text
stringlengths
30
4k
source
stringlengths
60
201
results) we have 0,8 n/¯ 4 n/ 2 h = Y ξ(0) ξn,p n,p W = Y W (0)Y † These redefinitions are easily implemented in Q0 1,5 . They simply take [ξ W ΓlC0(P +)W †ξ(u)] → [ξ n,p (d) n,p (d)(0) n,p W (0)ΓlC0(P +)W (0)†ξ(u)(0) n,p ] (11.6) where we used the fact that Y commutes with the wilson coefficient C0(P +). Thi...
https://ocw.mit.edu/courses/8-851-effective-field-theory-spring-2013/5a73e8bb8f7f637a9b3eb58c5e733e6b_MIT8_851S13_SCETIIApplicat.pdf
Programming Languages Copyright c Nancy Leveson, Sept. 1999 As difficult to discuss rationally as religion or politics. Prone to extreme statements devoid of data. Examples: "It is practically impossible to teach good programming to students that have had a prior exposure to BASIC; as potential programmers the...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
Selection by position (long parameter lists) Defaults and implicit type conversion Attempts to interpret intentions or fix errors Meaning of features should be precisely defined (not dependent on compiler.  Relationship between PL and Correctness (3) Copyright c Nancy Leveson, Sept. 1999 Understandability "Th...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
between PL and Correctness (6) Copyright c Nancy Leveson, Sept. 1999 General High-level languages take many decisions out of programmer’s hands. One reason they are so fiercely resented by experienced programmers. Language should restrict programmer to decisions that really matter. Decisions should be recorded ...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
c Nancy Leveson, Sept. 1999 Cites experiments ("atheoretical" ) that evaluate only current programming practice. More interesting question: Can we elucidate underlying psychological principles to allow generalization of results to other classes of information structure in programming? Hypothesis 1: If one langua...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
ijkstra’s guarded command: if hard: boil if not hard, juicy: fry if not hard, not juicy: chop roast �  Green: Program Creation Programs as plans. Copyright c Nancy Leveson, Sept. 1999 Role expressiveness: Outcome of a programmer’s effort is a structure in which each part plays some role vis-a-vis the progr...
https://ocw.mit.edu/courses/16-355j-software-engineering-concepts-fall-2005/5ab720f0c9da832dd1ce8737ad21131a_cnotes9.pdf
The Invention Machine The Invention Machine Computational adaptation of TRIZ, Computational adaptation of TRIZ, Value Engineering and Value Engineering and the Semantic Web the Semantic Web Thanks to Invention Machine and Dr. Mikhail Verbitsky for materials and consultation and SDM04 students who participated Cou...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
Today’’s Problems: Today 1) System does not cool well enough 2) Sensor is not accurate - leads to overheating 3) Customers complain about Noisy Fan 4) Management pressure to reduce costs © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 7 Step 1: Value Equation Development Problem-Sta...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
. Patterns of technical systems evolution are repeated across different industries. Systems are being developed in the directions of: (i) increased ideality; (ii) increased degree of flexibility 3. Best innovations use scientific effects from different fields © Speller 2007, Engineering Systems Division, Massachuse...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
7, Engineering Systems Division, Massachusetts Institute of Technology Unstructured Text 22 Sample content: “Or the Curie temperature can be controlled by using two or more rare earth elements and adjusting the composition ratio between them.” Subject Action Object Earth elements control Curie temperature 1. What ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
7, Engineering Systems Division, Massachusetts Institute of Technology 31 • • • • • Conclusions Major steps of innovative design: (i) diagnostics of the current design; (ii) identification of the ideal design; (iii) moving current architecture closer to the ideal Traditional TRIZ tools: Physical Effects, Matrix of ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
/contradiction pairs © Speller 2007, Engineering Systems Division, Massachusetts Institute of Technology 34 • The mechanics of the TRIZ principles make us think about what are the effects that have been separated, and the contradiction therefore eliminated It allows going into detail, because the separation of the ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
concept creation1 The process of concept creation is the coupling of an intent-function pair with a form that performs it. There are several ways to do this, and some of us just have it as a talent. However, when trying to do this commercially, it is not feasible to trust in a group of artists that will invent when t...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
architecture of the semantic TRIZ itself is possible to see that the intent is to systematically approach the invention process, with a solution that has all the advantages of the intended effect, and none of the disadvantages of the counter effects, looking through the broadest possible field of concepts. The form ...
https://ocw.mit.edu/courses/esd-34-system-architecture-january-iap-2007/5ac7834e631541ae97d1783412aed765_triz_ve.pdf
3.044 MATERIALS PROCESSING LECTURE 5 General Heat Conduction Solutions: ∂T = ∇ · k∇T, T (¯x, t) ∂t Trick one: steady state ∇2T = 0, T (x) Trick two: low Biot number ∂T = α h(Ts ∂t − Tf ), T (t) Transient: - semi-infinite - infinite series: book, analytical - graphical solutions - computers, numerical, finite elements Exam...
