_id stringlengths 7 16 | description stringlengths 55 95.2k |
|---|---|
pmc-6624152-1 | Case
Our patient is a 19-year-old male who reports cigarette smoking ½ pack per day. Past medical history is significant for type I diabetes mellitus (DM). Our patient presented to the clinic with neurological deficits consisting of trouble walking and diffuse pain throughout his body when standing and considerable difficulty with balance. These symptoms began three months prior to his presentation in clinic when he fell asleep in an awkward position and, on awakening, found that he was unable to walk. There was severe lower back pain with initial paresthesia. He further indicated that he was having bowel dysfunction. On exam, it was noted that foot dorsiflexion and big toe extension was compromised. An intervertebral disc prolapse was suspected to have led to the development of cauda equina syndrome. Further, the patient was noted to have fatigue, change in appetite, muscle aches, muscle weakness, back pain, and swelling in his extremities. He indicates that he has restless legs due to the pain and migraines. It was decided that operative intervention would be beneficial, and radiological evaluation via MRI was undertaken with results presented in Figure .
Pre-operative findings
Congenitally shortened pedicles caused a congenital baseline spinal canal stenosis as seen in Figure . At the L3-L4 intervertebral disc level, there is a circumferential disc bulge with a superimposed right subarticular to right posterior midline epidural disc extrusion. On axial views, extruded disc material extends from the right subarticular location along the lateral epidural space, reaching the ligamentum and extending medially into the posterior epidural space. Disc material is seen on the sagittal view in the posterior epidural space with disc material contributing to severe spinal canal stenosis in both anterior and posterior epidural locations. There is mass effect on the traversing nerve roots of the cauda equina, displacing the nerve roots to the left of midline.
Operative procedure
Decompression seemed the best surgical intervention. In the operating room, the patient was placed in the prone position with chest rolls. Using microsurgical technique under both the microscope and fluoroscopic guidance, a bilateral laminectomy of L3 was achieved. Subsequently, a bilateral partial laminectomy of L4 was completed in addition to a bilateral foraminotomy of L4. Under the microscope, the dura was exposed and a large mass was identified and located directly posterior to the dura which was not fat or tumor. When this was followed to the right, this substance was revealed to be a portion of an extruded herniated disk, which was compressing the filum terminal in a tumor/mass effect-related manner. Careful dissection was carried out until the disk space was clearly exposed. After that, discectomy was accomplished at L3-L4 level. Foraminotomy of the L3-L4 level was completed bilaterally. Dura integrity was preserved throughout the process. Reconstruction was completed using an auto-fat graft. Musculature and subcutaneous fat was approximated. A JP drain was placed and the skin was closed. Post-operative imaging is demonstrated in Figure . Several aspects of this case are noteworthy from a surgical aspect. Given the young age of the patient, a complete foraminotomy on the affected side is inappropriate due to the rendered instability that it would cause. Further, the required instrumentation at such decompression would ultimately leave this patient with reduced range of motion. While this would not normally be of concern, the young age of the patient makes these interventions tenuous. As stated above, directly after the completion of the hemilaminectomy on the affected side, tissue of unknown origin was observed. Given that preoperative imaging revealed extruded disc at this level, it is likely this tissue was from the disk itself. However, the rare presentation and location of this disc extrusion, presenting within the epidural space, requires careful consideration of how to proceed next from an operative standpoint since the tissue, which is of an apparent etiology on imaging, may not be revealed to be of the same origin in actuality. When tissue, such as an extruded disc, is observed in an aberrant location, it is essential that careful tissue dissection and tracing to the inside of origin is established prior to complete tissue resection. Since a number of different tissues can present directly underneath the lamina, including infectious abscess, tumor, epidural lipomatosis, and others, early resection, removal, or debulking of the tissue may result in removal of tissue needed to identify the tissue based on origin and location. This necessitates occasionally unnecessary and delayed pathological analysis and complicates treatment. This case exemplifies successful surgical intervention wherein tissue was successfully dissected first posteriorly and then laterally to trace the tissue to the distal portion. This allowed for simultaneous identification of the tissue as benign in origin while successfully decompressing the cord, relieving mass effect.
Post-operative findings
Congenitally shortened pedicles, which caused a baseline congenital spinal canal stenosis, are consistent with pre-operative findings as seen in Figure . Lack of spinous process and lamina at the L3 level is consistent with interval laminectomy. There is evidence of removal of extruded disc material with restoration of nerve roots towards the midline and resolution of extrusion-induced mass effect. There is significant improvement of canal stenosis. The circumferential disc bulge previously noted at the L3-L4 level was significantly improved as compared to presentation on pre-operative studies. Together, it was noted the L3 disc extrusion visualized on pre-operative studies was significantly improved post resection with restoration of the nerve roots toward their expected central location.
Follow up
After surgery, the patient was found to be hypoglycemic as the only abnormality. He complained of only incisional pain. On exam, he was able to move all four extremities. He was noted to be hypertensive. The patient had severe pain on post-operative day 2. He was discharged on post-operative day 3. At the first post-operative visit, the patient was noted to walk without a walker. The patient indicated that his bowels were back to normal function. However he did have pain in the lumbar region that increased throughout the day. The patient had no observable acute neurological deficits. |
pmc-6624157-1 | A previously healthy 61-year-old gentleman, with no prior risk factors for coronary artery disease, presented to the hospital with posterior chest pain after slipping on ice. Upon admission, he was found to have a hemoglobin of 8.7 g/dl and computed tomography (CT) scan of the chest and abdomen revealed a splenic hematoma. An electrocardiogram (EKG) and troponin level were normal at the time (Figure ). He was discharged on pain medications after a subsequent workup was found to be unremarkable.
The patient returned to the hospital two weeks later with dyspneic spells and dizziness. He was found to have an elevated troponin level of 0.049 ug/L that peaked at 3 ug/L (normal < 0.03 ug/l) over the next 15 hours. A hemoglobin level was stable at 8 g/dL, and thyroid stimulating hormone and B-type natriuretic peptide were noted to be normal. There was no acute process seen on cardiopulmonary imaging. Initial EKG showed a first-degree heart block (Figure ) during this presentation. Transthoracic echocardiography (TTE) showed an ejection fraction of 60% with no valvular or wall motion abnormalities.
A repeat EKG three hours later demonstrated progression to second-degree (Mobitz type 1) atrioventricular heart block (AVB) (Figure ). A radionuclide stress test was consistent with a small and fixed defect of mild severity in the mid-anteroseptal and apical anterior location, consistent with myocardial infarction. Persistence of his presenting symptoms six hours later necessitated another EKG, which showed a complete heart block (Figure ). This was managed urgently with a successful dual-chamber pacemaker, following which his symptoms resolved and his troponin levels normalized. He was discharged home on the following day. |
pmc-6624158-1 | A 23-year-old female with a past medical history significant for human immunodeficiency virus (HIV) obtained via vertical transmission presented to the emergency department (ED) with a gradual onset of worsening headache over 10 days, with blurry vision, photophobia, nausea and vomiting, and progressive memory lapses. The patient was diagnosed at age two, but she had not taken any antiretroviral medications for the past year and she did not know her last CD4 count. The patient had visited two EDs previously, with unclear timelines, and was diagnosed with sinusitis and discharged home with antibiotics. Review of systems was negative for fever, nuchal rigidity, and weight loss.
On arrival to the ED, she had an initial temperature of 98.9°F, with a blood pressure of 94/79 mm Hg and a pulse rate of 79 beats/min. Her respiratory rate was 18 breaths/min with oxygen saturation at 100%. She did not have any focal neurological deficits and she was alert and oriented x 4. Her pupillary exam was significant for photophobia with equal and reactive 3 mm pupils bilaterally. Her blood tests, including complete blood count (CBC), comprehensive metabolic panel (CMP), urinalysis, and drugs of abuse screen were within normal limits. Electrocardiogram (EKG) showed normal sinus rhythm and chest plain radiograph was normal. A non-contrast brain computed tomography (CT) revealed no acute hemorrhage or lesion. Upon reassessment in the ED, she developed a fever of 102°F and became more confused and agitated, with interspersed screaming and yelling. A lumbar puncture (LP) was performed in the lateral decubitus position to analyze the cerebral spinal fluid (CSF), with opening pressure measurement due to concern for encephalitis; unfortunately, the patient was too agitated to safely obtain a reliable opening pressure. Results from the LP showed a cloudy appearing CSF, white blood cell (WBC): 22 (normal <5 per mm3), tube 1 red blood cell (RBC): 59 (normal <5 per mm3), % polymorphonuclear neutrophil (PMNs): 15% (normal 0% - 15%), % lymphocytes: 66% (normal >50%), glucose: 43 (normal >40 mg/dL), protein: 66 (normal <50 mg/dL). Gram stain was positive for Cryptococcus neoformans/budding yeast with a cryptococcal reactive antigen of 1:320 (normal <1:1). The patient was admitted to the medicine floor with a diagnosis of cryptococcal meningitis and was started on intravenous amphotericin B 250 mg every 24 hours and flucytosine 250 mg by mouth every six hours while in the ED, with recommendations from neurology and infectious disease consultation.
On hospital day one, the patient had a waxing and waning mental status. A repeat LP was performed by the inpatient team, which revealed an opening pressure of 55 cm H2O (normal <21cm). The decision was made to remove about 22 mL of fluid, with a closing pressure of 12 cm H2O, with documented mental status improvements. The CD4+ result was noted to be 15 cells/uL, confirming the diagnosis for acquired immunodeficiency syndrome (AIDS) []. Later that evening, while being transported for a repeat CT scan, the patient became acutely altered, lethargic, and bradycardic to the 40s with a blood pressure of 128/83 mmHg, necessitating a rapid response team (RRT). She was given one amp of D50 with a post-interventional point-of-care glucose level of 206 mg/dL and subsequent improvement of her mental status. Her repeat non-contrast brain CT showed no herniation and the patient was transferred to the intensive care unit (ICU).
On hospital day two, the patient became severely agitated, with worsening mental status changes, requiring 5 mg of intravenous haloperidol, followed by obtundation with decorticate posturing and sluggish pupils. The patient was immediately intubated for airway protection and a repeat non-contrast brain CT showed diffuse loss of gray-white matter differentiation with the maintenance of perfusion of the thalami and deep gray matter concerning for global ischemic encephalopathy (Figure ). Post-intubation LP revealed an opening pressure of 55 cm H2O and 30 cc of bloody fluid were removed to reduce intracranial pressure. Shortly after the procedure, the patient became tachycardic and a closing pressure was unattainable. She went into pulseless electrical activity (PEA) cardiac arrest with a return to spontaneous circulation after 30 seconds of chest compressions. Her post-arrest exam was significant for absent brainstem reflexes and the patient was ultimately declared brain dead in the following week. |
pmc-6624159-1 | A 15-year-old female presented with heat intolerance and palpitations. Laboratory tests revealed low TSH to 0.01 uIU/mL (reference range: 0.45-5.33 uIU/mL), elevated free T4 to 2.73 ng/dL (reference range: 0.61-1.44 ng/dL), and elevated thyroid-stimulating immunoglobulin to 422 U/mL (reference range: < 60 U/mL). Radioactive iodine uptake and scan showed diffusely increased homogenous uptake to 69% consistent with Graves’ disease. The patient was diagnosed with hyperthyroidism secondary to Graves’ disease and started on therapy with methimazole. Further laboratory testing revealed elevated levels of liver enzymes with aspartate aminotransferase (AST) of 62 IU/L (reference range: < 35 IU/L) and alanine aminotransferase (ALT) of 159 IU/L (reference range: < 72 IU/L) with normal bilirubin levels. Preexisting liver function tests were not available. Liver enzymes repeated after six weeks showed AST 189 IU/L and ALT 325 IU/L. Methimazole was discontinued. As a result, the patient underwent radioactive iodine ablation. She was later started on levothyroxine for post-ablative hypothyroidism. Liver enzymes continued to trend upward after eight weeks despite stable thyroid function. Laboratory workup revealed negative anti-nuclear antibody (ANA), anti-smooth muscle antibody, and hepatitis serologies. The decision was made to perform a liver biopsy given unclear cause of transaminitis. Liver biopsy showed portal fibrosis and interface hepatitis consistent with autoimmune hepatitis. Accordingly, oral steroid therapy was started for treatment of autoimmune hepatitis. After one month of steroid therapy, the liver enzymes normalized. |
pmc-6624159-2 | A 21-year-old female presented with fatigue and palpitations. She was diagnosed with Graves’ disease after laboratory tests revealed low TSH to 0.09 uIU/mL, elevated free T4 to 2.03 mg/dL, and elevated thyroid-stimulating immunoglobulin to 89 U/mL. Liver profile was also obtained which showed AST 108 IU/L, ALT 127 IU/L, normal bilirubin, and normal alkaline phosphatase. Radioactive iodine uptake and scan revealed diffusely increased homogenous uptake consistent with Graves’ disease. Patient’s physician was hesitant to use anti-thyroid drugs for fear of worsening liver enzymes. Initial liver enzyme elevation was attributed to the hyperthyroidism itself. She then underwent radioactive iodine ablation for treatment of Graves’ disease. Afterwards, she was initiated on levothyroxine for post-ablation hypothyroidism. Her palpitations resolved and thyroid function normalized.
However, the patient continued to experience fatigue. Her liver enzymes were repeated after eight weeks and were notable for AST 111 IU/L and ALT 191 IU/L. Further workup revealed positive liver-kidney microsomal type 1 antibody to 320 U (reference range: < 20 U) with negative ANA and anti-smooth muscle antibody. A diagnosis of autoimmune hepatitis was confirmed after liver biopsy revealed bridging necrosis. The hepatitis progressed despite treatment with immunosuppression and she underwent a successful liver transplant two years later. |
pmc-6624159-3 | A 39-year-old female presented with fatigue and worsening jaundice for three months. Laboratory tests were notable for low TSH to <0.01 uIU/mL, elevated AST to 136 IU/L, elevated ALT to 169 IU/L, elevated alkaline phosphatase to 466 IU/L (reference range: 44-147 IU/L), and elevated total bilirubin to 8 mg/dL (reference range: 0.1-1.2 mg/dL). Further workup revealed increased free T4 to 2.5 ng/dL and positive thyroid-stimulating immunoglobulin. Laboratory testing for ANA, anti-smooth muscle antibody, and liver-kidney microsomal type 1 antibody was negative but liver biopsy was consistent with autoimmune hepatitis. Radioactive iodine uptake and scan showed diffusely increased homogenous uptake consistent with Graves’ disease.
The patient was concurrently diagnosed with Graves’ disease and autoimmune hepatitis. She was started on prednisone and methimazole. The decision was made to definitively treat Graves’ disease with radioactive iodine ablation. After treatment, the patient went into remission of both Graves’ disease and autoimmune hepatitis. Her thyroid and liver tests remained stable until a few years later when she developed recurrence of autoimmune hepatitis. She eventually required a liver transplant at the age of 41. |
pmc-6624159-4 | A 38-year-old female presented with marked jaundice and malaise. Laboratory tests were notable for elevated AST to 1665 IU/L, elevated ALT to 606 IU/L, elevated alkaline phosphatase to 123 IU/L, and elevated serum total bilirubin to 19.5 mg/dL. Further laboratory workup revealed positive anti-nuclear antibody (titer 1:5120) and positive anti-smooth muscle antibody titer. Liver biopsy revealed significant hepatic necrosis and bridging fibrosis, confirming the diagnosis of autoimmune hepatitis. The patient was started on immunosuppression. Her liver function eventually normalized and remained stable.
Fifteen years later, the patient developed symptoms of heat intolerance, tremors, and palpitations. Laboratory workup revealed low TSH to < 0.01 uIU/mL, elevated total T3 to 0.9 ng/dL, elevated free T4 to 3.67 ng/dL, and elevated serum thyroid-stimulating immunoglobulin to 281 U/mL. Radioactive iodine uptake and scan revealed diffusely increased homogenous uptake of 43% consistent with Graves’ disease. Her immunosuppression was continued for autoimmune hepatitis and she was initiated on methimazole for Graves’ disease. The patient’s clinical course was complicated by acute liver injury attributed to non-adherence with immunosuppression; however, hepatotoxicity from methimazole could not be ruled out. She received pulse dose steroids with normalization of liver enzymes. After initially refusing, she finally agreed to undergo radioactive iodine ablation six months later. Her liver enzymes remained stable and thyroid function returned to normal. |
pmc-6624459-1 | The patient was a 39-year-old female who had experienced a gradually progressive decrement in visual acuity of the right eye during the past 2 months. Her medical history indicated that she had been treated for breast carcinoma, which had been originally diagnosed in her right breast 6 years ago, with no signs of metastases. Histopathological evaluation confirmed invasive ductal adenocarcinoma of the breast. She had been since treated by mastectomy and adjuvant chemotherapy with docetaxel until 3 years ago when her treatment with oral tamoxifen was begun. The treatment limited the neoplastic process and there were no clinical or radiological signs of progressive disease during these years.
The patient had no significant medical history. She was taking tamoxifen. She had no history of alcohol or tobacco use and there was no environmental toxic exposure. Her family history was negative for breast cancer and other diseases.
Office examination revealed a best-corrected visual acuity of counting fingers at 2 meters in the right eye and 10/10 in the left eye (by Snellen E chart from six meters). There was a 3+ relative afferent papillary defect in the right eye. Extraocular motility was intact in both eyes. Intraocular pressures were within normal limits in both eyes in applanation tonometry. Color plate testing results (by Ishihara’s color plate test) was 1/14 for the right eye and 14/14 for the left eye. Anterior segment examination was unremarkable. Dilated fundus examination of the right eye demonstrated 1+ cells in the vitreous, optic disc swelling, obscuration of vessels and infiltration by a large yellowish mass that disrupted the normal structure of the optic disc, and flame-shaped hemorrhages in the peripapillary (PP) region (). Fundus examination of the left eye was normal. Humphrey visual field testing in the right eye showed an altitudinal defect with enlarged blind spot (). PP optical coherence tomography (OCT) demonstrated significant retinal nerve fiber layer thickening in all four quadrants in the right eye (). Fluorescein angiography (FA) of the right eye detected a hyperfluorescent mass on the right optic disc with no sign of leakage, which suggested infiltrative optic neuropathy (). Humphrey visual field testing in the left eye revealed a non-specific arcuate scotoma (). OCT and FA in the left eye were normal ( and ). B-Scan ultrasonography of right eye revealed slight abnormal increase in right optic nerve sheath diameter (). Magnetic resonance imaging (MRI) was unremarkable and intraorbital and intracranial portions of both optic nerves had normal appearance.
According to the patient’s present condition, her past history of breast cancer, optic disc features on fundus examination, and imaging findings, the first diagnosis was infiltrative optic neuropathy of the right eye. The patient was referred to an oncologist for further systemic examination and necessary interventions. |
pmc-6624460-1 | A 33-year-old man presented to our clinic with complaints of watering, redness, and purulent discharge in the right eye. The patient reported seeing a physician a year earlier in Georgia due to fatigue, nausea, vomiting, and diarrhea. After his diarrhea and vomiting had resolved, he had swelling of the lymph nodes on the right side of the neck. After returning to Turkey for treatment, he had received cephalosporin and penicillin for suspected pharyngitis. When night sweating and weight loss were added to his complaints, he had presented to another hospital where his treatment was changed to amoxicillin-clavulanic acid 1 g 3 times a day and ciprofloxacin 750 mg twice a day, and incisional drainage was performed on the lymph nodes of his neck. When his symptoms failed to resolve completely, he had presented to the department of infectious diseases of a different university hospital. Serum agglutination test was positive for F. tularensis at a titer of 1/1280 and he was prescribed streptomycin 1 g per day for 9 days followed by 1 g twice a day for 5 days for a total of 14 days, followed by doxycycline 100 mg twice a day for 1 week. Ultrasound examination of the neck had revealed multiple abscesses in the right submandibular region and pathological lymph nodes including multiple calcifications in the right cervical chain, while magnetic resonance imaging of the neck showed retropharyngeal abscess narrowing right nasopharynx and oropharynx and submandibular lymphadenopathies (LAP) including cystic and necrotic areas (). He reported that the LAPs had resolved after a few months with no recurrence, but complaints of watering, swelling in the lacrimal sac area, hyperemia, and pain in the right eye developed a few weeks later. The patient presented to our clinic with recurrent swelling around the lacrimal sac, hyperemia, and purulent discharge.
On examination his best corrected visual acuity was 20/20 in both eyes. Intraocular pressure measured by automatic tono-pneumometry was 15 mmHg in each eye. On slit-lamp examination, epiphora was noted in the right eye and the left eye was normal. There was swelling in the area of the right lacrimal sac (). Fundus examination was normal in both eyes. In nasolacrimal lavage, the patient’s right nasolacrimal duct was occluded and the common canaliculus was patent. Discharge of purulent material from the right lower punctum was noted after lavage. A sample of the purulent discharge was collected and sent to the microbiology laboratory for culturing and the patient was started on oral amoxicillin-clavulanic acid 1 g twice a day and topical ciprofloxacin drops 4 times a day. Antibiotherapy was discontinued because the culture was negative. Consultation from the otorhinolaryngology (ENT) department was requested to rule out any intranasal pathology. The patient underwent ENT examination, followed by nasal endoscopic examination. In addition, to rule out intranasal pathologies that may present an obstacle to surgery, the paranasal sinuses were examined using computed tomography. No intranasal pathologies were detected in ENT evaluation. Dacryocystorhinostomy surgery was recommended to the patient, but he refused the procedure. |
pmc-6624461-1 | A 54-year-old man presented with complaints of decreased visual acuity in his left eye for approximately 1 week. His medical history included no systemic disease other than hypertension that had been present for 5 years and was controlled with medical treatment. In ophthalmologic examination, his corrected visual acuity was 1.0 in the right eye and 0.2 in the left eye. He had no history of previous ocular surgery, and anterior segment examination was normal. Fundus examination revealed no pathology in the right eye but BRVO was detected in the superotemporal region of the left eye (). Intraocular pressure was 15 mmHg in the right and 14 mmHg in the left eye. Fundus fluorescein angiography of the left eye showed late filling, dilation, and increased tortuosity of the superotemporal retina vein and areas of capillary nonperfusion consistent with BRVO (). Spectral domain optical coherence tomography (OCT) demonstrated retinal thickening (710 µm) and cystoid macular edema (). The patient was diagnosed with macular edema associated with BRVO and Ozurdex was injected. The injection was done in aseptic conditions from the superotemporal quadrant 4 mm from the limbus using the recommended standard procedure. During implantation, slight deflation of the globe and momentary hypotony were observed immediately after inserting the sharp tip of the implant through the sclera and before pulling the trigger, despite the absence of vitreous leakage. Vitreous leakage or hypotony were not observed after injection and no complications were noted in routine follow-up examination the next day.
At 1-month follow-up, the patient’s visual acuity had increased to 0.5. Hemorrhage was observed in the superotemporal region on fundus examination (). Macular OCT examination revealed that the cystoid macular edema had resolved, foveal thickness was 266 µm, and foveal contour had normalized (). A full-thickness retinal hole about 1 disc diameter in size surrounded by sporadic hemorrhages was noted in the temporal region of the macula (). The patient was informed of their condition and laser photocoagulation was performed on the ischemic areas and around the retinal hole. At follow-up 4 months after injection, visual acuity in the left eye was 0.3 and intraocular pressure measured by Goldmann applanation tonometry was 15 mmHg in both eyes. Central macular thickness had increased to 613 µm. The patient was given a second Ozurdex implant. He was last seen 1 month after the second injection. At that time, his visual acuity increased to 0.4 in the left eye. The retina was attached and the laser spots showed pigmentation. Central macular thickness had decreased to 284 µm. |
pmc-6624466-1 | A 63-year-old woman with metastatic breast carcinoma presented to the ophthalmology clinic with diplopia in right gaze and head turn to the right. Medical history revealed that she was diagnosed with estrogen receptor (ER)-positive and progesterone receptor (PR)-positive invasive ductal carcinoma 1 year earlier with mediastinal lymph node and bone metastasis at the time of diagnosis. She was treated with zoledronic acid 4 mg monthly and paclitaxel 80 mg/m2 weekly for 12 weeks, followed by endocrine therapy with letrozole.
On ophthalmological examination, best corrected visual acuity was 20/25 in both eyes. Slit-lamp examination of the anterior segment and fundus was unremarkable other than bilateral posterior chamber intraocular lenses. On motility exam, abduction was totally limited in the right eye with globe retraction and narrowing of the palpebral fissure on attempted abduction (). Abnormal head position towards the right side was noted. Magnetic resonance imaging (MRI) revealed isolated enlargement of the right medial rectus muscle (). Clinical evaluation and laboratory studies were carried out for differential diagnosis. There were no clinical findings suggestive of thyroid eye disease and thyroid function tests were normal. Rheumatologic assessment for inflammatory and vasculitic diseases was not contributory. Biopsy of the right medial rectus muscle was performed to establish a definite diagnosis and initiate appropriate treatment.
Hematoxylin and eosin staining of the biopsy specimen revealed large, round to polygonal epithelioid tumor cells arranged in loosely cohesive clusters and sheets infiltrating fibrocollagenous tissue and muscle fibers (). Immunohistochemical analyses using streptavidin-biotin peroxidase complex method revealed panCytokeratin and cytokeratin 7 positivity (). ER, PR and human epidermal growth factor receptor 2 (HER2/neu) were negative (triple-negative). Based on the patient’s clinical history and the morphological and immunohistochemical features of the tumor, she was diagnosed with breast carcinoma metastasis to the right medial rectus muscle. Pathological examination demonstrating a triple-negative breast carcinoma indicated discordance with the primary tumor, which was ER- and PR-positive at the time of diagnosis.
The patient was referred to the radiation oncology department for external beam radiation therapy. The orbital mass was irradiated with 45 Gy in 15 fractions. Following radiotherapy, chemotherapy with docetaxel 100 mg/m2 once every 21 days was initiated. After 15 months of follow-up, abduction of the right eye has partially recovered; the patient is stable and continuing to receive palliative chemotherapy. |
pmc-6624786-1 | A 6 years old, neutered male Lhasa Apso was presented with a 1 month history of progressive gait dysfunction characterized by the owner as an “army crawling” appearance. The dog's initial clinical presentation included a low head carriage, ataxia of all limbs, and suspected cervical hyperpathia. The cervical hyperpathia and ataxia resolved with a 2 weeks course of treatment with carprofen and cage rest, but over the subsequent weeks the gait evolved into what the owner described as “army crawl” ().
Significant physical examination abnormalities were limited to the nervous system. The dog was ambulatory but tetraparetic, with weakness in the thoracic limbs more severe than in the pelvic limbs. Thoracic limb weight bearing occurred on the antebrachii. Thoracic limb postural reaction deficits and paresis were present and associated with reduced thoracic limb muscle tone, flexor withdrawal, and triceps reflexes bilaterally. Pelvic limb proprioception and postural reactions were delayed in the left pelvic limb and normal in the right pelvic limb. The pelvic limb spinal reflexes were intact. No apparent cervical hyperpathia was observed. Moderate muscle atrophy was present in the thoracic limbs. Neuroanatomic diagnoses included C6-T2 myelopathy with central cord component or bilateral brachial plexus neuropathy.
The dog was anesthetized and electromyographic (EMG) examination of the left cervical region and forelimb and an MRI of the cervical vertebral column were performed. Increased insertional activity, fibrillation potentials, and positive sharp waves were identified on EMG of the left triceps, biceps brachii, extensor carpi radialis, and supraspinatus muscles. No abnormal EMG findings were noted in muscles of the head, thoracolumbar epaxial region, or left pelvic limb. The MRI revealed extradural T2W hypointense material in the ventral vertebral canal overlying the C6-C7 disc space consistent with IVDH resulting in moderate ventral and left-sided extradural compression and dorsal displacement of the spinal cord. On sagittal T2W and STIR images, a well-defined, linear intramedullary hyperintensity was identified that extended from C5 to the cranial aspect of C7. On transverse T2W () and FLAIR images, the hyperintensities were bilaterally symmetric and restricted to the ventral gray matter. These hyperintensities were isointense on T1W images and non-enhancing following IV gadolinium administration. The neuroradiological diagnosis was C6-C7 intervertebral disc extrusion with associated mutisegmental ISC. The distribution of the ISC was interpreted as compatible with a bilateral ventral horn lesion, with an SEM-like phenotype as described in humans (). Differential diagnoses for the observed ISC included cavitations, edema, gliosis, and necrosis.
Ventral slot decompression was performed at C6-C7. The dog was discharged to the care of the owner 2 days after surgery with no change in its neurological status. An examination performed 2 weeks later revealed worsening thoracic limb paresis and muscle atrophy. A computed tomographic scan of the cervical spine revealed no residual extradural compression at C6-C7 or other complications associated with the ventral slot procedure. A physical therapy program was initiated. Despite rehabilitation, thoracic limb motor function gradually declined over the subsequent 4 weeks at which point the dog was euthanized when non-ambulatory from thoracic limb paralysis. A necropsy was performed.
On gross examination, there was no evidence of extruded intervertebral disc material in the vertebral canal, and a ventral slot defect filled with fibrous tissue was present at C6-C7. Bilateral cavitary lesions () involving ventral horn gray matter was observed extending from the cranial aspect of the C5 through the C8 spinal cord segments. On microscopic examination, the lesions were somewhat symmetric in appearance and restricted to laminae VI-IX of the gray matter, but were most severe within the C5-C7 spinal cord segments. Cavitary regions in gray matter, which were most conspicuous in lamina VI, the central aspect of lamina VII and the dorsomedial aspect of lamina VIII, contained cellular processes, gitter cells, astrogliosis, faintly eosinophilic and shrunken ghost neurons lacking nuclear staining, and rare chromatolytic neurons. Neurons in the lateral portions of laminae VII, central portion of lamina VIII, and in laminae IX displayed acidophilic neuronal necrosis characterized by shrunken, angular and hypereosinophilic cytoplasm, and nuclear pyknosis. No fibrocartilaginous emboli were detected with Alcian blue staining. The final diagnosis was regionally extensive, bilaterally symmetric, chronic gray matter necrosis in spinal cord segments C5-C8 resulting in neurogenic thoracic limb muscular atrophy and fibrosis. |
pmc-6624786-2 | An 8 years old, neutered male mixed breed dog was evaluated for a 3 days history of cervical hyperpathia and right hemiparesis that progressed to tetraplegia. Upon presentation, the dog was tetraplegic with absent postural reactions in all limbs, diminished muscle tone and hyporeflexia in the thoracic limbs, and pelvic limb spasticity and hyperreflexia. Cervical hyperpathia was apparent on flexion of the neck. The neuroanatomic diagnosis was C6-T2 myelopathy.
An MRI of the cervical spine was performed under general anesthesia, the results of which were consistent with C5-C6 IVDH with associated compressive extradural hemorrhage (). No abnormal changes were observed within the spinal cord parenchyma. Ventral slot decompression was performed at C5-C6. The dog was ambulatory with pelvic limb ataxia when it was discharged to the owner 3 days after surgery.
Seven days after surgery, the dog represented non-ambulatory with severe lower motor neuron paresis and muscle atrophy in the thoracic limbs, with the pelvic limbs being neurologically intact. A cervical MRI examination was repeated and complete resolution of the previously identified extradural compression at C5-C6 was noted. However, contrast-enhancing ISC with an SEM-like phenotype was observed (), and subacute reperfusion injury, intramedullary hemorrhage, edema, myelitis, or infarction considered possible etiologies for the imaging abnormalities. Lumbar CSF analysis revealed albuminocytologic dissociation (total protein 101 mg/dl; reference range <45 mg/dl). CBC, indirect blood pressure, buccal mucosal bleeding time, and coagulation profile were within reference ranges. The dog underwent physical therapy and treatment with prednisone (0.5 mg/kg/day PO for 10 days) but remained non-ambulatory. Thoracic limb motor function and muscle mass declined insidiously and the dog was euthanized and a necropsy performed 3 months after surgery. Pathological findings in the gray matter were similar to those described for Case 1, except that at the junction of the ventral and intermediate gray horns with white matter, vacuolization of the white matter associated with variable axonal swelling was observed (). The final diagnosis was multisegmental, bilaterally symmetric, chronic gray matter necrosis, spinal cord segments C5-C8. |
pmc-6624786-3 | A 4 years old spayed female Doberman Pinscher was initially evaluated for ambulatory tetraparesis and cervical hyperpathia that localized to the C6-T2 spinal cord segments. A cervical MRI examination performed at that time revealed disc-associated CSM at C6-C7, with no abnormal ISC detected (). A ventral slot decompression was performed at C6-C7 and a complete neurological recovery was made.
The dog represented approximately 6 years later with recurrent ambulatory tetraparesis referable to a C6-T2 myelopathy and generalized muscle atrophy. A cervical MRI examination was repeated which revealed decreased in situ signal intensity involving all discs in the cervical region. There were mild disc protrusions at C5-C6 and C6-C7 resulting in minimal compression of the spinal cord. T2W hypointense material was noted dorsal to the spinal cord at C5-C6 and C6-C7 with minimal attenuation of the dorsal epidural fat and CSF signal. Bilaterally symmetric T2W/STIR hyperintensity consistent with an SEM-like phenotype was observed over the disc space of C6-C7 (), as were changes within the vertebral bodies of C6-C7 consistent with a previous ventral slot procedure. The MRI findings were interpreted as consistent with progression of CSM with adjacent segment disease and ligamentous hypertrophy. Muscle biopsies were performed to identify possible concurrent neuromuscular disorders that may have been causing or contributing to the observed generalized muscle atrophy. Muscle biopsies obtained from the triceps and biceps femoris revealed moderate generalized muscle atrophy and excessive intramyofiber lipid droplets in type 1 fibers, consistent with a metabolic myopathy secondary to oxidative disorder, carnitine deficiency, or endocrinopathy. The dog was diagnosed with hypothyroidism, and therapy with levothyroxine (0.1 mg/4.5kg PO q 12 h), acetyl-L-carnitine (50 mg/kg PO q 12 h), coenzyme Q10 (1 mg/kg PO q 24 h), riboflavin (5 mg/kg PO q 24 h), vitamin E (200 IU PO q 24 h), and gabapentin (5 mg/kg PO q 12 h) was initiated.
The dog was re-evaluated 10 months later for slowly progressive and severe thoracic limb weakness and muscle atrophy. The dog was weakly ambulatory with a neurological examination that remained consistent with C6-T2 myelopathy, although a central cord component or progression of the previously diagnosed generalized neuromuscular disorder were also suspected due to the preferential severity of weakness of the thoracic limbs. Euthyroidism was documented. A third cervical MRI was obtained, with findings similar to the previous examination except that SEM signal was present at C5-C6 and C6-C7, and spinal cord atrophy had progressed at both sites based on objective and serial measurements of spinal cord diameter at the lesion epicenters (). Given the SEM-like findings suggestive of gliosis or poliomyelomalacia, additional surgical therapy was not pursued. Clinical signs continued to deteriorate and the dog became non-ambulatory with severe muscle atrophy 16 months later. A fourth cervical MRI examination documented additional progression of the CSM characterized by worsening disc protrusion and progressive spinal cord atrophy at C5-C6 and C6-C7. The previously distinct, bilaterally symmetric SEM signals at C5-C6 and C6-C7 had coalesced into singular T2W/STIR hyperintense lesions affecting the gray matter (). The dog was euthanized and a necropsy performed.
