_id stringlengths 7 16 | description stringlengths 55 95.2k |
|---|---|
pmc-6219255-1 | A male patient aged 5-year-and-1-month was referred for genetic evaluation of development and speech delay, intellectual disabilities at the genetic counselling clinic in Shenzhen Maternal and Child Healthcare Hospital. The parents described that an affected brother also presented the same clinical phenotype but was not available for the clinical examination. The chromosome karyotype and chromosomal microarray analysis (CMA) in the proband were normal. The mother was pregnant again and pursued genetic counseling. The proband was subject to comprehensive neurological testing including the Gesell Developmental index. Molecular genetic tests and biochemical and neurochemical analysis were performed on the proband. The present study was approved by the hospital’s Institutional Review Board and written informed consent was obtained from their parents.
The proband was the second boy of healthy nonconsanguineous parents (pedigree in Fig. ). He was born at 39 weeks of gestation from an uneventful pregnancy and delivered by Caesarean section (weight, 3600 g; length, 50 cm; head circumference, 36 cm). He showed head control at 12 months, ability to sit by himself at 15 months, and walking with aid at 20 months. His verbal language was nearly absent and he made no visual contact. He suffered from seizures from 6 months old. He had no craniofacial dysmorphism. Gastrointestinal problems such as chronic constipation or nausea were noted in the proband. The physical examination on the proband showed 95 cm height, weight 18.2 kg and developmental and language delay. The proband also had an electroencephalogram (EEG) test, which showed sharp and slow waves in sleep during 24-h EEG monitoring. A brain stem auditory-evoked potential (BAEP) test showed mild abnormality. The proband had a Children’s Autism Rating Scale (CARS) score of 33, which indicated mildly autistic characteristics. The Gesell developmental scale test was used to evaluate the proband. Both the development age (DA) and developmental quotient (DQ) data showed extremely low grades which suggested severe development delay (adaptability, DA = 14.23mo., DQ = 23; gross motor, DA = 26.37mo., DQ = 43; fine movement DA = 15.87mo., DQ = 26; vocabulary DA = 13.07mo., DQ = 21; personal-social skill DA = 13.3mo., DQ = 22). The test results are depicted in Additional file : Figure S1A. The affected brother of the proband (II:1) was not available for the physical examination. The parental description of the clinical phenotype of the brother was mostly the same as the proband. The parents were physically healthy and indicated no significant past medical, surgical or family history.
DNA samples were provided from the index patient and other family members, which were extracted as previously described []. The present study used the TruSight One Sequencing Panel and NextSeq 500/550 Mid Output v2 kit (300 cycles) with high depth of coverage for 4813 target genes (approximately 62000 target exons) that are associated with clinically relevant phenotypes. An average sequencing depth of 136.88x was achieved and 98.25% of targeted variants were covered at least to a 10x depth, and 97.04% of targeted variants were covered at least by 20x. The total detected variants numbered 24594, which included 21,733 SNPs, 1,182 insertions and 1,679 deletions respectively. The data were analyzed on the TGex (Translational Genomics Expert) platform featuring with the VarElect scoring system []. A missense mutation, c.1181C > A (p.Thr394Lys), in the SLC6A8 gene was called with high probability as a candidate mutation.
Sanger sequencing was performed to confirm the SLC6A8 gene c.1181C > A mutation (forward primer 5’ ACGGAACTTGTCAGATTGT3’, and reverse primer 5’CAACAGCATGAAGAAGAACA3’). The father (I:1) was wildtype and the mother (I:2) was heterozygous for the c.1181C > A variation. The affected brother (II:1) and the proband (II:2) both carried the hemizygous variation of c.1181C > A. The pregnant mother had an amniocentesis at 22 weeks and Sanger sequencing targeting the SLC6A8 gene c.1181C > A was performed. The result showed a wild-type allele (II:3) and the mother gave birth to a healthy baby girl (Fig. ). In silico variant prediction analysis methods, including SIFT, PolyPhen2, PROVEAN, and Mutation Taster demonstrated this variant had probably damaging or diseasing-causing effects.
Biochemical screening was performed with blood and urine samples from the proband and his mother. The creatine/creatinine (Cr:Crn) ratio was determined by liquid chromatography-mass spectrometry with deuterated internal standards in two urine samples taken on different days. A urine creatine test of the proband showed significantly elevated levels of creatine (0.805 mg/ml, normal control 0.160 ± 0.177 mg/ml) (Additional file : Figure S1B), and the creatine/creatinine ratio was significantly elevated compared to controls. Proton magnetic resonance spectroscopy (MRS, Magnetom Skyra 3.0-T, Siemens Healthcare GmbH, Erlangen, Germany), examination using a 3.0-T system at the brain left parietal lobe, right parietal lobe and genu of corpus callosum all showed marked reduction of the brain creatine peak (Fig. left part). Brain MRI showed a thin corpus callosum in the proband (Fig. right part). The MRS and MRI examination of the mother (I:2) showed normal results (Additional file : Figure S1C). |
pmc-6219662-1 | A 55-year-old woman with no smoking history presented to a hospital with chief complaints of bilateral lymphadenopathy of her neck. She had a panic disorder, and her family history was as follows: her father had liver cancer and mother had type 2 diabetes mellitus. On physical examination, swollen lymph nodes were palpable on both sides of her neck. Neck, chest, and abdominal computed tomography (CT) examination was performed, and swelling of the bilateral supraclavicular, left accessory, mediastinal, and abdominal lymph nodes were detected (Figure ). She underwent [18F]-fluorodeoxyglucose (FDG) positron emission tomography, and high FDG uptake was detected at the same lymph nodes detected via CT examination. However, the primary site of the tumor could not be determined. Malignant lymphoma was suspected, and she was transferred to our hospital. The levels of each of the following markers were increased: serum squamous cell carcinoma (SCC) antigen, cytokeratin 19 fragments (CYFRA 21-1), carbohydrate antigen (CA) 125 (CA125), CA15-3, and soluble interleukin-2 receptor levels (36.7 ng/ml, 8.1 ng/ml, 1547 U/ml, 63.3 U/ml, and 1366 U/ml, respectively). We performed a neck lymph node biopsy, and histopathological examination showed that the tumor was a poorly differentiated adenocarcinoma. To detect the primary lesion of the tumor, she underwent upper gastrointestinal endoscopic examination, colonoscopy, and gynecologic examination; however, no primary site of the tumor was detected. Immunohistochemical staining of the left neck lymph node specimen showed CK7 and TTF-1 positivity (Figure ). The results of the immunohistochemical staining led to the presumption that the primary site of the carcinoma was the lung or thyroid. The tumor specimen was also examined as an advanced primary lung adenocarcinoma and assessed for the following tumor markers: epidermal growth factor receptor (EGFR) mutation, anaplastic lymphoma kinase (ALK) rearrangement, ROS1 rearrangement, and programmed death-ligand 1 (PD-L1) expression. PD-L1 expression was examined by immunohistochemical staining with 22C3 antibody. As a result, ROS1 rearrangement and PD-L1 positivity (tumor proportion score [TPS]: 100%) were detected.
Oral crizotinib, an ROS1 inhibitor, was administered at a dose of 250 mg twice daily. Four weeks later, the patient experienced crizotinib-related adverse events, including palsy of the whole body. Therefore, we reduced the dose of crizotinib to 250 mg once daily. Eight weeks later, all swollen lymph nodes showed marked improvement on CT examination and FDG PET (Figure ). Serum SCC antigen, CYFRA 21-1, CA125, and CA15-3 levels also decreased remarkably (1.3 ng/ml, 1.7 ng/ml, 17 U/ml, and 15.7 U/ml, respectively). To date, the patient is alive with no disease progression and has continued crizotinib for a total of 3 months.
Informed consent was signed by the patient. |
pmc-6219860-1 | A 43-year-old male presented to the emergency department with worsening abdominal pain due to ingestion of a razor blade one week ago. His past medical history was significant for schizophrenia, treated with haloperidol decanoate 250 mg per month. However, he demonstrated poor treatment adherence and received his last dose two months ago. The patient had no history of dysphagia, food impaction, or gastrointestinal surgery. He did not report any difficulty breathing. Upon evaluation, he was hemodynamically stable. His blood pressure was 126/84 mm Hg, heart rate 85 beats per minute, temperature 37.9°C, respiratory rate 16 per minute, and oxygen saturation 98% on room air. Physical and abdominal examinations were unremarkable. No blood was noticed in the rectal vault on the digital rectal examination.
A plain abdominal radiograph showed a razor blade overlying the L2 vertebral body in the duodenal location, measuring approximately 45 x 22 mm with no evidence of bowel obstruction or pneumoperitoneum (Figure ).
However, the precise location of the foreign body in the gastrointestinal tract could not be determined. Therein, a computed tomography (CT) scan of the abdomen identified the razor blade within the lumen of the stomach (Figure ).
Subsequently, urgent esophagogastroduodenoscopy (GIF-H190-2413376; Olympus, Center Valley, PA) was performed, which showed the sharp-edged razor blade in the body of the stomach (Figure ).
It was easily grasped but was larger (height: 22.0 mm) than the internal diameter (16.7 mm) of the tapered end of the 50-cm long Guardus® overtube (BX00711148; US Endoscopy, Mentor, Ohio). Endoscopy showed minor linear laceration in the cervical esophagus; however, there was no evidence of mucosal injury in the stomach.
After a consensus of the expert endoscopists, it was decided to modify the overtube. Two small incisions were made at the tapered end followed by flattening the tip of both the outer and inner tubes. This modification resulted in a wider oval shape at the distal end to accommodate the ingested razor blade (Figure ).
The modified overtube system was then backloaded over the endoscope. The razor blade was grasped with a rat-tooth grasper, and it was brought into the distal flattened portion of the overtube (Figure ).
This maneuver resulted in the successful removal of the razor blade (Figure ).
Re-endoscopy showed no evidence of perforation or injury. Retroflexion was performed in the stomach and the endoscope was withdrawn from the patient. He was transferred back to the surgical intensive care unit. The post-procedure clinical course was uneventful and the patient was transferred to the psychiatric inpatient unit after 24 hours.
The patient showed significant improvement in psychotic symptoms after reinitiation of haloperidol treatment for the schizophrenia relapse. There was no auditory hallucination after treatment and he no longer experienced the urge to ingest objects following commanding auditory hallucination. His speech was coherent and relevant and he was able to hold meaningful conversation. The patient was able to maintain good personal hygiene. He was discharged from the hospital when remission was achieved. In order to avoid potential treatment nonadherence, attempts were made to mobilize family support. Psychoeducation was carried out to help his family understand the need for treatment compliance. At the follow-up psychiatric evaluations, the patient remained in remission for several months now. His level of functioning was also noticeably improved. With improvement of social interactions, social functioning was restored. |
pmc-6219861-1 | A 75-year-old diabetic and hypertensive male with a complex past medical history—status post-coronary artery bypass surgery for coronary artery disease, ongoing long-term Coumadin therapy, and an automated, implantable cardioverter-defibrillator in place for chronic atrial fibrillation and low ejection fraction—presented with the classical signs and symptoms of appendicitis. The diagnosis was confirmed by a computed tomography (CT) scan of the abdomen. The patient was scheduled for a laparoscopic appendectomy and was admitted to the intensive care unit (ICU) because of hypotension secondary to septic shock. Laboratory results were significant for a white blood cell count of 20 k/µL, a serum creatinine level of 2.3 mg/dL, a blood urea nitrogen level of 50 mg/dL, and an international normalization ratio of 4.3. A right internal jugular vein central line was placed in a single attempt using ultrasound guidance for fluid resuscitation and vasopressor support. After adequate resuscitation, the patient was taken to an operating room and general anesthesia was induced. Prior to incision, a radiologist called into the operating room to report the presence of a right-sided pneumothorax (Figure ). For safety, since the patient was on mechanical ventilation, a right-sided pigtail catheter was placed despite the absence of hemodynamic instability and a post-procedure x-ray was taken. Subsequently, the appendectomy was performed uneventfully. The patient was extubated and taken back to the ICU. Half an hour after extubation, the patient had several episodes of hemoptysis and oxygen saturation decreased to 70%, with complaints of shortness of breath and a muffled voice. The patient was emergently re-intubated, during which a cardiopulmonary arrest ensued. Cardiopulmonary resuscitation was performed according to advanced cardiac life support guidelines with a return of spontaneous circulation after 15 minutes. For the next hour, the patient was intubated and vital signs were recorded every 15 minutes and were reported as stable. After that, he was spontaneously opening his eyes, following commands, and was also able to move his legs and squeeze his right hand. A bronchoscopy was performed and showed the sloughing of the bronchial mucosa, causing a large amount of tissue obstructing the right main-stem bronchus and, to a lesser extent, the main carina and the endotracheal tube. The X-ray that led to the discovery of the pneumothorax was reviewed again with the radiology department. Upon review, the radiologist determined that a skin fold was misdiagnosed as a pneumothorax. A CT scan was performed, and it showed the catheter in the lung parenchyma coursing from the third right intercostal space through the right upper lobe and terminating adjacent to the minor fissure. An intra-parenchymal hemorrhage/consolidation along its course was also seen (Figure , Figures -). |
pmc-6219863-1 | A 68-year-old male with a past medical history of a neuroendocrine tumor (NET) of the left femur presented with progressive dyspnea, orthopnea, and lower extremity edema. Three years ago, the patient was found to have a mass on the left femur. Biopsy revealed poorly differentiated neuroendocrine carcinoma of unknown primary. He had undergone surgical resection of the left femoral tumor and above-knee amputation with adjuvant chemotherapy (cisplatin and etoposide) and radiation therapy. Routine surveillance imaging showed no evidence of malignancy. Chest computed tomographic (CT) and magnetic resonance imaging of the abdomen/pelvis with contrast were performed at three-month intervals for the first year followed by six-month intervals. The patient was in clinical remission for the last two years.
On physical exam, his blood pressure was 119/76 mmHg, heart rate was 104 beats per minute, respiratory rate was 22 breaths per minute, and jugular venous pressure was elevated. Grade III/VI systolic ejection murmur was present at the left sternal border and rales at the lung bases. Chest X-ray revealed cardiomegaly and bilateral pleural effusions. A transthoracic echocardiogram revealed a large mass measuring 8.10 X 6.54 cm within the right ventricle causing right ventricular outflow obstruction, and the left ventricular ejection fraction was 60-65% (Figure ). Cardiac magnetic resonance imaging confirmed the mass extending from the right ventricular free wall with compression of the left ventricle and dilated right atrium (Figure ). A positron emission tomographic/computed tomographic scan showed increased standardized uptake value activity of 9.3 in the right ventricular mass (Figure ). Cardiac biopsy of the right ventricular mass was consistent with metastatic neuroendocrine tumor (Figure ). The tumor cells were negative for synaptophysin and chromogranin A but positive for CDX2, a marker for neuroendocrine tumor of unknown primary []. In view of the tumor that caused impairment in the right ventricular filling and congestive heart failure (CHF), the patient received chemotherapy (doxorubicin and cyclophosphamide) with improvement in the right ventricular failure. |
pmc-6219867-1 | A 37-year-old male patient presented to the emergency department with a puncture wound to the left hand that he had sustained while working with machinery. His medical history was negative for any cancer or chronic musculoskeletal complaints such as joint pain, weakness, or limited range of motion. Physical exam revealed no weakness, loss of range of motion, or numbness of the affected digits. A radiograph of the left hand demonstrated no fracture, dislocation, or foreign body. However, multiple small non-aggressive appearing periarticular sclerotic foci were visualized incidentally (Figure ).
Further review of the patient’s prior imaging studies revealed that similar appearing periarticular sclerotic foci were present in other areas as well, including the left knee (right not imaged), bilateral shoulders, hips and sacroiliac joints (Figures -). The radiographic findings coupled with the patient’s medical history are compatible with the diagnosis of osteopoikilosis. |
pmc-6219868-1 | A 37-year-old woman with a history significant for HIV/acquired immunodeficiency syndrome (AIDS) (treated via anti-retroviral therapy), and epilepsy (treated via anti-epileptic meeldications) presented with abdominal pain ongoing for three months associated with nausea and vomiting. The pain was diffuse, radiating to her back, and it limited her oral intake. She reported night sweats and chills but did not recall exposure to any people with signs of illness. Clinical laboratory tests were performed, and abdominal computed tomography (CT) scan was ordered.
Her most recent CD4 count was 37 cells/mm3 (reference range: 500–1,500 cells/mm3). The CT scan of her abdomen and pelvis showed diffuse irregular small bowel wall thickening and submucosal edema along with retroperitoneal and diffuse mesenteric lymphadenopathy. Based on her history and the radiology findings, the patient received an endoscopy. The endoscopy revealed lymphoid nodules in the gastric body.
Also, we noted multiple hard, friable nodules ranging in size from 5 mm to 2 cm starting at the second portion of the duodenum and extending into the visualized jejunum (Figures -); multiple biopsies were obtained.
The biopsy from the colon revealed colonic mucosa with mild stromal edema and focal lymphoid aggregate. The terminal ileum biopsy revealed small intestinal mucosa with preserved villous architecture. The small intestine, jejunum biopsy was significant for high-grade B-cell lymphoma showing small intestinal mucosa with submucosal large malignant lymphocytes with a moderately abundant cytoplasm (Figure ).
Immunohistochemistry results showed that cells were positive for CD20 (Figure ) and CD3.
The Ki-67 stain was positive showing large atypical cells (Figure ).
Stomach, antrum, and body biopsies showed negative immunostain for Helicobacter pylori and some evidence of mild chronic inflammation. A bone marrow biopsy, clot, and aspirate showed small lymphoid aggregate and hemosiderosis with no evidence of lymphoma.
In the context of the patient’s AIDS, our differential diagnoses were medication-induced pancreatitis, chronic pancreatitis, cholecystitis, and peptic ulcer disease. Regarding endobronchial findings, the differential would consist of familial adenomatous polyposis and its variants such as Turcot’s and Gardner syndromes, as well as mucosa-associated lymphoid tissue (MALT) lymphoma. The patient was started on chemotherapy with dose-adjusted rituximab with etoposide, prednisone, vincristine, cyclophosphamide, and doxorubicin (DaRR-EPOCH).
The patient was readmitted to our facility with recurrent seizures. Records from the outside hospital indicated she was recently diagnosed with toxoplasmosis after a magnetic resonance imaging (MRI) scan showed multiple new irregular predominantly peripheral enhancing lesions. She was receiving treatment. However, her care team recommended she undergo further testing which she refused. She signed out against medical advice. |
pmc-6220088-1 | On January 4th, 2018, a 57-year-old woman was hospitalized in the department of Psychiatry, Sir Run Run Shaw Hospital because of pain and acid bilge in multiple sites of her upper body for more than 1 year. Over a year ago, the patient started feeling pain and discomfort in the upper left abdomen, and the pain got worse when coughing but with no other discomfort. Two months later, the upper left abdomen pain and acid bilge extended to the front chest, back, abdomen, and upper limbs. The symptoms persisted for months, and aggravated when changing body posture. Test results including cervical MRI, chest CT, abdominal B ultrasound of upper abdomen in a local hospital showed no abnormalities. Treated with Chinese medicine for more than 3 months, there was no significant improvement. About 6 months ago, the patient came to our hospital, expressing the symptoms above and worries about them, with weight loss of about 1–1.5 kg, but denying continuous depression, anxiety, and other symptoms (the score of 24 items of Hamilton Rating Scale for Depression was 12, and Hamilton Anxiety Rating Scale score was 11), and was diagnosed as “somatic symptom disorder.” After 4 months of treatment with 60 mg of duloxetine enteric-coated capsules twice daily and hypnotic drugs, the symptoms were obviously alleviated but not completely relieved and there was a significant weight loss of about 5 kg. Therefore, medication was adjusted to escitalopram tablets 20 mg once daily. Two months later, the patient felt no further improvement.
With hypertension history of more than 10 years, the patient claimed that it's not necessary for her to take any antihypertensive drugs to control blood pressure in recent 1 year. She had bronchitis for 12 years but no medicine was needed. She denied any history of diabetes, heart disease and other diseases and claimed there was no history of surgery and trauma. Also, the patient denied long-term chemical substances, drug or poison exposure history and had no history of smoking and drinking alcohol.
After admission, due to long-term poor efficacy of the patient, we re-evaluated the patient's physical condition to rule out organic diseases. However, through Blood routine, Blood Biochemistry, Stool Routine, Urine Routine, Chest Film, Electrocardiogram, and so on, no specific abnormality was found. We found that the patient's tumor marker CA-153 was 61.2 U/mL (< 25.00 U/mL) and ferritin was 198.70 ug/L (13.00–150.00 ug/L), with no specificity. There was another finding of patient suffering from cholecystitis and gallstones through abdominal ultrasound examination; however, the surgeon suggested that it could not explain the patient's symptoms. When perfecting cranial MRI, we unexpectedly discovered below result: diffuse thickening of the skull and increasing signal intensity. Metastasis? Multiple myeloma? (Figure ).
And lumbar MRI prompted lumbar vertebra, attachment and right iliac bone multiple bone changes, multiple myeloma? Transfer? (Figure ). Skull and pelvis plain radiographs prompted skull, maxillofacial bone, pelvis, and femoral bone changes, multiple myeloma? Transfer? (Figure ).
After perfecting corresponding blood examination, the patient eventually underwent bone marrow aspiration and the results suggested that the patient was suffered from multiple myeloma (Figure ). The patient was finally referred to the hematology department and received appropriate treatment.
Here we report on a case of a 57-year-old woman with pain and discomfort in multiple sites of upper body who was diagnosed as somatic symptom disorder after completing a partial examinations of relevant parts which turned out to be negative. Finished imageological examinations of all painful parts, she was eventually diagnosed with multiple myeloma after 6-month being misdiagnosed as somatic symptom disorder. This case highlights the importance of completing imageological examinations of all the painful parts of the patient to exclude the possibility of multiple myeloma especially when symptoms are associated with objective signs and treatment has been ineffective; and it is as well as significant to notice characteristics of symptoms and to pay excessive attention directed toward the symptoms in the diagnosis of somatic symptom disorder.
MM is a disease which is characterized by the neoplastic proliferation of immunoglobulin-producing plasma cells. Most patients with MM present with signs or symptoms related to the infiltration of plasma cells into the bone or other organs or to kidney damage from excess light chains. MM accounts for ~1–2% of all cancers and slightly more than 17% of hematologic malignancies (). Worldwide, there are ~154,000 cases and 101,000 deaths per year attributed to MM (). MM is also slightly more frequent in men than in women (~1.4:1). The risk of developing MM increases with body mass index (, ). MM is a disease of older adults. The median age at diagnosis is 66 years; only 10 and 2% of patients are younger than 50 and 40 years, respectively (, ).
Most patients with MM present with signs or symptoms related to the infiltration of plasma cells into the bone or other organs or to kidney damage from excess light chains. As an example, a retrospective analysis of 1,027 sequential patients diagnosed with MM at a single institution found the following symptoms and signs at presentation: Anemia-73%, Bone pain-58%, Elevated creatinine-48%, Fatigue/generalized weakness-32%, Hypercalcemia-28%, Weight loss-24%, one-half of whom had lost ≥9 kg ().
In American Psychiatric Association's Diagnostic and Statistical Manual, Fifth Edition (DSM-5) (), SSD is characterized by one or more somatic symptoms that are accompanied by excessive thoughts, feelings, and/or behaviors related to the somatic symptoms. It is estimated the prevalence in the general population is 4% (, ) and that among primary care patients is 17% (, ). An analysis of individual patient data from nine community studies (total n > 28,000) found that the most frequent burdensome symptom was pain (). SSD is not defined by the number of distressful physical symptoms that are present; however, patients who complain about multiple symptoms are more likely to have the disorder. In this case, the patient had a number of pains and acid bilge in multiple locations which are typically present in somatic symptom disorder, with no other symptoms of MM, for instance, anemia, elevated creatinine, fatigue/generalized weakness, hypercalcemia. These enhance the possibilities of misdiagnosing MM as SSD. The percentage of underlying somatic diseases in patients previously diagnosed with SSD is relatively small but unneglectable. A meta-analysis () reviewed six diagnostic evaluation studies (total N = 1,804 patients), 16 follow-up studies (total N = 2,440 patients), and the percentage of misdiagnosis with SSD was 8.8% (95% CI 1.0–22.2, p = 0.007) in diagnostic evaluation studies, 0.5% (95% CI 0.01–1.5, p = 0.03) in follow-up studies, while the correct diagnosis shall be diabetes mellitus, duodenal ulcer, Crohn's disease, polymyalgia rheumatica, carcinoma, herniated disc, and so on.
Imaging is a key part of the evaluation of all patients with suspected MM. In this case, we found some related negative imaging test results like cervical MRI, chest CT, abdominal B ultrasound of upper abdomen from another hospital, however, neglected to do examinations of other important parts where the patient reported discomfort, such a lumbar and pelvis imageological examinations. Pain and acid bilge in multiple sites are usually associated with musculoskeletal and nervous system disease, and MRI is the best imaging choice for the early stage of these diseases. In the diagnosis procedure of SSD, thorough physical examination, laboratory tests and imageological examinations are necessary to help clinicians and patients build confidence and ensure that no important diagnosis will be missed (–). Moreover, criteria for selective use of tests include objective signs rather than the volume of the concerns expressed by the patient, the presence of complex symptoms, and persistence of symptoms (). For instance, in our case, the pain of the patient aggravates when the body posture is changed or coughing. This characteristic probably points to a physical disease which is ignored during the early processes of out-patient treatment.
SSD patients always have excessive thoughts, feelings, or behaviors associated with the somatic symptoms. The patient was also anxious because of her symptoms which now we can consider it as healthy anxiety. Clinicians taking a history should determine whether somatic symptoms trigger healthy anxiety or not, in addition, determine whether the patient manifests persistent thoughts and anxiety related to the somatic symptoms, and whether the patient devotes excessive time and energy to the somatic symptoms (–). In International Classification of Disease-10 (ICD-10) () which is currently widely used in the world, somatoform disorders are defined on the basis of failure to find physical causes rather than the presence of definite psychological and behavioral features. The notion of taking medically unexplained symptoms as the defining feature of ICD-10 somatoform disorders creates a major hindrance to the clinical utility of the diagnosis. There is evidence that the decision about whether symptoms are medically unexplained is unreliable and lacks validity. The inherent dualism in the notion of a lack of medical explanation for somatic symptoms that are cross-sectionally assessed is simplistic and ultimately unhelpful to patent care (). In ICD-11 (), excessive attention directed toward the symptoms is highlighted in the diagnosis of Bodily distress disorder.
There is evidence that antidepressants are effective for SSD (, ). However, SNRIs could relieve pain by inhibiting reuptake of serotonin and norepinephrine, and suppressing painful sensation uploading regardless of physical disease or psychiatric disorders. Therefore, pain of the patient was obviously alleviated after 4 months of treatment with 60 mg of duloxetine enteric-coated capsules twice daily. This phenomenon also could perplex the revision of the diagnosis.
This case indicates that imageological examinations of all the painful parts of the patient should be completed to exclude the possibility of MM, especially of those whose symptoms are associated with objective signs and treatment has been ineffective. Furthermore, diagnosis of SSD requires not only the elimination of somatic diseases, but also excessive thoughts, feelings, or behaviors associated with the somatic symptoms. |
pmc-6220311-1 | The index case, a 5-year-old male, was born to non-consanguineous healthy Chinese parents. Three previous pregnancies had resulted in miscarriages in the first and second trimesters without obvious cause, but this pregnancy had been uneventful, though delivery was complicated by a clavicular fracture. He had a good birthweight of 4.1kg and did not require resuscitation with Apgars recorded as 91 and 105. He showed signs of severe hypotonia from birth with subsequent neurodevelopmental delay, achieving independent sitting at 12 months, but never being able to stand or walk. Language skills were also severely delayed in that he was unable to understand even simple instructions and made no attempt to speak or supplement communication with non-verbal behaviour. He was reliant on parents for all activities of daily living. Obstructive sleep apnoea was confirmed by polysomnography at the age of 3 years, and he had a tonsillectomy prior to commencing non-invasive nocturnal ventilation. On examination at 4 years, he was noted to be obese (32 kg) and exhibited generalised weakness, hypotonia and areflexia in his lower limbs. Iron deficiency anaemia was identified though the cause was unclear. Brain MRI revealed dysgenesis of the corpus callosum but was otherwise normal (Fig ). Electrophysiological testing showed normal motor nerve velocities, but low amplitude CMAPs and a neurogenic pattern on electromyography. At 5 years, he presented with a brief febrile illness associated with a mild metabolic acidosis (venous lactate 2.48 mmol/l, normal range 0.7–2.1 mmol/l) and leucocytosis. Further metabolic workup revealed increased serum alanine (520 μmol/l; normal range < 416), but ammonia, CDG and biotinidase activity were normal, as was PDHc activity in patient fibroblasts. Acylcarnitines and urinary organic acids were not determined. His condition deteriorated rapidly with generalised seizures and encephalopathy prior to a cardiorespiratory arrest from which he could not be resuscitated. An older female sibling, also considered to have neurodevelopmental delay, died in China aged 12 months. This death was also preceded by a febrile illness, but the cause remains unclear. A younger male sibling was born following pre-natal testing for the genetic mutation identified in the index case (Fig A). |
pmc-6220395-1 | A 74-year-old woman presented to the emergency department with sudden onset (24 hours) of painful neck swelling and concurrent dysphonia and solid dysphagia. She denied neck trauma. On physical examination, there was a tough and painful mass and ecchymosis in the thyroid bed. Nasofiberoscopy showed bulging of the left lateral pharyngeal wall leading to right displacement of the endolarynx. Left ventricular fold and ventricle exhibited a violaceous coloration. Computed tomography revealed a nonenhancing collection in the left parapharyngeal space (). Magnetic resonance imaging confirmed the presence of a parapharyngeal haematoma with probable origin in a parathyroid adenoma (). Analytically, there was parathyroid hormone elevation (242.9 pg/mL, with normal values ranging from 10 to 60 pg/mL). The patient began intravenous methylprednisolone (1 mg/kg/day). After one week, there was complete symptom resolution and fiberoscopy showed neither pharyngeal bulging nor endolaryngeal displacement (). |
pmc-6220396-1 | A 15-month-old male presented to the Emergency Department (ED) with sudden onset of right arm and leg weakness beginning 3 hours prior to admission. His clinical history included a viral illness 5 days prior to admission, with malaise, fever, vomiting, and diarrhea. Early in the course of that illness he was seen by a pediatrician who noted mild dehydration, and suggested oral rehydration and antipyretics. He was otherwise healthy, with up-to-date immunizations.
On arrival to the ED physical exam revealed flaccidity in right upper and lower extremities. X-rays of right upper extremity obtained to rule out trauma were negative. Lab results showed microcytic anemia with hemoglobin of 6 g/dL, and thrombocytosis, with a platelet count of 512,000. The remaining labs were normal. Computed tomography (CT) of the head without contrast showed hypodensity of the left thalamus (). In addition, high attenuation was noted throughout the bilateral deep venous system, compatible with acute DCVT ().
Anticoagulation therapy and IV hydration were initiated immediately after radiologic findings were discussed with the ED physician. The patient was transferred to the Intensive Care Unit of our tertiary pediatric hospital. Magnetic resonance imaging (MRI) of the brain demonstrated restricted diffusion in the central aspect of the thalamus, surrounded by vasogenic edema, compatible with acute venous infarction (). No other parenchymal lesion was detected. Signal changes within the deep venous system were compatible with acute intraluminal thrombus (). MR venography confirmed lack of flow-related signal throughout the deep venous system ().
The patient had a follow-up MR venography done two days later before discharge but was found to have no significant interval change with relatively stable venous infarct in the left thalamus and posterior limb of the internal capsule. No other follow-up imaging was done since. His symptoms resolved completely after six months of physical and speech therapy without residual symptoms. He is now being followed closely by pediatric neurology and hematology physicians. |
pmc-6220397-1 | A 60-year-old woman underwent transurethral resection of bladder tumor (TURBT) at our institute in 2004; her pathological diagnosis was a high-grade UC with adenocarcinomatous differentiation (pT2a, G2>G3). Radical cystectomy was conducted. Only carcinoma in situ (CIS) was found in the surgical specimen, and the surgical margin was negative. There was no cancer cell infiltration in the resected uterus or anterior wall of the vagina, and no lymph node involvement was detected. The patient developed continuous pain and bleeding from the residual vagina in 2010, and a tumor was found in the residual vagina; magnetic resonance imaging (MRI) showed it to be located on the anterior wall (). A biopsy of the tumor revealed a pathological diagnosis of adenocarcinoma (). Computed tomography (CT) and bone scintigraphy revealed no metastasis. Based on a preoperative diagnosis of a primary adenocarcinoma occurring on the residual vagina, tumor resection was performed (). The sigmoid colon was partially resected as it was strongly adherent to the tumor. On pathological examination, adenocarcinoma and SCC were detected (); on immunohistochemistry, sections of the tumor were positive for the SCC markers CD56, chromogranin A, and synaptophysin and were negative for the urothelial carcinoma markers GATA-3, p63, uroplakin, thrombomodulin, and 34βE12. We then reexamined the original TURBT specimen and confirmed the presence of SCC (). Adenocarcinoma and SCC were mostly present in the superficial layer of the TURBT specimen, while high-grade UC was found in the deeper layers where muscle invasion was present. Based on these findings, the tumor was diagnosed as a recurring bladder tumor. Local recurrence and pelvic bone metastasis were detected via MRI 3 months after the patient underwent surgical resection of the vaginal recurrence, whereupon she underwent radiation therapy (52 Gy, 26 fractions). She developed ileus in January 2011 and underwent release surgery. Subsequently, multiple lung metastases and local recurrence in the pelvis developed in June, and she died of disease progression the following month. |
pmc-6220398-1 | An informed verbal consent was obtained from the parents.
A 1-month-old male neonate with a known antenatal ultrasound (US) diagnosis of fused horseshoe kidneys and bilateral renal hydronephrosis presented in the outpatient clinic with a history of skin jaundice since he was 1 week old. His mother reported a history of passing dark urine and pales tools. The mother also noticed that he was passing a smaller amount of urine and his abdomen was distended. Antenatally, the mother was free from any medical complications during pregnancy; the neonate was delivered by spontaneous vaginal delivery, with a birth weight of 3 Kg
Urinary ultrasound after delivery revealed fused horseshoe kidneys and mild left hydronephrosis. Micturition cystourethrogram (MCUG) was performed, which showed no evidence of posterior urethral valve or vesicoureteral reflux. There was positive consanguinity but no family history of a similar condition or liver disease. He was transferred to the pediatric medical ward for further investigations and management.
