text
stringlengths
16
3.88k
source
stringlengths
60
201
what it means. 31 Semantics • Meaning of a sentence is truth value {t, f} • Interpretation is an assignment of truth values to the propositional variables [ • ² i φ Sentence φ is t in interpretation i ] • 2i φ [Sentence φ is f in interpretation i ] • ² i true • 2i false interpret.] • ² i ¬ φ • ² i φ Æ ψ • ...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
conjunction] if and only if ² i φ or ² i ψ [disjunction] iff i(P) = t Lecture 3 • 33 Now we have one more clause. I’m going to do it by example. Imagine that we have a sentence P. P is one of our propositional variables. How do we know whether it is true in interpretation I? Well, since I is a mapping from vari...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
al, equivalence] → → (φ Lecture 3 • 36 Finally, the double arrow just means that we have single arrows going both ways. This is sometimes called a “bi-conditional” or “equivalence” statement. It means that in every interpretation, Phi and Psi have the same truth value. 36 Some important shorthand • φ ψ ...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
ψ φ Ç ψ [conditional, implication] → ¬ antecedent ≡ • φ ψ ↔ ≡ → (φ → consequent → Truth Tables P P Æ Q P Ç Q P f f t t Q f t f t ¬ t t f f f f f t f t t t Q Q P → t t f t P → t f t t P Q ↔ t f f t Q is t Note that implication is not “causality”, if P is f then P → Lecture 3 • 38 Mo...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
is assigned to P by the interpretation, “P or not P” is true. 40 Terminology • A sentence is valid iff its truth value is t in all interpretations (²φ) Valid sentences: true, false, P Ç P ¬ • A sentence is satisfiable iff its truth value is t in at ¬ least one interpretation Satisfiable sentences: P, true,...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
wanted to know if a particular sentence was valid, or if I wanted to know if it was satisfiable or unsatisfiable. I could just make a truth table. Write down all the interpretations, figure out the value of the sentence in each interpretation, and if they're all true, it's valid. If they're all false, it's unsatisf...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
KB is also a model of \Phi. Lecture 3 • 46 46 Models and Entailment • An interpretation i is a model of a sentence φ iff ² i φ • A set of sentences KB entails φ iff every model of KB is also a model of φ Sentences Sentences Lecture 3 • 47 So, here’s the picture. If we consider two groups of sentences, we mi...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
e s Sentences Sentences Interpretations Interpretations subset Now, we can ask whether the first set of interpretations is a subset of the second set. Lecture 3 • 50 50 Models and Entailment • An interpretation i is a model of a sentence φ iff ² i φ • A set of sentences KB entails φ iff every model of ...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
φ = B U Lecture 3 • 53 Now, we can use a Venn diagram to think about the interpretations. Let U be the set of all possible interpretations. 53 Models and Entailment • An interpretation i is a model of a sentence φ iff ² i φ • A set of sentences KB entails φ iff every model of KB is also a model of φ s c...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
m e s Sentences entails Sentences Interpretations Interpretations subset KB = A Æ B φ = B A Æ B ² B A Æ B B U Lecture 3 • 56 So, we find that A and B entails B. If we know that A and B are true, then B has to be true. 56 Models and Entailment • An interpretation i is a model of a sentence φ iff ² ...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
. That lets you draw valid conclusions from assumptions. 57 Examples Let’s work through some examples. We can think about whether they're valid or unsatisfiable or satisfiable. Lecture 3 • 58 58 Examples Interpretation that make sentence’s truth value = f Valid? valid smoke Sentence smoke → smoke Ç ...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
We could show that by drawing out the truth table (and you should do it as an exercise if the answer is not obvious to you). Another way to show that a sentence is not valid is to give an interpretation that makes the sentence have the truth value F. In this case, if we give “smoke” the truth value F and and “fire”...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
smoke = t, fire = f s = f, f = t s f = t, → ¬ s → ¬ f = f Lecture 3 • 63 What about “b or d or (b implies d)”? We can rewrite that (using the definition of implication) into “b or d or not b or d”, which is valid, because in every interpretation either b or not b must be true. 63 Recitation Exerci...