On gross examination, there was protrusion of the intervertebral discs into the vertebral canal at C4-C5, C5-C6, and C6-C7. There was a region of dorsoventral collapse and softening of the C6 cord segment. On sectioning, the C6 segment contained extensive bilateral cavitations, poliomyelomalacia, and tan discoloration of the gray matter (). The C5 and C7 segments were similarly affected, but not as severe.
Microscopic examination revealed that the cavitary processes extending from the C5-C7 segments largely obliterated the gray matter bilaterally and extended in a symmetric cribriform fashion far into adjacent white matter, with changes most extensive in the C6 segment (). The cavitary regions in gray matter consisted predominantly of unstained regions containing thin cellular processes, ill-defined granular debris, ghost form neurons, gitter cells, and astrogliosis. The vacuolated white matter contained some swollen axons, astrogliosis and loss of myelin in severely affected regions. The ventral spinal nerve roots in affected segments demonstrated marked endoneurial edema and fibrosis. No annulus fibrosis was observed between the C6-C7 vertebral bodies and the intervertebral disc space was occupied by a cartilaginous mass with basophilic matrix and relatively acellular connective tissue interpreted as mature fibrous connective tissue. The cartilaginous endplates were focally disrupted, with extension of fibrous tissue and cartilage within adjacent vertebral bodies. These fibrous and cartilaginous elements focally protruded into the vertebral canal, covered by a densely ossified dorsal longitudinal ligament. The final diagnosis was extensive bilateral cavitary pan-necrosis of gray matter, extending into white matter, spinal cord segments C5-C7, suspected secondary to CSM. |
pmc-6624786-4 | A 3 years old, neutered male, Boxer was evaluated for a 6 weeks history of progressive gait abnormality characterized by thoracic limb weakness. The owner reported that the dog's gait abnormalities developed in the absence of any known precipitating event. Neurological examination findings were similar to those described for Case 1, except the pelvic limb posture and gait were normal, such that the dog stood and ambulated in a prayer-type position. Additionally, the thoracic limb paresis, neurological deficits, and muscle atrophy were asymmetric with the right side being more severely affected than the left. The neuroanatomic diagnosis was C6-T2 myelopathy with central cord component or bilateral brachial plexus neuropathy.
An MRI examination of the cervical spine was obtained under general anesthesia (), with ISC with an SEM-like phenotype identified in the caudal cervical spinal cord. Cerebrospinal fluid was obtained via lumbar puncture, and albuminocytologic dissociation was the only observed CSF abnormality (total protein 68 mg/dl; reference range <45 mg/dl). Positive sharp waves were detected on EMG of the left triceps, rhomboideus, infraspinatus, and supraspinatus muscles. Infectious disease testing was performed including evaluation of serum antibody titers against toxoplasmosis, neosporosis, Ehrlichia canis, and rocky mountain spotted fever (Infectious Disease Laboratory, Athens, GA, USA). Serum was also tested for cryptococcal antigen (latex agglutination) and CSF for canine distemper virus (RT-PCR; Infectious Disease Laboratory). No infectious etiology was identified, and the dog was treated for presumptive immune-mediated myelitis with cyclosporine (5 mg/kg/day PO) and prednisone (1 mg/kg PO q 12 h), with no change in clinical status observed at the 1 week recheck examination.
Five weeks after diagnosis, the dog died shortly after being admitted to the hospital in septic shock secondary to elbow decubital ulcers. The owner reported that the dog's clinical condition had worsened since the last recheck, and thoracic limb muscle atrophy was notably more severe at this admission. A necropsy examination revealed a bilaterally symmetric chronic poliomyelomalacia involving the C5-C8 spinal cord segments and neurogenic muscular atrophy of the thoracic limb musculature, with gross and microscopic features closely recapitulating those reported for Case 1. No other lesions or etiology for the SEM-like phenotype were identified. |
pmc-6624868-1 | An 84-year-old patient with multiple chronic conditions (arterial hypertension, multifactorial anaemia, chronic obstructive pulmonary disease (COPD), prostatic hypertrophy, gout, diverticulosis of the colon, chronic renal failure) was admitted to the State Hospital in San Marino on the 9 August 2016 for diarrhoea and impaired general condition. Ten months before he had started taking prednisone 25 mg a day for worsening of the COPD, and a few days before admission he had undergone an oesophagogastroduodenoscopy (EGD) for epigastric pain, with evidence of diffuse oedema and hyperaemia of the gastric mucosa, and of an ulcerated polypoid lesion in the second portion of the duodenum. Upon admission, the full blood count showed mild normocytic anaemia (haemoglobin 10.8 g/dl), white blood cells and full blood count were within the normal range of values (in particular eosinophil count was 222 eosinophils/μl), C-reactive protein (CRP) was 5.20 mg/dl (normal values <1). The dose of diuretics already taken by the patient was increased and prednisone was continued; symptomatic treatment and cholestyramine were added. On the 8th day of hospitalisation an antibiotic treatment was started (piperacillin-tazobactam) and steroidal treatment was increased (prednisone was changed to parenteral methylprednisolone 20 mg twice a day) due to worsening respiratory conditions with signs of a pulmonary infiltrate at the chest X rays. However, the respiratory impairment continued worsening, and the patient started having nausea and vomiting with bile and blood. A total body computed-tomography (CT) scan showed diffused tree in bud sings, while excluding involvement of other organs. On the 17th day of hospitalisation, the results of the biopsies performed during EGD were communicated to the clinicians: nematodes compatible with S. stercoralis were present in the duodenal and gastric mucosa (). In the meantime, S. stercoralis larvae were also found in the microscopic examination of a bronchoalveolar lavage. Microscopic examination of multiple stool and urine samples was negative. Treatment with albendazole 400 mg a day was hence started on the 26 August, and changed 3 days later with ivermectin 200 μg/kg/day following consultation with a tropical diseases specialist. Moreover, steroids were stopped. Nevertheless, the condition progressed to multi-organ failure and the patient died on the 2nd September. Strongyloides serology was positive, but the result was made available only 2 days after the death. Afterwards, previous clinical records were reviewed, showing that the patient had presented eosinophilia: 944 cells/μl in June 2016, 4490 cells/μl in August 2012. |
pmc-6624868-2 | An 85-year-old patient with moderate-severe chronic renal failure, insulin-dependent diabetes mellitus with peripheral polyneuropathy, COPD, prostatic hypertrophy and rheumatic polymyalgia with probable small-vessel vasculitis was admitted to the State Hospital in San Marino on the 8 March 2017 for fever, asthenia and hyporexia. Blood tests showed hypochromic microcytic anaemia (haemoglobin 9.2 g/dl), mild eosinophilia (558 eosinophils/μl), hyperglycaemia (265 mg/dl), increased erythrocyte sedimentation rate (99 mm/h, normal values <13) and CRP (8.43 mg/dl, normal values <1). Two sets of blood culture were negative. During the first days of hospitalisation, he was kept on his usual therapy, which included prednisone 12.5 mg/day. On the 13th March a contrast-enhanced CT scan was done, showing diffuse bowel and gastric wall thickening, thickening of the bronchial walls and pulmonary interstitial oedema. A colonoscopy demonstrated a flat lesion in the right colon, intestinal inflammation, ulcers and petechial spots (). The histological examination revealed lymphoplasmacellular and eosinophilic infiltration, epithelioid granuloma and multiple S. stercoralis larvae (). Also, intranuclear inclusion bodies compatible with cytomegalovirus (CMV) infection were found; this infection was confirmed by PCR on blood, that showed 1888 UI/l viraemia. On the 16 March treatment with ivermectin 200 μg/kg/day and piperacillin/tazobactam 2.25 g three times a day (dosage adjustment for renal failure) was started. The dose of prednisone was gradually reduced. In the meantime, also stool examination, PCR and IFAT resulted in positive for S. stercoralis. Hence, on the 20 March, albendazole 400 mg twice a day was added. The general condition of the patient gradually improved, and CMV viraemia reduced spontaneously along with clinical recovery. Antihelminthic therapy was stopped 2 weeks after negativisation of stool microscopy, that was achieved after 21 days of treatment. The patient was discharged on the 7th April, in fair clinical condition. On the 30 May, he underwent a colonoscopy that showed almost complete resolution of the inflammation. The biopsy of the flat lesion (observed also in the previous examination) demonstrated a villous adenoma. |
pmc-6624925-1 | A 24-year-old white male with past medical history of recurrent acute pancreatitis, gastroesophageal reflux disease, and obesity presented for evaluation following a referral from an outside hospital after a 3-week hospitalization due to refractory acute pancreatitis. The patient reported gastrointestinal symptoms including colicky discomfort and reflux as a teenager that evolved into sharp, severe abdominal pain requiring over 20 hospitalizations for pancreatitis in the last 10 years. Hospitalizations for recurrent acute pancreatitis ranged in severity from multi-day hospitalizations for pain management, anti-emetic therapy, bowel rest, and supportive care to one- and two-day hospitalizations where symptoms severity was less intense; less severe episodes that did not require hospitalization were also increasingly common. With the initial episodes, alcohol use increased the likelihood of symptoms occurring, but complete abstinence for the last two years did not alter the likelihood of recurrence. While episodes occurred initially every 6–12 months, the frequency increased over recent years to approximately every 3 months. He denied episodes correlated to diet, but alcohol use did increase the frequency of pancreatitis events. Prior ultrasound and computed tomography imaging for pancreatitis ruled out gallstones or anatomical etiologies. The patient was treated with proton-pump inhibitors and avoided spicy foods and alcohol with minimal resolution of symptom severity or frequency.
On presentation, the patient reported intermittent right upper quadrant pain with nausea and episodes of constipation and diarrhea, but without evidence of fat malabsorption. He denied emesis, fever, or weight loss, and also denied sinus or respiratory symptoms. He had no current alcohol use. Family history included a brother with CF carrier status who suffered from recurrent acute pancreatitis.
Physical examination was significant for obesity (BMI = 39.4 kg/m2), mild right upper quadrant tenderness, and negative pulmonary findings. Laboratory evaluation was notable for normal LFTs with mildly elevated lipase (116 U/L). Despite obesity, he had severely diminished fecal elastase (< 15.0 μg/g feces) and decreased Vitamin D (11.7 ng/mL), suggesting at least intermittent or evolving pancreatic insufficiency. Computed tomography of abdomen demonstrated acute interstitial edematous pancreatitis without evidence of necrosis and thickening of duodenum likely due to pancreatic inflammation. Abdominal ultrasound showed hepatomegaly with hepatic steatosis with abnormal flow within hepatic veins suggesting possible hepatic fibrosis. Pulmonary function testing resulted in 87 and 90% of predicted FVC and FEV1, respectively, with a preserved FEV1/FVC (0.80) High-resolution computed tomography of the chest showed modest air trapping in the dependent lungs with early signs of bronchial wall thickening; sputum cultures were negative for CF pathogens. Sweat chloride testing indicated CFTR dysfunction (57 mmol/L). Genetic testing demonstrated disease causing CFTR mutations: R1117H/7 T/F508del.
Awaiting genotyping, the patient was prescribed pantoprazole 40 mg daily and pancrelipase 20,880 USP units TID with meals, and he declined other respiratory interventions. On follow-up 6 weeks later, he reported that low dose pancrelipase worsened gas and diarrhea symptoms. Pancrelipase was discontinued and the patient was prescribed ivacaftor 150 mg BID. After 6 weeks of ivacaftor treatment, patient reported improved gastrointestinal symptoms. For an additional 19 months, patient reported no episodes of pancreatitis, representing a marked improvement in frequency (Fig. ), until he discontinued ivacaftor. Over the next 3 weeks, patient experienced progressive nausea and sharp epigastric pain and laboratory studies confirmed pancreatitis with elevated amylase (231) and lipase (1221), but normal LFTs. Patient experienced 2 episodes of pancreatitis in the first month off medication. They were instructed to resume ivacaftor but subsequently lost to follow up. |
pmc-6624932-1 | 1A 58-year-old woman presented to the ophthalmology clinic with 1 and a half years of right eye redness and ocular hypertension. Tracing her history, she had recurrent headaches for several years without a history of head trauma. She was diagnosed with right eye dry eye and glaucoma and received treatment including an NSAID, immunosuppressive therapy, a prostaglandin analogue and β-blocker combination medication for eye pressure reduction, and even embolization of the lacrimal punctum. However, all the treatments only slightly decreased the intraocular pressure with no improvement in eye redness and headache. On examination, the visual acuity and intraocular pressure in the right eye of the patient were 20/40 and 20 mmHg after the aforementioned treatment, while these variables in the other eye were 20/25 and 14 mmHg, respectively. Physical examination revealed exophthalmos and severe corkscrew hyperaemia with dilated vessels in the right eye. The results of fundoscopic examination of both eyes were normal. No obvious lesions were found in the optic disc and fundus vessels of either eye (Fig. ).
After we considered that the symptoms may be related to abnormal intracranial vessels, computed tomography angiography and venography (CTA + CTV) were performed, and the results showed an arteriovenous malformation (AVM) in the right parietal-occipital area in the brain. The AVM was definitively located by further examination with digital subtraction angiography (DSA). DSA revealed that the AVM is fed by the posterior cerebral artery and pericallosal artery and is drained by the medial atrial vein. Then, this malformed venous structure could lead the arterial blood flowing into the superior ophthalmic vein (Fig. ).
With these results, the patient was ultimately diagnosed with an “occipital lobe cerebral arteriovenous malformation”, and surgical treatment was given.
After the general cerebral angiography probe reached the right occipital lobe AVM embolism, the arteriovenous malformation mass was blocked. This block led to restoration of normal blood flow of the superior ophthalmic vein, in which the conjunctival congestion of the right eye was significantly relieved (Fig. ) and the intraocular pressure decreased to normal (14–15 mmHg). |
pmc-6624935-1 | A 40-year-old woman presented with complaints of occasional abdominal pain, especially in the mesogastric region, vomiting, and alternating mucous diarrhea and constipation for about 2 years (since 2016).
The patient reported that the symptoms had existed for about 2 years.
The patient’s medical history was unremarkable.
There were no remarkable findings on physical examination.
Abdominal ultrasound and computed tomography (CT) were performed and revealed a neoplasm (10 cm × 7 cm) with strong enhancement in the pancreatic body tail. We began to suspect PNET or sarcoma according to these imaging findings. The CT imaging also showed that, cranially, the tumor was in contact with the splenic artery but without signs of infiltration. In addition, an enlarged para-aortic lymph node (1.7 cm) was found below the left renal artery, near the left lower adrenal border. No intra/extrahepatic bile ducts’ dilation was observed.
The patient underwent ultrasound-guided fine needle aspiration, and cytological analysis of the aspirate confirmed the PNET diagnosis.
Upon surgical investigation, a massive, hard lesion (12 cm) was found at the level of the pancreatic tail and determined to be causing a dislocation of the stomach (Fig. ). The central region of the mass showed tenacious adhesion to the retroperitoneal wall, and a sample was sent for histological typing. Finally, a distal pancreatectomy with splenectomy was performed. No postoperative complications were observed, and the patient was discharged 8 days after the surgery. Histological analysis showed the spleen to be free of tumor cells but the retroperitoneum to be infiltrated by tumor cells (pT3N1). In addition, the lesion was confirmed to be a well-differentiated PNET (G2), with a poorly differentiated small component and perineural and vascular invasive growth (G3). Of the 6 lymph nodes excised, 1 was metastatic.
After surgery, the patient underwent 68Gallium-DOTATOC positron emission tomography (commonly known as PET) imaging analysis, which produced no evidence of pathological uptake. Consequently, in October 2016, the adjuvant treatment was started, due to the high risk of local and distant relapse (high grade, lymphnodal metastases), consisting of combined concurrent radio chemotherapy, which was administered until January 2017. The radiotherapy was carried out by an intensity-modulated static step-and-shot technique to the surgical bed and locoregional lymphatic drainage, according to our institutional protocol []. A total dose of 6120 cGy, with daily fractionation of 180 cGy, was given to the planning target volume that had been defined according to the International Commission on Radiation Unit (commonly known as ICRU) Report 83 guidelines. The chemotherapy was carried out concomitant to radiation treatment, by means of an i.v. infusion of cisplatin (40 mg/mq weekly) and an oral administration of etoposide (100 mg on days 1–6 and 22–27).
The treatment regimen was well tolerated, with only a grade II gastro-intestinal toxicity (Common Toxicity Criteria of Adverse Event in the Clinic v4.2 recording system), which manifested nausea and vomiting. Subsequently, octreotide was administered s.c. every 28 days until October 2017, when a biochemical relapse was reported (chromogranin A (CgA) at 337 ng/mL), bringing an end to the 12-month disease-free interval. The patient also reported the development of a lesion in the left breast at this time.
The patient’s breasts and nipples were grossly normal in shape and symmetric, without secretions. In the left axillary region, however, the skin was red with retraction. A palpable hard mass was found, which was adherent to the surrounding tissues. The patient also indicated the presence of a small subcutaneous lesion in the left posterior region of the neck.
A quadrantectomy was performed on the upper outer portion of the left breast. Extemporaneous examination of the neck was carried out, followed by surgical excision of the lesion in the left posterior region. |
pmc-6624950-1 | Patient 2 (P2), the 5.1-year-old younger brother of P1, presented with a fever of unknown origin and had polyarthritis at age 2.6. He was initially diagnosed with polyarticular juvenile idiopathic arthritis (JIA) because of the chronic synovitis of his joints, which was found in a local hospital (Fig. d). He was admitted to our hospital for further assessment due to abdominal pain, diarrhea and perianal abscess after discharge from the local hospital. On admission, HLA-B27 was positive, but no significant autoantibody was detected in his serum. Under endoscopy, multiple ulcers were found on the gastrointestinal tract. The change of pathology was consistent with Crohn’s disease. Therefore, the patient was diagnosed with Crohn’s disease and inflammatory bowel disease-related arthritis (IBD-RA). Prednisolone, Etiasa and MTX were given to him, and his joint symptoms and intestinal symptoms disappeared gradually. He is currently being treated with anti-TNFα (etanercept 12.5 mg/ 5 days), Etiasa and MTX. The treatment has displayed good efficacy. |
pmc-6624950-2 | Patient 4 (P4), a 9-year-old girl, visited a local hospital complaining of a fever of unknown origin and polyarthritis at the age of 7 years. She was also diagnosed with polyarticular juvenile idiopathic arthritis (JIA) because of the chronic synovitis of her joints (Fig. e). She was referred to our hospital for evaluation due to oral ulcers, cough, and positive ANA and anti-ds DNA antibodies after discharge from the local hospital. She had no relevant past medical history and no family history of rheumatic diseases. On admission, laboratory studies showed hyperferritinemia (> 2000 ng/ml), hypertriglyceridemia (5.57 mmol/L), hypofibrinogenemia (2.0 g/L), and increased levels of Alanine Aminotransferase (61 IU/L), Glutamic-oxalacetic Transaminase (97 IU/L) and lactate dehydrogenase (726 IU/L). HLA-B27 and ANA were positive for her, but no other autoantibody was detected in her serum. Lung CT scan showed interstitial lung disease (ILD) (Fig. f). Therefore, she was diagnosed with JIA, macrophage activation syndrome (MAS) and ILD. Voltaren, prednisolone, and CSA were given to her, and her temperature became stable while joint symptoms disappeared quickly. She is currently receiving anti-TNFα (etanercept 25 mg/week) in association with low dose prednisolone. The treatment has displayed good efficacy, and ILD was significantly improved (Fig. f).
The demographic and clinical features of the patients are summarized in Table and Table , respectively. The laboratory findings of pre-therapy and post-therapy in the patients are summarized in Table . |
pmc-6624960-1 | A 57-year-old woman presented with a 15-year history of a slowly growing left maxillary bony tumor causing significant proptosis and distortion of her left orbit with associated loss of vision (). The patient underwent resection by ENT via a modified Weber-Ferguson incision (). The resulting defect included the left hemi hard palate, lateral nasal wall, orbital floor, and lateral wall of the maxilla. The orbital floor was reconstructed with a titanium mesh implant and the soft tissue was reconstructed with an anterolateral thigh single perforator free flap. The skin paddle was folded to reconstruct the intraoral palatal defect and lateral intranasal wall. The final pathology report showed an 8 cm long fibro-osseous lesion with features suggestive of fibrous dysplasia. Postoperatively, the patient has improved globe position and has resumed a normal diet with her dentures. The patient will undergo revision surgery including flap debulking and soft tissue resuspension (). |
pmc-6624965-1 | A 43-year-old pregnant woman (16 weeks) from Meana Town of Gibi District was sick on April 23, 2018. She had a mild fever at the beginning of her illness. She did not seek medical attention as early as possible considering that her illness was mild. New sign and symptoms gradually appeared and the illness was getting worse. She started manifesting respiratory distress, weakness, and difficulty of swallowing, muscle, joint and back pains. Following the appearance of the new symptoms, she sought medical care at one of the public clinics in Peter Town on May 2, 2018. The clinic treated her for malaria in pregnancy and prescribed quinine, amoxicillin and paracetamol tablets. They referred her to another health facility, private clinic, on May 3, 2018, where she admitted for two nights. Moreover, the clinic later transferred her to the referral hospital on May 5, 2018. The referral hospital admitted her to obstetrics and gynecology ward and gave her supportive treatment. However, her clinical condition was not improved and she started vomiting with blood. At this point, the clinician at the hospital suspected LF and sent a blood specimen to the National Reference Laboratory on May 7, 2018, and the result turned positive for LASV. However, the patient died of her illness before the hospital able to provide ribavirin, which is available and effective antivirus for LF treatment.
Four ml blood specimens were collected from the two acute febrile cases in a lavender top K3EDTA glass tube and transported to the National Reference Laboratory at NPHIL. The specimens were first tested for Ebola virus disease (EVD) and then tested for LASV by RT-PCR which is a gold standard diagnosis for LASV [] to detect RNA virus. Previously established and described Trombley RT-PCR assay was used to test specimens for LASV [].
We captured the geographic coordinates of residential places of the two cases using a mobile-based global positioning system (GPS) and created a point map on the base map of Liberia, using Arc GIS 10.4.1 (Fig. ).
Following the detection of the first case, we strengthened the public health surveillance system at a district, health facility, and community levels through distributing standard and community case definitions and increasing awareness. We conducted an active case search in all health facilities and communities through engaging health workers and community informants. Accordingly, we identified five LF alert cases, cases with unexplained fever and ruled out for malaria, through an active case search. A blood specimen was collected from all the reported alert cases. The hospital admitted the alert cases in the isolation room and provided supportive treatment while laboratory results waited. We ruled out all the five alert cases, as the specimens from all patients were negative for LASV by RT-PCR at the national reference laboratory.
The Margibi Health Team together with its partners worked to trace and identify family members, health workers, and friends who may have had contact with the patients or their body fluids or their dead bodies. Contact tracers recruited, trained and deployed to identify all contacts. Through discussions with the family members, caregivers, and health workers, the contact tracers have identified 89 contacts and categorized them to low and high-risk contacts based on the level and degree of their contact with confirmed patients. Twenty-two (25%) and 67 (75%) contacts were classified as high and low-risk contacts respectively. Among the total contacts, 31 (35%) had contact with first case while 58 (65%) had contact with second case. Most of the contacts, 32 (36%) were health care workers (HCW). All the contacts have been followed-up by trained contact tracers for 21 days after the last date of contact with the case. All the contacts have completed the follow-up period. We did not observe an associated case among contacts.
Following the detection of the LASV from the blood specimen of the two diseased patients, we reinforced infection prevention and control (IPC) measures in all public and private health care facilities. We sensitized and mentored the health workers on LF prevention, use of appropriate Personal Protective equipment (PPE), hand hygiene practices and waste management procedures. Furthermore, we updated, printed, and distributed the LF flyers and brochures to health workers and community informants. The county health promoter has presented LF jingles at two radio stations in the county. The county health team has activated the emergency operations center, and coordinated the response interventions on a daily bases.
Trained and protected morticians of the hospital placed the dead body of the first LASV confirmed case in a waterproof plastic body bag in an isolation room and taken to the morgue. Moreover, the morticians and country surveillance officer placed the body on the car and taken directly to the funeral home on May 4, 2018, at 11:00 am. The county surveillance officer advised the family members, relatives, and friends not to touch the dead body while viewing to avoid the possible risk of infections. In addition, the surveillance officer supervised the dead body at the funeral home. The county burial team escorted and transported the dead body from the funeral home to the burial site to ensure safe and dignified burial practice on May 05, 2018 at 12:00 pm.
Similarly, the morticians managed the dead body of the second case and placed it in a plastic body bag. We kept and supervised the body in the morgue room of the hospital until the laboratory result returned back. The family members prepared a burial place while the dead body was in the morgue of the hospital. Ensuring the readiness of the burial place, the burial team placed the dead body on a car and took it directly to the burial site in Gibi district. The county burial team managed dignified and safe burial procedures. The hospital disinfected the morgue room by chlorine solutions after the dead body taken to the burial site. |
pmc-6625038-1 | A six-year-old boy was referred to the Department of Endocrinology at Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine (Shanghai, China) for being lethargic and pale for 1 week. During this time, he had developed polydipsia, polyuria (>10 times of the daily amount), polyphagia, and weight loss (4 kg in 1 week); however he had no fever, cough, vomiting, or diarrhea.
His medical history showed that he had cerebral infarction with paralysis of the left arm and ventricular premature beat (VPB) without infection symptoms at the age of 9 months, bilateral hearing loss at the age of 1 year, and cochlear implant surgery at the age of one and a half years. When he was 4 years old, he was admitted to the local hospital because of listlessness, and his medical condition was diagnosed as diabetes mellitus. However, he did not receive any insulin therapy, but his blood glucose level was measured every 2–3 months. He was born at full term following an uneventful pregnancy to non-consanguineous parents of Chinese descent. He had no relevant family history of diabetes or deafness.
On examination, he was found to be 112.5 cm tall (−1SD: 111.1 cm, −2SD: 115.8 cm), and he weighed 17 kg (−2SD, 17.27 kg). He had horizontal nystagmus and was sensitive to light. His heartbeat showed arrhythmia, but without any obvious arrhythmic sound. Furthermore, he had hepatomegaly 2 cm below the rib line. No other physical abnormalities were detected.
The electrocardiogram (ECG) showed an ectopic rhythm (VPB) and QT extension, and echocardiography showed a slightly enlarged left atrium and left ventricle (LA = 2.57 cm, LVDD = 4.27 cm; the limit of a six-year-old child: LA = 2.15 cm, LVDD = 3.89 cm) with normal left ventricular systolic function. A homogeneous or heterogeneous pancreas and two enlarged kidneys with diffusely enhanced medullas were observed in the abdominal ultrasound. Head CT scan revealed atrophy of the right cerebral hemisphere, and a softening at the right side of the basal ganglia (Fig. ).
The patient had hyperglycemia (serum glucose: 26.5 mmol/L) and diabetic ketoacidosis (ECO2: 16.0 mmol/L, serum and urine ketones: 4+). His serum insulin and C peptide levels were below normal (serum insulin: 0.1 uIU/mL, normal range 1.9–23; C peptide: 0.64 ng/ml, normal range 1.1–4.4), while his glycated albumin (GA) and glycosylated hemoglobin (HbA1c) levels were elevated (GA: 46.6%, normal range 11–16%; HbA1c: 74 mmol/mol, normal range 18–40). Antibodies pertaining to diabetes, such as glutamic acid decarboxylase antibody (GADA), islet cell antibody (ICA), and insulin antibody (IAA) were absent in his blood. He was also found to have leukopenia (Neutrophils: 1.0 × 109/L, with WBC: 3.1 × 109/L), thrombocytopenia (Platelets: 52 × 109/L), and anemia (Hb: 62 g/L, MCV: 98.0 fl, MCH: 31.6 pg, MCHC: 32%).
As he had anemia, we performed some examination to identify its type. Vitamin B12 and folic acid levels were not low at all (1333.00 ng/L, normal range: 197–866; 12.90 μg/L, normal range: 3.1–17.5, respectively). In addition, the levels of serum iron and serum iron saturation were above normal (31.1 μmol/L, normal range: 6.6–26; 80.2%, normal range: 20–55%, respectively), while the levels of unsaturated iron binding capacity, total iron binding capacity, and transferrin were below normal (7.7 μmol/L, normal range: 20–62; 38.8 μmol/L, normal range: 54–77; 1.60 g/L, normal range: 2–3.6, respectively). Bone marrow cytology showed active bone marrow hyperplasia, and active iron in the red blood cells (the positive rate of iron staining was 82%, and a few were suspected as ring sideroblasts). However, there were no obvious abnormalities in his hepatic, renal, hematopoietic and thyroid functions and urinary amylase levels.
Genomic DNAs of the patient and his parents were isolated from 2 ml peripheral blood samples collected from the cubital veins using a QIAamp Blood DNA Mini Kit® (Qiagen GmbH, Hilden, Germany). A total of 3 μg of the patient DNA was sheared to fragments of 150–200 bp using a Covarias® M220 Ultrasonicator system (Covaris, Inc. Woburn, MA, U.S.). An adapter-ligated library was generated with Agilent SureSelect Target Enrichment System (Agilent Technologies, Inc., Santa Clara, CA, U.S.) according to the manufacturer’s instructions. Capture library was prepared using an XT Inherited Disease Panel (cat. No.: 5190–7519, Agilent Technologies, Inc.), and comprised 2742 genes. Clusters were then generated through isothermal bridge amplification using an Illumina cBot station, and sequencing was performed with an Illumina HiSeq 2500 System (Illumina, Inc., San Diego, CA, U.S.).
Base calling, and assessment of the sequence read quality were performed using Illumina HCS 2.2.58 software (Illumina, Inc.) for the Illumina HiSeq 2000 system, which included new versions of HiSeq control software and Real Time Analysis. Alignment of the sequence reads against a reference human genome (Human 37.3; SNP135) was performed using NextGENe® (SoftGenetics LLC, State College, PA, U.S.). All single nucleotide variants (SNVs) and indels were saved in a VCF format file and uploaded to be processed with Ingenuity® Variant Analysis™ (Ingenuity Systems, Mountain View, CA, U.S.) for biological analysis and interpretation.
The primers for amplification of the SLC19A2 gene (GenBank accession no.: NM_006996.2) were designed using UCSC ExonPrimer online software () and synthesized by Map Biotechnology, Co., Ltd., Shanghai, China. The primers designed for exon 3 were as follows: forward 5′-TCGCCAGAGGGGATAAATG-3′, and reverse 5′-AGTCATAGTCCTGCTCCACTTG-3′. The primers designed for exon 2_1 were as follows: forward 5′- TCTGAACTGCTGTTGTCAAGG-3′, and reverse 5′- AGCCTGCCACTGAGACAAG − 3′. The exon and exon-intron boundaries were amplified using polymerase chain reaction (Takara Biotechnology, Co., Ltd., Dalian, China). The resulting DNA was sequenced with the forward and reverse primers using an ABI3730XL sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, U.S.). The sequence data were analyzed using Mutation Surveyor® software version 4.0.4 (SoftGenetics, LLC.).
For a rapid and accurate clinical diagnosis, the patient was screened for causal variants using targeted DNA sequencing according to an in-house analysis protocol. Consequently, a novel compound heterozygous mutation in the SLC19A2 gene of the patient was identified: a single nucleotide deletion (c.903delG) in exon 3, and a duplication (c.405dupA) in exon 2_1 (Fig. ). The two frameshift variants do not exist in the current the genome Aggregation Database (gnomAD). Alamut software predicted that the mutation could cause premature termination during translation, resulting in the formation of a truncated THTR-1 protein. Therefore, we classified this compound mutation as a “pathogenicity variation.” Subsequently, the SLC19A2 genes of the patient’s parents were analyzed using Sanger sequencing. Thereby, it was identified that the patient’s father carried c.903delG mutation (heterozygous) in the SLC19A2 gene, and the patient’s mother carried c.405dupA mutation (heterozygous).
Based on the bone marrow cytology, genetic analysis, and clinical presentations, such as diabetes, anemia, and deafness, the patient was diagnosed to have TRMA syndrome. Consequently, he was treated with insulin (1 U/kg/day), thiamine (30 mg/ day), and propafenone (150 mg/day). Following thiamine administration, the patient’s blood glucose showed improved levels of thiamine (5–6 mmol/L), and his daily insulin requirements progressively decreased to 0.5 U/kg/day. In addition, the hemoglobin level in his blood gradually increased from 62 g/L to 112 g/L in 3.5 months, and his ECG reading turned to normal in 1 month. |
pmc-6625043-1 | A 44-year-old Indian man, resident of New Delhi, India, a known alcoholic, presented with a 2 day history of fever. His fever was 39.44 °C (103 °F), continuous and was associated with chills and rigors. Two days after onset of fever, he developed painful bluish discoloration of both hands and feet. There was no history of bluish discoloration of tongue, breathlessness, or chest pain. There was no history of hypertension, diabetes, malaria, or any chronic illness in this patient.
On clinical examination he was conscious, oriented, and well hydrated. His pulse was 80 beats per minute. Bilateral radial and dorsalis pedis arteries were feeble with bluish discoloration of fingers (Fig. ) and toes. His other peripheral pulses (carotid and femoral arteries) were palpable but low in volume. Blood pressure was not recordable in both upper limbs and was 90/60 mmHg in both his lower limbs. Both hands and feet were pale and cold to touch and there was marked tenderness in both forearm and calf muscles. There was no cyanosis of tongue or nose and there was no lymphadenopathy. The rest of the clinical examination was unremarkable.
A provisional diagnosis of symmetrical arterial ischemia/obstruction with impending gangrene was made and he was investigated further.
His hemoglobin was 15.9 g/dL (13–18 g/dL), hematocrit 44.8% (40–50%), total leukocyte count 3.9 × 103/mm3 (4–11 × 103/mm3), and platelet count 8000/mm3 (150,000–400, 000/mm3). Renal and liver functions were deranged with blood urea 90 mg/dL (15–45 mg/dL), serum creatinine 2.6 mg/dL (0.5–1.5 mg/dL), serum bilirubin 12.70 mg/dL (0.2–1.2 mg/dL), direct bilirubin 9.86 mg/dL (0.0–0.2 mg/dL), indirect bilirubin 2.84 mg/dL (0.0–1.0 mg/dL), albumin 2.4 g/dL (3.4–5.0 g/dL), aspartate transaminase 116 IU/L (5–40 IU/L), alanine transaminase 46 IU/L (5–40 IU/L), and alkaline phosphatase 116 IU/L (45–116 IU/L). His prothrombin time was 27.3 (control value 13); his international normalized ratio (INR) was 2.30. His random blood sugar was 64 mg/dL and arterial blood gas analysis was unremarkable.
Arterial Doppler of both upper and lower limbs was normal and did not reveal any thrombus in any of the arteries. Radiography of his chest was normal.
A peripheral smear (using Giemsa stain) for malaria revealed ring forms and schizonts of P. vivax (Fig. a, b). The level of parasitemia in thick blood films was 2+ which corresponds to 11–100 parasites/100 thick films fields examined. This was later confirmed by a malaria antigen rapid diagnostic test (RDT) which detected P. vivax lactate dehydrogenase (LDH) ruling out a mixed infection with P. falciparum. NS1 antigen and dengue serology were negative. Fibrin degradation products was > 20 μg/ml (< 5). His D-dimer level was 26.52 μg/mL (< 0.5) fibrinogen-equivalent units. Tests for antinuclear antibodies and antineutrophil cytoplasmic antibodies were negative.
