s1 - s54 , p1 - p34 , b1 - b16 , r1 - r16 , al - 16 calbiochem - novabiochem gmbh , p . o box 1167 , 65796 bad soden ; tel . : 0800 - 6931000 or 06196 - 63955 ; fax : ++ 49 - 6196 - 62361 . reference is also made to solid - phase synth . 2000 , 377 - 418 and to r . knorr , a . trzeciak , w . bannwarth , d . gillessen , tetrahedron lett . 1989 , 30 , 1927 - 1930 . the use of the reagents hatu / hoat is described in l . a . carpino , a . el - faham , f . albericio , tetrahedron lett . 1994 , 35 , 2279 - 2282 and in l . a . carpino , a . el - faham , c . a . minor , f . albericio , j . chem . soc . chem . commun . 1994 , 2 , 201 - 203 . the cleavage with hfip is disclosed in r . bollhagen , m . schmiedberger , k . barlos , e . grell , j . chem . soc ., chem . commun . 1994 , 22 , 2559 - 2560 and the use of the ivdde - protecting group is described in s . r . chhabra , b . hothi , d . j . evans , p . d . white , b . w . bycroft , w . c . chan , tetrahedron lett . 1998 , 39 , 1603 - 1606 . the cyclization with dppa is described in t . shioiri , k . ninomiya , s . yamada , j . am . chem . soc . 1972 , 94 , 6203 - 6205 and in s . f . brady , w . j . paleveda , b . h . arison , r . m . freidinger , r . f . nutt , d . f . veber , in 8th am . pept . symp . ( eds . : v . j . hruby , d . h . rich ), pierce chem . co ., rockford , ill ., usa , tuscon , ariz ., usa , 1983 , pp . 127 - 130 . the application of the peptides of the invention as anti - tumour agents is made in accordance with standard methods known to skilled practitioners from the prior art . among others , such applications include the use of the peptide of the invention together with the usual , pharmaceutically acceptable excipients and / or the usual pharmaceutically acceptable carriers for preparing a pharmaceutical composition . such pharmaceutical compositions may be used for the therapy of tumours . as a rule , all tumours bearing somatostatin receptors may be treated . among others , these are tumours of the pituitary gland , mamma carcinomas , glucagonomas , renal carcinomas , prostate carcinomas , meningiomas , gliomas , pancreas tumours , insulinomas and liver tumours . the treatment of the tumours is also carried out in accordance with standard procedures . 5 . the use of the somatostatin derivatives as diagnostic agents for tumours methods for tumour diagnosis by means of positron - emission tomography ( pet ) and radioscintigraphie as well as other radiodiagnostic methods are known to skilled practitioners from the prior art . this also applies for the radionuclides to be used for this purpose and their suitable complexing agents and bifuntional chelators [ chemical reviews thematic issue : medicinal inorganic chemistry ; september 1999 volume 99 , no . 9 ; guest editors : chris orvig , university of british columbia ; michael j . abrams , anormed , inc .]. by way of example , reference is made to the following four publications describing the use of the 18 f isotope for tumour diagnosis ( r . haubner , h .- j . wester , w . weber , c . mang , s . ziegler , r . senekowitsch - schmidtke , h . kessler , m . schwaiger , cancer research 2000 , 61 , 1781 ), and of the 125 i - isotope ( r . haubner , h .- j . wester , u . reuning , r . senekowitsch - schmidtke , b . diefenbach , h . kessler , g . stöcklin , m . schwaiger , j . nucl . med . 1999 , 40 , 1061 ), and of that of metallic radioisotopes such as 111 in and 99m tc and suitable bifunctional chelators . chemical reviews thematic issue : medicinal inorganic chemistry ; september 1999 volume 99 , no . 9 radiometal - labeled agents ( non - technetium ) for diagnostic imaging carolyn j . anderson and michael j . welch pp 2219 - 2234 and 99 mtc - labeled small peptides as diagnostic radiopharmaceuticals shuang liu and d . scott edwardspp 2235 - 2268 . thus , the present invention also relates to compounds which are derived from the peptides according to claims 1 to 31 , and which contain a radionuclide that is linked to the peptide . neither the radionuclide to be incorporated into the peptide of the invention nor the method of binding it and its position within the peptide is limited , provided the binding to the somatostatin receptor is not adversely affected and / or the peptide is internalised by tumour cells , so that a signal may be observed with appropriate measurement techniques , that may be used to discriminate the enrichment in tumour tissue from healthy tissue , thereby permitting the diagnosis of tumours . incorporation of 125 i and 131 i into the side chain of tyrosine in the radicals a and d is preferred . the incorporation of 99m tc and 111 in , 6768 ga , 90 / 86 y , 64 cu via complexing agents and bifuntional chelators such as dota , dtpa ( diethylenetriaminepentaacetic acid ), edta ( ethylenediiaminetetraacetic acid ), dfo ( desferrioxamine - b ) or short peptides such as cys - gly - cys , lys - gly - cys or diamidedithiol ( dads ) linked to the z residue are also preferred . the incorporation of 125 i adjacent to the oh group of tyrosine is particularly preferred . 6 . the use of the tetra - and pentapeptides of the present invention as anti - inflammatory or analgetic agents this aspect of the present invention is based on the recognition that the development of neurogenic and non - neurogenic inflammations can be prevented and an alleviation of pain can be accomplished by using the compounds of the present invention . although , as indicated above , somatostatin prevents the experimentally induced neurogenic inflammation , it cannot therapeutically be taken into consideration because of its broad spectrum of activities and its short half life in the human body . thus the invention relates to the use of tetra - or pentapeptides as described in the claims 1 - 31 as well as the salts of these compounds for the preparation of pharmaceutical compositions possessing neurogenic or non - neurogenic anti - inflammatory as well as analgetic effects . a common characteristic of the pharmaceutical compostitions prepared by the process of invention is that they inhibit the substance p release ( and thus inflammation processes ) to a greater extent than natural somatostatin does and in the same range as tt232 does , but they are more stable under the conditions of use . according to the invention , pharmaceutical compositions useful for the inhibition of neurogenic and non - neurogenic inflammations and for pain alleviation can be prepared by mixing the compounds of claims 1 - 31 , the salts or metal complexes thereof with carriers and / or auxiliaries commonly used in the pharmaceutical industry , thereby transforming them into pharmaceutical compositions . the pharmaceutical composition for the therapeutic use may contain any solvent suitable for pharmaceutical use ( e . g . water , aqueous solution containing thioalcohol and / or polyalcohol such as polyethylene glycol and / or glycerol etc . ); salts ( e . g . sodium chloride for adjustment of the physiological osmotic pressure ; iron cobalt , zinc or copper chlorides and the like for supplementing trace elements ); fillers and carriers ( e . g . lactose , potato starch , talc , magnesium carbonate , calcium carbonate , waxes , vegetable oils , polyalcohols etc . ); auxiliaries promoting dissolution ( such as certain polar solvents , in the case of water usually ethanol , polyalcohols , most frequently polyethylene glycol or glycerol and / or complex forming agents , e . g . cyclodextrins , crown ethers , natural proteins , saponins and the like ); tablet - disintegrating agents ( artificial or natural polymers strongly swelling in water , e . g . carboxymethylcellulose ); complex - forming agents usually employed in retard compositions ( such as water - insolble or slightly soluble cyclodextrin derivatives , artificial and natural polymers , crown ethers and the like ); ph - adjusting compounds such as mineral or organic buffers ; taste - improving agents ( cyclodextrins and / or crown ethers ); and flavouring agents ( beet sugar , fruit sugar or grape sugar , saccharin , invert sugar etc . ); antioxidants ( e . g . vitamin c ) as well as substances promoting the effectiveness of the action of compounds of claims 1 - 31 . the compounds of claims 1 - 31 are useful also in aerosol compositions aimed at the absorption through the skin surface or lungs . for the preparation of tablets , dragées or hard gelatine capsules e . g . lactose , maize , wheat or potato starches , talc , magnesium carbonate , stearic acid and its salts etc . can be used as carriers . for the preparation of soft gelatine capsules e . g . vegetable oils , fats , waxes , or polyalcohols with an appropriate density can be used as carriers . for the preparation of solutions and syrups e . g . water , polyalcohols such as polyethylene glycol and glycerol , beet sugar , grape sugar , etc . can be employed as carriers . parenteral compositions may contain water , alcohol , polyalcohols or vegetable oils as carriers . suppositories may contain e . g . oils , waxes , fats or polyalcohols of appropriate density as carriers . suitable doses of the active ingredients can be determined in accordance with standard procedures that are known to the person skilled in the art . typical doses may be in the range of 0 . 5 to 5000 μg / kg of body weight . however , higher or lower doses may also be appropriate , depending on the individual case and on the active ingredient that is used . it allows to diminish inflammations of both neurogenic and non - neurogenic orignin with simultaneous exertion of an analgetic effect . the somatostatin analogues used in the invention are more slowly decomposed under in vivo conditions than the natural compound ; therefore their action is more durable . all solvents for moisture sensitive reactions were distilled and dried in accordance with standard procedures . the pd / c used is a donation from degussa , frankfurt / main , germany . column chromatographies at increased pressure were carried out with the solvents specified on silica gel 60 , 230 - 400 mesh ( merck kgaa , darmstadt ). tritylchloropolystyrene resin by pepchem goldammer & amp ; clausen and hatu by perseptive biosystems were used for solid phase syntheses . all reactions in a solution were monitored by means of thin - layer chromatography ( 0 . 25 mm precoated silica gel 60 f 254 aluminium plates ; merck kgaa , darmstadt ). melting points were measued with a bütchi - tottoli apparatus and reported in uncorrected form . analytical and semi - preparative reverse - phase - hplc was carried out with the aid of waters equipment ( high pressure pump 510 , multi - wavelength detector 490e , chromatography workstation maxima 820 ), an apparatus from beckman ( high pressure pump 110b , gradient mixer , controller 420 , uv detector uvicord by knauer ) or a device by amersham pharmacia biotech ( äkta basic 10 / 100 , autosampler a - 900 ). the preparative reverse - phase - hplc was carried out on a beckman system gold ( high pressure pump module 126 , uv detector 166 ). c 18 columns ( by - ymc ) were used for the chromatographies . the solvents used were a : h 2 o + 0 . 1 % cf 3 cooh and b : ch 3 cn + 0 . 1 % cf 3 cooh . detection was carried out at 220 and 254 nm . [ 0131 ] 1 h and 13 c nmr spectra of the compounds were taken on apparatuses by bruker , karlsruhe ( bruker — ac 250 , bruker dmx - 500 or bruker dmx - 600 ). references for the chemical shift of the proton resonances were chcl 3 ( δ = 7 . 24 ) and dmso ( δ = 2 . 49 ), respectively . multiplets were noted as s ( singlet ), d ( doublet ), t ( triplet ), q ( quartet ), m ( multiplet ), and br ( broad ). the chemical shift for 13 c resonances is reported in relation to cdcl 3 ( δ = 77 . 0 ) and [ d 6 ] dmso ( δ = 39 . 5 ), respectively . die nmr data were processed on a bruker x32 work station using uxnmr software . the allocation of the proton and carbon signals was carried out by means of hmqc , cosy , tocsy and hmbc experiments . where possible , coupling constants were determined from the corresponding 1d - spectra as well as cosy dqf and cosype spectra . hplc - esi mass spectra were prepared on a finnigan device ( ncq - esi with hplc conjunction lcq ; hplc system hewlett packard hp 1100 ; nucleosil 100 5c 18 ). high - resolution mass spectra were recorded on a finnigan mat 95q with fab ( cs + ions and m - nitrobenzyl alcohol as matrix ). in the following experiments , every step is taken at room temperature ( 18 to 25 ° c .) unless explicitly specified otherwise . preparation of the furanoid z group from diacetone glucose which is available commercially and inexpensively both groups z1 und z2 are prepared in accordance with the above scheme 1 . 1 , 2 : 5 , 6 - di - o - isopropylidene - 3 - o - triflyl - α - d - glucofuranose : triflic anhydride ( 54 . 2 g , 0 . 19209 mol ) was slowly added with stirring to a solution of diacetone glucose ( 25 g , 0 . 96 mol ) and pyridine ( 30 . 39 g , 0 . 384 mol ) in ch 2 cl 2 ( 1 l ) in a 3 - neck flask at − 10 ° c . ( acetone - ice cooling bath ) ( l . d . hall , d . c . miller , carbohydr . res . 1976 , 47 , 299 ; r . w . binkley , m . g . ambrose , d . g . hehemann , j . org . chem . 1980 , 45 , 4387 ). the pyridinium triflate salt precipitated and the solution turned brown . the reaction was completed after 1 . 5 hrs . ( tlc control : acoet / hexane 2 : 1 ). the reaction mixture was added to 1 l of ice water . the aqueous phase was extracted with ch 2 cl 2 ( 4 ×). the organic phase was dried with mgso 4 and distilled several times on a rotatory evaporator while repeatedly adding toluene in order to remove the pyridine from the mixture . the brown residue was extracted with hexane ( 3 ×). after removal of the hexane , the desired product was obtained in the form of white crystals ( 36 . 88 g , 98 %). r f = 0 . 61 ( acoet / hexane 2 : 1 ). both the melting point and 1 h nmr were congruent with the values given in literature ( l . d . hall , d . c . miller , carbohydr . res . 1976 , 47 , 299 ). a solution of the trifyl sugar described above ( 37 . 1 g , 0 . 0945 mol ) dissolved in dmf ( 200 ml ), was slowly added to a solution of nan 3 ( 12 . 3 g , 0 . 189 mol ), bu 4 ncl catalytic , ˜ 0 . 1 g ) in dmf ( 1 . 5 l ) at 50 ° c . after 5 hrs . of stirring at 50 ° c ., the reaction was completed ( tlc control : acoet / hexane 2 : 1 ). the dmf was removed on the rotary evaporator at reduced pressure and the residue dissolved in acoet . the organic phase was washed with water ( 2 ×). the aqueous phase was re - extracted with acoet until no product 6 was detectable by tlc . the combined organic phases were dried over mgso 4 and the solvent removed . a syrup of 6 and the elimination byproduct was obtained . ( 1 h nmr showed that the ratio between product and byproduct was 7 : 3 ). the crude product 6 was purified by fc ( acoet / hexane 1 . 3 ) and 6 obtained as a colourless liquid ( 18 . 2 g , 70 %), r f = 0 . 55 ( acoet / hexane 1 : 3 ). the 1 h nmr von 6 was congruent with the values given in literature ( h . h . baer , y . gan , carbohydr . res . 1991 , 210 , 233 ). for the oxidation step ( 4 ), 6 ( 16 g , 0 . 056 mol ) was dissolved in acoh ( 77 %, 38 ml ) and stirred at reflux for 3 hrs . after removal of the solvent the crude product 7 was purified by fc ( acoet / hexane 2 : 1 ). white crystals of 7 were obtained ( 10 . 98 g , 80 %). naio 4 ( 8 . 4 g , 0 . 036 mmol ) was successively added dropwise to a cooled solution ( 10 ° c .) of 7 ( 8 g , 0 . 