_id
stringlengths
7
16
description
stringlengths
55
95.2k
pmc-6433455-1
A 16-month-old male presented to the emergency department (ED) with tachypnea and dyspnea. Left-sided lymphadenopathy was found on examination, as well as a large mass was found on the lateral frontal bone just above the orbit. The patient’s mother noted that it had been growing for six weeks; and, ultrasound of the mass showed it was cystic in nature. On history, the patient had seven to eight documented ear infections within the previous year. Chest X-ray (CXR) found indications of heart failure (HF) (enlarged heart and interstitial edema typical of HF); however, echocardiogram demonstrated normal heart structure and function. Computed tomography (CT) showed hilar and subcarinal lymphadenopathy (Figure ). The patient was treated with ceftriaxone and zithromax. After treatment showed limited effectiveness (persistent infection and fever of 103°F), the patient underwent bronchoalveolar lavage (BAL). BAL indicated airways with no active infection or malignant cells; however, there were signs of inflammation. Head CT showed sharply defined lytic lesion of the left orbit region, concerning for eosinophilic granuloma or hematologic malignancy (Figure ). Biopsy was performed; immunohistochemistry was positive for CD1a, S100, CD68, and CD207 (Langerin). The patient was also positive for the BRAFV600E mutation. With this information a diagnosis LCH was confirmed and therapy was initiated with vinblastine and prednisone. After his first dose of chemotherapeutic treatment, he was discharged from the hospital. Approximately one week after initiating chemotherapy, the patient was re-admitted to the hospital with left brain stroke. Head and neck magnetic resonance imaging/magnetic resonance angiogram (MRI/MRA) found large left middle cerebral artery (MCA) territory infarction, with acute cutoff of left MCA and significant decrease in caliber of the left internal carotid artery (ICA) throughout its intracranial course (Figures -). Echocardiogram demonstrated a functionally and structurally normal heart with intact atrial septum; and, no thrombus or vegetation was noted. Following an extensive workup and ruling out all other possible causative factors, the etiology of stroke was attributed to secondary CNS vasculitis. This was possibly secondary to his primary diagnosis of LCH.
pmc-6433456-1
The following clinical case is of a 38-year-old, white female patient from the municipality of São Pedro de Alcântara, State of Santa Catarina, Brazil (South America). She worked as a part-time car mechanic and as a security guard. The patient had a long history of psoriasis since the age of 22, which was later confirmed by histopathology. She consulted many dermatologists previously, having used a large variety of topical steroidal creams that showed little benefits. During her last visit to her dermatologist, she was put on oral methotrexate 7.5 mg/week as an initial dose in association with 5 mg folic acid/day with clobetasol 0.05% cream twice a day. The patient received medical treatment through the public health care system (Sistema Único de Saude - SUS) located at Santa Teresa Dermatologic Hospital in São Pedro de Alcântara, Santa Catarina, Brazil. The patient mentioned that she showed poor results after three months of treatment. The patient felt that it was necessary to interrupt the medication by her physician due to the side effects of methotrexate (anemia, thrombocytopenia, and leukopenia). After two weeks of taking a suspension of methotrexate, the patient showed acute worsening of her condition and went to the Family Medicine Health Care Clinic (Maria Rasveiler Junckes) where she consulted another dermatologist on June 22, 2016. On initial physical examination, the patient showed signs of facial swelling (Figure ), predominantly on the right side of her face with significant "wet" edema of the upper and lower extremities (Figure ). The patient referred to having "shivers" and severe itching and joint pain with disseminated lesions notated throughout almost all her body surface. Her Psoriasis Area Severity Index (PASI) score was of 48 (Figure ). Erythrodermic psoriasis is a condition that sometimes may "throw off" the body's chemistry, causing proteinuria with fluid loss and leading to severe illness. Infection is an important aspect to be taken into consideration, which can bring upon pneumonia and congestive heart failure. The patient was monitored closely at our clinic and regular laboratory evaluations were performed to observe any significant metabolic changes. The patient was very concerned about her condition and expressed this verbally, refusing to take any immunosuppressive cytotoxic drugs, such as methotrexate, which was prescribed previously. At this moment, a low-dose naltrexone (LDN) regimen was the only "open-door" option for her and her family, due to the less aggressive side effects of methotrexate. Treatment Oral low-dose naltrexone (LDN) was prescribed at a starting dose of 4.5 mg every night with 25 mg of hydroxyzine every 12 hours, with topical colloidal oat cream every eight hours. Her vitals signs kept within normal ranges at all times and showed progressive normalization of her laboratory values. Initial renal function showed mild proteinuria with elevated serum urea and creatinine that normalized throughout the following two weeks. Her folate levels were very low as well. Congestive heart failure and infections were excluded by electrocardiogram (ECG), chest X-ray, and laboratory results. A daily follow-up was done during the first 10 days, followed by a 20-day, three-month, and, finally, six-month follow-up. Results After 10 Days of Treatment The patient showed significant improvement after 10 days of 4.5 mg of LDN orally every night. She no longer mentioned an itchy sensation and discontinued hydroxyzine at nine days of treatment. Signs of regression of the facial swelling and edema of upper and lower extremities were notable after 10 days. Like in the Metze et al. study [], LDN has been proven to eliminate these symptoms. After 20 Days of Treatment The patient showed complete improvement after 20 days of treatment with 4.5 mg of LDN orally every night and applying topical colloidal oat cream on a regular, daily basis. The Phan et al. study [] on antipruritic treatment with systemic mu-opioid receptor antagonists, such as LDN, has proven its benefits as an antipruritic agent. Noticeable reduction in facial edema (Figure ) by more than 50%, upper extremity swelling (Figure ), and considerable reduction of disseminated pruritic plaques on the skin surface (Figure ) were also evident. After Three Months and Six Months Treatment A follow-up was done at three months and six months consecutively after an acute "flare-up" episode. During the consultation, she showed complete psoriasis remission at three months (Figure ), with a Psoriasis Area Severity Index (PASI) score of 0 (Figure ). The same clinical condition was evident after six months of LDN treatment (Figure ). No side effects of LDN were referred to or observed throughout the whole treatment. Quality of life was improved dramatically by having a profound positive impact on her daily routine. The patient returned to work after 20 days of treatment. It is important to note that the patient used to work as a security corrections officer at night and worked as a car mechanic during the day. Having left her night job also played an important role in the recovery of her condition.
pmc-6433457-1
A 49-year-old Hispanic female presented to the clinic one month following a widening of a previous laminectomy for the resection of a lumbar (L) level four to five arachnoid cyst, with worsening right lower extremity radicular pain and urinary retention. The patient reported bilateral lower extremity pain but predominantly focused on the worsening right-sided radicular pain that resulted in a burning sensation down into the sole of her foot. The agonizing pain was complicating our patient’s ability to walk and urinate, as the need to strain in order to get proper function resulted in increased pain down in the right leg. She did, however, deny urinary incontinence, fecal incontinence, or motor weakness in the lower extremities. Magnetic resonance imaging (MRI) was obtained (Figures -) and revealed caterpillar-like pan-neuraxis arachnoid cysts that initially appeared to be intradurally distributed throughout her spinal canal. Two were visualized in the thoracic region, one extending from thoracic (T) level one to four and the other extending from thoracic level four to six. Two were localized to the lumbar region, one extending from lumbar level one to three, and the other extending from lumbar level four to five. Upon completion of a thorough neurological exam, our patient had full strength in both her upper and lower extremities without any pronator drift; a sensory exam indicated an intact system. However, on more special testing, we were able to elicit a positive straight leg raise on the right. Reflexes in the upper extremities were normal while bilateral patellar and Achilles reflexes were three-plus, suggesting myelopathy. MRI performed one week prior (Figure ) showed the arachnoid cyst at thoracic level four to six. It appeared to be enlarging and exerting a mass effect on the spinal cord, causing compression with flattening of the cord at thoracic level five. The arachnoid cyst at lumbar level one to three was noted to be enlarging and compressing the descending nerve roots more on the right side. A computed tomography (CT) myelogram was obtained the following day and revealed all caterpillar-like arachnoid cysts to be posterior and communicating separately with the subarachnoid space. Due to the patient’s difficulty with normal daily function, severe pain, and advanced myelopathy, she was brought urgently to the operating room the day after the CT myelogram was obtained for surgical intervention. A thoracic level four to six laminectomy was planned with the excision of an intradural arachnoid cyst with dural repair. In addition, a separate incision was made for a lumbar level one to three laminectomy, with the excision of an intradural arachnoid cyst with complex dural repair at lumbar level three, the site where the patient had a prior dural defect and was found to be leaking cerebrospinal fluid (CSF). Surprisingly, at surgery, the cysts at thoracic level four to six and lumbar level one to three were noted to be extradural in nature. In both areas, we were able to work around the curved edges of the superior mass and detect the area connecting to the midline of the dura where a small area of communication within the dura was visualized. At both the thoracic level four to six and lumbar level one to three, the caterpillar-like cysts were excised epidurally and the dura was closed watertight. Postoperative MRI (Figures -) revealed the unroofing of the thoracic level four to six and lumbar level one to three cysts, improvement in the caliber of the thecal sac and spinal cord, and resolution of the previously noted CSF leak. The patient’s postoperative course was encouraging, and she was discharged on postoperative Day 5. At the one and six-month follow-up visits, the patient endorsed the improvement of preoperative symptoms, including the resolution of right lower extremity radicular pain, urinary retention, and headaches.
pmc-6433458-1
A 50-year-old male presented with a two-month history of progressive right arm weakness and pain. The initial presenting symptom was a stiff neck with intermittent low-grade neck pain that developed into severe right shoulder pain. Several weeks after the onset of pain, he noticed diffuse right arm weakness and loss of muscle tone that persisted. Upon presentation, he reported painful paraesthesia in C6 dermatomal distribution. Motor examination found diffuse weakness in the right arm: shoulder abduction 4/5, elbow flexion 4/5, elbow extension 5/5, finger flexion 4/5. He was hyperreflexive in all extremities. Magnetic resonance imaging (MRI) of the cervical spine (Figure ) showed multilevel degeneration and stenosis most pronounced at C4-5: retrolisthesis with 5 mm right paracentral disc herniation extending into the foramen (Figure ) and C5-6: a right paracentral disc extrusion compressing the right anterior aspect of the spinal cord (Figure ). Electromyography/nerve conduction studies (EMG/NCS) demonstrated subacute right C5 and C6 radiculopathy along with chronic right C7 radiculopathy. C4-5 and C5-6 anterior cervical discectomy and fusion with placement of a titanium interbody (Spira-C, Camber Spine, Wayne, NJ) and titanium plate and screws (Depuy Spine, Raynum, MA) was performed. Postoperative course Immediately postoperatively the patient had relief of arm pain and improvements in strength and sensation. This was maintained for nine months after surgery. Two weeks postoperatively, the patient’s symptoms and neurologic function improved drastically. Greater right arm strength was noted with 5/5 strength in upper and lower extremities bilaterally. Right shoulder abduction was 5/5 and external rotation 4+. Six months postoperatively, the patient reported relief of all pain and complete recovery of strength and sensation. At the nine month follow-up, the patient remained completely asymptomatic. A lateral X-ray at four months (Figure ) showed improved alignment, resection of posterior osteophytes, and early graft incorporation. A lateral X-ray at nine months (Figure ) continued to demonstrate similar findings.
pmc-6433744-1
A 69 year-old right-handed Caucasian female was evaluated for a 15 month history of cognitive and language impairment, slurred speech, and mild weakness. Her first symptom was difficulty “getting the words out” even though she knew what she wanted to say or write. Very shortly thereafter, her voice became “strangled” sounding and progressively slurred. Interestingly, the patient denied any problems with her speech or ability to express herself until only about 2 months prior to the initial evaluation. Past history was significant for hypertension, mixed hyperlipidemia, osteoporosis, gastroesophageal reflux, cholecystectomy, and carpal tunnel syndrome release. There was no history of psychiatric disturbances, sleep problems, and drug or alcohol abuse. Although herself a non-smoker, she had been exposed to second hand smoke during her 40-year marriage to a heavy smoker. She was exposed to a variety of chemicals and toxins working as a beautician for 40 years. There was no family history of neuromuscular disorders, including motor neuron disease or ALS, Parkinson's disease, multiple sclerosis, or dementia. Medications included and antihypertensive, antacid, and anxiolytic. Laboratory investigations revealed normal CBC and differential, comprehensive metabolic profile, TSH, CRP, but elevated cholesterol and triglycerides. Serum proteins were normal except for slightly reduced IgG consistent with mild hypogammaglobulinemia of no clinical relevance. Mild secondary hyperparathyroidism was identified and paraneoplastic antibodies (anti-Hu, anti-Yo/Purkinje cell) were negative. Testing for C9orf72 gene expansion (on previously banked DNA) was negative. Electrodiagnostic testing of the right body, including cranial muscles, revealed no evidence of lower motor neuron degeneration. At baseline evaluation, neurologic deficits included lack of insight, pseudobulbar affect, severe dysphasia, dysarthria with right body predominant upper motor neuron (UMN) signs and minimally reduced revised ALS functional rating scale (ALSFRS-R) score only in the bulbar domain (6/12/12/12 = 42/48). Formal psychometric testing (see below) revealed significant expressive language problems, with mild complex attention and executive function difficulties. At follow-up evaluation 20.4 months later, neurologic decline was primarily bulbar (mixed UMN and lower motor neuron [LMN] signs), but also involved limb and respiratory functions, as reflected by decreased ALSFRS-R score across all domains (1/10/8/8 = 27/48). Rate of decline of the ALSFRS-R score over that period of time was substantial [ΔFS = −0.74, derived when the difference between the two ALSFRS-R total scores () is divided by 20.4 months]. Formal neuropsychometric testing was performed ~20 months apart (at about the same time as neuroimaging) using the same standardized tests at both time points, with some modifications at follow-up testing because of significant progression in deficits. These tests included: Wechsler Adult Intelligence Scale, 3rd Ed. (Information, Block Design, Digit Symbol, Matrix Reasoning and Symbol Search), Peabody Picture Vocabulary Test (Form IIIA), Mattis Dementia Rating Scale (Construction, Conceptualization), Boston Naming Test, Token Test, Aural Comprehension, Victoria Symptom Validity Test, Wechsler Memory Scale, 3rd Ed. (Faces), Spatial Span, Rey Auditory Verbal Learning Test, Trail Making Test (Forms A & B), Visual Form Discrimination, Figural Fluency, and Wisconsin Card Sorting Test. At baseline, the patient's performance was most notable for expressive language dysfunction. She performed poorly on a measure of confrontation naming, and qualitatively, her written statements were notable for word omissions and substitutions. The patient also had difficulty on a measure of verbal complex attention and mild difficulties on measures of set-shifting. Her performance on other neuropsychological measures, including those assessing receptive language abilities, generally fell within expectation. She did not endorse significant emotional distress but was rather defensive when responding to self-report measures, which might have suppressed these results. Compared with the baseline neuropsychological evaluation, at follow-up (20.4 months later), the patient showed a marked decline in her language and executive functions. Both expressive and receptive language capabilities declined, meaning that the patient did not reliably comprehend the syntax in sentences and was showing signs of difficulty identifying concrete nouns and verbs. Her written expression declined to a non-functional level at this point, due largely to her dysgraphia; while she appeared to know what she wanted to write, she was unable to reliably write out the word she was searching for and the result was unintelligible. The patient's memory performance and visuospatial skills showed remarkable stability when compared with the previous evaluation, as long as language function was not involved. Emotionally, the patient denied depressive symptoms on a questionnaire (though her comprehension of this was not clear) and she did not show overt signs of depression or anxiety. Over the 20.4 month period, marked decline occurred in executive functions, language (both expressive and receptive), resulting in aphasia and dysgraphia. The pattern of cognitive decline was consistent with worsening FTD, which had produced aphasia (in addition to the patient's anarthria), and was most consistent with a primary progressive aphasia (PPA) form of ALS-FTD.
pmc-6433823-1
CG is a 46-year-old, right-handed Argentinean woman with 18 years of formal education and high proficiency in Spanish (L1) and English (L2). She reported no neurological or psychiatric antecedents, and no history of familial sinistrality. She first became exposed to English at the age of two and attended a bilingual school for 7 years, where she took all subjects in Spanish and English. Later, she took private English lessons for 9 years and traveled to different countries where she mainly spoke this language. Also, during her appointment as a financial executive at an international bank in Argentina, she used her L2 daily in oral and written communications. Even after her two strokes, she reported being able to understand complex L2 materials, such as full scientific conferences. On September 9, 2011, at the age of 43, CG suffered from sudden severe headache, nausea, and loss of consciousness. During hospitalization, radiological findings revealed a subarachnoid hemorrhage (Fisher scale: grade IV; Hunt-Hess scale: grade V) due to a ruptured 5-mm fusiform aneurysm at the right medial cerebral artery which later complicated with severe vasospasm, leading to extensive damage affecting multiple RH regions, namely: the medial anterior temporal lobe (parahippocampal gyrus and amygdala), the mid and superior temporal gyri, the supramarginal and angular gyri, the inferior parietal lobule, the complete insula, a portion of the putamen, and the inferior frontal operculum (; for details on the extension of the lesion in each area and additional images highlighting the involvement of the left and right amygdala, see ). Of note, such regions have been previously related to inferencing (, ), prosody production (; ; ), and non-literal language comprehension (; ; ). She spent 41 days in intensive care and was then discharged with moderate left-sided hemiparesis. Two years later, a second (ischemic) stroke produced by a sudden reswallowing (presumably related to a previous craniotomy) induced additional damage in the LH, including the anterior insula and its underlying white matter, the putamen, and the dorso-lateral amygdala (). These regions have been implicated in bilingual processing via phonological (; ; ; ), semantic (; ) and syntactic (; ; ) tasks. Exceptionally, after clinical stabilization, CG did not show noticeable neurological, cognitive, emotional or behavioral impairments. She only reported loss of sensitivity on the right hand and a transient form of personality-color synesthesia (), which were resolved after therapy. No further signs of focal neurological deficits were reported. Formal neuropsychological evaluations after discharge (all performed in her L1) revealed high preservation of executive functions –scoring 25/30 on the INECO Frontal Screening (IFS) battery ()– and overall cognitive status –with a score of 96/100 on the Argentine adaptation of the Addenbrooke’s Cognitive Examination Revised (ACE-R) (). Comparisons of these outcomes with sociodemographically matched controls –for details, see – showed no significant differences in the IFS (Crawford’s t-test = 0.07, p = 0.94) or in the ACE-R (Crawford’s t-test = -1.17, p = 0.29).
pmc-6433840-1
An 18-year-old female was diagnosed with CVID at age six. As previously described in Chen et al. she, her mother, and younger brother were found to have a heterozygous pathogenic variant in NFKB2 that results in an autosomal dominant form of CVID (). She developed autoimmune manifestations, including acquired central adrenal insufficiency, alopecia universalis, vitiligo, and nail dystrophy. Her infectious history was significant for both bacterial and viral respiratory infections, recurrent herpes simplex of the lips and surrounding perioral skin, and chronic candidal onychomycosis. Adrenal insufficiency was treated with maintenance doses of hydrocortisone and stress dose adjustments during times of illness. Early-onset hypogammaglobulinemia required lifelong gammaglobulin replacement to prevent recurrent sinopulmonary infections. Recurrent herpes simplex infection was controlled with chronic suppressive oral valacyclovir therapy. A Luminex-based assay of the patient's plasma [1:100 dilution, as described by Ding et al. ()] identified the presence of autoantibodies against interferon-α (IFN-α) and interferon-ω (IFN-ω) (). Next, patient plasma was incubated with control peripheral blood mononuclear cells and STAT1 phosphorylation was measured by flow cytometry after incubation in unstimulated or stimulated conditions as described by Burbelo et al. (). The patient's plasma demonstrated neutralizing anti-IFN-α and IFN-ω antibodies which inhibited STAT1-phosphorylation in control cells, whereas control and parental plasma did not lead to inhibition (). The affected sibling's plasma also demonstrated neutralizing anti-IFN-α antibodies, and partial blockade of IFN-ω signaling. At 16 years of age, the patient required intensive care hospitalization for decompensated septic shock of unknown etiology requiring vasopressor support. Prior to the hospitalization she had become non-compliant with medications, including gammaglobulin replacement. She developed acute renal injury, electrolyte disturbances, and adrenal crisis secondary to sepsis of unknown etiology which required stress dosing of steroids and electrolyte replacement. During this time, hypomagnesemia resulted in torsades de pointes and prolonged QT syndrome. Her persistent renal injury required chronic daily oral electrolyte replacement to prevent recurrence of arrhythmias. Two years later, the patient presented to the emergency department with a month-long history of progressive, painful, vegetative facial lesions. The lesions initially developed periorally, similar to prior herpes simplex outbreaks. Despite increasing valacyclovir to treatment dosing, the lesions became purulent and continued to spread, involving the nose and right cheek. She was treated for presumed bacterial cellulitis with oral cefdinir. When a bacterial culture reportedly grew group B streptococcus, cefdinir was transitioned to oral clindamycin. Valacyclovir was discontinued as the lesions did not improve while on the medication. She reported tactile fevers and chills with continued progression of the vegetative lesions despite antibiotic treatment. Upon hospitalization, laboratory evaluation identified leukocytosis (neutrophils 7,000 cells/μl; lymphocytes 7,900 cells/μl) and elevated C-reactive protein (11.6 mg/dL; normal range 0–1.5 mg/dL). Natural killer (NK) cell expression of CD107a was reduced, and NK cell functional assays demonstrated reduced cytotoxicity (Cincinnati Children's Diagnostic Immunology Laboratory). Her cutaneous exam revealed exophytic, thick, yellow-brown plaques involving the bilateral nares, right oral commissure, and adjacent medial cheek. The plaques were exudative and distorted the nasal architecture (). A wound swab from the medial cheek was positive for HSV by polymerase chain reaction (PCR) assay. Other bacterial or viral infections often seen in immunodeficient patients, including varicella zoster and cytomegalovirus (CMV), were ruled out. The patient's systemic symptoms raised concern for HSV viremia, and a HSV peripheral blood PCR was positive. She did not have any neurological symptoms or meningeal signs; thus, HSV meningitis or encephalitis were not suspected. HSV type-1 was isolated from tissue culture of affected skin on the medial cheek; pathology demonstrated spongiosis and mixed granulomatous dermal infiltration with fat necrosis. Intravenous foscarnet therapy resulted in rapid improvement of her cutaneous eruption, including the associated pain, and systemic symptoms (). Slower, continued resolution occurred over several weeks (). The patient had recurrence of HSV vegetans and HSV viremia 3 months later. On this second occasion, early identification of HSV as the source of skin infection led to expedited hospitalization and early initiation of antiviral therapy. She had a significantly shorter hospital course with transition to oral valacyclovir at discharge when HSV culture demonstrated susceptibility to acyclovir.
pmc-6433848-1
An otherwise healthy 10-year-old girl was referred to the pediatric nephrology unit for further investigation and treatment of an asymptomatic stage II HTN (defined as ≥95th percentile + 12 mm Hg). The girl was born at term, after an uneventful pregnancy (birth weight 3,650 g). There were no reported post-natal complications. Family history was remarkable for treated HTN in her father since the age of 35 years. At the age of 7 years, our patient was referred to a pediatric endocrinologist for further investigation of bilateral breast development and pubic hair growth, which started 6 months earlier. On clinical examination, weight was 34 kg (+4.61 Standard Deviation Score, SDS), height 140 cm (+4.42 SDS), body mass index 17.35 kg/m2 (+1.44 SDS) and the latest annual growth was 12.6 cm/year (+7.77 SDS). Blood pressure was 99/66 mmHg (<90th percentile). She had a Tanner stage 3 breast development, a Tanner stage 3 pubic hair and a moderate axillary hair. Bone age (Greulich-Pyle) was already advanced at first visit (8 years for a chronological age of 7). Pelvic echography displayed an enlarged uterus for age (uterine volume of 5.5 ml). The right ovary was also enlarged for age (2.6 ml) with some follicles. The left ovary could not be seen due to overlying bowel gas. The magnetic resonance imaging of hypothalamus-pituitary axis (performed after the Luteinizing Hormone Releasing Hormone (LHRH) stimulation test) was normal. Estradiol level at first visit was 19 pmol/l. Central isosexual precocious puberty was confirmed with a positive LHRH stimulation test: LH peak 17.6 mU/l and Follicle Stimulation Hormone (FSH) peak 11.8 mU/l. To protect the child from a distress of the dissociation induced by a mature (pubertal) body in a psychologically and emotionally immature person, encompassing obvious differences in school and among peers, decision was taken to treat her. The patient received 3.75 mg (one set) at the onset of therapy. A second set was injected 14 days later, following strictly the recommendations provided by the manufacturer (Ferring). No allergic reaction was observed. However, an increased blood pressure was noticed after 2 months treatment (121/80 mm Hg). Blood pressure remained elevated throughout the period of treatment leading to stop it at 9.5 years, whereas the goal was to continue until 10 years. She was then referred to the nephrology clinic for an asymptomatic high blood pressure (139/85 mmHg), confirmed with an ambulatory blood pressure monitoring (ABPM). Mean day BP was 140/96 mmHg, mean night BP was 121/76 mmHg, and systolic blood pressure load was 62.5%. Clinical exam was normal and the initial workup showed no renal, thyroid, or electrolytes abnormalities. There was no proteinuria. The renal ultrasound showed no parenchymal disease and no increased renal resistance index suggestive of a renal artery stenosis. Echocardiography and fundoscopy were normal. After reading the above-mentioned case reports, we purposely postponed any antihypertensive treatment, hoping for a spontaneous normalization of her blood pressure. Indeed, 6 weeks after stopping GnRHa treatment, the girl had a normal office BP, and a normal ABPM with a mean day and night BP values of 115/76 and 108/70 mmHg, respectively.
pmc-6433933-1
A 57-year-old woman with a past medical history of hypertension, scoliosis and depression presented with 1 week of flu-like symptoms (diffuse body aches, fatigue, and chills) and generalized weakness that rapidly progressed over several days in June 2018. Her social history is significant for living in a trailer in a wooded area in Florida, living in areas close to a mix of salt and river water, and exposure to mold, rats, and bat droppings near her home. On initial neurological examination, the patient was lethargic but oriented to person, place and time. She had impaired concentration and required occasional tactile or auditory stimulus to maintain attention. There were no cranial nerve deficits. Strength was 4/5 in the bilateral upper extremities and 3/5 in the bilateral lower extremities. There were no pathologic reflexes and sensation to light touch was intact in all extremities. The patient then had a rapid deterioration requiring intubation and mechanical ventilation. Serum laboratory results and serology testing throughout the hospital course are presented in –. Ceftriaxone, acyclovir, vancomycin, and ampicillin were started due to suspicion of meningitis based on the initial clinical presentation and serum testing. Computed Tomography (CT) angiogram of the head was unremarkable. Initial MRI Brain without contrast (hospital day 1) showed abnormally increased T2 FLAIR signal in the deep gray nuclei bilaterally, most prominent in the striatum (). Blood cultures were negative throughout her hospitalization. Cerebrospinal fluid (CSF) analysis was suggestive of meningitis and is presented in . Her CSF arboviral antibody panel is shown in and was initially unremarkable except for California encephalitis IgG 1:256. Electroencephalogram (EEG) showed diffuse background slowing and rare left temporal sharp waves. On hospital day 4, neurological exam in the setting of pharmacologic sedation and mechanical ventilation was significant for a comatose state with absent brainstem reflexes except for bilateral positive corneal reflexes. She withdrew to painful stimuli in the upper extremities but not lower extremities. Continuous EEG (cEEG) eventually found evidence of non-convulsive status epilepticus (NCSE) and the patient was stabilized with levetiracetam, valproic acid, and lacosamide. Acute viral encephalitis was suspected and a 5-day course of 0.4 g/kg/day IVIg was started on hospital day 7. Results from repeat CSF arbovirus panel drawn 5 days after the first panel (hospital day 7) showed strongly positive EEE IgM titer at 1:512, and positive California encephalitis IgG at 1:64. Follow up MRI Brain with and without contrast (hospital day 8) demonstrated progressive abnormal increased T2 signal in the deep gray nuclei with restricted diffusion. There was new diffuse involvement of the cortex, most prominent in the bilateral mesial temporal lobes and the high convexities. There was also leptomeningeal and perivascular enhancement throughout the cerebral hemispheres. After completion of empirical IVIg trial, the patient continued to be in a comatose state in the absence of pharmacologic sedation. MRI Brain with and without contrast 10 days after completing IVIg (hospital day 22) showed decreased leptomeningeal and pial enhancement suggestive of decreased inflammation. There was again progressive T2 hyperintensity in the deep gray nuclei, with near complete involvement of the caudate and putamen. There were no new areas of restricted diffusion. The patient was successfully weaned off mechanical ventilation 5 weeks after empiric IVIg treatment completion. During clinic follow-up 6 weeks post-IVIg trial completion, neurological exam showed an awake state with spontaneous eye opening, presence of bilateral blink to threat, intact corneal reflexes, and withdrawal to noxious stimuli in all extremities. She was non-verbal, unable to follow simple instructions, unable to walk, and completely dependent in her activities of daily living.
pmc-6433996-1
A 59-year-old female was diagnosed with early-stage gastric cancer during health screening and admitted to our hospital for radical surgical treatment. Physical examinations and blood tests revealed nothing of note, including tumor markers. Esophagogastroduodenoscopy (EGDS) revealed that the type 0-IIc gastric cancer was located in the posterior wall of the mid-body of the stomach (Fig. a). The histological type was poorly differentiated adenocarcinoma. EGDS and CT (Fig. b) suggested that the depth of tumor invasion was the submucosal layer without lymph node swelling. The clinical stage according to the TNM 7th edition was cT1b N0 M0, cStage I. Based on preoperative examinations, we planned laparoscopic distal gastrectomy with D1+ lymph node dissection and Billroth-I reconstruction. The surgery progressed without any problems on dissection around the left gastroepiploic vessels. During the dissection of the infrapyloric area (Fig. a), a part of the pancreatic head showed unusual adherence to the first part of the duodenal wall (Fig. b). This made it difficult to safely separate the pancreatic head from the first part of the duodenal wall (Fig. c). Since we should dissect and mobilize the duodenal bulb as long as possible for Billroth-I anastomosis (delta-shaped anastomosis using linear staplers []), we converted our reconstruction plan of the Billroth-I method to Roux-en-Y. For safe and accurate lymphadenectomy without causing pancreatic injury, we deliberately focused on tracing the dissectible layer between the pancreatic parenchyma and fatty tissues, including lymph nodes (Fig. d). After distal gastrectomy, we could not find the ligament of Treitz or jejunum on the left side, below the transverse colon. Furthermore, the right-side colon had been completely mobilized to the left-side abdomen (Fig. a), and the small intestine was located in the right-side abdomen with a completely mobilized duodenum without duodeno-jejunum loop (Fig. b). We reviewed the CT image carefully during surgery, and the right-side small bowel, left-side colon sign (Fig. c), and superior mesenteric vein (SMV) inverse position (Fig. d) were confirmed. Based on these findings, we diagnosed this patient with intestinal malrotation. Although we encountered the intestinal malrotation during surgery incidentally, we could complete radical gastrectomy with Roux-en-Y reconstruction laparoscopically. We closed the defect between the Roux limb and retroperitoneum to prevent possible internal herniation. Because there was no Ladd’s ligament, we did not add Ladd’s operation. We also did not perform prophylactic appendectomy due to marked adhesion around the vermiform appendix. Upon reconstruction, it was straightforward and safe to perform gastrojejunostomy by creating a Roux limb. Furthermore, there was no transverse colon or mesentery behind the Roux limb. Therefore, we closed the defect behind the Roux limb by delicately suturing the Roux limb mesentery and retroperitoneum covering the pancreas. We also closed the mesenteric defect of the small intestine as performed in normal cases. We carefully checked and confirmed that there was no other peritoneal defect. The type of malrotation was non-rotation (90°). This patient was discharged from our hospital without any complications. According to the TNM 7th edition, the final pathological stage was pT1a, pN0(0/54), M0 pStage IA. Histological analysis revealed signet ring cell carcinoma. After a one-year outpatient follow-up, she was alive without any cancer relapse or complications.