He was treated with injection artesunate 120 mg followed by lumefantrine 480 mg and artemether 80 mg two times per day for 3 days followed by primaquine 15 mg (0.25 mg/kg) per day for 14 days; his glucose-6-phosphate dehydrogenase (G6PD) levels were normal. He also received six units of platelet concentrates, along with cautious use of intravenously administered fluids.
The response to this line of treatment was striking and gratifying. He became afebrile by the second day of admission and by the third day all peripheral pulses were well felt along with normalization of blood pressure in all his limbs. Bluish discoloration of both hands and feet started fading by the third day and pain disappeared in the involved regions. His laboratory investigations normalized by sixth day of admission following treatment except for slightly raised bilirubin. He was discharged and no clinical or laboratory abnormality was reported on follow-ups at 2 weeks and 6 weeks. |
pmc-6625076-1 | The second case occurred in 2013 involving a 15-year-old boy who presented for medical male circumcision at a VMMC clinic established in 2012. The clinic staff numbered 22 including managers, medical officers, nurses, and support staff. On the day of the incident 58 circumcisions had been performed, 34 of these by the operator prior to the incident. As in the previous case, after informed consent was sought from the boy's guardian, standard guidelines were followed in the screening and surgical preparation. The operator was a medical officer, who had completed 8000 circumcisions, assisted by 2 nurses. The surgical technique used in the procedure was the forceps-guided method. Local anaesthetic, 2 ml Marcaine 0,5% plus 8 ml lignocaine 2%, was injected into the base of the penis via ring block using a syringe and needle with marked swelling of the penis from the base of the penis to the foreskin. The operative procedure was initiated at 15 h19. The operator clamped the foreskin with a forceps and palpated for the position of the glans. As the foreskin was excised the operator noticed that the glans had been partially amputated and the urethra was exposed. The procedure was abandoned and haemostatic control was maintained whilst a urologist was called in to assess the patient. A partial distal glans amputation was diagnosed by the attending urologist and within 3 hrs the patient was taken to theatre for repair and reconstruction. Glans reconstruction was attempted with re-attachment of the transacted part of the glans and catheter inserted. However, post-operatively, a large portion of the reattached glans became necrotic and the patient subsequently developed a urethro-cutaneous fistula. The patient required further reconstruction. |
pmc-6625076-2 | The third case was a 10-year-old boy occurred at a VMMC clinic situated in a rural area. The clinic was established in 2012 and has a total staff complement of 22, including medical officers, clinical associates, nurses and other support staff. On the day of the incident, 120 circumcisions were performed at the clinic. The operator involved was a clinical associate (a cadre of staff with four years of medical training and licensed to do circumcisions) with experience of over 1000 circumcisions. He performed 25 circumcisions that day prior to the incident. The patient was consented and screened as in the previous two cases. The procedure started at 12 h30, using a modified forceps guided circumcision as the patient had phimosis. Local anaesthetic was injected by penile ring block using 3 ml lignocaine 2% and 1 ml Marcaine 0,5%. After the dorsal slit was made, preputial adhesions were released and the glans was palpated before the forceps was clamped. After the foreskin was excised the operator noted a partial amputation of the glans on the dorsal aspect, the urethra was not involved. A medical officer was immediately called to assist. A urethral catheter was inserted and haemostatic control of the wound was achieved through cauterisation and sutures. The patient was referred to a hospital for further reconstruction by a urologist. The patient has healed without sequelae.
The total number of men and boys under 15 years, and those 15 years and over circumcised in five high volume male circumcision clinics under the same administration as the three clinics where the glans amputation occurred was 17,551 and 53,782, respectively, yielding rates of glans amputation of 11.3/100000 and 1.8/100000 in those younger than 15 years, and 15 years of age or older, respectively (p = 0.0126). |
pmc-6625137-1 | The subjects were a 5-year-old girl and her parents. Both parents were clinically asymptomatic for β-thalassemia, but clinical examination of their daughter showed anemia, paleness, jaundice, and splenomegaly. She also had a history of transfusion dependence but her most recent transfusions were in the years before this study was undertaken, so the transfused cells are not expected to interfere with the present study. A complete blood count and Hb analysis were carried out for the family according to standard methods. Molecular studies were undertaken on both genomic DNA and RNA isolated from family members, after obtaining informed written consent. The mother's samples were labeled “M”, the daughter's samples were labeled “D”, and control samples were labeled “N”. |
pmc-6625138-1 | A 4-year, 6-month-old male was referred to us with newly diagnosed β-mannosidosis. His birth history was notable for maternal preeclampsia necessitating C-section at term. After an uneventful infancy, he was found to have hypotonia at 8 months of age. He rolled at 11 months, sat alone at 12 months and walked at 22 months. He first spoke at 30 months. At age 1 year, macrocephaly was noted, and an MRI revealed mild-to-moderate cerebral hypomyelination. He was diagnosed with Autism Spectrum Disorder at age 2. Due to persistent language and motor developmental delays in the face of multiple rehabilitative therapies, repeat MRI at age 4 years, 3 months re-demonstrated poor myelination with symmetric T2 hyperintensities in the deep and subcortical white matter as well as the posterior limbs of the internal capsule (Figure ). Additionally, he was noted to have a head circumference at the 93rd percentile. Given the constellation of findings, the possibility of a metabolic storage disease was part of the differential diagnosis, and a leukocyte oligosaccharidosis screen was performed that showed low leukocyte β-mannosidase activity at 2.62 nmol hr-1 mg-1 (normal range 10–162.4 nmol hr-1 mg-1, Figure ). Sequencing of MANBA (OMIM #248510) revealed compound heterozygous mutations: NP_005899.3:p.(Trp192Ter) (known pathogenic) and NP_005899.3:p.(Arg500His)(novel, but predicted to be pathogenic).
His exam prior to UCBT showed dysarthria, mild hypotonia, mild dysmetria, and wide-based gait with external hip rotation. An EEG, nerve conduction study (NCS), tympanogram, and otoacoustic emissions evaluation were all normal. Initial neurocognitive assessment prior to UCBT indicated slightly below average intellectual functioning and impaired language functioning. |
pmc-6625149-1 | Patient 3’s first seizure occurred when he was 3 days old. The seizures were general tonic-clonic seizures with lip cyanosis. He was first treated with intravenous phenobarbital, after which the seizures temporarily remitted. At 1 year old, the patient had another general tonic-clonic seizure and was treated with OXC. His MRI and neurodevelopment were unremarkable. The family history showed that the patient's mother had had seizures from birth. A genetic study for KCNQ2 showed that both he and his mother had the c.387+1 G>T mutation but no KCNQ3 mutation (Supplementary Figure : upper). |
pmc-6625149-2 | Patient 5’s first seizure was a general tonic-clonic seizure with lip cyanosis when she was 3 days old. The seizures remitted after she had been treated with oral phenobarbital. Her MRI and neurodevelopment were unremarkable at 4 years old. The family history showed that the patient's mother and sister had had seizures from birth. A genetic study for KCNQ2 showed that all three had the c.1741 C>T(p.Arg581*) mutation. |
pmc-6625209-1 | A 54-year-old Chinese man consulted a medical doctor with the complaint of recent painful neck and right upper limb without any clear causes. He had a medical history of left traumatic humeral fracture 10 years ago that did not significantly affect his recent daily life after surgery. The patient had no recent history of head or spinal trauma and did not take any related antiplatelet or anticoagulant drugs. In addition, the patient had no exposure to any toxic substances and no significant relevant family history. A clinical diagnosis of cervical spondylosis was originally considered based on X-rays of the cervical spine, and the patient received small needle-scalpel treatment for relieving pain relief, which was administered by a rural doctor. When no obvious improvement was observed 20 days later, the patient was admitted to our hospital for further diagnosis and treatment. The patient was experiencing progressive neurologic deterioration involving both upper and lower limbs. Upon neurological evaluation, he exhibited reduced response to light touch and pinprick, with a sensory level below the angle of the mandible. He had trouble during urination and significantly decreased muscle tension. He was subsequently incapable of antigravity power in his upper limbs (the left and right muscle strength was graded as 4/5 and 2/5, respectively) and had a significant loss of motor function in both lower extremities (the muscle strength was graded as 1/5). Urgent magnetic resonance imaging (MRI) of the cervical spine demonstrated a right spinal epidural hematoma located at the posterior spinal epidural space with severe cord compression and subcutaneous soft tissue hemorrhage, extending from the C2 to C7 spinal vertebral level (). Routine laboratory investigations indicated that renal and liver functions, serum potassium and coagulation index were normal. Given his progressive symptoms and MRI results, the diagnosis of cervical extradural hematoma was finally considered. The patient had received the ventilatory and adjunctive therapy, omeprazole, mannitol, and a high dose of steroids after the diagnosis of cervical extradural hematoma. Unfortunately, the patient refused urgent surgery; thus, he continued to progressively deteriorate and later died due to respiratory failure. |
pmc-6625222-1 | Patient A is a 39-year old female from the United Kingdom who was diagnosed with probable CVID at age 24 after presenting with recurrent childhood infections, including pneumonias. She also experienced multiple autoimmune complications, including vitiligo in her adolescent years and developed alopecia at age 20 (). At age 24, she was hospitalized with severe bulbar palsy and was diagnosed with myasthenia gravis without thymoma. At this time, immunological studies were performed, which were positive for lymphopenia, neutropenia, autoimmune hemolytic anemia (AIHA), and a IgG deficiency (3 g/L), but without deficiency in IgM or IgA. Because of lack of response to two challenges of pneumococcal vaccines, deficiency in one immunoglobulin isotype, and negative test for hyper IgM syndrome, a diagnosis of probable CVID was made (). She was subsequently started on IVIG replacement, and azathioprine and pyridostigmine for her myasthenia gravis. At age 28, she presented with restriction in movement of joints, prompting synovial fluid analysis which was negative for inflammatory cells. Subsequently, a muscle biopsy was performed revealing macrophagic myofasciitis. She initially responded well to treatment with steroids, but experienced 2 further relapses of macrophagic myofasciitis over 4 years, requiring steroids. Methotrexate was started as a steroid-sparing agent and azathioprine was stopped. She then developed knee arthritis, and another synovial fluid analysis was done on her right knee, which demonstrated inflammatory cells. She was diagnosed with inflammatory arthritis at age 33. She continued on methotrexate and steroids with addition of sulfasalazine, but due to suboptimal response, sulfasalazine and methotrexate were replaced with anti-TNFα with no response, then with anti-IL-1 (Anakinra) with no significant improvement. At age 34, patient A visited a rheumatology clinic and was started on tocilizumab, an anti-IL-6 biological agent, resulting in complete remission of joint-related symptoms. She has been in remission for the past 5 years. As part of the 2018 BRIDGE study on genetic defects in PID cohorts, she underwent whole exome sequencing and was found to have a compound heterozygous RAG2 mutation (c.a. G1352C, b. T629C; p.a. I210T, b. G451A), causing an average recombination activity of 6.4 ± 0.2% (). Elevated IgA reflects inflammation and patient had progressive B cell loss and very low fraction of naïve T cells. Anti-cytokine antibodies were also present (). Together, based on the immunological phenotype and reduced recombination activity, CID phenotype was established. |
pmc-6625222-2 | Patient B is a 5 year-old female from Bulgaria who was born full-term with no complications, but had multiple gastrointestinal and upper respiratory infections starting at 4 months of age (). She required hospitalization at 14 months for bacterial gastroenteritis after presenting with high fever, diarrhea, decreased oral intake, and was subsequently treated with antibiotics. Two months later, she was hospitalized again with fever, rash, swelling of the legs, feet, and fingers, with concern for Kawasaki's disease after live MMR vaccination. Eventually, she was diagnosed with macrophage activation syndrome (MAS), successfully treated with parenteral and oral corticosteroids with good effect. Given that she was previously hospitalized with a bacterial infection and recurrent infections since 4 months of age, she also had a workup for immunodeficiency, which raised a suspicion for primary immune deficiency ().
At 20 months of age, she presented with another episode of fever and swelling of multiple joints with laboratory workup revealing leukopenia, elevated IgM, elevated CRP, elevated ESR, elevated ANA titer (1:1,280), and positive anti-dsDNA and anti-phospholipid IgM antibodies. At this time, she was diagnosed with inflammatory arthritis, with differential diagnosis of systemic lupus erythematosus as she fulfilled the WHO classification criteria for SLE (4/11 criteria: arthritis, leucopenia, positive ANA and positive dsDNA and APL). Her joint symptoms were controlled with NSAIDs and glucocorticoids. At 30 months of age, elevated ANA titers prompted therapy with hydroxychloroquine and glucocorticoids that resulted in a reduction in ANA titer to 1:320. Patient B was asymptomatic until 4 years of age, when she developed alopecia that was thought to be a side effect of hydroxychloroquine and therefore discontinued. Approximately 8 months later, she was hospitalized with pneumonia.
Because of her clinical history and abnormal immune phenotype, patient B's was further investigated. Fortunately, cord blood was obtained at birth and preserved at the National Public Cord Blood Bank. Immunological testing of the cord blood revealed an absence of T cells and B cells, and T-cell receptor excision circles (TREC) were undetectable. This led her clinicians to search for SCID-related genetic defects, revealing a homozygous RAG1 mutation (c. C1443T, p. A444V) which causes a recombination activity of 1.4 ± 0.2% (). Patient B had low naïve CD4 count, declining B cell numbers, and expansion of the NK cells. Although patient B had hypergammaglobunemia, she had a broad autoantibody profile (). Together, based on the immunological phenotype and reduced recombination activity, CID phenotype was established. |
pmc-6625477-1 | The patient was a 44-year-old Chinese man who was born healthy and developed normally until the age of 40 when he felt difficult to walk straight. The patient displayed cognitive decline and behavioral abnormality when he first sought medical advices associated with this discomfort at the age of 43 at the Second Affiliated Hospital and Yuying Children's Hospital, Wenzhou Medical University. Neurological examinations revealed bilateral cerebellar ataxia and generalized hyperreflexia. The Mini-Mental State Examination score of the patient was 12/30. His muscle bulk, tone, strength, and sensory function were normal. No abnormality in electrocardiogram and echocardiography was found. No endocrine disorder was detected. The Laboratory parameters including plasma lactate, complete blood count, and cerebrospinal fluid protein content were normal. His parents are non-consanguineous. His grandparents, parents, and his elder brother did not show any neurological or psychiatric problems.
The T1- and T2-weighted image of brain magnetic resonance imaging (MRI) exhibited extensive symmetric periventricular white matter abnormalities with slight ventricular system enlargement and sulci widening. The midline structure remained unchanged (Figure a,b). Multiple segments of high signal in the corpus callosum were detected in the sagittal view of T2-weighted image (Figure c). Analyses by fluid attenuated inversion recovery (FLAIR) showed hyperintensity in the deep and periventricular white matter, indicating white matter rarefaction (Figure d). Diffusion-weighted imaging (DWI) showed sporadic restricted diffusion abnormalities in periventricular white matter (Figure e). No enhanced signal was found in contrast enhanced MRI (CEMRI; Figure f). Magnetic resonance spectroscopy (MRS) showed a relatively high level of choline and low level of N-acetylaspartate in the left periventricular brain tissue (Figure g), where the T2-weighted hyperintensity was detected (Figure b).
Exome sequencing revealed that the patient carried a homozygous mutation in AARS2, that is, c. 452T>C (p. M151T). The mutation was confirmed by Sanger sequencing of his blood DNA (Figure a). The patient's father passed away at the age of 62 with no record of neurological disorders. We sequenced and analyzed the AARS2 genotype of his mother and elder brother. The results showed that both of them were heterozygous (Figure b,c). Thus, this patient in principle maternally and paternally inherited the mutation to be homozygous (Figure ).
The mutation was missense and localized in the exon 3 of AARS2 (Figure d). There was no record of this mutation in dbSNP (). The mutation was “probably damaging” as predicted by PolyPhen-2 () and ascribed to the category of “affected protein function” based on SIFT ().
Donepezil at the dose of 5 mg/day was prescribed to the patient for a duration of 1 month. Regular exercise such as walking was suggested. No significant improvement in cognitive function was observed in his follow-up visits. |
pmc-6625672-1 | A 67-year-old male, retired as security officer of copper mines area, presented with complaints of difficulty in micturition and backache since last four months. MRI pelvis showed enlarged prostate, altered signal intensity in peripheral zone of prostate gland predominantly on right side, involving adjacent part of right seminal vesicle, with irregularity of the prostatic capsule and right side iliac bone sclerotic metastatic lesion. Serum prostate-specific antigen (PSA) value was 67.69 ng/ml. Core needle biopsy from the prostate lesion was as moderately differentiated adenocarcinoma, Gleason’s score 3 + 4 = 7, perineural invasion was present, tumor was present in all cores. Bone scan showed right iliac bone metastasis lesion. Contrast enhanced CT scan chest and ultrasonography of abdomen were normal with no evidence of any metastatic lesion. He was diagnosed as carcinoma prostate with right iliac bone metastasis. He was treated with six cycles of docetaxel chemotherapy and denosumab, bicalutamide and gonadotropin releasing hormone (GnRH) agonist goserelin. Serum PSA levels came to 0.016 ng/ml after three months of initiation of the therapy. The hormone therapy was continued for the next two years and he remained asymptomatic for this period. After two years of the diagnosis of the prostate cancer he presented with difficulty in breathing, pain in left chest and backache for one week. Chest X-ray showed moderate left side pleural effusion. Left side inter-coastal drainage tube was inserted and pleural fluid aspiration was done. Pleural fluid cytology showed no malignant cells. Contrast enhanced CT scan of chest showed left side pleural effusion, hydropneumothorax with resultant partial collapse of left lung, left lung pleural thickening with calcification and a pleural-based nodule measuring 17 x 13 mm in left upper lung (Figure ).
Biopsy from the left pleural nodule by video-assisted thoracoscopic surgery (VATS) was done. The biopsy showed islands of cartilage surrounded by sheets of undifferentiated mesenchymal cells arranged in diffuse sheets with pleomorphic hyperchromatic nuclei with irregular nuclear borders and inconspicuous nucleoli and scant to moderate amount of cytoplasm (Figure ).
Immunohistochemistry staining was vimentin positive, S100 focally positive, WT-1 positive, CD 99 positive, D2-40 positive (Figure ) while negative for Pan CK, S-100, NKX3.1, calretinin, PSA, P504, with Ki67 proliferation index of 80%, which was suggestive sarcomatoid mesothelioma with chondrosarcomatous differentiation.
Poor prognosis was explained to the patient’s relatives, in view of aggressive mesothelioma as second malignancy. He was treated with six cycles of pemetrexed and carboplatin-based chemotherapy. PET-CT scan done for response assessment, showed FDG avid (SUV 7.44) residual stable generalized nodular left lung pleural thickening with multifocal calcification, collapse and consolidation in left lung lower lobe, reticulo-nodular septal thickening and ground glass haze in left lung likely due to lymphangitic spread (Figure ).
He was advised for best supportive management with palliative care as further treatment. |
pmc-6625673-1 | A 71-year-old gentleman with a past medical history of type 2 diabetes mellitus had been diagnosed with seronegative myasthenia gravis (MG). He was subsequently started on prednisone. He eventually received intravenous immunoglobulins (IVIG) every four weeks. He had undergone a CT chest angiogram for worsening dyspnea three months prior that had shown bilateral, acute, large pulmonary emboli. IVIG was felt to have contributed to this thrombotic event. He was discharged on apixaban.
The patient was now evaluated in the ER for a one-day history of chest pain with dyspnea, 18 months after initial diagnosis of MG. He was afebrile with blood pressure of 108/67 mmHg, heart rate 70 beats per minute (bpm), and with oxygen saturation of 95% on 2 liters/minute (L/min) oxygen via nasal cannula. Physical examination was remarkable for bibasilar crackles. He was noted to have leukocytosis with a white cell count of 11,300 mm3 including a 95% neutrophilic predominance. His creatinine was 1.0 mg/dL.
A repeat CT chest angiogram showed multifocal infiltrates in all five lung lobes with subtle ground glass opacity surrounding most infiltrates. The patient tested negative for HIV. He was started on broad-spectrum antibiotics including vancomycin, piperacillin-tazobactam, and ciprofloxacin. At the time, he reported taking prednisone 20 mg daily and mycophenolate 1000 mg twice daily for MG, in addition to pyridostigmine. Bronchoscopy was performed to rule out atypical infections such as pneumocystis jiroveci pneumonia (PJP). Urinary streptococcal, histoplasmosis, and legionella antigens (Ag) were ordered. In addition, viral respiratory polymerase chain reaction (PCR) testing, bacterial cultures, fungal cultures, and acid-fast bacilli (AFB) cultures were performed on the bronchoalveolar lavage (BAL). Antibiotics were subsequently de-escalated to levofloxacin as bacterial respiratory and BAL cultures returned negative. He was discharged home. However, he was re-admitted within a week with acute hypoxemic respiratory failure. A repeat CT chest angiogram now showed diffuse nodular infiltrates that were worsening despite having recently received antimicrobial therapy (Figure ).
He also reported two episodes of hemoptysis a few days prior to this presentation. No antibacterial agents were started at this point. He was afebrile. Given concerns for possible vasculitis, screening anti-neutrophil cytoplasmic antibodies (ANCA) and autoimmune panel were ordered. Meanwhile, results from his prior BAL were reviewed and returned positive for histoplasma antigen (Ag). Silver stain was positive for budding yeast, which was subsequently identified as Cryptococcus. Urine histoplasma Ag then returned positive as well. Infectious disease (ID) team was consulted. Management was started for disseminated histoplasmosis with pulmonary manifestation. Given he had MG and was on immunosuppressive agents, he was considered high-risk for opportunistic infections.
The patient was started on IV liposomal amphotericin B with close monitoring of renal function, magnesium, and potassium. Serum cryptococcal antigen was ordered which resulted positive as well. Amphotericin was continued for one week until it had to be discontinued secondary to acute kidney injury, with creatinine increased to 2.1 mg/dL from his baseline of 1.0 mg/dL. He was then transitioned to fluconazole. Lumbar puncture was performed to evaluate for further dissemination of disease. However, cerebrospinal fluid (CSF) analysis was negative for cryptococcal Ag and CSF cultures were negative subsequently. Hence, the patient was discharged on fluconazole with a plan to follow-up as outpatient in ID clinic. |
pmc-6625674-1 | A 39-year-old lady with uncontrolled diabetes mellitus and a previous history of recurrent urinary tract infection secondary to right staghorn calculi was admitted to the medical ward due to sepsis with right pyelonephritis. Blood culture and sensitivity grew Klebsiella pneumonia. She was treated with intravenous cefepime. Unfortunately, on day four of admission, she developed sudden-onset reduced vision over the right eye associated with eye pain and redness.
Her best-corrected vision was 6/60 in the right and 6/6 in the left eye. Right anterior segment examination showed injected conjunctiva with severe anterior chamber inflammation and hypopyon. Posterior segment examination revealed severe vitritis with a large sub-retinal abscess on the nasal part of the retina, about a four-disc diameter in size, extending from 1 o'clock to 5 o’clock with inferior exudative retinal detachment (Figure ).
The left eye examination was unremarkable, with no apparent diabetic retinopathy. B-scan ultrasonography demonstrated a sub-retinal hyperechoic lesion on the nasal side of the globe, consistent with a sub-retinal abscess.
The diagnosis of right endogenous endophthalmitis was made. An intravitreal tap and injection of antibiotics (vancomycin 2 mg/0.1 ml and ceftazidime 2 mg/0.1 ml) was done immediately and intravenous ciprofloxacin, along with eyedrops (cefuroxime, gentamicin, and dexamethasone), were given. Liver ultrasound was performed and showed no evidence of liver abscess.
Despite intensive systemic and topical antibiotics, her right eye condition worsened and her vision dropped to counting fingers. She finally underwent vitrectomy with silicone oil tamponade two days later. Postoperatively, the patient responded well to treatment, and her vision was gradually improved. At the three-month follow-up, her right best-corrected visual acuity was 6/36, and there was complete resolution of intraocular inflammation and the sub-retinal abscess (Figure ). |
pmc-6625957-1 | A 16-year-old boy with a severe deformity underwent a modified Ravitch procedure in an institution. Two metal struts were inserted to stabilize the deformity and were sewn to the ribs with heavy No. 2 multifilament nonabsorbable braided sutures. The position of the bars was such that the tension had been larger on the inferior strut due to the asymmetry of the PE. The position of the metal bars had been verified postoperatively by anteroposterior and lateral chest X-ray only. The displacement of one strut was noted after 4 months. The inferior strut migrated approximately 1cm rightward and threatened to perforate the skin. The mechanism of migration was straightening of the strut due to the severity of the intrathoracic deformity, its strong pulling force and consequent displacement. The dislocated bar was surgically removed and the other strut left in place. The postoperative course was uneventful and the position of the remaining bar checked only by radiography. At the time of initial surgery, the laboratory results were consistent with the findings of a healthy young adolescent.
The patient complained of limb pain 10 days post strut removal. With pain intensification, he was examined by a vascular surgeon about 2 months after the second intervention. Bilateral distal arterial and venous leg thromboses were diagnosed by the color Doppler. The transthoracic heart ultrasound showed the remaining metal strut perforating the anterior right ventricular (RV) wall, the intraventricular septum, ending its course in the left ventricular (LV) cavity with massive intracardiac biventricular thrombosis with no pericardial effusion. He was immediately transferred to a pediatric cardiac surgery center.
On admission, the boy was neurologically intact, with no clinical signs of venous obstruction. The femoral arterial pulses were vaguely present, the popliteal were absent. An urgent multi detector computer tomography (MDCT) was performed. The brain scan was normal. The superior vena cava (SVC) pathway was clear, but the inferior vena cava (IVC) system was partially occluded with two long plaques below the cavoatrial junction (
).
The portal venous system was unobstructed, there was a partial occlusion of the left femoral vein. The arterial circulation was severely damaged, partial occlusion of both femoral arteries with no circulation in the popliteal and posterior tibial arteries. An indication for urgent cardiac operation and strut removal was quoted to the parents with high intraoperative risks (
).
The operation was performed on cardio pulmonary bypass (CPB) in deep hypothermia and neck cannulation. A transoesophageal echocardiogram (TOE) was performed during the surgery. The sternum was severely adherent to the pericardium with the lower left sided ribs, completely detached from the sternum. After the cardiac arrest, the strut was removed without resistance (
and
).
The cardiac apex was macerated, the enterance hole on the parietal wall of the RV was “muffed” with thrombi and fibrin. The RV clots were removed through the undamaged tricuspid valve. The large iatrogenic ventricular septal defect (VSD) involved the cardiac apex with the surrounding muscular septum. Left-sided massive thrombi and fibrin detritus were evacuated transeptally and via the VSD. The mitral valve (MV) was intact. The VSD was closed with a 0.6 mm polytetrafluoroethylene (PTFE) patch and the cardiac apex reconstructed with direct pledgeted sutures (
).
The postoperative TOE showed poor myocardial function with severe dyskinesia of the ventricular septum but no residual masses. He was resuscitated for 30 minutes postoperatively for refractive ventricular fibrillations in spite of aggressive antiarrhythmic therapy and pacemaker overdrive. The patient was in junctional ectopic tachycardia (JET), required high-inotropic support, but converted into sinus rhythm within 12 hours. Control MDCT showed ischemic brain lesions with no bleeding. The laboratory tests did not imply of an underlying coagulopathy. The improved cardiac status allowed extubation within a week but due to further neurological deterioriation with frequent generalized convulsions, he was discharged severely impaired and transferred to his local hospital. Migration of metal struts is a rare complication and, except in our case, had been dealt with successfully. |
pmc-6625974-1 | On May 2018, a 75-year-old man was referred to our Department due to an increasing low-back pain and right-sided radicular pain irradiating down to the right lower limb, along the posterior thigh and the postero-lateral aspect of the lower extremity up to the lateral aspect of the foot, numbness in the sole of his right foot, especially marked on the plantar surface of his toe (VAS 8); the patient’s pain was refractory to conventional medical treatment. He complained also with a subjective decrease in strength in his right lower limb; his walk was slow and difficult due to the pain.
On clinical examination hypoesthesia at the right S1 and S2 dermatome areas and moderate muscle weakness in the right lower limb (3–4/5) were observed, reflexes were bilaterally normally elicitable and plantar response was flexor.
His past medical history included total gastrectomy, omentectomy, regional lymphadenectomy (D2) and reconstruction by mean Roux-en-Y anastomosis 2 years before (on January 2016) due to a gastric adenocarcinoma in the subcardial region; the histopathological diagnosis was poorly-differentiated gastric adenocarcinoma of intestinal type and 4/14 lymphnodes were positive for metastatic disease (pT3 pN2 R0; stage IIIa). Before surgery (January 2016), he underwent a whole body CT scan using a first-generation 640-slice CT scanner (Aquilion One, Toshiba Medical Systems, Outerwear, Japan), that showed the subcardial neoplasm measuring about 25 × 15 mm () without sign of distant metastases. The patient had a family history of gastric adenocarcinoma, his mother being affected. After surgery, the patient underwent 4 courses of adjuvant chemotherapy consisting of Oxaliplatin 120 mg/m2 and Capecitabine 825 mg\mq2. In clinical and radiological follow-up, the last on December 2017 (a), no local recurrence or metastases were observed.
His past medical history also included a L1 vertebral body fracture 3 years before (on July 2015), requiring a lumbar MRI (Magnetic Resonance Imaging) performed on a 1.5T General Electric Medical System (a), with subsequent surgical stabilization.
On May 2018, patient underwent a lumbar MRI using a 1.5T General Electric Medical System, that showed a significant enlargement of the intraforaminal right S1 nerve root due to the presence of a right-sided S1 nerve root mass involving the spinal ganglion in its intra-foraminal region and growing along the spinal nerve root, measuring about 25 × 20 × 25 mm; the mass showed homogeneously hypo-intensity signal on SE T1-weighted images (repetition time [TR] 400 ms; echo time [TE] 14 ms; e), significant hyper-intense signal on TSE T2-weighted images (repetition time [TR] 3960 ms; echo time [TE] 114 ms; b–d), avid and homogeneous contrast enhancement on SE T1-weighted images (repetition time [TR] 400 ms; echo time [TE] 14 ms; f, g) enhanced by gadolinium-diethylenetriaminepenta-acetic acid (16 ml Dotarem, 0.2 ml/kg). The mass was not evident in the previous MRI (a) – CT (a) exams and was considerate suspicious for metastasis.
Afterwards he received an 18F – FDG (18F-Fluorodeoxyglucose) CT-PET (h) that showed an area of focal hyperaccumulation within the sacral foramina of right S1 nerve root (SUV max. 5.2), suggestive of metastasis.
He also underwent a whole body CT scan using a first-generation 640-slice CT scanner (Aquilion One, Toshiba Medical Systems, Outerwear, Japan), that confirmed the presence of the slightly hypervascular right-sided S1 nerve root mass (b–d) and showed initial erosive bone changes (e) on S1 sacral foramina; no other CT alterations suspicious for metastatic lesion was detected in the brain, thorax, abdomen and pelvis.
A fine-needle aspiration biopsy (FNAB) was performed and the histologic examination confirmed a metastasis of gastric adenocarcinoma (f).
Following interdisciplinary discussion, the patient was referred for radiotherapy; radiation to the right S1 nerve root mass was performed to relieve the local pain and a total dose of 16 Gy in two fractions was given. The patient reported a reduction of pain intensity (VAS 6) and muscle weakness in the right lower limb (2+/5). |
pmc-6626341-1 | A 56-year-old Japanese man was admitted to our hospital owing to complaints of acute chest pain. At the age of 30 years, he had fever and hypersensitivity to sunlight; the causes of which were undetermined. He was diagnosed with hypertension during his 30s and was treated with antihypertensive drugs. Despite having well-controlled blood pressure levels, he experienced cerebral infarction at the age of 54 years; subsequently, antiplatelet therapy was initiated with 75 mg/day of clopidogrel.
On admission, the patient’s blood pressure level and heart rate were 126/70 mmHg and 80 bpm, respectively, and he had reddish exanthema on both cheeks (Fig. ). His physical examination did not reveal any other abnormal findings. Although chest X-ray images did not reveal any significant finding, electrocardiograms exhibited prominent ST elevation in the precordial leads, thereby suggesting acute anteroseptal myocardial infarction (Fig. ). Results of laboratory analyses revealed elevated levels of cardiac enzymes, such as creatine kinase (1511 IU/L), troponin T (1.400 ng/mL), and lactate dehydrogenase (454 IU/L). Conversely, cardiovascular risk factors, such as total cholesterol (162 mg/dL), low-density lipoprotein cholesterol (95 mg/dL), and hemoglobin A1c (6.5%), were desirable for the primary prevention of coronary heart disease. The patient had no history of diabetes mellitus or dyslipidemia; further, he was a current smoker, although the frequency was low (two cigarettes per day for the past 30 years), and was underweight (body mass index, 17.9 kg/m2).
Results of emergency coronary angiography revealed abrupt and total occlusion of the left anterior descending artery (LAD) (Fig. , left). Access using a guide wire resulted in partial recanalization of the occluded site (Fig. , right). The morphology of the lumen and vessel wall was observed by performing intravascular ultrasound (IVUS) and optical coherence tomography (OCT). IVUS images revealed an extremely large thrombus at the occlusive site (Fig. a-1) and an atherosclerotic plaque with calcification proximal to the occlusive site (Fig. b). OCT images revealed that the thrombus exhibited strong signal attenuation and obscured underlying vascular structures, suggesting that it was a red thrombus mostly comprising red blood cells (Fig. a-2). Interestingly, there was no distinct evidence of a ruptured plaque. Following balloon dilatation, a drug-eluting stent was successfully deployed, which completely recovered coronary blood flow in LAD.
The maximum creatine kinase level that contributed to apical cardiac aneurysm formation was 6381 IU/L. On hospital day 9, anticoagulation therapy with warfarin was initiated to prevent the formation of a left ventricular thrombus. Accordingly, triple antithrombotic therapy was initiated, which included dual antiplatelet therapy with aspirin and clopidogrel during coronary stenting and single anticoagulation therapy with warfarin.
Interestingly, the patient had a low-grade fever since admission but no evidence of infection. Based on the rashes on his cheeks, coexistence of a connective tissue disease was suspected. Additional laboratory tests demonstrated elevated levels of antinuclear antibodies (titer, 1/1280) and anti–double-stranded DNA antibodies (22 IU/mL). Furthermore, the lymphocyte count was low (550 cells/μL) and direct Coombs test result was positive. Based on these findings, the patient was diagnosed with systemic lupus erythematosus (SLE). In addition, the patient was positive for lupus anticoagulant, although a definitive diagnosis of APS requires consistently positive antiphospholipid antibody test results after > 12 weeks. Triple antithrombotic therapy was decided to be continued for as long as possible. The patient was discharged on hospital day 26. |
pmc-6626367-1 | Our patient was a 40-year-old Congolese woman married to a nonconsanguineous 43-year-old man. She was of low socioeconomic status, had an unsupervised pregnancy, and her fetus had an unknown gestational age because her last menstrual period was also unknown (she felt pregnant during the lactational amenorrhea). She came to consult for absence of fetal movements for 2 days. She declared that fetal movements were rare during the whole course of the pregnancy (one low-intensity movement per day). She was gravida 11 (G11P10L9D1) and had a previous history of full-term spontaneous vaginal delivery. She had a deceased infant who was issued from her third pregnancy and died in the sixth month of life with febrile gastroenteritis. She noted that one of her children has polydactyly. Her other children are apparently healthy and present no obvious congenital malformations. The patient declared that she took unknown tablet drugs against malaria, which she received from an open market drugstore, during the first term of her pregnancy. She occasionally drinks traditional alcohol (made with fermented maize). She does not smoke or take traditional drugs. She has no history of diabetes in her family. She had no antenatal ultrasonography report, nor were any blood investigations performed.