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
S PROCESSING 3 cp = 0.12 kJ kg K h ≈ 10 − 1000 T0 = 1200K Tf = 300K T ≈ 750K Solve for h (the only changable variable): h ≈ 260 W m2 K - oil bath w/ standoff/air gap - big fans - other gases Example 2: Thermal Spray Coatings / Plasma Spray Specific Example: oxyacetylene torch: T = 2700◦C powder: Ni alloy MAR-M200, r = 2 ...
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
8s recall: v = 100 m s ⇒ distance travelled efore melting = 18m b How to decrease t and therefore decrease distance travelled? - preheat the powder T0 ↑ - better plasma? Tf ↑ - smaller R → plausible but costs a lot of money - change material - change h → but h is already pretty large Arc Melter to increase plasma tempe...
https://ocw.mit.edu/courses/3-044-materials-processing-spring-2013/5b02d3e73eaf3afa6ec9564595714beb_MIT3_044S13_Lec05.pdf
6.801/6.866: Machine Vision, Lecture 11 Professor Berthold Horn, Ryan Sander, Tadayuki Yoshitake MIT Department of Electrical Engineering and Computer Science Fall 2020 These lecture summaries are designed to be a review of the lecture. Though I do my best to include all main topics from the lecture, the lectures ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
• Arcane grammar is used for legal purposes - “comprises”, “apparatus”, “method”, etc. • References of other patents are often included - sometimes these are added by the patent examiner, rather than the patent authors • Most patents end with something along the lines of “this is why our invention was necessary” or “th...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
This approximates derivatives in a coordinate system rotated 45 degrees (x , y0). The derivatives can 0 be approximated using the Kx0 and Ky0 kernels: → Kx0 =  → Ky = 0   0 −1 0 −1  1 0 0 −1 ∂E ∂x0 ∂E ∂y0 • Sobel Operator: This computational molecule requires more computation and it is not as high-re...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
an image, we can estimate the brightness gradient using some of the filters defined above. 2. Compute Brightness Gradient Magnitude and Direction: Using the CORDIC algorithm, we can estimate the brightness gradient magnitude and direction. The CORDIC algorithm does this iteratively through a corrective feedback mecha...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
the procedure above. Some formulas for this system: 1. G0 = G2 + G2 (gradient estimation) x q 2. Gθ = tan  −1 Gy Gx y  (gradient estimation) 3. R0 = max(|Gx|, |Gy|) (octant quantization) 4. S0 = min(|Gx|, |Gy |) (octant quantization) At a high level, the apparatus discussed in this patent is composed of: ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
of an edge in a discrete, and therefore, sampled image, and since the edge in the case of u(x) is infinitely thin, we will not be able to find it due to sampling. In Fourier terms, if we use a perfect step function, we introduce artificially high (infinite) frequencies that prevent us from sampling without aliasing effect...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
by the same location as the inflection point of u(x) and the maximum of ru(x): 2 Gradient2 of “Soft” Unit Step Function, ru(x) 0.1 5 · 10−2 ) x ( u 2 r 0 −5 · 10−2 −0.1 −6 −4 −2 2 4 6 0 x For those curious, here is the math behind this specific function, assuming a sigmoid for u(x): 1. u(x) = 1+exp (−x) ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
Next, we will look at the Sobel operator. For this analysis, it will be helpful to recall the following result from Taylor Series: f (x + δx) = f (x) + δxf 0(x) + (δx)2 2! f 00(x) + (δx)3 3! f 000(x) + (δx)4 24 f (4)(x) + ... = ∞ X i=0 (δx)if (i)(x) i! , where 0! = 1 Δ Let us first consider the simple two-pixe...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
f (x) δx + 2 f (x)−f (x−δx) δx = f 0(x) + (δx)2 6 f 000(x) + ... Now we have increased the error term to 3rd order, rather than 2nd order! As a computational molecule, this higher-order filter Sobel operator looks like dE → Kx = (−1 0 1). But we can do even better! So long as we do not need to have a pixel at our...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
with minimal error by estimating it at the point at the center of these 2D filters. Estimating these individually in each dimension requires 3 operations each for a total of 6 operations, but if we are able to take the common operations from each and combine them either by addition or subtraction, this only requires ...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
most common padding technique, but there are other techniques as well, such as wraparound padding. • This approach avoids the half-pixel (in which we estimate an edge that is not on a pixel) that was cited above. • Smoothing/averaging is a double edge sword, because while it can reduce/remove high-frequency noise by fil...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
Supression, http://justin-liang.com/tutorials/canny/#suppression 3. Padded Convolution, https://medium.com/@ayeshmanthaperera/what-is-padding-in-cnns-71b21fb0dd7 7 MIT OpenCourseWare https://ocw.mit.edu 6.801 / 6.866 Machine Vision Fall 2020 For information about citing these materials or our Terms of Use, visit:...
https://ocw.mit.edu/courses/6-801-machine-vision-fall-2020/5b03361b8fe3ccb51a0ce3c685dd88ae_MIT6_801F20_lec11.pdf
Optics Overview MIT 2.71/2.710 Review Lecture p-1 What is light? • Light is a form of electromagnetic energy – detected through its effects, e.g. heating of illuminated objects, conversion of light to current, mechanical pressure (“Maxwell force”) etc. • Light energy is conveyed through particles: “photons” – ba...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
10 Review Lecture p-5 c=λν “Dispersion relation” (holds in vacuum only) Light in matter light in vacuum Speed c=3×108 m/sec light in matter Speed c/n n : refractive index (or index of refraction) Absorption coefficient 0 Absorption coefficient α energy decay coefficient, after distance L : e–2αL E.g. vacuu...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
Lecture p-8 Monochromatic, spatially coherent light 1/ν λ • nice, regular sinusoid • λ, ν well defined • stabilized HeNe laser good approximation • most other cw lasers rough approximation • pulsed lasers & non- laser sources need more complicated description Incoherent: random, irregular waveform MIT 2.7...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
follows the symmetric path POP’. P ′′ mirror P’ θ θ P MIT 2.71/2.710 Review Lecture p-14 The law of refraction reflected θ θ n n′ incident refracted θ′ n sin θ ′= n ′ θ sin Snell’s Law of Refraction MIT 2.71/2.710 Review Lecture p-15 Optical waveguide n≈ 1.00 n =1.51 TIR n =1.5105 n =1.51...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
0 Huygens principle Each point on the wavefront acts as a secondary light source emitting a spherical wave The wavefront after a short propagation distance is the result of superimposing all these spherical wavelets optical wavefronts MIT 2.71/2.710 Review Lecture p-22 Why imaging systems are needed • Eac...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
agnification Energy conservation M a s i− = s o M M x a = 1 Imaging condition: ray-tracing image (virtual) 1st FP object thin lens (+) 2nd FP c h i e f r a y • The ray bundle emanating from the system is divergent; the virtual image is located at the intersection of the backwards-extended rays • The ...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
we will see later; diffraction introduces undesirable artifacts in the image. MIT 2.71/2.710 Review Lecture p-35 Field of View (FoV) φ FoV=angle that the chief ray from an object can subtend towards the imaging system MIT 2.71/2.710 Review Lecture p-36 Numerical Aperture medium of refr. index n θ θ: half...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
in the image MIT 2.71/2.710 Review Lecture p-40 Diffraction limited resolution ) s t i n u y r a r t i b r a ( y t i s n e t n i t h g i l object spacing δx lateral coordinate at image plane (arbitrary units ) Point objects “just resolvable” when δx ≈ 22.1 λ (NA) Rayleigh resolution criterion MIT 2.71/2.7...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
10 Review Lecture p-44 Fresnel diffraction formulae x y x´ y´ z ( x , g in ) y   exp i  2π  z ∫ g  λ  in g out ( ′ x , ′ z ; ) y = 1 i λ z x ′ , yx ′ (out g ) ( x ′ − x ) + ( y ′ − y ) λ z 2 2   x d d y  ( , ) x y exp i π    y z ) ( v u , G in  = exp i   2π  z ...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
y g ) 2 ) ( x , t y = x ,( y ) g 1 impulse response convolution = ( ′ ′ x y g , 3 ∗ x y ,( ) g 2 output amplitude ) = x h ,( y ) Fourier transform Fourier transform (≡ plane wave spectrum ) ) ( v u , G 2 transfer function multiplication v u ),( G 3 v u ),( G 2 = v...
https://ocw.mit.edu/courses/2-717j-optical-engineering-spring-2002/5b0a3acf433dcdadf931bc6223ff4fe6_wk2_a.pdf
Machine learning for Pathology Andrew H Beck MD PhD CEO @ PathAI 6.S897/HST.956: Machine Learning for Healthcare. MIT. March 19, 2019 © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 1 Pat...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ Beck ... Koller. Science Translational Medicine 2011 9 Even today, the anatomic path lab has been largely unchanged for routine diagnostics © sources unknown. All rights reserved. This content is...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
34-1241. © Springer Nature. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 12 Discordance among pathologists is common in interpretation of melanocyti...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
is reproducible and objective • Efficient – massive parallelization for speedy processing • Exploratory - learn relationships in a purely data-driven manner 16 What AI can’t do for pathology Replace pathologists! Proprietary & Confidential 17 A diagnosis/detection example: Breast cancer ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Successfully applied deep learning approach to pathology Our team won the Camelyon challenge in 2016, demonstrating outstanding initial performance in pathology L A M R O N R O M U T Whole Slide Image Training Data Deep Model I N A R T T S E T Whole Slide Image Image Patches Deep Model from Training Tumor Proba...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
/help/faq-fair-use/ 24 Pathologist + PathAI © 2016 PathAI - Confidential & proprietary. Do not distribute. Proprietary & Confidential © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 25 ...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Proprietary & Confidential © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ 29 Why is this a good application for AI? • Exhaustive analysis is benefici...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
more information, see https://ocw.mit.edu/help/faq-fair-use/ 34 Can we do better? • Deep learning is data hungry • Need 10s of thousands of precise cell annotations First, we need the data Proprietary & Confidential 35 Board-certified training data Working with pa...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
, see https://ocw.mit.edu/help/faq-fair-use/ Proprietary & Confidential 42 Predictive features guided by biomedical priors Immune cell (lymphocyte) detection © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/he...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
) Total number of plasma cells in epithelial/stroma interface (80um) Area (mm2) of epithelial/stroma interface (80um) target positive cancer cells on target stain Area (mm2) of epithelial PDL-1 positive macrophages on target stain Necrosis area on target stain Proportion of tumor infiltrating lymphocytes engaged b...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
umor Epithelium 51 Melanoma Cell Map © source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ TCGA-EE-A2GL, Malignant Melanoma Lymphocytes: Green Macrophages: Orange Plasma Cells: Blue Fibroblast...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
Gene Set Name REACTOME_IMMUNE_SYSTEM REACTOME_ADAPTIVE_IMMUNE_SYSTEM PID_TCR_PATHWAY REACTOME_IMMUNOREGULATORY_INTERACTIONS_BETWEEN_A_ LYMPHOID_AND_A_NON_LYMPHOID_CELL KEGG_PRIMARY_IMMUNODEFICIENCY PID_IL12_2PATHWAY PID_CD8_TCR_PATHWAY KEGG_CELL_ADHESION_MOLECULES_CAMS KEGG_CYTOKINE_CYTOKINE_RECEPTOR_INTERACT...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-use/ • Same pipeline for any solid tumor type • Contrast to traditional approach: hand-crafted algorithms. Proprietary & Confidential 56 Extensive Slide Search & Data Standardization Pro...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
to practice Analyze samples, quantified & visual results delivered We can execute process in 4 – 8 weeks for new assays Proprietary & Confidential 62 AI in medicine Some closing thoughts • ML in the real world: •...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
health care delivery. The pathologist as medical information specialist.” (Arch Pathol Lab Med. 1987) 67 MIT OpenCourseWare https://ocw.mit.edu 6.S897 / HST.956 Machine Learning for Healthcare Spring 2...
https://ocw.mit.edu/courses/6-s897-machine-learning-for-healthcare-spring-2019/5b28c3a5a47a51faf2c97f17d2a8f5a1_MIT6_S897S19_lec12.pdf
7.91 / 20.490 / 6.874 / HST.506 7.36 / 20.390 / 6.802 C. Burge Lecture #9 Mar. 6, 2014 Modeling & Discovery of Sequence Motifs 1 Modeling & Discovery of Sequence Motifs • Motif Discovery with Gibbs Sampling Algorithm • Information Content of a Motif • Parameter Estimation for Motif Models (+ others) ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
w.mit.edu/help/faq-fair-use/. Source: Ericsson, A. O., L. O. Faria, et al. "TcZFP8, A Novel Member of the Trypanosoma Cruzi CCHC Zinc Finger Protein Family with Nuclear Localization." Genetics and Molecular Research 5, no. 3 (2006): 553-63. CX2CX4HX4C Zinc finger (DNA binding) Ericsson et al. Genet. Mol. Res. 2006 ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
.1 0.1 0.1 … 0.0 0.5 Background (-) Pos Generic A C G T 0.25 0.25 0.25 0.25 S = S1 S2 S3 S4 S5 S6 S7 S8 S9 Odds Ratio: R = P(S|+) = P-3(S1)P-2(S2)P-1(S3) ••• P5(S8)P6(S9) P(S|-) = Pbg(S1)Pbg(S2)Pbg(S3) ••• Pbg(S8)Pbg(S9) Background model homogenous, assumes independence 7 ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
thought of calling it ‘information’, but the word was overly used, so I decided to call it ‘uncertainty’. When I discussed it with John von Neumann, he had a better idea. Von Neumann told me, ‘You should call it entropy, for two reasons. In the first place your uncertainty function has been used in statistical mech...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
ttcgatttcaagagttcaaaacgtg cccgataggactaataaggacgaaacgagggcgatcaatg ttagtacaaacccgctcacccgaaaggagggcaaatacct agcaaggttcagatatacagccaggggagacctataactc gtccacgtgcgtatgtactaattgtggagagcaaatcatt ... ...can be posed as an alignment problem 12 Approaches to Motif Finding • Enumerative (‘dictionary’) -...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Θ s k,A 1, k × Θ 2, s k,A +1 k × ... × Θ 8, s k,A + 7 k ×θB, s k ,Ak=8 × ... ×θB, L ks = “actactgtatcgtactgactgattaggccatgactgcat” Motif location kA Lawrence et al. Science 1993 16 The Gibbs Sampling Algorithm In Words I Given N sequences of length L and desire...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
The Gibbs Sampling Algorithm In Words, II Given N sequences of length L and desired motif width W: 5) Sample a starting position in seq 1 based on this probability distribution and set a1 to this new position. 6) Choose a sequence at random from the set (say, seq 2). 7) Make a weight matrix model of width W from ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
ggcaattgtaaaacgacggcaatgttcg cgtattaatgataaagaggggggtaggaggtcaactcttc aatgcttataacataggagtagagtagtgggtaaactacg tctgaaccttctttatgcgaagacgcgagggcaatcggga tgcatgtctgacaacttgtccaggaggaggtcaacgactc cgtgtcatagaattccatccgccacgcggggtaatttgga tcccgtcaaagtgccaacttgtgccggggggctagcagct acagcccgggaatatagacgcgtttggagtgcaaacat...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Gibbs Sampler Summary • A stochastic (Monte Carlo) algorithm for motif finding • Works by ‘stumbling’ onto a few motif instances, which bias the weight matrix, which causes it to sample more motif instances, which biases the weight matrix more, … until convergence • Not guaranteed to converge to same motif every ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
atgcctcctctgccgattcggcgagtgatcg gatggggaaaatatgagaccaggggagggccacactgcag ctgccgggctaacagacacacgtctagggctgtgaaatct gtaggcgccgaggccaacgctgagtgtcgatgttgagaac attagtccggttccaagagggcaactttgtatgcaccgcc gcggcccagtgcgcaacgcacagggcaaggtttactgcgg ccacatgcgagggcaacctccctgtgttgggcggttctga gcaattgtaaaacgacggcaatgttcggtcgccta...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Practical Motif Finding • MEME is a classic method Deterministic - like Gibbs, but uses expectation maximization Bailey & Elkan 1995 paper is posted. Run MEME at: http://meme.nbcr.net/meme/ The Fraenkel lab’s WebMotifs combines AlignACE (similar to Gibbs), MDscan, MEME, Weeder, THEME Described in Romer et ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
, qC = qG = 1/8 Suppose: pC = 1. H(q) - H(p) < 2 But RelEnt D(p||q) = log2(1/(1/8)) = 3 Which one better describes frequency of C in background seq? * Alternate names: “Kullback-Leibler distance”, “information for discrimination” 35 ...
https://ocw.mit.edu/courses/7-91j-foundations-of-computational-and-systems-biology-spring-2014/5b2e28907ea0396609fd2cbccd2dd462_MIT7_91JS14_Lecture9.pdf
Chapter 4 Nonlinear equations 4.1 Root finding Consider the problem of solving any nonlinear relation g(x) = h(x) in the real variable x. We rephrase this problem as one of finding the zero (root) of a function, here f (x) = g(x) − h(x). The minimal assumption we need on f, g, h is that they’re continuous. We have...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
LINEAR EQUATIONS In practice, this iteration is stopped once f (mk) gets small enough. Let x ∗ be the unknown root. The error obeys |x ∗ − mk| ≤ |bk − ak| = 2−k|b0 − a0|. Every step of the bisection discovers a new correct digit in the binary expansion of x ∗ . The advantage of the bisection method is that it is ...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
77 408 Starting with x0 = 1, we get x1 = 3 = 1.5, x2 = 17 = 1.4167..., = 1.4142157... The true value of 2 is 1.4142135... x3 = Convergence is very fast, when it occurs. Assume that f '' is continuous, and that f ' (x) = 0 in some neighborhood of the root x ∗ (large enough so that all our iterates stay in this neig...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
∗)/f ' (x ∗)) as n → ∞. Hence the sequence is bounded '' (x |En+1| ≤ CE2 ,n |En| ≤ (CE0)2k . where C > 0 is some number (which depends on f but not on n.) It follows that 1 C We say the method “converges quadratically” because the exponent of En is 2. The number of correct digits is squared at each iteration. I...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
. If we do not know the derivative, we cannot set up Newton’s method, but we can approximate it by replacing the derivative by (let fn = f (xn)) f [xn−1, xn] = fn − fn−1 . xn − xn−1 Hence we define xn+1 by xn+1 = xn − fn . f [xn−1, xn] The geometrical idea is to replace the tangent line at xn by the secant ...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
and xn. Evaluat­ ing this relation at the root x = x ∗ , we get 0 = fn + f [xn−1, xn](x ∗ − xn) + 1 f '' (ξ)(x ∗ − xn)(x ∗ − xn−1). 2 On the other hand the definition of xn+1 gives 0 = fn + f [xn−1, xn](xn+1 − xn). Subtracting these two equations we get En+1 = '' (ξ) 1 f 2 f [xn−1, xn] EnEn−1. Again, thanks...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
isection, but slower than Newton’s method. The secant method inherits the problem of Newton’s method: it only converges when the starting guesses x0 and x1 are sufficiently close to the root. 5 CHAPTER 4. NONLINEAR EQUATIONS We can also set up Newton’s method in several dimensions. A system of nonlinear equations...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
is that we can fit the tangent plane to each of the surfaces y = fi(x1, . . . , xn) in Rn+1 , find the line at the intersection of all these planes, and check where this line intersects the (hyper)plane y = 0. Newton’s method is still quadratically convergent in multiple dimensions, and special care must still be ta...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
. 4.2 Optimization problems Another important recurring problem in science and engineering is that of finding a minimum or a maximum of a function F (x). A point x ∗ is a local minimum when F (y) ≥ F (x ∗) for all y in a neighborhood of x ∗ . It is a global minimum when F (y) ≥ F (x ∗) for all y. We write min F (x...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
∂F . We get ∂xi xn+1 = xn − [VVF (xn)]−1 VF (xn). The matrix VVF of second partial derivatives of F is called the Hessian. In index notation, (VVF )ij = ∂2F ∂xi∂xj . Compare Newton’s method with simple gradient descent: xn+1 = xn − αVF (xn), for some sufficiently small scalar α. Gradient descent is slower but ...
https://ocw.mit.edu/courses/18-330-introduction-to-numerical-analysis-spring-2012/5b325bfa56a599794c7196de926844b0_MIT18_330S12_Chapter4.pdf
Lecture # 17 Solar Thermal Energy Ahmed Ghoniem April 6, 2020 Renewables: Some characteristics and specifics. Historical Trends … Solar Thermals: Concentrators and Plants Renewable Sources and Their Utilization Biomass Geothermal Solar Wind/Wave Chemical Thermal photo Kinetic Combustion Gasification...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
Saturated steam is generated at the receiver tower, fed directly to the turbine, or some stored in hot water tank for extending the hours of operation. The receiver is a forced circulation radiant boiler receiving ~ 55 MWt of concentrated solar radiation. Storage capacity is 20 MWht, sufficient to operate the turbin...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
% of total power used in commercial applications was from natural sources (wind and water). By 1911, all but 2% of power was generated from burning coal and harnessing steam. “Within a few generations at most, some other energy than that of combustion of fuel must be relied upon to do a fair share of the work of the...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
. 10 © Ausra, Inc. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/fairuse. 11 Solar Thermal Electric Generation Stations (SEGS) 1985-2002 Modern plants 2006-2014 Nine SEGS Plants in the Mojave Desert (350MW) US DOE Image...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
• Average ~ 300 W/m2 (strong function of location) © Source unknown. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/fairuse. In London, solar intensity, average over the year is ~ 100 W/m2 from MacKay © Ahmed F. Ghonie m 13 ...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
ors: q = β I − ˆ( − Ta ) h Tc q net flux collected by a fluid passing through the collector I β fraction absobed, depends on orientation & transmissivity < 0.8 hˆ overallheat transfer coefficient Tc Irradiance < 1 kW / m 2 environment T collector T Ta at q = 0 (Tc )max = Ta + β I hˆ for high (Tc )max , hˆ must be ...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
lost from the small area of the collector only. • Concentration Ratio CR is the ratio between irradiance on the collector (at the focal point of the concentrator) and incident irradiance, I, is (also the area ratio): CR = 107.5 Dm F for cylindrical 2Dm ⎛ ⎞ = 11560 F⎜ ⎟ ⎝ ⎠ Dm : mirror dimension, F : focal length f...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
Solar field efficiency: Upper temperature limits of HT Oils HT Steels HT Alloys C = 2500 Dish C: concentration ratio Heliostat C = 1000 C = 700 C = 3 Vacuum C = 1 Flat C = 1 C = 1 C = 200 Trough C = 40 C = 80 From Winter “Solar Power Plants” Greenhunt,M.Sc. Thesis, p. 35 20 ...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
Solar thermal Electric Power systems Source: US DOE 2005 Table courtesy of DOE. © Ahmed F. Ghoniem Source: US DOE 24 Parabolic-Trough Technology Developed by Luz Int., and installed in Kramer Junction in 1991, company failed commercially in 92 (low NG prices), but plant is still in operation. Image ...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
29 Power Tower Technology Image courtesy of DOE. Image courtesy of DOE. © Ahmed F. Ghoniem 30 Dispatchable Power Requires Storage Image courtesy of DOE. 31 2009, Near Lancaster, CA © Source unknown. All rights reserved. This content is excluded from our Creative Commons license. For more informa...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
ocw.mit.edu/fairuse. 36 Operating Hybrid Combined Cycle Solar Plant © DCSP. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/fairuse. 37 Table and figure © SolarPACES. All rights reserved. This con...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
Solar Chimney the Hydroelectric Power for the desert” r the desert” Vch = ΔT T 2gH ch Courtesy Elsevier, Inc., http://www.sciencedirect.com. Used with permission. Operated in Spain, 1982-89 From Encyclopedia of Physical Science and Technology, 2000 Article by J Schlaich and W Schiel Figures 1 and 2 © Source unk...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
. Ghoniem, Journal of Hydrogen Energy, 40(7): 2939-2949, 2015 45 Solar Fuels? Novel, looping based reformer Parabolic Solar Collector Solar Radiation Solar Window Receiver Reactor Solar Radiation Courtesy Elsevier, Inc., http://www.sciencedirect.com. Used with permis...
https://ocw.mit.edu/courses/2-60j-fundamentals-of-advanced-energy-conversion-spring-2020/5b41ce8e948ad3b93015bb1827897026_MIT2_60s20_lec17.pdf
Lecture 4: Stochastic Thinking and Random Walks (cid:1010)(cid:856)(cid:1004)(cid:1004)(cid:1004)(cid:1006)(cid:3)(cid:62)(cid:286)(cid:272)(cid:410)(cid:437)(cid:396)(cid:286)(cid:3)(cid:1008) 1 Relevant Reading Pages 235-238 Chapter 14 6.0002 LECTURE 4 2 The World is Hard to Under...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
as well treat the world as inherently unpredictable Predictive nondeterminism 6.0002 LECTURE 4 7 Stochastic Processes An ongoing process where the next state might depend on both the previous states and some random element def rollDie(): """ returns an int between 1 and 6""" def rollDie(...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
if impossible, and 1 if guaranteed. If the probability of an event occurring is p, the probability of it not occurring must be When events are independent of each other, the probability of all of the events occurring is equal to a product of the probabilities of each of the events occurring. 6.0002 LECTURE 4 ...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
15 Output of Simulation Actual probability = 0.0001286 Estimated Probability = 0.0 Actual probability = 0.0001286 Estimated Probability = 0.0 How did I know that this is what would get printed? Why did simulation give me the wrong a...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
= [0]*366 for p in range(numPeople): birthDate = random.choice(possibleDates) birthdays[birthDate] += 1 return max(birthdays) >= numSame 6.0002 LECTURE 4 19 Approximating Using a Simulation def birthdayProb(numPeople, numSame, numTrials): numHits = 0 for t in range(n...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
/help/faq-fair-use/. Chart 6.0002 LECTURE 4 22 Another Win for Simulation Adjusting analytic model a pain Adjusting simulation model easy def sameDate(numPeople, numSame): possibleDates = 4*list(range(0, 57)) + [58]\ + 4*list(range(59, 366))\ + 4*list(range(180, 270)) birthdays = [0]*366 for...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
Walk Robert Brown 1827 Louis Bachelier 1900 Albert Einstein 1905 Images of Robert Brown and Albert Einstein are in the public domain. Image of Louis Bachelier © unknown. All rights reserved. This content is excluded from our Creative Commons license. For more information, see https://ocw.mit.edu/help/faq-fair-...
https://ocw.mit.edu/courses/6-0002-introduction-to-computational-thinking-and-data-science-fall-2016/5b4ec0ef29910b74e6a4bbd5ccf4dda5_MIT6_0002F16_lec4.pdf
6.045: Automata, Computability, and Complexity Or, Great Ideas in Theoretical Computer Science Spring, 2010 Class 4 Nancy Lynch Today • Two more models of computation: – Nondeterministic Finite Automata (NFAs) • Add a guessing capability to FAs. • But provably equivalent to FAs. – Regular expres...
https://ocw.mit.edu/courses/6-045j-automata-computability-and-complexity-spring-2011/5b6d125bc94344e53285a1cdbdb33371_MIT6_045JS11_lec04.pdf
� ∪ {ε }. The result is a set of states. – q0 ∈ Q, is the start state, and – F ⊆ Q is the set of accepting, or final states. Formal Definition of an NFA • An NFA is a 5-tuple ( Q, Σ, δ, q0, F ), where: – Q is a finite set of states, – Σ is a finite set (alphabet) of input symbols, – δ: Q × Σε → P(Q) is t...
https://ocw.mit.edu/courses/6-045j-automata-computability-and-complexity-spring-2011/5b6d125bc94344e53285a1cdbdb33371_MIT6_045JS11_lec04.pdf
two additions: – Allow δ(q, a) to specify more than one successor state. – Add ε-transitions. • Formally, an NFA is a 5-tuple ( Q, Σ, δ, q0, F ), where: – Q is a finite set of states, – Σ is a finite set (alphabet) of input symbols, – δ: Q × Σε → P(Q) is the transition function, Σε means Σ ∪ {ε }. – q0 ∈ Q, i...
https://ocw.mit.edu/courses/6-045j-automata-computability-and-complexity-spring-2011/5b6d125bc94344e53285a1cdbdb33371_MIT6_045JS11_lec04.pdf
– Then after another 0: { a, b } – After 1: { a, c } – After final 0: { a, b } • Since neither a nor b is accepting, M does not accept 0010. 0 0 0 { a } Æ { a, b } Æ { a, b } Æ { a, c } Æ { a, b } 1 0,1 ε ε a Example 2 0 1 b e c f 1 0 d g • L(M) = { w | w ends with 01 or 10 } • Computations for...
https://ocw.mit.edu/courses/6-045j-automata-computability-and-complexity-spring-2011/5b6d125bc94344e53285a1cdbdb33371_MIT6_045JS11_lec04.pdf