pmc-6434000-1
A 66-year-old man, who complained of upper abdominal pain, was found to have EGJ tumor by endoscopy (Fig. ). He was diagnosed as having Siewert type II adenocarcinoma (E=G, cT1b, cN0, cM0, cStage I) []. We planned to perform lower esophagectomy and proximal gastrectomy with double tract reconstruction. In the computed tomography (CT) scan before surgery, a 10-mm aneurysm in the middle third of the splenic artery was found (Fig. ). Due to the anatomical location of the aneurysm, endovascular treatment was not considered due to recanalization and coil migration. The size of the aneurysm was not a high risk of rupture [], but we concerned about the possibility of SAA rupture due to postoperative pancreatic fistula (PF) associated with suprapancreatic lymph node dissection such as station 11p and 11d. We thought that spleen blood flow could be preserved even after SAA resection by preoperative CT scan and unnecessary invasive procedures could be avoided by simultaneous surgery. However, during simultaneous proximal gastrectomy and SAA resections, it was not clear whether there was sufficient blood supply to the spleen. Thus, we performed the surgery with a minimally invasive abdominal and left thoracic approach (MALTA) while continuously examining for the presence of blood supply to the spleen using fluorescence imaging. The patient was placed under general anesthesia and was positioned in reverse Trendelenburg with the left side of the upper body lifted and the legs spread. Laparo- and thoracoscopic proximal gastrectomy and lower esophagectomy with D1+ lymph node dissection and double tract reconstruction were performed. First, we resected the SAA. Next, laparoscopic proximal gastrectomy was performed using five ports. Four ports were inserted into the thoracic cavity through the 9th, 10th (× 2), and 11th intercostal spaces, with the patient in the same body position. Lower thoracoscopic esophagectomy and lymph node dissection of the lower mediastinum was performed under artificial pneumothorax. The lower esophagus was resected under the thoracoscopic view to ensure an adequate margin. SAA located at the distal side of the branch of the great pancreatic artery (Fig. ), so we clamped the splenic artery to preserve the great pancreatic artery temporally. Then, we injected 5 mg of indocyanine green (ICG) intravenously to the patient. Blood supply to the spleen was confirmed using fluorescence imaging (Fig. ). Therefore, we resected the SAA without splenectomy (preserving the great pancreatic artery and the spleen). Intrathoracic esophagojejunostomy was performed with a transoral anvil (OrVil™) and a circular stapler (EEA25™) using the laparo- and thoracoscopic techniques. In addition, an oblique jejunogastrostomy for double tract reconstruction was performed. The operative time was 362 min, and there was no blood loss. Histopathological diagnosis of the tumor was adenocarcinoma with enteroblastic differentiation (pTIb, pN1, pStage IIB according to the UICC Classification, 8th edition,) and with clear margins. Oral intake was resumed on postoperative day 5. Postoperative CT scan revealed the preservation of the great pancreatic artery and omental branches of the left gastroepiploic artery (Fig. ). There was no splenic abscess due to ischemia or other complications. The patient’s length of hospital stay was about a month.
pmc-6434006-1
A 65-year-old woman was admitted with right hypochondrial pain and high fever. On physical examination, her vital signs were as follows: temperature, 38.0 °C; blood pressure, 140/82 mmHg; heart rate, 80 beats per minute and regular; respiratory rate, 14/min; and peripheral capillary oxygen saturation, 98% at room air, respectively. Her consciousness was lucid and Murphy’s sign was positive. Laboratory evaluation showed an increase in inflammatory response with a white blood cell count of 23,200/mm and C-reactive protein level of 30.5 mg/dL without liver, renal, and hematological dysfunction. Abdominal ultrasonography revealed acute calculous cholecystitis with thickened wall and gallbladder stone. Magnetic resonance cholangiopancreatography (MRCP) showed that the confluence of the right and left hepatic duct was unclear (Fig. ). Under preoperative diagnosis of acute calculous cholecystitis (grade II) [], an emergency LC was planned. However, the procedure was converted to open cholecystectomy (OC) because of unclear anatomy of the cystic duct with severe inflammation at Calot’s triangle. Because identification of the cystic duct was difficult, the gallbladder was incised at the level of Hartmann’s pouch, and intraoperative cholangiography (IOC) from Hartmann’s pouch showed the main right hepatic duct entering the cystic duct (Fig. ). After identifying the aberrant bile duct, subtotal cholecystectomy was performed to avoid injuring the aberrant hepatic duct. The gallbladder neck was closed by suture and ligation without approaching the cystic duct. A postoperative complication of bile leakage from the resection stump of the gallbladder was treated by endoscopic nasobiliary drainage (Fig. ). The patient was discharged on postoperative day 25.
pmc-6434098-1
A 13-year-old young man was admitted to our hospital with non-sustained ventricular tachycardia episode, noticed during routine athletic evaluation. Resting ECG was normal, with sinus rhythm, normal heart rate in the absence of significant alterations of the ventricular repolarization phase (QTma × 413 ms, QTmin 383 ms, QTd 39 ms, QTcd 44 ms). Exercise stress test (treadmill) didn’t show signs of inducible ischemia through maximal effort (METS 21, HR max 194 beats per minutes), but induced asymptomatic non sustained ventricular tachycardia, with left bundle branch morphology an inferior axis with a rate of 150 beats per minute during the second minute of the recovery phase (). Standard echocardiographic views showed a not clearly normal coronary pattern. Indeed, the right coronary artery appeared with high take-off from the aortic wall, without clear identification of right coronary artery ostium. As a result of genetic screening for catecholaminergic tachycardia, beta-blocking therapy with nadolol was started and continued until the first cardiological follow up. In order to exclude the presence of a possible coronary artery anomaly and disease, coronary computed tomography angiography was performed. The scan showed anomalous origin of the all three branches of coronary arteries of a single origin from left coronary sinus with malignant course of the right coronary artery, squeezed between the pulmonary trunk and the proximal ascending aorta. The distal part of the artery took its normal course. The left anterior descending artery and the circumflex artery calibers appeared to be normal. All the data were confirmed by cardiac magnetic resonance (). Myocardial scintigraphy with protocol of two days steps and treadmill stress test (exercise) was performed, without significant evidences of perfusion defects. Catheter coronary angiography was performed to decide the tailored treatment plan. The coronary angiography showed the rare coronary anomaly pattern (). Furthermore, the exam showed a significant milking effect at the middle segment of the left anterior descending artery, with borderline value of indices of intracoronary pressure and coronary flow reserve measured by Fractional Flow Reserve (FFR 0,74) and invasive Fractional Flow Reserve (iFFR 0,83) analysis. On intravascular ultrasound (IVUS) both a slit like right coronary ostium and eccentric systolic compression in the proximal bridge segment of vessel were evident. The depth and the length of the bridging muscle segment were measured as 16 mm and 25 mm, respectively (). Planned on pump surgery was discussed. We performed a surgical unroofing of the right coronary artery intramural section and resuspension of the intercoronary commissure, that resulted in relocation of the coronary artery into the appropriate aortic sinus. Surgical myotomy involving resection of the overlying muscle fibers on middle segment of the left anterior descending artery was performed. The patient's postoperative course was uneventful. He stayed overnight in the intensive care unit and left the hospital on postoperative day 7. No complications occurred during the first six months of follow-up.
pmc-6434289-1
A 36-year-old woman developed a painless cyst on the inner right labium majus at approximately 6 months of gestation which remained stable during the rest of the pregnancy. She delivered by cesarean section and the cyst was excised two months later, at which time she was breastfeeding. The excision comprised multiple irregular pieces of pale tan tissue up to 1.3cm in aggregate. Microscopic examination showed a disrupted tumor with morphologically variable but intermingled areas (). Much of the tumor demonstrated hidradenoma papilliferum type architecture with papillary and glandular areas in which the surface/luminal lining cells were bland cuboidal to low columnar with round to oval hyperchromatic nuclei, absent nucleoli, and scant eosinophilic cytoplasm (). Apical snouts were evident in areas (). Elsewhere closely packed small tubules were associated with desmoplastic and hyalinized stroma (Figures and ). Other glandular spaces showed cells with abundant pale multivacuolated cytoplasm similar to mammary lactational change (). The features were those of a mammary-like gland tumor showing hidradenoma papilliferum-like areas, tubular adenoma features, and lactational change. No definite nonneoplastic mammary-like glands were noted in the peritumoral tissue. Immunohistochemistry showed diffuse positivity for CK7, CK18, and GATA3, the latter two weaker in the lactational areas. There was patchy positivity for estrogen receptor (ER) throughout the lesion () whilst androgen receptor (AR) showed patchy staining in the nonlactational areas (). Very occasional cells were positive for progesterone receptor (PR) and there was focal staining for GCDFP-15 (). Calponin and p63 highlighted the basal myoepithelial cells. There was variable staining for MIB-1 with foci of increased activity which generally corresponded to CK5 positive areas that had an elongated ductal or tubular morphology.
pmc-6434298-1
A 12-year-old boy was referred to our hospital with an acute injury of the left knee that had occurred while playing soccer. Slight swelling and pain at the knee were observed. Assessment of active range of motion was impossible due to pain. The patient had no history of chronic medication or Osgood-Schlatter disease. Radiographs and computed tomography (CT) showed small flecks of bone at the proximal tibial tuberosity (). Magnetic resonance imaging (MRI) revealed swelling and loosening of the patellar tendon (). We also recognized patella alta in comparison with the right knee with a Sugimoto index of 1.36 [] (). Based on these clinical and radiological findings, we diagnosed patellar tendon avulsion with a tibial tuberosity sleeve fragment and determined that surgery was required. Surgery was performed 9 days after the injury. During the operation, we found that the patellar tendon was avulsed with a sleeve fragment from the tibial tuberosity (). The avulsed tendon was repaired using two suture anchors, and the fragment including cartilage was attached by the tension band wiring method (). After the fixation, the height of the left patella was fluoroscopically confirmed to be at the same level as the right patella. The knee was immobilized by casting with a slightly flexed knee position for 3 weeks. After 3 weeks, rehabilitation of active and passive range of motion was started. The K-wire and soft wire were removed 4 months after the surgery. At 6 months postoperatively, active range of motion of the knee was equal to that of the contralateral side without pain. At the 1-year follow-up, no complication was observed.
pmc-6434302-1
This 42-year-old female, with no known comorbids, presented to us with complaints of anterior neck swelling, more on the right side which has gradually increased in size over the last 5 years accompanied with shortness of breath especially while climbing stairs which has progressively worsened since the onset of symptoms. She had no complains of dysphonia or dysphagia. On examination, a right anterior neck swelling was present which was firm, approximately 3 × 3 cm in size, nontender, noncompressible, and appears nodular, with overlying skin normal. The rest of the systemic examination was normal. She underwent fine needle aspiration biopsy which showed a benign thyroidal swelling. Computed tomography scan was done which showed large, well circumscribed, multinodular goiter with extension of right lobe and isthmus to superior mediastinum with a size of 8.8 × 6.5 × 4.5 cm (). She was admitted electively and underwent total thyroidectomy with excision of mediastinal component. Initially, thyroid was mobilized with transverse neck incision. Subsequently, the sternotomy was performed and the retrosternal component that was adherent to innominate vein and mediastinal fat was mobilized. The intraoperative findings were enlarged right lobe of thyroid of about 8 × 6 cm and left lobe of about 4 × 3 cm in size. The mass appeared in continuity from neck to mediastinum but separately capsulated sizing to 5 × 5 cm. The postoperative course was unremarkable, and she was discharged on the 3rd postoperative day. She was found to be doing well up to six-week follow-up, and her histopathology revealed benign nodular hyperplasia of thyroid with adenomatous nodules in the mediastinal thyroid. She was referred to endocrinology service for further management.
pmc-6434302-2
This patient is a 68-year-old female, known case of hypertension for the last eight years, presented to us with complaints of anterior neck swelling for about 40 years which had gradually started increasing in size for the last four years. She developed progressive difficulty in swallowing and breathing for the last three months. On examination, there was a presence of large neck swelling, multinodular, which moved on deglutition, with lower limit of swelling not palpable. Prominent dilated veins were appreciated on the neck. A computed tomography scan was done which showed enlarged thyroid with multiple internal calcifications and retrosternal extension up to the level of ascending aorta with multiple collateral vascular channels around mass lesion in anterior mediastinum (). She also underwent total thyroidectomy, sternotomy, and excision of mass lesion. The intraoperative findings were enlarged multinodular goiter with thyroid gland reaching the manubrium. The mediastinal component was also large and separately capsulated from cervical component, extending up to the arch of aorta and superior vena cava with compression of brachiocephalic vein (). The mass was carefully dissected from the above vessels. Specimen was sent for histopathology. Postoperatively, the patient remained well. She was given intravenous analgesia and deep venous thrombosis prophylaxis. She developed respiratory distress on 2nd post-op day, and a chest X-ray showed elevation of the right hemidiaphragm (most likely due to iatrogenic right phrenic nerve injury) and right lower lobe atelectasis and hence was shifted to the intensive care unit for observation. She was managed conservatively with chest physiotherapy, nebulizers, and application of BIPAP. She responded to supportive therapy and recovered well. She also developed asymptomatic hypocalcaemia and was managed with both intravenous and oral replacement. She was discharged from the hospital on eighth postoperative day. She did well on follow-ups. She was kept on oral thyroxin and calcium. Her histopathology revealed benign nodular hyperplasia with degenerative changes in both tissues with lymph nodes showing benign reactive changes. Both tissues were negative for malignancy. She was also advised to continue regular follow-ups in endocrinology clinic for further management.
pmc-6434310-1
A 76-year-old female presented with a 2-day history of easy bruising and bleeding from her mouth. She denied epistaxis, melena, hematochezia, hematuria, or other bleeding manifestations. She had estrogen receptor positive stage 1 breast cancer 24 years ago for which she underwent lumpectomy followed by tamoxifen for 5 years. She has had regular mammograms since then, and there has been no evidence of local disease recurrence. Fourteen years ago, she was diagnosed with Waldenstrom's macroglobulinemia for which she was treated with chlorambucil and prednisone for 3 months with significant improvement. Her plasma cell dyscrasia has been quiescent. M-spike on serum protein electrophoresis was minimal. She had intermittent hospitalizations for pneumonia, thought to be related to functional immunoglobulin deficiency. She was on intravenous immunoglobulin replacement for 6 months, but it was discontinued later. Three years ago, she presented with pleural and pericardial effusions, and pleural biopsy showed activated B-cell (ABC) diffuse large B-cell lymphoma (DLBCL). A PET scan showed uptake in the pleural space with no lymphadenopathy. A bone marrow biopsy showed no evidence of DLBCL, and she was treated with rituximab and bendamustine for 3 months and remained in remission for the next three years. Four weeks prior to the current admission, she presented with fatigue, night sweats, and 10-pound weight loss and was found to have retroperitoneal lymphadenopathy. She underwent CT-guided core biopsy of the retroperitoneal nodes that confirmed recurrence of her DLBCL. A repeat bone marrow biopsy showed normocellular bone marrow with progressive trilineage hematopoiesis, but no evidence of DLBCL. She was scheduled to start salvage therapy for DLBCL with rituximab and lenalidomide. Viral hepatitis serologies were performed prior to initiation of rituximab, showing evidence of prior hepatitis B infection (IgG anti-HBc antibody). She was therefore started on prophylactic entecavir 0.5 mg daily 5 days prior to the current admission. Other medical problems included diabetes mellitus, hypertension, atrial fibrillation, gout, hypothyroidism, hyperlipidemia, and osteoporosis. Her other medications besides entecavir included allopurinol, amiodarone, rosuvastatin, diltiazem, pantoprazole, dabigatran, ramipril, and levothyroxine. No recent change in these medications had occurred. On physical examination, her temperature was 98.3°F with blood pressure 100/68 mmHg, pulse 90 beats per min, and respiratory rate 18 per minute. She looked tired but had no pallor, icterus, or generalized lymphadenopathy. The anterior nares were clear without epistaxis. Mucous membranes were moist, and the oropharynx revealed two scabs in the buccal mucosa with dried blood. She had normal S1 and S2 without any rubs, murmurs or gallops, and normal vesicular breath sounds. Her abdomen was soft and nontender without hepatosplenomegaly or ascites. Skin was warm and dry without petechia, purpura, or ecchymosis. The rest of the physical exam was unremarkable. Complete blood count showed thrombocytopenia with a platelet count of 7000/mm3. Peripheral blood smear showed no evidence of platelet clumping. The hemoglobin and white blood cell counts were normal. Thyroid function tests and a coagulation profile were essentially normal. Her last recorded platelet count 10 days prior to starting entecavir was 136,000/mm3. Her baseline platelet count range is between 120,000 and 150,000/mm3. Entecavir was discontinued, but her other drugs were continued. She received 3 units of platelets followed by intravenous immunoglobulin (1 g/kg) for 5 consecutive days. Her platelet counts improved and normalized in one week (). She then received lenalidomide and rituximab for her DLBCL, but did not receive any HBV prophylaxis as it was considered unsafe to expose her to any of the other nucleoside analogues.
pmc-6434437-1
A 27-year-old previously fit man presented acutely to our hospital Emergency Department with sudden onset of diplopia, dysarthria, facial drooping and vomiting. This was preceded by a week of general malaise with progressively worsening headache and nausea. Two years earlier, he complained of recurrent oral and genital ulcers for which he had been prescribed oral antibiotics. On examination, he was noted to have fever of 37.9℃, nuchal rigidity, mild right upper and lower limb weakness (Power 4/5), right upper facial nerve palsy and right abducens nerve paresis. There were no other neurological abnormalities of note, and the rest of the clinical examination was otherwise unremarkable. The initial investigations included mildly raised inflammatory markers with a C-reactive protein of 23 mg/dL and an erythrocyte sedimentation rate of 29 mm/h. The CT brain was unremarkable (). T2-weighted brain MRI scan was then undertaken, and this revealed a large lesion involving the pons and the medulla, with mild mass effect and ring enhancement (). Initial blood cultures grew Streptococcus parasanguis and Streptococcus mitis in one out of two bottles. Lumbar puncture sample was clear and colourless. Cerebrospinal fluid analysis revealed a raised cell count with a 95% lymphocytosis (240 × 106/L) and raised protein level at 1.41 g/L, but no organisms or oligoclonal bands were detected. Based on the above results, the patient was empirically treated with intravenous Ceftriaxone, Vancomycin, Meropenem, Aciclovir and Amphotericin B. Despite broad spectrum pharmacotherapy, the patient deteriorated over the subsequent 72 hours with the development of dysarthria, dysphagia coupled with poor pharyngeal sensation and ataxic gait, in keeping with progressive bulbar dysfunction. Due to poor respiratory effort and declining consciousness, he required intensive care unit admission for tracheostomy and invasive ventilation. Given the previous history of oro-genital ulceration, a presumptive differential diagnosis of Neuro-Behçet’s Disease was made and the earlier positive blood cultures (in the context of repeated sterile blood cultures thereafter) were felt likely to be contaminants. The patient was transferred to a tertiary centre Neuro intensive care unit for specialist management. Prompt initiation of aggressive intravenous immunosuppression with methyl-prednisolone and cyclophosphamide resulted in dramatic clinical improvement, allowing respiratory weaning after 72 hours. Six months after the initial presentation, he remains asymptomatic with no neurological deficit, having completed a six-month regimen of oral methotrexate and prednisolone. There was a parallel resolution of radiological abnormalities ().
pmc-6434613-1
A 69-year-old Japanese woman who had been undergoing cancer treatment for advanced LAC was admitted to our hospital in January 2018 because of anorexia, fatigue, and general weakness. The patient had a maternal family history of esophageal cancer. The patient had been a housewife since her 20s, had never smoked cigarettes, and did not have a drinking habit. The patient’s medical history was unremarkable until June 2016, when an abnormal x-ray shadow was found in her right lung. A computed tomographic (CT) scan revealed a tumor (3.1 cm) in the upper lobe of her right lung (Fig. a), right hilar and mediastinal lymph node swellings, and liver tumors. A transbronchoscopic biopsy from the lung tumor revealed LAC with vascular invasion (Fig. ). IHC revealed no anaplastic lymphoma kinase rearrangement, and a genetic analysis of the cancer cells detected no epidermal growth factor receptor mutation. Whole-body technetium-99m methylene diphosphonate scintigraphy revealed multiple lesions at the thoracic and lumbar vertebrae, sternum, ilium, and right ischial bones. Brain magnetic resonance imaging (MRI) revealed tumors in the left temporal lobe and right cerebellar hemisphere (Fig. b). As a result, the patient was diagnosed with LAC with distant metastases to the brain, liver, and bones (cT2aN2M1b, stage IV) []. The patient underwent stereotactic radiation surgery (total, 22 Gy) for her metastatic brain tumors in July 2016. Thereafter, she received four courses of chemotherapy with intravenous cisplatin, pemetrexed, and bevacizumab from July 2016 to October 2016; this treatment regimen effectively controlled her advanced LAC with a Response Evaluation Criteria in Solid Tumors (RECIST) classification of partial response []. The patient subsequently received nine courses of maintenance chemotherapy with intravenous pemetrexed and bevacizumab from November 2016 to April 2017. CT scans performed in May 2017 revealed no progression of the primary LAC or metastatic brain and bone lesions, but they showed evidence of progression of the metastatic liver tumors. Subsequently, the patient began second-line chemotherapy with intravenous nivolumab (133 mg [3 mg/kg] every 2 weeks) in May 2017 (Fig. ). Thyroid function was routinely monitored in July 2017 after five courses of nivolumab therapy, and she showed high levels of serum free thyroxine (FT4, 1.91 ng/dl) and low levels of thyroid-stimulating hormone (TSH, 0.04 μIU/ml). The patient had no symptoms of thyrotoxicosis or exophthalmos but had mild and soft struma without any pain or fever. Ultrasonography revealed rough and mildly low echogenicity in a slightly enlarged thyroid gland without a tumor (Fig. a, b), and technetium-99m pertechnetate thyroid scintigraphy revealed a low thyroid uptake of 0.1% (reference range, 0.5–4%) in the entire thyroid gland (Fig. c). The patient had negative test results for TSH-binding inhibitory immunoglobulin (TBII), thyroglobulin autoantibody (TgAb), and thyroid peroxidase autoantibody (TPOAb). On the basis of these findings, she was diagnosed with painless thyroiditis induced by nivolumab and was closely followed without medication. The patient exhibited primary hypothyroidism (FT4, 0.66 ng/dl; TSH, 11.41 μIU/ml) in September 2017 and initiated thyroid hormone replacement therapy with oral levothyroxine (50 μg/day). Because the CT scans performed after the sixth cycle of nivolumab revealed enlargements of the metastatic liver tumors, nivolumab therapy was discontinued in August 2017. The patient received three courses of third-line chemotherapy with docetaxel and ramucirumab beginning in September 2017, which effectively controlled her LAC (RECIST classification of partial response), but this treatment was terminated in October 2017 because of side effects, such as joint pain and rhabdomyolysis. The patient did not consent to continue anticancer drug therapy after considering the potential benefits and side effects, and she chose to receive best supportive care. In November 2017, the patient’s body weight, blood pressure, and pulse rate were 45 kg, 121/67 mmHg, and 76 beats per minute, respectively. She had normal levels of serum electrolytes (sodium 140 mEq/L, potassium 4.3 mEq/L, and chloride 106 mEq/L). However, the patient developed acute anorexia, fatigue, and general weakness in December 2017 and was admitted to the Department of Respiratory Medicine at our hospital in January 2018. On admission, the patient had clear consciousness and did not complain of headache, abdominal pain, diarrhea, or joint and muscle pain. Her height, body weight, body temperature, blood pressure, and pulse rate were 153 cm, 38 kg, 36.9 °C, 90/54 mmHg, and 73 beats per minute, respectively. She had mild and soft goiter without pain. No heart murmur, chest rales, rash, vitiligo, skin pigmentation, or peripheral edema was detected. No paralysis, cerebellar ataxia, pyramidal or extrapyramidal tract symptoms, visual disturbance, hearing loss, dysarthria, or epileptic seizures were found. A blood analysis revealed hyponatremia (serum sodium 124 mEq/L); asymptomatic hypoglycemia (fasting plasma glucose 65 mg/dl); and low levels of immunoreactive insulin (< 0.2 μU/ml), ACTH (2.6 pg/ml), and cortisol (< 0.2 μg/dl) (Table ). Because AI was suspected, oral levothyroxine was discontinued on day 2 of admission because hormone replacement therapy with thyroid hormone alone can exaggerate AI symptoms when hypothyroidism and AI coexist. The patient was referred to the Department of Endocrinology and Metabolism on day 5 of admission. A rapid cosyntropin stimulation test suggested secondary AI (Table ). Dynamic tests assessing the secretion of pituitary hormones showed the normal release of growth hormone (GH), TSH, and prolactin; age-appropriate release of luteinizing hormone and follicle-stimulating hormone; but no ACTH release following a corticotropin-releasing hormone load (Table ). A GH-releasing peptide 2 loading test also showed no ACTH release, whereas GH release was sufficient (Table ). These findings were indicative of IAD. A brain MRI study revealed slight atrophy of the anterior pituitary with a pituitary height of 2.2 mm (Fig. ). The patient had negative test results for anti-pituitary cell antibody, TgAb, TPOAb, and TBII as well as other organ-specific autoantibodies, including glutamic acid decarboxylase autoantibody, insulin autoantibody, gastric parietal cell autoantibody, intrinsic factor autoantibody, adrenocortical autoantibody, antinuclear antibody, Sjögren’s syndrome A and B antibodies, anti-citrullinated peptide antibody, and rheumatoid factor. Human leukocyte antigen (HLA) typing revealed the presence of A*08:01/12:02, B*48:01/52:01, and C*08:01/12:02 class I genes and DRB1*04:05/09:01, DQB1*03:03/04:01, DQA1*03:02/03:03, and DPB1*04:02/14:01 class II genes. The patient began corticosteroid replacement therapy with oral hydrocortisone (15 mg/day) for AI secondary to IAD on the afternoon of day 8 of admission. Subsequently, she resumed oral levothyroxine (50 μg/day) for primary hypothyroidism on day 9 of admission. The patient experienced improvements in anorexia, fatigue, and general weakness and became ambulatory within days. Her hyponatremia was corrected within 1 week, and her hypoglycemia was resolved. Laboratory data obtained on day 21 of admission showed normal levels of serum sodium (140 mEq/L), potassium (4.3 mEq/L), chloride (106 mEq/L), FT4 (1.60 ng/dl), TSH (3.28 μIU/ml), and fasting plasma glucose (78 mg/dl). The patient was discharged on day 25 of admission. The subsequent clinical course of the patient was mostly uneventful for 6 months after discharge. As her LAC progressed, her ability to perform activities of daily living decreased, and in November 2018, she was transferred to a local hospital to receive terminal care.
pmc-6434622-1
The patient is a 24-year-old male with no prior trauma who presented with a 7 year history of forefoot pain placed on several over-the-counter drugs and other conservative treatments including percutaneous therapy. The patient recalled steroid injection and intralesional sclerotherapy three years prior to her admission with no relief. Physical examination demonstrated a firm mass on the plantar surface of the first intermetatarsal space (IMS) without motor nor sensory deficit. Vascular examination was unremarkable. Plain x-ray demonstrated a soft tissue widening of the 1st IMS with phleboliths (Fig. ). The surrounding bony structures of the forefoot were unaffected. Magnetic Resonance Imaging (MRI) demonstrated a hypo intense lesion on T1 weighted sequence taking up the plantar surface of the left foot.. There was peripheral heterogeneous enhancement after gadolinium injection. The lesion was multi-lobulated, measuring 30 × 22 mm, with intermediate intensity and contained several separations on T2 weighted and fat suppression sequences. The lesion had completely taken up the 1st IMS displacing the soft tissues of the midfoot without any signs of infiltration (Fig. ). The patient underwent surgery after written and informed consent was obtained. A plantar longitudinal approach across the 1st interosseous metatarsal space was undertaken. After careful dissection, an intramuscular tumor taking up the interosseous muscles was excised. (Fig. ). Immediate postoperative recovery was uneventful. Pathology examination of the surgical specimen demonstrated an intramuscular hemangioma without any signs of malignancy. Patient has no signs of local recurrence or functional impairment of the foot at the last follow-up, 3 years after complete excision.
pmc-6434671-1
A 13 year 7 month-old male patient, during permanent dentition phase, presented with the chief complaint of a prolonged retention of the right upper primary canine without signs of mobility. He also complained about the “crooked smile,” where the right side was lower than the left side. Overall health signs showed no alterations. He reported a dental trauma in childhood, with the avulsion of the upper right primary incisor, followed by a nail-biting habit. No family history of dental impactions or severe dental ectopic events. Patient presented poor oral hygiene standards.
pmc-6434673-1
The patient was a 24-year-old woman who previously underwent orthodontic treatment for 3 years. The patient was unsatisfied with the incorrect angulation and excessive proclination of the anterior teeth, with crowding on the lower arch. Facial analysis revealed a convex profile and mandibular asymmetry, with deviation to the right side, which probably provoked an asymmetry on the upper arch. The analysis of the midline showed a 3-mm deviation in comparison with the facial midline, with angulation of the anterior teeth to the right side. Analysis of the intraoral photographs showed a Class I relationship on both sides (). On this basis, one of the treatment options for this case was four premolar extractions. This option would encompass almost all the necessities of the case. However, the occlusal plane canting would remain uncorrected. Furthermore, the patient refused the extractions due to the spaces that would be created before closing with orthodontic mechanics. Thus, the best option considered was the use of skeletal anchorage to level the occlusal plane and obtain spaces to reduce the projection of the incisors and eliminate crowding in the lower arch. Standard Edgewise brackets with 0.022 × 0.028-in slots were bonded on the upper and lower arches, except for the lower incisors. Alignment and leveling were performed from the 0.012 and 0.014-in nickel-titanium archwires through the 0.016, 0.018, and 0.020-in stainless steel archwires up to rectangular 0.019 × 0.025-in archwires. At this moment, four miniplates were positioned, one in each posterior region of the quadrants, and the intrusion on the left side of the upper arch started with elastomeric chains connected directly from the miniplate to the arch, with 200 g/f. After one month, the retraction of both arches with elastics connected from the miniplates to hooks welded over the arches was started. Three months after initiating the retraction, the lower incisors were bonded, and an overlaid 0.012-in nickel-titanium archwire was inserted to align and level the teeth. The treatment progressed until correction of the upper occlusal plane, and at this moment, this arch was stabilized with metal ligatures connected to the miniplate. The patient was instructed to use intermaxillary elastics directly connected to the miniplate in the upper arch and to the lower teeth, to promote the lower dentition extrusion on the left side (). After the extrusion of the lower arch, the treatment was stabilized for 4 months before debonding. The final results of the treatment are shown in .
pmc-6434673-2
A 48-year-old woman sought for orthodontic retreatment, complaining about unaesthetic smile. The facial analysis revealed an increased lower third height, and the patient presented no passive lip seal. The profile was convex, and the smile aesthetics was impaired due to occlusal plane canting associated to incorrect angulation of the anterior teeth to the right side. Intraoral photographs showed: Class III relationship and crossbite on the right side; Class II relationship on the left side; upper midline deviated 1.5 mm to the right, and edge-to-edge relationship among incisors. The patient received implant-prosthetic rehabilitation on the right maxillary first molar, right maxillary lateral incisor, and left mandibular first molar (Figs 12 and 13). The first alternative considered was the surgical correction of the occlusal plane canting through the maxillary impaction on the left side and mandibular surgical rotation, which could lead to a counterclockwise rotation of the mandible, reducing the facial height and profile convexity. However, the patient refused the orthognathic surgery. Thus, this option was discarded. The second option considered was the combination of intrusion on the maxillary left side and mandibular right side with the aid of miniplates. This alternative could provoke the mandibular counterclockwise rotation and reduce the facial vertical pattern. Moreover, the Class III relationship would be corrected by means of distalization on the right side, eliminating the anterior edge-to-edge relationship, whereas the lower left second molar would be uprighted and supported by the implant on the first molar. The patient chose this treatment option. The treatment started with alignment and leveling with 0.012 and 0.014-in nickel-titanium archwires, followed by 0.016 to 0.019 × 0.025-in stainless steel archwires with 0.022 × 0.028-in ceramic standard Edgewise brackets. After six months, a TPB was installed on the upper arch, and the patient was referred to a maxillofacial surgeon to insert a miniplate on the zygomatic area on the left side of the maxilla and on the external oblique ridge on the right side of the mandible. One month after the surgery, power arms were adapted on the tubes fitted to the miniplates, and elastomeric chains were connected from the power arms to the archwire. Only an intrusion force was present on the upper arch, whereas on the lower arch, intrusion and retraction forces were delivered by the elastics, to correct the Class III relationship and anterior crossbite. On the lower arch, the lingual arch was discarded due to the implant on the left side; the implant was used with a contracted archwire during the intrusion, avoiding the overexpansion of the arch on the right side. After 4 months of intrusion, the posterior occlusal plane canting was almost totally corrected. However, the upper arch presented occlusal plane canting that was localized mainly on the left side of the anterior region. Therefore, a cantilever made with 0.017 × 0.025-in titanium-molybdenum wire was inserted in the bracket of the upper right lateral incisor, which was an implant, and connected to the region between the upper left lateral incisor and canine, with an intrusion force of 100 g/f. Then, the lower arch would be extruded on the left side. The option was bonding another bracket over the buccal surface of the mandibular left first molar, which was also an implant, and connecting a similar cantilever to the maxillary arch, delivering an extrusion force of 100 g/f. Another step was performed on the posterior region of the arch, close to the implant, provoking an extrusion of the premolar region (). Four months after the orthodontic treatment, the patient was referred to perform a gingival surgery from the maxillary right second premolar to the maxillary left premolar, increasing the crown lengthening and establishing symmetry among the gingival contour of the maxillary teeth, and after the surgery, the patient started her aesthetic rehabilitation. The final results can be observed in .