On clinical examination, the patient was anxious but hemodynamically stable (arterial pressure 120/60 mmHg), afebrile (temperature 36.5 °C), and had a symphysis-fundal height of 31 cm. Fetal heartbeats were absent, and the fetus was in breech presentation. Ultrasonography was performed and revealed a unique fetus with no heartbeat and no movement. Its skull was not perfectly individualized and gave an impression of skull bones overlapping or anencephaly. The femoral length was 54.4 mm (pregnancy age estimated to be 30 weeks) with the fetus in breech presentation. The placenta and genital organs were not visualized. Oligohydramnios was seen with a viscous aspect, giving the impression of maceration. Hence, a cesarean section was indicated for a breech presentation of a macerated intrauterine dead fetus. Intraoperatively, we observed an intrauterine dead fetus in breech presentation, macerated at second degree with polymalformation. The amniotic fluid was green-blackish, and the placenta was friable and weighed 200 g. The fetus weighed 1200 g, had a length of 35 cm, and had a cranial perimeter of 25 cm.
On the anterior and profile views of the fetus (Figs. and ), we observed the following morphological abnormalities: anencephaly, ocular hypertelorism, low-set ears, prominent infraorbital folds, downward-curved nose, and receding chin suggestive of Potter facies; amelia of the left upper limb with the trunk directly attached to the head; agenesia of the anterior abdominal wall with the umbilical cord inserted to something that looked like the omentum; presence of one umbilical artery on the umbilical stump; renal dysgenesis; blind-end colon; undetermined sex (no external genital organs); and absence of urinary meatus. The lower limbs were fused in one single limb from the pelvis, with two feet fused posteriorly, giving two flipper-like feet with five toes on each foot spreading out in a fanlike pattern (ectopode mermaid-like). The external palpation of lower limbs gave the impression of probably two femurs and two tibias. Due to financial constraints, an x-ray was not done. In a posterior view (Fig. ), we observed a fleshy structure with the appearance of a small, 2-cm tail.
We could not get consent for autopsy or additional explorations on a dead baby, owing to respect for traditional and cultural beliefs. No genetic testing was done due to financial constraints and lack of a genetic diagnostic laboratory in the Democratic Republic of Congo. The mother received 2 g of ampicillin intraoperatively and underwent a bilateral tubal ligation. She was maintained in the hospital for observation. She received adequate postpartum counseling and was discharged on day 7 postpartum. |
pmc-6626396-1 | An 83-year-old man was firstly admitted to hospital 13 years ago for prostatic adenocarcinoma and underwent radical prostatectomy. He also received adjuvant radiotherapy and annual injection of leuprorelin (enantoneR) for a biochemical recurrence characterized by a prostate-specific-antigen (PSA) level of 4.60 ng/mL detected 2 years after surgery. Clinical evolution was favorable and serum PSA level has progressively decreased to lesser than 0.1 ng/mL. At 8-years follow-up, he presented with an abundant gross hematuria. Serum PSA level was slightly increased (0.60 ng/ml). A cystoscopy was performed showing a nodular tumor growth on the right side of the lateral bladder wall that appeared as a large calcified tumor on computed tomography. Transurethral resection of bladder (TURB) was carried out. Tumor specimens consisted of small fragments of whitish firmer tissue. Microscopic examination showed frond like papillary projections which were lined by thick layers of stratified transitional epithelial cells with central fibrovascular cores. There was a predominant disorderly pattern with marked variation of architectural features. Tumor epithelial cells focally showed prominent cytologic abnormalities with moderate to significant nuclear pleomorphism. Quite numerous mitotic figures were observed and prominent nucleoli were also present in places. In some areas, the tumor cells disrupted the basement membrane and invaded into the lamina propria. The muscularis propria was respected. All these findings were consistent with the diagnosis of high-grade papillary urothelial carcinoma with infiltration of lamina propria (pT1 stage). Coexisting urothelial carcinoma in situ was found focally (Cis). The tumor stroma contained multiple bone trabeculae of variable size, lamellated or coarsed-fibred and separated by loose fibrous connective tissue with osteoid seams (Fig. a). Those osteoid and bony structures were outlined by numerous isolated large cells with abundant blue cytoplasm and quite numerous multinucleated giant cells that respectively correspond to osteoblasts and osteoclasts, without atypia nor pleomorphic stromal cells (Fig. b). No cartilage formation was observed. Immunohistochemistry showed in osteoid areas and bone tissue, a positive expression of CD56 (Fig. c) in osteoblasts. There was a discrete and heterogeneous staining for PS100, a discrete immunoreactivity for P53, and a Ki67 index of 20% in tumor cells. MDM2 and CDK4 immunostaining was negative in both metaplastic bone and carcinomatous components. Multinucleated osteoclasts were also strongly stained by CD68 (Fig. d). At 2-months follow-up after TURB, a control cystoscopy was performed and showed necrotic zone and retractile fibrous scar on the right side of the bladder trigone which were completely excised by secondary TURB. Those remaining lesions correspond essentially to fibro-inflammatory changes without residual tumor. Six courses of BCG therapy have been indicated. Two local recidives with recurrent episodes of gross hematuria have occurred during an 8-month follow-up period after immunotherapy. These local tumor recurrences displayed the same histological findings that demonstrated a high grade papillary urothelial carcinoma with superficial invasion of the lamina propria but were devoided of SOM foci. The multidisciplinary discussion recommended six further courses of BCG therapy at the time of the first recurrence. The second tumor recurrence appeared 2 months later and has been completely excised.
At one-month follow-up, the patient was well and did not complain of any symptoms. |
pmc-6626404-1 | A 68-year old male was diagnosed with stage IV melanoma (cM1c (0) AJCC 2017, BRAF wild type) with iliac lymph node, adrenal and splenic metastases (Fig. ). Anti-PD-1 monotherapy with pembrolizumab was initiated (2 mg/kg q3w) as first-line therapy. Eighteen days after the first application of pembrolizumab, the patient reported a weight gain of 10 kg within 7 days and massive peripheral edema. Laboratory tests revealed an acute renal failure with nephrotic syndrome (creatinine 2.86 [0–1.17] mg/dl, urea 78.9 [10–50] mg/dl, potassium 5.2 [3.5–5] mmol/l, calcium 1.7 [2–2.7] mmol/l, cholesterol 399 [130–220] mg/dl, total protein 4.2 [6.6–8.7] g/dl, albumin 1.6 [3.5–5.5] g/dl). Prior to pembrolizumab, renal function tests were normal and proteinuria was absent. The patient was hospitalized and a kidney biopsy was performed. Light microscopy showed a tubular damage (presumably due to a preexistent hypertensive nephropathy) without signs for interstitial nephritis. Amyloidosis, the presence of immune complexes or complement-mediated glomerulonephritis were ruled out by immunohistochemistry. Ultimately, electron microscopy showed findings consistent with a minimal change disease. Based on these findings, an acute renal failure with nephrotic syndrome due to a minimal change disease related to pembrolizumab was diagnosed. Other risk factors for a minimal change disease (e.g. non-steroidal anti-inflammatory drugs) were not evident. Treatment with oral corticosteroids (100 mg prednisolone qd) and diuretics was initiated. Renal function recovered to creatinine levels around 1.5 mg/dl and proteinuria decreased to 329 mg/l (Fig. ). Prednisolone was tapered over approximately 6 weeks, diuretic treatment with torasemid was reduced to a maintenance dose of 25 mg qd.
During irAE treatment, S100 serum levels increased significantly and a computed tomography (CT) scan of chest and abdomen 2 months after the single dose of pembrolizumab showed diesease progression (PD, RECIST 1.1) (Fig. ). A grand round recommended re-exposure to a PD-1-based immunotherapy due to lacking effective therapy alternatives. The recommendation was discussed with the patient including the risk of an immunotherapy-related terminal dialysis-dependent renal insufficiency. Finally, a combined checkpoint inhibition with ipilimumab (3 mg/kg) and nivolumab (1 mg/kg) was initiated. Proteinuria and blood pressure were monitored weekly. After two applications of the combined immunotherapy, creatinine levels increased to values ~ 2 mg/dl and the patient once again showed massive proteinuria (total protein 18,200 mg/l) (Fig. ). Fortunately, there were no signs of peripheral edema and his body weight remained stable. To curtail proteinuria, oral treatment with the ACE inhibitor ramipril was escalated to 5 mg qd.
Ipilimumab and nivolumab were continued without a dose delay. Creatinine serum levels and proteinuria stabilized (Fig. ). Nevertheless, we abstained from the fourth dose after another nephrological consultation and due to sonographic and serological signs for response becoming evident. An ultrasound of the abdomen performed after two doses of ipilimumab and nivolumab had already shown a shrinkage of the iliac lymph node metastasis and S100 serum levels were dropping (Fig. ). A CT scan after three doses of combined checkpoint inhibition confirmed a deep partial response (PR, RECIST 1.1) with regression of all known visceral and lymph node metastases. There were no signs for new thoraco-abdominal or brain metastases (MRI). Due to the renal irAE during anti-PD-1 monotherapy and a deep PR after three doses of ipilimumab and nivolumab, we refrained from a maintenance treatment with nivolumab. |
pmc-6626428-1 | A 21-year-old male patient with mild abdominal pain and showed no apparent abnormality in the initial abdominal computed tomography (CT) was brought to the local hospital’s emergency department due to a traffic accident. The patient’s abdominal pain became progressively worse during observation in the hospital that led to the patient being referred to our hospital. The patient’s vital signs were stable, and a physical examination revealed marked tenderness and rebound pain throughout the abdomen. The patient’s white blood cells were increased (11.64 × 109/L, normal range: 4–9 × 109/L). The serum amylase and lipase levels were elevated (1,707 and 1,160 IU/L, normal range: 25–125 and 13–60 IU/L, respectively). The abdominal computed tomography revealed pancreatic neck parenchymal discontinuity, peripancreatic effusion, and hemorrhage (Fig. a). Then, the patient underwent exploratory laparotomy. Intraoperative examination identified a large amount of flaxen ascites in the abdominal cavity, the neck of the pancreas was completely ruptured, the head and tail of the pancreas were congested and edematous with accompanying black necrotic tissue of the pancreas, scattered saponification spots were observed in the greater omentum, and no apparent abnormalities were observed in the other organs. The patient underwent central pancreatectomy (CP). We removed the damaged pancreas around the transection of the pancreatic neck until the normal pancreatic tissue was exposed (Fig. a), reconstruction of the distal pancreatic remnant was accomplished by Roux-Y pancreaticojejunostomy (Fig. b). The surgical principle can be referenced by Fig. or described by Motoi F et al. []. The patient was treated with antibiotics, acid inhibition, and nutritional support for 10 days after surgery. Symptoms of the patient were significantly relieved, and white blood cells, serum amylase, and lipase levels returned to normal. Postoperative abdominal CT showed a small amount of gas and fluid in the abdominal cavity, whereas the anastomotic site of the pancreas and intestine healed well (Fig. b). The patient underwent follow up examination for 6 months with no evidence of exocrine or endocrine insufficiency. |
pmc-6626432-1 | In 2018, a 72-year-old female with a long-standing renal transplant was diagnosed with metastatic BRAF-wildtype melanoma, 5 years after a cutaneous melanoma (Breslow thickness 0.8 mm) had been radically excised. She presented with a solitary large left axillary metastasis of 6 cm which encased the axillary artery and the plexus brachialis, resulting in edema and paralysis of her left arm. The patient had received a deceased donor kidney transplant in 2013 due to end-stage renal disease caused by hypertensive nephropathy and a unilateral nephrectomy because of renal cell carcinoma (T2N0M0) in 2006. Apart from the development of post-transplantation diabetes mellitus, the clinical course after her transplantation had been uneventful. At the time of melanoma diagnosis, she had a stable renal function with limited proteinuria (urinary protein to creatinine ratio of 33 g/mol) and a serum creatinine concentration of 150 umol/L, corresponding to an eGFR of 30 mL/min per 1.73 m2 (CKD-EPI formula) [].
The large left axillary mass was considered unresectable. After radiotherapy combined with hyperthermia, she had progressive disease with pulmonary and distant lymph node metastases. She was carefully counselled about ICI-associated side effects, specifically about the possibility of renal allograft rejection. Progressive axillary metastasis with severe vascular and neurologic complications led to the shared decision to start first-line nivolumab (3 mg/kg Q2W). The immunosuppressive regimen consisting of tacrolimus (1.5 mg q.d.) and mycophenolate mofetil (500 mg b.i.d.) was switched to prednisolone (20 mg q.d.) and nivolumab was administered 1 week thereafter.
Twelve days after first nivolumab administration, the patient presented with nausea, vomiting, loose stools and abdominal pain located at the site of her transplant. Laboratory investigation demonstrated severe renal insufficiency with a serum creatinine of 549 umol/L. A kidney transplant biopsy was performed and demonstrated extensive acute ischemic changes with capillary endothelial necrosis, tubular epithelial degeneration, edema and haemorrhage, consistent with infarction (Fig. a). These findings were interpreted as acute kidney transplant rejection and methylprednisolone pulse therapy (1000 mg intravenously for 3 consecutive days) and haemodialysis were initiated. Because of ongoing rejection despite methylprednisolone treatment, prednisolone was discontinued and transplant nephrectomy was performed. Because of advanced malignancy, T lymphocyte-depleting antibodies were not administered.
After transplant nephrectomy, nivolumab was continued for a period of 8 weeks. As she experienced immune-related adverse events, including pneumonitis grade 2 and colonoscopy-conformed colitis grade 2 (common terminology criteria for adverse events version 4.03), nivolumab was discontinued and prednisolone was initiated. Three months after the start of nivolumab, 18F-FDG PET-CT revealed progressive disease with new lung and lymph node metastases (Fig. ). The patient decided to stop haemodialysis and died 5 months after the start of nivolumab.
The patient participated in the MULTOMAB clinical trial, (see Dutch Trial Register number NTR7015), in which blood is collected prospectively for translational purposes. After kidney transplant rejection, previously obtained blood samples were analyzed for dd-cfDNA. Dd-cfDNA was expressed as a percentage of total cfDNA (see section below). Prior to administration of nivolumab, dd-cfDNA was low (0.9%; Fig. ). One week after administration of nivolumab, dd-cfDNA increased to 2.9%, indicating active rejection of the allograft. At the time of rejection, 12 days after first administration of nivolumab, dd-cfDNA increased to a maximum of 23.1%. Dd-cfDNA levels declined to 8.8, 0.1 and 0.0% at 3–5 h, 22 days and 77 days after transplant explantation, respectively, corresponding with the half-life of dd-cfDNA [].
Histopathological examination of the explanted kidney allograft demonstrated severe vascular, acute T-cell mediated rejection with an almost entirely necrotic kidney parenchyma with hemorrhage and moderate endothelialitis with focal fibrin deposition (Fig. b). CD3+ T lymphocytes were found subendothelially (Fig. c) and included both CD4+ (Fig. d) and CD8+ T cells (Fig. e). No CD20+ B lymphocytes were identified (Fig. f). The cytotoxic CD8+ T cells were active and viable, as evidenced by the presence of intracellular granzyme B (Fig. g) and Ki-67 (Fig. h), reflecting their cytotoxic potential and proliferation, respectively. PD-1+ staining was also seen in the vessel wall (Fig. i).
Despite the necrotic status of the renal explant, viable lymphocytes were revealed, which mainly consisted of CD3+ T cells (59%). Within the total CD3+ T cell population, the CD4+:CD8+ ratio was approximately 1:3 (22% CD4+ and 73% CD8+, Fig. a). Cytokines, such as IFN-y, TNF and IL-2, play an important role in the immune response that mediate allograft rejection. The amount of these pro-inflammatory cytokines, produced by T-cells, indicates whether these cells are activated. After polyclonal stimulation, the capacity of the T cells to produce IFN-γ, TNFα and IL-2 was measured []. CD8+ T cells had a higher capacity than CD4+ T cells to produce IFN-γ (91% vs. 37%; Fig. b) and TNFα (66% vs. 34%), whereas CD4+ T cells showed a higher capacity for IL-2 production (5% vs. 17%).
Further immunological analysis was performed to examine whether nivolumab was successfully bound to the graft infiltrating lymphocytes (GILs), which were considered to have caused rejection. Among the GILs, PD-1 was expressed on both the CD4+ and CD8+ T cells (31 and 34%, respectively; Fig. c), indicating that the receptor for nivolumab was present on the surface of these cells. To determine the amount of free PD-1 binding places on the GILs in the explant, conjugated nivolumab was added to the explant of both the current and a control patient, who experienced an acute rejection without ICI. In the renal explant of the control patient, nivolumab binding capacity was 49% of CD4+ and 37% CD8+ T-cells (Fig. d), whereas conjugated nivolumab was not able to bind CD4+ and CD8+ T-cells (0 and 0%, respectively) in the nivolumab-treated patient. |
pmc-6626626-1 | A 29-year-old unmarried Nepali man presented to our clinic with a complaint of soft, painless swelling at the tip of the penis since childhood. His mother had noticed the swelling when the patient was at the age of 3, and the swelling had increased in size for a few years to reach its present dimension. However, the swelling had been nonprogressive for the past 15 years. He had no complaints of pain, itching, burning, tenderness, discharge, trauma, or oozing. The lesion did not interfere with urination or penile erection. He did not have any history of congenital anomaly, any medical illness, or similar lesions in family members. The patient’s only concern was cosmetic and the possibility of interference in sexual activity, because he was planning to get married soon.
His physical examination revealed a solitary, soft, translucent cystic lesion of about 2-cm diameter at the ventral aspect of the glans penis, close to the meatus, but not involving the margins of the urethral orifice (Fig. ). The overlying mucosa was shiny, whereas the surrounding mucosa was normal. The cyst was soft and nontender on palpation. The urethral opening was not obstructed, and examination of other regions of the penis, scrotum, and perineal region were unremarkable. No palpable inguinal lymphadenopathy was seen. The results of the patient’s urinalysis and hemogram were normal. Ultrasonography (USG) of the cyst was advised, which demonstrated an isoechoic cystic lesion at the tip of the penis (Fig. ). There was no evidence of a solid component, septation, or vascularity within the cyst seen by USG (Fig. ). The urethra was separated from the cyst, which was entirely within the mucosa (Fig. ). On the basis of clinical and USG findings, a diagnosis of MRC of the penis was made.
The cyst was excised with the patient under local anesthesia (Fig. a, b). During excision, the cyst ruptured, releasing the mucinous content. The whole specimen was sent for histopathological examination. Hematoxylin and eosin (H&E) staining showed the cyst wall was lined partly by ciliated, pseudostratified columnar epithelium and partly by columnar epithelium with apical mucin (Fig. a, b). The lamina propria showed mild chronic inflammatory infiltrates. No features of dysplasia or malignancy were noted. IHC could not be done, owing to technical and financial reasons. The patient was followed for 1 year. The site of the excision healed without any residual effect (Fig. b). There were no issues related to urination or sexual activities. Recurrence was not observed during the 2-year follow-up period. |
pmc-6626709-1 | The case was a 68-year-old female from Bardaskan, Northeast of Iran, admitted to the Ophthalmology Center of Khatam-Al-Anbia Hospital in Mashhad, Iran. The patient was a farmer dealing with livestock. She presented with severe pain, burning, foreign body sensation, and reduced vision in her right eye. She had long-term uncontrolled diabetes and was unable to close her right eye due to the anatomical problem of the eyelid. The patient did not remember if she had received any inoculation in the past.
Direct microscopic analysis of the corneal scraping smear showed branched septated mycelium indicating a fungal infection. The corneal scraping samples were cultured on malt extract agar and incubated at 25°C and 37°C for 7 days. Both uni- and biseriate Aspergillus heads and black colored sclerotia resembling A. flavus were observed and the latter measured 300-500 µm in diameter ().
The patient was initially misdiagnosed; accordingly, she did not respond to any of the antifungal therapies (e.g., amphotericin B (1 mg/ml, Q2H) and voriconazole (1 mg/mL, Q2H) eye drops, and fluconazole [300 mg/day]). This irresponsiveness may be due to the delay in the treatment and spread of infection, which eventually led to a corneal transplantation surgery after obtaining informed consent ().
Final identification was performed using partial calmodulin (CaM) gene sequencing. DNA extraction was accomplished by means of the UtracleanTM Microbial DNA isolation kit (MoBio, Solana Beach USA). Amplification of a part of the CaM gene and sequencing were performed using two primer pairs, namely cmd5 (CCGAGTACAAGGAGGCCTTC) and cmd6 (CCGATAGAGGTCATAACGTGG) [12], following the study by Frisvad et al. [].
The partial CaM sequences of our isolate were 100% identical to those of A. minisclerotigenes deposited in the GenBank under the accession numbers of HM803026, , and . The generated sequence in this study was deposited in the GenBank under accession number MG490650. In addition, the isolate was deposited in the culture collection of the Westerdijk Fungal Biodiversity Centre, Utrecht, the Netherlands, under collection number CBS145094. |
pmc-6626906-1 | Patient 1 was a 31 year-old man who was the only child born to his healthy non-consanguineous parents. Family history and delivery history of the patient were unremarkable. At the age of 24, he first developed slurred speech. The symptom progressed slowly. Mild dystonia of left leg were later noticed when he was admitted to our hospital (). Also, short statue, microcephaly and bulbous nasal tip were present in this patient. However, there was no evidence of additional neurological features such as developmental delay, intellectual disability and seizure. Brain magnetic resonance imaging (MRI) was unremarkable from the age of 24 to 31. Administration of medication, including levodopa, baclofen and benzhexol, did not show any clinical benefit. Whole-exome sequencing (WES) was performed and detected a novel heterozygous stop-gain variant c.4075C>T (p.Q1359*) in KMT2B. The variant was absent in dbSNP, ExAc, 1000 Genomes, and gnomAD. It was predicted to “disease causing” by MutationTaster and scored 38 by CADD. Segregation analysis revealed that the stop-gain variant was absent in his parents which indicated it was de novo (; ). |
pmc-6626906-2 | Patient 2 was a 15 year-old girl from a non-consanguineous family with negative family history. She firstly experienced abnormal gait with dystonia posturing in her feet at the age of 7 years. During the following years, she developed slurred speech, followed by abnormal posture of right hand, leading to handwriting difficulty (). The severity of these symptoms mildly progressed, especially the severe dysphonia. Neuroimaging of brain showed no obvious abnormalities. Medical interventions including levodopa were of little effect. The testings of gene GCH1, TOR1A, and THAP1 did not detect any pathogenic variants. WES was then performed and uncovered a heterozygous KMT2B frameshift variant c.4458delC (p.R1487AfsTer7), which was never reported before. This variant was absent in dbSNP, ExAc, 1000 Genomes and gnomAD, and predicted a score of 29.5 by CADD. Segregation analysis demonstrated the de novo status of the variant (; ). |
pmc-6626906-3 | Patient 3 was a 33 year-old woman, who first developed right-handed writer's cramp at 18 years old. The symptom was improved after the treatment of botulinum toxin A injection. At 28 years old, a remarkable spasmodic torticollis was developed and progressively deteriorated in the following years. On current examination, in addition to the demonstrated cervical dystonia, abnormal posture of trunk was also noted (). In this patient, exome sequencing uncovered a novel heterozygous missense variant c.454C>T (p.R152W) in KMT2B, which was predicted to be damaging by SIFT, PolyPhen2, and MutationTaster. The CADD score was 25.7. The variant was rare in ExAc, 1000 Genomes and gnomAD (MAF 0.02531%, 0.0599042%, and 0.02246%, respectively). Segregation analysis revealed that the variant was inherited from her father who did not show any abnormal symptoms at current examination (; ).
In addition, several variants in other dystonia related genes were also identified, including GCH1 c.638_641del in patient 4, PINK1 c.1474C>T and c.938C>T in patient 7, SGCE c.304C>T in patient 26, VPS13A c.7867C>T in patient 23, and ANO3 c.970A>G in patient 40. |
pmc-6626928-1 | A 9-year-old girl presented to the Ophthalmology emergency department with a 3-day history of tingling and foreign body sensation in her right eye.
Her medical and family history was unremarkable, with the exception of her geographic origin: she was born and raised in the Equatorial Guinea, but she had been living in Spain for the past three years. The last visit to Equatorial Guinea was 6 months before.
Visual acuity was 20/20 in both eyes. On slit lamp examination, a large, translucent, coiled, slowly moving worm was observed underneath the inferior bulbar conjunctiva on the patient’s right eye (). No other pathological findings were observed on anterior and posterior pole examination.
Surgical extraction of the subconjunctival worm was intended on slit lamp, after instillation of 10% phenylephrine, 1% tropicamide, 0,1% tetracaine and 0,4% oxybuprocaine, but it was impossible due to the poor cooperation of our patient. Complete worm paralysis was not achieved. A second attempt was made 20 minutes later, in the operating room, under sedation. By the time of surgery, the larva had already migrated into the retroocular sub-Tenon’s space, making its surgical extraction impossible.
The patient was sent home with a prescription of ciprofloxacin ointment and fluorometholone drops, three times daily each. She was referred to the pediatric ophthalmology clinic the next day.
In clinic, slit lamp examination of anterior and posterior segment revealed no signs of any worm. Ocular motility and pupillary response were conserved with no relative afferent pupillary defect. There were no signs of conjunctival hyperemia, Tyndall or vitritis. A complete blood count and polymerase chain reaction (PCR) for filarial DNA were performed. The patient was advised to come back to the emergency room if any symptoms came back.
That same evening, she turned back to the emergency room complaining of tingling and the presence of the worm in her right eye. Slit lamp examination confirmed the presence of the worm under the medial bulbar conjunctiva. Again, 10% phenylephrine, 1% tropicamide, 0,1% tetracaine and 0,4% oxybuprocaine were instilled in an attempt of numbing the conjunctiva and paralyzing the worm for eventual surgical extraction. While waiting for proper numbing, anterior segment optical coherence tomography (AS-OCT) was performed to document the larva (,).
Vertical cross section at inferior bulbar conjunctiva showing a hyporeflective coiled area in the subconjuntival space, corresponding to the coiled Loa loa larva.
On this occasion, the patient’s collaboration was slightly better. Opening of the conjunctiva was achieved under slit lamp visualization, but due to some discomfort, the patient failed to cooperate for further extraction. While preparing for another surgical exploration under sedation, the larva migrated one more time into the deep retroecuatorial sub-Tenon’s space, so the procedure was cancelled.
Next day, the blood test revealed 1180 eosinophils/ µl, 2000 Loa loa microfilariae/ ml, and presence of Loa loa DNA on PCR sequencing.
Treatment was started with oral albendazole 200 mg twice daily for 3 weeks, obtaining a decrease in blood microfilaremia from 2000 to 450 microfilariae/ ml. One month later, a second cycle of albendazole was administered achieving a reduction of microfilaremia to 150 microfilariae/ ml. Finally, a 3 weeks cycle of oral diethylcarbamazine (DEC), 90 mg three times daily, led to microfilaremia seroconversion.
New manifestations of the subconjunctival worm were no longer reported since the beginning of the antiparasitic treatment.
The patient did not present Calabar swelling at any time.
Prednisone (1 mg/ kg/ day) was used prophylactically while on albendazole and DEC, to avoid encephalopathy. |
pmc-6626934-1 | A 67-year-old male presented to our department complaining for bilateral blurred vision of one-month duration, starting during a recent two-month hospitalization at a different hospital for severe acute pneumonia, which included a one-week admission to the intensive care unit. The patient was discharged two weeks prior to his presentation with an antibiotic and corticosteroid (methylprednisolone) oral regimen. His past medical history was remarkable for coronary artery disease with a history of coronary artery bypass surgery, systemic hypertension, and hyperlipidemia.
At presentation, his best-corrected visual acuity (BCVA) was 20/80 in his right eye and 20/ 63 in his left eye. Slit-lamp biomicroscopy revealed an anterior chamber reaction of 2+ and 1+ in his right and left eye, respectively. Vitreous haze was graded 1+/ 2+ and 1+ in his right and left eye, respectively. Fundoscopy revealed several small whitish pre-retinal lesions within the posterior pole, as well as larger whitish-yellow chorioretinal lesions within the retinal vascular arcades with associated perilesional subretinal hemorrhages, bilaterally (). Moreover, a large pre-retinal whitish round lesion temporarily to the optic nerve was evident in the patient’s right eye, resembling a large “cotton-ball” colony ().
A bilateral endogenous fungal endophthalmitis was strongly suspected and a pars-plana vitreous aspiration needle tap was performed in his right eye after admission, followed by an intravitreal injection of Voriconazole 0.2mg/ 0.1ml. Vitreous aspiration samples were sent to the Microbiology Laboratory for cultures and stains. In addition, systemic steroid uptake was discontinued, and systemic antifungal treatment with oral Voriconazole 200mg b.i.d was initiated, and the patient underwent a complete lab examination, including serological tests for a series of infectious pathogens, both bacterial and viral, as well as blood and urine cultures. An intravitreal (IVT) injection of Voriconazole 0.2mg/ 0.1ml was repeated bilaterally two days later as a relative deterioration of his clinical picture was noted.
Five days post-admission vitreous cultures and stains were negative for microorganisms, while his serological tests indicated a primary cytomegalovirus (CMV) infection with positive IgM antibody titers for CMV. Apart from this finding, his rest lab exams were unremarkable, including blood and urine cultures, while the patient remained afebrile. Meanwhile, the patient’s fundoscopic picture continued to deteriorate with a mild increase in vitreous haze and the appearance of new intra-retinal hemorrhages. Therefore, on the sixth day, a vitrectomy was performed in his right eye for both therapeutic and diagnostic purposes, accompanied by an IVT administration of Amphotericin B 5μg/ 0.1ml. Two days following vitrectomy, cultures and stains of vitreous washings were again negative, while the presence of CMV DNA in the vitreous was confirmed via polymerase chain reaction (PCR). Intravenous (IV) Gancyclovir 225mg b.i.d was initiated, accompanied by bilateral IVT administration of Amphotericin B 5μg/ 0.1ml every second day (four IVT injections in each eye in total). Administration of Voriconazole 200mg b.i.d orally was continued. In the following days, significant improvement was recorded with gradual regression of fundus lesions and improvement of the patient’s BCVA ().
The patient was discharged on the eighteenth day with a maintenance oral regimen of Voriconazole 200mg b.i.d and Valganciclovir 450mg daily. During his follow up visit, almost three weeks later, his BCVA had improved to 20/ 40 bilaterally, chorioretinal lesions had completely resolved leaving well demarcated areas of chorioretinal atrophy and vitreous was relatively clear ().
Endogenous endophthalmitis has been strongly associated with a series of predisposing risk factors, that include, among others, immunosuppression, immunosuppressive treatment, malignancies, intravenous drug abuse, catheters, parenteral nutrition, and urinary and pulmonary tract infections [,]. Nevertheless, Shankar et al. [] recently reported a case series of culture proven endogenous bacterial endophthalmitis in otherwise healthy individuals. Endogenous fungal endophthalmitis is the dominant variant of the disease [,]. On the other hand, intraocular infection by CMV is a well-documented condition within immunocompromised patients []. Cases of CMV retinitis have been reported following periocular or intraocular corticosteroid administration [,], as well as in immunocompetent individuals without any identifiable risk comorbidities such as drug induced immunosuppression or diabetes mellitus [,]. Moreover, in a recent article of Downes et al. [], systemic use of corticosteroids was one of the most identifiable risk factors reported in cases of CMV retinitis and infection in patients negative for human immunodeficiency virus (HIV) infection, other immunodeficiency syndromes or prior periocular or intraocular steroid administration.
In our case, the patient’s clinical picture upon presentation was compatible with endogenous fungal endophthalmitis. The presumptive diagnosis was further supported by the patient’s recent two-month hospitalization due to acute pneumonia and long-term systemic use of corticosteroids. Despite our strong clinical suspicion, we were unable to confirm our presumptive diagnosis despite repeated vitreous cultures, while we encountered the unexpected finding of positive serological indication of primary CMV infection. At the same time, the patient’s clinical picture continued to deteriorate, despite systemic and intravitreal administration of antifungal agents, and a vitrectomy in his right eye was decided. Following vitrectomy, PCR confirmed the presence of CMV viral load in the patient’s vitreous, while new vitreous cultures remained negative for both bacterial and fungal pathogens. Despite the poor clinical evidence of CMV-related retinitis, possibly excluding the appearance of new dot intra-retinal hemorrhages, we decided to change our therapeutic approach, including both antiviral and antifungal systemic treatment and IVT administration of Amphotericin B instead of Voriconazole. The aforementioned approach led to significant regression of clinical lesions, up to almost complete resolution on the patient’s first follow up visit, while continuing both antifungal and antiviral maintenance therapy.
Weiss et al. [] reported a case of simultaneous aspergillus endogenous endophthalmitis and CMV retinitis following kidney transplantation. To our knowledge, this is the second reported case of a mixed fungal and CMV intraocular infection. A limitation of our report is that no fungal species was isolated from cultures to confirm our diagnosis. Nevertheless, high culture negativity rates in cases of endogenous endophthalmitis have been previously documented in large case series []. On the other hand, while CMV intraocular infection was confirmed by PCR, poor clinical evidence of typical CMV infection, such as retinitis or vasculitis, could be documented. A presumptive early-subclinical stage of the indolent type of the viral insult combined with the prompt commencement of antiviral treatment after serological evidence of acute CMV infection and the discontinuation of systemic steroids could potentially explain the lack of typical clinical signs in our case. Whether the systemic and topical antifungal treatment alone combined with the therapeutic vitrectomy performed in the patient’s right eye would have led to the same favorable result remains unknown to the authors. |
pmc-6626935-1 | A 53-year-old male patient with a history of stage C colon cancer complained of painless diminution of vision in his right eye of acute onset and stationary course for 3 days. He underwent a hemicolectomy for his colon cancer 5 months before and had been receiving chemotherapy in the form of 5-fluorouracil, oxaliplatin, and folinic acid every 2 weeks for 4 months. He had a past medical history of hypertension, which was controlled by medication. He had no previous history of ocular problems.
Examination revealed a corrected distance visual acuity of 20/ 400 in the right eye and 20/ 80 in the left. Color vision was 2/ 10 in the right eye and 10/ 10 in the left using Ishihara plates. Examination of the pupil revealed a right relative afferent pupillary defect. Intraocular pressure was 16 mmHg in both eyes. Extraocular motility was full. Anterior segment examination revealed nuclear cataract in both eyes. Fundus examination showed bilateral optic disc elevation with multiple superficial nodular swellings over both optic discs. There were also multiple flame-shaped hemorrhages over the right optic nerve head with an anomalous left retinal vasculature (
).
A computed tomography scan of the brain and orbit was performed which revealed no cerebral pathology but suggested the presence of bilateral ODD more on the left side (
).
Right NAION on top of bilateral ODD was suspected and fundus fluorescein angiography was subsequently performed to confirm the diagnosis (
).