https://ocw.mit.edu/courses/6-825-techniques-in-artificial-intelligence-sma-5504-fall-2002/5a2344cf5fdd746421d4ab2b8bc60ee8_Lecture3Final.pdf
Programs with Flexible Time When? Contributions: Brian Williams Patrick Conrad Simon Fang Paul Morris Nicola Muscettola Pedro Santana Julie Shah John Stedl Andrew Wang courtesy of JPL Steve Levine Tuesday, Feb 16th (cid:2) Assignments Problems Sets: • Pset 1 due tomorrow (Wednesday) at 11:59pm • Pset 2 released tomorr...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
(cid:29)CD or Y+ < X- (cid:2)(cid:5) [Villain & Kautz; Simmons] Temporal Relations Described by a Simple Temporal Network (STN) • Simple Temporal Network • Tuple <X, C> where: • variables X1,…Xn, represent time points (real-valued domains) • binary constraints C of the form: ) ∈ X X − ( [ ba , ik ik ]. k i [Dechter...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
)(cid:8)+(cid:29)(cid:17)(cid:13)(cid:29)(cid:21)(cid:27)(cid:26)(cid:13)(cid:22)(cid:21)(cid:27)(cid:16)(cid:28)(cid:29)(cid:27)(cid:8)(cid:16)(cid:23)(cid:17)(cid:21)(cid:14)(cid:8)(cid:29)(cid:23)(cid:9)(cid:26)(cid:15) [Dechter, Meiri, Pearl 91] (cid:3)(cid:3) Algorithm: offline scheduling Initialize execution win...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
cid:29),(cid:27) (cid:21)(cid:27)(cid:8) 1. Describe Temporal Plan 1. Describe Temporal Plan 2. Test Consistency 2. Test Consistency 3. Schedule Plan 3. Reformulate Plan 4. Execute Plan 4. Dynamically Schedule Plan (cid:13))) (cid:21)(cid:27)(cid:8) (cid:13)(cid:27) (cid:21)(cid:27)(cid:8) (cid:4)(cid:4) Algorithm: of...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
] -1 9 1 -1 -1 2 1 -2 10 0 [-∞, ∞] 11 -2 Assign the first event (cid:5)$ [-∞, ∞] Computing a schedule outgoing edges to neighbor: u’ = min(u, ti + wu) incoming edges from neighbor: l’ = max(l, ti - w ) l [-∞, 10] t = 0 10 0 -1 9 1 -1 -1 2 1 -2 [-∞, ∞] 11 -2 [-∞, ∞] Propagate updated time bounds to neighbors (cid:5)(ci...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
[2, 11] Arbitrarily pick another time point and assign it... (cid:5)(cid:10) t = 0 Computing a schedule t = 3 -1 9 1 -1 -1 2 1 -2 10 0 [2, 2] 11 -2 [2, 11] Propagate updated time bounds to neighbors (cid:5)(cid:11) t = 0 Computing a schedule t = 3 -1 9 1 -1 -1 2 1 -2 10 0 [2, 2] 11 -2 [4, 4] Propagate updated time bo...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
Schedule events “on the fly,” after observing past event times. – Increases robustness to many unanticipated fluctuations. – Flexible temporal constraints allow this! (cid:10)(cid:2) To Execute a Temporal Plan (cid:25)(cid:26)*(cid:8)+" (cid:8)(cid:29),)) (cid:21)(cid:27)(cid:8)(cid:29) (cid:25)(cid:26)*(cid:8)+" (cid...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
1 -2 10 0 [0, 9] 11 -2 Arbitrarily picking next event… (cid:10)(cid:11) Naïve (wrong!) online scheduling t = 0 10 0 t = 3 -1 9 1 -1 -1 2 1 -2 t = 2 11 -2 ...but wait! We just assigned a past time! (cid:10)( [4, 4] Enablement conditions dictate the ordering of dispatched events • Online: must assign monotonically inc...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
ti Propagate to all xi’s neighbors & update their windows Add xi to S Add to E any now-enabled events (cid:11)(cid:3) Running online dispatcher Compute dispatchable form (i.e., APSP) Initialize execution windows to [-∞, ∞] E (cid:3) {events with no predecessors} S (cid:3) {} while unexecuted events: Wait until some e...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
-enabled events t = 0 10 0 Dispatch A and propagate E = {C} S = {A} [1, 10] -1 9 1 -1 -1 2 [0, 9] 11 -2 [2, 11] 1 -2 (cid:11)5 Running online dispatcher Compute dispatchable form (i.e., APSP) Initialize execution windows to [-∞, ∞] E (cid:3) {events with no predecessors} S (cid:3) {} while unexecuted events: Wait unt...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
Propagate to xi’s neighbors Add xi to S Add to E any now-enabled events E = {B} S = {A, C} [3, 3] t = 0 10 0 -1 9 1 -1 -1 2 [4, 4] 1 -2 B is now enabled (but still not D). t = 2 11 -2 68 Running online dispatcher Compute dispatchable form (i.e., APSP) Initialize execution windows to [-∞, ∞] E (cid:3) {events with no ...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
in E is active ti = now Propagate to xi’s neighbors Add xi to S Add to E any now-enabled events E = {} S = {A, C, B, D} t = 3 t = 0 10 0 -1 9 1 -1 -1 2 Finish up by dispatching D! (1 t = 2 11 -2 t = 4 1 -2 73 Online dispatching algorithm remarks • By considering predecessors, we guarantee that events assigned monoton...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
