_id
stringlengths
7
16
description
stringlengths
55
95.2k
pmc-6388875-1
A 75-year-old female patient was admitted to the emergency department with a sudden-onset tonic-clonic seizure and status epilepticus in December 2017. She had a history of left maxillary sinus DLBL diagnosed in July 2009. The patient was intubated and admitted to the medical intensive care unit (MICU) for the management of status epilepticus. Magnetic resonance imaging (MRI) of the brain with contrast revealed a dominant left frontal mass approximately 3.8 cm in diameter with an adjacent rim of vasogenic edema (Figure ). Signal characteristics, restricted diffusion, and the pattern of enhancement raise question of lymphoma, metastasis, or less likely intermediate-grade primary brain tumor, given the multifocal disease. In July 2009, she was admitted with seven weeks of left facial swelling, erythema, and pressure sensation. 18F-fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) scan demonstrated 2.3 x 1.4 cm focus anterior to the left maxilla. A biopsy was done by oral surgery, and the definitive pathology diagnosis was DLBL with positive immunohistochemical stain for CD20, BCL2, LCA, and CD45RB. The bone marrow biopsy was negative. The patient was staged as stage IIA with a CNS international prognostic index (CNS-IPI) score of four (high-risk group). Three cycles of chemotherapy with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) regimen and 36 Gy involved-field radiation therapy were given. The post-chemo/radiotherapy PET/CT scan showed decreased size and activity of the subcutaneous soft tissue mass anterior to the left maxilla with a residual mass of 2.4 x 0.6 cm. This mass resolved on further follow-up. Subsequent biopsy of the frontal lobe mass with frameless CT-guided navigation confirmed DLBL with positive immunohistochemical stain for CD10, CD20, BCL2, and MUM1. Over 80% of the cells stained for Ki-67 and 70% were positive for MYC. They were negative for CD3 and BCL6. The immunophenotype of the neoplastic cells was not specific for primary CNS large B-cell lymphoma, raising suspicion for CNS involvement by lymphoma originating at a different location. The patient received five cycles of high-dose methotrexate and rituximab. Two weeks after the last cycle, she had status epilepticus again and was admitted to the MICU and intubated. Brain MRI with contrast showed right frontal and parietal infarcts with a significant progression of frontal lymphoma. Chemotherapy was stopped, and the patient was started on temozolomide 150 mg/m2 since May/2018.
pmc-6389018-1
A 25-year-old female was admitted into a partial psychiatric hospital program after a short stay in the behavioral health unit of a community hospital. She initially presented to the emergency department due to recurrent depression, mood swings, anxiety, and suicidal thoughts/intent. Upon initial evaluation, she reported suicidal thoughts, sad mood, a low energy level, anhedonia, and feelings of worthlessness, helplessness, and hopelessness. She also admitted poor sleep, poor appetite, poor concentration, and recurrent episodes of self-harm. She denied any symptoms of hypomania or mania. However, she did admit to a history of mood swings and anxiety. She had several superficial lacerations on her forearms in multiple stages of healing consistent with self-mutilation. She told staff that she had been “cutting” since she was a teenager and had also tried to intentionally overdose as a teen. The patient had a long history of psychiatric conditions and had multiple prior psychiatric hospitalizations. She denied any history of physical or sexual abuse. She reported a family history of substance abuse, bipolar disorder, and borderline personality disorder. The patient was also diagnosed with Ehlers-Danlos syndrome with symptoms beginning in early childhood.
pmc-6389021-1
A 65-year-old female presented to the Department of Neurosurgery with an unruptured right middle cerebral artery (MCA) aneurysm (Figure ). Other than a left facial droop and subsequent left hemifacial spasm (which is incidental to an aneurysm), the patient had no relevant past medical or surgical history. The patient was admitted to the hospital for a right-sided craniotomy for clipping of a right MCA aneurysm. A pterional craniotomy was performed under general anesthesia. Intraoperative neurophysiological monitoring methods Median, ulnar, and posterior tibial nerve somatosensory evoked potentials (SSEP) were used in standard fashion. TCMEP and DCMEP were used for functional monitoring of the motor pathways. For TCMEP, a multi-pulse train of six was used with a pulse width of 50 µsec and an interstimulus interval (ISI) of 2 ms (500 Hz). Voltage stimulation between 100 and 300 volts was applied (controlling for the inhibition of the “crossover” response). Stimulation parameters for DCMEP included a multi-pulse train of five delivered at a constant current of 15 mA with a pulse width of 500 µsec and an ISI of 2 ms (500 Hz). Upper extremity and lower extremity muscles were used as target acquisition sites using standard intraoperative electromyography (EMG) needle electrodes for TCMEP and DCMEP. Transcranial motor evoked potential methods TCMEP data was collected before incision. The stimulus was delivered and optimized to inhibit a “crossover” recording from the ipsilateral hand muscles. Three sets of stimulation electrodes were affixed to the patient’s scalp using corkscrew needle electrodes, providing three channels of motor stimulation to switch between using a TCS 4 constant voltage stimulator unit (Cadwell, Kennewick, WA). This technique (involving the use of multiple stimulation channels) allowed for better optimization of the TCMEP recordings (Figure ). Scalp electrodes for TCMEP stimulation were placed so as not to disturb the surgical site. Direct cortical motor evoked potential methods Once the dura mater was open and the aneurysm located, a 1 x 6 strip electrode was slid under the dura and skull towards the precentral gyrus for DCMEP stimulation. Before DC stimulation was initiated, the left median nerve was stimulated at 25 mA, and somatosensory evoked responses were recorded directly from the cortical surface to ensure that the strip electrode was adequately placed over the motor area. All six contacts from the strip electrode demonstrated adequate placement over the motor cortex. Next, all six contacts from the strip electrode were plugged into six different positive output channels of an ES-IX constant current stimulator unit (Cadwell, Kennewick, WA) to allow for anodal stimulation. Six off-site returns (corkscrew electrodes placed on the scalp) were used as cathodes (negative) for each stimulation channel. Using multiple stimulation channels allowed the neurophysiologist to switch between each electrode contact from the strip electrode to find optimal DCMEP recordings. Stimulation at contact 2 from the strip electrode yielded the most reliable and robust DCMEP recordings from the targeted upper and lower extremity muscle groups (Figure ). Once reliable and reproducible recordings from DC stimulation were obtained, the DCMEP was prioritized over other neuromonitoring modalities for the remainder of the procedure. The DCMEP recordings attenuated from all upper extremity muscle groups during the temporary occlusion of the parent vessel. The lower extremity DCMEP recordings did not deviate from their established baseline. At this point, the surgeon removed the temporary clip which yielded an immediate return of the upper extremity DCMEP recordings. Once blood flow was restored to the MCA and maintained, temporary occlusion of the parent vessel was performed for a second time. Again, the DCMEP upper extremity recordings attenuated in amplitude and were eventually not obtainable (Figure ). At this point, TCMEP stimulation was conducted and there was no diminution noted compared to the baseline recordings (Figure ). All upper extremity TCMEP recordings remained within established baseline limits, whereas the DCMEP upper extremity recordings were absent. The permanent clip was placed across the neck of the aneurysm and the temporary clip was immediately removed. The DCMEP upper extremity recordings returned almost immediately after the temporary vessel occlusion was released, and the signals remained within baseline limits for the remainder of the procedure. Hemostasis was achieved, and closure was performed in standard fashion. The patient awoke neurologically intact. SSEPs were not conducted during the time of the DCMEP deterioration, which is a limitation to the case study.
pmc-6389023-1
A 32-year-old male with a known history of bipolar disorder was brought to the emergency department with altered mental status. The patient's symptoms started with slurring of speech and left-sided motor weakness a day before the presentation. The patient suffered two episodes of seizures in the emergency department, which were controlled with two intravenous doses of lorazepam. He had no prior history of seizure disorder. He had to be immediately intubated and sedated for airway protection and was transferred to the intensive care unit from the emergency department. Noncontrast computed tomography (CT) of the head was significant for an infarct in the right frontotemporoparietal region of the brain (Figure ). A CT angiogram of the head and neck revealed complete occlusion of the right middle cerebral artery (Figure ) and a nonocclusive thrombus in the right internal carotid artery (Figures -). The etiology of stroke was unclear at this time. There was no personal history of known thrombophilia and family history was not available, as he was an adopted child. Laboratory investigations were pertinent for macrocytic anemia (hemoglobin: 11.2 mg/dl, mean corpuscular volume: 105 fl/cell). The Factor V Leiden, protein C, and protein S levels were within normal limits. A urine toxicology test obtained prior to administering lorazepam to the patient was negative. The vitamin B12 and folate levels were found to be low (198 pg/ml, and 2.5 ng/ml, respectively). The methylmalonic acid level was in the normal range (0.12 mcmol/L; ref. range: 0.0-0.4 mcmol/L) while the homocysteine level was elevated (253 mcmol/L; ref range: 0-10). Laboratory findings were significant for hyperhomocysteinemia, which led us to gather more history in order to understand its etiology. It was ultimately revealed that the patient had been inhaling nitrous oxide as a recreational agent for the past five years. The patient's symptoms at presentation were past the 4.5 hour time window for thrombolytic therapy and, therefore, he was not a candidate for it. He was mechanically ventilated and oral aspirin 81 mg and atorvastatin 80 mg once daily was administered through an orogastric tube for secondary prophylaxis of ischemic stroke. He was also started on intravenous levetiracetam for seizure prophylaxis. On Day 5 of admission, the patient had a successful weaning trial and was subsequently extubated. Physical therapy and speech therapy were provided to the patient, and he was discharged home on Day 11 of admission. The patient continues to follow up in our neurology clinic. On his last follow-up, 12 months after discharge from the hospital, the patient had residual, left-sided motor weakness in both the upper and lower extremities and mild dysarthria without any signs and symptoms of peripheral neuropathy.
pmc-6389026-1
Here, we report a case of a 55-year-old woman who presented with six months of intermittent high fever, chronic non-bloody watery diarrhea and weight loss. There were no other complaints. She went to another hospital two years ago for chronic diarrhea and abdominal pain, for which she had an incomplete sigmoidoscopy which was normal according to the patient. There was no history of extra-intestinal and hepatobiliary manifestations when she was seen for the first time two years ago. Besides hypertension, she had no significant past medical or surgical history. She denied any travel history, intravenous (IV) drug abuse or a history of chronic intake of immunosuppressants or antibiotics. Her family history was non-contributory. Her vital signs were: temperature 102.2 F, heart rate 105 beats per minute, respiratory rate 18/minute and blood pressure 150/103 mmHg. Physical examination was only significant for mild tenderness in the epigastric/periumbilical area with intact bowel sounds. There was no guarding/rebound tenderness or organomegaly. Laboratory workup revealed elevated white blood cell (WBC) count at 25.91 x 109 cells per liter with a left shift, hemoglobin at 10.1 g/dL and platelets at 462 x 109/L. The basic metabolic panel did not reveal significant electrolytes disturbances. Kidney and liver functions were within normal limits except mild coagulopathy with international normalised ratio (INR) at 1.58 and hypoalbuminemia at 2.9 g/dL. Inflammatory markers erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) were remarkably elevated. Infectious workup including human immunodeficiency virus (HIV), hepatitis, clostridium difficile, ova/parasites, Entamoeba, Giardia and feces culture with toxin were not suggestive. Stool osmolar gap was indeterminate and celiac workup was negative. Abdominal computed tomography (CT) scan revealed a multiloculated abscess (10 cm x 8 cm) and multiple small abscesses on the left liver lobe (Figure ). A clinical diagnosis of the hepatic abscess was made. She was treated with IV fluids and antibiotics including piperacillin-tazobactam and metronidazole. CT-guided biopsy and Jackson-Pratt drainage tube placement were done on day three of hospitalization. Pus-like drainage fluid was drained and culture was positive for Streptococcus viridans. Patient was discharged home with two weeks of IV piperacillin-tazobactam. Follow-up CT abdominal scan at three weeks revealed the resolution of multifocal abscess in the liver. Her vital signs, WBC and CRP at follow-up were within normal limits. The medical report we requested from the other hospital where she had the incomplete sigmoidoscopy finally arrived and the pathology report indicated the diagnosis of CD. She was scheduled for a follow-up colonoscopy for further management of her CD.
pmc-6389027-1
A 35-year-old male, with no family history of cardiovascular disease or early unexpected cardiovascular death, presented to the hospital with bilateral leg swelling, shortness of breath, and chest heaviness. Review of his surgical history revealed a recent aortic root and aortic valve replacement due to infective endocarditis. On admission an electrocardiogram (ECG) showed a recalculated QTc of 469 ms when accounting for his left bundle branch block (LBBB) (Figure ) []. Pertinent admission labs included aspartate aminotransferase (AST) 150 U/L (10–55 U/L), alanine aminotransferase (ALT) 119 U/L (10–55 U/L), creatinine 1.3 mg/dl (0.5–1.3 mg/dl), and blood urea nitrogen (BUN) 15 mg/dL (8–21 mg/dL). An echocardiogram was performed and showed a dehisced aortic valve which required urgent surgical repair. His operation was complicated by blood loss and coagulopathy, which required the transfusion of two units of packed red blood cells, two units of cryoprecipitate, four units of fresh frozen plasma, and two units of platelets. The patient had an intraoperative episode of hypocalcemia with a drop in serum ionized calcium from 1.20 mmol/L to 0.91 mmol/L (1.17–1.33 mmol/L) following blood product transfusion, which then precipitated an episode of intraoperative ventricular fibrillation. During this time, the patient's serum potassium was 3.6 mmol/L (3.4–5.3 mmol/L) and his serum magnesium was 2.1 mg/dl (1.6–2.7 mg/dl). During the post-operative period, the patient received an additional three units of packed red blood cells and one unit of platelets. The patient then had another drop in his serum ionized calcium from 1.32 mmol/L to 1.10 mmol/L, which precipitated an episode of TdP (Figure ). His serum electrolytes at this time were potassium 3.4 mmol/L and magnesium 2.1 mg/dl. There were no new medications administered prior to this event, except for the administration of blood products containing the preservative citrate. Pertinent post-operative labs included AST 171 U/L (10–55 U/L), ALT 72 U/L (10–55 U/L), creatinine 1.2 mg/dl (0.5–1.3 mg/dl), and BUN 15 mg/dL (8–21 mg/dL). Fortunately, the patient was defibrillated out of TdP within two minutes of going into the adventitious rhythm. An ECG performed immediately after the episode of TdP showed a prolonged QTc of 562 ms (Figure ). Prior to discharge, and at least five days after the patient's last blood transfusion, he had an ECG which showed a significant improvement in his QTc to 401 ms (Figure ). At the time of this ECG, his serum potassium was 3.5 mmol/L, magnesium 1.6 mg/dl, and ionized calcium 1.25 mmol/L. The patient continued to improve clinically and was subsequently discharged from the hospital with no further arrhythmias.
pmc-6389028-1
A 31-year-old female presented to the emergency department (ED) in January 2017 with complaints of sharp epigastric pain radiating to the back associated with nausea and diarrhea. Past medical history was significant for cholecystectomy in 2010, depression, and IBS-D. She did not have a family history of pancreatitis. She did not consume alcohol or tobacco. Her medications included eluxadoline, bupropion, and oral contraceptive pills. Vital signs included blood pressure 123/78 mm Hg, heart rate 110 beats/minute, sinus tachycardia on telemetry, respiratory rate 18/minute, and oxygen saturation was 100% on room air. On examination, no jaundice or pallor was noted. The patient had epigastric tenderness without rebound. No organomegaly was noted. She had presented with similar complaints three weeks ago to the ED when she was diagnosed with acute pancreatitis due to epigastric pain and a lipase level of 1067 U/L by Atlanta criteria at that time. There was no abnormality on computed tomography (CT) scan of the abdomen. After stabilization in hospital, she was discharged home with symptomatic management with analgesics, anti-emetics and a plan to advance diet as tolerated. Her symptoms had resolved except for vague abdominal discomfort after meals that was characteristic of her IBS-D. Further history revealed that the patient was started on eluxadoline 75 mg BID for IBS-D three weeks before the first episode of pancreatitis. This was the reduced dose, recommended for patients without a gallbladder. Lipase level before starting the drug was 31 U/L. During this admission, her lipase level was found to be 1374 U/L. Triglyceride level was 128 mg/dl. Magnetic resonance cholangiopancreatography (MRCP) showed a normal ductal anatomy and absence of stones or tumors. The IgG4 level was normal. Lipase level decreased to 157 U/L within two days of stopping the eluxadoline. Liver function tests and blood counts were normal on both occasions. She was discharged home in a stable condition once her symptoms improved.
pmc-6389029-1
A 34-year-old female with an unremarkable past medical history presented to the hospital with an eight-day history of abdominal pain, nausea, and vomiting. She had reported chills, but there was no documented fever, and she was admitted to the medical floor. Her social medical history was significant for intravenous heroin use. On the medical floor, she developed respiratory decompensation and was moved to the intensive care unit (ICU). She started spiking high-grade fevers. She was empirically started on cefepime and vancomycin. Chest computed tomography (CT) was performed and showed septic pulmonary emboli. Soon afterward, she had to be intubated for hypoxic respiratory failure. Blood cultures drawn earlier came back positive for MRSA. The sputum culture also came back positive for MRSA. Antibiotics were de-escalated to vancomycin only. A two-dimensional (2D) transthoracic echocardiogram showed pulmonic valve endocarditis, pulmonic valve insufficiency, and tricuspid regurgitation. Despite the maintenance of a vancomycin trough between 15 and 20 mcg/dl, her blood cultures remained persistently positive for MRSA. Initial blood cultures showed a vancomycin MIC of 1.0. After around 10 days of persistently positive blood cultures, vancomycin MIC increased to 2.0. At this time, for the treatment of MRSA bacteremia, we initiated daptomycin 10 mg/kg and continued vancomycin for MRSA pneumonia. Blood cultures remained positive despite the addition of daptomycin 10 mg/kg. After a discussion with the critical-care team, we decided to discontinue the current antibiotics and initiated ceftaroline fosamil 600 mg intravenous (IV) Q8 hour. Since Q12 hour dosing is approved for skin and soft tissue infections, we used Q8 hour dosing to address the more severe infection of endocarditis, persistent positive bacteremia, and MRSA pneumonia. After two additional days of ceftaroline fosamil use, her blood culture became negative. She spent another two days in the ICU and then was transferred to the step-down unit. We were able to send her to a nursing home to finish a six-week course of IV antibiotics with ceftaroline fosamil.
pmc-6389031-1
A 15-year-old boy was admitted to Nippon Medical School Tama Nagayama Hospital because of appetite loss, vomiting, and abdominal pain persisting for approximately seven days. The patient had no history of previous gastrointestinal surgery and his medical comorbidity was autism. His vital parameters were normal and his general physical examination results were unremarkable. An abdominal examination showed distention and mild generalized tenderness without signs of peritonitis. Laboratory studies showed a mild elevation of the white blood cell count (8100/µl), a serum C-reactive protein level of 1.61 mg dl, and a serum total bilirubin level of 1.9 mg/dl (Table ). An abdominal X-ray demonstrated dilatation and a stair-step pattern in the small intestine (Figure ). Computed tomography (CT) suggested a foreign body in the ileum with proximal small bowel dilatation. The object showed high-density outside and iso-density inside. The shape of the object was oval and 30 mm in diameter. The 3D construction image from the CT images showed a clearer shape of the object (Figure ). Repeated interviews showed the following. The patient had eaten a whole peach eight days before visiting the hospital. Therefore, we diagnosed him with a small bowel obstruction caused by a seed. The foreign object was not expected to be discharged naturally because of its size. Therefore, we decided to perform surgical treatment. Intraoperatively, the foreign body was found impacted at the small intestine (approximately 20 cm from the oral side of the terminal ileum) (Figure ). There was no major damage and no defects in the neighboring small intestine. Furthermore, there was no gastrointestinal disease in any other site of the small intestine. Enterotomy was performed proximally and the seed was manipulated out of the small intestine. The bowel condition was good (no damage or stenosis), and primary repair of the enterotomy site was performed. The diameter of the foreign body was 35×28 mm, and it was a peach seed, as expected (Figure ). The patient was discharged nine days after surgical treatment, with no perioperative complications.
pmc-6389032-1
A 58-year-old African American male with autoimmune myositis diagnosed within the past year, and required tracheostomy and percutaneous endoscopic gastrostomy (PEG), was brought to the hospital by paramedics, from a nursing home, due to difficulty in breathing. He had minimal speech capabilities due to the tracheostomy in November 2017 and was subsequently placed on a ventilator. The patient was accompanied by his brother who stated that the patient was disconnected from the ventilator at the nursing home and developed difficulty in breathing. The brother also endorsed that the patient denied chest pain, dizziness, lightheadedness, headaches, palpitations, nausea, vomiting, vision changes, auditory changes, cough, congestion, back pain, abdominal pain, fevers, chills, diarrhea, constipation, or any international travel. The brother also mentioned that the patient had insulin-independent diabetes mellitus, hypertension, hyperlipidemia, chronic obstructive pulmonary disease, and a myocardial infarction status post-percutaneous coronary intervention. The brother denied any family history of malignancy and stated that the patient had no known allergies to medication or food. The patient used to be a basketball referee and had progressively mild weakness in the lower extremities for over a decade. Prior to admission, the patient was taking lisinopril-hydrochlorothiazide 20 mg/25 mg daily, sotalol 80 mg daily, apixaban 5 mg daily, atorvastatin 80 mg daily, metoprolol 100 mg twice a day, prednisone 20 mg daily, mirtazapine 15 mg, Protonix 40 mg daily, and Lantus and Novolog for diabetes mellitus. Upon arrival at the emergency department, the patient was connected to the ventilator and had stable vital signs otherwise. Physical exam findings were positive for bilateral lower lobe rhonchi, 1 + pitting edema in the lower extremities, weak neck flexor muscles, and severely weak upper- and lower-extremity proximal and distal muscle groups with atrophy of the quadriceps muscles. His ventilation settings were pressure-regulated volume control (PRVC) with the fraction of inspired oxygen (FIO2) being 40% and positive end-expiratory pressure (PEEP) of 5 mmHg. His complete blood count (CBC) showed a white cell count of 13.7 K/cm with a left shift. Serum CK and troponin levels were both elevated to 1509 U/L and 0.69 ng/ml, respectively. C-reactive protein levels were also elevated to 9.35 mg/L. Venous blood gas (VBG) showed pH of 7.51 and pCO2 of 46 mmHg. On imaging, chest X-ray was positive for a bilateral patchy infiltrate in the lower lobes. The patient’s medical records were obtained from another institution that showed that the patient had been worked up for NAM, which included autoimmune antibodies and muscle biopsy. As shown in Figure , the muscle biopsy revealed “necrotizing myopathic process without any evidence of significant inflammatory process”, a classic pathological finding for NAM. During the current hospital course, an autoimmune panel, including anti-nuclear antibodies (ANA), serum CK, anti-histidyl transfer ribonucleic acid synthetase (anti-Jo-1), anti-ribonucleoprotein (anti-RNP), anti-smooth muscle (anti-SM), anti-3-hydroxy-3-methylglutaryl-coenzyme A reductase (anti-HMGCR), and anti-signal recognition particle (anti-SRP) antibodies, was ordered for further clarification of the serotype of NAM. The patient was solely positive for anti-SRP antibody, with negative ANA and anti-HMGCR antibodies, represented in Table . A computed tomography (CT) scan of the chest and the abdominopelvic region was performed to screen for any possible malignancy leading to NAM. The result of CT scan was negative for any malignancy, ruling out a malignant etiology leading to NAM. In regards to the treatment, the patient received 50 mg of oral prednisone once daily that was tapered down to 5 mg over a five-day course. Due to the refractory nature of the disease, the patient was treated twice with 1000 mg of rituximab given two weeks apart, with each dose supplemented with 100 mg of Solu-Medrol. The patient was discharged and scheduled for a follow-up to monitor the treatment response.
pmc-6389033-1
A 23-year-old male with a past medical history of ulcerative colitis on sulfasalazine presented to the hospital with a complaint of blurry vision five days after an influenza vaccine. He had no medical history of diabetes mellitus, hypertension, glucose intolerance, systemic vasculitis, hyperlipidemia, smoking, or obesity. He denied smoking cigarettes, drinking alcohol, using intravenous drugs, and was sexually active with one female partner only. He had no significant family history of neurological disorders. On a general physical exam, his blood pressure was 122/67. The ophthalmic exam showed a dilated pupil in the right eye, mild ptosis, and diplopia with reduced adduction, elevation, and depression of the right eye but abduction and intorsion were fine. No abnormality was detected in other cranial nerve exams. Neurological and other system examinations were normal. On blood work, the complete blood count, comprehensive metabolic panel, erythrocyte sedimentation rate, lipid panel, and hemoglobin a1c (HbA1c) were unremarkable. Imaging of the brain that included computed tomography (CT) of the head without contrast, magnetic resonance imaging (MRI) of the brain with and without intravenous (IV) contrast, and magnetic resonance angiography (MRA) of the head and neck with and without IV contrast were unremarkable. The cerebrospinal fluid analysis was normal. He was treated conservatively with lubricating eye drops, and his symptoms resolved in two weeks.
pmc-6389040-1
A 56 year-old male without known cardiac risk factors presented to the emergency room complaining of retrosternal chest pain radiating to his back with excessive sweating, vertigo and mild dyspnea for about 30 minutes. Physical examination revealed scattered wheezing and a little shortness of breath. The first electrocardiogram (ECG) (18:18) demonstrated ST segment elevation of 2 mm in leads I, aVL, and ST depression in leads II, III and aVF (Fig. ). The second ECG at 18:32 indicated that all ST segments recovered to baseline. 2 hours later, the chest pain relapsed, ECG showed ST segment elevation of 3-4mm in leads II, III, aVF, V3R~V5R (Fig. ). Emergency coronary angiography revealed 50% stenosis in the middle segment of left anterior descending(LAD), 50% stenosis in the proximal segment of LCX, 90% stenosis in the middle and subocclusion in the distal segment of right coronary artery (RCA) all the stenosis disappeared after 200μg intracoronary nitroglycerin (Fig. ). He was diagnosed as coronary vasospasm and given oral isosorbidemononitrate and diltiazem as well as atrovastatin and double anti-platelet therapy (DAPT), chest pain seemed to be controlled. 11 days later, severe substernal chest pain attacked again at 2:40 during sleep, ECG showed ST segment elevation of 4mm in leads V1~V4 and ST depression of 3mm in leads V5 and V6 (Fig. ). The frequent onset of chest pain was not controlled by doubled anti-vasospasm drugs during hospitalization. The frequent onset of ischemic chest pain pushed us to probe into the inducer of coronary vasospasm, and detailed medical history enquiry provided new information pointing to anaphylaxis: the patient had experienced bronchial asthma for 6 months. Seven days before the first attack of cardiac event, he was given Chinese traditional decoction called “Ma-Xing shi gan tang”, which was boiled with Ephedra (Ma-Huang), earthworm (Di-Long) and other herbs. He suffered skin allergy with flushing, itching, erythematous rashes and urticaria on the exact day taking the decoction and experienced several episodes of mild chest pain. Therefore, discontinuation of the traditional herbs therapy (which was the suspicious sensitizer of coronary vasospasm) accompanied by oral loratadine were performed to cure anaphylaxis, this treatment strategy seemed to be effective because the onset of chest pain turned rare and mild in the following 1 month, and the patient kept symptomless for the next 2 months. However, he then attempted to resume the herbs and suffered the 3rd cardiac event, presenting extremely strong chest pain, tall and peaked T waves in leads V3~V6 in ECG (Fig. ) and obvious elevation of blood eosinophil of 23.4%. This time he completely discarded the herbs and complied to anti-vasospasm therapy for 6 months, he felt no more attacks and discontinued the anti-vasospasm drugs. During the 3 years’ follow-up, he kept free of ischemic chest pain without any anti-vasospasm drugs, although wheezing still relapsed intermittently.
pmc-6389040-2
A 57 year-old male suffered anaphylactic shock and loss of consciousness when Given Intravenous administration of cervus and cucumis polypeptide for treatment of low back pain in a local hospital. His vital signs recovered in 30 minutes after successful salvage, but then he developed tightening central chest pain and dyspnea, the ECG showed ST segment elevation of 0.5 mm in leads II, III and avF (Fig. ). He was suspected acute myocardial infarction and sent to our hospital. He had no cardiac risk factors and history of cardiovascular disease (CVD). On admission, his symptom had partly relieved, ECG showed ST segment recovered and Q wave in leads III (Fig. ). Emergency coronary angiography (5 hours after the event) showed 50% stenosis in the proximal and middle segments of LAD, 25–50% stenosis in the middle segment of LCX and 25–50% stenosis in the middle segment of Without evidence of thrombosis or trace of dissolved thrombosis in the coronary arteries. Chest pain did not relapse during hospitalization, T waves inversion persisted in leads II, III and Q wave in leads III in subsequent ECGs (Fig. ). His troponin I was 2.27ng/mL on the 5th hour of onset and reached to the peak of 3.0 ng/mL on the 18th hour, and blood eosinophil was 15.5% on arrival. Echocardiography showed regional wall motion abnormality in the inferior left ventricular wall. The patient was diagnosed as acute ST-segment elevation myocardial infarction due to allergic coronary vasospasm, the allergen was recognized as injection cervus and cucumis polypeptide. He had neither injected cervus and cucumis polypeptide nor suffer any attack of chest pain during the 1-year follow-up.
pmc-6389040-3
A 68 year-old male without known cardiac risk factors had suffered bronchial asthma for 2 years, aggregating for 3 months with the suspected allergen of detergent and pesticide sprays since he moved from south China to Beijing, accompanied by recurrent precordial squeezing pain, dyspnea and excessive sweating several hours after the episodes of wheezing and spontaneously resolved in 10~15 minutes. After admitted to the cardiology unit, he complained allergy to the smell of pesticide sprays and suffered chest pain for several times at 1:00~3:00 in the morning which was relieved by intravenous administration of nitroglycerin. ECG showed ST segments depression of 0.2-0.3 mv in leads V1-V6 on attack and resolution of ST segments when symptom was resolved, Holter showed non-sustained ventricular tachycardia at the time he felt dyspnea, while repeated tests of troponin I were negative. Coronary angiography was performed on the third day after admission, revealing a 90% stenosis in the proximal segment of LAD, a 75% stenosis in the middle segment of LAD and a 50% stenosis in the proximal segment of LCX respectively, and all stenosis disappeared after 200ug intracoronary administration of nitroglycerin. The patient was diagnosed as coronary vasospasm and was given oral isosorbidemononitrate and diltiazem for long-term therapy. The attacks of chest pain developed less frequently but still relapsed after wheezing, he could predict the mid-night chest pain by the preceding contact of allergen and wheezing, and experimentally taking loratadine (which is a non-sedating anti-histamine drug that inhibit the release of histamine from mast cells) could effectively prevent or alleviate the episodes of chest pain.
pmc-6389040-4
A 42 year-old female without history of atopy and cardiovascular risks received surgical abortion under intravenous anesthesia of Propofol in February, 2013. At 7:00 on the 7th morning of the surgery, she suffered a sudden severe pressure-like pain of 10 minutes in the left subclavian and retrosternal area when she was lying in bed. After that, such pain recurrently occurred in the midnight and early morning. She was diagnosed as angina pectoris in the local hospital and given aspirin, clopidogrel, atorvastatin and nitrates, but chest pain still relapsed. After a serious attack of 15 minutes with heavy sweating at 2:00, she was sent to our hospital. On admission, her blood pressure was 150/100 mmHg, heart rate was 76 beat per minute, physical examination revealed no abnormalities. ECG on admission was normal (Fig. ), troponin I was negative and the rate of eosinophil was 2.5%, coronary angiography revealed a plaque in the proximal segment of LAD without stenosis and other coronary arteries were normal. She was suspected as coronary vasospasm and was given mononitrate, nifedipine, aspirin, clopidogrel and atrovastatin. However, ischemic chest pain continued attacking in the morning during hospitalization. On the 3rd morning after angiography, she suffer a 5-minute episode, ECG showed downsloping ST segments depression of 1~3mm in leads I, aVL, II, III, aVF and V2-V6 (Fig. ), the symptom was relieved by one dose (0.5 mg) of sublingual nitroglycerin and ST segments recovered, whereas another two attacks occurred 2 hours and 4 hours later, respectively, with the same ECG presentation. After continuous 48-hour intravenous administration of nitroglycerin, as well as added dose of mononitrate and nifedipine before night sleep, chest pain seemed to calm down, she kept symptomless for 5 days and discharged. She occasionally suffered early morning chest pain for 5-10 minutes in the first 4 months though adhering to drugs. Interestingly, the episodes suddenly stopped when her menopause recovered in August, 2013, and her chest pain never relapsed during the 4 years follow-up.
pmc-6389040-5
A 45 year-old male developed flushing and urticaria 15 minutes after eating pineapple, then he felt precordial squeezing pain radiating to the left shoulder, lasting for several minutes, accompanied by palpitation and excessive sweating. He is a smoker with no other cardiac risk factors and no history of CVD, he was allergic to pineapple before but only manifested as slight itching and skin rashes which spontaneously disappeared in hours. Before this onset, he had been working day and night for 1 month with doubled tabacco smoking, though he did not smoke after eating pineapple. The patient was sent to the emergency room, on arriving, his symptoms had been relieved by sublingual nitroglycerin, his blood pressure was 120/70mmHg, pulse rate was 80 beat per minute, and ECG revealed no abnormalities while the symptom had relieved. 24h Holter (Figs. , and ) revealed ST segment elevation for 2~3 mm in leads II, III, aVF, V5, V6 at 13:40-13:42 (when he felt malaise, chest pain and palpitation at rest) and 20:20-20:22 (when he was driving, he felt chest pain and left arm numb), as well as ventricular bigeminy and nonsustained ventricular tachycardia at 13:20 and 13:42. He was admitted to cardiology department, blood test showed normal troponin I level and elevated eosinophil of 7.6% on the first day of admission. Coronary angiography showed subocclusion in the proximal segment of LCX with TIMI grade 3 flow, which was relieved by 3 times of 200μg intracoronary nitroglycerin. He was diagnosed as coronary vasospasm on the basis of anaphylaxis to pineapple, and received anti-vasospasm therapy of mononitrate and nifedipine as well as antiallergic agent, the eosinophil rate declined to 6.1% on the 7thday, chest pain didn’t relapse during hospitalization. After 12 months of mononitrate and nifedipine medication, anti-vasospasm therapy was discontinued. During 3 years follow-up, he kept free of cardiac events.