Examination upon admission revealed that he had deep jaundice but was not pale. The anterior fontanelle was normally opened, with no dysmorphic features. His vitals were as follows: HR, 104 b/min; RR, 44 cycle/min; blood pressure, 95/50 mmHg; temperature, 36.5 C; and capillary blood glucose 58 mg/dl with oxygen saturation 100% in room air. His weight was 3 kg, height 52 cm, and head circumference 35 cm. He looks dehydrated with dry mucous membrane. His abdomen was slightly distended and the liver was palpable 2 cm below the costal margin. Other systemic reviews were unremarkable.
Investigation showed elevated white blood cell count 21,000 cell/cumm with 55% polymorphs and 35% lymphocytes, hemoglobin 9.5 g/dl reticulocyte was 3.32%, LDH 180 units/L, platelets 356/cumm, C-reactive protein 50 mg/l, serum total bilirubin 17.78 mg/dl, direct serum bilirubin 15.16 mg/dl, indirect serum bilirubin mg/dL 2.62, serum aspartate transferase 172 IU/L, serum alanine transaminase 162 IU/L, serum gamma-glutamyl transferase (GGTP) 252 IU/L, total serum proteins 5.2 g/dl, serum albumin 2.6 g/dl, and serum sodium 123 mmol/L and serum creatinine was within normal 0.4 mg/dl. Urine analysis showed presence of nitrate and leukocyte esterase 500 with WBC 65/hpf. Urine culture showed Enterobacter cloacae. Blood culture revealed no growth. TSH was 1.99 mIU/mL. TORCH titers revealed high IgG levels of rubella and cytomegalovirus.
Abdominal US revealed a contracted gallbladder and right ectopic fused kidneys. There was mild hydronephrosis in the left kidney and no hydronephrosis in the right kidney. Both kidneys showed normal corticomedullary differentiation. The urinary bladder showed a thick wall with a turbid content, consistent with cystitis.
Abdominal plain radiography revealed a paucity of the bowel gas in the right side. There was no abnormal bowel loop dilatation. Air within the rectum was noted, without pneumoperitoneum or abnormal calcification.
The patient was started on IV fluid on admission. Then normal saline 3% was started with maintenance D5 NSS to correct his depletional hyponatremia and IV antibiotic for 14 days based on the sensitivity pattern. He also received packed red blood cell transfusion for 3 hours due to a drop in his hemoglobin to 5.8 g/dl sepsis and frequent blood sampling. IV Vitamin K 5 g and oral ursodeoxycholic acid were administered. Repeated urine culture showed no growth and UTI resolved jaundice completely. He started passing stool freely and was discharged, with regular follow-up. |
pmc-6220400-1 | A 32-year-old female patient was referred to our urology department with intermittent vaginal leakage of urine. According to obstetric history, she underwent a first elective cesarean section in 2014, at 38 weeks of pregnancy. Three years later, despite her will to encounter a vaginal birth after cesarean section (VBAC), at 40 weeks and 3 days of her 2nd pregnancy, it was considered as problematic in association with bladder and uterine rupture, resulting in an emergency C-section. A concurrent restoration of bladder and uterus was performed. One week after her second delivery, the patient noted a watery vaginal discharge. The initial approach was conservative with a 14 French (Fr) Foley catheter draining the bladder for a 2-month period. Meanwhile, she had secondary amenorrhea due to breastfeeding; thus no menstrual bleeding and no cyclic hematuria (menouria) were reported. Her symptoms gradually ameliorated. The 2-month postoperative cystoscopy depicted 2 fistula orifices in the posterior bladder wall (). Vaginal ultrasound depicted two fistulas between uterus and bladder (2.05 and 0.42 cm in length) (). Moreover, contrast-enhanced computed tomography (CT) scan of the lower abdomen demonstrated the presence of a VUF ().
For the next five months, the main symptom was intermittent urine leakage through the vagina, followed by lower urinary tract symptoms (LUTS), due to recurrent infections treated with oral antibiotics.
The VUF was, finally, surgically repaired 7 months after the second emergency caesarean section (C-section). Despite the initial surgical planning for laparoscopic approach, careful preoperative consideration led to the open repair of the VUF. A consensus was reached based on the laborious second delivery, which resulted in a bladder and uterine rupture, as well as the risk for abdominal adhesion development from the previous cesarean sections. Entrance in the abdominal cavity was done through a Pfannenstiel incision. Once the uterus and vesicouterine space were dissected, bladder and uterus were completely detached and the VUF fistula was clearly exposed. A transvesical approach permitted an adequate exposure of the fistula tract. The margin of the fistula was elevated with forceps and excised with scissors circumferentially. The entire fistula tract was dissected. The ureteral orifices were catheterized and the open-ended straight ureteral stents were left aside prior to externalization (). The layers of the bladder wall and uterus were adequately delineated, and, after mobilization, they were drawn together with fine sutures without tension. The uterus was closed with 2-0 polyglycolic acid sutures and bladder with 3-0. A 3-way Foley catheter (20 Fr) was inserted into the bladder. Intraoperative anastomosis testing was done with irrigation of 120 ml Methylene Blue (MB) solution mixed with normal saline via the catheter. The assessment of the anastomosis integrity proved to be efficient with no leakage. Both fibrin sealant patch and omental flap were carefully interposed between uterus and bladder. Diligent hemostasis was done and the abdominal wall was closed in layers. Furthermore, drainage was placed in the vesicouterine fold to prevent blood and fluid from draining into the peritoneal cavity. The transverse abdominal incision was closed with running subcuticular suture. The ureteral stents were externalized to a drainage bag on the left (urostomy pouch). Broad-spectrum antibiotics and analgesic regimens were administered for 10 days. There was no need for intravenous opioids.
Total operative time was 150 min, with no intra- and postoperative complications. Blood loss was less than 100 ml during the first postoperative day. Length of hospital stay (LOS) reached 10 days, with cutaneous externalized ureteral catheters being removed on the 7th postoperative day. Times to oral intake and ambulation were 10 and 17 hours, respectively. The patient made an uneventful postoperative recovery and was discharged from the hospital with a recommendation for follow-up at 3, 6, and 12 months. The indwelling 3-way Foley catheter (20 Fr) left, draining the bladder, for 30 days. Retrograde cystography was given at 1 month, revealing bladder integrity without leakage (). Our patient is currently being followed up, with no signs or symptoms of recurrence six months after surgery. |
pmc-6220401-1 | A 74-year-old man presented to our tertiary care hospital's emergency department with severe pain and swelling in his right lower extremity. The patient had a skin biopsy on the right leg about 2 weeks prior to presentation for a possible skin cancer. He had no immediate complications following the biopsy, and the pathology was negative for cancer. One week after the biopsy, he went on a planned vacation with his extended family to the Bahamas. During the vacation, he went swimming in chlorinated pools at the resort and “swam with the pigs,” an adventure activity in the ocean with wild pigs. The night before his scheduled departure, he developed pain and redness at the site of his prior skin biopsy. Overnight, the pain became more severe, and he developed associated significant edema and worsening discoloration of the leg. On the morning of departure, he was unable to walk due to pain and also reported malaise and subjective fever and chills. The patient boarded a plane from the Bahamas to the US and went directly to the emergency department from the airport. On arrival, the patient had a temperature of 39.1 degrees Celsius, blood pressure of 109/55 mmHg, and his pulse was 140 bpm. His physical exam was notable for a circular wound on his right anterior shin with marked erythema, warmth, and induration surrounding, very tender to palpation (). He had significant 2+ pitting edema extending up to his knee, and the erythema extended up in streaks onto his thigh and into his right groin, with enlarged inguinal lymph nodes.
The patient's past medical history was significant for coronary artery disease with a history of coronary artery bypass graft, mitral valve replacement with a porcine valve and graft, and atrial fibrillation. He was on warfarin chronically for anticoagulation and a beta blocker. He was a former smoker but quit over 40 years ago. He reported having 1 glass of wine daily and no known liver disease.
His creatinine was 1.49 mg/dL with normal liver function tests. Lactic acid level was elevated at 2.48 mmol/L. The white blood cell count was 10.6 × 103/mcL with an absolute neutrophil count of 9.61 × 103/mcL; hemoglobin and platelets were within normal limits. INR was 2.68 and PT was 31.5 seconds. Blood cultures were tested using the BACT/ALERT® (bioMérieux, Durham, NC) blood culture instrument. The aerobic and anaerobic bottles were both positive in this patient at 24 hours. The organism was an oxidase-positive, lactose nonfermenting gram-negative rod that produced mucoid, brownish colonies on sheep blood agar.
Lower extremity venous duplex ultrasound of the right lower extremity did not reveal deep venous thromboembolism. MRI of the ankle and tibia/fibula with and without contrast was performed and revealed extensive cellulitis throughout the right lower extremity spanning the length of the knee to the ankle (). There was no evidence of myositis, abscess, or osteomyelitis. Transthoracic echocardiogram was performed given the patient's history of porcine prosthetic mitral valve. No vegetations were seen.
The patient was started empirically on cefepime, doxycycline, and vancomycin to ensure adequate coverage of suspected marine pathogens. The oxidase-positive gram-negative rod growing in the patient's blood was ultimately identified as Shewanella species using the VITEK® MS matrix-assisted laser desorption ionization time-of-flight mass spectrometer (bioMérieux, Durham, NC) using IVD Knowledge Base Version 2.0 and Myla Version 4 information management software. The species was subsequently identified as Shewanella putrifaciens on the MicroScan WalkAway plus ID/AST system (Beckman Coulter, Brea, CA) using the Neg Breakpoint Combo 44 panel. The isolate was susceptible to cefepime, ceftazidime, piperacillin-tazobactam, and levofloxacin. MIC values were interpreted using CLSI breakpoints for other non-Enterobacteriaceae.
Cefepime was continued as monotherapy. Repeat blood cultures after initiation of antibiotics were negative. The swelling, erythema, and discoloration of the patient's right lower extremity gradually improved. No surgical intervention was required. Cefepime was continued as monotherapy for a total of 2 weeks since he had prolonged QTc. |
pmc-6220402-1 | Otherwise healthy, 12-year-old boy was admitted to the ward with a history of swelling of the right and left forearms, for 1 day duration.
He gave a history of a swelling in the right forearm first noticed six weeks prior to the current presentation, and it has resolved gradually without any acute intervention. During the initial presentation, the mother claimed that he was treated with a course of amoxycilline for an upper respiratory tract infection prior to the onset of the swelling. Since then, he was well till this current admission.
During this presentation, the swelling of the right elbow joint along with the forearm swelling worsened progressively. He did not have any history of trauma or febrile illness associated with the current presentation.
He denied any bleeding tendency in the past except a history of mild extra bleeding which settled spontaneously following a dental extraction one month back. There was no history of photosensitive skin rashes, renal problems, recent weight loss, or poor appetite. He did not have any family history bleeding disorders.
On examination, he was alert, pale but not icteric or febrile. His weight : height ratio lied between 1 SD and median. He did not have lymphadenopathy, hepatosplenomegaly, or ballotable masses.
Examination of the upper limbs revealed that the range of movements was reduced due to the pain and there was diffused tense swelling of both forearms. But there were no inflammatory changes noted on the over line skin or adjacent joints of the swollen areas. Rest of his systemic examination was unremarkable.
During initial investigations, his full blood count revealed a white cell count of 8.62 × 109 with a normal differential count. His haemoglobin was 7.7 g/dl with a platelet count of 278 × 109/L.
His clotting profile showed a normal PT/INR with normal bleeding and clotting time but his APPT was significantly prolonged (patient: 109.9 seconds; control: 28 secs). His factor assay showed that factor VIII level was <5%, and factor IX level was normal.
His ESR was 25 mm/1st hour, and rest of the investigations including liver function test, 2 D echocardiography, chest X-ray, ultrasound scan of the chest and abdomen, thyroid, profile and LDH level were normal. Antinuclear and antiphospholipid antibodies were negative.
Blood picture was interpreted as iron deficiency anaemia with evidence of active bleeding. Ultrasound of the upper limbs showed that there is a possibility of bleeding into the left forearm muscle with small collection of fluid in the right elbow joint.
As there was prolonged APTT with low factor VII levels and the forearm swelling was progressive, it was decided to treat this patient as haemphilia A, and factor VIII concentration was commenced to achieve a correction of 50%. In spite of commencing the factor correction regime, it was noted that swelling was progressive with significant pain. His haemoglobin dropped significantly indicating active bleeding. Hence, an inhibitor screening was performed (Bethesda assay), and it was 33.6 BU, which is a very significant inhibitor titer. A diagnosis of acquired haemophilia A due to inhibitors was made.
With this high inhibitor titer, it was decided to manage him with the Factor Eight Inhibitor Bypassing Activity (FEIBA) (aPCC-activated prothrombin complex concentrate) 75 U/kg every 12 hours, but his response was unsatisfactory. As a result, he was commenced on recombinant activated factor VII (rFVIIa) 90 micro gram/kg with a marginally satisfactory response. Hence, in addition to this regime, the patient was commenced on prednisolone 1 mg/kg/day to eradicate the acquired antibody response and showed a promising response. He required 3 units of pack cell transfusions during this period.
Currently, he is on prednisolone 10 mg daily, and his recent APTT was 51.2 seconds with an inhibitor level of 1.98 BU. |
pmc-6220404-1 | A 74-year-old male was referred to our hospital because of hypertension, proteinuria, and hematuria. He was found to have hypertension (BP 146/92 mmHg) and his serum analysis revealed Cr:5.47 mg/dL, UA:11.6 mg/dL, K:6.1 mEq/l. Value of serum tumor markers was high in CEA (7.4 ng/ml), CYFRA (5.7 ng/ml), and proGRP (178.9 pg/ml). His past history was hypertension, and family history was unremarkable. Abdominal CT revealed a mass measured in 9.7×7.0 cm in the lower portion of the right kidney (). CT also revealed multiple small nodules in lower lobes of lungs, suspecting metastatic tumors (). Laparoscopic right nephrectomy was done for the right renal tumor. Grossly, 55x94 mm white to tan tumor occupied the lower portion of the right kidney (). Hemorrhage and necrosis were marked. Microscopically, polygonal to ovoid tumor cells with round nuclei and clear to eosinophilic cytoplasm made solid tumor (). Cell border was indistinct. Mitosis was found in 5/10 high power field (). Immunohistochemical results are shown in . CD10, MUC-1, vimentin, WT-1, SMA, caldesmon, and CD34 were positive (). Cytokeratin (AE1/AE3), cytokeratin (CAM5.2), EMA, PAX8, S-100, HMB45, c-kit, and STAT6 were negative. Renin was positive in a few tumor cells. MIB1 labeling index was 4% (). Ultrastructurally, near rhomboid crystalline structure was observed (). Pathological diagnosis was juxtaglomerular cell tumor, malignant. The patient is well 9 months after operation. His serum renin was normal (0.2 ng/ml), 2 months after operation. By follow-up CT, the sizes of multiple lung nodules were stable or diminished, negatively suggesting metastatic tumor, however, not examined histologically. Gene mutations were not found by any probes used in this study. |
pmc-6220405-1 | A 17-year-old nonobese Caucasian female who had a history of a medulloblastoma diagnosed at 7 years of age was treated with radiation therapy. She subsequently developed TSH and GnRH deficiencies. Though GHD was suspected based on height (z-score of – 3.1; see ), treatment had not been initiated based on the initial management focus being to treat her medulloblastoma. At 15 years of age when her bone age showed full skeletal maturity, her parents were informed that GH therapy could not be pursued because her linear growth was complete.
On presentation, the patient's height was 141.3 cm (z= -3.1) and weight was 53 kgs (36th percentile for age). Body mass index was 25.8 kg/m−2 (86th percentile for age). Surveillance labs done at the oncology clinic showed glucosuria. Further testing showed HbA1c of 9.6% and on another day her fasting glucose was 277 mg/dL. Based on these results, diabetes mellitus was diagnosed.
When glutamic acid decarboxylase (GAD-65; Esoterix), islet-cell (Esoterix), insulin (Esoterix), and zinc transporter 8 (ARUP Laboratories) antibodies as well as DNA panel for maturity onset diabetes of youth (MODY) genes (HNF4α, GCK, IPF1, HNF1α, and HNF1β, [Athena Diagnostics]) returned all negative along with an elevated fasting C-peptide level of 3 ng/mL (normal: 0.4 - 2.1), T2DM was diagnosed. With the initiation of traditional basal/bolus insulin therapy using conventional dosing, a rapid escalation to peak total daily insulin dose of 2.9 units/kg/day (~ 155 units/day) was required to treat her refractory hyperglycemia. Treatment nonadherence was thought to be the unlikely cause of her increased insulin requirements based on the agreement between her insulin dosing and prescription refill data.
A comprehensive evaluation for conditions associated with IR was negative. However, based on Arginine/Clonidine stimulation testing showing peak GH level of 0.8 (normal: ≥ 10 ng/mL), a diagnosis of GHD was made. GH supplementation was initiated at 0.3 mgs daily and titrated based on IGF-1 levels.
After GH was started, her systolic and diastolic blood pressures (BP) which were mildly elevated between 124-136 and 77-89, respectively, became more normal. Despite this, lisinopril 5 mgs once daily was added for microalbuminuria.
With the diagnosis of T2DM and our patient having a significant family history of adverse cardiovascular risk factors, she was started on atorvastatin 10 mgs once daily. Within 2 months of therapy, her LDL cholesterol (LDL-C) decreased to 74 mg/dL. shows serial lipid profiles.
Though her diabetes was not fully reversed with GH, her HbA1c decreased to 5.9% and 5.8% at 6 and 19 months, respectively. Her insulin therapy requirement decreased to 1.9 units/kg/day (~ 100 units) at 12 months after the start of GH.
Magnetic Resonance Imaging (MRI) of the brain and abdomen indicated a small anterior pituitary gland and liver masses, respectively. Liver biopsy showed steatohepatitis with bridging fibrosis (). With GH therapy, her liver transaminases trended to normalcy (). Repeat MRI abdomen at 20 months after the start of GH showed stability of the liver lesions when compared to that done at 14 months. These hyperintense lesions like the initial ones were located in the liver's parenchyma and the appearance of the liver was otherwise normal.
With GH therapy, the patient's stamina improved. She was now able to work for 20 hours weekly without becoming fully exhausted and her Quality of Life-Assessment of Growth Hormone Deficiency in Adults (QoL-AGHDA) and Quality of Life Satisfaction (QLS) scores, both questionnaire-based, improved (). |
pmc-6220406-1 | A 60-year-old Caucasian woman was referred to endocrinology division by her ophthalmologist because of abnormal thyroid tests. Her chief complaint for the past several weeks was bilateral eye pain and photophobia. She was symptomatic for occasional palpitations and mild shortness of breath. On physical examination, her blood pressure was elevated at 152/88 mmHg with a normal heart rate at 80 bpm. She presented with bilateral exophthalmos and an enlarged thyroid gland. She was on prednisone 20 mg twice daily as per the ophthalmologist's recommendation. Laboratory tests done two weeks prior revealed a suppressed TSH at 0.009 mIU/mL (0.270-4.200), an elevated FT4 at 4.59 ng/dL (0.93-1.70), and an elevated T3 at 231 ng/dL (80.0-200.0). The TSH Receptor Autoantibodies (TRAb) and Thyroid Stimulating Immunoglobulin (TSI) were both positive at 48.5 (<16.0 %) and 458 (<140 % baseline), respectively. New tests showed FT4 and T3 at 3.06 ng/dL and 242.1 ng/dL, respectively. The alanine aminotransaminase (ALT) level was elevated at 112 U/L (0-33). The patient was started on atenolol 25 mg daily and imaging studies were ordered. The thyroid ultrasound showed a mildly enlarged gland. In the right lobe, there was a heterogeneous solid nodule measuring 11 x 11 x 7 mm without calcifications (). A thyroid uptake and scan was performed and the 24-hour iodine-131 (I-131) uptake was calculated at 54%. On scintigraphy, the gland demonstrated increased uptake of technetium-99m pertechnetate and a discrete hot nodule in the upper pole of the right lobe corresponding to the nodule detected on ultrasound (). The patient was eventually started on methimazole 5 mg twice daily. Over the following weeks, ALT levels normalized and the dose of methimazole was increased to 30 mg daily. After receiving potassium iodine 1g/mL, 2 drops three times daily for one week, she underwent total thyroidectomy followed by bilateral orbital decompression one month later. Thyroid pathology was consistent with hyperplastic tissue and the diagnosis of Graves' disease. |
pmc-6220407-1 | A 60-year-old Asian male with past medical history of glaucoma presented to the emergency department (ED) after a syncopal episode. The patient was seated at his workplace when he suddenly felt moderate epigastric pain and slumped down in his chair, after which he lost consciousness. The bystanders caught him while falling to the ground from his chair. He denied a previous episode of syncope and denied having chest pain, shortness of breath, palpitations, nausea, or vomiting. He was a nonsmoker and had occasional alcohol intake.
In ED, his blood pressure was 125/58 mmHg, heart rate 55 beats per minute, regular, he was afebrile, and saturated 100% on room air. His electrocardiogram (ECG) showed sinus bradycardia at 53 beats per minute, peaked T waves, 1 mm ST-segment elevation in leads II, III, and aVF, and 2 mm ST elevation in V3 (). With the concern for ST-segment elevated myocardial infarction (STEMI), he was given aspirin 324 mg and was taken for left heart catheterization (LHC) emergently. His LHC showed nonobstructive coronary artery disease (CAD). His laboratory workup was remarkable for lipase of 25,304 IU/l (normal level 8–78 IU/l) and white blood count 11,800/mcl. His liver function test, serum electrolyte level, and triglyceride level were unremarkable. Troponin was <0.01 ng/ml. A computed tomographic exam of the abdomen revealed acute interstitial pancreatitis with a small discrete fluid collection in the uncinate process (). The ultrasound of his abdomen ruled out biliary etiology, showing a normal appearance of the gallbladder and biliary tree, without evidence of calculus or obstruction. His echocardiogram revealed normal ejection fraction with no regional wall motion abnormality.
He was admitted to the telemetry floor and treated with aggressive intravenous fluid resuscitation. He was symptomatically better the following day and could tolerate a diet on day 3. He was discharged on day 3 with adequate follow-up. The discharging ECG is shown in . His initial syncopal episode was thought to be a vasovagal response either due to epigastric pain or intravascular volume depletion from having severe pancreatitis. |
pmc-6220415-1 | A 42-year-old man presented with swelling on the right side of the neck for two months which was insidious in onset and gradually progressive. He was asymptomatic except for a single episode of fever associated with pain in the swelling which subsided after a course of antibiotics. He was a nonsmoker and had no history of chewing tobacco, consumption of alcohol, or prior radiation exposure. On examination, there was a solitary swelling of 5 × 3 cm on the right side of the neck, below the angle of mandible which was deep to sternocleidomastoid muscle at the junction of upper and mid-third of the muscle. It was nontender, firm in consistency, and with well-defined borders and smooth surface. Skin over the swelling was normal and pinchable. It was noncompressible and nonpulsatile (). Examination of the oral cavity and other systems was normal. Contrast-enhanced computed tomography (CECT) of the neck was performed which showed a solitary, relatively well-defined predominantly cystic lesion measuring 3.8 × 3.7 × 3.9 cm with smooth margins and minimally enhancing eccentric solid areas in the right side of the neck inferomedial to parotid gland located between sternocleidomastoid muscle laterally and carotid space medially (). On magnetic resonance imaging (MRI), cystic component of the lesion showed fluid-fluid level that was hyperintense on both T1- and T2-weighted images suggesting hemorrhagic or proteinaceous component. The eccentric solid component was heterogenous and isointense on T2-weighted images (Figures and ). Fine needle aspiration cytology (FNAC) of the swelling revealed hemorrhagic fluid and inconclusive cytology; hence, excision biopsy of the swelling was performed. A transverse skin incision was placed over the swelling along the upper cervical skin crease. A well-encapsulated 4 × 3 × 3 cm cystic swelling was present in the region of level II between medial border of sternocleidomastoid and internal jugular vein. Superiorly, it extended up to mastoid process. It was excised completely without any spillage. On exploration, there were no significantly enlarged lymph nodes. Postoperative period was uneventful.
Histological examination revealed a globular solid-cystic mass of size 4.5 × 3.5 × 2.5 cm (). Cystic area measured 3.5 × 2.6 cm and was filled with blood while the solid area measured 2 × 1.1 × 0.8 cm. Microscopically, tumor was composed of ovoid to spindle-shaped cells arranged in sheets and focal storiform pattern (). Tumor was interspersed with numerous vascular spaces and hyalinized blood vessels. Perivascular cuffing of lymphocytes was present. Individual tumor cells had vesicular nucleus with diffuse fine chromatin (). Immunohistochemical analysis showed positive staining for CD23 (), CD35 (), and vimentin. Tumor cells showed weak staining for CD21 () and negative staining for pan-cytokeratin (panCK) (), leukocyte common antigen (LCA), epithelial membrane antigen (EMA), and smooth muscle actin (SMA). Ki67 index was 4–5% (). Based on the histologic findings and immunohistochemistry, a diagnosis of FDCS was made. Further staging was done with positron emission tomography-CT (PETCT) that did not show any other site of involvement. The case was discussed in multidisciplinary tumor board, and no further treatment was advised since surgical resection was complete and no adverse prognostic features were present. There is no evidence of recurrence of disease after one year of follow-up. |
pmc-6220483-1 | A 7-year-old male patient who presented at the Neurology service for a headache in his right temporal region that had evolved during one week, of intermittent nature, mild to moderate intensity, each episode between 3-4 seconds; and with subsequent, complete recovery. No history of trauma; he denies presenting fever or other systemic manifestations. There was no distal coldness, crying, or pallor, no feeling of dizziness, nausea, emesis, photophobia, phonophobia, or autonomic symptoms, no relationship with valsalva, or associated with exercise. Neither the patient nor his parents identified any triggering factors.
The patient reports four episodes of PSH in the week prior to the consultation, without interfering with his sleep hours. There is no history of other neurological symptoms, epileptic seizures or changes in personality. The interrogation did not recognize alterations in neurodevelopment, he presents a good school performance and an adequate sleep pattern. No personal background of relevance. No headaches or other related pathologies are reported in the family history.
On physical examination, he presented normal vital signs, a weight of 22 kg and 1.22 m of height. In the neurological examination, neither alterations nor skin stigmas indicative of neuro-cutaneous syndromes were identified.
The intervention was started with a one-month observation period, in which the child's caregiver was asked to prepare a headache diary that would allow characterizing and quantifying the episodes (date and time, laterality, associated activity, duration and need for medication).
The following month, he was cited for a control, where 21 episodes were quantified with the clinical characteristics described above but without a predominant laterality; no triggering or attenuating factors were identified. A simple and contrasted cerebral magnetic resonance imaging was performed, which showed no alterations of any kind. Based on the characteristics of the episodes, the clinical course and the results of the MRI, he was diagnosed with PSH, so a therapeutic test was prescribed with Coenzyme Q10, in a dose of one 100-mg tablet given orally every 12 hours as a prophylactic treatment, and the diary registry of headaches continued.
After two months of administration of Coenzyme Q10, no improvement in symptoms was identified. Due to this therapeutic failure, it was decided to suspend that medication. Two weeks later, it was initiated a new treatment with half a tablet of 1.5 mg melatonin daily (0.07 mg/kg), administered at night; with this therapy, it was achieved a reduction in the frequency of headaches during the first two weeks of treatment: only two episodes occurred during this period. Along the six months of follow-up, no new episodes or adverse effects have been documented (), and both tolerability and therapeutic adherence have been optimal, as assessed by the scale of 8-item therapeutic adherence of Morisky . |
pmc-6220512-1 | A 43-year-old man – a refugee Sudanese man – who had been living in Germany for 19 months was referred to our clinic by his rheumatologist with low back pain and the suspected diagnosis of ankylosing spondylitis. On admission our patient complained of low back pain radiating into his right hip, which started gradually during the last 4 months. He described the pain as persistent and more intense at night so that he could not sleep. Fever, weight loss, and night sweats were denied. In the clinical examination, movements of his right hip were painful. Before admission treatment with 25 mg prednisolone and diclofenac had been already initiated since spondyloarthritis was suspected. Prednisolone therapy was started 2 months before admission with an initial dose of 40 mg/day and was tapered to 25 mg/day until admission. On admission his erythrocyte sedimentation rate was normal and his C-reactive protein (CRP) was elevated (87 mg/l, normal range < 5 mg/l). The rest of routine laboratory tests were normal, except for a slight increase in gamma glutamyltransferase (gamma GT, 78 U/l; normal range < 55 U/l). The immunological tests showed a low titer of antinuclear antibodies (1:160) with no specification in the extractable nuclear antigen (ENA) screening test. The tests for rheumatoid factor and anti-citrullinated protein antibodies were negative. An HIV (human immunodeficiency virus) test was also negative. A conventional chest X-ray revealed no pathological findings. During his in-patient stay low grade fever was discovered. Conventional radiographs of his right hip, pelvis, sacroiliac joints, and his lumbar spine revealed osteosclerosis of his left sacroiliac joint without further abnormalities. In correlation with the pain in the area of his right hip, a pelvis and hip magnetic resonance imaging (MRI) scan revealed synovitis of his right hip with trochanteric bursitis (Fig. ). Furthermore, there was left-sided osteitis of the sacral bone. We then performed an interferon-gamma release assay (IGRA), which was positive. Therefore, we collected material for microbiological as well as pathological diagnostics by puncture of his left hip joint. Histological examination of the periarticular tissue revealed the formation of granulomas with caseous necrosis (Fig. ). Despite a negative acid-fast stain of the gained tissue sample, Mycobacterium tuberculosis was identified by polymerase chain reaction (PCR). Culture for mycobacteria remained negative. All other specimens submitted for microbiological testing (blood culture and sputum probes) remained culturally and PCR negative for Mycobacterium tuberculosis.
Based on the above described findings, we made a diagnosis of tuberculous coxitis with trochanteric bursitis. Molecular testing yielded no evidence of mycobacterial resistance to isoniazid or rifampicin. We therefore started a four-drug anti-mycobacterial regimen with rifampicin, isoniazid, ethambutol, and pyrazinamide. Prednisolone was gradually reduced until its complete discontinuation. After 2 months of therapy, ethambutol and pyrazinamide were stopped. Rifampicin and isoniazid were continued for 7 more months. In the follow-up, 6 months after starting therapy and 2 months after completion of a 9-month anti-mycobacterial regimen, his CRP was normal, and low back pain and painful motility of his right hip resolved completely. Conventional radiographs of his right hip showed a slight joint space narrowing with no further pathological findings. In the absence of functional limitation no surgical treatment was required. |
pmc-6220520-1 | A 62-year-old male never smoker presented with several painless but slowly enlarging lymph nodes in the bilateral neck in December 2014. After a series of examinations (Fig. -), the patient was diagnosed with lung adenocarcinoma of the left upper lobe (stage IV, cT2N3M1b) harboring L858R mutation in exon 21 of EGFR gene in January, 2015.
The patient was recruited to a clinical trial (NCT 02353741) and administered with erlotinib (150 mg/d) plus radiotherapy in left lung and mediastinum (PGTV60Gy/30F/6W) from January 8, 2015. Partial response (PR) was identified in this patient according to the Response Evaluation Criteria in Solid Tumors (RECIST) (version 1.1).
Disease progressed in March 2016. Neck CT found enlarged right supraclavicular nodules and axillary lymph nodes (Fig. ). Resection biopsy of the right supraclavicular lymph node found EGFR T790 M mutation in exon 20 (detected by ARMS-qPCR), but the lung lesions did not change much (Fig. ). Therefore, local radiotherapy was adopted. After following up from April 7, 2016 to January 4, 2017, the tumor response was assessed and stable disease (SD) was achieved.
Pelvis magnetic resonance imaging (MRI) and whole-body bone scintigraphy (Fig. ) showed multiple bone metastases in April 2017. Resection biopsy of supraclavicular lymph node revealed that there was no pathological transformation. Peripheral blood molecular detection found EGFR T790 M mutation (14.4%). Thus, the patient received second-line treatment with oral osimertinib (80 mg/day) combined with radiotherapy of bilateral ischia (PGTV 54Gy/18F). No other systemic therapy was added.
However, thoracic CT identified pulmonary nodule progression (progressive disease, PD) two months later, and the patient’s performance status (PS) didn’t improve. Resection biopsy of the left axillary lymph node showed that EGFR L858R mutation still existed, but T790 M mutation disappeared. Erlotinib combination with pemetrexed for two cycles from July 4, 2017. A mass of 5.5 cm *2.9 cm growing from the left paravertebral soft tissues of L1–2 and enlarged retroperitoneal lymph nodes in the pelvis were found on August 21, 2017 (Fig. ). Core needle biopsy of paravertebral mass revealed no pathological transformation of SCLC (CK +, TTF-1 +, LCA -, Ki-67 50%+). EGFR T790 M mutation was still negative and L858R was positive. The patient was switched to apatinib, a VEGFR2 inhibitor, from August 29, 2017. However, a large amount of pleural effusion was found on September 7, 2017, and PS was 4. One month later, the patient died. A brief introduction to the treatment history was shown in Fig. . |
pmc-6220595-1 | An 18-year-old male was referred to us with history epigastric discomfort and right loin pain for a period of 3 weeks. The pain was localized, nonradiating, and dull aching in character. He had associated low-grade fever with multiple episodes of diarrhea and vomiting since 1 week. He is a known patient of chronic calcific pancreatitis, for which he underwent a celiac plexus block (10 mL of absolute ethyl alcohol) 2 months back. He had no comorbid conditions and no history of previous surgeries.
General examination revealed heart rate of 108 per minute and febrile with a temperature of 101°F. Abdominal examination revealed tenderness in the right hypochondriac quadrant and right loin. All other quadrants were normal with no palpable mass or tenderness. Laboratory investigations showed elevated total leukocyte count of 11,000 cu/mm and normal serum creatinine level of 1.01 mg/dL; rest of the parameters were within normal limits. Contrast-enhanced CT was done at the referral hospital and it showed right hydronephrosis with a large well-defined collection in retropancreatic region extending along precaval and aortocaval region (urinoma), with a contrast leak from the pelviureteric junction (PUJ) ().