events: Wait until some event xi in E is active ti = now Propagate to xi’s neighbors Add xi to S Add to E any now-enabled events (5 Online dispatcher efficiency • Consider an STN with n edges. • How many edges in APSP distance graph? n2. • How many neighbors to propagate to each step? n. Compute dispatchable form (i.e...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
8) 7- 79 You don’t need all those edges! 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 -0 You don’t need all those edges! 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 1 -1 1 9 -1 0 Equivalent minimal dispatchable network -1 You don’t need all those edges! Let’s consider a specific triangle of edges. 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 -2 You don’...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
B could slide freely! Not the same behavior. Collectively, AB and BD entail AD (but AD does not entail both AB and AD). .0 Upper dominating edges - detection from APSP dBC dAC If dAC, dBC ≥ 0 and dAB + dBC = dAC then BC dominates AC (Proof omitted - based on triangle rule property of APSP. Please see notes / readi...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
(cid:2)$0 Dominance example Lower dominated! 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 (cid:2)$1 Dominance example 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 Lower dominated! (cid:2)$2 Dominance example 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 Lower dominated! (cid:2)$3 Dominance example 10 0 -1 9 1 -1 -1 2 1 -2 11 -2 (cid:2)$4 Lower dominated! D...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
:2)09 Avoiding Intermediate Graph Explosion > Problem: K All pairs shortest path table computation consumed O(n2) space K Only used as an intermediate - not needed after minimal dispatchable graph obtained. > Solution: K Interleave process of APSP construction with edge elimination. > Never have to build whole APSP ...
https://ocw.mit.edu/courses/16-412j-cognitive-robotics-spring-2016/5a40e2ff010a7721fdf6c5513ce5e26a_MIT16_412JS16_L4.pdf
MIT OpenCourseWare http://ocw.mit.edu 6.005 Elements of Software Construction Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 6.005 elements of software construction basics of mutable types Daniel Jackson heap semantics of Java pop quiz what ha...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
null, or get/set field © Daniel Jackson 2008 6 the operator == the operator == ‣ returns true when its arguments denote the same object (or both evaluate to null) for mutable objects ‣ if x == y is false, objects x and y are observably different ‣ mutation through x is not visible through y for immutable obj...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
mutable datatypes mutable vs. immutable String is an immutable datatype ‣ computation creates new objects with producers class String { String concat (String s); ...} StringBuffer is a mutable datatype ‣ computation gives new values to existing objects with mutators class StringBuffer { void append (St...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
value a simple theorem ‣ if we define a ≈ b when f(a) = f(b) for some function f ‣ then the predicate ≈ will be an equivalence an equivalence relation is one that is ‣ reflexive: a ≈ a ‣ symmetric: a ≈ b ⇒ b ≈ a ‣ transitive: a ≈ b ∧ b ≈ c ⇒ a ≈ c © Daniel Jackson 2008 16 a running example a duration class ‣...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
Duration d2 = new Duration(1,2); System.out.println(d1.equals(d2)); // prints true Object d1 = new Duration(1,2); Object d2 = new Duration(1,2); System.out.println(d1.equals(d2)); // prints false! © Daniel Jackson 2008 20 explaining bug #2 what’s going on? ‣ we’ve failed to override Object.equals ‣ meth...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
new Duration(1,2); System.out.println(d1.equals(d2)); // false System.out.println(d2.equals(d1)); // true © Daniel Jackson 2008 24 bug #4 yet another attempt ‣ this time not transitive @Override public boolean equals(Object o) { if (! (o instanceof Duration)) return false; if (! (o instanceof ShortDuratio...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
get(k): to get value associated with key k examine all entries in table[i] as for insertion if find one with key equal to k, return val else return null resizing ‣ if map gets too big, create new array of twice the size and rehash © Daniel Jackson 2008 29 hashing principle why does hashing work? e: table[i]....