pmc-6389052-1
This case involves a 20-year-old healthy white man incarcerated in a detention center in Geneva, Switzerland. He had no medical or mental health conditions and did not take any medication. He has two older siblings, had dropped out of school at a young age, and was living with his mother at the time of incarceration. He used to smoke tobacco and cannabis, which he stopped 2 years ago, consumed cocaine and ecstasy (methylene-dioxymethamphetamine) until 6 months before his incarceration, and drank alcohol occasionally without reporting any binge drinking. Due to a recent trauma to his left wrist, he was accompanied to our University Hospital for an X-ray. Once in Radiology, he confessed to the technician that he had ingested an illicit drug packet 4 days earlier in anticipation of an impending cell search. The drug packet was reportedly 4 to 5 cm in size, contained 6 to 8 g of cocaine, and was wrapped in a condom and plastic food-wrap. He was worried because he had not yet evacuated the packet and had been experiencing mild epigastric pain for a few hours before his x-ray appointment. He did not have any other gastrointestinal (GI) symptoms, including nausea, vomiting, diarrhea, and constipation. After the wrist X-ray he was taken to our Emergency Department (ED) for the management of the body stuffing. On admission, his vital signs were as follows: blood pressure of 131/60 mmHg, heart rate of 74 beats/minute, and temperature of 37.6 °C. He was alert, oriented, calm, and expressed no intention of self-harm. A physical examination revealed epigastric tenderness, but no abdominal rigidity, guarding, rebound tenderness, or evidence of a palpable mass. The rest of the examination was unremarkable, including a cardiopulmonary and a complete neurological examination. Laboratory findings were within normal range, including a complete blood count (hemoglobin of 16.2 g/dL, white cell count of 8.5 G/L, platelet count of 121 G/L), kidney and liver function tests, and a urine analysis. Tests for HIV and hepatitis B were negative. He returned to our Radiology Department where a low-dose abdominal CT scan was performed and revealed multiple foreign bodies of similar aspect throughout his stomach, his duodenum, and his small intestine, all of which were consistent with packets of loosely aggregated drugs (Fig. ). There was no sign of GI perforation or obstruction. He was subsequently admitted to our in-patient Carceral Unit for observation. When confronted with the radiology findings of multiple foreign bodies he insisted on having swallowed only one drug packet. Further exploration revealed that he used various GI-stimulating techniques which had been recommended by his fellow inmates to accelerate the expulsion of his slow-progressing packet. These included drinking large quantities of water (more than 3 L daily), ingesting three to four tablespoons of olive oil daily, a cupful of natural fig-based laxative, and applying warm towels on his “liver.” On day 3 after the packet ingestion and as a last resort, he carved and ingested 12 bite-sized apple chunks with the hope that together they would push the packet through his GI system. Despite all these attempts, he continued to have regular bowel movements once daily without evacuating the packet. The fear of a complication compelled him to seize the opportunity of being brought to the X-ray room to reveal the circumstances of his condition to the radiology technician. Since the apple chunks could have been interpreted as images of loosely compacted drug packets, a second low-dose CT scan was performed the day after his admission (day 5 post-ingestion): the apple chunks were partially digested and the images showed the persistence in his stomach of one foreign body containing air and measuring 3.1 × 3.2 × 4 cm (Fig. ). Since the packet had been trapped in his stomach for the past 5 days, the condom wrapping was likely to have been compromised by gastric acidity, thus increasing the risk of rupture. Therefore, a proton pump inhibitor (PPI) of esomeprazole was administered intravenously. After discussing management options with our patient, GI specialists recommended using surgery rather than gastric endoscopy in order to extract the drug packet with a minimum of risk. A laparoscopic gastrotomy confirmed a floating packet in the gastric fluid which was removed without complications (Fig. ). Analysis of the packet after retrieval confirmed that the drug was cocaine. The packet was loosely wrapped in two different materials: a first double layer of plastic food-wrap inserted into a condom which was tied with a knot and folded back to form another layer and secured with an outer knot (Figs. and ). He presented a transitory fever up to 38.8 °C at 48-hours post-surgery but otherwise maintained normal vital signs. He resumed oral intake shortly after surgery and continued the PPI treatment for 2 weeks after surgery to aid healing. He was discharged back to prison on day 4 post-surgery. An out-patient follow-up in the prison health service was unremarkable. He was released from detention 2 months after surgery and further follow-up was not possible.
pmc-6389057-1
A 47-year-old male with a body weight of 84 kg and height of 1.65 m living in underprivileged part of Islamabad has a history of generalized pain, fatigue, and fever. He was diagnosed with chronic HCV (3a genotype) infection in 2003. The patient’s medical history was not significant except for dental surgery and few surgical stitches. He remained treatment naïve for 5 years. In 2007, he received the first IFN (100 mg/week) plus RBV (400 mg/day) combination therapy and was on this treatment for 6 months. However, SVR was not achieved. He remained without treatment for the next 2 years (2008–2009). In 2010, he again underwent the same combination therapy. After 6 months of treatment, he, remained positive for HCV RNA. These treatments were not only expensive but also resulted in adverse effects, including stomach burning, loss of appetite, nausea, fever, fatigue, and anxiety. In 2011, Patient was advised to undergo PEG-IFN plus RBV combination therapy. However, he remained a non-responder. After one and a half year, in 2013, patient received the same (PEG-IFN plus RBV) combination therapy for 6 months. Yet patient’s serum was still positive for HCV RNA. Eventually, in 2015, he underwent SOF (400 mg/day) plus RBV combination therapy for 6 months. Still SVR was not achieved and surprisingly a high viral load of 5.2 × 105 IU/ml was reported by real-time polymerase chain reaction (PCR) diagnosis. An ultrasound revealed that his liver was of normal shape, size, and echotexture; he had a mildly fatty liver with no fibrosis or lesion. The patient’s diagnostic and treatment history are summarized in Tables and , respectively. Viral genotype remained undetermined/untypable for the years 2012, 2014, and early 2016 (Table ) following 6 months of combination therapy (Table ), perhaps due to the detection method’s incapability or the detection limit as it was performed on conventional PCR-based method followed by detection on the agarose gel. In late 2016, the viral load was found to be 5.2 × 105 IU/ml and the patient was found positive for genotype 3a (Table ). After partial genome sequencing of NS5B, BLAST analysis showed 93% similarity to the already existing NS5B nucleotide sequences in the GenBank database (Fig. ). This shows virus (accession number KY971494; variant ‘Pk1-RV’) is of genotype 3a. Analysis further confirmed that the variant (Pk1-RV) is distinct from HCV genotypes 3 k, 3b, 1a, and 1b (Fig. ). Taking into account the medical history of the patient, we performed restriction fragment length polymorphism (RFLP) for interleukin 28B (IL28B) at rs8099917 and rs12979860. The present study showed polymorphism cytosine and thymine (CT) and guanine and thymine (GT) at (rs12978960, (rs8099917) respectively, as in (Fig. ). Same polymorphism was reported by Yang et al. who has linked it with successful treatment outcome (SVR) [].
pmc-6389061-1
A 21-year-old female with a palpable painless mass in her lower abdomen which was gradually increasing in size was admitted to our institution. Physical examination demonstrated a firm, non-tender and non-movable mass measuring 8 × 9 cm in size protruding through the anterior pelvic wall. The index of hemotology and biochemistry were all in the normal scope. The patient has no history of injury or surgery, and no family history was identified. The nosocomial MRI revealed a well-defined, 12 × 10 × 9 cm-sized, lobulated mass within the mid-pelvis. The mass exhibited isointensity relative to muscle in fat-supressed T1-weighted MR image (Fig. ) and heterogeneous relatively hyperintensity with a little stip and patchy hypointensity inside on fat-suppression T2-weighted MR image (Fig. ). Meanwhile, circinate low signal intensity can be found around the tumor, indicating that there was a capsule or pseudocapsule. Sagittal T2WI showed that the rectus abdominis was open with umbrella shape (Fig. ). The tumor showed restricted diffusion on diffusion weighted imaging (DWI) (Fig. ) and apparent diffusion coefficient (ADC) map (Fig. ), which presented as heterogeneous hyperintensity and hypointensity, respectively. It also showed heterogeneous enhancement on fat-suppression T1WI after the contrast agent injected (Fig. -). The area of higher signal intensity exhibited more obvious enhancement compared with lower signal intensity area on T2WI. At surgery, the mass was located at the symphysis ossium pubis, invading the lower right rectus abdominis and the bottom of the bladder. It was well circumscribed, firm and lobulated appearance. The cut surface of the lesion was pale white and glistening with neither necrosis nor hemorrhage. Microscopic examination identified alternating fibrous and myxoid stroma areas inside the tumor, the tumor cells arranging in a whorled growth pattern with curvilinear capillaries (Fig. ). Immunohistochemically, the tumor cells were positive for smooth muscle actin (SMA) (Fig. ). MRI findings combined with histopathological analysis made a final diagnosis of LGFMS. The patient was discharged from hospital 10 days after the operation. During one year of follow-up, the patient was in a good status without evidence of recurrence.
pmc-6389062-1
An asymptomatic 61-year-old woman (gravida 0, reaching menopause in her 40s) was referred to our hospital because of elevated levels of CA125 (389 U/mL; normal range < 35 U/mL) and CA19–9 (785 U/mL; normal range < 37 U/mL). Pelvic magnetic resonance imaging showed a heterogenous mass 7.3 cm in diameter composed of an enhanced solid area and a bloody liquid area, suggesting degenerated leiomyoma or leiomyosarcoma. Endometrial and cervical cytology was performed, which did not indicate any malignant tumors. Because significant uptake of fluorodeoxyglucose was observed in the lesion, a total hysterectomy and bilateral salpingo-oophorectomy were performed. After surgery, the peripheral levels of both tumor markers returned to normal. The patient then underwent adjuvant chemotherapy (paclitaxel and carboplatin) and currently remains free of disease 9 months since the operation. Macroscopic examination of the resected specimen did not reveal any significant changes in the luminal surface of the uterine cervix, endocervix, endometrium, or peritoneal surface, except for an endometrial polyp and intramural and subserosal myomas. The tumor (8 cm × 6.5 cm) was located in the left-sided posterolateral wall of the corpus and was entirely confined to the myometrium (Fig. ). The tumor was comprised of a yellow–white bulky polypoid mass in an intramural cyst containing brownish serous fluid and an invasive lesion in continuum with the intracystic component (Fig. ). No abnormalities in the uterine cervix or adnexa were observed. The tumor was composed of an intracystic bulky component confined to the intramural cyst and an invasive component in the myometrial layer (Fig. ). In the former component, a variety of morphologic patterns, such as tubular, papillary, acinar, and solid growth, were observed. These patterns were admixed but changed abruptly in some areas. The predominant and characteristic growth pattern was a tubular pattern, in which back-to-back, small, round, uniform tubules were lined by cuboidal or flattened cells, and some of their lumens exhibited densely eosinophilic, PAS-positive secretion (Fig. ). Acinic and solid patterns were observed at the periphery of the mass neighboring the myometrial wall (Fig. ). The tumor cells were relatively bland and absent from the nuclear pleomorphism, although occasional mitotic figures were observed. In addition to the abovementioned component at the periphery of the intracystic mass, a more atypical tumor component invaded the myometrial wall (Fig. ). This component exhibited a ductal pattern with many mitotic figures and moderate cytologic atypia. No squamoid or mucinous elements were detected. Invasion was observed from the outer-most layer of the cyst to just beneath the peritoneal surface. No tumor necrotic foci were observed in either component. No neoplastic changes were observed in the cervix, endometrium, or fallopian tubes. Scattered ectopic endometrial tissue was observed in the myometrium. Despite a careful and thorough examination, no mesonephric remnants were identified in the myometrium or uterine cervix. Regardless of the differences in histologic patterns, all neoplastic cells were diffusely positive for CK7 and PAX8 and completely negative for CK20, inhibin, PgR, and WT1 (Table ). Only a small number of cells (<1%) in the tubular pattern expressed ER and Napsin A; neither was observed in other patterns. Luminal staining of the neoplastic tubules for CD10, nuclear and cytoplasmic staining for calretinin, and nuclear staining for GATA3 were observed focally (Fig. –). Tumor cells in the tubular and acinar patterns exhibited diffuse expression of vimentin and TTF-1, whereas no expression was observed in those in the solid pattern (Fig. ). Focal but intense expression of CA125 and CA19–9 was observed in the tumor regardless of the histologic pattern (Fig. , ). A high labeling index of Ki67 antigen was observed in the solid and ductal patterns in the myometrial layer but was much lower in the tubular and acinar patterns in the cystic component. Significant expression of p53 antigen was not observed in either component.
pmc-6389070-1
A 66-year-old Japanese woman presented with a 5-month history of cough and sore throat. Clinical examination revealed a palpable elastic hard mass on the right side of the neck; ultrasonography and computed tomography revealed the mass to be in the lower pole of the right thyroidal lobe without extrathyroidal extension and the Delphian and paratracheal lymph nodes to be slightly enlarged. No other enlarged lymph nodes and metastatic lesions were detected in the body. Serum thyroid stimulating hormone (29.32 μIU/mL, reference range: 0.35–4.94 μIU/mL) and anti-thyroid peroxidase antibody (576 IU/mL, reference range: 0–16 IU/mL) levels were elevated. Serum free T3 (1.42 pg/mL, reference range: 1.71–3.71 pg/mL) and serum free T4 (0.46 ng/dL, reference range: 0.70–1.48 ng/dL) levels were slightly decreased; however, other laboratory data were normal, including thyroglobulin (1.73 ng/mL, reference range: 0–33.7 ng/mL) and IgG4 (60.3 mg/dL, reference range: 4.8–105 mg/dL) levels. Fine needle aspiration of the thyroidal mass obtained follicular cell clusters containing less amounts of colloid, which were categorized as “atypia of undetermined significance or follicular lesion of undetermined significance (AUS/FLUS),” in a background slightly rich in lymphocytes and plasma cells []. The patient and her family had no relevant previous history of disease. The clinical and radiological findings indicated thyroidal cancer rather than thyroidal inflammatory disorders such as subacute and Hashimoto thyroiditis; therefore, partial thyroidectomy (right lobectomy) with Delphian and paratracheal lymph node dissection was carried out after careful informed consent. The postoperative course was uneventful. Gross examination revealed that whitish, firm, somewhat nodular lesions were distributed into the upper and lower poles (Fig. and ). Particularly in the lower pole, lesions were fused, forming a somewhat circumscribed mass measuring approximately 2.5 cm in diameter, which was clinically and radiologically misinterpreted as thyroidal cancer. As shown in Fig. , the histology seems to differ between mass lesion and background thyroidal tissue. In the lower pole’s mass, interstitial storiform fibrosis extended abundantly; however, it did not extend beyond the thyroid capsule. Most of the follicular epithelium was effaced, and a few cells underwent squamous metaplasia and formed morulae sporadically. There was extensive infiltration of lymphocytes and plasma cells with the occasional formation of well-developed germinal centers. Meanwhile, in the background tissue, lymphocytes and plasma cells intensely infiltrated the parenchyma, as seen in lymphocytic thyroiditis; however, storiform fibrosis did not occur. The thyroid follicles were not effaced but atrophic and regenerative with less colloid. Obstructive and non-obstructive phlebitis was not observed. As shown in Fig. and , immunohistochemical analysis revealed that the infiltrating lymphocytes included numerous IgG4-secreting plasma cells (45–55 cells/high power field), and the IgG4/IgG-secreting plasma cell ratio was increased (approximately 49.4%) in both the whitish sclerotic nodular lesions and the background thyroidal tissue. In-situ hybridization assay demonstrated that the κ and λ light-chain-producing plasma cell populations did not differ significantly. The Delphian and paratracheal lymph nodes were grossly swollen, measuring 7 mm and 11 mm, respectively (major axis). Histologically, lymph node architecture was reactively hyperplastic, and plasma cells, including IgG4-secreting cells, were infiltrated in great number, particularly in the interfollicular area of the inner cortex (Figs. and ).
pmc-6389076-1
A 46-year old female patient, who had been suffering from autoimmune thyroid disease for eight years, presented at our clinic with an acute exacerbation of GO. Clinical examination revealed a convergent strabismus fixus with severe hypotropia of both eyes (Fig. ). The patient complained of increasing loss of eyesight and heavy retrobulbar pain. Visual acuity had deteriorated significantly from 0.6/0.5 to 0.1/0.1 within 3 months. A contrast enhanced orbital MRI scan showed distinct swelling of all extraocular muscles with bilateral compression of the optic nerve (Fig. ). There was no history of comorbidities except nicotine abuse. Laboratory tests showed a euthyroid biochemical status with TSH within the normal range, but elevated levels of Anti-Thyroid Peroxidase Antibody, Anti-Thyroglobulin Antibody and Thyroid Receptor Antibody. The patient’s daily medication comprised of 200 μg L-Thyroxin and 200 μg Selenium. Over many years, the patient had shown only mild to moderate symptoms of GO, but following a thyroidectomy, the symptoms had recently worsened dramatically. Since the disease could not be controlled by high-dose systemic glucocorticoid therapy, bilateral three wall orbital decompression had been performed twice previously. In the first step, the medial orbital wall had been resected via an endonasal approach. Due to ongoing findings as before, two months later partial resection of the orbital floor and fenestration of the lateral orbital wall via a combined transconjunctival/transcaruncular approach with piezosurgery had been performed. In addition, high-dose systemic glucocorticoid therapy was conducted prior to surgery and for the first two months after surgery. Glucocorticoid medication had to be gradually reduced until zero because the patient suffered from an upcoming depression and Cushing syndrome. Orbital radiotherapy for the treatment of thyroid eye disease had been considered as a therapeutic option, but the rapid progress of the disease with the growing risk of dysthyroid optic neuropathy forced us to act more quickly than orbital radiotherapy could perform []. Since the patient increasingly suffered from loss of vision and heavy pain attacks because of medial caudal squinting, we decided to correct the hypo- and esotropia surgically by releasing and repositioning the insertion points of the inferior and medial rectus muscle. Acute surgery was the last remaining treatment option. Operations on the left and right eye were performed consecutively with an interval of one week. The eye with the lower vision (left side) was chosen first. A forced duction test showed a complete fixation of the bulb. We opted for a transconjunctival approach (limbal incision) combined with lateral canthotomy to gain access to the dorsal part of the inferior part of the eye bulb. The insertion of the inferior rectus muscle was localized and then circuited with a squint hook (Fig. ). A non-absorbable polyethylene suture (Mersilene 4.0, Ethicon, U.S.) was placed at the anterior rim of the muscle before the muscle was detached from the outer bulb. This release in tension immediately resulted in the spontaneous elevation of the bulb. Lengthening of the muscle with an interposition graft (e.g. fascia lata) was not possible because of the deep retraction of the muscle. Instead, the polyethylene thread loop was directly fixed to the sclera at the former muscle insertion area, placing the muscle 12-15 mm dorsally with regard to its original fixation position. By marking of the original muscle insertion point with a non-absorbable polyethylene suture, an option could be preserved for a more precise muscle readaption at a later stage. Subsequently, the same procedure was carried out with the medial rectus muscle. Less tension allowed direct refixation of the muscle to the sclera without bridging by the polyethylene suture. The bulb was freely movable and remained vertically and horizontally in a primary position (Fig. ). Despite a significant exophthalmos, passive eyelid closure could easily be performed. The significant conjunctival contraction caused by the long-term hypotropia meant that only partial conjunctival wound closure with a polyglactin suture (Vicryl 7.0, Ethicon, U.S.) was possible. No postoperative complications occurred under the postoperative systemic antibiotic medication with Clindamycin of 3x600mg per day over three days supplemented by local application of Neomycin eye ointment for one week. Surgery of the right eye was conducted in the same manner (Fig. ) and under the same perioperative protocol one week later. Additionally, two mucosal grafts of 3.0 × 1.5 cm were harvested bilaterally from the inner cheek to be used for the bilateral reconstruction of the conjunctiva. The intraoral donor sites were closed primarily by using Vicryl 3.0 (Ethicon, U.S.). Starting from extreme eso- and hypotropia, the operation succeeded in repositioning the bulbs into the vertical and horizontal primary position with no restriction of passive movements. Three months postoperatively, the patient was free of pain and had a visual acuity of 0.3/0.6. Visual field testing (Goldmann perimetry) showed only slight concentric bilateral restrictions. Surprisingly, the patient did not suffer from diplopia despite the persistent restriction of active ocular mobility and a moderate bilateral exotropia (Fig. ). Follow-up examinations of the patient will be performed at close intervals, including ophthalmological check-ups and the testing of thyroid blood parameters. Contrast enhanced orbital MRI scans will allow the measurement of extraocular muscle volume, as described by Kolk et al. []. Orbital MRI scans were performed preoperatively and three months postoperatively (Fig. ) and the volumes of the extraocular muscles were calculated by using manual segmentation (Osirix Imaging software 5.9) (Table ). During this time interval, the total extraocular muscle volume increased from 24.91cm3 to 29.29cm3. Together with the ongoing high levels of thyroid-specific antibodies (Anti-Thyroid Peroxidase Antibody, Anti-Thyroglobulin Antibody and Thyroid Receptor Antibody), this indicated that the patient was still in an active stage of GO. Volumetric measurements of the extraocular muscles, based on follow-up MRI scans, will help to monitor the course of the disease. Further squint surgery, in terms of a precise readaption of the extraocular muscles, will be postponed to the future, when a more stable stage of the systemic autoimmune disease will be reached.
pmc-6389105-1
A 31-year-old woman was admitted to our hospital because of a mass on the neck. Examination revealed a 3-cm mass on the right neck with no pain and with movement during swallowing. Color Doppler Ultrasound revealed enlargement of the right lobe of the thyroid, tallish echo nodules, 19 × 11 mm, of uncertain nature, and the absence of images manifesting the left lobe ECT examination demonstrated the absence of images manifesting the left lobe and definite nodules on the right lobe in the middle of the thyroid. CT showed an enlarged right lobe and the absence of images manifesting the left lobe (Fig. ) and showed no sign of tracheal compression. The antiTG and antiTPO levels were 45 and 8.5 IU/L, respectively, indicating normal thyroid and parathyroid gland function. The patient had no similar family history. In order to eliminate a tumor, the patient agreed to an operation but rejected needle biopsy. The operation revealed the absence of the left lobe of the thyroid and the left side of the parathyroid gland (Fig. ). Diffuse enlargement and a hard nodule on the right lobe of the thyroid were found synchronously. The operation was immediately terminated when pathological examination of the thyroid nodule led to the diagnosis of Hashimoto’s thyroiditis (Fig. ). The patient recovered well and accepted thyroxin tablets.
pmc-6389137-1
A 70-year-old white man developed right knee pain and swelling followed by left ankle pain and swelling over a week. Over the next 4 months, his symptoms progressed to include both knees, both feet, and both hands. Due to the severity of his symptoms he was unable to ambulate or carry out normal activities of daily living. He initially took ibuprofen 800 mg three times daily with some mild improvement, but at the time of presentation, it offered no relief. In addition, he endorsed morning stiffness that persisted for most of the day. Due to the stiffness in his joints, he could no longer ambulate and presented to our clinic in a wheelchair. He previously was fully functional and independent in his activities of daily living. He was an avid fisherman and was unable to pursue his interests at all. His past medical history was significant for metastatic melanoma initially diagnosed 2 years ago. His initial lesion was located over the left side of his neck and he had a Mohs procedure with negative margins. He was monitored closely for 1.5 years until he was found to have new right lower lobe lung nodules on positron emission tomography (PET)/computed tomography (CT) with increased fluorodeoxyglucose (FDG) uptake. Wedge resection of the right lower lobe revealed metastatic melanoma with wild type BRAF and no C-KIT mutations. Continued surveillance demonstrated an increasing number of right pulmonary nodules over the next 6 months. Dual therapy nivolumab (1 mg/kg every 3 weeks for four doses followed by 240 mg every 2 weeks) and ipilimumab (3 mg/kg every 3 weeks) immunotherapy was started. After the second cycle of his immunotherapy he developed severe non-infectious colitis requiring hospitalization. His immunotherapy was stopped and his colitis resolved with supportive care and glucocorticoids. Without further immunotherapy, he developed new left pulmonary nodules within 6 months that were increasing in size. Single agent immunotherapy with nivolumab (240 mg every 2 weeks) was started 4 months before his presentation to Rheumatology. With single agent immunotherapy, the pulmonary nodules receded fully and no further metastatic disease was seen on subsequent PET/CT imaging 3 months later. His medical history was also notable for hypertension and benign prostatic hypertrophy. He was treated with hydrochlorothiazide, aspirin, and nivolumab. He had no known drug allergies. There was no family history of connective tissue disease or inflammatory arthritis. His mother died from colon cancer in her 80s and his father had coronary artery disease. He was married with three living children. He served in the Navy during the Vietnam War and worked as a mechanic after his military service until retirement. He denied any history of recreational drug or alcohol use. He reported a 20-pack year tobacco smoking history, but quit over 10 years ago. He denied having any chest pain, shortness of breath, rashes, oral or nasal ulcers, alopecia, Raynaud’s disease, fevers, chills, night sweats, or unintended weight loss. He did endorse feeling weak because of his chronic condition. He appeared his stated age and in no apparent distress. His temperature was 37 °C, blood pressure 116/78, heart rate 70 beats per minute, and oxygen saturation 100% on ambient air. His musculoskeletal examination was significant for tender boggy synovitis of his bilateral metacarpophalangeal joints (MCPs), proximal interphalangeal joints (PIPs), wrists, elbows, knees, ankles, and metatarsophalangeal joints (MTPs). There was no palpable effusion in any joint but he had significant soft tissue pitting edema present over his extremities. There was +3 pitting edema over the dorsum of both hands and feet extending up to his wrists and mid-shins respectively. There was mild erythema and warmth present over his joints, most notable over his MCPs (Fig. ). There was decreased range of motion in his hands, feet, ankles, elbows, and knees. There also were extensor tendon rubs noted on range of motion of his MCPs bilaterally by palpation and auscultation. The remainder of the musculoskeletal examination and general physical examination was unremarkable. There were no rheumatoid nodules noted on examination. Results of the laboratory evaluation are shown in Table . Our patient’s erythrocyte sedimentation rate and C-reactive protein (CRP) were quite elevated. The remainder of his laboratory tests was unremarkable. Ultrasound and X-ray imaging of his hands were obtained (Figs. and ) demonstrating soft tissue swelling and extensor tenosynovitis. There were no erosions present. He was started on prednisone 40 mg (0.5 mg/kg per day) and tapered gradually over the course of 6 weeks to 10 mg daily. He had a very rapid response to the prednisone with almost complete resolution of his symptoms. Once his prednisone was decreased below 10 mg he began noticing a steady return of his symptoms. During this time period he continued treatment with nivolumab and on surveillance imaging he had complete resolution of metastatic disease. Due to the marked response of his melanoma to immunotherapy, it was felt that paraneoplastic RS3PE was unlikely. Although at the time there were no published reports of nivolumab or other checkpoint inhibitors causing a RS3PE picture, it was felt that because of the temporal relationship between the nivolumab and the acute onset of his symptoms that they were related. The numerous previously described autoimmune conditions associated with checkpoint inhibitors raised the possibility that this presentation of RS3PE was another rheumatological manifestation. The clinical dilemma we were left with was that our patient had previously demonstrated a very rapid relapse of his stage 4 melanoma when off treatment, yet was incapacitated with the side effect of the treatment. After a careful discussion with his oncologist, we elected to maintain a steady dose of prednisone of 7.5 mg daily to control rheumatological symptoms and continue nivolumab. At 9 months, he demonstrated minimal pitting edema, no inflammatory arthritis, and continued full response from nivolumab therapy.
pmc-6389155-1
A 40-year-old man with no significant medical history, had experienced occasional left-sided waist back pain for 11 months. No organomegaly was noted in the waist on physical examination. Abdominal ultrasound demonstrated a round mixed echogenicity mass in the spleen, with internal color Doppler flow (Fig. ). Within the mass, the inhomogeneous echogenicity with patchy hyperechoic and iso-echoic foci were noted. Magnetic resonance imaging (MRI) displayed a hyper-enhancing abnormal signal lesion on T1-weighted and T2-weighted images (Fig. ), the result of which was considered an inflammatory myofibroblastic tumor (IMT). The differential diagnosis included an atypical hemangioma and lymphoproliferative disorders. No sign of infiltration of adjacent organs was found but malignancy could not be ruled out. The patient underwent splenectomy and has remained well in follow-up for 3 years. Macroscopically, the resected spleen measured 13 cm × 7.8 cm × 6.5 cm. Cut sections of the spleen revealed a solitary, well-circumscribed but unencapsulated, round and solid mass with dark red color sized 7.5 cm × 7 cm × 6.5 cm. The lesion demonstrated expansile growth compressing the adjacent normal splenic parenchyma (Fig. ). A small accessory spleen (approximately 0.6 cm in diameter) was also noted. On histologic examination, the lesion was less well demarcated from the adjoining parenchyma and compressed the surrounding tissue (Fig. ). It was composed of unorganized slit-like, narrow tubular or cavernous vascular channels lined with plump or flat endothelial cells. These vascular channels contained erythrocytes, and the extravasation of red cells was also prominent (Fig. ). Variable numbers of small lymphocytes, neutrophils, plasma cells, and siderophages infiltrated the loose stroma. There were scattered small aggregates of lymphocytes while no organized lymphoid follicles of the white pulp were observed. Foci of fat vacuoles were noted, and there was no extramedullary hematopoiesis (Fig. ). The most striking population was isolated bizarre large cells that were scattered throughout the lesion. These bizarre stroma cells did not line or appear within the vascular lumens, nor were they aggregated around the sinusoid-like channels (Fig. ). They exhibited irregular morphology of nuclei, such as oval, reniform, multilobulated, convoluted, or deeply cleaved with scarcely visible cytoplasms. The chromatin was finely granular or vesicular. Intranuclear pseudoinclusions and nuclear grooves occasionally were noted. Nucleoli were inconspicuous and sometimes prominent in some bizarre cells. Mitotic activity, necrosis, or infiltrative growth pattern was not identified. The rest of the spleen and the accessory spleen presented normal components of red and white pulp. An immunohistochemical panel (Table ) was performed. On immunohistochemical staining, the lining cells of sinusoid-like channels stained positively for CD8, consistent with the endothelia of normal splenic sinuses (Fig. ). CD31 and Fli-1 were also positive for lining cells while CD34 was focal positive (Fig. ). Histiocytes were revealed by CD68 and CD31. Immunostain for vimentin was diffusely positive (Fig. ). The bizarre stroma cells were negative for all other markers except for vimentin.
pmc-6389237-1
A 50-year-old Caucasian woman with a 6-month history of Crohn’s disease and receiving methotrexate for this disease presented with deranged liver function tests to our gastroenterology clinic. She had recently been discharged from the hospital 1 week earlier, following a flare of her Crohn’s disease. On discharge, she was sent home with nasogastric feeding to help with her malnutrition, and as part of recognizing any refeeding syndrome, she was having regular blood tests in the community. Her routine blood tests on 19 December 2016 showed marked derangement in her transaminases, with aspartate transaminase (AST) of 787 U/L and alanine transaminase (ALT) of 1032 U/L. Her bilirubin and alkaline phosphatase (ALP) were normal, and her γ-glutamyl transferase (GGT) was only mildly raised at 51 U/L. Results of her liver tests done 3 days prior, on 16 December, following discharge from the hospital were completely normal. Of note, she was started on 150 mg of bupropion on 13 December, which was increased to 150 mg twice daily 3 days later, on 16 December, to assist with smoking cessation. Results of her remaining blood tests, apart from long-standing stable normocytic anemia, were unremarkable. The patient had a history of osteoporosis, palpitations, and depression. Her regular medications for these diagnoses included methotrexate 15 mg weekly for Crohn’s colitis, folic acid 5 mg weekly, cholecalciferol, sertraline, melatonin, propranolol, conjugated estrogen (Premarin; Wyeth Pharmaceuticals, Philadelphia, PA, USA) as hormone replacement therapy for menopause, pantoprazole, oxycodone, Coloxyl (Aspen Australia, St. Leonard’s, Australia), and a 7-week weaning course of prednisone (from 35 mg daily) for her recent Crohn’s flare with co-trimoxazole cover to continue until weaned off prednisone. The patient’s blood tests on 20 December, done following the initial derangement on 19 December, were even more markedly deranged, with AST of 4006 U/L and ALT of 5007 U/L. Her GGT was also mildly more raised at 73 U/L. However, her bilirubin and ALP remained normal. She was reviewed on 22 December in the gastroenterology clinic. She had weaned to 30 mg of prednisone at that point. There had been no new medications other than the bupropion added since her discharge from the hospital. On examination, she did not have any jaundice, bruising, or any signs of chronic liver disease. Because she was feeling subjectively well with a normal bilirubin level, she was managed in the community setting. Her bupropion had already been stopped on 20 December by her general practitioner. All her usual medications, including prednisone and co-trimoxazole, were continued. At her 22 December clinical review, apart from an increase in GGT to 138 U/L, the remaining markers showed significant improvement with the AST decreased to 263 U/L and ALT reduced to 2643 U/L. Hence, a liver biopsy was not pursued, and instead she was followed with further surveillance liver tests, which continued to show improvement with subsequent near-normalization almost 4 weeks later, on 12 January, with ALT of 39 U/L and GGT of 94 U/L. Her AST had already normalized by 27 December. The trends of her liver tests are shown in Fig. .
pmc-6389240-1
The first case is a 28-year-old female patient referred to us after an incisional biopsy in the vulvar region revealing DFSP. She presented to us with a 5.0-cm lesion in the mons pubis (Figure A). Surgery was indicated, and consisted of a vulvectomy with a local advancement flap as the first approach in order to obtain a 2.0 cm margin from the tumor. Margins were assessed by CCPDMA protocols and they were all free of disease. Therefore, it was possible to avoid clitoris resection.To perform the vulvar reconstruction, a skin expander was placed in the inferior part of the abdominal wall one year after vulvectomy (Figure B). Weekly expansion was performed 3 weeks after the procedure and, in the third month, sufficient skin was attained in this area. The expander was taken out and the inferior 2/3 of the flap was split. The skin of the mons pubis was decorticated and the medium and proximal portions of the flap were advanced to protect the pubis bone. The distal portion was incised horizontally on both sides and folded after, in order to reconstruct the labius majoras (Figure C and D).This patient has been followed for almost 40 months (Figure E). There is no clinical or radiological evidence of recurrence. Regarding the surgery, we considered that a very adequate aesthetic effect was achieved. The patient verbally reported good quality of life, although no quality of life (QOL) questionnaires were applied.The second case is a 57-year-old female patient, also referred to our hospital after an incomplete resection of a DFSP in the vulvar region. She presented to us with a 2.0 cm residual lesion in the right labium major. As the lesion was too close to the clitoris, we performed a 1.0-cm margin instead of the traditional 2.0-cm one, followed by primary closure. The CCPDMA revealed all positive margins except for the upper lateral region of the specimen. The patient was submitted to another WLE of 2.0 cm and subsequent primary closure could be performed once more (Figure A). This patient has been followed for 10 months without any aesthetic or functional issue related to the surgery.
pmc-6389243-1
A 46-year-old Javanese woman presented with urinary incontinence following an abdominal hysterectomy with bilateral salpingectomy 3 months earlier. She is a housewife with no history of routine drug use and no prior history of hypertension, diabetes, allergies, or other chronic disease. She does not smoke tobacco and does not consume alcohol. A physical examination revealed that her general condition was good and her vital signs were: blood pressure 112/74 mmHg, heart rate 89 beats per minute, respiratory rate 18 times per minute, and temperature 36.6 °C. There were no abnormalities in her chest and abdomen, or in musculoskeletal and neurological examinations. In a genitalia examination using a speculum, we identified fistulae above her vagina wall that were 1 cm in size. All laboratory findings (that is, complete blood count, liver functions, renal functions, and urine analysis) were within normal limits. After discussion with our patient regarding the risks and benefits of an open abdominal procedure and laparoscopic approach, we discussed the similarities and differences between the two procedures were her. We chose surgical management using laparoscopic approach with the considerations that it could facilitate precise dissection, offer good visualization, and be minimally invasive, thereby enabling faster recovery. Our patient was placed in the lithotomy position and received general anesthesia. A cystoscopy was performed to confirm the fistulae orifice and a stent was inserted into the fistulae tract from her bladder to her vagina. A tamponade was inserted into her vagina up to the vaginal apex, to be able to identify the vagina and prevent loss of pneumoperitoneum. A transperitoneal approach was performed with trocars distributed as follows: The camera was placed through a 12 mm port with 30° down lens located superior to the umbilicus. Two ports for the surgeon were placed on the right side (Fig. ). She had adhesions; therefore, adhesiolysis was performed, using a combination of sharp and blunt dissection to expose the vaginal stump and the superior aspect of her bladder (Fig. ). A simple cystotomy was performed and extended to include the fistulae site, and the fistula tract was excised until viable fresh tissue was exposed. Later the defect was repaired by using a running stitch of 3–0 Vicryl. Knots were tied intracorporeally. A second layer of closure was performed in an imbricating fashion with the same suture. The vagina defect was not closed separately but covered with an omental flap (Fig. ). A vascularized omental flap was made using a scalpel, which was placed in the plane of dissection between her bladder and her vagina, and it was secured with two attachment points. The ureteral stents were removed without difficulty. A urethral catheter was placed for adequate postoperative urinary drainage. This procedure takes approximately 2.5 hours; the estimated blood loss for our case was minimal and there were no intraoperative complications. Our patient was given intravenously administered ceftriaxone 1 gram per 12 hours postoperatively for prophylaxis and orally administered diclofenac for pain control on an as-needed basis from the following day. At postoperative day 1, she was able to eat as usual and complained of minimal abdominal pain during mobilization. The surgical wound was good and there was no urine leakage from her vagina. After that, she was discharged while still using urethral catheter for adequate postoperative urine drainage for 2 weeks. She returned for a follow-up 2 weeks after surgery and reported that she experienced no recurrent incontinence and urination was normal. She continued to do well at 1-month, 3-month, and 6-month postoperatively.