A retrograde pyelogram and attempt to secure a guidewire in to the right pelvicaliceal system failed with guidewire stopping ∼4 cm from PUJ. A 12F malecot catheter was placed as a right-sided percutaneous nephrostomy under ultrasound guidance. On follow-up, after 3 weeks, a repeat CT urogram was performed, which shows a complete resolution of urinoma. A simultaneous antegrade and retrograde pyelogram were done under anesthesia (). A long-segment ureteral defect was seen with an abrupt cutoff of the contrast 4 cm from PUJ on retrograde pyelogram and contrast seen within the renal pelvis on antegrade pyelogram.
Having assessed the patient and with a diagnosis of long segment upper ureteral stricture, we have decided to go ahead with robotic ureterocalicostomy. The procedure is done in standard left lateral position with three-port technique. After adequate colonic mobilization, ureteral mobilization was done only to see a fibroses upper ureter and a distorted renal pelvis. The upper end of ureter was transected just below the level of fibrosis. Subsequent dissection around hilum revealed a significant fibrosis. With a large ureteral defect to bridge and distorted renal pelvis, we have decided to go ahead with ureterocalicostomy. First, renal descensus was done to marginally cut down on the length of defect and then, after hilar clamping, lower polar parenchymal division was done to expose the lower calix. Hemostatic sutures were taken to control the parenchymal bleed and then, caliceal mucosal eversion was done. Parenchymal approximation was done on either side of the exposed calix. The dissected upper end of ureter was splayed and a tension-free and water-tight ureterocalicostomy was completed after placing a Double-J stent ().
Postoperative period was uneventful and free of complications. Abdominal drain was removed on the fourth postoperative day. Patient was discharged on the eighth postoperative day. Double-J stent was removed after a duration of 4 weeks. Intravenous pyelography was done after 4 months (), which shows an intact ureterocalicostomy anastomosis and good drainage of contrast. |
pmc-6220734-1 | A 55-year-old female was evaluated for persistent hyponatremia of one-month duration. The physical exam was unremarkable for volume overload or depletion. The workup () revealed a sodium level of 126 mmol/l without other electrolyte abnormalities, serum osmolality of 260 mOsm/kg, serum uric acid level of 2.0 mg/dl, normal cortisol, normal TSH, urine sodium of 45 mmol/l, and urine osmolality of 274 mOsm/kg, consistent with SIADH. Citalopram was thought to be the cause of SIADH and stopped. However, persistent hyponatremia prompted a further workup, especially with extensive smoking history and weight loss. Computed tomography showed right hilar mass with metastasis to the liver, right femur, and ribs (Figures and ) with biopsy revealing SCLC.
Despite SCLC diagnosis, the patient continued to smoke cigarettes. Approximately two weeks later, the patient was admitted for acute hypoxic and hypercapnic respiratory failure due to postobstructive pneumonia, COPD exacerbation, and secondary pneumothorax, which were managed with improvement in her respiratory status. However, PaCO2 and serum bicarbonate began to increase with the bicarbonate level approaching up to 45 mEq/dl, associated with refractory hypokalemia and uncontrolled hypertension. Metabolic alkalosis was noted to be chloride resistant (urine chloride of >20 mEq/dl). Additionally, hyponatremia which responded moderately to fluid restriction gradually normalized after the onset of metabolic alkalosis (). Uncontrolled hypertension, chloride-resistant metabolic alkalosis, and hypokalemia prompted the workup for hyperaldosteronism. Serum aldosterone and plasma renin activity were within normal limits. A high-dose dexamethasone suppression test revealed elevations of ACTH (319 pg/ml) and cortisol (131.5 μg/dl), consistent with ACTH-dependent hypercortisolism and SAME () from an ectopic nonsuppressible source of ACTH.
The patient also had significant weight loss of 28 pounds after diagnosis of SCLC, and profound muscle wasting. The second chest CT showed extensive local infiltration of the lung cancer with widespread hepatic metastasis and bilateral adrenal hypertrophy (). Palliative chemotherapy was commenced with carboplatin (target AUC—5, dose = 635 mg) and etoposide (100 mg/m2 IV). But ACTH and cortisol levels remained elevated () despite the first cycle of chemotherapy. Oral ketoconazole (200 mg two times a day) was subsequently started two weeks after chemotherapy. However, the patient did not tolerate the therapy well and continued to deteriorate rapidly with persistent hypercortisolism. Given end-stage disease with poor functional status, palliative care, and comfort measures were pursued as end-of-life care. The patient passed away within 2 months after diagnosis of EAS. Family did not want an autopsy. |
pmc-6220740-1 | The left hand of a right-handed 29-year-old man was injured by a meat chopper. The injured fingers were not replantable; therefore, amputation of the middle and ring fingers at the level of the proximal phalanx and of the little finger at the middle phalanx was performed at another hospital (). The patient's occupation was chef at an Indian restaurant. Six months following the injury, the patient was referred to our hospital for hand reconstruction. Radiographic images confirmed the clinical findings (). The patient's preoperative visual analogue scale (VAS) score was 4/10 (this score is based on the patient's phantom pain after the finger amputations) and his Quick-DASH was 81.82/100.00. Examination of foot vascularity with contrast-enhanced computed tomography confirmed that bilateral STT was compatible for the reconstruction of two fingers (). Therefore, one year after the injury, the bilateral second toes were transferred to the middle and ring fingers.
A curved incision was made over the volar surface of the distal middle and ring fingers (). We identified the digital artery, digital nerve, and flexor digitorum profundus on the volar side. The digital artery and digital nerve were isolated to provide for inflow and reinnervation.
First, the dorsalis pedis artery and superficial dorsal vein were marked under ultrasound guidance. A v-shaped incision was made at the base of the second toe and extended proximally. The superficial dorsal veins, first dorsal metacarpal artery, and extensor digitorum longus were dissected on the dorsal side. A plantar dissection was also made, and the flexor digitorum longus and proper palmer digital nerves were identified. Disarticulation was performed at the second metatarsophalangeal joint. While harvesting the second toe from the recipient artery, long pedicle was maintained in order to facilitate vascular anastomosis and to avoid the kinking of the artery. The second metatarsal bone was cut at the base to adjust the length of fingers. The foot was closed with a knotless suture fixation system (ZipTight™; Arthrex Inc., FL, USA) to firmly close the wound, avoiding unwanted reduction of tension during the closure (). |
pmc-6220749-1 | A 62-year-old male with history of hypertension, coronary artery disease, and sick sinus syndrome presented to outpatient device check clinic to establish care for a pacemaker device. He underwent implantation of a dual-chamber pacemaker device (St. Jude Accent generator with Medtronic CapSure SP Novus atrial and ventricular leads) in 2002 for sick sinus syndrome and had a generator changeout in 2011. The lead model was not implicated in a recall to our knowledge and search. The patient had his last device check performed in March 2017, and no problems with the device function were reported at that time. The patient denied any trauma to the chest or upper extremities, chest pain, shortness of breath, palpitations, presyncope, or syncopal episodes. He denied any device-related complications in the past. The patient reported a recent visit to a popular theme park in the 1st week of August, where he enjoyed multiple high thrill rides including high-velocity roller coaster rides. On physical examination, he was afebrile with normal pulse, blood pressure, and respiratory rate. His left pectoral pacemaker implant site showed no erythema, swelling, warmth, drainage, or signs of erosion. Labs showed normal blood counts and normal renal and liver function. A 12-lead ECG showed normal sinus rhythm with a heart rate of 60 beats per minute and atrial pacing spikes with loss of capture (). Pacemaker device evaluation showed approximate remaining battery life of 9 years and programmed DDDR pacing mode. Heart rate histograms showed 54% atrial pacing and 15% ventricular pacing. The right ventricular lead showed normal sensing, impedance, and pacing threshold. The right atrial lead was noted to have unusually high impedance of 2175 ohms and no capture on testing at voltages as high as 7.5 mV. Lead impedance history clearly showed an abrupt increase in the atrial lead impedance in August, at the time patient had visited the theme park, from around 600 ohms to 1000 ohms and subsequently above 2000 ohms (). EGM showed atrial lead noise. A chest X-ray (CXR) was obtained which revealed an intact right ventricular lead and complete severance of the right atrial lead tip (Figures and ). The pacemaker was reprogrammed from DDDR to VVIR mode. After discussion and review with the patient, it was decided not to retrieve the fractured lead or insert a new atrial lead, due to his intrinsic sinus rhythm having taken over, no evidence of atrioventricular (AV) block, and no current requirement for pacing. It was decided to follow the patient clinically to see if he will require insertion of an atrial lead in future. |
pmc-6220751-1 | A 46-year-old male with a history of alcoholic liver cirrhosis complicated by small esophageal varices after banding and moderate ascites was awaiting liver transplant (MELD 24, Child-Pugh class B). He presented with a 3-day history of abdominal pain. He described the pain as sharp and located around the periumbilical area with notable suprapubic discomfort. He also reported associated symptoms of nausea, hematochezia, and general malaise. On further review of systems, he reported chills, increased fatigue, shortness of breath, lightheadedness, and decreased appetite 4 days prior to presentation. He reported compliance at home with a sodium-restricted diet and medications. Physical exam was significant for abdominal distension with positive fluid wave, generalized abdominal tenderness, and splenomegaly. Scant blood was noted on the rectal exam. Laboratory studies revealed stable hemoglobin of 12.4 g/dL, hematocrit of 36.8%, platelet of 83 K/UL, leukocytosis of 15.4 K/UL with 78% neutrophils and 16% bands, sodium of 130 mmol/L, ammonia of 83 Umol/L, ALT of 40 U/L, AST of 42 U/L, and alkaline phosphatase of 127 U/L. International normalized ratio (INR) was 2.02. Diagnostic paracentesis revealed serosanguinous fluid and ascitic fluid polymorphonuclear neutrophils (PMN) count of 686 cells/mm3, consistent with culture negative neutrocytic ascites. Blood cultures revealed no growth of organisms. The patient was started on intravenous (IV) ceftriaxone, IV pantoprazole infusion, and an IV bolus of octreotide followed by continuous infusion. He completed a 5-day course of IV ceftriaxone therapy.
The patient underwent an esophagogastroduodenoscopy (EGD) which showed ulcerations in the distal esophagus from prior banding of small esophageal varices and diffuse portal hypertensive gastropathy (). Mucosal edema and erythema with an area of oozing of blood were identified in the duodenum bulb and between proximally located duodenal folds with no specific identifiable lesion. These findings correlated with a diagnosis of portal hypertensive duodenopathy (). Colonoscopy was performed, and it showed no active bleeding. However, there were old blood clots in the terminal ileum in addition to mild inflammation in the terminal ileum near the ileocecal valve. Video capsule endoscopy was also performed, and it revealed no active bleeding. Because of the concern of the possible failure of the patient on medical therapy for portal hypertension while awaiting liver transplant, the patient was referred for evaluation by a transjugular intrahepatic portosystemic shunt (TIPS). The patient successfully underwent the TIPS procedure. Follow-up occurred one month later in clinic. At this time, the patient reported resolution of the hematochezia. |
pmc-6221239-1 | A 12-year-old boy presented to the outpatient clinic of Tabarak Allah Rural Hospital in Gedaref State in October 2013, with complaints of fever, chills, headache, dry cough, and vomiting for 1 week, and with anorexia for the last 2 days. The patient had no history of visceral leishmaniasis, but he came from Barbar El Fugara village in the Atbara River area (lat. 13°34′47.7″N, long. 36°18′30.6″E), the most endemic area for visceral leishmaniasis in Sudan. He was enrolled in a clinical study called “Neglected Infectious Diseases Diagnosis” (NIDIAG) and underwent standard history taking, physical examination, and a set of diagnostic tests targeting severe and treatable infectious causes of persistent fever, that is, visceral leishmaniasis, malaria, tuberculosis, enteric fever, brucellosis, amebic liver abscess, relapsing fever, rickettsial diseases, leptospirosis, and human immunodeficiency virus (HIV) infection. The NIDIAG project did not interfere with the choice of treatment of the included patients, but made sure that essential medicines for the target conditions were present at the study site.
The initial physical examination (day 0) revealed that his weight was 21 kg, height 118 cm, axillary temperature 40.7°C, respiratory rate 30/minute, heart rate 108/minute, and blood pressure 90/70 mm Hg. He presented with a normal level of consciousness, moderate cachexia, pallor, cervical and inguinal lymphadenopathy (size 1 cm), and bilateral tonsil inflammation. Chest examination revealed crackles and decreased air entry in the right lung. No abnormalities were found on abdominal examination. The rest of the physical examination was unremarkable.
On laboratory testing, the hemoglobin level was 11.2 g/dL and the white blood cell count 12.6 × 109/L. Urine analysis revealed 10–25 leukocytes/μL. Both Giemsa-stained blood microscopy and rapid diagnostic tests for malaria (Pf-HRP2 and pan-pLDH) were negative. A rapid diagnostic test for HIV (Determine™; Inverness Medical, Shinjuku-ku, Japan) was negative. Direct microscopical search for Leishmania amastigotes on lymph node aspirate was negative, and as the patient did not have clinical splenomegaly, spleen aspiration was not carried out. Blood samples were collected for the direct agglutination test for visceral leishmaniasis and for blood culture (using two HiMedia™ (HiMedia Laboratories, Mumbai, India) culture bottles and searching for Salmonella and Brucella).
On day 0, the clinical picture was consistent with bacterial pneumonia, and oral erythromycin and amoxicillin treatment was initiated. On day 2, as the high fever persisted, treatment was switched to intravenous ceftriaxone. The next day, the direct agglutination test was found to be positive (titer 1/12,800) and, accordingly, a diagnosis of probable visceral leishmaniasis was made. The patient was admitted to the hospital and received intramuscular sodium stibogluconate (20 mg/kg) combined with paromomycin (15 mg/kg) daily for 17 days, and ceftriaxone was stopped. The fever subsided in the following days and the patient was discharged on day 19 with no remaining symptoms and signs.
On day 12, the reference laboratory in Khartoum identified Salmonella Paratyphi in the blood culture taken on admission, but the result could only be communicated to the medical team in the field and subsequently to the patient on day 25. The paromomycin component of the treatment of visceral leishmaniasis could have had a partial effect on the patient’s salmonellosis, as paromomycin is an aminoglycoside with poor activity against intracellular bacteria. The attending physician decided to treat the patient with trimethoprim/sulfamethoxazole for 2 weeks. On day 43, Brucella melitensis biovar 1 was identified in the admission blood cultures and, despite the absence of symptoms, the patient was treated with oral doxycycline for 6 weeks and intramuscular gentamicin for 2 weeks. The patient remained well during treatment and follow-up. |
pmc-6221513-1 | A 49-year-old African American male presented to our hospital center after ventricular fibrillation cardiac arrest with return of spontaneous circulation achieved after 10 minutes of cardiopulmonary resuscitation and defibrillation by emergency services. Personal cardiovascular risk factors included untreated hyperlipidemia and hypertension. Cardiac past medical history included one episode of diaphoresis and palpitations, four years prior to this admission. Per the patient, workup at that time at another local hospital revealed an unspecified arrhythmia and cardiac hypertrophy, but the patient did not follow up. The patient denied a family history of recurrent syncope or unexplained cardiac death, but reported unspecified cardiac hypertrophy and unspecified arrhythmia in one brother, and coronary artery disease in mother and brother.
On arrival to the emergency department, the patient was asymptomatic. Clinical examination showed a blood pressure of 135/67, with irregular heartbeat of 72 beats per minute, decreased heart sounds and soft systolic murmur but no S4 on cardiac auscultation. Troponin-T was minimally elevated at 0.021 ng/mL. Lipid panel was deranged – cholesterol 239 mg/dL, triglycerides 149 mg/dL, low-density lipoprotein cholesterol 170 mg/dL, and high-density lipoprotein cholesterol 48 mg/dL. Transaminitis (aspartate aminotransferase 504 unit/L, alanine aminotransferase 332 unit/L), elevated creatinine 1.5 mg/dL and anion gap were noted on laboratory studies. Other labs were unremarkable including normal white blood cell count, hemoglobin and thyroid-stimulating hormone.
Serial 12-lead ECGs showed deep T inversions in V3-V6 and early repolarization in V1 and V2 leads (Figures , ). On arrival, the patient was also in atrial fibrillation with rapid ventricular response (Figure ), which resolved with intravenous Amiodarone. Septal infarct of undetermined age, possible inferior subendocardial injury, possible anterolateral subendocardial injury, and prolonged QT were also reported on automated interpretation of ECG. The patient underwent cardiac catheterization, which showed patent coronary arteries, however, the classic ace of spades sign was seen on ventriculogram (Figure ). Initial transthoracic echocardiogram without contrast was interpreted as normal left ventricular wall thickness, with an ejection fraction of 70% and no wall motion abnormalities.
The patient was treated with aspirin 81 mg daily, carvedilol 6.25 mg twice a day, hydrochlorothiazide 25 mg daily, atorvastatin 40 mg daily, and an automated implantable cardioverter-defibrillator (AICD) for secondary prevention of another cardiac arrest. The patient was asymptomatic up to discharge three days after admission. Liver function enzymes (aspartate aminotransferase and alanine aminotransferase) trended down to 65 unit/L and 199 unit/L, respectively. Creatinine also normalized to 1.1 mg/dL. |
pmc-6221515-1 | Our patient is a 51-year-old African American male who presented to the emergency department (ED) with a chief complaint of bilateral knee pain and weight loss. Upon interviewing the patient, he admitted to a weight loss of 52 pounds, all of which had occurred over the last eight weeks. Around this same time he recalls having trauma to his knees while colliding with his opponent during a game of basketball. Beginning in this same eight week period, he has had horrible knee pain, making it increasingly difficult for him to ambulate. Upon admission he was tachycardic with a heart rate of 127 bpm, afebrile with a temperature of 99.0 F, and his blood pressure was 124/63 mmHg. On physical exam, his knees were stiff, moderately swollen, moderately erythematous, and were extremely tender to palpation both medially and laterally along the joint line. He appeared cachectic, alert, oriented, and his mucous membranes were moist. He also happened to be tall and slender of habitus. His cardiovascular, pulmonary, abdominal, and genitourinary system exam findings were benign. He denied any shortness of breath, chest pain, melena, abdominal pain, night sweats, fever, chills, or changes in bowel movements. He denied any usage of drugs, tobacco, or alcohol. He denied ever having a colonoscopy. The patient had no pertinent past medical, surgical, or family history, although he admitted to not seeing a doctor since his teenage years. His laboratory results were as follows: white blood cell count (WBC) of 18.84, hemoglobin (Hg) of 8.4, and mean corpuscular volume (MCV) of 76.7. Knee X-rays done in the ED ruled out any acute fractures.
On the medicine floors, an extensive laboratory workup was ordered keeping infectious, malignancy, and rheumatologic issues on the differential. His erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) both came back elevated at 105 and 10.67, respectively, displaying severe inflammation. His WBC count was 23.25. His C3/C4 complement levels were normal at 157 and 33, respectively. His cytoplasmic antineutrophil cytoplasmic antibodies (c-ANCA) and perinuclear antineutrophil cytoplasmic antibodies (p-ANCA) were also negative. A drug panel came back negative. His Lyme serology, human immunodeficiency virus (HIV), syphilis, hepatitis A, B, and C panels were all negative as well. His antinuclear antibodies (ANA) titer was negative, while his double stranded DNA antibody (Ds-DNA) was mildly elevated at 51. The patient was started on 400 mg Ibuprofen PRN, which didn’t yield clinical improvement. Iron studies were ordered and came back consistent with anemia of chronic disease, likely explaining his tachycardia, with a serum ferritin of 613 and total iron binding capacity of 143. His thyroid workup came back normal with a thyroid-stimulating hormone (TSH) value of 3.23.
On hospital day three, a rheumatology consult was placed to perform an arthrocentesis of the knee joint. The tap came back showing a cell count of 39,346 and was negative for crystals, ruling out both septic arthritis and gout. The patient was started on 10 mg prednisone BID, which yielded much improvement clinically. The swelling minimally decreased and the stiffness receded. The patient was then able to ambulate with the help of physical therapy (PT). The patient refused a fecal occult blood test (FOBT) but agreed that he would have one done outpatient.
On hospital day four, the patient became febrile overnight with a temperature of 101.5 F. An infectious workup was begun by ordering a chest X-ray, urine and blood cultures. The X-ray showed a questionable pneumothorax at which point radiology recommended a repeat on expiration (Figure ). The repeat showed what appeared to be a spontaneous pleural bleb rupture and the surgery department was consulted. As the patient was asymptomatic, the surgery department recommended withholding treatment at this time. The cultures were negative.
Over the next few days, the rheumatoid factor came back high at 52 and anti-cyclic citrullinated peptide (anti-CCP) came back >250 confirming inflammatory RA as the definitive diagnosis. The patient was then discharged and told to follow up as an outpatient with the rheumatologist to establish a more definitive treatment plan. |
pmc-6221534-1 | A 52-year-old female with a history of consuming a high dose of artificial sweeteners was diagnosed with Hashimoto’s hypothyroidism. She had been using artificial sweeteners on an average of 6g/dl for 14 years. On presentation, her thyroid stimulating hormone (TSH) was 12.2 mIU/L (normal: 0.4-4.5), free T4 0.5 ng/dl (normal: 0.58-1.64), and anti-thyroid peroxidase antibody (Anti TPO Ab) 196 IU/ml (normal: <35). Treatment with levothyroxine 0.75 mg/day normalized her TSH, which remained between 1.23 mIU/L and 2.16 mIU/L during the following three years. She was also ruled out for other autoimmune disorders (Grave's disease, De Quervain thyroiditis) as well as drug-induced thyroiditis. The patient noticed a significant weight gain of 20 lbs since she started using artificial sweeteners. She correlated her weight gain with the use of artificial sweeteners, so she reduced and eventually stopped taking the sweeteners. Stopping the artificial sweeteners was followed by an unanticipated drop in her TSH to 0.005 mIU/L. The TSH remained suppressed despite the reduction in levothyroxine dose to 0.5 mg/day. After the complete discontinuation of levothyroxine, normal TSH and Anti-TPO Ab <20 IU/ml (normal: <35), thyroid stimulating immunoglobulin (TSI) 113% (normal less than 140%), and thyrotropin binding inhibiting immunoglobulin (TBII) <6.0% (normal: <16%) were achieved. She remained clinically euthyroid without any treatment during the subsequent follow-up visits. All the relevant lab values have been summarized below (Table ). |
pmc-6221536-1 | A 47-year-old female patient with a past medical history significant for migraine headaches presented to the neurology clinic for the evaluation of a feeling of imbalance. The symptoms began four months prior to presentation when she returned from a three and a half week cruise. She had been feeling “off-balance” ever since the time she stepped off the cruise. She described the symptom as a feeling of constant motion throughout the day, which persisted while lying down.
To her surprise, she noticed that these symptoms temporarily subsided when she drove a car and even rode a bicycle, but they returned as soon as she got out of the car or off the bicycle. She also reported a history of vertigo about three years ago, which had subsided with positional exercises, and noted that this was a different kind. She denied headaches, nausea, vomiting, tinnitus, or falls.
Prior to her visit to this neurology clinic, the patient was seen by numerous physicians, including an otorhinolaryngologist who had suggested vestibular exercises that did not seem to help her. She was also started on clonazepam, which the patient self-discontinued within a week because it was ineffective.
The physical examination, including a complete neurological examination, was unremarkable. An extensive workup, consisting of magnetic resonance imaging (MRI) brain (Figure ), video-nystagmography (VNG), oculomotor testing, positional testing, and audiogram were all normal. The patient’s prior laboratory investigations were unremarkable. In this context of a typical history with a normal physical examination and investigations, a provisional diagnosis of Mal de Débarquement syndrome was made after a literature review. The patient was then reassured that her symptoms would hopefully spontaneously resolve in a year. |
pmc-6221563-1 | The patient was a 31-year-old woman diagnosed with CVID. She had chronic sinusitis at 20, and beginning at age 25 was repeatedly treated with antibiotics because of recurrent bronchitis. She smoked 20 cigarettes per day since she was 18. The patient did not receive prophylactic vaccination against influenza, pneumococci, or Haemophilus influenzae. She was referred to a clinical immunologist at 29 because of 2 episodes of severe pneumonia in the course of 1 year. She has significant vitiligo and a congenital hypoplastic left kidney. Her family history of chronic diseases was unremarkable. Testing at the Department of Immunology confirmed: a persistent deficiency of 3 main classes of antibodies: IgG 10 mg/dL (n = 600–1600), immunoglobulin M (IgM) 4 mg/dL (n = 40–230), absent immunoglobulin A (IgA), and absent isohaemagglutinins. Flow cytometry found an increased percentage of non-switched memory B cells (IgM++ IgD+ CD38+ CD27+ CD21+) 22% (3.3–12.8%), but lowered class-switched memory B cells (IgM– IgD– CD38+ CD27+ CD21+) –3.2% (4.0–22.1%). We excluded T-cell deficiency and human immunodeficiency virus (HIV) infection, by polymerase chain reaction analysis. Based on the long-term history of increased susceptibility to infection and results of laboratory tests we diagnosed the patient with CVID and qualified her for immunoglobulin replacement. In September 2015, she received the first IVIg which was continued regularly at doses of 0.5 to 0.6 g/kg/mo. In the course of treatment we achieved partial clinical response: there were no severe bacterial infections but recurrent bronchitis persisted. She needed repeated oral antibiotic cycles. A chest computerized tomography (CT) scan after 1 year of treatment revealed mild bronchiectases and interstitial lung inflammation. The IgG trough level was 710 mg/dL. Her body weight increased from 67 to 82 kg, body mass index increased from 25.22 to 30.86 before pregnancy. Moreover she had very difficult venous access. Despite education she did not stop smoking, did not go on a diet, or did not change her lifestyle. Due to difficult venous access, high demand for immunoglobulin (50 g every 3–4 weeks) and wear off effect on IVIg, we proposed changing to conventional SCIg treatment. In November 2016 she found she was pregnant and refused to change replacement modality for weekly home SCIg therapy. During pregnancy peripheral swelling made peripheral venous access impossible. In week 27 of pregnancy, after obtaining the patient's consent, we introduced fSCIg every 3 or 4 weeks. The treatment was well tolerated. Infusions were given into both thighs, simultaneously 25 g 10% IgG (250 mL) facilitated by 12.5 mL recombinant human hyaluronidase per site, at 300 mL/h infusion rate. The treatment schedule is presented in Table . At week 41, she was delivered of a healthy boy (2780 g/52 cm) by cesarean section indicated due to lack of progress in the first phase of delivery. Six days after delivery the baby's IgG level was 889 mg/dL. Postpartum, the mother continued fSCIg at the same dose. Now she is trained for home fSCIg administration. Her last IgG trough level was 729 mg/dL. |
pmc-6221582-1 | A 46-year-old man came to our department in May 2016, complaining of fever and cough for 2 days. The laboratory findings were as follows: WBC (119.2 × 109/L), granulocyte (2.3%), lymphocyte (32%), monocyte (65.6%), basophils (0.1%), hemoglobin (98 g/L), platelets (16 × 109/L). His bone marrow smear demonstrated 1 population of blasts (primitive monocytes 63.5%) (Fig. ), peripheral blood smear found primitive monocytes with absence of basophils. The karyotype analysis of bone marrow cells revealed 46, XY, t (9; 22). Molecular genetic analysis showed BCR-ABL1 (p190) positive without ABL1 kinase domain mutations (Fig. ). No mutations of FLT3-ITD, NPM1, C-kit/D816, CEBPA, PML-RARa, MLL, or CBFβ/MYH11 were found. Flow cytometry analysis demonstrated 1 population of leukemia cells, expressing CD13 (66%), CD33 (96%), CD34 (45%), HLA-DR (96%), CD38 (63%). CD11b, CD19, CD5, CD7, CD22, CD117, CD10, CD14, CD71, CD56, CD15, cCD3, and MPO were detected negative (Fig. ) and so was cCD79a in further examination. Physical examination showed no evidence of splenomegaly. According to morphology, immunology, cytogenetic, and molecular criteria, the patient should be diagnosed as Ph+ AML due to no antecedent hematological anomaly. He experienced tumor dissolved syndrome, acute kidney injury, acute heart failure, pulmonary infection, and perianal ulcer combining infection events. After continuous renal replacement therapy and anti-infective therapy, most organ functions returned to normal. We then gave him dasatinib (100 mg/day) considering that he still had a serious perianal ulcer combining infection. The patient had no significant side effects except leukopenia and the need for blood transfusion to support the treatment. Two weeks later, his bone marrow examination demonstrated the status of nonremission. The dosage of dasatinib was then added to 140 mg/day for the next 3 weeks, and a complete remission was achieved. The BCR/ABL1 fusion transcript rate was 12.1%. The dosage of dasatinib was then reduced to 100 mg/day because of leukocyte reduction. After 2 months’ treatment with dasatinib in total, the patient achieved a complete cytogenetic response. Since the patient's serious perianal ulcer improved at that time, so he began to receive 2 cycles of chemotherapy with IA (idarubicin 8 mg/m2, day 1–3; cytarabine 100 mg/m2, day 1–7) in August, 2016, and finally achieved a complete molecular remission. |
pmc-6221603-1 | A 63-year-old man was admitted to our hospital on June 6th, 2016, because of lower back pain for a month, without fever, cough, hemoptysis, hoarseness, or obvious loss of weight. He had no alcohol or tobacco history before admission. His family and social histories were unremarkable. The patient was initially diagnosed as asymptomatic pulmonary cyst empirically on November 11th, 2015 during health examination, as his chest CT indicated an isolated thin-walled cystic lesion measuring 1.5 cm in diameter in the left upper lung (Fig. ). Whole-body CT scan, biopsy, or thoracoscopic resection of the lesion was not performed, and he was advised to take periodic examination by the clinicians in the local hospital.
His thorough physical examination on admission showed nothing abnormal. Further tests were performed step by step for differential diagnosis. Routine serum tumor markers of carcinoembryonic antigen, cytokeratin 19 fragment, squamous cell carcinoma, neuron-specific enolase, alpha fetal protein, serum ferritin, carbohydrate antigens (CA) such as CA242, CA72–4, CA153, CA125. and CA19–9 were all in normal range. Subsequently, radiological examinations were carried out for a definite diagnosis. His chest and abdomen CT revealed a morphologically solitary, thin-walled cavitary lesion, measuring 1.6 cm in diameter, along with several hepatic masses (Fig. ). The cystic lesion was suspicious of malignancy,because the wall was slightly thickened unevenly comparing with the imaging findings (Fig. ) nearly half a year ago.
Therefore, positron emission tomography-computed tomography (PET-CT) was performed, which indicated a solitary thin-walled pulmonary cystic lesion, several hepatic masses, intramuscular and osteolytic damages, and enlarged mediastinal lymph nodes with hyper-metabolic features. These lesions demonstrated significantly abnormal uptake of fluorine-18-fluorodeoxyglucose (FDG) (Fig. ). The isolated thin-walled cavitary lesion showed a maximum standard uptake values (SUVmax) of 4.3. Similarly, SUVmax of the masses located in left hepatic lobe, the right scapula, pelvis, and sacrum was 5.6 and 11.3, respectively. The SUVmax of right paratracheal, aortopulmonary, and hilar lymph nodes was 8.4. These lesions were strongly suspicious of malignancy. Then CT-guided percutaneous liver biopsy was performed, which showed aggregation of atypical malignant cells, in accordance with lung cancer (Fig. C and D). His Eastern Cooperative Oncology Group (ECOG) score was 1. Based on the above findings, his diagnosis was corrected as stage IV pulmonary adenosquamous carcinoma according to the 7th edition of the TNM staging system for lung cancer.
Subsequently, the patient received 4 cycles of pemetrexed (500 mg/m2 of body surface area) plus cisplatin (75 mg/m2 of body surface area), followed by 4 cycles of concurrent gemcitabine (1000 mg/m2, day 1 and day 8) plus cisplatin (75 mg/m2) and bevacizumab (Avastin, Roche Pharma [Schweiz] Ltd., 10 mg/kg of body weight). Meanwhile, zoledronic acid (4 mg at a time) was administered every 21 days along with the chemotherapy. During the treatment, whole-body CT and bone emission computed tomography scan were carried out every 2 to 3 months. The pulmonary cystic lesion indicated stable disease, whereas the hepatic lesions were slightly enlarged after the chemotherapy, as shown by whole-body CT. One month later, he had been recovered from chemotherapy-related thrombocytopenia and fatigue. Then his ECOG score was 2. Oral apatinib (425 mg per day) was given as third-line therapy for 3 months, followed by leukopenia, thrombocytopenia, and cough, which could be controlled by medication. Thereafter, the dosage of apatinib was decreased to 200 mg/day for another 3 months.
The pulmonary cystic lesion maintained stable disease, whereas the hepatic lesions were enlarged and disseminated (progressive disease) as indicated by radiography 15 months after the treatment. Further therapeutic regime was suspended because of concomitant apatinib-related side effects, including discontinuous rhinorrhagia, leukopenia, thrombocytopenia, albuminuria, and fatigue. And his ECOG score was 3 at that time. Therefore, best supportive care was given with the aim to alleviate his suffering, and further laboratory or imaging examinations were no longer performed. His treatment process was depicted in Figure . He died of multiple organ failure nearly a month later. |
pmc-6221626-1 | An 8-year-old boy visited the hospital for a history of out-toeing gait and abnormal frog-leg sitting position. On examination, both lower extremities were outwardly rotated and both knees could not be put together when standing. When sitting, he could not cross or overlap his legs. When squatting, both lower limbs demonstrated a type “o” feature and the heels did not touch the ground. The muscles on both sides of the buttocks were noticeably tight. The flattening of the right buttock was also observed. Bilateral hip adduction and abduction activities were significantly limited. The angle of passive adduction in hip flexion was −40°.
Gray-scale ultrasound (GSUS) showed bilateral gluteus maximus muscle thinning and strips of echogenic foci (contracture strips) inside the muscles, within which no significant blood signal was observed using color Doppler flow imaging (CDFI). The right strip was approximately 5 mm thick, and the left was approximately 6.6 mm thick (Fig. A and B).
The SWE color-coded elastogram of the contracture zone was mainly orange-red in the longitudinal section and blue in the transverse section. The average of the mean shear-wave velocity was 9.15 and 3.10 m/s, respectively (Fig. C and D). |
pmc-6221626-2 | A 10-year-old girl was found to have an abnormal gait 1 year ago. On examination, she could stand with knees put together. When sitting, she could not overlap her legs. During squatting, both knees are rounded, and snapping sound could be heard from the sliding contracture bands. The bilateral gluteal muscles appeared to be slightly tensed upon palpation. Bilateral hip adduction and abduction activities were mildly limited. The angle of passive adduction in hip flexion was 0°.