B scan ultrasonography was also performed to confirm the presence of ODD and revealed bilateral buried drusen (
). Visual field testing revealed an altitudinal field defect in the right eye involving the inferior hemifield. A final diagnosis of bilateral ODD with right NAION was made and diminution of vision in the left eye was attributed to the presence of nuclear cataract and ODD. Follow-up of the patient a few months later revealed right optic disc pallor with no improvement in visual acuity. |
pmc-6626975-1 | We report a case of a 22 years old pregnant female medically free, referred to us from her Obstetrician when she was complaining of abdominal pain and jaundice. Abdominal US confirmed a single intrauterine pregnancy at 28th week of gestation with appropriate growth for date and showed dilated intrahepatic ducts otherwise it was inconclusive due to the gravid uterus (). Her blood investigations showed a picture of cholestatic jaundice, and all other labs were within normal. So, we decided to proceed with a Magnetic resonance cholangiopancreatography (MRCP) which showed dilatation of both of the CBD (measuring 0.9 cm) & pancreatic duct, as well as an ampullary mass measuring 2 cm (). Later on, Endoscopic retrograde cholangiopancreatography (ERCP) with shielding of the abdomen to protect the fetus from radiation revealed an ampullary and distal CBD strictures. A punch biopsy was taken & the CBD was stented. The histopathology came as invasive adenocarcinoma & full metastatic work up was done and did not reveal any metastatic lesions. So, surgery was the best available option with the best possible outcome but we were reluctant to delay the surgery to ascertain the viability of the fetus. At 34th week of gestation induction of labor was done, both mother and the baby did well and were discharged home on 2nd day postpartum. The mother was readmitted one week later & full body CT scan repeated & there was no vascular invasion or distant metastasis.
Therefore, we proceeded with pancreaticoduodenectomy. A laparotomy incision was done, intraoperative examination of the abdomen revealed; a palpable mass at the ampulla of Vater and the stent was felt in the CBD and duodenum, a bulky uterus as the patient was still in the postpartum period. There was no vascular invasion, peritoneal deposits or any other distant metastasis. For the pancreatojejunostomy anastomosis, a two-layer end-to-side duct-to-mucosa approach was adopted. The pancreatic duct was stented to divert the pancreatic secretions away from the anastomosis. Then the hepaticojejunostomy was done in an end-to-side fashion followed by the gastrojejunostomy.
The Patient had uneventful postoperative course and was discharged 1 week after her surgery. Histopathology came as poorly differentiated invasive adenocarcinoma of ampulla of Vater with negative resection margins. Three out of thirteen lymph nodes revealed metastatic involvement so she received six cycles of adjuvant chemotherapy which she tolerated well. Upon 6 years follow up, computed tomography (CT) and positron emission tomography (PET) scans were normal with no evidence of recurrence. |
pmc-6627002-1 | A 34 years old male patient presented to ER after a fall from height (4th floor) impacting on his limbs and chest. Upon primary survey his airway was patent with equal bilateral air entry. Breathing was spontaneously with bilateral chest rise, oxygen saturation was 98% on room air, respiratory rate (RR) 28 breaths/min, Blood pressure (hypotension 77/48 mmHg) pulse rate 154 beats/min with raised jugular venous pressure, muffled heart sound and pelvic was stable with multiple fracture. Electrocardiography (ECG) showed low-voltage complexes. The abdomen was soft and lax with no tenderness and GCS was 15/15. Two large wide bore cannula were inserted, and the patient resuscitated with ringer lactate and one unit of packed red blood cells which helped to stabilize the patient. X-rays were done which showed no hemothorax or pneumothorax and multiple pelvic fractures. Focused assessment with sonography in trauma (FAST) and Extended FAST (eFAST) was done which showed no hemoperitoneum, no signs of pleural effusion, no apparent solid organ injury and the cardiac window was free with no fluid collection in the pericardium. Arterial blood gas (ABG) was within normal range pH: 7.4, PaCO2: 39 mmHg, PaO2: 94 mmHg. Foleys catheter was inserted and initially brought 150 ccs of clear urine. Log roll and per rectal examination (PR) were unremarkable. Initial labs tests showed hemoglobin 14.54 g/dL, white blood cells count 23 × 109 per liter (L), platelet count 299 × 103/microliter, Creatinine: 190 μmol/L. Computed tomography (CT) scan with intravenous (IV) contrast for trauma was done after stabilizing the patient, and showed sternal fracture with huge retrosternal hematoma (), no solid organ injury, no hemoperitoneum, no pneumothorax or hemothorax, multiple pelvic fractures, right 1 st rib fracture, right perinephric hematoma, compression fracture of D12, right transverse process fracture of L5 and multiple limbs fractured. After 1 h the patient started to deteriorate rapidly and became hypotensive 70/40 mmHg, pulse rate 130 beats/min, RR: 27 and oxygen saturation was still 98% with a patent airway and bilateral equal air entry. Resuscitation was started the massive transfusion protocol with two units of packed RBC, two units of fresh frozen plasma (FFP) and two units of platelets. The patient was intubated immediately, and an Echocardiogram was ordered along with preparation to go to the operation room urgently due to high suspicion of a rare case of cardiac tamponade most likely related to the earlier CT finding of retrosternal hematoma but the patient had cardiac arrest and couldn't be revived despite the CPR effort. |
pmc-6627070-1 | A 34-year-old female with CD remained in remission for three years. She wished to become pregnant and was concerned about the risk for her child to also develop CD. She carried a homozygous mutation within NOD2 (p.L1007fsX).
The incidence (rate of newly diagnosed cases) and prevalence (number of patients at a specific time point) of IBD vary worldwide. In Europe, the annual incidence is 0–13 per 100,000 inhabitants for CD and 1–24 per 100,000 for UC. The prevalence for CD is 1–322 per 100,000 inhabitants, and that for UC is 5–505 per 100,000 inhabitants. Similar figures are reported for North America []. Low-incidence areas include Asia and South America, with a crude annual overall incidence value per 100,000 individuals of 1.37 for IBD in Asia []. This incidence is increasing, even in populations that were previously considered low-risk groups. This is partly due to the modernization and industrialization of these countries []. This means a baseline lifetime risk of 1.3% for someone of European ethnicity, like our case 1 described above [].
Case 1 has an affected first-degree relative, which is the strongest established risk factor for IBD (). Studies of familial risk in IBD have reported a 4–15 times greater risk for IBD in first-degree relatives [,,,]. If both parents have IBD, the lifetime risk for their offspring is even thought to be over 30% [,]. The rate of family history in CD and UC has been reported to be approximately between 2% and 15% and is usually higher in patients with CD than in patients with UC [,,]. Also, an additive risk increment for CD in subjects from multiple-affected families was reported per additional affected relative []. A shared genetic background as well as environmental factors could lead to the familial aggregation often seen in IBD.
Large-scale international genetic studies have identified more than 240 susceptibility loci harboring common variants (minor allele frequency >1–5%) associated with IBD [,]. These loci typically only have low to intermediate penetrance, which reflects the complexity and polygenic nature of IBD. The strongest risk is seen for NOD2 variants, with an odds ratio estimated between 2.1 and 3.0 in Europeans []. Most other susceptibility variants show odds ratios in the order of 1.1–1.5 []. Even when carrying the ‘high-risk’ NOD2 variant, with an average life-time risk for IBD of 1.3%, this represents an increase of lifetime risk to 3.9% (life-time risk 1.3% multiplied with the effect size of 3.0) (). This is still fairly low and also means that 96.1% of individuals carrying this risk variant will never develop the disease. It is also important to highlight the effect of demographic, environmental, lifestyle, and clinical risk factors. It is often underappreciated that many other risk factors have effect sizes that are like those of risk alleles discovered by GWAS, such as smoking, which is known to increase risk of CD (effect size of 1.8 []).
Individual risk variants are thus not helping us in predicting the risk to develop IBD. Considering the polygenic nature of IBD, a combined genetic burden instead of individual risk variants could maybe be used to identify individuals at clinically significant increased risk of IBD. This overall genetic burden is calculated as polygenic risk scores (PRS), summing risk alleles across all susceptibility loci, each weighted by the strength of their association. The use of PRS has become increasingly popular in the context of complex diseases [] and has been applied also to IBD [,,]. Patients with IBD tend to have larger risk scores on average, but the distributions of scores in patients and the general population overlap for the most part () [,,]. In familial IBD, a higher burden of common risk variants has been observed: unaffected first-degree relatives of IBD patients have a higher PRS than the general healthy population, although their PRS is lower than that of individuals diagnosed with IBD [,]. Therefore, there is a clear genetic basis in the observed increase of IBD in families; however, the established susceptibility single-nucleotide polymorphisms (SNPs) seem to account for only a portion of the observed heritability of IBD. Thus, the utility of PRS for diagnosing the disease is currently limited even in familial IBD. It should also be noted that PRS is only able to tell something about the risk of one getting the disease (compared to the general population) but not about whether one will get the disease (). At present, genetic profiling might help to identify individuals at high risk, though there currently are no established effective prevention strategies available. The latter are in general required to define genetic testing as useful and ethical. However, PRS-based risk estimates are beginning to show promise in their ability to identify possibly misdiagnosed patients. Using a genetic risk score with CD-versus-UC association weights and looking at patients at either extreme of the distribution could identify patients more likely to require a revised diagnosis (CD instead of UC or UC instead of CD) at follow-up []. |
pmc-6627070-2 | A 25-year-old male with a two-year history of ileocolonic CD had maintained clinical remission for two years with azathioprine. Three weeks before the visit, he developed cramping abdominal pain, nausea, vomiting, and diarrhea. His leukocyte count was 6500/μL, C-reactive protein (CRP) was 1.5 mg/dL (<0.6), and Crohn’s disease activity index (CDAI) was 350. He had smoked half a pack of cigarettes per day for five years. A CT enterograph revealed mucosal thickening, enhancement of the terminal ileum, and focal narrowing of the distal ileum without proximal dilatation. A colonoscopy revealed active longitudinal ulcers in the terminal ileum with multiple scars. Infliximab (5 mg/kg) was initiated with daily azathioprine. Endoscopic biopsies and blood sampling were conducted before the first infusion of infliximab. Two weeks later, his CDAI had decreased to 120, and maintenance with infliximab was planned. Will he have a well-sustained response to infliximab?
Between 20% and 30% of IBD patients are refractory to any given medication, despite optimal dose and duration. Besides response, treatment side effects and toxicity are also variable. The need to predict the response to therapy is as pressing as the need to predict the disease course in IBD and will become even more important as more classes of therapeutics become available (e.g., anti-TNF agents, cell adhesion molecule inhibitors, anti-IL-12/23 agents, and other small molecules). Some clinical factors (e.g., concurrent use of immunomodulators, age, smoking, disease duration and location) have been identified but were not sufficiently reliable for predicting response to anti-TNF agents [,,,]. To date, also no clear associations exist to justify the use of serological markers in the prediction of the response to (anti-TNF) therapy in clinical management [,,]. |
pmc-6627070-3 | A 28-year-old female immigrant from South Korea with a three-year history of UC displayed inflammation confined to the rectum. Sulfasalazine and a mesalazine suppository were administered daily. She had experienced two flare-ups and progressed proximally to the splenic flexure in the past year, and azathioprine was planned with the tapering of prednisone. Do we need to perform genetic testing before administering any of these medications to avoid adverse events?
Adverse events related to IBD medications are typically rare but potentially life-threatening. Recent studies have reported that some rare complications of these therapies are associated with clinically useful genetic variations. |
pmc-6627116-1 | A previously healthy, 72 year old man with a history of well-regulated hypertension was diagnosed with bladder cancer causing severe nephropathy due to bilateral obstruction of the ureter ostium. The patient was referred to an 18F-FDG PET/CT for staging. 18F-FDG PET/CT was acquired 60 min after injection of 280 MBq 18F-FDG on a Biograph mCT Flow 64 (Siemens Medical Solutions, Erlangen, Germany) with a flow table of 0.8 mm/s. The PET images were reconstructed using Ordered Subset Expectation Maximum, applying time-of-flight and point-spread-function. A CT (120 kV/10–150 mA) was performed without intravenous contrast due to the patient’s nephropathy.
Non-enhanced CT showed a large hollow process with a distinct calcified wall mimicking a porcelain gallbladder. However, the fused PET/CT demonstrated a discrete FDG uptake in the central part of the process, comparable to blood pool activity (SUVmax 3.5) with a surrounding mural thrombus () corresponding to a large HAA measuring approximately 107 × 105 mm with a thick calcified wall. Color Doppler ultrasound was performed to confirm the diagnosis. Ultrasound showed a giant aneurysm with perimural thrombus and intraluminal turbulent flow (). In addition, 18F-FDG PET/CT revealed lymph node metastases and peritoneal carcinosis.
The patient was discussed at the urological multi-disciplinary team conference and, based on the disseminated urothelial carcinoma, no treatment with curative intent was possible. The patient was offered palliative chemotherapy. For evaluation and potential treatment of the giant HAA, the patient was referred to the Department of Vascular Surgery. Based on the poor prognosis of the cancer, it was decided that there was no indication for either open or endovascular treatment of the aneurysm due to the high risk of such procedures. Palliative treatment was initiated for the bladder cancer, and the patient was followed with non-contrast enhanced CT.
A total of three CT scans were performed, showing minimal progression of the HAA from 107 × 105 mm to 110 × 106 mm. The patient did not experience any symptoms related to the aneurysm until his death 8 months later. The patient presented in this case report was identified during a quality assurance of our use of FDG PET/CT in bladder cancer. This study was approved by the Danish National Data Protection Agency and according to national legislation retrospective, observational studies do not require approval from the ethical committee. |
pmc-6627205-1 | This patient—a police officer, 35 years old at the time of his initial visit in October 1995—reported he had had a round, uniformly red rash on his upper inner right leg just below the knee, roughly the size of a lemon, some time 5–10 years earlier. It was thought to be a ‘spider bite’ and no treatment was given. He developed hip pain in 1992 with anxiety, panic attacks, and palpitations. In summer 1994, extreme fatigue developed, and by fall 1994 he was feverishness, with malaise and flu-like symptoms, chills, mild unrelenting headache, and a stiff neck. In December 1994, disorientation, memory and speech difficulties developed.
He was active out of doors for work and recreation in Rockland County, New York. He hiked extensively in the lower Hudson River Valley and had an indoor/outdoor dog.
A physician treated him with amoxicillin for two weeks with improvement, but symptoms recurred following cessation of the drug. A second course of amoxicillin of four weeks duration likewise improved his symptoms, but they relapsed following cessation of the agent. The treating physician advised the patient that he suspected him to have Lyme disease and he was referred to an infectious diseases specialist, who did not agree with the diagnosis, as serologic tests were negative. Neurological consultation was obtained. An MRI of the brain with and without gadolinium was normal in May 1995, as was spinal fluid. Although Lyme disease was not able to be confirmed by laboratory methods, the neurologist advised the patient that it had not been ruled out. In June 1995 he was treated for six weeks with IV ceftriaxone, with initial intensification of joint symptoms, but with subsequent marked overall improvement. By fall of 1995 he experienced a relapse of symptoms, feeling ‘hung over’ and also a sense of breathlessness. A pulmonary evaluation was obtained. The angiotensin converting enzyme was elevated but pulmonary evaluation did not sustain a diagnosis of sarcoidosis.
The brain single photon emission computed tomography SPECT at Columbia Presbyterian Medical Center in November 1995 showed diffuse heterogeneous cerebral hypoperfusion, with decreased up-take in the white matter. A Lyme ELISA at the State University of New York at Stony Brook was negative, and a Western blot showed no bands on IgM but 39 and 41 kiloDalton (kDa) bands on IgG [].
He experienced multi-system symptoms, including headaches, stiff neck, chills, photosensitivity, swollen glands that accompanied his cycling symptoms, mood swings, sleep disturbance, joint pain, debilitating fatigue, cognitive and balance difficulties, and diminished libido, among others.
Aware of his cognitive difficulties, the patient often found himself in situations that could involve split-second decisions on resorting to deadly force. He sought and received medical leave from duty in the fall of 1995.
Formal detailed neuropsychological testing in May 1996 demonstrated impairments in practical reasoning, social judgment, auditory processing speed, primary visuospatial processing, and visual memory—areas of particular premorbid strength. These objective findings corroborated the patient’s subjective sense of cognitive difficulties and buttressed the administrative decision to grant medical leave.
From November 1995 to February 1996 he was treated with high dose amoxicillin (maximum dose was 3.5 g of amoxicillin Q 8 h, along with probenicid) aimed at CNS Lyme disease, achieving a peak amoxicillin blood level of 20.6 mcg/mL (therapeutic for CNS = 15–25 mcg/mL) []. Treatment was combined with clarithromycin in doses as high as 1.5 g PO Q 12 h. Despite this, he was getting lost while driving in familiar areas, had difficulty expressing himself, and experienced intolerable anxiety. Minocycline was substituted for clarithromycin.
In January 1996, a Lyme Western blot at the State University of New York at Stony Brook showed 30, 39, and 93 kiloDalton bands on IgM and 41, 45, and 58 kDa bands on IgG [,].
In March 1996, oral amoxicillin was discontinued, and IV ceftriaxone (2 g/day) was initiated and continued, with some hiatuses, until October 1996, when it was suspended due to the development of asymptomatic pseudocholelithiasis. Imipenem/cilastatin (1 g IV Q 8 h) was substituted until December 1996, and then cefotaxime (2 g IV Q 8 h) was administered until February 1997, when this drug was discontinued due to leukopenia. Oral minocycline was continued until October 1996, when clarithromycin was resumed and minocycline stopped. Altogether, treatment with IV antibiotics had continued for the bulk of the eleven months from March 1996 to February 1997, with occasional hiatuses.
During this treatment period, the patient reported improved mental sharpness, with easier word retrieval and facility of speech, diminished depression and anxiety, and improved sleep quality and libido.
Repeat brain SPECTs at Columbia Presbyterian Medical Center in October 1996 and April 1997 showed interval improvements, with progressive improvement in cortical heterogeneous and white matter hypoperfusion, however the pattern did not return to normality.
Oral antimicrobial therapy, with high dose amoxicillin and probenicid, combined with clarithromycin, was resumed in March 1997.
In April 1997, the patient was able to resume work on a limited schedule. The patient felt he had improved to about 65–70% of his normal ‘pre-morbid’ status and felt he was still making gains on oral antimicrobial therapy, although he experienced stiffness about his hips and deep bone pain in his thighs. Oral antibiotics were changed to cefuroxime (1 g) and azithromycin (0.5 g PO Q 12 h).
In May 1997 at the State University of New York at Stony Brook, a Western blot showed 37 and 41 kDa bands in IgM and 18, 39, 41, and 93 kDa bands on IgG [,,].
In late May 1997, the patient’s psychiatrist added donepezil, which resulted in improved word-finding and confidence with speech. The patient felt psychologically improved, and felt his condition was ‘holding’ on oral antimicrobial therapy.
In July 1997, on his own advice, he adopted a ‘pulse’ approach to oral antibiotic usage, partly due to loose bowels when on intensive treatment, despite ample probiotics. Diarrhea remitted. He felt at “75%” of his pre-morbid status and was able to resume full-time police work by fall 1997. Oral azithromcyin was discontinued and instead cefuroxime (2 g PO Q 12 h) was combined with doxycycline (150 mg PO Q 12 h) []. In December 1997, monotherapy with azithromycin (500 mg PO Q 12 h) was begun, to which cefuroxime was added in January 1998. He was maintaining his ground on oral antimicrobial therapy.
In February 1998, the patient sustained an Achilles tendon rupture while playing sports, and surgical repair was undertaken. He had never received any treatment with quinolone antimicrobials.
In July 1998, the patient was doing well on a rotating schedule of single antimicrobial agents, which included cefuroxime, doxycycline, amoxicillin, and clarithromycin, sequentially. In October 1998 the patient was feeling well and he suspended all antibiotic treatment. In April 1999, he was working hard, full time, occasionally doing ‘double shifts’. In July 1999, he noted spells of feeling ‘sick’ with malaise, sinusitis-like symptoms, stiffness about his hips, and some decrease in articulateness. In November 1999, he took a two-week course of left-over cefuroxime (1 g Q 12 h). In an exam in December 1999 he was noted to exhibit mild ataxia on tandem gait with eyes closed. Over the prior spring, summer, and fall, he had been hiking, including ‘bushwacking’, through dense brush in Harriman State Park and the Shawangunk Mountains—heavily tick-infested areas—but he was unaware of any known tick attachments.
In February 2000, he reported experiencing monthly flares of symptoms, which had been absent since the prior spring but had begun to resurface in the summer and fall of 1999. High dose amoxicillin was resumed but then discontinued from March to August of 2000. Modest doses of amoxicillin were resumed until October 2000, then discontinued, as the patient was unclear as to the cause of his symptoms or the efficacy of amoxicillin. He modified his habits, with more rest, and avoidance of alcohol and caffeine. Nonetheless, right hip pain severe enough to interfere with sleep, dull head pressure, anxiety and panic attacks, and feeling ‘at a loss’ for words recurred. He suspected that Lyme disease was responsible. In January 2001 he resumed left-over doxycycline, using up to 400 mg/day, and noted that his hip pain resolved within a few days []. Further doxycycline was prescribed for a few months.
In September 2001, he developed fatigue so severe he could barely get out of bed, along with muscle and joint pain and stiffness, and he resumed left-over doxycycline. By November 2001, he was feeling relatively well once again. He reported hiking in Harriman State Park several times per month until the fall of 2001, again, without known tick attachments.
In November 2001, a Western blot at the State University of New York at Stony Brook showed band 23 on IgM and bands 23 and 41 on IgG.
Doxycycline was continued until January 2002, when it was discontinued by the patient, who was feeling relatively well. Within one month of discontinuing the drug, muscle and joint stiffness recurred. Doxycycline was resumed but after one additional month it did not seem to be conferring benefit. He had a deep aching in his thigh muscles ‘close to the bone’, diminished stamina, bilateral Achilles tendon pain, and recurrent cognitive symptoms. Treatment was changed to cefuroxime, combined with clarithromycin, and by June 2002 the patient was feeling remarkably better.
A decision was made to treat ‘episodically’ as seemed necessary, and discontinue when a satisfactory status was achieved, with the option to resume treatment if needed.
The patient remained relatively well off antibiotic therapy from June 2002 until January 2004, when sinusitis-like symptoms occurred. He was treated for sinusitis by a physician, with amoxicillin/clavulanate for 10 days, and felt better for several weeks. Sinusitis-like symptoms recurred, along with fatigue, leg pain, heaviness, stiffness, and weakness. He reconsulted the physician he had seen and was re-treated with the same regimen. All symptoms responded. The patient began to suspect Lyme disease once again because of the recurrence of this familiar constellation of symptoms. He used a friend’s left-over cefuroxime (1 g Q 12) for some three months and felt better.
He was feeling fairly well and able to function. He had had no known tick attachments but had been in the woods a lot with his dog at Harriman State Park, in June 2004. After the outing, he removed some 20 ticks from the animal.
In late August 2004, off antimicrobials, a dry cough developed that lasted six weeks, which was resolved with cefuroxime but recurred 3 weeks later. This resolved with amoxicillin, which he acquired from a friend.
He commented that sinusitis had been a prominent symptom with the onset of his illness in 1994, and that an annoying ‘dry’ cough was a frequent symptom that responded to antibiotic therapy. He averred that on antibiotic therapy he generally would feel well, his anxiety would decrease, and his libido would improve.
With recurring symptoms of Lyme disease, and ongoing exposure risk, a laboratory re-assessment for tick-borne infection was undertaken in December 2004, which revealed a positive Lyme ELISA at the State University of New York at Stony Brook, with an optical density of +0.206 and a positive cut-off of 0.152, but a concurrent Western blot showed only band 41 on IgM and IgG. Empiric re-treatment with cefuroxime and clarithromycin was instituted and continued until February 2005. With this, he felt better and suspended further treatment.
In March 2005 right elbow pain and right knee pain developed, which required three–four weeks to resolve, and which flared again in early June 2005, along with a dry cough and some anxiety. He resumed left-over cefuroxime and clarithromycin—the joint pain improved within several days of resumption of antibiotics and the cough and anxiety resolved.
In February 2006, he returned for care, reporting significant stiffness since the prior November, interfering with his functioning and quality of life. He was also experiencing loss of words and, once again, difficulty with his sense of direction, and expressed that he was living a ‘diminished’ life. Oral amoxicillin was prescribed at 3500 mg PO Q 12 h, and he remained on this between February and October 2006, feeling relatively well.
He retired from the police department after 20 years of service in August 2006.
In late February 2007, he developed a mild fever and chills, worse with exertion, which lasted 10 days. Once again, he began to consider Lyme disease. During 2007, he resorted to short courses of azithromycin, doxycycline, or amoxicillin when symptoms which he interpreted as denoting Lyme disease (sinusitis, right knee and left Achilles tendon pain, anxiety) recurred, achieving temporary surcease and returning to a sense of relative well-being.
In late 2007 and early 2008, the patient experienced periodic ‘flares’ of symptoms he attributed to Lyme disease, with sinusitis-like symptoms, excessive somnolence, headache, feverishness, and a stiff neck. In May 2008, minocycline was prescribed.
His psychiatrist prescribed duloxetine, which was tried without benefit.
A Lyme ELISA at the State University of New York at Stony Brook, March 2008 was positive, with an optical density of 0.239 and a positive cut-off of 0.140, with a 41 kDa band on the IgM Western blot but no bands on the IgG blot. A Western blot at IGeneX in May 2008 showed the presence of 31, 34, and 41 kDa bands on the IgM Western blot [].
A brain SPECT in April 2008 at Columbia Presbyterian Medical Center showed moderate global cortical hypoperfusion and heterogeneity, which had worsened compared to the prior study of April 1997.
In May 2008, otolaryngology was consulted in view of recurring sinusitis-like symptoms. An MRI of the sinuses was clear of any anatomical features typical of sinusitis, despite the patient’s symptoms.
In September 2008, despite treatment with minocycline, the patient reported a worsened cognitive status, with poor comprehension and sense of direction and an inability to read, which he usually enjoyed.
IV ceftriaxone was instituted in April 2009 and continued, with some hiatuses related to difficulties with vascular access during the spring and summer of 2009, for a total of 28 administered doses. Parenteral treatment was combined with oral clarithromycin.
Around this time, serologies returned positive for exposure to Babesia duncani from several different laboratories, including the Public Health Laboratory of the County of Sonoma, California. Treatment aimed at babesia piroplasms was instituted for the first time, using atovaquone/proguanil.
Parenteral and oral treatment was discontinued in September 2009, with greatly improved symptoms, including the resolution of cognitive difficulties, with the patient feeling generally well.
In November 2009, following a hike in Harriman State Park, he removed a fully engorged tick from his skin. A 50 cent piece-sized area of inflammation developed around the tick bite site, and a one-month course of doxycycline was taken.
In December 2009, chills, fatigue, and difficulty regulating his body temperature occurred, and the patient took left over amoxicillin, up to 5.25 g PO Q 12 h, with no impact on his chills. Ceftriaxone was resumed until March 2010 with atovaquone/proguanil, chills subsided, and he was feeling well.
In May 2010, he was on azithromycin and atovaquone liquid and feeling well with no further chills or sense of ‘air hunger’. Artemesinin was added (150 mg PO BID), and by September 2010 he reported feeling the best he had in a year [].
From November 2011 to April 2014, the patient was under the care of a practitioner who utilized benzathine penicillin, atovaquone, clarithromycin, and sulfamethoxazole/trimethoprim for his treatment.
In November 2013, he had sustained a new, engorged deer tick attachment, for which doxycycline was prescribed for 21 days.
In December 2013, serology for exposure to Babesia duncani was reactive from one commercial reference lab, and in March 2014 this was confirmed at a second commercial lab.
A Lyme PCR in whole blood was positive for detection of the OspA plasmid target, at IGeneX, April 2014, confirmed by southern dot blot. A Lyme Western blot at the same lab showed the presence of a 39 kDa band and faint bands at 31 and 41 kDa on IgM and 41 and 58 kDa bands on IgG, with a faint band at 23 kDa.
Benzathine penicillin was discontinued in May 2014, and the patient was treated with intramuscular ceftriaxone, initially at 1 g in a regimen of two days on and one day off (per the patient’s preference), along with a regimen of oral treatment mostly consisting of azithromycin (0.5–1 g PO QD), atovaquone (250 mg) and proguanil (100 mg PO X 2 BID), as well as liquid atovaquone (ranging from 750–2250, mg twice daily), but orals were usually limited to five consecutive days per week (again, per the patient’s preference).
Due to inadequate control of symptoms, ceftriaxone was increased to 2 X 1 g IM, two days on and one day off, September 2014.
Treatment was changed to IV ceftriaxone between December 2015 and February 2016. At that point, an attempt to transition from parenteral ceftriaxone with oral azithromycin and atovaquone to oral minocycline or doxycycline with artemether/lumefantrine proved unsuccessful. All treatment was suspended in March 2016, but a return of the symptoms of tick-borne infection required reinstitution of atovaquone with azithromycin []. A fully implanted vascular access device was placed, and the patient was treated with IV ceftriaxone (2 g/day) from May 2016 until August 2016. From August 2016 to January 2018, the patient was treated with IM ceftriaxone (1 g X 2), two days on and one day off. Attempts at cessation of treatment with azithromcyin and atovaquone resulted in the onset of drenching night sweats.
The patient was advised of the impact of treatment with disulfiram in the patients described in Cases 1 and 2, and after due consideration, including a discussion of its potential risks and its uncertain utility in the treatment of human Lyme disease, he requested a trial of treatment with that agent. Correspondence was held with his treating psychiatrist before treatment was initiated.
Disulfiram (250 mg tablets, 1–2 per day) was prescribed, and the patient initiated treatment in mid-January 2018, discontinuing all other antimicrobial treatment.
Disulfiram resulted in profound fatigue that interfered with functioning, and initially the patient was unable to tolerate more than 125 mg of disulfiram every other day. The dose was gradually increased from January to April, when he was able to tolerate 500 mg/day for about the last two months of treatment (ending in late May 2018). Periodic surveillance laboratory testing was satisfactory. Notable to the patient was that, despite the discontinuance of azithromycin and atovaquone in mid-January of 2018, he experienced no recurrence of night sweats, even shortly after initiating only low dose disulfiram. He remained clinically well on no antimicrobial treatment until December 2018. He noted improved libido following the course of disulfiram. In retrospect, he opined that the debilitating initial effects of disulfiram seemed most consistent with Jarisch–Herxheimer-like effects, which he had experienced with the application of conventional antibiotics during his course of care.
In November 2018, he requested interval testing for tick-borne diseases stating, however, that he remained clinically well. Surprisingly, Lyme PCR for detection of the plasmid target in the serum returned positive. Babesia duncani antibodies at the County of Sonoma Public Health Laboratory also returned reactive, at 1:256. Babesia microti antibodies were negative, as were direct detection for B. microti and B. duncani by PCR and F.I.S.H at IGeneX.
During December 2018 and January and February of 2019, the patient experienced left Achilles tendon and right hip pain, the latter interfering with sleep and reminiscent of past relapses of Lyme disease. On his own advice, he administered a five-day course of IM ceftriaxone, with left-over supplies that he had on hand. The course, from 12 February 2019 to 16 February 2019, reduced musculoskeletal pain by some 60%, by his estimation.
A second course of disulfiram was initiated on 19 February 2019, starting slowly with 0.5 X 250 mg every other day, with the intention to ramp the dose up over several weeks to 750 mg/day, remain at that dose for 90 days, and then discontinue the agent for a period of observation. |
pmc-6627459-1 | In April 2014, a 62-year-old male, non-smoker came to our attention with a sudden weakness, mainly in right upper limb. A total body computed tomography (CT) scan showed a lesion of 4.5 cm in diameter in the right upper lobe of the lung with an omolateral mediastinal lymphadenopathy and multiple, large and diffuse brain lesions (A and ). After diagnostic bronchoscopy he was histologically diagnosed with lung adenocarcinoma.
EGFR mutation analysis (exons 18–21) performed on the biopsy tissue demonstrated no mutation together with no identified concomitant rearrangement of the ALK or ROS1 genes.
The patient was submitted to whole brain radiotherapy (20 Gy delivered in five fractions) and chemotherapy with a schedule consisting of cisplatin (75 mg/m2) and pemetrexed (500 mg/m2) every 3 weeks. After four cycles of chemotherapy a full body CT scan showed significant shrinkage of primary lung tumor, mediastinal lymph nodes and BMs. Further shrinkage was obtained after six cycles. Subsequently, the patient underwent maintenance chemotherapy with pemetrexed (500 mg/m2) administered every 3 weeks. After 18 cycles we decided to stop chemotherapy since the disease had stabilized.
The patient has then been subjected to a restaging via brain magnetic resonance imaging (MRI). This showed a residual metastasis in the left frontal lobe and an 18 fluorodeoxy-D-glucose (FDG) positron-emission tomography/computed tomography (PET-CT) scan revealed an increased fluorodeoxyglucose uptake on the primary tumor site and on the omolateral mediastinal lymph nodes. In January 2016, the patient underwent a final treatment of intensity-modulated radiation therapy (IMRT) and helical tomotherapy (HT) on the remaining lung lesion, mediastinal lymph nodes (60 Gy delivered in 25 fractions), and residual brain metastasis (20 Gy delivered in four fractions). A complete response to IMRT-HT along with signs of fibrosis was observed on follow up imaging (B and ). After 58 months from diagnosis of the primary tumor, the patient continues to enjoy good health with no evidence of disease recurrence. |
pmc-6627500-1 | A 68-year-old Japanese man was admitted to our hospital in winter due to disturbed consciousness and difficulty with body movements. Approximately two weeks prior, he had experienced fever and generalized edema. Thirteen days before admission, his family physician prescribed levofloxacin at 500 mg/day, furosemide at 20 mg/day, and spironolactone at 25 mg/day for seven days. The patient complied with this and became afebrile, and his edema disappeared. Two days before admission, his wife noticed that his speech was slurred, and he was only able to understand short and simple sentences. On the day of admission, he could not communicate and was unable to speak comprehensibly. He could not move by himself. His past medical history included cerebral palsy with lower limb atrophy, but he could walk using a frame. He had normal mental and intellectual development. He also had chronic kidney disease (CKD) at the stage of G4A3 due to nephrosclerosis and a horseshoe kidney, with a creatinine level of around 2.5 mg/dL. He had been treated with nifedipine, doxazosin, and febuxostat and did not use any over-the-counter supplements or illegal drugs.
Upon physical examination, his blood pressure was 65/40 mm Hg, his heart rate was 40 bpm, his respiratory rate was 20 breaths/min, and his body temperature was 27.9 °C. His consciousness was registered as E4V1M4 (E: Eye opening, V: Best verbal response, M: Best motor response) on the Glasgow Coma Scale. Accidental hypothermia was suspected, because his room had been cold and he had stayed there throughout the night. He was rewarmed immediately, and his body temperature increased to 35.7 °C, after which his vital signs became stable. However, his consciousness level remained abnormal, and he also showed myoclonus in both upper limbs. The deep tendon reflex of the biceps was normal. Laboratory findings showed a white cell count of 2700/μL, a hemoglobin level of 5.9 g/dL, a platelet count of 16.5 × 104/μL, albumin at 2.0 g/dL, aspartate aminotransferase at 137 U/L, alanine aminotransferase at 50 U/L, alkaline phosphatase at 288 U/L, γ-glutamyl transpeptidase at 13 U/L, blood urea nitrogen at 82.3 mg/dL, creatinine at 3.84 mg/dL, sodium at 142 mEq/L, calcium at 8.0 mg/dL, glucose at 101 mg/dL, thyroid-stimulating hormone at 9.29 μU/mL, free T4 at 1.03 ng/mL, and vitamin B1 at 3.9 g/dL. Antithyroid peroxidase antibody and antithyroglobulin antibody were undetectable. An arterial blood gas analysis did not show CO2 elevation and indicated mild metabolic acidosis. An electrocardiogram initially showed first-degree atrioventricular block, which became normal sinus rhythm after rewarming. Head-computed tomography and magnetic resonance imaging examinations showed no abnormalities, and an electroencephalogram showed generalized slowing waves. CSF was shown to have a cell count of 0/μL, a protein concentration of 68 mg/dL, and a glucose level of 65 mg/dL. Levofloxacin-associated encephalopathy and myoclonus were suspected based on the patient’s history of high levofloxacin dosages and present renal function.