pmc-6389258-1
The 31-year-old woman, gravida-1 para-1, with no apparent risk factors for congenital anomaly, achieved natural pregnancy. Oligohydramnios and intrauterine growth restriction was, however, noted at 14 weeks of gestation. Amniocentesis, carried out at 16 weeks of gestation for chromosomal analyzes, revealed a normal 46, XY male karyotype pattern. At 30 weeks of gestation, echographic examination revealed loss of fetal movement; intrauterine fetal death was confirmed 3 days thereafter, and the fetus was delivered by artificial abortion. Autopsy carried out 2 h after delivery of the 600 g stillborn revealed multiple systemic malformations. Macroscopic autopsy findings are summarized in Table . The stillborn demonstrated a proportionally unbalanced, large head with acrocephaly (Fig. ), postaxial polysyndactyly (Fig. and ), gastrointestinal malformations including malrotation and atresia of the anus, agenesis of the gallbladder (Fig. ) and the pancreas, hypoplasia of both kidneys (Fig. ), and the endocrine organs. Except these malformations, histopathological alteration of other major organs such as heart, liver, and bone was not noted. In view of these macroscopic features suggestive of GCPS or PHS, mutation of the GLI3 gene was analyzed. Routinely formalin-fixed (10%) and paraffin-embedded archival samples of infant thymus tissue samples obtained from Kobe University Hospital (Kobe, Hyogo) deparaffinized with xylene, suspended in 5 μl of 1 × TE and then mixed with pre-warmed and liquefied low-melting agarose (3.2%) at 1:1. A total of 10 μl of agarose beads containing 1 × TE and tissue fragments was formed in 250 μl of pre-chilled mineral oil, and then incubated at 50 °C overnight in 1000 μl of 200 μg/ml proteinase K, 10 mM Tris-HCl (pH 8.0) and 25 mM ethylene diamine tetraacetic acid. Bead fragments were washed in 1 × TE, sliced into several pieces, and analyzed by PCR using sets of primers encompassing all known coding exons and exon–intron boundaries of the GLI3 gene. Primers were designed as described []. The PCR mixture contained Mighty AMP® DNA polymerase (Takara, Tokyo, Japan) and bead fragments in a final volume of 25 μl. The PCR products were electrophoresed in a 3% agarose gel and stained with ethidium bromide. Purified PCR products were cloned into TA-vector, and amplified plasmids were analyzed for the DNA sequence. Each PCR product was analyzed by sequencing, and the missense mutation (c.2155 C > T) leading to p.P719S was detected in 6 of 12 independent clones from PCR targeting exon 6, which altered the amino acid property from hydrophobic (Proline, P) to hydrophilic (Serine, S) within the proteolytic cleavage (PC) site of GLI3 (Fig. ). Because this missense mutation was absent in both parents (data not shown), without family history of GCPS or PHS, and non-maternity factors like egg donation, surrogate motherhood, and errors in embryo transfer, the c.2155 C > T mutation probably occurred de novo in the fetus, albeit parental germline mosaicism cannot be ruled out.
pmc-6389352-1
A female baby was born at 37 weeks’ gestational age to a 29-year-old healthy Japanese woman by cesarean section because of pelvic position and twin pregnancy. Her birth weight was 2140 g (−1.6 SD) with birth length of 45.0 cm (−1.3 SD). Apgar scores were 4 at 1 minute and 8 at 5 minutes. Shortly after birth, the infant was hospitalized in the neonatal intensive care unit at our hospital because of respiratory distress. Among her physical findings on admission, tachypneic and subcostal retractions were observed. Chest-abdominal X-ray images revealed thoracic deformity and skeletal osteopenia (). Subperiosteal resorption of cortical bones and coarse trabecular bones were observed, the appearance of which matches the skeletal findings of hyperparathyroidism. Her twin brother’s perinatal course was uneventful. His birth weight was 2345g (−1.2 SD). He showed mild PTH elevation and low 25-hydroxy vitamin D, but no abnormal skeletal finding. Maternal calcium and phosphate were within normal ranges, but vitamin D deficiency was found, along with a high PTH level for the lactation period (). Initially, we diagnosed the patient as having secondary hyperparathyroidism caused by maternal vitamin D deficiency; however, reasons for the discordance in clinical symptoms between the twin siblings were unclear at that time. We administered vitamin D analog (alfacalcidol) and calcium lactate to the patient. After treatment, the PTH level decreased gradually. It had normalized by 6 weeks of age (). Bone mineral content (BMC) and areal bone mineral density (BMD) of her lumbar spine (L2-L4) were measured using dual X-ray absorptiometry (Lunar Prodigy, GE Healthcare) at 2 months of age. Her BMC was 0.50 g; BMD was 0.101 g/cm2 (z score, −6.97 SD). Those values were remarkably lower than those of age-matched Canadian children []. Respiratory support was required up to 2 months of age. By 4 months, her osteopenia had gradually improved: BMC and BMD were 1.05 g and 0.164 g/cm2, respectively. She was discharged from the neonatal intensive care unit with enteral tube feeding. By 6 months of age, X-ray images showed that her skeletal deformity had resolved almost completely (). At 11 months of age, she completed her treatment with alfacalcidol. On review at age 18 months, she showed catch-up in growth and developmental milestones, with no recurrence of skeletal deformity occurred after she completed the treatment.
pmc-6389462-1
A 32 year-old Caucasian male with recently diagnosed HIV was admitted with acute symptomatic microcytic anemia, fatigue, and abdominal pain. He was diagnosed with HIV four months prior to presentation and had been initiated on anti-retroviral therapy (ART) as part of a trial. Absolute CD 4 count at diagnosis of HIV was 309 cells/mm3. An upper endoscopy for workup of the anemia revealed oozing ulcers in the stomach body and granular masses in the second part of the duodenum which were biopsied. Histology demonstrated a high-grade B-cell lymphoma, not otherwise specified (NOS) consistent with Burkitt-like lymphoma in both sites, involving gastric and duodenal mucosa. Staging PET/CT demonstrated widespread metastatic disease, with gastric, duodenal, and small bowel wall thickening with intense FDG uptake, multiple peritoneal implants, hepatic lesions, moderate ascites, and bilateral thyroid intense FDG uptake, consistent with stage III disease. Bone marrow biopsy was negative for lymphoma. Systemic chemotherapy with dose-escalated R-EPOCH (rituximab, prednisone, etoposide, doxorubicin, vincristine, and cyclophosphamide) was initiated. Twenty-four hours after completing the second cycle of chemotherapy, he developed acute profound voice hoarseness and bilateral grade 3 peripheral neuropathy in his fingers and toes. The cumulative dose of vincristine he had received was 3.2 mg/m2. There was no obstruction or anatomical abnormality noted on CT neck. An urgent otolaryngology referral was made, and a fiberoptic laryngoscopy examination showed a sluggish right vocal cord fold and an incomplete glottic closure with a gap confirming a diagnosis of unilateral VCP due to vincristine. The subsequent four cycles of chemotherapy were continued with omission of vincristine, and there were no further complications. The subjective voice hoarseness completely resolved, and the grade 3 peripheral neuropathy improved to grade 1 within 8 weeks of discontinuing vincristine. The abdominal pain resolved, fatigue improved, and hematocrit showed continued improvement. A re-staging PET/CT following completion of six cycles of chemotherapy demonstrated a complete response (CR). He remains in CR over one year following completion of chemotherapy.
pmc-6389464-1
A 50-year-old female, without comorbidity and with a previous histopathological confirmation of MPM obtained with pleural biopsy in video-assisted thoracic surgery, received neoadjuvant chemotherapy (three cycles of carboplatinum and pemetrexed) and subsequently left P/D with complete removal of the tendineous part of the diaphragm with partial removal of muscle itself due to the direct extension of the illness. The residual diaphragm muscle was reconstructed with a synthetic monofilament continuous absorbable suture (Maxon™). During the first three postoperative days, the patient was normal, no bleeding, with normal chest X-ray, and normal air leaking as common in P/D procedures in our experience. In the IV postoperative day, she stopped air leaking and referred chest pain and dyspnea. At the chest X-ray, there was evidence of complete collapse of the lung and air image resembling the stomach. A chest CT scan showed complete intrathoracic stomach and intestinal herniation (Figure A,B). After rethoracotomy, the complete herniation of the stomach and bowel was observed, with the spleen near the heart. To avoid other complication, as infection, we used a polypropylene mesh under the diaphragm and fixed it to the abdominal side of the diaphragm. Then, we made the reconstruction of the residual diaphragm muscle over the mesh. At the end of the reconstruction, we had the mesh not in contact with the lung and with the residual air leaks (Figure A,B) but on the abdominal side of the muscle. A nasogastric tube was positioned to maintain clean and decompressed the stomach. The patient was discharged after ten postoperative days, without problems and with complete resolution of the herniation.
pmc-6389465-1
A 75-year-old man in whom a 6.0 × 60-mm self-expanding bare nitinol stent (Misago; Terumo, Tokyo, Japan) had been deployed to the stenotic midportion of the left superficial femoral artery (SFA) 9 months prior was admitted to our hospital with a recurrence of intermittent claudication on the left side. He had hypertension, dyslipidemia, diabetes mellitus, and a history of coronary artery bypass grafting. The ankle-brachial index was 0.81 on the right and 0.45 on the left, and contrast computed tomography and angiography revealed occlusion of the left SFA. The beginning of the occlusion was about 5 cm proximal to the stent, and its end was on the distal side of the stent (Figure A). A 6-F straight guiding catheter (Parent plus; Medikit, Tokyo, Japan) was placed proximal to the CTO entrance stump. Intravascular ultrasound (IVUS)-guided wiring was performed with 0.014-inch wires (Chevalier Tapered 15; Cordis Corporation, Miami Lakes, FL, USA, and Jupiter Tapered 45; Boston Scientific, Marlborough, MA, USA) to cross over the plaque located within a few centimeters from the CTO entrance. IVUS (Eagle Eye Platinum ST Catheter; Philips Corporation, San Diego, CA, USA) could approach the proximal edge of the Misago stent, but could not be advanced into the internal parts of the stent. Balloon angioplasty with a 3.0 × 20-mm balloon catheter (Shiden; Kaneka Medix Corporation, Tokyo, Japan) was performed because a few centimeters of the 0.014-inch wire were located within the stent, which was confirmed by rotation angiography. The GOGO catheter (Medikit) was advanced antegradely to the point where it was confirmed to be within the stent by IVUS (Figure B). The 0.014-inch wires were protruded through the stent struts. The IVUS-guided technique was attempted, but the IVUS also protruded through the stent strut (Figure C). The 0.014-inch wire and the IVUS were then removed from the GOGO catheter, and a knuckle wire technique was performed with a 0.035-inch small J-type hydrophilic guidewire (Radifocus; Terumo). The small J-type and loop-shaped 0.035-inch wire was also protruded through the stent strut (Figure D,E). We terminated the wire crossing by the knuckle wire technique with the 0.035-inch wire. An IVUS-guided tapered 0.018-inch wire (Astato; Asahi Intecc Corporation, Aichi, Japan) could cross into the occluded stent lumen. Subsequent to a successful balloon angioplasty to the occluded stent, an 8.0 × 150-mm bare nitinol stent (S.M.A.R.T. control; Cordis Corporation) implantation was performed to the proximal side of the Misago stent. We were able to treat this ISR-CTO case without any complications.
pmc-6389466-1
A 67-year-old woman presented to our hospital with dyspnea. She developed general fatigue 5 years ago and numbness of the right body 3 years ago. She presented to an orthopedic surgeon and was diagnosed as having OPLL of the cervical spine. The neuropathy had been getting worse, and she began to feel numbness up to the extremities and had trouble walking. One year ago, she developed dyspnea on exertion. Her body weight had fallen from 46 to 41 kg over the 5 years. Spirometry conducted by a local physician revealed restrictive ventilation impairment, but the diagnosis remained unclear and she presented to our hospital for further evaluation. She had no medical, family, or social history of note. She had never smoked. Her vital signs included a body temperature of 36.2°C, pulse rate of 71 beats/min with a regular rhythm, and blood pressure of 103/56 mm Hg. A physical examination revealed decreased thoracic motion, muscle weakness of the right upper limb, numbness of the extremities, and claudication. No rales were audible although breath sounds were decreased in both lungs. Her Japanese Orthopaedic Association Score (JOA score) was 14 points. The JOA questionnaire grades the status of patients suffering from cervical myelopathy. A JOA score of 14 points means that cervical myelopathy is mild, and there is no indication for surgery. Chest X-ray (Figure A,B) and chest computed tomography (CT) did not show any abnormal shadows in either lung field, but the movement of her diaphragm was decreased when comparing the inspiratory X-ray with the expiratory image. Cervical X-ray (Figure ) revealed ossification of the posterior longitudinal ligament (OPLL) of the cervical spine runs longitudinally across the vertebral body. Sagittal T2-weighted magnetic resonance imaging (MRI) showed a thickened posterior longitudinal ligament that was severely compressing her cervical cord at C3/4. Spinal cord MRI showed atrophic change, and an intramedullary T2-weighted high-intensity area was seen at the C3/4 level (Figure ). There was no abnormality in the thoracic cord. Her blood gasses under ambient air showed a pH of 7.36, PaO2 of 64.8 Torr, PaCO2 of 61.3 Torr, HCO3 - of 33.6 mmol/L, and alveolar-arterial oxygen pressure difference of 1.18 Torr. No other remarkable changes were seen in the biochemical examination of her blood and urine. Pulmonary function test results (% predicted) showed restrictive ventilatory impairment: vital capacity (VC) of 1.09 L (39.4%), FEV1 of 0.99 L (62.7%), and FEV1/FVC of 98%. Polysomnography showed obstructive sleep apnea (OSA) with an apnea-hypopnea index (AHI) of 20.7 and minimum oxygen saturation of 86%. From these findings, we considered that cervical myelopathy due to OPLL was causing her respiratory muscle paralysis and that OSA might also be affecting its course. First of all, we started continuous positive airway pressure (CPAP) only at night, and her AHI and minimum saturation with CPAP improved to 13.9% and 88%, respectively, but her daytime hypercapnia and dyspnea on exertion did not improve. In addition, the neuropathy of her extremities was worsening, and C3-7 laminoplasty was performed. Although her pulmonary function did not improve immediately after surgery, it began to gradually and steadily improve over the first postoperative year. The mobility of her diaphragm increased during inspiration/expiration (Figure C,D), and her blood gasses also improved (Figure ). One year after laminoplasty, her PaO2 improved from 64.8 to 85.4 and PaCO2 from 61.3 to 40.9 Torr, and they have been maintained without deterioration for 6 years after surgery. Pulmonary function testing also showed improvement in her %VC postoperatively, from 39.4% to 57.3% 3 years after surgery. Although it has declined somewhat since the 4th year, it is still maintained at a value that is 15% higher than that before surgery. Her AHI by polysomnography without CPAP also improved from 20.7 to 9.0, so the CPAP treatment was stopped. With the improved pulmonary function, her chief complaints of dyspnea on exertion and general fatigue also disappeared. She has regained her daily life and is able to exercise lightly at a fitness club.
pmc-6389467-1
A 57-year-old woman, suffering from abnormal genital bleeding, consulted her gynecologist. At her first consultation, a cervical tumor, suspected of being a cervical cancer, was detected. She was referred to our hospital for medical treatment of the tumor. We recognized the easily bleeding tumor in her uterine cervix. Transvaginal ultrasonography showed a tumor, 3 cm in diameter. The uterine corpus and both ovaries were normal in appearance. Pelvic magnetic resonance imaging (MRI) showed an enhanced cervical tumor and a swollen lymph node in the right obturator space. A cervical biopsy revealed a squamous cell carcinoma. The patient was diagnosed as having early-stage cervical cancer. We undertook a radical hysterectomy with bilateral salpingo-oophorectomy and removal of the pelvic lymph nodes. The pathologic diagnosis was of a squamous cell carcinoma of the uterine cervix (non-keratinizing type), with parametrial invasion and with right obturator lymph node metastasis (pT2bN1M0). We administered concurrent adjuvant chemoradiation (whole pelvic 50.4 Gy/28fr + weekly CDDP, 40 mg/m2). At 26 months after the surgery, a follow-up computed tomography (CT) scan revealed a tumor, 2.5 cm in diameter, in her right latissimus dorsi muscle, and another mass, 2 cm in diameter, in the armpit. Fluorodeoxyglucose-positron emission tomography (FDG-PET) imaging showed increased uptake values only in these two tumors and excluded other detectable sites of metastasis (Figure ). The patient was asymptomatic. However, referring the CT images, we examined her and a tumor at the right armpit was palpated. A needle biopsy of the armpit tumor proved it to be a squamous cell carcinoma (non-keratinizing type). Histologically, resembling the primary squamous cell carcinoma (Figure ), the biopsy specimen shows pleomorphic tumor cells with hyperchromatic nuclei (Figure ). We diagnosed a recurrence of the cervical cancer and, after chemotherapy reduce the size of tumors, planned to perform surgical resection. Two cycles of combination chemotherapy with Paclitaxel and Carboplatin failed to reduce the size of tumors; however, we still performed the surgical resection. Final pathology of the resected tumors concluded that they were metastases of a squamous cell carcinoma, with similar morphology to the primary disease. The surgical margins were free of disease. We administered adjuvant radiotherapy to her right latissimus dorsi muscle (50 Gy/25Fr). In a follow-up CT scan, four months after completion of radiotherapy, we found two recurrent tumors, one (2 cm in diameter) in her right biceps muscle and the other (1 cm in diameter) in the right latissimus dorsi muscle. FDG-PET showed increased uptake values in these two tumors and excluded other sites of metastasis. We again performed surgical resection. Metastatic squamous cell carcinoma was again diagnosed. It was pathologically unclear as to whether malignant tissues remained at the resection margins. Two months later, the patient was admitted suffering a pain in her right biceps muscle, which was accompanied with red swelling and tenderness. CT scan revealed the recurrence of disease in the right latissimus dorsi, thoracic wall, pleura, mediastinal lymph nodes, and in the mediastinum and costal bones. Two regimens of chemotherapy (intravenous nedaplatin and oral etoposide) were administered; neither was effective. The metastatic biceps muscle tumor grew and became exposed on the surface of the skin (Figure ). She received best supportive care (BSC). Four months after ceasing chemotherapy, she came to our hospital suffering from paralyzed legs. CT revealed that the tumor in the latissimus dorsi invaded into the T7 vertebral body and spinal canal (Figure ), causing the consequent paralysis of her lower extremities. The patient continued to receive BSC at our hospital; she died of disease two months later.
pmc-6389468-1
A 56-year-old man suffering from dyspnea for mild efforts was admitted to our hospital. He denied home therapy and he had a history of systemic arterial hypertension, obesity, sleep apnea, and persistent atrial fibrillation treated with electrical cardioversion in 2015, without known recurrences. His physical examination pointed out cardiac arrhythmic activity, pulmonary congestion, jugular venous distension, hepatomegaly, and mild ankles swelling. Blood tests in the emergency department suggested acute heart failure with mild elevation of myocardial necrosis indices (pro-BNP 5264 pg/mL, LDH 256 UI/L, CPK 597 UI/L, troponin T hs 0.023 μg/L with normal value <0.014 μg/L). Hilar congestion and cardiomegaly resulted from chest x-ray examination. The 12-lead ECG showed sinus rhythm with frequent monomorphic PVCs in bigeminy pattern, short runs of nonsustained VT (NSVT), and accelerated idioventricular rhythm. PVCs had right bundle branch block (RBBB) pattern, precordial transition in lead V1, and inferior QRS axis (Figure ). Transthoracic echocardiogram revealed severely reduced systolic\function (EF 23%) with global hypokinesia, mild left ventricular dilatation (LVEDD 60 mm), normal LV mass, and wall thicknesses. Moreover, moderate mitral regurgitation and restrictive transmitral flow pattern were detected. The coronary angiography was performed and no coronary stenoses were found. Heart failure therapy was started. Because of the limited effectiveness of beta-blockade on PVCs and NSVT, amiodarone was administered, but it caused prolongation of QTc interval requiring suspension of the antiarrhythmic drug. In the suspicion of acute viral myocarditis, the serology for the most common cardiotropic viruses was tested but resulted negative. Due to the impossibility to suppress arrhythmias and to perform real-time sequences, cardiac magnetic resonance imaging (CMR) was not realized. The electrophysiological study was performed with electroanatomical mapping system (Carto® 3, Biosense Webster) guided by intracardiac echocardiography (ICE) (Figure A). The high-density substrate mapping did not found any scar zones. Through the right femoral artery, an irrigated-tip ablation catheter (ThermoCool® SmartTouch® Catheter, Biosense Webster Inc, Irvine, CA, US) was inserted via a retrograde transaortic fashion for mapping and ablation. The earliest activation site was found in close proximity to the anterior part of the aorto-mitral continuity (AMC), which was prior to onset of QRS 28 ms (Figure B). Multiple RF applications were delivered to the earliest activation site with a target temperature of 43°C and a maximum power of 40 W, resulting in transient suppression of PVCs during erogations and early recurrence after the end of deliveries (Figure C). Electroanatomical mapping of RVOT was also performed in order to exclude a right exit of VAs, with multiple RF deliveries at the earliest activation site in the postero-septal RVOT wall which showed a local presystolic activation of 25 ms. As in LVOT ablation attempts, RF resulted in rapid disappearance and early recurrence of PVCs. A nonmatching pace-map resulted when pacing from the earliest site of endocardial activation at both sides of the septum. These features suggested an intramural focus within the interventricular basal septum. Mapping the site of origin via venous system was not accomplished because the mapping catheter could not be positioned in a perforator branch of the great cardiac vein (GCV). Hence, after many RF energy deliveries, the procedure was aborted, resulting in failure to suppress PVCs. After 72 hours of observation, PVCs disappeared although there were no changes in medical therapy. One week after the PVCs disappearance, transthoracic echocardiogram showed improved systolic performance with a LVEF of 40% and slight reduction in LV diameter. After one month of follow-up, cardiac function was completely normalized and ambulatory ECG monitoring showed stable sinus rhythm without arrhythmia recurrences.
pmc-6389469-1
The patient (IV.8, Figure ) was a 25-year-old male, born healthy at birth to a first cousin parents. He was the fifth born child in the family and was normal up to one and half years of age. Initial symptoms of the disease, as noticed, were as developmental delay, microcephaly, difficulty in walking due to spasticity, and speech delay. The MRI of the brain and the electroencephalogram (EEG) were not performed on the patient. A clinical examination at the age of 24 revealed hypotonia in the patient's hands, injuries due to skin lesions, mental retardation, microcephaly, a minor problem in walking, and difficulty in speech. Molecular tests for the Fragile X syndrome and karyotype were normal. There was no family history of mental retardation. Due to the current pregnancy of the patient's sister (IV.5, Figure ), who also was in a consanguineous marriage, the family requested genetic investigations, and we performed clinical Whole Exome Sequencing (WES).
pmc-6389472-1
In 2013, a 27-year-old male patient presented to the Prosthodontics Department of Tehran University of Medical Sciences and complained of unattractive smile and difficult mastication. His dental history revealed an unsuccessful maxillary Le Fort I orthognathic surgery in 2010 as an attempt to modify his class III malocclusion and correct his open bite, which relapsed afterward. The patient, also suffering from mouth breathing, had a long oval face with a convex profile, incompetent lips with a nasolabial angle of 110°, and chin deficiency. The open bite and maximum mouth opening measured 10 and 48 mm, respectively. Intraoral examinations revealed an ovoid arch form, deep palate, dental caries, short yellow-brown pitted and porous teeth, hyperplastic and edematous gingiva (Figure ), wide occlusal surfaces, and a buccolingual alveolar defect at the site of upper right central incisor. Other problems observed included tapered crowns, posterior occlusal contact to the second premolar, a biplanar open bite, reverse curve of Spee, no anterior guidance, low crown height of the posterior teeth, and no proximal contact. The upper left lateral incisor was missing and the upper right lateral incisor was peg-shaped. The posterior teeth had wide pulp chambers and furcation proximity to the alveolar ridge, rendering crown lengthening surgery impossible. The diagnosis of hypomaturation-hypoplasia with taurodontism (type IV AI) was made. A crown-root ratio analysis and a diagnostic wax-up were carried out, which revealed that the open bite could not be corrected solely by prosthetic treatment (Figure ). Further oral examinations revealed bleeding on probing, moderate to severe gingivitis, and moderate staining of teeth. Calculus was observed on the lingual surface of the mandibular anterior teeth, and the plaque index was calculated to be 80%. Thus, scaling and root planing was performed and an ointment was applied to prevent air contact with soft gingival tissue during mouth breathing while asleep. Oral hygiene instructions were also provided to the patient. As a result, his oral hygiene improved, his plaque index decreased to 30%, edema and inflammation were eliminated, and bleeding on probing stopped. Diagnostic casts were poured and mounted on a Dentatus articulator (Dentatus USA Ltd., NY, USA) using a face bow. Lateral cephalometric studies and consultation with oral and maxillofacial surgeons led to the conclusion that the patient had maxillary deficiency, mandibular prognathism, and anterior open bite. The patient had undergone Le Fort I osteotomy 8 years earlier with 4 mm advancement, 2 mm superior repositioning of the anterior maxilla, and 5 mm superior repositioning of the posterior maxilla, along with a mandibular setback surgery which was unsuccessful and relapsed. According to the Epker and Dolphin imaging software prediction (Dolphin Imaging & Management Solutions, Chatsworth, CA, USA), the patient was scheduled for segmental orthognathic surgery to close the biplanar open bite. The first phase of the surgical procedure involved slight superior repositioning and setback of the anterior mandible, as a result of which, the curve of Spee, open bite, and class III jaw relationship improved. The second phase included a bilateral posterior maxillary segmental osteotomy for superior repositioning to correct the open bite, long face, and space shortage of the posterior teeth. Autogenous bone grafting was simultaneously performed at the peg lateral region for the anterior maxillary defect. Consequently, chin deficiency was slightly modified due to mandibular autorotation. Noticeably, in our patient, modifying the biplanar open bite with orthodontic treatment was not possible due to insufficient crown height and the enamel condition, which would not allow bracket bonding. To prevent toothache during the recovery period after orthognathic surgery, the following procedures were performed: The maxillary left first molar and the right central incisor were extracted. The maxillary right second premolar and molar, and the mandibular right first molar were endodontically treated, and the carious mandibular left first molar was restored with glass ionomer (GC Corporation, Tokyo, Japan). After conduction of a model surgery and fabrication of a surgical stent (Figure ), the actual surgical procedure was carried out, and the open bite decreased by 7.4 mm. To prevent relapse and super-eruption of teeth after surgery, a special space-maintaining stent was fabricated to be fixed to the posterior maxillary segments since there was insufficient space for crowded teeth, due to short crowns of the posterior teeth and proximity of their furcation to the alveolar crest (Figure ). The upper right lateral incisor was not extracted during the orthognathic surgery, due to the possibility of fistulation of bone graft exposed to the oral cavity. Autogenous graft was harvested from the medial sinus wall and maxillary tuberosity and implanted in the upper right central incisor area. Postoperative results showed that a number of the patient's problems, namely the long face, chin strain, and open bite were successfully corrected (Figure ), and an occlusal splint was fabricated for the patient to serve as a space maintainer. After 2 months, the first impression was made with alginate (Zhermack, Badia Polesine, Italy) and a study cast was poured with dental stone (Kerr Dental, Orange County, CA, USA). Then, it was mounted on a Denar Mark II articulator (Whip Mix, Kentucky, USA). Esthetic analysis was carried out and the patient's smile line was transferred to the cast. Based on this cast, a surgical stent was fabricated for crown lengthening surgery and leveling of the gingiva (Figure A,B). It was decided to extract the peg lateral incisor due to its small crown-root ratio, assessed in the diagnostic session, and anticipation of poor esthetics and lack of function in the future. The third molars were also extracted due to the proximity of their root furcation to the bone crest, which would complicate the treatment. After the extraction of lateral incisor, socket preservation was performed using demineralized bone matrix (Hamanand Saz Baft Kish Co., Kish, Iran) (Figure C). One month later, a primary impression was made. Another diagnostic cast was poured and mounted on a Denar Mark II articulator. Lip line, smile line, and midline were evaluated. The anterior plane of the mandible was analyzed, and the left central incisor, lateral incisor, and canine were reduced by 0.5, 1, and 1.5 mm, respectively. An anterior diagnostic wax-up was fabricated and the occlusal plane was determined using the Broadrick flag. Based on the occlusal index, a complete wax-up was performed (Figure ). A radiographic barium sulfate coated stent was fabricated for cone-beam computed tomography prior to dental implantation. The bone width and height and angulation of implant were evaluated. Dental implants (Xive, Dentsply Friadent, Mannheim, Germany) were then placed at the site of maxillary right central incisor, maxillary left second premolar, and mandibular left first molar (Figure ). Closed sinus lift was also performed simultaneous with implant placement in the upper left premolar area. An immediate screw-retained temporary crown was fabricated during the implant surgery session with a temporary abutment and a shell fabricated following wax-up (Figure ). The screw-retained crown was used to form and prepare the soft tissue and dental papilla for the final impression. The prosthetic phase began 2 months later. Due to the extensive loss of tooth structure, post patterns were fabricated for the upper right second premolar and first molar, and the lower right first and second molars. The posts were cast (Degubond, Dentsply Sirona Prosthetics, Pennsylvania, USA) and cemented with Panavia F 2.0 resin cement (Kuraray Co., Ltd., Tokyo, Japan). The final preparations for all-ceramic crowns (butt joint margin) and laminate veneers (incisal overlap) were made for the six mandibular anterior teeth, and the teeth were restored with temporary crowns. A customized anterior guidance table and the posterior determinant of occlusion were designed based on the casts of the temporary crowns in Denar Mark II articulator, and the final crowns were fabricated accordingly (Figure ). The final impression was made using polyvinyl siloxane (Panasil, Kettenbach, Eschenburg, Germany) addition impression material. Subsequently, recording and mounting were performed. The master cast was poured, and cross-recording and cross-mounting were performed. Proper Esthetic Base abutment (Xive Dentsply Friadent, Mannheim, Germany) was chosen for the implants after obtaining a putty index and wax-up. The dies were scanned by Cercon computer-aided design/computer-aided manufacturing system (Dentsply, sirona prosthetics, Pennsylvania, USA). To ensure optimal esthetics of the anterior restorations, zirconia frameworks (A2) were fabricated of ultra-translucent multi-layered and superior translucent multi-layered ceramic (Porcelain Ceram Kiss/e.max: A2/A3, Katana Zirconia Block, Kuraray, Tokyo, Japan) (Figure ). A radiograph was obtained to ensure correct seating of each framework. Porcelain was added to the framework and the crowns were tried in. Centric and eccentric occlusal contacts were then evaluated. The patient's occlusion was canine rise and mutually protected occlusion. During the delivery session, the crowns were cemented with temporary non-eugenol cement (Kerr Dental). Choice 2 cement (Bisco, Illinois, USA), which is a light-cure luting cement, was used for cementation of composite laminate veneers. Oral hygiene instructions were given to the patient, and an occlusal guard was delivered to minimize the complications of zirconia-based restorations. The patient was recalled 24 hours later for the first follow-up session. He reported no complications and had no complaints. Two weeks later, permanent cementation was performed with Panavia F 2.0 (Kuraray, Tokyo, Japan) (Figure ). An annual follow-up was scheduled for the next 5 years with no reports of any complications or complaints. The patient was satisfied with the treatment outcome.
pmc-6389478-1
A 34-year-old woman was referred to our clinic due to reoccurring cervical swelling on the left side with concomitant dysphonia and dysphagia. Computed tomography revealed extensive abscess formation. Therefore, the patient was hospitalized, and the abscess was drained and put on intravenous antibiotics. Past medical history of the patient revealed several neck operations starting when she was ten years of age. Multiple hospitals were involved in the process. Initially, second branchial cleft cyst was suspected, and extirpation was performed. Thereafter, multiple reinfections occurred, with abscess incisions and drainages performed several times. Extensive diagnostic work-up with repetitive computer tomography, magnetic resonance imaging, and barium esophagograms was performed but failed to show the presence of a fistula and sinus tract. Due to the recurring infections, exploratory cervicotomies were performed twice, without any sign of remaining cyst duct or fistulas. In total, the patient underwent 12 interventions, including seven operations in general anesthesia and four tomographic imagings. The cumulative x-ray exposure was calculated to be 16 mSv. After the patient was finally referred to our clinic, we began a new diagnostic work-up as we assumed the diagnosis to be erroneous, since the patient suffered so many recurrences. Careful patient history revealed that new cervical abscess formation almost always followed upper respiratory tract infections. This was a strong clinical clue for a fistula and sinus of the upper aerodigestive tract with allowing spread of the infection to the neck. Retrospective evaluation of pathological reports showed that the suspected cyst contained merely pseudoepithelium. True cysts remnants would have contained epithelium; therefore, the diagnosis recurring second branchial arch cyst infections should have been doubted earlier. Suspecting a branchial cleft anomaly of the third or fourth arch, we performed a new barium esophagogram (that was unremarkable) followed by immediate subsequent computed tomography of the neck. The latter showed accumulation of contrast medium in the superior part of the piriform sinus on the left side (Figure ). The findings were discussed with the patient and she consented to direct laryngoscopy, during which a fistula in the apex of the left sinus piriformis was detected (Figure ). Blue dye was injected to mark the fistula. Cervicotomy was performed with exposure of the left recurrent laryngeal nerve and left hemithyroid. After resection of the inferior cornu of the thyroid cartilage, the fistula tract could be identified (Figure ). The fistula tract was excised, and the pharynx was closed with an inverted purse-string suture. The postoperative period remained uneventful with return to oral feeding on the third postoperative day. At 1 year of follow-up, the patient remains free of infection.
pmc-6389479-1
An 80-year-old Caucasian female with history of hypertension and chronic back pain presented for emergent repair of a 7.2 cm aneurysm of the ascending aorta with Stanford classification type A dissection. Because the ascending aorta was unsuitable for arterial cannulation, the surgeon elected to perform axillary cannulation via the right subclavian artery with side graft anastomosis. The patient arrived to the operating room (OR) with nicardipine and esmolol infusions running through an 18-gauge peripheral intravenous (IV) line in the right antecubital (AC) fossa. Prior to induction of anesthesia, we disconnected the infusions from the right AC and administered medications though an 18-gauge IV in the left forearm. The patient also had a left radial arterial line (AL), and we placed the pulse oximeter and noninvasive blood pressure (NIBP) cuff on the RUE. After intubation, we placed a right radial AL, and the surgeons placed a left femoral AL. All arterial pressures correlated closely. Additionally, a 9-French central line was placed in the right internal jugular vein. The patient was cleansed and draped for surgery with her arms tucked to her sides. Shortly after the procedure began, the right radial AL tracing went flat, and the pulse oximeter waveform was lost. We attributed this to the surgeon partially clamping the right subclavian artery in preparation for arterial cannulation. We switched the pulse oximeter to the left hand and relied on the left radial and femoral AL for pressure readings. Just prior to arterial cannulation, we noted that the right radial pressure returned, although about 20 points lower than the left radial/femoral. Immediately after initiating CPB, the right radial mean arterial pressure (MAP) increased to 200 mm Hg, and left radial/femoral MAP decreased from 60 to 30 mmHg. The perfusionist alerted the surgeon about the high line pressures and decreased CPB flows. After a brief attempt to troubleshoot and adjust the cannula with little improvement in pressure or flow, the surgeon proceeded with the operation. Over the next few minutes, the left radial/femoral MAP increased to 60 mmHg. As deep hypothermic circulatory arrest (DHCA) was initiated, the right radial MAP decreased to 30 mmHg and left radial/femoral MAP decreased to 10. When CPB was reinstated, right radial MAP again increased to 200 mmHg. After 29 minutes of DHCA and 265 minutes of CPB, the patient was successfully weaned from CPB, and right radial MAP decreased to about 10 points lower than left radial MAP. Despite these issues, the surgery was otherwise uneventful. However, upon the surgical drapes being taken down, we noticed that the patient's RUE was swollen with blisters and bullae from the shoulder to the hand; yet, the skin of the upper arm where the NIBP cuff had been placed was normal as seen in figures. The IV in the right AC appeared to be infiltrated and weeping fluid even though we had not used it during the case and did not have any IV fluids attached to it (Figures and ). The IV and right radial AL were removed in the OR, and a Xeroform gauze dressing was applied to the RUE with the surgeons present. The intensive care unit nurses were instructed to elevate the arm and perform hourly neurovascular checks. On postoperative day 1, the patient complained of tenderness and burning in the RUE, but she maintained adequate capillary refill, motor function, and sensation. Plastic Surgery was consulted to rule out compartment syndrome. They were unsure of the diagnosis but recommended nonoperative management and continued neurovascular checks. Eventually Dermatology was also involved, and they performed a punch biopsy of the patient's right dorsal hand. Their initial diagnosis was allergic contact dermatitis (ACD) due to the fact that the area of skin covered by the NIBP cuff was spared. However, the biopsy showed pauci-inflammatory dermal-epidermal blistering, which did not favor ACD. Direct immunofluorescence was also negative, ruling out localized pemphigus. Given the histologic findings, the final diagnosis was hydrostatic edema/bullae correlating with rapid edema during surgery. The patient continued to be managed nonoperatively with 1% triamcinolone ointment and gauze dressings, and within one month the blisters had completely resolved.