pmc-6434673-3
A 32-year-old woman sought for orthodontic treatment, complaining about the crowding on the anterior region of the mandibular arch. The smile analysis revealed an occlusal plane canting, with more gingiva displayed on the left side. Intraoral analysis showed: Class I molar relationship, slight Class III canine relationship, correct upper midline (measured in the papilla), and lower midline deviated 2 mm to the right. The lower arch discrepancy was -7 mm, and the upper arch discrepancy totaled -2 mm. Analysis of Bolton discrepancy revealed a 2-mm excess on the anterior region of the lower arch (). The treatment plan involved intrusion of the upper left side with mini-implant positioned between the premolars, as the initial periapical radiography showed a good space on that region. Given the increased lower discrepancy and the Bolton discrepancy with lower excess, the decision was to extract tooth #41 and close the space with tooth #31 in the midline. Treatment started with bonding of standard Edgewise brackets on both arches and extraction of tooth #41. Alignment and leveling were performed with rounded nickel-titanium archwires until the 0.019 × 0.025-in stainless steel archwires. At this moment, a mini-implant was inserted between teeth #24 and #25, and a small force (50 g/f) was immediately applied from the mini-implant to the upper arch with an elastic chain. One month after, the force was increased to 200 g/f, and the intrusion was monitored monthly. After three months, canting of the upper arch was corrected; this arch was stabilized with metallic ligatures, as shown in Figure 17. To promote the lower teeth extrusion, intermaxillary elastics (3/8-in) were connected from the upper to the lower teeth, in the shape of an "M'. After correcting the lower arch cant, the treatment was stabilized for four more months before the removal. After the orthodontic treatment, the patient underwent oral rehabilitation with the new prosthesis and restorations ().
pmc-6434803-1
A 69-year-old woman was seen in follow-up at an outpatient orthopaedic clinic approximately 10 weeks after completing a 3-month course of antibiotic therapy for a right knee PJI due to Brucella suis, as reported previously []. She completely recovered following treatment of her B. suis PJI, but noted onset of acutely worsening right knee pain, warmth, and overlying redness 1 day prior to her scheduled follow-up. She was afebrile and systemically well. An original total arthroplasty of the right knee was performed 12 years prior and she was diagnosed with a B. suis PJI after multiple synovial fluid aspirates grew the organism in 2015. She underwent irrigation and debridement with removal of all prosthetic components and implantation of a gentamicin, vancomycin, and ceftazidime impregnated static cement spacer. She completed 10 days of intravenous aminoglycoside therapy (initially tobramycin and then gentamicin) combined with oral doxycycline and rifampin. Oral antibiotics were continued for a total of 12 weeks. On initial follow-up, she had improved knee pain, no fever, normalization of inflammatory markers and a healed surgical wound. The patient’s past medical history was otherwise significant for obesity, hypertension, gastroesophageal reflux disease and osteoarthritis with chronic back pain. Her medications were hydrochlorothiazide, ramipril, and pantoprazole. She had no known allergies. The patient lives on a remote island in the Canadian Arctic and works as an artist. She would regularly butcher wild meat (including caribou, muskox, seal and fish) and often consumed the meat and fish raw. On physical examination, she was non-toxic and afebrile. Her right knee was swollen and erythematous. She had a static cement spacer at the time of this assessment and was not able to perform range of motion. There was no apparent drainage or visible sinus tracts on the right knee. The remainder of her physical examination was unremarkable. Radiographs of the right knee revealed that the position of the intramedullary pins and large spacer was unchanged with no skeletal changes, however diffuse soft tissue swelling was evident. Erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) had risen from normal levels 3 months earlier to 49 mm/h and 171.4 mg/L respectively. Complete blood count did not show leukocytosis or neutrophilia. Serum creatinine was 66 μmol/L. A repeat Brucella IgG plus IgM standard agglutination assay performed in the previous month was negative with a titre of < 1:40. Given the clinical suspicion for recurrent PJI, a right knee arthrocentesis was performed in the orthopaedic outpatient clinic, which revealed a synovial fluid white blood cell count of 25,330 × 106/L comprised of 87% polymorphonuclear cells. No organisms were seen on direct gram stain of the fluid. A gram-positive bacillus was reported to be growing from liquid media culture 2 days after collection. The patient was taken back to the operating room the following day where she had irrigation and debridement of the right knee with removal of the previous prosthetic components and reinsertion of a static cement spacer with 3.6 g of tobramycin per bag of polymethylmethacrylate bone cement. Three bags of cement were used. No preoperative antibiotics were given. Once intra-operative tissue specimens had been collected, 2 g of cefazolin IV were given. The organism recovered from the pre-operative knee aspirate was confirmed as E. rhusiopathiae by 16S rRNA sequencing at the Provincial Laboratory for Public Health in Edmonton, Canada. This organism was also seen on direct gram stain and eventually isolated from all 5 intraoperative tissue specimens. Whole genome sequencing was performed on two of these isolates using the Illumina MiSeq platform. The 250 bp paired-end reads were assembled de novo using SPAdes (v3.10.1), and the assemblies compared to sequence data from previously isolated E. rhusiopathiae from various mammal carcasses from the Canadian Arctic, isolates from domestic swine and poultry as well as wild birds, mammals, and fish originating from various locations in North America and Europe []. This was done by generating a core genome alignment and phylogenetic tree using parsnp (Harvest Tools v1.2) (Fig. ). The isolate tested susceptible in vitro by E-test methods to ampicillin (minimum inhibitory concentration (MIC) 0.094 μg/mL), ciprofloxacin (MIC 0.047 μg/mL), and erythromycin (MIC 0.032 μg/mL) (interpreted according to the current M45 Clinical and Laboratory Standards Institute clinical breakpoints) and was reported resistant to vancomycin as this is an intrinsic characteristic. Four blood cultures, which were collected on the same day of this visit to the orthopedic outpatient clinic and prior to the administration of antibiotics, remained negative after 5 days of incubation. An echocardiogram was not performed as it was felt that the patient was unlikely to have endocarditis. She was initially treated with intravenous ceftriaxone 1 g daily but was switched to intravenous penicillin G once susceptibility results were available. She completed 6 weeks of intravenous antibiotic therapy and subsequently completed an additional 6 weeks of oral amoxicillin 1 g three times daily. On the last day of her oral antibiotic therapy she was reviewed as an outpatient and was clinically well with no fever and resolution of knee pain. Her surgical wound had healed well with no evidence of recurrent infection on physical examination. Her CRP and ESR had normalized to 1.4 mg/L and 13 mm/h respectively. She was again seen in follow-up 4 months later (approximately 8 months after her last surgery) and remained well with no clinical evidence of relapse and CRP and ESR remaining within normal limits at 0.9 mg/L and 15 mm/h respectively. The patient declined a second stage revision procedure and remained clinically well 1 year after her last surgery.
pmc-6435483-1
A 13-year-old male presented to the Pediatric Emergency Room at a tertiary care academic medical center due to progressive quadriparesis that reportedly began after a prolonged episode of coughing 3 days earlier. His neurological symptoms manifested as bilateral hand numbness with persistent back and neck pain, but rapidly progressed to quadriparesis and widespread tactile and proprioceptive sensory loss over 2 days. The day prior to his presentation, he was unable to walk without support. He was subsequently admitted to the Pediatric Intensive Care Unit (PICU) due to concern for potential rapid respiratory compromise. Other than a cough, the patient reported no recent acute illness and denied travel, trauma, exposures, and vaccinations (all childhood vaccinations were up to date). Additionally, there was no history of developmental or cognitive impairment (was performing well in eighth grade), no drug or alcohol use, and no history of smoking or e-cigarette use. He had a history of mild persistent asthma, and his only medication was his albuterol inhaler that he had been using about twice daily for a week prior to admission. There were no reported allergies. At the time of admission, he was hemodynamically stable with normal vital signs. He was afebrile and in no acute distress. Heart and lung exams were normal. Neurological exam revealed diffuse hypotonia, diminished deep tendon reflexes in all extremities, persistent quadriparesis with most marked weakness in the radial, median, and ulnar nerve distributions (C5-T1 levels), and decreased sensation at the C4-L2 levels. Additionally, the patient had diffuse, severe hyperesthesia in response to sharp stimuli. There was no evidence of acutely altered mental status, visual or other cranial nerve deficit, nystagmus, or overt ataxia. Babinski and Hoffman's signs were negative and there was no ankle clonus. There was no spinal or paraspinal tenderness to palpation. On hospital day (HD) 1, still unable to support himself while standing, the patient developed urinary retention requiring multiple straight catheterizations, representing a symptomatic nadir 2–3 days after initial symptom onset. He otherwise remained hemodynamically and neurologically stable during his stay in the PICU. He showed steady recovery after the following workup and treatment on HD 3–10 and was discharged to the Pediatric Acute Rehabilitation Unit on HD 22 in good condition. Given the acute nature of the patient's neurological symptoms, on HD 1 brain and spine imaging were performed. Brain CT and MRI were unremarkable—there were no lesions, structural abnormalities, or edematous changes of the parenchyma or cranial nerves, and there was no contrast enhancement or leptomeningeal disease. Total spine MRI, however, showed a longitudinally extensive, non-enhancing, T2-hyperintense central cord lesion strictly involving the gray matter from C2-T2 with mild edema, intervertebral disc intensity changes in the cervical levels () and robust diffusion restriction (). These findings were initially thought to be suggestive of spinal cord infarct, although no abnormal flow void, cord compression, mass lesion, discrete disc herniation or desiccation, or other spinal or foraminal stenosis was noted. Follow-up MRA of the thoracic aorta was inconclusive, and concern for spinal ischemia necessitated high-resolution intravascular imaging. On HD 3, interventional angiogram showed brisk, robust filling and collateralization of the vascular supply of the spinal cord, and canal after left vertebral artery injection (). The anterior spinal artery was patent and of normal caliber. There was no evidence for aortic dissection or other vascular abnormality. Furthermore, serial fibrinogen, coagulation, and liver function tests showed no evidence of coagulopathy. Out of secondary concern for an autoimmune or infectious etiology, the patient was started on Intravenous Immunoglobulin (IVIG) (400 mg/kg daily), high-dose steroids (methylprednisolone 1 g daily), vancomycin, ceftriaxone, and acyclovir for empiric meningoencephalitis coverage, and aspirin (81 mg daily) for secondary prevention of possible cord ischemia. Initial laboratory workup, however, was not indicative of an infectious or an acute inflammatory etiology with a normal white blood cell count (7.1*103/μL), negative blood cultures and respiratory viral panel, and normal sedimentation rate and C-reactive protein levels (1 mm/h and <0.1mg/L, respectively). Urine studies, including toxicology, were likewise unremarkable. Cerebrospinal fluid (CSF) obtained by lumbar puncture also proved unrevealing (WBC 0, RBC 9, glucose 65, protein 27.3). CSF infectious studies for enterovirus, HSV 1/2, syphilis, Lyme disease, ehrlichiosis, Cryptococcus, Epstein-Barr virus, and cytomegalovirus were negative, and serum titers for additional pathogens including mycoplasma and West Nile virus did not support acute infection. Additional workup for common autoimmune myelopathies including neuromyelitis optica spectrum disorders (NMOSD) and multiple sclerosis (MS) was non-diagnostic (serum was negative for aquaporin-4 antibodies (AQP-4) (titer <1:10), myelin oligodendrocyte glycoprotein antibodies (MOG) (titer <1:10), and CSF was negative for oligoclonal bands). Serum tests for myositis (aldolase, creatine kinase) were negative. After two doses of high-dose steroids (total 5 day course) and IVIG on HD 3–5, the patient's lower extremity strength began to improve, urinary retention resolved, and deep tendon reflexes returned to baseline. Given the negative infectious workup, antibiotics and acyclovir were discontinued on HD 3. However, the patient demonstrated a persistent weakness of the bilateral upper extremities that prompted a 5 day plasmapheresis course (HD 5–10) as salvage therapy for medically-refractory myelitis. Over the next few days, the patient achieved significant gains in strength, sensation, and balance. The patient was transferred to a pediatric acute rehabilitation unit on HD 22. His exam remained notable for diminished hand, wrist, biceps, and triceps strength bilaterally, but he was able to walk with minimal assistance and his muscle strength normalized. Sensation was intact in the extremities but remained slightly diminished in the T4-T10 dermatomes. Paresthesias were no longer present. At his 3 month follow-up with the pediatric neurologist, his only residual finding was bilateral hand weakness, although greatly improved. He was back at school on a full-day, regular schedule. Diagnosis remained “unspecified inflammatory spinal cord syndrome.”
pmc-6435522-1
A 57-year-old Japanese man was referred to our hospital with a 6-week history of distal paresthesia in his four limbs and unsteady gait (). He was an office worker with a medical history of diabetes mellitus and hyperuricemia. He had no family history of neurological disorders. On admission, physical examination revealed no abnormalities. Neurologically, he presented with normal cranial nerve function except for impaired taste sensation, and normal strength in all four limbs, although clumsiness was observed in both hands due to reduced sensation. The nose-to-finger test and the heel-knee test revealed left side-dominant mild ataxic movements in all four limbs, which were worsened by eye-closing. The patient had paresthesia in his four extremities. Touch sensation was disturbed in all four distal limbs and pain sensation was reduced in both hands, but vibration sensation was preserved. Position sensation was disturbed in both feet. Deep tendon reflexes were absent, apart from a reduced response in his right quadriceps femoris. He needed a cane while walking, and his walking appeared ataxic because he used a wide-based gait in a careful manner; the Romberg sign was positive. The patient complained of constipation, urination difficulty, and erectile dysfunction. Blood studies revealed hyperglycemia (192 mg/dl; normal range 70–139 mg/dl) with an HbA1c level of 6.1% (normal range 4.6–6.2%) and hypertriglyceridemia (296 mg/dl; normal range 30–149 mg/dl). Tumor markers were within normal levels, except for an elevated squamous cell carcinoma antigen level of 9.8 ng/ml (normal range < 1.5 ng/ml). Anti-nuclear antibody was positive (titer, 1:160). Anti-GM1 IgM antibody was positive at low titer (0.118 optical density; normal range < 0.1). Onconeural antibodies, including anti-amphiphysin, CV2, PNMA2 (Ma2/Ta), Ri, Yo, Hu, recoverin, SOX1, titin, zic4, glutamic acid decarboxylase of 65 kDa, and Tr (delta notch-like epidermal growth factor-related receptor) antibodies were all negative. Other autoantibodies, including anti-acetylcholine receptor, ganglionic acetylcholine receptor, and anti-neutrophil cytoplasmic antibodies were all under normal limits. Antimyelin-associated glycoprotein and anti-ryanodine receptor 1 antibodies were not examined. Angiotensin-converting enzyme and lysozyme were within normal levels. Immunoelectrophoresis revealed no abnormal M-protein. Cerebrospinal fluid examination revealed an elevated protein level (96 mg/dl; normal range 20.0–40.0 mg/dl), with very slight pleocytosis (6 cells/mm3; normal range < 5 cells/mm3). The IgG index was within normal levels (0.69; normal range < 0.7). Cytological analysis of cerebrospinal fluid showed no malignancy. Magnetic resonance imaging of the whole spine showed no spinal canal stenosis or abnormal intensity change in the spinal cord. Gadolinium enhancement was seen in some parts of the cauda equina and lumbar plexus. The results of electrodiagnostic studies are shown in . Motor distal latencies of the bilateral median nerves were prolonged. Sensory nerve action potentials were slightly decreased, as were sensory nerve conduction velocities. Repetitive nerve stimulation study was performed in the right ulnar nerve and the compound muscle action potentials were recorded from the abductor digiti minimi muscle, revealing no abnormal waning or waxing. Somatosensory-evoked potentials were not examined. Eight weeks after onset of neurological symptoms, IVIg was commenced under the tentative diagnosis of chronic inflammatory demyelinating polyradiculoneuropathy, which slightly improved distal paresthesia in the four limbs. After IVIg, neurological symptoms were stabilized; however, reduced sensation and gait instability persisted and remained unimproved. Subsequent whole-body computed tomography revealed a tumorous lesion in the anterior mediastinum (). Sixteen weeks after the onset of neurological symptoms, the patient underwent a thymectomy. Microscopic examination revealed thymoma, classified as type B3, with invasion of the right brachiocephalic vein. For 4 weeks after the surgery, the patient's neurological symptoms remained unimproved and he still needed a cane while walking. The results of electrodiagnostic studies at this time are shown in . Sensory nerve action potentials were further decreased compared with those of the first study. A second round of IVIg was then commenced, and at 5 weeks after surgery radiation therapy for thymoma was started. There was no neurological relief at 6 weeks after the surgery (22 weeks after the onset of neurological symptoms), so oral steroid therapy (prednisolone, 30 mg/day) was started. He showed remarkable improvement of neurological symptoms 1 week after the steroid therapy started and 6 weeks after the steroid therapy started, the patient's neurological symptoms, including decreased sensation, hand clumsiness, gait instability, and autonomic failure, were resolved, except for slight distal paresthesia in his feet. The oral dose of prednisolone was gradually reduced and ended 32 weeks after it commenced, with no re-aggravation of his symptoms (). The results of electrodiagnostic studies 28 weeks after the start of steroid therapy are shown in . The results from his motor nerves were completely normal and sensory nerve action potentials were increased compared with the results of the pre-steroid examination.
pmc-6435606-1
A 57 years-old male patient had a thoracic aortic aneurysm (TAA) with the maximal diameter of 68 mm and origin of the aneurysm at the lesser curve 8 mm distal to the LSA. The patient was an ex-smoker, suffered from hypertension, type II diabetes and had an ischemic stroke 2 years previously. Two wires were placed; one in ascending aorta (Lunderquist, Cook, MA, USA) and the second into the left brachial artery (Terumo exchange, Terumo, Japan) which was snared from a left brachial puncture (SeQure, Lifetech, Shenzen, China) both from the same right common femoral artery access following a cut down (see Fig. for deployment sequence). The 34 × 130 mm stent-graft delivery system was advanced over the two wires and deployed with the fenestration hole marker located at the origin of the LSA. The LSA diameter measured on CT was 9 mm, so a 10 × 60 mm self expandable expanded polytetrafluoroethylene (e-PTFE) stent-graft (S&G Biotech, Soul, Korea) was advanced and deployed over the wire in the LSA from the femoral access. The post-implantation aortogram showed complete exclusion of the aneurysm with no endoleak (Fig. ).There was a moderate stenosis of the LSA stent that was immediately solved by post dilatation of the stent (Mustang 10 × 60 mm, 10 ATM Boston Scientific, USA) (Fig. ). The total procedure time was 84 min and Fluoroscopic time 32 min. There were no immediate or 30 day complications. Six months follow-up CT showed complete exclusion of the aneurysm, no endoleak, patent LSA stent and slight decrease in maximal diameter of the aneurysm. (65 mm, Fig. ).
pmc-6435606-2
A 52-year old man presented with an 8 h history acute lower limb ischemia and severe back and abdominal pain to a local hospital. He was a current smoker with uncontrolled hypertension. He was referred to our hospital for urgent revascularization. On admission, neither femoral artery was palpable, with poor abdominal peristaltic sounds but no peritonitis. Aortic contrast enhanced CT confirmed an aortic dissection with an entry tear 5 mm from the LSA, extending down to the mid abdominal aorta. The false lumen was 24 mm virtually occluding the true lumen at the celiac trunk. Following informed consent, we performed a fenestrated TEVAR. The stent graft used for this patient was actually prepared for other patient who has an elective schedule, but in view of the greater urgency of this man’s case and similarities in anatomy it was agreed following informed consent to proceed to use the device for this patient instead. After percutaneous puncture of right femoral artery and placement of 7F sheath, we tried crossing the compressed true lumen using an MP-1 (Medtronic, Santa Rosa, CA, USA) angiographic catheter and 260 cm Terumo exchange wire, which failed. Using a percutaneous left brachial artery (LBA) access, a Judkins Right catheter (Medtronic, Santa Rosa, CA, USA) and a 260 cm Terumo exchange wire were advanced to the abdominal aorta. This was then snared (SeQure, Lifetech, Shenzen, China), externalized from the right femoral artery and used to exchange the femoral sheath to an 18F sheath (S&G biotech, Seoul, Korea). Another 260 cm Terumo exchange wire was advanced to the ascending aorta through a MP-1 catheter and exchanged for a super stiff wire (Lunderquist, Cook, MA, USA). Over these two wires, as for case 1, a 32 mm single fenestrated stent-graft was advanced to the distal aortic arch and deployed successfully as previously described (Fig. ). Subsequently a 10 × 60 mm e-PTFE stent-graft (S&G Biotech, Soul, Korea) was advanced and deployed over the wire in the LSA. The final aortogram showed complete exclusion of the entry tear, patent LSA, expansion of the true lumen and patent visceral branches. There were no immediate or 30 day complications. Total procedure time was 65 min and fluoroscopic time was 20 min. The patient was discharged at 5 days with resolution of his pain and paralytic ileus as well as improvement of his creatinine levels (2.58–1.4 g/dL). The 6 month CT showed good position of the graft with complete exclusion of the entry tear, no endoleak, partial thrombosis of the false lumen and patent LSA stent (Fig. ).
pmc-6435999-1
A 47-year-old woman presented to our clinic and complained of a left upper eyelid lesion that had increased slowly in size over the past three years. The lesion was 1.0 cm in size. It was round shaped, circumscribed elevated and had brown pigmented color (Figure 1 ). The appearance was typical of a seborrheic keratosis. Her visual acuity and eyelid movements were normal. The procedure is performed under local anesthesia with intravenous sedation and magnification. Upper eyelid tumor is marked with 2 mm margin. A line is drawn on the eyelid at the level of the lid crease. Then, the advancement flap of the anterior lamella is outlined with two Burow’s triangles marked for excision, one triangle medial or lateral to the defect and the second diagonal to the first, above the lid crease (Figure 2 ). An incision is then made through the skin and the subcutaneous tissue of the lesion. The lesion was excised with a 2 mm free margin. The triangles’ boundaries are cut with a scalpel, dissected, and mobilized with blunt scissors (Figure 3A ). The subcutaneous tissue at the edges of the defect is undermined in the subdermal plane to minimize the tension at the suture lines. An advancement flap of the skin and orbicularis of the upper eyelid was undermined, elevated, and advanced inferiorly over the defect (Figure 3B ). Interrupted buried 6/0 nylon sutures are used to approximate the dermis and subcutaneous tissue and close the defect completely (Figure 4 ). Topical antibiotic ointment is applied twice daily for 7 days. The sutures are removed in 10 days. Histopathological examination of the tumor revealed seborrheic keratosis and confirmed that the margin was free of tumor. The patient has been followed up for six months with no evidence of recurrence and has no concerns with eyelid function. Moreover, this treatment produces good aesthetic results (Figure 5 ) and increased patient satisfaction.
pmc-6436000-1
A 40-year-old female patient presented with a painless sudden loss of vision in her right eye of one month duration. The loss of vision was preceded by a binocular diplopia which worsened on the right gaze for the past 3 months. A right sided upper molar tooth extraction was done prior to the onset of symptoms. She also gave a history of repeated headaches for the past 3 years. She had no systemic illnesses. A non-contrast computerized tomography (CT) scan done previously was essentially normal with some non-specific inflammatory changes involving the sphenoid sinus. With a clinical suspicion of right sided optic neuritis, she had received a treatment regimen of injectable steroids for 3 days followed by tapering doses of oral steroids elsewhere. On examination, her best corrected visual acuity (BCVA) was perception of light in the right eye and 6/6 in the left eye. Anterior segment examination showed a relative afferent pupillary defect in her right eye with an abduction restriction consistent with a right sixth nerve palsy. Fundus examination showed a resolving disc edema in her right eye. Her left eye was normal. Other cranial nerves were normal. A detailed systemic workup including a complete blood count examination showed an elevated erythrocyte sedimentation rate (ESR) of 87 mm/h. Diabetes and any signs of immunosuppression were ruled out. Chest X ray and Mantoux test were negative. Magnetic resonance imaging (MRI) was advised and mucosal thickening was noted in both compartments of the sphenoid sinus. Areas of altered bone marrow signal intensity with adjacent bone destruction were observed involving the walls of the sphenoid sinus (Figure 1A ), bilateral posterior clenoid processes, right anterior clenoid process, dorsum sella, the proximal half of clivus, and the right petrous apex region. Posterior one third of the intraorbital portion and of the intracanalicular portion of the right optic nerve, the right half of the optic chiasm was enlarged and showed hyperintense signal intensity on subtracted post contrast T1 image (Figure 1B ). A hyperintense signal was also noted involving the right optic tract. We also observed a mild enlargement of the pituitary gland and pituitary stalk. Post contrast T1 image in the coronal plane showed an asymmetry of the right cavernous sinus due to enhancing soft tissue within it. (Figure 1C ). These imaging features were suggestive of fungal sphenoid sinusitis with osteomyelitis involving the right cavernous sinus, adjacent dura, right optic nerve pathway, and pituitary gland. Opinions of a neurosurgeon and an ophthalmologist were sought and the patient underwent a biopsy of the sphenoidal lesion. Although the biopsy was negative for fungal or bacterial infections, she was empirically started on amphotericin B as clinically and radiologically it was looking like a fungal infection. On follow-up after 1 month, the BCVA in her right eye improved to 3/60, her abduction defect had resolved and the disc was pale, suggesting of a resolved disc edema.
pmc-6436222-1
A 67-year-old Japanese woman presented with complaints of a mass of skin on her left thumb and index finger that had been gradually increasing in size over the preceding few months. Her general condition was good (height, 147 cm; weight, 65 kg; heart rate, 62/minute; blood pressure, 136/72 mmHg, and body temperature, 36.3 °C). No abnormal breath or heart sounds were heard during auscultation. An abdominal examination revealed no tenderness, rigidity, or rebound, and her bowel sounds appeared normal. Neurological abnormalities such as absent or brisk deep tendon reflexes, muscle weakness, and hyperesthesia were not observed. In addition, no edema was present. According to the laboratory data, glycated hemoglobin (HbA1c) was high (8.9–9.4 over the previous 6 months); however, no abnormalities were noted in the other parameters. Furthermore, no abnormalities or signs of infection were observed in her urine analysis (Table ). She was under medication (hypoglycemic agents, antihypertensive drugs, and antihistamine drugs) for diabetes mellitus, hypertension, and allergic rhinitis, respectively. She had a history of smoking 10 cigarettes a day over the past 20 years. She did not drink alcohol, and there was no history of ALHE or other allergic diseases in her family. She was a housewife and was not involved in any specific occupation. Several skin masses, each approximately 10 mm in diameter, were observed at the base and dorsum of her left thumb and on the volar side of her index finger (Fig. a). They were hard and reddish in color, with the majority of them presenting with a smooth, hairless surface and poor mobility. The masses were accompanied by pain, itching, and bleeding. A blood test indicated no inflammatory response; however, the eosinophil fraction was higher (11.8%) than the reference value. Magnetic resonance imaging revealed that the tumor was confined to the skin and had not extended to the thumb joint (Fig. b). A biopsy performed at the Department of Dermatology indicated signs of ALHE. She was then referred to the Department of Orthopedic Surgery for re-examination of the pathological condition, which was performed using tissue excised along the tumor margins on the distal phalanx of her index finger. The aponeurosis on the flexor digitorum superficialis, which was juxtaposed to the surface of the tumor, was also resected (Fig. a). Reconstruction was performed using a reverse palmar digital island flap harvested from the base of her index finger and the resected aponeurosis tissue was examined (Fig. c). Vascular proliferation in the dermis and infiltration of eosinophils around the surrounding vascular endothelial cells were noted. These findings were consistent with ALHE. Consequently, the lesions on her thumb and index finger were surgically excised using the tumor margins and aponeuroses as the resection range (Fig. a). As shown in Fig. b, the skin defect was covered with collagen-based artificial skin (Pelnac®, Gunze Co. Ltd., Ayabe, Japan). Subsequently, the interphalangeal and metacarpophalangeal joints of her thumb and the carpometacarpal joint were fixed using a Kirschner wire (Fig. c). She was prescribed loxoprofen sodium (180 mg/day) for approximately 10 days. The Kirschner wire was removed 2 weeks after the surgical procedure. A gradual progression of the epithelialization of the artificial skin was noted along with healing 2 months post-surgery (Fig. d). Mild contracture of the dorsal side of her thumb finger was observed after surgery; however, no hindrances in daily life activities were reported. Importantly, no tumor recurrence was noted at the 12-month follow-up.
pmc-6436331-1
The patient was a 76-year-old woman with a chief complaint of backache. Her medical history included hypertension and lumbar spinal canal stenosis that had not been treated with an oral anticoagulant or antiplatelet agent. She became aware of a sense of discomfort in the dorsal region without cause 4 days before she visited our hospital. Backache aggravated suddenly, and she had vomiting and difficulty with body movement; she visited the Department of Surgery at our hospital and was admitted for examination and treatment. There were no abnormal findings on thoracoabdominal CT or endoscopy from a surgical perspective, and she was referred to our department. In the initial examination, body temperature was 36.2°C, blood pressure 192/109 mmHg, and pulse 79/min. The consciousness level was Glasgow Coma Scale (GCS) (E4, V4, M6), showing mild disturbance of orientation. She complained severe backache without headache. On neurological examination, no hypesthesia or muscle weakness of the lower limbs was noted. Regarding deep tendon reflexes, both the patellar tendon and Achilles tendon reflexes were (+) on the bilateral sides, showing no increase or reduction, and there was no pathological reflex or bladder and rectal disturbance. There were no other abnormalities, including in hemorrhage and coagulation test findings. On plain radiography at admission, there were no abnormal findings in the thoracolumbar vertebrae. On lumbar spinal MRI 4 days after onset, a band-like shadow continuous from the thoracic spinal level with high intensity on T1-weighted imaging and low intensity on T2-weighted imaging, and STIR was detected on the subdural extramedullary ventral side. To examine the lesion at the upper level more closely, thoracic spinal MRI was performed 7 days after onset and a band-like shadow extending from Th2 to L3 was observed on the subdural extramedullary ventral side. A mass present in the shadow at Th7 was compressing and deforming the spinal cord centered on this region, and changes in intramedullary brightness of Th6 over Th8 were noted (). There was no tumorous contrast enhancement in the mass region on contrast MRI, and no vascular malformation was observed on contrast-enhanced CT. The patient had no previous trauma, abnormality of the coagulation system, or history of lumbar puncture or anticoagulant therapy, and no tumorous lesion or vascular malformation was detected on imaging. Based on these findings, she was diagnosed with spontaneous SDH with no inducer. Since hematoma was extensive and there was no neurologic manifestation, course of observation with conservative treatment was selected. Disturbance of orientation and delusion appeared 7 days after onset, and muscle weakness of MMT 3-4 was observed in the iliopsoas and lower muscles. Cranial SAH was detected in the bilateral parietal lobes and cerebral sulcus in the left occipital lobe on head CT (). The hemorrhagic regions differed from the representative hemorrhagic regions of aneurysm rupture and hypertensive hemorrhage, and the hemorrhage volume was small. There was no apparent aggravation, such as expansion of the hematoma and exclusion of the dural canal, on thoracic spinal MRI. Therefore, after consultation with the Department of Neurosurgery, antihypertensive management and intracranial pressure management by intravenous drip infusion were initiated. No aneurysm was detected in screening using head MRA, and the symptoms gradually improved. Muscular strength of the iliopsoas and lower muscles recovered to MMT 4-5 at 3 weeks after onset, and backache and disturbance of orientation resolved at 4 weeks, after which ambulation was started. Muscular strength of the iliopsoas and lower muscles recovered to a normal level of MMT 5 at 6 weeks after onset, and the patient transferred to a rehabilitation hospital at 7 weeks. She was able to walk with canes after 6 months and was discharged home. On MRI at 6 months after onset, the hematoma had been absorbed, the mass had shrunk, and changes in intramedullary brightness had been reduced. However, dilation of the subarachnoid space at Th4-6 and displacement and deformity of the spinal cord were observed (). These findings were considered to be due to adhesive arachnoiditis, but the course remained favorable thereafter. No recurrence of backache or neurologic manifestation was noted at final follow-up at one year after onset.
pmc-6436336-1
This is a 7-year-old male patient, with a diagnosis of Bruck syndrome proven by genetic testing (gene FKBP10 mutations: c.449G>A, p.Trp150Ter). He has no family history of OI or AMC, parental consanguinity, dentinogenesis imperfecta, blue sclera, or hearing loss and a birth weight of 3.2 kg. He was treated with bisphosphonates (pamidronate, 1 mg/kg/dose intravenously for three days per cycle with a cycle every four months) for five years and his most recent DEXA scan showed a lumbar z-score of −7, 4. Currently, he is nonambulatory and uses a power wheelchair. He has flexion contractures of both hips with a range of motion to 45 degrees on the right and 35 degrees on the left. Knee contractures limited the range of motion to 60 degrees on the right and 70 degrees on the left. His right ankle was dorsiflexed to neutral, and his left ankle to 30 degrees of dorsiflexion and 30 degrees of plantarflexion. Finally, his right foot had -10 degrees of abduction and 10 to 40 degrees of adduction, and his left foot had -10 degrees of abduction and 10 to 50 degrees of adduction. He developed multiple orthopedic problems. His cervical spine developed progressive kyphosis with no basilar invagination. He required a spinal fusion from occiput to C4 at the age of 4 years, and recurrence of the deformity required revision spinal fusion from C1 to C5 at the age of 5 years (). Kyphoscoliosis and thoracic deformity (“barrel chest” deformity) developed and progressed during growth to 45 degrees by the age of 7 years. Flexion contractures of the upper limbs were present at birth with limited elbow range of motion to 5 degrees on the right and 15 degrees on the left, wrists bilaterally, and left fifth finger. At the age of 7 years, he had a right ulna fracture that was treated by casting. In his lower limbs, he had flexion contractures of the hips and knees at birth and bilateral clubfoot. Subsequently, he had multiple fractures in his lower extremities that were treated by operative intramedullary stabilization and had subsequent recurrence of deformities with growth requiring revisions. At the age of 2 years, he had intramedullary Rush rod fixation in the left femur and tibia. At the age of 3 years, the left femur recurred and he underwent revision with new intramedullary Rush rod fixation. At the age of 5 years, he had intramedullary stabilization of the right femur and revision of the left femur as well as left tibia intramedullary Rush rod fixation. At the age of 6 years, he underwent right tibia intramedullary Rush rod fixation and revision of the right femur with dual Rush rods. At the age of 7 years, he underwent left femoral and tibial rod exchange with Fassier-Duval rods (tibia with dual-locking plates and bone grafting). He had bilateral clubfoot treated with serial casting using the Ponseti method as an infant with deformity that relapsed until at the age of 7 years when he underwent bilateral Achilles tenotomies ().