The patient was treated through the administration of fluids and furosemide with the aim of levofloxacin being excreted in his urine. Although the patient produced more urine, his creatinine did not return to basal level, and his consciousness level did not improve. Hemodialysis was carried out on days 3 and 5 after admission, and his consciousness level improved and completely recovered by day 7 (). The myoclonus disappeared four days after admission. An electroencephalogram on day 15 showed no slowing waves. His Naranjo adverse drug reaction probability scale registered at 7 points, which indicated a probable relationship between his symptoms and adverse drug reactions to levofloxacin []. Sixteen days after admission, the patient was transferred to another hospital for rehabilitation. Later, we measured the concentration of levofloxacin in the reserved samples of plasma or CSF, obtained during hospitalization. The plasma concentrations of levofloxacin were 16.9, 16.2, 2.44, 0.61, and 0.71 μg/mL on days 1, 2, 4, 6, and 7 after admission, respectively (). The initial CSF concentration of levofloxacin was 6.81 μg/mL. |
pmc-6627654-1 | A 38-year-old male with a remote history penetrating neck trauma in 2013 presented himself to the emergency department with a chief complaint of acute posterior cervical neck pain and paresthesia. Prior to the onset of acute neck pain, the patient had attempted to manipulate his own cervical vertebrae in order to relieve himself of a continuously nagging “crick in the neck.” After his first attempt of using both hands (one hand on the anterolateral aspect of his mandible, and the other hand on his occipital region) to apply external rotation and torsion of his cervical vertebrae, he heard a loud crunching sound, followed by immediate neck pain. This neck pain worsened with movement, associated with unilateral radiating pain and paresthesia down his right arm and extending to his right pectoral region, whole body numbness below his shoulders, and a throbbing component of pain when at rest. Patient denied any other neurological symptoms including headache, nausea, vomiting, blurry vision, changes in hearing, loss of balance, aphasia, loss of extremity strength, fecal or urinary incontinence or retention, and denies any use of aspirin or any other anticoagulation medications.
Physical examination found that the patient had 5/5 strength throughout except a 4+/5 distal right hand strength. The patient also had decreased sensation to light touch below the neck, which was worse on the right side. The patient did not have clonus or Hoffman’s sign, no Babinski’s sign, nor hyperreflexia. Initial MRI results showed a large 5–6 mm traumatic right paracentral posterior disc protrusion with disruption of the posterior disc annulus at the C5–C6 level with associated severe central spinal stenosis and ligamentous damage to the posterior longitudinal ligament (PLL). There was also mild to moderate central spinal stenosis secondary to smaller disc protrusions at the C3–C4 and C6–C7 levels (). Initial MRI showed no osseous fractures of the vertebrae, nor asymmetry in the alignment of any faucet joints.
A discectomy and arthrodesis surgical intervention was opted to be performed on the patient due to myelopathy upon examination. In addition to this, the patient had radiculopathy and ligamentous injury. |
pmc-6627855-1 | A 52-year-old man with a history of hyperparathyroidism was referred to the nuclear medicine department for Tc-99m MIBI scintigraphy. A year earlier, he had been diagnosed with primary hyperparathyroidism on the basis of hypercalcemia (12.6 mg/dL; reference range, 8.6–10.1 mg/dL) and an increased parathyroid hormone level (98.1 pg/mL; reference range, 15–65 pg/mL). Previous ultrasonography (USG) of the neck had revealed a small nodular lesion in the left lobe of the thyroid gland that was suspected to be parathyroid adenoma/hyperplasia. A dual-phase Tc-99m MIBI scintigraphy examination was performed to investigate the parathyroid lesion, the first phase at 15 min after injecting 30 mCi of Tc-99m MIBI for a duration of 10 min and the second at 120 min for a duration of 10 min. However, no focal MIBI uptake was observed on delayed Tc-99m MIBI planar scintigraphy images (). A year later, the patient revisited our department because of a steadily increasing serum parathyroid hormone level (120.1 pg/mL). There was still no significant focal radioactive uptake on early or late Tc-99m MIBI planar images. A Tc-99m MIBI SPECT/CT gamma camera (Symbia T6, Siemens Healthcare, Erlangen, Germany) was used to obtain the images of the neck and chest at 150 min after 30 mCi of Tc-99m MIBI injection for 15 min in the delayed phase. The images revealed two focal areas with retention of radioactivity in the left lobe of the thyroid. One lesion was observed in the lower portion of the left lobe and the other below the lower pole of the left lobe (). We reported these two lesions as possible parathyroid adenoma or hyperplasia. The patient underwent left partial parathyroidectomy. The lesion in the lower portion of the left lobe was pathologically confirmed to be thyroid hyperplasia and the other lesion below the lower pole of the left lobe to be parathyroid adenoma (). After excision of the parathyroid lesion, the serum parathyroid hormone level returned to normal (30.3 pg/mL). The authors have obtained the patient’s informed consent. |
pmc-6627917-1 | This is a case of a 14-year-old female patient (23 kg) diagnosed with Purine Nucleoside Phosphorylase Deficiency (PNP) syndrome, a form of combined immunodeficiency syndrome (CID). She had a history of recurrent respiratory infections and recurrent septic shocks requiring a recent several-months-long hospitalization in the pediatric intensive care unit at another tertiary hospital and was discharged two weeks prior to admission to our hospital. During that hospitalization, a bronchoalveolar lavage (BAL) culture was positive for methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa, and Aspergillus flavus. She received multiple antimicrobials, including meropenem, colistin, and amphotericin B. This was in addition to her prophylactic regimen, which included posaconazole, valganciclovir, trimethoprim/sulfamethoxazole, inhaled tobramycin, and inhaled pentamidine, in addition to monthly intravenous immunoglobulin (IVIG).
Two weeks after discharge from the other hospital, the patient presented to our emergency department with a history of high-grade fever (39 °C on admission) with chills, increased work of breathing, cough, decreased activity, and oral intake. Upon assessment in the emergency department, she was found to have severe respiratory distress, for which she was given non-invasive mechanical ventilation (BiPAP). A chest X-ray was done on admission and revealed a bilateral bibasilar consolidation, which was more prominent on the right side, with mild pleural effusion. She was diagnosed with bilateral bronchopneumonia. She was also found to have a septic shock and she received fluid resuscitation and inotropic support for a few hours. She was started on meropenem 900 mg IV q8h (40 mg/kg/dose), vancomycin 330 mg IV q6h (14 mg/kg/dose), amikacin 360 mg IV daily (15 mg/kg/day), liposomal amphotericin B 100 mg IV daily (4 mg/kg/day), in addition to her prophylactic antimicrobial regimen listed above.
Over the next 48 h, the patient remained febrile, without improving, necessitating the addition of colistin 2,000,000 IU IV q12h (3 mg/kg/dose of colistin base) to her antimicrobial regimen. Oral valganciclovir was also changed to intravenous ganciclovir. A BAL culture was sent five days after admission and revealed multidrug-resistant Pseudomonas aeruginosa, which was resistant to all beta-lactams, intermediate to ciprofloxacin, amikacin, and gentamicin, and only susceptible to colistin (). Antibiotics susceptibility testing was performed using VITEK® 2 (bioMerieux, Paris, France). Confirmation of colistin susceptibility was done using Microscan® broth microdilution test (Beckman Coulter, California, USA). All susceptibility results are reported according to Clinical & Laboratory Standards Institute (CLSI) breakpoints. An echocardiogram was done on the same day and showed moderate pulmonary hypertension, for which patient was started on oral sildenafil. All blood and urine cultures were negative.
Despite all antibiotics received by the patient, her condition continued to deteriorate. She remained febrile, with each febrile episode lasting approximately four hours. When she had chills, she had increased oxygen requirement and looked very toxic. She also needed BiPAP continuously, with increased requirements to meet her rising PCO2. A Carba-R® PCR test (Cepheid, CA, USA) was negative for the five main carbapenemases (OXA-48, KPC, VIM, IMP, and NDM). Susceptibility testing to ceftolozane/tazobactam and ceftazidime/avibactam was performed using E-test® (bioMerieux, Paris, France). Organism was susceptible to ceftolozane/tazobactam but resistant to ceftazidime/avibactam, so the decision was made to start her on ceftolozane/tazobactam. She was started on 1.5 grams IV every 8 h (44/22 mg of ceftolozane/tazobactam/kg/dose) on the sixth day of hospital admission. Meropenem, vancomycin and liposomal amphotericin B were stopped.
Forty-eight hours after initiating ceftolozane/tazobactam, the patient started to show signs of improvement, with less persistent fever, improved activity, and decreased requirement for BiPAP. Over the next 24 h that followed, she was shifted from BiPAP to high flow nasal cannula (20 L/min). Four days after the initiation of ceftolozane/tazobactam, the patient was afebrile for the first time since admission. Six days after initiation of the novel agent, the patient significantly improved, was tolerating oxygen supplementation via nasal cannula (2 L/min) and was safely transferred to the general pediatric ward on ceftolozane/tazobactam, amikacin, and colistin. No adverse events related to the use of ceftolozane/tazobactam were reported during the entire course of hospitalization. A follow-up CT scan, performed three weeks after admission, showed bilateral consolidation, more prominently seen in the right middle lobe, as well as bronchiectasis, which was markedly seen in the right middle lobe, and in both lower lobes. Consent was obtained from patient’s father and the Institutional Review Board (IRB) approved the publication of this manuscript. |
pmc-6628285-1 | In November 2014, a 25-year-old-male presented to the Department of Gastroenterology at a secondary care facility after having experienced several months of weight loss, diarrhea, and flu-like symptoms. He had a past medical history of peri-anal abscess and was on no prescribed or over-the-counter medications. He was a non-smoker. Ileo-colonoscopy demonstrated moderately inflamed mucosa with nodular congestion, marked erythema, and multiple shallow ulcers in the terminal ileum with minimal colonic involvement (). The ileocecal valve appeared normal. A few small, non-bleeding mucosal erosions were present within the colon; at the hepatic flexure, transverse colon, and sigmoid colon. The overall impression was ileo-colonic Crohn’s disease with moderately severe and active ileal disease. Biopsies gave histopathological confirmation of moderately active ileal Crohn’s disease with mild, patchy colonic inflammation. At diagnosis, his symptoms indicated a Harvey-Bradshaw Index (HBI) score of 17, indicating moderately severe disease [].
Treatment was commenced January 2015 with the biologic agent infliximab, 5 mg/kg by intravenous infusion every 8 weeks. After 37 weeks, the treatment dose was escalated to 7.5 mg/kg due to lack of symptomatic clinical response. The patient’s symptoms improved, but he did not achieve clinical remission. After 1 year of infliximab treatment, his HBI score was 5, indicating mildly active disease. Although he had demonstrated significant clinical response to therapy, he had failed to achieve clinical remission and continued to experience fatigue, bloating, and episodic severe abdominal pain.
In March 2017, having been on infliximab for 2 years, the patient reported a complete elimination of animal products and processed foods from his diet for forty days during a period of religious observation. During this time, he experienced a complete resolution of symptoms (HBI 0). Prior to this, his diet had been the typical American diet consisting of daily consumption of meat, dairy products, refined grains, processed foods, and modest amounts of vegetables and fruits. Having experienced complete clinical remission for the first time since his Crohn’s disease diagnosis, the patient decided to switch to a whole food, plant-based diet permanently, severely reducing his intake of processed foods and limiting animal products to one serving, or less, per week. There were a few reported periods of poor diet adherence, at which point symptoms of fatigue, nausea, bloating, and occasional aphthous ulcers would recur (HBI 2). HBI scores decreased back to 0 with adherence to the plant-based diet. He also began to employ stress-relief strategies including yoga, weight-lifting, and running. After 6 months of implementing these changes in diet and lifestyle, a follow-up ileo-colonoscopy in August 2017 demonstrated complete mucosal healing with no visible evidence of Crohn’s disease ().
One year after this follow-up colonoscopy, infliximab therapy was ceased based upon ongoing complete clinical remission. As of May 2019, the patient had been off standard medical therapy for a total of 10 months and had not yet experienced a significant clinical relapse. |
pmc-6628402-1 | A 30-year-old male PRO triathlete, a 40-year-old female AGE GROUP athlete and a 34-year-old AGE GROUP athlete, all with no history of medical illness, who regularly competed at long distance triathlons presented with shortness of breath, chest tightness and coughing up pink sputum during the last part of the bike phase of a full distance triathlon race. Ambient air temperature varied between 6 and 8 °C and the water temperature was around 14.2 to 14.4 °C during the races in 2016 and 2017 and somewhat higher in 2018 with an air temperature of 10 °C and water temperature at 17.5 °C. The PRO male athlete had completed the same competition the previous 3 years without any medical complications. The female and the male AGE GROUP athletes entered their first Extreme triathlon, but they had both previously completed several full Ironman competitions without symptoms of SIPE. As part of another study during the same competition, normal spirometry was performed the day before the race for both the PRO athlete and the female athlete. Written informed consent for publication was obtained from all athletes.
During the swim, all athletes wore a well-fitted wetsuit and neoprene swim cap. They later reported that they felt increasingly breathless and were struggling to keep the usual pace in the water just minutes after the start. None of them reported that they had aspirated during the swim.
The bike leg during the Norseman Extreme Triathlon starts with approximately 40 km uphill, from sea level to 1245 m above sea level ().
All athletes reported an improvement in breathing during the first major uphill (1245 m elevation over 40 km) of the bike phase and reported increasing symptoms during the downhill. The female athlete contacted the medical crew due to shortness of breath and coughing pink sputum after about 122 km. During the clinical examination, she presented mild facial edema, jugular vein distention and lip cyanosis. Peripheral capillary oxygen saturation (SpO2) was measured to 88%, and she was coughing up pink sputum. No signs of airway obstruction were found, and she denied any previous history of allergies. The athlete was taken out of the competition by one of the race doctors. She was transferred to the nearest local medical center for further treatment but recovered quickly after being treated with oxygen and hospitalization was not indicated. The male athletes managed to complete the 180 km long bike phase, but due to coughing and increased shortness of breath, they were both forced to withdraw from the race just a few meters into the run phase.
The PRO athlete was examined by one of the race doctors immediately after withdrawal. The medic reported end-expiratory crackles bilaterally and a productive cough with pink sputum. He had facial edema but no cyanosis. He was transferred to the nearest hospital, approximately 1 h away for further examination.
On arrival, his blood pressure was 105/62 mmHg, respiratory rate 20 breaths/min, heart rate 84 beats/min and oxygen saturation was 96% on room air. A laboratory examination showed a serum sodium level of 142 mEq/L, B-natriuretic peptide (BNP) level of 26 pmol/L (normal range < 10 pmol/L), troponin T 76 ng/L (normal range < 10 ng/L), C-reactive protein 23 mg/L (normal range < 5 mg/L), hemoglobin 12.1 g/dL and D-dimer 0.7 mg/L (normal range < 0.5 mg/L). An electrocardiogram (ECG) showed sinus rhythm with incomplete right bundle branch block (RBBB). He had normal findings on clinical examination.
Arterial blood gas results were; pH 7.48, pCO2 4.84 kPa, pO2 9.39 kPa, bicarbonate 26.2 mmol/L, base excess 3.4 mmol/L and lactate 2.7 mmol/L.
An echocardiogram was performed at arrival at the emergency department that showed a well-contracting, normal-sized left ventricle and mildly dilated right ventricle. The end-diastolic impression of the intraventricular septum led to suspected high pulmonary artery pressure.
At the hospital, he was initially diagnosed with suspected pulmonary embolism and transferred to a larger regional hospital for a thoracic computed tomography (CT) scan. The findings included bilateral ground glass opacity in the peripheral lungs but no pulmonary embolism. Due to the complete regression of symptoms, no treatment other than rehydration and oxygen was given during hospitalization. He was discharged from hospital the following day.
At a 1-month follow-up-examination, the athlete had fully recovered with complete regression of CT findings and echocardiogram changes. He was diagnosed with swimming-induced pulmonary edema.
The male AGE GROUP athlete called the emergency number directly and was not examined by a race doctor. After completing the bike phase (180 km), he experienced increased shortness of breath and coughing with pink sputum. When examined by the paramedics he presented with heavy coughing. SpO2 was measured to 90%. He was transferred to the nearest hospital for further examinations, which was the same hospital as the PRO athlete was transferred to two years earlier. On arrival, his blood pressure was 123/70 mmHg, respiratory rate 16 breaths/min, heart rate 70 beats/min and oxygen saturation was 93% on room air. A laboratory examination showed a serum sodium level of 142 mEq/L, troponin T 101 ng/L (normal range < 10 ng/L), C-reactive protein 8 mg/L (normal range < 5 mg/L), hemoglobin 13 g/dL and D-dimer 0.4 mg/L (normal range < 0.5 mg/L). An ECG showed sinus rhythm with pathological R-progression in V1 to V6. Clinical examination reported end-expiratory crackles bilaterally but otherwise normal findings.
Arterial blood gas results were; pH 7.46, pCO2 5.01 kPa, pO2 8.20 kPa, bicarbonate 25.9 mmol/L, base excess 2.6 mmol/L and lactate 2.2 mmol/L.
No echocardiogram was performed. He was given diuretics and was discharged from the hospital with complete regression of symptoms the following day. |
pmc-6628480-1 | A 50-year-old Caucasian man with adult-onset RRP was referred for rhinology consultation for multiple unilateral nasal papillomata. He had undergone endoscopic potassium titanyl phosphate (KTP) laser ablations for diffuse laryngotracheal disease nearly every 3 months prior. Previous biopsies showed evidence of moderate to severe dysplasia on some of the tracheal lesions. Repeat airway debulking and nasal biopsy at our institution revealed squamous papillomata without evidence of dysplasia in both specimens. In situ hybridization (ISH) studies for HPV were negative for high-risk subtypes.
Three months later, his examination exhibited increased nasal involvement with lesions of the middle and superior turbinates and posterior septum while sparing his nasopharynx. Computed tomography (CT) imaging showed mucosal irregularities consistent with examination findings without hyperostosis or posterior ethmoid involvement (Fig. ).
Intraoperative frozen sections were consistent with benign respiratory papilloma. However, permanent section pathologic analysis revealed inverted type Schneiderian papilloma in all nasal specimens and benign squamous papillomata with mild to moderate atypia in the larynx and trachea. His surgical resection included removal of the majority of the lesion with an attachment site centered on the middle turbinate. The mucosal surface of the posterosuperior septum and a small portion of skull base were also removed, as they were involved with papilloma (see Fig. ). It is unclear if this patient exhibited synchronous IP of the middle turbinate and recurrent respiratory papilloma of the septum and skull base, or if the multisite disease represents diffuse nasal IP. Viral ISH studies demonstrated evidence of HPV family 6 (subtypes 6 or 11) in both the septum and middle turbinate subsites. Repeat nasal excision with margin analysis is planned in conjunction with the next laryngeal procedure as frozen section pathology was equivocal and the lesion encroached on his skull base.
Prior to coming to our institution, he underwent previous treatments that included KTP laser, cidofovir injections, and indole-3-carbinol. He did endorse a history of smoking cigarettes and has recently decreased consumption from one pack per day to half a pack per day. Based on the initial presentation and pertinent medical history, our patient is at increased risk for malignant transformation of papillomata, particularly in the larynx []. Now at 12 months postoperatively, he is stable with no signs of residual malignancy. |
pmc-6628487-1 | A 3-year-old boy from an urban area of Trujillo, Peru, with no completed vaccines and mild anemia, was admitted to our hospital on March 19, 2018, for persistent fever. The mother indicated that her son has been scratched by a stray cat on the anterior region of the left arm with no apparent signs of inflammation.
Eighteen days before admission, he had a fever of 38.5 °C. The day after, colicky abdominal pain begun. He was brought to the emergency ward of another hospital where metamizole was administrated and hours later he was discharged.
Sixteen days before admission, in a private consultation, it was diagnosed apparently with a food poisoning, and he was treated again with metamizole. At this point the fever ceased. Fifteen days before admission, the mother indicated that he had an episode of diarrhea, without mucus or blood, also presenting nausea.
Thirteen days before admission, the fever appeared again, now accompanied with non-productive cough. In a private consultation he was diagnosed with an acute respiratory infection, and was treated with amoxicillin–clavulanic acid (75 mg/kg/day) until his hospitalization, without significant improvement.
The day of the admission to our hospital, his physical exam revealed fever (38.5 °C), pallor (+/+++), a no congestive pharynx and soft and depressible abdomen. His vital signs include a respiratory rate of 24 breaths/min, a cardiac rate of 106 beats/min, an SO2 of 96% and a FiO2 of 21%. No signs of regional lymphadenitis were observed. At this point, fever of unknown origin (FUO) was suspected. Laboratory tests at income revealed mild anemia, mild thrombocytosis, prolonged coagulation times, including increase fibrinogen and an increased C-Reactive Protein (Table ).
The first day of hospitalization, he presented microscopic hematuria, abdominal pain, and persistent fever. An abdominal ultrasound revealed mild hepatomegaly with multiple hypoechogenic formations with non-defined borders < 11 mm at liver, as well as also at spleen, of < 10 mm in the spleen, suggesting hepatosplenic micro-abscesses (Fig. ).
At day four, treatment with ceftriaxone (81 mg/kg/day) and metronidazole (30 mg/kg/day) was started. On the seventh day of hospitalization, ceftriaxone was changed to imipenem (75 mg/kg/day). Although that, fever persisted for 3 days. Additional laboratory tests at this moment included blood culture for bacteria and fungi, STORCH serologies (VDRL, FTA-Abs, toxoplasmosis, rubella, CMV and EBV, HSV-1, HSV-2), ELISA for HIV, PPD, acid fast bacilli (AFB) from sputum, as well as agglutination tests for Bartonella bacilliformis and Salmonella. All these tests were negative. An indirect immunofluorescence antibodies (IFA) assay tested positive for IgG against B. henselae (titers 1:256) confirming the diagnosis of CSD. Therapy with imipenem and metronidazole was stopped and treatment with azithromycin (10 mg/kg/day) was initiated. One day later fever ceased.
On the tenth day, an abdominal CT-scan with contrast showed irregular hypovascular nodules of 4.8, 4.6 and 6.5 mm in the liver, in segments II, III and VI, and spleen till 10 mm, confirming the ultrasound findings of micro-abscesses. On the day fifteen, a follow-up ultrasound showed augmented hypoechogenic images in the liver up to 19 mm in segments IV and II of the liver, and up to 10 mm in the spleen (Fig. ). Two weeks later an additional follow-up ultrasound showed a significant decrease on size of the micro-abscesses.
Then, 2 weeks after finished the antimicrobial therapy and 50 hospitalization days, the patient was discharged. Follow-up till 8 weeks after discharge show no further related alterations. |
pmc-6629053-1 | A 27-day-old female neonate weighing 4 kgs was referred to our department with a postnatal diagnosis of upper partial SC. The baby had an uneventful antenatal, intranatal, and perinatal period. On inspection, the baby had an intact skin cover over the chest wall (Figure ) with a midline supraumbilical raphe.
The baby was asymptomatic except for the paradoxical movement of the upper chest wall, particularly while crying (Video ).
In the upper part of the sternum, suprasternal and cardiac pulsations were visible through the intact skin while the lower half was fused and appeared normal. The infant was hemodynamically stable without any respiratory distress. The baby was evaluated for primary sternal closure as the presentation was early.
A midline skin incision was made and the intact lower end of the sternum was exposed. Subcutaneous tissue and the muscle plane were dissected out to expose the sternal bars on either side. The inferior surface of sternal bars was also dissected from the deep connective tissues and thymus (Figure ).
Midline sternotomy was performed in the intact sternum and the cartilaginous tissue was trimmed on both sides to create a straight margin for proper approximation. The medial portion of sternal bars was freshened by elevating the periosteum to facilitate bone healing. Prepared sternal ends were approximated using multiple 2-0 non-absorbable sutures (Figure ).
The baby tolerated the sternal closure well (Figure ) without any hemodynamic instability or change in the ventilator parameters.
The baby was extubated on the day of surgery. The infant had an uneventful postoperative recovery and discharged with a stable sternum. |
pmc-6629187-1 | A retired 56-year-old female was admitted to our hospital owing to a progressive movement disorder. Before admission, the patient reported numbness and weakness of the left limbs, gait difficulties, obvious dizziness, and paroxysmal tremor of the left limbs for almost 50 days. Difficulties in the movement of her left limbs gradually worsened. Upon admission, the patient began to have involuntary flexion in the distal left extremities but had no obvious cognitive impairment. Evaluations for amyotrophic lateral sclerosis, other motor neuron diseases, Parkinson’s disease, and other movement disorders were negative. She had no relevant family history and no exposure to neurotoxins, biologic agents, ticks, or rabies. However, we suspected carcinoma of the right thyroid lobe after the pathological analysis of the thyroid. Neurologic examination revealed temporal hemianopia in the left eye, an increase in the muscle tone of the left extremity, and hyperreflexia, which was suggestive of higher cortical dysfunction. Cerebellar tests were hard to assess because of the patient’s tremor. The sensory examination showed no obvious abnormalities. There are no signs of meningeal irritation to suggest mening involvement. The electromyography method could not be conducted because the patient was unable to cooperate. During hospitalization, the patient showed progressive cognitive decline and gradually increased muscle tone. At 2 months post-hospitalization, the patient’s symptoms aggravated rapidly, and she presented with frequent myoclonic jerks and apparent psychotic symptoms, which included dreaminess, anxiety, and hallucinations during the night. The following week, the patient showed akinetic mutism.
The differential diagnosis included various dementing disorders, and comprehensive assessments, including neurophysiologic tests and multiple cerebrospinal fluid (CSF) and blood analyses, were performed. Following genetic testing, the patient was diagnosed with gCJD. As compared to the standard PRNP sequence (NCBI: NM183079.1), the sequence analysis of the PRNP gene in the current patient showed a missense mutation occurring at codon 196 (E196A: GAG-GCG) (). The 14–3-3 protein in CSF was positive. The level of neuron-specific enolase (NSE) in blood was higher (45.45 ng/ml,<25.00 ng/ml). The autoimmune encephalitis-related antibodies in CSF were negative. In the current case, the diffusion-weighted magnetic resonance imaging (DWI/MRI) showed an increase in signal intensity changes at the surfaces of the right temporal and parietal lobes, left parietal lobe, and the bilateral basal ganglia region (). Electroencephalography (EEG) was performed twice, but no typical periodic sharp wave complexes (PSWCs) were observed (). The patient’s relatives declined a brain biopsy and autopsy; therefore, the present case lacked neuropathological data. The pathological analysis of the thyroid showed atypical degenerative cells in the right lobe of the thyroid, which was indicative of thyroid cancer. |
pmc-6629457-1 | The patient was a 28-year-old female physician who engaged in regular physical activity and had no known prior diseases. She presented complaining of a mass in the right cervical region (), causing pain when she moved her neck, and she was unable to state the time since onset of symptoms. She had no family history of vascular malformations.
At the first consultation, she provided a Doppler ultrasonography scan of the vasculature of the neck (), conducted on 25, November, 2016, showing the following: right external jugular vein with segmental ectasia, free from thrombi in the lumen, measuring 3.6 mm at the largest diameter. She was managed conservatively, with periodic examinations to monitor the mass. However, the patient began to present symptoms of localized pain and hardening of the mass.
On physical examination, there was swelling in the right cervical region, with hardening and mild inflammation along the path of the external jugular vein. The patient did not exhibit any other signs and her only symptom was localized pain. She was therefore medicated with rivaroxaban, for what was apparently localized thrombophlebitis, and monitored periodically with imaging exams.
After 1 year of clinical treatment, a Doppler ultrasonography scan was performed on 14 December, 2017 (), showing a heterogeneous hypoechoic nodular formation in the upper right cervical area, measuring around 2.4 × 1.5 × 0.9 cm, in the topography of the right external jugular vein, and signs of thrombosis of the external jugular vein. The patient had exhibited little sign of improvement to the symptoms seen at the first consultation, even after clinical treatment with rivaroxaban.
Diagnostic investigation was initiated with angiotomography of the supra-aortic arterial and venous trunks (), showing an oval-shaped lesion with the density of soft tissues and regular outline, situated lateral of the mid third of the right sternocleidomastoid muscle, compressing the external jugular vein medially, and measuring approximately 25 × 16 × 10 mm in diameter. The lesion had higher density than the adjacent musculature and lymph nodes, during the phase of the examination without contrast, and exhibited discrete uptake of contrast during the phase with contrast. The imaging exams and physical examination were suggestive of a number of diagnostic hypotheses: hemangioma, lymphangioma, or branchial cyst.
Since the patient’s symptom of significant localized pain was limiting, and since the esthetic impact upset her greatly, conventional surgical treatment was performed with excisional resection of the mass and proximal and distal ligature of the right external jugular vein. The operation was conducted by a multidisciplinary team, in which a head and neck surgeon participated. Surgery and the postoperative period were free from complications and the patient’s symptoms improved. She was discharged from hospital on the same day.
Definitive diagnosis was made on the basis of macroscopic anatomopathological examination of the specimen, which was an irregular, chestnut colored, elastic, lobulated tissue fragment measuring 1.5 × 1.0 × 0.5 cm, identified histopathologically as: hemangioma of the external jugular vein with thrombosis. Histological sections () showed fibrous connective tissue with proliferation of small vessels containing red blood cells. Also present were organized endothelial cells, fibroblasts, and fibrin forming a thrombus in the vessel interior, the lumen of which was delimited by internal elastic lamina and smooth muscle cells. The patient is still in outpatients follow-up, is satisfied with the esthetic results, and is free from pain. |
pmc-6629458-1 | A 67-year old man was examined for prostate cancer screening. Prostate biopsy revealed an adenocarcinoma of the prostate, with clinical TNM – PT2cN0M0 stage II; and he was referred to our department for surgical resection. Elective laparoscopic prostatectomy was planned in the Hospital do Coração (Hcor), Belém, PA, Brazil. The patient had been in good health apart from mild hypertension and diabetes. Height, body weight, and BMI were 168 cm, 96.0 kg, and 34.0 kg/m2, respectively. The patient was a non-smoker.
The surgery was performed under general anesthesia. The patient wore limb stockings throughout the procedure to maintain temperature. He was placed in the lithotomy position during the procedure using a Levitator© (MIZUHO Corporation, Tokyo, Japan).
The operation was technically difficult, because the patient was overweight, with rich visceral fat and a narrow pelvic cavity. He remained in the lithotomy and head down tilt position for 240 min and the surgery lasted 180 min. His vital signs remained stable throughout. Systolic blood pressure was maintained at a mean of 80 mmHg. During surgery, we did not check the appearance or compression of the lower legs. Postoperative anticoagulation therapy was not administered.
After the procedure, the patient remained in the intensive care surgical unit. Twelve hours after the procedure, he began to complain of pain and edema in his lower limbs (). Femoral, popliteal, and distal pulses were broad and bilaterally symmetrical. Swelling of the calves required attention. An imaging test (Doppler ultrasound) showed no evidence of deep vein thrombosis or occlusion of blood flow. Blood chemistry analysis revealed high levels of lactate dehydrogenase (1830 U/L) and creatine kinase (1240 U/L). Urinalysis results were 3+/3+ for blood and 3+/3+ for protein. Myoglobin was elevated, at 1520 ng/mL.
The patient’s renal function suddenly worsened with concomitant elevation of urea and creatinine. The patient underwent nephrological evaluation and, on the basis of examination findings and laboratory results, catheter hemodialysis was promptly initiated.
The complaints worsened on the second postoperative day. This led us to believe that the patient was suffering from lower limb compartment syndrome. Intracompartmental pressure was not measured.
A bilateral fasciotomy with double incisions was urgently performed to release all four compartments. All compartment muscles were extruded () and anterior lower left limb compartment muscle pain was observed (), although there was no muscle necrosis. The incisions were left open with sterile dressings, changed daily.
Postoperatively, the patient developed a deficit of plantar flexion of the lower limbs, which was worse in the left lower limb. Initially, he was unable to perform dorsiflexion or inversion of either foot. Three days after fasciotomy, he began physiotherapy-led rehabilitation. Closure was performed two weeks later. On the 30th day after the operation, he began to walk with crutches. His condition resolved almost completely, with the exception of discrete motor disorder and pain in the left lower limb. At follow-up, six months after fasciotomy, he reported no motor or sensory impairment and had no complaints of pain ().
Written informed consent was obtained from the patient for the publication of this case report. The patient's anonymity has been preserved. |
pmc-6629765-1 | A 5.16 kg, 12-year-old male neutered Bichon Frise was evaluated approximately 14 h after ingestion of a dark chocolate bar containing 450 mg tetrahydrocannabinol (THC, 90 mg/kg). The presenting complaint was profound sedation. No vomiting or regurgitation was noted at home.
At presentation to the Emergency Department, the patient was stuporous with a reduced to absent gag reflex, and globe position was ventromedial bilaterally (OU). Rectal temperature was 99.0°F (37.2°C). Cardiorespiratory auscultation was unremarkable; however, his respiratory rate was 12 breaths/min with shallow chest excursions and his heart rate was 56 beats/min. Initial venous blood gas demonstrated a respiratory acidosis with only a mild increase in plasma bicarbonate concentration suggesting an acute process (). Doppler blood pressure was 160–170 mmHg. The patient was hospitalized in intensive care unit (ICU) for monitoring, seizure watch and fluid therapy (36 mL/h for 8 h and then 18 mL/h for 5 h) after receiving a single injection of 1 mg/kg maropitant intravenously (Cerenia; Zoetis, Parsippany, NJ, USA) to decrease the risk of vomiting and consequent aspiration pneumonia.
During the first 8 h of hospitalization, the patient's neurologic status progressed from stuporous to comatose. The respiratory pattern became shallower (24 breaths/min), while the rectal temperature decreased to 96.8°F (36°C). Due to financial limitations and inability to hospitalize the patient in ICU for an extended time, ILE therapy was initiated in an attempt to shorten hospitalization time (, , ).
Baseline vital parameters () were obtained and then an ILE protocol derived from human dosing recommendations was initiated. An initial 20% sterile lipid (INTRALIPID 20% IV Fat Emulsion; 500 mL, Baxter Healthcare, Deerfield, IL, USA) bolus of 7.5 mL (1.4 mL/kg) over 10 min was administered through an in-line 1.2 micron filter intravenously. This was followed by an intravenous constant rate infusion (CRI) of 0.16 mL/kg/min over 1 h. Serum was assessed at 30 and 60 min after discontinuation of ILE by centrifugation of a heparinized micro-hematocrit capillary tube (Heparinized micro-hematocrit capillary tube, Kimble-Chase, Rockwood, TN, USA) with visual assessment of lipemia. Serum was evaluated to be lipemic at both time points. Intravenous fluid therapy was resumed after a total ILE infusion volume of 57 mL.