0327 mol ) in meoh ( 60 ml ) and h 2 o ( 100 ml ) ( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 ; 1983 ; 2126 - 2131 1983 , 53 , 1917 ). the mixture was stirred for 5 hrs . inorganic salts precipitated after meoh ( 150 ml ) was added . they were filtered off and washed repeatedly with meoh . the combined organic phases were concentrated under vacuum on a rotary evaporator until a slightly yellow syrup remained . the aldehyde obtained was used in the oxidation step to obtain 8 without further purifaction . [ 0147 ] 1 h nmr ( 250 mhz , cdcl 3 / meod , 298 k ): δ = 1 . 35 ( s , ch 3 ), 1 . 55 ( s , ch 3 ), 3 . 65 ( dd , j 3 , 4 = 4 . 72 , j 2 , 3 = 4 . 37 hz , h 3 ), 4 . 1 ( d , j = 4 . 7 hz , h 4 ), 4 . 7 ( dd , j 1 , 2 = 3 . 7 , j 2 , 3 = 4 . 5 hz , h 2 ), 5 . 9 ( d , j 1 , 2 = 3 . 8 hz , hl ), 9 . 7 ( br . s , h 5 ). with stirring , kmno 4 ( 6 . 7 g , 42 mmol ) was slowly added to a solution of the aldehyde in hoac ( 50 %, 150 ml ) ( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 ; 1983 ; 2126 - 2131 1983 , 53 , 1917 ), which resulted in a purple solution . after 12 hours , the reaction was completed . the solution was adjusted to a ph of 1 with conc . hcl and excess kmno 4 removed with na 2 so 3 . the solution was extracted with chcl 3 ( 3 ×). the organic phase was dried with mgso 4 and the solvent removed under vacuum . recrystallisation in acoet / hexane yielded crystals of 8 ( 4 . 29 g , 1 . 87 mmol , 89 % for both steps together ). general procedure for the simultaneous reduction and protection of the azides with fmoc ( gp ) with stirring , the solution of the azide in meoh / h 2 o ( 2 : 1 , 0 . 15 mol / l ) is adjusted to a ph of 8 with saturated nahco 3 . a solution of fmoc - cl ( 1 . 1 equiv .) in thf ( 0 . 16 mol / l ) is added , followed by the addition of the catalyst ( pd / c , 10 wt .-%, ( wet ) 49 . 7 wt .-% h 2 o , degussa e 101 , 1 g of catalyst per 1 g of azide ). the suspension is gassed with h 2 repeatedly . in general , the reaction is completed in 18 to 24 hrs ( contol by means of thin - layer chromatography ). the solvents are removed under reduced pressure . the solvent is suspended in water and adjusted to a ph of 8 - 9 with saturated nahco 3 and the aqueous phase extracted three times with ethyl acetate . the combined organic phases are washed with aqueous nahco 3 solution . the aqueous phase is adjusted to a ph of 1 with 1 mol / l hcl and extracted three times with ethyl acetate . the combined organic phases are washed with a saturated aqueous nacl solution , dried over mgso 4 and concentrated under reduced pressure . as described in gp , the azide 8 ( 1 g , 4 . 36 mmol ) was reduced to the amine and protected with fmoc at the same time . 1 ( 1 . 4 g , 3 . 29 mmol , 76 %) was obtained as a colourless syrup . [ 0154 ] 1 h nmr ( 500 mhz , [ d6 ] dmso , 300 k ): δ = 1 . 26 ( s , 3h , ch 3 ), 1 . 46 ( s , 3h , ch 3 ), 4 . 07 ( m , h 3 ), 4 . 22 ( m , 1h , fmoc - ch ), 4 . 25 ( m , 1h , h 4 ), 4 . 30 ( m , 2h , ch 2 fmoc ), 4 . 60 ( t , j = 4 . 0 , 1h , h 2 ), 5 . 84 ( d , j = 3 . 4 , 1h , h 1 ), 7 . 32 ( m , arom h ), 7 . 40 ( m , arom h ), 7 . 63 ( m , h n ), 7 . 72 ( m , arom h ), 7 . 87 ( d , j = 7 . 3 hz , 2h , arom h ); 13 c nmr ( 125 mhz , [ d 6 ] dmso , 300 k ): δ = 26 . 06 ( ch 3 ), 26 . 29 ( ch 3 ), 46 . 30 ( ch fmoc ), 56 . 25 ( c 3 ), 65 . 61 ( ch 2 fmoc ), 75 . 36 ( c 4 ), 78 . 01 ( c 2 ), 104 . 17 ( c 1 ), 111 . 63 ( c isoprop . ), 119 . 75 ( c arom ), 124 . 89 ( c arom ), 127 . 17 ( c arom ), 143 . 32 ( c 5 ); fab - hrms calc . c 23 h 23 no 7 na [ m + na ] + 448 . 1372 , found : 448 . 1366 . as described in gp , the azide 7 ( 2 g , 8 . 31 mmol ) was reduced to the amine and protected with fmoc at the same time . fc ( acoet / hexane 1 : 1 ) resulted in a white powder of 9 ( 3 . 3 g , 7 . 48 mmol , 92 %). [ 0157 ] 1 h nmr ( 500 mhz , cdcl 3 , 300 k ): δ = 1 . 35 ( s , 3h , ch 3 ), 1 . 55 ( s , 3h , ch 3 ), 2 . 12 ( s , 0 . 8h , oh ), 3 . 60 - 4 . 65 ( m , 13h , h 2 , h 3 , h 4 , h 5 , h 6 , h 6 ′ , ch 2 fmoc , ch fmoc , h 2 o ), 5 . 47 ( br . s , 1h , h n ), 5 , 80 ( br . s , 1h , h 1 ), 7 . 32 ( m , 2h , h arom ), 7 . 40 ( m , 2h , h arom ), 7 . 57 ( m , 2h , h arom ), 7 . 76 ( d , j = 6 . 7 hz , 2h , h arom ); 13 c nmr ( 125 mhz , cdcl 3 , 300 k ): δ = 26 . 46 ( ch 3 ), 26 . 61 ( ch 3 ), 47 . 12 ( ch fmoc ), 55 . 74 ( c 3 ), 63 . 73 ( c 4 ), 67 . 47 ( c 5 ), 79 . 25 ( c 2 ), 80 . 41 ( ch 2 fmoc ) 103 . 77 ( c 1 ), 112 . 85 ( c isoprop ), 120 . 05 ( c arom ), 124 . 90 ( c arom ), 127 . 80 ( c arom ), 141 . 32 , 143 . 53 , 143 . 57 ( c arom , c 6 ); esi - ms : calc . c 24 h 27 no 7 na 464 . 1685 , found : 464 . 1 ; t r = 14 . 41 ( hplc - ms , 30 - 90 % b in 20 min ). the diol 9 and tempo ( 1 mg , 0 . 064 mmol , 0 . 011 eq ) were suspended in ch 2 cl 2 ( 1 . 8 ml ) at 0 ° c . a solution of kbr ( 14 . 5 mg , 0 . 064 mmol , 0 . 11 eq ) and tbu 4 ncl ( 8 . 9 mg ) in saturated aq nahco 3 was slowly added to the reaction mixture . a mixture of naocl ( 13 %, 1 . 5 ml ), saturated nacl solution ( 1 . 32 ml ) and saturated nahco 3 solution ( 0 . 7 ml ) was added dropwise to the reaction mixture over 30 min . the reaction mixture was stirred over night and then diluted with acoet ( 2 ml ). the organic phase was extracted twice with saturated nacl solution . the aqueous phase was adjusted to a ph of 2 with 1 n hcl and extracted with acoet extrahiert . the solvent was distilled off at reduced pressure , leaving behind a colourless syrup of 2 ( 0 . 17 g , 62 %). [ 0160 ] 1 h nmr ( 500 mhz , [ d 6 ] dmso , 300 k ): δ = 1 . 25 ( s , 3h , ch 3 ), 1 . 47 ( s , 3h , ch 3 ), 4 . 05 - 4 . 30 ( m , 6h , h 3 , h 4 , h 5 , ch 2 fmoc , ch fmoc ), 4 . 55 ( br . s , 1h , h 2 ), 5 . 73 ( br . s , 1h , h 1 ), 7 . 30 - 7 . 90 ( m , 9h , h arom , h n ); 13 c nmr ( 125 mhz , [ d 6 ] dmso , 300 k ): δ = 23 . 97 ( ch 3 ), 24 . 39 ( ch 3 ), 45 . 19 ( ch fmoc ), 51 . 88 ( c 3 ), 63 . 70 ( c 4 ), 67 . 18 ( c 5 ), 75 . 30 ( c 2 ), 76 . 98 ( ch 2 fmoc ) 101 . 73 ( c 1 ), 111 . 35 ( c isoprop . ), 117 . 20 ( c arom ), 122 . 39 ( c arom ), 124 . 14 ( c arom ), 124 . 51 ( c arom ), 143 . 80 ( c 6 ); fab - hrms calc for c 24 h 25 no 8 na [ m + na ] + 478 . 1478 , found : 478 . 14167 ; t r = 15 . 71 ( hplc - ms , 10 - 90 % b in 20 min ). according to standard methods , tcp resin ( 1 . 3 g ) was loaded with 629 mg of fmoc - tyr - oh , 2 . 77 ml of collidine in 10 ml of dcm in a 20 ml syringe . the loading was determined to be 0 . 477 mmol / g resin by gravimetry . 165 mg of the resin loaded with fmoc - tyr - oh as above were allowed to swell for 2 hrs . in a 5 ml syringe with frit in nmp . fmoc - deprotection : with agitation , the resin is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 1 ( 50 , 5 mg , 1 . 5 equiv ) is dissolved in 2 ml of nmp together with hoat ( 16 mg , 1 . 5 equiv ), hatu ( 45 mg , 1 . 5 equiv ) and collidine ( 156 μl , 15 equiv ). this solution is charged into the syringe containing the tyr - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) a few resin beads were taken from the syringe and treated with a few drops of a 20 vol .-% hfip in dmc solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - tyr - oh thus separated from the resin was characterised through esi mass spectrum : esi - ms : 1237 . 6 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 4 [ 2m + k ] + ; 1199 . 2 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 4 [ m + na ] + ; 589 . 3 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hours with fmoc - thr ( otrt )- oh ( 115 mg , 2 . 5 equiv ), hatu ( 75 mg , 2 . 5 equiv ), hoat ( 27 mg , 2 . 5 equiv ) and 260 μl collidine in 2 ml of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hrs . with fmoc - lys ( ivdde )- oh ( 112 . 9 mg , 2 . 5 equiv ), hatu ( 74 . 7 mg , 2 . 5 equiv ), hoat ( 27 mg , 2 . 