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
} @Override public int hashCode () {return i;} } public static void main (String[] args) { Set m = new HashSet <Counter> (); Counter c = new Counter(); m.add(c); System.out.println ("m contains c: " + (m.contains(c) ? "yes" : "no")); c.incr(); System.out.println ("m contains c: " + (m.contains(c) ? "yes" : "no"))...
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
principles object heap is a graph ‣ to understand mutation & aliasing, can’t think in terms of values equality is user-defined but constrained ‣ must be consistent and an equivalence abstract aliasing complicates ‣ may even break rep invariant (eg, mutating hash key) © Daniel Jackson 2008 36
https://ocw.mit.edu/courses/6-005-elements-of-software-construction-fall-2008/5a6830a94eaa166e2db4b5e820498609_MIT6_005f08_lec16.pdf
operator ξ S†ΓµW hv which is not equivalent to (10.6) because S and W do not commute. This apparent problem is solved by considering the remaining two diagrams of the same order as this one n,p 11 SCETII APPLICATIONS Diagrams. These diagrams both yield the current Fig() = Fig() = 2 if abcT c g 2 ν µ n¯ n n · qs...
https://ocw.mit.edu/courses/8-851-effective-field-theory-spring-2013/5a73e8bb8f7f637a9b3eb58c5e733e6b_MIT8_851S13_SCETIIApplicat.pdf
W (0))ΓµY †hv 3. Matching SCETI onto SCETII by taking Yn → Sn. JII = (ξ (0) n W (0))ΓµS†hv (10.10) (10.11) (10.12) 11 SCETII Applications (ROUGH) In this section we will apply the SCETII formalism developed in previous sections to various processes to illustrate the formalism • γ∗γ → π0 • B → Dπ • The Massive Ga...
https://ocw.mit.edu/courses/8-851-effective-field-theory-spring-2013/5a73e8bb8f7f637a9b3eb58c5e733e6b_MIT8_851S13_SCETIIApplicat.pdf
ize the matrix element (Dπ| O0,8 |B). We can represent this factorization diagrammat­ ically as (INSERT FIG) where there are no gluons between π quarks and B/D quarks. For this process we expect a B → D form factor (Isgur-Wise form factor) and a pion wavefunction/distribution. This fac­ torization will be possible bec...
https://ocw.mit.edu/courses/8-851-effective-field-theory-spring-2013/5a73e8bb8f7f637a9b3eb58c5e733e6b_MIT8_851S13_SCETIIApplicat.pdf
,5 . They simply take [ξ W ΓlC0(P +)W †ξ(u)] → [ξ n,p (d) n,p (d)(0) n,p W (0)ΓlC0(P +)W (0)†ξ(u)(0) n,p ] (11.6) where we used the fact that Y commutes with the wilson coefficient C0(P +). This argument cannot be applied to Q1,5 because Y , containing generators of its own, does not commute with T a . However, by ...