pmc-6389480-1
An 11-month-old Caucasian male was brought to the office by his mother. On the day of the visit while at daycare, the child rolled off the changing table and landed on his head on a nonpadded floor. There was no loss of consciousness, no seizure like activity, or any vomiting. The patient's mother who was not present at the day care center when the event occurred. She was called to the daycare center. The mother took the child to the child's pediatrician who found no major issue and advised head trauma precautions. Immediately after the visit to the pediatrician, the patient was then taken to our office. The child's past medical history was noncontributory. He had normal neurological milestones prior to this visit. Physical examination revealed a small, reddened area just above his right orbital region. ART testing of the head was negative. He was assessed as having a head contusion. His mother was given standard head trauma precautions and no specific brain injury treatments. No analgesics were prescribed, recommended or provided by the child's mother. The patient's mother reported that since the fall the child was more irritable and had a change in personality. He cried more often and didn't seem to make full, alert eye contact with her. Physical examination revealed a child who appeared disengaged with his external environment and irritable. The rest of the standard medical physical exam was unremarkable. ART using the surrogate format was positive over the frontal region of the patient's head. The clinical impression was that the patient's irritability, change in personality, increased crying, and lack of alert eye contact were the result of a concussion that occurred from the patients fall that occurred 14 days earlier. Based on MKC's prior training and experience in NT a NT treatment was performed. The child was given eight ≤0.5 mL subcutaneous injections of 0.5% preservative free procaine in a circumferential manner around the level of his forehead in a headband-like distribution spaced 3 inches apart. After completion of the injections, the mother exclaimed, “He's back!” After the procedure it became even more apparent how his previous behavior was abnormal when his now normal behavior emerged. He had a bright-eyed look about him, laughed, and was fully engaged in his environment. No analgesics were prescribed, recommended or provided by the child's mother. Follow-up with the patient 4 weeks later indicated no post head trauma sequelae. An interview with the patient's mother 8 years later indicated no head trauma sequelae. The patient's mother called the results of the treatment a “miracle” and related that the day after the treatment the child's day care teacher remarked that the child was back to normal. The patient was seen originally in May of 2010 and the mother interviewed regarding the head trauma visits in June 2018. The purpose of the 8 year follow-up interview was to ascertain the duration of the treatment effect and whether or not any late head trauma sequelae had developed. All assessments were clinical in nature as this report is based on a retrospective chart review not a prospective study with standardized questionnaires and protocols.
pmc-6389481-1
A 50-year-old Japanese man presented to our hospital complaining of numbness and paralysis of the left foot. Magnetic resonance imaging showed a tumor mass around the vertebral bodies, which was invading the spinal canal from L2 through L4 (Figure A). The tumor originated from the posterior wall of the lumbar vertebrae and was compressing the dura mater. In addition, there were multiple abnormal signals within the T12, L3-5 vertebral bodies. Systemic examination by 18F-fluoro-deoxy-glucose (FDG) positron-emission tomography/computed tomography (PET/CT) showed multiple nodular FDG uptakes in the vertebrae, ribs, pelvis, and femur (Figure B). Needle biopsies of the L5 vertebra showed no sign of tumor cells, and the cerebrospinal-fluid examinations were normal. Finally, partial excision of the tumor mass by surgical procedure was performed for diagnosis. Microscopic examination revealed mononuclear tumor cells with eosinophilic cytoplasm infiltrating between the bone trabeculae (Figure ). The tumor cells were positive for CD33 and CD68 and negative for CD3, CD20, CD34, and CD56, which confirmed the diagnosis of MS. Laboratory tests showed no abnormalities in blood count and coagulation tests. There was no sign of leukemia morphologically in the bone marrow. Cytogenetic examination revealed 46, XY and was negative for translocation of PML/RARα and other balanced translocations routinely searched for in AML patients by a reverse transcription polymerase chain reaction (RT-PCR). Based on these laboratory findings, the patient was diagnosed with de novo MS. Initially, we treated the patient with local irradiation to the vertebral tumor, which immediately resolved the neurological symptoms. Additionally, we treated the patient with daunorubicin and cytarabine, followed by a course of high-dose cytarabine. At the end of chemotherapy, the PET/CT showed no abnormal uptake. Four months later, the MS relapsed as multiple tumors involving the right ribs. Because the tumors were localized, we attempted radiation therapy again. However, this time, the tumor was resistant to irradiation and soon expanded to multiple systemic bone tumors. We reevaluated the bone marrow, but leukemic cells were not detected morphologically and cytogenetically. Salvage chemotherapy with mitoxantrone and high-dose cytarabine followed by a subsequent intrathecal injection of methotrexate was performed and resulted in a second remission. We recommended allogenic stem-cell transplantation as a consolidation therapy, but the patient refused transplantation. The second remission lasted for 6 months after the termination of the treatment. This time, the patient relapsed concomitant with leukopenia, thrombocytopenia, and disseminated intravascular coagulation (DIC). The bone marrow contained aberrant promyelocytes and faggot cells (Figure ). The PML/RARα fusion gene was detected in 49% of cells by FISH, and also by RT-PCR. Finally, the diagnosis of APL was made. Chromosomal analysis showed a complex karyotype (47, XY, +8, der(11;22)(q10;q10), add(14)(q32), der(15)t(15;17)(q22;q12), ider(17)(q10)t(15;17)). At this point, we re-examined the initial sarcoma sample, which was paraffin embedded and stored. We were able to detect the fusion signal of PML/RARα using FISH in the preserved sample and concluded it was de novo MS/APL from the onset of the disease. We treated the patient with a combination of all-trans retinoic acid (ATRA), daunorubicin, and cytarabine, which is the standard induction therapy for APL patients in our institute. Differential syndrome did not occur during treatment with ATRA. Hematological remission was acquired 39 days afterward, yet the PML/RARα fusion gene was still detected in bone marrow by RT-PCR. Although we subsequently treated the patient with a combination of arsenic trioxide (ATO) and ATRA, the copy number of the PML/RARα fusion gene started to increase 9 weeks after starting ATRA therapy. Hematological recurrence became prominent 4 weeks after. Salvage treatment with gemtuzumab ozogamicin and tamibarotene was not sufficient for achieving remission. The patient died of a brain hemorrhage due to DIC induced by refractory APL shortly afterward, a total of 40 months from onset.
pmc-6389482-1
Our patient is a 19-year-old girl, with a long surgical history of multiple complicated abdominal surgeries. She was diagnosed with Primary Hyperoxalosis for which she underwent same setting liver and kidney transplant. A few years afterward, she was diagnosed with intestinal type diffuse large B-cell lymphoma. After that, she had an ileocecal mass that obstructs the bowel lumen and required oncological resection with right hemicolectomy and anastomosis which was further complicated by anastomotic leakage, wound dehiscence and intra-abdominal sepsis thus requiring emergency exploratory laparotomy and Hartmann's procedure with end ileostomy. The patient then underwent laparotomy, Hartmann's revision and ileostomy site closure. For the purpose of graft preservation, the patient was on long-term immunosuppressants. After more than a year from the last surgery, she developed a central abdominal bulge at the site of her laparotomy scar; she had midline incisional hernia. Due to the long history of laparotomies and multiple surgical procedures, a multidisciplinary approach was necessary, and a surgical treatment plan was set. An enhanced CT scan was performed and showed thinning of the anterior abdominal wall muscles with severe atrophy of the left rectus abdominis muscle with rectus diastasis of around 10 cm distance (Figure ). The injection was performed by the interventional radiologist with the patient in supine position under ultrasound guidance (Figure ). Injection sites were marked at the anterior axillary line between the costal margin and anterior superior iliac spine according to the technique described by Smoot et al. The area was prepped and draped in a sterile technique which was followed by application of local anesthesia in the form of 1% lidocaine at the skin of injection sites. Under ultrasound guidance, BTA was injected at the three sites on either side of the abdomen. The patient received a total of 300 units of BTA diluted in 150 mL of 0.9% saline with a concentration of 2 units/mL. Each of the six injection sites received a volume of 25 mL. Each of the three injection sites on either side of abdomen were used to target the external oblique, internal oblique, and transversus abdominis muscles. After the procedure, the patient recovered smoothly and was discharged home the next day to return for surgery after 3 weeks. Above the iliac crest, transversus abdominis at anterior axillary line. Mid abdomen, internal oblique at mid axillary line. Below costal margin, external oblique at anterior axillary line. Patient went for surgery 3 weeks after Botox injections. The procedure started by infiltrating normal saline for subcutaneous hydro-dissection followed by removing the old scar at the midline. De-epithelization was continued just beneath the skin to raise it above the adherent bowel underneath until reaching the normal fascia on both sides of the abdomen. Then, the abdominal flap was raised in the subscarpal plane above the fascia. Closure of the defect and plication of the recti were done followed by placement of sized on-lay fully resorbable monofilament mesh (Figure ). To further relax the lateral abdominal muscles, a total of 200 units of BTA diluted in 8 mL of normal saline were infiltrated at the same previously injected sites (Figure ). Drains were placed bilaterally above the mesh. Subcutaneous tissue was approximated with interrupted sutures in two layers. Skin was closed with 4-0 Monocryl in subcuticular fashion (Figure ). Patient had no complications and was followed up for the next 18 months with no recurrence.
pmc-6389483-1
A 77-year-old male with a past medical history of coronary artery disease status post coronary artery bypass grafting, hypertension, chronic obstructive pulmonary disease, diabetes mellitus type 2, and cerebrovascular accident presented to a local hospital with acute abdominal pain and bloating. A computed tomography (CT) scan of the patient's abdomen and pelvis was performed and showed intraabdominal bleed and multifocal liver lesions. Initial complete blood count (CBC) revealed a hemoglobin of 7 g/dL and he was transfused one unit of packed red blood cells prior to transfer to our institution. On arrival, CT angiogram of the abdomen and pelvis showed multiple dense, heterogeneous masses throughout the liver with associated perihepatic and intraperitoneal hemorrhage and areas of tumor blush were noted but no extravasation was seen to suggest active hemorrhage. There was also multiple enlarged periportal and upper mesenteric lymph nodes, likely representing metastatic adenopathy. There were no lesions present on the pancreas. CT chest was obtained and showed no evidence of intrathoracic metastatic disease. Initial blood work revealed normal liver function tests, appropriate response in hemoglobin to transfusion and negative viral hepatitis panel. Tumor markers revealed AFP elevation to 8705 ng/mL, normal Carcinoembryonic Antigen and Cancer Antigen 19-9. Magnetic Resonance Imaging (MRI) of the abdomen and pelvis showed multiple lesions throughout the liver with targetoid appearance. There was no evidence of cirrhosis and these lesions did not have imaging characteristics of typical HCC (Figure ). It was suspected the multifocal liver lesions were HCC given the elevated AFP. However, the MRI was not consistent with HCC and a liver biopsy was obtained. Pathology results were consistent with poorly differentiated, large cell-type neuroendocrine carcinoma with metastatic disease to the liver (Figure ). The patient had an unremarkable colonoscopy and esophagogastroduodenoscopy six months prior to presentation therefore, it was suspected the primary origin of NET was in the small bowel. Regarding the intraabdominal bleed noted on initial CT scan, this remained stable on repeat scans and surgery recommended conservative management. The planned chemotherapy regimen will be Carboplatin and Etoposide.
pmc-6389484-1
An 8-month-old female presented to the emergency department of our hospital with a right-sided hemiparesis and a mild right-sided facial paresis, which had been progressive since one day. Further clinical examination was normal and there were no apparent skin lesions. The week before, she had experienced high fever for two days followed by irritability, anorexia, and low-grade fever. She was born full term via uncomplicated vaginal delivery after a normal pregnancy and was the third child of healthy non-consanguineous parents from African European descent. Besides an uncomplicated Varicella infection at the age of 6 months, anamnesis and family history did not reveal any relevant information. Laboratory investigation, including complete blood count, C-reactive protein, liver function tests, kidney function, and electrolytes, was within the normal range. Computed tomography of the brain did not show any abnormalities, whereas the magnetic resonance imaging (MRI) with angiography of the brain revealed a (sub) acute ischemic lesion of the left capsule-thalamic region with irregularities of the left arteria cerebri media, suggestive of vasculitis (Figure ). The vasculitis lesion can be classified as benign (single, concentric, graduated, and smooth aspect of the lesion) and proximal (location on the M1 segment of the left middle cerebral artery). Electroencephalography was normal. Lumbar puncture was done showing normal liquor opening pressure. Examination of liquor indicated an elevated white blood cell count (186 cells/mm3) with normal glucose (55 mg/dL) and protein levels (20 mg/dL). While in-house PCR for Varicella zoster virus and Herpes simplex virus were negative, PCR for enterovirus (GeneXpert, Cepheid) was positive. Bacterial culture remained negative. The sample was sent to the national reference center, and the strain was typed as Echovirus 6 by sequencing. Echocardiography and Doppler ultrasound of the lower limbs and abdomen were normal. Hereditary and acquired hypercoagulability workup (activated partial thromboplastin time, prothrombin time, fibrinogen, D-dimers, antithrombin III, protein C activity, activated protein C resistance, protein S activity, prothrombin G20210A mutation) was normal. Lupus anticoagulant was negative. Since the focal origin of the vasculitis, and the suspected cause of this, a brain biopsy was not considered. Intravenous methylprednisolone (1 mg/kg/d, 5 days) and acyclovir (30 mg/kg/d, 14 days) were administered as initial therapy. Even though PCR for Varicella zoster and Herpes simplex were found to be negative, the treatment with corticosteroids and acyclovir was completed because of the clear neurologic deficit and the history of the Varicella zoster infection. Because of the severity of the neurologic deficit and in anticipation of the results of the coagulopathy screening, subcutaneous enoxaparin (2 mg/d) was started. Neurologic abnormalities recovered slowly during the following weeks. Enoxaparin was discontinued after eight weeks, and oral aspirin (30 mg/d, for two years) was initiated.
pmc-6389490-1
An 18-year-old male Caucasian referred to plastic surgery clinic from dermatology department as a case of extensive skin folding on the forehead and depressed nasolabial fold. He also complained of bilateral knee joint pain and swelling. These symptoms were first noted at 16 years of age. No history of similar condition in family and consanguinity. No history of trauma and fractures. On examination, he had pronounced folds in the area of forehead, between the eyes, in the nasolabial grooves and on the chin, furrowing on his forehead skin and first one inch of the scalp posterior to hairline, and bilateral partial ptosis (Figure ). The development of the patient's skin folds was insidious and progressive. Clubbing of his fingers and toes (Figure ) was noticed. Patient has swollen knee joints (Figure ). Patient has profuse sweating and seborrhea in his axillae, hands, and feet. Examination of the cardiovascular, respiratory, and gastrointestinal systems revealed no significant abnormalities. Laboratory analysis showed a mild increase in ESR (18 mm/first h; normal < 15) and significant increase in C-reactive protein (31.5 mg/L; normal < 5). The following parameters were normal: random blood sugar, serum calcium, growth hormone, and thyroid function tests. Radiographic investigations were done to look for skeletal abnormalities. Plain X-rays revealed thickening of the bone indicating increased bone formation, symmetric shaggy sub-periosteal bone formation with the involvement of epiphyseal regions, acro-osteolysis of the tufts of distal phalanges, irregularity in the superiolateral borders of both scapulae, and diffuse soft tissue thickening (Figure ). According to the data available from history, examination, and investigation, the patient was diagnosed with complete primary form of PDP. Two weeks after diagnosis, the patient underwent frontal rhytidectomy to remove excess skin in the forehead and to decrease the prominent nasolabial folds. A frontal rhytidectomy was performed through a brow lift incision, with dissection into forehead in the subgaleal and subfrontalis planes (Figure ). Excision of 2 inches of excess forehead skin was achieved and sent for histopathological examination. Closure of skin with 3-0 Nylon was done without tension. Autologous dermal-fat graft from the lower abdomen was placed in the nasolabial fold bilaterally through a small nasolabial incision, due to lack of enough fat available for liposuctioning and grafting. Postoperative recovery was unremarkable. Hyaluronic acid (1.6 mL of Juvederm® filler) was injected in the forehead area 1 week after the operation, and Botulinum toxin type A (120 IU of Dysport®) was injected in the forehead muscles 4 weeks postoperatively (Figure ). He was satisfied with the operation cosmetic outcome. Future interventions might be needed with further progression of the disease. Microscopic evaluation of the excised skin revealed unremarkable epidermis and thickening of the dermis with fibrous bands extending into subcutaneous tissue surrounded by thick collagenous bundles with increased amount of ground substance. Well-controlled alcian blue and colloidal iron special stains highlight dermal per adnexal mucin deposition. Features of skin with deep dermal fibrosis, increased fibroblasts, and neuronal hyperplasia were consistent with the clinical diagnosis of Pachydermoperiostosis (Figure ).
pmc-6389502-1
The patient was a 34-year-old Japanese man, whose family history included a father with hypertension, and a mother that suffered a subarachnoid hemorrhage, but which did not include either a consanguineous marriage or any incidence of renal cysts. At the age of 31, the patient presented with mild albuminuria, and a serum creatinine (Cr) level of 2.98 mg/dL. At the age of 34, the patient was admitted to hospital with a creatinine level of 8.2 mg/dL. Upon admission, the patient's height, weight, and blood pressure were 179 cm, 58 kg, and 126/80 mm Hg, respectively. The patient exhibited anemia (Hb 8.2 g/dL), azotemia (Cr 8.38 mg/dL), hyperphosphatemia, metabolic acidosis, and secondary hyperparathyroidism; thus, he was diagnosed with ESRD. An abdominal ultrasonography revealed that, although the size of both kidneys appeared to be normal, the patient's renal parenchyma showed increased brightness. We performed a percutaneous renal biopsy; histologically, six of 16 glomeruli displayed global sclerosis, along with mild cellular infiltration, conspicuous interstitial fibrosis, renal tubular atrophy, and cystoid irregular dilation (Figure ), suggesting an NPHP diagnosis. We performed targeted sequencing using a next-generation sequencer, with the approval by the research ethics committee of Tokyo Medical and Dental University in accordance with the Declaration of Helsinki and the patient's written informed consent. A homozygous full gene deletion of NPHP1 (NM_000272.3:g110879716-110962709) was resultantly identified, as well as heterozygous substitutions in PKD1 (NM_0001009944.2:c.6395T>G(p.Phe2132Cys)) (Figure ), BBS1 (NM_024649.4:c.908T>C(p.Val303Ala)), and INPP5E (NM_019892.4:c.1652C>T(p.Thr551Met)).
pmc-6389503-1
A 90-year-old male was admitted to our hospital for the complaint of lower abdominal pain. The physical examination revealed tenderness in the lower abdomen; however, he had no symptom of peritoneal irritation. He presented with comorbidities of hypertension, hyperlipidemia, and hyperuricemia. He had no history of surgery and trauma. The laboratory data revealed anemia and low estimated glomerular filtration rate (eGFR) (hemoglobin level: 10.3 g/dL; eGFR: 35 mL/min/1.73m2). All the other data were within the normal range. The abdominal contrast-enhance CT indicated a mass with coexisting low- and high-density areas with a maximum diameter of 120 mm adjacent to the stomach and transverse colon (a,b). An extravasation was observed in the mass in the arterial phase, and it spread in the portal phase (c,d). The mass was diagnosed as a mesenteric hematoma. We selected conservative therapy, because the vital signs were stable and the anemia was mild. In addition, there was an improvement in the abdominal pain. On the 2nd day of the admission, the anemia progressed (hemoglobin volume: 9.5 g/dL); therefore, the abdominal contrast-enhance CT was performed again to confirm the findings. It was observed that the density of the mass had decreased; the size of the mass had reduced; and the extravasation was not present. The patient’s hospitalization course was uneventful. He was discharged on the third day after admission due to the improvement of anemia (hemoglobin volume: 11.4 g/dL) and his strong hope. After 7days from discharge, we checked his laboratory data in the outpatients clinic; showed no anemia progress (hemoglobin level: 11.4 g/dL). After 15 days from discharge, he was admitted to the hospital again for the complaint of bloody stool. He had no other complaints, such as fever and abdominal pain. The laboratory data revealed that his white blood cell (WBC) count was within the normal range; but, the C-reactive protein (CRP) level was elevated (18.36 mg/dL); the hemoglobin level was 10.5 g/dL, which was not different from that during the first visit. On the abdominal contrast-enhanced CT, an air-filled mass measuring 90 mm in diameter was observed (). We diagnosed it as a mesenteric hematoma with a fistula between the transverse colon. We thought that the etiology, malignancy or not, change operation methods. We decided to perform a colonoscopy on the following day. The colonoscopic findings revealed many ulcers and fistulae with the blood flowing out at the transverse colon at the splenic flexure (a,b). There was no diverticulum. We selected an antibacterial drug therapy before the operation, because he had no other complaints and his vital signs were within the normal range. Subsequently, the patient underwent a laparoscopic transverse colectomy. The mass was confirmed in the mesentery of the transverse colon at the splenic flexure, and it had formed adhesions between the stomach, pancreas, and omentum. We changed the procedure to hand-assisted laparoscopic surgery (HALS) to perform the operation safely (a,b). The total operation time was 248 min, and the total intraoperative blood loss was 268 ml. Macroscopically, the fistula was found between the transverse colon and mesenteric hematoma (). Histopathologically, an ulcer was also identified in the wall of the transverse colon. The bottom of the ulcer was connected to the mesentery by an abscess cavity (a-c). There were no findings of mesenteric aneurysm and arterial sclerotic change. Abscess wall was constituted of inflamed granulation tissue with internal bleeding. The patient was diagnosed with a spontaneous mesenteric hematoma that formed a fistula to the transverse colon without any malignancy. The postoperative course was uneventful, and hence, the patient was discharged on the 10th postoperative day.
pmc-6389550-1
A 91-year-old Chinese female with a background of hypertension and ischemic heart disease was admitted with a three-day history of central abdominal and back pain. She had previously undergone an endovascular aortic aneurysm repair (EVAR) twenty years prior, with a bifurcated endovascular aortic Vanguard device (Boston Scientific Ltd, Marlborough, MA, US) for a 6.5 cm diameter infra-renal abdominal aortic aneurysm. Until this admission, she was on regular stent-graft surveillance and had been free of any EVAR-related complications or re-interventions. Her blood pressure has been well controlled on a single agent – Amlodipine and takes only aspirin for secondary prevention for cardiovascular disease. A pre-operative CT aortogram (CTA) was performed and showed that the contralateral limb of her graft had become disconnected from the main body (type III endoleak), with an interval increase in size of the aneurysmal sac from 4.5 to 4.8 cm the past year. In view of the potential risk of aneurysmal rupture, the patient was counselled for and underwent percutaneous relining of the graft using two kissing Endurant™ limbs (Medtronic Ltd, Dublin, Ireland). This was performed by our consultant surgeon Mr Tang Tjun Yip. During the procedure, there was some anticipated difficulty cannulating the disconnected graft from the ipsilateral groin because of the angulation of the limb fracture and a contralateral wire from the main body side had to be snared first through the disconnected limb to get a through and through wire (see ). Kissing stents had to be deployed to reposition the bifurcation of the graft; otherwise one side would have allowed one limb to hang over to the other side and potentially impinge on the blood flow to the other side, as the main body length of this graft is relatively short. The patient tolerated the procedure well and did not report further episodes of abdominal and back pain. She recovered well and was discharged two days post-procedure after a repeat CTA scan showed a no further endoleak. We reviewed her in clinic three months later, with a follow-up CTA showing no endoleaks, stable aneurysmal sac size and no narrowing of the limbs from the relining process.
pmc-6389552-1
A 67 Y old, caucasian male, patient was admitted to outpatients’ service of our Istitution showing an US and a CT scan. These diagnostic tests described a solid mass with a diameter of 55 mm localized at lower pole of the spleen. The imaging performed did not provide an unambiguous definition about the mass, so a MRI of the abdomen was also performed. Unfortunately, also MRI scan did not reveal any remarkable features, showing a mass of lower third of the spleen (55 mm of diameter) with a not uniform enhancement (). At the admission to ward, he denied any recent fever, allergy, chills, or changes in bowel habits. He had history of ischaemic cardiopathy with acute myocardial infarction five years before. Physical examination revealed no pathological findings. Laboratory values upon admission showed 15 g/dL haemoglobin, 45% hematocrit, 88 fL mean corpuscular volume (normal = 83–97), 31 pg mean corpuscular haemoglobin (normal = 27–33), 36 g/dl mean corpuscular haemoglobin concentration (normal = 32–36), 11,000 × 10*3/uL white blood cells (WBC) and C reactive protein (CRP) value was 5 mg/dl (normal value <0.5). The remaining laboratory data including electrolytes, liver function tests, urine analysis and coagulation factors were unremarkable. According to these findings, with the suspicious of splenic abscess, patients underwent surgical intervention with diagnostic and therapeutic intent. At surgery a little enlarged spleen with a mass located in lower pole was confirmed. The dimensions of the mass were approximately like a chicken egg with an hard, woody consistency. Upon this findings a splenectomy was performed. The post-operative course was complicated by mild fever (37.5–37.8 °C) between 3rd and 5th postoperative days. Due to this a CT scan was performed showing a fluid collection (diameter 10 cm) in splenic seat therefore at the same time a percutaneous drainage was placed and a full recovery was obtained in two days. The following postoperative course was uneventful and patients was discharged in postoperative day 7th. The pathological examination documented a splenic mass (4.5 × 3.5 cm) formed by many little nodules composed by “like capillary” vascular spaces surrounded by thick connective tissue. Immunohistochemical profiles was then performed and diagnosis of SANT was made (). The patient is asymptomatic and disease free at 3 years after surgery.
pmc-6389554-1
A 30-year-old Chinese woman, G1P1, with a history of an excisional biopsy for a benign right breast mass seven years ago, presented with a new palpable left breast mass in the postpartum period. She was not breastfeeding and had no family history of breast or ovarian cancer. On clinical breast exam, there was a 3.6 cm mass at the 12 o’clock position of the left breast, 4 cm from the nipple, with a normal axillary examination. On ultrasound, there was a corresponding heterogenous 3.48 cm mass (). Ultrasound-guided core needle biopsy demonstrated benign breast tissue with focal secretary changes and chronic inflammation. The pathology was considered to be discordant with imaging findings. The patient underwent a left breast excisional biopsy which revealed a 3.2 cm malignant phyllodes tumor focally extending to inferior, medial, and posterior margins with noted tumor <1 mm from all other margins. Given the close and positive margins, the patient underwent a re-excision of all margins to achieve a final 1 cm in all margins. Pathology demonstrated no further evidence of the malignant phyllodes tumor, however, incidentally noted a 1.5 cm area of DCIS at the lateral margin, ER+ (90%) and PR- (negative) with a positive margin (). Bilateral diagnostic mammogram demonstrated a small cluster of punctate calcifications in the left upper outer quadrant, in the posterior aspect of the lumpectomy cavity which was suspicious for malignancy. The patient was referred for genetic counseling and testing which was negative for BRAC 1/2. She subsequently underwent a left breast re-excision lumpectomy of the lateral margin along with wire localization excisional biopsy of the calcifications. Final pathology revealed an additional 7 mm of intermediate grade DCIS, with no evidence of malignant phyllodes tumor and a negative final margin. She completed adjuvant radiation therapy and was placed on tamoxifen. Follow-up mammography, ultrasound, and clinical exam had been stable with no evidence of new or recurrent malignancy for almost three years.
pmc-6389554-2
A 30-year-old nulliparous Chinese woman presented with a palpable right breast mass for one month. On clinical exam, a 1 cm firm nodule was palpated in the medial aspect of the right breast. On the diagnostic US, there was a 1.3 cm heterogeneous, hypoechoic nodule at the 3 o’clock position in the periareolar region with no suspicious microcalcifications or architectural distortion (). Subsequent ultrasound-guided core needle biopsy demonstrated a fibroepithelial tumor for which the patient underwent an excisional biopsy. Pathology revealed a 1.5 cm benign phyllodes tumor with mild cytologic atypia and no stromal overgrowth; additionally, a 3.5 mm intermediate grade DCIS was found as a single focus within the benign phyllodes tumor, ER+ (85%) and PR+ (95%) (). DCIS was 2 mm from the anterior margin and >5 mm for all other margins. Phyllodes tumor was <1 mm from anterior and posterior margins, at 1 mm from the medial margin and >5 mm from remaining margins. She underwent genetic counseling and testing which was negative for BRCA 1/2. The patient desired to start a family and declined radiation and tamoxifen treatment. At the last follow up at 1 month after surgery, she was considering bilateral nipple-sparing mastectomy.
pmc-6389595-1
The patient was a 36-year-old woman with Turner’s syndrome (TS) diagnosed at 9 years of age. She received an oral contraceptive pill as a hormone replacement therapy (HRT) from the age of 16 years. She was referred to our department in July 2017 after presenting at a local hospital with fatigue and liver tumors detected on computed tomography (CT). Her physical examination and blood tests showed no remarkable findings. Abdominal ultrasonography showed a low echoic tumor, which was 60 mm in diameter, in the posterior section of the liver and an isoechoic tumor, which was 6 mm in diameter, at the root of the right hepatic vein (RHV; ). CT showed a 60-mm tumor in the posterior section of the liver. This tumor showed high density in the arterial phase and isodensity in the portal and late phases. Another small 10-mm tumor at the root of RHV also showed high density in the arterial phase and isodensity in the portal and late phases (). Gadoxetic acid ethoxybenzyl magnetic resonance imaging (Gb-EOB-MRI) of the large tumor showed high intensity on T2-weighted images and in the arterial and portal phases, and low intensity in the late and hepatobiliary phases, while the small tumor showed low intensity in the hepatobiliary phase (). Based on the diagnosis of multiple HCAs or hepatocellular carcinomas (HCCs), segmentectomy of No 7 of the liver was performed. The operation time was 178 min, and blood loss was 681 mL. Macroscopic findings showed a whitish and brownish tumor, which was 61 mm in diameter and without capsula and another small, whitish, 11-mm tumor without capsula. Pathological findings of the larger tumor showed hepatocytes without atypia, with sinusoid dilatation and a single vessel seen within the tumor. This tumor was diagnosed as HCA. Immunohistochemistry findings of the larger tumor showed that the hepatocytes were positive for C-reactive protein (CRP) and liver fatty acid-binding protein (LFABP) and negative for β-catenin, glutamine synthetase (GS), and glypican-3 (). The small tumor showed same pathological and immunohistochemistry findings; therefore, both the tumors were diagnosed as inflammatory HCA (IHCA). The patient was discharged on postoperative day 14. At the 13-month postoperative follow-up, she was doing well and there was no evidence of recurrence of HCA without the pill.
pmc-6390234-1
A 63-year-old Caucasian female with established seropositive (+RF, +ACPA) rheumatoid arthritis for 11 years on treatment with infliximab and methotrexate (MTX; 20 mg/week) presented with a 1.5-month history of fever, cough, and dyspnea. She was initially suspected to have community-acquired pneumonia treated with antibiotics and systemic steroids with transient improvement; however, her symptoms recurred. Initial lab tests showed anemia (Hb: 8.8) and thrombocytopenia (platelet: 51) with an elevated ferritin of 28,000 ng/ml, low complements (C3: 21; C4: <2), low fibrinogen, elevated CRP, normal lipids, and mildly elevated liver enzymes. CT chest was remarkable for subpleural opacity without parenchymal infiltrates. Her physical examination demonstrated chronic limited range of motion of the left wrist and no active synovitis. Due to significant elevation in ferritin, recurrent fevers, cytopenias, and failure to respond to antibiotics, secondary hemophagocytic lymphohistiocytosis (HLH) was suspected, with possible triggers being RA, immunosuppression, malignancy, and infection. Additionally, further testing demonstrated an elevated soluble IL-2 receptor (sIL-2) at 7970 U/ml (Ref: 45–1105 U/ml). Hence, the patient fulfilled 5 out of 8 HLH-2004 diagnostic criteria for HLH with elevated ferritin, low fibrinogen, fever, cytopenia (Hb < 9 and low platelets), and elevated sIL-2 receptor. She was empirically started on high-dose systemic glucocorticoids for management of HLH; however, she continued to experience recurrent high-grade fever. Due to suspicion for an underlying infectious etiology of HLH, bone marrow biopsy was performed which revealed hypercellular bone marrow with multiple fungal elements consistent with histoplasmosis without evidence of hemophagocytosis. Subsequent urine and blood cultures confirmed disseminated histoplasmosis. Antifungal treatment with intravenous amphotericin was promptly initiated in the hospital; after adequate clinical response, the patient was transitioned to itraconazole. Infliximab and MTX were held during antifungal treatment, and the patient was switched to hydroxychloroquine. Her infection was under control during her 9 months of follow-up with infectious disease, and she remained on antifungal treatment indefinitely.
pmc-6390235-1
A 43-year-old female with past medical history of asthma and bipolar disorder presented to our emergency room with progressive chest pain and shortness of breath for 3 days. She had been prescribed alprazolam, lamotrigine, prednisone, and albuterol for more than 10 years but was not compliant to her medication. Further questioning revealed that she took oral prednisone in recent days because of shortness of breath. She described non-exertional pressure like pain over the middle of her chest. The pain was 10/10, constant, without radiation, localized to the retrosternal area, and aggravated by deep breathing. Exercise tolerance was reported as less than 1 block due to shortness of breath. Patient denied fever, wheezing, fatigue, chill, nausea, vomiting, diarrhea, constipation, joint pain, or rash. Patient lived in Maryland but recently traveled to Miami two weeks prior to presentation and only arrived in New York one week before presentation. Upon further question, the patient's brother revealed that she had been going to unlicensed establishments and receiving silicone injections in her buttocks. She did not reveal the exact time she had these injections but stated she had come to New York to have the procedure. On physical examination, the patient was afebrile. Her heart rate and blood pressure were normal, and her respiratory rate was 20 breaths/minute. Arterial oxygen saturation was 93% on ambient air. On auscultation, crackles were heard over bilateral lung fields, without wheezing. Cardiovascular, abdominal, neurological, musculoskeletal, and skin examinations were unremarkable. A chest radiograph demonstrated increase bilateral peripheral lung field opacities (). Computed tomographic (CT) imaging of the chest showed peripheral predominant ground-glass opacities. No bronchiectasis or fibrosis was noted (Figures –). After admission to general medicine, her respiratory rate increased to 29 breaths/min with labored breathing and accessory muscle use. Patient received rapid-sequence endotracheal intubation for severe hypoxia. She was treated with a lung protective strategy (tidal volume of 6cc/kg of ideal body weight; plateau pressure less than 30 cm H2O). Broad-spectrum antibiotics, including ceftriaxone and azithromycin, was instituted. High-dose methylprednisolone was also initiated and gradually tapered to oral prednisone. Further laboratory investigation, including renal and liver function tests, serum antinuclear antibody, anti-neutrophil cytoplasmic antibodies (Myeloperoxidase antibody/Proteinase-3 antibody), IgG levels specific to Aspergillus (Aspergillus niger/Aspergillus flavus/Aspergillus fumigatus), stool ova/parasite, syphilis testing, influenza A and B by PCR, respiratory syncytial virus by PCR, legionella urine antigen, and procalcitonin were negative. Urine toxicology was negative for benzodiazepines, cannabinoids, opioid, cocaine, and phencyclidine. Total IgE is 149 KU/L (reference ≤100 kU/L). We performed bronchoscopy with BAL and transbronchial biopsies on day 8 of admission. Serial BAL of the right lower lobe demonstrated increasingly blood-tinged fluid from tube 1 to tube 5. Cell count performed on the BAL fluid showed red blood cell 24,484/mm3, white blood cell 89/mm3, segment 65%, lymphocyte 28%, monocyte 1%, and mesothelial cell 6%. Grocott-Gomori methenamine silver stain of the fluid was negative for P. jirovecii. Bacterial, viral, and fungal cultures were all negative. Tests for acid-fast bacilli and ova and parasites were also negative. Transbronchial biopsies showed benign bronchial alveolar tissue with inflammation; no eosinophils were found. The day after bronchoscopy and extubation, the patient left against medical advice in stable condition.