The patient became alert and responsive to stimuli during the ILE CRI. Heart rate and temperature increased compared to baseline [80 beats/min, 98.9°F (37.1°C), respectively]. The patient developed frequent episodes of liquid diarrhea 1 h after finishing the ILE CRI. At 5 h post-ILE infusion, the patient became acutely tachypneic and developed progressive respiratory distress. Respiratory rate was 140 breaths/min with increasing effort that progressed to orthopnea with gray mucous membranes. Auscultation revealed loud, diffuse crackles bilaterally. Flow-by supplemental oxygen was provided and a pulse oximeter reading obtained with oxygen therapy was 90%. Serum remained markedly lipemic at this time. The patient developed a severe productive cough, producing increasing amounts of a white foamy fluid at which point he was endotracheally intubated. Bedside ultrasound revealed scant pleural effusion and no left atrial enlargement assessed using left atrial to aorta ratio (stated as “not enlarged” in the medical record, considered to be an left atrial to aorta ratio <1.5). Doppler blood pressure was 50 mmHg. At this point the decision to euthanize was made due to financial limitations in the face of progressive decline. A large amount of pink tinged foamy white fluid was dumped from the endotracheal tube after euthanasia. Pulmonary fluid was evaluated and total protein (TP) obtained via refractometer was 5.4 g/dL (resulting in an edema fluid-to-plasma protein ratio of 0.76). A sterile sample of the 20% IV lipid emulsion used in this patient was negative for aerobic and anaerobic growth at 72 h.
Postmortem exam revealed a scant amount of clear pleural effusion and foamy fluid throughout the lower airways. The lungs were heterogeneously wet and heavy, supporting pulmonary edema. There was no gross evidence of hemorrhage or aspirated stomach contents.
Six sections from affected areas of lung were examined histologically by a board-certified veterinary anatomic pathologist following routine processing and hematoxylin and eosin staining (). A large proportion of the alveoli contained proteinaceous fluid admixed with small to moderate amounts of fibrin, moderate numbers of foamy macrophages, and occasionally small number of neutrophils, consistent with diffuse alveolar damage. Occasionally, alveolar septa were distended by discrete, round to tubular, empty spaces that appear to be intravascular and could represent lipid emboli. However, at the time of manuscript preparation, unprocessed lung sample were no longer available to pursue special stains for lipid on frozen sections. The finding of diffuse alveolar damage correlates with the clinical diagnosis of ARDS. The potential lipid emboli may have been additional drivers or contributors to impaired pulmonary physiology. |
pmc-6629888-1 | The first patient is a young woman, 20 years old at the time of diagnosis of a synovial sarcoma that originated from the soft tissue of the left hip. The neoplastic mass was surgically removed in May 2012, and the histological examination showed a synovial sarcoma with close surgical margins. Consequently, adjuvant chemotherapy with Doxorubicin and Ifosfamide was administered for a total of six cycles. During follow-up, in February 2015, the CT scan showed almost 15 nodules in the lung ranging from 5 to 10 mm (). In the same month the patient started therapy with Trabectedin at the dose of 1.5 mg/m2 every 3 weeks. The first radiological evaluation in April 2015 showed a dimensional reduction of all the lung nodules (). The patient continued the therapy, and in July and October 2015 the CT scan confirmed the partial response of the lung lesions.
In February 2016, after 16 cycles, the patient developed hematological toxicity with thrombocytopenia G2 and neutropenia G2. From the 17th cycle the dose was reduced to 1.2 mg/m2 (80% of the expected dose). In June 2016, after 20 cycles, the CT scan still showed stable disease. The patient asked for a therapeutic pause in order to complete her university studies and recover from the treatment's toxicity. Therefore, she started a follow-up program with a CT scan every 3 months.
In September 2017 (13 months after last dose) two lung nodules appeared to be increasing. After a multidisciplinary discussion with dedicated surgeons and radiotherapists it was decided to treat the two lung lesions with stereotactic radiotherapy. The treatment was well-tolerated. However, 6 months later, in March 2018 the radiologic findings showed disease progression with multiple, new lung metastases (). In April 2018, after a new multidisciplinary discussion, it was decided to restart systemic therapy with Trabectedin. The subsequent radiological evaluations in July and October 2018 showed stable disease with signs of response in some nodules (). The patient is continuing Trabectedin, without new significant adverse events. In the meantime, she successfully graduated and started her first work experience. |
pmc-6629888-2 | The second patient is a woman who was 44 years old at time of the diagnosis of uterine high grade leiomyosarcoma following radical hysterectomy (July 2011). She was referred to our Department in October 2011 when bilateral lung metastases were detected. She underwent a first line chemotherapy with Doxorubicin and Dacarbazine for six cycles, with a very good radiological partial response. In June 2013 the patient received second line therapy with Gemcitabine, due to lung progression. The treatment was stopped in January 2014, after nine cycles, for a drug holiday. In November 2015 a new lung and soft tissue (gluteus muscle) progression occurred (). As third line therapy she received Trabectedin. Overall, the therapy was well-tolerated by the patient. However, she developed hematological toxicity, in particular G3 neutropenia. Consequently, there were some delays of the programmed chemotherapy infusions and the need of granulocyte-colony stimulating factors (G-CSFs). After the introduction of G-CSFs prophylaxis after every cycle the therapy could proceed without delays.
In February 2016 the CT scan documented a partial response (), which was maintained until November 2016 when, according to patient's desire, a drug holiday was started. In July 2017 the CT scan showed a significant dimensional increase of a single lung nodule (). We discussed the case in a dedicated multidisciplinary meeting and decided to treat only the progressive lesion with stereotactic radiotherapy; gaining 6 further months of disease stability. Unfortunately, in December 2017 the patient experienced a multifocal lung progression. Therefore, she re-started Trabectedin with prophylactic G-CSFs and after four cycles, in March 2018, the CT scan documented a partial response (). At the time of this writing the patient is still on therapy maintaining a partial response and without new significant adverse events. |
pmc-6629888-3 | The third patient is an elderly woman, aged 78, who underwent the removal of a retroperitoneal mass (July 2014) which was pathologically diagnosed as leiomyosarcoma grade 3. Keeping in consideration the age of the patient no adjuvant treatment was offered. In April 2015 the patient experienced disease progression with multiple lesions in the retroperitoneum, so from May 2015 she received three cycles of pegylated liposomal Doxorubicin. The CT scan in August 2015 showed the appearance of new hepatic lesions (). In the same month she started Trabectedin at the recommended dose of 1.5 mg/m2 every 3 weeks. She achieved a partial response in April 2016, with asthenia G2 being the only adverse event. The response was then maintained until December 2016 (), when a therapeutic holiday was proposed to the patient after a total of 22 cycles of Trabectedin. All the next follow-up visits showed stability of disease up to November 2017, when the CT scan documented a stable disease according to RECIST criteria, with only slight increase in some of the lesions. In the following weeks the patient was hospitalized due to complete atrioventricular block, with necessity to implant a pacemaker, so we decided to continue the drug holiday. The hospitalization was prolonged due to episodes of asystolia. At December 2018, the patient was still alive although with an impaired performance status, due especially to her cardiological conditions. Last CT scan performed in November 2018 showed a slow progressive disease, but because of the performance status we decided to not offer active treatment. |
pmc-6629888-4 | The last patient is a 43 years old man with myxoid liposarcoma that had his first treatment in April 2003 for what was thought to be a PNET of the popliteal fossa. In fact, he was treated with six cycles of VAC-EI (Vincristine, Actinomycin D, Cisplatin and Ifosfamide, Etoposide) and neoadjuvant radiotherapy (45 Gy) before surgery, achieving a pathological complete response. Seven years later, the patient returned to the Oncology Department for a new supraclavicular mass, which was surgically removed, with a histological diagnosis of low-grade sarcoma. The next year the patient developed two new abdominal masses which were surgically removed. These new surgical specimens and the older histological samples from previous surgeries were then reviewed by an expert pathologist who diagnosed a myxoid round cell liposarcoma in December 2011.
Two years later, in May 2013, the patient experienced a multifocal abdominal progression. The patient was already treated with anthracyclines, so Trabectedin was chosen as therapy for metastatic disease. The therapy was administered at the standard dose of 1.5 mg/m2 without any relevant toxicity.
The MR scan after nine cycles showed a partial response and, after a multidisciplinary discussion, it was decided to surgically remove the remaining lesions. However, the surgery was not radical. Fortunately, the patient experienced a lasting stability with 25 months of follow-up without relapses. A CT scan showed a new abdominal progression in June 2016 () with the appearance of multiple peritoneal lesions. We decided for a Trabectedin re-challenge. The patient started at the end of June 2016, and then continued the therapy without significant toxicities. After 18 months of therapy and a new partial response in some of the abdominal nodules (), we proposed a new drug holiday in February 2018. Now, the patient is continuing the second pause and the disease is still stable at follow-up assessments. |
pmc-6630029-1 | The presented case is a 68-year-old female patient with BMI 26, ASA score II, ECOG performance status 0, CR POSSUM operative severity score 6 with mortality prediction 1%, with hypothyroidism and high blood pressure, non-smoker, with a history of Billroth II gastric resection, cholecystectomy and choledochoduodenostomy. The patient exhibited suspected neoplastic lesion of the liver with negative CT guided biopsy. The workup included gastroscopy with chronic gastritis and subsequent colonoscopy with extensive benign polyp of lateral spreading tumor type 15 cm from the anal verge with size 30 × 25 × 25 mm and non-lifting phenomenon contraindicated for endoscopic treatment. A low anterior resection was carried out. The anastomosis was performed with a circular stapler approximately 10 cm from the anal verge. The only peroperative complication was bleeding from sacral excavation with a blood loss of approximately 800 ml. On the fourth postoperative day, septic shock with CT-confirmed inflammatory changes in small pelvis and peritoneal cavity effusion without a confirmed leak. Skin inflammation of the right groin and femoral region developed. Broad-spectrum antibiotics and surgical revision under general anesthesia with abdominal washing and diverting ileostomy was performed. Further intensive care required broad-spectrum antibiotics, the circulation was supported with small doses of norepinephrine. In the following course, general and local clinical conditions were still worsening with localized skin necrosis and maximum SOFA score 12 (Respiratory system +2, Nervous system +3, Cardiovascular system +3, Liver 0, Coagulation +3, Kidneys +1) with 80% mortality risk.
On the 8th postoperative day, severe necrotic tissue infection in the right groin and a presacral anastomotic leak were confirmed (). Endoscopy showed a 3 cm wide anastomotic dehiscence on the ventrolateral margin with a 5 cm long cavity and pelvic necrotic tissue (). Necrectomy of necrotic skin and soft tissue extending to right lower pelvis was carried out and drained with subsequently proven Enterococcus and Pseudomonas infection (). The leak was managed by EVAC with an extraluminal installation.
The technique consisted of sigmoidoscopic determination of the leak, measuring of the cavity, lavage and necrectomy and application of the foam using overtube. The negative pressure was set to 50–75 mmHg, subsequently to 100–125 mmHg. In the course of EVAC therapy, clinical status was rapidly improved. A total of 6 procedures were performed until there was a defect of 1 cm in diameter. The whole hospital stay took 40 days, the ICU stay 16 days.
Colonoscopy 3 months after surgery showed a healed anastomosis without remanent cavity, fistula or stenosis (). The skin defects were healed after 117 days, the ileostomy was restored 14 months after primary surgery. Within 3 years of follow-up, no rectal fistula, stenosis or continence impairment occurred. The liver lesion disappeared, thus suspected to be caused by ascending biliary infection following choledochoduodenostomy. |
pmc-6630232-1 | A 45-year-old man presented to the hospital with complaints of rectal pain and bright red blood with each bowel movement for the past 6 months. He also described cramping rectal pain alleviated by bowel movements and aggravated by sitting and straining. He denied fevers or chills, but endorsed 15-pound weight loss in the last 3 weeks due to anorexia and fear of having a painful bowel movement. He admitted to have receptive anal intercourse, but had not been sexually active for the past 14 months due to pain. He also complained of dysuria and straining to urinate with incomplete voiding. The patient had a history of HIV infection and treated syphilis 6 months ago. His antiretroviral treatment consisted of dolutegravir and darunavir/cobicistat. A physical exam revealed a soft, nontender, and nondistended abdomen with normal bowel sounds. A rectal exam showed normal rectal tone, tenderness to palpation, external hemorrhoids, and a deep anal fissure. Laboratory studies were significant for hemoglobin of 12.6 g/dL, a white blood cell count of 5.6 K/uL, and creatinine of 1.15 mg/dL. His CD4 count was 283 cells/uL and his HIV viral load was undetectable. Urinalysis was normal. Computed tomography revealed prominent concentric thickening of the mid and lower rectum with associated mesorectal fat stranding and lymphadenopathy, highly concerning for an underlying rectal neoplasm or severe proctocolitis.
For this reason, the patient underwent a colonoscopy that showed a fungating and infiltrative partially obstructing medium-sized mass in the rectum, 10–15 cm from the anal verge (A). Discontinuous areas of nonbleeding ulcerated mucosa with no stigmata of recent bleeding were present in the rectum. Multiple biopsies were obtained. He was started empirically on doxycycline 100 mg every 12 hours for possible lymphogranuloma venereum or syphilis. Further infectious work-up revealed a negative gonorrhea/chlamydia PCR in urine and rectum. RPR (rapid plasma reagin) titer was 1:8; however, the patient had a titer of 1:32 6 months ago, consistent with history of adequately treated syphilis. Given the possibility of rectal cancer, magnetic resonance imaging (MRI) was ordered for staging, which demonstrated a polypoidal mass with a circumferential nodular border. More than 50% of the tumor had a very high T2 signal intensity compared with perirectal fat (B). Lymphadenopathies of ≥9 mm were identified in the mesorectal/superior rectal space. Histologic sections of the biopsy revealed colorectal mucosa with ulceration, epithelial cells with viral nuclear inclusion, exuberant granulation tissue, marked lymphoplasmacytic and eosinophilic infiltrate, and fibrinopurulent exudate (C). Immunohistochemistry for herpes simplex virus-1 was positive in epithelial cells demonstrating a viral cytopathic effect (D), supporting the diagnosis of HSV infection. Immunostain for Cytomegalovirus (CMV) and Adenovirus were negative. Warthin–Starry stain was negative for spirochetes. Gomori methenamine silver (GMS) stain and trichrome stain failed to demonstrate fungal organisms or parasites. The overall histologic changes were not suggestive of human herpes virus-8 (HHV-8) or HPV infection; therefore, testing for these viruses was not performed. Doxycycline was discontinued and the patient was started on valacyclovir (1 g) every 8 hours for 21 days. At 3-month follow-up, the patient reported complete resolution of rectal pain and denied any further episodes of bloody stools. Three months later, a sigmoidoscopy was performed and revealed a normal rectal mucosa and no evidence of masses. |
pmc-6630371-1 | A 67-year-old male with 15 days macrohematuria and consequent anemization was presented. Nothing of relevant was collected from his clinical history, despite the use of chronic aspirin as secondary prevention due to previous myocardial ischemic events that did not require interventions. Regarding the anamnesis, he reported a recent (about 20 days earlier) but non-relevant trauma falling from the stairs.
Our Internal Review Board approved the retrospective analysis of this interventional procedure (OSP2015/2495). Any further consent was not expected: EVOH is an embolic agent approved and usually used for peripheral embolization.
The urologist proposed to our Radiology Department to proceed with an ultrasound that was not diagnostic. Then, a CT scan was proposed. A multi phases CT revealed a left pseudoaneurysm ().
The patient was proposed to our Interventional Radiology (IR) Unit for transarterial embolization. First angiogram confirmed pseudoaneurysm; selective catheterization of the feeder was obtained (). Due to the optimal position of the microcatheter, the operator chose EVOH Onyx 34 (Medtronic plc, Dublin, Ireland) as an embolic agent. The volume of EVOH injected was about 0.3 mL, with an injection rate of about 0.15 mL/min. Additionally, 0.7 mL of dimethyl-sulfoxide DMSO was used to fill the dead space of the microcatheter. No adverse reactions were reported in the patient. In our institution, we are currently performing a prospective collection of patients with altered coagulant status and renal traumatic or iatrogenic pseudoaneurysms treated with EVOH (usually Onyx 34), in order to compare the safety and effectiveness of them with the cases treated with other embolic agents.
During the injection of EVOH, an extravasation of the embolic agent was observed, and a slow filling of the inferior renal calyx was observed (). Migration and incomplete embolization of the PSA have been confirmed by the angiogram. The procedure was concluded through microcoils. The patient was stable and asymptomatic during the entire procedure.
Given the stability of these parameters and the disappearance of the hematuria, the patient was referred to our IR unit to remove the sheath after 2 days. Due to accidental migration of EVOH during procedure, a single shot on left flank was acquired. EVOH was no longer observed in the renal calyx, while it was shown in the bladder by a further single shot of the pelvis (). Complete exclusion of the PSA has been confirmed through a renal angiogram ().
Although the patient was completely asymptomatic, the operator, according to the patient, decided to approach the bladder per via retrograde to attempt the removal of EVOH migrated. The embolic agent was then completely removed using a goose neck catheter ().
Two days later, the patient was discharged as urine was clear and he was asymptomatic. However, one week later, patient presented hematuria again; he was then admitted to our Urology Department to perform a new CT. Pseudoaneurysm was in part refilled. A new arteriography and intra-procedural cone beam CT (CBCT) were performed: the results confirmed blood penetration through the coils. To stop the flow behind the coils, one millimeter of N-butyl-2-cyanoacrylate (NBCA) (1:1) has been selectively injected. Final angiogram showed complete exclusion of PSA (). After 3 days, the patient has been discharged; hematuria no longer appeared in the available follow up of 12 months. |
pmc-6630633-1 | A 45-year-old female patient with a history of breast cancer, previously treated by left mastectomy 4.5 years ago, chemotherapy 2.5 years ago and radiotherapy 1.5 years ago, started third -line hormonal treatment with Everolimus (AFINITOR 10 mg) and Exemestane (AROMASINE 25 mg) in addition to Zoledronic acid (ZOMETA 4 mg/100 ml). After three months of hormonal therapy, the patient complained of chronic impairment in swallowing in the upper gastrointestinal tract, from the lips to the upper esophageal sphincter. The patient was diagnosed with chronic dysphagia by a certified speech-language therapist. For the assessment of the severity of dysphagia and the follow-up, a functional outcome swallowing scale (FOSS) for staging oropharyngeal dysphagia was used []. The treatment of choice was the therapeutic use of photobiomodulation. One session of PBM was given every 24 hours for five days. The FOSS scale was used to measure the severity of dysphagia before the treatment, per-treatment and after 15 days of treatment. Diagnosis revealed that the patient had compensated abnormal function manifested by significant dietary modifications and prolonged mealtime with a stable weight, occasional cough, with an absent aspiration. No ethical committee approval was necessary for our research since the protocol used in this case report is described in literature. The patient signed a written informed consent before enrolling in the study.
i Assessment of Dysphagia
The functional outcome swallowing scale for staging oropharyngeal dysphagia, proposed by John. R Salassa in 1999, was used for the assessment of dysphagia before treatment (T0), at day two of treatment (T2), immediately after treatment (T5) and fifteen days after treatment (T15). The FOSS was at stage II before the treatment ().
ii Treatment Protocol of Dysphagia
The photobiomodulation therapy protocol and parameters used was based on evidence derived from the literature and expert opinion that provided a guideline for the use of photobiomodulation in supportive cancer care for dysphagia (). Intraoral and extraoral application of diode laser 980 nm (FONA Laser Sirona Dental Systems GmbH, Germany) was used. Intraoral application of the diode laser 980 nm was made with an energy density of 3 J/cm2 for 10 seconds at each point, in a continuous and non-contact mode, tip of 320 µm. Bilaterally four points on the soft palate, bilaterally four points on the oropharynx. Extra-oral application was made with an energy density of 3 J/cm2, 10 seconds of irradiation on each point, tip of 320 µm, in a continuous and non-contact mode. The irradiation was made on the lateral and ventral pharynx and larynx, midline neck and lateral neck anterior to sternocleidomastoid muscle ().
iii Results
At T0, the FOSS was at stage II. After three sessions of photobiomodulation therapy (T3), there was occasional cough, symptomatic, a little difficulty in swallowing and prolonged meal time with the sensation of food getting stuck in the throat or esophagus (between stage II and I). After the treatment (T5), the patient had complete physiological function and was asymptomatic. Therefore, at stage 0 of FOSS, which persisted after 15 days (T15). A significant reduction of dysphagia (from stage II to Stage 0) was noted after 5 sessions of PBM with the protocol used. Therefore, PBM therapy successfully treated the hormonal therapy induced dysphagia (). |
pmc-6630656-1 | The patient, a 39-year-old gravida 11 para 10 woman, presented to the local emergency department, seven weeks into her eleventh pregnancy with a three-day history of fevers, non-bilious vomiting, and right iliac fossa pain. Her bloods showed a mild elevation in liver transaminases, a mild lymphopenia and a moderately elevated C-reactive protein. Bedside ultrasonography revealed a viable intrauterine pregnancy with a small perigestational bleed. Her fever and abdominal pain subsided in the short stay observation unit, and she was discharged with antiemetic medication and follow-up with her general practitioner.
Apart from a past history of genital herpes simplex 2 infection, the patient disclosed no significant medical nor surgical history. She did not take any regularly prescribed medications beyond antenatal supplements, and had a documented anaphylactic reaction to penicillin.
Together with her husband and children, the patient resided on a large property reliant on tank water remote from the district hospital. The property was home to various animals, including cows, horses, chickens, ducks, dogs, and cats. All family members were well at the time of her presentation. She reported no recent travel, alteration in diet, neither animal nor insect bites, and the animals remained well on the property. She denied any illicit drug use, was a non-smoker, and drank no alcohol.
Two days following her initial presentation, the patient re-presented to the emergency department with ongoing vomiting and right iliac fossa pain. She described recurrent fevers and rigours at home. On this presentation, her bloods showed worsening liver dysfunction, lymphopenia and ongoing elevation in her inflammatory markers, with a new modest.
She was admitted to the general surgical unit and commenced empirically on clindamycin for presumed acute appendicitis. Subsequent abdominal ultrasonography, however, showed no radiological signs of appendicitis and confirmed a viable intrauterine pregnancy. In light of her elevated liver transaminases, a liver panel was undertaken which included serology for Epstein-Barr virus and cytomegalovirus, as well as anti-neutrophil and smooth muscle antibody testing and serum lactate dehydrogenase, all of which were unremarkable. Atypical infectious investigations were also ordered, which included Q fever and arboviral serology.
Over the course of her admission, her nausea and vomiting were managed with antiemetic medication, and her fevers and abdominal pain abated spontaneously. She was subsequently discharged after a three-day admission.
Following discharge, at nine weeks gestation, the patient was found to have a positive Q fever phase II IgG and IgM on indirect immunofluorescence assay (IFA) with titres of 3200 and >400, respectively (). She was contacted and commenced on cotrimoxazole therapy with high-dose folic acid. Follow-up investigations included transthoracic echocardiography, which demonstrated normal heart valves, left ventricle size, and systolic function. Both her liver function abnormalities and thrombocytopenia normalised over the ensuing month.
The remainder of the patient’s pregnancy progressed uneventfully. She declined suppressive acyclovir in the third trimester and remained on twice daily cotrimoxazole until 36 weeks gestation. Repeat Q fever IFA serology at this stage remained strongly positive, with a phase I IgG of 800 and phase II IgG of 1600. Q fever PCR on serum was negative.
She presented in spontaneous labour at 40 + 2 weeks gestation with membranes intact. Strict barrier nursing precautions were observed. On admission, the patient was examined and found to have no evidence of herpetic lesions. Her group B streptococcus status was unknown. She made good progress and spontaneously delivered a vigorous, live infant male weighing 3600 g. The third stage was actively managed with prompt delivery of the placenta, which showed no gross evidence of placentitis. The placenta was sent fresh for histopathology, with a small sample sent separately for Q fever PCR. Both PCR and histopathology were negative for Q fever placental infection, as too was breastmilk PCR. A blood sample was also taken from the baby for PCR, which was also negative.
The patient recommenced cotrimoxazole postpartum. Repeat Q fever IFA serology at three months indicated persistent infection, with Phase I IgG of 1600 and Phase II IgG of 100. At the time of writing, she was planned for repeat outpatient echocardiography and consideration of positron emission tomography to look for an infective focus. Ongoing surveillance serology was planned at three-monthly intervals, and the baby’s serology at three months remained negative. |
pmc-6630765-1 | A 65 year old male patient was referred to a private dental clinic with the chief complaint of pain in the lower second left molar. The patient’s medical history included hypertension and heavy smoking. His medical and dental history was noncontributory and there was no sign of any systemic diseases or syndromes. He mentioned that he had the upper left first molar extracted and the supernumerary premolar (that he already knew he had), erupted in this area. He also mentioned that his daughter had a supernumerary tooth in the same area but had had it extracted, hence her clinical records were not provided. A panoramic radiograph was performed on the patient, which incidentally revealed the existence of a supernumerary fully formed impacted paramolar located mesially to the upper right first molar (). The crown of both paramolars (impacted and erupted) had two cusps and somewhat resembled a permanent premolar. The patient was informed of the existing condition and was advised to undergo a further radiological evaluation due to the potential risk of root resorption of the teeth adjacent to the impacted paramolars. Since both paramolars were asymptomatic, the patient was unwilling to proceed with further radiographic evaluation or removal of any of the teeth. Thus he was advised to undergo regular radiographic revaluation. After a two-month interval, the patient’s 25 year old son attended the same dental clinic, complaining of pain in the left area of the maxilla. Panoramic radiography examination revealed bilaterally impacted third molars in both jaws and a fully formed impacted paramolar. The root of the paramolar was positioned close to the left sinus maxillary (). All of the radiographic findings and the potential risk of root resorption of the adjacent teeth was explained. The patient seemed unenthusiastic to proceed with further radiographic evaluation and intervention, so he was advised to undergo regular radiographic revaluation. |
pmc-6630765-2 | A 60 year old male patient attended a private dental clinic with pain to the area of the upper left second molar. The patient’s medical history included hypertension, heavy smoking and alcohol consumption and he did not have syndromic features. His dental history included tooth mobility due to severe periodontitis. The panoramic radiograph incidentally revealed the existence of a fully formed impacted parapremolar located on the right side of the mandible between the first premolar and the canine (). It was decided not to perform a cone beam computer tomography (CBCT) examination to evaluate the presence of root resorption of the adjacent teeth since they had a very poor prognosis. The patient’s 34 year old son attended the same dental clinic. In his medical history he reported frequent respiratory infections, the removal of his thyroid gland a year ago and he did not present any syndromic features. Concerning his dental history, his bilateral lower third molars had been extracted. An incidental finding in the panoramic radiograph of the son () was a fully formed parapremolar in the mandible, located diagonally with its crown mesial to the second left premolar and its apex distal to the left second incisor. In order to better evaluate the exact location of the parapremolar and the potential risk of root resorption to the adjacent teeth, a cone beam computer tomography (CBCT) was performed (). As seen in the CBCT the parapremolar was located lingually. The supernumerary tooth as a whole was lingually located in the root of the lower left first premolar and was tangent to the latter. In particular, the distal portion of the supernumerary tooth’s crown was located proximal to the middle third of the root of lower left second premolar. The root of the supernumerary was located lingually and slightly below lower left canine. Moreover, it presented an abnormal morphology. The patient did not want to proceed with a surgical extraction of the supernumerary tooth and so observation was decided upon instead. |
pmc-6630877-1 | A 77-year old female came to the department of oral medicine complaining about an ulceration on the left side of her tongue. A few days earlier, she had her lower left first molar non-surgically extracted. She reported that the tooth was very sharp and irritated her tongue. Now she was edentulous in the upper and lower jaw. Her medical history revealed hypertension and a penicillin allergy. She was taking nebivolol, lysinopril, and acetylsalicylic acid daily, and pantoprazolum occasionally. She did not smoke or consume alcohol. Clinical examination revealed an oblong ulceration on her left side of the tongue, the size of 1.5 × 4 cm. The extraction wound was healing fine. The patient was given a perilesional instillation of corticosteroid (methylprednisolone, 0.5 mL of 40 mg/mL,) around the tongue wound and local therapy, which included an antiseptic solution (chlorhexidine gluconate 2%) and corticosteroid ointment (betamethasone in orabase) to be applied four times a day.
At the control examination, after one week, the tongue lesion was enlarged (). The extraction wound healed, but an exposed area of bone was visible on the lingual side of the lower jaw, in the projection of the wound (). The patient did not wear dentures after the tooth extraction, so this was not a denture pressure sore, and also, this was not trauma from tooth extraction because it appeared a week after in the distal part of the mandible. Conventional radiographic analysis (orthopantomograph) had shown a healthy bone without osteolysis in that area (). An oral surgeon specialist smoothed the visible bone edges with a chisel without elevating the mucoperiosteal flap (to avoid ischaemia and further spreading of the wound). There was no bone sequestration and the exposed bone was not removed and histopathologically analyzed. The patient received local therapy, which included antiseptic solution (chlorhexidine gluconate 2%) and corticosteroid ointment (betamethasone in orabase) to be applied four times a day.
At the next control examination after one more week, the earlier lesions remained unchanged, but another area of exposed bone appeared in the edentulous ridge of the same jaw in the anterior region, and also on the lingual side of the jaw, with a diameter of 0.5 cm (). The sharp and protruding edges of the first lesion of exposed bone in the distal part of the mandible were manually reduced one more time, again without elevation of the mucoperiosteal flap. The patient was referred to make a complete blood count, blood glucose, and serum iron level to exclude anemia or diabetes mellitus as possible causes of slow healing, and all findings were within a normal range. The patient received local therapy for home, according to the previous protocol.
The control examination was after one week and there were no changes in the clinical appearance of the lesions. Since there was no improvement despite local therapy, a biopsy sample of mucosa was taken from the tongue ulceration to exclude possible malignant transformation. The histopathological finding was: “On most of the surface of the received sample, there is no preserved surface epithelium and there is a granulation tissue. At the edge of the sample, there is a multilayer squamous epithelium, which is degeneratively and reparatory transformed. The finding corresponds to the edges of an ulcer. There is no tumor tissue in the examined and received material”.
We decided to try the conservative treatment and the patient was then prescribed systemic antibiotic therapy of clindamycin 3 × 600 mg and metronidazole 3 × 400 mg for ten days.
At the control examination 7 weeks after the first clinical examination and 10 days after antibiotics were prescribed, all lesions healed. |
pmc-6631016-1 | An 86-year-old woman was admitted to the University Hospital of Rouen with suspected pneumonia and persistent fever showing no improvement after four days of treatment with amoxicillin/clavulanic acid. She had a history of hypertension, hypercholesterolemia, moderated aortic stenosis (mean gradient of 25 mmHg and aortic valve area 1 cm2) and stable ischemic heart disease (stent in the circonflex artery 2015). On admission, she was afebrile and without other symptoms. A physical examination found no sign of endocarditis (no systolic murmur was heard). White blood cell count was 15.5 giga/L with 81.7% of neutrophils and C-reactive protein 141 mg/L. Two sets of blood culture were positive for GH (Penicillin minimum inhibitory concentration was 0.125 mg/L). An intravenous treatment with amoxicillin (12 g/day) and gentamicin (200 mg/day) was started under the hypothesis of infective endocarditis. After five days, the patient’s condition severely deteriorated due to acute pulmonary edema. The transthoracic echocardiography found a severe aortic regurgitation without vegetation (vena contracta measured 6 mm and the ratio jet width on left ventricular outflow tract (LVOT) was 100%), the left ventricle was not dilated and non-hypertrophic and the ejection fraction was 60%, which was normal. A comprehensive geriatric assessment (CGA) had been performed on admission to screen for geriatric conditions that might influence the prognosis and thus therapeutic strategies. The Charlson Comorbidity Index was 5 indicating a low degree of comorbidities, the functional abilities evaluated by the Instrumental Activities of Daily Living (IADL) and the Activities of Daily Living (ADL) were normal. There was no sign or history of cognitive disorders and no sign of delirium confirmed by a negative Confusion Assessment Method (CAM). Concerning the nutritional parameters, the patient was overweight (BMI = 29.4 kg/m2) with a hypoalbuminaemia (21 g/L). The combination of absence of major geriatric syndromes and the severity of the valvular disease supported a potential benefit of a surgical approach. The patient was transferred to the department of cardiology on the day of the transthoracic echocardiography and underwent aortic valvular replacement surgery by a bioprothesis two days later. This resulted in an improvement in both clinical and blood values following surgery. The anatomo-pathological examination of the native valve found a Gram-positive coccus. The polymerase chain reaction (PCR) 16S rRNA gene amplification sequencing of the native valve confirmed the existence of bacterial material. The study of the amplified sequence confirmed the presence of GH. Abdominal and pelvic CT and a dental exam did not show any anomalies. The antibiotic therapy was continued for six weeks. The patient went to a rehabilitation ward to undergo physiotherapy and an oral nutrition program. She went back home in the same conditions as before the hospitalization. Albumin four months after discharge from hospital was 35 g/L.
The patient on whom we wrote the case report signed an informed consent form to approve the use of her data. An ethical approval from the ethical committee of our hospital was not necessary according to the GCP guidelines of our university. |
pmc-6631357-1 | A seven-year-old spayed female Labrador retriever presented to the Utah State Veterinary Diagnostic Laboratory for necropsy following an acute onset of thrombocytopenia and anemia coupled with a peripheral neutrophilia, lymphocytosis and monocytosis. The history indicated a previous diagnosis of coccidioidomycoses that was being treated at the time of death. Abdominal ultrasound revealed an enlarged, granular liver with irregular liver margins. The urogenital tract showed no significant ultrasonographic abnormalities. In addition to fluconazole and amphotericin B treatment for coccidioidomycoses, the patient was receiving prednisone and myocophenolate for a presumptive immune mediated anemia and thrombocytopenia, and S-adenosyl-L-methionine (SAMe) for elevated hepatic enzymes prior to presentation for necropsy. The patient died naturally at home seven days after initial presentation.
Gross necropsy revealed a hemoabdomen with approximately 1 L of serosanguineous fluid within the abdominal cavity, petechiation along the ventral abdomen and dark-red-to-purple viscous material within the entirety of the gastrointestinal tract. Originating within the pelvic fat lateral to the pelvic urethra and coursing caudally and dorsally within the subcutaneous fat overlying the left semimembranosus and semitendinosus muscles was a 2 × 3 × 10 cm, cylindrical to tubular, mottled tan-to-red mass that ended abruptly approximately one quarter to one third of the way down the pelvic limb. It was not determined at the time of necropsy if the mass directly communicated with the urinary bladder or urethra. The mass was grossly soft to spongy with a central slit-like lumen measuring up to 25 mm in diameter on cross section. The lumen continued down the entire length of the mass ending approximately 1 cm proximal to the blinded end within the pelvic limb.