https://ocw.mit.edu/courses/8-851-effective-field-theory-spring-2013/5a73e8bb8f7f637a9b3eb58c5e733e6b_MIT8_851S13_SCETIIApplicat.pdf
Programming Languages Copyright c Nancy Leveson, Sept. 1999 As difficult to discuss rationally as religion or politics. Prone to extreme statements devoid of data. Examples: "It is practically impossible to teach good programming to students that have had a prior exposure to BASIC; as potential programmers the...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
defined (not dependent on compiler.  Relationship between PL and Correctness (3) Copyright c Nancy Leveson, Sept. 1999 Understandability "The primary goal of a programming language is accurate communication among humans." Readability more important than writeability. Well "punctuated" (easy to directly det...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
restrict programmer to decisions that really matter. Decisions should be recorded in program independent of external documentation. Simplicity of language less important than ability to write conceptually simple programs.  Can programming language influence correctness? Languages affect the way we think about...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
thesis 2: Every notation highlights some type of information at the expense of others; the better notation for a given task is theone that highlights the information that given task needs. More generally, the comprehensibility of a notation may depend on the number and complexity of mental operations required to ...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
purposes for each part Visible or easily inferred relationships between each part and the larger structure. Important to alleviate mismatches between programmer’s task and program structure. Hypothesis that role expressiveness tends to detract from reusability of program fragments. "When a program fragment makes...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
The Invention Machine The Invention Machine Computational adaptation of TRIZ, Computational adaptation of TRIZ, Value Engineering and Value Engineering and the Semantic Web the Semantic Web Thanks to Invention Machine and Dr. Mikhail Verbitsky for materials and consultation and SDM04 students who participated Cou...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
about Noisy Fan 4) Management pressure to reduce costs © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 7 Step 1: Value Equation Development Problem-Statement Value Engineering, TRIZ Alternative Architecture List of Problems Value = F/(P+C) © Speller 2007, Engineering Systems Divisio...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
: Effects © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 16 Courtesy of Invention Machine Corporation. Used with permission. Traditional TRIZ: Effects © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 17 Courtesy of Invention Machine Corporation. U...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
NL ? Process… Semantic Knowledge Base DOC RTF HTM(L) PDF TXT © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 24 Access to External and Internal Intellectual Assets Invention Machine Content Scientific Effects Patent Collections 9,000 10,000,000 …and via Knowledge Producer Includes ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
of Technology 32 -Theory (TRIZ, a theory of invention), -Method (Altshuller’s step-by-step creative process) -Tool (ex. Goldfire1), SDM’rs evaluation A theory of invention, as stated by Altshuller the inventor of TRIZ should: • Be systematic, a step-by-step procedure • Be inclusive to a broad solution space hoping t...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
with different concepts, patents, scientific effects, and technology trends. • The fact that the intent is expressed in a high level allows thinking in a broad range of solutions. • A deep web search on patents classified through the use of the semantic engine, again here the patents help to clarify the idea, but ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
and with a steady flow. The process is therefore conceptualizing, and the operand will be the solution that changes from non-existent to existent, delivering value to the Corporation (the beneficiary) In the case of the user, the benefit is slightly different. Because of the exposure to many different ideas, the sem...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
3.044 MATERIALS PROCESSING LECTURE 5 General Heat Conduction Solutions: ∂T = ∇ · k∇T, T (¯x, t) ∂t Trick one: steady state ∇2T = 0, T (x) Trick two: low Biot number ∂T = α h(Ts ∂t − Tf ), T (t) Transient: - semi-infinite - infinite series: book, analytical - graphical solutions - computers, numerical, finite elements Exam...
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
K T ≈ 750K Solve for h (the only changable variable): h ≈ 260 W m2 K - oil bath w/ standoff/air gap - big fans - other gases Example 2: Thermal Spray Coatings / Plasma Spray Specific Example: oxyacetylene torch: T = 2700◦C powder: Ni alloy MAR-M200, r = 2 − 50μm Problem Statement: need a particle to melt in flight (T = Tm...