pmc-6390236-1
A 39-year-old man, born of a consanguineous marriage, had epilepsy since the age of 12 years, as well as dyslipidemia; he was referred to our hospital because of acute painless visual loss and progressive gait disturbance. His visual acuity was 20/16 bilaterally after bilateral cataract surgery at the age of 31 years. His developmental milestones were normal. He denied a history of neonatal jaundice or infantile diarrhea, smoked half a pack of cigarettes per day, and drank socially. His family history was unremarkable. Medications included carbamazepine, phenytoin, clobazam, and bezafibrate. On physical examination, swelling was observed in the tendons of Achilles, patella, and triceps, which indicated xanthoma (). A neuroophthalmological examination showed corrected visual acuities of 20/125 in the right eye and 20/30 in the left eye. The right pupil measured 4 mm with a round shape in dark and 2 mm in light conditions; both pupils constricted briskly in response to light. The right eye exhibited an afferent pupillary defect. A biomicroscopic examination was remarkable for bilateral centrally-fixed intraocular lens. Funduscopic examination showed mild swelling in the nasal side of the right optic disc (); the left eye was normal. Humphrey 30-2 visual field examination showed a cecocentral scotoma in the right eye (). Optical coherence tomography (OCT) of the right eye showed intact thickness of the retinal nerve fiber layer (RNFL) in the macula (), while the peripapillary RNFL thickness had increased. Fundus fluorescein angiography (FAG) showed mild leakage on the nasal side of the right optic disc (). Pattern-reversal visual-evoked potentials (VEPs) with check sizes of 7.5', 15', 30', and 60' revealed no clear potentials in both eyes, and the P100 wave could not be identified. All findings indicated optic neuropathy. Neurological examination revealed Minimental State Examination scores of 22/30. The patient exhibited slurred speech, weakness in the lower limbs with spasticity, brisk deep tendon reflexes throughout all extremities, and bilateral positive Babinski sign. His gait was unstable because of truncal ataxia. Routine laboratory tests revealed the following: normal renal and liver functions, no elevations in inflammatory markers such as erythrocyte sedimentation rate and C-reactive proteins, normal LDL cholesterol, 137 mg/dL, high triglycerides, 331 mg/dL, increased lactic acid levels, 17.3 mg/dL (reference range: 3.0–17.0 mg/dL), and pyruvate levels, 2.02 mg/dL (reference range: 0.3–0.94 mg/dL). Serological analyses of the herpes simplex virus, cytomegalovirus, Epstein-Barr virus, angiotensin-converting enzyme, PR3 and MPO anti-neutrophil cytoplasmic antibodies, anti-nuclear antibody, SS-A and SS-B antibodies, and anti-DNA antibody revealed negative results. Moreover, anti-aquaporin 4 and anti-myelin oligodendrocyte antibodies were not detected. No mitochondrial DNA mutations (i.e., nucleotide positions 3460, 11,778, and 14,484) associated with Leber's hereditary optic neuropathy (LHON) were observed. Cerebrospinal fluid (CSF) analysis revealed no cells but showed an increased protein level (77 mg/dL); isoelectric focusing revealed no oligoclonal bands in the CSF. Brain magnetic resonance imaging (MRI) revealed bilateral swelling in the optic nerves on T1-weighted images () and enhancement on gadolinium-enhanced T1-weighted and T1-weighted fat-suppressed images (Figures and ), suggesting optic neuritis. Furthermore, T2-weighted images showed an enlarged fourth ventricle, atrophy of the cerebellum, and hyperintensities in the bilateral dentate nuclei (Figures and ); fluid-attenuated inversion recovery images demonstrated hyperintensities in the bilateral dentate nuclei and the pyramidal tract (). The patient was finally diagnosed with CTX upon observance of an elevated serum cholestanol level of 13.6 μg/mL (reference range: 2.0–3.4 μg/mL) and a homozygous missense mutation (c.1421G>A) in CYP27A1. One month later, before the initiation of oral chenodeoxycholic acid (CDCA) treatment, the patient's visual acuity spontaneously recovered to 20/16 bilaterally, and hyperintensities in the optic nerves were found to be diminished on follow-up MRI. His neurological symptoms, however, were not altered 6 months after administration of CDCA.
pmc-6390238-1
A 28-year-old para 1001 woman with a past medical history of systemic lupus erythematosus was found to be 5-week pregnant at the onset of a lupus flare. She reported headaches, fevers, fatigue, and arthralgias. She had a known positive antinuclear antibody (ANA) level of 1:640 as well as positive rheumatoid factor, anti-double stranded DNA antibodies, anti-SSA antibodies, anti-smith antibodies, lupus anticoagulant, and anti-RNP antibodies. The patient was managed in conjunction with rheumatology. The patient was started on hydroxychloroquine 200 mg twice daily and aspirin 81 mg daily. She was scheduled to begin limited ultrasounds every two weeks beginning at 16 weeks due to her positive anti-SSA antibody status. By 8 weeks, she exhibited mouth and lip sores, lymphadenopathy, pleuritic chest pain, and a maculopapular rash. She was found to have a low C3 (30.0) and elevated liver enzymes (AST 141 U/L and ALT 58 U/L) so prednisone 10 mg twice daily was initiated. Despite the prednisone and hydroxychloroquine, her symptoms persisted and due to anorexia and nausea/vomiting of pregnancy, she experienced a 20-pound weight loss over the next 4 weeks. After documenting a normal thiopurine methyltransferase enzyme activity, the patient was started on azathioprine 100 mg daily. Within one week of starting azathioprine the patient's pain considerably decreased and her lymphadenopathy almost resolved. At 18 5/7 weeks, the patient presented to clinic with new onset shortness of breath and was subsequently admitted to the intensive care unit with acute hypoxic respiratory failure. During the week prior, the patient complained of daily fevers. The patient's respiratory status rapidly declined, requiring intubation and mechanical ventilation. Laboratory studies upon admission were notable for a normal white blood cell (WBC) count of 4.6 K/UL, mild anemia with a hemoglobin 10.3 gm/dL, normal platelet count of 198 K/UL, AST 123 U/L, ALT 57 U/L, and lactate dehydrogenase (LDH) of 110 U/L. A chest X-ray showed five lobe infiltrates and computed tomography (CT) angiography of the chest was negative for pulmonary embolism. An abdominal ultrasound showed mild splenomegaly (12.7 cm in length). She was started on broad spectrum antibiotics; however extensive infectious evaluation including blood, urine, and bronchial cultures were all negative for an infectious process. Within 24 hours, the patient developed leukopenia and thrombocytopenia with WBC 3.1 K/UL and platelets of 60 K/UL. During the course of her initial work-up she was also noted to have a significantly elevated ferritin of 3534 ng/mL. With the negative infectious work-up and lack of response to antibiotics, her acute respiratory distress syndrome (ARDS) was felt to be secondary to an autoimmune etiology and she was started on high dose methylprednisolone. Given her negative work-up thus far and worsening pancytopenia, hematology was consulted at 19 1/7 weeks. Soluble IL-2 receptor (sCD25) levels were sent for evaluation and later returned as 11,370. A bone marrow biopsy was performed showing hemophagocytosis of all cell lineages and the diagnosis of HLH syndrome was confirmed. She was started on etoposide and dexamethasone per the HLH-94 treatment protocol and she received a 5-day course of intravenous immunoglobulin. Over the next week, the patient continued to deteriorate with progressive pancytopenia (nadirs of WBC 1.8 K/UL, hemoglobin 6.1 gm/dL, and platelets 18 K/UL), persistent fevers, and increasing ferritin (>7500 ng/mL max). Persistent fetal tachycardia was observed daily into the 200s. At 20 4/7 wga, the patient coded twice requiring chest compressions without medications (each episode less than 1 minute in duration). Over the next week there was cyclical improvement and deterioration in the patient's respiratory status. A growth ultrasound was done and intrauterine growth restriction (estimated fetal weight 210 grams) was noted. At 21 4/7 wga, the patient developed vaginal bleeding and subsequently delivered a demised male fetus. The following day the patient developed tachycardia into the 170s and a temperature of up to 103.0°F. Rapid neurologic decline prompted a head CT which revealed a left middle cerebral artery infarct. Aggressive measures including cyclosporine were attempted; however the patient had further neurologic deterioration and was transitioned to comfort measures. Autopsy was declined by the family.
pmc-6390241-1
A 24-year-old Caucasian male with a history that includes Addison's disease, developmental delay, hypogammaglobulinemia, PNH complicated by lower extremity thrombosis, minimal change disease (MCD), and end-stage renal disease (ESRD) presented with headaches, fevers, and neck stiffness for several days after a tunneled dialysis catheter was placed for hemodialysis. The patient was diagnosed with Addison's disease at the age of 14 years following a workup for ongoing fatigue. At that time, he was also found to have macrocytic anemia (hemoglobin 9.3 G/dL, hematocrit 26.9 G/dL, and mean cell volume 114 FL), thrombocytopenia (platelets 16,000 U/L), elevated lactate dehydrogenase (1261 U/L), and reticulocytosis (3.6%). His direct antiglobulin test, platelet antibodies, and HIV antibodies were negative, and the ADAMTS13 activity level was normal. Hemoglobin electrophoresis was not suggestive of hemoglobinopathy. His peripheral blood smear reported anisopoikilocytosis, mild to moderate schistocytes, and Howell–Jolly bodies. Splenic ultrasound with Doppler studies were normal. Slightly increased osmotic fragility was present, and bone marrow biopsy reported a hypercellular marrow with predominance of erythroid precursors. Further evaluation including bone marrow biopsies, cytogenetic analysis, and autoimmune panels failed to confirm a cause for this patient's hemolytic anemia. After returning to the clinic with progressive fatigue and hematuria, the diagnosis of PNH was made when flow cytometry indicated PNH clonal populations in 38% of red blood cells (RBCs), 68% granulocytes, and 71% monocytes. Since the patient's anemia was transfusion independent and without evidence of thromboembolic disease, treatment with eculizumab was not offered until two years after the confirmed diagnosis which the patient refused. His renal function declined over time, and initial renal biopsies reported hemosiderosis due to PNH. His renal function continued to worsen over the next three years, and he eventually developed significant proteinuria (20 g/24 h) prompting repeat kidney biopsy. The results indicated significant hemosiderosis due to PNH as well as effacement of podocyte foot processes consistent with MCD. He was treated with prednisone and later rituximab for MCD. Rituximab was later discontinued after the patient developed new onset hypogammaglobulinemia after starting rituximab. His proteinuria resolved with continued steroid therapy, but his renal function did not improve, requiring initiation of hemodialysis. After the diagnosis of ESRD, the patient was agreeable to eculizumab and started therapy. The patient's clinical course was further complicated by recurrent catheter-associated infection. Over the past two years, the patient has been treated for frequent episodes of sepsis due to coagulase-negative Staphylococcus aureus bacteremia, methicillin-sensitive and resistant Staphylococcus aureus bacteremia, Enterococcus faecalis meningitis, and Streptococcus pneumoniae bacteremia and pneumonia. It was thought that the patient's recurrent infections were from poor tunneled dialysis catheter hygiene and maintenance. On the current admission, peripheral blood smear demonstrated the presence of numerous Howell–Jolly bodies (), Pappenheimer bodies, acanthocytes, and target cells. Splenic sonogram now showed multifocal scarring and splenic atrophy, measuring 7.9 × 3.9 × 3.3 cm, suggestive of recurrent infarctions (). Liver-splenic scintigraphy with 99mTc-labelled colloid did not show splenic uptake, consistent with AS (). The patient continued to have recurrent episodes of staphylococcus bacteremia, leading to tunneled dialysis catheter removal and transition to peritoneal dialysis.
pmc-6390251-1
We present the case of a 48-year-old male, who was evaluated by the medical genetics service because he had noticed weakening of his voice with a high pitch since age 35, associated with premature graying since his 30s and skin lesions since about the age of 40. At the age of 32, bilateral cataracts were diagnosed and at 44 he was diagnosed with diabetes mellitus, currently on oral hypoglycemic agents. Additionally, he has hypothyroidism and hypertriglyceridemia in management and calcification of the Achilles tendon. Patient endorses lack of an early adolescent growth spurt; however, final stature is similar to his other 3 siblings (164 cm). Patient reports he had no child by choice. Patient is product of the union of consanguineous parents (second cousins) and has a 49-year-old brother with similar clinical characteristics, including voice changes since the age of 28, bilateral cataracts at age 29 (subsequently presents complications from corneal ulceration and is currently legally blind), and premature graying since age 33, moreover, scleroderma-like skin changes since his 30s and diagnosis of type 2 diabetes mellitus at age 35. His brother also endorses no child by choice. No other complications such as atherosclerosis, dyslipidemia, hypertension, osteoporosis, or tumors were reported. Unfortunately, patient's brother and parents declined genetic testing. There are no other relatives with clinical suspicion of WS. Patient states maternal aunt has unspecified type leukemia and father with a history of acute myocardial infarction at age 65 and a diagnosis of melanoma at age 85. Maternal uncle diagnosed with lung cancer at age 72 and maternal grandfather with prostate cancer diagnosed at age 73. On initial physical examination, he appeared much older than his age with “bird-like” facial appearance, beak-shaped nose, and bilateral cataracts, his voice was high-pitched and his hair and eyebrows were scarce and markedly gray. He had thin upper limbs with decreased subcutaneous fat and truncal obesity (). Moreover, we found short stature, hypogenitalism, lower limbs with markedly atrophied skin and subcutaneous fat, abnormal pigmentation of the skin and hyperkeratosis, and flat feet (Figures and ). WRN gene sequencing identified the homozygous variant NM_00553.4: c.2581C>T (NP_000544.2: pGln861Ter). WRN gene sequencing report can be found in Supplementary . This variant generates a stop codon at position 861 and has been classified as pathogenic and previously described in homozygous status in a Caucasian patient from the United States in 2006 []. Laboratory findings included normal renal function, high blood glucose (164 mg/dl), elevated glycosylated hemoglobin (9.4%), and elevated triglycerides (324.6 mg/dl) with normal cholesterol (162.4 mg/dl). EKG showed an elevation of the J point by early repolarization. Abdominopelvic CT-scan showed bilateral renal cysts, small umbilical hernia, and no fatty liver. Testicular ultrasound showed decreased bilateral testicular volume mainly left side. Regular screening for malignancies is recommended for patients with WS, due to the high risk of early-onset neoplasms. Also, it is very important to rule out cardiovascular and metabolic diseases during the follow-up of these patients. Our patient is still under periodic clinical observation and follow-up. Currently, he is on treatment with oral hypoglycemic agents for DM2 with adequate glucose control and in treatment of hypertriglyceridemia. Until now no signs of atherosclerosis or cardiovascular disease have been detected. However, he was recently diagnosed with refractory cytopenia with multilineage dysplasia, a form of myelodysplastic syndrome, which has required multiple transfusions. According to a clinical history, the patient's brother is being monitored for inadequate control of diabetes mellitus and severe skin lesions that have been difficult to treat, but no cancer has been documented.
pmc-6390254-1
A 76-year-old Mexican man, from the state of San Luis Potosí, Mexico, was examined at a private cardiology clinic in the Mexican state of Nuevo Leon in April 2018 because of episodes of excessive dry cough, severe dyspnea, and accelerated palpitations as of the previous day. These episodes were frequent and of sudden onset and short duration, without angina, lipothymia, or syncope. He was asymptomatic between episodes. There were no nonpathological antecedents of importance; he had worked as a farmer until his retirement; he did not smoke nor consume alcohol or drugs; and he was neither diabetic nor hypertensive. The only personal pathological antecedent of interest was a hospitalization due to an AMI 3 years ago, which had been attended in the patient's native state. Access to his medical file was not an option at the moment of the consult. Upon arrival at the clinic, he was calm and symptom-free. However, at the start of the clinical interview, he suddenly presented a new episode of severe dyspnea accompanied by intense desperation, which lasted less than 1 minute, after which he remained calm and asymptomatic. The physical examination did not yield relevant data, except for arrhythmic heart sounds due to premature beats. The pulmonary fields were considered clean and well-ventilated, abdominal visceromegalies were not found, and no edema was detected in the lower limbs. The blood pressure was 120/80 mmHg, the heart rate 76 bpm, and the respiratory rate 20 respirations per minute. The initial ECG revealed a sinus rhythm with a heart rate of 55 bpm, PR 0.18, QRS 0.08, AQRS at -30 degrees, and tracing without significant abnormalities (). A ventricular arrhythmia was suspected, but a 24 h Holter monitoring was discarded because of the apparent urgency of the situation. Instead, a color Doppler echocardiography was performed immediately. The echocardiogram revealed a left ventricular ejection fraction (LVEF) of 34% and a large submitral aneurysm in the posterolateral basal-medial region of the left ventricle, as well as severe anterior and inferior basal-medial hypokinesia, mild mitral valve insufficiency, and no pulmonary artery hypertension (Figures and ). As the patient presented symptoms of intermittent heart failure probably due to paroxysmal tachycardia, which, in the context of a cardiac posterolateral submitral VA (SVA), could be potentially lethal, medical treatment was initiated with spironolactone (50 mg/day), furosemide (20 mg/day), amiodarone (200 mg every 12 hours for 2 weeks and then a single 200-mg dose daily), nitroglycerin patches (5 mg/day), and apixaban (5 mg every 12 hours, orally). On a control visit three weeks later, the patient had no cardiovascular symptoms (New York Heart Association (NYHA) functional class I) and had not experienced recurrence of palpitations nor episodes of sudden dyspnea. The laboratory blood values were as follows: hemoglobin, 16.4 gr/dL; leukocytes, 7,400/mm3; platelets, 261,000/mm3; glucose, 108 mg/dL; creatinine, 1.16 mg/dL; uric acid, 5.5 mg/dL; total cholesterol, 207 mg/dL; triglycerides, 147 mg/dL; low-density lipoprotein cholesterol (LDL-c), 144.3 mg/dL; and high-density lipoprotein cholesterol (HDL-c), 51 mg/dL. Hepatic function tests and serum electrolytes were normal, except for an elevated thyroid-stimulating hormone (TSH) level (45 mIU/mL). Urinalysis was without significant abnormalities: pH, 7.5 and density, 1.010. The posteroanterior chest radiograph () revealed grade II cardiomegaly with a rounded growth on a left profile, compatible with VA, without further abnormalities. Levothyroxine (first week, 50 μg/day; from second week onwards, 75 μg/day) and simvastatin (20 mg/day) were added to the treatment. With this therapeutic scheme, the patient remained asymptomatic until August 2018, month of the last follow-up visit at this private clinic. At the beginning of this month, the last monitored TSH level was 7.48 mUI/mL. The good clinical response to treatment and the tendency to a sinus bradycardia did not seem to justify the inclusion of beta-blockers. The patient, with low economic resources, will continue his follow-up and treatment at a third-level public hospital in Monterrey, Mexico. Cardiac gammagraphy, cardiac catheterization, and electrophysiological monitoring were recommended.
pmc-6390258-1
We describe a clinical case of a 56-year-old woman from Angola, with diabetic end-stage kidney disease under maintenance hemodialysis and chronic anemia with frequent blood transfusion requirements, who presented with lumbar back pain and lower extremity muscle weakness for 3 months. The patient reported myalgia, rigors, and epigastric pain for 1 month, which had worsened in the previous 7 days, at which time she travelled to Portugal. At presentation, the patient's vital signs were normal, and physical examination was remarkable for pallor and proximal weakness of the lower limbs. Blood tests on admission revealed anemia (hemoglobin 6 g/dL, mean corpuscular volume 67.1 fL, mean corpuscular hemoglobin concentration 20.5 pg, hematocrit 19.6%, and red cell distribution width 28%), leukocyte count 8.6 × 109/L and platelet count 77 × 109/L, C-reactive protein 26.88 mg/dL, creatinine 8.36 mg/dL, and urea 141 mg/dL, with no evidence of hemolysis. The peripheral blood smear revealed trophozoites and schizonts of Plasmodium malariae, and the patient was treated with artemether/lumefantrine for 3 days, under cardiac monitoring with electrocardiogram and blood potassium monitoring. No infected erythrocytes were identified on peripheral blood smear after treatment conclusion, and no adverse events were reported.
pmc-6390259-1
A 65-year-old female presented to the emergency room with a complaint several weeks of worsening of right-sided headache, nausea, vomiting, cold-induced epistaxis, and blurring of vision from the right eye. Over the previous two months, the patient developed right facial numbness, 25-pound weight loss, and increasing right tongue swelling. On physical examination, the patient was noted to have disconjugate gaze to the right, as well as a right cranial nerve VII and XII palsy. Laboratory studies reveled 10% circulating blasts; there was no evidence of coagulopathy or tumor lysis syndrome. On review of the peripheral blood smear, there was a mixture of myeloblasts and promonocytes with granulated cytoplasm, irregular nuclei, and prominent vacuoles. Computed tomography (CT) imaging of the head performed in the emergency department demonstrated a large focus of edema involving the right temporal lobe as well as hyperdense dural thickening in the right medial petrous apex with 6 mm of midline shift (). Magnetic resonance imaging (MRI) [] demonstrated abnormal T1-intense signal along the dural surface of the right medial petrous region and paraclinoid region as well as sphenoid bone and cavernous sinus with upper sphenoid tumor extension, also extending to the foramen ovale and into the upper margins of the right infratemporal fossa (). Imaging performed 2 months prior as part of surgical planning for a right mastoidectomy for chronic mastoiditis showed no evidence of this mass. The patient was taken to the operating room for endoscopic biopsy of tissue in the sphenoid sinus, which subsequently demonstrated a myeloperoxidase- (MPO-) positive blast population infiltrating the sinus mucosal and bony tissue, positive for CD34, CD117, HLA-DR, CD33, CD11b, and partial CD13 by flow cytometry, consistent with a myeloid sarcoma. Positron emission tomography-computed tomography (PET-CT) was performed that showed intense fluorodeoxyglucose (FDG) avidity in the right temporal lobe, paraclinoid region, sphenoid bone, cavernous sinus, and infratemporal fossa on the right. A subsequent bone marrow biopsy demonstrated a hypercellular marrow with 23% myeloblasts with similar morphologic and immunophenotypic characteristics to the sinus myeloid sarcoma tissue. FISH analysis showed a t(8;21)(q22;q22.1) in all myeloblasts on metaphase analysis, without any additional cytogenetic abnormalities, consistent with a diagnosis of acute myeloid leukemia (AML) with a balanced translocation of RUNX1-RUNX1T1. Subsequent PCR-based testing demonstrated no mutations in c-KIT. The patient was transferred to the inpatient hematology service and initiated induction chemotherapy with cytarabine and daunorubicin (7 + 3 regimen). Her induction course was complicated by hyperbilirubinemia, likely drug-induced. A repeat bone marrow biopsy obtained on day 12 demonstrated no increase in blasts but residual positivity for t(8;21) by FISH in 9 out of 20 metaphases; however, this resolved on repeat biopsy 1 week later. Repeat MRI showed residual tumor involving the right Meckel cave and cavernous sinus. Because of this, she went on to receive consolidative radiotherapy involving the whole brain, with follow-up MRI confirming complete resolution of the mass. Given the patient's favorable risk disease, she proceeded to consolidative chemotherapy with high-dose cytarabine (HiDAC) alone. After 1 cycle, she presented with increasing fatigue and generalized weakness, and repeat bone marrow biopsy confirmed a relapse of AML, with 23% blasts negative for any evidence of the prior t(8;21), but demonstrating a new isolated del(20)(q11.2) in 9 out of 20 metaphases on karyotypic analysis. Lumbar puncture was performed and was negative for any leukemic involvement. She received salvage chemotherapy with G-CLAM, with her subsequent course complicated by neutropenic enterocolitis and recurrent drug-induced hyperbilirubinemia. She experienced delayed count recovery, with a repeat bone marrow biopsy demonstrating no residual disease. She was started on growth factor support and discharged home, where 1 week later, she experienced altered mental status and a fall. Her initial CT scan demonstrated left frontal trauma with associated intraparenchymal hemorrhage in the left frontal and right temporal lobes in the setting of thrombocytopenia. After a slow and incomplete recovery in the neurologic critical care unit, the family elected to take the patient home on hospice care, and she subsequently passed away.
pmc-6390263-1
A 32-year-old male patient presented to our emergency department complaining of severe low back pain radiating to the right lower limb. He was an obese man with a previous acute back pain episode few months ago. He had previously experienced back pain after hard work or exercise for several years. The findings of a physical examination were unremarkable, except for mild tenderness at the right lumbar paravertebral area and right lower limb numbness over dorsum aspect of the right foot. Motor power at the level of the extensor hallucis longus was 5/5, triceps surae was 5/5, right flexor hallucis longus was 5/5, and tibialis anterior was 5/5. No pathological reflexes were noted. The straight leg raising test was positive on the right. Initially, plain radiographs followed by a spine MRI were ordered which showed the absence of the right L5-S1 zygapophyseal joint (). MRI confirmed the absence of the unilateral L5 lumbar inferior articular process. However, the contralateral joint was normal and did not show any pathological changes. There was a disc herniation seen at the L5-S1 level. On spine CT scan () along with 3D reconstruction (), a better view of the affected area was seen, showing a detailed visual of the bony anomaly. After thorough clinical examination and relevant imaging, the patient was managed conservatively with IV medications and discharged home on supportive treatment with anti-inflammatory modalities. He was scheduled for a follow-up appointment for his symptoms.
pmc-6390298-1
A 38-year-old male presented to our emergency room with a 4-day history of intermittent fever and chills without nausea or vomiting. The patient had a past history of intravenous heroin abuse and atrioventricular reentry tachycardia status post radiofrequency catheter ablation. Shortness of breath, cough with some yellowish sputum, tachycardia, low blood pressure (80/40 mmHg under Levophed use), and anuria were noted. The patient had not experienced nausea or vomiting. Physical examination revealed bilateral coarse breath sounds and a 4/6 pan systolic heart murmur over the left fourth rib. Laboratory analysis revealed a white blood cell count of 35,030 μL (range: 3500–9100 μL; neutrophilia, 73.4%) and a creatinine level of 3.19 mg/dL (range: 0.70–1.30 mg/dL). Chest X-ray revealed interstitial infiltration with mottled consolidation superimposed on bilateral lung fields and blunting of the left costophrenic angle. Chest computerized tomography (CT) showed loculated pleural effusion, consolidations with central lucency collection in both lungs, and mild pericardial effusion (Fig. ). Echocardiography revealed normal left ventricle wall motion (left ventricular ejection fraction, 58%) and a floating vegetation in the tricuspid valve with moderate to severe tricuspid regurgitation. Because left empyema and tricuspid valve IE with septic or cardiogenic shock were suspected, left chest tube were inserted and left pleura effusion culture showed methicillin-susceptible S. aureus. Right heart failure secondary to severe TR and poor response to medical therapy were noted 1 day after chest tube insertion. An endotracheal tube was insert ion and the patient underwent tricuspid valve replacement with a 33 mm Hancock II tissue valve via median sternotomy with another left chest tube insertion due to all of the anterior chordae tendineae were rupture. The pre-operative transesophageal echocardiography (TEE) showed 0.9 × 1.2 cm2 vegetation over tricuspid valve. (Fig. ). Blood and sputum cultures showed methicillin-susceptible S. aureus. The patient received postoperative antibiotic treatment (oxacillin, 2000 mg six times daily). The early postoperative treatment course was uneventful, with white blood cell count decreased to 14,300 μL and creatinine level decreased to 1.08 mg/dL. However, fever up to 38.4 °C and dyspnea were noted on postoperative day 14. Follow up chest X-ray revealed loculated bilateral pleural effusions with perihilar and lower lung haziness infiltrates (Fig. ). Chest CT revealed multiple cavitary nodules in the bilateral lungs (Fig. ). The patient underwent thoracoscopic decortication of the right pleura and incision of the right lower lung abscess with postoperative chest tube drainage. Intraoperative pleural fluid and lung abscess cultures showed carbapenem-susceptible A. baumannii complex and C. albicans. We replaced oxacillin with meropenem 500 mg four times daily and fluconazole 200 mg one time daily. No further fever was noted. After 4 weeks of antibiotic treatment, chest X-ray revealed bilateral clear lung markings with only mild blunting of the right costophrenic angle.
pmc-6390321-1
A 66-year-old woman presented at a hospital with chest pain. Her history included diabetes, hypertension, and hyperlipidemia. On examination, the patient had a pulse of 100 beats/minute and blood pressure of 150/80 mmHg. Her electrocardiogram, echocardiogram, and blood test results were normal. Multislice computed tomography (CT) showed a saccular LMCA aneurysm and significant stenosis in the LAD artery (Fig. ). Coronary angiography revealed a saccular LMCA aneurysm measuring 9.8 × 7.5 mm with 75% stenosis in the proximal portion of the LAD artery. The operation was performed under general anesthesia. A median sternotomy was performed, and after a longitudinal pericardial opening was made, the heart was inspected. The LITA was removed from the inner chest wall in a skeletonized fashion using electric cautery. A distal segment of 1.5–2 cm was procured and reserved for use as a patch repair. Before aortic cannulation, the ascending aorta was dissected from the pulmonary artery. Under cardiopulmonary bypass, coronary artery bypasses of the left internal thoracic artery to the LAD artery were constructed in the beating heart. After aortic cross-clamping, the LMCA saccular aneurysm was exposed without main pulmonary artery transection. The saccular LMCA aneurysm was carefully dissected and completely excised. There was no thrombus in the lumen. Then, the LITA was longitudinally divided and trimmed to fit the incised LMCA. The small internal thoracic artery patch was sutured to the normal and firm lateral coronary arterial wall with a continuous 7–0 Polypropylene suture. Resection of the saccular aneurysm and closure using a small internal thoracic artery patch was then complete. The aortic cross-clamp time was 120 min, and the CPB time was 147 min. The patient had an uneventful hospitalization and was discharged on aspirin therapy. Follow-up multislice CT 10 days after the operation revealed the complete disappearance of the aneurysm and a successful repair with no luminal stenosis by the internal thoracic artery patch. The LITA graft was also found to be patent (Fig. ). The patient has been followed up yearly since 2009. Fortunately, at the 9-year follow-up, the patient was still asymptomatic, and there were no changes in the ECG and UCG. The patient included in the follow-up had preserved preoperative left ventricular function, and there was no coronary incompetence. Pathology of the aneurysm revealed that the aneurysm wall was very thin due to a lack of trilaminar arterial structure from the remarkable atherosclerotic changes (Fig. ).
pmc-6390337-1
A 62-year-old female with no illnesses in the past and who ran marathons in her 30s started experiencing difficulty in breathing during exercise since her 60s. Previous electrocardiograms obtained in her 40s showed some abnormalities, which were unknown to us. On admission to our hospital, an electrocardiogram obtained during the treadmill test revealed a complete left bundle branch block. Echocardiography showed an enlarged RCA (10 mm) and a vessel with blood flow into the pulmonary artery (PA). Left ventricular ejection fraction was 60% and mild mitral regurgitation was noted. Coronary computed tomography (CT) revealed that the LCA arose from the dorsal side of the PA and that both the coronary arteries were markedly dilated and tortuous. On performing cardiac catheterization, the contrast medium was observed to flow from the RCA into the PA via the LCA; the pulmonary/systemic blood flow ratio was 1.4 and pulmonary artery pressure (systolic/diastolic/mean) was 39/19/28 mmHg. Adenosine-loading myocardial scintigraphy revealed ischemia in the left anterior descending branch. Subsequently, surgery was performed using median sternotomy. A cardiopulmonary bypass was established from the superior and inferior vena cava to the ascending aorta. The patient was then cooled to 32 °C. The PA was longitudinally incised, following which the ostium of the LCA was located. Cardiac arrest was induced using an antegrade injection of the cardioplegic solution from the ascending aorta. Following injection, the surgeon occluded the retrograde flow in the LCA with his index finger to prevent leakage of cardioplegic solution from the RCA. A 6-mm Gelsoft™ Plus (Terumo, Tokyo, Japan) was anastomosed end-to-end using a 5–0 Polypropylene suture at the ostium of the LCA in the PA. A small hole was then made in the PA by incising the aortic side. Subsequently, the anastomosed vascular prosthesis was then passed through the hole in the PA wall. The PA wall and protruding part of the vascular prosthesis were sutured using a 5–0 Polypropylene suture. Thereafter, the vascular prosthesis was anastomosed end-to-side to the ascending aorta using a 4–0 Polypropylene suture. After de-clamping of the ascending aorta, the PA incision was closed [Figs. and ]. The surgery was terminated after assessing the cardiac function as good. Postoperative hemodynamics, including blood pressure and cardiac output were stable and no ischemic change was observed. After resuming meals postoperatively, the patient was administered oral aspirin (100 mg) and warfarin (till the prothrombin time-international normalized ratio became around 1.5). Postoperative echocardiography showed no inflow from the coronary artery into the PA, and no jet suggestive of supravalvular pulmonary artery stenosis due to the implanted vascular prosthesis was observed. Coronary CT confirmed the patency of the vascular prosthesis. Subsequently, the patient was transferred to another hospital for rehabilitation on the 10th postoperative day. Coronary CT obtained after 2 postoperative years showed a patent graft that was anastomosed to the coronary artery [Fig. ]; moreover, no stenosis of the PA was observed at echocardiography [Fig. ]. The patient did not admit symptoms and did not need any re-intervention for 2 years.