Bilateral gluteus maximus muscle thinning and intramuscular strips of echogenic foci (contracture strips) were observed; the strips on the right and left sides were about 4.8 and 6.5 mm thick, respectively. No obvious blood flow signal was observed (Fig. A and B).
The color-coded shear-wave elastogram was uneven cyan and orange in the longitudinal section and uneven cyan in the transverse section, and the average of the mean shear-wave velocity was 5.84 and 4.12 m/s, respectively (Fig. C and D). |
pmc-6221626-3 | A 28-year-old woman was unable to walk in a straight line. On examination, her knees could be put together when standing. She could not cross legs in sitting postures and bring knees together during squatting. The bilateral gluteal muscles appeared to be moderately tensed upon palpation. Bilateral hip adduction and abduction activities were moderately restricted. The angle of passive adduction in hip flexion was −10°.
The US revealed bilateral gluteus maximus muscle thinning and intramuscular cord-like zone of strong echo. The thickness of the strong echo zone was about 12 mm on the left side and about 7.4 mm on the right side. No significant blood flow signal was observed (Fig. A and B).
In the longitudinal section, the SWE color-coded elastogram of the contracture zone was uneven cyan, orange, and red. The average of the mean shear-wave velocity was 7.18 m/s (Fig. C). Correspondingly, the color-coded shear-wave elastogram of the contracture zone was uneven cyan and the average of the mean shear-wave velocity was 4.13 m/s in the transverse section (Fig. D).
The 3 patients had no history of any treatment and selected surgical therapy. Besides the bilateral gluteus maximus muscles, the gross pathologic examination of the 3 patients also revealed piriformis muscle contracture and fiber plate-like changes. Pathology confirmed the diagnosis of GMC. Symptoms of abnormal gait and limited hip joint function were greatly improved after surgical treatment. The average follow-up period was 3 months, We found no postoperative complications. |
pmc-6221629-1 | A 53-year-old woman was diagnosed with left breast cancer in April 2011, and radical mastectomy and lymph node dissection were performed, followed by radiotherapy and chemotherapy. In May 2012, a chest CT and radionuclide bone scan demonstrated the presence of bone metastases (L3 lumbar vertebrae). In March 2013, liver metastases were found, and the patient underwent transcatheter arterial chemoembolization twice. In May 2016, the patient was treated with RFA for the metastatic liver lesions. Unfortunately, 2 weeks later, the patient suffered from a cough with yellow, sticky, bitter-tasting sputum, chest tightness, shortness of breath, and worsening symptoms after exercise. The patient was admitted to a local hospital and was diagnosed with a mycotic and bacterial pulmonary infection. The patient underwent treatment with imipenem (1 g, intravenous drip every 12 hours) for 10 days and empirical voriconazole (200 mg, intravenous drip every 12 hours) for 15 days. However, after the treatment with imipenem and empirical voriconazole, the patient developed a fever with a temperature of 42°C without associated shivering. The fever was alleviated with an intravenous injection of dexamethasone (5 mg). However, the intermittent fever lasted for 40 days, and the patient's body temperature ranged between 36°C and 38°C. During this period, the patient received antifungal treatment (oral voriconazole 200 mg twice a day). After September 2016, the patient had no fever, but had a persistent cough with yellow sputum, and wheezing after exercise. The patient was then admitted to our department in November 2016. The patient had an obvious cough with yellow-green sputum, and mild abdominal discomfort, but no symptoms of fever, hemoptysis, nausea, vomiting, or jaundice.
On physical examination, the left breast was absent, and an annular scar of approximately 7 cm was present. Breath sounds were decreased in the right lower lung field. The abdomen was soft, but the upper abdomen was tender and had rebound pain. The patient had a positive Murphy sign, hepatomegaly <4 cm under the rib arch, and edema of both lower extremities. The remainder of the physical examination was normal. The patient's laboratory tests showed a white blood cell count of 9.72 × 109/L (normal range: 3.5–9.5 × 109/L), a neutrophil count of 7.77 × 109/L (normal range: 1.8–6.3 × 109/L), a lymphocyte count of 0.98 × 109/L (normal range: 1.1–3.2 × 109/L), a monocyte count of 0.92 × 109/L (normal range: 0.1–0.6 × 109/L), and an erythrocyte sedimentation rate of 10 mm/h (normal range: 0–18 mm/h). Liver function testing revealed an aspartate transaminase of 93 IU/L (normal range: 13–35 IU/L), an alanine aminotransferase of 23 IU/L (normal range: 7–40 IU/L), an alkaline phosphatase of 601 IU/L (normal range: 50–135 IU/L), an albumin of 30 g/L (normal: 40.0–55.0 g/L), a total bilirubin of 21.9 μmol/L (normal range: 5–21 μmol/L), a direct bilirubin of 13.3 μmol/L (normal range: <6 μmol/L), and an indirect bilirubin of 8.6 μmol/L (normal range: 2–15 μmol/L). Coagulation testing showed a prothrombin time of 18.3 seconds (normal range: 8.0–13.8 seconds), a prothrombin time activity of 48% (normal range: 70–140%), and a fibrinogen of 1.82 g/L (normal range: 2.00–4.00 g/L). Values for tumor-associated markers included the following: 165.80 ng/mL (normal range: 0.1–3.3 ng/mL) for nonsmall-cell lung cancer associated antigen, 5.24 ng/mL (normal range: 0–20 ng/mL) for alpha-fetoprotein, >1000 μg/L (normal range: 0–5 μg/L) for carcinoembryonic antigen, >300 U/mL (normal: 0–25 U/mL) for carbohydrate antigen (CA-153), and 299.10 U/mL (normal range: 0–35 U/mL) for carbohydrate antigen (CA-125). A fungal d-glucan test was negative, and serologic examination for aspergillus was negative (Table ). There was no fungal or bacterial growth on culture of the sputum. Notably, the total bilirubin level of the sputum was 120 μmol/L, and direct bilirubin was 80 μmol/L.
High-resolution computed tomography (HRCT) of the chest and abdomen showed enlargement of the right lung hilum and mediastinum with slightly enlarged lymph nodes, pleural thickening of both lungs, multiple nodular enhancements in the right pleura, bilateral pleural effusion, atelectasis of part of the right lung, ascites, and multiple intrahepatic metastases (Fig. A–E). Bronchoscopy showed the presence of yellow airway secretions, tracheal mucosal hypertrophy of the basal segment of the right lower lobe, obvious swelling, and no organisms. There were no abnormalities in the visible portion of the remaining bronchus. Furthermore, lavage specimens were collected, and the lavage fluid was positive for bile (Fig. F).
The presence of bile in the sputum and bronchial lavage fluid strongly supported the diagnosis of BBF.[ Therefore, we recommended that the patient undergo laparotomy to confirm the diagnosis of BBF and to allow for therapeutic intervention during laparotomy. Unfortunately, after clinical evaluation, the multidisciplinary team thought that the patient could not tolerate a laparotomy. They suggested that endoscopic nasobiliary drainage (ENBD) might provide stronger evidence for further confirmation of the diagnosis. However, the patient's family elected to forego further examination and treatment after learning of the condition of the patient.
During this period of hospitalization, the patient was first treated with antibiotics including sulbactam and cefoperazone (2 g/12 h) and levofloxacin (0.6 g/d) for 5 days. In addition, her antibiotic regimen was then changed to meropenem for 4 days. She was also prescribed hepatoprotectants, nutritional support and other supportive treatments. After treatment for 10 days, the symptoms of cough with yellow-green sputum and mild abdominal discomfort improved. On the 10th day of hospitalization, she was discharged home. We recommended that the patient should continue receive treatment for her primary disease after discharge. In addition, we also recommended that the patient should receive future treatment with laparotomy once her general condition improved. The patient was followed up for 6 months. Unfortunately, the patient died because of liver failure. |
pmc-6221639-1 | A 15-year-old girl was admitted into our center with a history of bleeding gums for 6 months and high fever for 18 days. On physical examination, spleen could be palpable below the costal margins without surperficial lymphadenopathy. The initial complete blood count revealed that the white blood cell count was 64.32 × 109/L with 2% myeloblasts, hemoglobin level was 94 g/L, and the platelet count was 20 × 109/L. Then bone marrow aspirate was taken on. She had a fever again and the hemogram gradually declined, while waiting the result of bone marrow aspirate. And we found that triglycerides (2.18 mmol/L), alanine aminotransferase (67 IU/L), aspartate aminotransferase (84 IU/L), lactate dehydrogenase (3537 IU/L), serum ferritin (81066 ng/mL) and soluble CD25 (1010 U/mL) were elevated. A reduced natural killer cell activity (12.5%) and fibrinogen level (0.5 g/L) were detected. Taken together with the clinical and laboratory findings, the patient was diagnosed with HLH according to the 2004 diagnostic guidelines for HLH.[ She was immediately treated with dexamethasone and etoposide based on the HLH-2004 regimen and dexamethasone dose was gradually reduced. Also bone marrow aspirate showed a hypercellular marrow with 1% myeloblasts. Flow cytometry (FCM) studies indicated that 1.9% of nucleated cells were positive for CD34, HLA-DR, CD13, CD33, CD56, CD117 and negative for CD5, CD7,CD16, CD19, which indicated an abnormal myeloid blast origin. Chromosomal analysis of the bone marrow cells showed an abnormal karyotype-46, XX, t(8;21;22)(q22;q22;q11.2) (Fig. ). Moreover the RUNX1–RUNX1T1 fusion transcripts were detected in further molecular study. Other possible triggers of HLH were screened simultaneously and the genetic detections of HLH showed that the patient and her mother had the same heterozygous genetic variants in lysosomal trafficking regulator (LYST) (exon46; c.10526G >A; p.Arg3509Gln). Etiological examinations and autoimmune antibodies were negative.
Eventually, based on the presence of the recurrent genetic abnormality, the patient was diagnosed with AML with t(8;21;22)(q22;q22;q11.2), RUNX1–RUNX1T1. After 4 weeks of the treatment of HLH, the serum ferritin still elevated (684 ng/mL), but the HLH-associated clinical symptoms and other laboratory abnormalities disappeared. Repeated bone marrow examinations showed a hypercellular marrow with 13% myeloblasts and the RUNX1–RUNX1T1 fusion gene was still positive. Subsequently, the patient underwent standard AML induction chemotherapy consisting of cytarabine (160 mg, intravenous, days 1–7) and idarubicin (20 mg, intravenous, day 1, 10 mg, intravenous, days 2–3). The patient achieved complete remission (CR) with RUNX1–RUNX1T1 positive. Unfortunately she experienced leukemia replase revealed by 40.5% myeloblasts in the bone marrow after 2 cycles of consolidation chemotherapy consisting of high-dose cytarabine (4500 mg, intravenous, every 12 hours, days 1, 3, 5) and idarubicin (10 mg, intravenous, day 1). Then patient received standard CLAG (cladribine, cytarabine, granulocyte colony-stimulating factor) regimen, which was failed and there were still 59% myeloblasts in bone marrow. Finally patient received paternal haploidentical hematopoietic stem cell transplantation. After the transplantation, bone marrow achieved complete remission and RUNX1–RUNX1T1 fusion gene was negative for more than one year. |
pmc-6221646-1 | A 52-year-old man underwent acupuncture and cupping treatment at an illegal Chinese medicine clinic for neck and back discomfort. Multiple 0.25 mm × 75 mm needles were utilized and the acupuncture points were located in the middle and on both sides of the upper back and the middle of the lower back. The acupuncture and subsequent cupping treatment lasted 30 minutes, respectively. The patient presented to the hospital with severe gasp and dyspnea about 30 hours later. Physical examinations were as follows: blood pressure (BP) was 149/94 mm Hg, heart rate (HR) was 86 beats/min, and blood oxygen saturation level was 54%. The patient was lucid, was gasping, and had apnea and low respiratory murmur, accompanied by some wheeze in both sides of the lungs. Because of the respiratory difficulty, the patient could hardly speak. After primary physical examination, he was suspected of having foreign body airway obstruction. Around 30 minutes after admission, the patient suddenly became unconscious with HR and BP not being measured. The patient died after an hour of cardiopulmonary resuscitation.
This study was approved by the Academic Committee of the Institute of Forensic Science, Ministry of Justice, People's Republic of China. Written informed consents were obtained from the victim's family to publish these case details. |
pmc-6221663-1 | A 26-year-old primigravida at 10 week's gestation was admitted to our emergency department with complaints of a sudden onset of extreme dyspnea, chest tightness, and confusion over a 6-hour period. No significant medical history or drug consumption was noted. She had dysphoria accompanied by tachycardia (141 beats/min) and tachypnea (42 breaths/min). Consistent with the peripheral blood oxygen saturation value, arterial gas analysis showed decompensated metabolic acidosis (pH: 7.216, PO2: 47.2 mm Hg, PCO2: 37.7 mm Hg, lactate: 6.10 mmol/L, and base deficit: −11.6 mmol/L) (Table ). Endotracheal tube intubation and mechanical ventilation were initiated immediately. An electrocardiogram (ECG) was taken considering that her symptoms revealed an S1-Q3-T3 pattern particularly seen in PE (Fig. ).
The patient was then transferred to the intensive care unit after central vein catheterization. Laboratory tests, including prothrombin time, activated partial thromboplastin time, international normalized ratio, fibrin degradation products, D-dimer, troponin I, serum electrolytes, and arterial blood gas, were obtained every 6 hours within the first 24 hours. The fetus had been at high risk of death before the mother was admitted to our hospital, due to the duration of acute anoxia. Informed consent for procedures that might cause fetal harm and worse, may require the necessity of an abortion was obtained when the kin reached an agreement with respect to the patient's condition. Transthoracic echocardiography revealed moderate-to-severe tricuspid regurgitation and a distended right ventricle. The right ventricle free-wall was hypokinetic, which was simultaneously accompanied by moderate pulmonary hypotension. The left ventricle was normal in size and function (Fig. ). Because of the contraindication to the use of radiation, contrast-enhanced spiral computed tomography performance was delayed, as was catheter embolectomy. At this point, in view of the patient's life-threatening condition and to avoid the risk of metrorrhagia, thrombolytic therapy with a low-dosage of alteplase (10 mg loading dose and 40 mg pumped intravenously over 2 hours) was administered once informed consent was obtained. Sedation was continuously monitored. Bicarbonate was provided to correct metabolic acidosis, and administration of low-molecular-weight heparin (LMWH, enoxaparin, 6000 IU twice daily) commenced subsequently according to the prothrombin time for the first 48 hours. Following thrombolysis, reduction in heart and respiratory rates, as well as improvement in blood pressure and oxygen saturation in arterial gas analysis were observed. An ECG was repeated and showed reversal of the S1-Q3-T3 pattern after thrombolysis (Fig. ). However, a serious reduction in fibrinogen (less than 0.5 g/L) was seen. Lyophilized human fibrinogen was infused to correct this treatment side effect, and the fibrinogen level returned to within the normal range within the first 24 hours. On the day following thrombolysis, we observed a heart rate of 105 beats/min, 96% oxygen saturation (invasive ventilation, 100% oxygen), and blood pressure of 105/56 mm Hg; however, a repeated arterial gas analysis revealed no significant change in lung perfusion, and hypoxemia remained (pH: 7.428, PO2: 64.3 mm Hg, PCO2: 29.9 mm Hg, lactate: 1.2 mmol/L, and base deficit: −3.5 mmol/L). Unfortunately, urinalysis revealed that severe hematuria was present, as sediment in the urine contained 508 red blood cells, as seen by the high-power-field of a microscope. However, the performance of a pelvic Doppler ultrasound showed a regular fetal heartbeat, normal placenta, and normal liquid presence (Fig. ). At this point, treatment progress reached a stalemate among clinicians.
Maintenance of the conservative anticoagulation regimen was elected following multidisciplinary discussions. Clinicians from the Department of Cardiac and Thoracic Surgery suggested that the thrombus could be removed through surgical embolectomy or percutaneous catheter-directed treatment; however, the major limitation of this option was her family's wish, at this point in time, to prevent miscarriage, taking into account that it would be difficult for the fetus to tolerate the greater impact from surgery. Although predicting the recanalization of the lung perfusion remained problematic, the clinicians from Gynecology suggested that maintaining the conservative anticoagulation therapy might be the best option. Not only had the urinalysis shown severe hematuria, but also the patient's vital signs revealed a recovery potential. After comprehensive evaluation and careful consideration, we adopted the suggestion from Gynecology. We then advised the patient's family of the effects of long-term severe anoxia on the fetus, the high-risk of relapses, and exacerbation of PE; in view of that information, her family wished for us to maximize our efforts to save the mother's life and to avoid concomitant mental retardation of the fetus. Therefore, an induced abortion was unexpectedly proposed and was subsequently performed successfully. The natural history of PE markedly altered after the first 24 hours postoperatively; 2 arterial blood gas analyses showed that oxygen partial pressure had first risen to 78 mm Hg (invasive ventilation, 60% oxygen), and then to 143 mm Hg (invasive ventilation, 50% oxygen) (Table ). A sequential high-flow nasal catheter was inserted successfully when invasive ventilation was weaned on the morning of the 2nd postoperative day.
No major bleeding was observed, and all laboratory test levels had gradually recovered to within normal limits, except for disturbing results of a protein S test—serum protein S activity had dropped to less than 16%. Given her severe condition, we considered that the deficit of this anticoagulant factor may have been involved in her unprovoked PE, while all her ultrasound results were negative for problems in her extremities and abdomen.
LMWH was subsequently changed to warfarin and new oral anticoagulants during the postoperative period. Complete disappearance of hypoxia and normalization of laboratory test results were observed in the following days, and she was subsequently discharged home in good condition 13 days after admission. Repeat postsurgery contrast-enhanced CT scan results were also consistent with the significant serum results, indicating that the thrombi had been substantially diminished in infarct size, when the recanalization of lung perfusion was evaluated at the 3rd month follow-up (Fig. ). The study protocol approved by the hospital's Ethics Review Committee and complied with the tenets of the Declaration of Helsinki. |
pmc-6221664-1 | A 50-year-old Filipino woman presented with nodular erythema on the arms, legs, and face. She had no history of allergy or medications and had no past medical history such as bronchial asthma. One year after initial presentation, a dermatologist performed a skin biopsy, wherein histopathological findings showed eosinophilic infiltration. Blood examination showed eosinophilia (3450/μL; normal, <500 /mm3) and abnormally elevated levels of nonspecific IgE (113,000 IU/mL; normal, <170 IU/mL) and Th-2 chemokine (TARC) (27,480 pg/mL; normal, <450 pg/mL). As T-SPOT test was positive, Mycobacterium tuberculosis infection was suspected. Therefore, she was referred to our hospital for further investigation. Computed tomography (CT) findings did not show infectious lesion in the lung fields but showed swollen lymph nodes on both sides of the axillae and the neck (Fig. A). M tuberculosis was cultured from the axillary lymph node biopsy specimen, and the patient was accordingly diagnosed as having tuberculous lymphadenitis.
Anti-tuberculosis (TB) drugs were started as a combination protocol of isoniazid, rifampicin, ethambutol, and pyrazinamide. However, the patient experienced nausea and edema, and she had to stop the treatment only 5 days after initiation. Two months had passed after stopping the therapy because the patient dropped out from attending our hospital. The axillary lymphadenopathy worsened, and the lymph nodes further increased in size (Fig. B). As rifampicin was suspected to be the causative agent of the previous symptoms, anti-TB therapy was restarted with isoniazid, ethambutol, and pyrazinamide. However, the patient developed renal dysfunction. The drugs were stopped again 83 days after the second initiation. In spite of cessation of drug administration, the renal dysfunction worsened, and she was admitted to the hospital.
On admission, vital signs were almost normal: blood pressure, 160/100 mmHg; pulse rate, 102 beats/min; body temperature, 36.8°C; and SpO2, 98% (room air). Physical examination showed no abnormal signs other than the presence of nodular papules on the face. Laboratory findings revealed eosinophilia, with a count of 1690/mm3 (normal, <500/mm3), which was still high but lower than before starting anti-TB treatment. The serum creatinine level was 3.11 mg/dL (normal, <1.0 mg/dL), and C-reactive protein was 3.43 mg/dL (normal, <0.3 mg/dL), with an erythrocyte sedimentation rate (ESR) of 123 mm (normal range, 2–10 mm). The serum PR3-ANCA level was elevated to 24.0 U/mL (normal, <3.5 U/mL). Urinalysis showed hematuria (3+) and proteinuria (2+). Chest CT showed regression of axillary and cervical lymphadenopathy, reflecting the efficacy of previous anti-TB therapy (Fig. C). However, new pleural effusion was evident on the right side and no mycobacteria were cultured from the pleural fluid sample. Renal biopsy was performed, and histopathological examination revealed crescentic glomerulonephritis with peritubulitis (Fig. ). Otolaryngological medical examination also revealed right chronic otitis. Based on these findings, we diagnosed GPA; pleurisy, otitis, and renal failure were considered to be organ disorders subsequent to vasculitis. Accordingly, 500 mg of methylprednisolone was administered once daily for 3 days followed by 40 mg of prednisone for 2 weeks. Eosinophil counts decreased to undetectable levels along with resolution of the rash and pleurisy, and the PR3-ANCA level decreased to 11.6 U/mL (normal, <3.5 U/mL). The serum creatinine level also gradually decreased (Fig. ). In addition, anti-TB treatment was restarted with isoniazid, ethambutol, pyrazinamide, and levofloxacin. The treatment had been continued for 18 months, and neither any adverse event nor relapse of TB lymphadenopathy had occurred after that. |
pmc-6221709-1 | A 52-year-old male patient complaining of worsening appetite, abdominal distension, and pruritus for 3 months visited the hepatobiliary and pancreatic surgery department. There were intermittent night sweats and significant weight loss during the past 3 months. He underwent liver transplantation for hepatitis B cirrhosis and hepatocellular carcinoma 12 years ago. For immunosuppression he was treated with tacrolimus and prednisone right after the surgery for 3 months and then tacrolimus 1 mg twice a day ever since. He also took entecavir 0.5 mg once a day for HBV infection but stopped that by himself after 2 years. During the last decade, he was on regular follow up at a local clinic with normal liver function and normal liver morphology by ultrasonography. On physical examination, he had a hard abdominal mass about 15 cm in diameter without tenderness. He was suspected of recurrent hepatocellular carcinoma.
Laboratory test showed normal liver function, an elevated lactate dehydrogenase level of 459 U/L (normal range 120–246) and a high HBV deoxyribonucleic acid (DNA) load. EBV viral load was negative. Virology data were shown in Table . Serum tacrolimus level was 7.2 ng/mL.
Abdominal contrast enhanced computed tomography (CT) revealed a retroperitoneal mass 127 mm × 114 mm × 119 mm in size, near pancreas extending to lumbar 4 vertebra, encompassing aorta abdominalis, right renal artery, inferior vena cava, and bilateral renal veins. There was mass effect on pancreas and kidney, resulting in displacement of the head of the pancreas and right hydronephrosis.
Biopsy of the mass was performed. Histopathology showed interspersed growth of the tumor cells in the rhabdomyus and immunohistochemistry showed cluster of differentiation (CD) 20(+), paired box-5 (PAX-5) (+), B-cell lymphoma (BCL)-2 (focal+), BCL-6 (+), CD10 (–), multiple myeloma oncogene (MUM)-1 (+), CyclinD-1 (–), Ki-67 (90%+), CD138 (–), CD3 (–), CD30 (–), anaplastic lymphoma kinase (ALK) (–), myeloperoxidase (MPO) (–). EBV-encoded ribonucleic acids (EBER) were negative by in situ hybridization. Monomorphic PTLD, diffuse large B-cell lymphoma was established.
Enhanced cervical and thoracic CT detected several small mediastinal lymph nodes, the largest 11 mm × 6 mm in size. Bone marrow biopsy didn’t reveal lymphoma involvement.
Reduction of immune suppression was performed right after the diagnosis with close monitor of the liver function. With no sign of graft rejection, tacrolimus was tapered off. Antiviral therapy for HBV infection was initiated with entecavir and as the drop in HBV DNA viral load was not satisfactory, combination therapy of entecavir 50 mg and adefovir 10 mg once a day was administered. For lymphoma treatment conventional combined chemotherapy consisting of cyclophosphamide, epirubicin, vindesine, and prednisone, was given every 3 weeks. Rituximab was avoided because of the high HBV load. Per square meter of his body surface area, cyclophosphamide was given 750 mg on day 1 and epirubicin 80 mg on day 1. A maximum dose of 4 mg vindesine was given on day 1 and 100 mg prednisone per day was given orally for 5 consecutive days on days 1 to 5. After 6 cycles of chemotherapy, positron emission tomography–computed tomography showed residual mass 24 × 13 mm in size, with maximum standard uptake value 2.96. Therefore, he received consolidation radiotherapy for the involved field. Six weeks after radiotherapy, he was followed up with contrast enhanced computed tomography and complete remission (CR) was achieved according to the Lugano response criteria for non-Hodgkin's lymphoma.[
The patient was on continuous entecavir treatment for HBV infection and was followed up closely. His liver function is normal, HBV DNA has not been detectable and he is still in CR 2 years after radiotherapy. |
pmc-6221747-1 | A pancreatic mass was observed in a 54-year-old Chinese man during a routine follow-up of cutaneous melanoma. Six years earlier, he had consulted a dermatologist with a progressively growing pigment mole after trauma on his back. After detailed imaging studies and other relevant examinations, he was diagnosed with malignant melanoma of stage T3N0M0, according to the 7th American Joint Committee on Cancer definition. This patient underwent extended surgical resection of the malignant lesion and immunotherapeutic treatments with IFNα-2b plus IL-2 on 1, 3, 6, 12, 18, 24, 30, 36 months after surgery (IFNα-2b, 3000,000 U, 15 times; IL-2, 1000,000 U, 15 times, intramuscular injection alternately). Postoperative pathological results also confirmed as malignant melanoma of stage T3N0M0. However, in year 4 following the index surgery, this patient complained of an upper abdominal discomfort but refused to receive further systemic examinations and treatments. In year 6, he presented with an unexplained jaundice of skin and was admitted to our department. The blood test showed a significantly elevated bilirubin level (total bilirubin, 153.4 μmol/L; direct bilirubin, 86.5 μmol/L) and a normal CA199 level of 33.3 U/mL (normal range < 40 U/mL). Contrast-enhanced computed tomography (CECT) revealed a solid hypovascular mass measuring about 3.1 × 2.4 cm localized at the junction of pancreatic head and uncinate process, which compressed the lower common bile duct resulting in expansion of the upstream bile ducts (Fig. ). Percutaneous transhepatic catheter drainage was performed in this patient to reduce the serum concentration of serum bilirubin. Given the patient's acceptable general condition, good control of primary disease and imaging studies indicating tumor resectability, we obtained approval from him as well as his family and performed an LPD and regional lymphadenectomy on this patient. There were no complications following the surgery and the patient was discharged on day 19 after surgery.
The gross morphology of the specimen is shown in Fig. . The pathological outcomes following the skin melanoma resection are given in Fig. A. Postoperative pathological results after LPD revealed a malignant melanoma with negative margins (Fig. B). Immunohistochemical (IHC) findings also suggested a malignant pancreatic tumor accompanied by necrosis and pigmentation, which confirmed the pathological diagnosis. Immunoreactivity was strongly positive for anti-S-100 protein (+++) and positive for anti-Vimentin (+) (Fig. C1-2 and D1-2). The cancer cells were negative for CEA, CK8/18, P53, Violin, CK19, SMA with Ki-67 over 40% (Fig. E1 and E2) So this pancreatic mass was confirmed to be a metastatic pancreatic melanoma from the primary cutaneous lesion.
After LPD, this patient was followed up by readmission to hospital every 2 months in the first half year. The serum bilirubin and tumor markers such as CA199 were normal. CECT and did not find any newly developed neoplasm at the pancreas or metastasis at other organs. At the last follow-up at 6 months after LPD, the patient's general condition was acceptable and the physical examination and imaging studies revealed no significant findings of melanoma. |
pmc-6221754-1 | A 16-month-old boy presented with growth retardation and hypotonia. He was the second child who was born to non-consanguineous Chinese couple. His elder sister developed normally. He had an uncle and a cousin on his mother's side. His parents claimed that their relatives had no similar medical history.
This child was born 5 weeks prematurely by cesarean section. His birth weight was 2.0 kg with no history of asphyxia. He often experienced the symptoms of coughing, snoring and stuffy nose after birth. The first 3 months after birth, he developed relatively normally. Nevertheless, it was found that his independent activities were less than his peers when he was 3 months old. After that, he began to present with crying weakness, limb weakness and hypotonia, accompanied by diurnal symptom marked fluctuation. Then he was diagnosed as “growth retardation” and suspected as “cerebral palsy”. Two months later, he still had a poor strength to grip. He could not suck his finger or look up more than 45 degrees in the prone position. He was also unable to keep his neck stable vertically when he was pulled up. He could recognize parents and understand the meaning of their talk. There were no remarkable symptoms such as abnormal eye movements, convulsion, hidrosis, and ptyalism.
There were no obvious peripheral nerve abnormalities in electromyography (EMG) examination. Brain magnetic resonance imaging showed bilateral widened frontotemporal extracerebral space which in line with imaging manifestations of premature children. After physical examination and neostigmine test, the possibility of myasthenia gravis (MG) was ruled out. It was suspected that he may suffer from spinal muscular atrophy (SMA) in children because of myasthenia and dyskinesia, but no relevant genetic pathogenic mutations were detected by molecular genetic study.
He was hospitalized in Beijing at the age of 6 months. It was considered that he suffered from congenital hereditary metabolic disease based on the aforementioned characteristics. His blood cell counts, hemoglobin, electrolytes, C-reactive protein, lipids, blood glucose, liver function tests, serum ceruloplasmin, urine gas chromatography-mass spectrometry, tandem mass spectrometry, and biotinidase were unremarkable. 3-hydroxybutyric acid level elevated which suggested ketonuria. Urine neopterin level was within normal limits and biopterin level was slightly lower. As an end product from adrenaline and norepinephrine, the urine vanillylmandelic acid (VMA) level was significantly decreased [2.46 μmol/24 hours, (reference level:11.7–84.6 μmol/24 hours)].
After obtaining informed consent, the genetic analysis revealed 2 heterozygous mutations c.457C>T (paternal) and c.698G>A (maternal) (Figs. and ), which resulted in amino acid changes p.R153X and p.R233H. His parents were subjected to genetic tests, and they proved to be healthy carriers afterwards (Figs. and , Figs. and ) while his elder sister was not subjected to the test. This child was diagnosed with DRD and treated with levodopa.
According to our follow-up, his condition improved dramatically after the treatment with 1/12 tablet of a levodopa 200 mg/benserazide 50 mg combination twice daily. The patient adhered to treatment with help from his parents. He weighed 7.5 kg and could raise his head at the age of 11 months. One month later, he was able to turn over and call “mom” and “dad”. Sitting alone can be maintained for about 10 seconds with the armrest when he was 14 months old. The dose was increased to 1/8 tablet, 3 times per day at the age of 15 months. His parents found no obvious problem during the treatment course. |
pmc-6221852-1 | A 76-year-old woman presented to our hospital with a mass occurring on the skin of her right chest wall. She had been diagnosed with right breast cancer (T1N0M0, stage I) 9 years previously and had received breast-conserving surgery, sentinel lymph node biopsy, and adjuvant chemotherapy and radiation therapy for the residual whole right breast at a previous hospital. She then developed pigmented skin on her right breast 6 years after surgery, and this lesion was diagnosed as an angiosarcoma. The patient underwent a breast mastectomy to treat for RAAS. Following this, however, the angiosarcoma on her chest wall recurred three times within 2 years. The angiosarcoma was resected each time, and she received radiation therapy to her chest wall after the third operation. Four years after the first occurrence of RAAS, we observed light pigmentation and a dark red tumor (gross diameter of 5 mm) on her right chest wall (Fig. ). Clinically, recurrence of RAAS was suspected, and recurrence of angiosarcoma was diagnosed by biopsy. We considered that it was necessary to remove the irradiated skin as much as possible in order to cure the RAAS. After extensive resection of the irradiated skin and tumor, new skin collected from her right thigh was grafted to the site (Fig. ). Pathologically, the tumor size was 6 mm and the surgical margin was negative. Histologically, there were many spindle cells and dilated vascular channels. Immunostaining showed that the tumor was CD31-positive and mildly positive for CD34 (Fig. ). Ki-67 index was also high. It was revealed that there is no inconsistency as recurrence of RAAS is pathological. After the operation, the patient was hospitalized for 30 days and did not experience any complications. Although some reports suggest chemotherapy can be used to treat RAAS, we considered that this option would offer little benefit in this case, because the patient was elderly and had a history of cerebral infarction. Indeed, the patient has remained angiosarcoma-free for the last 3 years following our intervention, even without chemotherapy (Fig. ). |
pmc-6221853-1 | A 75-year-old man was referred to our department for resection for peritoneal metastasis of HCC. Two years before admission, he had undergone transarterial embolization and segmentectomy of segment 6 with open surgery for ruptured HCC. Histologically, the tumor was confirmed as moderately differentiated hepatocellular carcinoma. Follow-up computed tomography (CT) revealed a 12-mm peritoneal metastatic lesion on the abdominal wall near the cut surface of the liver (Fig. ). He had no history of alcohol abuse, hepatitis B or C infection. His liver function was Child-Pugh A, and ICG retention rate at 15 min was 25.2% (normal range; < 10%). Serum α-fetoprotein level and protein induced by vitamin K absence or antagonist-II level were 6.8 ng/mL (normal range; < 10 ng/mL) and 64 mAU/mL (normal range; < 40 mAU/mL), respectively. Contrast-enhanced CT and magnetic resonance imaging revealed that there were no other metastases, and resection of the solitary metastasis was scheduled. ICG was intravenously injected at a dose of 0.5 mg/kg as a routine measure for the evaluation of liver function, 72 h preoperatively. After dissection of the hard and wide range of adhesions, the abdominal cavity was explored with an endoscopic, ICG near-infrared fluorescence (NIF) imaging system (1588 AIM camera system; Stryker Corporation, Kalamazoo, MI, USA) (Fig. ). ICG fluorescence mode revealed clear green fluorescence at the tumor site (Fig. ). The tumor was resected with adequate surgical margin by partial resection of the liver and diaphragm. Immediately after resection, the surgical specimen was sliced in a plane including the lesion, and the presence of fluorescence was confirmed with illumination using the ICG camera system (Fig. , ). The tumor was histologically confirmed as a peritoneal metastasis of HCC, and the surgical margins were negative. To date, no recurrence has been observed after 12 months of follow-up. |
pmc-6221951-1 | The index case was a previously well 6-year-old male, born to non-consanguineous Caucasian parents (family tree, Figure ). He spontaneously developed acute, painful erythema and discoloration of his fingers and toes (Figures ). There were no reported precipitants, specifically no evidence of any intercurrent infection, and no past medical history suggestive of immunodeficiency. On systems review, he reported intermittent non-peritonitic abdominal pain, and arthralgia of knees and ankles. He rapidly deteriorated over the next 48 h, developing critical digital ischaemia of his toes (Figures ).