5 equiv ) and 260 μl of collidine in 2 ml of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after washing with nmp , the resin is washed twice for dcm ( 1 min ) and twice with meoh ( 1 min .) and dried in vacuum over night . after that it is divided in equal parts and charged into 2 syringes ( one for g and one for h ) at 122 mg resin each . from this point onwards , synthesis of tg and th is carried out separately . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - trp - oh ( 50 mg , 3 equiv ), hatu ( 45 mg , 3 equiv ), hoat ( 16 mg , 3 equiv ) and 156 μl of collidine in 1 ml of nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - d - trp - oh ( 50 mg , 3 equiv ), hatu ( 45 mg , 3 equiv ), hoat ( 16 mg , 3 equiv ) and 156 μl of collidine in 1 ml of nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . cleavage of the protected linear peptides fmoc - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh and fmoc - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh from the resin : after the fmoc - deprotection and washing with nmp as described above , both peptides are washed with dcm ( 3 × 1 min .) with agitation and then separated from the resin with 20 vol -% hfip in dcm ( 3 × 20 min .) with agitation . the dcm is removed under reduced pressure . in each case characterisation is carried out through hplc - ms : h - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh : esi - ms : 1306 . 4 [ m − h + 2k ] + ; 1290 . 5 [ m − h + na + k ] + ; 1274 . 6 [ m − h + 2na ] + ; 1268 . 6 [ m + k ] + ; 1252 . 6 [ m + na ] + ; 1230 . 4 [ m + h ] + ; 988 . 5 [ m - trt + h ] + ; 930 . 5 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 12 . 90 min ( hplc - ms , 40 - 90 % b in 15 min ). h - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh : esi - ms : 1306 . 4 [ m − h + 2k ] + ; 1290 . 5 [ m − h + na + k ] + ; 1274 . 6 [ m − h + 2na ] + ; 1268 . 6 [ m + k ] + ; 1252 . 6 [ m + na ] + ; 1230 . 4 [ m + h ] + ; 988 . 5 [ m − trt + h ] + ; 930 . 5 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 12 . 97 min ( hplc - ms , 40 - 90 % b in 15 min ). the peptides h - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh and h - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh were dissolved in 12 ml of dmf each . 37 . 9 μl of dppa and 25 mg of nahco 3 were added with stirring . after 12 hrs ., the reaction was completed . c [- trp - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1256 . 7 [ m − h + 2na ] + ; 1250 . 7 [ m + k ] + ; 1234 . 7 [ m + na ] + ; 1219 . 0 [ m + li ] + ; 970 . 5 [ m − trt + h ] + ; 912 . 6 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 22 . 13 min ( hplc - ms , 30 - 70 % b in 15 min ). c [- d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1256 . 7 [ m − h + 2na ] + ; 1250 . 7 [ m + k ] + ; 1234 . 8 [ m + na ] + ; 1218 . 8 [ m + li ] + ; 970 . 6 [ m − trt + h ] + ; 912 . 7 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 22 . 28 min ( hplc - ms , 30 - 70 % b in 15 min ). the protected cyclopeptides are dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf and these and the peptide precipitated with diethyl ether . purification in each case was carried out by semi - preparative hplc . after lyophilisation both peptides were present as an amorphous white powder . c [- trp - lys - thr ( otrt )- z1 - tyr -] ( tg ): semi - preparative hplc purification : gradient : 40 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1044 . 5 [ m + k ] + ; 1028 . 5 [ m + na ] + ; 1006 . 2 [ m + h ] + ; 764 . 4 [ m − trt + h ] + ; 706 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + ; t r = 13 . 94 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonnitrile + 0 . 1 % tfa ). c [- d - trp - lys - thr ( otrt )- z1 - tyr -] ( th ): semi - preparative hplc purification : gradient : 50 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1044 . 5 [ m + k ] + ; 1028 . 6 [ m + na ] + ; 1012 . 6 [ m + li ] + ; 764 . 4 [ m − trt + h ] + ; 706 . 4 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 14 . 35 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). tcp - resin ( 2 g ) was loaded with 933 mg ( 1 . 2 equiv ) of fmoc - phe - oh , dipea ( 2 . 5 equiv , 1 . 05 ml ) in 16 ml of dcm in a 20 ml syringe according to standard methods . by gravimetry , the loading was determined to be 0 . 677 mmol / g resin . 52 . 4 mg of the fmoc - phe - oh loaded resin were allowed to swell with frit in a 2 ml syringe in nmp for two hrs . fmoc - deprotection : with agitation the resin is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 2 ( 24 . 3 mg , 1 . 5 equiv ) is dissolved in 194 μl of dmf together with hoat ( 7 . 3 mg , 1 . 5 equiv ), hatu ( 20 . 25 mg , 1 . 5 equiv ) and collidine ( 70 . 7 μl , 15 equiv ). this solution is charged into the syringe containing the phe - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) a few resin beads were taken from the syringe and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - tyr - oh thus separated from the resin was characterised through an esi mass spectrum : esi - ms : 1249 . 3 [ 2m − h + 2na ] + ; 1227 . 2 [ 2m + na ] + ; 1204 . 9 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hours with fmoc - thr ( otrt )- oh ( 42 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 . 5 mg , 2 . 5 equiv ) and 95 pi of collidine ( 20 equiv ) in nmp ( 250 μl ) with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hrs . with fmoc - lys ( ivdde )- oh ( 41 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 . 5 mg , 2 equiv ) and 95 μl of collidine ( 20 equiv ) in 250 μl of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - trp - oh ( 30 . 2 mg , 2 equiv ), hatu ( 25 , 7 mg , 2 equiv ), hoat ( 9 . 7 mg , 2 equiv ) and 94 μl of collidine in nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . cleavage of the protected linear peptide fmoc - d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe - oh from the resin after fmoc - deprotection and washing with nmp as described above , the peptide was washed with dcm with agitation ( 3 × 1 min .) and then separated from the resin with 20 vol -% of hfip in dcm ( 3 × 20 min ) with agitation . the dcm is removed under reduced pressure . the peptide h - d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe - oh was dissolved in 7 . 1 ml of dmf and 23 al of dppa and 4 . 9 mg nahco 3 added with agitation . after 12 hrs ., the reaction was completed ( no linear peptide visible in the esi mass spectrum ). the protected cyclopeptide was dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf and added dropwise to diethyl ether to precipitate the peptide . purification in each case was carried out by semi - preparative hplc . after lyophilisation the peptide was present as an amorphous white powder . c [- d - trp - lys - thr ( otrt )- z2 - phe -] ( sgnc 18 ): semi - preparative hplc purification : gradient : 50 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 , 1 % tfa ) parallel synthesis of sgnc 12 : c [- d - trp - lys - phe ( f 5 )- z1 - phe -]; sgnc 13 : c [- d - trp - lys - bip - z1 - phe -]; sgnc 14 : c [- d - trp - lys - bpa - z1 - phe -]; sgnc 15 : c [- d - trp - lys - 1 - nal - z1 - phe -]; sgnc 16 : c [- d - trp - lys - 2 - nal - z1 - phe -]: tcp - resin ( 2 g ) was loaded with 933 mg ( 1 . 2 equiv ) of fmoc - phe - oh , dipea ( 2 . 5 equiv , 1 . 05 ml ) in 16 ml of dcm in a 20 ml syringe according to standard methods . by gravimetry , the loading was determined to be 0 . 677 mmol / g resin . 52 . 4 mg of the fmoc - phe - oh loaded resin each were weighed and charged into a 2 ml syringe and allowed to swell in nmp for two hrs . fmoc - deprotection : with agitation the resin in each of the 5 syringes is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 1 ( 113 . 5 mg , 1 . 5 equiv ) is dissolved in 1 ml of dmf together with hoat ( 36 . 3 mg , 1 . 5 equiv ), hatu ( 101 . 3 mg , 1 . 5 equiv ) and collidine ( 353 μl , 15 equiv ). this solution is charged in equal parts , i . e . 270 . 