pmc-6436336-2
This is a 24-year-old female patient with Bruck syndrome proven by genetic testing (defects in PLOD2, mutation: c.517G>C; p. Alal73Pro). She has no family history of OI or AMC, parental consanguinity, dentinogenesis imperfect, blue sclera, or hearing loss and a birth weight of 2.5 kg. However, she has micrognathia. She ambulates with bilateral ankle-foot orthotics. She received bisphosphonate (pamidronate, 1 mg/kg/dose intravenously for three days per cycle with a cycle every four months) therapy for five years. Her last DEXA scan was normal for her age. Joint contractures were present in the upper and lower limbs from birth. The range of motion of both shoulders was limited to 90 degrees of flexion. Her hips were in 90 degrees of flexion with limited hip abduction, and her knees were in -30 degrees of extension. At 12 years of age, coliosis developed in the spine with a thoracic curve of 51 degrees and lumbar curve of 27 degrees. She also had spondylolisthesis at L5 and lumbar hyperlordosis (). At the age of 13 years, she had a posterior spine fusion from C7 to T10. In her upper limbs, she fractured her right olecranon at the age of 14 years. This fracture was treated by casting. At the age of 16 years, she fractured her right proximal humeral shaft, which was treated by an intramedullary flexible nail. Subsequently, at the age of 23 years, she developed left ulna nerve compression (cubital tunnel syndrome), which was treated by operative decompression and subcutaneous transposition. In the lower limbs, she had bilateral clubfoot treated by casting. Operative realignment was performed on her right foot at the age of 2 years. At the age of 9 years, she fractured her right femur, which was treated by two intramedullary flexible nails. At the age of 11 years, she refractured the diaphysis of the right femur and bent the intramedullary rod, which required revision with repeat intramedullary flexible nailing. Her left femur was fractured when she was at the age of 12 years; this was treated with two flexible nails. At the age of 14 years, she developed left acetabular protrusio (). At the age of 21 years, her right femur was fractured in the diaphysis, which was treated by a locking plate-intramedullary rod construct. The plate was removed when she was at the age of 22 years ().
pmc-6436336-3
This is a 6-year-old male patient, with a suspected diagnosis of Bruck syndrome at the second day of life, proven by genetic testing (defects in PLOD2 and FKBP10, mutation: c.831dupC). There is no family history of OI or AMC, dentinogenesis imperfecta, blue sclera, parental consanguinity, or hearing loss and a birth weight of 2.8 kg. This child is also nonambulatory and uses a wheelchair in the community. He has hip flexion contractures of 15 degrees on the right and 25 degrees on the left). He has knee flexion contractures with popliteal angles of 30 degrees on the right and 40 degrees on the left. He has bilateral elbow flexion contractures of 10 degrees. His right foot is internally rotated, and his left foot is externally rotated. He uses bilateral knee-ankle-foot orthotics for support. He was treated with bisphosphonate (pamidronate, unknown dosage) from the age of 6 months to 3 years at another hospital. His last DEXA scan was normal for this age. At 6 weeks of age, he developed fractures in the vertebral bodies and six right ribs, right clavicle, right radius, and bilateral femurs. The fractures healed with voluminous callus (). Subsequently, the callus remodeled normally, and the limb bones grew into a gracile shape, appearing narrow at the cortex (). At the age of 3 years, he had a right midshaft femoral fracture treated with spica casting. He had a left midshaft femoral fracture at the age of 4 years treated with splinting ().
pmc-6436336-4
This is a 4-year-old male patient with a diagnosis of Bruck syndrome at birth. There is no family history of OI or AMC, parental consanguinity, dentinogenesis imperfecta, blue sclera, or hearing loss and a birth weight of 2.9 kg. Currently, he is nonambulatory and uses a wheelchair for all mobility activities. In his upper limbs, he had flexion contractures at birth of the elbow and wrist. The left upper limb is the most involved with contractures. His left elbow is unable to be extended past 90 degrees and the wrist beyond 30 degrees. In his lower limbs, he had a right midshaft femur fracture at birth and midshaft nondisplaced right tibia fracture at the age of 4 years. Both fractures were casted and no orthopedic surgeries have been required (). There was no treatment with bisphosphonates.
pmc-6436337-1
A 40-year-old male presented to our office in 2017 complaining of chronic left knee pain. This was his first visit to this office and was establishing care after moving to the area. The patient's electronic medical record was obtained from an outside institution which indicated a past medical history of diabetes, hyperlipidemia, and hereditary multiple exostosis. The patient disclosed that he had multiple osteochondroma removal surgeries which included his left knee, lumbar spine, and left foot at an outside institution. In addition, he had a left hip arthroplasty with refractory numbness/tingling of the leg. The patient stated he had left knee pain for years until he had an osteochondroma removed in his left distal femur in 2016 which seemed to help for 6 months. He stated the pain returned at 7/10 and is worse with movements. He had limited range of motion with 70° of flexion, negative pain with varus and valgus movement, and negative secondary tests. Baseline X-rays were ordered for this patient's knee (). There were osteoarthritic changes with significant osteochondroma formation; however, arthroplasty was not recommended at that time because of the patient's young age and his left lower extremity being distally neurovascular intact. The patient was adamant about having his knee replaced and was referred to a specialist at an outside institution where an arthroplasty of the left knee was performed. The patient returned 3 months later with continued limited active and passive range of motion (<90° flexion). Follow-up radiographs were ordered showing good alignment of a Smith & Nephew posterior stabilized prosthesis without subsidence (). It was decided to perform manipulation under anesthesia followed by 6 weeks of physical therapy which improved his range of motion to 110° flexion. The patient continues to have limited range of motion of his left knee with flexion to 90°. The large posteriorly projecting osteochondroma of his left tibia continues to be asymptomatic and painless, and therefore, it was decided not to perform surgical interventions at this time. Performing an arthroplasty helped relieve the patient's pain, however, did not result in significant improvement of active and passive range of motion of the joint. Overall, the patient is satisfied with his knee replacement but still has refractory numbness/tingling of his distal left lower extremity from his prior hip replacement. The patient has chronic pain elsewhere, which is being closely monitored (Figures and ).
pmc-6436338-1
The patient was a 57-year-old male, with ESRD secondary to diabetes and hypertension, on hemodialysis for 20 months. He was evaluated to undergo living unrelated donor kidney transplant. The donor was a 54-year-old female with unremarkable past medical history. She was medically and surgically cleared after full assessment. Preoperative computed tomography (CT) angiography for the donor revealed a small complex cyst (Bosniak IIF), a short right renal vein (2 cm), and a right renal artery with an early bifurcation of an upper pole artery. Surgical approach deemed best by the living donor selection committee was to remove the right kidney with the complex cyst via laparoscopic approach. The risks of surgery and potential complications were explained to both donor and recipient. Written informed consent was obtained prior to surgery from both patients. A standard hand-assisted laparoscopic living donor nephrectomy (LLDN) was performed to retrieve the right kidney and the right ovarian vein for reconstruction. The length of the donor renal vein was reduced by 10-15 mm due to the standard use of vascular stapler device to control the renal vein stump. Status after procurement upon visualization in the back table is that the length of the donor renal vein was 3 mm. In order to elongate the vein, the donor ovarian vein was dissected and used for reconstruction. It was opened longitudinally, folded over, and anastomosed to the donor renal vein using end-to-end anastomosis with an 8-0 Prolene (). The donor kidney had a renal artery with early bifurcation of an upper pole artery. After mobilization of the inferior vena cava as much as possible, the endovascular stapler was placed after the bifurcation from the renal artery and the length of the vessel was reduced by 10-15 mm. At the back table the donor kidney presented two individual arteries: the main renal artery and the short upper pole arterial branch. Consequently, the recipient IEA was used as an extension graft to perform an end-to-side anastomosis between the upper pole arterial branch and the main renal artery using 8-0 Prolene (). The complex cyst was dissected all the way down into the calyces and substantial margin of healthy parenchyma was removed. Distal margin was sent to pathology to rule out malignancy. The calyces and the renal parenchyma were oversewed with 5-0 PDS and the edges of the defect with U-stitch of 4-0 PDS using pledget (). The extended renal vein and the main renal artery were anastomosed end-to-side to the external iliac vein (EIV) and artery (EIA) respectively, using 6-0 Prolene (). We performed an extravesical ureteroneocystostomy and a Jackson Pratt drain was placed. The warm ischemia time was 33 minutes. Postoperative course was uncomplicated and the patient has maintained adequate renal function with stable serum creatinine (1.32 mg/dl) at 5-month follow-up. The final pathology report and the intraoperative frozen section of the margin were negative for malignancy.
pmc-6436364-1
A 72-year-old woman presented to the emergency room with gastrointestinal symptoms and hypokalemia. Air in the sigmoid colon mesentery and a solid pancreatic head mass were noted on CT of the abdomen/pelvis (). Sigmoid diverticular perforation and a small pericolonic abscess were confirmed on subsequent Hartmann procedure. With cushingoid features, the Endocrinology service was consulted postoperatively. Collateral history from her family revealed a recent general decline in health and the development of signs and symptoms of hypercortisolism over the past 12 months. On exam, in addition to a cushingoid appearance, obesity (body mass index of 40) and mild hypertension (blood pressure 145/77 mmHg) were noted. Investigations were consistent with ectopic ACTH-dependent hypercortisolism from a pancreatic neuroendocrine tumor (). MRI sella was contraindicated because she had a pacemaker, but no pituitary adenoma was visible on CT of the head. Inferior petrosal sinus sampling was not completed because the patient was unstable. Treatment with metyrapone, followed later by the addition of ketoconazole was initiated with some benefit. Short-acting octreotide was added based on a positive octreotide scan (). Metyrapone and ketoconazole were discontinued several days later due to a significant drop in serum cortisol on octreotide. Given her recent Hartmann procedure and clinical instability, surgery was not an option. Almost one month after initiation of octreotide, she became hypotensive and unresponsive from a suspected intracranial hemorrhage. Her family decided against further medical intervention. A postmortem examination was not performed.
pmc-6436364-2
A 56-year-old woman was referred to our center for management of pathologically confirmed multicentric MCT, postthyroidectomy. Genetic testing was negative for the ret-proto-oncogene mutation and there was no evidence of MEN 2A, with documented eucalcemia and negative 24-hour urinary metanephrines. Persistent postop elevation of serum calcitonin, MIBG, and octreotide scans suggested mediastinal disease which was confirmed upon mediastinal exploration. Over the next two years, calcitonin gradually rose and serial imaging showed metastatic foci of disease. 24-hour urine for metanephrines was negative and a 24-hour UFC was marginally elevated at 320 nmol (normal < 300 nmol), with a repeat measurement being normal at 208 nmol. She had no overt cushingoid features on physical exam. Subsequent exploratory laparoscopic surgery revealed liver metastases, making further surgery unsuitable. The decision was made to treat medically with octreotide. At age 61, five years after her initial diagnosis with MCT, her condition deteriorated. She was noted to have mild cushingoid features and further investigations revealed likely ectopic Cushing's syndrome from her MCT (). She was admitted to hospital with complaints of dyspnea, mild abdominal pain, and profound hypokalemia of 2.4 mmol/L and required intubation and ventilation for progressive respiratory distress. On CT scan, there was free intraperitoneal air and an abnormal loop of bowel in the region of the sigmoid colon, consistent with perforated sigmoid diverticular disease. She opted for palliative care and was deceased two weeks later.
pmc-6436364-3
A 58-year-old woman was referred for evaluation of Cushing's syndrome following a one-year history of skin thinning, easy bruising, hirsutism, worsening headaches, a 25 pound weight gain, and a new diagnosis of type 2 diabetes mellitus. Physical examination revealed facial plethora, supraclavicular and dorsocervical fat pads, and mild proximal myopathy. Subsequent laboratory and imaging investigations were consistent with Cushing's disease (). Transsphenoidal surgery was completed and pathology revealed a corticotroph adenoma. Steroid replacement, which was started post-op, was tapered over 18 months with resolution of cushingoid features and no biochemical evidence of disease recurrence. However, at age 68, she had recurrent signs and symptoms of Cushing's disease which was confirmed on biochemical testing (). She was started on pasireotide, on which she developed liver enzyme elevation and worsening glycemic control. She also experienced left lower quadrant abdominal pain with ongoing constipation. Pasireotide was discontinued and abdominal ultrasound revealed an extensive gas collection within the intrahepatic portal branches and main portal vein. CT abdomen/pelvis showed a small pelvic abscess adjacent to the sigmoid colon, representing a secondary abscess from a perforated diverticulum (). She responded to intravenous antibiotics. Three months later, she was readmitted to hospital with a colocutaneous fistula, which resolved with conservative management alone. Off all treatment for more than two years, she had ongoing cyclical Cushing's disease and a residual microadenoma on MRI sella that was not amenable to surgery given its proximity to the optic chiasm. Cabergoline was initiated and her 24-hour UFC levels normalized for seven months, following which levels were intermittently elevated (). At the age of 71, she sustained a diverticular tear during screening colonoscopy when her 24-hour UFC was above normal. Emergent laparotomy was performed, during which she had a right hemicolectomy.
pmc-6436364-4
A 71-year-old woman, unwell for three months with recurrent exacerbations of chronic obstructive pulmonary disease and congestive heart failure, was hospitalized multiple times at her local hospital. Her internist suspected Cushing's syndrome based on the presence of suggestive signs and symptoms. Biochemical and dynamic testing supported this diagnosis (). During this time, she was experiencing intermittent lower abdominal pain. With recurrent abdominal pain one month later, CT abdomen/pelvis showed chronic perforation of a hollow viscus on a background of extensive sigmoid diverticular disease, confirmed on subsequent barium enema. With adequate response to antibiotic treatment, no surgical intervention was required. A repeat 24-hour UFC was normal, thus supporting the presence of cyclical Cushing's syndrome. One month later, with a recurrence of cushingoid features, transsphenoidal hypophysectomy was performed. Bisection of the pituitary gland yielded a gush of tumor fluid but no tissue was available for immunostaining. She remained eucortisolemic nine months after surgery, and a repeat CT abdomen showed an enterocolic fistula within the left hemipelvis, but no peridiverticular abscess or perforation.
pmc-6436364-5
A 51-year old male was suspected of having Cushing's syndrome based on his presentation with purpura, central obesity, facial plethora, and hypertension. Subsequent investigations confirmed ACTH-dependent Cushing's syndrome, likely of pituitary etiology (). During his first transsphenoidal surgery, tumor was visualized but no sample was obtained for pathological analysis. With persistent postop hypercortisolism, repeat transsphenoidal surgery was completed two months later, with a corticotroph adenoma being confirmed on pathology. The patient remained hypercortisolemic after the second surgery and one year later, cabergoline 1 mg twice weekly was used for persistent and moderately elevated 24-hour UFC levels. At age 54, during a period of medication nonadherence, 24-hour UFC increased to twice normal (). Two months later, he presented to hospital with a three-day history of worsening left lower quadrant abdominal pain. CT abdomen showed a large collection of stool and gas centrally in the mesentery, on the background of multiple diverticulae. Surgery revealed a 1.5 × 3 cm perforation of the sigmoid colon, with features more consistent with a perforated stercoral ulcer, rather than a diverticular perforation. Distal sigmoidectomy with creation of an end colostomy was performed. The patient did well and remained eucortisolemic on cabergoline 1 mg twice weekly.
pmc-6436364-6
A 53-year-old woman was referred for investigation of hypercortisolism following a two-year history of easy bruising, proximal muscle weakness, and poor wound healing after surgery for diverticulitis and a vaginal fistula 15 months earlier. Pathology showed perforated diverticulitis of the rectosigmoid colon, and her surgery was complicated by deep vein thrombosis and pulmonary embolism. Additional history revealed insomnia, depression, obesity, and hypertension. Mild diverticular disease had been diagnosed three years earlier when she underwent investigations for left lower quadrant pain. Physical examination revealed classic features of cortisol excess with facial plethora, supraclavicular and dorsocervical fat pads, and mild proximal myopathy. Investigations, including inferior petrosal sinus sampling, were consistent with Cushing's syndrome of a pituitary etiology (). The patient underwent transsphenoidal resection and pathology confirmed a corticotroph adenoma.
pmc-6436461-1
A 17-year-old male water polo player presented with pain in the ulnar side of the right wrist for the past 3 months. He is a member of the water polo team at his high school, and his level was high enough to participate in the interscholastic water polo competition. After shooting a goal 1 week ago, his pain increased; however, there was no previous direct trauma to the right wrist. Upon an initial presentation to a private clinic, no specific injury was diagnosed, and he was then referred to our institution. Upon initial physical examination, he had tenderness on the hypothenar region and ulnar pain when moving the wrist. The grip strength of his right hand was 10 kg, contrasted with 44 kg of the left hand. Radiographs taken in the previous clinic did not show any injury (). Tenderness around the pisiform was also noted, and because arthritis of the joint was suspected, triamcinolone acetonide was injected into the pisotriquetral joint region. One week after the injection, he showed improved tenderness around the pisiform; however, hypothenar pain persisted when he flexed his right wrist. Furthermore, his grip weakness did not improve. To diagnose the injury, magnetic resonance imaging (MRI; T1-weighted, T2-weighted, T2-weighted STIR) of the affected region was performed. The right wrist showed intensity changes around the hamate hook, suggesting inflammation (). A computed tomography scan finally showed fracture of the hamate hook (). Upon a careful reexamination, tenderness was observed on the hamate hook. Three weeks after his initial presentation, we surgically removed the hamate hook fragment. Mild synovitis of the flexor tendon of the small finger was intraoperatively found but not at the site of injury itself. Radiograph taken after the surgery showed that the hamate hook fragment was completely removed (). He was advised not to play water polo for 3 weeks after the surgery, and he did not resume practice until 4 weeks. Three months after the surgery, mild tenderness around the surgical scar was reported; however, his grip strength of the right hand improved and was measured as 44 kg. One year after the surgery, he was completely pain-free, and the grip strength of his right hand had further improved to 46 kg. He achieved the full range of motion in the wrist (95° extension, 115° flexion) and felt no pain around his right wrist at any time, including while playing water polo. The most recent Disabilities of the Arm, Shoulder and Hand score was 2.6 points.
pmc-6436667-1
A 69-year-old Caucasian male presented with a complaint of constant fatigue and weakness for multiple years. The patient had a history of epistaxis since childhood. According to the patient, tilting his head backward exacerbated the nosebleed and sitting upright alleviated the bleeding. The patient also had multiple first- and second-degree relatives with arteriovenous malformations and epistaxis. The patient also complained of a productive cough with clear sputum for the past six months. Additionally, the patient reported having exertional dyspnea and intermittent paroxysmal nocturnal dyspnea. His past medical history consisted of anemia, GI bleeding, gastric ulcer, melena, diabetes mellitus type 2, bilateral DVT, hypertension, arteriovenous malformation of the small bowel, occasional orthostatic lightheadedness, and scarlet fever. Past surgical history included multiple esophagogastroduodenoscopy (EGD) procedures. Upon physical examination, the patient was not in acute distress. His vitals were as follows: a blood pressure of 119/70 mmHg, a pulse of 68 beats per minute (bpm), a temperature of 103 F, and a respiratory rate of 16 breaths per minute (bpm). At presentation, the patient had multiple vascular malformations on the fingers, upper palate, tongue, lower lips, ears, and the face (as shown in Figures -, respectively). The S1 and S2 sounds were audible with a regular rate and rhythm. The tenderness was present on deep palpation in the left lower quadrant. There was no leg swelling, warmth, or redness. Peripheral pulses were palpable. The deep tendon reflex was normal and the cranial nerves were intact. Hospital course Considering the consistently low hemoglobin (Hb), fatigue, and occult positive stool results, the patient was admitted to the hospital and was given two units of blood. The epistaxis episode resolved spontaneously. On day one, the patient's Hb level was 4.9, and he was treated with four units of packed red blood cells (PRBC), and the Hb increased to 8.0. On day two, the patient's Hb dropped to 7.7, and he was infused with another unit of PRBC. The colonoscopy result showed bleeding in the ascending colon. The patient also underwent esophagogastroduodenoscopy (EGD), showing multiple 4-millimeter angiodysplasias with active bleeding at the cardia and fundus. There were also non-bleeding angiodysplasias in the duodenum and the jejunum, which were treated with argon beam coagulation and photodynamic therapy.
pmc-6436670-1
A 47-year-old male with a history of hypertension presented to the emergency department after losing consciousness while sitting at his computer. Co-workers witnessed “seizure-like” activity and lowered the patient to the floor. In the emergency department, the patient was amnestic to the episode and complained of right shoulder pain. Review of systems was negative for tongue biting, bowel or bladder incontinence, headache, chest pain, palpitations or shortness of breath. The patient had no past history of seizures. The social history was significant for occasional alcohol consumption without drug use. By history alone, the providers were not sure if the patient had suffered a seizure or other forms of a syncopal episode. In the emergency department, the patient’s vital signs were blood pressure 156/90 mmHg, heart rate 92 beats per minute, respiratory rate of 17, room air oxygen saturation 97%, and temperature 96.7 degrees Fahrenheit. The physical examination of the patient revealed a male in moderate discomfort from right shoulder pain. The cardiopulmonary examination was unremarkable. There were no focal neurologic deficits. The patient held his right shoulder in adduction with internal rotation. The shoulder was diffusely tender to movement without visible deformity. The patient had intact deltoid muscle sensation, 5/5 muscle strength in the radial, median, and ulnar nerve distributions. He had a 2+ radial pulse. The were no breaks in the skin. Initial work up included a point-of-care of 169 mg/dL; electrocardiogram (EKG) showed normal sinus rhythm with an incomplete right bundle branch block. There was no prior EKG. A PoCUS of the right shoulder was performed using a low-frequency curvilinear transducer. The humeral head was posteriorly displaced from the glenoid fossa suggesting a posterior shoulder dislocation (Figure ). Initial radiographs were inconclusive, and the radiologist suggested further views to determine if a dislocation was present. As the dislocation was detected on ultrasound, the patient did not require repeat imaging which both saved time and minimized patient discomfort. The dislocation was reduced using traction counter-traction with the patient under deep sedation with propofol. The successful reduction was then confirmed by both PoCUS and a radiograph (Figure ). The patient was admitted to the hospital for observation and specialty evaluation by the Orthopedic, Cardiology and Neurology services. He was discharged with the diagnosis of a first-time seizure.
pmc-6436673-1
A 31-year-old Hispanic woman presented for an evaluation of a diffuse asymptomatic rash, of four years duration, on her anterior neck and her chest between her breasts. Her medical history was significant for PCOS diagnosed 10 years earlier. Clinical manifestations of her PCOS included heavy, irregular menses, acne, hirsutism, and acanthosis nigricans. Her medication only included an oral contraceptive pill. Cutaneous examination, on initial presentation, revealed reticulated hyperpigmented patches on her chest – in between her breasts – and anterior neck (Figure ). In addition, there was not only macular hyperpigmentation on her cheeks (consistent with melasma), but also velvet-like hyperpigmented plaques on her posterior neck and axilla (consistent with acanthosis nigricans) (Figure ). Correlation of the presentation and clinical examination of the anterior neck and chest lesions was most consistent with CARP. Azithromycin, 250 mg once a day, was prescribed. After two months of treatment, her chest and anterior neck dermatosis had resolved; the plaques had flattened and the skin hyperpigmentation had faded (Figure ). The velvet-like plaques on her posterior neck and axillae persisted. The clinical response to azithromycin confirmed the suspected diagnosis of CARP on her chest and anterior neck. In contrast, the persistence of the lesions on her posterior neck and axillae strongly suggested a diagnosis of acanthosis nigricans at these sites. The dose of azithromycin was titrated down and eventually stopped during the next month. There was no recurrence of the CARP on subsequent follow-up visits.
pmc-6436674-1
A 69-year-old Caucasian female, with a past medical history significant for hypertension, came in with the chief complaint of unilateral numbness involving the left side of the face and both left upper and lower extremities, which lasted for about 10 to 15 minutes and resolved spontaneously. On examination, the National Institutes of Health Stroke Scale (NIHSS) score was 0, and the ABCD2 (A: age; B: blood pressure at presentation; C: clinical features; D: duration of symptoms) score was 0. The presence of diabetes (1 point) score was 3. There was carotid bruit bilaterally with higher intensity on the right and no focal neurological deficits. Stroke alert was called initially in the emergency department. A stat computed tomography (CT) brain revealed no acute intracranial abnormalities. The patient was not a candidate for alteplase, as the NIHSS is 0 and the symptoms had resolved, and aspirin 325 mg was given immediately. Magnetic resonance imaging (MRI) brain was done the same day and showed no acute ischemic or hemorrhagic infarct. We diagnosed the patient with a transient ischemic attack, and further workup was initiated to evaluate the underlying cause. The 12-lead electrocardiogram and cardiac monitoring showed no dysrhythmias, including atrial fibrillation. The transthoracic echocardiogram ruled out any intracardiac source of emboli. The carotid ultrasound revealed 50%-69% stenosis of the left internal carotid artery and no stenosis in the right carotid system. She had a CT angiogram of the neck and the great vessel and was found to have 80% stenosis at the origin of the innominate artery from the aortic arch, with no evidence of any significant stenosis in the right internal carotid artery (Figure ). There was about 50% stenosis at the origin of the left common carotid artery of the aortic arch, with mild stenosis of about 40% in the left internal carotid artery. Because of these findings, cardiology was consulted to evaluate the innominate artery stenosis, which recommended an angiogram and possible stent placement. We initially heparinized the patient for the procedure. The cardiologist placed a 6-French sheath into the right brachial artery after using local anesthesia and with the help of the ultrasound and micropuncture technique. Following this, a J-wire was used to enter into the aortic arch, but it would not advance, so a guidewire was placed and the innominate artery lesion crossed. Then, a marker pigtail catheter was set, and angiography of the arch and the proximal subclavian and brachial artery angiography was performed. The aortic arch angiogram showed the innominate artery originating from the ascending portion of the aortic arch, and shortly after the origin from the aorta, it had a severe, ulcerated, eccentric, irregular plaque estimated to be about 80%, calculated using the North American Symptomatic Carotid Endarterectomy (NASCET) criteria. The plaque was deemed to be the source of the embolization and transient ischemic attack. A 7-French 45 cm long sheath was advanced but was unable to cross the lesion. Therefore, the lesion was ballooned using a 6 x 20 mm long balloon and the 7-French sheath was advanced. Then, an 8.0 x 38 mm long atrium-covered stent was deployed to decrease the risk of future embolic events. Following this, a 9.0 x 40 mm long balloon was placed and a balloon dilatation performed with good angiographic results. No complications were encountered during the procedure. The patient was discharged on dual antiplatelet therapy with aspirin and clopidogrel for six weeks and statin therapy, and after that, on aspirin and statin therapy indefinitely. On her three-month follow-up, the patient reported no further episodes of numbness of the left side of her body. There was no postoperative imaging done, as the patients had no postoperative complications or recurrence of her symptoms.
pmc-6436675-1
A 26-year-old, overweight (BMI—27.9 kg/m2), Asian-Bangladeshi female, presented with the complaint of severe LBP that preferably localized over the lower lumbar spine segment, aggravated with prolonged sitting, bending forward from her waist, even after the usual domestic chores for years. There were increased pain bouts in the last few weeks with a patient’s reported global pain assessment score 9/10, based on VAS (visual analog scale,10 cm) scale. The pain was well localized to the spine and not associated with significant morning stiffness as seen in inflammatory LBP. History of recent trauma, nocturnal fever, cough, weight loss, urinary incontinence, or altered bowel habit was also insignificant. The patient claimed, five years ago, multiple lumbar spine pricks that were performed during spinal anesthesia at her first cesarean section could perpetuate the pathology; however, she failed to register doctors’ attention regarding the problem. Considering all these facts, the initial clinical diagnosis ‘lumbar ligament sprain’ (LL sprain) was made, and we recommended a magnetic resonance imaging (MRI) of the lumbosacral spine for further analysis. At that time, the patient was managed conservatively including local application of ice, etoricoxib, and proton pump inhibitor (esomeprazole). Unfortunately, until her second visit to us, we lost the patient to follow up for some months. However, a few months later, all of a sudden, she developed severe radiating LBP with crunching, following lifting some weights on her back, followed by limited movements, impairing ADLs, though without alteration of usual bowel-bladder habits. PLID at L5-S1 level with corresponding nerve roots compression had been diagnosed based on both clinical and MRI findings (Figure ). As the pain was intractable, she reported to the emergency orthopedic department and was managed by a consultant with a single shot of unguided lumbar inter-laminar epidural steroid injection that eventually relieved her radiating LBP significantly (more than 50% pain had relieved) within the next five days. Later on, in her third visit to our clinic, we found the patient with localized lumbar spine pain as was seen in her first visit, though with a reduced VAS for pain (7/10 cm) score. On physical examination, no significant abnormalities were revealed, except a focal, well-localized, tender area in between L3 and L4 spinous processes, measuring 11 cm cranial to sacral cornua, under high-frequency musculoskeletal ultrasonogram (curvilinear probe, 5 MHz) (Chison CEO1, Guangdong, PR China) (Figures -). Alongside, MRI evidences of lumbar disc degeneration-herniation at the L5/S1 level, mid-sagittal MRI-T2-weighted image revealed high-signal intensity at L5/S1 interspinous ligament representing degeneration, with marked narrowing of the interspinous ligament at L3/4, L4/5/S1 levels (Figure ). Second time, LL-degeneration diagnosis with MRI-evidenced PLID (clinically lenient) was made. Finally, injection lidocaine (2%) was placed at the maximum tender area over the spine that provided more than 50% immediate pain relief. The patient was recommended to do regular spine muscle strengthening exercise.
pmc-6436770-1
A 16-year-old boy was admitted with a gunshot injury on the upper left side of the chest. He received initial treatment in another hospital while in shock and hypoxemic with a Glasgow coma scale score of 14. Thereafter, he was transferred to our facility with stable hemodynamics following resuscitation and placement of a chest tube. The gunshot entry point was approximately 1 cm below and lateral to the midclavicular line, and the exit point was just lateral to the scapular spine posteriorly, leaving a non-expanding and non-pulsatile chest hematoma. Bilateral radial, ulnar, and brachial pulses were palpable. The patient showed signs of brachial plexus injury and was not able to extend his wrist. Furthermore, he experienced impaired sensation in his upper left limb. A computed tomography angiogram of the chest revealed a distinct 5 x 5-mm pseudo-aneurysm in the third part of the axillary artery just proximal to the posterior origin of the circumflex humeral artery. A well-defined regional hematoma was adjacent to that segment of the artery, and no active bleeding was noted. The left brachial artery was accessed in the angio suite, confirming the computed tomography findings with diagnostic angiography. Some contrast extraversion was also observed (). Using a 7-F sheath, one 6 x 50 mm VIABAHN®-covered stent (W. L. Gore & Associates, Flagstaff, Arizona, USA) was placed over the injury site to cover the origin of the posterior circumflex humeral artery. A 6×100-mm non-compliable balloon was inflated through the stent to ensure complete sealing of the arterial segment. Finally, completion angiography revealed exclusion of the pseudo-aneurism and patent blood flow (). The patient was discharged 3 days after the procedure with take-home medication of 81 mg of aspirin orally once a day. During the 1-month follow-up, duplex scanning revealed normal flow velocities at the patent stent. After 6 months, the patient underwent brachial plexus repair, and a cast was applied postoperatively. During the sixth follow-up visit (8 months post-procedure), he was readmitted because the pulse in his left radial and brachial arteries was not palpable. An urgent duplex scan showed in-stent stenosis with a velocity of 385 cm/s. The next day, a diagnostic angiograph confirmed these findings and also revealed severe stenosis in the stent with a smooth outline and a long segment of arterial stenosis distal to the stent. Balloon angioplasty of the stent and a distal arterial segment were performed using a 6 x16-mm stent as well as a completion angiogram. The patient was then instructed to take 75 mg of clopidogrel daily in addition to aspirin. Clopidogrel was discontinued 3 months after the second procedure. Monthly duplex scanning conducted for four months, then twice yearly, and then yearly revealed normal velocities in the left upper limb arteries.