pmc-6390365-1
In January 2018, a 70-year-old man residing in South Korea was admitted to Chosun University Hospital with reported consistent low back pain. At first, he had been admitted to a local hospital on 24 November 2017, a month before visiting Chosun University Hospital with a history of 5 days of chills and fever. In the local hospital, in view of the possibility of acute pyelonephritis, he was first treated with intravenous ceftriaxone at a dosage of 2 g daily. Two days after admission, back pain started. During antibiotic treatment, blood cultures taken on admission yielded Salmonella enterica. He remained on ceftriaxone (2 g daily) for 18 days including initial treatment to cover S. enterica. Upon follow-up blood culture, no bacteria were detected on the 8th and 25th days after starting treatment, and the patient no longer had fever; he was subsequently discharged from the local hospital on 19 December 2017. However, he consistently suffered from lower back pain, nausea, and vomiting; he was re-admitted to the same local hospital 9 days after his discharge. When he was re-admitted to the local hospital again on 30 December 2017, magnetic resonance imaging (MRI) was performed and L1 spondylitis was demonstrated. MRI revealed whole bone marrow oedema with endplate lytic changes in the L1 body and focal marrow oedema in the upper endplate of L2 bodies. Additionally, mild destruction of intervertebral disc at L1–2 was shown. These findings were considered to be indicative of pyogenic spondylitis (Fig. a, b, c). He was empirically treated with cefazolin (1 g, 3 times a day) for 10 days to cover the possibility of Staphylococcus aureus infection, which is a common cause of pyogenic spondylitis. Then, blood cultures were tested and yielded S. enterica again. Finally, he was transferred to Chosun University Hospital, and bone biopsy of L spine was performed on 3 January 2018. He had no fever, and the initial blood test was generally unremarkable except that his erythrocyte sedimentation rate (ESR) level was 108 mm/h. After 7 days, the biopsy results of bone and blood cultures were positive for Salmonella enterica. Cultures of bone and blood obtained during biopsy at the Chosun University Hospital grew O:2-positive Salmonella. The organism was serotyped to be serovar Paratyphi A ([1],2,12:a:-) by the tube agglutination method combining Salmonella O and H (flagella) antigens according to the Antigenic Formulae of the Salmonella serovars. After the bacteria were identified, with suspicions of metastatic spondylitis, he was treated with ciprofloxacin for 13 days. Computed tomography (CT) was performed for further evaluation. CT scans revealed L1–2 spondylitis spreading to the left psoas muscle. Fluorodeoxyglucose positron emission tomography (FDG PET) was performed to detect clinically undetected diseases in different sites, and it showed hypermetabolism and bone destruction in L1 and L2 vertebral bodies, as well as mild hypermetabolism in the right facet joint between L4 and L5 vertebral bodies. The antimicrobial susceptibility test using MIC plate by the Chosun University Hospital and Health and Environment Research Institute of Gwangju City found that the identified organism was resistant to ciprofloxacin and nalidixic acid (Table ). Since susceptibility tests for macrolides could not be carried out due to unavailability of the disc, the specimen was sent for testing to Korea Centers for Disease Control and Prevention. While waiting for results, the antibiotic used in the treatment of the patient was changed from ciprofloxacin to azithromycin due to the identified resistance to ciprofloxacin and nalidixic acid. While he was treated with azithromycin for 15 days, C-reactive ptrotein (CRP) gradually decreased to the normal value of 0.09 mg/dL; ESR level decreased as well, but not to normal levels (CRP: 0.09 mg/dL, ESR: 44 mm/h on the 20th day of admission). He was discharged and followed up through an outpatient clinic. Seven days later, the Salmonella Paratyphi A isolates were found to have an MIC > 16 mg/L for azithromycin. As he had resistance to both azithromycin and nalidixic acid, the treatment was switched to a combination of ciprofloxacin and cefotaxime. While he was treated with combination therapy for 2 months, his clinical symptoms such as back pain reduced, and the ESR level gradually decreased to normal (ESR: 20 mm/h on the 64th day of combination therapy). We carried out NGS to determine the cause of failure of the initial treatment for Salmonella Paratyphi A infection and elucidate the mechanism underlying antimicrobial resistance in Salmonella Paratyphi A. Purified genomic DNA was randomly sheared to yield DNA fragments approximately 350 bp in size using a Covaris S2 Ultrasonicator. Library preparation was performed using the Illumina TruSeq DNA PCR-free Preparation Kit following the manufacturer’s instructions. Adaptor enrichments were performed using PCR according to the manufacturer’s instructions. The final library size and quality were evaluated electrophoretically with an Agilent High Sensitivity DNA Kit. The 100-bp paired-end reads were sequenced on the Illumina HiSeq 2500 platform. Further image analysis and base calling were performed with RTA 2.7.3 (Real Time Analysis) and bcl2fastq v2.17.1.14. The draft genome was assembled using A5 pipeline ver. 20,160,825 with paired-end reads. For annotation of the prokaryotic genome, Prokka v1.1.0 was used. The gene models were predicted through the open reading frame (ORF) finding method using prodigal v2.6.2. Then, tRNA, rRNA, and repetitive sequences were identified using Aragon v1.2.36, barrnap v0.6, and minced v0.2.0, respectively. For functional annotation, genes were searched against the UniProt and NCBI RefSeq databases using BLASTP v2.2.29+ with an E-cutoff value of 1 × 10− 6. Protein domains were also searched against Pfam using HMMER 3.1b1. Resistance genes were identified using Resistance Gene Identifier (RGI) in the Comprehensive Antibiotic Resistance Database (CARD, ) using predicted peptide sequences. All sequences were run through all databases in CARD with a selected threshold of ID = 98.00%. The clinical isolates were identified with a VITEK II automated system (bioMérieux, Marcy-l’Etoile, France). Tests for antimicrobial susceptibility including MIC were performed with the VITEK II system. In Chosun University Hospital, we cultured the blood collected on 30 December 2017 in the local hospital and conducted antimicrobial susceptibility tests using Clinical and Laboratory Standards Institute (CLSI) guideline (Table ). The antimicrobial susceptibility test performed by the Health and Environment Research Institute of Gwangju City showed that the identified organism from the closed pus taken from bone biopsy when the patient was admitted to Chosun University Hospital on 3 January 2018 exhibited resistance to ciprofloxacin (MIC = 1 mg/L) and nalidixic acid (MIC> 128 mg/L) (Table ). The antibiotic resistance test results for the blood samples obtained on December 30, 2017 and the biopsy samples obtained on January 3, 2018 were the same. The isolate also presented resistance to macrolides (MIC> 16 mg/L) in a test performed by the Korea Centers for Disease Control and Prevention. We carried out NGS to determine the cause of failure of the initial treatment for Salmonella Paratyphi A infection and elucidate the mechanism underlying antimicrobial resistance in Salmonella Paratyphi A. The isolate used for NGS was taken in the local hospital when he was readmitted in 30 December 2017. Next-generation sequencing results for Salmonella Paratyphi A with a selected threshold of ID = 98.00% showed that there are antimicrobial resistance gene families present in the isolate, including resistance-nodulation-cell division (RND) antibiotics efflux pumps such as mdsC, CRP, and sdiA; gyrA associated with fluoroquinolone resistance such as Salmonella enterica gyrA; and MATE transporters such as MdtK and AAC (6′)-ly (Table ). Based on the results, the most likely cause of treatment failure was a RND antibiotic efflux pump. Meanwhile azithromycin resistance genes such as mph and mef were not identified (Table ). There were also no resistance genes related to ceftriaxone, such as CTX-M, CMY-2, or other extended-spectrum beta-lactamases.
pmc-6390378-1
A 59-year-old European man crashed his car into a concrete dam (Fig. ). Bystanders attending to the accident found him in cardiac arrest and started cardiopulmonary resuscitation (CPR) immediately. Sufficient CPR efforts were continued until the emergency services had arrived. The first recorded heart rhythm was ventricular fibrillation (VF). On inspection, no signs of injury were immediately visible and no skid marks were found. CPR was continued by physician-staffed emergency medical services (EMS) according to the current advanced life support (ALS) guidelines []. Return of spontaneous circulation (ROSC) was achieved after 30 minutes. He remained unconscious without any sign of muscular activity. He was intubated, mechanically ventilated, and treated with catecholamines during and post CPR. Although the car was severely damaged, the prehospital physician deemed a traumatic cause for out-of-hospital cardiac arrest (OHCA) unlikely. Based on findings indicative of myocardial ischemia in a post-ROSC electrocardiogram (ECG), acute coronary syndrome was suspected as the etiology of cardiac arrest. After telephone consultation with the trauma leader of the regional trauma center, the patient was transported to the trauma center with percutaneous coronary intervention (PCI)-capability primarily within 120 minutes of the accident. On arrival at the trauma center, the patient appeared clinically stable. His heart rate was 65 per minute, systolic blood pressure was 150 mmHg, oxygen saturation measured by pulse oximetry was 94%, and body temperature was 34.2 °C. Signs of myocardial ischemia were found in the ECG (Fig. ). His pupils were found to be equal, round, and reactive to light. After primary evaluation in the emergency room a whole-body CT scan revealed findings listed in Table . An MRI scan (Fig. ) of his head and neck was obtained immediately due to the severity of the CT findings. Additional findings in the MRI scan are summarized in Table . The medical and social history of our patient were provided by his family. Subjective overall health assessment found the married man, who was a father and grandfather, to be in good health. He had suffered a fall leading to a fractured scapula 8 years before this accident, which was treated non-operatively. Two years ago, he was assessed for suspected coronary heart disease by a specialist in cardiology, who could not substantiate this suspicion. He was transferred to the intensive care unit (ICU) for further treatment. Halo fixation was installed because only ligamentous structures were disrupted in this case. This procedure is common and adequate in AOD when no cervical spine fractures are present []. Due to several episodes of severe bradycardia, transient transvenous pacing was conducted. Cardiac diagnostics showed an ischemic cardiomyopathy with recurrent episodes of ventricular tachycardia. Assessment via echocardiography was performed in the trauma room, 3 weeks and 2 months after the accident and revealed akinesia of the left anterior descending coronary artery (LAD) region and hypokinesia of the inferior wall after a suspected myocardial infarction and VF. Early coronary angiography could not be performed due to severe brain injuries. Although he was initially assessed to have a poor neurological prognosis from the perspective of the neurologists and neurosurgeons because of his severe brain injuries, he could be discharged from the ICU after 23 days; he was responding to verbal contact and was able to move all his extremities. After 23 days of treatment at the trauma center he was transferred to a hospital close to his home. Further in-patient treatment was continued by local protocol for further 33 days (timeline in Table ). He was discharged to a neurological rehabilitation facility, where care and rehabilitation efforts were continued with great success. Three months after the incident the tracheostomy was surgically closed. Coronary angiography was performed 4 months after the primary event and revealed no coronary artery disease. Subsequently, he had to wear a life vest due to arrhythmia. He was defibrillated once by the LifeVest® 3 months after the trauma during his stay at the neurological rehabilitation facility. Finally, 6 months after wearing the life vest an implantable cardioverter-defibrillator (ICD) was installed. Six months after the trauma, he was fully conscious, spontaneously breathing, independent of help in everyday life, and mobile with walking crutches. However, he was unable to swallow granular feed due incomplete bilateral paresis of the hypoglossal nerve. His neurologic status is continuously improving; treating neurologists attested a high potential of restitution.
pmc-6390523-1
A 73-year-old Caucasian male presented to our acute care tertiary hospital with a several day history of rash that initially started on the scalp and was felt to be due to sunburn from outdoor exposure, but subsequently spread over the torso and arms with associated blistering. He also began to develop increasing fatigue and malaise, which prompted him to seek medical attention. His past medical history was significant only for hypertension and osteoarthritis. He denied any medications but did acknowledge alcohol substance use disorder. Remainder of review of systems was otherwise unremarkable. On admission, he was febrile at 38.9 °C, heart rate was 110 beats/min, blood pressure was 105/82 and respiratory rate was 18 breaths/min. Physical examination was significant for skin findings including multiple flaccid bullae on an erythematous base with serosanguinous fluid diffusely over the torso, back and arms. A thick confluent plaque over the scalp was also noted. Palpable purpura at the lower extremities was present with petechiae to the fingers and toes. There was no mucosal involvement. The remainder of physical examination including precordium, respiratory and abdomen were within normal limits. Initial laboratory investigations revealed pancytopenia (hemoglobin: 105 g/L; platelets: 53 × 109/L, white blood cell: 3.3 × 109/L,), CRP of 19.1 mg/L (0–8 mg/L) and ESR of 28 mm (0–10 mm). Haptoglobin was low at 0.09 g/L (0.3–2.0 g/L), suggesting an element of hemolysis. Albumin was low at 23 g/L (33–48 g/L) lactate dehydrogenase was increased at 349 U/L (100–235 U/L), as well as alanine aminotransferase at 141 U/L (1–40 U/L) and gamma glutamyl-transferase at 201 U/L (11–63 U/L). Ferritin was profoundly elevated at > 8000 μg/L (13–150 μg/L). Fibrinogen and D-dimer were within normal limits. Triglycerides were mildly elevated at 2.04 mmol/L (0.0–1.70 mmol/L). An initial immunological work-up showed an ANA titre of 1:80 with a homogenous and speckled pattern. ENA revealed positive Smith and RNP antibody. C3 and C4 were both depressed at 0.32 g/L (0.6–1.6 g/L) and 0.04 g/L (0.1–0.4 g/L), respectively. Of note, atypical ANCA was observed on indirect immunofluorescence but MPO and PR3 ANCA by ELISA were negative. Soluble IL-2R by ALBIA (addressable laser bead immunoassay methodology) was high. Abdominal ultrasound demonstrated heavy hepatic steatosis but no evidence of hepatosplenomegaly. Chest X-ray and echocardiogram were within normal parameters. Due to the new onset of pancytopenia, a bone marrow biopsy was performed revealing a hypercellular marrow with granulocyte hyperplasia and the presence of hemophagocytosis; suggestive of HLH (Fig. ). Skin biopsies from the torso showed full-thickness epidermal necrosis with subepidermal blister formation and absence of hemophagocytosis. A second skin biopsy done from the purpuric right fifth toe showed ulceration with focal epidermal and fat necrosis and dermal hemorrhage suggestive of ischemic changes. He also began to clinically deteriorate with refractory hypotension and tachycardia. At this time, he was suspected to have new onset acute cutaneous SLE presenting with bullous lesions with secondary HLH. Therefore, he was treated with methylprednisolone 1000 mg IV daily for a three-day pulse course and then was switched to prednisone 60 mg daily. He was also started on hydroxychloroquine 400 mg daily. At time of discharge, his blood counts had slightly improved and fevers had dissipated with hemodynamic stability. One month after discharge, he was seen in the outpatient rheumatology clinic with resolution of the skin rash and improving blood counts (hemoglobin 112 g/L, platelets and white blood cell count normal) and ferritin of 1065 μg/L.
pmc-6390527-1
A 28-year-old woman was admitted for the surgical treatment of a mediastinal tumor that was detected on a chest roentgenogram. Chest computed tomography (CT) showed that her mediastinal tumor was in the right thoracic outlet and adjacent to the right subclavian vein and right brachiocephalic artery (Fig. a, b). A definitive preoperative diagnosis was unavailable. The tumor was suspected to be a benign neurinoma with a possibility of malignancy. The operation was started with VATS, in preparation for TMA. The patient was placed in the left semi-lateral decubitus position. Three access ports were placed at the 5th intercostal space on the middle axillary line, the 3rd intercostal space on the middle axillary line, and the 5th intercostal space on the anterior axillary line. Dissection of the caudal side could be performed with VATS (Fig. c); however, safe dissection of the cranial side was difficult and risky because of the low mobility of the tumor, poor visualization, difficulty in handling surgical devices and tumor location (adjacent to right subclavian vein and right brachiocephalic artery). Therefore, TMA was sequentially performed. Because TMA allows good visualization of the cervical vessels and nerves, the cranial side was safely dissected, and the tumor was completely resected (Fig. d). The intraoperative diagnosis was a benign tumor compatible with a neurogenic tumor. Postoperatively, Horner syndrome was detected transiently and resolved naturally. The patient was discharged 6 days postoperatively. The final diagnosis was schwannoma, and the tumor was completely resected. Three months after the operation, she was free of Horner syndrome and any functional restriction of the right upper extremity.
pmc-6390527-2
A 37-year-old man was admitted for the surgical treatment of a mediastinal tumor that was detected on a chest roentgenogram. CT showed that his mediastinal tumor was in the left thoracic outlet and adjacent to the left common carotid and left subclavian arteries (Fig. ). A definitive preoperative diagnosis was unavailable. The operation was started with VATS, in preparation for TMA. The patient was placed in the right semi-lateral decubitus position. Three access ports were placed at the 5th intercostal space on the anterior axillary line, the 3rd intercostal space on the midclavicular line, and the 3rd intercostal space on the anterior axillary line. Dissection of the caudal side was performed with VATS; however, the cranial side was judged to be difficult and risky to dissect owing to tumor location, poor visualization and difficulty in handling surgical devices. Therefore, TMA was sequentially performed, and the tumor was completely and safely resected. The intraoperative diagnosis was schwannoma. The patient was discharged 1 week after the operation. The final diagnosis was also schwannoma, and the tumor was completely resected. Horner syndrome appeared transiently, but he was well without Horner syndrome 1 year postoperatively. He had no functional restriction of the left upper extremity.
pmc-6390538-1
A 25- year-old Sri- Lankan female presented with progressively worsening shortness of breath, orthopnoea and dry cough for three days. Her symptoms were not associated with chest pain, fever, oedema or wheezing. At the onset she noted shortness of breath on mild exertion which progressed to shortness of breath even at rest by third day. The patient reported a good urine output throughout. She was asymptomatic prior to the onset of this illness excepting a mild iron deficiency anaemia for which she was on oral iron treatment and dysmenorrhoea attributed to an ovarian cyst. The patient had undergone an appendicectomy eight months prior to the presentation for appendicitis associated with round worm infestation. Examination revealed dyspnoea at rest, elevated jugular venous pulse, tachycardia with a heart rate of 120/min, blood pressure of 100/70 mmHg on both arms. There was an early diastolic murmur over left sternal edge associated with a thrill and bilateral lower lung field crackles. Rest of the examination was normal. Her estimated body surface area was 1.24m2 with a body weight of 40 kg and height of 140 cm. Investigations revealed white cell count of 7.1 × 109/l (4–11 × 109/l), platelet count of 435 × 109/l (150–400 × 109/l),haemoglobin of 10.9 g/dl (11.5–15.5 g/dl) with mean corpuscular volume of 78 fl (80-96 fl). C- reactive protein was 18 mg/l (< 6 mg/l) and Erythrocyte sedimentation rate (ESR) was 114 mm/1st hour (< 20 mm/1st hour). Renal and liver functions, urinalysis, blood sugar and coagulation profile were in normal range. Electrocardiogram revealed sinus tachycardia with no ischaemic changes. Troponin I was negative. Chest radiograph had findings consistent with pulmonary oedema. Repeated blood cultures were negative. Transthoracic echocardiogram demonstrated ejection fraction > 60%, severe aortic regurgitation with dilated aortic root when adjusted for her body surface area(annulus 21 mm, sinus 34 mm). Aortic valve leaflets were morphologically normal. There was no left ventricular hypertrophy, regional wall motion abnormalities or vegetations. Other cardiac valves were normal. All four cardiac chambers were of normal size. Transoesophageal echocardiogram confirmed the absence of vegetations. She was started on supportive management for acute pulmonary oedema and treatment was initiated as for infective endocarditis empirically. Though she was referred to cardiac surgery team urgent surgical interventions were not performed since she improved with medical management. After completion of four weeks empiric antibiotics her echocardiographic changes and ESR remained unchanged. However, heart failure improved with medical management with complete resolution of orthopnoea and dyspnea being limited to moderate exertion. Intravenous antibiotics were omitted in the absence of convincing evidence of endocarditis. Further evaluation was performed in view of persistently high ESR and aortic regurgitation with no definitive cause. Chronic infections such as tuberculosis, vasculitic conditions such as Takayasu arteritis were considered. Further questioning did not reveal constitutional symptoms, contact with tuberculosis, arm claudication, headache or any neurological symptoms. Examination did not reveal any lymphadenopathy, hepatosplenomegaly, cutaneous or joint involvement, fundoscopic abnormalities, pulse deficit or vascular bruits. Rheumatoid factor, serum cryoglobulins, anti nuclear antibodies and complement levels were normal. Peripheral blood smear revealed rouleaux formation with evidence of mild iron deficiency anaemia. Serum protein electrophoresis and serum Lactate dehydrogenase were normal. Human Immunodeficiency Virus antibodies and Serology for syphilis were negative. Mantoux test and induced sputum for acid fast bacilli were negative. Ultrasound abdomen, Contrast enhanced Computed tomography (CT) of the chest, abdomen and pelvis as well as CT aortogram with arch vessels were normal except mild aortic root dilatation. Bone marrow biopsy revealed reactive marrow with no other abnormalities while bone marrow culture for bacteria, fungi, mycobacteria, brucella and leishmania were negative. Colonoscopy and biopsy did not reveal any abnormality. The patient was followed up for one year with detailed clinical assessment and continuation of medical management of heart failure. She did not develop any new symptoms and her exertional dyspnoea remained static. Her ESR remained above 100 mm/1st hour. Clinical examination about one year after initial presentation revealed a reduced pulse volume of left upper limb with a blood pressure difference (right- 100/70 mmHg, left- 70/40 mmHg). There was a left subclavian bruit as well. But, patient did not have any constitutional symptoms or any symptoms of left upper limb ischaemia. Digital subtraction angiography at that point revealed significant stenosis at first part of left subclavian artery and at the origin of left vertebral artery (Fig. ). Based on the new findings she was diagnosed to have Takayasu arteritis and was started on prednisolone 1 mg/kg body weight daily with plan for follow up at cardiology and rheumatology units. Six weeks after initiation of glucocorticoids patient remained clinically well and ESR decreased to 25 mm/1st hour. Glucocorticoid dose was slowly tapered. Decision on aortic valve replacement was decided to be made few months later after resolution of active inflammation and repeat cardiac assessment. Ravascularisation for arterial stenosis was not offered in the absence of symptoms of upper limb or cerebral ischaemia. Sequence of events from her presentation to the diagnosis is given in a timeline in Table .
pmc-6390555-1
A forty-nine-year-old female from a suburban community in Sri Lanka presented with insidious high grade intermittent fever with chills and rigors for 2 months. She experienced one to two febrile episodes daily with complete defervescence in between. She also had anorexia, weight loss, sore-throat and symmetrical large joint arthritis without morning stiffness. Small joints and axial skeleton were spared. She also noticed an itchy desquamating erythematous rash over back of the trunk and proximal limbs. Erythematous patches were transient and recurring but did not temporally correspond to febrile peaks. The patient did not have any symptoms referable to a focus of infection and did not report photosensitivity, Raynaud phenomenon, past history of tuberculosis, or high risk sexual behaviours. The patient was averagely built (BMI: 23.1 kg/m2), febrile (39.9 °C), ill and pale. A firm 1.5 cm lymph node in the right posterior cervical group was noted. Throat was non-inflamed. Erythematous macules noted over the trunk and proximal limbs were transient. Symmetric arthritis affected elbow, wrist and knee joints. A smooth non-tender 2 cm hepatomegaly was noted. The rest of the examination was unremarkable. Investigations revealed a normocytic normochromic anaemia, neutrophil leukocytosis with toxic changes, reactive thrombocytosis, elevated ESR (110 mm 1st hour), CRP (165 U/L) and ferritin (3200 U/L). Renal function was normal and liver enzymes were mildly elevated (AST 66 U/L, ALT 57 U/L). Auto antibody panel, including rheumatoid factor, antinuclear antibodies (ANA), dsDNA antibodies, pANCA and cANCA were negative. Contrast enhanced computerized tomography of the neck, chest, abdomen and pelvis demonstrated enlarged cervical lymph nodes and fatty liver. Radiographs of large joints were normal. Biopsy of the lymph node showed reactive lymphoid hyperplasia with no evidence of neoplastic changes, suppuration or granuloma. Bone marrow aspiration and trephine showed no abnormalities. Blood and bone marrow cultures for bacteria, tuberculosis, brucellosis, melioidosis and fungi were negative. Serum protein electrophoresis showed polyclonal gamma-globulinaemia and reduced albumin fraction. As she had been exposed to flood water 2 weeks prior to symptom onset (compatible with incubation period of 1–3 weeks) and several cases of melioidosis had been reported in her residential area, antibodies against Burkholderia pseudomallei were tested. It turned positive (1:640, indirect haemagglutination) and titre continued to rise over time (Fig. ). Febrile illness, possible exposure to infectious agents during floods and elevated inflammatory markers necessitated consideration of empiric antibiotic therapy. The patient was treated with ceftazidime (2 g 6 hourly IV) and imipenem (1 g 8 hourly IV) for 14 days and ceftazidime and cotrimoxazole (1440 mg bid orally) for another 14 days, due to positive serology for melioidosis. However she did not show clinical improvement. Fever persisted and inflammatory markers remained elevated. Serum ferritin and melioidosis antibody titre continued to rise exponentially. However repeated peripheral blood cultures for melioidosis did not isolate any bacteria and repeated imaging did not reveal a focus of infection. Despite a month of broad spectrum antibiotics she remained febrile with persistently elevated inflammatory markers. In retrospect, AOSD was considered as a possible diagnosis. She showed partial response to NSAIDs, further favouring this diagnosis. Subsequently, she was commenced on high dose steroids (prednisolone 1 mg/kg/day). Within 2 days she achieved complete defervescence and made a good clinical recovery. Serum ferritin level and melioidosis antibody titre declined over time (Fig. ). After one month of steroid therapy she remained afebrile, but had mild residual large joint arthritis with minimal functional impairment. Methotrexate was commenced and steroids were tapered over next 2 months and at 6 months she remained asymptomatic on methotrexate with normal inflammatory markers. Long term follow up was arranged. The final diagnosis of AOSD was made based on clinical features and exclusion of other connective tissue disorders, neoplasms and infections. During the course of her illness the patient did not develop Macrophage Activation Syndrome, a serious complication of AOSD.
pmc-6390564-1
A 54-year-old Caucasian man with known HIV infection for approximately 30 years had been treated with lamivudine, stavudine and indinavir since 1997. Under this therapy he was stable with an undetectable viral load. He also had dyslipidaemia which was treated with simvastatin 40 mg for many years. He presented to his primary care physician (PCP) with a 10-day history of asthenia, myalgia and jaundice. The initial laboratory revealed elevated liver enzymes (Alanine aminotransferase (ALAT) and Aspartate aminotransferase (ASAT) > 1000 U/l) and preserved kidney function (serum creatinine level of 79 μmol/l and estimated glomerular filtration rate (eGFR) of 90 ml/min/1.73 m2). He was diagnosed with acute hepatitis A and active hepatitis C genotype 1a, which was a new diagnosis. A second visit to his PCP 6 days later showed improvement of the liver enzymes. As stavudine had been withdrawn from the Swiss market, his HIV therapy was switched to Genvoya® at that time. The patient had declined referral to an HIV-specialist for confidentiality reasons. Ten days after this medication switch, the patient presented to the emergency department (ED) with worsening myalgia and asthenia and could barely walk. He reported a reduced urine output during the prior days. There was no history of trauma, prolonged immobilization, convulsions or consumption of alcohol or illicit substances. On evaluation in the ED, the patient was slightly hypertensive at 144/84 mmHg. He presented with mucocutaneous jaundice. The cardiopulmonary status was unremarkable and the patient had no edema of the extremities. Abdominal examination revealed hepatomegaly 2 cm below the costal margin. Muscle strength was severely diminished, mostly in the axial muscles. Initial laboratory evaluation on admission revealed elevated creatinine kinase (CK): 185190 U/I, creatinine: 553 μmol/l, phosphate: 3.03 mmol/l, potassium: 7.2 mmol/l, ASAT: 7017 U/I, ALAT: 2881 U/I, gamma-glutamyl transferase (GGT) 198 U/I, and total bilirubin: 130 μmol/l (for more details, refer to Table ). Arterial blood gas showed a primary metabolic acidosis with a positive anion gap of 19 and appropriate respiratory compensation (Table ). HIV-viral load was low (< 80 copies/ml) with a CD4 count > 550 cells/μl. Thyroid stimulating hormone titre was normal. Abdominal ultrasound did not show evidence of urinary or biliary tract obstruction, but it did show a homogeneous hepatosplenomegaly. No urine could be collected because of anuria. A diagnosis of severe rhabdomyolysis-induced AKI was made. The patient was initially treated with intravenous (IV) fluids and medical treatment for life-threatening hyperkalaemia with electrocardiographic changes. Because of refractory hyperkalaemia and metabolic acidosis, he was initiated on haemodialysis in a tertiary care setting. His antiretroviral and lipid lowering therapies were discontinued. Intermittent haemodialysis was continued for over 5 weeks followed by progressive improvement of renal function and diuresis, serum electrolytes, liver enzymes and CK. His viral load remained low. Five months later, his creatinine had normalised to 77 μmol/l and antiretroviral therapy was restarted by an HIV-specialist with emtricitabine, tenofovir alafenamide, etravirine, ritonavir and duranavir. These were well tolerated both clinically and metabolically after several weeks. His lipid panel at the time did not warrant further treatment with a statin and he has yet to be started on treatment for hepatitis C.
pmc-6390573-1
A 78-year old male patient with RA treated with tofacitinib (10 mg p.o. daily), methotrexate (20 mg p.o. weekly) and low dose corticosteroids (prednisolone 5 mg p.o. daily), was admitted to hospital with a 2-week history of arthralgia, nausea and confusion (Additional file ). RA was diagnosed 6 months ago, as the patient fulfilled the 2010 ACR/EULAR classification criteria with bilateral symmetric swollen and tender joints (wrists, hands and feet; over 10 affected joints in total) and arthralgia for 3 years (negative anti-CCP antibody and negative rheumatoid factor IgM). No signs of erosions were found on X-ray (hands and feet). Therapy was initiated with prednisone (20 mg/day) and MTX 15 mg/week s.c. with increasing doses over time. Tofacitinib was initiated 2 months prior hospital admission due to lack of efficacy of MTX monotherapy (MTX was switched to p.o. at that time, as the patient disliked injections). At time of admission the patient reported shortness of breath on exertion but not at rest. Physical examination showed following vital signs: temperature (auricular): 36.5 °C blood pressure: 178/95 mmHg, heart rate: 75 bpm, oxygen saturation: 88–90% at rest and on exercise 80% on room air. Wrists and ankles were swollen and tender bilaterally symmetric. There were normal findings on auscultation of heart and lungs without any other signs of venous congestion. Laboratory findings on admission revealed hypercalcemia (albumin-corrected 3.12 mmol/l (normal range 2.0–2.6 mmol/l) and elevated 1,25- dihydroxyvitamin D levels (162 ng/l, normal range 22–111 ng/l). PTH was appropriately low at < 0.5 pmol/l (normal range < 1.3 pmol/l). Further laboratory findings are described in Table . Further investigation of hypercalcemia included a whole body CT scan, which showed bilateral interstitial pneumonic infiltrates without pleural effusions (Fig. ). The patient was referred from normal ward care to the ICU due to acute respiratory failure requiring non-invasive ventilation/ high-flow oxygen therapy. PCR from bronchoalveloar lavage (BAL) was positive for P. jirovecii and Rhinovirus A/B/C and a diagnosis of PJP was made with colonization of Rhinovirus. Adequate therapy with TMP/SMX i.v. (15 mg/kg/d) and prednisolone p.o. (1 mg/kg/d) was initiated. Treatment with TMP/SMX was stopped after 10 days because of severe hyponatremia (drop from 136 mmol/l to 119 mmol/l; normal range 136–144 mmol/l) and acutely worsening confusion, which was attributed most likely to acute hyponatremia or as a direct adverse drug reaction to TMP/SMX. As second line therapy we initiated clindamycin and primaquine. Confusion improved but thrombocytopenia developed (drop from 441 G/l to 83 G/l) 4 days later, which was felt to be due to primaquine and led to the discontinuation of clindamycin and primaquine. Both the patient’s clinical condition and hypercalcemia were improved after 17 days of antibiotic therapy. PJP- prophylaxis with monthly inhaled pentamidin (300 mg) was initiated.
pmc-6390614-1
The patient was a 14-year-old boy born of nonconsanguineous parentage presenting with muscle weakness from 3 years of age without any family history. He presented congenitally with decreased fetal movements and mild developmental motor delay with toe walking evident. He had normal mental growth. He was observed to have slowly progressive weakness of the proximal muscles of the extremities and the axial muscles of the trunk but was still able to perform activities of daily living without assistance. At the same time, it was difficult for him to climb stairs, jump, run, and rise from the floor, but he had no respiratory dysfunction. He had hyperkeratosis pilaris on the extensor surface of the legs and arms. Six months before admission, he developed recurrent gross hematuria, three bouts in total, with the presence of blood clots in the urine. There was no history of fever, lumbodynia, urinary tract infection, urinary frequency, trauma, edema, arthralgias, or skin rashes during the disease course. On examination, respiratory and cardiovascular examinations were normal. There was follicular hyperkeratosis on the extensor surface. Tests of mental function and cranial nerves function were normal. His face, lip, tongue, and throat muscles were unaffected. His neck muscles were noticeably weak (Medical Research Council (MRC) grade 3/5). The muscle weakness in the limbs was symmetrical (MRC grade 4/5 proximally and 3–4/5 distally) with muscle atrophy of the shoulder girdle and lower legs. His sensations were undamaged, and muscle stretch reflexes were nonexistent. Neither joint contractures nor muscle contractions were apparent apart from contracture of the ankles and pes cavus. Routine blood and stool tests were normal. Routine urine tests disclosed 3823 urinary red cells/μL and 16 red cell casts/μL. Proteinuria was 187.60 mg/day, and blood pressure and glomerular filtration rate were within the normal range. Urine red blood cell phase demonstrated that 80% of the urinary erythrocytes were abnormal. Cystoscopy was performed with no abnormal signs other than some blood clots. Abdominal ultrasonography and contrast-enhanced CT scan demonstrated no abnormal signs. Electrocardiography and echocardiography were normal. Muscle enzymes were mildly elevated (CK: 394 U/L, 2-fold the upper limit of the reference range; CK-MB: 27.14 U/L, slightly higher than the upper limit). Nerve conduction tests of the patient were normal. Needle electromyography of the biceps brachii muscle revealed myopathic features with myotonic discharges and polyspike and polyphasic motor unit potentials (MUP) with early recruitment. The duration of polyphasic MUP was 8.9 ms, and the amplitude was 450.7uV. Muscle biopsy of the left biceps brachii in the patient revealed that the normal muscular structure was disturbed with fibrosis and adipose tissue infiltration. The muscle fibers varied in size. Small fibers appeared rounded in form, and hypertrophic myofibers could also be recognized. The numbers of central nuclei within the myofibers was increased (Fig. a, b & c). Muscle fiber necrosis with phagocytosis and regeneration presented in small groups. Type-I and type-II fibers were affected equally with fiber type grouping (Fig. d & e). Disorganization of myofibril arrangement was noted after NADH staining (Fig. f). Immunostaining with monoclonal antibodies against dystrophin (R, N, and C) revealed a normal staining pattern (not shown). We performed a collagen VI-stain by immunohistochemistry. The collagen-VI fibers were indistinguishable between the patient and the control (Additional file : Figure S1). Unfortunately, a renal biopsy was not performed due to a lack of parental approval. MRI of the thigh muscles revealed slight fat infiltration and bone marrow edema of the left collum femoris. Next-generation sequencing of the whole-exome was performed. The result of sequencing revealed a de novo heterozygous G-to-A nucleotide substitution at position 877 in exon 10 of the COL6A1 gene (Fig. b), leading to an amino acid change of glycine to arginine, which had been previously described as pathogenic [–]. The same mutation was not detected in his parents. (Fig. c & d). After treatment with idebenone 90 mg daily for 10 days, the hematuria healed, but the muscle weakness failed to improve.
pmc-6390777-1
A 68 years old male patient was referred to our sleep center because of 6-year history of falling from bed during sleep and 3-year history of repeated nocturnal episodes of violent and complex behaviors clearly reflecting dream enactment with frequent dream recall (e.g. being chase by dog, jumping over a wall, etc). During the episodes, the patient often screamed, fell from the bed, and would injure his wife. The episodes were reported to recur 2–3 times per month at the time of our evaluation. In addition, the patient reported infrequent episodes of discomfort in the lower limbs during sleep, which often cause awaking in the nocturnal sleep, together with excessive daytime somnolence. Finally, the patient also reported a deficiency in recent memory (the duration was not remembered and it was noticed by the patient’s wife and daughter). The male patient had a history of Behcet’s disease for 20 years and a history of Sjogren’s syndrome for 2 years before the sleep disorder was reported, and the immune diseases were treated by Total glycosides of paeony (TGP), loxoprofen and mycophenolate mofetil. Neurological examination showed a weakness in the left limbs (muscle strength IV grade) and deep tendon hyperreflexia in the left lower limb without extrapyramidal signs. Neuropsychological examination showed a score of 28/30 on the mini-mental state examination (MMSE) and a score of 22/30 on the Montreal cognitive assessment (MoCA), with a score of 18 (> 10) on the Epworth sleepiness scale (ESS). Nocturnal video PSG disclosed a sleep latency of 6 min, REM latency of 139 min, sleep efficiency of 92.8%, and abnormal representation of the different sleep stages, with increased N1% sleep period time (SPT) 35.9%, decreased N2% SPT 49.1%, decreased N3% SPT 0.1% and decreased REM% SPT 14.8%; periodic leg movement during sleep (PLMS) index was 64.5/h; periodic leg movements were less in REM sleep (total 20 times) than in NREM sleep (total 502 times) and did not show a significant correlation with arousals. The arousal index was 18/h and times of arousals were less in REM sleep (total 19 times) than in NREM sleep (total 127 times), with the respiratory associated arousal index 5.7/h, PLM associated arousal index 1.1 and spontaneous arousal index 11.2/h. The sleep respiratory pattern was mild abnormal (apnea/hypopnea index 9.1/h with average oxygen saturation 96%). Finally, during REM sleep an excessive amount of tonic chin electromyogram activations was evident (Fig. ), and complex behaviors were also detected during REM sleep through video. During the next-day MSLT, the patient fell asleep in 4 of the 5 sessions with a mean sleep latency of 12.6 min; no sleep-onset REM episodes were recorded. Thyroid hormones and numerous laboratory blood tests (including iron metabolism) were within the normal limits and a higher titer of ANA (1:80) with positive anti-SSA was detected. Cerebral magnetic resonance imaging (MRI) showed demyelination in right corona radiata, with mild cortical and cerebellar atrophy (Fig. ) and magnetic resonance angiography (MRA, Fig. ) showed a normal cerebral vessel. Arterial ultrasound showed no stenosis nor atherosclerosis plaque in the bilateral carotid and subclavian artery. The patient refused a lumber puncture procedure for the assessment of the orexin-1 level in the cerebrospinal fluid. After a careful consideration of the therapeutic possibilities with the patient and his spouse, an agreement was made concerning therapy and clonazepam was administrated at a start dosage of 1.5 mg at bedtime with pramipexole 0.125 mg/day, which was followed by a beneficial effect on the nocturnal complex motor behaviors and dream-enactment, also had an excellent on discomfort in the lower limbs during sleep and excessive daytime somnolence. Auto set-continuous positive airway pressure (APAP) was also used at the pressure ranging from 5 cm to 20 cm H2O to the mild OSA, with the apnea/hypopnea index 0.6/h after APAP treatment. The clinical history and video-PSG findings satisfied the ICSD-3 (International Classification of Sleep Disorders, 3rd Edition) diagnostic criteria for RBD, mild OSA and severe periodic leg movement disorder (PLMD).