7 ill each , into 5 syringes containing the phe - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) by way of an example , a few resin beads were taken from the syringe to synthetise sgnc 13 and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - phe - oh thus separated from the resin was characterised through an esi mass spectrum : esi - ms : 1738 . 7 [ 3m + na ] + ; 1716 . 8 [ 3m + h ] + ; 1205 . 4 [ 2m − h + na + k ] + ; 1167 . 1 [ 2m + na ] + ; 1144 . 9 [ 2m + h ] + ; 611 . 3 [ m + k ] + ; 595 . 3 [ m + na ] + ; 573 . 2 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling with agitation was carried out for 2 - 3 hrs . each to synthesise sgnc 12 : with 33 . 9 mg of fmoc - phe ( f 5 )- oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl nmp ; to synthesise sgnc 13 : with 33 . 0 mg of fmoc - bip - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl nmp ; to synthesise sgnc 14 : with 35 mg of fmoc - bpa - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl of nmp ; to synthesise sgnc 15 : with 31 mg of fmoc - 1 - nal - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl of nmp ; to synthesise sgnc 16 : with 31 mg of fmoc - 2 - nal - oh , 27 mg of hatu , 10 mg o hoat and 94 μl collidine in 300 μl of nmp ; after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 to 3 hrs . as follows : to synthesise sgnc 12 - 14 and sgnc 16 : fmoc - lys ( ivdde )- oh ( 163 mg , 2 equiv ), hatu ( 108 mg , 2 equiv ), hoat ( 38 mg , 2 equiv ) and 377 μl of collidine ( 20 equiv ) are dissolved in 1 . 3 ml of nmp . this solution is charged into the pertinent syringe in equal parts , i . e . 419 μl each , and subjected to coupling with agitation . to synthesise sgnc 15 : fmoc - lys ( ivdde )- oh ( 40 . 75 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 mg , 2 equiv ) and 94 μl of collidine ( 20 equiv ) is dissolved in 300 μl of nmp gelöst , charged into the syringe and subjected to coupling with agitation . after that , washing with nmp was carried out with agitation ( 5 × 1 min .). after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 to 3 hrs . as follows : to synthesise sgnc 12 - 14 und sgnc 16 : fmoc - d - trp - oh ( 121 mg , 2 equiv ), hatu ( 108 mg , 2 equiv ), hoat ( 38 mg , 2 equiv ) and 377 μl of collidine ( 20 equiv ) are dissolved in 1 . 3 ml nmp . this solution is drawn into the pertinent syringe in equal parts , i . e . 419 μl and subjected to coupling with agitation . to synthesise sgnc 15 : fmoc - d - trp - oh ( 30 . 2 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 mg , 2 equiv ) and 94 μl of collidine ( 20 equiv ) are dissolved in 300 μl of nmp , drawn into the syringe and subjected to coupling with agitation . after that , washing with nmp was carried out with agitation ( 5 × 1 min .) after fmoc - deprotection and washing with nmp as described above , the peptides were washed dcm with agitation ( 3 × 1 min .) and then separated from the resin with 20 vol -% each of hfip in dcm ( 3 × 20 min ) with agitation . the dcm is removed under reduced pressure . the protected linear peptides were dissolved in 7 . 1 ml of dmf each and 23 μl of dppa and 4 . 9 mg of nahco 3 each added with agitation . after 12 hrs ., the reaction was completed ( no linear peptide visible in the esi mass spectrum ). exemplary characterisation of the ivdde - protected sgnc 12 : c [- d - trp - lys ( ivdde )- phe ( f 5 )- z1 - phe -] by esi - ms : 1134 . 6 [ m − h + 2na ] + ; 1128 . 6 [ m + k ] + ; 1112 . 7 [ m + na ] + ; 1090 . 6 [ m + h ] + ; 1032 . 6 [ m - acetone + h ] + . the cyclopeptides ivdde - protected in the lysine side chain were dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf each and the peptide precipitated with diethyl ether . purification in each case was carried out by semi - preparative hplc . after lyophilisation all of the peptides were present as an amorphous white powder . c [- d - trp - lys - phe ( f 5 )- z1 - phe -] ( sgnc 12 ): semi - preparative hplc purification : gradient : 30 - 70 % b in 30 min ; ( 13 = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) t r = 24 . 35 esi - ms : 1806 . 4 [ 2m ( 1 * 13 c )+ k ] + ; 1805 . 4 [ 2m + k ] + ; 1790 . 3 [ 2m ( 1 * 13 c )+ na ] + ; 1789 . 3 [ 2m + na ] + ; 1768 . 2 [ 2m ( 1 * 13 c )+ h ] + ; 1767 . 2 [ 2m + h ] + ; 922 . 3 [ m + k ] + ; 906 . 4 [ m + na ] + ; 884 . 3 [ m + h ] + ; 826 . 4 [ m - acetone + h ] + ; t r = 11 . 65 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). c [- d - trp - lys - bip - z1 - phe -] ( sgnc 13 ): semi - preparative hplc purification : gradient : 45 - 63 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1028 . 2 [ m + tfa − h + 2na ] + ; 1022 . 4 [ m + tfa + k ] + ; 1006 . 5 [ m + tfa + na ] + ; 908 . 4 [ m + k ] + ; 892 . 6 [ m + na ] + ; 870 . 4 [ m + h ] + ; 812 . 5 [ m - acetone + h ] + ; t r = 13 . 05 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). c [- d - trp - lys - bpa - z1 - phe -] ( sgnc 14 ): semi - preparative hplc purification : gradient : 45 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water + 0 . 1 % tfa ); t r = 17 . 5 min ; esi - ms : 1056 . 1 [ m + tfa − h + 2na ] + ; 1050 . 3 [ m + tfa + k ] + ; 1034 . 4 [ m + tfa + na ] + ; 936 . 5 [ m + k ] + ; 920 . 6 [ m + na ] + ; 898 . 4 [ m + h ] + ; 840 . 5 [ m - acetone + h ] + . sgnc 15 : esi - ms : 1840 . 7 [ 2m ( 1 * 13 c )+ tfa + k ] + ; 1710 . 6 [ 2m ( 1 * 13 c )+ na ] + ; 1687 . 5 [ 2m + h ] + ; 1002 . 1 [ n + tfa − h + 2na ] + ; 996 . 4 [ m + tfa + k ] + ; 980 . 3 [ m + tfa + na ] + ; 882 . 5 [ m + k ] + ; 866 . 6 [ m + na ] + ; 844 . 4 [ m + h ] + ; 786 . 5 [ m - acetone + h ] + . t r = 3 . 75 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). c [- d - trp - lys - 2 - nal - z1 - phe -] ( sgnc 16 ): semi - preparative hplc purification : gradient : 45 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1839 . 6 [ 2m + tfa + k ] + ; 1709 . 6 [ 2m + na ] + ; 1687 . 6 [ 2m + h ] + ; 1002 . 1 [ m + tfa − h + 2na ] + ; 996 . 4 [ m + tfa + k ] + ; 980 . 4 [ m + tfa + na ] + ; 882 . 5 [ m + k ] + ; 866 . 6 [ m + na ] + ; 844 . 4 [ m + h ] + ; 786 . 5 [ m - acetone + h ] + . general procedure for anchoring of the first fmoc - protected amino acid on tcp resin ( gp 2 ): the unloaded dry tcp resin in a syringe ( exact weight known ), completed with a frit , was swelled in nmp ( 30 min ). the resin was filtered off , before a solution (˜ 0 . 125 m ) of 1 . 2 equiv of fmoc - protected amino acid ( with respect of the theoretical capacity of the tcp resin ) and 2 . 5 equiv dipea ( with respect to the quantity of fmoc - protected amino acid used ) in dcm ( abs .) was added . after shaking for 1 h at rt the capping solution ( 20 % dipea in meoh ) is added . after 15 min the resin is filtered off , and the resin is washed with dcm ( 3 × 3 min ), dmf ( 3 × 3 min ), and meoh ( 3 × 3 min ), and dried overnight under vacuo . subsequently the exact weight of the dried resin was determined , and the loading of the resin was calculated : c [ mol / g ]=( m total − m resin )/{ mg xaa − 36 . 461 )× m total mg xaa molar weight of the fmoc - protected amino acid ( xaa ) the preloaded resin was swelled for 30 min in nmp . the fmoc - protecting group of the amino acid attached to the resin is removed by treating the resin with a 20 % piperidine solution in dmf ( 3 × 10 min ). the resin is filtered off and washed with nmp ( 5 × 3 min ), before a solution of the next fmoc - protected amino acid ( 3 equiv ), or fmoc - z - oh ( that is in the following examples either fmoc - z1 - oh or fmoc - z2 - oh ) ( 1 . 5 equiv ), hatu and hoat ( l . a . carpino , a . el - faham , f . albericio , tetrahedron lett . 1994 , 35 , 2279 - 2282 ; l . a . carpino , a . el - faham , c . a . minor , f . albericio , j . chem . soc . chem . commun . 1994 , 2 , 201 - 203 ) ( 1 . 