pmc-6436771-1
A 46-year-old male patient with dilated cardiomyopathy was admitted to our clinic with New York Heart Association (NYHA) class 3-4 functional capacity. Physical examination revealed that the heart rate was 90 beats/min, blood pressure was 105/65 mmHg, and respiratory rate of 26 breaths per minute. There was crepitation on bilaterally basal segments of lungs and 3/6 diastolic murmur was present in the aortic valve area with auscultation. There was no pathological finding in other systems. Despite maximal medical treatment and intra-aortic balloon pumping, hemodynamic deterioration developed in the second day of hospitalization. Systolic blood pressure was 85 mmHg, signs of organ malperfusion with altered mental status; cold, clammy skin; oliguria (30 ml/h); increased serum-lactate (8 mEq/L). Echocardiography revealed that left ventricular (LV) ejection fraction was 20%, and he presented with severe aortic insufficiency, moderate calcific aortic stenosis, aortic annular dilatation and an ascending aortic aneurysm. His central venous pressure (CVP) was 13 mmHg, alanine transaminase was 48 IU/l, aspartate transaminase was 59 IU/l, international normalized ratio was 1.27, tricuspid annular plane systolic excursion (TAPSE) was 14 mm, pulmonary vascular resistance was 2.4 Wood Units, transpulmonary gradient (TPG) was 8 mmHg, and right ventricular stroke work index (RVSWI) was 370 mmHg*ml/m2. Therefore, no pulmonary vasodilatatory agent, including nitroprusside or milrinone, was required for the functional reduction of the RV. The ascending, arcus, and descending aortic diameters were 55 mm, 35 mm, and 33 mm, respectively, in the computed tomographic imaging (). This patient was on the heart transplantation list, but due to the progression of his clinical status and hemodynamic deterioration, our heart team decided to perform an LVAD implantation and Bentall procedure. After conducting a median sternotomy, the pericardium was opened and the aorta was assessed. Sinus valsalva and proximal segment of ascending aorta were aneurysmatic and the aortic tissue was very thin and fragile. There was normal size aorta segment on the distal ascending aorta for cannulation and cross clamping. Therefore, an aortic arterial cannulation was performed at the level of brachiocephalic artery and a right atrial venous cannulation was also performed. Cardiopulmonary bypass (CPB) was established in the standard fashion. The patient's body was cooled to 28°C. After applying an ascending aortic cross clamp, an aortotomy was performed on the aneurysmal ascending aorta, and cold blood cardioplegia was delivered to the coronary arteries via the coronary ostia. There was commissural fusion and diffuse calcification on the aortic annulus, and the aortic valve exhibited a tricuspid structure. It was excised, and the coronary ostia were prepared as buttons. The ascending aortic aneurysmal tissue was also excised, and a distal aortic anastomosis area was prepared. A conduit with a no. 28 Dacron tube graft and a no. 25 Carpentier-Edwards Perımount pericardial aortic bioprosthesis valve was placed into the aortic annulus with the aid of pledgets. Then, the coronary buttons were anastomosed to the Dacron graft, and a distal aortic anastomosis was performed. Thus, the Bentall procedure was completed. Next, the cross-clamp was removed, and the body was warmed to 36°C. The LV position was adjusted, and a suitable area on the LV was determined via transesophageal echocardiography for the LVAD implantation. The ring of a HeartMate 3 LVAD (Abbott Laboratories, Chicago, IL, USA) was implanted on the apex of the heart enforced with Teflon felt under beating heart conditions. The inflow cannula of the device was placed into the ventricular cavity, and the battery cable of the device was removed from the right inferior quadrant of the abdomen via the subxiphoid tunnel. All the air was evacuated from inside the device and heart, and the outflow graft of the device was anastomosed to the ascending aortic graft in an end-to-side fashion (). Then, the device was started. While the support of the device increased, the support of the CPB was slowly decreased and ended. The last control of the device was performed via transesophageal echocardiography. The cardiac index was greater than 2.8 l/min/m2 at a speed of 8,400 rpm. The RV function was satisfactory: TAPSE=16 mm, TPG=10 mmHg, and RVSWI=405 mmHg*ml/m2. The patient was admitted to the intensive care unit in a stable condition. The CPB time was 138 minutes, and the aortic cross clamp time was 64 minutes. The mean arterial pressure, CVP, cardiac rhythm, and pulmonary capillary wedge pressure were 75 mmHg, 14 mmHg, 83 beats/minute, and 10 mmHg, respectively. Therefore, the hemodynamic parameters were normal. The patient awoke 6 hours after the surgery, and his neurological status was entirely normal. The total drainage was 1,250 cc during the first day and 650 cc during the second day postoperatively. Three units of erythrocyte suspension were used in total. The extubation was performed at the postoperative 21st hour. RV failure findings were not observed, and the early postoperative period was satisfactory. This patient was discharged on postoperative day 32. The control examination was satisfactory in terms of the clinical, laboratory, and echocardiographic measurements during second month after the surgery (). He is still on the heart transplantation list.
pmc-6436777-1
A 58 year-old male patient presented with history of acute chest pain which was radiating to the back. He was investigated for acute myocardial infarction but on subsequent imaging he was found to have acute type A aortic dissection. The urgent surgery was planned. He underwent acute Stanford Type A aortic dissection repair. On postoperative day 2, the patient was still intubated and ventilated. The urine output had dropped below 20mls an hour and the creatinine level were increased to 280 micromol/L. The blood gas PH:7.28, PO2: 8.3kpa, PCO2: 5.1, HCO3: 22 mEq/L and Lactate 3.2 mmol. A conventional double lumen dialysis catheter insertion for continuous veno-venous haemodialysis through left internal jugular vein was performed by a consultant intensivist under Ultrasound guidance (). As clear from the check chest x-ray film, that the tip of the catheter is abnormally directed toward the hilum of the left lung, which normally should cross the midline to the opposite direction. After recognising the abnormal position of the catheter, the decision was made not to use the dialysis catheter until the confirmation of location and position is made. The chest x-ray landmarks are not typical for the position of the left innominate vein. The tip of the dialysis catheter is at T6 level and is too close to the carina at the level of thoracic vertebrae 4/5. The left innominate vein should be much higher at thoracic vertebrae T2/3 level and it should only join the right innominate vein past the midline at thoracic vertebra T4 level. Therefore, the appearances cannot be accepted without further confirmation of the position of the catheter. However, the patient remained stable since the line was inserted; no difficulties were experienced during the line insertion. The chest x-ray does not show a Pneumothorax, pleural or mediastinal collection. An easy and fluent aspiration of the blood from the catheter confirmed the intravascular position, but the concern still persists. Firstly, the blood from both dialysis catheter lumens was tested on a blood gas machine. The proximal lumen blood sample showed a venous, while the distal lumen blood sample showed an arterial gas result. The suspicion of the proximal lumen into the vein and the distal lumen in an artery was a significant concern. The further evaluation by using the standard pressure transducer was made. Both the lumens were separately connected to the pressure transducer and both showed the venous waveform trace. How do we reconcile these confusing findings? Before making any decision to remove the catheter, an opinion from the colleague radiologist was requested. The contrast chest computed tomography (CT) () clearly shows the anomalous left superior pulmonary vein, which has been missed on preoperative CT scan. On the radiologist's advice, a contrast Linogram () through the dialysis line was performed. Contrast was injected individually through both the lumens. The first image with the contrast injection down the proximal lumen showed the contrast moving horizontally and then to the right. This confirms the catheter's position within the innominate vein. However, the second injection showed a contrast-filled structure that descends further down to the left para-mediastinal silhouette, but there was no extravasation of the contrast. The two possible diagnoses that came to mind for a venous structure down the left para-mediastinal silhouette were a persistent Left sided Superior vena cava[ or an Anomalous left sided pulmonary venous drainage to the central systemic veins[. The Left sided superior vena cava should travel to the coronary sinus, that does not appear to be the case. Since the contrast was flowing towards the hilum of the left lung, followed by a branching pattern into the lung parenchyma confirmed the diagnosis of a partial anomalous left superior pulmonary vein. Moreover, the arterial blood gas via the distal dialysis central line supports the diagnosis. The sample of the blood collected from the proximal lumen confirms that the proximal lumen is in the left innominate vein. A review of the preoperative CT scan was also done. Apart of the obvious acute Type A aortic dissection, the diagnosis of a coexisting pathology had been missed. Since, it was missed on preoperative scans it is extremely rare to encounter a silent congenital malformation. The Left superior pulmonary vein emerging from the lung hilum was clearly seen to ascend and join the left innominate vein. The anatomy of the remaining pulmonary venous drainage was normal.
pmc-6436886-1
A 74-year-old male with past medical history of atrial fibrillation, hypertension, dyslipidemia, and benign prostatic hypertrophy presented to the emergency department with testicular swelling and pain for four days. Physical exam was notable for an abscess on the inner gluteal fold of the perineal region that was spontaneously draining serosanguinous output. His left hemi-scrotum appeared erythematous and indurated without overt signs of cellulitis. There was mild tenderness to palpation of the scrotal area although no crepitus was felt in the thighs or scrotum. He also endorsed blood-tinged drainage from the wound for several weeks. He was admitted for the management of his scrotal wound. He was evaluated by urology and general surgery who had low suspicion for Fournier’s gangrene. Medical records demonstrated several urological procedures for ureterolithiasis and nephrolithiasis in the few months prior to this admission. The procedures included a bilateral ureteroscopy with laser lithotripsy followed by stone removal, stricturotomy, and placement of ureteral stents to prevent the progression of hydronephrosis. He had developed iatrogenic urinary incontinence after the procedures and had an indwelling Foley catheter inserted in view of incontinence. He also reported a fall at home three weeks ago, following which he developed persistent back pain but did nothing about it. On our evaluation the computed tomography (CT) scan of the spine (Figure ) revealed a recent L1 vertebral compression fracture with sclerosis and slightly ill-defined margins with additional lumbar spine compression fractures of T12 , L3 and L4 with several other multilevel degenerative changes in the lumbar spine. The patient also reported a gradual drop in height from 6 feet 3 inches to 5 feet 9 inches over the course of many years. Upon admission to our inpatient department, review of his CT findings was out of proportion to age-related bone changes which led us to go back and do an extensive chart review which revealed that the patient had a long-concealed history of hyperparathyroidism, which was diagnosed incidentally from a routine blood draw which demonstrated hypercalcemia 12 years ago. He was initially referred by his primary care physician to endocrinology who strongly recommended surgical removal of the adenoma. However, the patient declined surgical intervention because he felt he was asymptomatic.The patient instead opted for medical management of his hyperparathyroidism and was started on long-term alendronate therapy by his primary care physician for approximately 10 years. Home care records demonstrate that he was non-adherent to routine follow-up and was predominantly home bound with minimal activity and minimal sunlight exposure. His laboratory records persistently demonstrated hypercalcemia and increased parathyroid hormone levels. At current admission his calcium was 8.9 mg/dl, parathyroid hormone was at 102 ng/L, vitamin D was 24 ng/ml and alkaline phosphatase was 75 IU/L. Upon directed evaluation in the inpatient setting we found that along with nephrolithiasis and bone changes he had also developed other classical signs such as neurocognitive changes such as hallucinations of men standing in the air with food carts. He continued to decline parathyroidectomy despite worsening of his disease. His 10-year-long alendronate course was recently replaced by denosumab in view of treatment failure. Alternatively at the current admission denosumab was discontinued in view of increased risk of infections and he was started on cinacalcet therapy and intravenous antibiotic and was referred to the neurosurgery unit for the management of his chronic unstable L1 vertebral fracture.
pmc-6437228-1
A 76-year-old Japanese male with a history of hypertension, dyslipidemia, and peripheral vascular disease had previously undergone successful endovascular treatment for occlusive right common iliac artery at 71 years of age. At the time, transthoracic echocardiography performed for screening revealed a dilated aortic root with a width of 49 mm. Subsequent electrocardiogram-gated cardiac computed tomography (EG-CT) revealed SVAs in both the LCS and RCS with no obstruction to surrounding cardiac structures. The sizes of the SVAs from the center of the aorta were 27.2 and 33.1 mm for LCS and RCS, respectively. Due to the relatively small size, they were observed carefully for 5 years, at which time the follow-up EG-CT (Fig. ) revealed that the LCS and RCS sizes had grown to 34.5 and 35.7 mm, respectively, and transthoracic echocardiography showed moderate aortic regurgitation. The SVA in the LCS was grown between the pulmonary artery and the left atrium and bulged out on the anterior surface of the heart (Fig. b). The SVA in the RCS has also grown pressing the right ventricular outflow tract (Fig. c). Since both SVAs had been expanding on the surface of the heart (Fig. b, d), we concluded that they were extracardiac SVAs. Given that the SVAs, which were extracardiac type with a relatively high risk of rupture, were expanding gradually, the patient provided inform consent to undergo surgery for SVA removal. The operation was performed via median sternotomy with cardiopulmonary bypass. After cardioplegic arrest, the ascending aorta was transected just above the sinotubular junction. Inspection of the interior of the aortic root revealed SVAs in the left lateral half of the LCS and the RCS on both sides of the commissure between the left and right coronary cusps. Left and right coronary arteries were intact. Aortic walls were missing in the floor of the SVAs adjacent to the aortic annulus, and cardiac muscles could be observed even outside of the annulus through a translucent membrane (Figs. and ). The SVAs appeared to originate from the orifices with partial aortic wall defects. The modified Bentall’s approach was performed using a handmade composite graft with a 26-mm polyester graft (Vascutek Gelweave Valsalva graft, Terumo Cardiovascular Systems, Ann Arbor, MI, USA) and a 23-mm bovine pericardial aortic valve (Carpentier-Edwards Perimount Magna Ease, Edwards Lifesciences, Irvine, CA, USA). Pathological examination revealed mild atherosclerotic changes in the aortic wall near the SVAs and inflammatory changes in all aortic valve cusps. The patient recovered well after the surgery and has been well for one and a half years without any events.
pmc-6437310-1
We present the case of a 25-year-old female German patient with dysexecutive syndrome (affective instability, sensory overload, concentration, and impulse control problems), rapid-onset physical fatigue, and continuous headache. The patient's history was negative for in-utero or birth complications, inflammatory brain diseases, or febrile convulsions. She reported cognitive deficits (memory difficulties and needing more time to learn than her siblings) and impulsive behaviors (especially when things change) since her first decade of life. Both symptoms were mild and did not meet the diagnostic criteria for attention-deficit/hyperactivity disorder or autism. The subject did not encounter tics, or extraordinary personality traits, though she had known a physical lack of energy for as long as she could remember. She was easily exhausted in sports at school and could not keep up with her family on hikes. She had to go to bed early, upon which she fell asleep swiftly. Since she was 6 years old, she experienced repeated syncopations which based on history probably represented vasovagal pathomechanisms. There was no history of increased frequency of infections, especially no signs of mucocutaneous candidiasis. Dental history was unremarkable. When she was seventeen, she fell off her bike in an unclear way and suffered brain trauma with cerebral hemorrhage. The cerebral magnetic resonance imaging (MRI) showed left hemispheric subdural hemorrhage and “contre-coup” right fronto-opercular as well as multiple right temporal cerebral contusions. Neither a subsequent change of personality nor other neurocognitive or psychomotor symptoms were observed by the patient or her family. Five years ago, she noticed hyperpigmentation (). Four years ago, she developed early morning nausea that occurred almost on a daily base. She had no appetite and could eat very little. At age 25 (half a year before presentation in our clinic), she developed an infection-triggered Addison crisis with hypotension, diarrhea/vomiting, hypoglycemia, vigilance reduction, and metabolic acidosis. The diagnosis of Addison's disease was suspected due to the Addison crisis, anti-adrenal cortex autoantibodies (titer of 1:100; reference < 1:10) and indicative laboratory values (ACTH increased, 71.4 pg/ml; reference: 5–50 pg/ml). During her inpatient stay, the patient already noticed a self-limiting, discrete hemiparesis on the right side. Treatment was started with a glucocorticoid (hydrocortisone) and a mineralocorticoid (fludrocortisone). Later, the patient developed two grand mal seizures, for which she was admitted to an intensive care unit. An anti-epileptic treatment with levetiracetam was initiated. While being on intensive care treatment, she developed progressive disorientation, reduced vigilance, headache, coordination disturbances and, again, hemiparesis on the right side. The MRI showed a subacute left parieto-occipital cortical/subcortical lesion involving the precentral gyrus with T2-weighted FLAIR signal increase and diffusion restriction without respecting vascular territories and the multiple right-hemispheric chronic posttraumatic lesions. There was a clear lactate peak in the lesion (). The EEG showed an intermittent slowing temporoparietal on both sides (stronger on the left) and singular spike-wave complexes temporal (once temporoparietal) on the left. During her subsequent stay in a neurological rehabilitation clinic, her neurological deficits receded almost completely. On occasion her right hand may feel clumsier than her left, but this occurs rarely. Following the grand mal seizures symptoms of sensory overload and affective instability evolved and persisted ever since. She has not experienced any further early morning nausea following treatment with hydro- and fludrocortisone. Several attempts to reduce levetiracetam led to an exacerbation of cognitive deficits. The patient suffered from Hashimoto's thyroiditis for years (substituted with L-thyroxine) and, as already mentioned, Addison's disease. When being diagnosed for the Addison crisis normochromic, normocytic anemia was recognized (hemoglobin: 10.4 g/dl; reference 12–16 g/dl). Two years prior to present admission a gastroscopy was done revealing mild to moderate antrum gastritis suspicious of chronic toxic (type C) gastritis. Her mother, sister, and maternal grandfather all suffered from type 1 diabetes mellitus, while another sister is healthy. Analysis of the complete mitochondrial genome from peripheral blood leukocytes showed a heteroplasmic base exchange mutation in the mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 (MT-ND4) gene (m.12015T>C; p.Leu419Pro). Heteroplasmy level for the mutation in blood showed 12%, in muscle tissue 15%. This point mutation was not detected in the blood of the patient's mother, no other tissues were analyzed in the mother. No other pathogenic or likely pathogenic alteration was detected in the mtDNA of the patient. In MITOMAP, the human mitochondrial genome database () the alteration is only reported as a mtDNA coding region sequence variant and has not been reported in association with disease yet. Several simulations (prediction tools) assume a benign change (fathmm, MutationTaster, PROVEAN), according to SIFT it is a pathogenic variant (). Besides the mtDNA analysis, only the nuclear DNA polymerase subunit gamma (POLG) gene was analyzed in the patient. In the POLG gene (part of mitochondria-related nDNA) no pathogenic variant (mutation), but the well-known polymorphism c.156_158delGCA; p.Q55del (rs727504102) was detected in heterozygous state. For this deletion, an association with diabetes mellitus has been reported in the Human Gene Mutation Database (). It is classified as a clearly benign polymorphism in several databases (). The psychiatric investigation showed attention and concentration deficits, memory difficulties, affective instability, impulsive behaviors and sensory overload. Cognitive performance showed partially below-average results (). The lactate ischemia test revealed a more than three-fold increase in lactate levels compared to resting state values. The lactate concentration in the cerebrospinal fluid (CSF) was not increased. In the muscle biopsy, single cytochrome c oxidase (COX)-negative muscle fibers were identified. In the immunological screening, increased anti-thyroglobulin, increased anti-thyroid peroxidase, anti-adrenal cortex, anti-glutamic acid decarboxylase (GAD-65), anti-partial cell, anti-intrinsic factor, and anti-nuclear antibodies (ANAs) were discerned. Serum concentration for immunoglobulin (Ig)G, IgM and especially IgA were within normal range. The B-cell panel showed clearly increased number of IgD-CD27+B-cells, IgA+CD27+memory B-cells, and IgM+/–CD38++plasma blasts of B-cells. The urine analyses revealed only slightly increased albumin-creatinine quotient and therefore no typical signs of focal segmental glomerulosclerosis (). A current gastroscopy showed signs of autoimmune gastritis. The examination's findings are summarized in . The follow-up cMRI 6 months after the stroke like events showed a chronic cortical to subcortical parieto-occipital brain lesion on the left side involving the posterior margin of the precentral gyrus with signs of chronic hemorrhagic transformation and the known multiple post-traumatic right hemispheric lesions (). Single-voxel magnetic resonance spectroscopy results show slightly increased lactate (Lac)+/creatine ratios in the dorsal anterior cingulate cortex (dACC), dorsolateral prefrontal cortex (DLPFC), and orbitofrontal cortex (OFC; ).
pmc-6437316-1
Case 1 A 75-year-old woman had been followed-up by our hospital since 2009 via abdominal computed tomographic (CT) examination, magnetic resonance cholangiopancreaticography (MRCP), or other examination methods for intraductal papillary mucinous neoplasm (IPMN). Following its introduction, when EUS was performed as follow-up for IPMN in January 2017, observation of the mediastinum revealed a lesion measuring 15 mm × 9 mm with heterogeneous echoic pattern and partly calcified pattern at the left atrial wall (Fig. ). A left atrial tumor was suspected based on a contrast CT scan (Fig. ) and other considerations. A left atrial tumor resection was performed in April 2017. The tumor was a 20 mm × 15 mm broad-based tumor attached to the atrial septum. Histopathological examination revealed small circular and spindle-shaped tumor cells in the mucous stroma, in addition to hemosiderin deposits and linear calcification (Gamna–Gandy bodies), which are indicative of myxoma (Fig. a, b). Based on these findings, the lesion was determined as left atrial myxoma. The patient has exhibited a favorable postoperative course and continues to be followed-up regularly for IPMN.
pmc-6437316-2
Case 2 A 67-year-old man underwent EUS in December 2017 to examine localized gallbladder wall thickening identified at another hospital. Observation from the stomach and duodenum revealed localized wall thickening with Rokitansky–Aschoff sinuses at the base of the gallbladder. This was diagnosed as localized fundal type adenomyomatosis of the gallbladder. Continued observation of the mediastinum revealed aortic wall thickening and a sac-like protrusion of the aortic lumen, and an aortic aneurysm was suspected (Fig. ). Contrast CT examination revealed a saccular aneurysm in the aortic arch (Fig. ), which was determined to be operable. Aortic replacement surgery at the aortic arch was performed in March 2018. The patient’s postoperative course has been favorable.
pmc-6437724-1
A 36-year-old gravida 1 para 0 presented to the obstetric medicine clinic for preconception counselling. Her medical history was notable for chronic thrombosis of the extra-hepatic portal, splenic, and mesenteric veins since 2011. She had developed cavernous transformation in her portal vein, portal hypertension, splenomegaly, and secondary grade 1-2 gastric varices. A few years after the thrombosis was discovered, a diagnosis of latent myeloproliferative neoplasm was made on the basis of a positive Jak-2 mutation (V617F, 1.65% mutational allele burden) and increased cellularity on the bone marrow biopsy. Until now, she has never developed polycythemia, thrombocytosis, or leukocytosis (last hemoglobin level 135 g/L, platelet count 349×109/L, and leukocytes count 8.8×109/L). The patient was also known for essential hypertension, hypothyroidism, migraine, and obesity. Her first pregnancy (2011), while on depo-provera and warfarin, was interrupted voluntarily. In 2012, she had bilateral salpingectomy with unilateral left ovariectomy for possible endometriosis. On medication review, she had taken warfarin after the thrombosis diagnosis until it was replaced by dalteparin (18 000 units once a day, subcutaneous injection) because of difficulty to reach and maintain the target international normalized ratio (INR) despite doses greater than 20 mg daily. The patient decided to stop dalteparin nine months after the initial thrombosis. It was not replaced by another anticoagulant because of the risk of variceal bleeding. However, aspirin 80 mg once daily was prescribed to address established platelets, leukocytes, and endothelium interaction in the pathogenesis of vascular occlusion in MPN [, ]. Aspirin was replaced by clopidogrel 75 mg once daily after she developed an allergic reaction. Rivaroxaban 20 mg once daily was finally added to her medication when splenic infarctions were discovered at the time of an episode of abdominal pain. At her preconception visit, she was taking rivaroxaban 20 mg once daily and clopidogrel 75 mg once daily. After a frank and open counselling about the risks associated with a pregnancy, namely, thrombosis (especially considering the in vitro fertilization and MPN) and variceal bleeding, she decided to begin the process of in vitro fertilization. Rivaroxaban was replaced by once a day subcutaneous therapeutic dose of dalteparin (18 000 units) and clopidogrel was stopped. She was already taking nadolol 20 mg once daily for her gastric varices. At her 5th week of pregnancy, she had vaginal bleeding, but after a few days of bed rest, it did not recur. Her ultrasound at gestational week 22 showed fetal growth at the 10th percentile. She was hospitalized for 48h at 26 weeks of pregnancy for severe intrauterine growth restriction (IUGR) secondary to placental insufficiency. Nadolol may have also contributed to the IUGR []. There was no preeclampsia so she was discharged from the hospital. She finally had a cesarean section at 32+1 weeks for severe IUGR and increased umbilical doppler resistance. This delivery route was chosen because of breech presentation. At her 3 weeks postpartum followup, she confirmed her decision not to pursue breastfeeding. After a long discussion, it was then decided to stop dalteparin and start apixaban 2.5 mg twice daily, a reduced dose to minimize the risk of variceal bleeding while preventing another thrombosis.
pmc-6437727-1
The patient was a 3-year 7-month-old female referred by her speech-language pathologist, presenting with oromyofascial dysfunction characterized by speech sound production errors, difficulty swallowing, open mouth breathing, and noisy breathing during sleep. With respect to sleep, there were reports of difficulties going to sleep, waking up two to three times per night to drink water, getting up to go to the bathroom, open mouth breathing while asleep (), snoring during sleep, and sweating more than usual during sleep. She experienced wheezing that was associated with asthma, which was treated with an Albuterol sulfate inhaler. There were reports of difficulty with effective chewing. In addition, the patient would eat around 50% of her meals, before refusing the rest. She experienced chronic cough and recurrent upper respiratory tract infections. Physical examination () of the patient showed her to be well developed, well nourished, and to appear the stated age. The patient was alert, oriented, able to communicate, and respond appropriately to questions. During the nasal examination, the nose had no external deformity. The nasal septum was straight, and the inferior turbinates were grade 2 bilaterally. There were class 3 dental occlusion and a class 3 facial-skeletal relationship characteristic of anterior-posterior maxillary deficiency. Oropharyngeal examination showed grade 3 modified Mallampati tongue position and grade 2 tonsils. The patient was found to have a restrictive class 2 upper labial frenulum with tethering of the upper lip () and restrictive grade 4 lingual frenulum [] (). Based on the patient history and the physical examination, the assessment revealed that the patient had functional and structural mouth breathing due to open mouth posture and low tongue posture in the setting of restrictive labial and lingual frenulum. The risks and benefits of lingual and labial frenuloplasty to facilitate lip closure and proper tongue resting posture were discussed with the parents and included, but were not limited to pain, inflammation, bleeding, scarring, need for revision surgery, and failure for significant improvement. An informed consent document was signed by the parents. The maxillary labial frenuloplasty was performed under general anesthesia. Local anesthesia was achieved by applying 1 cc of 0.25% Marcaine with 1 : 200000 epinephrine to the maxillary labial frenulum via a 27-gauge needle. Pressure was applied lateral to the frenulum to locate the point of maximum tension. The maxillary labial frenulum was incised at the base of attachment with the use of sharp scissors. A V-to-Y lip closure was performed with a 4-0 chromic suture applied in a simple interrupted fashion (). The lingual frenuloplasty procedure was then performed. A 2-0 silk suture was applied to the tip of the tongue as a retraction stitch. Local anesthesia was achieved by applying 1 cc of 0.25% Marcaine with 1 : 200000 epinephrine to the lingual frenulum via a 27-gauge needle. The tongue was retracted in the anteroposterior direction extending to the roof of the mouth and maxillary central incisors. Tension was applied to the floor of the mouth to protect the floor of mouth salivary glands, as well as Wharton's duct. A hemostat was used to clamp the restrictive lingual frenulum 5 mm above the attachments of the sublingual gland duct. The fibrous band was gently excised with the use of iris scissors. The underlying myofascial fibers of the genioglossus muscle were dissected further, with blunt cotton tips and sharp iris scissors being used to release the muscle from the overlying mucosa. The dissection was continued until there was adequate improvement to the tongue range of motion such that the tongue could extend up towards the maxillary central incisors in maximal mouth opening position. Simple interrupted sutures were used to close the diamond-shaped defect into a vertical line, as a means to lengthen the ventral tongue, with 4-0 chromic suture applied in a simple interrupted fashion. In total, the tongue was released from a grade 4 restricted range of motion to a grade 1 range of motion (). All wounds were hemostatic at the completion of the procedure. The patient was gently awoken from anesthesia and taken to recovery in stable condition. The patient returned to the clinic four days after the procedure. The wound sites were healing appropriately, and there were no postoperative complications observed. The patient's mother reported that within the first day of returning home, the patient's issues with chewing had improved significantly, and she was more interested in eating different foods. In addition, her appetite appeared to have increased, and the patient would complete her entire meal before asking for more food (as compared to having only eaten around 50% before treatment). By the fourth day after surgery, the patient exhibited closed-mouth nasal breathing while asleep (). There were no longer any observed events of snoring and/or noisy breathing. The mother reported that the patient had remained compliant with myofunctional and speech therapy. The patient returned for a 2-month postoperative visit. During the examination at this visit, no scar tissue was observed, and the wound sites had closed. Grade 1 tongue range of motion was observed (). The patient's family wrote in a letter to the clinic approximately six months after the procedure, mentioning that the patient was doing very well with no complications. In addition, the patient had been reported to have completely stopped mouth breathing and snoring while asleep. However, the patient was reported to still have occasional episodes of cold and cough, as well as one episode of asthma exacerbation. Finally, the patient was reported by her family to have made progress with myofunctional and speech therapy, but the goals of eliminating the tongue thrust, achieving proper resting posture, and improving speech sound production errors were not met due to early discontinuation of treatment.
pmc-6437729-1
A 57-year-old woman with good performance status was detected to have a large right renal mass with adrenal extension and tumor thrombus extending to the right atrium (Figures and ). She was also noted to have enhancing liver lesions (), suggestive of metastatic disease (cT4N1M1). Pulmonary embolus and retroperitoneal lymphadenopathy were also noted. Biopsy of the mass revealed clear cell renal cell carcinoma, WHO ISUP nucleolar grade 3. She received Apixaban 10mg/day for management of pulmonary embolus. She was started on Pazopanib 800 mg orally once daily which was later switched to Nivolumab after she developed upper gastrointestinal bleeding secondary to a duodenal ulcer. Interval imaging 6 months after targeted therapy revealed a decrease in the size of the primary renal mass, although the thrombus extension into the IVC still persisted with development of new hilar lymphadenopathy and segmental pulmonary embolism. Nivolumab was continued and 3-month PET/CT showed further reduction in the size of the renal mass with thrombus extension now to the level of liver. There were new enhancing masses in the liver suspicious for metastases with subcarinal, precarinal, and bilateral hilar mediastinal lymphadenopathy. She was initiated on Cabozantinib in addition to the Nivolumab in view of new lymphadenopathy. She tolerated the new regimen very well and was completely symptom-free with this therapeutic combination (). New imaging with PET/CT showed no FDG avid lesions anywhere in the body including the IVC thrombus with significant reduction in the size of the renal mass. MRI Angiogram of the abdomen showed the IVC thrombus invading the IVC lateral wall and situated below the hepatic veins (). Based on the imaging, it was decided to proceed with posttherapy right cytoreductive nephrectomy with IVC thrombectomy. The anticoagulant was stopped and bridging was done with Heparin prior to the surgery. Intraoperative findings were that of a large renal mass with an infiltrating IVC thrombus in the retrohepatic location (using TEE assistance) with no gross evidence of metastases. Open radical nephrectomy with IVC thrombectomy and caval reconstruction was carried out with complete tumor thrombus resection (). The patient did well postoperatively and was discharged on 6th postoperative day symptom-free. Radical nephrectomy specimen examination showed a necrotic nonviable carcinoma consistent with an RCC with complete response measuring 7 cm in size with perinephric extension. The tumor was extensively sampled and no viable carcinoma was detected (). The necrotic tumor was surrounded by a thick fibromuscular pseudocapsule typically see in clear cell renal cell carcinoma which maintains its structure and did not have necrosis []. IVC specimen showed a necrotic nonviable carcinoma in the lumen of renal vein as well (). The AJCC 8th edition pathological stage was ypT0Nx Mn/a. She was fully back to her activities of daily living with no complaints at the time of her first follow-up visit to the clinic at the postoperative visit at 3 weeks. She will continue to follow up with both the Urological Oncology and Medical Oncology teams. She has not been planned for adjuvant targeted therapy at this stage in view of no evidence of residual disease.
pmc-6437748-1
A 23-year-old young woman presented at the Obstetrics and Gynaecology Department of the Tamale Teaching Hospital (THH) with abdominal swelling of four months duration and a month's history of abdominal pain. Physical examination revealed a right-sided tender mass, mobile in all the planes. A pelvic ultrasound diagnosis of a benign ovarian mass with cystic components was made. All the other systems were essentially normal. She had emergency laparotomy and right oophorectomy performed. The specimen was sent to Der Medical Diagnosis Centre for histopathological examination. Gross. A tan nodular mass measuring 12.5x10.0x8.5cm was received in the diagnostic centre. Slicing through the mass revealed a lesion with predominantly tan to whitish grey solid component with few cystic cavities (). Microscopic Examination. Sections of representative portions of the ovarian mass showed predominantly a solid lesion with few cystic areas. The cysts were lined by squamous, gastrointestinal, and respiratory type epithelium. The solid component was composed largely of islands, nests, sheets, and tubules of immature neuroepithelial cells or elements. There were islands of mature brain tissue, adipose tissue, cartilage, and skeletal muscles in the stroma (). Histological Diagnosis. Right ovary (oophorectomy): immature cystic teratoma.