Laboratory investigations (Supplemental Table ) in the proband revealed normal renal function and blood pressure, and there was no evidence of proteinuria or other organ specific involvement. Chest radiograph, abdominal ultrasonography, echocardiography, and visceral digital subtraction catheter arteriography were all normal. There was only minor elevation of the erythrocyte sedimentation rate (13 mm/hour; reference range [RR] 0-10), and normal C-reactive protein (CRP) < 5 mg/L (RR < 20). All full blood count parameters were normal. Blood film examination was unremarkable. He had low titer antinuclear antibodies (1:160). Other autoantibodies (rheumatoid factor, ANCA, including anti-proteinase 3 and anti-myeloperoxidase; anti-double stranded DNA; anticardiolipin antibodies and lupus anticoagulant; thyroid peroxidase antibodies; and antibodies against extractable nuclear antigens) were all negative. Extensive investigations for an infectious cause of his symptoms were negative, specifically negative mycoplasma pneumoniae serology; and he had negative cryoglobulins. A full prothrombotic workup was also negative. Notably, however, he had persistently low serum C3 (0.22 g/L; RR 0.75–1.65), and normal C4 (0.21 g/L; RR 0.14–0.54); complete absence of alternative complement functional activity (0%, RR >10%); and reduced functional classical pathway activity (31%; RR> 40%; Table ). Low C3, normal C4, absent alternative complement pathway activity, and markedly decreased classical complement pathway activity persisted, and prompted more detailed scrutiny of the complement pathway (see below for complement deficiency work up). Vasodilatory treatment for critical digital ischaemia included oral nifedipine 40 mg/day with little response, and subsequently prostacyclin infusion (20 ng/mg/min continuous infusion over 5 days) to improve the perfusion in his toes. He was also treated with a short course of oral prednisolone (2 mg/kg/day; weaning over 12 weeks), aspirin (5mg/kg /day) and oral azathioprine (2 mg/kg/day), on which he currently remains 12 months later. He made a full recovery with no residual skin lesions or permanent tissue loss. Corticosteroids however were reintroduced with good response 13 months later as there was recurrence of finger ischaemia. C3 remains persistently decreased 0.22 g/L, with normal C4 0.27 g/L despite ongoing treatment.
Table summarizes the genotype and results of complement studies. All experimental work was performed with ethical approval (ethics number: 08H071382) and with written informed consent from all adult participants, assent (where appropriate) for children, and parental consent for children. C3 and C4 measurements were performed using a standard nephelometry assay (BN II Siemens Healthcare UK). Classical and alternative complement assays (EuroDiagnostics, Sweden); MBL assays (BioPorto) were performed by enzyme-linked immunosorbent assay (ELISA). Complement factor I and H were measured at Pathology Imperial College Healthcare, NHS, UK using ELISA (Binding Site, UK). C1q was measured by radial immunodiffusion (RID) and C1q antibodies by ELISA at the Protein Reference Unit Sheffield, UK.
Genetic investigation of the index case (II-1) was performed using our recently developed targeted gene panel for Vasculitis and AutoInflammation Panel (VIP) that contains 201 genes, including 19 pertaining to complement and regulatory proteins (Supplemental Table ) (). This revealed a heterozygous c.3124C>G (p.R1042G) variant in exon 24 of C3 gene, which was confirmed by Sanger sequencing (Figure ). This variant is not reported in the population databases (1000 genomes, ESP 6500, and ExAC) and is predicted to be damaging according to 3 different in silico analysis; SIFT [D], PolyPhen2 [D], and MutationTaster [D]. There were no other class 4 or 5 genetic variants detected in any of the other genes included in the targeted panel for the index case.
Detailed complement studies were undertaken in other first-degree family members and showed low C3 levels, absent alternative complement pathway activity, and markedly decreased classical complement pathway activity in II-2 and I-1. These studies were normal for I-2 and II-3 (Table ). Sanger sequencing in all enrolled family members confirmed that the heterozygous p.R1042G C3 mutation was also present in both II-2 and I-1 and absent in I-2 and II-3 (Figures ). Interestingly I-1 subsequently developed recurrent cutaneous vasculitis (purpuric rashes) and arthralgia (Figure ) with no documented renal abnormalities and required corticosteroid therapy. II-2 was also reporting long standing history of recurrent fingertip erythema with no other systemic symptoms while I-2 and II-3 were asymptomatic (see Supplemental Table for other laboratory tests for I-1 and II-2). |
pmc-6222078-1 | We present the case of a 25 year old lady from Papua New Guinea who was admitted to the Cairns base hospital (CBH) with a 3 day history of abdominal pain and distension on a background of being 20 weeks pregnant. She had a slightly elevated white cell count upon admission, was haemodynamically stable and tolerating oral diet. The patient had last passed a bowel motion 2 days prior.
Plain abdominal X-ray and chest X-ray showed mild gaseous distension of her small bowel and right colon. Her admission diagnosis was possible abdominal tuberculosis (TB) given she had previous TB and was from an endemic area. On day 3 of her admission she became tachycardic and tachypnoeic with a grossly distended abdomen and worsening abdominal pain. She was febrile with a white cell count of 19 × 109/L cells, lactate 3.2 mmol/L and haemoglobin of 126 g/L. An urgent MRI of her abdomen was performed, showing a likely large bowel volvulus with associated free fluid, but no perforation (, ).
Given the patients worsening clinical condition and imaging findings she was taken for an urgent laparotomy. A splenic flexure volvulus with gangrenous colon was found (, ) and the patient underwent a left hemicolectomy and end colostomy. The decision was made not to perform a primary anastomosis given her clinical condition and the risk presented by a potential anastomotic leak adjacent to the gravid uterus. She had pre and postoperative obstetric team review. The patient recovered well and delivered a healthy baby at full term 4 months later. She underwent a reversal of her colostomy 6 months later and was discharged home without incident. Happily both mother and baby were both well at follow up in the outpatient clinic. |
pmc-6222088-1 | A 45-year-old male patient presented to our institute in December 2017. He suffered of kidney failure and multiple myeloma for about 10 years. The patient complained of dysphagia and respiratory difficulty. Clinical examination showed a big swelling of the neck. He had not shown any signs of systemic amyloidosis. There were no symptoms suggestive of hypo- or hyper-thyroidism. Ultrasound showed an increased volume of the thyroid gland (right lobe 49 × 38 × 100 mm; left lobe 41 × 34 × 51 mm.) with involvement of the mediastinum. No lateral cervical lymphadenopathy was appreciated. CT and MRI showed diffuse and multinodular enlargement of both lobes of the thyroid gland, no lateral cervical lymphadenopathy (right lobe reaches C2; left lobe reaches the brachio-cephalic trunk). Fine needle aspiration (FNA), performed in one nodule of 2 cm in its greatest dimension, showed the presence of colloid and histiocytes. The patient underwent total thyroidectomy. The post-operative course was unremarkable.
Grossly, thyroid was diffusely enlarged with a nodular external surface (A). The cut surface showed a soft, irregularly nodular and salmon in color parenchyma (B). Histologically there was a diffuse stromal deposition of amorphus eosinophilic material, reminiscent of fibro-sclerotic changes (C and D). Residual normal-sized or cistically dilated thyroid follicles were seen (C and D). Notably some areas showed a variably fatty stromal component characterized by mature adipocytes (E). This component was interpreted as a fatty stromal metaplasia. PAS staining was negative or only weakly positive in the amorphus eosinophilic stromal material. Conversely, a positive staining was obtained with Rosso Congo stain (apple-green birefringence under polarized light). Based on morphological and histochemical features, the diagnosis of “amyloid goiter” was rendered. |
pmc-6222212-1 | A 66-year-old independently functioning woman presented to the emergency room with an episode of midepigastric and left sternal chest pain. Her medical history included hypertension, hyperlipidemia, glaucoma, and multiple previous episodes of chest pain similar to her current episode that necessitated three separate coronary angiograms which showed no stenotic or occluding lesions in the coronary arteries. The patient described her chest pain as a sensation of burning that started suddenly at 11 pm in the night while she was resting comfortably at home after having dinner. The pain was mild in intensity, nonradiating, and lasted for a few minutes before resolving spontaneously. She denied having any dyspnea, palpitations, dizziness, or loss of consciousness during this episode. She had no history of smoking or illicit drug use. Her home medications included felodipine extended release 5 mg once daily, isosorbide mononitrate extended release 30 mg once daily, atorvastatin 80 mg once daily, losartan 100 mg once daily, hydrochlorothiazide 25 mg once daily, and metoprolol succinate extended release 100 mg once daily. The patient activated emergency medical services immediately after onset of her symptoms, who brought the patient to the emergency room. On arrival in the emergency room, the patient was asymptomatic. Her vital signs were as follows: blood pressure of 168/46 mmHg (right arm, supine position), heart rate of 66/min, respiratory rate of 19/min, and an oral temperature of 97.9 F. An electrocardiogram was obtained which showed a normal sinus cardiac rhythm with a left bundle branch block, possible left ventricular hypertrophy, and T wave inversions in the lateral leads. No ST segment changes were noted (). There were no prior electrocardiograms available for comparison. Her laboratory data included a cardiac troponin level of 0.15 ng/ml. Follow-up cardiac troponin levels obtained 6 and 12 hours later were 4 ng/ml and 9 ng/ml, respectively. The patient continued to be asymptomatic during this time, and a follow-up EKG showed no changes compared to the first EKG (). Her blood pressure, however, continued to remain high during her time in the emergency room with a peak blood pressure recording of 195/43 mmHg. Based on the elevated troponin level up to 9 ng/ml with the absence of ST segment changes on the EKG and the significantly elevated blood pressure, it was decided to admit the patient to the cardiac intensive care unit for treatment of a hypertensive crisis with elevated troponin levels possibly due to a type 2 myocardial infarction. She was given a loading dose of aspirin 325 mg and clopidogrel 300 mg orally and was started on an intravenous heparin drip at 12 units/kg/hour. A onetime dose of hydralazine 5 mg was administered intravenously which was followed by an improvement in the blood pressure to 150/46 mmHg. An echocardiogram was ordered with DEFINITY which showed a small left ventricular cavity with apical hypertrophy, an impaired relaxation pattern during left ventricular diastolic filling, and a left ventricular ejection fraction of 76–80%. The patient subsequently underwent a coronary angiogram the next day through right femoral artery access which showed normal left main, left anterior descending, left circumflex, and right coronary arteries with no stenotic or occluding lesions (). A cardiac left ventriculogram was done by cardiac chamber catheterization during the procedure, which confirmed the echocardiographic finding of apical hypertrophy (). Based on the finding of apical hypertrophic cardiomyopathy, it was decided to start the patient on metoprolol succinate extended release 100 mg daily and verapamil sustained release 180 mg daily. The remainder of the patient's hospitalization was uneventful, with an optimally controlled blood pressure and a downtrend in her cardiac troponin levels, and she was subsequently discharged on the 3rd hospital day. |
pmc-6222214-1 | An 80-year-old Caucasian male presented to emergency room for evaluation of fever, headache, and recurrent falls for 3 weeks. Fever was intermittent, associated with chills at night and occasional occipital headaches, without any nausea, vomiting, visual changes, photophobia, phonophobia, or rash. He also had intermittent dizziness with multiple falls. There was no reported seizure activity or loss of consciousness. Review of symptoms was pertinent for intermittent chest pain, polydipsia, and polyuria but negative for palpitation, cough, shortness of breath, runny nose, ear pain dysuria, and weight loss. Patient had stable angina for which he was on as needed sublingual nitroglycerine; however for last three weeks he reported using the pills more frequently. There was no history of travel, tick bites, or sick contacts. His past medical history was significant for coronary artery disease, cerebrovascular accident with no residual deficit, corrected patent foramen ovale, diabetes mellitus type II, hypertension, hyperlipidemia, benign prostatic hyperplasia, and gout. His medications included aspirin 81mg daily, atorvastatin 80 mg daily, finasteride 5 mg daily, and tamsulosin 0.4 mg daily.
In the emergency room, on physical examination, he was febrile with a temperature of 101.4F, blood pressure of 162/80 mm Hg, pulse rate 110 beats/minute, respiratory rate of 18/minute, and saturating 98% on room air. Cardiovascular examination was significant for sinus tachycardia with a grade 2/6 systolic ejection murmur in aortic area. Respiratory examination revealed normal vesicular breath sounds in bilateral lung fields. Neurological examination was negative for any gross neurological focal deficits. There was no neck rigidity and Kernig's sign was negative. His abdominal examination revealed soft abdomen without any hepatosplenomegaly. Neck was supple without any thyromegaly or tenderness on palpation. There was no lymphadenopathy or skin rash. Rest of the physical examination was unremarkable.
CT head was ordered due to the history of recurrent falls and was pertinent only for small old infarcts in left posterior pons. Patient requested to go home after initial laboratory investigation showed a normal white count () and chest X-ray. Blood and urine cultures were drawn which remained negative. Patient returned after 4 days with no relief in his symptoms and was admitted for further evaluation. Inflammatory markers came back elevated with ESR of 86 mm/hr and CRP of 192 mg/L. Transthoracic and transesophageal echocardiogram were negative for any vegetations. As infectious etiology could not be found, undiagnosed malignancy was next among our differentials and therefore a CT chest, abdomen, and pelvis () with contrast were done which were unrevealing for any occult tumors but to our surprise showed a heterogeneous thyroid gland with surrounding hazy changes suspicious for subacute thyroiditis. Thyroid function tests were done as a follow-up which showed elevated Total T3 (6 ng/dL) and Free T4 (2.55 ng/dL) with low TSH (0.01 mIU/mL) suggestive of hyperthyroidism. Thyroglobulin (TG) antibodies and thyroid peroxidase (TPO) antibodies were undetectable. An ultrasound of the thyroid gland showed enlarged, heterogeneous thyroid gland involving right lobe (6.5 x 3.1 x 2.7 cm) and isthmus (1.4 cm in AP dimension), without any discrete nodules. Doppler studies revealed mildly increased intrinsic vascularity within the right thyroid. Retrospective review revealed TSH of 3.05 mIU/mL, 3 weeks prior to presentation.
Based on above findings, a diagnosis of subacute thyroiditis was made. As patient, received iodine contrast for CT scan of chest, abdomen, and pelvis with contrast, we could not perform radio-active iodine uptake (RAIU) studies. Patient was started on prednisone 40mg daily and dose of carvedilol was also increased from 3.125 mg to 12.5 mg to control cardiovascular symptoms of angina, which could have been related to cardiovascular effects of hyperthyroidism. |
pmc-6222215-1 | A 37-year-old female teacher presented to the ENT clinic with a four-month history of hoarseness and difficulty in voice production. Her background history was significant only for a recent diagnosis of mild hemochromatosis, and she was on no regular medication.
Four months before, she had delivered a healthy baby boy via normal vaginal delivery with epidural analgesia. The delivery was uneventful, aside from issues with assymetrical epidural block requiring manipulation. She did not suffer with postdural puncture headache, and no drops in blood pressure were noted. Immediately postpartum, she noticed marked hoarseness and had difficulty in voice production. She denied any sore throat, dysphagia, or choking episodes.
On examination, she was markedly hoarse, and flexible laryngoscopy revealed left-sided vocal cord paralysis with no evidence of any mass lesions.
Her neurological exam was otherwise normal.
Computed tomography (CT) of the neck and thorax was performed which showed no lesions along the course of the recurrent laryngeal nerve.
She was advised to rest her voice and delay her return to work. She was not prescribed any medication.
On subsequent review the following month, her voice showed marginal improvement; however, on flexible laryngoscopy, the left vocal cord remained paralysed. Two months later, movement had begun to recover, with complete closure of the vocal cords on maximal strain.
By nine months postpartum, her voice had returned to normal, with flexible laryngoscopy demonstrating full return to movement of the left vocal cord. |
pmc-6222219-1 | The patient is a 37-year-old female with a history of epilepsy secondary to astrocytoma that had been surgically resected and followed with radiation and chemotherapy a year prior to the current presentation. Her seizure semiology ranged from focal seizures to generalized tonic-clonic seizures. Her outpatient AEDs included levetiracetam (LEV), valproic acid (VPA), and zonisamide (ZNS). Ten days prior to her presentation, she discovered that she was pregnant and decided to self-discontinue her VPA. She experienced a significant increase in her seizure frequency, for which she was admitted to our neurocritical care unit (NCCU). Initially her home doses of LEV and ZNS were increased from 1500 mg bid to 2000 mg bid and from 200 mg bid to 300 mg bid, respectively. The patient's blood levels of LEV and ZNS on admission were 23 ug/mL and 29 mcg/mL, respectively, which are within therapeutic ranges.
On day 2 of her hospitalization, she was started on daily prenatal vitamins in addition to 4 mg folic acid. Transvaginal ultrasound showed a single intrauterine pregnancy corresponding with a 6-week, 6-day gestation by crown rump length.
The patient continued to have intermittent seizures involving both sides of the face with associated confusion. She was placed on continuous electroencephalogram (EEG) monitoring that showed right hemisphere focal SE. Her seizures continued at a rate of multiple episodes per hour, and she failed to respond to a total of 10 mg of lorazepam administered in 2 mg doses; thus the decision was made to intubate and start anesthetic agents. Continuous propofol infusion was initiated without a bolus dose at a rate of 30 mcg/kg/min and titrated to 45 mcg/kg/min; however, further up titrations were not tolerated because of dose related hypotension. She received a bolus of 80 mg ketamine intravenously (IV) and was started on a continuous ketamine infusion at a rate of 100 mcg/kg/min. Additionally, a continuous infusion of magnesium sulfate was initiated. Her EEG continued to show right focal SE presenting with both clinical and subclinical seizures; thus the ketamine infusion rate was increased to 150 mcg/kg/min. Nine hours after the initiation of ketamine, the seizures stopped both clinically and electrographically. Twenty-four hours later, propofol was discontinued. Twenty-four hours after propofol was stopped, the seizure suppression continued, so the ketamine infusion was gradually decreased to 75 mcg/kg/min while continuing her maintenance AED regimen, which included LEV 3000 mg q8h, ZNS 300 mg bid, oxcarbazepine 300 mg bid, and lacosamide 200 mg bid. On day 7 of ketamine, the infusion rate was decreased to 50 mcg/kg/min for 6 hours, then to 30 mcg/kg/min, and subsequently discontinued. The patient remained seizure-free both clinically and electrographically ().
She remained intubated for a total of 8 days and was successfully extubated. She remained on EEG monitoring for 3 additional days which showed no seizures. After 2 weeks in the NCCU, she was transitioned to a regular floor. On day 18 of her hospitalization, ZNS was discontinued. She remained in the hospital for an additional 5 days, experienced no clinical seizures, and was subsequently discharged home.
Multiple ultrasounds after discharge showed a normal fetus, appropriate to gestational age, and normal amniotic fluids. Fetal echocardiogram showed no evidence of cardiac anomalies. The patient was admitted for elective caesarean section at 37 weeks and 5 days' gestation and delivered a single viable female. The baby scored 9 on both the 1-minute and 5-minute Apgar scores. The patient and the newborn were discharged 4 days postoperatively in stable condition. At the most recent follow-up visit 38 weeks after the birth of the baby discharge she denied any further episodes of status epilepticus. She reported no cognitive deficits or mood changes. Her baby was brought to the clinic and was notably healthy while achieving all normal developmental milestones. |
pmc-6222221-1 | A 39-year-old Thai male patient presented with progressive pain and swelling of seven-month duration over the antecubital fossa of the right elbow. Initially, there was only slight swelling. Three months later, he complained of dull pain. The patient went to a private clinic where the diagnosis was distal biceps tendinitis. The first doctor gave a local steroid injection, but the symptoms recurred about one month later. Four months later, the patient complained of pain at night and weakness on supination of the forearm and flexion of the elbow. He had no underlying disease, chest symptoms, fever, weight loss, or history of contact with patients suffering from pulmonary tuberculosis.
Physical examination of the right elbow when patient visited the hospital in Thailand demonstrated swelling at the antecubital fossa, mild tenderness at the distal biceps, and muscle weakness or pain when attempting to supinate the forearm and flex the elbow. All other systemic examinations were normal. There was a high white blood cell count (12,710 cells/mcL); neutrophil count was 72% and lymphocyte count 17%. Erythrocyte sedimentation rate was 17 mm/hr, and C-reactive protein was 6.69 mg/L. Radiography of the right elbow showed swelling at the antecubital fossa, and chest radiographs showed infiltration of the left upper lung. Magnetic resonance images showed disruption of the distal biceps tendon with an associated ill-defined soft tissue mass (about 2 × 2 cm). A less enhanced area was observed at the inferior part, which was likely to be necrotic or cystic. An abnormal marrow signal was detected at the proximal radius with focal cortical erosion at the radial tuberosity ().
In this case, we suspected that the patient had disseminated tuberculosis because preoperative chest radiographs demonstrated left upper lung infiltration, which was likely pulmonary tuberculosis, and there was a soft tissue mass at the distal biceps tendon. We performed an open excisional biopsy and debridement using the single-incision anterior approach. The finding was a soft tissue mass involving the distal biceps tendon with complete tendon rupture. There was also a small focal cortical defect at the radial tuberosity. The ruptured distal biceps tendon was debrided. The tendon was repaired to the long-head tendon insertion, which was proximal to the focal defect by about 5 mm, using a TWINFIX Ti 2.8 mm Suture Anchor with one #2 ULTRABRAID Suture (Smith & Nephew Inc.). Antituberculosis chemotherapy started one day after the surgery, following a positive test of the fluid for acid-fast bacilli and a positive polymerase chain reaction for Mycobacterium tuberculosis. The patient received a total of 6 months of a rifampin-based regimen, which is recommended for musculoskeletal tuberculosis []. The patient initially received isoniazid 300 mg, rifampicin 600 mg, ethambutol 800 mg, and pyrazinamide 1500 mg daily for two months and then reduced to isoniazid and rifampicin for the remaining four months. The elbow was immobilized in a posterior elbow slab with the forearm supinated for four weeks. Mycobacterium culture revealed Mycobacterium tuberculosis. Microscopic examination of the soft tissue revealed granulomatous inflammation with multinucleated Langhans giant cells and caseous necrosis.
At the 1-year follow-up, erythrocyte sedimentation rate was 10 mm/hr, and C-reactive protein was 2 mg/L. Motor power of supination and flexion showed grade V and the hook test was negative. This study was approved by the Khon Kaen University Ethics Committee for Human Research (KKUEC) in which the study ID was HE611179. |
pmc-6222224-1 | A 46-year-old female patient underwent a left hip resurfacing arthroplasty (Birmingham®, UK) for severe hip osteoarthritis, secondary to developmental hip dysplasia, in 2005. She had a good initial outcome with no complications. The surgery was performed in another centre.
She consulted with us for the first time six years later (2011) complaining about hip pain and paresthesia in the anterior left thigh, which progressively compromised her function. She denied fever or other signs of infection. Physical exams revealed a mild claudication gait and limited active and passive hip flexion. No palpable masses or skin lesions were observed. Laboratory analyses showed a WBC, ESR, and CRP within normal limits. No signs of osteolysis were found in the hip anteroposterior radiography; nevertheless, a vertical cup was noted (). It was compared with the immediate postsurgery radiography, and no change was noted.
Computed tomography and an MRI demonstrated a biloculate hypodense mass of approximately 34 × 19 cm that extended from the retroperitoneum, compromising the left iliopsoas muscle and an intimate contact with the femoral vessels, to the left hip and the left femoral-cutaneous nerve (Figures and ). A routine hip arthrocentesis was performed to rule out infection. The cytochemical and Gram analyses were negative for infection. Cultures were negative after 14 days.
Thus, a pseudotumour was the diagnosis, and surgery led by an orthopaedic surgeon and a coloproctology surgeon was planned. The aim was to remove the pseudotumor entirely and to perform an RHA. As the CT shows (), the intrapelvic mass was significant, so it was decided to start with a laparotomy by the coloproctology surgeon.
First, the patient was positioned supine, and an infraumbilical laparotomy was performed; the left paracolic gutter was dissected to address the retroperitoneum. The iliac vessels and the left ureter were protected, and an irregular cystic mass was observed in direct contact with the psoas muscle and femoral bundle. It was punctured, and an abundant grey milky-like fluid was obtained. The membrane of the cyst was carefully removed, protecting the vessels and the femoral nerve. The lesion was completely resected, and samples were sent for biopsy and cultures ().
Then, the patient was repositioned in lateral decubitus, and a posterolateral hip approach was performed. The capsule was looking distend; it was punctured and then, a 30 cc fluid was obtained, similar to the liquid found in the retroperitoneum. After capsulotomy and femoral neck osteotomy, all arthroplasty components were removed, noticing an anterosuperior wall defect in the acetabulum. After complete pseudotumour resection, RHA was performed (). The acetabular cup component was a cementless 56 mm Dynasty® (Wright Medical, Memphis, USA), and the femoral component was a high offset femoral cementless stem (Stellaris®, Mathys, Bettlach, Switzerland, no. 17). The bearing surface used was polyethylene-ceramic, being Dynasty® polyethylene liner, on the acetabulum and a 40 mm ceramic on the femoral head (BIOLOX®, Mathys, Bettlach, Switzerland). Post surgery, an anteroposterior pelvic radiograph was taken (). After fourteen days, tissue cultures obtained at surgery were negative for infection.
Histopathological findings confirm the pseudotumour. The analyses reported an extensive aseptic inflammatory infiltrate of macrophages with detritus inside near a necrotic tissue area (). A PAS histochemical stain confirmed these findings. No signs of ALVAL were observed. Also, reparative tissue was found with black particulate material corresponding to the prosthetic material near the neoformation of blood vessels and fibroblast ().
No early- or late-surgery complication is reported. Since post surgery, the patient progressively recovers the hip's range of motion and normal gait. In the last follow-up, 60 months postoperatively, the patient is in excellent condition with no functional limitations and a full hip range of motion. Radiological exams, which included an annual MRI, showed no pseudotumour formation and no arthroplasty loosening. The MRI at five years of follow-up is shown in . |
pmc-6222226-1 | An 18-year-old female presented to our hospital with chief complaints of progressive fatigue, fever, myalgia, and shortness of breath for last 3 weeks. There was no significant past illness. There was no history of significant weight loss, cough, orthopnea, pain abdomen. On physical examination, she was febrile, pale, and icteric. The spleen was palpable 2 cm below the left costal margin. Her pulse rate was 102/minute with a blood pressure of 106/70 mmHg.
A complete blood count (CBC) revealed severe anemia (hemoglobin—5.8 g/dl, mean corpuscular volume (MCV)—92 fl) with a platelet count of 148 × 103/µL and white blood cell count (WBC) of 3.37 × 103/µL. A peripheral blood smear showed few spherocytes, nucleated red blood cells. Biochemistry showed indirect hyperbilirubinemia with high lactate dehydrogenase (LDH—1540 IU/L). On further investigations, corrected reticulocyte count was 5.4%. A direct Coombs test was strongly positive (4+). Based on initial investigations, we made an initial diagnosis of autoimmune hemolytic anemia. Viral markers (HIV, HBs Ag, anti-HCV) were negative. Serology for Epstein–Barr virus (EBV) and mycoplasma was also negative. Antinuclear antibodies were absent. Our patient remained febrile during hospitalisation, which was not explained by hemolytic anemia; on further evaluation, there was a recent history of consumption of unpasteurized milk. Since Brucella is one of the common zoonotic diseases in western India, we suspected brucellosis. The serology for brucellosis was positive in high titre (standard agglutination test—1:640). The diagnosis was confirmed with positive blood culture for Brucella melitensis. We made a final diagnosis of acute brucellosis with Coombs-positive hemolytic anemia. The patient was prescribed a combination of oral doxycycline (100 mg twice a day) with rifampicin (600 mg once a day). She was also prescribed corticosteroids (prednisolone 1 mg/kg/day). 1 week after starting steroids, the patient showed significant clinical improvement with a hemoglobin count of 9 gm/dl and serum LDH of 988 IU/L. The patient was discharged, and steroid was gradually tapered with doxycycline, and rifampicin was advised for further 5 weeks. After 6 weeks, corticosteroid was tapered successfully. The patient was symptomatically better with a hemoglobin count of 13 gm/dl (). She was doing well with complete remission of hemolytic anemia at 3-month follow-up. |
pmc-6222232-1 | A 28-year-old male patient with Type II Rothmund-Thomson syndrome presented to his physician with an enlarged left supraclavicular (Virchow's) node. Due to his syndrome, he had a small build, areas of skin hyperpigmentation, early skin aging with actinic keratoses, sparse thin hair, abnormal skeletal development, and osteoporotic brittle bones with a history of 18 fractures. Previously, at age 25, a lesion at the base of the penis was excised which was diagnosed as Bowen's disease. At the time of presentation, a neck ultrasound confirmed an enlarged 1.8 cm left supraclavicular node which appeared to be avascular. A chest X-ray and abdominal ultrasound were performed at that time which were normal. An outpatient referral was made to a local surgeon.
Two months later, he presented to a community hospital with a three-week history of progressively worsening postprandial vomiting and upper abdominal pain. At that time, he was not tolerating any oral intake. A repeat ultrasound demonstrated a concerning mass on the left lateral aspect of the aorta. An esophagogastroduodenoscopy was done urgently, and a polyp was found in the 2nd part of the duodenum as well as an inflamed and friable obstructing lesion in the 3rd part of the duodenum. The scope could not be advanced beyond this point. Biopsies taken at the time of endoscopy revealed high grade invasive mucinous adenocarcinoma of the signet ring cell type with neuroendocrine features at the site of the obstructing lesion. The biopsies of the polyp demonstrated high grade intramucosal mucinous adenocarcinoma arising within a tubulovillous adenomatous polyp.
He was transferred to our institution to undergo further imaging and management. At that time, his functional status was poor. He had lost approximately 25 lbs and had an ECoG performance status of 3 to 4. On examination, a fullness in the epigastrium was noted. The CT scan demonstrated a large distal duodenal mass with extensive lymphadenopathy, as well as a nodule in the right upper lobe of the lung. Attempts to place a duodenal stent across the lesion were unsuccessful. He underwent palliative radiotherapy and subsequently underwent a laparotomy and gastrojejunostomy to bypass the obstructing lesion. The patient declined systemic chemotherapy and was treated with palliative intent, as per his goals of care, which allowed him to return home to be with his family.
He developed Herpes Zoster shortly after his discharge and was treated as an outpatient with oral antiviral therapy. Two months after his diagnosis of duodenal adenocarcinoma, he presented to the hospital with significant shortness of breath. Additional imaging was done which revealed multiple masses in the right lung, significantly increased mediastinal adenopathy compressing the pulmonary artery, postobstructive pneumonitis in the right lower lobe, and airspace disease suspicious for aspiration bilaterally. He progressively worsened despite supportive care and passed away shortly thereafter. |
pmc-6222233-1 | A 44-year old male with medical history of morbid obesity, diabetes mellitus, end stage renal disease, and osteomyelitis presented to our emergency department (ED) with the chief complaint of penile swelling. Nine days prior to presentation, the patient sustained an unintentional bite injury to the penis while receiving oral intercourse. Following the injury, he described worsening swelling, redness, penile discharge, pain, and inability to retract foreskin due to pain. The patient was initially treated for suspected balanitis with a seven-day course of an oral first generation cephalosporin, Keflex, and an oral anti-fungal, fluconazole, with plans for outpatient follow-up in the urology clinic. When the patient presented to the urology clinic the following week, he was found to have worsening tenderness and induration of his penis with phimosis and purulent drainage. An urgent computed tomography (CT) scan was performed showing subcutaneous emphysema involving the dorsal aspect of the penis concerning for a necrotizing soft tissue infection. The patient was subsequently taken to the operating room urgently for penile exploration and debridement.
Examination under anesthesia demonstrated phimosis with purulent drainage from the phimotic ring as well as induration of the penile shaft (). A dorsal midline incision was made through the foreskin to expose the glans of the penis and the penis was completely degloved down to the base. There appeared to be necrotic, nonviable tissue involving the dorsal aspect of the glans and shaft of the penis (). All nonviable tissue was sharply debrided and the remaining tissue of the proximal shaft and ventral aspect of the penis appeared viable (). The penis was irrigated using a PulsaVacR and the edges of the foreskin were reapproximated with running 3-0 chromic suture. The penis was dressed with XeroformR gauze and Kerlix moistening in saline. Preliminary culture results obtained from the necrotic tissue collected during the surgery revealed a likely polymicrobial infection. Therefore, treatment with intravenous clindamycin, cefepime, and vancomycin was initiated.
Two days following the initial debridement, the patient returned to the operating room (OR) for a repeat exam under anesthesia and further debridement. On initial exam, the dorsal aspect of the glans and shaft of the penis were found to be necrotic and nonviable (). All nonviable tissue was then sharply excised from the dorsal aspect of the glans moving ventrally. As there was no visible, salvageable glandular tissue, we performed a complete glansectomy using sharp dissection. The necrotic tissue on the dorsal aspect of the penile shaft was shaved until we encountered viable, bleeding tissue from the corpora of the mid-shaft. The distal urethra was sharply resected during removal of the glans of the penis. The distal urethral remnant was then spatulated in the epithelial edges of the new widely patient urethral meatus and the edges were reapproximated using interrupted 3-0 Vicryl suture. The corpora of the penile shaft was then reapproximated in a tubularized fashion using interrupted 2-0 Vicryl suture through the tunica albuginea (). Once the shaft was reapproximated and hemostasis had been ensured, PulsaVacR was used to irrigate the wound with 3 L of sterile normal saline and the penile shaft was dressed with Kerlix moistened in saline. Plastic surgery was consulted for intraoperative evaluation with possible grafting and/or other types of wound coverage with plans for returning to the OR.