5 equiv each for saa coupling , 3 equiv each for other amino acids ), and 2 , 4 , 6 - collidine ( 15 equiv / 30 equiv ) in nmp ( for coupling with fmoc - protected z1 dmf , was used as solvent ) is added . after 2 - 3 h reaction is complete ( monitoring by esi - hplc - ms ). the resin is washed with nmp ( 5 × 3 min ), prior to the subsequent fmoc - deprotection and coupling steps . after coupling of the last amino acid , and subsequent fmoc - deprotection , the resin is washed with nmp ( 3 × 3 min ), ch 2 cl 2 ( 1 × 3 min ), and dried overnight in vacuo . the compounds are cleaved from the dry resin using 20 % hfip solution in ch 2 cl 2 ( 3 × 10 min )( r . bollhagen , m . schmiedberger , k . barlos , e . grell , j . chem . soc ., chem . commun . 1994 , 22 , 2559 - 2560 ). the crude peptides were purified via rp - hplc . in all cases peptide ( hplc ) purity was & gt ; 99 %. the fmoc - deprotected linear peptide is dissolved in dmf ( 0 . 1 mm ), and dppa ( 3 equiv ) and nahco 3 ( 11 equiv ) are added ( t . shioiri , k . ninomiya , s . yamada , j . am . chem . soc . 1972 , 94 , 6203 - 6205 ; s . f . brady , w . j . paleveda , b . h . arison , r . m . freidinger , r . f . nutt , d . f . veber , in 8 th am . pept . symp . ( eds . : v . j . hruby , d . h . rich ), pierce chem . co ., rockford , ill ., usa , tuscon , ariz ., usa , 1983 , pp . 127 - 130 ). after 12 h reaction is usually complete . after side chain deprotection ( c . f . gp 5 ) the cyclic peptides were precipitated with et 2 o and purified via rp - hplc , and finally lyophilized from water or dioxane . the peptide is dissolved in 3 % hydrazine / dmf solution , stirred for 10 - 15 min , and the solvent is evaporated . this procedure is repeated 3 times . synthesis of the first library of somatostatin analogues sga , sgb , sge , sgf according to gp 2 , tcp resin ( 2 . 008 g ) was loaded with fmoc - phe - oh ( 933 . 6 mg , 2 . 4098 mmol ) and dipea ( 1 . 05 ml , 6 . 025 mmol ) in 16 ml dcm . the loading was c = 0 . 677 mol / g resin . similar to gp 2 ( instead of dipea 2 , 4 , 6 - collidine was used as base ), tcp resin ( 1 . 300 g ) was loaded with fmoc - tyr - oh ( 629 mg , 1 . 56 mmol ) and 2 , 4 , 6 - collidine ( 2 . 77 ml ) in 10 ml dcm . the loading was c = 0 . 477 mmol / g resin . synthesis of sga and sgb : according to gp 3 , sga and sgb were synthesized parallel in the same syringe (( 2 ml ), 137 mg of the fmoc - phe - oh loaded tcp resin ). coupling was verified by a sample cleavage of the dipeptide fmoc - z1 - phe - oh : esi - ms : 1205 . 6 [ 2m - h + na + k ] + ; 1167 . 2 [ 2m + na ] + ; 1144 . 9 [ 2m + h ] + ; 611 . 4 [ m + k ] + ; 595 . 4 [ m + na ] + ; 573 . 3 [ m + h ] + ; t r = 25 . 04 min ( anal . hplc , 20 - 80 % b in 30 min ). the first coupling was done with fmoc - protected z1 ( 60 . 8 mg ), hoat ( 18 . 9 mg ), hatu ( 53 mg ) and 2 , 4 , 6 - collidine ( 184 μl ). subsequentely fmoc - lys ( ivdde )- oh ( 133 mg ) ( hoat ( 31 . 6 mg ), hatu ( 88 . 2 mg ), 2 , 4 , 6 - collidine ( 307 μl )) was coupled . the resin was split into two equal parts — one for the synthesis of sga , one for the synthesis of sgb . coupling with fmoc - l - trp - oh , or fmoc - d - trp - oh ( 59 . 4 mg of l -, or d - trp respectively ) ( hoat ( 18 . 9 mg ), hatu ( 52 . 9 mg ), 2 , 4 , 6 - collidine ( 184 μl )) respectively , and subsequent washing fmoc - deprotection and cleavage steps ( gp 3 ) yielded the linear , ivdde - protected precursors of compounds sga and sgb , characterized by hplc - ms : h 2 n - trp - lys ( ivdde )- z1 - phe - oh ( precursor to sga ): 909 . 5 [ m + k ] + ; 893 . 5 [ m + na ] + ; 871 . 5 [ m + h ] + . 813 . 5 ; [ m - acetone + h ] + ; t r = 11 . 41 min ( hplc - ms , 30 - 90 % b in 15 min ), t r = 14 . 41 min ( anal . hplc , 30 - 90 % 1b in 15 min ). h 2 n - d trp - lys ( ivdde )- z1 - phe - oh ( precursor to sgb ): 915 . 5 [ m − h + 2na ] + ; 909 . 5 [ m + k ] + ; 893 . 5 [ m + na ] + ; 871 . 5 [ m + h ] + . 813 . 5 ; [ m - acetone + h ] + ; t r = 11 . 31 min ( hplc - ms , 30 - 90 % b in 15 min ). the precursors to sga and sgb were cyclizied according to gp 4 ( dppa ( 37 . 9 μl ), nahco 3 ( 25 mg ), dmf ( 12 ml )) to yield the protected cyclic precursors : cyclo [- trp - lys ( ivdde )- z1 - phe -] ( precursor of sga ): esi - ms : 1729 . 0 [ 2m + na ] + ; 890 . 6 [ m + k ] + ; 875 . 7 [ m + na ] + ; 853 . 6 [ m + h ] + ; 795 . 6 [ m - acetone + h ] + ; t r = 19 . 19 min ( anal . hplc , 30 - 90 % b ). cyclo [- d - trp - lys ( ivdde )- z1 - phe -] ( precursor of sgb ): esi - ms : 1743 . 1 [ 2m + k ] + ; 1729 . 0 [ 2m + na ] + ; 1705 . 6 [ 2m + h ] + ; 897 . 6 [ m − h + 2na ] + ; 891 . 7 [ m + k ] + ; 875 . 7 [ m + na ] + ; 853 . 6 [ m + h ] + ; 795 . 6 [ m - acetone + h ] + ; t r = 21 . 32 min ( anal . hplc , 10 - 60 % b ). ivdde - deprotection according to gp 5 , purification via rp - hplc ( semipreparative ; gradient : 35 - 55 % b in 30 min ( sga ), and 20 - 60 % b in 30 min ( sgb ), respectively ; ( b = 90 % mecn , 10 % h 2 o , + 0 . 1 % tfa )), and subsequently lyophilization yielded the compounds sga ( 10 mg , 33 %) and sgb ( 10 . 7 mg , 36 %) as white , fluffy powder . sga : esi - ms : 1445 . 1 [ 2m + tfa + k ] + ; 1331 . 3 [ 2m + k ] + ; 1315 . 2 [ 2m + na ] + ; 1293 . 2 [ 2m + h ] + ; 799 . 1 [ m + tfa + k ] + ; 783 . 1 [+ tfa + na ] + ; 685 . 2 [ m + k ] + ; 669 . 4 [ m + na ] + ; 647 . 2 [ m + h ] + ; 589 . 2 [ m - acetone + h ] + ; t r = 4 . 78 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgb : esi - ms : 1445 . 2 [ 2m + tfa + k ] + ; 1331 . 4 [ 2m + k ] + ; 1315 . 3 [ 2m + na ] + ; 1293 . 3 [ 2m + h ] + ; 799 . 1 [ m + tfa + k ] + ; 669 . 3 [ m + na ] + ; 647 . 2 [ m + h ] + ; 589 . 3 [ m - acetone + h ] + ; t r = 5 . 74 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). synthesis of sge and sgf : according to gp 3 , sge and sgf were synthesized parallel in the same syringe ( 2 ml ), 190 mg of the fmoc - tyr - oh loaded tcp resin ). the first coupling was done with fmoc - protected z1 ( 58 mg ), hoat ( 18 . 5 mg ), hatu ( 52 mg ) and 2 , 4 , 6 - collidine ( 180 μl ). coupling was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . characterization : esi - ms : 1237 . 6 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 4 [ 2m + k ] + ; 1199 . 2 [ 2m + na ] + ; 921 . 6 [( 3m + 2k )/ 2 ] 2 + ; 913 . 7 [( 3m + na + k )/ 2 ] 2 + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 4 [ m + na ] + ; 589 . 3 [ m + h ] + ; t r = 21 . 68 min ( anal . hplc , 20 - 80 % b in 30 min ). according to gp 3 fmoc - lys ( ivdde )- oh ( 130 mg ) ( hoat ( 31 mg ), hatu ( 86 mg ), 2 , 4 , 6 - collidine ( 300 μl )) was coupled . the resin was split into two equal parts — one for the synthesis of sge , one for the synthesis of sgf . coupling with fmoc - l - trp - oh , or fmoc - d - trp - oh ( 58 mg of l -, or d - trp respectively ) ( hoat ( 18 . 5 mg ), hatu ( 52 mg ), 2 , 4 , 6 - collidine ( 180 μl )) respectively , and subsequent washing fmoc - deprotection and cleavage steps ( gp 3 ) yielded the linear , ivdde - protected precursors of compounds sge and sgf . the precursors to sge and sgf were cyclizied according to gp 4 ( dppa ( 38 μl ), nahco 3 ( 25 mg ), dmf ( 12 ml )) to yield the protected cyclic precursors : cyclo [- trp - lys ( ivdde )- z1 - tyr -] ( precursor of sge ): esi - ms : 1759 . 9 [ 2m + na ] + ; 906 . 7 [ m + k ] + ; 891 . 6 [ m + na ] + ; 869 . 6 [ m + h ] + ; 811 . 6 [ m - acetone + h ] + ; t r = 11 . 89 min ( anal . hplc , 30 - 90 % b , 30 min ). cyclo [- d - trp - lys ( ivdde )- z1 - tyr -] ( precursor of sgf ): esi - ms : 906 . 7 [ m + k ] + ; 891 . 6 [ m + na ] + ; 869 . 6 [ m + h ] + ; 811 . 6 [ m - acetone + h ] + ; t r = 11 . 74 min ( anal . hplc , 30 - 90 % b , 30 min ). ivdde - deprotection according to gp 5 , purification via rp - hplc ( semipreparative ; gradient : 20 - 60 % b in 30 min ( sge ), and 25 - 60 % b in 30 min ( sgf ), respectively ; ( b = 90 % mecn , 10 % h2o , + 0 . 1 % tfa )), and subsequently lyophilization yielded the compounds sge and sgf as white , fluffy powder . sge : esi - ms : 799 . 