Microscopic evaluation of the mass revealed an unencapsulated, moderately cellular, well-demarcated expansile mass (). The mass was centered on a lumen lined primarily by urothelium that multifocally transitioned to non-keratinizing, stratified-squamous epithelium (). In portions of the mass lined by stratified squamous epithelium, the supporting stroma contained low numbers of hair follicles and associated sebaceous sweat glands with scattered apocrine glands (). The lumen was surrounded by a dense collagenous stroma with few skeletal muscle bundles containing numerous, variably sized, dilated vascular channels with luminal erythrocytes (). The vascular channels occasionally anastomosed and were lined by a single layer of endothelium. The sub-urothelial collagenous stroma was multifocally infiltrated and expanded by aggregates of lymphocytes and fewer plasma cells forming discrete aggregates ().
Additional gross and histologic diagnoses included cirrhosis, multiple adenohypophyseal cysts, meningioangiomatosis, splenic and bone marrow myeloid dysplasia, adrenal cortical hyperplasia and hypertrophy, lymphoplasmacytic gastritis and hemomelasma ilei. The cause of death in this dog was attributed to sequela associated with cirrhosis. Presumptive myeloid dysplasia was diagnosed on histopathologic examination of the bone marrow and splenic tissue. A complete blood count in the ante-mortem period was unavailable to confirm a concurrent diagnosis of myeloid leukemia. |
pmc-6631397-1 | A 31-year-old woman, previously healthy, with pregnancy at 26 weeks, was admitted to a primary health center facility in Santander with a 2-day history of fever, headache and myalgia. The initial physical exam showed blood pressure of 146/92 mmHg without any other abnormality. She had no fever, high pulse rate or petechiae, or any bleeding signs. Laboratory evaluation revealed a total leukocyte count of 7280 cells/mm3, hemoglobin of 11 g/dL and platelet count of 61,000 cells/mm3. Additionally, proteinuria of 100 mg/dL was detected. The patient was diagnosed with preeclampsia and was transferred to the University Hospital of Santander, a tertiary level hospital, for further evaluation and treatment.
At admission, biochemical analysis was performed, finding that her aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels, renal function tests and electrolytes were normal. Treatment with nifedipine and magnesium sulfate was started. At admission and during the follow-up, blood pressure measures were within the normal range, but treatment was administered given the single high blood pressure measure presented in the first clinical evaluation. Also, an ultrasound with fetal Doppler was obtained, showing a fetal heart rate between 110 and 150 beats/min, estimated weight of 862 g (percentile 0.17), amniotic fluid index (AFI) of 16.04 (normal), fetal hemodynamic changes with absence of diastolic flow in the umbilical artery and redistribution phenomenon, brain/placenta pulsatility index (PI) relation in 2.5 percentile, and an average PI of 1.8. Severe intrauterine growth restriction was diagnosed, and lung maturation with steroids was immediately initiated.
On day 2 of hospitalization, the result of the urine culture was received, showing >100,000 CFU of Enterococcus spp. sensitive to Ceftriaxone and because the patient persisted with fever, antibiotic treatment was started. Additionally, she started to present respiratory distress and desaturation, with diminution in basal ventilation of the lungs. The new blood evaluation showed a decrease in total leukocyte count to 3660 cells/mm3 and in the platelet count to 47,000 cells/mm3. Because Santander is an endemic area for dengue, the new suspicion was dengue infection. IgM specific for dengue was requested.
On day 3, the patient started labor spontaneously. A male was born, with a weight of 730 g and length of 34 cm. He was transferred to the neonatal intensive care unit where he died with cerebral hemorrhage and respiratory distress. Before child birth, two blood units and six platelet units were transfused. After the birth, five new blood units were transfused to the patient. The control platelet count after the transfusions was 37,000 cells/mm3.
In the immediate post-partum, hepatomegaly was detected, with superficial breathing and basal stertorous. The patient started to present visual and auditive hallucinations with agitation periods. Chest x-ray showed bilateral pleural effusion. Additional treatment with clarithromycin was initiated, with a presumptive diagnosis of complicated pneumonia. Initiation of mechanical ventilation and vasoactive with inotropic support were required. The dengue IgM result was positive on day 4. On day 5, the patient presented respiratory dysfunction and failure to respond to inotropic treatment, ultrasonography and computed axial tomography discarded the presence of pulmonary embolism. Finally, the patient died from cardiorespiratory arrest. shows the follow-up of the laboratory results available in the clinical records.
The autopsy revealed pleural effusion, pericardial effusion and hemorrhage at the base of the skull and in the right lobe of the liver, with changes associated with microangiopathic thrombosis, which is commonly associated with dengue virus. The Colombian National Institute of Health received samples of the tissues for analysis, finding Dengue IgG negative, IgM positive and a positive RT-PCR for DENV-2, confirming the case as a fatal dengue case with a primary infection.
Paraffin-embedded formalin-fixed tissues from the lung, liver, heart, brain, kidney and spleen of the patient were obtained. Initially, a histological evaluation with hematoxylin/eosin staining was performed, followed by immunopathological evaluation with immunohistochemistry using different cellular markers in order to identify the cellular infiltration and its relationship with tissue damage. Briefly, the tissues underwent deparaffinization with xylene, rehydration in an alcohol battery, antigen retrieval with citrate buffer pH 6.0, blocking of endogenous peroxidases with hydrogen peroxide at 3%, blocking with normal goat serum 3%, incubation with primary antibody, posterior addition of secondary antibody from goat, incubation with Avidine/Biotin-ABC Kit (VECTOR/PK-6101 Peroxidase) and revealing of the reaction with DAB Kit (VECTOR/SK-4100).
The primary antibodies used in immunohistochemistry were: rabbit polyclonal anti-CD3 at a dilution of 1:200 (DAKO A045201), mouse monoclonal anti-CD4 at a dilution of 1:100 (DAKO M731001), mouse monoclonal anti-CD8 at a dilution of 1:100 (DAKO M710301), mouse monoclonal anti-CD68 at a dilution of 1:100 (DAKO M087601) and mouse monoclonal anti-CD20 at a dilution of 1:100 (DAKO M075501). The secondary antibodies used were biotinylated goat anti-rabbit at 1:200 and goat anti-mouse at 1:200. These stained tissues were evaluated by two different pathologists, with a concordance index of 0.95. The main findings in these tissues are described in and shown in .
The main organ affected was the lung, with the presence of edema, hemorrhage, alveolar damage and vascular congestion (a). The main cell types infiltrating the tissue were T cells in septa and alveoli, predominantly CD8+ T cells, with an inversion of the ratio CD4+/CD8+ (a,b). These T cells were found to express high levels of HLA-DR, a marker of T cell activation (c). Macrophages were also found abundantly in the lung, mainly in alveoli (d). B cells were present to a lesser extent, with multiples focus in septa all over the tissue (e). Neutrophils were not evaluated with specific staining but, in the histological evaluation, were found infiltrating septa in moderate amounts.
To discard another co-infection, DNA and RNA from the tissues were extracted with Kit FFPE DNA/RNA QIAGEN® to perform conventional PCR for the detection of Lepstospira spp. [] and Plasmodium spp. []. Additionally, real-time RT-PCR (qRT-PCR) was made for the detection of Zika virus [], Chikungunya virus [], influenza B virus and influenza A virus []. All the tests were made in duplicate, with a negative control from the extraction and a negative control from the RT-PCR process. Primers used for these experiments were designed and standardized elsewhere [,,,,]. Influenza A infection was confirmed in the lung tissue, in two different experiments, with an average Cycle Threshold CT of 35 (cut-off point of 38.5), and the negative controls showed no amplification curve. |
pmc-6631546-1 | A 17-year-old female student was referred to the Department of Dentistry for the prophylactic removal of 4 unerupted third molars due to dental crowding. She had no medical history. Teeth extraction was planned in two sessions under local anesthesia (Fig. ).
The extraction of the left upper and lower third molar teeth was uneventful. During the second step 2 weeks later, the right upper third molar was accidentally pushed upward and laterally and became unreachable. Immediate retrieval maneuvers were unsuccessful. The wound was closed using 3/0 polyglactin sutures, and amoxicillin–clavulanate (1000 mg × 3/day) was administered orally for 3 weeks.
An immediate postoperative cone beam computed tomography (CBCT) scan showed displacement of the third molar to the ITF up to the level of the sigmoid notch of the mandible (Fig. ). The position of the tooth was horizontal, with the crown being posterior (Fig. ).
A computed tomography (CT) scan acquired 3 weeks after the procedure showed that the tooth had spontaneously returned to the vertical position with a downward crown and had migrated back down to the level of the lingula (Fig. ).
The lack of a solid cranial support of the tooth observed on the CT scan led to the patient being at risk of further upward displacement during a retrieval attempt. A combined surgical and image-guided approach was decided.
A retrieval procedure under general anesthesia using nasotracheal intubation was performed in the interventional 4D MSCT scan unit, 2 months after the initial extraction attempt because of organizational purposes (Additional file ). Indeed, the patient was unavailable and, as she did not complain from any significant symptoms, there was no emergency for retrieval.
In the first step, radiologists inserted a 12 Gauge bone trocar (Bonopty®-AprioMed AB, Sweden) under CT-guidance (Toshiba MEC Aquilion ONE®) through the superior buccal sulcus by an ascending approach. The trocar was positioned exactly between the tooth apices to provide cranial support (Fig. ).
The extraoral end of the trocar was then gently tilted upward to push the crown downward. Finally, after marking the parotid duct papilla and infiltrating the mucosa using adrenaline and epinephrine 1%, an incision was performed through the posterior superior buccal sulcus.
The crown was identified and easy retrieval using a Kelly forceps was achieved (Fig. ). The right lower molar was extracted simultaneously. The surgical approach was closed using 3/0 polyglactin absorbable sutures, and postoperation, amoxicillin–clavulanate (1000 mg × 3/day) was administered orally for 3 weeks.
The CT-guided insertion of the trocar in the appropriate position took a total of 19 min. The surgical retrieval took 3 min. The total dose-length Product was 284.00 mGy.cm. The patient did not feature any significant edema, pain, or mouth opening limitation after 6 h and was discharged, therefore achieving outpatient care. The patient had no edema and was very satisfied with her surgical management. Postoperative follow-up at 3 weeks and 1 year did not retrieve any complication. |
pmc-6631552-1 | A 75-year-old Japanese woman with dementia and disuse syndrome presented with black vomiting. Her physical examination demonstrated a right inguinal bulge and sharp pain. Computed tomography revealed a right strangulated femoral hernia with no intestinal ischemia (Fig. ). She had ileus complicated by incarcerated femoral hernia, which we repositioned. However, we performed the operation with consideration of the possibility of intestinal ischemia because the onset was 5 days previously. Laparoscopic intraperitoneal observation was initially done to check for intestinal nonischemia.
During the laparoscopic surgery, the patient was placed in supine position under general anesthesia. A 2-cm transverse skin incision was made in the umbilicus, followed by an incision in the peritoneum from the fascia defect to the abdominal cavity. A 10-mm trocar attached to an access port was inserted, and carbon dioxide was insufflated at 8 mmHg. We diagnosed a right femoral hernia and confirmed that the intestinal tract was not ischemic (Fig. a, b). However, the intestinal tract was expanded because of ileus, and securing a clear field of vision was difficult. Hence, we switched to TEP at the same incision and performed iSTEP. The trocar was removed, and the peritoneum was closed after a catheter was inserted to degas the cavity. The peritoneum was closed and ligated with 3-0 Vicryl (Ethicon, Somerville, NJ, USA). The rectus abdominis was split, and the posterior sheath was exposed. A multichannel access port (GelPOINT MINI; Applied Medical, Rancho Santa Margarita, CA, USA) was installed in the preperitoneal space, and carbon dioxide was insufflated at 8 mmHg. The preperitoneal space was dissected using a bipolar forceps by pulling toward the Retzius cavity, and the peritoneal edge was checked. The hernia sac was observed at the femoral rings, confirming the diagnosis of femoral hernia (Fig. a, b). The peritoneal edge was grasped and dissected toward the dorsal and lateral sides to secure a space for the mesh. We also found a part of the hernia sac at the obturator foramen and secured a space for mesh equally (Fig. c, d). A 10 × 15-cm TiLENE mesh (PFM Medical, Cologne, Germany) was inserted through the incision. After the mesh was positioned to cover the Hesselbach triangle, femoral rings, inguinal ring, and obturator foramen, it was fixed to the Cooper’s ligaments, interior side, and lateral sides using SECURESTRAP® (Ethicon Endosurgery, Cincinnati, OH, USA) (Fig. a, b). Observation of the abdominal cavity revealed that the repair was complete (Fig. a, b). The total procedure time was 49 minutes, and blood loss was 1 ml. After undergoing treatment of the paralytic ileus and undergoing rehabilitation, the patient was transferred to another hospital and had no recurrence or other complications. |
pmc-6631598-1 | This 80-year-old Swedish woman (Patient 5), born to non-consanguineous parents, had early-onset of unsteadiness and gait difficulties during childhood leading to gradual loss of mobility. She needed a cane at age 50, followed by walker, and became wheelchair-bound by age 60. She developed scoliosis, restrictive pulmonary dysfunction, macular degeneration and sensorineural hearing loss, requiring hearing aids. Her symptoms included numbness, paresthesia with pain and discomfort in both legs, and tongue burning, relieved with gabapentin. Despite these, she had worked part-time in an office. The patient also reported slurred speech and mild dysphagia. On exam, she exhibited leg amyotrophy, foot drop, upper limb and facial myokymia, gaze-evoked and hypermetric saccades mild appendicular dysmetria and dysarthria (Additional file 1: Video). Previously, side-changing nystagmus was documented in her medical records. There was no evidence of spasticity or other pyramidal signs, the limbs were rather flaccid especially the legs. The Montreal Cognitive Assessment score was 26/30. Brain MRI showed atrophy in frontal and parietal brain regions and in the cerebellar hemispheres (Fig. a and b). Electroneurography and quantitative sensory testing demonstrated a severe axonal and demyelinating sensorimotor polyneuropathy involving thin sensory fibers. Electromyograpy demonstrated reduction of motor units and myokymia with spontaneous regular rhythmic discharges of motor units in triplets or quadruples in facial muscles. In addition, myokymia activity was recorded in the facial muscles. The vestibular assessment demonstrated a very poor vestibular function compatible with bilateral vestibular areflexia: absence of caloric nystagmus (Fig. ) or elicitation of dizziness/vertigo upon bithermal caloric irrigation. In addition, the vHIT revealed a very poor gain for the stimulation of the posterior and lateral canals and a depressed but still consistent, response with stimulation of the anterior semicircular canals in both sides. The VOR gain measured with vHIT had an average of 0.29 (Fig. ). The cVEMP did not demonstrate reproducible responses at two different trails each side (Fig. ). After excluding FRDA, polyglutamine-related spinocerebellar ataxias, and duplication/deletion in the PMP22 gene, we proceeded with whole exome sequencing, which detected the pathogenic homozygous mutation c.2860C > T (pArg954*, R954X) in SH3TC2. This is the most common CMT4C mutation reported to date [, , ]. |
pmc-6631613-1 | Our patient was a 43-year-old Caucasian woman reported a lump in her left breast and presented to her gynecologist in 2015. Notably, she had routine screening mammograms in 2014 and earlier in 2015 that were notable for dense breast tissue but otherwise unremarkable (Fig. a). Her physical examination revealed this mass to be “cystic” in nature but of fair size, measuring approximately 3 cm. She thereafter underwent a left breast ultrasound (Fig. ) that showed three masses within the upper outer quadrant of the left breast. The 1:00 mass measured 3.7 × 2.2 × 4.0 cm; the 12:00 mass measured 3.4 × 1.8 × 2.7 cm; and the 2:00 mass measured 0.8 × 0.4 × 1.2 cm. Ultrasound-guided biopsy of all three lesions was performed. Three postbiopsy clips were present within the lesions (Fig. b).
Pathology revealed the following: (1) 1:00 spindle cell neoplasm, p63 (transformation-related protein 63), cytokeratin 5/6, and pan-keratin negative; (2) 12:00 fibroadenoma with prominent epithelial elements in uniform bland myxoid stroma; and (3) 2:00 fibroadenoma. Biopsies of the spindle cell neoplasm did not display significant cytologic atypia or mitotic activity. Differential diagnoses included mucoid hamartoma, myofibroblastoma, solitary fibrous tumor, and spindle cell lipoma. Malignant phyllodes tumor was less likely, owing to the low-grade nature of the patient’s lesions.
After a multidisciplinary evaluation, the patient underwent left breast nipple-sparing mastectomy due to multiple large lesions in that breast with immediate expander placement and eventual implant. Pathology demonstrated an 8.8-cm, white-gray, rubbery mass in the upper outer quadrant (Fig. ) consistent with a malignant phyllodes tumor showing some areas of leaflike proliferation (Fig. a) but with infiltrative borders (Fig. b) and sarcomatous stromal overgrowth with increased mitotic activity (Fig. c). The superior surgical margin was positive. Mismatch repair protein immunohistochemical staining showed intact protein expression for MLH1, MSH2, and PMS2 with partial loss of protein expression for MSH6 (Fig. ). Molecular testing for microsatellite instability (MSI) was performed and was found to be stable.
The patient then underwent left chest wall radiation therapy from late 2015 in 25 fractions, which was complicated by an admission for cellulitis. Due to positive margins and extensive disease, adjuvant chemotherapy was administered. She had three cycles of doxorubicin and ifosfamide for 2 months in early 2016, complicated by chemotherapy-induced nausea/vomiting, thrombocytopenia, and leukopenia.
Genetic counseling was initially completed to help inform surgical decisions for her newly diagnosed breast cancer. On the basis of the size of her breast tumor, unilateral mastectomy was suggested. The patient wanted information on the risk for a contralateral breast cancer in order to decide whether she should have prophylactic mastectomy of the contralateral breast. At the initial counseling session, the patient reported a very strong maternal family history of colon, uterine, ovarian, stomach, and brain cancers suggestive of Lynch syndrome (Fig. ). The patient underwent Myriad myRisk Hereditary Cancer® genetic testing in 2015. This panel was chosen on the basis of her young age of diagnosis of breast cancer and multiple family members with cancer diagnoses.
Although the patient was not found to carry a mutation in any of the genes associated with an increased risk for breast cancer, she was found to have an MSH6 pathogenic mutation associated with Lynch syndrome/HNPCC. She underwent extensive counseling regarding her diagnosis. Her family was offered cascade testing for the identified mutation. As suggested by the family history, her mother had a positive test result for the MSH6 mutation. Although her mother carries the MSH6 mutation, she was cancer-free at age 65 after having had prophylactic total abdominal hysterectomy/bilateral salpingo-oophorectomy (TAH/BSO) at age 52, and had been undergoing screening with colonoscopy and endoscopic gastroduodenoscopy (EGD) based on her family history. The patient’s two brothers and daughter were also found to carry the identified MSH6 mutation and were recommended to follow National Comprehensive Cancer Network guidelines for Lynch syndrome screening.
The patient underwent a prophylactic TAH/BSO a few months after completion of therapy in 2016, and the pathology was found to be benign. She is currently followed in a high-risk program and undergoes colonoscopy/EGD, capsule endoscopy, urine cytology, and skin examinations for screening. |
pmc-6631617-1 | A 6-year-old boy presented to an emergency room with subacute abdominal fullness and acute abdominal pain. Computed tomography (CT) showed multiple solid tumors in his pelvis, with a thickened omentum and ascites (Fig. ). Because a malignant tumor with peritoneal dissemination was suspected, he was remitted to our hospital. He underwent biopsy and was diagnosed with retroperitoneal rhabdomyosarcoma-embryonal type (positive for myogenin, myogenic differentiation 1, and desmin; and negative for α-smooth muscle actin and leukocyte common antigen). The patient was diagnosed with stage IV disease due to dissemination. However, considering that he was less than 10 years old and the histology demonstrated good prognosis, he was classified as an intermediate risk by IRS-V preoperative system. He was treated using the COG D9803 VAC protocol []. The schedule of chemotherapy, surgery, and radiotherapy is shown in Fig. . G4 hematotoxicity (leukopenia and thrombocytopenia) was observed (CTCAE version 5) after VAC, before the administration of radiotherapy, but had recovered quickly without delaying the chemo-schedule. He responded extremely well to the VAC, and after the first course of VAC, his ascites almost disappeared. By the 13th week, just before the surgery, CT showed a 2-cm residual tumor in his pelvis. He underwent tumor resection during the 14th week. However, innumerable nodules that were suspected to be peritoneal disseminated tumors were observed in the abdominopelvic region and resecting all of them was not feasible. The nodules were conspicuous in the pelvis; thus, the surgeon randomly picked three nodules for pathological diagnosis. Within the 2-cm tumor, observed via CT prior to the surgery, there was 5% residual tumor, but the tumor was resected without any marginal tumor cells. The three nodules that were suspected to be peritoneal dissemination and were resected for pathological analysis had no residual tumor cells. We concluded that the patient had achieved complete resection. However, there is a high chance of recurrence in the pelvis and abdomen. Therefore, we planned and delivered 30-Gy/20-fr whole abdominopelvic radiotherapy and a 6 Gy/4-fr sequential boost to the pelvis (Fig. ) with 10-MV photons. For radiotherapy treatment planning, Eclipse version 13.6 (Varian Medical Systems, Palo Alto, CA) was used. The patient was placed in the supine position with vacuum fixation cushions and a thermoplastic body shell to immobilize his body and suppress breathing motions. He could not follow our instruction and hold his breath, thus CT was performed without holding the breath. The clinical target volume (CTV) for whole abdominopelvic radiotherapy consisted of the peritoneal cavity, excluding the kidney and liver and CTV for sequential pelvic boost consisted of the pelvic cavity caudal to the kidney. The planning target volume (PTV) was obtained by adding 5 mm to the CTV in all directions. The planning CT was obtained without holding breath, but we evaluated the dose distribution in both the inspiration and exhalation phases and calculated the CT dose in both phases to ensure a sufficient dose distribution for both phases. We adopted the volumetric modulated arc therapy (VMAT) technique for the initial and boost IMRT treatments plan. The dose-volume histogram (DVH) was as shown in Fig. . The dose covering 95% of liver, right kidney, and left kidney were 16Gy, 12Gy, and 12Gy. The percent of the right and left kidney volume receiving at lease 20Gy were 31 and 27%, respectively. Clinac ix (Varian Medical Systems, Palo Alto, CA) was used to carry out radiotherapy. We used kilovoltage X-ray imaging system first to apply the bone-match, then achieved cone beam CT image to check if the diaphragm was included in the PTV. During and after the radiotherapy, G1 dermatitis, G2 enteritis and cystitis, and G4 hematotoxicity (leukopenia and thrombocytopenia) were observed (CTCAE version 5). Leukopenia and thrombocytopenia were observed both before and after the radiotherapy, but was extremely severe, particularly after radiotherapy; as a result, the patient required multiple platelet transfusions (Fig. ). Just after irradiation, the patient’s total bilirubin level transiently increased but eventually decreased to a normal level without any treatment. Transfusion dependence lasted for 1 month after the entire treatment was completed. However, eventually, the patient no longer required transfusion and was discharged. Considering the late adverse event, the patient experienced G1 cystitis and hepatic damage (CTCAE version 5), but did not experience kidney toxicity or radiation pneumonitis. He was in good health with no recurrence for 3 years. In terms of growth, his height increased from 121.7 to 132.4 cm, and his weight increased from 23.5 to 36.1 kg during 3 years of follow-up. The average height and weight for Japanese boys of his age are 119.6 ± 5.1 cm and 23.1 ± 4.1 kg before the treatment and 134.5 ± 5.8 cm and 31.9 ± 7 kg after 3 years; thus, his height and weight are within the 1SD for Japanese boys of the same age. The fusion of images of the pelvis to the femur before treatment and 2 years after treatment is shown in Fig. . The volume of his left iliac bone, which was within the irradiating field, increased from 66.1 to 81.1 cm3 (23% increase), whereas that of the femur, which was outside of the irradiating field, increased from 154.7 to 202.5 cm3 (31% increase). |
pmc-6631786-1 | A 40-year-old woman (gravida 4, para 4) was evaluated at our specialized center for rapidly progressive symptoms of heart failure in the first week postpartum. The patient’s medical background and first three pregnancies were unremarkable. The last pregnancy was uneventful except for a caesarian section for nuchal cord during a term spontaneous labor. She was prescribed antibiotics on day five postpartum for new onset dyspnea and dry coughing. She rapidly deteriorated with dyspnea at rest, orthopnea, and paroxysmal nocturnal dyspnea. Echocardiography showed a left ventricular ejection fraction (LVEF) of 10%, severe left ventricular dilatation with left ventricular end-systolic diameter (LVESD) of 58 mm and moderate functional mitral regurgitation. The electrocardiogram showed sinus rhythm and new onset left bundle branch block (LBBB) with a QRS width of 158 ms. Dobutamine perfusion was initiated for low cardiac output signs along with intravenous Furosemide. The coronary angiogram was normal and the Swan–Ganz catheterization showed a cardiac index of 1.71 L/min on inotropic support with normal pulmonary artery and capillary wedge pressures. The cardiac MRI showed no sign of inflammation or fibrosis. At this point, the differential diagnosis included peripartum cardiomyopathy and idiopathic dilated cardiomyopathy. However, the latter seemed less likely because of the absence of previous symptoms and the acute onset of symptoms in the early postpartum period, which is characteristic of peripartum cardiomyopathy. Valsartan 40 mg PO twice a day and Eplerenone 25 mg PO daily was initiated. Slow weaning of Dobutamine was completed after five days and small dose Metoprolol was eventually added. Despite uptitration of therapy, the patient did not improve. Bromocriptine was discussed with the patient considering some evidence to support its use but was not initiated because of the initial preference of the patient to breastfeed. However, the inherent difficulties of the long hospitalization led the patient to abandon breastfeeding []. At this point, complete pre-transplant assessment was performed. Considering the typical LBBB and enlarged QRS > 150 ms, we decided to implant CRT. An endovenous dual chamber pacemaker and defibrillator was implanted but unfortunately, due to unfavorable anatomy and ostial stenosis of the two posterolateral branches, the left ventricular pacing lead implantation failed. Considering the possible benefits and absence of significant clinical improvement, a minimally invasive thoracotomy was performed to implant a left ventricular pacing lead ().
After the intervention, the patient improved to a NYHA functional class II. Control echocardiography showed resolution of mitral regurgitation and a mild increase in LVEF of 15%. The patient was followed at our specialized heart failure outpatient clinic and the titration of the optimal medical therapy was done including Sacubitril-Valsartan up to 49–51 mg PO twice a day, Bisoprolol 10 mg PO daily, and Aldactone 25 mg PO daily. The echocardiography follow-up showed increase in LVEF to 35% and 50% after seven and thirteen months respectively (). |
pmc-6631910-1 | A 50-year-old male presented at the Dental School, University of Seville, with a chief complaint of “gingival swelling all over his mouth”. After the completion of the informed consent, the cases were studied. The swelling caused difficulties in speaking and chewing. No other complaints including pain, bleeding, or halitosis were present. The patient began 4–5 years ago and progressed slowly. His medical history was unremarkable, and he was not taking any medication. His weight and height were within normal limits. An extraoral examination revealed a natural face. The patient could close his lips; however, he was an oral breather. An intraoral examination presented signs of gingival enlargement, a bilateral fullness of the cheeks with painless swelling and palate extension to the midline (A–D). We suggested an examination of his family. His wife suffered chronic periodontitis without any gingival enlargement. He had two daughters: one ten years old and the other twelve years old. The younger daughter presented with regular aspects of the gums and the oldest daughter presented with generalized enlargement similar to her father (A–D). According to these data, a diagnosis of hereditary gingival fibromatosis was established. The treatment consisted of a rigorous oral hygiene program in addition to professional debridement and gingivectomy at both maxillary quadrants. |
pmc-6631927-1 | A 63-year-old man presented in June 2014 to the High Technology Medical Center of Tbilisi (Georgia) with right upper quadrant pain following approval by the Ethic Committee of Tbilisi State Medical University (# 44/3 04.06.2014). On further evaluation, a diagnosis of colonic cancer (sigmoid) was established, and in 2013, he underwent sigmoid bowel resection. The histopathological analysis of the specimen showed a moderately differentiated adenocarcinoma and confirmed tumour-free resection margins. He did not receive any adjuvant treatment. He remained asymptomatic until May 2014, when he developed features of pain in his right hypochondrium and fatigue. Computed tomography (CT) revealed a 10.7 cm lesion in segment 4 and two smaller lesions in segment 6 with imaging characteristic of CLM (see , a,b), and a diagnosis of TXNXM1, stage IV was made. A biopsy was performed in December 2014, which revealed moderately differentiated adenocarcinoma in the liver, and a diagnosis of liver cancer secondary to CLM was established. He received super-selective TAE using 100–300 μm and 300–500 μm diameter microspheres in December 2014 for the 4 cm lesion in segment 4 of the liver with a complete obliteration of the tumour feeder branches. The post-procedural CT scan revealed a partial technical response while the remaining tumour in the cranial segment remained vascular.
The patient refused any chemotherapy; he underwent a second session of TAE for the same lesion in March 2015. The patient tolerated the embolization procedures well, experiencing just the insignificantly revealed postembolization syndrome lasting for a few days after the procedure. CT was performed 10 weeks after the second TAE session; a complete response was documented showing a necrotic lesion in segment 4 with no evidence of arterial vascularization.
The right lobe’s two smaller masses grew from 14 and 21 mm to 18 and 29 mm, correspondingly, as documented by CT 3 months after the second TAE session, and were treated by percutaneous RFA. Due to the subcapsular location of the lesions, hydrodissection was performed through percutaneously positioned 8 Fr diameter drainage catheters, and around 3000 mL of glucose solution was injected into the peritoneal cavity to achieve 10 mm of separation between the liver surface with the abdominal wall and the diaphragm (a,b). No complications occurred during the procedure. A repeated CT scan was performed one month after RFA ablation, demonstrating the complete response to it (a,b). The segment 4 lesion appeared to be necrotic and reduced in size, but there was evidence of this mass’ revascularization from the gastrohepatic trunk, which was not seen in the previous CT scan (). A third session of TAE in November 2015 for the segment 4 lesion was performed because of this, while the prior ablated masses did not show any features suggestive of recurrence. After this, the patient received a short course of nexatinplus- and capecitabine-based chemotherapy.
The follow-up CT scan performed six months later showed multiple new satellite lesions in both lobes. The decision was made to start oxaliplatin-based chemotherapy in combination with capecitabine (Xeloda) in April 2017, and a follow-up CT did not show any changes.
Further evaluation in October 2017 showed a progression of the disease on CT; chemotherapy started with 350 mg irinotecan infusions, which the patient received until 15 March 2018. In spite of this, he did not show any improvement; liver failure developed later, and he died two years and nine months after the RFA procedure. Concurrently, we explored the impact of RFA on the adaptive immune response in the absence of the influence of any other therapeutic modality, as he refused any other form of treatment. Peripheral blood samples were obtained before and after one and three months of RFA. The immunophenotypic analysis was accomplished within 24 h of sample collections for a panel of cellular and cytokine subsets including CD39+CD4+, CD4+ T cells, IL-10, IL-17, INF-γ and TGF-β. Additionally, the neutrophil/lymphocyte ratio (NLR) and platelet/lymphocyte ratio (PLR) were calculated as parameters of systemic inflammation.
In contrast to the percentage of CD39+CD4+ cells to the total CD4+ T cells in normal subjects, which is approximately 10%, the preprocedural (RFA) value was 75.2%; however, following one month of RFA, it declined to 36.7 % but rose again after three months to 62.3% ().
Similarly, we observed elevated levels of IL-10, TGF-β, IFN-γ and IL-17, which declined one month following RFA and remained unchanged until three months (see a–c).
These changes in cytokine levels as well as the CD39+CD4+ T cells’ frequency were accompanied by a reduction of gamma-glutamyl transferase (GGT) and systemic inflammatory markers NLR and PLR, while ALT and AST increased at one month and decreased at three months after RFA ().
However, further assessments of immunomodulatory changes were not made, as the patient decided to opt for chemotherapy. |
pmc-6632496-1 | A 48-year-old Hispanic female with a past medical history of multiple bariatric surgical procedures, presented with increasing lower extremity edema secondary to worsening chronic lymphedema.
During her hospitalization she developed altered mental status in the setting of elevated serum ammonia levels, despite having no history of liver disease.
Vertical banded gastroplasty was initially performed at age 28, but it failed to produce adequate weight loss. Consequently, three years later, she underwent open surgical revision which was converted to an open RYGB with concomitant cholecystectomy. She had lost over 100 kg since the first bariatric procedure (166 kg preoperatively to 63 kg on presentation). However, she developed multiple complications, including chronic lower extremity lymphedema, small bowel obstruction requiring multiple surgical interventions, malabsorption secondary to short bowel syndrome, multiple vitamin deficiencies, wet beriberi requiring chronic thiamine replacement, osteoporosis causing a left hip fracture, and chronic low back pain.
In July 2018, she initially presented to the emergency department with increasing lower extremity edema secondary to chronic lymphedema. On arrival, her vital signs were within normal limits. Her physical exam was remarkable for bilateral lower extremity pitting edema extending to the hips and an otherwise unremarkable exam. A chest x-ray disclosed no cardiomegaly, pulmonary congestion or pleural effusion. Her last echocardiogram showed an ejection fraction of 60% with no wall motion abnormalities.
During the admission, the patient received intravenous bumetanide with significant improvement. However, she developed waxing and waning episodes of confusion, and on day 3 of her hospitalization became overtly encephalopathic. She was disoriented to person, time, and space, with bizarre affect as well as incoherent speech, unable to recognize her close relatives. On physical exam patient was lethargic and had asterixis. According to her family members, the patient had previous episodes where she would become lethargic, but never to this degree.
Laboratory results were significant for an elevated plasma ammonia level of 173 μmol/L (normal range 11 - 50 μmol/L), despite downtrending transaminases (aspartate transaminase of 32 U/L and alanine transaminase of 55 U/L). Results were also significant for macrocytic anemia (hemoglobin 10.3 g/dL and mean corpuscular volume 107/5), a low serum albumin of 2.3 g/dL, low serum protein of 4.1 g/dL, alkaline phosphatase of 122 U/L, total bilirubin of 0.5 mg/dL, and an elevated international normalized ratio (INR) of 1.65. Serum glucose and zinc levels were borderline low at 62 and 54 (normal range 56 – 134 μg/dL), respectively. The laboratory findings are further outlined in . Additionally, her plasma salicylate level, acetaminophen level, and urine toxicology were all negative. Despite a history of vitamin deficiencies, she was receiving chronic thiamine and vitamin B12 replacement at home, with normal values on admission. Noncontrast computed tomography (CT) imaging of the head disclosed no evidence of acute infarction, intracranial hemorrhage, or mass effect. The patient had no history of prior liver conditions or cirrhosis, and even though she presented elevation of transaminases and the INR, these abnormalities resolved once her condition improved. The patient had no other laboratory findings for compatible signs of cirrhosis (no thrombocytopenia or hyperbilirubinemia), neither physical stigmata suggestive of acute or chronic liver disease. Abdominal ultrasound was performed to further elucidate liver panel abnormalities and demonstrated only mild hepatic steatosis with no evidence of cirrhosis or ascites.
She was treated with supportive care and lactulose. The following day she had numerous bowel movements, and her serum ammonia level came down to 24 μmol/L. Given the fast clinical improvement and resolution of laboratory abnormalities after supportive treatment, a liver biopsy was not indicated. Once her clinical condition improved and her mental status returned to normal, the patient was discharged from the hospital. |
Subsets and Splits
Exclude ER emergencies
Retrieves 100 descriptions that do not contain the terms 'ER' or 'emergency', providing a basic filter of the dataset.