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
http://ocw.mit.edu 3.044 Materials Processing Spring 2013 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
6.801/6.866: Machine Vision, Lecture 11 Professor Berthold Horn, Ryan Sander, Tadayuki Yoshitake MIT Department of Electrical Engineering and Computer Science Fall 2020 These lecture summaries are designed to be a review of the lecture. Though I do my best to include all main topics from the lecture, the lectures ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
the patent examiner, rather than the patent authors • Most patents end with something along the lines of “this is why our invention was necessary” or “this is the technical gap our invention fills” • Software is not patentable - companies and engineers get around this by putting code on hardware and patenting the “appar...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
 → Ky = 0   0 −1 0 −1  1 0 0 −1 ∂E ∂x0 ∂E ∂y0 • Sobel Operator: This computational molecule requires more computation and it is not as high-resolution. It is also more robust to noise than the computational molecules used above: → Kx = ⎡ −1 2 −1 ⎣ 0 0 0 ⎤ 1 2⎦ 1 ⎡ −1 → Ky = ⎣ 0 1 ⎤ 0 ⎦ 1...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
IC algorithm, we can estimate the brightness gradient magnitude and direction. The CORDIC algorithm does this iteratively through a corrective feedback mechanism (see reference), but computationally, only uses SHIFT, ADD, SUBTRACT, and ABS operations. 3. Choose Neighbors and Detect Peaks: This is achieved using brig...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
x|, |Gy|) (octant quantization) 4. S0 = min(|Gx|, |Gy |) (octant quantization) At a high level, the apparatus discussed in this patent is composed of: 3 • Gradient estimator • Peak detector • Sub-pixel interpolator Next, let us dive in more to the general edge detection problem. 1.3 Edges & Edge Detection Let us...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
artificially high (infinite) frequencies that prevent us from sampling without aliasing effects. Let us instead try a “soft” step function, i.e. a “sigmoid” function: σ(x) = . Then our u(x) takes the form: 1 1+e −x A “Soft” Unit Step Function, u(x) ) x ( u 1 0.8 0.6 0.4 0.2 0 −6 −4 −2 2 4 6 0 x The gradient...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
1. u(x) = 1+exp (−x) 1 2. ru(x) = du dx = d dx 1+exp −x 1 = exp(−x) (1+exp(−x))2   2 3. r u(x) = d2 u dx2 d = ( dx (1+exp(−x))2 exp(−x) ) = − exp(−x)(1+exp(−x))2+2 exp(−x)(1+exp(−x)) exp(−x) (1+exp(−x))4 Building on top of this framework above, let us now move on to brightness gradient estimation. ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
Let us first consider the simple two-pixel difference operator (in the x-direction/in the one-dimensional case), i.e. → Kx = (−1 1). Let us look at the forward difference and backward difference when this operator is applied: dE dx 1 δ 1. Forward Difference: ∂E ≈ f (x+δx)−f (x) ∂x δx = f 0(x) + δx f 00(x) + 2 (δx)2 6...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
x − δ x x + ). There is no pixel at x but we can still compute the derivative here. This yields an error that is 0.25 the error above due to the fact that our pixels are apart, as opposed to δ apart: 1 2δ δ 2 δ 2 dx 2 error = ( xδ )2 2 6 f 000(x) This makes sense intuitively, because the closer together a set ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
operator (in each dimension) as being the dis- crete convolution of a 2-by-2 horizontal or vertical highpass/edge filer with a smoothing or averaging filter: 1. x-direction: 1  −1 2δx −1    1 1 ∗ 1 1 1 1 ⎡ −1 = −2 ⎣ −1 0 0 0 ⎤ 1 2 ⎦ 1 2. y-direction: 1 2δy  −1 −1 1 1   ∗  1 1 1 1 ⎡ = ⎣ 0 1 −1 −2 −1 0 ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
G0: (1) G−, (2) G0, and (3) G+. Let us look at the results for these two types of functions: 1. Quadratic: s = G+−G− 4(G0− 1 (G+−G−)) 2 , this results in s ∈ [− 1 , ]. 1 2 2 2. Triangular: s = 2(G0−min(G+ ,G−)) G+−G− A few notes about these approaches: • Note that in each case, we only want to keep if the magnit...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
Optics Overview MIT 2.71/2.710 Review Lecture p-1 What is light? • Light is a form of electromagnetic energy – detected through its effects, e.g. heating of illuminated objects, conversion of light to current, mechanical pressure (“Maxwell force”) etc. • Light energy is conveyed through particles: “photons” – ba...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
c/n n : refractive index (or index of refraction) Absorption coefficient 0 Absorption coefficient α energy decay coefficient, after distance L : e–2αL E.g. vacuum n=1, air n ≈ 1; glass n≈1.5; glass fiber has α ≈0.25dB/km=0.0288/km MIT 2.71/2.710 Review Lecture p-6 Materials classification • Dielectrics typic...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