2 [ m + tfa + na ] + ; 685 . 4 [ m + na ] + ; 663 . 2 [ m + h ] + ; 605 . 3 [ m - acetone + h ] + ; t r = 15 . 46 min ( anal . hplc , 20 - 60 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgf : esi - ms : 1363 . 3 [ 2m + k ] + ; 1347 . 1 [ 2m + na ] + ; 1325 . 2 [ 2m + h ] + ; 685 . 4 [ m + na ] + ; 663 . 3 [ m + h ] + ; 605 . 3 [ m - acetone + h ] + ; t r = 20 . 19 min ( anal . hplc , 10 - 60 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgnc 7 was synthesized according to gp 3 ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ). coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . coupling of the fmoc - thr ( otrt )- oh , was verified by a sample cleavage : some beads were fished out , and the tripeptide fmoc - thr ( otrt )- z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1885 . 3 [ 2 m + na ] + ; 1863 . 0 [ 2m + h ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 4 [ m + h ] + ; 243 . 2 [ trt ]+. according to gp 3 fmoc - nle - oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , and purification via rp - hplc ( semipreparative ; gradient : 50 - 100 % b in 30 min ), yielded the sgnc 7 as a white fluffy powder : esi - ms : 1998 . 7 [ 2m + li ] + ; 1143 . 4 [ m − h + tfa + k ] + ; 1127 . 5 [ m − h + tfa + na ] + ; 1029 . 5 [ m + k ] + ; 1013 . 5 [ m + na ] + ; 997 . 7 [ m + li ] + ; 990 . 6 [ m + h ] + ; 771 . 7 [ m − trt + na ] + ; 749 . 4 [ m − trt + h ] + ; 691 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 21 . 05 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 18 was synthesized according to gp 3 ( 2 ml , 52 . 4 mg of the fmoc - phe - oh loaded tcp resin ). coupling of the fmoc - protected z2 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z2 - phe - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1829 . 8 [ 3m + na ] + ; 1227 . 2 [ 2m + na ] + ; 1205 . 0 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + ; 551 . 3 [ m - acetone + li ] + ; 545 . 1 [ m - acetone + h ] + . according to gp 3 fmoc - thr ( otrt )- oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , the ivdde cyclic precursor cyclo [- d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe -]: esi - ms : 1264 . 8 [ m + k ] + ; 1248 . 9 [ m + na ] + ; 1226 . 5 [ m + h ] + ; 1006 . 8 [ m − trt + na ] + ; 984 . 6 [ m − trt + h ] + ; 926 . 7 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . subsequent ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 50 - 65 % b in 30 min ), yielded the sgnc 18 as a white fluffy powder : esi - ms : 1058 . 3 [ m + k ] + ; 1042 . 5 [ m + na ] + ; 1020 . 2 [ m + h ] + ; 800 . 6 [ m − trt + na ] + ; 778 . 4 [ m − trt + h ] + ; 720 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 15 . 18 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 20 was synthesized according to gp 3 ( 2 ml , 52 . 4 mg of the fmoc - phe - oh loaded tcp resin ). coupling of the fmoc - protected z2 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z2 - phe - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1829 . 8 [ 3m + na ] + ; 1227 . 2 [ 2m + na ] + ; 1205 . 0 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + ; 551 . 3 [ m - acetone + li ] + ; 545 . 1 [ m - acetone + h ] + . according to gp 3 fmoc - bip - oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , ivdde - deprotection and purification via rp - hplc ( semipreparative ; gradient : 50 - 65 % b in 30 min ), yielded sgnc 20 as a white fluffy powder : esi - ms : 938 . 9 [ m + k ] + ; 922 . 9 [ m + na ] + ; 900 . 7 [ m + h ] + ; 842 . 7 [ m - acetone + h ] + . t r = 13 . 10 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 38 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . according to gp 3 fmoc - thr ( obzl )- oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 35 - 50 % b in 30 min ), yielded the sgnc 38 as a white fluffy powder : esi - ms : 892 . 2 [ m + k ] + ; 876 . 5 [ m + na ] + ; 860 . 9 [ m + li ] + ; 854 . 4 [ m + h ] + ; 796 . 3 [ m - acetone + h ] + ; t r = 8 . 82 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 51 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - tyr ( obzl )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1742 . 9 [ 2m − h + na + k ] + ; 1727 . 3 [ 2m − h + 2na ] + ; 1722 . 2 [ 2m ( 1 * 13 c )+ k ] + ; 1706 . 3 [ 2m ( 1 * 13 c )+ na ] + ; 1705 . 3 [ 2m + na ] + ; 1683 . 2 [ 2m + h ] + ; 902 . 4 [ m − h + na + k ] + ; 886 . 4 [ m − h + 2na ] + ; 880 . 4 [ m + k ] + ; 864 . 5 [ m + na ] + ; 842 . 3 [ m + h ] + ; 784 . 4 [ m - acetone + h ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- d - trp - lys ( ivdde )- tyr ( obzl )- z1 - tyr -]: esi - ms : 1177 . 8 [ m + k ] + ; 1161 . 7 [ m + na ] + ; 1139 . 7 [ m + h ] + ; 1081 . 7 [ m - acetone + h ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 51 as a white fluffy powder : esi - ms : 1926 . 5 [ 2m ( 1 * 13 c )− h + na + k ] + ; 1903 . 9 [ 2m + k ] + ; 1888 . 9 [ 2m ( 1 * 13 c )+ na ] + ; 1866 . 9 [ 2m ( 1 * 13 c )+ h ] + ; 971 . 8 [ m + k ] + ; 955 . 7 [ m + na ] + ; 933 . 6 [ m + h ] + ; 883 . 7 [ m - acetone + li ] + ; 875 . 7 [ m - acetone + h ] + . t r = 11 . 43 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 50 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - d - bta - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- d - bta - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1269 . 0 [ m ( 1 * 13 c )+ k ] + ; 1251 . 8 [ m + na ] + ; 1230 . 6 [ m ( 1 * 13 c )+ h ] + ; 1009 . 8 [ m − trt + na ] + ; 987 . 6 [ m − trt + h ] + ; 243 . 2 [ trt ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 50 as a white fluffy powder : esi - ms : 1061 . 6 [ m + k ] + ; 1045 . 6 [ m + na ] + ; 1029 . 8 [ m + li ] + ; 1023 . 5 [ m + h ] + ; 842 . 6 [ m − trt − h + na + k ] + ; 828 . 5 [ m − trt − h + 2na ] + ; 781 . 5 [ m − trt + h ] + ; 723 . 5 [ m − trt - acetone + h ] + , 243 . 2 [ trt ] + . t r = 12 . 29 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 8 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - l - bta - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- bta - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1267 . 8 [ m + k ] + ; 1251 . 8 [ m + na ] + ; 1229 . 3 [ m + h ] + ; 1009 . 7 [ m - trt + na ] + ; 987 . 6 [ m − trt + h ] + ; 929 . 7 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 8 as a white fluffy , powder : esi - ms : 1061 . 6 [ m + k ] + ; 1053 . 6 [ m − h + li + na ] + ; 1045 . 6 [ m + na ] + ; 1029 . 5 [ m + li ] + ; 1023 . 5 [ m + h ] + ; 842 . 6 [ m − trt − h + na + k ] + ; 826 . 4 [ m − trt − h + 2na ] + ; 781 . 4 [ m − trt + h ] + ; 723 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 12 . 29 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 10 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - 2 - nal - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- 2 - nal - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1261 . 7 [ m + k ] + ; 1245 . 6 [ m + na ] + ; 1230 . 6 [ m ( 1 * 13 c )+ li ] + ; 1224 . 1 [ m ( 1 * 13 c )+ h ] + ; 1026 . 6 [ m − trt − h + 2na ] + ; 1018 . 7 [ m − trt + k ] + ; 1003 . 6 [ m − trt + na ] + ; 981 . 5 [ m − trt + h ] + ; 923 . 5 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ]+. ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 63 % b in 30 min ), yielded the sgnc 10 as a white fluffy powder : esi - ms : 1175 . 3 [ m + tfa − h + 2na ] + ; 1169 . 4 [ m + tfa + k ] + ; 1153 . 3 [ m + tfa + na ] + ; 1056 . 6 [ m ( 1 * 13 c )+ k ] + ; 1039 . 6 [ m + na ] + ; 1017 . 3 [ m + h ] + ; 775 . 5 [ m − trt + h ] + ; 717 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 14 . 46 min ( hplc - ms , 30 - 70 % b in 15 min ). 80 mg of a tcp resin loaded with fmoc - d - asp - odmab ( i . e . fmoc - d - asp bound to the resin through the acid group of the side chain ) wherein the loading corresponds to 0 . 