pmc-6390888-1
Presentation A 39-year-old male reported to the Aga Khan Hospital with the complaint of swelling on the left chest wall for the past three weeks. There was no associated pain or lymphadenopathy. A systemic examination was unremarkable. The patient was referred to radiology for imaging. Imaging An ultrasound of the chest wall demonstrated a well-defined hypoechoic solid mass between the intermuscular plane showing internal heterogeneity and significant vascularity (Figure ). On computed tomography (CT) imaging, a well-defined, rounded, soft tissue density lesion between the left pectoralis major and minor muscles was seen (Figures -). The magnetic resonance imaging (MRI) scan exhibited a T1 isointense, T2 hyperintense well-defined lesion within the intermuscular plane intervening between the left-sided pectoralis major and pectoralis minor muscles (Figures -). The mass demonstrated post-contrast enhancement (Figure ). Management The patient was admitted and underwent an excision of the chest wall mass under general anesthesia. Post-procedure, the patient was monitored and eventually discharged once stable. Histopathology A subsequent histopathological analysis showed a well-demarcated lesion composed of fascicles of spindle cells, exhibiting thick vessels, along with an area showing verrucae bodies. Areas of infarction were also seen. On immunohistochemistry, the tumor was S100 positive. These features were suggestive of a benign neural lesion, most probably a schwannoma.
pmc-6390979-1
Our patient was a 33-year-old man with congenitally corrected transposition of the great arteries and ventricular septal defect (VSD). Cardiac MRI showed a dilated right ventricle with an indexed end-diastolic volume of 165 mL/m2 on the left side, and moderate systolic dysfunction, having an ejection fraction (EF) of 36%. In addition, morphologically, left subpulmonary ventricle was observed on the right side with moderate depression (EF of 37%). The VSD was subpulmonary and presented a pulmonary/systemic flow rate (Qp/Qs) of 1.8. Right cardiac catheterization showed severe pulmonary hypertension (mean pulmonary arterial pressure of 92 mm Hg, systolic pulmonary arterial pressure of 109 mm Hg, and diastolic pulmonary arterial pressure of 70 mm Hg). Considering these findings, an implantable cardioverter defibrillator (ICD) was provided as the primary prevention for the sudden death, and treatment with bosentan was started. One year later the patient’s functional condition worsened; the maximal oxygen uptake in the exercise testing was 41% of the theoretical. Bosentan was replaced by sildenafil, but due to poor tolerance to sildenafil, Ambrisentan was prescribed. Five months later, the patient was hospitalized for atrial flutter. During electrophysiological study, atrial fibrillation (AF) was induced, and cavotricuspid isthmus ablation and isolation of pulmonary veins were performed. The patient was then discharged in sinus rhythm and anticoagulated with 110 mg of dabigatran every 12 hours. Nevertheless, his clinical status progressively worsened in the following months, with limiting dyspnea and symptoms of low cardiac output. An upgrade from ICD to cardiac resynchronization therapy was performed, since the patient presented a high percentage of ventricular stimulation and reduced ejection fraction. A risk assessment study for heart and lung transplantation (HLT) was carried out. The echocardiogram showed severe biventricular dysfunction with severe tricuspid regurgitation. Right cardiac catheterization confirmed pulmonary hypertension; he had a mean pulmonary arterial pressure of 90 mm Hg, systolic pulmonary arterial pressure of 104 mm Hg, diastolic pulmonary arterial pressure of 72 mm Hg, pulmonary capillary wedge pressure of 36 mm Hg, pulmonary vascular resistance of 9 Wood units, and cardiac output of 2.92 L/min. No absolute contraindications for HLT were detected. The patient was included in the waiting list for transplantation and was discharged with anticoagulation therapy (dabigatran), after checking idarucizumab was available. In October 2016, an optimal donor was found. The patient was admitted to the hospital 7 hours after the last dose of dabigatran (110 mg). Two ampoules of intravenous idarucizumab 2.5 mg were given over 5 minutes each, with an interval of 15 minutes between the first and second doses. Since the antidote is a non-competitive inhibitor, the onset of inhibition of the anticoagulant action of dabigatran is practically instantaneous. Therefore, the drug was administered once it was confirmed the donor was suitable and the transplant could be performed. Dabigatran mainly prolongs the activated partial thromboplastin time (APTT) and, to a lesser extent, the prothrombin time (PT). However, idarucizumab routine monitoring is not necessary due to its stable and predictable pharmacokinetics []. The patient’s APTT and PT before CPT was 41 and 14.3 seconds, respectively. HLT was performed without hemorrhagic, intra-operative or post-operative complications.
pmc-6390981-1
A 49-year-old Iranian man underwent liver transplantation for chronic hepatic failure due to hepatitis B and cirrhosis (MELD score of 20). Early post-operative recovery period was uneventful. An immunosuppressive regimen comprising prednisone, tacrolimus and cellcept were administered. Trough blood concentration of tacrolimus was maintained at 7–8.7 ng/mL with the daily dose of 4 mg. Hepatic function and coagulation status were within normal ranges 15 days after the transplantation. The patient did not experience any serious complications and clinical episodes except for ascites on the 10th postoperative day. Ultrasonographic evaluation showed massive ascites. Color Doppler ultrasonography of the hepatic vessels, inferior vena cava and portal vein demonstrated normal findings. Ascites was resistant to treatment and the weekly therapeutic aspiration of the ascitic fluid was necessary to alleviate symptoms. Cytological, biochemical and microbiological analyses of the ascitic fluid had unremarkable results. A liver biopsy was obtained under ultrasound guidance, which showed no significant abnormality in two separate pathological reviews. Cytomegalovirus viral load was analyzed, which presented a level below the lower limit of the assay (700 copies/mL) in plasma. Tacrolimus concentration was analyzed. Tacrolimus was considered as the only offending drug that was subsequently withdrawn and substituted by sirolimus at a concentration of 5 ng/mL. Resolution of ascites was observed 10 days after conversion of tacrolimus to sirolimus. In his last follow-up visit, the patient has remained asymptomatic for more than two years.
pmc-6391304-1
We present the case of a 29-year-old female with history of dyspareunia over a 5-month period, who discovered an “ovarian” cyst during an annual scheduled ultrasound appointment. The present study is based on information derived from the patient`s medical record. The study received ethical approval by the Institutional Board of Bioethics of “Attikon" University Hospital (IRB number: 0052/18) and is in accordance with the Declaration of Helsinki and its latter amendments concerning animal and human. According to the ultrasound findings, the patient had a single unicolar cyst (85x74x83mm) which seemed to originate from the right ovary. The cyst had no irregular inner walls or papillary nodules, showed no blood flow during the colored Doppler examination, and inner ground glass appearance (imaging compatible with endometriosis) (). The physical examination revealed no abdominal sensitivity, however the patient mentioned mild tenderness at cervical examination (chandelier sign positive), especially to the left. The anal sphincter had normal tone and the rectal vault was empty while no abnormal masses were palpated. Blood tests revealed white blood cell count and inflammation markers as well as neoplasia markers (AFP, CEA, CA 19/9, CA 125, CA 15/3, b-hCG) within normal rates. However, the intraoperative findings were surprising. The uterus as well as the ovaries had no pathological findings. The patient suffered from a large cyst that originated from the retrorectal space (presacral space), 7x8x9cm in dimensions, which caused symptoms due to its close proximity to the cervix and the anal canal. The cyst was completely resected and sent for histopathological examination. Frozen section analysis was reported as negative for malignancy. Histology disclosed a cystic space lined mostly with non-keratinizing squamous epithelium (), with areas covered by columnar, non-ciliated epithelium containing mucinous cells (). Lack of structured intestinal wall excluded an enterogenous duplication cyst, absence of neural elements a neurenteric duct cyst, whereas absence of other tissues excluded a presacral teratoma (, ). No malignancy was documented. Postoperative course was normal and she was discharged after 3 days.
pmc-6391319-1
A 4-year-old boy, born in Zhejiang Province of China, was admitted to Yuying Children's Hospital affiliated to Wenzhou Medical University in June 2014 with complaints of productive cough accompanied with high fever for 5 days. He was the first-born child to unrelated healthy parents, born at 38 weeks of gestation after an unremarkable pregnancy. His birth weight was 3.5 kg, and meconium was passed on the first day of life. The patient had no history of meconium ileus or diabetes mellitus and lacked family history of CF. Tracing back his medical history, the patient was formula feeding but failure to thrive with a weight of 6.8 kg at the age of 8 months and had intermittent diarrhea. For further evaluation of the condition of growth and development, the patient was taken to a local hospital at the age of 8 months, and received complete blood count and liver function tests. And the results indicated liver involvement with slightly elevated alanine aminotransferase (ALT) and aspartate aminotransferase (AST) with values of 78 and 82 U/L, respectively. The patient suffered from recurrently and slightly elevated ALT levels ranging from 70 to 92 U/L and AST levels ranging from 80 to 90 U/L. In addition, the common etiologies that easily lead to increased levels of ALT and AST were also excluded, such as cytomegalovirus and hepatitis B virus infection. Initially, these symptoms were not paid enough attention by the physicians or parents because the elevated levels of ALT and AST can recover to normal levels automatically without treatment or through the injection of magnesium isoglycyrrhizinate before four years of age. Physical examination for the patient at the age of 4 years showed a weigh of 16.5 kg with a height of 104 cm. The patient had a BMI of 15.3, which was in the 50th percentile for his age. The physical examination also revealed tachypnea and a barrel-shaped chest. The liver was palpable ~2 cm below the right costal margin, and the spleen was palpable about 1 cm below the left costal margin. Clubbed fingers were absent. Laboratory examination indicated increased ALT and AST values of 93 and 92 U/L, respectively, whereas other markers such as γ-glutamyl transferase (GGT), bilirubin, bile acid, fasting blood glucose, albumin, and globulin were within normal limits. Other laboratory investigations including of complete blood count, serum electrolytes, urine, arterial blood gas, amylase, and lipase were normal. The sputum and bronchoalveolar lavage fluid cultures tested positive for Pseudomonas aeruginosa. The Sudan III dye test of fecal matter indicated fat droplet positivity. Pulmonary function tests failed to be performed because of the difficulty at this young age for the child. Additionally, the lack of laboratory facilities caused impracticability of the sweat chloride test. Utilizing computed tomography (CT), we identified severe bilateral paranasal sinusitis () and diffuse fatty infiltration of the liver () in the patient. In addition, the chest CT scan verified the presence of bilateral bronchiectasis and marked peribronchial thickening, especially in the middle and lower lobes (). Extensive sticky and purulent secretion were observed in the lungs by bronchoscopy (). Based on the aforementioned pathological findings, the patient was primarily diagnosed with CF. Genetic testing of the patient revealed a homozygous nonsense mutation from a C-to-T substitution (c.1657C > T) in the CFTR gene, which was inherited from both his father and mother (). This single-nucleotide variant changed an arginine at position 553 into a premature termination codon (p.R553X). Notably, CF screening using amniotic fluid of the mother during her second pregnancy also indicated the fetus (sibling) to be a p.R553X carrier. Other than hypertonic saline nebulization, high-frequency chest wall oscillation, expectorant administration, pancreatic enzyme replacement therapy, and supplementation with vitamins A, D, E, and K, the child was prescribed intravenous ceftriaxone to address the P. aeruginosa. Respiratory symptoms gradually improved after 7 days of treatment, and he was discharged on the 15th day after admission. Ursodeoxycholic acid was prescribed after confirmation of genetic diagnosis, but taken irregularly by the patient. Therefore, the medicine failed to bring about the desired effect. Remarkably, the patient was later re-hospitalized two times because of pulmonary infections and liver involvement. Liver function test showed that the levels of both ALT and AST ranged from 90 to 120 U/L. Further examination of abdominal CT and ultrasound have suggested the progression of hepatic cirrhosis. The final hospital admission in August 2016 was due to complaint of a stomachache for 3 days. Abdominal CT showed a wave-like margin of the liver and many areas of multifocal hypoattenuation in the liver, which indicated the occurrence of hepatic cirrhosis on the basis of diffuse hepatic steatosis (). Simultaneously, the patient presented with pancreatic atrophy and splenomegaly (). In addition, both chest CT scan and bronchoscopy showed the characteristics of bilateral bronchiectasis, marked peribronchial thickening, and extensive sticky and purulent secretion, similar to that observed in 2014 (). The abnormal prothrombin time (PT) and activated partial thromboplastin time were 20.2 s (normal control: 13 s) and 52.6 s (normal control: 36 s), respectively. The international normalized ratio (INR) was 1.85, which confirmed the diagnosis of liver failure.
pmc-6391501-1
An 81-year-old man was referred to our center due to an abnormal shadow finding on a chest plain radiograph with chief complaints of cough and hip pain. The patient had no smoking history. His Eastern Cooperative Oncology Group performance status was 1. He had chronic renal failure; hence, we did not use any contrast agents for computed tomography (CT) or magnetic resonance imaging (MRI). CT revealed a lung nodule in the right upper lobe, mediastinal lymph node enlargement (Fig. a), an osteolytic lesion of the left iliac bone, and an anterior mediastinal cyst measuring 5 cm in size. The former three lesions showed significant fluorodeoxyglucose (FDG) accumulation on FDG-positron emission tomography (PET), and advanced lung cancer with clinical stage T1bN2M1b was suspected. Endobronchial ultrasound-guided transbronchial needle aspiration indicated that the lung adenocarcinoma was ALK-negative, with wild-type EGFR and a high PD-L1 tumor proportion score (95%). The latter mediastinal cyst showed no abnormal accumulation on PET-CT, and MRI demonstrated high intensity on T2-weighted images (Fig. b). Magnetic resonance cholangiopancreatography performed 1 year before the appearance of the mediastinal tumor indicated that the tumor occurred within the year. We determined that the patient had double neoplasms with advanced NSCLC and a mediastinal tumor. It was unknown whether the mediastinal tumor was benign or malignant. The patient’s prognosis seemed to depend on the treatment of the NSCLC rather than the mediastinal tumor. Therefore, we prioritized lung cancer treatment. Blood screening before immune checkpoint inhibitor (ICI) therapy (such as autoimmune and endocrine function, including thyroid function) showed normal data with the exception of renal failure. Radiation therapy with 39 Gy to the left iliac bone was performed, and pembrolizumab was administered as the first-line treatment; we observed the mediastinal tumor. Treatment with pembrolizumab yielded a partial response from the NSCLC in 3 months (Fig. c), but the mediastinal cyst enlarged extremely rapidly to 15 cm in diameter (Fig. d) and was suspected to be a sarcoma. Owing to the NSCLC treatment, the size of the mediastinal tumor rather than the NSCLC seemed to be more directly associated with prognosis. We decided to resect the mediastinal tumor under immunotherapy. Two weeks after the fourth administration of pembrolizumab, we performed mediastinal tumor excision by posterolateral thoracotomy, combined with resection of the right phrenic nerve and pericardium, which was reconstructed with an expanded polytetrafluoroethylene patch. We achieved a pathologically curative resection, but the tumor tended to infiltrate the surrounding structures and bled easily even with careful dissection. The blood loss was 1400 ml, and the patient received blood transfusion. The tumor was filled with a jelly-like substance and weighed 920 g. Pathological findings revealed spindle cells in a rich myxoid stroma with a high rate of mitosis and multinucleated pleomorphic nuclei (Fig. ). Immunohistochemical staining was negative for CD68, bcl2, ckit, ALK, SMA, desmin, S100, AE1/3, EMA, STAT6, and MUC4 and positive for CD99, CD34, MDM2, and CDK4. The pathological diagnosis was myxofibrosarcoma with no expression of PD-L1 (tumor proportion score, 0%). The postoperative course was uneventful. Immunotherapy was resumed 3 weeks after the operation, and a total of 13 courses were administered without any adverse effects. No adverse events were noted on the blood screens performed. No recurrence of mediastinal sarcoma or progression of NSCLC was found until the patient died in an accident 8 months after surgery. Patient consent was obtained for publication of this case report.
pmc-6391639-1
A 37-year-old Caucasian woman, with a 15 pack-year ongoing smoking history, presented to our outpatient interventional pulmonary clinic with complaints of progressive fatigue, shortness of breath on exertion, loss of appetite, and a 30-pound weight loss during the six months preceding presentation. In addition, she also reported nausea with occasional vomiting, dysphagia, and intermittent chest discomfort with lower abdominal pain. Prior diagnostic investigations included chest X-ray and computed tomography (CT) scans of her chest over the preceding two months, which had demonstrated a persistent and progressively enlarging right lower lobe opacity with clustered nodules and micronodules despite outpatient antibiotic treatment. Bronchoscopy with bronchoalveolar lavage (BAL) and multiple conventional forceps transbronchial biopsies (10 fragments of tissue measuring less than 0.1–0.1 cm in greatest dimension) were suggestive of respiratory bronchiolitis, without malignancy or microorganisms identified (Fig. ). Histoplasma antigen on the BAL and cultures was negative (bacterial, fungal, acid-fast bacterial). Positron emission tomography (PET) scan, performed six weeks later due to persistent symptoms, demonstrated substantial interval enlargement of the right lower lobe opacity. It was 4.4 × 2.9 cm in axial dimension, PET avid, and now with a mass-like appearance that was earlier a cluster of nodules and micronodules (17 × 11 mm in largest dimension). There were numerous surrounding micronodules and ground-glass opacities (Fig. ). In light of this progressive pulmonary process inadequately characterized with traditional bronchoscopic sampling methods, the patient underwent a second bronchoscopy with transbronchial cryobiopsies. Four transbronchial cryobiopsies (0.5 cm in the greatest dimension each) were obtained from different segments targeting peripheral and central areas of the lesion in the involved right lower lobe using a previously detailed technique with a 1.9 mm-sized cryoprobe without guide sheath (Fig. ) . The biopsy site was first interrogated with radial endobronchial ultrasound probe to confirm appropriate targeting of consolidated parenchyma and presence of significant vasculature. The technique of performing transbronchial cryobiopsies for focal parenchymal lesions is similar to that of diffuse parenchymal lung disease (DPLD), except that the optimal area of biopsy in DPLD is at 1–2 cm from the pleura. Surgical pathology demonstrated necrotizing granulomatous inflammation with neutrophilic microabscesses within the granulomas (Fig. ). Gomori methenamine silver staining demonstrated frequent large yeast forms with broad-based budding, consistent with Blastomyces dermatiditis (Fig. ). Magnetic resonance imaging of brain excluded central nervous system involvement. She was referred to the infectious disease service and treated with itraconazole (200 mg twice daily). Since starting treatment her weight has remained stable with decreased cough nausea and fatigue. Follow-up imaging showed almost complete resolution of right lower lobe consolidation and nodularity.
pmc-6391754-1
A 50-year-old man presented with a 2-year history of abdominal distension. He also had lower urinary symptoms such as the sensation of incomplete voiding and increased frequency. He had no symptoms of bowel obstruction. Physical examination revealed a palpable mass occupying the lower abdomen up to the level of the navel, but there was no tenderness. Digital rectal examination revealed an elastic hard mass on the anterior side of the rectum without palpable intraluminal mass. Total colonoscopy showed no masses or stenosis in the rectum. We evaluated the urinary symptoms were due to the compression of the bladder by the tumor. The results of laboratory tests were normal. Serum prostate-specific antigen (PSA) was not available preoperatively. Urinalysis was normal, with no evidence of hematuria. Enhanced CT showed a large retroperitoneal mass measuring 30 cm in size with multiple septations surrounding the rectum and displacing the bladder, prostate, and seminal vesicle to the right anterior side (Fig. ). MRI showed a mass composed of cysts of various sizes ranging from smaller than 1 up to 6 cm and solid components. Whereas most cysts had simple fluid appearance (very high intensity on T2-weighted images), some showed the presence of layering which suggests the likelihood of either fat or blood in content (Fig. a, b). Several solid components which showed isointensity on T2-weighted images were enhanced on gadolinium-enhanced fat-saturated T1-weighted images (Fig. c–f). From these radiological findings, preoperative diagnosis was leiomyoma with cystic degeneration or perivascular epithelioid cell tumor (Fig. ). Biopsy of the mass was performed under CT guidance, and histology showed a spindle cell tumor. Immunohistochemically, preoperative biopsy of the tumor showed positive staining for SMA, desmin, and caldesmon while negative for S-100, HMB-45, and MDM2, indicating smooth muscle differentiation. Differential diagnosis of leiomyoma, low-grade leiomyosarcoma, and perivascular epithelioid cell tumor was made. We suspected the tumor originated from the smooth muscle of the bladder or deep soft tissue in the retroperitoneal space. As the biopsy findings did not reveal obvious evidence of malignancy and because the outer wall of the tumor was relatively smooth, we chose to forego total pelvic exenteration and instead attempt complete macroscopic resection of the tumor with minimal combined resection of adjacent organs. Laparotomy was performed through a midline incision, which revealed a huge mass from the pelvic floor up to the level of the navel (Fig. ). During exploration, the bilateral ureter was preserved but the vas deferens was resected. Because the plane of the interface between the bladder and tumor was unrecognizable, we injected air into the bladder and identified the border of the mass. We dissected the tumor, preserving the bladder and prostate with partial resection of the prostate. The tumor was not attached to the sacrum or levator ani and was mobilized from the pelvic floor. Because the tumor extended into the left pelvic sidewall and surrounded the rectum, we sacrificed the rectum as well as the left hypogastric nerve and left pelvic plexus. Finally, we performed a complete resection of the tumor with low anterior resection. Intraoperatively, the border between the tumor and normal prostate was not so clear. The gross pathologic specimen was a 33 × 23 × 10 cm solid mass containing multilocular cavities. Sectioning revealed a multicystic cut surface (Fig. ), and blackish-brown intratumoral fluid was drained from the tumor. Histologically, the tumor was composed of variously sized dilated glandular structures lined by prostatic epithelia surrounded by fibromuscular stroma (Fig. a). Lesions of the well-developed, dilated prostate glands resembling prostatic hyperplasia were also evident (Fig. b). The cysts were lined by cuboidal to columnar secretory cells and basally located nuclei (Fig. c). Cytologically, we observed no atypical features or mitosis. Epithelial cells of the cysts and stromal glands were positive for PSA on immunohistochemical staining (Fig. d). The epithelium cells of the tumor were also positive for AR and NKX3.1 staining, indicating that the tumor originated from the prostate. The spindle cells seen on preoperative biopsy were thought to be stromal components of the tumor. Final histology indicated a giant multilocular prostatic cystadenoma. Postoperatively, whereas the patient developed a pelvic abscess due to urine leakage from the prostatic urethra, he recovered conservatively and was discharged on postoperative day 37. Since there is no positive evidence of adjuvant therapy of this prostatic cystadenoma, the patient is now under follow-up by blood tests and CT scan every 3–6 months. At 2 months after surgery, the patient had a PSA of 0.365 ng/ml, which was within the normal ranges. Since then, we have observed no signs of tumor recurrence. The patient was completely asymptomatic at the 6-month follow-up visit and made a full recovery, with no complaints of any urinary disorders or sexual dysfunction.
pmc-6391787-1
A 45-year-old Chinese man involved in a road traffic accident was admitted to the emergency department presenting with a Glasgow Coma Scale (GCS) of 8. A computed tomography (CT) scan of his brain revealed a small, acute subdural hematoma in the right frontotemporal region and traumatic intracerebral hemorrhage in the right frontotemporal lobe with no mass effect (Fig. a). He initially received conservative treatment. The patient improved with a GCS of 12 on the second day after admission, and a follow-up brain CT scan revealed a larger traumatic intracerebral hemorrhage in the right temporal lobe (Fig. b) and a PTCI in the right frontotemporal lobe around the traumatic intracerebral hemorrhage (Fig. c). A brain CT angiography was subsequently performed, which revealed no abnormalities of the main intracranial arteries (Fig. d). Follow-up brain CT scans performed on the third and fourth day after admission revealed the gradually broadening scope of the PTCI (Fig. a). The PTCI showed a significant mass effect on the follow-up brain CT scan on the fourth day after admission, and the patient deteriorated again, with a GCS of 9, indicating the need for operation. He was transferred to the operating room and underwent a right DC. The patient remained intubated on postoperative day 1, and the postoperative follow-up CT scan showed the operation was successful, but a small amount of left SDE was revealed (Fig. ). Although we bandaged his head after the peak time of cerebral swelling, the left SDE enlarged progressively. Meanwhile, right subcutaneous effusion, interhemispheric SDE and ventricular dilation were detected on a follow-up CT scan 2 weeks after the DC (Fig. c). The patient began to deteriorate 6 weeks after DC, with a fixed left pupil, and a new brain CT scan revealed enlargement of the left SDE with a significant mass effect (Fig. d). He was transferred to the operating room immediately and underwent a left burr-hole drainage. The follow-up brain CT scan revealed the left SDE was reduced significantly (Fig. a), and the patient improved compared to his preoperative condition. A brain CT scan was taken after removal of the drainage tube (Fig. b). Unfortunately, the patient deteriorated again, with left eye mydriasis on the fifth day after drainage tube removal. An emergency brain CT scan detected a significant mass effect from SDE again (Fig. c), and he was transferred to the operating room and underwent a left subdural peritoneal shunt (SPS). Although the ventricle narrowed, the SDE did not disappear completely (Fig. d). He underwent a cranioplasty 20 days after the SPS (Fig. a), but the follow-up brain CT scan revealed that the SDE did not resolve completely and the ventricle was dilated again (Fig. b). Ultimately, we conducted a ventriculoperitoneal shunt (VPS) 75 days after the cranioplasty (Fig. c). During the VPS placement, we connected the ventricular shunt tube to the valve of the SPS with a Y-shaped connection tube. A follow-up brain CT scan three months after the VPS placement showed that the SDE disappeared but the ventricular dilation still remained (Fig. d). Ultimately, he remains severely disabled, obeying simple commands and with a Glasgow Outcome Scale of 3 when transferred to the rehabilitation hospital.
pmc-6391791-1
A 67-year-old man who was a current smoker presented with an edematous right arm and face in our hospital. A chest computed tomography (CT) scan revealed a tumor of approximately 40 mm in diameter in the right upper lobe, with right axial and mediastinal lymph node metastases, and pleural effusion (Fig. a and b). According to the findings of a transbronchial lung biopsy and systemic survey, he was diagnosed with adenocarcinoma corresponding to clinical T4N3M1c (stage IVB: 8th edition of UICC TNM staging). An epidermal growth factor receptor mutation and rearranged anaplastic lymphoma kinase genes were not detected. His tumor had invaded the superior vena cava (SVC), leading to the swelling of his right arm and face, suggesting SVC syndrome. He was treated with palliative radiotherapy consisting of a total dose of 30 Gy for SVC syndrome. After irradiation, the size of the tumor in the right upper lobe was slightly decreased (Fig. c and d). Immunohistochemistry using the 22C-3 antibody revealed the high expression of PD-L1 and a TPS of 75%. He did not have a personal or family history of any autoimmune conditions and autoimmune related antibodies such as anti Jo-1 antibody, anti-thyroid peroxidase antibody, anti-thyroid stimulating hormone antibody, free T3, free T4, rheumatoid factor (RF), anti-acetylcholine receptor antibody, antinuclear antibody and anti-glutamic acid decarboxylase antibody did not show abnormal findings. Subsequently, pembrolizumab (200 mg/body, every 3 weeks) was initiated as the first-line therapy. Approximately 2.5 months after treatment with pembrolizumab, he presented with an asymptomatic, poorly demarcated 1–3 cm erythematous plaque over the right trunk of his body, which gradually developed in size (Fig. a and b). He had no symptoms and his blood examination test results showed no remarkable changes. Therefore, pembrolizumab therapy was continued. Histopathologic examination from a skin biopsy showed ectatic dermal lymphatics with intraluminal aggregations of histiocytes (Fig. c), which were positive for CD68 and lymphatic vessels that were positive for podoplanin (D2–40) (Fig. d and e). We ultimately diagnosed him as ILH based on the clinical and histopathological findings. RF and anti-cyclic citrullinated peptide (CCP) antibody were checked after the appearance of erythematous plaques; however, they were negative. Laboratory results revealed that TNF-α levels were increased after 2 months of pembrolizumab treatment (Fig. ). After 4 cycles of pembrolizumab treatment, the size of the tumor in right upper lobe had decreased. However, the tumor in the axial lymph node progressed (Fig. a and b) and his right arm swelling worsened. Therefore, the treatment was changed to cisplatin (75 mg/m2) and pemetrexed (500 mg/m2) as second-line therapy. After 2 cycles of chemotherapy, he maintained a partial response without any severe adverse events and ILH was gradually resolved with topical steroid therapy.
pmc-6391797-1
A 42-year-old woman who had undergone twice cesarean sections presented with hematochezia and was evaluated by CT scan in August 2011. A CT only detected an enhanced abdominal wall mass near the abdominal scar, which was thought to be desmoid at the time (Fig. a and b). As the hematochezia continued, a further endoscopic workup was performed, and well-differentiated adenocarcinoma was detected at sigmoid colon. The whole body CT scan detected no other distant metastasis. She underwent elective open sigmoidectomy with D3 lymph node dissection for sigmoid colon cancer with mid-line incision in May 2012. Histology of the sigmoid colon showed well-differentiated adenocarcinoma invading to subserosa with 8 out of 20 regional lymph nodes involved. The sigmoid colon cancer was classified as pT3N2b, according to the TNM classification of the Union for International Cancer Control Eights Edition []. Molecular analysis showed KRAS mutation and microsatellite-stable. Postoperative course after sigmoidectomy was uneventful and the patient was treated with 12 cycles of FOLFOX regimen as adjuvant chemotherapy. The patient entered a scheduled clinical follow up program which included: regular physical examinations and CEA test every 3 months, and whole-body CT every 6 months. CT after adjuvant chemotherapy revealed the lesion on the abdominal wall had decreased in size and inguinal lymph nodes were all normal in size (Fig. c and d). In April 2014, a routine follow-up CT scan revealed enlarged left inguinal lymph nodes as well as a growing enhanced mass lesion on the abdominal wall at the site of cesarean section scar (Fig. e and f). 18F-fluorodeoxy glucose positron emission tomography (FDG-PET) revealed significant accumulation at both lesions (Fig. g and h). A CT showed no distant metastases were detected in other organs and laboratory data showed serum CEA level was within the normal range (1.3 ng/ml). Although metastases to both inguinal lymph nodes and the abdominal wall from colon adenocarcinoma are clinically uncommon, needle biopsy of those lesions was performed with the suspicion of inguinal lymph node recurrence and abdominal wall metastasis from colon cancer. Histopathological findings indicated well-differentiated adenocarcinoma, and immunohistochemistry revealed positive expression of CDX-2, substantiating its gastrointestinal origin (Fig. ). Thus, under the diagnosis of sigmoid colon cancer recurrence in left inguinal lymph nodes and synchronous abdominal wall metastasis, because abdominal wall mass was exist when primary tumor resection, we performed left inguinal lymph node dissection and resection of the abdominal wall with reconstruction using an anterolateral thigh flap, with a curative intent. Intraoperative findings showed no evidence of dissemination, distant metastasis, or other non-curative clinical factors. Pathology revealed well to moderately differentiated adenocarcinoma in both lesions. Three of the eight retrieved inguinal lymph nodes showed involvement of adenocarcinoma. The patient had a favorable postoperative course and was discharged from the hospital without any complications. Follow-up CT one year after the inguinal lymph node dissection showed multiple distant lymph node metastases, including some in para-aortic lymph nodes. The patient received FOLFIRI as palliative chemotherapy, but died due to disease progression 51 months after inguinal lymph node dissection (Additional file ).
pmc-6391823-1
A 40-year-old Caucasian woman with training in human resources but unemployed since 2014 due to borderline personality disorder and active suicidal thoughts, was found unconscious at home by her husband. She was a nonsmoker and a social drinker. Her medical treatment consisted of clomipramine 150 mg once daily and lorazepam 2.5 mg twice daily. She was rapidly transported to the emergency room (ER) by ambulance with an oxygen mask. On arrival, her vital signs were as follows: blood pressure of 119/62 mmHg, heart rate of 62 beats/min, and temperature of 35.0 °C. She was unalert with a Glasgow Coma Scale score of 5/15 (E1 V1 M3) and presented no protective airway reflexes. The result of her cardiopulmonary examination was normal, and we found no abdominal distention or guarding and no masses on palpation. Neurological examination revealed an unconscious patient with a slight reactive bilateral miosis and no focal neurological deficits on cranial nerve or peripheral neurological examination. Laboratory findings were within normal range, including a complete blood count (hemoglobin of 133 g/L, white cell count of 6.2 × 109/L, platelet count of 153 × 109/L), coagulation test, full electrolytes, kidney and liver function tests. Arterial blood gas showed a nonhypoxemic respiratory acidosis (pH 7.34, partial pressure of oxygen 56.9 kPa, partial pressure of carbon dioxide 6.2 kPa, bicarbonate 24.8 mmol/L). We proceeded to perform an endotracheal intubation (propofol 50 mg, fentanyl 50 μg, suxamethonium chloride 70 mg, rocuronium 50 mg, propofol 100 mg/h, and a slow drip of 250 ml of Ringer’s lactate solution) followed by a chest x-ray that revealed multiple coffee grain-sized opaque masses in the stomach. Empty blister packs found around her by paramedics suggested an ingestion of up to 8,625 g of slow-release clomipramine (Anafranil SR® 75 mg; Novartis Pharma Schweiz AG, Switzerland), 125 mg of lorazepam (Temesta® 2.5 mg; Pfizer PFE Switzerland GmbH), and 160 mg of domperidone (Motilium® 10 mg; Janssen-Cilag AG). In accordance with the national poisons information center (Tox Info Suisse, Zürich, Switzerland), we started a multidose activated charcoal (AC) regimen (60 g loading dose in the ER, completed by 30 g every 6 h for 24 h), followed by a gastric endoscopy that found an important pharmacobezoar extending from the fundus to the great curvature of the stomach (Fig. ). Three liters of normal saline were used in the stomach to fragment the aggregate, and a manual extraction of the tablets was performed with a wire basket with partial success. The patient was admitted to the intensive care unit (ICU) for mechanical ventilation and further observation, and she never showed any signs of cardiovascular disturbance. Her treatment in the ICU consisted of fentanyl 0–50 μg/h, enoxaparin 40 mg subcutaneously once daily, AC 30 g every 6 h, and glucosaline intravenous drip 1 L/day. Eight hours after ICU admission, another abdominal x-ray (Fig. ) confirmed a persistent gastric tablet aggregate, and a second attempt at gastroscopic extraction was performed. The patient gradually awakened and was weaned off mechanical ventilation after 30 h. She was transferred to our psychiatric unit on day 3 for further care. During her stay, she had normal electrolytes, hemoglobin, and white blood cell count. She never presented any hemodynamic instability, had no QT interval prolongation on electrocardiogram or any arrhythmias, and we had no clinical argument for seizures. No therapeutic drug monitoring of clomipramine was performed at baseline or during the patient’s hospital stay because she improved and recognized having taken all the tablets from the empty blister packs found at her home. She was hospitalized in our local psychiatric hospital and discharged after 10 days. Regular follow-up with her psychiatrist was uneventful for the next 2 years.