Five days later the patient returned to the OR for a final surgery, which included wound coverage. On initial exam, the patient had 6 cm of residual penile shaft. There was fibrinous material on the left lateral aspect of the dorsal shaft and around the base of the penis. All remaining nonviable tissue was debrided. We then used the PulsaVacR to irrigate with 3 L of normal saline mixed with 160 mg of gentamicin. The soft tissue defect around the base of the penis was closed using 4-0 Monocryl interrupted vertical mattress suture. Anchoring sutures were placed at the dorsal base of the penis between Buck's fascia and the dermis of the skin using interrupted 3-0 Vicryl. Length and width of the shaft following closure at the based of the penis measured 7 cm and 9 cm, respectively, resulting in about 1 cm of penile shaft length gained by adding these sutures. We then turned our attention towards the wound coverage. We opted for split thickness skin grafting given the wound bed viable aspect. A rectangular area of the left anterior thigh was chosen as a donor site for skin harvest. Using a dermatome, a split thickness skin graft measuring 0.1 – 0.2 mm in depth, 7 cm in length, and 9 cm in width was harvested. The graft was wrapped around the shaft of the penis and secured into place using anchoring interrupted 4-0 chromic suture (Figures and ). Once the graft was secured on the shaft of the penis, a new 16 Fr Foley was placed, followed by application of a MepiTEL AGR (Molnlyche) dressing that was wrapped around the graft to protect from adhering to negative pressure therapy device (Wound V.A.C.R) foam, and the shaft was covered using 2 pieces of black foam and wound V.A.C.R drape.
The patient continued to do well postoperatively. Intraoperative cultures ultimately grew Escherichia coli, Enterococcus avium, and Gamella morbillorum. He remained on broad spectrum IV antibiotics throughout his hospitalization for a total of 13 days. He was discharged home with 2 weeks of Amoxicillin-clavulanate and Clindamycin. He returned to urology and plastic surgery clinic three weeks later for follow-up where he demonstrated overall clinical improvement. His penile wounds continued to heal and his Foley catheter was removed. |
pmc-6222242-1 | An 80-year-old woman fell in her bathroom at home and experienced acute-onset low back pain. Following a plain radiograph, she was diagnosed with a L2 compression fracture and began conservative treatment. One month after the injury, she began experiencing severe radicular pain when walking, with no obvious precipitant. After 3 months of treatment, she visited our university hospital as the cause of her radicular pain was still unclear. On lying supine, she had no pain, but when she stood up or walked, she experienced severe pain in the inside of her thigh in addition to mild lower back pain. Magnetic resonance imaging showed a change in the signal intensity within the L2 vertebral body (), but little canal stenosis at the L2, and L2/3 levels (Figures and ). Computed tomography demonstrated a bone tip under the pedicle (). A left L2 root block was effective in reducing her pain temporarily. Radiography demonstrated compression of the L2 root in the foramen (). In the case like this with nonunion, fusion surgery is usually undergone. The patient were very old and with poor condition for surgery; further, the patient had little low back pain. We explained the risk without fusion surgery to the patient and attempted to decompress the L2 root using spinal endoscopy.
The patient was able to walk the day after surgery. No complications related to surgery occurred perioperatively, and her pain was relieved immediately. Her preoperative Japanese Orthopedic Association (0–29) and visual analog scale (0–100) scores were 9 and 82, respectively, and at the 36-month follow-up, scores changed to 19 and 34, respectively. |
pmc-6222999-1 | An 84-year-old man presented with a slow-growing mass on the left upper eyelid for one year with no treatment. On examination, a 30 × 25 mm hard mass involving the tarsus was observed (Fig. ). No other ophthalmologic abnormality was detected. We performed complete excision (Fig. , approximately 75% defect) and eyelid reconstruction with our procedure. The histopathologic diagnosis was sebaceous gland carcinoma. We incised the skin along the mark according to the McGregor procedure and undermined the skin-orbicularis flap. Subsequently, we vertically incised the lower eyelid tarsus and disconnected the retractor and conjunctiva of the lateral tarsus, sparing the orbicularis and eyelid skin (Fig. ). We made two lateral periosteal flaps (Fig. ) and connected the inferior flap to the nasal tarsus of the lower eyelid. Then, we rotated the tarsus and connected it to the remnant nasal tarsus of the upper eyelid, levator and superior lateral periosteal flap (Fig. ). Finally, we sutured the skin-orbicularis flap (Fig. ). We divided the flap during a second stage 3 months later. Good functional and aesthetic results were achieved for the eyelid (Fig. ). The surgical video is available in Additional file . |
pmc-6222999-2 | A 66-year-old woman presented with a recurrent mass on the right upper eyelid. She underwent local surgical excision twice at other clinics with no pathologic diagnosis. There was no evidence of regional lymph node involvement or distant metastases. On examination, a 10 × 7 mm hard mass involving the eyelid margin and tarsus was observed. After completely excising the mass (Fig. , approximately 50% defect), we performed the procedures similar to Case 1 (Fig. ) except that we connected the temporal tarsus of the lower eyelid with the remnant temporal tarsus of the upper eyelid (Fig. ) and rotated the combined tarsus to reconstruct the posterior lamellar defect of the upper eyelid. The histopathologic diagnosis was sebaceous gland carcinoma. A satisfactory result was achieved (Fig. ). |
pmc-6222999-3 | A 78-year-old woman complained of a severe foreign body sensation after upper eyelid tumour (sebaceous gland carcinoma) excision at another clinic. On examination, the upper eyelid skin was found to overturn inwards and to be in contact with the cornea (Fig. , eyelid margin defect approximately 90%). We performed similar procedures mainly to reconstruct the posterior lamella (Fig. ). The patient confirmed that the foreign body sensation had completely vanished after the surgery through telephone follow-up. However, she was unable to return to our clinic because of the long distance required for such travel. The video of the first stage surgery is available in Additional file . |
pmc-6223005-1 | A 54-year-old woman with no previous comorbidity was brought to our Emergency Department for further evaluation of increased levels of muscle enzymes and cardiac enzymes. Prior to admission, she was admitted in a local clinic with myalgia in the upper and lower limbs, oedema and a fever of 7 days’ duration. She was diagnosed clinically with scrub typhus by the presence of an eschar in the area of the right shin and was treated with 100 mg doxycycline for 2 days. The occupation of patient was housewife. Upon our physical examination, the blood pressure was 120/80 mmHg, the pulse rate was 101 beats/min, the respiratory rate was 18 breaths/min, and the body temperature was 36.7 °C. She was alert and fully oriented. Auscultation of both lungs revealed mild rales in both lower lobes. No heart murmur was audible. The eschar was observed in the area of the right shin.
An electrocardiogram (ECG) performed in the emergency room showed a normal sinus rhythm with a low QRS voltage in all limb leads and precordial leads (Fig. ). Chest X-ray revealed a slightly increased cardiothoracic ratio. Laboratory testing showed elevation of the following parameters: white blood cell count (15,980/μL, normal = 4000–10,800/μL), erythrocyte sedimentation rate (35 mm/hr., normal range = 0–30 mm/hr), C-reactive protein (2.13 mg/dL, normal = 0–0.3 mg/dL), aspartate aminotransferase (75.9 IU/L, normal = 10–40 IU/L), creatine phosphokinase (CPK) (3337 U/L, normal = 55–215 U/L), creatinine kinase-myocardial band (CK-MB) (104.6 ng/mL, normal = 0–4.88 ng/mL), troponin I (0.055 ng/mL, normal = 0–0.016 ng/mL), myoglobin (2498 ng/mL, normal = 25–58 ng/mL), prohormone of brain natriuretic peptide (proBNP) (477.6 pg/mL, normal = 0–270 pg/mL) and blood urea nitrogen (36.4 mg/dL, normal = 8.0–20 mg/dL). Additionally, laboratory testing showed normal levels of creatine (0.66 mg/dL, normal = 0.5–1.3 mg/dL) and potassium (4.4 mEq/L, normal = 3.5–5.0 mEq/L) and a decreased level of albumin (3.07 g/dL, normal = 3.5–5.2 g/dL). Transthoracic echocardiography (TTE) revealed normal left ventricular systolic function with an ejection fraction of 62%, along with mild pericardial effusion (Fig. ).
First of all, scrub typhus with rhabdomyolysis was suspected, administration of intravenous fluid and doxycycline (200 mg/day) was initiated immediately. We confirmed that the serum indirect immunofluorescence assay (IFA) IgM titer against O. tsutsugamushi was < 1:16 and that the IgG titer was 1:4096. In addition, the nested polymerase chain reaction (PCR) targeting the O. tsutsugamushi 56-kDa protein-encoding gene was negative in a specimen from the blood buffy coat, but positive in an eschar specimen. A comparative analysis of the O. tsutsugamushi DNA sequence obtained from the eschar with sequences in the GenBank database confirmed that the patient was infected with the Boryong genotype []. PCR tests to detect Hantavirus, severe fever thrombocytopenia syndrome virus, and species of Anaplasma, Ehrlichia, and Borrelia were all negative [–] (Table ).
During the patient’s hospitalization, muscle enzyme and cardiac enzyme levels increased continuously. On day 3 of hospitalization, the creatine phosphokinase level was 18,262 U/L (normal = 55–215 U/L), the CK-MB level was 272.3 ng/mL (normal = 0–4.88 ng/mL), the troponin I level was 1.62 ng/mL (normal = 0–0.016 ng/mL) and the myoglobin level peaked at 3000 ng/mL (normal = 25–58 ng/mL). Despite the lack of specific symptoms, we suspected myocarditis based on the ECG results, TTE imaging findings and the rapid increase in cardiac enzyme levels. Therefore, cardiac magnetic resonance imaging (MRI) was performed. The cardiac MRI demonstrated normal left ventricular function (58.9%) with a large amount of pericardial effusion. The delayed enhancement images revealed a subepicardial enhancement involving the basal lateral, mid anteroseptal, mid anterior and apical segments of the left ventricle wall (Fig. , ).
On day 5 of hospitalization, we performed pericardiocentesis due to the large amount of pericardial effusion without concomitant tamponade physiology, and 195 cc of serous pericardial fluid was aspirated. The pericardial fluid and buffy coat of the patient was inoculated onto L929 cells to isolate the causative microorganisms, but no microorganisms could be isolated. Real-time PCR targeting the O. tsutsugamushi 16S rRNA gene using a pericardial fluid specimen showed a positive result at a crossing point cycle (Cp) of 32.3, and qPCR using an eschar specimen was positive at a Cp of 35.97 [] (Fig. ). The pericardial fluid analysis showed a white blood cell count of 150/mm3 (80% monocytes), a total protein level of 4.08 g/dL, a fluid/serum protein ratio of 0.77, a lactate dehydrogenase (LDH) level of 764 U/L, and a fluid/serum LDH ratio of 0.65. By these results, the pericardial fluid was classified as an exudate []. The adenosine deaminase level was 21.7 U/L (normal = 5.8–23 U/L), the bacterial and fungal cultures were sterile, and the IFA IgM titer against O. tsutsugamushi was < 1:16 but the IgG titer was 1:2048 in the pericardial fluid. On the same day, coronary angiography for a differential diagnosis of myocardial infarction revealed no abnormalities. Based on the cardiac MRI results, we performed endomyocardial biopsy (EMB) to evaluate a definite diagnosis of myocarditis. The biopsy specimen consisted of five pieces, which was barely sufficient for real-time PCR, but the pathology report indicated that the specimens contained inadequate tissue for definitive diagnosis. However, we could confirm the diagnosis of scrub typhus myocarditis based on the elevated cardiac enzymes, the pericardial fluid analysis results, and the TTE and cardiac MRI imaging findings. On day of 8 of hospitalization, a follow-up TTE revealed normal left ventricular function with no pericardial effusion.
On day 10 of hospitalization, we also confirmed the diagnosis of rhabdomyolysis from the bone scan, which revealed increased soft tissue uptake in both arms and legs (Fig. ). The patient was given continuous intravenous fluid and diuretics for the management of rhabdomyolysis, a 6-day course of doxycycline for the scrub typhus infection and conservative therapy for myocarditis. The patient’s renal function and potassium level remained within the normal range throughout the hospitalization. The cardiac enzyme and muscle enzyme levels decreased. On day 16 of hospitalization, the CPK level had decreased to 595 U/L (normal = 55–215 U/L), the CK-MB level was within the normal range at 4.140 ng/mL (normal = 0–4.88 ng/mL) and the troponin I level had decreased to 0.096 ng/mL (normal = 0–0.016 ng/mL). The patient was discharged on day 17 of hospitalization after resolution of her presenting symptoms. |
pmc-6223010-1 | A 12-year-old German boy suffered from an accidental electrocution with 15,000 volts as he was playing in a railroad car. The boy was intubated at the site of the accident and immediately admitted to our burn care unit with deep partial-thickness and full-thickness burns. He sustained a 70% total body surface area (TBSA) burn of the face, neck, spine, thorax, abdomen, both arms, and both legs (Fig. ). A source lesion was noted on his right shoulder, and a ground lesion was visible on his right thigh. Directly after the admission, escharotomy and tracheostomy took place. In the first 24 to 48 hours after the removal of blisters a “wet-wound-dressing” with paraffin gauze dressing and polyhexanide solution was applied.
He was resuscitated according to the Parkland formula. In the first 24 hours, only Ringer lactate solutions and no colloids were used. He was started on a high-calorie diet (enteral feeding). Cardiac monitoring was done for 24 hours and no cardiac dysrhythmias were observed.
Within the first 3 weeks seven operations were performed including dermabrasion, application of Suprathel® (PolyMedics Innovations GmbH, Denkendorf, Germany), tangential excision and split-thickness skin graft, epifascial excision, application of Integra™ (Integra LifeSciences Corp., Plainsboro, NJ, USA), and autologous keratinocyte transplantation.
The duration of the mechanical ventilation reached 85 days.
In the course of the stationary treatment (135 days) he developed acute renal failure treated with veno-venous hemofiltration for 7 days and acute liver failure treated conservatively.
The boy developed persisting hypotension, edema, and ascites after the 10th week postburn. The hypotension required dobutamine therapy. A chest X-ray showed an increase of the cardiothoracic ratio from 0.50 (at the time of admission) to 0.63 (at this critical point) (Fig. ). In order to clarify this persisting hypotension, a second echocardiography was performed. The first echocardiography was performed 4 weeks after the accident proving the healthy initial condition of the heart of our young patient. A four-chamber DCM with biventricular dysfunction was diagnosed 13 weeks after the accident: left ventricular ejection fraction (LV-EF) 18% (Fig. ).
The most common possible causes of DCM (viruses, infections, drugs, toxins, endocrinologic disorders, metabolic disorders, and arrhythmia) were tested and excluded.
Inotropic therapy was initially required. It began with digitalis and then an application with phosphodiesterase inhibitor (milrinone) followed. A diuretic therapy with torasemide was also applied. Then, heart failure therapy followed with angiotensin-converting enzyme (ACE) inhibitor (enalapril), beta blocker, diuretics, and digoxin.
At the point of hospital discharge there was an increase of EF (22%) as well as an increase of the contractility of his heart. The LV end diastolic diameter (LVEDD) reached 58 mm.
One year after the accident, echocardiography showed a normal function of his heart with 64% EF and normal cavities’ dimensions (LVEDD 51 mm). No mitral and tricuspid insufficiency was present. |
pmc-6223034-1 | A 7-year-old, 18 kg, ASA-PS 1 boy, with congenital bilateral sensorineural deafness and failed right cochlear implant. He underwent a Magnetic Resonance Imaging (MRI) before transfer to operating theatre for ABI insertion. During the MRI, his airway was secured with a size 5.5 mm internal-diameter (I.D.) uncuffed ETT.
Planned intraoperative neurophysiology monitoring included brainstem auditory sensory evoked potentials, brainstem mapping of CN IX, X, XI, XII and their motor nuclei, and corticobulbar tract motor-evoked potential (MEP). Lead placement for CN IX, X, XI, XII was performed by the anesthesia team.
CN X monitoring (Fig. ) was performed using a 32 mm by 29 mm laryngeal electrode (Inomed, Emmendingen, Germany). To identify optimal electrode placement on the tracheal tube, the patient was positioned as intended for surgery (right lateral), and the depth of ETT corresponding to the laryngeal inlet was identified using C-MAC Laryngoscope (KARL STORZ, Deutschland). This corresponded to 6 cm at vocal cords (15 cm at lips). A new #5.5 uncuffed ETT was then prepared with the laryngeal electrodes (Fig. ) and the child re-intubated, in keeping with the measurements. Using C-MAC, the pin electrode for CN IX was placed on the ipsilateral soft palate; electrodes for CN XII were placed on the anterior tongue. Rolled up gauzes were placed on either side of the tracheal tube (Fig. ) to stabilize the tracheal tube, and as a bite block.
Total intravenous anesthesia (TIVA) included propofol (Paedsfusor Target Control Infusion, target plasma concentration 3.5–5.0 mcg/ml) [], remifentanil (0.08–0.3 mcg/kg/min) and ketamine (0.2–0.33 mcg/kg/min). Analgesia included intravenous paracetamol 15 mg/kg, morphine 2.5 mg and local anesthetic infiltration. Anti-emetics (dexamethasone 0.2 mg/kg, ondansetron 0.1 mg/kg) were administered. Surgery was uneventful except for 3 episodes of transient bradycardia (40/min). Duration of procedure, including MRI was 9 h. |
pmc-6223034-2 | A 6-year old girl, 18.9 kg, ASA-PS 1, with congenitally bilaterally absent cochlear nerves scheduled for a right ABI implant.
A #2.5 laryngeal mask was used during pre-operative MRI, and changed to a #5.0 mm-internal-diameter microcuff tube for surgery.
The CN X electrode was wrapped above the ETT cuff at the level of the intubation depth marker (4 cm). The patient was then intubated using a C-MAC Pocket Monitor (KARL STORZ, Deutschland), the ETT secured at the depth of 4 cm at vocal cords, 12 cm at lips. Subsequently, the anesthetist placed intraoral electrodes, and the patient was then positioned for surgery.
Total intravenous anesthesia (TIVA) was conducted with propofol and remifentanil. Analgesia included paracetamol, morphine, and local anesthetic infiltration. Dual antiemetics, dexamethasone and ondansetron were administered. The procedure was uneventful.
In both, laryngoscopy at the end of procedure revealed cranially displaced tracheal tubes (Fig. ). Both patients experienced nausea with poor appetite for 2 days despite anti-emetics. |
pmc-6223070-1 | A 53-year old white male was referred to University Hospital Limerick with a macular rash on extensor aspects of upper limb and torso, bilateral loin pain, arthralgia, fatigue, active urinary sediment and acute kidney injury in August 2015. The current presentation was preceded by two previous episodes of illness in which he had reported similar symptoms along with haemoptysis in April and July 2014. Past medical history revealed the presence of a peripapilary melanoma of the left eye treated with radiotherapy in 2010 and a basal cell carcinoma of the mid-back excised in 2000. The patient denied tobacco use and drank occasionally and denied any family history off kidney disease. He worked on a farm and was married with two children. On presentation his blood pressure was 124/70 mmHg, weight 91 kg, and there was evidence of macular rash on his back but no lower limb oedema. Urine evaluation demonstrated activity with 3+ protein and 3+ blood, and his serum creatinine was elevated at 128 μmol/L compared to a baseline of 116 μmol/L recorded in April 2014. Serology was positive for P-ANCA with a titre of 160 and he had an anti-MPO titre of over 200 units/mL; apart from this ANA was positive with a titre of 1600 with negative Anti-dsDNA, Anti-Sm, Anti-Sm/RNP and Anti-SSB/RO/LA; Serology for HIV 1 + 2 Ag/Ab and Hepatitis BsAg & Hepatitis C antibody were negative; complement levels were within normal range C3 of 0.82 g/L and C4 of 0.24 g/L. ESR was 30 mm/h and Hs-CRP was 48 mg/L; rest of his routine bloods were unremarkable (White cell count 5.8 × 109/L, haemoglobin 13.5 g/dL, neutrophils 4.00 × 109/L, platelet 210 × 109/L, sodium 141 mmol/L, potassium 4.2 mmol/L, total protein 69 g/L, albumin 39 g/L, serum calcium 2.31 mmol/L, serum phosphate 1.09 mmol/L, bilirubin 7.3 µmol/L, alkaline phosphatase 81 IU/L, gamma-glutamyl transferase 25 IU/L, alanine-aminotransferase 39 IU/L, prothrombin time 12.0 s, activated partial thromboplastin time 32.0 s). Chest X-ray was normal. A recent ultrasound of his kidneys demonstrated normal size and shape with normal cortex. A native kidney biopsy revealed evidence of moderate arteriosclerosis with 30–35% fibrosis, areas of thrombotic microangiopathy but without evidence of fibrinoid necrosis or epithelial crescents. Immunofluorescence was negative and electron microscopy revealed thin glomerular basement membranes with mean measurements less than 250 nM and many measurements less than 200 nM, consistent with thin basement membrane disease (TBMD).
Based on the presence of an AKI with active urine sediment, associated skin rash, and positive serology with high titres of P-ANCA and anti-MPO along with an antecedent history of haemoptysis, we diagnosed an ANCA-associated vasculitis likely microscopic polyangiitis (MPA) based on the European Medicines Agency Algorithm, although the kidney biopsy sample failed to demonstrate classical features of renal vasculitis []. Treatment was initiated with corticosteroids and intravenous rituximab infusions (at day 0 and day 18) with prophylaxis for pneumocystis (co-trimoxazole), osteoporosis (oral Vitamin D3 and bisphosphonates), and gastritis (proton pump inhibitor). Four weeks later his urine sediment normalised with no detectable blood or protein; his CRP fell to < 5 mg/L and his ANCA titres fell to 40 but his anti-MPO level remained remarkably high 198 IU/mL. Two months later, he developed severe depression attributed to steroids requiring taper and the initiation of anti-psychotic therapy.
Six months following initial presentation, his vasculitis remained clinically quiescent and the patient was commenced on azathioprine (AZA) as a steroid sparing agent for maintenance immunosuppression. Two weeks after AZA commencement, the patient presented to the emergency department with acute painful disseminated morbilliform rash along with fever and myalgia. On examination temp was 39.7 °C and a widespread indurated erythematous papular rash was noted (Fig. a, b). An extensive viral and immunologic work up was negative including virology for herpes zoster, and simplex. Considering his history of immunosuppression he was empirically started on acyclovir. Full blood count revealed neutrophilic leucocytosis with neutrophil count of 12.2 × 109/L, Hs-CRP 259 and ESR 59, and a stable serum creatinine concentration of 115 μmol/L. A full septic work up was negative including negative serology for HIV, hepatitis A, B, C, and CMV. A skin biopsy was diagnostic of Sweet’s syndrome, in which the affected lesions revealed extensive neutrophilic infiltrate in the dermis but without evidence of leukocytoclastic vasculitis, herpes, zoster, or erythema multiform. Azathioprine was stopped and the patient was treated with oral prednisolone (30 mg once daily followed by a steroid taper) and colchicine (500 mcg twice daily) []. Within 4 weeks, the rash had completely resolved (Fig. c, d) and his inflammatory markers normalised. As the onset of symptoms were temporally related to initiation of AZA, a diagnosis of drug-induced Sweet syndrome. His steroid dose was tapered gradually to zero and treatment with colchicine was continued. As of August 2017, his vasculitis remains quiescent and there has been no recurrence of Sweet syndrome, however his ANCA titres remain elevated with anti-MPO levels 170 RU/mL. |
pmc-6223080-1 | A 54-year-old man was admitted to our hospital for a mass in RA on an echocardiography examination occasionally. There was no symptom or sign of fever, chest pain, dizziness, palpitations and no history of a heart disease and tumor. He was a teacher, running and training on a weekly basis. He also was a non-smoker and drank 50 ml Chinese liquor each day for 30 years. There was no other medical history of note and no family history of sudden death. Clinically, the patient has stable vital signs with no fever, a heart rate of 68 beats per minute and blood pressure of 128/79 mmHg. The serum tumor markers and D-dimer were normal. An electrocardiogram (ECG) showed normal sinus rhythm. The chest X-ray showed normal cardiac size and clear lungs.
The echocardiography (Siemens, ACUSON SC2000) showed normal left ventricular systolic function (ejection fraction 66%), normal left and right ventricular cavities and normal cardiac valves. Only mild tricuspid and aortic valve regurgitate. Incidentally, an apparently smooth mass-like echogenic structure (9*11 mm) attached to tricuspid valve was noted in the right atrium and suggestive of a thrombus or a tumor in four-chamber apical view (Fig. ).
Due to the limitation of acoustic window of echocardiography, the patient was arranged to our center of nuclear medicine for PET/MRI for diagnostic work up of the mass to be determined. Cardiac PET/MRI was performed with Siemens Biograph mMR (Software version B20P, Siemens Healthcare, Erlangen, Germany). The MRI showed the findings: Cine gradient-echo image in four-chamber view confirmed the presence of a banded structure (arrowhead) attached to the posterior wall of RA and the mass moved during systole and diastole period (Fig. ) (See Additional file : Video S1). On T2-weighted short tau inversion recovery (T2-STIR) of the four chamber and short axis view (Figs. and ), the mass (arrowhead) had similar signal intensity to myocardium revealing a myocardial structure. On T2-STIR with fat suppression of the four chamber and short axis view (Figs. and ), the results were consistent with T2-STIR images. There was no abnormal enhancement about the mass (arrowhead) on late gadolinium enhancement (LGE)-MRI (Figs. and ). Furthermore, PET/MRI indicated no obvious 18F-fluorodeoxyglucose (18F-FDG) uptake on the mass (Fig. , arrowhead), which exclude malignant tumor. These typical findings detected by PET/MRI lead to the diagnosis of a prominent crista terminalis. The case follow-up hitherto had no special symptom. |
pmc-6223377-1 | A 56-year-old man presented with complaints of left-side chest pain for 2 months and
hemoptysis for 1 month. There were no medical comorbidities or familial history of
malignancies. The patient was a nonsmoker and occasional drinker. Baseline positron
emission tomography and computed tomography (PET/CT) revealed two metabolically
active soft tissue masses (one was 2.7 × 2.4 cm in the left suprahilar region
and the other was 2.4 × 1.6 cm in the left lower lobe), enlarged prevascular
and left hilar lymph nodes, a metastatic lesion in the left fourth rib, and moderate
left pleural effusion. Biopsy from the lung mass revealed adenocarcinoma positive
for ALK gene rearrangement and negative for epidermal growth factor
receptor gene mutation by fluorescent in situ hybridization analysis. Pleural fluid
cytology was positive for metastatic adenocarcinoma. The diagnosis was advanced
NSCLC (T4N2M1a, stage IV, according to the American Joint Committee on Cancer
Staging Manual, 7th edition). The baseline hemogram, liver function tests, and
kidney function tests were within normal limits.
The patient received palliative radiotherapy with 20 Gy in five fractions over 5 days
to the lung mass for controlling hemoptysis. The patient was started on tablet
crizotinib 250 mg twice per day; a liver function test (LFT) was recommended once
per week for monitoring liver toxicity. After 1 month, PET/CT imaging showed a
partial response to therapy with a reduction of more than 30% in the size of primary
tumor and a decrease in pleural effusion along with a reduction in uptake of
fluorodeoxyglucose. The patient tolerated the treatment well without any significant
adverse effects during the first month. Then, after 39 days of crizotinib
administration, the patient presented to the emergency department with complaints of
generalized weakness, vomiting, poor oral intake, sleep disturbances, and
constipation for 2 days. The patient stopped taking crizotinib after the onset of
symptoms 2 days before he was hospitalized. A complete blood count and liver and
kidney function tests were performed that revealed deranged liver function. Serum
bilirubin had increased to 5.2 mg/dL, AST was 96 IU/L, ALT was 64 IU/L, and serum
alkaline phosphatase was normal at 238 IU/L. Prothrombin time (PT) was increased to
28.3 seconds, and international normalized ratio (INR) was 2.6. No abnormalities
were revealed after a CT scan of the brain was performed. An ultrasonogram of the
abdomen did not reveal any focal lesions in the liver or any features of biliary
obstruction. Tests were performed for viral markers, including hepatitis B surface
antigen, anti-hepatitis C–, anti-hepatitis A–, and anti-hepatitis
E–virus antibodies; all were negative thus ruling out viral hepatitis. Serum
copper and ceruloplasmin levels were within normal limits. Serum antinuclear
antibody and anti–smooth muscle antibody were negative. Tests for
cytomegalovirus, Epstein-Barr virus, herpes simplex virus, and HIV were negative.
Serum ammonia had increased to 271 μ/dL. Thus, a diagnosis of drug-induced
acute liver failure was made according to Hy’s law of drug-induced liver
injury.
During the course of treatment, the patient developed hepatic encephalopathy, which
progressed from grade 2 to grade 4. Fundus examination revealed features suggestive
of papilledema. The patient was managed intensively with vitamin K supplementation,
fresh frozen plasma transfusion, lactulose enema and laxatives, prophylactic
antibiotics, proton pump inhibitors, injectable l-ornithine and
l-aspartate, injectable N-acetylcysteine, and mannitol,
according to guidelines from the American Association for the Study of Liver
Diseases. The option of liver transplantation was ruled out in view of his
metastatic disease. The patient worsened clinically with progressive deterioration
in functional status. Bilirubin, PT /INR, and hepatic aminotransferase enzyme level
fluctuations are depicted in and
. The patient died after 18 days of
hospitalization as a result of multiorgan dysfunction. |
pmc-6223380-1 | A 61-year-old woman with metastatic breast cancer was enrolled in a phase II trial
(NLG2101) in September 2015 and was randomly assigned to the experimental arm:
docetaxel 75 mg/m2 administered intravenously every 3 weeks on day 8 plus
indoximod 1200 mg oral on days 1 to 14. She tolerated cycles 1 and 2 and achieved a
good response. In November, on day 16 of cycle 3, the patient developed severe
fatigue and lower extremity weakness, without new back pain, and required a
wheelchair for mobility. Home medications included aspirin, ibuprofen, oxycodone,
pravastatin, ondansetron, prochlorperazine, ranitidine, alprazolam, calcium
carbonate, vitamin B12 and D3, fish oil, and indoximod. Family history included
Parkinson’s disease (PD) in her father. On exam, she was able to stand and
walk with assistance only, had 4/5 strength in all extremities, a shuffling gait, no
arm swing, resting tremor in her hands, rigidity, and a fixed facial expression.
Bloodwork was normal and ruled out thyroid disease, adrenal insufficiency, or
electrolyte abnormalities. Brain magnetic resonance imaging showed no evidence of
progressive multifocal leukoencephalopathy or encephalitis. Within a week, she began
having dysphagia and dysarthria and was evaluated by neurology. CSF and
electromyogram were unrevealing and ruled out viral encephalitides and myositis or
other myopathies, respectively. One week later, she developed hypophonia, slow
ocular upward tracking and nonexistent downward tracking, upper extremity
hypertonicity, and cogwheel rigidity. She was diagnosed with Parkinsonism, having
the cardinal signs of resting tremor, rigidity, and bradykinesia, along with common
signs of masked facies and shuffling gait, with other possible diagnoses ruled out.
A SPECT DaTscan showed normal dopamine transporter uptake in bilateral striata
(), which was consistent with
drug-induced Parkinsonism. None of the multiple medications she was taking has been
found to cause Parkinsonism, and as indoximod is the only drug she was taking that
had not been extensively studied, it is the likely culprit. Indoximod was
discontinued and she was started on carbidopa-levodopa and trihexyphenidyl without
any clinical improvement. She then received 6 weeks of high-dose prednisone with
near resolution of her symptoms. Unfortunately, the patient subsequently died in May
2016 from cardiac arrest. |
pmc-6223666-1 | A 31-year-old male presented with stable dysphonia for four years. There were no sinonasal complaints, dyspnea, dysphagia, sore throat or a cough. Direct laryngoscopy exam showed left supraglottic/false vocal fold submucosal fullness extending to the aryepiglottic fold with papillomatous changes to the mucosa of the false vocal fold (Figure ).
Magnetic resonance imaging (MRI) of the neck revealed an ill-defined enhancing soft tissue mass centered in the left false vocal cord and paraglottic fat, extending to the left true vocal cord, anterior commissure, and left aryepiglottic fold (Figure ). Imaging findings were suspicious for laryngeal cancer. No pathologically enlarged lymph nodes were identified by the imaging size criteria. The pathology report showed congophilic amyloid deposits within the stroma and around the sub-mucosal glands containing a mixed population of kappa and lambda staining plasma cells. The findings were consistent with laryngeal amyloidosis. Systemic workup including serum and urine electrophoresis, cardiac exam, and bone marrow biopsy was negative. Local debridement was considered; however, due to the disease size and concern for residual amyloidosis, the patient was managed conservatively. Follow-up MRI performed three months later showed no interval change. |
pmc-6223718-1 | The patient is a 42-year-old female of Swedish ethnicity and no previous medical history. In 2018, she developed an enlarged lymph node in the right lateral aspect of the neck, and a subsequent fine-needle biopsy was consistent with metastatic papillary thyroid carcinoma (PTC). Thyroid ultrasonography visualized a focal lesion, 8 mm in diameter, located in the cranial part of the right lobe, but a fine needle aspiration biopsy only gave a bloody exchange, and no cytological diagnosis of the primary tumor was obtained. The patient underwent total thyroidectomy plus central and lateral lymph node dissection, and the histopathological examination revealed an 11-mm conventional PTC in the superior aspect of the right thyroid lobe. The tumor did not exhibit extrathyroidal extension and was radically removed. Moreover, lymph node metastases to the cervical (8/10 positive nodes) and lateral (9/24 positive nodes) compartments respectively were observed. Close to the primary tumor, a 3-mm parathyroid gland adjacent to the thyroid capsule was visualized, with focal findings that caught our interest for a more detailed analysis. Immunohistochemistry was performed using standardized protocols used in clinical routine. |
pmc-6224015-1 | An 8-year-old girl presented with a history of sudden morning numbness of right limbs, headache, and vomiting, followed by tonic-clonic seizures and a loss of consciousness. On admission she was somnolent, moderately dehydrated, with right hemiparesis and right hemihypoesthesia. The warmth of right limbs was decreased but the pulse on peripheral arteries was normal. Magnetic resonance (MR) imaging revealed symmetrical changes in postero-lateral thalami and medial occipital lobes. Smaller areas were noted in the region of splenium of corpus callosum and within deep structures of the left cerebral hemisphere (Fig. a–d).
A series of tests towards the diagnosis of metabolic, autoimmune, and rheumatoid diseases, or coagulopathies was performed. None responded positive.
After 7 days, she deteriorated: became non-responsive, on neuro-exam anisocoria R > L, right-sided central facial palsy, bilateral hemiparesis R > L, and positive bilateral Babinski sign were noted. MR scan revealed a new large hyperintense area in the pons and some smaller in the cerebellum (Fig. e, f). 3D-TOF angiography showed an embolic mass within the basilar artery (BA) at the level of left AICA and partial occlusion of P2a segments of both posterior cerebral arteries (PCAs) (Fig. ).