037 mmol / g resin were weighed into a syringe . before the 1 st coupling , the acid function was deprotected 3 times with 3 % hydrazine in nmp solution followed by washing with 5 % dipea in nmp ( 2 ×) and nmp ( 5 ×). with agitation , the acid was preactivated with a solution consisting of 0 . 6 equiv . each of hatu , hoat and 30 equiv . of collidine in 300 μl of nmp for 30 min . with agitation before adding 3 equiv . of 1 -( aminomethyl ) naphthaline . after 2 hrs ., the coupling solution was discarded , the resin washed with nmp ( 3 ×) and preactivated once more with 0 . 6 equiv . of hatu , hoat and 30 equiv . of collidine in 300 μl of nmp for 30 minutes before adding 3 equiv . of the 1 -( aminomethyl ) naphthalene . after 2 hours , the coupling solution was discarded and the resin washed 5 × with nmp . after that , synthesis was carried out analogously to the synthesis of the above cyclopeptides described in examples 2 to 4 . a few resin beads were taken and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the amino acid thus separated from the resin : was characterised through an esi mass spectrum : esi - ms : 1010 . 8 [ 2m + na ] + ; 989 . 5 [ 2m + h ] + ; 517 . 2 [ m + na ] + ; 495 . 4 [ m + h ] + . biological evaluation : apoptosis - inducing effect both in multi - resistant and non - resistant hepatoma cancer cell lines rat hepatoma cells were cultivated in a f 12 medium ( gibcobrl ), to which 5 % of foetal calf serum had been added , in a atmosphere saturated with humidity (& gt ; 95 %) and having a co 2 content of 8 % in air . the cell line named “ klon 2 ” was isolated by venetianer et al . ( cytogentc . cell . genet 28 : 280 - 283 , 1980 ). the cell line 2 ( 10 × 80 ) t1 is a sub - clone of klon 2 having a moderate multi - drug resistance 8 ( pirity , hever - szabo and venetianer , cytotechnology 19 : 207 - 214 , 1996 ). the degree of resistance of cell line 2 ( 10 × 80 ) was determined by a niagara blue exclusion test , the cells being exposed to different concentrations of the following cytostatic agents for 72 hrs . the following ic 50 values were determined for the cell line : 5 . 2 for vinblastine , 9 . 4 for doxorubicine , 11 . 4 for puromycin , 7 . 7 for actinomycin d and for colchicine ( pririty et al ., cytotechnology 19 : 207 - 214 , 1996 ). the xtt / pms assay ( scuderio et al ., cancer res . 48 : 4827 - 4833 , 1988 ; roehm et al ., j . immun . methods 142 : 257 - 265 , 1991 ) was utilised to determine the cytotoxicity of the compounds . for this purpose , the viability of the sensitive cell line klon 2 was tested in comparison with that of the multi - drug resistant cell line klon 2 ( 10 × 80 ). an identical number of cells was applied to a 96 cell culture plate . after one day , the cells were incubated with different concentrations of the compounds to be tested , compound tt - 232 serving as internal control . the cell viability was determined by triple determination for each concentration by means of the xtt / pms dye test ( scuderio et al ., cancer res . 48 : 4827 - 4833 , 1988 ; roehm et al ., j . immun . methods 142 : 257 - 265 , 1991 ). after an incubation time of 72 hrs . the absorption of treated cells at 450 nm in relation to cells not treated with dye was used as a viability standard . the concentrations of the test compound having 50 % viability ( ic 50 ) was determined by double determination in two independent experiments . multidrug resistant drug sensitive activity [ μm ] cells cells c [- tyr - d - trp - lys - thr ( otrt )- z1 -] 25 31 ( th of example 2 ) c [- tyr - trp - lys - thr - z1 -] 47 75 these results demonstrate that high activities can be achieved with the compounds according to the invention in cells with multiple drug resistance as well as in cells that do not exhibit such a resistance . the compounds shown below were tested on two cell - lines , a431 ( a . t . c . c . reference no . crl - 1555 , c . f . american type culture collection , http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view = ce , 663682 , crl - 1555 & amp ; text = a - 431 , 2001 , pp . http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view - ce , 663682 , crl - 661555 & amp ; text = a - 663431 ; http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view = ce , 663682 , crl - 661555 & amp ; text = a - 663431 ) ( an epidermoid cancer ) and panc - 1 ( a . t . c . c . reference no . crl - 1469 , c . f . american type culture collection , http :// phage . atcc . org / cgi - bin / searchengine / longview . egi ? view = ce , 609764 , crl - 1469 & amp ; text = panc - 1 ) ( a well differentiated pancreatic adenocarcinoma ), both of human origin , using the mtt ( carmichael j et al . cancer res . 47 ( 4 ): pp . 936 - 42 , 1987 .) and mb ( oliver m h , harrison n k , bishop j e , cole p j , laurent g j ; j cell sci 1989 march ; 92 ( pt 3 ): 513 - 8 ) assays . each compound was tested under 4 conditions : 6 h ( to exclude necrosis ) and 48 h to see inhibition of proliferation and apoptosis . high ratio between 48 / 6 h inhibition shows little necrotic , but pronounced apoptotic activity of the tested compound . the results are summarized in table 1 . neurogenic inflammation participates in all inflammatory responeses where nociception or pain sensation occurs . the principal mediator of this type of inflammation is substance p . classical anti - inflammatory agents as the cyclooxygenase ( cox ) inhibitors do not inhibit neurogenic inflammation . stable peptide analogues of somatostatin are potent broad spectrum anti - inflammatory agents which inhibit both the release of substance p from sensory nerve terminals and also the development of neurogenic inflammation ( helyes , zs ., pintér , e ., németh , j ., kéri , gy ., thán , m ., oroszi , g ., horváth , a . and szolcsányi , j . : anti - inflammatory effect of synthetic somatostatin analogues in the rat . br . j . pharmacol . 134 , 1571 - 1579 , 2001 , pintér , e ., helyes , zs , németh , j ., pórszász , r ., peth { acute over ({ acute over ( o )})}, g ., thán , m ., kéri gy ., horváth a ., jakab b ., szolcsányi , j . : pharmacological characterization of the somatostatin analogue tt - 232 : effects on neurogenic and non - neurogenic inflammation and neuropathic hyperalgesia . naunyn - schmiedeberg &# 39 ; s arch . pharmacol . ( 2002 , in press )). effect of tg , sga , tr , and tt - 232 on the release of substance p in vitro methods : after exsanguination the tracheae of 2 - 2 female wistar rats were removed and perfused ( 1 ml min − 1 ) in an organ bath ( 1 . 8 ml ) at 37 ° c . for 60 min with oxygenated ( 95 % o 2 and 5 % co 2 ) krebs solution of the following composition ( in mm ): nacl 119 , nahco 3 25 , kh 2 po 4 1 . 2 , mgso 4 1 . 5 , kcl 4 . 7 , cacl 2 2 . 5 , glucose 11 . after stopping the flow the solution was changed 3 times for 8 min ( prestimulated — stimulated — poststimulated ). electrical field stimulation ( 40 v , 0 . 1 ms , 10 hz , 120 s ) was performed to induce release of sensory neuropeptides from the tissue pieces in the presence or absence of sgtg , sga , sgth , or tt - 232 ( 500 - 500 nm ). the fractions were collected in ice - cold tubes and the wet weight of the tracheae were measured . concentration of sp was determined by specific radioimmunoassay ( ria ) methods developed in our laboratory ( németh , j ., oroszi , g ., thán , m ., helyes , zs ., pintér , e ., farkas , b . and szolcsányi , j . : substance p radioimmunoassay for quantitative characterization of sensory neurotransmitter release . neurobiology , 7 , 437 - 444 , 1999 ) and was expressed as the released amount of peptide per tissue weight . the results which are summarized in table 2 below and depicted in fig2 show that substance p release evoked by electrical stimulation of sensory nerve terminals is inhibited by sgtg , sga and sgth to a similar extent as elicited by tt - 232 .
2