pmc-6391836-1
A 60-year-old man presented with sudden severe right shoulder and flank pain and numbness of the right hand. The patient had a history of working in his home garden every day. He had no subjective symptoms prior to the day of admission, and no past medical history other than hypertension, which was managed with medication. The patient called an ambulance 3 h after the onset of symptoms and was able to get into the ambulance unassisted. He was transported to a nearby hospital. At the hospital, he developed hemoptysis and hypoxemia with severe forced breathing and tachypnea. He was tracheally intubated and transferred to our emergency department by air ambulance helicopter 6 h after the onset of symptoms. On examination in our emergency department, a coarse crackle with right lateral dominance was audible. A small volume of blood was continuously suctioned through the tracheal tube, although bronchoscopic examination did not reveal any source of bleeding. The patient’s blood pressure was 132/87 mmHg, pulse was 109 beats per minute and body temperature was 36.7 °C. He was mechanically ventilated with spontaneous breathing at a rate of 14 breaths per minute under sedation. No skin eruptions or lesions were observed. Upon examination of chest computed tomography (CT), we saw infiltration predominant in the right upper lobe and spreading to the right middle and lower lobe and left hilar area (Fig. ). Peripheral blood was collected for laboratory examination. Arterial blood gas analysis showed a pH of 7.174, with a partial pressure of carbon dioxide of 62.4 mmHg, a partial pressure of oxygen of 94.3 mmHg, a base deficit of − 7.4. under the condition of end-expiratory pressure at 10 cm H2O, and a fraction of inspired oxygen of 0.5, indicating acute respiratory failure. Other laboratory data were normal, including blood cell count, coagulation, and biochemistry, including inflammatory biomarkers, other than a slight elevation in serum creatinine level (1.37 mg/dL). Electrocardiography showed a sinus rate of 86 beats per minute, with an obvious ST segment elevation in the inferior leads. Echocardiography also showed severe hypokinesis of the cardiac inferior wall. The patient’s serum troponin T level was elevated (0.487 ng/mL). The patient’s history was obtained from his family, and showed only hypertension. His current medications included enalapril, carvedilol, and amlodipine. He had no known allergies and no recent travel history. He did not smoke and there was no history of unusual ingestions. The Triage DOA® intoxication screening test result was negative. From the laboratory results and other tests, there were two contradictory clinical concerns: revascularization of the coronary artery and alveolar hemostasis. As the etiology of the alveolar hemorrhage was unknown, we were obliged to seek the pathogenesis under mechanical ventilation, with no obvious indicators for a hemostatic approach. Thus, after discussion, we decided to prioritize the revascularization of the coronary artery. After heparinization, coronary angiography confirmed 99% severe stenosis with a flow delay (thrombolysis in myocardial infarction grade 2 flow) of the mid right coronary artery at segment 2. Thrombus aspiration was performed, followed by implantation of a drug-eluting stent (DES). To minimize the bleeding risk, we delayed administration of antiplatelet drugs, aspirin and prasugrel, until the time of definite decision to implant the DES. Next, transcatheter arterial embolization was performed to treat the alveolar hemorrhage. Although we did not detect overt extravasation by angiography, we believed that the location of the hemorrhage was a branch of the right bronchial artery, which we embolized using a gelatin sponge. However, we were unable to control the alveolar hemorrhage, which increased and blew out from the tracheal tube, making it very difficult to maintain oxygenation and circulation. The patient died 12 h after the onset of symptoms. No antibiotics were administered during treatment. Autopsy was performed with the family’s consent immediately after the patient’s death. The following day, additional laboratory blood exams revealed that negative for the anti-neutrophil cytoplasmic antibody, anti-nuclear antibody, and anti-glomerular basement membrane antibody. Levels of lung surfactant proteins A and D, as well as KL-6, were normal. Later, B. cereus was cultured from the sputum sample suctioned through the tracheal tube. Immunohistochemistry of B. cereus and real-time PCR for pXO1-like plasmid from lung tissue were performed to confirm that the bacterium was B. cereus and whether this bacterium produced anthrax-like toxin. The lungs were fixed in 20% formalin for 24 h and embedded in paraffin, followed by pathological examination. B. cereus immunostaining was performed using anti-Bacillus cereus rabbit polyclonal antibody (Abcam, Cambridge, UK). Next, we performed DNA extraction and real-time PCR for B. anthracis toxin plasmid. Two pieces of 10 μm-thick Formalin fixed paraffin embedded (FFPE) sections were collected in Eppendorf tubes. DNA was extracted from these sections with the use of Nucleospin DNA FFPE XS kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instruction. For detecting infection with B. cereus containing pXO1-like plasmid, lethal factor (LF) gene (Genbank M29081.1) and protective antigen gene (PAg) (Genbank AF268967.1) were amplified by real-time PCR. For amplifying LF, two primer sets were prepared.: LF1, 5′- CAGCTTTATGCACCGGAAGC-3′ (forward) and 5′- CGCTCCAGTGTTGATAGTGC-3′ (reverse), generating a product of 148 bp; and LF2, 5′- TCAGCTTAAGGAACATCCCACA -3′ (forward) and 5′- GCTTCCGGTGCATAAAGCTG-3′ (reverse), generating a product of 144 bp. PAg was amplified using the primers 5′- CAGGCTCGAACTGGAGTGAA -3′ (forward) and 5′- TCACTAGGATTAACCGCCGC -3′ (reverse), generating a product of 118 bp. PCR reactions were carried out in a 25-μL final volume containing 2 μL of sample DNA, 12.5 μl of 2× reaction mixture (QuantiTect SYBR Green PCR Kits; Qiagen, Hilden, Germany) and 0.2 μM primers. The real-time PCR was performed with Rotor Gene Q (Qiagen), with an initial holding step at 95 °C for 15 min, followed by 50 cycles of three-step PCR (94 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s) with SYBR Green fluorescence monitoring to detect amplification. The melting curve was examined to check for contamination. As a positive control, genomic DNA of Bacillus anthracis (JNBP01251) was provided by the Gifu Type Culture Collection, Graduate School of Medicine, Gifu University. Histologic sections of the lung, especially of the right upper lobe, demonstrated necrotizing hemorrhagic pneumonia similar to anthrax, with tremendous proliferation of gram-positive rods. The bacteria were diffusely gram-positive. Additionally, hemorrhagic diffuse alveolar damage within the hyaline membrane that was probably due to acute respiratory distress syndrome was also observed throughout the lungs. The bacteria reacted to the B. cereus antibody, and did not react to Pseudomonas aeruginosa and Escherichia coli antibodies. There was no infiltration of neutrophils. There was also no deposition of immunoglobulins or complements on the alveolar walls by immunofluorescence, excluding a diagnosis of vasculitis. B. cereus was also confirmed from the sputum culture. Therefore, B. cereus necrotizing pneumonia was confirmed pathologically (Fig. ). In the real-time PCR, amplification was obtained in the positive control (B. anthracis DNA), but not in the patient sample or the negative control (no template).
pmc-6392507-1
A 21-year-old female without specific medical history presented with a protruding right eye and an obstructed nasal passage of 1-month duration. The patient was diagnosed with sinusitis at another clinic and was prescribed oral antibiotics. Her symptoms were not relieved by the antibiotic treatment or nasal irrigation. She was referred to our clinic, and we performed a diagnostic work-up. Corrected visual acuity was 1.0 in both eyes. Hertel exophthalmometry revealed 3-mm proptosis (Fig. A). The extraocular muscle was intact. No specific findings were observed in the anterior or posterior segments. Computed tomography and magnetic resonance imaging (MRI) showed a large homogenous well-enhanced mass with surrounding bony erosion and remodeling (Fig. ). The mass had extended to the nasal cavity and right orbit. Regional neck lymph node involvement was observed. A fiber-optic endoscopic biopsy of the nasal cavity confirmed alveolar rhabdomyosarcoma. The immunohistochemical analysis was positive for desmin, myeloperoxidase, and CD56, consistent with the diagnosis. As neck lymph node metastasis was suspected; surgical debulking, chemotherapy, and radiation therapy were scheduled. The maxillary and nasal cavity mass was excised using the Caldwell–Luc approach, and the orbital mass was excised through a transconjuctival incision in the inferior fornix followed by a caruncular incision. Complete tumor removal was difficult because the tumor contained the orbital wall and was located near the optic canal. The excised mass was pathologically confirmed as alveolar rhabdomyosarcoma. The right eye proptosis was relieved after surgery (Fig. B). Ultrasonography-guided fine needle aspiration of a neck lymph node confirmed malignancy of the tumor. The Intergroup Rhabdomyosarcoma Study Group (IRSG) postsurgical staging was group 3. The patient underwent 6 cycles of VAC (vincristine, dactinomycin, and cyclophosphamide) and radiation therapy (5120 cGy). Her visual acuity and ocular motility were intact 1 year after treatment. MRI revealed complete regression of the previous tumor, mucosal wall thickening, and sinusitis (Fig. ). A positron emission tomography scan showed no distant metastases. There was no local recurrence of tumors for a total follow-up period of 1.5 years; afterwards, loss of follow-up was occurred.
pmc-6392508-1
A 37-year-old man who was transferred to our hospital presented with a one-week history of CSF rhinorrhea, a four-day history of fever and a one-day history of headache. Six months prior to admission, he had suffered a traumatic brain injury in a traffic accident. Brain computed tomography (CT) revealed bilateral frontal lobe contusions and multiple fractures of the bilateral frontal bones. Under general anesthesia, an emergency contusion cleaning procedure and bilateral frontal decompressive craniectomy were performed. Postoperatively, the patient had a favorable recovery. Head CT showed bilateral frontal bone defects and brain necrosis, and a significantly sunken scalp was noted (Fig. A and B). However, one week prior to the present admission to our hospital, he developed CSF rhinorrhea 20 min after jumping rope, along with a subsequent 4-day fever. At admission, a brain CT revealed an intracranial pneumatocele (Fig. C and D). At admission, he was drowsy upon physical examination. His temperature was 37.6°C. Neck stiffness and meningeal irritation were observed. A laboratory examination revealed an elevated C-reactive protein level of 126 mg/L and a peripheral leukocytosis of 20.1 × 109/L. A CSF examination revealed pleocytosis (287 × 106 cells/L, of which 80% were polymorphonuclear cells), increased total protein (998 mg/L) and a Pandy test result of ++. Streptococcal pneumonia was detected in a bacterial culture of the CSF sample. The patient was therefore treated with high-dose ceftriaxone. Two weeks later, the patient's symptoms returned to normal. Three CSF examinations showed normal results. Two months after the onset of CSF rhinorrhea, the patient still had persistent unilateral clear nasal drainage that worsened when standing or sitting. Axial and sagittal CT revealed an open frontal sinus. In addition, low-density areas indicating liquid were visible in the opened frontal sinus (Fig. ). A cranioplasty and dural defect repair were planned. A bicoronal scalp incision was made along the primary surgical incision, and a scalp flap was carefully elevated. The frontal sinus was filled with CSF, and the dural tear was identified. After opening the dura, a hyperplastic gliosis scar was visible around the area of the original contusion. We excised the glial scar. Wide apposition of the whole region of the anterior skull base including the ethmoidal roof, orbital roof, and lateral walls extending to the orbital apex was performed. After careful examination of the anterior skull base, no other leaks were found. The dural defect was repaired with artificial dural mater. The frontal sinus was filled with temporal muscle, temporalis fascia, and fibrin glue. Simultaneous cranioplasty was performed using a customized titanium mesh (Fig. ). The operation was uneventful. During a follow-up period of 12 months, the patient's recovery was satisfactory.
pmc-6392536-1
A 56-year-old male without any previous medical history presented to our emergency room (ER) with multiple traumas from a 10 meter fall in a construction field. Physical examination revealed a male patient with a body mass index in the normal range and an acutely ill looking appearance. His right lower leg and ankle were swollen and bruised, and he had a 2 cm laceration wound on the plantar aspect of his right foot. The patient's right ankle had limited range of motion due to pain. The patient had tenderness at the right anterolateral aspect of the mid lower leg and anterior aspect of the ankle. There was grade 1 anterolateral instability of the left ankle. The neurologic examination was normal. Based on the patient's clinical history and physical examination, the orthopedic surgeon suspected a fracture of the right fibular diaphysis and ligament injury of the right anterolateral ankle. Initial radiographs of the ankle in the anteroposterior and lateral views showed fractures at the diaphysis at the fibula and anterior lip of the tibial plafond (Fig. ). The patient was not able to undergo ankle Mortise view because of his limited range of motion due to extreme pain. In a subsequent lower extremity computed tomography (CT), the orthopedic surgeon in the ER noticed a segmental fracture of the right fibular shaft and the anterior lip of the tibial plafond. To evaluate the ankle ligaments, a turbo spin-echo (TSE) two-point mDixon technique applied to an ankle MRI (Table ) was performed after procuring written informed consent. In addition to the fractures of the right fibular shaft and tibial plafond, this MRI demonstrated a tiny chip fracture of the lateral talar dome. A tiny wafer-shaped talar dome chip fracture fragment about 7 (anterior–posterior diameter) × 3 (head to toe diameter) mm was clearly delineated only in the sagittal T2-weighted mDixon opposed-phase MRI (Fig. B). In T2-weighted mDixon in-phase imaging, which is considered a conventional T2-weighted image, there was a definite focal wedge-shaped cartilage defect at the corresponding area. However, there was only focal and subtle cortical irregularity and the cortical step-off was not definite (Fig. C). In a T2-weighted mDixon water-only image, which is considered a conventional fat-suppressed T2-weighted imaging, the cartilage lesion and focal cortical irregularity were once again noted, and the subcortical bone marrow edema was additionally confirmed. In these 2 sequences, a fracture was suspected, but the radiologists could not fully delineate the fracture line (Fig. D). In T2-weighted mDixon fat-only imaging, there were dark signal alterations at the subcortical region, but these were not considered fractures (Fig. E). T1-weighted imaging was obtained in the axial plane, and the fracture line was not depicted in this plane (Fig. F). In a CT image reviewed by an experienced musculoskeletal radiologist, there was a lateral talar shoulder cortical fracture at the identical area where the chip fracture was noted (Fig. A) from the T2-weighted mDixon opposed-phase image. In addition, there was a grade 2 injury to the anterior talofibular ligament with severe subcutaneous swelling of the ankle. During ankle arthroscopy, there was a free floating osteochondral fragment about 4 x 8 mm at the posterolateral talar shoulder, which was removed with basket forceps (Fig. ), and microfractures were performed at the posterolateral talar cortical fracture site. The patient did well after the arthroscopy with recovery of full range of motion after 2 months.
pmc-6392561-1
A 51-year-old woman visited our outpatient clinic because of latent tuberculosis infection detected by a screening examination performed by a healthcare worker. She had no relevant prior medical history. Laboratory findings were normal with a serum creatinine (Cr) level of 0.76 mg/dL (normal 0.6–1.5 mg/dL) and blood urea nitrogen (BUN) level of 12.8 mg/dL (normal 8–23 mg/dL). Antituberculosis treatment was started with isoniazid at 300 mg/d and rifampicin at 600 mg/d. During the 25-day antituberculosis therapy regimen, she complained of nausea, vomiting, general weakness, and edema. Serum Cr and BUN levels were 1.0 and 18 mg/dL, respectively. Rifampicin and isoniazid were discontinued. However, her symptoms progressed for 4 days and urinalysis revealed 4+ proteinuria (normal negative). She was admitted to the hospital for more detailed examinations. On admission, her blood pressure was 110/80 mm Hg, body temperature was 36.5°C, height was 158 cm, and body weight was 68.6 kg. She had gained 8.6 kg in body weight over the preceding 1 month. The results of physical examination were unremarkable except for pitting edema on both lower extremities. Laboratory findings were as follows: white blood cell count 7490/mm3 (normal 4000–10,000/mm3) with 63.1% neutrophils and 1.4% eosinophils, hemoglobin 13.6 g/dL (normal 12–16 g/dL), platelet count in peripheral complete blood 295,000/mm3 (normal 140,000–440,000/mm3), BUN 45 mg/dL, serum Cr 1.72 mg/dL, total protein 3.67 g/dL (normal 6.5–8.2 g/dL), albumin 1.73 g/dL (normal 3.5–5.0 g/dL), total bilirubin 0.67 mg/dL (normal 0.1–1.2 mg/dL), aspartate transaminase 116 IU/L (normal 10–35 IU/L), alanine transaminase 94 IU/L (normal 0–40 IU/L), total cholesterol 453 mg/dL (normal 120–200 mg/dL), sodium (Na) 133 mEq/L (normal 135–145 mEq/L), potassium 5 mEq/L (normal 3.5–5.5 mEq/L), and chloride 103 mEq/L (normal 98–110 mEq/L). Urinalysis showed specific gravity >1.050 (normal 1.005–1.03), osmolality 687 mOsm/kg (normal 300–900 mOsm/kg), urine Na <10 mEq/L, and urinary Cr 267.34. The calculated fractional sodium excretion was 0.02%. The creatinine urine to plasma ratio was 155. Urinary sediment did not show either red blood cells or granular casts. A 24-h urine sample contained 12.2 g of protein. Serum and urine electrophoresis results showed no M-spike and nonselective proteinuria. The patient was negative for hepatitis B, hepatitis C, HIV, and syphilis serological markers. Rheumatoid factor, antinuclear antibody, antineutrophil cytoplasmic antibody, and antiglomerular basement membrane antibody tests were all negative. In addition, results for complement 3 (144.3 mg/dL, normal 90–180 mg/dL), complement 4 (32.4 mg/dL, normal 10–40 mg/dL), immunoglobulin G (551 mg/dL, normal 700–1600 mg/dL), immunoglobulin A (267 mg/dL, normal 70–400 mg/dL), and immunoglobulin M (111 mg/dL, normal 40–230 mg/dL) were negative. Chest X-ray revealed a small amount of bilateral pleural effusion (Fig. A). The patient was treated with torsemide at a dose of 50 mg/d for edema. Renal biopsy was performed at 1 week after discontinuation of medication. However, she developed dyspnea and pulmonary edema on the day of the procedure (Fig. B). As we suspected nephrotic syndrome with acute nonoliguric renal failure, we performed dialysis and oral administration of prednisolone at 60 mg/d. Acute renal failure was confirmed with temporary loss of renal function that required dialysis, and with peaked serum Cr (2.68 mg/dL) that more than 3-fold increase in baseline Cr (0.76 mg/dL). Renal biopsy revealed nonsclerotic glomeruli with normocellularity and a mild focal tubular injury pattern on light microscopy (Fig. A and B). No deposition of immunoglobulins or complement components was observed in the glomeruli. Electron microscopy showed diffuse loss of the podocyte foot processes of glomerular epithelial cells, but the glomerular basement membrane showed normal thickness and architecture, consistent with MCD (Fig. A and B). The diagnosis was confirmed to be MCD. Heavy proteinuria developed after using antituberculosis agents. We speculated that this was a case of antituberculosis medication-induced nephrotic syndrome and toxic hepatitis. Following discontinuation of rifampicin and isoniazid with the aid of prednisolone therapy, the patient's nausea, vomiting, and pulmonary edema improved after 1 week of steroid therapy, and dialysis was stopped. Her body weight recovered from 68.6 to 60.7 kg at 3 weeks after discontinuation of rifampicin and isoniazid, and she was then discharged. Proteinuria became negative and renal function tests showed normal results at 4 weeks (serum Cr, 0.86 mg/dL; BUN, 24.7 mg/dL). Furthermore, her albumin and cholesterol levels were 3.15 g/dL and 276 mg/dL, respectively, at 4 weeks after stopping the drugs. Prednisolone was then tapered and withdrawn 3 months after initiation. Recurrence of proteinuria was not observed during a 3-month follow-up. The patient's clinical course is summarized in Fig. . Informed consents were obtained from the patient for the publication of clinical details and accompanying images. As this study is a clinical case report, no ethical committee approval was required for its conduction, which is in compliance with the institutional and national policies concerning research approvals.
pmc-6392565-1
An 80-year-old male presented with a 2-week history of fever and 10-day history of a progressive ascending muscle weakness in the legs and arms. He had smoked 20 cigarettes per day for 55 years. There was a medical history of hypertension. He had a fever and started to cough 2 weeks prior to visit, and took common cold medications on his own. In the past 10 days, the patient felt weakness in legs in the beginning when he was still able to move around. However, his status worsened. He experienced increasing difficulty walking upstairs, standing up, and sitting down. Three days ago, symptoms gradually showed up in the arms, which could not move with ease. At the time of office visit, he could no longer walk or hold up objects. The physical examination revealed paralysis of the arms and legs (Medical Research Council [MRC] grade 2) with absent deep-tendon reflexes. Sensory examination including light touch, pinprick, vibration, and joint position were all normal. The left lung breath sounds were weakened. His blood pressure was 180/100 mm Hg. The patient reported no difficulty with defecation or urination, but significant weight loss of approximately 3 kg over the last 2 months. Routine laboratory data showed that urinalysis and fecal tests were normal; levels of autoantibodies such as extractable nuclear antibody spectrum, antiphospholipid antibodies, and antineutrophil cytoplasmic antibodies were normal; blood routine showed a leukocyte level of 20.55 × 109/L, and neutrophil percentage of 88.70; C-reactive protein (70.74 mg/L) and erythrocyte sedimentation rate (60 mm/h) were increased; antinuclear antibodies (ANAs, titer: 1:10,000) were positive; tumor marker examination indicated that carcinoembryonic antigen (CEA, 16.75 ng/mL), neuron-specific enolase (NSE, 28.45 ng/mL), and cytokeratin 19 fragment (CYFRA21-1, 73.96 ng/mL) were elevated; a lumbar puncture showed elevated protein content (1207.00 mg/L), with normal cell count, glucose and chloride levels, and without abnormalities in microbiological cultures or cytology; and the antiganglioside M1 (GM1) IgG antibodies in cerebrospinal fluid (CSF) was positive. Electromyography examination revealed a significant slowdown of motor nerve conduction velocity in upper and lower extremities, notably decreased amplitude. Nerve conduction studies showed normal sensory studies in the upper and lower extremities, except for the superficial peroneal nerve where the value was undetectable. The left median nerve had prolonged F wave, while the left ulnar nerve, peroneal nerve, and tibial nerve F wave cannot be measured. Spontaneous potential was seen in the legs and arms with reduced recruitment, which suggested severe peripheral nerve demyelination (Table ). The results for repeated electrical stimulation including low frequency attenuation and high frequency incremental tests were both negative. Cerebral magnetic resonance imaging was unremarkable. Thoracic enhanced computed tomography (CT) scan revealed a large mass in the inferior lobe of the left lung; lobulation and spiculation sign were observed in the margin (Fig. ) that consistent with lung cancer performance. Furthermore, the whole-body positron emission tomography-CT imaging indicated a 69 × 88 mm soft tissue density lumps with fluorodeoxyglucose uptake (maximum standardized uptake value 10.1) in the left inferior lobe without any other abnormal fluorodeoxyglucose uptake (Fig. ). The CT-guided percutaneous pulmonary biopsy confirmed the diagnosis of poorly differentiated adenocarcinoma. Microscopic examination revealed an infiltrating tubuloglandular proliferation of the tumor, and the tumor cell nucleus was prominent with hyperchromatism, pleomorphism, and pathological mitotic figures. Immunohistochemical staining indicated that the tumor cells were positive for NapsinA, thyroid transcription factor-1, and cytokeratin, but negative for synaptophysin, cluster of differentiation (CD)56, and p63, along with a negative expression of anaplastic lymphoma kinase (Fig. ). Based on the test results and clinical manifestation, the final diagnosis was “pulmonary adenocarcinoma and paraneoplastic GBS.” He was treated with methylprednisolone at 80 mg Qd for 10 consecutive days, which only resulted in improvement in arms (MRC grade 4), and the symptoms of the legs did not improve (MRC grade 2). The dose was then adjusted to 40 mg Qd for another 10 consecutive days, followed by oral prednisone 10 mg Qd for 3 months. Given his age and poor general condition, although there was no metastasis, the patient and his family members still chose to discharged from hospital automatically without any surgery or chemotherapy. A follow up was performed 3 months after his discharge, and his symptoms did not worsen. However, the patient experienced systemic weakness again after 6 months; he became completely bedridden and gave up re-admission treatment (Table ).
pmc-6392568-1
A 64-year-old woman present with a 3-day history of reduced vision in her left eye. Best corrected visual acuity (BCVA) was 1.0 in her right eye and 0.5 in her left eye. Slit-lamp examination shows no alteration in anterior segment in both eyes. Intraocular pressure was 16 mm Hg in both eyes. Fundus examination was normal in her right eye. Left eye showed a subretinal elevated pigmented lesion in the inferior temporal vascular arcade surrounded by a ring of hard exudates that extends to the fovea. Another subretinal flat pigmented lesion in the superior temporal vascular arcade was present without exudation (Fig. ). An ultrasound B-scan was not performed due to the large exudation presented did not allow measurements properly. Autofluorescence did not show lipofuscin overlying the lesion (Fig. ). Fluorescein angiography (FA) show a vascular network with small polypoidal structures producing a serous detachment of the retina in the macular region on the surface of the tumor (Fig. ); indocyanine green angiography (ICG) showed 2 hypofluorescent lesions, correspondent with the alterations seen clinically, besides showing polypoidal lesions with minimal leakage in the late phases in the inferior lesion (Fig. ). Optical coherence tomography (OCT) showed the presence of flat subfoveal fluid, serous pigmentary epithelial detachment, and intraretinal hiperrrefletive foci support with hard exudates (Fig. ). A diagnosis of PCV associated with choroidal nevus was made. After receiving informed consent, PDT was administrated in the left eye. One month after PDT, increase in the area of exudation, hard exudates, and bleeding were observed (Fig. ). It was decided to start treatment with 1 dose of intravitreal bevacizumab and evaluate response. One month after injection, improvement was observed: less area of exudation and hard exudates, no bleeding, and improvement in visual acuity. It was decided to inject 2 additional doses of intravitreal bevacizumab with 1-month interval. At the final visit, the patient referred improvement in her visual acuity, the BCVA on her left eye rose to 0.7. Fundus examination showed less hard exudates and no bleeding (Fig. ). OCT showed no subretinal fluid, less intraretinal hiperreflective foci, and a homogeneous hiperreflective material accumulation under retinal pigmented epithelial (Fig. ). Because bleeding was reduced significantly, an ultrasound B-scan was performed, which showed a minimally elevated dome-shaped, highly reflective choroidal lesion that measured 0.9 mm × 4.11 mm (Fig. ). Follow-up FA and ICG were not performed because the patient was not able to tolerate such examinations when were performed initially. The patient was followed up during 6 months with no recurrence of exudation and final BCVA of 0.7.
pmc-6392569-1
A 71-year-old male patient was transferred to our department due to soft tissue defect in the left lower leg and infected Achilles tendinitis. The patient underwent incision and drainage of both lower legs with necrotizing fasciitis, at another hospital two months ago. Continuous wound care was performed; however, the left leg open Achilles tendinitis and soft tissue defects were not resolved. Physical examination revealed a 12 × 5 cm wound with exposed Achilles tendon over the posteromedial aspect of lower one-third of the leg (Fig. ). His wound culture grew methicillin-resistant Staphylococcus aureus (MRSA). We performed an operation with the patient placed in the supine position. All infection associated with necrotic Achilles tendon in the proximal muscle tissue was excised (Fig. ). After debridement, the patient had a 16 cm tendon defect from the muscle with the ankle joint in neutral position. He had 2 cm of the distal tendon attached to the calcaneus. We extended the skin incision to the outside of the zone of injury in the anterior aspect of the ankle, dissected anterior tibial artery and vena comitantes to perform vascular anastomosis out of injury zone. We made a template with surgical glove, which included the vascularized fascia lata for the reconstruction of Achilles tendon (Fig. ). We used the already manufactured template on the ipsilateral thigh, centering the flap over the perforator and drew the flap larger than the recipient site (Fig. ). A 14 × 7 cm ALF flap with a large piece of fascia lata (bilaterally, approximately 2 cm extra fascia is taken) was harvested (Fig. ). The donor defect was closed primarily over a silicon drain. For the reconstruction of tendon, the fascia lata was repaired first using multiple figure-eight sutures and modified Becker method[ with 4–0 prolene sutures at the separated end-to-end of the Achilles tendon. An end-to-end microvascular anastomosis was performed between the anterior tibial vessels and the flap pedicle vessels using 9–0 sutures microscopically after inserting the flap into the defect (Fig. ). Postoperatively, the ankle and leg were wrapped in a bulky dressing and immobilized with an above-knee splint and the flap was monitored intensively for 7 days. Anticoagulation therapy with prostaglandin E1 (10 μg/day) and heparin (5000 units/day) were administered for 1 week and aspirin 100 mg once a day for 4 weeks after the surgery. The flap survived completely without complications. Passive and active exercise of the ankle joint was started at 6 weeks after surgery. Subsequently, the patient underwent a graduated rehabilitation program, from a non-weight bearing exercise to partial-weight bearing exercise. Twelve weeks after the surgery, the patient was permitted full-weight bearing with gait training. At 12 months of follow-up, the patient was able to resume full daily activities, felt a little discomfort at the donor site after more than 2 h of hiking, but was able to walk without pain and without the need for support, also was able to squat, showed an ankle range of motion of 15° dorsiflexion and 45° plantar flexion, and the American Orthopaedic Foot and Ankle Society (AOFAS) score was 94 (Fig. ).
pmc-6392590-1
A lung tumor was accidentally discovered in a 54-year-old Chinese man with a 20-year history of smoking when he underwent computed tomography (CT). The patient underwent upper right lobectomy in September 2011. Immunohistochemistry indicated low squamous cell differentiation, and he was diagnosed with stage IIB disease (T2N1M0) according to the Union for International Cancer Control (7th edition). He received 4 cycles of chemotherapy with gemcitabine and cisplatin, and subsequently he was followed up every 3 months. In March 2013, follow-up CT revealed recurrent disease in the hilum of the right lung (Fig. A). He received 2 cycles of salvage chemotherapy with docetaxel and cisplatin, but follow-up CT showed disease progression. The patient received intensity-modulated radiotherapy (IMRT) at a dose of 64 Gy in 32 fractions at the locoregionally recurrent lesion (Fig. A1–3). Partial response was observed by the end of radiotherapy based on CT (Fig. B). In March 2015, the patient presented with chest distress and shortness of breath, malaise, fatigue, cough, and an enlarged tumor in the hilum of the right lung and atelectasis of almost the right lung based on CT (Fig. C). The patient refused chemotherapy and so was treated instead with salvage IMRT for local failure at a dose of 60 Gy in 30 fractions (Fig. B1–3) with the following dosimetry: left lung V5, 21%; left lung V20, 6%; maximum heart dose, 61.1 Gy; V40, 30%; V30, 39%; and maximum spinal cord dose in the dose overlap region, 23.2 Gy. The patient's respiratory symptoms improved noticeably during radiotherapy. CT revealed that the enlarged tumor in the right lung had shrunk significantly, and that the atelectasis had nearly disappeared (Fig. D). One month after this repeat radiotherapy, the patient experienced fever (37.6°C), cough, chest distress, and shortness of breath. The patient's laboratory results at that time are shown in Table . We performed serologic tests, laboratory tests for procalcitonin, and C-reactive protein, as well as sputum and blood cultures to rule out bacterial infection. Chest CT showed consolidation with air bronchogram in the hilum of the right lung and ground-glass densities in the right lower lobe and left upper lobe (Fig. A). These radiographic signs are typical of RP. As the patient required oxygen, he was diagnosed with grade III RP. The patient was immediately prescribed oxygen, anti-infectives for prophylaxis, treatments to facilitate expectoration andprevent asthma, and most importantly, intravenous methylprednisone at an initial dose of 60 mg/day. After 1 week, the patient's respiratory symptoms improved obviously, and the patchy shadow on the chest radiograph disappeared almostly (Fig. B). At this point, we cut the steroid dose in half. After another week, the steroid dose was halved again. Then the patient was switched to an equivalent dose of oral prednisolone, which was tapered and discontinued after 8 weeks. During systemic prednisolone therapy, the patient experienced systemic side effects of weight gain, hyperglycaemia, and sleep disturbance. One month after the end of oral prednisolone therapy, the patient again developed a productive cough with a low fever, chest distress, and shortness of breath. Chest CT again showed a consolidated shadow inside the irradiated volume (Fig. C), and the patient was diagnosed with recurrent RP. We administered intravenous methylprednisolone at an initial dose of 60 mg/day for 1 week, then we halved the dose for another week. The patient's symptoms improved obviously, and the patchy shadow on the chest radiograph nearly disappeared. As the patient had a history of COPD associated with chronic bronchitis, which was brought under control in 2006 using Seretide (FP 500 μg and Salm 50 μg), and as the patient had reacted adversely to previous systemic steroid therapy, we decided to give him FP (500 mg)/Salm (50 mg) twice daily for 2 months. Then the dose was halved for an additional 2 months. The patient showed no signs of tumor or RP relapse by the last follow-up in March 2018 (Fig. D).
pmc-6392636-1
A 51-year-old Japanese woman had visited our hospital 4 years earlier for pain in her left knee joint. She had no abnormal findings in blood tests and physical examination of the knee showed no abnormalities. X-rays, however, showed osteolytic lesions and periosteal reactions in the left distal femur (Fig. A). T1-weighted magnetic resonance imaging (MRI) showed focal lesions in the distal femur and iso-signal intensity of skeletal muscle, lesions were also observed in T2-weighted, and high-intensity gadolinium-enhanced images (Fig. B). Thallium scans showed high accumulation during early phase and no wash out appearance in delayed phase, with no metastatic lesions (Fig. C). Histological examination of a CT-guided needle biopsy sample resulted in a diagnosis of leiomyosarcoma of the bone. She was treated with preoperative chemotherapy, consisting of 3 cycles of doxorubicin and cisplatin and 2 cycles of ifosfamide and etoposide. Wide excision of the tumor was followed by reconstruction using an autograft frozen in liquid nitrogen, along with total knee arthroplasty (Fig. D). The resected specimen was diagnosed pathologically as a leiomyosarcoma (Fig. E). Three weeks after surgery, she was started on postoperative chemotherapy, consisting of 2 cycles of ifosfamide and etoposide. She underwent CT scans of the chest and abdomen every 3 months. The CT scan at 6 months after tumor resection revealed no focal hepatic lesions (Fig. F). Eleven months later, however, a focal lesion was detected in her right liver (S6), although there were no lung metastases (Fig. G). A 2-deoxy-2-[fluorine-18] fluoro-D-glucose integrated with computed tomography (18F-FDG-PET) scan showed accumulation of 18F in the right liver (S6), the eleventh thoracic vertebra, and the right ilium. Histologic analysis of an ultrasound-guided needle biopsy specimen of the liver focal lesion resulted in the diagnosis of a metastatic leiomyosarcoma. A partial hepatic resection was performed to remove this lesion (Fig. H). Two years later, there was no evidence of local recurrence (Fig. I). She was administered chemotherapy, consisting of gemcitabine and docetaxel, to treat the lesions in the eleventh thoracic vertebra and right ilium.
pmc-6392636-2
A 60-year-old Japanese man had been referred to our hospital at age 55 years for a mass in his left thigh. Blood tests showed no abnormalities, and his personal and family histories were not contributory. Palpation detected an elastic, hard spherical tumor, measuring 10×5 cm, and his mobility was impaired. There were no other inflammatory findings. MRI localized the tumor to the left quadriceps femoris muscle, with T1-weighted images showing iso-signal intensity of skeletal muscle, and T2-weighted images showing high signal intensity (Fig. A). An 18F-FDG-PET scan showed high accumulation of radioactivity by the tumor, but no metastases (Fig. B). Histologic examination of a needle biopsy specimen resulted in a diagnosis of leiomyosarcoma. He was treated with preoperative chemotherapy consisting of 3 courses of doxorubicin and ifosfamide. Wide excision was performed (Fig. C), with the resected specimen diagnosed pathologically as a leiomyosarcoma (Fig. D). Three weeks later, he was started on postoperative chemotherapy, consisting of 2 cycles of doxorubicin and ifosfamide. He underwent CT scans of the chest and abdomen every 3 months, with the 6-month scan showing no focal lesions of the liver (Fig. E). Three years later, however, a contrast CT scan showed a focal lesion in the medial liver between S4 and S8, despite the absence of pulmonary nodules (Fig. F). In addition, an 18F-FDG-PET scan showed accumulation only in the medial liver (Fig. G). He underwent partial hepatic resection for the hepatic focal lesion, which was diagnosed histologically as a metastasis of leiomyosarcoma (Fig. H). At his last follow-up, there was no evidence of local recurrence (Fig. I).