pmc-6437748-2
A 10-year-old girl presented at the outpatient department of the Upper East Regional Hospital, Bolgatanga, with a six-month history of recurrent intra-abdominal pain. Examination revealed a painful mobile intra-abdominal mass. Abdominopelvic ultrasound conducted suggested a mature cystic teratoma. She was referred to the Obstetrics and Gynaecology Unit of the same hospital where she had an emergency laparotomy carried out. The specimen was sent to Der Medical Diagnostic Centre in Tamale, in the Northern Region for histopathological examination. Gross. A tan nodular mass measuring 19.0x17.0x7.5cm was received at the Diagnostic Centre. The cut surface was variegated with solid and cystic components. The cysts were filled with cream-coloured semisolid material (). Microscopy. Sections of representative portions of the ovarian mass showed a multicystic lesion with solid components. The cysts were lined by mature and immature ectodermal elements. The solid components consisted predominantly of sheets, nests, and tubules of immature neuroepithelial cells or elements. The immature mesenchymal elements were cartilage, bone, skeletal muscle, and ocular elements (). Histological Diagnosis. Right ovary (oophorectomy): immature cystic teratoma.
pmc-6437748-3
A 20-year-old adolescent girl presented at the outpatient unit of the Presbyterian Hospital in Bawku in the Upper East Region of Ghana with a left intra-abdominal mass of more than five-month duration. A diagnosis of a mature left ovarian cystic teratoma was made based on the ultrasonographic findings. She had laparotomy and oophorectomy and the specimen was sent to Der Medical Diagnostic Centre in Tamale for histopathological examination. Gross. An ovarian mass that measured 17.0x14.0x8.0cm was received. The cut surface of the mass was multicystic with tan nodular solid components. The cysts were filled with cream-coloured semisolid material. Microscopic Examination. Sections of representative portions of the ovarian mass showed a lesion with cystic and solid components. The cysts were lined by squamous and respiratory type epithelium. The solid component was composed predominantly of immature neuroepithelial cells or elements in sheets and tubules. There were areas of haemorrhages and necrosis (). Histological Diagnosis. Left ovarian mass (oophorectomy): immature cystic teratoma.
pmc-6437752-1
A 60-year-old male presented with fatigue, sensory neuropathy, and lab findings of anemia and elevated albumin-globulin gap. Serum protein electrophoresis (SPEP) with immunofixation detected an IgM-kappa monoclonal protein quantitated at 3.9 g/dL. Free kappa-lambda light chain ratio was >390. Bone marrow evaluation revealed 70% marrow cellularity with kappa light chain restriction on staining. Bone marrow core biopsy evaluation showed 14% plasmacytes and plasmacytoid lymphocytes. A diagnosis of WM was made after serum IgM returned elevated at 12,500 mg/dL. The patient underwent plasmapheresis after developing hyperviscosity symptoms of blurred vision and headache. Subsequently, he received several lines of systemic therapy including rituximab-based and bortezomib-based treatment as well as ibrutinib. He was eventually hospitalized for fevers and altered mental status. Infectious work up, brain MRI, and routine CSF studies were unrevealing and he spontaneously improved. Several weeks later, he was hospitalized again with confusion and falls. Despite treatment of identified bacteremia and urinary tract infections, his mental status progressively worsened. Exam was notable for bilateral paratonia with sustained leg flexion, decorticate posture of right upper extremity, bilateral patellar hyperreflexia, and complete disorientation. MRI brain showed left cerebellar signal hyperintensity on T2 FLAIR sequence. Serum viscosity was within the normal range. EEG revealed no epileptiform activity. CSF had elevated protein and normal glucose levels, and all CSF infectious studies were negative. Cell counts showed only 2 WBC/mm3, and cytology and flow cytometry were limited by a paucity of cells. Paraneoplastic panels in serum and CSF were unrevealing. Immunofixation of CSF revealed a kappa-restricted IgM. Serum levels of IgM, free light chains, and beta-2 glycoprotein all were stable to improved. Given the cerebellar enhancement noted on MRI and monoclonal IgM noted in the CSF, concern was raised for infiltration of CNS by his WM. Brain biopsy was offered but declined by the patient's family, given his overall clinical deterioration. A trial of empiric high-dose corticosteroid failed to yield improvement, and he was transitioned to hospice care.
pmc-6437879-1
In January, 2018, a 58 years old male patient was hospitalized for a tumor of the tongue (Fig. a). As comorbidity factors, a gastric ulcer (1983), vein thrombosis (2016), smoking and alcohol abuse stopped in 2015, were documented. In 2017, the patient was treated by radio-chemotherapy for an invasive carcinoma of the anal canal, stage T3NxM0. At examination, the lingual tumor was localized on the submucosal part of the left side of the tongue and measured 11 × 11 mm at MRI (Fig. b). The patient benefited from a surgical removal of the tumor (Fig. a). The histological analysis of the specimen showed that the bulk of the tumor was localized in the tongue muscle, the upper part of the lesion remaining at 0.5 mm of the basal membrane (Fig. b). The epithelium was normal, without ulceration or intra-epithelial neoplasia. At higher magnification, the tumor corresponded to a squamous cell carcinoma (SCC), keratinizing (Fig. c). The stroma presented moderate lymphocytic infiltration. No vascular or peri-neural invasion was seen. Immunophenotyping revealed a strong p16 labeling (100% of the cells) (Fig. d). The tumor was well limited in the periphery and the surgical margins were clear. Considering the previous diagnosis of carcinoma of the anal canal, the histological features of the two tumors were compared and complementary virological analyses were performed in order to document a possible metastasis to the tongue from the original primary anal tumor. Histologically, anal and lingual tumors corresponded to bona fide SCCs (Fig. c, e). As compared to the lingual tumor, the keratinization in the anal carcinoma was less pronounced and a poorly differentiated component somewhat reminiscent of a basaloid carcinoma was also present, exhibiting necrotic foci. At the upper part of this anal tumor specimen, there was an ulceration edged by lateral extension of high grade intra-epithelial neoplasia. In addition, on the epithelium, distant from the ulceration, there were condylomatous changes characterized by the presence of irregular nuclei, monocellular dyskeratosis and koilocytes at the surface layer of the epithelium (Fig. f). Immunohistochemistry showed a strong p16 expression (100% of the cells), also observed in the intra-epithelial and condylomatous lesions. HPV detection was performed by PCR using primers specific for HPV16 and HPV18, as well as the consensus GP5/GP6 primers. This analysis found HPV16 DNA in the two tumor specimens (Fig. ) and consensus HPV sequences in the anal carcinoma specimen. In situ hybridization was performed using the INFORM HPVIII Family 16 probe (Ventana Medical Systems Tucson, AZ, USA) detecting HPV16, 18, 31, 33, 35, 45, 52, 56, 58, 66 genotypes. This analysis showed the presence of scattered dot signals, located close to the nucleus membrane of the tumor cells in anal and lingual carcinoma (Fig. ), corresponding to the presence of integrated HPV DNA sequences. No signal was found in the surrounding tissue or in the epithelium. The condylomatous lesion in the anal specimen was negative. The two tumors presented thus substantial histological and viral similarities but these observations could not permit to conclude metastasis originating from anal tumor since similar tumors associated with the same HPV genotype could be developed independently in the two organs. Therefore, we decided to further analyze these two tumors using the CaptHPV assay in separate experiments, in order to see if specific viral signature could help to make the diagnosis more precise. Using this assay, HPV53 and HPV16 genomes were found in the anal carcinoma (5258 and 75,990 reads, respectively, out of 111,644 reads including 3 human one-copy housekeeping genes as a control for the CaptHPV method). Whereas HPV53 DNA sequences corresponded to the full length viral genome, most probably related to viral episomes, HPV16 DNA showed a breakpoint on the E2/E4 ORFs with a deletion of 6 nucleotides. The LCR, E6 E7 L1 and L2 ORFs were conserved. The identified integration mechanism of HPV16 in the tumor cell genome was that of two junctions in a co-linear pattern (2J-Col). Analysis found 55 viral/human hybrid reads allowing the identification of the HPV16 DNA integration in the 4q25 chromosomal band locus with a 178,808 bp deletion in the cell genome corresponding to the deletion of C4orf32 (FAM241A) gene and CCDC34P1, RPS12P8, RPL36AP19 and TUBB8P3 pseudogenes (Fig. ). In the carcinoma of the tongue, molecular analysis disclosed 6110 reads of HPV16, without evidence of HPV53 DNA. The viral pattern was strictly identical to that observed in the anal tumor: conservation of the LCR, E6 E7 L1 and L2 ORFs and breakpoint of the E2/E4 ORF with 6 nucleotides deletion. A total of 131 hybrid reads between HPV16 and the cell genome were found, corresponding exactly to the same locus of integration of viral DNA at the 4q25 site. The 178,808 bp genomic deletion was also found in the lingual tumor. We hypothesized that the absence of HPV53 in the lingual tumor was related to the fact that this genotype was associated with the intra-epithelial neoplasia found in the vicinity of the anal carcinoma, and was not involved in the tumor spread. To confirm this hypothesis, we performed macro-dissection of this intra-epithelial neoplasia and DNA extracted was analyzed using CaptHPV method. This analysis found episomal HPV53 DNA sequences, confirming thus the co-occurrence HPV53-associated intra-epithelial lesion and HPV16-associated invasive carcinoma in the anal tissue specimen. On the whole, the perfect identity of the molecular features of the HPV16 DNA sequences and integration pattern in the two tumors demonstrates that the tongue tumor is a metastasis of the anal carcinoma.
pmc-6437885-1
A 51 year-old male veteran presented with progressive lethargy, fevers and constant frontotemporal headache for past 3 weeks as well as 20 pound weight loss in past 6 months. Born in Guam, the patient had been stationed as part of the military in Texas, Arizona and Kansas. His medical history was notable for polycythemia vera (PCV) treated with ruxolitinib for 18 months. Three months before admission, he had recurrent mouth ulcers, followed by a dental root canal procedure complicated by ulcerative gingivitis, pulpitis and tooth erosions requiring antibiotics and multiple oral surgeries. All antimicrobials had been discontinued over a month prior to presentation. On admission the patient was febrile to 103.5 °F, tachycardic, and saturating 95% on 2 l of oxygen by nasal cannula. Physical exam revealed somnolence, diminished breath sounds at the left lung base and diffuse abdominal tenderness. Neurologic exam identified no focal deficits. Initial laboratory studies (normal range) revealed hyponatremia to 125 (136–145) mmol/L and a creatinine elevation to 1.8 (0.67–1.17) mg/dL. He also had an elevated alkaline phosphatase of 208 (35–140) U/L and total bilirubin of 1.6 (< 1.2) mg/dL. White cell count was 8002 (4000-10,000) cells/mm3 with 74% polymorphonuclear cells and 13% lymphocytes. The C-reactive protein level was 3.89 (< 0.5) mg/dL and the erythrocyte sedimentation rate was 36 (< 30) mm/hr. Rapid HIV antibody testing, as well as HIV viral load, were negative. The brain MRI revealed innumerable rim enhancing lesions at the gray-white junction consistent with pyogenic abscesses secondary to hematogenous infection (Fig. a). A lumbar puncture revealed 10 mononuclear cells and 9 polymorphonuclear cells/ml CSF. Glucose was 27 (40–70) mg/dL and protein was 72 (15–45) mg/dL. Vancomycin, ceftriaxone and metronidazole were initiated empirically. The patient subsequently underwent chest (Fig. b and c) and abdominal CT examinations (Fig. d) to evaluate diminished breath sounds and abdominal tenderness. A retrocardiac mass was seen measuring 2.7 cm as well as bilaterally enlarged adrenal glands consistent with infiltrative infection or neoplasm. CSF cultures grew no bacteria; however, cryptococcal antigen was detected with titer of 1:> 256 in CSF and 1:128 in the serum. Fungal CSF cultures grew Cryptococcus neoformans. An adrenal biopsy performed by interventional radiology revealed numerous fungal organisms on histopathology. Gomorri methenamine silver (GMS) and periodic acid-Schiff (PAS) stains highlighted budding yeast forms within macrophages, most consistent with histoplasmosis. Histoplasma capsulatum subsequently grew in fungal blood cultures. Histoplasma antigen was 11.9 (< 0.5) ng/mL in urine, 8.46 (< 0.4) ng/mL in the serum and 1.86 (< 0.4) ng/mL in CSF. Cryptococcal susceptibilities ultimately returned with an MIC of < 0.03 μg/ml to isavuconazole and 0.25 μg/ml to posaconazole; Histoplasma susceptibilities were < 0.03 μg/ml to both isavuconazole and posaconazole. The patient was diagnosed with concurrent cryptococcal meningitis as well as disseminated histoplasmosis. Amphotericin infusion as Ambisome at 5 mg/kg every 48 h with flucytosine 1 g q6hrs were initiated for treatment of both identified fungal organisms with improvement of symptoms. Given limited evidence of the successful use of the newer azoles, posaconazole [–] and isavuconazole [–] for CNS disease, the patient was continued on amphotericin infusions for three months and transitioned to 372 mg isavuconazole daily when renal toxicity was noted with Ambisome. A follow up MRI at that time demonstrated diminishing rim-enhancing lesions. The retrocardiac mass was smaller in size on repeat imaging; however, the appearance of the adrenal glands remained unchanged. Cryptococcal antigen titers were 1:16 in serum and 1:8 in CSF. Histoplasmosis antigen in the urine was 0.83 (< 0.5) ng/mL and was no longer detected in the serum. A biopsy of the brain lesions was not performed; however, we hypothesized that the brain lesions were caused by hematogenous spread of histoplasmosis to the gray-white junction with resulting granuloma formation. At the time this case report was written, the patient was still being treated with isavuconazole. Of note, once the patient was diagnosed with the two fungal infections, ruxolitinib was discontinued. Given the severity of his presentation, his primary oncologist believed that a re-challenge with ruxolitinib was contraindicated. After further discussion with the patient, he had recollected a 2 cm ulcerative, painful tongue mass (Fig. a) that first appeared three months after initiating ruxolitinib. This had been biopsied in the past and was not malignant, but had not been evaluated with fungal culture. Retrospective review of the pathology slides was suggestive of histoplasmosis, with small budding yeast forms noted within granulomas on GMS stain (Fig. b).
pmc-6437917-1
A 71-year-old woman with a history of hypertension, hyperlipemia, and angina was admitted to our Department of Neurology for tinnitus in the head. On physical examination, bilateral hearing impairment was found. The cerebral magnetic resonance imaging (MRI) detected signal changes consisted with multiple cerebral infarctions and bilateral demyelination in the centrum semiovale. And the cerebral MRA detected atherosclerotic cerebral arteries and bilateral stenosis of the middle cerebral arteries (Fig. a, b). For further diagnosis, the patient underwent DSA subsequently. The total amount of iopamidol (Bracco Imaging Italia S.r.L.) administered during the procedure was 110 ml. The DSA showed that the patient had bilateral embryonic posterior cerebral arteries, 40% stenosis of the left middle cerebral artery and tortuous vertebral arteries bilaterally. There was no obvious calcification of the aortic arch; angiography of the arch using 25 ml iopamidol was performed only once. Ten minutes after the aortic arch angiography, the patient experienced mild headache. The pain was bearable, and the patient could cooperate during the remainder of the procedure. The DSA was completed 20 min later. No haemorrhage or vasospasm was detected during the procedure. The headache was continuous, and the patient suffered nausea and vomiting. The immediate physical examination showed no obvious abnormal sign. The patient was treated with 8 mg ramosetron and 10 mg dexamethasone. After 20 min of observation, the symptoms were relieved. Her cerebral CT scan at the time was normal (Fig. a, b, c). Two hours later, the patient manifested dizziness with nausea and vomiting and was treated with 8 mg ondansetron and 20 mg diphenhydramine. Meanwhile, compound sodium chloride injection was used to facilitate the elimination of the contrast agent. The treatment alleviated her symptoms. Four hours after the procedure, the patient re-experienced dizziness; thus 5 mg dexamethasone was administered but resulted in no alleviation until after 11 h wherein dizziness was relived but her blood pressure was 183/92 mmHg. The patient was drowsy but could answer questions correctly. The pupil were symmetric and reactive, and limb movements were preserved. To manage hypertension, 30 mg nimodipine tablets were used. Fourteen hours after the procedure, the patient fell asleep, but at 17 h, respiratory failure progressed and oxygen saturation dropped to 88%. The patient was in a coma state, with sighing respiration. Anisocoria with non-reactive pupils developed, limb drop test was positive along with flexor plantar and Babinski sign was negative. Therefore, cerebral hernia was considered. The patient was treated with 20% mannitol, nikethamide, lobeline and diprophylline, and was transferred to the intensive care unit for further treatment after cardio-pulmonary resuscitation, endotracheal intubation and mechanical ventilation. Two days after the procedure, cerebral CT scan indicated diffuse cerebral oedema, loss of grey-white differentiation, effacement of the cerebral sulci and decrease in cerebrospinal fluid space (Fig. d, e, f). The patient was treated with dehydration, mechanical ventilation, and anti-infectious agent, but the diffuse cerebral oedema did not improve. Nine days after the procedure, the third cerebral CT scan showed that the cerebral oedema had become much more severe, the ventricles had disappeared and there was hyperdense signal in the subarachnoid space, which was considered to be indicative of a pseudo-subarachnoid haemorrhage due to the severe cerebral oedema [] (Fig. g, h, i). Fifteen days after the procedure, the cerebral CT scan detected unrelieved diffuse cerebral oedema, and the hyperdense signal in the subarachnoid space persisted (Fig. j, k, l). None of these cerebral CT scans showed intracerebral haemorrhage or infarct in this patient. The patient remained in a continuous deep coma state, and the brainstem reflexes had disappeared; she died 56 days after that sudden deterioration.
pmc-6437929-1
One patient, a 62-year-old male, had a PR after two consecutive cycles of icaritin treatment. This patient started the medication after progression on transcatheter arterial chemoembolization (TACE) due to newly identified multiple abdominal lymph node metastases. Tumour lesion shrinkage was observed at 8, 16, and 32 weeks post-treatment compared to the CT image at baseline (D0) with the RECIST1.1 evaluation standard (Fig. A). After 4 cycles (16 weeks) of treatment, the target lesions were assessed as CR (Fig. A, left bottom), and the total objective response was PR, given the presence of non-target liver lesions (Fig. ). Baseline levels of NLR, PLR and SII were 1.66, 58, and 192, respectively. The baseline AFP level was 5216 ng/ml at pre-screening and it continuously declined to 6.7 ng/ml during treatment (Fig. B). Circulating IL-6, IL-8, and IL-10 levels were concomitantly decreased along with tumour shrinkage after 24 weeks of treatment. Interestingly, the IFN-γ level was increased by up to 3 folds after 2 weeks of icaritin treatment, which may indicate the cytotoxic immune T-cell priming or activation (Fig. B).
pmc-6437957-1
A 32-year-old man was admitted to our hospital on June 5, 2018, with a 2-month history of recurrent fever and the loss of 5 kg of weight. Two months prior, he suffered chills after eating kebabs, followed by a fever (up to 39 °C), accompanied by a headache and dizziness. He received anti-infective and anti-inflammatory therapy for a pulmonary infection at the local hospital. However, he still had a high fever with fatigue. On April 23, the serum agglutination test for Brucella was positive, with a titer of 1:400. Both the blood and bone marrow cultures were negative, and after he was diagnosed with brucellosis, therapy with doxycycline, moxifloxacin, and streptomycin was initiated. After 1 month of regular anti-brucellosis therapy, although the peak temperature had dropped to 38 °C, he still had the fever and aggravated anaemia. Due to the negative repeat test for Brucella, the regimen was adjusted to isoniazid, levofloxacin, streptomycin, rifampicin and dexamethasone anti-tuberculosis therapy. He continued to experience the recurrent fever until admission to our hospital on June 5. In March 2009, he had undergone a Bentall procedure and ventricular septal repair due to congenital heart disease and was found to be positive for the hepatitis B surface antigen but did not receive antiviral therapy. The patient was immunocompetent, serologically negative for human immunodeficiency virus (HIV) and denied any history of contact with cattle and sheep. At admission, his body temperature was 37.5 °C, his heart rate was 78 beats/min, his respiratory rate was 18 breaths/min, and his blood pressure was 120/66 mmHg. On physical examination, he was found to be anaemic. His abnormal laboratory findings were as follows: aggravated normochromic anaemia (haemoglobin: 71 g/mL), elevated levels of inflammatory markers (C-reactive protein: 43.1 mg/L; procalcitonin: 0.38 ng/mL), acute renal insufficiency (blood urea nitrogen: 23.1 mmol/L; creatinine: 343 μmol/L) and hypoproteinemia (albumin: 30 g/L) with normal levels of aminotransferase (Table ). An interferon-gamma release assay (IGRA) for tuberculosis was positive. Furthermore, next-generation sequencing (NGS) detected M. tuberculosis complex from two blood samples. However, the Xpert MTB assay and acid-fast bacilli smear for sputum samples were both negative. The blood cultures remained negative. A computed tomography (CT) scan of the chest suggested bilateral pneumonia (Fig. ). Abdominal ultrasound revealed enlargement of his liver, spleen (169 × 65 mm) and kidney (left: 145 × 67 mm; right: 146 × 52 mm). Echocardiography showed mechanical prosthetic aortic valve paravalvular abscess without vegetation formation (Fig. ). Then, the patient was empirically administered fosfomycin and daptomycin as a treatment for gram-positive bacterial infection, but his body temperature remained high (up to 38.4 °C). Thus, the regimen was switched to anti-tuberculosis drugs (isoniazid 0.3 g once daily, ethambutol 0.75 g once daily, moxifloxacin 0.4 g once daily and linezolid 0.6 g once daily); however, his temperature remained between 37 and 38.5 °C. Then, he was transferred to the Department of Cardiac Surgery, Shanghai Sixth People’s hospital for a second surgery on June 25. Surprisingly, NGS detected a large number of M. tuberculosis complex sequences in intraoperative samples of the aortic root abscesses. The patient had postoperatively intermittent fever, mostly peaking in the afternoon. After 2 weeks of combined anti-tuberculosis treatment with linezolid (0.6 g once daily), rifampicin (0.3 g twice daily), pyrazinamide (0.5 g three times daily), ethambutol (0.75 g once daily), isoniazid (0.3 g once daily) and moxifloxacin (0.6 g once daily), his body temperature returned to normal, and his laboratory parameters improved (Table ); finally, he was discharged. On July 31, the culture of the aortic valve intraoperative scrapings was found to be positive for M. tuberculosis, which further confirmed the diagnosis of tuberculous PVE. To date, he continues to receive oral anti-tuberculosis treatment.
pmc-6438013-1
A 33-year-old chinese woman with a history of previous cesarean section was referred to her local emergency room with 8 weeks’ delay of menstruation and frequent increasing pain in the right upper quadrant of her abdomen and intense reflex sensitivity in the right shoulder for a duration of one day. In her medical history there was no record of use of an IUD, endometriosis, pelvic inflammatory disease, tubal surgery, intrauterine device, or previous ectopic pregnancy. Laboratory evaluation showed quantitative hCG of 3129.94 IU/L and hemoglobin of 10.3 g/dL. TVS examination demonstrated no evidence of intrauterine pregnancy, a normal bilateral adnexa and a large amount of free fluid in the abdomen. Considering the above factors, a CT scan of the abdomen and pelvis was performed. A 90-mm-long mixed hypodense mass was evident on the upper surface of the right liver lobe. She was diagnosed with ectopic pregnancy implanted in the liver and advised to transfer the patient to tertiary referral center. The patient traveled to our hospital and presented to the emergency room with increasing abdominal pain and weakness. On examination, her pulse was 109beats/minute and blood pressure was 90/50 mmHg. Diagnostic abdominocentesis was performed and found blood uncoagulable. Given the concern for ruptured abdominal pregnancy and hemorrhagic shock, she was taken laparoscopic surgery immediately. The laparoscopy revealed a significant hemoperitoneum (of approximately 1500 ml of blood). The uterus and ovaries appeared normal, with a corpus luteum cyst in 50 mm on the left ovary. There was no evidence of bleeding from the pelvic organs while a mount of free blood appearred aroundding perihepatic and spleen. The upper abdomen was inspected and a active bleeding was discovered from the mass with the size of 80 mm* 50 mm on the surface of diaphragm (Fig. ). The mass was completely resected from the diaphragm. When villus tissues invade the diaphragm, bleeding occurred at the attachment site, a bipolar electrocoagulation was placed to achieve hemostasis. The patient was stable and discharged 3 days after surgery with instruction for making follow-up weekly. The pathology of 7 days after surgery confirmed ectopic pregnancy (Fig. ). Her hCG levels returned to the normal range in two weeks.
pmc-6438019-1
Our patient was a 2-year-and-6-month-old Yemeni girl diagnosed with neonatal diabetes at 20 days of age on intensive insulin therapy who presented with chronic diarrhea and liver dysfunction for further evaluation. She was born at term, with a birth weight of 2000 g, and an unremarkable peinatal history, from a healthy consanguineous parent (Additional file : Figure S1). At the age of 18 months, she developed chronic diarrhea with greasy frequent stool. At the age of 22 months, she was admitted with diabetic ketoacidosis and acute liver dysfunction that resolved spontaneously. She had 3 previous hospital admissions with diabetic ketoacidosis. At the age of 2 years and 6 months, she presented at King Abdul-Aziz Hospital for the first time with a case of neonatal diabetes, chronic diarrhea with dehydration, and liver dysfunction for further evaluation and management. During her admission, she continued to have loose, greasy, pale stool. She exhibited appropriate development for her age. Physical examination revealed that her height and weight were at the 3rd percentile; she was normocephalic. She had no facial dysmorphism and a normal eye exam. She also had hepatomegaly with a span of 10 cm with no splenomegaly. No apparent skeletal deformities were noted. Initial laboratory tests revealed microcytic hypochromic anemia Hb 9.2 g/dl (10.9–13.8 g/dl), normal blood gas, normal kidney function, normal C-peptide levels, negative diabetes-associated autoantibodies, and uncontrolled glycemic control with an HbA1C of 11%. She had primary hypothyroidism: TSH 9.5 μIU/L (0.27–4.2 μIU/L) and FT4 13 pmol/L (12–22 pmol/L). She was administered 25 mcg of l-thyroxine daily. We investigated common causes of chronic diarrhea, but these causes were excluded. Stool fecal elastase was not tested as it is not available at our hospital. However, given the clinical picture, we highly suspected an exocrine pancreatic insufficiency. Regarding hepatic dysfunction, her liver function test revealed a high AST of 166 U/L (normal range, 15–37 U/L), ALT of 107 U/L (normal range, 12–78 U/L), total bilirubin of 3 Umol/L (normal range 0–17 Umol/L), and a normal coagulation profile. Viral infection, autoimmune hepatitis and metabolic problems were all excluded. Abdominal ultrasound revealed diffuse coarse hepatomegaly (10.6 cm) and a small hyperechoic pancreas. The clinical diagnosis of WRS was suspected given the presence of neonatal diabetes, recurrent episodes of acute liver failure, and chronic diarrhea most likely caused by an exocrine pancreatic insufficiency. Genomic DNA was extracted from her peripheral blood sample using a standard method. A skeletal survey of the skull, ribs, spine, pelvis, long bones (humerus and femur) showed no evidence of bone anomalies. Within less than one week following febrile illness, her clinical condition rapidly deteriorated as she developed septic shock with multisystem organ failure, including respiratory failure, hypotension, acute renal failure and fulminant liver failure with disseminated intravascular coagulation and pancytopenia. Her liver function deteriorated as follows: AST peaked to > 20,000 U/L (15–37 U/L), ALT peaked to 8944 U/L (12–78 U/L), a high total bilirubin of 140 Umol/L (0–17 Umol/L), a high direct bilirubin of 94 Umol/L, albumin was reduced to 23 g/L (40.2–47.6 g/L) and a high ammonia level of 283 Umol/L (11–32 Umol/L) with disseminated intravascular coagulation. A multidisciplinary meeting involving the pediatric intensivist, pediatric endocrinologist, and pediatric gastroenterologist was held to determine the best management plan for this child’s complex case, and the consensus was to arrange for a transfer for a possible life-saving liver transplantation. Her parents were continually involved in the decision-making. Needless to say, all necessary measures were implemented in our pediatric intensive care unit, including mechanical ventilation, inotropic support, renal dialysis, fresh frozen plasma, vitamin K and broad-spectrum antibiotics. Unfortunately, she went into asystole and died within 2 weeks of her admission. Three weeks post mortem, we received the clinical exome sequencing analysis report. Exome sequencing analysis identified that the patient harbored a novel biallelic frameshift variant (c.137_del GCCTCGGGGCGGCCGCTGCTCCCACCTCAGCGACG, p.Gly46AlafsTER19 [AHAE1] in the EIF2AK3 gene (OMIM # 60432). Genomic DNA from the specimen was enriched for the complete coding regions and splice junctions of the genes on the used panel. The products were sequenced using an Illumina Miseq instrument with 2 × 150 paired-end reads. The sequence was aligned to reference sequences based on the human genome build GRCh37/UCSC hg 19. Capillary sequencing was used to confirm relevant variants with clinical or uncertain significance. All sequence alterations were described according to the Human Genome Variation Society (HGVS). Data analysis was performed using gene-specific filtering sequencing analysis. A follow-up appointment was arranged with the parents to disclose the genetic testing results and provide further counseling and support. Unfortunately, we couldn’t perform mutation analysis testing on the parents due to their low socioeconomic status. Furthermore, the parents are from Yemen which makes commuting to our hospital in Jeddah quite difficult.
pmc-6438081-1
Case 10: A 56-year-old man had glioblastoma in the right parietal lobe, manifested by involuntary twitching at the left corner of the mouth. The tumor was resected en bloc using an optical navigation system under continuous somatosensory evoked potential monitoring. Being irradiated with a laser, resected tissues emitted strong red fluorescence, with weak red fluorescence in the surrounding area. The TPS concentration in tissue was 2.9538 μg/g in the area of strong fluorescence and 1.5765 μg/g in the area of weak fluorescence. The area of strong fluorescence was within the tumor bulk, and the area of weak fluorescence was within the surrounding brain tissues infiltrated with tumor cells. When the resection cavity was observed under laser irradiation, an area of weak fluorescence was detected and therefore was additionally resected. Pathologically, this area was assessed as a tumor infiltration area containing MIB-1 positive cells. A postoperative contrast-enhanced MRI revealed that the tumor was totally resected, and the additionally resected area was clearly identifiable ().
pmc-6438081-2
Case 18: A 41-year-old woman had glioblastoma in the left frontal lobe, manifested by mild motor aphasia and right hemiplegia. She underwent awake surgery, and laser irradiation was performed on the brain surface during the operation. By the laser irradiation, strong red fluorescence suggestive of a localized tumor was observed on the brain surface along with fluorescence from the blood vessels on the brain surface. When a laser was irradiated under white LEDs, a clear contrast was observed between the fluorescence and the surrounding brain surface. The tumor was resected en bloc and examined on the longitudinal cross-section. Strong ring-like red fluorescence was observed, which was similar to the ring-like enhancement surrounding the central necrosis on MRI images. Observation under LED illumination revealed a more detailed relationship with the surrounding brain tissue. The TPS concentration in tissue was 2.1861 μg/g in the strong fluorescence area, 0.9349 μg/g in the weak fluorescence area, and 0.4044 μg/g in the no fluorescence area in the periphery. A postoperative MRI confirmed that the contrast-enhanced lesion was totally resected ().
pmc-6438081-3
Case 2: A 30-year-old man had oligoastrocytoma in the left frontal lobe, manifested by a first episode of generalized tonic-clonic seizures. No obvious contrast enhancement was observed on the preoperative contrast-enhanced MRI. When the resected tumor tissue was irradiated with a laser, weak red fluorescence was observed at the site where the tumor had been located. The TPS concentration in tissue in this area was 0.6914 μg/g. A postoperative MRI confirmed that the lesion of prolonged T2 was totally resected ().
pmc-6438081-4
Case 1: An 18-year-old man had pilocytic astrocytoma in the vermis cerebelli, manifested by sudden headache and nausea. A preoperative contrast-enhanced MRI showed an enhanced mural nodule. During the surgery, the cyst was opened and irradiated with a laser. As a result, nodular fluorescence, tending to be strong, appeared with weak fluorescence from the surrounding cystic wall. The TPS concentration in tissue was high, being 3.163 μg/g in the strong fluorescence area and 1.614 μg/g in the weak fluorescence area. A postoperative MRI confirmed that the lesion including the cystic wall was totally resected ().