71/2.710 Review Lecture p-9 The concept of a monochromatic “ray” t=0 (frozen) λ z direction of energy propagation: light ray wavefronts In homogeneous media, light propagates in rectilinear paths MIT 2.71/2.710 Review Lecture p-10 The concept of a monochromatic “ray” t=∆t (advanced) λ z direction of...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
1.00 n =1.51 TIR n =1.5105 n =1.51 TIR • Planar version: integrated optics • Cylindrically symmetric version: fiber optics • Permit the creation of “light chips” and “light cables,” respectively, where light is guided around with few restrictions • Materials research has yielded glasses with very low losses (...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
another point in space (the “image.”) • The latter function is the topic of the discipline of Optical Imaging. MIT 2.71/2.710 Review Lecture p-23 Imaging condition: ray-tracing thin lens (+) 2nd FP chiefray image (real) 1st FP object • Image point is located at the common intersection of all rays which em...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
Photographic camera • Magnifier • Microscope • Telescope MIT 2.71/2.710 Review Lecture p-28 The human eye Remote object (unaccommodated eye) Near object (accommodated eye) MIT 2.71/2.710 Review Lecture p-29 The photographic camera meniscus lens or (nowadays zoom lens ) “digital imaging” Film or detect...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
degree that the “inverse problem” is solvable (i.e. its condition) 2.717 sp02 for details – electronic noise (thermal, Poisson) in cameras – multiplicative noise in photographic film – stray light – speckle noise (coherent imaging systems only) • Sampling at the image plane – camera pixel size – photographic f...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
�ΛΛΛ incident plane wave Λ m=3 m=2 m=1 m=0 m=–1 m=–2 m=–3 … “straight-through” order or DC term Condition for constructive interference: ( m integer) π 2 Λ π = 2 m λ ⇔ sinθ= m λ Λ diffraction order MIT 2.71/2.710 Review Lecture p-43 Grating dispersion Anomalous (or negative) dispersion poly...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
as a linear, shift-invariant system Thin transparency ( t ) , y x ( g 1 ) y x , = ( , x h = ) y 1 i λ z   exp i  2π  z  exp λ   i π   2x + y 2 λz    x ,( y g ) 2 ) ( x , t y = x ,( y ) g 1 impulse response convolution = ( ′ ′ x y g , 3 ∗ x y ,( ) g 2 o...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
Machine learning for Pathology Andrew H Beck MD PhD CEO @ PathAI 6.S897/HST.956: Machine Learning for Healthcare. MIT. March 19, 2019 © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 1 Pat...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Even today, the anatomic path lab has been largely unchanged for routine diagnostics © sources unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 10 And core technology breakthroughs in rout...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
on skin biopsies • 187 pathologists interpreted skin lesion biopsies, resulting in an overall discordance of 45% • 118 pathologists read the same samples 8 months apart, and had an intraobserver discordance of 33% Courtesy of Elmore, et al. Used under CC BY-NC. BMJ 2017;357:j2813 | doi: 10.1136/bmj.j2813 13 ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
et al. Relevant impact of central pathology review on nodal classification in individual breast cancer patients. Ann Oncol. 2012;23(10):2561-2566. 18 The data - CAMELYON • H & E stained, Formalin-Fixe d Paraffin-Embedded (FFPE) • 270 training slid...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
12;318(22):2199-2210. 26 22 Deep learning model outperforms human pathologists in the diagnosis of metastatic cancer Pathologists in competition Pathologists in clinical practice1 Pathologists on micro-metastasis2 Deep learning model Error Rate (1-AUC) 3.5% 13 ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 28 Pathology Report Pathology Report Confirm Patient: John Doe Diagnosis: Size: pTNM staging: # of Pos LN: # of Neg LN: Time per slide: 1 –...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 32 Manual interpretation of PD-L1 IHC is highly variable PDL1 manual IHC scores on immune cells are unreliable © American Medical Association. All rights reserved. This content is excluded from our Cre...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