Physical examination revealed a loss of right radial pulse. Doppler-US showed normal flow values in the arteries of right arm and forearm but the complete occlusion of right SA due to an embolic mass at the origin of right vertebral artery (VA). The VA was partially occluded but had a torticuous canal of patency in its initial segment. Chest X-Ray revealed the presence of cervical ribs bilaterally (Fig. ).
A CT-angiography of subclavian arteries in two typical arm positions was done (Fig. ). It showed the occlusion of right SA with a developed suprascapular arterial anastomosis supplying the brachial artery. The scans also revealed bony anomalies in the region of superior thoracic aperture: cervical ribs and bifid 1st rib on the right, which fixed the diagnosis of right-sided aTOS, confirmed subsequently in catheter angiography a few days after. Regarding her age, surgeons decided to postpone surgical excision of cervical rib until the end of skeletal growth. She was placed on anticoagulant therapy with low molecular weight heparin combined with warfarin. After a few days, her neurological status improved—she was in good logical contact, responsive, with scattered speech. After rehabilitation sessions, she started to sit and walk without support. She was discharged with right-sided weakness and intention tremor. |
pmc-6224018-1 | A 2-month-old male infant was referred to the emergency department with macrocephaly. He was born at term via a normal vaginal delivery. Antenatal screening was normal with no initial post-natal concerns. Two weeks prior to admission, the head circumference increased significantly, and he started to have difficulty feeding with severe GOR. On examination, the anterior fontanelle was bulging and tense with prominent scalp veins. Urgent CT followed by MRI (Fig. ) of the head demonstrated obstructive hydrocephalus due to a PFAC.
An endoscopic third ventriculostomy (ETV) was performed and a Rickham reservoir connected to an intraventricular catheter was inserted. The post-operative scan revealed decompression of the ventricular system and a stable PFAC. The infant was discharged home 3 days later.
In the following weeks, he developed torticollis (left lateral flexion) and GOR refractory to medical treatment. A repeat MRI revealed an increase in the size of the PFAC such that it was extending into the spinal canal through the craniocervical junction and causing significant mass effect on the brainstem. The previous ETV was still functioning (Fig. ).
We proceeded with endoscopic cyst fenestration. The cyst was entered and its wall was coagulated in places (to reduce its size) then fenestrated. The fenestrations were into the craniocervical junction, the fourth ventricle, out through the right foramen of Luschka and into the pre-pontine cistern. Choroid plexus was seen within the cyst (Fig. c). Neuropathologically the cyst was consistent with an AC. The symptoms resolved post-operatively, with significant reduction in cyst size after fenestration (Fig. ). The child was discharged home 4 days later.
He was readmitted with a CSF leak 1 week later. A CT scan demonstrated that the cyst was smaller and ruled out hydrocephalus. A trans-fontanelle tap revealed a raised white cell count with no organisms detected. He returned to surgery where the reservoir and intraventricular catheter were removed and replaced by an external ventricular drain (EVD). He received 14 days of intrathecal (IT) vancomycin and 16 days of intravenous meropenem and vancomycin. He made a good recovery. The EVD was removed and he was discharged home 20 days after surgery.
Despite reduction in the size of the cyst and a functioning ventriculostomy, the patient developed communicating hydrocephalus likely due to the infection. A left ventriculoperitoneal shunt was inserted after serial lumbar punctures. At 18-month follow-up he is fit and well, with no recurrence of symptoms. |
pmc-6224343-1 | Case 1 is a 10-year-old male who showed normal speech and motor development in the first year of life. During development, he showed signs of hyperactivity, attention deficit, stereotypies and “learning deficits” mainly in logical areas. At 8.5 years of age, he underwent a thorough neuropsychological evaluation through a Wechsler Intelligence Scale for Children (WISC-III) test. WISC-III revealed a disharmonic profile with lower scores in the language area (VIQ = 88; PIQ = 117; TIQ = 102). Certain abilities such as understanding, verbal fluency and auditory attention were categorized as not appropriate for his age (Supplementary Table ). No other health problems were identified. |
pmc-6224343-2 | Case 2 is a 21-year-old male who showed normal motor development in the first year of life. He exhibited a significant delay in speech development with first words at 18 months, and almost exclusive sign language until 4 years of age. Attention deficit and hyperactivity were noted at a very early age. As a toddler, he showed mild genu valgum, and he developed scoliosis during middle childhood. By the time he started elementary school, he exhibited learning difficulties, prompting a referral for a neuropsychological evaluation where specific support was requested. At the age of 10 he exhibited inadequate abilities compared to children of his age (Supplementary Table ). He showed particular difficulties in the spatio-temporal abilities, reproduction of geometrical figures and segmental control. Memorization and mental calculation were also inadequate for age. Proofs in writing, reading and speech showed dysorthography, inadequate metalinguistics, reading speed and comprehension, difficulties in the pronunciation of some phonemes and atypical swallowing. At 14 years of age, attention and concentration deficits were persistent and he showed a low self-esteem. Additionally, impairments in reading, writing, and memorization were evident. At 16 years of age the patient presented with main difficulties in attention and short-term memory and was diagnosed with dysorthography and dyscalculia. A WISC-R test showed an IQ at the lower limits of the normal range. |
pmc-6225072-1 | A 55-year-old woman was referred to our hospital due to an incidentally discovered 16-mm intracortical right renal mass in the anterior medial position (). A renal biopsy was performed, which confirmed renal cell carcinoma.
A hook wire was placed in the tumor by an interventional radiologist under CT guidance. This was done before performing the partial nephrectomy on the same day using the technique used for nonpalpable breast lesions to facilitate intraoperative localization of the tumor ( and ).
The patient was placed in a modified left lateral decubitus position. Pneumoperitoneum was established and the trocars were placed. The bowel was mobilized medially and the plane between the anterior Gerota's fascia and the posterior mesocolon was developed. The kidney was mobilized within Gerota's fascia. The hook wire was found, and the renal artery was clamped by the bulldog. The renal capsule was resected using scissors under warm ischemia (25 minutes) ().
Hemostasis was achieved using a combination of cautery, hemostatic agents, and suturing (using sutures preloaded with clips to secure a suture line allows for lateral compression, perpendicular to the renal capsule).
Histopathology confirmed clear-cell renal carcinoma with negative surgical margins, Classification TNM 2017: pT1a Nx. |
pmc-6225073-1 | A 54-year-old female patient presented with colic right flank pain. She did not have any urinary tract infection, stone, or tumor in her history. Urinalysis did not detect microscopic hematuria or pyuria. Moreover, her renal functions were normal, and urine culture did not yield any abnormal findings. Ultrasonography (USG) detected grade-2 hydronephrosis of the right kidney. Noncontrast CT did not detect any stone in the urinary system. However, intravenous urography (IVU) detected filling defects in the right proximal ureter (). MRI detected thickening of the wall of the right proximal ureter along with contrast enhancement (). These findings suggested the presence of a fibroepithelial polyp in the right proximal ureter. Ureterorenoscopy detected a 7-cm-long stemmed lesion originating from the right proximal ureter (). The lesion was resected by performing monopolar cautery with a Bugbee electrode, and the specimen was extracted through the ureteral orifice and was exteriorized outside the urethra by using forceps (). After the resection, the stalk of the polyp was cauterized. Resection of the polyp and cauterization of the ureteral wall was performed carefully to prevent ureteral perforation. Next, a 4.8F Double-J ureteral stent was placed in the ureter for 2 weeks. Histopathological analysis of the lesion indicated that it was a fibroepithelial polyp with negative surgical margins (). The patient was discharged on the first postoperative day and has had an uncomplicated postoperative course thus far. |
pmc-6225074-1 | A 39-year-old, HIV-negative woman presented with a 1-year history of worsening left flank pain, intermittent visible hematuria, and a fullness in the left flank. In addition, she reported constitutional symptoms such as loss of appetite and significant loss of weight. She had previously been treated five times by her local general practitioner for recurrent urinary tract infections.
The only relevant finding on clinical examination was that of an ill-defined left flank mass with pain on palpation. Apart from a normocytic, normochromic anemia, laboratory work was unremarkable. Contrast-enhanced abdominal CT scan images () showed a large, heterogeneously enhancing soft tissue mass arising from the lower pole of the left kidney. It measured ∼108 × 106 × 105 mm (transverse, anterior-posterior, craniocaudal). The collecting system and the ureter were poorly visualized. The mass displaced the left renal artery superiorly and the left renal vein was not well demonstrated. The inferior vena cava appeared patent. There was no evidence of metastatic spread to the adrenal glands, intra-abdominal lymph nodes, liver, or chest. No bladder lesions were identified on cystoscopy.
A tentative diagnosis of RCC, cT3aN0M0 was made, and we planned for a hand-assisted laparoscopic radical nephrectomy. Intraoperatively, we identified a large, left lower pole renal mass displacing the pedicle superiorly. In addition, we found a bulky, dilated proximal ureter. A decision was made intraoperatively to proceed with radical nephrectomy as well as ureterectomy. The ureter was mobilized caudally and divided at the level of the pelvic brim. Since no enlargement of lymph nodes was found preoperatively on radiological imaging and no enlarged lymph nodes were detected when palpated intraoperatively, a lymph node dissection was not performed.
The patient had an uneventful postoperative course and was discharged 4 days postsurgery.
Macroscopically ( and ), the cut surface of the bisected kidney showed a large, solid, unicentric, well-circumscribed tumor in the inferior pole of the left kidney with hemorrhage and necrosis. There was extensive involvement of the pelvicalyceal system and associated hydronephrosis. The renal sinus demonstrated the presence of a tumor thrombus within the opened ureter. The renal vein was uninvolved. The tumor capsule was intact, and Gerota's fascia was uninvolved. The margins, including the distal ureteric margin, were uninvolved by the tumor. The overall morphological features and immunophenotype were in keeping with an eosinophilic variant of clear cell RCC (ccRCC). The nuclear features corresponded with World Health Organisation/International Society of Urological Pathology grade 3. There was extensive coagulative tumor necrosis, but no evidence of sarcomatoid differentiation or lymphovascular invasion. |
pmc-6225076-1 | This is the case of a 68-year-old Caucasian male, with a medical history of BPH. For 2 years, the patient has reported storage symptoms such as pollakiuria (eight times per day), nocturia (three times per night), urgency, an urgency urinary incontinence associated with urinary pain. He has also experienced additional voiding symptoms, that is, staining, intermittency, slow stream, and terminal dribble. On digital rectal examination (DRE), prostate was homogeneous, regular, with an enlarged gland. International Prostate Symptom Score (IPSS) was 30/35, Incontinence Quality of Life (iQol) 6/6, and International Index of Erectile Function 5 14/25 with regular sexual activity.
Prostate specific antigen (PSA) total value was 5.63 ng/cc with a ration T/L of 9.2%. The TRUS reported BPH of 62 g with a median lobe of 6 g protruding into the bladder. The postvoid residual (PVR) volume was 22 cc (). The blood analysis showed good renal function (clearance 100 mL/m−1). At uroflowmetry, maximum urinary flow rate (Qmax) was 8 mL/s for 90 cc void volume and 20 cc PVR.
Sextant biopsies were carried out with 12 negative cores. First a medical treatment was introduced by α blockers once a day. During the follow-up, medical therapy failed overtime, with no decrease of the LUTS. He was then offered a surgical treatment option by laser therapy using the 180W XPS GreenLight™, with early catheter removal program. There was no contraindication to general anesthesia, the patient had a physical status score ASA 2, Mallampati 1.
To treat his prostate, the patient underwent a photovaporization of the prostate (PVP) under general anesthesia, using a non-morphine analgesic drug protocol to reduce the risk of acute urinary retention after early catheter removal. The cystoscopy noted a bulging prostate median lobe. A GreenLEP technique was done, using photo enucleation with one MOXY fiber par laser GreenLight™, with a total of 326 kJ delivered energy in 40 minutes. Overall surgical time was 1 hour and 10 minutes and no complication was reported. The patient was discharged the day after surgery with a medical prescription of tamsulosin LP 0.4 mg per day for 15 days.
At 1-month follow-up, functional outcomes were improved with a Qmax of 11 mL/s, PVR 0 cc, IPSS 12/35, iQol 2/6. At 3-month follow-up, outcomes still improved, even though TRUS reported a prostate volume of 30 g with a persistent median lobe (). |
pmc-6225558-1 | A 24-year-old South Asian man presented to our hospital with a progressively enlarging swelling that started on the left side of his neck and extended inferior to the clavicle (Fig. ) increasing in size over a period of 6 months. His opposite upper limb and neck region were normal. He had no co-morbidities.
On examination a 10 × 12 cm globular, firm, non-pulsatile and immobile swelling was palpable on the left side of his neck. Tinel’s sign was negative on percussion. The lateral border of swelling was felt in the apex of axilla; it had smooth lobulated borders. He did not have any motor or sensory deficits. However, the brachial, radial, and ulnar artery pulses were absent. There was no locoregional lymphadenopathy and no metastasis. The clinical staging was stage 3 tumor (T3, N0, M0) according to the tumour, nodes and metastasis (TNM) classification.
Magnetic resonance imaging (MRI) showed a well-encapsulated 7.4 cm × 9.2 cm × 13.6 cm, ovoid-shaped, heterogeneous lesion in the left interscalene and posterior triangle, the costoclavicular space, and retropectoralis minor space with hypointense areas on T2/short T1 inversion recovery (STIR) and hyperintense with isointense areas on T1 with fluid levels (Fig. ). Arterial duplex showed monophasic flow in his distal subclavian artery and vein. An ultrasound-guided biopsy proved the swelling to be synovial sarcoma with positive TLE1, epithelial membrane antigen (EMA), CD56 and CD57 with weak positive S100 and SYT-SSX1 translocation in immunohistopathology. At a multidisciplinary team (MDT) meeting with medical oncology it was suggested that excision of the lesion be attempted (in view of size and possibility of partial debulking surgery only) followed by adjuvant chemotherapy and radiotherapy (RT).
The mass was approached through a supraclavicular and infraclavicular approach to the brachial plexus with clavicle osteotomy. Immediately after the clavicle osteotomy the radial pulse was palpable. There was a good dissection plane between tumor and parts of the brachial plexus. The trunks, divisions, and cords of the brachial plexus were in contact with the superior and posterior borders of the mass. The mass arose from the C8 root and lower trunk; the tumor was successfully dissected out from the C8 root and lower trunk. The mass enveloped the mid and distal subclavian artery along its superior-posterior border (Fig. ). The mass was excised as a whole from the subclavian artery leaving no lesion behind, macroscopically. After the excision of the mass, the clavicle was fixed with a 6-hole dynamic compression plate (DCP). His postoperative period was uneventful. The postoperative volume of the brachial, radial, and ulnar pulses was better than intraoperative volume.
The histopathology was reported as intermediate grade synovial sarcoma with SYT-SSX1 translocation in immunohistopathology. Since it was near marginal excision and the lesion was of intermediate grade, the oncology MDT meeting decided on adjuvant RT based on the National Comprehensive Cancer Network (NCCN) guidelines []. He underwent a full course of RT that included cobalt-60 gamma rays with dose delivered at 66 Gy to mid-plane in 33 fractions. Field size reduction was done after 46 Gy. At 6-month follow-up there were no clinical or radiological signs of recurrence. |
pmc-6225567-1 | A 59-year-old male patient presented with widespread edema and decreased urine output. The patient had no history of active arthritis, hemoptysis, bleeding, purpura, fever, chills, weight loss, streptococcal infection or known tropical disease and had not suffered from asthma or any other atopic diseases. At the time of his visit to our hospital, his blood pressure was 136/93 mmHg, and his temperature was 36.9 °C. The physical examination showed that the patient was suffering from left-sided hearing loss and revealed the presence of a palpable swollen mobile and non-tender lymph node with a size of approximately 1.5*1 cm located behind the left ear. No other superficial lymph nodes were palpable. A urinalysis showed 3+ proteinuria and 3.68 g of proteinuria in 24 h.The serum albumin (Alb) concentration was 11.3 g/L, the serum creatinine concentration was 218.7 μmol/L, the BUN concentration was 25.33 mmol/L, the eGFR was 27.4 mL/min/m2, and the ESR was 112 mm/h. The patient’s serum complement (C3 and C4) levels, antinuclear antibody titers, antistreptolysin O titers, and hepatitis screening results were normal. Hematology revealed a normal hemoglobin concentration and platelet count, a total white blood cell count of 6.98*10E9/L, and a percentage of eosinophils of 6.6%. The serum IgE concentration was elevated, as it was higher than 4000 IU/mL. A Mycobacterium tuberculosis γ-interferon release test was negative, and a bone marrow biopsy did not display obvious abnormalities. A neck CT showed that the cervical vascular sheath was surrounded by several small lymph nodes, and an ultrasound demonstrated the presence of bilateral pleural effusions and ascites. Pleural effusion examination revealed a karyocyte count of 76*10E6/L, a neutrophil count of 12%, a lymphocyte percentage of 85%, an Alb concentration of 1.8 g/L, a lactate dehydrogenase (LDH) concentration of 44 U/L, and an adenosine deaminase (ADA) concentration of 1.3 U/L.
Histological sections of lymph nodes were examined in the department of pathology. The examinations revealed the presence of follicular and interfollicular hyperplasia and the proliferation of venules surrounded by infiltrating eosinophils, lymphocytes, plasma cells, and mast cells. An eosinophilic microabscess was detected in the cortical area of the lymph nodes (Fig. ). These findings confirmed the diagnosis of KD.
Renal biopsy showed that two glomeruli were sclerotic (13 glomeruli were assessed). The remaining glomerular mesangial cells and stromal cells showed signs of mild proliferation. No significant widening of the mesangial area was observed, and the basement membrane had no obvious lesions. The tubular epithelial cells displayed signs of vacuolization. Additionally, part of the renal tubular epithelium had flattened, and the bristles had fallen off. Small numbers of protein casts were present in the dilated tubules. No obvious interstitial inflammatory cell infiltration (including eosinophil infiltration) was present, and no IgG, IgA, IgM, C3, C1q, C4 or Fib deposition was noted in any of the glomeruli. Electron microscopy showed mild hyperplasia of mesangial cells and stromal cells, extensive fusing of the podocyte processes of the epithelial cells, and a lack of electron-dense deposits (Fig. ).These findings confirmed the diagnosis of MCD combined with acute renal tubular injury.
The patient’s volume load did not respond to diuretics, and his urine output decreased. Furthermore, increases in the patient’s urea and creatinine levels were observed. Therefore, hemodialysis was initiated to improve the patient’s edema and kidney function. The renal biopsy demonstrated the presence of MCD combined with acute renal tubular injury. The patient was ultimately diagnosed with KD associated with MCD and acute renal tubular injury. The patient subsequently received 40 mg/day methylprednisolone for 3 weeks. Urinary protein and renal function were monitored during treatment, which decreased the patient’s serum creatinine level to 62.3 μmol/L, increased the eGFR to 103 mL/min/m2, increased the serum albumin concentration to 15.6 g/L and significantly increased urine output compared with pre-treatment values. However, the patient’s proteinuria increased to7.02 g/day.
The patient withdrew from hemodialysis and continued taking 40 mg/day prednisolone after discharge, but returned to our hospital after 6 weeks. At that time, urinalysis revealed 1+ proteinuria. The serum albumin concentration was 37.5 g/L, the serum creatinine concentration was 69.4 μmol/L, the BUN concentration was 12.55 mmol/L, and the eGFR was 97.8 mL/min/m2. The changes in the patient’s laboratory indexes are shown in Fig. .
Several databases, including PubMed, EMBASE, MEDLINE (Ovid), the Chinese National Knowledge Infrastructure (CNKI), the VIP Database for Chinese Technical Periodicals (VIP), and WanFang Data, were systematically searched from the date of database inception until Nov 01, 2017 to collect published international and domestic studies with the term “Kimura’s disease” and “Nephrotic syndrome”. The selection criteria were as follows: 1). studies including patients who were diagnosed with KD by lymph node or mass biopsy; 2). studies in which renal involvement was noted in all patients, and renal biopsy was used to define the pathology. The exclusion criteria were as follows: 1). studies which the patients were diagnosed with Kimura’s disease but with no renal involvement; 2). the data provided by the articles could not be accessed, or the full text could not be transformed. 3). the articles were reviews or abstracts. Ultimately, 18 studies [, , –] were included in the analysis. 8 studies [, , –, , , ] were published in English, and the others were published in Chinese. 26 patients were involved in this review. 20 patients were from China, 2 were from India, and one each was from Japan, Turkey, Vietnam, and Egypt (Table ).
Of the 26 patients included in the review, two were female and were from China and India, respectively, and the remaining patients were male. Thus, the male-to-female ratio was 12:1. Most of the patients presented with cervical lymphadenopathy or subcutaneous masses in the head or neck region. The mean age of these patients was 31.1 ± 14.2 years, the daily protein excretion level was 8.04 ± 4.62 g/24 h, the serum albumin concentration was 21.2 ± 8.57 g/L, the serum creatinine concentration was 170 ± 190 μmol/L, the blood eosinophil count was 23.7 ± 15.4%, and the IgE titer was 1285 ± 1223 IU/mL.
Renal biopsy was performed in all patients. Most of the patients presented with mesangial proliferative glomerulonephritis (13 patients). Other patients presented with membranous nephropathy (4 patients), minimal change disease (3 patients), focal segmental glomerulosclerosis (3 patients), IgA nephropathy (2 patients) and acute tubular injury (1 patient).
The majority of patients were treated with corticosteroids alone, while a small number of patients received corticosteroids combined with immunosuppressive agents, such as Tripterygium wilfordii, cyclophosphamide and leflunomide. With the exception of 2 patients who progressed to ESRD (end stage renal disease) and received hemodialysis, all other patients achieved remission with respect to their proteinuria. Simultaneously, the neck lymph nodes or masses became smaller. However, 5 patients experienced a proteinuria relapse during follow-up, including 4 patients with mesangial proliferative glomerulonephritis and one patient with membranous nephropathy. |
pmc-6225569-1 | A 69-year-old male patient was admitted to our hospital with the chief complaint of jaundice of skin and sclera accompanied by epigastric pain for two weeks. Further examinations including enhanced abdominal and pelvic CT scans, chest X-ray, abdominal ultrasound, tumor markers, liver and renal function and coagulation function were performed.
CT revealed a low-density mass of 4.0 cm diameter located in uncinate process of pancreas, obviously dilated intra- and extra-hepatic bile ducts and slightly dilated pancreatic duct. Non-contrast CT scan showed calcification in the mass. Contrast CT showed that enhancement of the tumor was similar to surrounding normal pancreatic parenchyma (Fig. ). The laboratory data were as follows: white blood cell (WBC) count, 4.6 × 109/L (normal: 4.0–10.0 × 109/L); red blood cell (RBC) count, 4.3 × 1012/L (normal: 3.5–5.5 × 1012/L); hemoglobin (Hgb), 125 g/L (normal: 120–160 g/L); AFP, 71.5 ng/mL (normal: < 8.1 ng/mL); carcinoembryonic antigen (CEA), 2.0 ng/mL (normal: 0–5.0 ng/mL); carbohydrate antigen 19–9 (CA 19–9), 437.2 U/mL (normal: 0–37 U/mL); aspartate transaminase (AST), 51 U/L (normal: 15–40 U/L); alanine transaminase (ALT), 151 U/L (normal: 9–50 U/L); total bilirubin (TBIL), 281.2 μmol/L (normal: 5.0–21.0 μmol/L); direct bilirubin (DBIL), 212.6 μmol/L (normal: 0–6.8 μmol/L).
Based on these results, an incorrect diagnosis of pancreatic neuroendocrine neoplasm was suspected before the operation and pancreaticoduodenectomy was performed on this patient. Pancreatic ACC with invasion of duodenum and distal common bile was confirmed by postoperative pathology, and no metastatic lymph nodes were found. Gemcitabine-based regime was administered to this patient one month after the operation. The patient was followed-up with physical examination, laboratory tests, and imaging examinations every three months and was alive without relapse at nine months after the operation. |
pmc-6225569-2 | A 79-year-old male patient, without any clinical symptoms, was found to have a pancreatic mass by ultrasound during routine physical examination. After he was admitted to our center, we also performed further examinations including enhanced abdominal and pelvic CT scans, chest X-ray, tumor markers, liver and renal function, coagulation function, etc.
The CT images showed an irregular mass with the greatest diameter of about 4.5 cm located in uncinate process of pancreas, with well-defined margins. No dilated intra- and extra-hepatic bile ducts were found, and pancreatic duct was normal. In the arterial phase, heterogeneous enhancement of the tumor was seen, which was less intense than the normal surrounding pancreatic parenchyma, and enhanced capsule was found (Fig. ). The laboratory data were as follows (normal ranges were the same as above): WBC count, 6.9 × 109/L; RBC count, 4.6 × 1012/L; Hgb, 151 g/L; AFP, 4.0 ng/mL; CEA, 1.49 ng/mL; CA 19–9, 14.2 U/mL; AST, 57 U/L; ALT, 73 U/L; TBIL, 11.5 μmol/L; and DBIL, 4.4 μmol/L.
Pancreatic ACC was suspected before the operation and pancreaticoduodenectomy was performed on this patient. Pancreatic ACC was confirmed by postoperative pathology, with no metastatic lymph nodes. The patient rejected chemotherapy and routine follow-up was conducted. No recurrence was found one year after the operation. |
pmc-6225570-1 | The patient was a 45-year-old male with a 12-year history of paroxysmal weakness of the limbs. He was diagnosed with hypokalemic periodic paralysis in 2005 and hyperthyroidism in 2008. He had taken antithyroid drugs on an irregular basis since 2008 but had not undergone proper biochemical examination. Whenever he felt that his weakness was becoming severe, he would self-prescribe potassium chloride. In June 2017, the extent of his lower limb weakness increased such that he could no longer walk. He took potassium chloride without improvement. Subsequently, he was admitted to another hospital. His temperature was 36.7 °C, and his pulse was 96 beats/min. The muscle strength in his lower limbs was grade II [], and that in his upper limbs was grade III. His limb muscle tone was normal. His electrolyte and blood marker levels were as follows: K+, 1.4 mmol/l; Na+, 138 mmol/l, Cl−, 97 mmol/l; Ca2+, 2.61 mmol/l; free triiodothyronine (FT3) 6.96 pmol/l (1.86–6.44); free thyroxine (FT4) 38.96 mIU/l (11.45–22.14); thyroid-stimulating hormone (TSH) < 0.01 mIU/l (0.4–4.5); thyroglobulin antibody (TgAb) 16.61 IU/ml (0–150); and thyrotropin receptor antibody (TRAb) 22.36 mIU/l (0–5). Thyroid ultrasound demonstrated diffuse thyromegaly with a rich blood supply. The patient was diagnosed with GD and hypokalemic periodic paralysis and was treated with propylthiouracil (PTU) and potassium chloride. However, 2 days later, despite improvement of his weakness, his temperature increased to 41 °C, and he experienced cough and expectoration. Computed tomography (CT) imaging of his lungs revealed pneumonia. He was subsequently treated with cefazolin and transferred to our hospital 2 days later.
When the patient was admitted to our department, his limb weakness had significantly improved. He had a temperature of 38.8 °C, a pulse of 96 beats/min, a breathing rate of 20 respirations/min, a blood pressure of 106/68 mmHg, and grade II thyroid enlargement. Vascular murmur was audible in the thyroid. The muscle strength in his limbs was grade V, and his limb muscle tone was normal. The patient’s biochemical parameters were as follows (the reference values are different from those used in the previous department): [blood count] leukocytes 13.10 × 109/l, neutrophils 11.99 × 109/l and hemoglobin 13.3 g/dl; [serum electrolytes] K+ 2.110 mmol/l, Na+ 131.6 mmol/l, Cl− 91.1 mmol/l, Ca2+ 1.850 mmol/l, and Mg2+ 0.540 mmol/l; [thyroid function and thyroid antibodies] triiodothyronine (T3) 1.40 mmol/l (1.34–2.75), thyroxine (T4) > 300 nmol/l (78.38–157.40), FT3 5.32 pmol/l (3.60–6.00), FT4 51.23 pmol/l (7.86–14.41), TSH 0.01 mIU/l (0.34–5.65), thyroid peroxidase antibody (TPOAb) 36.33 IU/ml (0–30), TRAb 9.011 IU/ml (0–30), TgAb 6.04% (< 30%), and thyroid microsomal antibody (TMAB) 6.48% (< 20%); and creatine kinase (CK) 1398 U/l (38–174) and CK-MB 29 U/l (0.0–25.0). The patient’s liver and kidney functions were normal. We treated him with cefazolin, propranolol, PTU and potassium chloride. The patient’s vital signs and strength normalized after 3 days, and his leukocyte count had decreased to 5.97 × 109/l, his neutrophils had decreased to 3.59 × 109/l, and his CK had decreased to 40 U/l. However, his serum potassium level remained low despite 24 g/d of potassium supplementation. Additionally, the patient had hypomagnesemia and metabolic alkalosis (the results are shown in Tables and ). Further testing showed that his renin activity (supine) was 5.17 ng/ml/h (reference value 0.15–2.33), his aldosterone level was 436.10 pg/ml (10–160), his random urinary calcium/creatinine ratio was 0.23, his osteocalcin level was 1.06 ng/ml (6.00–48.00), his parathyroid hormone level was 11.22 pg/ml (6.0–80.0) and his calcitonin level was 4.87 pg/ml (0.00–18.00).
Based on these results, we suspected that the patient did not have thyrotoxic periodic paralysis (TPP) but rather GS. Therefore, we sent a blood sample to Beijing Huada Company for sequencing. The Next Generation Sequencing (NGS) was used. The sequencing protocol was based on the Roche Nimblegen SeqCap EZ Choice XL Library for exon trapping. A total of 25 genes (Table ) known to be associated with hypokalemia were targeted and the total size of target regions was 11.8 M. Libraries were prepared with the Kapa Hyper Prep kit and sequencing was carried out by Illumina NextSeq500 System. The sequencing data were compared to the human genome by BWA (0.7.12-r1039) software (/), and ANNOVAR (Date: 2015-06-17) was used to annotate the mutation sites based on dbSNP, Clinvar, ExAC, and 1000 genomes, among others. We found a homozygous mutation in the SLC12A3 gene (Exon12 1562-1564delTCA) with an amino acid change of 522delIle, which was first reported as a compound heterozygous mutation.by Vargas-Poussou []. The mutation was confirmed by sanger sequencing. No other phenotypes were found, including those for Bartter syndrome, hypokalemic periodic paralysis,Liddle syndrome, hyperaldosteronism, and apparent mineralocorticoid excess. The diagnosis was changed to GD with GS. Moreover, we obtained blood samples from the patient’s mother and son (his father had passed away) who did not have hypokalemia and hyperthyroidism. Both of them were proved as heterozygous mutation carriers by sanger sequencing. The sequencing chromatograms are shown in Figs. and . The patient had three brothers and one sister, but we were unable to obtain blood samples from them.
In addition to antithyroid drugs (methimazole 30 mg/d), we gave the patient potassium chloride (3 g/d), potassium citrate (6 g/d), and magnesium potassium aspartate (1.788 g/d). At the follow-up visit, we found that the patient often forgot to take his medicine. The results for thyroid function and electrolyte levels before and after treatment are listed in Table , which indicated that the patient’s thyroid function had improved. Hypothyroidism occurred during the course of treatment, but the patient’s thyroid function returned to normal after we reduced the dose of methimazole. The patient refused the recommendation to undergo I131 therapy. His serum potassium level remained low despite a sufficiently large daily dose of potassium, but no paroxysmal paralysis occurred after discharge. |
pmc-6225587-1 | A 26-year-old man with a history of consanguineous parents (cousins) was referred with weight loss, fever, hepatosplenomegaly and coughing. He had previously been diagnosed with lymphadenopathy in the neck at age 8 and prescribed anti-tuberculosis treatment. At 12-years of age he was diagnosed with pulmonary sarcoidosis and corticosteroid treatment was initiated.
On examination on the day of admission to our hospital the patient was pale with low-grade pyrexia (37.5 °C). Cardiovascular examinations were normal but he had cervical lymphadenopathy. A chest radiograph revealed extensive right-sided consolidation along with smaller foci of consolidation in left lung (Fig. ). Crackles were heard on the left side.
Moxifloxacin treatment for 2 weeks did not alleviate his cough, hypoxia or night sweats and fevers of up to 40 °C. Thoracic computed tomography demonstrated mediastinal lymphadenopathy and bilateral consolidation that was greater in the right lung. Non-specific inflammation was shown in a lung biopsy (Fig. and ). Full blood counts were normal and liver function tests and autoimmune and virology screens were negative.
Whole blood was examined with specific laboratory tests for neutrophil NADPH oxidase activity i.e. nitroblue tetrazolium (NBT) [] and DHR tests [–]. Low, subnormal levels of ROS were produced following stimulation of purified peripheral blood neutrophils (PMN) with phorbol 12-myristate 13-acetate (PMA) (Fig. ).
BAL and serum galactomannan (GAM) tests were negative but the BAL sample was sent for microbiological analysis. 48-72 h culture of the BAL sample on sabouraud dextrose agar at 30 °C resulted in the appearance of smooth light yellow powdery colonies that became darker over time (Fig. ). Lactophenol cotton blue (LPCB) mounting medium slide culture was performed for microscopic species identification (Fig. and ). Microscopic analysis revealed septate and hyaline hyphae with biseriate phialides extending from the upper portion of the vesicle and covering 2/3 of the plate. Hyaline, globose or oval and thick-walled chlamydoconidia were also seen (Fig. and ). The isolates were identified by phenotypic (macroscopic and microscopic) characteristics as Aspergillus terreus, and this identification was confirmed by DNA sequencing.
The fungal culture was disrupted with glass beads in a grinder and DNA was extracted with phenol chloroform. DNA was suspended in 50 μl of double distilled water and stored at − 20 °C for future use [, ]. The beta tubulin gene was amplified with forward (Bta2a: 5′-GGTAACCAAATCGGTGCTGCTTTC-3′) and reverse (Bta2b 5′-ACCCTCAGTGTAGTGACCCTTGGC-3′) primers and sequenced. The DNA sequence results were compared against the NCBI Genebank database, which showed a 99% similarity with an Aspergillus terreus isolate in the Gene Bank fungal library with accession no 1168 [, ] (Fig. ).
Genomic DNA was extracted from the blood mononuclear cell fraction using a Gentra Puregene Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. DNA sequencing was performed at the Sanquin Research Laboratory (Amsterdam, The Netherlands). GeneScan was used to determine the ratio between the number of exon 2 sequences of neutrophil cytosolic factor 1 (NCF1) gene, which encodes p47phox, and the number of Ψ-NCF1 exon 2 sequences []. This revealed a homozygous GT deletion (c.75_76delGT) at the start of exon 2 in NCF1, resulting in the introduction of a frame shift and a premature stop codon (p.Tyr26HisfsTer26) predicting a truncated and inactive p47phox protein.
The patient was treated with meropenem, vancomycin and liposomal amphotericin b for 2 weeks. After obtaining the results of fungal characterization, voriconazole was started and other antibiotics were removed from the treatment strategy. After 3 months, the patient had recovered as confirmed by chest imaging and clinical manifestations. The patient gained 10 kg in weight and is on maintenance treatment with voriconazole. |
pmc-6225625-1 | A 71 year-old male presented for an urgent biopsy of a lesion of Corpus Callosum on a background of clinically diagnosed intra-operative anaphylaxis for the same procedure 4 days prior, which was abandoned. Symptoms of the initial presentation, which brought the patient under the care of the Neurosurgical team, included impaired ability to self-care and mild cognitive dysfunction. Surgical and Medical teams deemed the histo-pathological diagnosis essential due to the need for tailored subsequent medical management including potential urgent administration of chemotherapy and radiation.
The specialised allergy testing was not feasible due to the brief 4 day timeline proposed between the two procedures. Decision was made to proceed with surgery due to the urgent need for the identification of the nature of the lesion.
Both patient and the prior care episode were evaluated. Patient had a background of treated hypertension, with no other underlying illnesses. Prior to this, he had undergone uneventful surgical procedures and anaesthesia.
History, records of the procedure, and tests for mast cell mediators, were reviewed by the attending anaesthetist. During the first care episode patient was given a single dose of midazolam, followed by remifentanil and propofol total intravenous anaesthesia, rocuronium and cephazolin in quick succession. The laryngoscopic view was a Grade 3 Cormack and Lehane, with direct laryngoscopy utilising a Macintosh 4 Blade. CMAC® Blade 4 Videolaryngoscope demonstrated an equivalent Grade 3 Cormack and Lehane view. Following successful airway management, patient developed intractable hypotension, concomitant bronchospasm and was diagnosed with clinical anaphylactic episode. The patient was treated with an adrenaline infusion, procedure was abandoned and he was admitted with an endotracheal tube in situ to Intensive Care Unit where he recovered uneventfully. The patient re-presented 4 days later for a repeat procedure. Specific allergen testing was unavailable and deemed not to be feasible at this point in time.
During the repeat care episode, decision was made to secure the airway via an awake flexible endoscopic intubation prior to administering general anaesthesia. Airway was topicalised generously using a mix of 4% nebulised xylocaine, 10% local anaesthetic sprays to the back of the pharynx, and topical co-phenylcaine nasal spray. In addition to the above, Disposable devilbis atomiser was used to a total of 9 mg.kg− 1 of xylocaine. Remifentanil infusion at the dose of 0.05 mcg.kg− 1.min− 1 was used during the intubation and airway was secured uneventfully through the nose with a flexible Storztm 5.1 mm video fiber-optic bronchoscope. After connecting the breathing circuit, confirmation of CO2 was obtained and patient was administered 250 mg of thiopentone. Remifentanil infusion was increased to 0.2 mcg.kg− 1.min− 1 and maintained at this level through the case. Anaesthesia was maintained with Sevoflurane at a total dose of less than 1 MAC. For infection prophylaxis, 600 mg of clindamycin was administered. Procedure was completed uneventfully, patient extubated and taken to recovery. Using the above technique, the only medication in common between the two episodes of care was remifentanil. |
pmc-6225725-1 | We present the case of a 61-year-old woman with a history of total hysterectomy owing to a uterine fibroid at the age of 35 years. Nine days before admission to our hospital, she developed an itchy rash covering the whole body. Seven days before admission to our hospital, she visited a dermatologist who prescribed oral and topical medicines; however, there was no improvement. Three days before admission to our hospital, she visited a physician for general malaise and loss of appetite. Liver function disorder was detected by blood tests (AST (aspartate aminotransferase), 165 U/L; ALT (alanine transaminase), 291 U/L; ALP (alkaline phosphatase), 840 U/L; γ-GTP (γ-glutamyl transpeptidase), 373 U/L) and thickening of the gallbladder wall was seen on abdominal echo imaging. She was referred to our department of gastroenterological medicine. However, on the day of her visit to our hospital, she experienced a dull headache and blurred vision on attempting to get out of bed. The itching increased and she was brought to our emergency outpatient department. On admission, her clinical parameters were as follows: height, 162 cm; weight, 46.5 kg; JCS (Japan Coma Scale), 0; temperature, 36.6 °C; blood pressure, 126/82 mmHg; pulse, 77 bpm; and peripheral capillary oxygen saturation (SpO2), 96% (room air). Conjunctival congestion and jaundice were present, and breathing sounds were normal. Several erythemas (millimeter size), itching sensations on the face, body, and upper and lower extremities, partially fused wheals, and small papules were also observed (Fig. , ). There was no dryness of the mouth, pedal edema, decreased body weight, purpura, superficial lymph nodes, or nocturnal sweating. Laboratory results are shown in the Table . The results (creatinine (Cr) 3.08 mg/dL) indicated rapid decline in renal function compared to the tests conducted 3 days prior to admission (Cr 0.74 mg/dL). In addition, liver function tests were also abnormal. The patient was referred to the nephrology department and admitted to our hospital for examination and treatment.
Abdominal computed tomography (CT) showed slight enlargement of both kidneys (right, 12 × 7 cm; left, 11 × 6 cm) (Fig. ). Hepatitis virus antigen/antibody tests were negative on admission and there was no history of drinking; however, hepatobiliary enzymes were elevated. In addition, abdominal CT showed splenohepatomegaly (Fig. ). For the systemic rash, the patient was referred to the dermatology department on the day of admission, and a skin biopsy was performed. The rash was suspected to be an adverse effect of a drug; therefore, use of the previously prescribed drug was discontinued. The patient was also referred to the ophthalmology department for her blurred vision. Cataracts and uveitis were observed, along with increased intraocular pressure (IOP) (left IOP, 14 mmHg; right IOP, 13 mmHg). Abdominal CT did not reveal obstruction of the urinary tract, thus ruling out postrenal failure. Assuming the possibility of a prerenal failure, we administered extracellular fluid to maintain the hemodynamics. However, there was no improvement in renal function. We then suspected rapidly progressive renal failure with renal parenchyma involvement, or interstitial failure. Among the causes of rapidly progressive renal failure, we suspected nephrotoxic medications or glomerulonephritis due to membrane-type lupus nephritis or renal lymphoma. During hospitalization, her IOP further increased (left IOP, 35 mmHg; right IOP, 37 mmHg), for which various eye drops (steroids, prostaglandin-related drugs, beta-blocking drugs, adrenergic alpha 2 receptor agonists, carbonic anhydrase inhibitors, rho kinase inhibitors) were administered. However, there was no improvement. We administered oral steroids (prednisolone 30 mg/day) to prevent blindness and protect the kidneys. An improvement in the eye symptoms was detected. On day 3 of hospitalization, we performed a renal biopsy to determine the cause of rapidly progressive renal failure. In addition, after renal biopsy, we administered pulse steroid therapy (methylprednisolone 500 mg/day for 3 days) to protect the kidneys and further improve the eye symptoms (Fig. ). The response to pulse steroid therapy was good and renal function gradually improved (day 3 of hospitalization, Cr 3.22 mg/dL; day 5, Cr 2.06 mg/dL; day 8, Cr 1.13 mg/dL) (Fig. ). One complete course of pulse steroid therapy was administered and the dose of prednisolone was decreased to 20 mg/day from day 18. Elevated hepatobiliary enzymes gradually improved with steroids (Fig. ). The systemic rash and itching sensation began to dissipate, although pigmentation was still visible. Her vision improved and IOP decreased, thus blindness was prevented. On day 22, a diagnosis of tubulointerstitial nephritis due to tubulointerstitial infiltration of PTCL-NOS was made, based on the results of renal biopsy (hematoxylin-eosin staining showed the presence of atypical lymphocytes; immunostaining showed that CD2, CD3, and CD4 were positive and CD5, CD7, CD8, and CD20 were negative) (Fig. , , , ) and a Ki-67 score of approximately 80%. We also diagnosed subcutaneous tissue infiltration of PTCL-NOS, based on the results of skin biopsy (hematoxylin-eosin staining showed the presence of atypical lymphocytes; immunostaining showed that CD2, CD3, and CD4 were positive and CD5, CD7, CD8, and CD20 were negative) (Fig. , , , ) and a Ki-67 score of approximately 80%. We performed flow cytometric analysis of the kidney and skin tissue, which showed similar results. We performed Southern blot analysis on kidney and skin tissue, but we could not obtain the result because of small amount of DNA. A presumptive diagnosis of PTCL-NOS to the liver and spleen and existence of Uveitis masquerade syndrome [] due to PTCL-NOS was made based on the clinical course. Since lymph node lesions were not seen on imaging, we assumed that the lesions were limited to extralymphatic organs. In addition, we performed a spinal fluid test and found an atypical lymphocyte count of 5%. These atypical lymphocytes showed the same findings on flow cytometric analysis as those in the kidney and skin. The patient was referred to the hematology department and initial CHOP therapy was administered on day 23 of hospitalization.
For 8 months after admission, seven courses of CHOP therapy (Vincristine 1.4 mg/m2, Doxorubicin 50 mg/m2, Cyclophosphamide 750 mg/m2, Prednisolone 100 mg/day day1-day5) were administered and positron emission tomography/CT was performed. No enhanced uptake of FDG (fluorodeoxyglucose) was seen in any principal organs or lymph nodes, indicating complete remission. There was no significant change in the size of the liver; however, a decrease in the size of the spleen and both kidneys was seen. |
pmc-6225729-1 | A 70-year-old bisexual man was admitted with generalized myalgia and abdominal pain lasting for 7 days. Three months earlier, he was diagnosed with HIV infection during the evaluation of a fever. The initial HIV RNA level was 36,500 copies/mL, with 114 CD4+ lymphocytes/μL, which were consistent with the definition of AIDS [] although the exact timing of HIV infection was unknown. At that time, abdominal and chest computed tomography (CT) showed no abnormality and an ophthalmologic examination showed no evidence of ocular disease. In addition, anti-cytomegalovirus (CMV) IgG was positive. For 3 months, he was treated with an integrase strand transfer inhibitor (INSTI)-based regimen (elvitegravir, cobicistat, tenofovir disoproxil fumarate, and emtricitabine) and showed good adherence.
At the time of the current admission, his vital signs were: blood pressure, 110/80 mmHg; pulse rate, 98/min; body temperature, 38.0 °C; and respiratory rate, 20/min. There was no localized tenderness of the abdomen on physical examination. The laboratory findings showed anemia (hemoglobin, 9.7 g/dL), thrombocytopenia (platelets, 53 × 103/mm3), acute kidney injury (creatinine, 1.8 mg/dL), and an elevated lactate dehydrogenase level (LDH; 6608 U/L). No HIV-RNA was detected (< 20 copies/mL), and there were 256 CD4+ lymphocytes/μL. Abdominal CT revealed multiple liver masses (Fig. ), and a core needle biopsy was performed to differentiate between liver abscess and malignancy. An atypical lymphocytic population composed of medium-sized basophilic cells was observed on hematoxylin and eosin staining (Fig. ). Immunohistochemistry was positive for the B cell markers CD20 (Fig. ) and CD79a (Fig. ), and the Ki-67 labelling index approached 90%. The tumor cells were also positive on EBV in situ hybridization (Fig. ). The liver lesion was diagnosed as Burkitt’s lymphoma. An additional diffuse hypermetabolic bone marrow lesion was found on positron emission tomography-CT (PET/CT), and he was confirmed to have stage IV Burkitt’s lymphoma by the Lugano classification.
Three cycles of antineoplastic chemotherapy based on rituximab plus fractionated cyclophosphamide, vincristine, doxorubicin, and dexamethasone (R-hyper-CVAD) were administered, and two cycles of methotrexate were given via an intrathecal route. The HAART was replaced with another INSTI-based regimen (raltegravir, tenofovir disoproxil fumarate, and emtricitabine) after considering potential drug interactions. Interim PET/CT showed a partial response with marked improvement of the lymphomatous involvement in the bone marrow and liver, but hypermetabolic para-aortic, aortocaval lymph nodes remained 3 months after initiating chemotherapy.
Just after the third cycle of R-hyper-CVAD, the patient suddenly complained of decreased visual acuity and an ophthalmologist diagnosed CMV retinitis. At that time, there were 56 CD4+ lymphocytes/μL, but no HIV RNA was detected (< 20 copies/mL). Intravitreal and intravenous ganciclovir were used for induction therapy, and valganciclovir maintenance therapy was continued. Chemotherapy was stopped after the third cycle of R-hyper-CVAD due to intolerance and the CMV retinitis. Four months after discontinuing the chemotherapy, PET/CT showed disease progression in the para-aortic, aortocaval lymph nodes, and newly developed lymphomatous involvement was seen in the paravertebral and cardiophrenic space.
Ten months after discontinuing systemic chemotherapy, the patient developed swelling and pain in his right thigh. CT showed edematous changes and skin thickening in this area (Fig. , arrow), but there was no remarkable size increase in the inguinal lymph nodes. There were 129 CD4+ lymphocytes/μL, and HIV RNA was undetectable. A skin punch biopsy was performed because it was unclear whether the manifestation was related to the Burkitt’s lymphoma. The biopsy specimen was composed predominantly of plump spindle cells with intervening vascular spaces (Fig. ). Despite the bland cytology of the tumor cells, frequent mitotic figures were seen and the tumor was infiltrating the dermal collagen fibers. The tumor cells were positive for CD31 (Fig. ) and HHV-8 latent nuclear antigen-1 (LNA-1) by immunohistochemistry (Fig. ). The histology was consistent with KS. Twenty Grays of radiation were given in five fractions without systemic chemotherapy. Two months after radiation therapy, multiorgan (bone, liver, and pericardium) lymphoma aggravation led to his death. |
pmc-6226298-1 | A 60-year-old man with a history of asthma, benign prosthetic hypertrophy, and hyperlipidemia presented 1.5 years after an uncomplicated primary right TKA done by an outside surgeon. He had been complaining of 4 months of increased pain in his right knee. An aspiration had been attempted, yielding 1 mL of sanguinous fluid which had not been sent for analysis. The patient continued to have swelling and increased pain in the knee, and an MRI was obtained demonstrating “pseudotumor” (Figure , A–C). He was then referred to our orthopaedic oncology office for further evaluation and management.
After review of initial radiographs (Figure , A and B) and CT (Figure , A–C), the patient underwent an open biopsy of his right tibial lesion adjacent to the tibial baseplate one week after presentation to the office. Pathology from his initial biopsy was consistent with GCTB. One week following his open biopsy, the patient underwent a complex reconstruction of his proximal tibia as well as patellar tendon (Figure , A and B).
Intraoperatively, complete destruction of the medial cortex of the tibia was noted, with the area infiltrated extensively by tumor. After the initial anterior exposure through the previous TKA incision, the area was extensively curettaged. A high-speed burr and argon beam coagulator was then used to complete the resection at the edges of the cavity. Following the removal of the mass, we noted that the tibial baseplate was mechanically stable even after the extended curettage. An intraoperative determination was made to preserve the primary arthroplasty components and to reinforce the tibia with cement and Steinmann pin fixation. Steinmann pins were fired distally into the tibia, which allowed buttressing of the tibial baseplate proximally. The entire excisional cavity was then packed with polymethyl methacrylate (PMMA) cement. Intraoperative examination demonstrated that the construct had excellent stability and strength afterward.
Following reconstruction of the proximal tibia, attention was turned toward the patellar tendon. We noted that the destructive process had eroded much of the patellar tendon and reconstruction was required. Marlex mesh was used in the technique described by Browne and Hanssen. The mesh was layered into a construct with approximate width as the patellar tendon and then weaved into the remnant of the native patellar tendon into normal tendon tissue. #5 Ethibond suture was used to reinforce the closure and attachment of the Marlex mesh to the tendon, avoiding the placement of mesh adjacent to skin.
Before discharge, the patient was placed in a long leg bivalved cast. Three weeks postoperatively, the patient was transitioned into a hinged knee brace, which is locked in extension while upright. The patient was then instructed to allow for bed dangles with the knee. At 6 weeks post-op, the patient began physical therapy for gentle range of motion of the knee, still with brace locked in extension while ambulating. At 7 weeks, the patient was placed on Keflex for 1 week after he noticed a small amount of discharge from his distal incision site after a scab was removed, with resolution of symptoms. Three months post-op, the patient was allowed to weight bear as tolerated on his extremity. At this time, he was started on a trial of denusumab (Amgen Manufacturing Limited) adjuvant chemotherapy under the medial guidance of his oncologist. The patient developed a rash after two doses and was changed to zoledronic acid (Zometa; Novartis Pharmaceuticals Corporation) for a total of 6 months of diphosphonate therapy. He completed the course without further incident. Radiographs taken at 16 months demonstrated maintained alignment without evidence of component subsidence or implant failure (Figure , A and B). At a 20-month follow-up, the patient was weight bearing on the extremity without assistance, using a cane only for long distances. |
pmc-6226580-1 | An 83-year-old female presented on two separate occasions with spontaneous groin and hip pain. Using MRI, the patient was diagnosed with an initial right compression type FNSF and subsequently with a left tension type FNSF. Of worthy mention, the patient has multiple comorbidities including: morbid obesity, hypertension, type 2 diabetes mellitus, osteoarthritis, osteoporosis, and vitamin D deficiency. Her Vitamin D level was 15 ng/mol. Pertinent review of medications includes: Ergocalciferol 50,000 units and Alendronate 70 mg. At the initial encounter, the patient presented for a month- long duration of hip pain that radiates to the groin and aggravated by minimal activity. On evaluation, she complained of anterior groin pain with all directions of motion of the hip and no other pertinent physical exam findings. MRI of the lower right extremity demonstrated high signal intensity edema in the bone marrow at the inferior medial aspect of the right femoral neck; findings that are consistent with a compression stress reaction (). After thorough consideration of the patient’s past medical history and review of the risks/benefits of a surgical procedure, the decision was made to treat her FNSF with percutaneous pinning with cannulated screw internal fixation. Postoperatively, the patient was treated weight bearing as tolerated with home physical therapy three to four times a week and followed closely in one month intervals. Three months later, the patient presented for a follow-up status-post internal cannulated screw fixation of her right hip with new onset pain on the contralateral side and inability to ambulate. At that time her Vitamin D level was 25 ng/ml. On evaluation, she complained of groin pain that is exacerbated by leg roll and present for a 3- week duration. Ranging of the hip joint revealed exquisite pain restricted to internal and external rotation flexed at 90°. MRI of the lower left extremity demonstrated high signal intensity edema in the bone marrow at the superior-lateral aspect of the left femoral neck (). These findings are consistent with a tension stress reaction, as opposed to a typical inferior medial aspect stress fracture. Risks and benefits of surgery for the left hip were discussed with the patient and the patient opted to receive cannulated screw fixation. At her 6 week follow-up, the patient had improved ambulation and decrease in pain. |
pmc-6226581-1 | A 42-year-old female patient with past medical history of obesity and a bariatric surgery consults for a year of symptoms consisting in progressive bilateral exophthalmos, especially on the left side, associated with eye pain, bilateral hyaline rhinorrhea and headache, without a change in visual capacity. Upon consultation to the emergency room (day 0), a brain MRI was performed, with a nasopharynx-dependent mass invasion of the anterior cerebral fossa, orbit and maxillary and frontal sinuses finding (see -B). At first, it was diagnosed as an invasive nasopharyngeal tumor associated with cerebrospinal fluid (CSF) fistula, which was scheduled for surgical resection.
She was admitted for tumor resection through bifrontal craniotomy with transnasal endoscopic approach (day +69). On admission, the patient was stable, without motor or sensory deficits at the neurological physical exam. After tumor resection, the microbiological study of the lesion was performed, where KOH showed septated hyaline hyphae on day +71 and the culture was positive for Aspergillus flavus (day +75) (see -A). Pathological analysis reported invasion of all the nasal respiratory mucosa by a granulomatous inflammatory infiltrate, with a few foci of necrosis and extensive areas of fibrosis, giant cells and histiocytes had septated hyaline hyphae phagocytized. The bone fragments were surrounded by the same type of inflammatory infiltrate. The coloring of PAS and Gomori allowed identification of the typical hyphae of Aspergillus in the respiratory mucosa and bone tissue. The patient received amphotericin B 50 mg IV q 24 h from day 70 to day 75, and subsequently, after the identification of A. flavus, management was changed to voriconazole 200 mg PO q12hours during 6 months.
On day +74, multiple extension studies were performed, including a negative serum galactomannan (0.326), a negative HIV serology, normal immunoglobulin G 14.4 g/l, CD4: 660 cells/µl (normal), CD3:1042 cells/µl (normal), and a computed tomography scan (CT scan) of the thorax, where a right apical pulmonary nodule with frosted glass pattern was reported, suggestive of initial infection by Aspergillus. Afterward, bronchoscopy and bronchoalveolar lavage (BAL) were performed (day +76), with galactomannan in BAL reported positive (result: 0.718, positive: >0.5).
Laboratory tests, including complete blood count (CBC), kidney and liver function tests (LFT) were within normal limits during the hospitalization. Protein electrophoresis showed moderate decline in albumin.
During the post-operatory, the patient persisted with a cerebrospinal fluid fistula and received acetazolamide from day +78 to day +98. The remaining clinical course was uneventful, and patient was discharged on day +89 with full recovery and without recurrence.
A 76-year-old female patient with a history of hypothyroidism managed with levothyroxine 50 g/day and recurrent left eye chronic dacryocystitis by Methicillin-resistant S. aureus (MRSA) (day −27). Required reconstructive surgery of the left lacrimal pathway (day 0), where a lacrimal duct lesion extending to the adenoid region was found, and resection of the lacrimal duct bone was also performed. The pathology report showed lymphoplasmacytic severe chronic inflammatory infiltrate in soft tissue and fragments of bone with osteomyelitis, as well as a mass that revealed septate hyphae and some irregular, partially pigmented with occasional formation of conidial heads of Aspergillus in the microbiological examination (day +13). In the fungal culture, Aspergillus flavus was isolated (day +26); thus craniofacial invasive aspergillosis was diagnosed, and management with voriconazole 200 mg PO q12h was initiated on day +13 and continued for three months (day +103). Extension studies were performed on day +14, which reported a normal CBC, kidney function, and LFT, negative serum galactomannan (0.315), negative HIV, a brain MRI showing microangiopathic leukoencephalopathy without others abnormalities and a thorax CT scan that reported nonspecific thickening of interlobular septae. The patient's clinical course was adequate without recurrence of the disease. |
pmc-6226587-1 | During August 2017, a 65year-old female was admitted to our department with histological finding of EPC of the right leg. One month before, she underwent surgical excision of a cutaneous lesion of the right leg. This lesion appeared brownish, exophytic, with ulcerated surface, more suggestive for a squamous cell carcinoma than an ulcerated nodular basal cell carcinoma. The histological examination revealed a poroid neoplasm extending into the reticular dermis with a thickness of 5 mm, 10 mitoses per 10 high-power field, absence of lymphovascular invasion and free margins with a clearing distance of 2 mm. shows the hematoxylin-eosin stain picture of the lesion.
She had a past medical history of hysterectomy and bilateral salpingo-oophorectomy for uterine fibromatosis, kidney transplantation for severe chronic renal failure, high blood pressure, aneurysmal dilatation of the right common carotid artery, hypercholesterolemia, hyperparathyroidism and previous inferior myocardial infarction. Laboratory tests, including blood count, biochemical investigations and serum viral markers were normal. After multidisciplinary discussion and based on the sub-optimal clearing margin we performed a re-excision of the previous wound to ensure wider safety margins of at least 20 mm. It was also decided to perform a SLNB; the pre-operative lymph node scintigraphy showed the presence of two sentinel lymph nodes in the right inguinal site. The patient underwent enlargement of the surgical excision until 20 mm of free margin from the previous excision and SLNB of the two lymph nodes identified preoperatively. Recovery from surgery was uneventful and the patient was discharged from hospital on the first post-operative day. Histopathological examination found no signs of residual or satellite neoplasia in the surgical sample and the two retrieved sentinel lymph nodes were negative for metastatic disease. Patient is disease free 7 months after the operation and continues follow- up. |
pmc-6226824-1 | A 86-year-old man presented to our Emergency Department after falling from standing height. Patient was immediately admitted from the Emergency Department to our trauma ward. On observation, the patient was noted to have a patent airway, decreased breath sounds and tenderness on the left chest, dyspnea with chest pain and the blood oxygen saturation level was decreased to 93% with room air, whereas hemodynamic measurements were stable. The patient whole body examinations did not reveal other injuries outside of the chest area. The Chest imaging revealed multiple rib fractures. In addition, computed tomographic scan examination showed comminuted fractures of ribs 6 through 9 on the left side, without lung contusion (), which we considered automatically to indicate operation in order to avoid the risk of abdominal organs injuries. Twenty four hours (24h) after injury, the patient underwent internal fixation of left ribs 8 and 9, An operation was then performed using a Portable color doppler ultrasound system mindray z5() to localize the fractured rib. The patient was under general anesthesia with differentiated ventilation, and then he was placed into a right lateral decubitus position. Judet struts were used in the fixation of ribs fractures in our present study (). After 1hour, the operation ended successfully and the patient were moved to the ward. The patient was given a combination of oral and transdermal pain medications. At 5days after surgery, the patient's chest tube was removed. The reporting pain intensity were 8 of 10 for both rest and activity. Fifteen days after surgery, the patient was discharged from the hospital without complications. At 6weeks follow-up, the patient did not present any signs of chest pain or difficulty breathing on exertion. |
pmc-6230226-1 | A 42 year old female with cutaneous lupus for 16 years was evaluated for new onset hypertension and ankle oedema of 2 months duration. She was found to have a nephrotic range proteinuria (3.7 g per day) with microscopic haematuria and underwent renal biopsy for suspected lupus nephritis. She did not have coagulopathy, local skin sepsis or uncontrolled hypertension at the time of the biopsy. The procedure was performed under ultrasound guidance, adhering to aseptic precautions by an experienced specialty trainee in nephrology. Two cores were obtained with two passes using a Histo Automated Spring-loaded renal biopsy gun with a 16G needle. No complications were observed during the immediate post-procedure period. Patient did not develop undue pain, haematuria or overt bleeding from the biopsy site. She was discharged from hospital the next day.
She was on prednisolone 60 mg daily and had steroid induced diabetes mellitus. Her glycemic control was poor (HbA1c 9.0%, fasting plasma glucose 188 mg/dL) while being on treatment with metformin 750 mg thrice daily and gliclazide 40 mg twice daily.
Eight weeks later she was re-admitted with pain in the left flank, intermittent fever and malaise for 1 week. She did not have urinary symptoms, haematuria, nausea or vomiting.
Her past medical, surgical, gynaecological and family history was otherwise unremarkable. She was a housewife, leading an active lifestyle, well supported by family members and was well compliant with treatment.
On admission, she was ill, febrile (37.5 °C), had tachycardia (112 beats per minute) with normal blood pressure (120/70 mmHg), respiratory rate (18 per minute) and oxygen saturation (99% on ambient air). She was pale and had bilateral symmetrical pitting ankle oedema, malar rash, and erythematous desquamating rash over sun exposed areas. Abdominal examination revealed an exquisitely tender subcutaneous induration in the left flank without overlying erythema, warmth or rash. Cardiovascular, respiratory and neurological examinations were unremarkable.
Investigations revealed a neutrophil leukocytosis (total white cell count 22 300 / mm3, neutrophils 88% with left shift and toxic granules), elevated C-reactive protein (120 mg/L, reference < 6 mg/L) and erythrocyte sedimentation rate (88 mm 1st hour). She also had normochromic normocytic anaemia (haemoglobin 8.9 g/dL), normal renal functions (Creatinine 57 micmol/L) and normal liver biochemistry except for hypoalbuminaemia (26 g/L). Renal biopsy was reported as having insufficient tissue as it contained only tubules, without any glomeruli.
Urinalysis showed proteinuria and microscopic haematuria without pyuria. Urine and blood cultures grew no organisms. Ultrasound scan of the abdomen showed a subcutaneous hypoechoeic area over the left flank suggestive of a fluid collection. A contrast enhanced CT scan of the abdomen was done which showed a retroperitoneal collection of pus that extended in to the subcutaneous tissues through the muscles of the posterior abdominal wall (Fig. ). No communication was reported between the abscess and the renal tissue.
She underwent incision and drainage of the abscess, which drained 400 mL of blood stained pus. Collection was found to be extending from the retroperitoneal region to the subcutaneous tissue plane, two regions communicating through a channel that penetrated the posterior abdominal wall musculature. The abscess had no communication with renal tissues or the collecting system. Pus culture isolated an extended spectrum beta lactamase producing Escherichia coli. She was treated with intravenous meropenem 1 g 8 hourly along with regular debridement of the surgical site.
Her symptoms gradually resolved with treatment and inflammatory markers returned to normal. Follow up imaging with ultrasonography did not reveal any residual collection. Two weeks later, she was discharged from in patient care with a plan for repeat biopsy from the right kidney. |
pmc-6230283-1 | A 65-year-old Japanese man was admitted to our department because of OH. He experienced a dry mouth 6 months before consultation. He undertook urinary catheter indwelling owing to urinary retention and noticed constipation 5 months prior to consultation. Four months previously, his primary care physician performed a screening test because he complained of appetite loss and body weight loss of 5 kg. Chest radiographs showed a tumor-like lesion. He was admitted to the Department of Respiratory Medicine in our hospital to evaluate the tumor-like lesion and was diagnosed with extensive disease-small cell lung carcinoma (ED-SCLC) 1 month before consultation. The tumor stage was stage IVA (T1cN2M1b). Following this, he noticed decreased diaphoresis, and suffered from OH. He undertook chemo-radiation therapy (carboplatin, etoposide and thoracic radiotherapy 50 Gy) for ED-SCLC 2 weeks before consultation. However, his daily living activities were restricted due to sustained OH after admission. ECOG PS decreased to 3 points. His medical history included hypertension at 40 years old, diabetes mellitus at 56 years old, and lumbar spinal stenosis at 59 years old. His family history was unremarkable. His medication included magnesium oxide, mosapride, lubiprostone, sennoside, pregabalin, voglibose and mitiglinide.
On consultation, his blood pressure and heart rate in supine position was 124/67 mmHg and 65/min. On standing, his blood pressure was decreased to 69/44 mmHg, and his heart rate was increased to 88/min. Physical examinations were normal. Neurological examination revealed no limb weakness, ataxia, and sensory disturbance. Pupil size and light reflex were normal, and the other cranial nerve examination was also normal. Deep tendon reflexes were in the normal range and plantar responses were flexor. However, he complained of autonomic nervous system impairment; dry mouth, urinary retention, constipation, decreased diaphoresis, and OH.
Laboratory evaluations showed elevated levels of fasting blood glucose (147 mg/dl) and hemoglobin A1c (7.2%). Anti-nuclear antibody, rheumatoid factor, anti-Ds-DNA antibody, anti-Sm antibody Anti-SS-A/Ro and anti-SS-B/La antibody tests were all negative. The coefficient of variation of RR interval was decreased (0.72%). 24-h urine catecholamine excretion showed normal level of adrenaline (4.5 μg/day; reference range 3.4–26.9) and dopamine (388.9 μg/day; reference range 365.0–961.5), and decreased level of noradrenaline (11.3 μg/day; reference range 48.6–168.4). Serum catecholamine levels also revealed normal levels of adrenaline and dopamine, but decreased levels of noradrenaline (30 pg/ml; reference range 100–450). Cerebrospinal fluid (CSF) analysis revealed normal cell counts (1 cells/μl), a total protein level of 34 mg/dl, and a glucose level of 94 mg/dl, with a concomitant blood glucose level of 147 mg/dl and a normal IgG index (0.65). Oligoclonal bands were negative. Motor and sensory nerve conduction evaluations showed no abnormalities and both waning and waxing were not shown by the repetitive nerve stimulation test. Abdominal contrast-enhanced computed tomography (CT) revealed marked colonic distention (Fig. ). Brain magnetic resonance imaging (MRI) and spinal MRI findings were unremarkable. 123I-metaiodobenzylguanidine (MIBG) myocardial scintigraphy was normal (Fig. ). Paraneoplastic autoantibodies for Hu and SOX1 were positive. Furthermore, an anti-gAchR antibody test (anti-α3 AchR) was positive. Other paraneoplastic autoantibodies including the anti-neuronal nuclear autoantibodies type 2 (Ri), delta/notch-like epidermal growth factor-related receptor (Tr), glutamic acid decarboxylase 65 (GAD65), zinc finger protein 4 (ZIC4), titin, recoverin, paraneoplastic antigen Ma2 (PNMA2), collapsin-response mediator protein 5 (CRMP or CV2), Purkinje cell antibody type 1 (Yo) were all negative. Detection of anti-α3-gAchR and the other PNS autoantibodies was performed by radioimmunoassay methodology and immunoblot analysis, respectively. Based on these results, we diagnosed the patient with autonomic PNS due to SCLC.
We used midodrine (8 mg/day), droxidopa (900 mg/day), pyridostigmine (180 mg/day), and fludrocortisone (0.1 mg/day) to treat the OH, and intravenous immunoglobulin (IVIg) 400 mg/kg body weight daily for 5 days because of diabetes mellitus and a catheter-associated urinary tract infection during admission (Fig. ). These treatments improved his autonomic symptoms due to PNS. He was able to walk again without the symptoms of OH, and ECOG PS improved to 1 point. Amelioration of urinary retention meant that the urethral balloon could be removed. Abdominal distention disappeared, confirmed by an abdominal CT after 83 days (Fig. ). The patient was then able to receive the 3 remaining courses of chemotherapy as his ECOG PS improved, and he was discharged 101 days after admission. On day 43 after discharge, his blood pressure in supine and standing positions were 124/83 mmHg and 117/69 mmHg, respectively. Four-course chemotherapy for SCLC achieved a partial response. The autonomic symptoms had not recurred and his ECOG PS remained at 1 point, 10 months after admission. |
Subsets and Splits
Exclude ER emergencies
Retrieves 100 descriptions that do not contain the terms 'ER' or 'emergency', providing a basic filter of the dataset.