pmc-6438394-1
CW is a 44-year-old female with four living children, who presented with an 8-month history of abnormal vaginal bleeding that started as intramenstrual spotting progressed to copious post-coital bleeding at presentation. She had occasional abdominal cramps and early satiety and no history of weight changes or constipation. No other systemic manifestations were elicited; she had a PAP smear test 6 years earlier that was normal. On clinical exam, the only positives were palpable abdominopelvic mass measuring 8 cm and a cervical tumour 3 cm with no evidence of parametrial, pelvic side wall or rectal involvement. An ultrasound revealed a complex cystic mass with vascular mural nodules and ascites seen within the right adnexa (). A bulky uterine cervix with a thickened endometrium that was heterogeneous in appearance was also noted. A staging MRI pelvis was also done (). A heterogeneous mass was seen arising from the cervix with endoluminal extension into the endometrial cavity. The mass was causing obliteration of the anterior fornix of the vagina with evidence of parametrial invasion anteriorly and on the left. The lower third of the vagina was normal and there was no evidence of bladder or rectal invasion. Also seen were complex masses with cystic and solid components arising from both ovaries. Moderate amount of ascites, peritoneal deposits and para-aortic lymphadenopathy were also seen. The rest of the solid and hollow abdominopelvic viscera including the visualized bone marrow signals were unremarkable. Provisional diagnosis at this stage was cervical malignancy with evidence of parametrial invasion (FIGO Stage IIb) and bilateral complex adnexal masses with ascites and peritoneal deposits suggestive of primary ovarian malignancy. Biopsy of the cervix was SCC of the cervix and an ultrasound-guided biopsy of the ovarian mass was a SCC. The patient was stages as metastatic cervical cancer. Following tumour board discussion, the patient was started to systemic therapy with carboplatin and paclitaxel to reduce the disease burden.
pmc-6438395-1
We present the case of a 67-year-old female with a complicated surgical history. She initially presented to our facility with a strangulated large bowel containing ventral hernia, 10 years after undergoing LAGB procedure elsewhere. At this time, she remained morbidly obese and had been lost to follow-up. She underwent emergency surgical hernia repair with resection of necrotic transverse colon and loop ileostomy formation. One year later she presented with a LAGB port-site infection and had the port removed with the tubing sutured to the abdominal wall. During both admissions, the LAGB tubing was repeatedly seen in a stable position adjacent to the transverse colon on CT (), with no concern for penetration. Elective reversal of the ileostomy was then performed 6 months following this but was complicated by abdominal sepsis in the early post-operative period. Abdominal CT demonstrated transection of the remaining proximal transverse colon by the LAGB tubing (). This required right hemicolectomy with removal of gastric band and tubing and end ileostomy formation.
pmc-6438396-1
A 17-year-old girl was admitted after experiencing sudden onset of thunderclap headache preceded by acute loss of consciousness at her home. There was no past history of hypertension, seizures, drug abuse, trauma or infection. On admission, the initial clinical examination showed an unconscious patient GCS 10/15 Hunt & Hess classification Grade IV. After stabilization, a CT scan was performed () showing diffuse subarachnoid haemorrhage and cisternal clot at interpeduncular cistern (Modified Fisher I). Moderate dilatation of temporal horns of lateral ventricle also seen. Angiography () revealed a ruptured saccular aneurysm of less than 3 mm in diameter, with a neck of 1.5 mm at the origin of left frontopolar artery (FPA). Considering the small size of aneurysm and ruptured nature, we decided to manage it conservatively. After 2 weeks of initial subarachnoid haemorrhage, the aneurysm bled once again. Another CT scan () was obtained showing superior interhemispheric frontal haematoma opened to ventricular system (Modified Fisher IV). Coiling done on Day 15 after second haemorrhage. After selective microcatheteration of the left FPA aneurysm, it was completely obliterated with a single coil maintaining the distal arterial lumen totally permeable (). Follow-up magnetic resonant angiogram was performed 6 months after coil embolization and showed stable occlusion. (). The patient never lost follow up, after 1 year of coiling she had an episode of GTCS, immediate CT scan done showing chronic infarct left frontal lobe ().
pmc-6438398-1
A male in his 60s with dementia suffering from urinary frequency newly presented with gross hematuria. The serum prostatic specific antigen level was within the normal limits. On abdominal ultrasound, there was a round slightly hyperechoic mass in the bladder (). On plain CT, a 4 × 3 cm mass and intravesical protrusion were observed at the left side of the base of the prostate (). The mass showed isodensity with the skeletal muscle. On MRI, the mass was well-circumscribed and showed slight hyperintensity compared to the skeletal muscle on T 1 weighted imaging (T1WI) and high signal intensity on T 2 weighted imaging (T2WI) (). On dynamic gadolinium-enhanced fat-suppressed T1WI, the mass appeared to be continuous with the prostatic urethra, and showed mild enhancement in the early phase and increased enhancement in the delayed phase (). On diffusion-weighted imaging (DWI) at a b-factor of 800 s mm− 2, the tumor showed homogeneously high signal intensity and the ADC (apparent diffusion coefficient) value of the tumor was 0.75–1.00 × 10–3 mm2 s−1 (). Possible radiological differential diagnoses for the mass were stromal tumor of uncertain malignant potential (STUMP) of the prostate, pheochromocytoma of the bladder, leiomyoma/sarcoma, urethral cancer, bladder cancer, prostatic cancer and benign prostatic hyperplasia. Prostatic needle biopsy revealed stromal spindle cells with no mitosis. As there were benign entities among the radiological differential diagnoses and the biopsy revealed no malignancy, conservative management was adopted. Flexible cystoscopy at 9 months revealed a mass at the trigone of the bladder, which appeared continuous with the prostatic urethra. Biopsy revealed fibroblast-like short spindle cells with no evidence of malignancy. On follow-up MRI at approximately 10 months, the mass had increased in size and measured 6 × 5 cm (). Prostatic needle biopsy was performed again and revealed tumor cells with round and short spindle-shaped nuclei with some mitoses. These findings favored a malignant lesion, possibly STUMP or stromal sarcoma, and therefore resection of the mass was planned. Pathologically, the tumor was found in the muscularis of the prostatic urethra or the bladder. The tumor consisted of spindle cells with fascicular and storiform patterns of growth, and mucinous degeneration and some necrosis were observed in the background. The tumor was hypercellular, and a significant number of mitoses (more than 10 in 10 high-power fields) were present. Immunohistochemical analysis revealed diffuse expression of CD34. Therefore, a diagnosis of malignant SFT was made. The above findings are shown in . On follow-up CT at 54 months, local recurrence in the pelvis and multiple lung metastases were observed. Currently, the patient is under palliative care.
pmc-6438401-1
A 62-year-old male born in Sierra Leone presented to a UK hospital in January 2012 with a 3-month history of personality change, somnolence, shuffling gait and fatigue. Examination revealed right side lateral gaze palsy with rigidity and bradykinesia. A few days into his admission he developed fevers with progressive somnolence. Admission CSF showed a WCC of 250 (100% mononuclear) and a protein of 0.57 g l−1 with a normal CSF/serum glucose ratio. Herpes virus PCR was negative. HIV and syphilis serology were negative. He was found to have high levels of voltage gated potassium channel-complex antibodies with moderate levels of N-methyl-D-aspartate antibodies. He was initially treated with i.v. acyclovir and ceftriaxone with no effect. He suffered a generalised tonic-clonic seizure and unresponsiveness that required intubation and intensive therapy unit (ITU) admission. Microscopy of a bone marrow trephine revealed Trypomastigotes of T. brucei, which were subsequently seen in peripheral blood. He was transferred to the Hospital for Tropical Diseases and commenced on nifurtimox/eflornithine combination therapy as per the WHO guidelines for a Stage 2 WAT. Repeat CSF showed a positive T.b. gambiense IFAT at 1:32 and a serum IFAT was positive at 1:3200. T2W FLAIR MRI performed on transfer showed bilateral supratentorial deep white matter high signal intensity () extending to involve the cerebellum and brain stem () as well as the mesial temporal lobe structures. The ventricles appeared prominent for his age. 4 days into treatment he was extubated with reversal of his coma and he was transferred to the ward. On day 9 of treatment he became drowsy. CSF showed no evidence of trypanosomes. Given his previously high VGKC-complex antibodies he was treated with 9 cycles of plasma exchange with good effect. At 1-month post-discharge his mobility and cognition had improved and his extrapyramidal symptoms had resolved. An MRI performed 3 months following the initial scan showed new blooming artefact on SWI in the pons, putamen and thalamus () with improvement in the deep white matter signal abnormality and residual high signal in the hippocampi ().
pmc-6438401-2
A 38-year-old British male presented to a South African hospital in August 2004 after 2 years of travelling in South Africa, Malawi, Mozambique and Namibia. He presented with a 4-month history of progressive fatigue, fever, headache and sleeplessness. On arrival he was found to be febrile with mild hepatomegaly and lymphadenopathy. Bloods showed raised inflammatory markers with a CRP of 54 mg l−1 and an of 120. CSF showed a raised protein at 1.2 g l−1 with a glucose level of 2.1 mmol l−1, the WCC was 82 (100% mononuclear). CT head was unremarkable. An HIV test was negative. A blood film was positive for trypanosomes and a diagnosis of Stage 2 EAT was made. He was treated with suramin and melarsoprol with prednisolone cover. He made a full recovery and 2 weeks post-treatment his CSF had normalised. In June 2005 he reported a 2-month history of headache, night sweats, somnolence and fever. Repeat LP showed a WCC of 58 (100% mononuclear), a protein of 0.79 g l−1 and a glucose of 2.9 mmol l−1. Blood and CSF showed no trypanosomes. He was treated as a relapsed trypanosomiasis and was commenced on a 2-week course of eflornithine from which he made a rapid recovery. His CSF WCC count fell to normal levels by August 2005. In December 2005 he presented with a 2-week history of headache, fever, vertigo, diplopia and somnolence. He had a left sixth nerve palsy on examination. LP showed trypanosomes in his CSF with a WCC of 125 (100% mononuclear), a protein of 0.8 g l−1 and a glucose of 3.1 mmol l−1. His blood was positive for trypanosomes. He was treated with a repeat course of suramin and melarsoprol with prednisolone cover for relapsed Stage 2 EAT. On day 16 of his treatment he became confused and suffered a generalised tonic-clonic seizure. LP showed an opening pressure of 34cmH2O with no cells and a protein of 1.06 g l−1. An MRI at this time demonstrated T2W hyperintense signal in the supratentorial white matter extending into the posterior limbs of the internal capsules and splenium of the corpus callosum (), both of which showed corresponding restricted diffusion (). Post-contrast sequences revealed mild ependymal enhancement of the occipital horns of the lateral ventricles with no parenchymal enhancement (). Focal signal loss on T 2-star (T 2*) imaging was also present in the splenium of the corpus callosum and basal ganglia () in keeping with microhaemorrhages and he was transferred to ITU where he was sedated and intubated. Follow-up imaging 6 months later showed residual but reduced T2W FLAIR signal hyperintensity in the deep white matter, resolution of the restricted diffusion abnormalities and mild supratentorial atrophy when compared to his admission MRI ().
pmc-6438402-1
A 72-year-old lady was being investigated at our clinic for chronic abdominal pain. She has a history of hypertension. A diagnostic colonoscopy was attempted but due to tight angulation at the splenic flexure, it was abandoned and she was scheduled for a barium enema. Barium enema examination was carried out using a balloon catheter which was placed and inserted by an experienced radiographer. Approximately 100 ml of 60% w/v concentration of barium sulphate was instilled and screening commenced. However, the contrast was seen outside the rectum during screening. The procedure was immediately halted and the catheter removed. The patient complained of mild abdominal discomfort and clinically she was tachycardic with minimal per vaginal bleeding. We proceeded with a plain CT scan of the abdomen and pelvis, which revealed contrast within the liver, spleen , uterus, and the pouch of Douglas . She was promptly sent to the Emergency Department for further management. Upon clinical assessment, she appeared to be comfortable at rest but was still tachycardic with a pulse rate of 120 bpm. Abdominal examination was unremarkable. Vaginal examination by the gynaecologist revealed an atrophic vagina. No active bleeding was seen. Initial investigations revealed metabolic acidosis (pH 7.238, Bicarbonate 18.3), leukopenia (White cell count 880 ul− 1), mild thrombocytopenia (136,000 ul− 1), raised serum lactate (5.26), deranged coagulation profile [Prothrombin time 32.3, international normalised ratio 3.1, Activated Partial Thromboplastin Time (APTT)161.8]. Her liver enzymes were not raised. She was transferred to the intensive care unit, where supportive treatment was instituted. The patient developed disseminated intravascular coagulopathy which responded to transfusion of fresh frozen plasma and platelets. After 3 days in the intensive care, she returned to the ward. She developed respiratory distress in ward and CTPA was done which ruled out pulmonary embolism. She was treated for pneumonia which responded to intravenous antibiotics. Further prospective review of her plain CT confirmed the presence of contrast in the pelvic veins, consistent with intravasation of barium sulphate from the vagina. She made a full recovery and was discharged.
pmc-6438405-1
A 50-year-old female with no significant past medical history presented to the emergency department of a tertiary hospital with a 5-day history of intermittent lower abdominal pain which had worsened in the preceding few hours. The pain was associated with nausea, vomiting and anorexia. She had been constipated for 4 days which was atypical for the patient. On physical examination, the abdomen was distended, guarded and tender to percussion and on rebound. Bowel sounds were hyperactive and a PR examination was unremarkable. Blood tests showed mild hyponatraemia and acute kidney injury but there was no elevation in lactate to suggest ischaemia. White cell count, liver function tests and other electrolytes were unremarkable. She was hemodynamically stable and proceeded to have a contrast-enhanced CT of the abdomen and pelvis with contrast.
pmc-6438412-1
A 63-year-old male with a past medical history of Crohn’s disease, alcoholism, and stage III chronic kidney disease was found hallucinating by his wife. Emergency medical services (EMS) was called, and the patient was found immobilized with his left leg caught between his bed and the adjacent wall. En route, the patient developed pulseless wide complex tachycardia requiring defibrillation. Return of spontaneous circulation was achieved after one epinephrine injection. He was intubated shortly after that. On arrival to the emergency room (ER), the patient was found to be febrile (103*F), hypotensive with a blood pressure of 90/60 mmHg, and oxygenating well on minimal ventilatory settings. He was sedated due to agitation. The physical exam showed a deep open ulcer on the lower left leg (LLL) and a gangrenous-appearing ipsilateral foot. All other systems were otherwise healthy. No murmurs were heard on auscultation. Investigation He had severe derangement of his lab workup, as follows: Creatinine (Cr) of 8.07 (0.6 to 1.2 milligrams per deciliter normal), blood urea nitrogen (BUN) of 90 (7 to 20 mg/dL normal), sodium of 171 milliequivalents per liter (mEq/L) (135 to 145 mEq/L normal), potassium of 4.9 mEq/L (3.5-5.0 mEq/L normal), and serum bicarbonate of 11 mEq/L with an anion gap of 40 and an osmolar gap of 27. His complete blood count (CBC) showed white blood count (WBC) 10,900 per cubic milliliter with 69% neutrophils (4000 and 11,000 normal), hemoglobin (Hb) 16.8 g/dL, hematocrit 54.7%, and platelets 77,000 per microliter (150,000 to 450,000 per microliter normal). His troponin was elevated at 0.78, creatinine kinase (CK) was 5029 unit per liter (22 to 198 U/L), aspartate transaminase was (AST) 298 U/L (10 to 40 U/L normal), and alanine transaminase (ALT) was 94 U/L (7 to 56 U/L). A serum and urine drug screen was obtained and was negative, including an undetectable serum alcohol level. Electrocardiogram (EKG) showed sinus tachycardia. An arterial blood gas test (ABG) revealed a pH of 7.17 with appropriate respiratory compensation to the metabolic acidosis. Treatment The patient was started on empiric antibiotics due to the anticipation of septic shock. After initial resuscitation with five liters of normal saline, his blood pressure improved. Acute kidney injury related to toxic alcohol ingestion was suspected, given his long-standing history of alcoholism. Nephrology consultation recommended temporary hemodialysis overnight, which resulted in a rapid improvement in his acid-base and electrolyte disturbances. Methanol and ethylene glycol levels, sent upon admission, returned undetectable on Day 2. It was also thought that rhabdomyolysis could have occurred secondary to immobility in a sustained posture, which might have lead to myoglobinuria-related acute tubular necrosis. The elevated CK supported this diagnosis. The patient was evaluated by surgery for the necrotic foot and the determination of dry gangrene was made. A plan for eventual amputation was made once he became stable. He continued to make progress and did not require dialysis after the first night. Urine output improved after the early 18 hours with anuria. On Day 5, his basal metabolic profile showed BUN 8 and Cr 0.89. However, the patient's mental status continued to wax and wane, and he repeatedly failed attempts to wean off the ventilator. Blood cultures returned negative. On Day 5, the patient's hypotension warranted vasopressors. A repeat blood culture was collected and the antibiotics coverage broadened, suspecting septic shock, with the gangrenous foot being the likely source - an assumption with which the surgeons did not concur. His repeat CBC showed WBC 5700 (51% neutrophils), Hb 9.4 g/dL, hematocrit 27.5%, and platelets 239,000 per microliter. His blood pressure maintained well on vasopressors throughout Day 5. The next morning, the patient became hypotensive again despite being on vasopressors. A holosystolic murmur was heard on auscultation. This murmur was a new finding, which had not been present on admission or until that day. It was a grade III/VI holosystolic murmur, best heard at the apex, with radiation to the axilla. Valsalva and handgrip tests were not performed since the patient was sedated and intubated. An electrocardiogram (EKG) was ordered, which did not show any changes indicative of ischemia. Troponin levels were repeated and were not detectable. A transthoracic echocardiogram (TTE) was ordered after a cardiology consultation to rule out infective endocarditis. The echocardiogram revealed a hyperdynamic left ventricle and SAM of the anterior mitral leaflet, resulting in LVOTO (Video ) and severe mitral regurgitation evident on Doppler imaging (Video ). In contrast, an echocardiogram done on Day 2 of admission showed normal left ventricular systolic function and no valvular disease. It was suspected that he developed the post-acute kidney injury (AKI) diuresis phase during the fourth to sixth days of admission, which resulted in hypovolemia. On top of that, he developed dynamic LVOTO due to catecholamines exposure. As per the diagnosis of SAM of the anterior mitral leaflet, more aggressive fluid resuscitation, along with decreasing the vasopressor dose as tolerated, was advised. The repeat blood cultures continued to be negative. Outcome and follow-up After the institution of interventions as mentioned above, the patient's blood pressure improved, vasopressors were weaned, and the systolic murmur disappeared. The patient was also weaned off the ventilator later on. The hyperdynamic left ventricle was thought to be a result of post-AKI diuresis, rendering him hypovolemic, with the administration of vasopressors making matters worse. A repeat echocardiogram closer to discharge revealed normal left ventricular systolic function without a hyperdynamic left ventricle (Video ) and trace mitral regurgitation was seen on Doppler imaging, which may be physiologic (Video ). The septum was normal in thickness, and no regional wall motion abnormality was detected, which confirmed the transient nature of the process during periods of hyperdynamic circulation.
pmc-6438684-1
A 72-year-old Caucasian female was initially treated with breast conserving surgery and adjuvant radiation (in 2005) to the right breast for ductal carcinoma in situ (DCIS). In the fall of 2014, she noted a new cutaneous lesion on the right lateral breast. She underwent a wide local excision in October 2014 which demonstrated AS; 2 cm in maximal dimension. She was recommended for close surveillance until, in late 2016, she noted a small violaceous area of skin thickening at the 3 o’clock position with associated induration. The residual scar from the initial resection was at least 10 cm from the new violaceous lesion (Figure -). A biopsy performed in January 2017 demonstrated recurrent AS, moderately differentiated (Figure ). Her case was discussed in the multidisciplinary tumor board. Accelerated hyperfractionated radiation and concurrent ETT was recommended as neoadjuvant therapy to be followed by mastectomy and flap reconstruction. Pre-operative therapy was recommended as it would allow for removal of the majority of the re-irradiated tissue at the time of surgery. For ETT administration, the BSD-500 unit was used for all treatments. The surface temperature was monitored during each administration utilizing the incorporated thermistors of the device. Eight thermistors were placed across the breast to prevent unrecognized heterogeneity in thermal dose (Figure ). Twice weekly, ETT was administered within 30 minutes of radiation for a total of six treatments with a tumor target temperature of 40-43◦C, with a water bolus temperature of 40◦C. The ETT duration was 50-60 minutes (median, 60 minutes) per session, with the medium applicator (MA-100) in a single field technique (Figure ). She underwent computed tomography simulation (CT-Sim) and was scheduled for twice-daily radiation using a 3D-conformal technique with tangent fields and 0.5 cm tissue equivalent bolus to encompass the lesion plus a 5 cm margin and all of the previously irradiated breast tissue (Figure ). She was prescribed 4450 centigrey (cGy), of which 4200cGy was delivered in 150cGy BID treatments and a single-daily 250cGy fraction due to dosing schedule issues within a day. She tolerated radiation and concurrent ETT well without any treatment breaks. She did experience pain (requiring narcotic use) and moist desquamation confluent over the right breast which was managed conservatively with silvadene. She was evaluated four weeks later with significant improvement in her pain and skin (Figure ). Seven weeks post-thermoradiotherapy, she underwent a right total mastectomy with latissimus dorsi rotational flap and left breast reduction mammoplasty without perioperative complications. Pathology demonstrated near pathological complete response with only a microscopic focus of residual cutaneous angiosarcoma (Figure ). She healed well after surgery and is currently five months from diagnosis, and without any evidence of the disease. This research was performed on an institutional review board approved protocol for evaluation of the safety of thermal therapy with concurrent radiation.
pmc-6438685-1
A 56-year-old man with a history of ischemic cardiomyopathy, diabetes, hypertension, and 30 pack-years of smoking, presented to our care in April of 2014 for an acutely infected right TKA, originally done in 2004. He had previously undergone a failed two-stage resection and implant in 2008. Three weeks prior, he was admitted to an outside hospital for re-infection of his knee, where wound and blood cultures were positive for oxacillin sensitive Staphylococcus aureus. He underwent I&D on three occasions with an eventual placement of vacuum-assisted closure (VAC) device. The wound could not be cleared and he was referred to our care. Intra-operatively, purulent material surrounded the knee. The patellar tendon, medial retinaculum, and distal quadriceps had been completely eroded (Figure ). Radical debridement with extensive skeletonization of the proximal tibia and distal femur was performed, including resection of the patella and removal of the infected TKA. A non-biodegradable drug delivery implant was placed. Medial and lateral gastrocnemius muscle flaps were rotated and covered 95% of the spacer. There remained a 6 x 6 cm area of exposed tibia devoid of periosteum and due to the patient’s medical co-morbidities, we did not feel that the patient was fit for a prolonged microsurgical free flap transfer. Therefore, the entire wound was covered with a matrix dermal regeneration template (Integra, Life Sciences, Plainsboro, NJ) and bolstered by a non-adherent dressing and VAC therapy sponge. The post-operative course was remarkable for bilateral pleural effusions secondary to heart failure and a small hematoma that formed over the wound on post-operative day five, which was evacuated at the bedside. Three weeks later, the Integra was removed. Five weeks after, the Integra matrix was approximately 50% covered with granulation tissue and parts of the skin edges were necrotic. The patient was given the option of an above knee amputation or a free tissue transfer for wound closure as a skin graft would not have provided an adequate soft tissue envelope for a future joint prosthesis. Eight weeks after, the wound bed was debrided and a vertical rectus abdominis free flap was transferred to the right knee, where the vascular pedicle was anastomosed to the posterior tibial artery in a side-to-end manner and two posterior tibial veins with venous couplers. A Cook-Swartz implantable Doppler was placed around the deeper of the two veins. A meshed split-thickness skin graft was fixed in place. Tissue specimens were positive for vancomycin-resistant Enterococcus and Candida tropicalis. Post-operative course was otherwise unremarkable. Eight months later, a TKA and extensor mechanism repair with an Achilles tendon allograft was performed with the aid of the plastic surgeon for flap elevation and complex closure of the wound. Eleven months after his initial presentation, the patient was satisfied with the outcome as he had regained his independence and could drive. His right knee demonstrated a passive range of motion from 0°-50° and active range of motion from 20°-60°. The incisions and donor graft site were well healed with no evidence of infection (Figure ).
pmc-6438687-1
A 71-year-old woman with the past medical history of heart failure with reduced ejection fraction (EF) and AICD placement in 2015 (for low EF 5-10%) presented to the emergency room in February 2017 complaining that she had received two shocks from the AICD following an episode of vomiting. Her medical history was significant for hypertension, chronic kidney disease, coronary artery disease, and heart failure with reduced ejection fraction. Surgical history included aortic valve replacement and annular ring placement in the mitral and tricuspid valves. The patient had the AICD placed in August 2015 for the primary prevention of severe systolic dysfunction (Figures -). Since then, she had two previous admissions for AICD shocks in December 2015 and March 2016, which were assessed as inappropriate shocks due to atrial fibrillation with a rapid ventricular response and an otherwise normally functioning AICD on interrogation. Chest x-ray done at that time showed correct placement of leads. In this encounter, she denied any chest pain, abdominal pain, shortness of breath, palpitations, or dizziness. Electrocardiogram (EKG) on admission showed an ectopic atrial rhythm with premature ventricular contractions in bigeminies, an anterior fascicular block, and a left axis deviation (Figure ). Her labs were significant for normal cardiac enzymes and normocytic normochromic anemia with a hemoglobin of 9.2 g/dL, which was around her baseline. Creatinine was 2.00 mg/dL, and serum potassium was 5.2 mEq/L, which was attributed to chronic kidney disease. Brain natriuretic peptide (BNP) on admission was 2,292 pg/mL, which was lower than her baseline BNP for a past hospital admission for acute decompensation of heart failure. On examination, she was found to be non-ill appearing, in no acute distress, sitting in bed, and speaking full sentences. She was alert, awake, and oriented to self, person, and time. No jugular venous distension was observed. She had normal S1 heart sounds but loud A2. There was no early diastolic murmur or collapsing pulse. The pacemaker was in the left pectoral area with no erythema, fluid collection, or erosion. The abdomen was soft, non-tender, and bowel sounds were normal. Lower extremities had no pitting edema, and pulses were slightly more diminished than normal pulse (2+). Her recorded blood pressure was 125/83 mm-Hg with a pulse rate of 87 beats per minute. Her respiratory rate was about 16 breaths per minute, and her body mass index at this encounter was recorded at 28. The patient’s AICD interrogation was assessed as an inappropriate shock due to atrial fibrillation with a rapid ventricular rate. It also revealed loss of capture of the right ventricular lead due to lead migration. Further evaluation with a chest x-ray showed that the right ventricular lead had migrated to the right atrium (Figure ). The defibrillator generator had flipped with leads coiled around it in the transverse axis. No apparent lead damage was observed. The patient was diagnosed with Reel syndrome, and an electrophysiologist was consulted for replacement of the AICD.
pmc-6439066-1
A 74-year-old woman, who presented with complaints of repeated upper abdominal pain for 3 days, was admitted to our hospital. She had no relevant past medical history. Abdominal ultrasonography and computed tomography (CT) scan at another hospital revealed a tumor in the pancreatic uncinate process; thus, she was referred to our hospital for a comprehensive examination. The results of the laboratory tests were found to be almost normal (the italicized text indicates the test results with abnormal values): white blood cell 9130/μl, total bilirubin 1.0 mg/dl, aspartate aminotransferase 16 U/l, alanine aminotransferase 9 U/l, hemoglobin A1c 6.0%, amylase 76 U/l, C-reactive protein < 0.02 mg/dl, Ca 10.3 mg/dl, soluble interleukin-2 receptor 271.0 U/ml, IgG4 31.5 mg/dl, and antinuclear antibody 160 index. The levels of tumor markers were also normal: carcinoembryonic antigen 3.0 ng/mL, carbohydrate antigen 19-9 11.0 U/ml, DUPAN-2 < 25 U/ml, span-1 8.9 U/ml, and elastase-1 85 ng/dl. An abdominal contrast-enhanced dynamic CT scan showed a 60-mm-diameter tumor in the pancreatic uncinate process, accompanied by multiple cysts (Fig. ), and the tumor size tended to increase over time. The gastroduodenal artery was noted to be passing through within the tumor. The pancreatic duct was not enlarged and separated from the tumor. The tumor had a poor contrast effect in the arterial phase and a small contrast effect in the equilibrium phase. The gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid-enhanced magnetic resonance imaging (MRI) showed a lobulated tumor with mixed high and low signals on T2-weighted imaging (Fig. ). Out-of-phase T1-weighted imaging showed a low-intensity area, which was a fat component. This finding suggested that the tumor was unlikely to be a malignant tumor. However, diffusion-weighted images revealed a high signal lobulated tumor and suggested potential for malignancy (Fig. ). Magnetic resonance cholangiopancreatography revealed a soft tissue tumor close to the pancreatic uncinate process, and it was not continuous with the main pancreatic duct. An upper gastrointestinal examination revealed that the gastric angle was pushed to the dorsal side of the stomach by the tumor. Endoscopic ultrasonography (EUS) showed a collective cystic lesion on the ventral side of the pancreatic uncinate process (Fig. ). The main pancreatic duct was negative for intraductal papillary mucinous neoplasm. In addition, given that the tumor was accompanied by a cystic lesion, a fine-needle aspiration was not performed. In the positron emission tomography CT scan, there was no significant fluoro-deoxy-glucose accumulation in the soft tissues of the pancreatic uncinate process. The tumor in the pancreatic uncinate process was thought to be the possible cause of the upper abdominal pain. Based on the abovementioned findings, we considered that the tumor was a benign vascular malformation, but because the tumor size tended to increase over time, there was a possibility of it being a malignant tumor; thus, we planned on performing a pancreatoduodenectomy (PD). After a detailed examination, we performed an elective open laparotomy. During the operation, intraoperative findings revealed that the tumor appeared to be benign and was separate from the pancreatic duct or bile duct. We therefore performed a partial pancreatectomy instead of PD. Since the right gastroduodenal artery and small vein penetrated the tumor, they were ligated and detached. The tumor was excised with a small part of the pancreatic uncinate process, and the mesentery of the transverse colon was also removed. The operation time was 200 min with 75 ml blood loss. The patient’s postoperative course was uneventful, and she was discharged on postoperative day 12. Macroscopically, the tumor was a 58 × 46 × 30-mm specimen with a spongioid appearance of the cut surface (Fig. ). Histologically, hematoxylin and eosin staining showed a mixed shape of small veins, small arteries, and capillaries (Fig. ). The pancreatic tissue was recognized within the tumor, suggesting that the tumor originated from the pancreas. There was no lesion with suspected malignancy. We performed immunostaining for CD31, CD34, Factor VIII, and D2-40, which revealed the following in general: CD31 was positive for vascular endothelium and histiocyte; CD34 and Factor VIII were positive for vascular endothelium; and D2-40 was positive for lymphatic endothelium. In the Elastica van Gieson staining, most vessels of the tumor had no muscular layer. These vessels were capillary blood vessels (CD31, CD34, and Factor VIII were positive, and D2-40 was negative) and lymphatic vessels (CD31 and D2-40 were positive; CD34 and Factor VIII were negative). Based on both histological appearance and immunostaining findings, we diagnosed the tumor as a capillary lymphatic malformation (CLM) according to the International Society for the Study of Vascular Anomalies (ISSVA) classification.
pmc-6439070-1
A 72-year-old man visited our hospital with a 1-day history of severe lower abdominal pain, vomiting, and the inability to pass gas or stools. Two months prior to presentation, the patient underwent a robotic-assisted laparoscopic prostatectomy with ePLND for prostate cancer. The patient had no history of previous illness except for prostate cancer and was not taking any regular medications. On physical examination, he showed a pulse of 97 beats/min and blood pressure of 122/64 mmHg. His abdomen was distended and tympanitic with rebound tenderness and muscular defense. Bowel sounds were absent. His groin examination was normal with no signs of herniation through the femoral or inguinal canals. Laboratory data showed only a marked elevation of the white blood cell count (15.0 × 103 μL) and no elevation of his C-reactive protein level (0.01 mg/dL). Abdominal non-enhanced computed tomography (CT) showed a small bowel obstruction (SBO) with marked ascites. Also, a coronal non-contrast CT image revealed thickened loops of small bowel with surrounding mesenteric edema in the left lower quadrant (Fig. ). Based on these physical and radiological findings, the patient was preoperatively diagnosed as having strangulated SBO. Enhanced CT was not performed because we decided to perform urgent surgery for the patient as soon as possible. The patient thus underwent urgent laparotomy that initially showed bloody ascites in the peritoneal cavity. The ileum, which was approximately 60 cm proximal to the ileocecal junction, formed a closed loop beneath the tortuous and elongated left external iliac artery after ePLND (Fig. ), and it was also strangulated by this artery. The incarcerated ileum was gently released by a pressing maneuver from the orifice. The released ileum, 120 cm in length, appeared non-viable, showing a color change to black. We therefore resected the strangulated ileum for a length of 120 cm and performed a functional end-to-end anastomosis. The orifice beneath the left external iliac artery was about 4 cm in diameter (Fig. ). In addition, there was no hernia sac around the artery. We found it risky to try to close the orifice because of the risk of injuring the iliac artery and decided to leave it unrepaired. The postoperative course was uneventful, and the patient was discharged from our hospital 10 days after surgery. Presently, the patient is doing well 5 months after surgery without recurrent disease.
pmc-6439269-1
The patient in question is a 63-year-old Chinese gentleman with a good performance status, a non-drinker and ex-smoker of seven pack years. He was diagnosed with Child-Pugh B8 liver cirrhosis secondary to chronic Hepatitis B infection in April 2017 after being admitted with liver decompensation with ascites. During that admission, a work-up for symptomatic iron-deficiency anemia (hemoglobin 5.0 g/dL) revealed hypertensive gastropathy and four column Grade II–III esophageal varices on upper endoscopy, which were banded uneventfully. A colonoscopy revealed colonic edema indicative of portal hypertension. A triphasic computer-tomography (CT) scan of the liver showed irregular nodular contour of the liver with left lobe hypertrophy indicative of cirrhosis, with splenic and gastric cardia varices, splenorenal shunt, and severe ascites. The gallbladder was noted to be markedly distended then, but with no evidence of biliary or duodenal/pyloric obstruction. Ascitic fluid was sent for microbiology, which returned negative. He was started on medical therapy during that admission with improvement of his ascites and was discharged well. A repeat CT scan in August 2017 showed a grossly dilated gallbladder, which was not seen to be compressing on the common bile duct (CBD) with mild prominence of the central intrahepatic biliary tree. The proximal small bowel loops were also noted to be mildly prominent with increased wall enhancement, likely related to portal hypertension. Given the concerning findings of gallbladder distension, an outpatient magnetic resonance cholangiopancreatography (MRCP) was performed. The MRCP performed in November 2017 showed a markedly distended, thin-walled gallbladder with a 1 cm gallstone lodged in the proximal cystic duct (). The CBD was stretched over the distended gallbladder with focal narrowing noted at its upper third related to the mass effect, with mild intrahepatic proximal dilation. The presence of loculated ascites, clustering of small bowel loops, and mild dilation of the proximal small bowel and duodenum raised the possibility of encapsulating peritonitis. The differential diagnoses for the patient at that point were intermittent GOO secondary to gallbladder mucocele, intermittent small bowel obstruction secondary to encapsulating peritonitis, and gastritis. Cholecystectomy was offered to the patient with the aim of removing the potential source of GOO, with the caveat that his vomiting symptoms may not be fully resolved given the presence of other synchronous diagnoses. The patient declined surgical intervention at that point. The patient was admitted for postural hypotension likely secondary to intermittent vomiting in early March 2018, and a repeat CT scan once again demonstrated the distended gallbladder, with spontaneous resolution of his symptoms. His next admission in mid-April 2018 was the decisive one. He presented this time with markedly different symptoms; multiple episodes of non-bilious emesis and being unable to retain neither solids nor liquids. Abdominal examination revealed epigastric fullness with a succussion splash (). A nasogastric tube placed on intermittent suction removed three liters of yellowish effluent over the course of two days. By the time of a repeat CT abdomen pelvis two days after his admission, the output from the nasogastric tube had decreased significantly and no epigastric fullness nor succussion splash were clinically evident. Nevertheless, the CT showed a markedly distended gallbladder that had increased marginally in size, measuring 9.8 x 8.5 cm, with a resultant mass effect and compression on the second part of the duodenum. The small bowel loops were normal in caliber, but were unchanged in appearance and distribution compared to his last CT scan in March 2018 (a and b). It was determined that given the nature of symptoms and lack of small bowel dilation, that his concomitant encapsulating peritonitis was a red herring, and that the patient’s symptoms were due to GOO resulting from duodenal compression. An attempt was made for laparoscopic cholecystectomy despite the pre-operative expectation that it would likely not be possible in view of the encapsulating peritonitis. This proved to be true as safe entry could not be achieved via the umbilicus due to dense peritoneal adhesions, and the decision was made promptly for a right subcostal incision and open cholecystectomy. The distended gallbladder was covered with firm white plaques, and a cholecystostomy was performed to allow decompression of the gallbladder with a suction apparatus to enable surgical manipulation of the gallbladder and better visualization of biliary anatomy (). White mucoid bile was aspirated. A fundus first approach was used as the large size of the gallbladder even after decompression meant that the hepatocystic triangle could not be accessed immediately. A single pigmented stone 1 cm gallstone was found impacted at Hartmann’s pouch and was milked back into the gallbladder before securing and transecting the cystic duct. The small bowel loops were encapsulated within a firm white capsule but were not dilated, and the liver surface was similarly covered in the same white fibrous capsule; a biopsy of the peritoneal lining was taken for histological confirmation. The patient recovered well, and was able to be taken off his nasogastric tube and tolerate diet by the second post-operative day, and was discharged by the third post-operative day. He was seen in clinic two weeks later with full resolution of his symptoms. The histology of the gallbladder showed features consistent with a gallbladder mucocele, and the peritoneal biopsy showed fibrous tissue with chronic inflammation and reactive mesothelial hyperplasia with no features of granulomatous inflammation or malignancy.
pmc-6439343-1
A 4,200-g-male newborn was born at 41 weeks of gestation from an uneventful pregnancy to a 23-year-old healthy mother via vaginal delivery with meconium-stained amniotic fluid. The infant required resuscitation with intubation in the delivery room with Apgar scores of 1, 3, and 7 at 1, 5, and 10 min, respectively. The cord blood and 30-min arterial blood gas analysis revealed severe metabolic acidosis (pH of 6.77 and 6.92, base deficit of 33 and 20 mmol/L, bicarbonate of 11.8 and 14.2 mmol/L, and lactate of 4.1 and 3.2 mmol/L, respectively). He was treated with surfactant lavage and was placed on conventional mechanical ventilation due to MAS. The whole-body cooling was started at the first hour of his life due to the clinical evidence of HIE as hypotonia, presence of diminished deep tendon reflexes, absence of primitive neonatal reflexes with moderate depression of the neurological activity on amplitude-integrated electroencephalogram (aEEG) monitoring. The Thompson score was 17 and classified as severe encephalopathy according to criteria defined by Thompson et al. () and Shankaran et al. (). He received high-frequency ventilation and nitric oxide due to progressive respiratory insufficiency and pulmonary hypertension (50 mm-Hg) with persistent hypoxemia in the following hours. The infant was referred to our neonatal intensive care unit (NICU) to be evaluated for ECMO support at 10th h of his life. Passive cooling was performed during transport with close monitoring of the body temperature. Upon arrival at the NICU, servo-regulated whole-body therapeutic hypothermia (Tecotherm TecCom, Munich Germany) was continued. Target rectal temperature of 33–34°C was achieved and maintained through the servocontrol throughout the duration of therapy. After 72 h of hypothermia, rewarming was slowly accomplished over 8 h to reach the rectal temperature target of 36°C. Since no improvement was observed on the respiratory support and the oxygenation index was >35 on last 4 h after admission, venovenous (VV) ECMO was decided at the 14th h after delivery. A bicaval double-lumen cannula (13 Fr, Avalon, Avalon Laboratory, Los Angeles, CA) was placed by the cardiovascular surgeon. ECMO treatment was conducted using a centrifugal pump-driven system (MaquetRotaflow, Maquet Cardiopulmonary AG, Hirrlingen, Germany) and hollow-fiber membrane oxygenators (Maquet Quadrox-iD, Maquet Cardiopulmonary AG, Hirrlingen, Germany). TH was continued throughout the first 72 h on ECMO according to our cooling protocol. No complications were noted during and after TH, and the aEEG returned to continuous normal voltage. A continuous unfractioned heparin infusion at 10 units/kg/h was administered with the ECMO initiation. The dosage of heparin was adjusted according to the activated clotting time at bedside, which was aimed to keep its level within 160–200 s, and the maximum dose of unfractioned heparin during the ECMO run was 40 units/kg/h. Any short-term bleeding and circuit or patient complications were not observed during the ECMO run. Serial transfontanellar ultrasound imaging revealed no intracranial hemorrhage. The infant was successfully decannulated on the 7th day of the ECMO run. The magnetic resonance imaging was performed on the 10th day of life which was reported as normal. He was discharged with normal neurological findings. His developmental assessment with Bayley Scales of Infant and Toddler Development III (BSID-III) at 2 years old revealed age-appropriate development in all subscales. His composite scores at cognitive scale was 90 (95% confidence interval [CI]: 83–99, percentile rank: 25%), language scales were 94 (95% CI: 87–102, percentile rank: 34%), and motor scales were 85 (95% CI: 79–94, percentile rank: 16%). His developmental monitoring and support are ongoing.
pmc-6439396-1
A 15-year-old female patient (bodyweight 50 kg, height 160 cm) presented with syncope. Severe arterial hypertension was diagnosed (178/147 mmHg left arm, 102/83 mmHg left leg). She reported previous episodes of exercise independent headaches and nose bleeds. Auscultation revealed no cardiac murmurs, but an accentuated second heart sound and reduced pulses in the lower limbs. There were no clinical signs to suggest Alagille or William’s syndrome or clinical evidence of neurofibromatosis. Blood tests showed normal inflammatory markers and normal creatinine. The urine dip showed no markers for blood or protein. No regular medication was taken at the time she presented. The electrocardiogram showed normal sinus rhythm, no significant signs of left ventricular (LV) hypertrophy or abnormal repolarization. Echocardiography detected a severe concentric LV hypertrophy (14 mm diastolic septal diameter, 15 mm diastolic diameter of the LV posterior wall) and a long hypoplastic segment in the abdominal aorta with massive arterial collateralization. Cardiac catheterization confirmed the diagnosis of a midaortic syndrome with a minimum diameter of <1.5 mm and a gradient of 50 mmHg between the aortic arch and the femoral arteries (Figure ). The narrow part began directly under the diaphragm above the truncus coeliacus and continued down to the bifurcation of the arteriae iliacae including the renal arteries, with reversed flow in the caudal aorta up to the renal arteries. Because of the extraordinary length of the hypoplastic segment of 23 cm, we decided for a stepwise interventional therapy with a paclitaxel covered balloon. No additional computed tomography scan or magnetic resonance imaging (MRI) was performed. Consultation with our surgeon, supported the interventional approach. The proposed procedure was reviewed and approved by our institutional review board, extensively discussed with the patient’s family, and informed consent was obtained before proceeding. After balloon interrogation of the long stenotic abdominal aorta using a 6 × 20 mm Tyshak balloon (NuMED Inc., Hopkinton, NY, USA) to differentiate between rigid stenosis and hypoplastic parts, serial balloon dilation with a 7 × 40 mm paclitaxel covered In.Pact balloon (Medtronic, Minneapolis, MN, USA) (3 µg/mm2 Paclitaxel on the balloon) was performed (Figure ) from end to end of the stenosis. Planned redilations, to stepwise improve the aortic compliance and reduce the risk of dissection, were performed after 2, 4, and 8 months with Elutax balloons ranging from 8 mm to 12 mm diameter (Aachen Resonance, Düsseldorf, Germany) (2 µg/mm At the end of the last interventional procedure, a mild endothelial lesion at the former narrowest point of the aorta was noticed (Figure ). This lesion healed and after 2.7 years MRI showed a stable and adequate result (Figure ). Today the girl is in unrestricted physical condition. The blood pressure has markedly improved (139/64 mmHg right arm and 127/65 mmHg right leg) under therapy with atenolol and amlodipine. The patient and patient’s family consented to the publication of this case’s history and the images presented.
pmc-6439419-1
KLM, a North American white man, was 61 years old in August 2010 when he was diagnosed with a distal rectal cancer, clinically staged as T3N1M0. His initial therapeutic approach included neoadjuvant radio/chemotherapy followed by close surveillance, since digital rectal examination, proctoscopy and pelvic MRI, at the end of treatment, were normal. In September 2011, an increase in serum levels of Carcinoembryonic Antigen (CEA) was noted. A local relapse and a 3 cm lesion in liver segment VIII were simultaneously diagnosed. Some suspicious, but undetermined, small lung nodules were also observed at that time. Patient was initially submitted to a full-thickness transanal excision and then to neoadjuvant (perioperative) chemotherapy with FOLFOX followed by hepatectomy and adjuvant FOLFOX. Intensive proctologic follow up was still maintained. Molecular analyses of the tumor obtained from liver metastasis showed KRAS and BRAF wild-type status. On December 2013, lung metastases became clear and first line chemotherapy with FOLFIRI/bevacizumab was initiated. Patient was treated with this regimen until June 2015, when new hepatic lesions were detected and chemotherapy changed to irinotecan with cetuximab (CPT11/CTX). At that time, the patient agreed by written consent to have his blood periodically collected for molecular testing. He was informed that results of these tests would be, however, kept unrevealed until at least the end of treatment with anti-EGFR. Blood samples were collected periodically from June 2015 until April 2017 and the emergence and dynamics of KRAS mutations in ctDNA was monitored using ddPCR as previously described (). Briefly, 15 ml of blood were collected using tubes containing EDTA. Plasma was separated from blood by centrifugation within 2 h after collection and plasma was stored at −80°C. Cell free DNA was isolated using the QIAamp MinElute Virus Vacuum Kit and stored at −80°C. We used a RNase P Copy Number Reference Assay to determine the total amount of DNA in plasma samples and a commercial assay designed for the detection of frequent KRAS mutations (KRAS Screening Kit BioRad – G12V, G12D, G12A, G12C, G12R, G12S e G13D). A total of 3000–3500 genome equivalents were analyzed per reaction for a detection sensitivity between 0.1 and 0.5%. ddPCR was performed on the QX200 Droplet Digital PCR System and data were analyzed using QuantaSoft software. ctDNA detection results are presented as fractional abundance (proportion of the mutant allele in total circulating DNA) for comparison between different time points. At the beginning of CPT11/CTX treatment, in June 2015, blood samples were negative for the presence of KRAS mutations (). First evaluation of response was performed after 6 cycles in August 2015 and showed stable disease by RECIST, with an expressive decline in serum CEA (from 162 to 80 μg/L). Treatment was maintained until clinical progression was observed in November 2015 at expenses of significant skin and gastrointestinal toxicities. KRAS mutations became detectable in September 2015, anticipating clinical disease progression, and raised considerably over the next 2 months reaching a fractional abundance of 33.8% in November 2015 (). From November 2015 to February 2016 patient remained in a “drug holiday period,” during which no chemotherapy was administered. Rapid CEA elevation and CT scans denoting progression in pulmonary and liver metastasis have induced a new treatment to begin. A significant increase in KRAS mutation fractional abundance was also observed during this period (from 33.8 to 70.7% in February 2016) (). He was then re-challenged with FOLFOX, achieving again an initial clinical benefit (small reduction in tumor sizes and CEA response) followed by progression of disease on August 2016. KRAS mutation abundance decreased significantly during the first two months of FOLFOX treatment, reaching a fractional abundance of 3.0% in April 2016. However, KRAS mutation abundance started to increase steadily thereafter, anticipating, once more, clinical disease progression (). A fourth line of palliative chemotherapy, combining irinotecan with panitumumab was also tried from November 2016 to February 2017 without success. High levels of KRAS mutations in ctDNA were detected in December 2016, remaining relatively stable until February 2017 and anticipating poor response to palliative treatment and disease progression. The best supportive care was offered up to patient's death in June 2017. A significant increase in KRAS mutation abundance in ctDNA was observed after the interruption of palliative treatment ().
pmc-6439983-1
The proband (designated patient V:1) is a 6.5 years old girl, born to consanguineous parents of Iraqi Jewish descent, who first presented to the pediatric rheumatology clinic with bilateral painless thickening of PIPs joints of two months duration. She denied any history of fever, trauma or rash. She was born after uneventful pregnancy and labor, at a birth weight of 3700 g. Her previous medical history was notable only for several episodes of pneumonia before the age of 3 years, and normocytic anemia. On presentation, physical examination revealed symmetric thickening of the DIPs and PIPs of both hands with no evidence of joint effusion, tenderness or stress pain. All joints showed normal range of motion. There was no evidence for tenosynovitis. All other joints showed no signs of synovitis, tenosynovitis or enthesitis. Muscle strength was normal and no evidence for muscle wasting. The skin was clear and no nail changes were noted. Her height was 110 cm (10th percentile) and weight was approximately 19 kg (~30th percentile). The initial evaluation included radiographs of the hands demonstrating short distal phalanges with bilateral swelling of soft tissue around the DIPs and PIPs (Fig. b); normal radiographs of the feet and pelvis; radiograph of the spine which showed shortening of the intervertebral spaces D 4–5-6 and D 10–11-12; and laboratory tests which included a complete blood count with absolute and relative eosinophilia (2.2 K/microL, Normal < 0.7 K/microL; 24.2%), normal C-reactive protein (CRP) and erythrocyte sedimentation rate (0.07 mg/l and 13 mm/hour, respectively), and biochemistry, CPK, complement levels, Rheumatic factor (RF) and serum lipid profile all within normal range. Testing for antinuclear antibody (ANA) was negative as well. Ophthalmological evaluation was normal and showed no evidence of uveitis, and abdominal ultrasound showed no evidence of hepatosplenomegaly. During several hospitalizations to our center an extensive evaluation ensued, and several working diagnoses were entertained, including mucopolysaccharidosis, pachydermatodactyly and Winchester syndrome. On a follow up visit at the age of 9.5 years, she had a further progression of the joint deformation (Fig. a), including restricted range of motion of the neck (80° on extension, 60° on lateral rotation bilaterally) and wrists, limited flexion and extension of the fingers at the PIPs level, knees and ankles. Back movements were within normal range. Once again, no evidence of active synovitis, tenosynovitis or enthesitis was noted. Due to the multiple joint involvement, physical therapy, occupational therapy and hydrotherapy were initiated in order to maintain range of motion.
pmc-6440010-1
A 4-month-old female Simmental calf was presented with polymelia. At first view, the malformation (in the following text termed “accessory limb”) appeared attached to the left upper part of the normal scapula and separated into two rudimental lower limbs distally (Fig. ). The thoracic part of the spine was scoliotic and lordotic. At presentation the calf was alert and in a good body condition. Except for a slightly increased respiratory frequency (34 breaths per minute) probably due to excitement, the clinical examination revealed an otherwise healthy animal with an adequate state of physiologic development according to its age. Haematology and blood chemistry showed no abnormalities. As dorso-ventral and latero-lateral radiographs showed significant overlapping of anatomical structures, it was decided to perform computed tomography (CT) to get more detailed information. After premedication with intramuscular (IM) xylazine hydrochloride (0.1 mg/kg; Xylasol 2% Dr. E. Graeub AG, Bern, Switzerland) and intravenous (IV) butorphanol tartrate (0.05 mg/kg; Morphasol 1% Dr. E. Graeub AG, Bern, Switzerland), anaesthesia was induced with IV ketamine hydrochloride (3 mg/kg; Narketan 10% Vetoquinol AG, Bern, Switzerland). and thereafter maintained with isoflurane (Attane™ Isoflurane ad us. vet., Provet AG, Lyssach, Switzerland) delivered in 100% oxygen under pressure-controlled mechanical ventilation.. Monitoring included pulse oximetry, side stream capnography, electrocardiogram (ECG) and oscillometric blood pressure. Computed tomography was performed in sternal recumbency. Anaesthesia was uneventful and recovery was smooth. Computed tomography images (Fig. a, b) revealed a polymelia originating from the area of the thoracic spine with formation of a single rudimentary scapula and humerus and paired rudimentary antebrachia and distal limbs. Multiple malformations of the thoracic spine between the 5th and 8th thoracic vertebrae were present. A spina bifida of T6 to T8 with fusion of the right sided spinous processes, a malformation of the dorsal spinous processes of T5 to T8, and a focal scoliosis and lordosis due to an asymmetric T7 hemivertebra were diagnosed. Due to the limited soft tissue contrast of CT, no statement concerning the status of the neuronal and vascular structures could be made. A neurologic examination revealed no abnormal findings. As surgical amputation of the accessory limbs was planned, it appeared particularly important to assess whether a noxious stimulus applied to the accessory limb could be perceived and, if this was the case, to describe the nocifensive reaction evoked. Pin prick stimulation as well as pinching did not elicit any withdrawal of the accessory limb, rather stamping of the ipsilateral normal limb. Due to this unexpected reaction it was decided to quantitatively evaluate the nociceptive withdrawal reflex of both the normal and the accessory front limbs to confirm the presence of a common spinal reflex pathway before surgical intervention was started. After shaving, cleaning and degreasing of the skin two self-adhesive stimulation electrodes were placed latero-proximal to the fetlock over the nervus digitalis communis, parallel to the nerve itself, on the normal front extremity and also on the corresponding anatomical location on the accessory limb for sensory nerve stimulation. The anode was placed in the distal position. The paired recording electrodes for surface electromyography were placed over the deltoid muscle of the ipsilateral, normal front limb to record its reflex muscle activity after direct (normal limb) and indirect (accessory limb) electrical stimulation. The ground electrode was placed over the back. Normal and accessory limbs were tested following the same order, starting with the normal limb. To define the reflex threshold, a standard stimulus consisting of constant current train-of-five 1 mS pulses at 200 Hz was applied starting at the intensity of 2 mA and increasing in steps of 0.5 – 1 mA until a reflex response was elicited. To confirm the threshold, stimulation was repeated three times at the current where the first electromyographic reflex activity had appeared. Afterwards the current was increased in 0.5–1 mA steps to define the stimulus evoking a reflex with the shortest latency. The results for the normal limb showed initial reflex activity at a current of 4 mA, with a latency of 80 mS, a reflex duration of 40 mS and an amplitude of 81 μV. The shortest latency reflex (31 mS) was seen with a stimulation intensity of 11 mA, a duration of 68 mS and an amplitude of 209 μV. The results from the accessory limb showed an initial reflex at 5 mA, with a latency of 112 mS, a duration of 57 mS and an amplitude of 84 μV. The shortest latency reflex (43 mS) was seen with a stimulation intensity of 20 mA, a duration of 61 mS and an amplitude of 248 μV (Fig. ). Three days before surgical excision of the accessory limb, a therapy with gabapentin (2.5 mg/kg, twice daily, per os; Neurontin 100 mg, Pfizer, Berlin, Germany) was started and continued until discharge from the hospital (24 days of treatment). Haematology and blood chemistry values were all within physiologic ranges the day before surgery. Food but not water was withheld the evening before surgery, and during the fasting period the calf was kept under maintenance fluid infusion with Ringer lactate solution (2 mL/kg/hr.; Ringer-Lösung “Bichsel”, Grosse Apotheke Dr. G. Bichsel AG, Interlaken, Switzerland). On the day of surgery benzylpenicillin sodium (30,000 IU/kg IV; Penicillin Natrium ad us. vet., Streuli Pharma AG, Uznach, Switzerland), flunixine meglumine (1.1 mg/kg IV; Finadyne ad us vet., MSD Animal Health GmbH, Luzern, Switzerland) and a tetanus antitoxin (3000 IU SC; Tetanus-Serum Intervet ad us. vet., MSD Animal Health GmbH, Luzern, Switzerland) were admistered 30 min before anaesthetic premedication with xylazine hydrochloride (0.15 mg/kg IM) and methadone (0.1 mg/kg IV; Methadon, Streuli Pharma AG, Uznach, Switzerland). Anaesthesia was induced with IV diazepam (0.05 mg/kg; Valium 5 mg, Roche Pharma AG, Reinach, Schweiz) followed by ketamine hydrochloride (3 mg/kg IV). The induction was smooth and endotracheal intubation was performed using a 14 mm endotracheal tube. The animal was placed into right lateral recumbency and connected to a circle breathing system. Volume-controlled mechanical ventilation was started immediately with an inspiratory volume of 10 mL/kg. Isoflurane in 100% oxygen was administered, combined with systemic constant rate infusions of ketamine hydrochloride (0.6 mg/kg/hr) and lidocaine hydrochloride (3 mg/ kg/hr., after a bolus of 1.5 mg/kg over 5 min; Lidocain 2% Streuli ad us. vet., Streuli Pharma AG, Uznach, Switzerland). Methadone boli (0.05 mg/kg IV) were admistered slowly over 5 min every hour and as one IM injection at the end of the procedure. Ringer lactate solution was administered at a rate of 10 mL/kg/hr. Monitoring included ECG, capnography, non-invasive oscillometric as well as continuous invasive (auricular artery) arterial blood pressure measurements. The arterial blood gas analysis results were always within physiologic ranges. After surgical preparation, a ring block with 20 mL bupivacaine hydrochloride 0.5% (Carbostesin 0.5%, AstraZeneca GmbH, Wedel, Germany) was performed proximal to the planned incision lineTwenty minutes later, an ellipsoid incision was made at the height of the scapulo-humeral joint of the accessory limb, the joint was dissected and the major part of the limb removed. The distal part of the remaining additional scapula, including the acromion, was cut through using an oscillometric saw. The exposed bone marrow of the scapula was covered with a hemostyptic bone wax. The sharp edges of the bone were abraded, and a continuous suction drain was placed. The fascial layer was closed and a wound catheter, previously flushed with bupivacaine hydrochloride 0.5%, was placed subcutaneously with its tip located at the highest point of the wound. Splash local anaesthesia was performed with 20 mL of bupivacaine hydrochloride 0.5%. The skin was closed and the wound covered with a sterile bandage. The calf was then allowed to wake up. Recovery was fast and uneventful. The animal was calm and showed no signs of pain. Intravenous maintenance fluid therapy was kept up until the next day, when the calf was adequately drinking and eating again. Systemic analgesic therapy included continuation of gabapentin, flunixine meglumine 1.1 mg/kg IV once per day, and buprenorphine hydrochloride (Bupaq ad us. vet., Streuli Pharma AG, Uznach, Switzerland) 0.01 mg/kg IV or IM every 6 h. with a total of 20 mL bupivacaine hydrochloride 0.5% was administered via the wound catheter every 4–6 h for three days. Pain assessment was regularly performed and included assessment of the calf’s overall general condition, occurrence of behavioural changes (respiratory changes, reluctance to move or restlessness, excitement or depression, looking towards the wound, anorexia), recording of physiologic parameters such as heart rate and respiratory rate, reaction to wound palpation (large area/punctual palpation), and subjective pain evaluation (no pain to non-bearable pain). Based on these observations, the interval between the application of local anaesthesia was adapted and additional buprenorphine hydrochloride (0.01 mg/kg IM) was administered on two occasions (during the first morning and the second night post-surgery). After removal of the wound catheter (3 days after surgery) and fading of the last bupivacaine hydrochloride injection, the calf showed increased reaction to wound palpation especially to punctual palpation over a period of 24 h. Nevertheless, it was otherwise in good condition and showed no additional signs of pain when left undisturbed. Flunixine meglumine and buprenorphine hydrochloride therapy was stopped 4 days postoperatively. Mild reaction to wound palpation was present until discharge from the hospital. Wound healing was adequate, and the suction drain was removed three days after surgery. Antibiotic therapy (benzylpenicillin sodium, 30,000 IU every 8 h IV) was maintained over 5 days and sutures were removed 10 days postoperatively. The calf was discharged from the hospital 21 days after surgery in good health conditions. A gross anatomical dissection was performed on the removed accessory limb. The extremity consisted of two left front limbs sharing one common scapula and one common humerus. Further distally, the bones included ossa antebrachii lacking typical characteristics and partially fused ossa carpi. Metacarpal bones and phalanges were typical as well as the metacarpophalangeal and interphalangeal articulations. No discernible muscle tissue could be identified, and tendons were firmly combined with fascia or periost. Only rudimentary tendons of the lateral digital extensor muscle and of the deep digital flexor muscle could be distinguished. On the palmar side, two metacarpal arteries and one single vein were recognizable as well as the equivalents of the common digital dorsal artery, vein and nerve. A genetic analysis was performed using genomic desoxyribunucleic acid (DNA) isolated from a skin biopsy of the accessory limb, hair roots from the body, and EDTA stabilized blood of the affected calf. Genotyping of 12 autosomal microsatellite DNA markers using standard methods [] revealed, at several loci, the presence of a third allele (Fig. ). The peak size of this additional marker allele varies between the three DNA sources. The lowest peak size was observed in DNA derived from blood cells, and a much higher signal intensity in DNA originating from the hair roots and skin of the accessory limb. These findings revealed the presence of cells with different genotypes, which indicated a chimeric condition of the affected calf known in bovine freemartin pregnancies. A heterosexual twin pregnancy was excluded because a polimerase chain reaction (PCR) showed absence of the SRY gene in all available DNA samples.
pmc-6440012-1
A 53-year-old male was hospitalised because of pain in the right hip that was ongoing for 3 months. On physical examination, positive signs included the enlargement of his right supraclavicular lymph node of 0.5 cm * 0.5 cm, and overt tenderness in his right groin with no mass palpated. The patient had a symmetric chest and breathing sounds of both lungs were clear on auscultation and no rales or crackles were heard. The abdomen was soft without any tenderness of rebound pain, bowel sounds were normal, and there was no redness or swelling found in any limbs. Blood routine, liver and kidney function, coagulation function for the patient were normal, except that the fibrinogen was 4.68 g/l, slight above average (Ref int 2.00–4.00 g/l). Computed tomography (CT) indicated malignant lesions of left upper lobe and multiple lymph node metastases in mediastinum, neck, both lungs and right acetabular bone (Fig. ). Fluorodeoxyglucose (FDG) metabolism of the left adrenal gland was slightly elevated. Multiple cysts were noticed in the liver and the left kidney. Ultrasound indicated multiple lymph node enlargement in bilateral supraclavicular regions (Fig. ). Past history revealed the patient had a smoking history for 30 pack years but was otherwise unremarkable. The patient denied any history of tuberculosis infection or thrombotic events. The level of tumor markers is shown in Table . The right supraclavicular lymph node was surrounded by vessels, making the biopsy impossible. The patient’s family refused needle biopsy of lung lesions. The clinical diagnosis of multiple metastasis of lung cancer was then made. After the diagnosis, the patient received palliative radiotherapy 2.5Gy/Fx on metastasis at the right acetabular bone, combined with zoledronic acid treatment and pain management. 5 days later, central catheters were inserted peripherally and chemotherapy (Taxol 210 mg dl + cisplatin 40 mg dl-3 q21d) was administered. 8 days after the initiation of chemotherapy, the right hip pain was alleviated. 2 days later, the patient described he felt distending pain in the left lower limb. Coagulation lab tests were as follows. Venous duplex ultrasonography indicated deep vein thrombosis (DVT) of the left femoral vein by detecting noncompressibility of the thrombosed vein with reduced blood flow. Compression of the left femoral artery caused by thrombosed vein was also noticed (Fig. ). Anticoagulant therapy (Aspirin) and thrombolytic therapy (Warfarin and low molecular weight heparin (LMWH)) were administered. However, the symptoms were progressively deteriorating. 4 days later, the distending pain had worsened, and new symptoms appeared including cyanosis and lower skin temperature. Ultrasound and CT-angiography (CTA) indicated insufficient blood supply to the left lower limb due to compression on arteries by DVT. The attempt of embolectomy and inferior vena cava (IVC) filter implantation was unsuccessful. The post-surgery biopsy indicated the thrombosis was a blood clot. Because the stent failed to enter the left superficial femoral vein where multiple older thrombi existed. The symptoms of DVT was deteriorating, with gangrene arising in the left lower limb. Thus, amputation of the left thigh was eventually performed.
pmc-6440023-1
A 32-year-old man presented with colicky abdominal pain in the left lower quadrant for 2 weeks duration. He had a significant weight loss of approximately 30 kg over 2 months associated with decreased appetite. He also has a history of chronic alcoholism and smoking. There was no associated nausea, vomiting, hematemesis, melena, or hematochezia. Review of symptoms was negative for fever, arthritis, skin rash, jaundice, and pruritus. Two months prior, the patient was discharged from another hospital following a 6-week hospitalization for alcohol-induced necrotizing acute pancreatitis, which was treated successfully by conservative measures. Admission vitals revealed an afebrile and normotensive patient with a heart rate of 92 beats per minute and oxygen saturation of 98% on room air. On physical examination, the abdomen was soft with mild tenderness to deep palpation in the left iliac fossa and lumbar region. There were no signs of peritonitis. Laboratory results and abdominal sonogram showed no significant findings. Abdominal CT scan from the episode of acute pancreatitis 2 months ago showed findings consistent with necrotizing acute pancreatitis (). A colonoscopy was done because of the abdominal pain and significant weight loss. The scope revealed ulceration with a partial stricture at the descending colon approximately 30 cm from the anal verge (). However, the scope could not be navigated beyond the stricture. Controlled radial expansion balloon dilatation was tried without success in dilating the stricture. Due to tuberculosis (TB) being a possible differential diagnosis, a workup for TB was warranted. This included sputum for acid-fast bacillus, chest X-ray, purified protein derivative test, erythrocyte sedimentation rate, and pathological examination, all of which were negative for TB. Biopsy of the lesion revealed active focal colitis with ulceration, but no granulomas were seen. Barium enema and CT colonoscopy were done to assess the length of the stricture to plan an appropriate treatment strategy as shown in and , respectively. Barium enema findings were consistent with inflammatory bowel disease, as a benign stricture was seen with no evidence of malignancy. Based on the clinical presentation and barium enema, Crohn’s disease was high in the differential diagnosis. ASCA immunoglobulin G antibodies to saccharomyces cerevisiae was ordered with a result of 22.2 U/mL (>10 U/mL; ELISA [enzyme-linked immune sorbent assay]). The patient was thought to have had a CD at this point and was subsequently initiated on sulfasalazine. Despite treatment for CD, the abdominal pain persisted over the next month with worsening weight loss. Repeat colonoscopy was performed, which revealed further strictures requiring a segmentectomy with single layer extra mucosal end-to-end anastomosis. Anatomically, the left colonic segment was observed to be adherent to the pancreas. A surgical biopsy specimen revealed active focal colitis, and negative for TB and CD. A final diagnosis of colonic stricture due to acute necrotizing pancreatitis was made. Abdominal pain decreased postoperatively, and the patient was discharged on postoperative day 7. A follow-up colonoscopy 2 months later revealed healed anastomotic sites.