further From quantitative assay to patient prediction ● PD-L1 scoring alone reduces billions of pixels to 1-2 numbers. ● Can we identify additional relevant information? ○ Using data from randomized controlled clinical trials ● However: Millions of patches, hundreds of patients Proprietary & Confidential 41 ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Total number of macrophages in invasive margin (250um) Total number of lymphocytes in epithelial/stromal interface on H&E stain Total number of plasma cells in epithelium on H&E stain Total number of plasma cells in stroma on H&E stain Tumor (epithelium + stroma) area on H&E stain Total number of plasma cells in e...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Map © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ TCGA-EE-A2GL, Malignant Melanoma Tumor Stroma Tumor Epithelium 51 Melanoma Cell Map © source unknown. All rights reserved. This content...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Stromal plasma cell area RNA signature strongly enriched for immune genes Gene Set Name REACTOME_IMMUNE_SYSTEM REACTOME_ADAPTIVE_IMMUNE_SYSTEM PID_TCR_PATHWAY REACTOME_IMMUNOREGULATORY_INTERACTIONS_BETWEEN_A_ LYMPHOID_AND_A_NON_LYMPHOID_CELL KEGG_PRIMARY_IMMUNODEFICIENCY PID_IL12_2PATHWAY PID_CD8_TCR_PATHWAY ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
type • Contrast to traditional approach: hand-crafted algorithms. Proprietary & Confidential 56 Extensive Slide Search & Data Standardization Proprietary & Confidential 57 Automated quality control Blurred areas Folded / damaged tissue © source unknown. All rights reserved. Thi...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
AI in medicine Some closing thoughts • ML in the real world: • Building the right dataset is 75% of the challenge • Modern ML: engineering and empirical science • Rigorous validation is key • Ideas and algorithms vs. teams and infrastructure Proprietary & Confidential 63 ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
7.91 / 20.490 / 6.874 / HST.506 7.36 / 20.390 / 6.802 C. Burge Lecture #9 Mar. 6, 2014 Modeling & Discovery of Sequence Motifs 1 Modeling & Discovery of Sequence Motifs • Motif Discovery with Gibbs Sampling Algorithm • Information Content of a Motif • Parameter Estimation for Motif Models (+ others) ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Member of the Trypanosoma Cruzi CCHC Zinc Finger Protein Family with Nuclear Localization." Genetics and Molecular Research 5, no. 3 (2006): 553-63. CX2CX4HX4C Zinc finger (DNA binding) Ericsson et al. Genet. Mol. Res. 2006 Courtesy of the authors. License: CC-BY-NC. Source: Bentem, Van, Sergio de la Fuente, et al....
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
7 S8 S9 Odds Ratio: R = P(S|+) = P-3(S1)P-2(S2)P-1(S3) ••• P5(S8)P6(S9) P(S|-) = Pbg(S1)Pbg(S2)Pbg(S3) ••• Pbg(S8)Pbg(S9) Background model homogenous, assumes independence 7 Ways to describe a motif Common motif adjectives: exact/precise versus degenerate stron...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
knows what entropy really is, so in a debate you will always have the advantage.” source: Wikipedia 10 Information Content of a DNA Motif ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
stochastic search of the space of possible PSPMs • Deterministic Optimization (e.g., MEME) - deterministic search of space of possible PSPMs 13 What the motif landscape might look like 14 14 Monte Carlo Algorithms The Gibbs motif sampler is a Mont...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
seq 1). 3) Make a weight matrix model of width W from the sites in all sequences except the one chosen in step 2. 4) Assign a probability to each position in seq 1 using the weight matrix model constructed in step 3: p = { p1, p2, p3, …, pL-W+1 } Lawrence et al. Science 1993 17 ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Gibbs Sampling Algorithm V 5. Sample a new site proportional to likelihood and update motif instances Likelihood (probability) Θ 23 Gibbs Sampling Algorithm VI 6. Update weight matrix Likelihood (probability) Θ 24 Gibbs Sampling Algorithm VII 7. Iterate until convergence ( ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
matrix ) 4 x ( y c n e u q e r F . m u C Nucleotide: Information content Motif strength ) s t i b ( n o i t a m r o f n I Iteration Courtesy of Mehdi Yahyanejad. Used with permission. Position in seq Current Position in seq . o N e c n e u q e S Position in seq Probability density e c n e u q e S Gibbs sam...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
acgaaacgagggcgatcaatgcccgataggactaataag tagtacaaacccgctcacccgaaaggagggcaaatacctt atatacagccaggggagacctataactcagcaaggttcag cgtatgtactaattgtggagagcaaatcattgtccacgtg ... Features that affect motif finding No. of sequences Length of sequences Information content of motif Match between expected length and actual l...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf