content
stringlengths
0
1.05M
origin
stringclasses
2 values
type
stringclasses
2 values
from odoo.tests.common import TransactionCase class TestComputeDomain(TransactionCase): at_install = True post_install = True def setUp(self): super(TestComputeDomain, self).setUp() self.demo_user = self.env.ref("base.user_demo") self.env["ir.rule"].create( { "name": "test ir_rule_website", "model_id": self.env.ref("base.model_res_partner").id, "domain_force": "[('parent_id', 'in', [website_id])]", } ) def _cached_compute_domain(self, website_id): test_domain = ("parent_id", "in", [website_id]) domain = ( self.env["ir.rule"] .sudo(user=self.demo_user.id) .with_context(website_id=website_id) ._compute_domain("res.partner") ) self.assertTrue(test_domain in domain) def test_cache(self): self._cached_compute_domain(1) self._cached_compute_domain(2)
nilq/baby-python
python
#%% import os, glob import numpy as np import tensorflow as tf # from myDataset import * # from myconfig import cfg # from yoloNet import * # model = yoloNetModle() # tf.keras.utils.plot_model(model, show_shapes=True, show_layer_names=True) # weight_reader = WeightReader('yolo.weights') # print(weight_reader.all_weights[:4]) # conv_layer = model.get_layer('conv_1') # for i in conv_layer.weights: # print(i.shape) # norm_layer = model.get_layer('norm_1') # for i in norm_layer.weights: # print(i.shape) # print(i.name) # %% # for i in norm_layer.weights: # print(i.shape) # print(i.name) # %% bn1 = tf.keras.layers.BatchNormalization(name='bn1') inTem = tf.convert_to_tensor([[1,2,3.0],[1,2,3.0]]) outTem = bn1(inTem) print(outTem) bn1.weights[1].assign(np.array([1,2,3], dtype=np.float32)) outTem = bn1(inTem) print(outTem) for i in bn1.weights: print(i) # print(i.shape) # print(i.name) # %% # %% # bn1.weights[1].assign(np.array([[1,2,3]], dtype=np.float32)) bn1 = tf.keras.layers.BatchNormalization(name='bn1') inTem = tf.convert_to_tensor([[1,2,3.0],[1,2,3.0]]) for i in range(10): outTem = bn1(inTem, training=True) # print(outTem) outTem = bn1(inTem, training=False) # False print(outTem) outTem = bn1(inTem, training=True) # False print(outTem) # %% for i in bn1.weights: print(i) # %%
nilq/baby-python
python
class Cliente: def __init__(self, nome, email, plano): self.nome = nome self.email = email self.lista_planos = ["basic", "premium"]#se fosse uma variavel somente pra essa funcao, nao precisaria do self. if plano in self.lista_planos: self.plano = plano else: raise Exception("Plano inválido!") def mudar_plano(self, novo_plano): if novo_plano in self.lista_planos: self.plano = novo_plano else: print("Plano inválido!") def ver_filme(self, filme, plano_filme): if self.plano == plano_filme: print(f'ver {filme}') elif self.plano == "premium": print(f'ver {filme}') else: print(f'filme não disponível no plano {self.plano}') cliente1 = Cliente("Isaque", "isaque@gmal.com", "basic") print(cliente1.plano) cliente1.ver_filme("Homem-Aranha", "premium") cliente1.mudar_plano("premium") print(cliente1.plano) cliente1.ver_filme("Homem-Aranha", "premium")
nilq/baby-python
python
import sys f=open(sys.argv[1],'r') patch_no=sys.argv[2] #g=open('/Volumes/Unnamed/patched_function_old/'+patch_no,'r') #method=g.readline().strip() from unidiff import PatchSet import os def get_patched_class(patch_no): patchfile=os.path.join('../../patches',patch_no) patch = PatchSet.from_filename(patchfile,encoding='utf-8') source_file=patch[0].source_file #print(source_file) line_no_list=[] tmp_file='tmp_result'+patch_no for hunki in range(len(patch[0])): for i in range(len(patch[0][hunki])): if not patch[0][hunki][i].is_context: line_no_list.append(str(patch[0][hunki][i-1].source_line_no+1)) break os.system('cd .. && make PatchInfo ARGS="'+os.path.join('../source/',source_file)+' '+tmp_file+' '+','.join(line_no_list)+'" >/dev/null') f=open('../'+tmp_file) res=f.readlines()[0].strip() f.close() os.system('rm ../'+tmp_file) return res method=get_patched_class(patch_no) traces=[] trace=[] stackdepth=0 isinTargetMethod=False #print('<Method_invoked,'+method+'>') for line in f: if line.startswith('<Method_invoked,'+method+'>'): stackdepth=1 trace=[] traces.append(trace) trace.append(line) isinTargetMethod=True continue if not isinTargetMethod: continue trace.append(line) if line.startswith('<Method_invoked,'): stackdepth+=1 # print(line.strip()) # print(stackdepth) # input() continue if line.startswith('<ReturnStatement>'): stackdepth-=1 # print(line.strip()) # print(stackdepth) # input() if stackdepth == 0: isinTargetMethod=False #print(len(traces)) for line in traces[0]: print(line.strip())
nilq/baby-python
python
# -*- coding: utf-8 -*- """Concrete VeiL api objects.""" from .cluster import VeilCluster from .controller import VeilController from .data_pool import VeilDataPool from .domain import (DomainBackupConfiguration, DomainConfiguration, DomainTcpUsb, DomainUpdateConfiguration, VeilDomain, VeilGuestAgentCmd) from .library import VeilLibrary from .node import VeilNode from .resource_pool import VeilResourcePool from .vdisk import VeilVDisk from ..base import VeilRestPaginator class VeilDomainExt(VeilDomain): """Extension of VeilDomain with methods related to VeilLibrary.""" async def backup_list(self, paginator: VeilRestPaginator = None): """List of domain backup files.""" lib = VeilLibrary(client=self._client, retry_opts=self.retry_opts, cache_opts=self.cache_opts) return await lib.list(domain=self.api_object_id, paginator=paginator) __all__ = ( 'DomainConfiguration', 'VeilGuestAgentCmd', 'DomainTcpUsb', 'VeilDomainExt', 'DomainBackupConfiguration', 'VeilLibrary', 'VeilNode', 'VeilController', 'VeilDataPool', 'VeilResourcePool', 'VeilVDisk', 'VeilCluster', 'DomainUpdateConfiguration' )
nilq/baby-python
python
from unittest import mock from py.test.tools import ( BaseTestCase, ) from py.src.match.model.data import ( GlobalRankedData, ) from py.src.view_model import ( GlobalViewModelCache, ) class GlobalIntegrationTest(BaseTestCase): @classmethod def setUpChildClass(cls): cls.matches = cls.sample_matches() def _create_global_view_model(self, global_dict): with mock.patch( 'py.src.view_model.get_global_ranked_match_cache', ) as mp: mp.return_value = global_dict return GlobalViewModelCache() def test_global(self): global_data = GlobalRankedData(global_dict=None) global_data._process_matches(self.matches, lambda m: True) vm_cache = self._create_global_view_model(global_data.to_dict()) global_vm = vm_cache.get_by_leagues([], []) self.assertEqual(188, global_vm.data.game_count) self.assertEqual(94, global_vm.data.game_wins) self.assertEqual(47, global_vm.data.characters[14].game_count) def test_to_dict(self): global_data = GlobalRankedData(global_dict=None) global_data._process_matches(self.matches, lambda m: True) dict1 = global_data.to_dict() dict2 = GlobalRankedData(global_dict=dict1).to_dict() self.assertEqual(dict1, dict2)
nilq/baby-python
python
""" Miscellanea utilities """ from __future__ import ( division, absolute_import, print_function, unicode_literals ) import sys, os, tempfile, logging if sys.version_info >= (3,): import urllib.request as urllib2 import urllib.parse as urlparse else: import urllib2 import urlparse # Courtesy of https://stackoverflow.com/a/16518224/8053968 def download_file(url, dest=None): """ Download and save a file specified by url to dest directory, """ u = urllib2.urlopen(url) scheme, netloc, path, query, fragment = urlparse.urlsplit(url) filename = os.path.basename(path) if not filename: raise "Couldn't get filename from URL" if dest: filename = os.path.join(dest, filename) with open(filename, 'wb') as f: meta = u.info() meta_func = meta.getheaders if hasattr(meta, 'getheaders') else meta.get_all meta_length = meta_func("Content-Length") file_size = None if meta_length: file_size = int(meta_length[0]) print("Downloading: {0} Bytes: {1}".format(url, file_size)) file_size_dl = 0 block_sz = 8192 while True: buffer = u.read(block_sz) if not buffer: break file_size_dl += len(buffer) f.write(buffer) status = "{0:16}".format(file_size_dl) if file_size: status += " [{0:6.2f}%]".format(file_size_dl * 100 / file_size) status += chr(13) print(status, end="") print() return filename if __name__ == "__main__": # Only run if this file is called directly print("Testing with 10MB download") url = "http://download.thinkbroadband.com/10MB.zip" filename = download_file(url) print(filename)
nilq/baby-python
python
''' Author= 'Parampreet Singh' Project= 'https://github.com/paramsingh96/TensorFlow-Tutorials' Simple tutorial for understanding MNIST Data Sets ''' # Importing different libraries import tensorflow as tf import matplotlib.pyplot as plt import numpy as np import tensorflow.examples.tutorials.mnist.input_data as input_data # MNIST are the data sets of hand written images ranging from 0 to 9 # The data is split into three parts: 55,000 data points of training data # 10,000 data points of test data # 5,000 of validation data # Each image is 28 pixel by 28 pixel mnist = input_data.read_data_sets('MNIST_data/', one_hot=True) # Within each, we can access images, labels and num_examples print(mnist.train.num_examples, mnist.test.num_examples, mnist.validation.num_examples) # (55000, 784) (55000, 10) print(mnist.train.images.shape, mnist.train.labels.shape) # The ranges of values in each images is from 0-1 print(np.min(mnist.train.images), np.max(mnist.train.images)) # We can visualize any one of the images by reshaping it to a 28*28 image plt.imshow(np.reshape(mnist.train.images[1000, :], (28, 28)), cmap='rainbow') plt.show() # try out with different data points and colors, we will get great insights. :)
nilq/baby-python
python
import concurrent.futures import datetime import itertools import json import logging import os from typing import Dict, Iterable, List import kafka from finitestate.common.retry_utils import retry from finitestate.common.timer import CodeTimer from finitestate.firmware.datasets import Dataset, Density, Format, Granularity from finitestate.firmware.bundle import FirmwareDataBundler, DEFAULT_MAX_WORKERS, get_file_suffix, list_keys __all__ = [ 'DynamicFirmwareDataBundler' ] logger = logging.getLogger(__name__) class DynamicFirmwareDataBundler(FirmwareDataBundler): """ A FirmwareDataBundler that leverages kafka messages and the status tracker build a bundle containing recent FWAN plugin output. The intended use of this implementation is to build a "delta" bundle to a first pass that includes all previously analyzed outputs (since the unpack process doesn't re-analyze previously-seen files). """ def __init__(self, firmware_metadata_bucket: str, *, max_workers: int = DEFAULT_MAX_WORKERS, kafka_bootstrap_server: str, topic: str, earliest_offset_time: datetime.datetime): """ Creates a new DynamicFirmwareDataBundler that will leverage kafka to determine which paths should go in the bundle. Note that instances of this class aren't re-usable, since they're associated to a specific timestamp. :param firmware_metadata_bucket: The bucket from which to read objects :param max_workers: The maximum number of parallel threads with which objects will be read from object storage. :param earliest_offset_time: The earliest time at which a relevant message may be found on the topic. """ super().__init__(firmware_metadata_bucket=firmware_metadata_bucket, max_workers=max_workers) self.kafka_bootstrap_server = kafka_bootstrap_server self.topic = topic self.earliest_offset_time = earliest_offset_time def build_paths(self, firmware_hash: str, datasets: List[Dataset], file_hashes: Iterable[str], delta_to: Dict[str, str] = None) -> List[str]: @retry(on='kafka.errors.NoBrokersAvailable') def get_kafka_consumer(): return kafka.KafkaConsumer(bootstrap_servers=self.kafka_bootstrap_server, enable_auto_commit=False) with CodeTimer('Connect to kafka'): consumer = get_kafka_consumer() with CodeTimer(f'Determine partitions and end offsets for {self.topic}'): topicparts = [kafka.TopicPartition(self.topic, p) for p in consumer.partitions_for_topic(self.topic) or []] end_offsets = consumer.end_offsets(topicparts) logger.info(f'End offsets = {end_offsets}') # Determine the start offsets using the earliest offset time if self.earliest_offset_time is not None: timestamp_millis = self.earliest_offset_time.timestamp() * 1000 with CodeTimer(f'Find offsets on {self.topic} for unpack timestamp'): start_offset_times = consumer.offsets_for_times( {topicpart: timestamp_millis for topicpart in topicparts} ) logger.info(f'Start offset times = {start_offset_times}') else: logger.warning(f'Earliest offset time is not specified - consuming all messages on topic') start_offset_times = {} consumer = None def get_paths_from_topicpart(topicpart: kafka.TopicPartition, datasets: List[Dataset], start_offset: int, stop_offset: int, delta_to: Dict[str, str] = None) -> List[str]: consumer = get_kafka_consumer() consumer.assign([topicpart]) if start_offset is not None: consumer.seek(topicpart, offset=start_offset) else: consumer.seek_to_beginning(topicpart) dataset_lookup = {d.name: d for d in datasets if d.granularity == Granularity.FILE} paths = set([]) def get_path(record) -> str: """ Parses and creates a path from the record value, which is expected to look like { "output_location": "bin_info/exports", "file_id": "<sha256 file hash>", "etag": "object storage checksum of the object at the time it was written" } :param record: A kafka record :return: An object storage path """ try: entity = json.loads(record.value) dataset = dataset_lookup.get(entity['output_location']) if dataset: file_hash = entity['file_id'] if file_hash in file_hashes: path = f'{dataset.name}/{file_hash}{get_file_suffix(dataset.format)}' if delta_to is None or entity['etag'] != delta_to.get(path): return path except json.JSONDecodeError as e: logger.warning(f'Failed to de-serialize {record}') except KeyError: logger.warning(f'Failed to process {record}') keep_polling = True while keep_polling: response = consumer.poll(max_records=1000, timeout_ms=60 * 1000).values() if not response: logger.warning(f'Timed out waiting for records on {topicpart} without hitting the stop offset - exiting polling loop') break for records in response: for record in records: paths.add(get_path(record)) if record.offset >= stop_offset: logger.info(f'Reached stop offset for {topicpart} - exiting polling loop') keep_polling = False return sorted(filter(None, paths)) paths = [] with concurrent.futures.ThreadPoolExecutor(max_workers=self.max_workers) as executor: futures = [] # Process FILE-level Datasets by looking for recent plugin outputs on Kafka for topicpart in topicparts: start_offset_time = start_offset_times.get(topicpart) futures.append( # stop_offset = end_offset - 1 because the end_offset points to the offset of the upcoming message, # i.e. the offset of the last available message + 1 executor.submit( get_paths_from_topicpart, topicpart=topicpart, datasets=datasets, start_offset=start_offset_time.offset if start_offset_time is not None else None, stop_offset=end_offsets[topicpart] - 1, delta_to=delta_to ) ) # Process FIRMWARE- and FIRMWARE_FILE-level outputs by directly accessing S3 for dataset in filter(lambda d: d.name != 'file_tree', datasets): file_suffix = get_file_suffix(dataset.format) if dataset.granularity == Granularity.FIRMWARE: paths.append(f'{os.path.join(dataset.name, firmware_hash)}{file_suffix}') elif dataset.granularity == Granularity.FIRMWARE_FILE: futures.append( executor.submit( list_keys, bucket=self.firmware_metadata_bucket, prefix=f'{dataset.name}/{firmware_hash}/', suffix=file_suffix, delta_to=delta_to ) ) return sorted(set(itertools.chain(paths, *[f.result() for f in concurrent.futures.as_completed(futures)])))
nilq/baby-python
python
#!/usr/bin/env python import sys, os import errno import arsdkparser from common import * #=============================================================================== # root file that includes all generated c files #=============================================================================== def gen_root_jni(ctx, out): out.write("/** Generated, do not edit ! */\n") out.write("#include <stdio.h>\n") out.write("#include <string.h>\n") out.write("#include <jni.h>\n") out.write("#include <arsdk/arsdk.h>\n") for featureId in sorted(ctx.featuresById.keys()): featureobj = ctx.featuresById[featureId] out.write("#include \"%s\"\n", jni_file_name(featureobj.name)) #=============================================================================== def gen_jni_callback_cache(feature, cls, evts, out): full_name = feature.name + ("_" + cls.name if cls else "") java_cb_name = ( "Lcom/parrot/drone/sdkcore/arsdk/" + java_feature_class_name(feature.name) + ("$" + cls.name if cls else "") + "$Callback;" ) # callback methods id cache out.write("static struct {\n") for evt in sorted(evts, key=lambda evt: evt.cmdId): out.write("\tjmethodID jmid_%s;\n", evt.name) out.write("} s_cb_%s_cache;\n\n", full_name) # class init out.write("JNIEXPORT void JNICALL\n%s_nativeClassInit(JNIEnv *env, jclass jcls) {\n", jni_func_name(feature, cls)) for evt in sorted(evts, key=lambda evt: evt.cmdId): out.write("\ts_cb_%s_cache.jmid_%s = (*env)->GetStaticMethodID(env, jcls, \"%s\", \"(%s%s)V\");\n", full_name, evt.name, java_method_name(evt.name), java_cb_name, jni_method_signature(evt.args)) out.write("}\n\n") #=============================================================================== def gen_jni_decode(feature, cls, evts, out): full_name = feature.name + ("_" + cls.name if cls else "") for evt in sorted(evts, key=lambda evt: evt.cmdId): # static decode fn out.write("static int evt_%s_%s(JNIEnv *env, jclass clazz, struct arsdk_cmd *cmd, jobject callback) {\n", full_name, evt.name) for arg in evt.args: out.write("\t%s %s;\n", c_arg_type(arg, feature), arg.name) if evt.args: out.write("\tint res = arsdk_cmd_dec_%s_%s(cmd, %s);\n", c_name(full_name), c_name(evt.name), ", ".join("&" + arg.name for arg in evt.args)) else: out.write("\tint res = arsdk_cmd_dec_%s_%s(cmd);\n", c_name(full_name), c_name(evt.name)) out.write("\tif (res < 0)\n\t\treturn res;\n") for arg in evt.args: if arg.argType == arsdkparser.ArArgType.BINARY: out.write("\tjbyteArray j_%s = (*env)->NewByteArray(env, %s.len);\n", arg.name, arg.name) out.write("\t(*env)->SetByteArrayRegion(env, j_%s, 0, %s.len, %s.cdata);\n", arg.name, arg.name, arg.name) out.write("\t(*env)->CallStaticVoidMethod(env, clazz, s_cb_%s_cache.jmid_%s, callback", full_name, evt.name) for arg in evt.args: out.write(", ") if arg.argType == arsdkparser.ArArgType.STRING: out.write("(*env)->NewStringUTF(env, %s)", arg.name) elif arg.argType == arsdkparser.ArArgType.BINARY: out.write("j_%s", arg.name) else: out.write("(%s)%s", jni_arg_type(arg), arg.name) out.write(");\n") out.write("\treturn 0;\n") out.write("}\n\n") # decode jni fn out.write("JNIEXPORT jint JNICALL\n%s_nativeDecode(JNIEnv *env, jclass jcls, jlong nativeCmd, jobject callback) {\n", jni_func_name(feature, cls)) out.write("\tstruct arsdk_cmd *cmd = (struct arsdk_cmd *)(uintptr_t)nativeCmd;\n") out.write("\tif (cmd->prj_id != %d || cmd->cls_id != %d)\n\t\treturn -1;\n", feature.featureId, cls.classId if cls else 0) out.write("\tswitch(cmd->cmd_id) {\n") for evt in sorted(evts, key=lambda evt: evt.cmdId): out.write("\t\tcase %d: return evt_%s_%s(env, jcls, cmd, callback);\n", evt.cmdId, full_name, evt.name) out.write("\t}\n") out.write("\treturn -1;\n") out.write("}\n\n") #=============================================================================== def gen_jni_encode(feature, cls, cmds, out): full_name = feature.name + ("_" + cls.name if cls else "") for cmd in sorted(cmds, key=lambda cmd: cmd.cmdId): out.write("JNIEXPORT jint JNICALL\n%s_nativeEncode%s(JNIEnv *env, jclass jcls, jlong nativeCmd", jni_func_name(feature, cls), jni_method_name(cmd.name)) for arg in cmd.args: out.write(", %s %s", jni_arg_type(arg), arg.name) out.write(") {\n") out.write("\tstruct arsdk_cmd *cmd = (struct arsdk_cmd *)(uintptr_t)nativeCmd;\n") for arg in cmd.args: if arg.argType == arsdkparser.ArArgType.STRING: out.write("\tconst char* c_%s = (*env)->GetStringUTFChars(env, %s, NULL);\n", arg.name, arg.name) elif arg.argType == arsdkparser.ArArgType.BINARY: out.write("\tstruct arsdk_binary c_%s = {\n", arg.name) out.write("\t\t.len = (*env)->GetArrayLength(env, %s),\n", arg.name) out.write("\t\t.cdata = (*env)->GetPrimitiveArrayCritical(env, %s, NULL)\n", arg.name) out.write("\t};\n") out.write("\tint res = arsdk_cmd_enc_%s_%s(cmd", c_name(full_name), c_name(cmd.name)) for arg in cmd.args: arg_prefix = "" if arg.argType == arsdkparser.ArArgType.STRING: arg_prefix = "c_" elif arg.argType == arsdkparser.ArArgType.BINARY: arg_prefix = "&c_" out.write(", %s%s", arg_prefix, arg.name) out.write(");\n") for arg in cmd.args: if arg.argType == arsdkparser.ArArgType.STRING: out.write("\tif (c_%s != NULL) (*env)->ReleaseStringUTFChars(env, %s, c_%s);\n", arg.name, arg.name, arg.name) if arg.argType == arsdkparser.ArArgType.BINARY: out.write("\t(*env)->ReleasePrimitiveArrayCritical(env, %s, (void *) c_%s.cdata, JNI_ABORT);\n", arg.name, arg.name) out.write("\treturn res;\n") out.write("}\n\n") #=============================================================================== def _evts(msgs): for msg in sorted(msgs, key=lambda msg: msg.cmdId): if isinstance(msg, arsdkparser.ArEvt): yield msg def _cmds(msgs): for msg in sorted(msgs, key=lambda msg: msg.cmdId): if isinstance(msg, arsdkparser.ArCmd): yield msg #=============================================================================== def gen_jni_feature(feature, cls, evts, cmds, out): if evts: # decode evts gen_jni_callback_cache(feature, cls, evts, out) gen_jni_decode(feature, cls, evts, out) if cmds: # encode cmds gen_jni_encode(feature, cls, cmds, out) #=============================================================================== def gen_jni(feature, out): out.write("/** Generated, do not edit ! */\n\n") if feature.classes: # Project based (old) for clsId in sorted(feature.classesById.keys()): cls = feature.classesById[clsId] gen_jni_feature(feature, cls, [evt for evt in feature.evts if clsId == evt.cls.classId], [cmd for cmd in feature.cmds if clsId == cmd.cls.classId], out) else: # feature based (new) gen_jni_feature(feature, None, feature.evts, feature.cmds, out) #=============================================================================== #=============================================================================== def list_files(ctx, outdir, extra): for featureId in sorted(ctx.featuresById.keys()): featureobj = ctx.featuresById[featureId] print(jni_file_name(featureobj.name)) #=============================================================================== #=============================================================================== def generate_files(ctx, outdir, extra): # main file that include all other files filepath = os.path.join(outdir, "arsdkgen.c") with open(filepath, "w") as fileobj: print("generating %s" % filepath) gen_root_jni(ctx, Writer(fileobj)) # features for featureId in sorted(ctx.featuresById.keys()): featureobj = ctx.featuresById[featureId] filepath = os.path.join(outdir, jni_file_name(featureobj.name)) try: os.makedirs(os.path.dirname(filepath)) except OSError as exc: if exc.errno != errno.EEXIST: raise print("generating %s" % filepath) with open(filepath, "w") as fileobj: gen_jni(featureobj, Writer(fileobj))
nilq/baby-python
python
# Generated by Django 3.2.2 on 2021-05-18 19:03 import datetime from django.db import migrations, models class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Email', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('sender', models.EmailField(max_length=254)), ('receiver', models.EmailField(max_length=254)), ('text', models.TextField()), ('date', models.DateField(default=datetime.date.today)), ('time', models.TimeField(null=True)), ('subject', models.CharField(blank=True, max_length=200)), ('attachment', models.URLField(blank=True)), ], ), ]
nilq/baby-python
python
# -*- coding: utf-8 -*- __author__ = "Frank Becker <fb@alien8.de>" __copyright__ = "Frank Becker" __license__ = "mit" import importlib def test_module_imports(): """Test if all modules can be imported.""" modules = ["api", "auth", "awattar", "cli", "config", "defaults", "poller", "utils", "weather"] for module in modules: try: importlib.import_module("discovergy." + module) except ImportError: assert False else: assert True
nilq/baby-python
python
class Queue: def __init__(self): self.storage = [] def size(self): return len(self.storage) def enqueue(self, item): self.storage.append(item) def dequeue(self): return self.storage.pop(0)
nilq/baby-python
python
# yellowbrick.utils # Utility functions and helpers for the Yellowbrick library. # # Author: Jason Keung <jason.s.keung@gmail.com> # Author: Patrick O'Melveny <pvomelveny@gmail.com> # Author: Benjamin Bengfort <bbengfort@districtdatalabs.com> # Author: Rebecca Bilbro <rbilbro@districtdatalabs.com> # Created: Thu Jun 02 15:33:18 2016 -0500 # # Copyright (C) 2016 District Data LAbs # For license information, see LICENSE.txt # # ID: __init__.py [79cd8cf] benjamin@bengfort.com $ """ Utility functions and helpers for the Yellowbrick library. """ ########################################################################## ## Imports ########################################################################## from .helpers import * from .types import *
nilq/baby-python
python
# Generated by Django 3.2.7 on 2021-11-26 08:30 from django.db import migrations # Migration that creates a user group called "Download approved user" def create_barrier_search_download_approved_group(apps, schema_editor): Group = apps.get_model("auth", "Group") Group.objects.create(name="Download approved user") # create a "download_barrier" Permission and add it to the group Permission = apps.get_model("auth", "Permission") ContentType = apps.get_model("contenttypes", "ContentType") Barrier = apps.get_model("barriers", "Barrier") barrier_content_type = ContentType.objects.get_for_model(Barrier) download_barriers_permission, created = Permission.objects.get_or_create( codename="download_barriers", defaults={ "name": "Can download barriers", "content_type": barrier_content_type, }, ) group = Group.objects.get(name="Download approved user") group.permissions.add(download_barriers_permission) def undo_create_barrier_search_download_approved_group(apps, schema_editor): Group = apps.get_model("auth", "Group") Group.objects.filter(name="Download approved user").delete() # remove "download_barriers" Permission Permission = apps.get_model("auth", "Permission") permission = Permission.objects.get(codename="download_barriers") permission.delete() class Migration(migrations.Migration): dependencies = [ ("user", "0022_auto_20210510_1019"), ("barriers", "0113_alter_barrier_options"), ] operations = [ migrations.RunPython( create_barrier_search_download_approved_group, undo_create_barrier_search_download_approved_group, ), ]
nilq/baby-python
python
import numpy as np # # class Decoration: # def __init__(self, s0, s1, s2, r0, r1, r2): # self.s0 = s0 # self.s1 = s1 # self.s2 = s2 # self.r0 = r0 # self.r1 = r1 # self.r2 = r2 # assert len(s0) == 3, "s0 not a valid R^3 vector" # assert len(s1) == 3, "s1 not a valid R^3 vector" # assert len(s2) == 3, "s0 not a valid R^3 vector" # # def normalise_decoration(self): # self.s0 = self.s0/np.linalg.norm(self.s0) # self.s1 = self.s1/np.linalg.norm(self.s1) # self.s2 = self.s2/np.linalg.norm(self.s2) class Vertex: def __init__(self,c,r, c_clover, r_clover): self.c = c self.r = r self.c_clover = c_clover self.r_clover = r_clover self.edges = [] class Edge: def __init__(self, v0,v1, connected): self.v0 = v0 self.v1 = v1 self.v0.edges.append(self) self.v1.edges.append(self) self.ev0v1 = np.dot(self.v0.r,self.v1.c) self.ev1v0 = np.dot(self.v1.r, self.v0.c) self.triangle = [] self.connected = False self.edge_connected = None class Triangle: def __init__(self, e0, e1, e2): self.edges = [e0, e1, e2] self.vertices = [e0.v0, e1.v0, e2.v0] edge_index = 0 for edge in self.edges: edge.triangle = self edge.index = edge_index edge_index+=1 [v0, v1, v2] = self.vertices #print([v.c for v in self.vertices]) # if np.linalg.det([v0.c,v1.c,v2.c]) < 0: # self.vertices = [v0, v2, v1] # if np.linalg.det([v0.c,v1.c,v2.c]) < 0: # for edge in self.edges: # [edge.v0,edge.v1] = [edge.v1, edge.v0] #print(np.linalg.det([self.edges[0].v0.c, self.edges[1].v0.c, self.edges[2].v0.c])) #print(self.t) self.neighbours = [] def add_neighbour(self, neighbour_triangle): self.neighbours.append(neighbour_triangle) class Surface: def __init__(self, c0, c1, c2, r0, r1, r2, c0_clover, c1_clover, c2_clover, r0_clover, r1_clover, r2_clover): vertices = [Vertex(c0,r0, c0_clover, r0_clover), Vertex(c1,r1, c1_clover, r1_clover), Vertex(c2,r2, c2_clover, r2_clover)] edges = [Edge(vertices[0],vertices[1], False),Edge(vertices[1],vertices[2], False),Edge(vertices[2],vertices[0], False)] #print(np.linalg.det([c0,c1,c2])) initial_triangle = Triangle(edges[0],edges[1],edges[2]) self.triangles = [initial_triangle] initial_triangle.distance_from_centre = 0 initial_triangle.index = 0 def add_triangle(self, connecting_edge, v0, v1, new_vertex): # if np.linalg.det(np.array([v0.c,v1.c,new_vertex.c])) > 0: # print(v0.c_clover,v1.c_clover, new_vertex.c_clover) connecting_edge.connected = True new_triangle = Triangle(Edge(v0, v1, True), Edge(v1,new_vertex, False), Edge(new_vertex,v0, False)) #print([v.c_clover for v in new_triangle.vertices]) connecting_edge.edge_connected = new_triangle.edges[0] new_triangle.edges[0].edge_connected = connecting_edge new_triangle.edges[0].connected = True self.triangles.append(new_triangle) new_triangle.add_neighbour(connecting_edge.triangle) self.triangles[-1].add_neighbour(new_triangle) new_triangle.index = connecting_edge.triangle.index+1 new_triangle.distance_from_centre = connecting_edge.triangle.distance_from_centre+1 return new_triangle def connect_edges(self, e1,e2): e1.edge_connected = e2 e2.edge_connected = e1 if e1.edge_connected: e1.connected = True if e2.edge_connected: e2.connected = True def flip_edge(self, edge): edge_forward = edge.triangle.edges[(edge.index+1) % 3] edge_backward = edge.triangle.edges[(edge.index-1) % 3] edge_connected = edge.edge_connected edge_connected_forward = edge_connected.triangle.edges[(edge_connected.index+1) % 3] edge_connected_backward = edge_connected.triangle.edges[(edge_connected.index - 1)%3] e_prime = Edge(edge_forward.v1, edge_connected_backward.v0, True) e_prime_forward = edge_connected_backward e_prime_backward = edge_forward # if edge_connected_backward.edge_connected: # self.connect_edges(e_prime_forward, edge_connected_backward.edge_connected) # if edge_forward.edge_connected: # self.connect_edges(e_prime_backward, edge_forward.edge_connected) e_prime_connected = Edge(e_prime.v1, e_prime.v0, e_prime.connected) self.connect_edges(e_prime,e_prime_connected) e_prime_connected_forward = edge_backward e_prime_connected_backward = edge_connected_forward # if edge_backward.edge_connected: # self.connect_edges(e_prime_connected_forward, edge_backward.edge_connected) # if edge_connected_forward.edge_connected: # self.connect_edges(e_prime_connected_backward, edge_connected_forward.edge_connected) triangle_1 = edge.triangle triangle_2 = edge_connected.triangle for triangle_index in range(len(self.triangles)): if self.triangles[triangle_index] == triangle_1: new_triangle_1 = Triangle(e_prime, e_prime_forward, e_prime_backward) new_triangle_1.index = triangle_1.index self.triangles[triangle_index] = new_triangle_1 for neighbour_index in range(len(self.triangles[triangle_index].neighbours)): if self.triangles[triangle_index].neighbours[neighbour_index] == triangle_1: self.triangles[triangle_index].neighbours[neighbour_index] = self.triangles[triangle_index] for neighbour in triangle_1.neighbours: self.triangles[triangle_index].neighbours.append(neighbour) for triangle_index in range(len(self.triangles)): if self.triangles[triangle_index] == triangle_2: new_triangle_2 = Triangle(e_prime_connected, e_prime_connected_forward, e_prime_connected_backward) new_triangle_2.index = triangle_2.index self.triangles[triangle_index] = new_triangle_2 for neighbour_index in range(len(self.triangles[triangle_index].neighbours)): if self.triangles[triangle_index].neighbours[neighbour_index] == triangle_2: self.triangles[triangle_index].neighbours[neighbour_index] = self.triangles[triangle_index] for neighbour in triangle_2.neighbours: self.triangles[triangle_index].neighbours.append(neighbour) return e_prime def normalise_vertices(self): all_vertices = [] for triangle in self.triangles: for vertex in triangle.vertices: if vertex not in all_vertices: all_vertices.append(vertex) for vertex in all_vertices: vertex.c = [vertex.c[0],vertex.c[1],vertex.c[2],1] #vertex.c_clover = [vertex.c_clover[0], vertex.c_clover[1], vertex.c_clover[2], 1] vertex.c = vertex.c/np.linalg.norm(vertex.c) #vertex.c_clover = vertex.c_clover / np.linalg.norm(vertex.c_clover) vertex.c = np.array(vertex.c[1:])/(1+vertex.c[0]) #vertex.c_clover = np.array(vertex.c_clover[1:])/(1+vertex.c_clover[0]) # def add_vertex(self, triangle, new_vertex): # decoration = triangle.decoration # decoration = np.array([np.transpose(decoration.s0), np.transpose(decoration.s1), np.transpose(decoration.s2)]) # distances = np.linalg.norm(np.repeat([new_vertex],3,axis=0)-decoration,axis=1) # other_vertices = decoration[np.argsort(distances)[:2]] # determinant = np.linalg.det([other_vertices[0],other_vertices[1],new_vertex]) # assert determinant != 0, 'New Vertex does not span a triangle.' # if determinant > 0: # self.add_triangle(triangle,Triangle(Decoration(other_vertices[0],other_vertices[1],new_vertex))) # else: # self.add_triangle(triangle, Triangle(Decoration(other_vertices[0],new_vertex,other_vertices[1])))
nilq/baby-python
python
# -*- coding: utf-8 -*- # Copyright 2019 Cohesity Inc. import cohesity_management_sdk.models.agent_information import cohesity_management_sdk.models.datastore_information import cohesity_management_sdk.models.vmware_object_id import cohesity_management_sdk.models.vmware_tag_attributes import cohesity_management_sdk.models.vcloud_director_info_information import cohesity_management_sdk.models.virtual_disk_information class VmwareProtectionSource(object): """Implementation of the 'VMware Protection Source.' model. Specifies a Protection Source in a VMware environment. Attributes: agent_id (long|int): Specifies the id of the persistent agent. agents (list of AgentInformation): Specifies the list of agent information on the Virtual Machine. This is set only if the Virtual Machine has persistent agent. connection_state (ConnectionStateEnum): Specifies the connection state of the Object and are only valid for ESXi hosts ('kHostSystem') or Virtual Machines ('kVirtualMachine'). These enums are equivalent to the connection states documented in VMware's reference documentation. Examples of Cohesity connection states include 'kConnected', 'kDisconnected', 'kInacccessible', etc. 'kConnected' indicates that server has access to virtual machine. 'kDisconnected' indicates that server is currently disconnected to virtual machine. 'kInacccessible' indicates that one or more configuration files are inacccessible. 'kInvalid' indicates that virtual machine configuration is invalid. 'kOrphaned' indicates that virtual machine is no longer registered on the host it is associated with. 'kNotResponding' indicates that virtual machine is failed to response due to external issues such as network connectivity, hostd not running etc. datastore_info (DatastoreInformation): TODO: type description here. folder_type (FolderTypeEnum): Specifies the folder type for the 'kFolder' Object. 'kVMFolder' indicates folder can hold VMs or vApps. 'kHostFolder' indicates folder can hold hosts and compute resources. 'kDatastoreFolder' indicates folder can hold datastores and storage pods. 'kNetworkFolder' indicates folder can hold networks and switches. 'kRootFolder' indicates folder can hold datacenters. has_persistent_agent (bool): Set to true if a persistent agent is running on the Virtual Machine. This is populated for entities of type 'kVirtualMachine'. host_type (HostType6Enum): Specifies the host type for the 'kVirtualMachine' Object. 'kLinux' indicates the Linux operating system. 'kWindows' indicates the Microsoft Windows operating system. 'kAix' indicates the IBM AIX operating system. 'kSolaris' indicates the Oracle Solaris operating system. id (VmwareObjectId): Specifies a unique Protection Source id across Cohesity Clusters. It is derived from the id of the VMware Protection Source. is_vm_template (bool): IsTemplate specifies if the VM is a template or not. name (string): Specifies a human readable name of the Protection Source. tag_attributes (list of VmwareTagAttributes): Specifies the optional list of VM Tag attributes associated with this Object. tools_running_status (ToolsRunningStatusEnum): Specifies the status of VMware Tools for the guest OS on the VM. This is only valid for the 'kVirtualMachine' type. 'kGuestToolsRunning' means the VMware tools are running on the guest OS. 'kGuestToolsNotRunning' means the VMware tools are not running on the guest OS. 'kUnknown' means the state of the VMware tools on the guest OS is not known. 'kGuestToolsExecutingScripts' means the guest OS is currently executing scripts using VMware tools. mtype (Type19Enum): Specifies the type of managed Object in a VMware Protection Source. Examples of VMware Objects include 'kVCenter', 'kFolder', 'kDatacenter', 'kResourcePool', 'kDatastore', 'kVirtualMachine', etc. 'kVCenter' indicates the vCenter entity in a VMware protection source type. 'kFolder indicates the folder entity (of any kind) in a VMware protection source type. 'kDatacenter' indicates the datacenter entity in a VMware protection source type. 'kComputeResource' indicates the physical compute resource entity in a VMware protection source type. 'kResourcePool' indicates the set of physical resourses within a compute resource or cloudcompute resource. 'kDataStore' indicates the datastore entity in a VMware protection source type. 'kHostSystem' indicates the ESXi host entity in a VMware protection source type. 'kVirtualMachine' indicates the virtual machine entity in a VMware protection source type. 'kVirtualApp' indicates the virtual app entity in a VMware protection source type. 'kStandaloneHost' indicates the standalone ESXi host entity (not managed by vCenter) in a VMware protection source type. 'kStoragePod' indicates the storage pod entity in a VMware protection source type. 'kNetwork' indicates the standard vSwitch in a VMware protection source type. 'kDistributedVirtualPortgroup' indicates a distributed vSwitch port group in a VMware protection source type. 'kTagCategory' indicates a tag category entity in a VMware protection source type. 'kTag' indocates a tag entity in a VMware protection source type. 'kOpaqueNetwork' indicates a opaque network which is created and managed by an entity outside of vSphere. 'kVCloudDirector' indicates a vCloud director entity in a VMware protection source type. 'kOrganization' indicates an Organization under a vCD in a VMware protection source type. 'kVirtualDatacenter' indicates a virtual datacenter entity in a VMware protection source type. 'kCatalog' indocates a VCD catalog entity in a VMware protection source type. 'kOrgMetadata' indicates an VCD organization metadata in a VMware protection source type. 'kStoragePolicy' indicates a storage policy associated with the vApp in a VMware protection source type. vcloud_director_info (list of VcloudDirectorInfoInformation): Specifies an array of vCenters to be registered virtual_disks (list of VirtualDiskInformation): Specifies an array of virtual disks that are part of the Virtual Machine. This is populated for entities of type 'kVirtualMachine'. """ # Create a mapping from Model property names to API property names _names = { "agent_id":'agentId', "agents":'agents', "connection_state":'connectionState', "datastore_info":'datastoreInfo', "folder_type":'folderType', "has_persistent_agent":'hasPersistentAgent', "host_type":'hostType', "id":'id', "is_vm_template":'isVmTemplate', "name":'name', "tag_attributes":'tagAttributes', "tools_running_status":'toolsRunningStatus', "mtype":'type', "vcloud_director_info":'vCloudDirectorInfo', "virtual_disks":'virtualDisks' } def __init__(self, agent_id=None, agents=None, connection_state=None, datastore_info=None, folder_type=None, has_persistent_agent=None, host_type=None, id=None, is_vm_template=None, name=None, tag_attributes=None, tools_running_status=None, mtype=None, vcloud_director_info=None, virtual_disks=None): """Constructor for the VmwareProtectionSource class""" # Initialize members of the class self.agent_id = agent_id self.agents = agents self.connection_state = connection_state self.datastore_info = datastore_info self.folder_type = folder_type self.has_persistent_agent = has_persistent_agent self.host_type = host_type self.id = id self.is_vm_template = is_vm_template self.name = name self.tag_attributes = tag_attributes self.tools_running_status = tools_running_status self.mtype = mtype self.vcloud_director_info = vcloud_director_info self.virtual_disks = virtual_disks @classmethod def from_dictionary(cls, dictionary): """Creates an instance of this model from a dictionary Args: dictionary (dictionary): A dictionary representation of the object as obtained from the deserialization of the server's response. The keys MUST match property names in the API description. Returns: object: An instance of this structure class. """ if dictionary is None: return None # Extract variables from the dictionary agent_id = dictionary.get('agentId') agents = None if dictionary.get('agents') != None: agents = list() for structure in dictionary.get('agents'): agents.append(cohesity_management_sdk.models.agent_information.AgentInformation.from_dictionary(structure)) connection_state = dictionary.get('connectionState') datastore_info = cohesity_management_sdk.models.datastore_information.DatastoreInformation.from_dictionary(dictionary.get('datastoreInfo')) if dictionary.get('datastoreInfo') else None folder_type = dictionary.get('folderType') has_persistent_agent = dictionary.get('hasPersistentAgent') host_type = dictionary.get('hostType') id = cohesity_management_sdk.models.vmware_object_id.VmwareObjectId.from_dictionary(dictionary.get('id')) if dictionary.get('id') else None is_vm_template = dictionary.get('isVmTemplate') name = dictionary.get('name') tag_attributes = None if dictionary.get('tagAttributes') != None: tag_attributes = list() for structure in dictionary.get('tagAttributes'): tag_attributes.append(cohesity_management_sdk.models.vmware_tag_attributes.VmwareTagAttributes.from_dictionary(structure)) tools_running_status = dictionary.get('toolsRunningStatus') mtype = dictionary.get('type') vcloud_director_info = None if dictionary.get('vCloudDirectorInfo') != None: vcloud_director_info = list() for structure in dictionary.get('vCloudDirectorInfo'): vcloud_director_info.append(cohesity_management_sdk.models.vcloud_director_info_information.VcloudDirectorInfoInformation.from_dictionary(structure)) virtual_disks = None if dictionary.get('virtualDisks') != None: virtual_disks = list() for structure in dictionary.get('virtualDisks'): virtual_disks.append(cohesity_management_sdk.models.virtual_disk_information.VirtualDiskInformation.from_dictionary(structure)) # Return an object of this model return cls(agent_id, agents, connection_state, datastore_info, folder_type, has_persistent_agent, host_type, id, is_vm_template, name, tag_attributes, tools_running_status, mtype, vcloud_director_info, virtual_disks)
nilq/baby-python
python
from adv_finance.multiprocess.multiprocess import mp_pandas_obj, process_jobs, process_jobs_
nilq/baby-python
python
import pytest from icevision.all import * @pytest.fixture def coco_bbox_parser(coco_dir): return parsers.COCOBBoxParser(coco_dir / "annotations.json", coco_dir / "images") @pytest.fixture def coco_mask_parser(coco_dir): return parsers.COCOMaskParser(coco_dir / "annotations.json", coco_dir / "images") def test_keypoints_parser(coco_dir, coco_keypoints_parser): records = coco_keypoints_parser.parse(data_splitter=SingleSplitSplitter())[0] assert len(records) == 2 record = records[1] assert record.filepath == coco_dir / "images/000000404249.jpg" assert len(record.detection.keypoints) == 1 assert record.detection.keypoints[0].n_visible_keypoints == 16 assert record.detection.keypoints[0].y.max() == 485 assert len(records[0].detection.keypoints) == 3 def test_bbox_parser(coco_dir, coco_bbox_parser): records = coco_bbox_parser.parse(data_splitter=SingleSplitSplitter())[0] assert len(records) == 5 record = records[0] assert record.record_id == 343934 assert record.filepath == coco_dir / "images/000000343934.jpg" assert record.width == 640 assert record.height == 480 assert len(record.detection.class_map) == 91 assert record.detection.class_map.get_by_id(90) == "toothbrush" assert record.detection.label_ids == [4] assert pytest.approx(record.detection.bboxes[0].xyxy) == ( 175.14, 175.68, 496.2199, 415.68, ) assert record.detection.iscrowds == [0] assert pytest.approx(record.detection.areas) == [43522.805] def test_mask_parser(coco_mask_parser): records = coco_mask_parser.parse(data_splitter=SingleSplitSplitter())[0] assert len(records) == 5 record = records[0] assert len(record.detection.masks) == 1 assert record.detection.masks[0].points == [ [ 457.3, 258.92, 458.38, 276.22, 467.03, 289.19, 473.51, 305.41, 483.24, 334.59, 492.97, 359.46, 496.22, 390.81, 492.97, 415.68, 478.92, 397.3, 472.43, 382.16, 464.86, 361.62, 452.97, 340, 437.84, 334.59, 428.11, 337.84, 415.14, 354.05, 387.03, 373.51, 362.16, 361.62, 339.46, 351.89, 311.35, 348.65, 307.03, 352.97, 301.62, 363.78, 295.14, 373.51, 283.24, 392.97, 274.59, 402.7, 231.35, 409.19, 210.81, 403.78, 190.27, 383.24, 182.7, 367.03, 185.95, 336.76, 197.84, 312.97, 205.41, 306.49, 229.19, 289.19, 254.05, 280.54, 256.22, 258.92, 234.59, 242.7, 220.54, 247.03, 208.65, 258.92, 202.16, 271.89, 180.54, 285.95, 177.3, 287.03, 175.14, 266.49, 178.38, 250.27, 176.22, 236.22, 175.14, 222.16, 188.11, 209.19, 212.97, 212.43, 234.59, 220, 256.22, 223.24, 297.3, 227.57, 318.92, 234.05, 330.81, 235.14, 351.35, 226.49, 360, 218.92, 376.22, 216.76, 398.92, 217.84, 418.38, 213.51, 420.54, 201.62, 419.46, 196.22, 435.68, 183.24, 449.73, 175.68, 468.11, 176.76, 464.86, 192.97, 460.54, 196.22, 458.38, 207.03, 464.86, 221.08, 468.11, 234.05, 469.19, 240.54, 468.11, 243.78, ] ] def test_coco_base_parser_init_from_dict(coco_dir): annotations_dict = json.load(open(coco_dir / "annotations.json")) parser_init_by_dict = parsers.COCOBBoxParser(annotations_dict, coco_dir / "images") assert parser_init_by_dict.annotations_dict == annotations_dict
nilq/baby-python
python
################################################################################ # # Package : AlphaPy # Module : analysis # Created : July 11, 2013 # # Copyright 2017 ScottFree Analytics LLC # Mark Conway & Robert D. Scott II # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ################################################################################ # # Imports # from alphapy.__main__ import main_pipeline from alphapy.frame import load_frames from alphapy.frame import sequence_frame from alphapy.frame import write_frame from alphapy.globals import SSEP, TAG_ID, USEP from alphapy.utilities import subtract_days from datetime import timedelta import logging import pandas as pd from pandas.tseries.offsets import BDay # # Initialize logger # logger = logging.getLogger(__name__) # # Function analysis_name # def analysis_name(gname, target): r"""Get the name of the analysis. Parameters ---------- gname : str Group name. target : str Target of the analysis. Returns ------- name : str Value for the corresponding key. """ name = USEP.join([gname, target]) return name # # Class Analysis # class Analysis(object): """Create a new analysis for a group. All analyses are stored in ``Analysis.analyses``. Duplicate keys are not allowed. Parameters ---------- model : alphapy.Model Model object for the analysis. group : alphapy.Group The group of members in the analysis. Attributes ---------- Analysis.analyses : dict Class variable for storing all known analyses """ analyses = {} # __new__ def __new__(cls, model, group): # set analysis name name = model.specs['directory'].split(SSEP)[-1] target = model.specs['target'] an = analysis_name(name, target) if not an in Analysis.analyses: return super(Analysis, cls).__new__(cls) else: logger.info("Analysis %s already exists", an) # function __init__ def __init__(self, model, group): # set analysis name name = model.specs['directory'].split(SSEP)[-1] target = model.specs['target'] an = analysis_name(name, target) # initialize analysis self.name = an self.model = model self.group = group # add analysis to analyses list Analysis.analyses[an] = self # __str__ def __str__(self): return self.name # # Function run_analysis # def run_analysis(analysis, lag_period, forecast_period, leaders, predict_history, splits=True): r"""Run an analysis for a given model and group. First, the data are loaded for each member of the analysis group. Then, the target value is lagged for the ``forecast_period``, and any ``leaders`` are lagged as well. Each frame is split along the ``predict_date`` from the ``analysis``, and finally the train and test files are generated. Parameters ---------- analysis : alphapy.Analysis The analysis to run. lag_period : int The number of lagged features for the analysis. forecast_period : int The period for forecasting the target of the analysis. leaders : list The features that are contemporaneous with the target. predict_history : int The number of periods required for lookback calculations. splits : bool, optional If ``True``, then the data for each member of the analysis group are in separate files. Returns ------- analysis : alphapy.Analysis The completed analysis. """ # Unpack analysis name = analysis.name model = analysis.model group = analysis.group # Unpack model data predict_file = model.predict_file test_file = model.test_file train_file = model.train_file # Unpack model specifications directory = model.specs['directory'] extension = model.specs['extension'] predict_date = model.specs['predict_date'] predict_mode = model.specs['predict_mode'] separator = model.specs['separator'] target = model.specs['target'] train_date = model.specs['train_date'] # Calculate split date logger.info("Analysis Dates") split_date = subtract_days(predict_date, predict_history) logger.info("Train Date: %s", train_date) logger.info("Split Date: %s", split_date) logger.info("Test Date: %s", predict_date) # Load the data frames data_frames = load_frames(group, directory, extension, separator, splits) # Create dataframes if predict_mode: # create predict frame predict_frame = pd.DataFrame() else: # create train and test frames train_frame = pd.DataFrame() test_frame = pd.DataFrame() # Subset each individual frame and add to the master frame leaders.extend([TAG_ID]) for df in data_frames: try: tag = df[TAG_ID].unique()[0] except: tag = 'Unknown' first_date = df.index[0] last_date = df.index[-1] logger.info("Analyzing %s from %s to %s", tag, first_date, last_date) # sequence leaders, laggards, and target(s) df = sequence_frame(df, target, forecast_period, leaders, lag_period) # get frame subsets if predict_mode: new_predict = df.loc[(df.index >= split_date) & (df.index <= last_date)] if len(new_predict) > 0: predict_frame = predict_frame.append(new_predict) else: logger.info("Prediction frame %s has zero rows. Check prediction date.", tag) else: # split data into train and test new_train = df.loc[(df.index >= train_date) & (df.index < split_date)] if len(new_train) > 0: new_train = new_train.dropna() train_frame = train_frame.append(new_train) new_test = df.loc[(df.index >= split_date) & (df.index <= last_date)] if len(new_test) > 0: # check if target column has NaN values nan_count = df[target].isnull().sum() forecast_check = forecast_period - 1 if nan_count != forecast_check: logger.info("%s has %d records with NaN targets", tag, nan_count) # drop records with NaN values in target column new_test = new_test.dropna(subset=[target]) # append selected records to the test frame test_frame = test_frame.append(new_test) else: logger.info("Testing frame %s has zero rows. Check prediction date.", tag) else: logger.info("Training frame %s has zero rows. Check data source.", tag) # Write out the frames for input into the AlphaPy pipeline directory = SSEP.join([directory, 'input']) if predict_mode: # write out the predict frame write_frame(predict_frame, directory, predict_file, extension, separator, index=True, index_label='date') else: # write out the train and test frames write_frame(train_frame, directory, train_file, extension, separator, index=True, index_label='date') write_frame(test_frame, directory, test_file, extension, separator, index=True, index_label='date') # Run the AlphaPy pipeline analysis.model = main_pipeline(model) # Return the analysis return analysis
nilq/baby-python
python
import asyncio import discord from common import botcolour, botname, db, logo, prefix from discord.ext import commands from modules.utils import getChannel, isAdmin, system_notification class New(commands.Cog): def __init__(self, bot): self.bot = bot @commands.command(name="new", aliases=['create']) async def new(self, ctx): if isAdmin(ctx.message.author, ctx.guild.id): sent_initial_message = await ctx.send("Welcome to the Reaction Light creation program. Please provide the required information once requested. If you would like to abort the creation, do not respond and the program will time out.") rl_object = {} cancelled = False def check(message): return message.author.id == ctx.message.author.id and message.content != "" if cancelled == False: error_messages = [] user_messages = [] sent_reactions_message = await ctx.send( "Attach roles and emojis separated by one space (one combination" " per message). When you are done type `done`. Example:\n:smile:" " `@Role`" ) rl_object["reactions"] = {} try: while True: reactions_message = await self.bot.wait_for('message', timeout=120, check=check) user_messages.append(reactions_message) if reactions_message.content.lower() != "done": reaction = (reactions_message.content.split())[0] try: role = reactions_message.role_mentions[0].id except IndexError: error_messages.append((await ctx.send( "Mention a role after the reaction. Example:\n:smile:" " `@Role`" ))) continue if reaction in rl_object["reactions"]: error_messages.append((await ctx.send( "You have already used that reaction for another role. Please choose another reaction" ))) continue else: try: await reactions_message.add_reaction(reaction) rl_object["reactions"][reaction] = role except discord.HTTPException: error_messages.append((await ctx.send( "You can only use reactions uploaded to servers the bot has" " access to or standard emojis." ))) continue else: break except asyncio.TimeoutError: await ctx.author.send("Reaction Light creation failed, you took too long to provide the requested information.") cancelled = True finally: await sent_reactions_message.delete() for message in error_messages + user_messages: await message.delete() if cancelled == False: sent_oldmessagequestion_message = await ctx.send(f"Would you like to use an existing message or create one using {self.bot.user.mention}? Please react with a 🗨️ to use an existing message or a 🤖 to create one.") def reaction_check(payload): return payload.member.id == ctx.message.author.id and payload.message_id == sent_oldmessagequestion_message.id and (str(payload.emoji) == "🗨️" or str(payload.emoji) == "🤖") try: await sent_oldmessagequestion_message.add_reaction("🗨️") await sent_oldmessagequestion_message.add_reaction("🤖") oldmessagequestion_response_payload = await self.bot.wait_for('raw_reaction_add', timeout=120, check=reaction_check) if str(oldmessagequestion_response_payload.emoji) == "🗨️": rl_object["old_message"] = True else: rl_object["old_message"] = False except asyncio.TimeoutError: await ctx.author.send("Reaction Light creation failed, you took too long to provide the requested information.") cancelled = True finally: await sent_oldmessagequestion_message.delete() if cancelled == False: error_messages = [] user_messages = [] if rl_object["old_message"] == True: sent_oldmessage_message = await ctx.send(f"Which message would you like to use? Please react with a 🔧 on the message you would like to use.") def reaction_check2(payload): return payload.member.id == ctx.message.author.id and payload.guild_id == sent_oldmessage_message.guild.id and str(payload.emoji) == "🔧" try: while True: oldmessage_response_payload = await self.self.bot.wait_for('raw_reaction_add', timeout=120, check=reaction_check2) try: channel = await getChannel(self.bot, oldmessage_response_payload.channel_id) if channel is None: raise discord.NotFound try: message = await channel.fetch_message(oldmessage_response_payload.message_id) except discord.HTTPException: raise discord.NotFound try: await message.add_reaction("👌") await message.remove_reaction("👌", message.guild.me) await message.remove_reaction("🔧", ctx.author) except discord.HTTPException: raise discord.NotFound if db.exists(message.id): raise ValueError rl_object["message"] = dict( message_id=message.id, channel_id=message.channel.id, guild_id=message.guild.id) final_message = message break except discord.NotFound: error_messages.append((await ctx.send("I can not access or add reactions to the requested message. Do I have sufficent permissions?"))) except ValueError: error_messages.append((await ctx.send(f"This message already got a reaction light instance attached to it, consider running `{prefix}edit` instead."))) except asyncio.TimeoutError: await ctx.author.send("Reaction Light creation failed, you took too long to provide the requested information.") cancelled = True finally: await sent_oldmessage_message.delete() for message in error_messages: await message.delete() else: sent_channel_message = await ctx.send("Mention the #channel where to send the auto-role message.") try: while True: channel_message = await self.bot.wait_for('message', timeout=120, check=check) if channel_message.channel_mentions: rl_object["target_channel"] = channel_message.channel_mentions[0] break else: error_messages.append((await message.channel.send("The channel you mentioned is invalid."))) except asyncio.TimeoutError: await ctx.author.send("Reaction Light creation failed, you took too long to provide the requested information.") cancelled = True finally: await sent_channel_message.delete() for message in error_messages: await message.delete() if cancelled == False and 'target_channel' in rl_object: error_messages = [] selector_embed = discord.Embed( title="Embed_title", description="Embed_content", colour=botcolour, ) selector_embed.set_footer(text=f"{botname}", icon_url=logo) sent_message_message = await message.channel.send( "What would you like the message to say?\nFormatting is:" " `Message // Embed_title // Embed_content`.\n\n`Embed_title`" " and `Embed_content` are optional. You can type `none` in any" " of the argument fields above (e.g. `Embed_title`) to make the" " bot ignore it.\n\n\nMessage", embed=selector_embed, ) try: while True: message_message = await self.bot.wait_for('message', timeout=120, check=check) # I would usually end up deleting message_message in the end but users usually want to be able to access the # format they once used incase they want to make any minor changes msg_values = message_message.content.split(" // ") # This whole system could also be re-done using wait_for to make the syntax easier for the user # But it would be a breaking change that would be annoying for thoose who have saved their message commands # for editing. selector_msg_body = ( msg_values[0] if msg_values[0].lower( ) != "none" else None ) selector_embed = discord.Embed(colour=botcolour) selector_embed.set_footer( text=f"{botname}", icon_url=logo) if len(msg_values) > 1: if msg_values[1].lower() != "none": selector_embed.title = msg_values[1] if len(msg_values) > 2 and msg_values[2].lower() != "none": selector_embed.description = msg_values[2] # Prevent sending an empty embed instead of removing it selector_embed = ( selector_embed if selector_embed.title or selector_embed.description else None ) if selector_msg_body or selector_embed: target_channel = rl_object["target_channel"] sent_final_message = None try: sent_final_message = await target_channel.send( content=selector_msg_body, embed=selector_embed ) rl_object["message"] = dict( message_id=sent_final_message.id, channel_id=sent_final_message.channel.id, guild_id=sent_final_message.guild.id) final_message = sent_final_message break except discord.Forbidden: error_messages.append((await message.channel.send( "I don't have permission to send messages to" f" the channel {target_channel.mention}. Please check my permissions and try again." ))) except asyncio.TimeoutError: await ctx.author.send("Reaction Light creation failed, you took too long to provide the requested information.") cancelled = True finally: await sent_message_message.delete() for message in error_messages: await message.delete() if cancelled == False: # Ait we are (almost) all done, now we just need to insert that into the database and add the reactions 💪 try: r = db.add_reaction_role(rl_object) except Exception: await ctx.send(f"The requested message already got a reaction light instance attached to it, consider running `{prefix}edit` instead.") return if isinstance(r, Exception): await system_notification(self.bot, ctx.message.guild.id, f"Database error when creating reaction-light instance:\n```\n{r}\n```", ) return for reaction, _ in rl_object["reactions"].items(): await final_message.add_reaction(reaction) await ctx.message.add_reaction("✅") await sent_initial_message.delete() if cancelled == True: await ctx.message.add_reaction("❌") else: await ctx.send( f"You do not have an admin role. You might want to use `{prefix}admin`" " first." )
nilq/baby-python
python
import math import random import numpy as np import quaternion from scipy import integrate import cv2 from scipy.interpolate import RegularGridInterpolator, NearestNDInterpolator from scipy.interpolate.interpnd import LinearNDInterpolator from visnav.algo.image import ImageProc from visnav.algo import tools class Particles: # TODO: figure out a better way than the following coef (maybe px_sr involved still?) CONE_INTENSITY_COEF = 3e-8 # heuristical coef that scales the jet intensities ( TYPE_HAZE_ONLY, TYPE_CONES, TYPE_VOXELS, ) = range(3) def __init__(self, cam, density, scale, voxels=None, cones=None, haze=0.0): self.cam = cam self.density = density self.scale = scale self.voxels = voxels self.cones = cones self.haze = haze self.type = Particles.TYPE_HAZE_ONLY if cones is not None: self.type = Particles.TYPE_CONES elif voxels is not None: self.type = Particles.TYPE_VOXELS else: assert haze > 0, 'Need to give either cones, voxels, or haze. Not both cones and voxels though.' def flux_density(self, img, dist, mask, lf_ast_v, lf_ast_q, lf_light_v, solar_flux): if self.voxels is not None: voxel_res = self.flux_density_voxels(lf_ast_v, lf_ast_q, mask, solar_flux, down_scaling=10, quad_lim=5) else: voxel_res = np.array([0]) if self.cones is not None: if isinstance(self.cones, dict): n = self.cones.pop('n') self.cones = Cone.random(n, self.cam, img, dist, mask, lf_ast_v, lf_ast_q, **self.cones) cone_res = self.flux_density_cones(lf_ast_v, lf_ast_q, mask, solar_flux, down_scaling=6) else: cone_res = np.array([0]) if self.haze > 0: haze_res = self.flux_density_haze(mask, solar_flux) else: haze_res = np.array([0]) return voxel_res + cone_res + haze_res def _px_ray_axes(self, scaling, dq): # TODO: use dq # construct an array of unit rays, one ray per pixel iK = self.cam.inv_intrinsic_camera_mx() xx, yy = np.meshgrid(np.linspace(self.cam.width, 0, int(self.cam.width * scaling)), np.linspace(0, self.cam.height, int(self.cam.height * scaling)), indexing='xy') img_coords = np.vstack((xx.flatten() + 0.5, yy.flatten() + 0.5, np.ones(xx.size))) ray_axes = iK.dot(img_coords).T * -1 ray_axes /= np.linalg.norm(ray_axes, axis=1).reshape((-1, 1)) return tools.q_times_mx(dq.conj(), ray_axes), xx.shape def flux_density_voxels(self, lf_ast_v, lf_ast_q, mask, solar_flux, down_scaling=1, quad_lim=15): # TODO: implement this someday in OpenGL, e.g. like this: http://www.alexandre-pestana.com/volumetric-lights assert down_scaling >= 1, 'only values of >=1 make sense for down_scaling' dq = lf_ast_q * self.voxels.lf_ast_q.conj() dv = tools.q_times_v(dq.conj(), lf_ast_v - self.voxels.lf_ast_v) ny, nx, nz = self.voxels.voxel_data.shape dx, dy, dz = [self.voxels.cell_size] * 3 gx = np.linspace(-(nx-1) * dx / 2, (nx-1) * dx / 2, nx) gy = np.linspace(-(ny-1) * dy / 2, (ny-1) * dy / 2, ny) gz = np.linspace(-(nz-1) * dz / 2, (nz-1) * dz / 2, nz) interp3d = RegularGridInterpolator((gx, gy, gz), self.voxels.voxel_data, bounds_error=False, fill_value=0.0) #interp3d = NearestNDInterpolator((gx, gy, gz), self.voxels.voxel_data) ray_axes, sc_shape = self._px_ray_axes(1 / down_scaling, dq)# tools.ypr_to_q(0, np.pi, 0) * dq) margin = 0.0 dist = np.linalg.norm(dv) fg_near = dist - nz*dz/2 fg_far = dist - margin/2 bg_near = dist + margin/2 bg_far = dist + nz*dz/2 def quad_fn(interp3d, ray_axes, near, far): points = None #np.linspace(near, far, nx/2) res = integrate.quad_vec(lambda r: interp3d(ray_axes * r - dv), near, far, points=points, limit=quad_lim) return res[0] # integrate density along the rays (quad_vec requires at least scipy 1.4.x) res = quad_fn(interp3d, ray_axes, bg_near, bg_far) bg_res = cv2.resize(res.reshape(sc_shape).astype(np.float32), mask.shape) bg_res[mask] = 0 # integrate density along the rays (quad_vec requires at least scipy 1.4.x) res = quad_fn(interp3d, ray_axes, fg_near, fg_far) fg_res = cv2.resize(res.reshape(sc_shape).astype(np.float32), mask.shape) result = ((0 if bg_res is None else bg_res) + (0 if fg_res is None else fg_res)) \ * Particles.CONE_INTENSITY_COEF * solar_flux * self.voxels.intensity return result def flux_density_cones(self, lf_ast_v, lf_ast_q, mask, solar_flux, down_scaling=1, quad_lim=25): """ - The jet generated is a truncated cone that has a density proportional to (truncation_distance/distance_from_untruncated_origin)**2 - Truncation so that base width is 0.1 of mask diameter - base_loc gives the coordinates of the base in camera frame (opengl type, -z camera axis, +y is up) - 95% of luminosity lost when distance from base is `length` - angular_radius [rad] of the cone, 95% of luminosity lost if this much off axis, uses normal distribution - intensity of the cone at truncation point (>0) - if phase_angle < pi/2, cone not drawn on top of masked parts of image as it starts behind object - direction: 0 - to the right, pi/2 - up, pi - left, -pi/2 - down """ assert down_scaling >= 1, 'only values of >=1 make sense for down_scaling' scaling = 1 / down_scaling base_locs = [c.base_loc for c in self.cones] phase_angles = [c.phase_angle for c in self.cones] directions =[c.direction for c in self.cones] trunc_lens = [c.trunc_len for c in self.cones] angular_radii = [c.angular_radius for c in self.cones] intensities = [c.intensity for c in self.cones] axes = [] for i in range(len(self.cones)): # q = np.quaternion(math.cos(-direction / 2), 0, 0, math.sin(-direction / 2)) \ # * np.quaternion(math.cos(phase_angle / 2), 0, math.sin(phase_angle / 2), 0) q1 = np.quaternion(math.cos(-phase_angles[i] / 2), 0, math.sin(-phase_angles[i] / 2), 0) q2 = np.quaternion(math.cos(directions[i] / 2), 0, 0, math.sin(directions[i] / 2)) q = q2 * q1 axis = tools.q_times_v(q, np.array([0, 0, -1])) axes.append(axis) base_locs[i] -= axis * trunc_lens[i] # density function of the jet def density(loc_arr, base_loc, axis, d0, angular_radius, intensity): loc_arr = loc_arr - base_loc r, d = tools.dist_across_and_along_vect(loc_arr, axis) # r, d = tools.point_vector_dist(loc_arr, axis, dist_along_v=True) # get distance along axis coef = np.zeros((len(loc_arr), 1)) coef[d > d0] = (d0 / d[d > d0]) ** 2 # get radial distance from axis, use normal dist pdf but scaled so that max val is 1 r_sd = d[coef > 0] * np.tan(angular_radius) coef[coef > 0] *= np.exp((-0.5 / r_sd ** 2) * (r[coef > 0] ** 2)) return coef * intensity dq = lf_ast_q * self.cones.lf_ast_q.conj() dv = tools.q_times_v(dq.conj(), lf_ast_v - self.cones.lf_ast_v) ray_axes, sc_shape = self._px_ray_axes(scaling, dq) def i_fun(r, arg_arr): result = None for args in arg_arr: res = density(ray_axes * r - dv, *args) if result is None: result = res else: result += res return result bg_args_arr, bg_near, bg_far = [], np.inf, -np.inf fg_args_arr, fg_near, fg_far = [], np.inf, -np.inf for args in zip(base_locs, axes, trunc_lens, angular_radii, intensities): base_loc, axis, trunc_len, angular_radius, intensity = args dist = np.linalg.norm(base_loc) if axis[2] < 0: # z-component of axis is negative => jet goes away from cam => starts behind object bg_args_arr.append(args) bg_near = min(bg_near, dist - trunc_len) bg_far = max(bg_far, 2 * dist) # crude heuristic, is it enough? else: # jet goes towards cam fg_args_arr.append(args) fg_near = min(fg_near, 0) fg_far = max(fg_far, dist + trunc_len) bg_res, fg_res = None, None if bg_args_arr: # integrate density along the rays (quad_vec requires at least scipy 1.4.x) res = integrate.quad_vec(lambda r: i_fun(r, bg_args_arr), bg_near, bg_far, limit=quad_lim) # bg_sc = np.max(res[0])/maxval bg_res = cv2.resize(res[0].reshape(sc_shape).astype(np.float32), mask.shape) # bg_res = cv2.resize((res[0]/bg_sc).reshape(xx.shape).astype(img.dtype), img.shape).astype(np.float32)*bg_sc bg_res[mask] = 0 if fg_args_arr: # integrate density along the rays (quad_vec requires at least scipy 1.4.x) res = integrate.quad_vec(lambda r: i_fun(r, fg_args_arr), fg_near, fg_far, limit=quad_lim) # fg_sc = np.max(res[0])/maxval fg_res = cv2.resize(res[0].reshape(sc_shape).astype(np.float32), mask.shape) # fg_res = cv2.resize((res[0]/fg_sc).reshape(xx.shape).astype(img.dtype), img.shape).astype(np.float32)*fg_sc result = ((0 if bg_res is None else bg_res) + (0 if fg_res is None else fg_res)) \ * Particles.CONE_INTENSITY_COEF * solar_flux # max_r = np.max(result) # if max_r > 0: # maxval = ImageProc._img_max_valid(img) # result = (result / max_r) * maxval * np.max(intensities) return result def flux_density_haze(self, mask, solar_flux): result = np.ones(mask.shape, dtype=np.float32) \ * Particles.CONE_INTENSITY_COEF * solar_flux * self.haze * 0.5 if mask is not None: result[np.logical_not(mask)] *= 2 else: result *= 2 return result class VoxelParticles: def __init__(self, voxel_data, cell_size, intensity, lf_ast_v=np.zeros((3,)), lf_ast_q=quaternion.one): self.voxel_data = voxel_data self.cell_size = cell_size self.intensity = intensity self.lf_ast_v = lf_ast_v self.lf_ast_q = lf_ast_q class Cone: def __init__(self, base_loc, trunc_len, phase_angle, direction, intensity, angular_radius, lf_ast_v, lf_ast_q): self.base_loc = base_loc self.trunc_len = trunc_len self.phase_angle = phase_angle self.direction = direction self.intensity = intensity self.angular_radius = angular_radius self.lf_ast_v = lf_ast_v self.lf_ast_q = lf_ast_q @staticmethod def random(n, cam, img, dist, mask, lf_ast_v, lf_ast_q, jet_int_mode, jet_int_conc, trunc_len_m, trunc_len_sd=0.2, ang_rad_m=np.pi/30, ang_rad_sd=0.3): fg_yx = np.vstack(np.where(np.logical_and(mask, img > np.max(img)*0.2))).T bg_yx = np.vstack(np.where(mask)).T cones = [] for i in range(n): phase_angle = np.random.uniform(0, np.pi) if phase_angle < np.pi / 2 and len(bg_yx) > 0: yi, xi = random.choice(bg_yx) elif len(fg_yx) > 0: yi, xi = random.choice(fg_yx) else: continue z = -dist[yi, xi] x, y = cam.calc_xy(xi, yi, z) base_loc = np.array((x, y, z)) alpha = jet_int_mode * (jet_int_conc - 2) + 1 beta = (1 - jet_int_mode) * (jet_int_conc - 2) + 1 intensity = np.random.beta(alpha, beta) direction = np.random.uniform(-np.pi, np.pi) trunc_len = 1e-3 * trunc_len_m * np.random.lognormal(0, trunc_len_sd) angular_radius = ang_rad_m * np.random.lognormal(0, ang_rad_sd) cones.append(Cone(base_loc, trunc_len, phase_angle, direction, intensity, angular_radius, lf_ast_v, lf_ast_q)) return cones
nilq/baby-python
python
import os import pickle import json import numpy as np from sklearn.externals import joblib from sklearn.linear_model import Ridge from inference_schema.schema_decorators import input_schema, output_schema from inference_schema.parameter_types.numpy_parameter_type import NumpyParameterType def init(): global model # AZUREML_MODEL_DIR is an environment variable created during deployment. # It is the path to the model folder (./azureml-models/$MODEL_NAME/$VERSION) # For multiple models, it points to the folder containing all deployed models (./azureml-models) model_path = os.path.join(os.getenv('AZUREML_MODEL_DIR'), 'sklearn_regression_model.pkl') # deserialize the model file back into a sklearn model model = joblib.load(model_path) input_sample = np.array([[10, 9, 8, 7, 6, 5, 4, 3, 2, 1]]) output_sample = np.array([3726.995]) @input_schema('data', NumpyParameterType(input_sample)) @output_schema(NumpyParameterType(output_sample)) def run(data): try: result = model.predict(data) # you can return any datatype as long as it is JSON-serializable return result.tolist() except Exception as e: error = str(e) return error
nilq/baby-python
python
import SimpleHTTPServer import SocketServer import sys import time class MyHandler(SimpleHTTPServer.SimpleHTTPRequestHandler): def handle_one_request(self): time.sleep(0.1) return SimpleHTTPServer.SimpleHTTPRequestHandler.handle_one_request(self) print("Serving local directory") httpd = SocketServer.TCPServer(("", 8080), MyHandler) while True: httpd.handle_request()
nilq/baby-python
python
""" Support to interface with LGE ThinQ Devices. """ __version__ = "0.23.0" PROJECT_URL = "https://github.com/ollo69/ha-smartthinq-sensors/" ISSUE_URL = "{}issues".format(PROJECT_URL) DOMAIN = "smartthinq_sensors" MIN_HA_MAJ_VER = 2022 MIN_HA_MIN_VER = 5 __min_ha_version__ = f"{MIN_HA_MAJ_VER}.{MIN_HA_MIN_VER}.0" CONF_LANGUAGE = "language" CONF_OAUTH_URL = "outh_url" CONF_USE_API_V2 = "use_api_v2" CLIENT = "client" LGE_DEVICES = "lge_devices" DEFAULT_ICON = "def_icon" DEFAULT_SENSOR = "default" STARTUP = """ ------------------------------------------------------------------- {} Version: {} This is a custom component If you have any issues with this you need to open an issue here: {} ------------------------------------------------------------------- """.format( DOMAIN, __version__, ISSUE_URL )
nilq/baby-python
python
# coding: utf-8 from sqlalchemy import CHAR, Column, Date, Float, ForeignKey, Integer, LargeBinary, SmallInteger, String, Table, Text, text from sqlalchemy.orm import relationship from sqlalchemy.ext.declarative import declarative_base Base = declarative_base() metadata = Base.metadata class Category(Base): __tablename__ = 'categories' CategoryID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('categories_categoryid_seq'::regclass)")) CategoryName = Column(String(15), nullable=False) Description = Column(Text) Picture = Column(LargeBinary) class Customercustomerdemo(Base): __tablename__ = 'customercustomerdemo' CustomerID = Column(CHAR(6), primary_key=True, nullable=False) CustomerTypeID = Column(CHAR(6), primary_key=True, nullable=False) class Customerdemographic(Base): __tablename__ = 'customerdemographics' CustomerTypeID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('customerdemographics_customertypeid_seq'::regclass)")) CustomerDesc = Column(Text) class Customer(Base): __tablename__ = 'customers' CustomerID = Column(CHAR(6), primary_key=True) CompanyName = Column(String(40), nullable=False) ContactName = Column(String(30)) ContactTitle = Column(String(30)) Address = Column(String(60)) City = Column(String(15)) Region = Column(String(15)) PostalCode = Column(String(10)) Country = Column(String(15)) Phone = Column(String(24)) Fax = Column(String(24)) class Employee(Base): __tablename__ = 'employees' EmployeeID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('employees_employeeid_seq'::regclass)")) LastName = Column(String(20), nullable=False) FirstName = Column(String(10), nullable=False) Title = Column(String(30)) TitleOfCourtesy = Column(String(25)) BirthDate = Column(Date) HireDate = Column(Date) Address = Column(String(60)) City = Column(String(15)) Region = Column(String(15)) PostalCode = Column(String(10)) Country = Column(String(15)) HomePhone = Column(String(24)) Extension = Column(String(4)) Photo = Column(LargeBinary) Notes = Column(Text) ReportsTo = Column(SmallInteger) PhotoPath = Column(String(255)) class Employeeterritory(Base): __tablename__ = 'employeeterritories' EmployeeID = Column(SmallInteger, primary_key=True, nullable=False) TerritoryID = Column(Integer, primary_key=True, nullable=False) class OrderDetail(Base): __tablename__ = 'order_details' OrderID = Column(SmallInteger, primary_key=True, nullable=False) ProductID = Column(SmallInteger, primary_key=True, nullable=False) UnitPrice = Column(Float, nullable=False) Quantity = Column(SmallInteger, nullable=False) Discount = Column(Float, nullable=False) class Region(Base): __tablename__ = 'region' RegionID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('region_regionid_seq'::regclass)")) RegionDescription = Column(CHAR(8), nullable=False) class Shipper(Base): __tablename__ = 'shippers' ShipperID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('shippers_shipperid_seq'::regclass)")) CompanyName = Column(String(40), nullable=False) Phone = Column(String(24)) class ShippersTmp(Base): __tablename__ = 'shippers_tmp' ShipperID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('shippers_tmp_shipperid_seq'::regclass)")) CompanyName = Column(String(40), nullable=False) Phone = Column(String(24)) class Supplier(Base): __tablename__ = 'suppliers' SupplierID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('suppliers_supplierid_seq'::regclass)")) CompanyName = Column(String(40), nullable=False) ContactName = Column(String(30)) ContactTitle = Column(String(30)) Address = Column(String(60)) City = Column(String(15)) Region = Column(String(15)) PostalCode = Column(String(10)) Country = Column(String(15)) Phone = Column(String(24)) Fax = Column(String(24)) HomePage = Column(Text) class Territory(Base): __tablename__ = 'territories' TerritoryID = Column(Integer, primary_key=True, server_default=text( "nextval('territories_territoryid_seq'::regclass)")) TerritoryDescription = Column(CHAR(64), nullable=False) RegionID = Column(SmallInteger, nullable=False) t_usstates = Table( 'usstates', metadata, Column('StateID', SmallInteger, nullable=False, server_default=text( "nextval('usstates_stateid_seq'::regclass)")), Column('StateName', String(100)), Column('StateAbbr', String(2)), Column('StateRegion', String(50)) ) class Order(Base): __tablename__ = 'orders' OrderID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('orders_orderid_seq'::regclass)")) CustomerID = Column(ForeignKey('customers.CustomerID')) EmployeeID = Column(ForeignKey('employees.EmployeeID')) OrderDate = Column(Date) RequiredDate = Column(Date) ShippedDate = Column(Date) ShipVia = Column(ForeignKey('shippers.ShipperID')) Freight = Column(Float) ShipName = Column(String(40)) ShipAddress = Column(String(60)) ShipCity = Column(String(15)) ShipRegion = Column(String(15)) ShipPostalCode = Column(String(10)) ShipCountry = Column(String(15)) customer = relationship('Customer') employee = relationship('Employee') shipper = relationship('Shipper') class Product(Base): __tablename__ = 'products' ProductID = Column(SmallInteger, primary_key=True, server_default=text( "nextval('products_productid_seq'::regclass)")) ProductName = Column(String(40), nullable=False) SupplierID = Column(ForeignKey( 'suppliers.SupplierID', ondelete='SET NULL'), nullable=True) CategoryID = Column(ForeignKey('categories.CategoryID')) QuantityPerUnit = Column(String(20)) UnitPrice = Column(Float) UnitsInStock = Column(SmallInteger) UnitsOnOrder = Column(SmallInteger) ReorderLevel = Column(SmallInteger) Discontinued = Column(Integer, nullable=False) category = relationship('Category') supplier = relationship('Supplier')
nilq/baby-python
python
from art import logo, vs from data import data import random print(logo) my_score = 0 missed = True while missed: random_data1 = random.choice(data) score_1 = random_data1["follower_count"] random_data2 = random.choice(data) score_2 = random_data2["follower_count"] print(f"Compare A: {random_data1['name']}, {random_data1['description']}, from {random_data1['country']}" ) print(vs) print(f"Compare B: {random_data2['name']}, {random_data2['description']}, from {random_data2['country']}" ) print(score_1,score_2) answer = input("Who has more followers 'A' or 'B': ").lower() if answer == "a" and score_1 > score_2: my_score += 1 print("\n Yes! \n \n") elif answer == "a" and score_1 < score_2: print(f"No! You lost! Your score is {my_score}") missed = False elif answer == "b" and score_1 < score_2: my_score += 1 print("\n Yes! \n \n") elif answer == "b" and score_1 > score_2: print(f"No! You lost! Your score is {my_score}") missed = False
nilq/baby-python
python
from typing import List, Optional from aws_cdk.aws_lambda import Runtime from aws_cdk.core import Stack from b_cfn_lambda_layer.lambda_layer import LambdaLayer class OpensearchIndexLayer(LambdaLayer): def __init__( self, scope: Stack, name: str ) -> None: super().__init__( scope=scope, name=name, source_path=self.source_path(), code_runtimes=self.runtimes() ) @staticmethod def source_path() -> str: from . import root return root @staticmethod def runtimes() -> Optional[List[Runtime]]: return [Runtime.PYTHON_3_8]
nilq/baby-python
python
import no_pda_exceptions as e class NOPDA(object): def __init__(self, rules, input_alphabet, states, initial_states, terminate_states): self.rules = rules self.input_alphabet = input_alphabet self.states = states self.current_state = initial_states self.terminate_states = terminate_states self.crash = False def _crash(self): self.crash = True def input(self, symbol): if self.crash: raise e.NOPDACrashException( "Error by input. PDA is crashed!") new_states = {} for state in self.states: try: ''' TODO Need add checkers for UnknowSymbols Exception ''' new_states.extend(self.rules[self.state][symbol]) except Exception as e: pass if not new_states: self._crash() else: self.current_state = new_states def in_terminate_state(self): self.current_states & self.terminate_states ''' input_alphabet = {'a', 'b', 'c'} states = {'s1', 's2', 's3'} rules = {'s1': {'a': ['s1'], 'b': ['s2'], 'c': ['s3']}, 's2': {'a': ['s2'], 'b': ['s2'], 'c': ['s3', 's1']}, 's3': {'a': ['s2'], 'b': ['s1'], 'c': ['s3']}} '''
nilq/baby-python
python
# Generated by Django 3.1.13 on 2022-05-28 00:03 from django.db import migrations, models import uuid class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Course', fields=[ ('id', models.UUIDField(default=uuid.uuid4, editable=False, help_text='Unique Record Identifier', primary_key=True, serialize=False)), ('created_at', models.DateTimeField(auto_now_add=True)), ('updated_at', models.DateTimeField(auto_now=True)), ('name', models.CharField(max_length=50)), ('code', models.CharField(max_length=10, unique=True)), ('credits', models.PositiveSmallIntegerField(default=1)), ], options={ 'abstract': False, }, ), ]
nilq/baby-python
python
# -*- coding: utf-8 -*- """ Created on Tue Apr 21 16:29:21 2020 @author: willi """ import re try: from snapgene_reader import snapgene_file_to_dict, snapgene_file_to_seqrecord except: pass try: from Bio import SeqIO from Bio import Entrez except: pass import os class FileParser(): ''' Class to parse incoming files ''' def __init__(self): self.file = None self.letter_dict = ['a','c','u','g'] self.sub_dict = {'m':'a','w':'a','r':'g','y':'t','k':'g','s':'g','w':'a','h':'a','n':'a'} self.test_seq = 'aucuguacguacguaucgaucguguacuggcaaaacguaguagcugagcaucaucuaug' pass def clean_seq(self,seq): ''' clean the sequences to lowercase only a, u, g, c ''' seq = seq.lower() for key in self.sub_dict.keys(): seq = seq.replace(key,self.sub_dict[key]) seq = seq.replace('t','u') return seq def get_sequence(self,file): ''' Return the sequence from several different file types Supported: .txt, .dna, .gb, .fasta ''' self.__check_valid_file(file) extension = file.split('.')[-1] if extension == 'dna': try: seq_record = snapgene_file_to_seqrecord(file) except: print('To read .dna files please install snapegenereader: pip install snapgene_reader - https://github.com/IsaacLuo/SnapGeneFileReader' ) sequence_str = str(seq_record.seq) if extension == 'txt': sequence_str = self.__get_seq_from_txt(file) if extension == 'gb': gb_record = SeqIO.read(open(file, "r"), "genbank") sequence_str = str(gb_record.seq) if extension == 'fasta': fastas = list(SeqIO.parse(file,'fasta')) if len(fastas) > 1: return 'Multiple line fastas not supported' else: sequence_str = (str(fastas[0].seq)) cleaned_sequence_str = self.clean_seq(sequence_str) return cleaned_sequence_str def __check_valid_file(self,file): extension = file.split('.')[-1] if extension in ['fasta','gb','txt','dna']: return True else: raise Exception("Unrecognized File type, the sequence file must be a .txt, .dna, .gb, or .fasta") def get_name(self,file): self.__check_valid_file(file) name = 'unknown' extension = file.split('.')[-1] if extension == 'fasta': fastas = list(SeqIO.parse(file,'fasta')) if len(fastas) > 1: return 'Multiple line fastas not supported' else: name = (str(fastas[0].id)) if extension == 'gb': gb_record = SeqIO.read(open(file, "r"), "genbank") name = str(gb_record.id) if extension == 'txt': name = self.__get_name_from_text(file) if extension == 'dna': try: seq_record = snapgene_file_to_seqrecord(file) except: print('To read .dna files please install snapegenereader: pip install snapgene_reader - https://github.com/IsaacLuo/SnapGeneFileReader' ) name = seq_record.name return name def get_description(self,file): self.__check_valid_file(file) extension = file.split('.')[-1] if extension == 'fasta': fastas = list(SeqIO.parse(file,'fasta')) if len(fastas) > 1: return 'Multiple line fastas not supported' else: desc = str(fastas[0].description) if extension == 'gb': gb_record = SeqIO.read(open(file, "r"), "genbank") desc = str(gb_record.description) if extension == 'dna': try: seq_record = snapgene_file_to_seqrecord(file) except: print('To read .dna files please install snapegenereader: pip install snapgene_reader - https://github.com/IsaacLuo/SnapGeneFileReader' ) desc = seq_record.description if extension == 'txt': desc = '<unknown description>' return desc @classmethod def __get_seq_from_txt(cls,file): with open(file) as f: raw = f.readlines() raw = ''.join(raw) onlychar = re.split(r'[^A-Za-z]', raw) validt = ['A', 'G', 'T', 'C'] validu = ['A', 'G', 'U', 'C'] sequence_str = '' for i in range(len(onlychar)): section = onlychar[i] if set(section.upper()) == set(validt): sequence_str += section.upper() elif set(section.upper()) == set(validu): sequence_str += section.upper() return sequence_str @classmethod def __get_name_from_text(cls,file): name = '' with open(file) as f: raw = f.readlines() raw = ''.join(raw) validt = ['A', 'G', 'T', 'C'] validu = ['A', 'G', 'U', 'C'] onlychar = re.split(r'[^A-Za-z]', raw) namelen = 0 for i in range(len(onlychar)): section = onlychar[i] if set(section.upper()) != set(validt): if set(section.upper()) != set(validu): if len(section)>namelen: name = section namelen = len(section) if name =='': name = os.path.basename(file)[:-4] return name
nilq/baby-python
python
#!/usr/bin/python3.8 import time from flask import render_template, flash, redirect, url_for, request from flask_login import login_user, current_user, logout_user, login_required from werkzeug.utils import secure_filename from webapp import app, config, db, db_manager, bcrypt from webapp.models import User from webapp.forms import RegisterUser, Login, RequestResetForm, ResetPasswordForm, InviteUser, TableViewSelect, TableSearch, AddVehicleForm, AddCheckinForm, AddExpenseForm from webapp.user_functions import send_reset_email, send_admin_invite from webapp.prepare_functions import prep_expense_summary ### User Function Web Routes ### @app.route('/register_user', methods = ['GET', 'POST']) @login_required def register_user(): form = RegisterUser() if form.validate_on_submit(): hashed_password = bcrypt.generate_password_hash(form.password.data).decode('utf-8') user = {"first": form.first_name.data, "middle": form.middle_name.data, "last": form.last_name.data, "email": form.email.data, "password": hashed_password} if db_manager.add_user(**user): return redirect(url_for('home')) return render_template('register_user.html', title = 'Register User', form = form) @app.route('/login', methods = ['GET', 'POST']) def login(): if current_user.is_authenticated: return redirect(url_for('home')) form = Login() if form.validate_on_submit(): user = User.query.filter_by(email = form.email.data).first() if user and bcrypt.check_password_hash(user.password, form.password.data): login_user(user, remember = form.remember.data) return redirect(url_for('home')) flash('Login Unsuccessful. Please check email and password.') return render_template('login.html', title = 'Login', form = form) @app.route('/logout') def logout(): logout_user() return redirect(url_for('home')) @app.route('/manage_users', methods = ['GET', 'POST']) @login_required def manage_users(): table_cols = ["first", "middle", "last", "email", "admin"] table_rows = None invite_form = InviteUser() search_form = TableSearch() if request.method == 'POST': if request.form.get('submit') == 'Send Invite': if current_user.admin >= 2: email = request.form.get('email') send_admin_invite('name', email) if db_manager.add_admin_invite(email): flash(f'Admin invite sent to {email}', "success") else: flash('Insufficient Privileges') elif request.form.get('submit') == 'Search': key = request.form.get('criteria') value = request.form.get('value') kwarg = {key: value} print('Applying search term', kwarg) table_rows = [i.get_row() for i in User.query.filter_by(**kwarg).all() if i.level] if not table_rows: flash("Your search didn't return any results.") if table_rows == None: table_rows = db_manager.get_users() return render_template('admin_users.html', title = 'Manage Admin Users', invite_form = invite_form, search_form = search_form, table_cols = table_cols, table_rows = table_rows, enumerate = enumerate) @app.route('/reset_password', methods = ['GET', 'POST']) def reset_request(): form = RequestResetForm() if form.validate_on_submit(): user = User.query.filter_by(email = form.email.data).first() send_reset_email(user) flash('An email has been sent with instructions to reset your password', 'info') return redirect(url_for('login')) return render_template('reset_request.html', title = 'Reset Password', form = form) @app.route('/reset_password/reset_password/<token>', methods = ['GET', 'POST']) def reset_token(token): user = User.verify_reset_token(token) if not user: flash('That is an invalid or expired token', 'warning') return redirect(url_for('reset_request')) form = ResetPasswordForm() if form.validate_on_submit(): hashed_password = bcrypt.generate_password_hash(form.password.data).decode('utf-8') user.password = hashed_password db.session.commit() flash('Your password has been updated! You can now log in', 'success') return redirect(url_for('login')) return render_template('reset_token.html', title = 'Reset Password', form = form) ### Main App Web Routes ### @app.route('/') @login_required def home(): user_id = current_user.get_id() user = db_manager.get_user(**{"id": user_id}) reminders = [] expense_summary = prep_expense_summary(user_id, "2021") print(expense_summary) vehicles = db_manager.get_user_vehicles(**{"user_id": user_id}) return render_template('home.html', user = user, reminders = reminders, expenses = expense_summary, vehicles = vehicles) @app.route('/add_vehicle', methods = ['GET', 'POST']) @login_required def add_vehicle(): uid = {"id": current_user.get_id()} user = db_manager.get_user(**uid) form = AddVehicleForm() if form.validate_on_submit(): vehicle = {"user_id": uid["id"], "year": form.year.data, "make": form.make.data, "model": form.model.data, "trim": form.trim.data, "color": form.color.data} if db_manager.add_vehicle(**vehicle): flash(f"You added a {vehicle['year']} {vehicle['make']} {vehicle['model']} to your garage!", "success") return redirect(url_for("home")) return render_template('add_vehicle.html', user = user, form = form) @app.route('/add_checkin/<vehicle_id>', methods = ['GET', 'POST']) @login_required def add_checkin(vehicle_id): user = db_manager.get_user(**{"id": current_user.get_id()}) form = AddCheckinForm() # vehicle = db_manager.get_vehicle(public_id = vehicle_id) if form.validate_on_submit(): checkin = {"vehicle_id": vehicle_id, "odometer": form.odometer.data} checkin_id, vehicle = db_manager.add_checkin(**checkin) checkin_type = form.checkin_type.data if checkin_type == "shift start": db_manager.start_shift_miles(db_manager.get_user_id(user["id"]), checkin_id) elif checkin_type == "shift end": if db_manager.complete_shift_miles(checkin_id): flash(f"You completed shift miles!", "success") flash(f"You added an odometer checkin for your {vehicle['year']} {vehicle['make']} {vehicle['model']}!", "success") return redirect(url_for("home")) return render_template('add_checkin.html', user = user, form = form) @app.route('/add_expense/<vehicle_id>', methods = ['GET', 'POST']) @login_required def add_expense(vehicle_id): user = db_manager.get_user(**{"id": current_user.get_id()}) form = AddExpenseForm() if form.validate_on_submit(): if form.odometer.data: checkin = {"odometer": form.odometer.data, "vehicle_id": vehicle_id} checkin_id, vehicle = db_manager.add_checkin(**checkin) else: checkin_id = None expense = {"vehicle_id": vehicle["id"], "expense_type": form.expense_type.data, "recur_interval": form.interval.data, "notes": form.notes.data, "odometer_id": checkin_id} if db_manager.add_expense(**expense): if expense["recur_interval"] == "none": message = f"You added a one-time {expense['expense_type']} expense!" else: message = f"You added a(n) {expense['expense_type']} expense that recurs every {expense['recur_interval']}!" flash(message, "success") return redirect(url_for("home")) return render_template('add_expense.html', user = user, form = form)
nilq/baby-python
python
import numpy as np from config import Config def compute_challenge_metric_custom(res,lbls,normalize=True): normal_class = '426783006' normal_index=Config.HASH_TABLE[0][normal_class] lbls=lbls>0 res=res>0 weights = Config.loaded_weigths observed_score=np.sum(weights*get_confusion(lbls,res)) if normalize == False: return observed_score correct_score=np.sum(weights*get_confusion(lbls,lbls)) inactive_outputs = np.zeros_like(lbls) inactive_outputs[:, normal_index] = 1 inactive_score=np.sum(weights*get_confusion(lbls,inactive_outputs)) normalized_score = float(observed_score - inactive_score) / float(correct_score - inactive_score) return normalized_score def get_confusion(lbls,res): normalizer=np.sum(lbls|res,axis=1) normalizer[normalizer<1]=1 A=lbls.astype(np.float32).T@(res.astype(np.float32)/normalizer.reshape(normalizer.shape[0],1)) # num_sigs,num_classes=lbls.shape # A=np.zeros((num_classes,num_classes)) # for sig_num in range(num_sigs): # A=A+lbls[[sig_num], :].T@res[[sig_num], :]/normalizer[sig_num] # B=np.zeros((num_classes,num_classes)) # for sig_num in range(num_sigs): # for j in range(num_classes): # # Assign full and/or partial credit for each positive class. # if lbls[sig_num, j]: # for k in range(num_classes): # if res[sig_num, k]: # B[j, k] += 1.0/normalizer[sig_num] # if np.sum(A!=B)>0: # fsfdsf=fsdfsdf return A
nilq/baby-python
python
# Copyright (c) 2015, Frappe Technologies Pvt. Ltd. and Contributors # MIT License. See license.txt import copy import frappe import frappe.share from frappe import _, msgprint from frappe.utils import cint rights = ("select", "read", "write", "create", "delete", "submit", "cancel", "amend", "print", "email", "report", "import", "export", "set_user_permissions", "share") def check_admin_or_system_manager(user=None): if not user: user = frappe.session.user if ("System Manager" not in frappe.get_roles(user)) and (user!="Administrator"): frappe.throw(_("Not permitted"), frappe.PermissionError) def print_has_permission_check_logs(func): def inner(*args, **kwargs): frappe.flags['has_permission_check_logs'] = [] result = func(*args, **kwargs) self_perm_check = True if not kwargs.get('user') else kwargs.get('user') == frappe.session.user raise_exception = False if kwargs.get('raise_exception') == False else True # print only if access denied # and if user is checking his own permission if not result and self_perm_check and raise_exception: msgprint(('<br>').join(frappe.flags.get('has_permission_check_logs', []))) frappe.flags.pop('has_permission_check_logs', None) return result return inner @print_has_permission_check_logs def has_permission(doctype, ptype="read", doc=None, verbose=False, user=None, raise_exception=True): """Returns True if user has permission `ptype` for given `doctype`. If `doc` is passed, it also checks user, share and owner permissions. Note: if Table DocType is passed, it always returns True. """ if not user: user = frappe.session.user if not doc and hasattr(doctype, 'doctype'): # first argument can be doc or doctype doc = doctype doctype = doc.doctype if frappe.is_table(doctype): return True if user=="Administrator": return True meta = frappe.get_meta(doctype) if doc: if isinstance(doc, str): doc = frappe.get_doc(meta.name, doc) perm = get_doc_permissions(doc, user=user, ptype=ptype).get(ptype) if not perm: push_perm_check_log(_('User {0} does not have access to this document').format(frappe.bold(user))) else: if ptype=="submit" and not cint(meta.is_submittable): push_perm_check_log(_("Document Type is not submittable")) return False if ptype=="import" and not cint(meta.allow_import): push_perm_check_log(_("Document Type is not importable")) return False role_permissions = get_role_permissions(meta, user=user) perm = role_permissions.get(ptype) if not perm: push_perm_check_log(_('User {0} does not have doctype access via role permission for document {1}').format(frappe.bold(user), frappe.bold(doctype))) def false_if_not_shared(): if ptype in ("read", "write", "share", "submit", "email", "print"): shared = frappe.share.get_shared(doctype, user, ["read" if ptype in ("email", "print") else ptype]) if doc: doc_name = get_doc_name(doc) if doc_name in shared: if ptype in ("read", "write", "share", "submit") or meta.permissions[0].get(ptype): return True elif shared: # if atleast one shared doc of that type, then return True # this is used in db_query to check if permission on DocType return True return False if not perm: perm = false_if_not_shared() return perm def get_doc_permissions(doc, user=None, ptype=None): """Returns a dict of evaluated permissions for given `doc` like `{"read":1, "write":1}`""" if not user: user = frappe.session.user if frappe.is_table(doc.doctype): return {"read": 1, "write": 1} meta = frappe.get_meta(doc.doctype) def is_user_owner(): doc_owner = doc.get('owner') or '' doc_owner = doc_owner.lower() session_user = frappe.session.user.lower() return doc_owner == session_user if has_controller_permissions(doc, ptype, user=user) == False : push_perm_check_log('Not allowed via controller permission check') return {ptype: 0} permissions = copy.deepcopy(get_role_permissions(meta, user=user, is_owner=is_user_owner())) if not cint(meta.is_submittable): permissions["submit"] = 0 if not cint(meta.allow_import): permissions["import"] = 0 # Override with `if_owner` perms irrespective of user if permissions.get('has_if_owner_enabled'): # apply owner permissions on top of existing permissions # some access might be only for the owner # eg. everyone might have read access but only owner can delete permissions.update(permissions.get("if_owner", {})) if not has_user_permission(doc, user): if is_user_owner(): # replace with owner permissions permissions = permissions.get("if_owner", {}) # if_owner does not come with create rights... permissions['create'] = 0 else: permissions = {} return permissions def get_role_permissions(doctype_meta, user=None, is_owner=None): """ Returns dict of evaluated role permissions like { "read": 1, "write": 0, // if "if_owner" is enabled "if_owner": { "read": 1, "write": 0 } } """ if isinstance(doctype_meta, str): doctype_meta = frappe.get_meta(doctype_meta) # assuming doctype name was passed if not user: user = frappe.session.user cache_key = (doctype_meta.name, user) if user == 'Administrator': return allow_everything() if not frappe.local.role_permissions.get(cache_key): perms = frappe._dict( if_owner={} ) roles = frappe.get_roles(user) def is_perm_applicable(perm): return perm.role in roles and cint(perm.permlevel)==0 def has_permission_without_if_owner_enabled(ptype): return any(p.get(ptype, 0) and not p.get('if_owner', 0) for p in applicable_permissions) applicable_permissions = list(filter(is_perm_applicable, getattr(doctype_meta, 'permissions', []))) has_if_owner_enabled = any(p.get('if_owner', 0) for p in applicable_permissions) perms['has_if_owner_enabled'] = has_if_owner_enabled for ptype in rights: pvalue = any(p.get(ptype, 0) for p in applicable_permissions) # check if any perm object allows perm type perms[ptype] = cint(pvalue) if (pvalue and has_if_owner_enabled and not has_permission_without_if_owner_enabled(ptype) and ptype != 'create'): perms['if_owner'][ptype] = cint(pvalue and is_owner) # has no access if not owner # only provide select or read access so that user is able to at-least access list # (and the documents will be filtered based on owner sin further checks) perms[ptype] = 1 if ptype in ['select', 'read'] else 0 frappe.local.role_permissions[cache_key] = perms return frappe.local.role_permissions[cache_key] def get_user_permissions(user): from frappe.core.doctype.user_permission.user_permission import get_user_permissions return get_user_permissions(user) def has_user_permission(doc, user=None): '''Returns True if User is allowed to view considering User Permissions''' from frappe.core.doctype.user_permission.user_permission import get_user_permissions user_permissions = get_user_permissions(user) if not user_permissions: # no user permission rules specified for this doctype return True # user can create own role permissions, so nothing applies if get_role_permissions('User Permission', user=user).get('write'): return True apply_strict_user_permissions = frappe.get_system_settings('apply_strict_user_permissions') doctype = doc.get('doctype') docname = doc.get('name') # STEP 1: --------------------- # check user permissions on self if doctype in user_permissions: allowed_docs = get_allowed_docs_for_doctype(user_permissions.get(doctype, []), doctype) # if allowed_docs is empty it states that there is no applicable permission under the current doctype # only check if allowed_docs is not empty if allowed_docs and docname not in allowed_docs: # no user permissions for this doc specified push_perm_check_log(_('Not allowed for {0}: {1}').format(_(doctype), docname)) return False # STEP 2: --------------------------------- # check user permissions in all link fields def check_user_permission_on_link_fields(d): # check user permissions for all the link fields of the given # document object d # # called for both parent and child records meta = frappe.get_meta(d.get("doctype")) # check all link fields for user permissions for field in meta.get_link_fields(): if field.ignore_user_permissions: continue # empty value, do you still want to apply user permissions? if not d.get(field.fieldname) and not apply_strict_user_permissions: # nah, not strict continue if field.options not in user_permissions: continue # get the list of all allowed values for this link allowed_docs = get_allowed_docs_for_doctype(user_permissions.get(field.options, []), doctype) if allowed_docs and d.get(field.fieldname) not in allowed_docs: # restricted for this link field, and no matching values found # make the right message and exit if d.get('parentfield'): # "Not allowed for Company = Restricted Company in Row 3. Restricted field: reference_type" msg = _('Not allowed for {0}: {1} in Row {2}. Restricted field: {3}').format( _(field.options), d.get(field.fieldname), d.idx, field.fieldname) else: # "Not allowed for Company = Restricted Company. Restricted field: reference_type" msg = _('Not allowed for {0}: {1}. Restricted field: {2}').format( _(field.options), d.get(field.fieldname), field.fieldname) push_perm_check_log(msg) return False return True if not check_user_permission_on_link_fields(doc): return False for d in doc.get_all_children(): if not check_user_permission_on_link_fields(d): return False return True def has_controller_permissions(doc, ptype, user=None): """Returns controller permissions if defined. None if not defined""" if not user: user = frappe.session.user methods = frappe.get_hooks("has_permission").get(doc.doctype, []) if not methods: return None for method in methods: controller_permission = frappe.call(frappe.get_attr(method), doc=doc, ptype=ptype, user=user) if controller_permission is not None: return controller_permission # controller permissions could not decide on True or False return None def get_doctypes_with_read(): return list({p.parent if type(p.parent) == str else p.parent.encode('UTF8') for p in get_valid_perms()}) def get_valid_perms(doctype=None, user=None): '''Get valid permissions for the current user from DocPerm and Custom DocPerm''' roles = get_roles(user) perms = get_perms_for(roles) custom_perms = get_perms_for(roles, 'Custom DocPerm') doctypes_with_custom_perms = get_doctypes_with_custom_docperms() for p in perms: if not p.parent in doctypes_with_custom_perms: custom_perms.append(p) if doctype: return [p for p in custom_perms if p.parent == doctype] else: return custom_perms def get_all_perms(role): '''Returns valid permissions for a given role''' perms = frappe.get_all('DocPerm', fields='*', filters=dict(role=role)) custom_perms = frappe.get_all('Custom DocPerm', fields='*', filters=dict(role=role)) doctypes_with_custom_perms = frappe.db.sql_list("""select distinct parent from `tabCustom DocPerm`""") for p in perms: if p.parent not in doctypes_with_custom_perms: custom_perms.append(p) return custom_perms def get_roles(user=None, with_standard=True): """get roles of current user""" if not user: user = frappe.session.user if user=='Guest': return ['Guest'] def get(): if user == 'Administrator': return [r[0] for r in frappe.db.sql("select name from `tabRole`")] # return all available roles else: return [r[0] for r in frappe.db.sql("""select role from `tabHas Role` where parent=%s and role not in ('All', 'Guest')""", (user,))] + ['All', 'Guest'] roles = frappe.cache().hget("roles", user, get) # filter standard if required if not with_standard: roles = filter(lambda x: x not in ['All', 'Guest', 'Administrator'], roles) return roles def get_doctype_roles(doctype, access_type="read"): """Returns a list of roles that are allowed to access passed doctype.""" meta = frappe.get_meta(doctype) return [d.role for d in meta.get("permissions") if d.get(access_type)] def get_perms_for(roles, perm_doctype='DocPerm'): '''Get perms for given roles''' filters = { 'permlevel': 0, 'docstatus': 0, 'role': ['in', roles] } return frappe.db.get_all(perm_doctype, fields=['*'], filters=filters) def get_doctypes_with_custom_docperms(): '''Returns all the doctypes with Custom Docperms''' doctypes = frappe.db.get_all('Custom DocPerm', fields=['parent'], distinct=1) return [d.parent for d in doctypes] def can_set_user_permissions(doctype, docname=None): # System Manager can always set user permissions if frappe.session.user == "Administrator" or "System Manager" in frappe.get_roles(): return True meta = frappe.get_meta(doctype) # check if current user has read permission for docname if docname and not has_permission(doctype, "read", docname): return False # check if current user has a role that can set permission if get_role_permissions(meta).set_user_permissions!=1: return False return True def set_user_permission_if_allowed(doctype, name, user, with_message=False): if get_role_permissions(frappe.get_meta(doctype), user).set_user_permissions!=1: add_user_permission(doctype, name, user) def add_user_permission(doctype, name, user, ignore_permissions=False, applicable_for=None, is_default=0, hide_descendants=0): '''Add user permission''' from frappe.core.doctype.user_permission.user_permission import user_permission_exists if not user_permission_exists(user, doctype, name, applicable_for): if not frappe.db.exists(doctype, name): frappe.throw(_("{0} {1} not found").format(_(doctype), name), frappe.DoesNotExistError) frappe.get_doc(dict( doctype='User Permission', user=user, allow=doctype, for_value=name, is_default=is_default, applicable_for=applicable_for, hide_descendants=hide_descendants, )).insert(ignore_permissions=ignore_permissions) def remove_user_permission(doctype, name, user): user_permission_name = frappe.db.get_value('User Permission', dict(user=user, allow=doctype, for_value=name)) frappe.delete_doc('User Permission', user_permission_name) def clear_user_permissions_for_doctype(doctype, user=None): filters = {'allow': doctype} if user: filters['user'] = user user_permissions_for_doctype = frappe.db.get_all('User Permission', filters=filters) for d in user_permissions_for_doctype: frappe.delete_doc('User Permission', d.name) def can_import(doctype, raise_exception=False): if not ("System Manager" in frappe.get_roles() or has_permission(doctype, "import")): if raise_exception: raise frappe.PermissionError("You are not allowed to import: {doctype}".format(doctype=doctype)) else: return False return True def can_export(doctype, raise_exception=False): if "System Manager" in frappe.get_roles(): return True else: role_permissions = frappe.permissions.get_role_permissions(doctype) has_access = role_permissions.get('export') or \ role_permissions.get('if_owner').get('export') if not has_access and raise_exception: raise frappe.PermissionError(_("You are not allowed to export {} doctype").format(doctype)) return has_access def update_permission_property(doctype, role, permlevel, ptype, value=None, validate=True): '''Update a property in Custom Perm''' from frappe.core.doctype.doctype.doctype import validate_permissions_for_doctype out = setup_custom_perms(doctype) name = frappe.get_value('Custom DocPerm', dict(parent=doctype, role=role, permlevel=permlevel)) frappe.db.sql(""" update `tabCustom DocPerm` set `{0}`=%s where name=%s""".format(ptype), (value, name)) if validate: validate_permissions_for_doctype(doctype) return out def setup_custom_perms(parent): '''if custom permssions are not setup for the current doctype, set them up''' if not frappe.db.exists('Custom DocPerm', dict(parent=parent)): copy_perms(parent) return True def add_permission(doctype, role, permlevel=0, ptype=None): '''Add a new permission rule to the given doctype for the given Role and Permission Level''' from frappe.core.doctype.doctype.doctype import validate_permissions_for_doctype setup_custom_perms(doctype) if frappe.db.get_value('Custom DocPerm', dict(parent=doctype, role=role, permlevel=permlevel, if_owner=0)): return if not ptype: ptype = 'read' custom_docperm = frappe.get_doc({ "doctype":"Custom DocPerm", "__islocal": 1, "parent": doctype, "parenttype": "DocType", "parentfield": "permissions", "role": role, "permlevel": permlevel, ptype: 1, }) custom_docperm.save() validate_permissions_for_doctype(doctype) return custom_docperm.name def copy_perms(parent): '''Copy all DocPerm in to Custom DocPerm for the given document''' for d in frappe.get_all('DocPerm', fields='*', filters=dict(parent=parent)): custom_perm = frappe.new_doc('Custom DocPerm') custom_perm.update(d) custom_perm.insert(ignore_permissions=True) def reset_perms(doctype): """Reset permissions for given doctype.""" from frappe.desk.notifications import delete_notification_count_for delete_notification_count_for(doctype) frappe.db.sql("""delete from `tabCustom DocPerm` where parent=%s""", doctype) def get_linked_doctypes(dt): return list(set([dt] + [d.options for d in frappe.get_meta(dt).get("fields", { "fieldtype":"Link", "ignore_user_permissions":("!=", 1), "options": ("!=", "[Select]") }) ])) def get_doc_name(doc): if not doc: return None return doc if isinstance(doc, str) else doc.name def allow_everything(): ''' returns a dict with access to everything eg. {"read": 1, "write": 1, ...} ''' perm = {ptype: 1 for ptype in rights} return perm def get_allowed_docs_for_doctype(user_permissions, doctype): ''' Returns all the docs from the passed user_permissions that are allowed under provided doctype ''' return filter_allowed_docs_for_doctype(user_permissions, doctype, with_default_doc=False) def filter_allowed_docs_for_doctype(user_permissions, doctype, with_default_doc=True): ''' Returns all the docs from the passed user_permissions that are allowed under provided doctype along with default doc value if with_default_doc is set ''' allowed_doc = [] default_doc = None for doc in user_permissions: if not doc.get('applicable_for') or doc.get('applicable_for') == doctype: allowed_doc.append(doc.get('doc')) if doc.get('is_default') or len(user_permissions) == 1 and with_default_doc: default_doc = doc.get('doc') return (allowed_doc, default_doc) if with_default_doc else allowed_doc def push_perm_check_log(log): if frappe.flags.get('has_permission_check_logs') == None: return frappe.flags.get('has_permission_check_logs').append(_(log))
nilq/baby-python
python
#!/usr/bin/python import os,sys import lcm import time home_dir =os.getenv("HOME") #print home_dir sys.path.append(home_dir + "/drc/software/build/lib/python2.7/site-packages") sys.path.append(home_dir + "/drc/software/build/lib/python2.7/dist-packages") from ipab.pause_command_message_t import pause_command_message_t def timestamp_now (): return int (time.time () * 1000000) if len(sys.argv)>1: val = sys.argv[1].lower() if (val[0] == 'f'): pause = False if (val[0] == 't'): pause = True # currently crashes otherwise else: print 'No mode specified!' pause= True msg = pause_command_message_t() msg.utime = timestamp_now() msg.pause = pause lc = lcm.LCM() lc.publish("VAL_COMMAND_PAUSE", msg.encode()) print "Commanding pause: " , pause
nilq/baby-python
python
from exporters.logger.base_logger import TransformLogger from exporters.pipeline.base_pipeline_item import BasePipelineItem class BaseTransform(BasePipelineItem): """ This module receives a batch and writes it where needed. It can implement the following methods: """ def __init__(self, options, metadata=None): super(BaseTransform, self).__init__(options, metadata) self.logger = TransformLogger({ 'log_level': options.get('log_level'), 'logger_name': options.get('logger_name') }) def transform_batch(self, batch): """ Receives the batch, transforms it, and returns it. """ raise NotImplementedError def set_metadata(self, key, value, module='transform'): super(BaseTransform, self).set_metadata(key, value, module) def update_metadata(self, data, module='transform'): super(BaseTransform, self).update_metadata(data, module) def get_metadata(self, key, module='transform'): return super(BaseTransform, self).get_metadata(key, module) def get_all_metadata(self, module='transform'): return super(BaseTransform, self).get_all_metadata(module)
nilq/baby-python
python
from Acccount import Account class Drive(Account): type = int activo = int def __init__(self, name, document, type, activo): super().__init__(name, document) self.type = type self.activo = activo
nilq/baby-python
python
import unittest from app.models import Source class SourceTest(unittest.TestCase): ''' Test Class to test the behaviour of the Source class ''' def setUp(self): ''' Set up method that will run before every Test ''' self.new_source = Source(1,"Washington Post", "Leading news outlet", "http://stuff.com", "business", "US", "en") def test_instance(self): ''' method asserts existence of an instance :return: ''' self.assertTrue(isinstance(self.new_source,Source))
nilq/baby-python
python
""" opstate.py "Specification of the OpState class." @author: Johan Monster (https://github.com/Hans-Bananendans/) """ class OpState: """This class represents a separate operational state, and can be used to calculate used power values and separate these by channel.""" def __init__(self, device_power_values, channels, device_channels, \ blips_on=1): self.device_power_values = device_power_values self.devices = list(device_power_values.keys()) self.channels = channels self.device_channels = device_channels self.blips_on = blips_on def power_used_channel(self): # Generate empty dictionary channel_power = {chan: 0 for chan in self.channels} # Calculate power for each channel for device in self.devices: # Find which power channel the device is connected to chan = self.device_channels[device] # Add power used by the device to total power used by channel channel_power[chan] += self.device_power_values[device] return channel_power def power_used_device(self): return self.device_power_values def power_used(self): return sum(self.device_power_values.values()) def blips(self): return self.blips_on
nilq/baby-python
python
# Copyright 2021 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Losses used for segmentation models.""" from typing import Optional, Sequence import tensorflow as tf class SegmentationLossDiceScore(object): """Semantic segmentation loss using generalized dice score. Dice score (DSC) is a similarity measure that equals twice the number of elements common to both sets divided by the sum of the number of elements in each set. It is commonly used to evaluate segmentation performance to measure the overlap of predicted and groundtruth regions. (https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient) Generalized dice score is the dice score weighted by the volume of groundtruth labels per class. Adaptive dice score adds weights to generalized dice score. It assigns larger weights to lower dice score, so that wrong predictions contribute more to the total loss. Model will then be trained to focus more on these hard examples. """ def __init__(self, metric_type: Optional[str] = None, axis: Optional[Sequence[int]] = (1, 2, 3)): """Initializes dice score loss object. Args: metric_type: An optional `str` specifying the type of the dice score to compute. Compute generalized or adaptive dice score if metric type is `generalized` or `adaptive`; otherwise compute original dice score. axis: An optional sequence of `int` specifying the axis to perform reduce ops for raw dice score. """ self._dice_score = 0 self._metric_type = metric_type self._axis = axis def __call__(self, logits: tf.Tensor, labels: tf.Tensor) -> tf.Tensor: """Computes and returns a loss based on 1 - dice score. Args: logits: A Tensor of the prediction. labels: A Tensor of the groundtruth label. Returns: The loss value of (1 - dice score). """ labels = tf.cast(labels, logits.dtype) if labels.get_shape().ndims < 2 or logits.get_shape().ndims < 2: raise ValueError('The labels and logits must be at least rank 2.') epsilon = tf.keras.backend.epsilon() keep_label_axis = list(range(len(logits.shape) - 1)) keep_batch_axis = list(range(1, len(logits.shape))) # Compute sample mask to filter out samples with both all-0's labels and # predictions because such samples should not contribute to mean dice score # in this batch. sample_mask = tf.logical_or( tf.cast(tf.reduce_sum(labels, axis=keep_batch_axis), dtype=tf.bool), tf.cast(tf.reduce_sum(logits, axis=keep_batch_axis), dtype=tf.bool)) labels = tf.boolean_mask(labels, sample_mask) logits = tf.boolean_mask(logits, sample_mask) # If all samples are filtered out, return 0 as the loss so this batch does # not contribute. if labels.shape[0] == 0: return tf.convert_to_tensor(0.0) # Calculate intersections and unions per class. intersection = tf.reduce_sum(labels * logits, axis=keep_label_axis) union = tf.reduce_sum(labels + logits, axis=keep_label_axis) if self._metric_type == 'generalized': # Calculate the volume of groundtruth labels. w = tf.math.reciprocal( tf.square(tf.reduce_sum(labels, axis=keep_label_axis)) + epsilon) # Calculate the weighted dice score and normalizer. dice = 2 * tf.reduce_sum(w * intersection) normalizer = tf.reduce_sum(w * union) if normalizer == 0: return tf.convert_to_tensor(1.0) dice = tf.cast(dice, dtype=tf.float32) normalizer = tf.cast(normalizer, dtype=tf.float32) return 1 - tf.reduce_mean(dice / normalizer) elif self._metric_type == 'adaptive': dice = 2.0 * intersection / (union + epsilon) # Calculate weights based on Dice scores. weights = tf.exp(-1.0 * dice) # Multiply weights by corresponding scores and get sum. weighted_dice = tf.reduce_sum(weights * dice) # Calculate normalization factor. normalizer = tf.cast(tf.size(input=dice), dtype=tf.float32) * tf.exp(-1.0) if normalizer == 0: return tf.convert_to_tensor(1.0) weighted_dice = tf.cast(weighted_dice, dtype=tf.float32) return 1 - tf.reduce_mean(weighted_dice / normalizer) else: summation = tf.reduce_sum( labels, axis=self._axis) + tf.reduce_sum( logits, axis=self._axis) dice = (2 * tf.reduce_sum(labels * logits, axis=self._axis)) / ( summation + epsilon) return 1 - tf.reduce_mean(dice)
nilq/baby-python
python
# -*- coding: utf-8 -*- from ..setup.constants import NETWORK_DEVICE, SERIAL_DEVICE from ..user import User, UserDetail from ..settings import Setting from ..certificate import Certificate from ..notifications import Notification, NotificationSetting from ..zones import Zone from ..keypad import KeypadButton HOSTS_FILE = '/etc/hosts' HOSTNAME_FILE = '/etc/hostname' NETWORK_FILE = '/etc/network/interfaces' EXPORT_MAP = { 'settings.json': Setting, 'certificates.json': Certificate, 'notifications.json': Notification, 'notification_settings.json': NotificationSetting, 'users.json': User, 'user_details.json': UserDetail, 'zones.json': Zone, 'buttons.json': KeypadButton }
nilq/baby-python
python
################################################################################ # # Copyright (C) 2013-2015, Michele Cappellari # E-mail: michele.cappellari_at_physics.ox.ac.uk # # Updated versions of the software are available from my web page # http://purl.org/cappellari/software # # This software is provided as is without any warranty whatsoever. # Permission to use, for non-commercial purposes is granted. # Permission to modify for personal or internal use is granted, # provided this copyright and disclaimer are included unchanged # at the beginning of the file. All other rights are reserved. # ################################################################################ # # This program is a wrapper for mge_fit_sectors procedure and it accepts all # keyword of that program. One should look at the documentation of mge_fit_sectors # for usage details. # # The wrapper implements the method described in Section 2.2.2 of # Cappellari (2002, MNRAS, 333, 400) to "regularize" an MGE model by restricting # the allowed range in qObs of the Gaussians until the fit becomes unacceptable. # In this way one ensures that the permitted galaxy inclinations are not being # artificially restricted to a smaller range than allowed by the data. # # The detailed approach implemented here is the one used for the MGE fits of # the galaxies in the Atlas3D project and described in Section 3.2 of # Scott et al. (2013, MNRAS, 432, 1894). # # The intended usage of this wrapper is the following: # 1. First perform a standard MGE fit with mge_fit_sectors; # 2. Once all parameters (e.g. PA, eps, centre, sky subtraction) are OK and the # fit looks good, simply rename "mge_fit_sectors" in your script into # "mge_fit_sectors_regularized" (and import the module) to cleanup the final solution. # This is because this wrapper calls mge_fit_sectors repeatedly, taking much longer, # so it is not useful to run it until all input parameters are settled. # # VERSION HISTORY: # V1.0.0: Michele Cappellari, Oxford, 22 January 2013 # V1.0.1: Fixed program stop when (qmin==qmax). Thanks to Silvia Posacki (Bologna) # for reporting the problem and the solution. MC, Oxford, 9 May 2013 # V2.0.0: Converted from IDL into Python. MC, Oxford, 27 March 2015 # V2.0.1; Removed truncation of input eps in mge_fit_sectors. # MC, Atlantic Ocean, 28 March 2015 # V2.0.2: Cleaned up loop. MC, Oxford, 30 May 2015 # ################################################################################ import numpy as np from Cappellari.mge.mge_fit_sectors import mge_fit_sectors #---------------------------------------------------------------------------- class mge_fit_sectors_regularized(object): def __init__(self, radius, angle, counts, eps, qbounds=[0, 1], **kwargs): qmin, qmax = qbounds nq = int(np.ceil((qmax - qmin)/0.05) + 1) # Adopt step <= 0.05 in qObs qrange = np.linspace(qmin, qmax, nq) bestnorm = np.inf frac = 1.1 # Allowed fractional increase in ABSDEV for j in range(nq - 1): qmin = qrange[j] m = mge_fit_sectors(radius, angle, counts, eps, qbounds=[qmin, qmax], **kwargs) absdev = m.absdev print('(minloop) qbounds=%6.4f %6.4f' % (qmin, qmax)) if absdev > bestnorm*frac: jbest = j - 1 qmin = qrange[jbest] break # stops if error increases more than frac else: jbest = j bestnorm = min(bestnorm, absdev) self.sol = m.sol for k in range(nq - 2, jbest, -1): qmax = qrange[k] m = mge_fit_sectors(radius, angle, counts, eps, qbounds=[qmin, qmax], **kwargs) absdev = m.absdev print('(maxloop) qbounds=%6.4f %6.4f' % (qmin, qmax)) if absdev > bestnorm*frac: qmax = qrange[k + 1] break # stops if error increases more than frac else: bestnorm = min(bestnorm, absdev) self.sol = m.sol print('Final qbounds=%6.4f %6.4f' % (qmin, qmax)) #----------------------------------------------------------------------------
nilq/baby-python
python
from typing import Optional from asserts import ( assert_equal, assert_false, assert_raises, assert_succeeds, assert_true, ) from dectest import TestCase, test from dbupgrade.args import Arguments from dbupgrade.files import FileInfo from dbupgrade.filter import ( MAX_API_LEVEL, MAX_VERSION, Filter, filter_from_arguments, ) class FilterTest(TestCase): @test def init(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) assert_equal("myschema", filter_.schema) assert_equal("postgres", filter_.dialect) assert_equal(5, filter_.min_version) assert_equal(10, filter_.max_version) assert_equal(3, filter_.target_api_level) @test def init__max_version_equals_min_version(self) -> None: with assert_succeeds(ValueError): Filter("myschema", "postgres", 5, 5, 3) @test def init__max_version_smaller_than_min_version(self) -> None: with assert_raises(ValueError): Filter("myschema", "postgres", 5, 4, 3) @test def matches__version_matches_lower(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 5, 2) assert_true(filter_.matches(file_info)) @test def matches__version_in_between(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 7, 2) assert_true(filter_.matches(file_info)) @test def matches__version_matches_upper(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 10, 2) assert_true(filter_.matches(file_info)) @test def matches__api_level_match(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 7, 3) assert_true(filter_.matches(file_info)) @test def matches__wrong_schema(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "wrongschema", "postgres", 5, 2) assert_false(filter_.matches(file_info)) @test def matches__wrong_dialect(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "mysql", 5, 2) assert_false(filter_.matches(file_info)) @test def matches__min_version_too_small(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 4, 2) assert_false(filter_.matches(file_info)) @test def matches__min_version_too_large(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 11, 2) assert_false(filter_.matches(file_info)) @test def matches__api_level_too_large(self) -> None: filter_ = Filter("myschema", "postgres", 5, 10, 3) file_info = FileInfo("", "myschema", "postgres", 7, 4) assert_false(filter_.matches(file_info)) class FilterFromArgumentsTest(TestCase): def _create_arguments( self, *, schema: str = "testschema", db_url: str = "postgres://localhost/foo", max_api_level: Optional[int] = None, max_version: Optional[int] = None, ignore_api_level: bool = False ) -> Arguments: return Arguments( schema, db_url, "/tmp", max_api_level, max_version, ignore_api_level=ignore_api_level, ) @test def schema(self) -> None: args = self._create_arguments(schema="myschema") filter_ = filter_from_arguments(args, 0, 0) assert_equal("myschema", filter_.schema) @test def dialect(self) -> None: args = self._create_arguments( db_url="postgres+psycopg2://localhost/foo" ) filter_ = filter_from_arguments(args, 0, 0) assert_equal("postgres", filter_.dialect) @test def min_version(self) -> None: args = self._create_arguments() filter_ = filter_from_arguments(args, 13, 0) assert_equal(13, filter_.min_version) @test def max_version_default(self) -> None: args = self._create_arguments(max_version=None) filter_ = filter_from_arguments(args, 0, 0) assert_equal(MAX_VERSION, filter_.max_version) @test def max_version_explicit(self) -> None: args = self._create_arguments(max_version=34) filter_ = filter_from_arguments(args, 0, 0) assert_equal(34, filter_.max_version) @test def target_api_level_default(self) -> None: args = self._create_arguments( max_api_level=None, ignore_api_level=False ) filter_ = filter_from_arguments(args, 0, 12) assert_equal(12, filter_.target_api_level) @test def target_api_level_ignore(self) -> None: args = self._create_arguments(ignore_api_level=True) filter_ = filter_from_arguments(args, 0, 0) assert_equal(MAX_API_LEVEL, filter_.target_api_level) @test def target_api_level_explicit(self) -> None: args = self._create_arguments(max_api_level=12) filter_ = filter_from_arguments(args, 0, 0) assert_equal(12, filter_.target_api_level)
nilq/baby-python
python
# -*- coding: utf-8 -*- from django.core.management import CommandError, call_command from django.test import TestCase from django.test.utils import override_settings from six import StringIO try: from unittest import mock except ImportError: import mock class ResetSchemaExceptionsTests(TestCase): """Tests if reset_schema command raises exceptions.""" def test_should_raise_CommandError_when_router_does_not_exist(self): with self.assertRaisesRegexp(CommandError, 'Unknown database router non-existing_router'): call_command('reset_schema', '--router=non-existing_router') @override_settings(DATABASES={ 'default': { 'ENGINE': 'django.db.backends.mysql', }, }) def test_should_raise_CommandError_when_database_ENGINE_different_thant_postgresql(self): with self.assertRaisesRegexp(CommandError, 'This command can be used only with PostgreSQL databases.'): call_command('reset_schema') @override_settings(DATABASES={ 'default': { 'ENGINE': 'django.db.backends.postgresql_psycopg2', 'NAME': 'test', 'USER': 'test', 'PASSWORD': 'test', 'HOST': 'localhost', }, }) class ResetSchemaTests(TestCase): """Tests for reset_chema command.""" def test_should_drop_schema_and_create_new_one(self): m_cursor = mock.Mock() m_router = mock.Mock() m_router.cursor.return_value = mock.Mock( __enter__=mock.Mock(return_value=m_cursor), __exit__=mock.Mock(return_value=False), ) expected_calls = [ mock.call('DROP SCHEMA test_public CASCADE'), mock.call('CREATE SCHEMA test_public'), ] with mock.patch('django_extensions.management.commands.reset_schema.connections', {'default': m_router}): call_command('reset_schema', '--noinput', '--schema=test_public') m_cursor.execute.assert_has_calls(expected_calls, any_order=False) @mock.patch('sys.stdout', new_callable=StringIO) @mock.patch('django_extensions.management.commands.reset_schema.input') def test_should_cancel_reset_schema_and_print_info_if_input_is_different_than_yes(self, m_input, m_stdout): m_input.return_value = 'no' call_command('reset_schema') self.assertEqual("Reset cancelled.\n", m_stdout.getvalue())
nilq/baby-python
python
from django.db.models.manager import BaseManager from .querysets import LocationQuerySet class LocationManager(BaseManager.from_queryset(LocationQuerySet)): """ Manager class for location models constructed from LocationQuerySet. Uses miles as distance unit. """
nilq/baby-python
python
from django.db import models from django.contrib.auth.models import AbstractBaseUser,BaseUserManager from panel.models import Discount from product.models import Product,ProductDetail # Create your models here. class MyAccountManager(BaseUserManager): def create_user(self,email,first_name,last_name,password): if not email: raise ValueError("Users must have an email address") if not first_name: raise ValueError("Users must have an first name") if not last_name: raise ValueError("Users must have an last name") if not password: raise ValueError("Users must have an password") user = self.model( email=self.normalize_email(email), first_name= first_name, last_name = last_name, ) user.set_password(password) user.save(using=self._db) return user def create_superuser(self, email ,first_name,last_name , password): user = self.create_user(email=self.normalize_email(email),password=password,first_name= first_name,last_name = last_name,) user.is_admin = True user.is_staff = True user.is_active = True user.is_store = True user.is_superuser = True user.save(using=self._db) return user class Account(AbstractBaseUser): email = models.EmailField(verbose_name="email", max_length=60, unique=True) first_name = models.CharField(max_length=200) last_name = models.CharField(max_length=200) phone = models.CharField(verbose_name="phone",max_length=30,blank=True,null=True) date_joined = models.DateTimeField(verbose_name='date joined', auto_now_add=True) last_login = models.DateTimeField(verbose_name='last login', auto_now=True) date_of_birth = models.DateField(verbose_name='last login',blank=True,null=True) """ Gender : -1: Belirtmek istemiyorum 0 : Erkek 1 : K """ gender = models.IntegerField(blank=True,null=True,default=-1) is_admin = models.BooleanField(default=False) is_active = models.BooleanField(default=True) is_superuser = models.BooleanField(default=False) is_staff = models.BooleanField(default=False) #-1,0-1-2-3 staff perm, different perms is_store = models.BooleanField(default=False) is_customer = models.BooleanField(default=False) date_activate = models.DateField(verbose_name="date of activate",blank = True, null=True) USERNAME_FIELD = 'email' REQUIRED_FIELDS= ['first_name','last_name'] objects = MyAccountManager() def has_perm(self,perm,obj=None): return self.is_admin def has_module_perms(self, app_label): return True def __str__(self): return self.email class Adress(models.Model): user = models.ForeignKey(Account,on_delete=models.CASCADE,related_name="customer") adress_first_name = models.CharField(max_length=100) adress_last_name = models.CharField(max_length=100) adress_phone = models.CharField(verbose_name="phone",max_length=30) city = models.CharField(max_length=100) country = models.CharField(max_length=100) adresss = models.TextField(max_length=100) def __str__(self): return f"{self.adress_first_name} {self.adress_last_name} - {self.adresss} {self.city}/{self.country}" class Order(models.Model): customer = models.ForeignKey(Account,on_delete=models.CASCADE,related_name="buyer") address = models.ForeignKey(Adress,on_delete=models.CASCADE,related_name="adress") items = models.ManyToManyField(ProductDetail) discount = models.ForeignKey(Discount,on_delete=models.CASCADE,related_name="indirim",blank=True,null=True) created = models.DateTimeField(verbose_name='date created', auto_now_add=True) """ Status Means : -1 : Error 0 : İade 1 : Ödeme bekleniyor 2 : Ödeme alındı 3 : Sipariş hazırlanıyor 4 : Kargoya verildi """ status = models.IntegerField() amount = models.FloatField() # def total(self): # for item in self.items: # total_price += item # return total_price
nilq/baby-python
python
#!/pxrpythonsubst # # Copyright 2020 Pixar # # Licensed under the Apache License, Version 2.0 (the "Apache License") # with the following modification; you may not use this file except in # compliance with the Apache License and the following modification to it: # Section 6. Trademarks. is deleted and replaced with: # # 6. Trademarks. This License does not grant permission to use the trade # names, trademarks, service marks, or product names of the Licensor # and its affiliates, except as required to comply with Section 4(c) of # the License and to reproduce the content of the NOTICE file. # # You may obtain a copy of the Apache License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the Apache License with the above modification is # distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the Apache License for the specific # language governing permissions and limitations under the Apache License. import os, unittest from pxr import Plug, Sdf, Usd, Vt, Tf, Gf class TestUsdAppliedAPISchemas(unittest.TestCase): @classmethod def setUpClass(cls): pr = Plug.Registry() testPlugins = pr.RegisterPlugins(os.path.abspath("resources")) assert len(testPlugins) == 1, \ "Failed to load expected test plugin" assert testPlugins[0].name == "testUsdAppliedAPISchemas", \ "Failed to load expected test plugin" cls.SingleApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestSingleApplyAPI") cls.MultiApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestMultiApplyAPI") cls.SingleCanApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestSingleCanApplyAPI") cls.MultiCanApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestMultiCanApplyAPI") cls.NestedInnerSingleApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedInnerSingleApplyAPI") cls.NestedOuterSingleApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedOuterSingleApplyAPI") cls.NestedInnerMultiApplyBaseAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedInnerMultiApplyBaseAPI") cls.NestedInnerMultiApplyDerivedAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedInnerMultiApplyDerivedAPI") cls.NestedOuterMultiApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedOuterMultiApplyAPI") cls.NestedMultiApplyInSingleApplyAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedMultiApplyInSingleApplyAPI") cls.NestedCycle1APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedCycle1API") cls.NestedCycle2APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedCycle2API") cls.NestedCycle3APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedCycle3API") cls.NestedMultiApplyCycle1APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedMultiApplyCycle1API") cls.NestedMultiApplyCycle2APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedMultiApplyCycle2API") cls.NestedMultiApplyCycle3APIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedMultiApplyCycle3API") cls.AutoAppliedToAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestAutoAppliedToAPI") cls.NestedAutoAppliedToAPIType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedAutoAppliedToAPI") cls.NestedAutoAppliedToAPIAppliedToPrimType = \ Tf.Type(Usd.SchemaBase).FindDerivedByName("TestNestedAutoAppliedToAPIAppliedToPrim") def test_SimpleTypedSchemaPrimDefinition(self): """ Tests the prim definition for a simple typed schema that has no built-in API schemas """ primDef = Usd.SchemaRegistry().FindConcretePrimDefinition( "TestTypedSchema") self.assertTrue(primDef) self.assertEqual(primDef.GetPropertyNames(), ["testAttr", "testRel"]) self.assertEqual(primDef.GetAppliedAPISchemas(), []) self.assertEqual(primDef.GetDocumentation(), "Testing typed schema") # Verify property specs for named properties. for propName in primDef.GetPropertyNames(): self.assertTrue(primDef.GetSchemaPropertySpec(propName)) # Verify the attribute spec and its fallback value and type testAttr = primDef.GetSchemaAttributeSpec("testAttr") self.assertEqual(testAttr.default, "foo") self.assertEqual(testAttr.typeName.cppTypeName, "std::string") # Verify the relationship spec self.assertTrue(primDef.GetSchemaRelationshipSpec("testRel")) def test_TypedSchemaWithBuiltinAPISchemas(self): """ Tests the prim definition for schema prim type that has API schemas applied to it in its generated schema. """ # Find the prim definition for the test single apply schema. It has # some properties defined. singleApplyAPIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestSingleApplyAPI") self.assertTrue(singleApplyAPIDef) self.assertEqual(singleApplyAPIDef.GetAppliedAPISchemas(), ["TestSingleApplyAPI"]) self.assertEqual(singleApplyAPIDef.GetPropertyNames(), [ "single:bool_attr", "single:token_attr", "single:relationship"]) self.assertEqual(singleApplyAPIDef.GetDocumentation(), "Test single apply API schema") # Find the prim definition for the test multi apply schema. It has # some properties defined. Note that the properties in the multi apply # definition are not prefixed yet. multiApplyAPIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestMultiApplyAPI") self.assertTrue(multiApplyAPIDef) self.assertEqual(multiApplyAPIDef.GetAppliedAPISchemas(), ["TestMultiApplyAPI:__INSTANCE_NAME__"]) self.assertEqual(multiApplyAPIDef.GetPropertyNames(), [ "multi:__INSTANCE_NAME__:bool_attr", "multi:__INSTANCE_NAME__:token_attr", "multi:__INSTANCE_NAME__:relationship"]) self.assertEqual(multiApplyAPIDef.GetDocumentation(), "Test multi-apply API schema") # Find the prim definition for the concrete prim type with built-in # API schemas. You can query its API schemas and it will have properties # from those schemas already. primDef = Usd.SchemaRegistry().FindConcretePrimDefinition( "TestWithBuiltinAppliedSchema") self.assertTrue(primDef) self.assertEqual(primDef.GetAppliedAPISchemas(), [ "TestSingleApplyAPI", "TestMultiApplyAPI:builtin"]) self.assertEqual(sorted(primDef.GetPropertyNames()), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Note that prim def documentation does not come from the built-in API # schemas. self.assertEqual(primDef.GetDocumentation(), "Test with built-in API schemas") # Verify property specs for all named properties. for propName in primDef.GetPropertyNames(): self.assertTrue(primDef.GetSchemaPropertySpec(propName)) # Verify fallback value and type for properties defined in the # concrete prim testAttr = primDef.GetSchemaAttributeSpec("testAttr") self.assertEqual(testAttr.default, "foo") self.assertEqual(testAttr.typeName.cppTypeName, "std::string") self.assertTrue(primDef.GetSchemaRelationshipSpec("testRel")) # Verify fallback value and type for properties from the single applied # schema. These properties will return the same property spec as the # API schema prim definition. singleBoolAttr = primDef.GetSchemaAttributeSpec("single:bool_attr") self.assertEqual(singleBoolAttr, singleApplyAPIDef.GetSchemaAttributeSpec("single:bool_attr")) self.assertEqual(singleBoolAttr.default, True) self.assertEqual(singleBoolAttr.typeName.cppTypeName, "bool") singleTokenAttr = primDef.GetSchemaAttributeSpec("single:token_attr") self.assertEqual(singleTokenAttr, singleApplyAPIDef.GetSchemaAttributeSpec("single:token_attr")) self.assertEqual(singleTokenAttr.default, "bar") self.assertEqual(singleTokenAttr.typeName.cppTypeName, "TfToken") singleRelationship = primDef.GetSchemaRelationshipSpec( "single:relationship") self.assertTrue(singleRelationship) self.assertEqual(singleRelationship, singleApplyAPIDef.GetSchemaRelationshipSpec("single:relationship")) # Verify fallback value and type for properties from the multi applied # schema. These properties will return the same property spec as the # API schema prim definition even the properties on the concrete prim # definion are namespace prefixed. multiTokenAttr = primDef.GetSchemaAttributeSpec( "multi:builtin:token_attr") self.assertEqual(multiTokenAttr, multiApplyAPIDef.GetSchemaAttributeSpec( "multi:__INSTANCE_NAME__:token_attr")) self.assertEqual(multiTokenAttr.default, "foo") self.assertEqual(multiTokenAttr.typeName.cppTypeName, "TfToken") multiRelationship = primDef.GetSchemaRelationshipSpec( "multi:builtin:relationship") self.assertTrue(multiRelationship) self.assertEqual(multiRelationship, multiApplyAPIDef.GetSchemaRelationshipSpec( "multi:__INSTANCE_NAME__:relationship")) # Verify the case where the concrete type overrides a property from # one of its applied API schemas. In this case the property spec from # the concrete prim is returned instead of the property spec from the # API schema. multiBoolAttr = primDef.GetSchemaAttributeSpec( "multi:builtin:bool_attr") apiBoolAttr = multiApplyAPIDef.GetSchemaAttributeSpec( "multi:__INSTANCE_NAME__:bool_attr") self.assertNotEqual(multiBoolAttr, apiBoolAttr) self.assertEqual(multiBoolAttr.default, False) self.assertEqual(apiBoolAttr.default, True) self.assertEqual(multiBoolAttr.typeName.cppTypeName, "bool") self.assertEqual(apiBoolAttr.typeName.cppTypeName, "bool") def test_UntypedPrimOnStage(self): """ Tests the fallback properties of untyped prims on a stage when API schemas are applied """ stage = Usd.Stage.CreateInMemory() # Add a prim with no type. It has no applied schemas or properties. untypedPrim = stage.DefinePrim("/Untyped") self.assertEqual(untypedPrim.GetTypeName(), '') self.assertEqual(untypedPrim.GetAppliedSchemas(), []) self.assertEqual(untypedPrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(untypedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertEqual(untypedPrim.GetPropertyNames(), []) # Add an api schema to the prim's metadata. untypedPrim.ApplyAPI(self.SingleApplyAPIType) # Prim still has no type but does have applied schemas self.assertEqual(untypedPrim.GetTypeName(), '') self.assertEqual(untypedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) self.assertEqual(untypedPrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(untypedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestSingleApplyAPI"]) self.assertTrue(untypedPrim.HasAPI(self.SingleApplyAPIType)) # The prim has properties from the applied schema and value resolution # returns the applied schema's property fallback value. self.assertEqual(untypedPrim.GetPropertyNames(), [ "single:bool_attr", "single:relationship", "single:token_attr"]) self.assertEqual(untypedPrim.GetAttribute("single:token_attr").Get(), "bar") # Applied schemas are unable to define fallback metadata values for # prims. Just verifying that no fallback exists for "hidden" here as # a contrast to the other cases below where this metadata fallback will # be defined. self.assertFalse("hidden" in untypedPrim.GetAllMetadata()) self.assertIsNone(untypedPrim.GetMetadata("hidden")) self.assertFalse(untypedPrim.HasAuthoredMetadata("hidden")) # Untyped prim still has no documentation even with API schemas applied. self.assertIsNone(untypedPrim.GetMetadata("documentation")) def test_TypedPrimOnStage(self): """ Tests the fallback properties of typed prims on a stage when API schemas are applied when the prim type does not start with API schemas. """ stage = Usd.Stage.CreateInMemory() # Add a typed prim. It has no API schemas but has properties from its # type schema. typedPrim = stage.DefinePrim("/TypedPrim", "TestTypedSchema") self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), []) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestTypedSchema') self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertEqual(typedPrim.GetPropertyNames(), ["testAttr", "testRel"]) # Add an api schemas to the prim's metadata. typedPrim.ApplyAPI(self.SingleApplyAPIType) typedPrim.ApplyAPI(self.MultiApplyAPIType, "garply") # Prim has the same type and now has API schemas. The properties have # been expanded to include properties from the API schemas self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:garply"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestTypedSchema') self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:garply"]) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:garply:bool_attr", "multi:garply:relationship", "multi:garply:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Property fallback comes from TestSingleApplyAPI attr = typedPrim.GetAttribute("single:token_attr") self.assertEqual(attr.Get(), "bar") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestMultiApplyAPI attr = typedPrim.GetAttribute("multi:garply:bool_attr") self.assertEqual(attr.Get(), True) self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestTypedSchema attr = typedPrim.GetAttribute("testAttr") self.assertEqual(attr.Get(), "foo") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Metadata "hidden" has a fallback value defined in TestTypedSchema. It # will be returned by GetMetadata and GetAllMetadata but will return # false for queries about whether it's authored self.assertEqual(typedPrim.GetAllMetadata()["hidden"], True) self.assertEqual(typedPrim.GetMetadata("hidden"), True) self.assertFalse(typedPrim.HasAuthoredMetadata("hidden")) self.assertFalse("hidden" in typedPrim.GetAllAuthoredMetadata()) # Documentation metadata comes from prim type definition even with API # schemas applied. self.assertEqual(typedPrim.GetMetadata("documentation"), "Testing typed schema") def test_TypedPrimsOnStageWithBuiltinAPISchemas(self): """ Tests the fallback properties of typed prims on a stage when new API schemas are applied to a prim whose type already has built-in applied API schemas. """ stage = Usd.Stage.CreateInMemory() # Add a typed prim. It has API schemas already from its prim definition # and has properties from both its type and its APIs. typedPrim = stage.DefinePrim("/TypedPrim", "TestWithBuiltinAppliedSchema") self.assertEqual(typedPrim.GetTypeName(), 'TestWithBuiltinAppliedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:builtin"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestWithBuiltinAppliedSchema') # Note that prim type info does NOT contain the built-in applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Add a new api schemas to the prim's metadata. typedPrim.ApplyAPI(self.MultiApplyAPIType, "garply") # Prim has the same type and now has both its original API schemas and # the new one. Note that the new schema was added using an explicit # list op but was still prepended to the original list. Built-in API # schemas cannot be deleted and any authored API schemas will always be # prepended to the built-ins. self.assertEqual(typedPrim.GetTypeName(), 'TestWithBuiltinAppliedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestMultiApplyAPI:garply", "TestSingleApplyAPI", "TestMultiApplyAPI:builtin"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestWithBuiltinAppliedSchema') # Note that prim type info does NOT contain the built-in applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestMultiApplyAPI:garply"]) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) # Properties have been expanded to include the new API schema self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "multi:garply:bool_attr", "multi:garply:relationship", "multi:garply:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Property fallback comes from TestSingleApplyAPI attr = typedPrim.GetAttribute("single:token_attr") self.assertEqual(attr.Get(), "bar") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestMultiApplyAPI attr = typedPrim.GetAttribute("multi:garply:bool_attr") self.assertEqual(attr.Get(), True) self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback actually comes from TestWithBuiltinAppliedSchema as # the typed schema overrides this property from its built-in API schema. attr = typedPrim.GetAttribute("multi:builtin:bool_attr") self.assertEqual(attr.Get(), False) self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestWithBuiltinAppliedSchema attr = typedPrim.GetAttribute("testAttr") self.assertEqual(attr.Get(), "foo") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Metadata "hidden" has a fallback value defined in # TestWithBuiltinAppliedSchema. It will be returned by GetMetadata and # GetAllMetadata but will return false for queries about whether it's # authored self.assertEqual(typedPrim.GetAllMetadata()["hidden"], False) self.assertEqual(typedPrim.GetMetadata("hidden"), False) self.assertFalse(typedPrim.HasAuthoredMetadata("hidden")) self.assertFalse("hidden" in typedPrim.GetAllAuthoredMetadata()) # Documentation metadata comes from prim type definition even with API # schemas applied. self.assertEqual(typedPrim.GetMetadata("documentation"), "Test with built-in API schemas") def test_TypedPrimsOnStageWithBuiltinReapply(self): """ Tests the fallback properties of typed prims on a stage when the same API schemas are applied again to a prim whose type already has applied API schemas. """ stage = Usd.Stage.CreateInMemory() # Add a typed prim. It has API schemas already from its prim definition # and has properties from both its type and its APIs. typedPrim = stage.DefinePrim("/TypedPrim", "TestWithBuiltinAppliedSchema") self.assertEqual(typedPrim.GetTypeName(), 'TestWithBuiltinAppliedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:builtin"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestWithBuiltinAppliedSchema') # Note that prim type info does NOT contain the built-in applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Property fallback comes from TestSingleApplyAPI attr = typedPrim.GetAttribute("single:token_attr") self.assertEqual(attr.Get(), "bar") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback actually comes from TestTypedSchema as the typed # schema overrides this property from its built-in API schema. attr = typedPrim.GetAttribute("multi:builtin:bool_attr") self.assertEqual(attr.Get(), False) self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestTypedSchema attr = typedPrim.GetAttribute("testAttr") self.assertEqual(attr.Get(), "foo") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Add the built-in api schemas again to the prim's metadata. typedPrim.ApplyAPI(self.MultiApplyAPIType, "builtin") typedPrim.ApplyAPI(self.SingleApplyAPIType) # Prim has the same type and now has both its original API schemas and # plus the same schemas again appended to the list (i.e. both schemas # now show up twice). self.assertEqual(typedPrim.GetTypeName(), 'TestWithBuiltinAppliedSchema') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestMultiApplyAPI:builtin", "TestSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:builtin"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestWithBuiltinAppliedSchema') # Note that prim type info does NOT contain the built-in applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestMultiApplyAPI:builtin", "TestSingleApplyAPI"]) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) # The list of properties hasn't changed as there are no "new" schemas, # however the defaults may have changed. self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Property fallback comes from TestSingleApplyAPI - no change attr = typedPrim.GetAttribute("single:token_attr") self.assertEqual(attr.Get(), "bar") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback has now changed from False to True as the # TestTypedSchema originally overrode the fallback from # TestMultiApplyAPI. But by applying TestMultiApplyAPI again with the # same instance, we've re-overridden the attribute getting the default # from the applied schema. attr = typedPrim.GetAttribute("multi:builtin:bool_attr") self.assertEqual(attr.Get(), True) self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Property fallback comes from TestTypedSchema - no change attr = typedPrim.GetAttribute("testAttr") self.assertEqual(attr.Get(), "foo") self.assertEqual(attr.GetResolveInfo().GetSource(), Usd.ResolveInfoSourceFallback) # Prim metadata is unchanged from the case above as there is still # no way for applied API schemas to impart prim metadata defaults. self.assertEqual(typedPrim.GetAllMetadata()["hidden"], False) self.assertEqual(typedPrim.GetMetadata("hidden"), False) self.assertFalse(typedPrim.HasAuthoredMetadata("hidden")) self.assertFalse("hidden" in typedPrim.GetAllAuthoredMetadata()) # Documentation metadata comes from prim type definition even with API # schemas applied. self.assertEqual(typedPrim.GetMetadata("documentation"), "Test with built-in API schemas") @unittest.skipIf(Tf.GetEnvSetting('USD_DISABLE_AUTO_APPLY_API_SCHEMAS'), "Auto apply API schemas are disabled") def test_TypedPrimsOnStageWithAutoAppliedAPIs(self): """ Tests the fallback properties of typed prims on a stage where API schemas are auto applied. """ stage = Usd.Stage.CreateInMemory() # Add a typed prim that has two types of built-in applied schemas. # TestMultiApplyAPI:builtin comes from the apiSchemas metadata defined # in TestTypedSchemaForAutoApply's schema definition. # TestSingleApplyAPI and TestMultiApplyAPI:autoFoo come from # TestTypedSchemaForAutoApply being listed in the "AutoApplyAPISchemas" # plugInfo metadata for both API schemas. # The built-in applied schemas that come from the apiSchemas metadata # will always be listed before (and be stronger than) any applied # schemas that come from apiSchemaAutoApplyTo. typedPrim = stage.DefinePrim("/TypedPrim", "TestTypedSchemaForAutoApply") self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchemaForAutoApply') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestMultiApplyAPI:builtin", "TestMultiApplyAPI:autoFoo", "TestSingleApplyAPI"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestTypedSchemaForAutoApply') # Note that prim type info does NOT contain the applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType)) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:autoFoo:bool_attr", "multi:autoFoo:relationship", "multi:autoFoo:token_attr", "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Add a concrete typed prim which receives an auto applied API schema. # TestSingleApplyAPI comes from TestTypedSchemaForAutoApplyConcreteBase # being listed in TestSingleApplyAPI's apiSchemaAutoApplyTo data. typedPrim.SetTypeName("TestTypedSchemaForAutoApplyConcreteBase") self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchemaForAutoApplyConcreteBase') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestTypedSchemaForAutoApplyConcreteBase') # Note that prim type info does NOT contain the auto applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Add a concrete typed prim which receives an auto applied API schema # because it is derived from a base class type that does. # TestSingleApplyAPI comes from the base class of this type, # TestTypedSchemaForAutoApplyConcreteBase, being listed in # TestSingleApplyAPI's apiSchemaAutoApplyTo data. typedPrim.SetTypeName("TestDerivedTypedSchemaForAutoApplyConcreteBase") self.assertEqual(typedPrim.GetTypeName(), 'TestDerivedTypedSchemaForAutoApplyConcreteBase') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestDerivedTypedSchemaForAutoApplyConcreteBase') # Note that prim type info does NOT contain the auto applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Add a concrete typed prim which receives an auto applied API schema # because it is derived from a base class type that does. # TestSingleApplyAPI comes from the base class of this type, # TestTypedSchemaForAutoApplyAbstractBase, being listed in # TestSingleApplyAPI's apiSchemaAutoApplyTo data. This is different # from case above in that the base class is an abstract type and cannot # be instantiated as a prim type, but API schemas can still be # designated to auto apply to abstract types to have the API applied # to prims of all derived types. typedPrim.SetTypeName("TestDerivedTypedSchemaForAutoApplyAbstractBase") self.assertEqual(typedPrim.GetTypeName(), 'TestDerivedTypedSchemaForAutoApplyAbstractBase') self.assertEqual(typedPrim.GetAppliedSchemas(), ['TestSingleApplyAPI']) self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), 'TestDerivedTypedSchemaForAutoApplyAbstractBase') # Note that prim type info does NOT contain the auto applied API # schemas from the concrete type's prim definition as these are not part # of the type identity. self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertTrue(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Verify that we can get the value of the auto apply API metadata for # TestSingleApplyAPI from the schema registry. self.assertEqual( Usd.SchemaRegistry.GetAutoApplyAPISchemas()['TestSingleApplyAPI'], ['TestTypedSchemaForAutoApplyConcreteBase', 'TestTypedSchemaForAutoApplyAbstractBase', 'TestAutoAppliedToAPI', 'TestTypedSchemaForAutoApply']) @unittest.skipIf(not Tf.GetEnvSetting('USD_DISABLE_AUTO_APPLY_API_SCHEMAS'), "Auto apply API schemas are not disabled") def test_TypedPrimsOnStageWithAutoAppliedAPIs_AutoApplyDisabled(self): """ Tests the disabling of auto apply schemas through the environment variable USD_DISABLE_AUTO_APPLY_API_SCHEMAS. """ stage = Usd.Stage.CreateInMemory() # Add a typed prim that has two types of built-in applied schemas. # TestMultiApplyAPI:builtin comes from the apiSchemas metadata defined # in TestTypedSchemaForAutoApply's schema definition and is NOT affected # by disabling auto apply API schemas. # # TestSingleApplyAPI and TestMultiApplyAPI:autoFoo would come from # TestTypedSchemaForAutoApply being listed in the "AutoApplyAPISchemas" # plugInfo metadata for both API schemas, but with auto apply disabled, # they are not applied to this type. typedPrim = stage.DefinePrim("/TypedPrim", "TestTypedSchemaForAutoApply") self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchemaForAutoApply') self.assertEqual(typedPrim.GetAppliedSchemas(), ["TestMultiApplyAPI:builtin"]) self.assertTrue(typedPrim.HasAPI(self.MultiApplyAPIType, 'builtin')) self.assertFalse(typedPrim.HasAPI(self.MultiApplyAPIType, 'autoFoo')) self.assertFalse(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "testAttr", "testRel"]) # Add a concrete typed prim which receives an auto applied API schema. # TestSingleApplyAPI would be auto applied to this type, but with auto # apply disable, this type has no applied API schemas. typedPrim.SetTypeName("TestTypedSchemaForAutoApplyConcreteBase") self.assertEqual(typedPrim.GetTypeName(), 'TestTypedSchemaForAutoApplyConcreteBase') self.assertEqual(typedPrim.GetAppliedSchemas(), []) self.assertFalse(typedPrim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(typedPrim.GetPropertyNames(), [ "testAttr", "testRel"]) # Verify that the auto apply API schema dictionary is empty when auto # apply is disabled.. self.assertEqual(Usd.SchemaRegistry.GetAutoApplyAPISchemas(), {}) def test_ApplyRemoveAPI(self): """ Tests the detail of the Apply and Remove API for API schemas. """ stage = Usd.Stage.CreateInMemory() rootLayer = stage.GetRootLayer() sessionLayer = stage.GetSessionLayer() self.assertTrue(rootLayer) self.assertTrue(sessionLayer) # Add a basic prim with no type. It has no applied schemas or properties. prim = stage.DefinePrim("/Prim") self.assertEqual(prim.GetAppliedSchemas(), []) self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) # Helper function for verifying the state of the 'apiSchemas' list op # field in the prim spec for the test prim on the specified layer. def _VerifyListOp(layer, explicit = [], prepended = [], appended = [], deleted = []): spec = layer.GetPrimAtPath('/Prim') listOp = spec.GetInfo('apiSchemas') self.assertEqual(listOp.explicitItems, explicit) self.assertEqual(listOp.prependedItems, prepended) self.assertEqual(listOp.appendedItems, appended) self.assertEqual(listOp.deletedItems, deleted) # Apply a single api schema withe default edit target. Adds to the end # prepend list. prim.ApplyAPI(self.SingleApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) self.assertTrue(prim.HasAPI(self.SingleApplyAPIType)) _VerifyListOp(rootLayer, prepended = ["TestSingleApplyAPI"]) # Apply the same API schema again. This will not update the list. prim.ApplyAPI(self.SingleApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) self.assertTrue(prim.HasAPI(self.SingleApplyAPIType)) _VerifyListOp(rootLayer, prepended = ["TestSingleApplyAPI"]) # Remove the API schema. This removes the schema from the prepend and # puts in it the deleted list. prim.RemoveAPI(self.SingleApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer, deleted = ["TestSingleApplyAPI"]) # Remove the same API again. This is a no op. prim.RemoveAPI(self.SingleApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer, deleted = ["TestSingleApplyAPI"]) # Remove a multi apply schema which is not currently in the list. The # This schema instance name is still added to the deleted list. prim.RemoveAPI(self.MultiApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer, deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:foo"]) # Apply the same instance of the multi-apply schema we just deleted. It # is added to the prepended but is NOT removed from the deleted list. # It still ends up in the composed API schemas since deletes are # processed before prepends in the same list op. prim.ApplyAPI(self.MultiApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:foo"]) _VerifyListOp(rootLayer, prepended = ["TestMultiApplyAPI:foo"], deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:foo"]) # Apply a different instance of the multi-apply schema. Its is added to # the end of the prepends list. prim.ApplyAPI(self.MultiApplyAPIType, "bar") self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"]) _VerifyListOp(rootLayer, prepended = ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"], deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:foo"]) # Remove the "bar" instance of the multi-apply schema on the session # layer. The schema is added to the deleted list on the session layer # and root layer remains the same. It does not show up in the composed # API schemas after composition with Usd.EditContext(stage, sessionLayer): prim.RemoveAPI(self.MultiApplyAPIType, "bar") self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:foo"]) _VerifyListOp(rootLayer, prepended = ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"], deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:foo"]) _VerifyListOp(sessionLayer, deleted = ["TestMultiApplyAPI:bar"]) # Re-apply the "bar" instance of the multi-apply schema on the session # layer. It is added to the prepend list in the session layer but still # remains in the delete list. Note that the "bar" instance is back in # the composed API schemas list but now it is first instead of second # like it was before as it get deleted and prepended by the session # layer. with Usd.EditContext(stage, sessionLayer): prim.ApplyAPI(self.MultiApplyAPIType, "bar") self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:bar", "TestMultiApplyAPI:foo"]) _VerifyListOp(rootLayer, prepended = ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"], deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:foo"]) _VerifyListOp(sessionLayer, prepended = ["TestMultiApplyAPI:bar"], deleted = ["TestMultiApplyAPI:bar"]) # These next few cases verifies the behavior when the list op has # appends or explicit entries. (Note that we don't define behaviors for # add or reorder). # Update the session layer to have an appended API schema. with Usd.EditContext(stage, sessionLayer): appendedListOp = Sdf.TokenListOp() appendedListOp.appendedItems = ["TestMultiApplyAPI:bar"] prim.SetMetadata('apiSchemas', appendedListOp) # Update the root layer to have an explicit list op. explicitListOp = Sdf.TokenListOp() explicitListOp.explicitItems = ["TestMultiApplyAPI:foo"] prim.SetMetadata('apiSchemas', explicitListOp) # Verify the initial authored and composed lists. self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"]) _VerifyListOp(rootLayer, explicit = ["TestMultiApplyAPI:foo"]) _VerifyListOp(sessionLayer, appended = ["TestMultiApplyAPI:bar"]) # On the session and root layers, try to apply the API schema that # is already in each respective list. This will be a no op even though # the schemas aren't in the prepended lists. with Usd.EditContext(stage, sessionLayer): prim.ApplyAPI(self.MultiApplyAPIType, "bar") prim.ApplyAPI(self.MultiApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), ["TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"]) _VerifyListOp(rootLayer, explicit = ["TestMultiApplyAPI:foo"]) _VerifyListOp(sessionLayer, appended = ["TestMultiApplyAPI:bar"]) # Apply the single apply schema to both layers. The root layer adds it # to the end of its explicit list while the session layer will add it # the prepends. The composed API schemas will only contain the schema # once with the prepend from the stronger session layer winning for # ordering. with Usd.EditContext(stage, sessionLayer): prim.ApplyAPI(self.SingleApplyAPIType) prim.ApplyAPI(self.SingleApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:foo", "TestMultiApplyAPI:bar"]) _VerifyListOp(rootLayer, explicit = ["TestMultiApplyAPI:foo", "TestSingleApplyAPI"]) _VerifyListOp(sessionLayer, prepended = ["TestSingleApplyAPI"], appended = ["TestMultiApplyAPI:bar"]) # Remove the starting API schemas from the root and session layers. In # the root layer it is just removed from the explicit list. In the # session layer it is removed from appends and added to the deletes. with Usd.EditContext(stage, sessionLayer): prim.RemoveAPI(self.MultiApplyAPIType, "bar") prim.RemoveAPI(self.MultiApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), ["TestSingleApplyAPI"]) _VerifyListOp(rootLayer, explicit = ["TestSingleApplyAPI"]) _VerifyListOp(sessionLayer, prepended = ["TestSingleApplyAPI"], deleted = ["TestMultiApplyAPI:bar"]) # Clear the apiSchemas in both layers for the next tests. # XXX: Should we have additional API for clearing the list op like we # do for other list op fields? with Usd.EditContext(stage, sessionLayer): prim.SetMetadata('apiSchemas', Sdf.TokenListOp()) prim.SetMetadata('apiSchemas', Sdf.TokenListOp()) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) _VerifyListOp(sessionLayer) # Trying to apply or remove a multi-apply schema with no instance name # is an error. with self.assertRaises(Tf.ErrorException): prim.ApplyAPI(self.MultiApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) with self.assertRaises(Tf.ErrorException): prim.RemoveAPI(self.MultiApplyAPIType) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) # Trying to apply or remove a single apply schema with an instance name # is an error. with self.assertRaises(Tf.ErrorException): prim.ApplyAPI(self.SingleApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) with self.assertRaises(Tf.ErrorException): prim.RemoveAPI(self.SingleApplyAPIType, "foo") self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) # Trying to apply or remove a no apply schema is an error. with self.assertRaises(Tf.ErrorException): prim.ApplyAPI(Usd.ModelAPI) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) with self.assertRaises(Tf.ErrorException): prim.RemoveAPI(Usd.ModelAPI) self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer) # AddAPITypeName will just add by schema type name with no validity # checks. But it still won't add duplicates. # # Valid type names prim.AddAppliedSchema("TestSingleApplyAPI") prim.AddAppliedSchema("TestMultiApplyAPI:bar") # Invalid type names. prim.AddAppliedSchema("BogusTypeName") prim.AddAppliedSchema("TestMultiApplyAPI") # Duplicate. prim.AddAppliedSchema("TestSingleApplyAPI") # Even though invalid type names get added to the apiSchemas metadata, # they won't show up in GetAppliedSchemas as they won't be composed into # the prim's UsdPrimDefinition. self.assertEqual(prim.GetAppliedSchemas(), ["TestSingleApplyAPI", "TestMultiApplyAPI:bar"]) _VerifyListOp(rootLayer, prepended = ["TestSingleApplyAPI", "TestMultiApplyAPI:bar", "BogusTypeName", "TestMultiApplyAPI"]) # RemoveAPITypeName will just delete by schema type name with no # validity checks. But it still won't add duplicate delete entries. # # Valid type names prim.RemoveAppliedSchema("TestSingleApplyAPI") prim.RemoveAppliedSchema("TestMultiApplyAPI:bar") # Invalid type names. prim.RemoveAppliedSchema("BogusTypeName") prim.RemoveAppliedSchema("TestMultiApplyAPI") # Duplicate. prim.RemoveAppliedSchema("TestSingleApplyAPI") self.assertEqual(prim.GetAppliedSchemas(), []) _VerifyListOp(rootLayer, deleted = ["TestSingleApplyAPI", "TestMultiApplyAPI:bar", "BogusTypeName", "TestMultiApplyAPI"]) def test_CanApplyAPI(self): """ Tests the details of the Usd.Prim.CanApplyAPI. """ stage = Usd.Stage.CreateInMemory() rootLayer = stage.GetRootLayer() sessionLayer = stage.GetSessionLayer() self.assertTrue(rootLayer) self.assertTrue(sessionLayer) # Add prims of various types to test CanApplyAPI. prim = stage.DefinePrim( "/Prim") prim2 = stage.DefinePrim( "/Prim2", "TestTypedSchema") prim3 = stage.DefinePrim( "/Prim3", "TestTypedSchemaForAutoApply") prim4 = stage.DefinePrim( "/Prim4", "TestDerivedTypedSchemaForAutoApplyConcreteBase") prim5 = stage.DefinePrim( "/Prim5", "TestDerivedTypedSchemaForAutoApplyAbstractBase") # Single apply schema with no specified "apiSchemaCanOnlyApplyTo" # metadata. Can apply to all prims. self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestSingleApplyAPI"), []) self.assertTrue(prim.CanApplyAPI(self.SingleApplyAPIType)) self.assertTrue(prim2.CanApplyAPI(self.SingleApplyAPIType)) self.assertTrue(prim3.CanApplyAPI(self.SingleApplyAPIType)) self.assertTrue(prim4.CanApplyAPI(self.SingleApplyAPIType)) self.assertTrue(prim5.CanApplyAPI(self.SingleApplyAPIType)) # Multiple apply schema with no specified "apiSchemaCanOnlyApplyTo" # metadata and no "allowedInstanceNames". Can apply to all prims with # all instance names (with the notable exception of instance names that # match a property name from the schema). self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiApplyAPI", "foo"), []) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "foo")) self.assertTrue(prim.CanApplyAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim2.CanApplyAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim3.CanApplyAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim4.CanApplyAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim5.CanApplyAPI(self.MultiApplyAPIType, "foo")) self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiApplyAPI", "bar"), []) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "bar")) self.assertTrue(prim.CanApplyAPI(self.MultiApplyAPIType, "bar")) self.assertTrue(prim2.CanApplyAPI(self.MultiApplyAPIType, "bar")) self.assertTrue(prim3.CanApplyAPI(self.MultiApplyAPIType, "bar")) self.assertTrue(prim4.CanApplyAPI(self.MultiApplyAPIType, "bar")) self.assertTrue(prim5.CanApplyAPI(self.MultiApplyAPIType, "bar")) self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiApplyAPI", "baz"), []) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "baz")) self.assertTrue(prim.CanApplyAPI(self.MultiApplyAPIType, "baz")) self.assertTrue(prim2.CanApplyAPI(self.MultiApplyAPIType, "baz")) self.assertTrue(prim3.CanApplyAPI(self.MultiApplyAPIType, "baz")) self.assertTrue(prim4.CanApplyAPI(self.MultiApplyAPIType, "baz")) self.assertTrue(prim5.CanApplyAPI(self.MultiApplyAPIType, "baz")) self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiApplyAPI", "Bar"), []) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "Bar")) self.assertTrue(prim.CanApplyAPI(self.MultiApplyAPIType, "Bar")) self.assertTrue(prim2.CanApplyAPI(self.MultiApplyAPIType, "Bar")) self.assertTrue(prim3.CanApplyAPI(self.MultiApplyAPIType, "Bar")) self.assertTrue(prim4.CanApplyAPI(self.MultiApplyAPIType, "Bar")) self.assertTrue(prim5.CanApplyAPI(self.MultiApplyAPIType, "Bar")) self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiApplyAPI", "qux"), []) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "qux")) self.assertTrue(prim.CanApplyAPI(self.MultiApplyAPIType, "qux")) self.assertTrue(prim2.CanApplyAPI(self.MultiApplyAPIType, "qux")) self.assertTrue(prim3.CanApplyAPI(self.MultiApplyAPIType, "qux")) self.assertTrue(prim4.CanApplyAPI(self.MultiApplyAPIType, "qux")) self.assertTrue(prim5.CanApplyAPI(self.MultiApplyAPIType, "qux")) # As mentioned above, property names of the API schema are not valid # instance names and will return false for CanApplyAPI self.assertFalse(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "bool_attr")) self.assertFalse(prim.CanApplyAPI(self.MultiApplyAPIType, "bool_attr")) self.assertFalse(prim2.CanApplyAPI(self.MultiApplyAPIType, "bool_attr")) self.assertFalse(prim3.CanApplyAPI(self.MultiApplyAPIType, "bool_attr")) self.assertFalse(prim4.CanApplyAPI(self.MultiApplyAPIType, "bool_attr")) self.assertFalse(prim5.CanApplyAPI(self.MultiApplyAPIType, "bool_attr")) self.assertFalse(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiApplyAPI", "relationship")) self.assertFalse(prim.CanApplyAPI(self.MultiApplyAPIType, "relationship")) self.assertFalse(prim2.CanApplyAPI(self.MultiApplyAPIType, "relationship")) self.assertFalse(prim3.CanApplyAPI(self.MultiApplyAPIType, "relationship")) self.assertFalse(prim4.CanApplyAPI(self.MultiApplyAPIType, "relationship")) self.assertFalse(prim5.CanApplyAPI(self.MultiApplyAPIType, "relationship")) # Single apply API schema that does specify an "apiSchemaCanOnlyApplyTo" # list. prim3 is a type in the list and prim4 derives from a type in the # list so only these return true. self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestSingleCanApplyAPI"), ["TestTypedSchemaForAutoApply", "TestTypedSchemaForAutoApplyConcreteBase"]) self.assertFalse(prim.CanApplyAPI(self.SingleCanApplyAPIType)) self.assertFalse(prim2.CanApplyAPI(self.SingleCanApplyAPIType)) self.assertTrue(prim3.CanApplyAPI(self.SingleCanApplyAPIType)) self.assertTrue(prim4.CanApplyAPI(self.SingleCanApplyAPIType)) self.assertFalse(prim5.CanApplyAPI(self.SingleCanApplyAPIType)) # Multiple apply API schema that specifies allow instance names # "foo", "bar", and "baz". All other instance names aren't allowed # and will return false. self.assertFalse(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiCanApplyAPI", "Bar")) self.assertFalse(prim.CanApplyAPI(self.MultiCanApplyAPIType, "Bar")) self.assertFalse(prim2.CanApplyAPI(self.MultiCanApplyAPIType, "Bar")) self.assertFalse(prim3.CanApplyAPI(self.MultiCanApplyAPIType, "Bar")) self.assertFalse(prim4.CanApplyAPI(self.MultiCanApplyAPIType, "Bar")) self.assertFalse(prim5.CanApplyAPI(self.MultiCanApplyAPIType, "Bar")) self.assertFalse(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiCanApplyAPI", "qux")) self.assertFalse(prim.CanApplyAPI(self.MultiCanApplyAPIType, "qux")) self.assertFalse(prim2.CanApplyAPI(self.MultiCanApplyAPIType, "qux")) self.assertFalse(prim3.CanApplyAPI(self.MultiCanApplyAPIType, "qux")) self.assertFalse(prim4.CanApplyAPI(self.MultiCanApplyAPIType, "qux")) self.assertFalse(prim5.CanApplyAPI(self.MultiCanApplyAPIType, "qux")) # Same multiple apply API schema with allowed instance name "baz". # The API schema type specifies an "apiSchemaCanOnlyApplyTo" list so # this instance can only be applied to those types. prim3 is a type in # the list and prim5 derives from a type in the list so only these # return true. self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "baz"), ["TestTypedSchemaForAutoApply", "TestTypedSchemaForAutoApplyAbstractBase"]) self.assertEqual( Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "baz"), Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI")) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiCanApplyAPI", "baz")) self.assertFalse(prim.CanApplyAPI(self.MultiCanApplyAPIType, "baz")) self.assertFalse(prim2.CanApplyAPI(self.MultiCanApplyAPIType, "baz")) self.assertTrue(prim3.CanApplyAPI(self.MultiCanApplyAPIType, "baz")) self.assertFalse(prim4.CanApplyAPI(self.MultiCanApplyAPIType, "baz")) self.assertTrue(prim5.CanApplyAPI(self.MultiCanApplyAPIType, "baz")) # Same multiple apply API schema with allowed instance name "foo". # The API schema type specifies an "apiSchemaCanOnlyApplyTo" list # specifically for "foo" so this instance can only be applied to those # types. prim3 is a type in the list and prim4 derives from a type in # the list so only these return true. self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "foo"), ["TestTypedSchemaForAutoApply", "TestTypedSchemaForAutoApplyConcreteBase"]) self.assertNotEqual( Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "foo"), Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI")) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiCanApplyAPI", "foo")) self.assertFalse(prim.CanApplyAPI(self.MultiCanApplyAPIType, "foo")) self.assertFalse(prim2.CanApplyAPI(self.MultiCanApplyAPIType, "foo")) self.assertTrue(prim3.CanApplyAPI(self.MultiCanApplyAPIType, "foo")) self.assertTrue(prim4.CanApplyAPI(self.MultiCanApplyAPIType, "foo")) self.assertFalse(prim5.CanApplyAPI(self.MultiCanApplyAPIType, "foo")) # Same multiple apply API schema with allowed instance name "bar". # The API schema type specifies yet another "apiSchemaCanOnlyApplyTo" # list specifically for "bar" so this instance can only be applied to # those types. prim4 and prim5 each derive from a different type in # the list so only these return true. self.assertEqual(Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "bar"), ["TestTypedSchemaForAutoApplyAbstractBase", "TestTypedSchemaForAutoApplyConcreteBase"]) self.assertNotEqual( Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI", "bar"), Usd.SchemaRegistry.GetAPISchemaCanOnlyApplyToTypeNames( "TestMultiCanApplyAPI")) self.assertTrue(Usd.SchemaRegistry.IsAllowedAPISchemaInstanceName( "TestMultiCanApplyAPI", "bar")) self.assertFalse(prim.CanApplyAPI(self.MultiCanApplyAPIType, "bar")) self.assertFalse(prim2.CanApplyAPI(self.MultiCanApplyAPIType, "bar")) self.assertFalse(prim3.CanApplyAPI(self.MultiCanApplyAPIType, "bar")) self.assertTrue(prim4.CanApplyAPI(self.MultiCanApplyAPIType, "bar")) self.assertTrue(prim5.CanApplyAPI(self.MultiCanApplyAPIType, "bar")) # Error conditions # Coding error if called on single apply schema with an instance name. with self.assertRaises(Tf.ErrorException): self.assertFalse(prim.CanApplyAPI(self.SingleApplyAPIType, "foo")) # Coding error if called on multiple apply schema without an instance # name. with self.assertRaises(Tf.ErrorException): self.assertFalse(prim.CanApplyAPI(self.MultiApplyAPIType)) # Coding error if called on multiple apply schema with an empty instance # name. with self.assertRaises(Tf.ErrorException): self.assertFalse(prim.CanApplyAPI(self.MultiApplyAPIType, "")) # Verify whyNot annotations when CanApplyAPI is false. result = prim4.CanApplyAPI(self.MultiCanApplyAPIType, "bar") self.assertTrue(result) self.assertEqual(result.whyNot, "") result = prim.CanApplyAPI(self.MultiCanApplyAPIType, "qux") self.assertFalse(result) self.assertEqual(result.whyNot, "'qux' is not an allowed instance name for multiple " "apply API schema 'TestMultiCanApplyAPI'.") result = prim.CanApplyAPI(self.MultiCanApplyAPIType, "bar") self.assertFalse(result) self.assertEqual(result.whyNot, "API schema 'TestMultiCanApplyAPI:bar' can only be " "applied to prims of the following types: " "TestTypedSchemaForAutoApplyAbstractBase, " "TestTypedSchemaForAutoApplyConcreteBase.") result = prim.CanApplyAPI(self.MultiApplyAPIType, "bool_attr") self.assertFalse(result) self.assertEqual(result.whyNot, "'bool_attr' is not an allowed instance name for " "multiple apply API schema 'TestMultiApplyAPI'.") def test_NestedSingleApplyAPISchemas(self): """ Tests the application of single apply API schemas that have nested built-in API schemas """ stage = Usd.Stage.CreateInMemory() # Simple helper for testing that a prim has expected attributes that # resolve to expected values. def _VerifyAttrValues(prim, expectedAttrValues): values = {name : prim.GetAttribute(name).Get() for name in expectedAttrValues.keys()} self.assertEqual(values, expectedAttrValues) # Add a prim with no type and apply the TestNestedInnerSingleApplyAPI. innerSinglePrim = stage.DefinePrim("/InnerSingle") innerSinglePrim.ApplyAPI(self.NestedInnerSingleApplyAPIType) # The authored applied API schemas for the prim is only the applied # TestNestedInnerSingleApplyAPI. self.assertEqual(innerSinglePrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(innerSinglePrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedInnerSingleApplyAPI"]) # The composed applied API schemas however also contain the # TestSingleApplyAPI and the "bar" instance of TestMultiApplyAPI as # these are built-in APIs of TestNestedInnerSingleApplyAPI expectedAPISchemas = [ "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar"] self.assertEqual(innerSinglePrim.GetAppliedSchemas(), expectedAPISchemas) # The prim "has" all these built-in APIs as well. self.assertTrue(innerSinglePrim.HasAPI(self.NestedInnerSingleApplyAPIType)) self.assertTrue(innerSinglePrim.HasAPI(self.SingleApplyAPIType)) self.assertTrue(innerSinglePrim.HasAPI(self.MultiApplyAPIType)) self.assertTrue(innerSinglePrim.HasAPI(self.MultiApplyAPIType, "bar")) # Properties come from all composed built-in APIs expectedPropNames = [ # Properties from TestNestedInnerSingleApplyAPI "innerSingle:int_attr", "innerSingle:relationship", "innerSingle:token_attr", # Properties from TestMultiApplyAPI:bar "multi:bar:bool_attr", "multi:bar:relationship", "multi:bar:token_attr", # Properties from TestSingleApplyAPI "single:bool_attr", "single:relationship", "single:token_attr"] self.assertEqual(innerSinglePrim.GetPropertyNames(), expectedPropNames) # Verify that the attribute fallback values come from the API schemas # that define them. The attribute "multi:bar:token_attr" is defined in # TestNestedInnerSingleApplyAPI and overrides the attr fallback value # defined in TestMultiApplyAPI:bar expectedAttrValues = { "multi:bar:token_attr" : "inner_override", "multi:bar:bool_attr" : True, "innerSingle:token_attr" : "inner", "innerSingle:int_attr" : 3, "single:token_attr" : "bar", "single:bool_attr" : True} _VerifyAttrValues(innerSinglePrim, expectedAttrValues) # Get the prim definition for the API schema and verify its applied # API schemas and properties match what was imparted on the prim. innerSingleApplyAPIDef = \ Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedInnerSingleApplyAPI") self.assertTrue(innerSingleApplyAPIDef) self.assertEqual(innerSingleApplyAPIDef.GetAppliedAPISchemas(), expectedAPISchemas) self.assertEqual(sorted(innerSingleApplyAPIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(innerSingleApplyAPIDef.GetDocumentation(), "Test nested single apply API schema: inner schema") # Add a prim with no type and apply the TestNestedOuterSingleApplyAPI. outerSinglePrim = stage.DefinePrim("/OuterSingle") outerSinglePrim.ApplyAPI(self.NestedOuterSingleApplyAPIType) # The authored applied API schemas for the prim is only the applied # TestNestedOuterSingleApplyAPI. self.assertEqual(outerSinglePrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(outerSinglePrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedOuterSingleApplyAPI"]) # The composed applied API schemas however also contain the # the "foo" instance of TestMultiApplyAPI and # TestNestedInnerSingleApplyAPI and as these are built-in APIs of # TestNestedOuterSingleApplyAPI. However, because # TestNestedInnerSingleApplyAPI has its own built-in API schemas, those # are also pulled into the composed applied API schemas for this prim self.assertEqual(outerSinglePrim.GetTypeName(), '') expectedAPISchemas = [ "TestNestedOuterSingleApplyAPI", "TestMultiApplyAPI:foo", "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar"] self.assertEqual(outerSinglePrim.GetAppliedSchemas(), expectedAPISchemas) # Properties come from all composed built-in APIs expectedPropNames = [ "innerSingle:int_attr", "innerSingle:relationship", "innerSingle:token_attr", # Properties from TestMultiApplyAPI:bar (included from # TestNestedInnerSingleApplyAPI) "multi:bar:bool_attr", "multi:bar:relationship", "multi:bar:token_attr", # Properties from TestMultiApplyAPI:foo "multi:foo:bool_attr", "multi:foo:relationship", "multi:foo:token_attr", # Properties from TestNestedOuterSingleApplyAPI "outerSingle:int_attr", "outerSingle:relationship", "outerSingle:token_attr", # Properties from TestSingleApplyAPI (included from # TestNestedInnerSingleApplyAPI) "single:bool_attr", "single:relationship", "single:token_attr"] self.assertEqual(outerSinglePrim.GetPropertyNames(), expectedPropNames) # Verify that the attribute fallback values come from the API schemas # that define them. The attribute override for "multi:bar:token_attr" # from TestNestedInnerSingleApplyAPI still comes through. # Also The attribute "single:token_attr" is defined in # TestNestedOuterSingleApplyAPI and overrides the attr fallback value # defined in TestSingleApplyAPI expectedAttrValues = { "innerSingle:token_attr" : "inner", "innerSingle:int_attr" : 3, "multi:bar:token_attr" : "inner_override", "multi:bar:bool_attr" : True, "multi:foo:token_attr" : "foo", "multi:foo:bool_attr" : True, "outerSingle:token_attr" : "outer", "outerSingle:int_attr" : 4, "single:token_attr" : "outer_override", "single:bool_attr" : True} _VerifyAttrValues(outerSinglePrim, expectedAttrValues) # Get the prim definition for the API schema and verify its applied # API schemas and properties match what was imparted on the prim. outerSingleApplyAPIDef = \ Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedOuterSingleApplyAPI") self.assertTrue(outerSingleApplyAPIDef) self.assertEqual(outerSingleApplyAPIDef.GetAppliedAPISchemas(), expectedAPISchemas) self.assertEqual(sorted(outerSingleApplyAPIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(outerSingleApplyAPIDef.GetDocumentation(), "Test nested single apply API schema: outer schema") # Apply the TestNestedInnerSingleApplyAPI to the same prim. This API # is already included through the TestNestedOuterSingleApplyAPI. outerSinglePrim.ApplyAPI(self.NestedInnerSingleApplyAPIType) # The authored applied API schemas for the prim now contain both the # applied APIs. self.assertEqual(outerSinglePrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(outerSinglePrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedOuterSingleApplyAPI", "TestNestedInnerSingleApplyAPI"]) # The composed applied API schemas are fully expanded from both authored # APIs and will contain duplicates. We don't check for duplicates that # occur because different authored APIs include the same applied schema # even though we do remove duplicates when determining what API schemas # a single API includes. self.assertEqual(outerSinglePrim.GetTypeName(), '') expectedAPISchemas = [ # API schemas from expanded TestNestedOuterSingleApplyAPI "TestNestedOuterSingleApplyAPI", "TestMultiApplyAPI:foo", "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar", # API schemas from expanded TestNestedInnerSingleApplyAPI (even # though they're already in the list) "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar"] self.assertEqual(outerSinglePrim.GetAppliedSchemas(), expectedAPISchemas) # The properties list and attribute values haven't changed though # because no actual new API schemas were added and the strength order # of the APIs haven't changed. self.assertEqual(outerSinglePrim.GetPropertyNames(), expectedPropNames) _VerifyAttrValues(outerSinglePrim, expectedAttrValues) # Now let's swap the order of these two APIs so that the inner comes # before the outer. outerSinglePrim.RemoveAPI(self.NestedOuterSingleApplyAPIType) outerSinglePrim.ApplyAPI(self.NestedOuterSingleApplyAPIType) self.assertEqual(outerSinglePrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedInnerSingleApplyAPI", "TestNestedOuterSingleApplyAPI"]) # The order of the expanded API schemas has now changed too. expectedAPISchemas = [ # API schemas from expanded TestNestedInnerSingleApplyAPI "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar", # API schemas from expanded TestNestedOuterSingleApplyAPI "TestNestedOuterSingleApplyAPI", "TestMultiApplyAPI:foo", "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar"] self.assertEqual(outerSinglePrim.GetAppliedSchemas(), expectedAPISchemas) # Once again The properties list doesn't change. self.assertEqual(outerSinglePrim.GetPropertyNames(), expectedPropNames) # However, the attribute value for single:token_attr has changed # because the override from TestNestedOuterSingleApplyAPI is no longer # stronger than the value from TestSingleApplyAPI as the first instance # of TestSingleApplyAPI now comes before it. expectedAttrValues["single:token_attr"] = "bar" _VerifyAttrValues(outerSinglePrim, expectedAttrValues) def test_NestedMultiApplyAPISchemas(self): """ Tests the application of multiple apply API schemas that have nested built-in API schemas """ stage = Usd.Stage.CreateInMemory() # Simple helper for testing that a prim has expected attributes that # resolve to expected values. def _VerifyAttrValues(prim, expectedAttrValues): values = {name : prim.GetAttribute(name).Get() for name in expectedAttrValues.keys()} self.assertEqual(values, expectedAttrValues) # Add a prim with no type and apply the # TestNestedInnerMultiApplyDerivedAPI using the instance "foo". innerMultiPrim = stage.DefinePrim("/InnerMulti") innerMultiPrim.ApplyAPI(self.NestedInnerMultiApplyDerivedAPIType, "foo") # The authored applied API schemas for the prim is only the "foo" # instance of the applied TestNestedInnerMultiApplyDerivedAPI. self.assertEqual(innerMultiPrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(innerMultiPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedInnerMultiApplyDerivedAPI:foo"]) # The composed applied API schemas however also contain the # the "foo" instance of TestNestedInnerMultiApplyBaseAPI as it is a # built-in API of TestNestedInnerMultiApplyDerivedAPI expectedAPISchemas = [ "TestNestedInnerMultiApplyDerivedAPI:foo", "TestNestedInnerMultiApplyBaseAPI:foo"] self.assertEqual(innerMultiPrim.GetAppliedSchemas(), expectedAPISchemas) # The prim "has" all these built-in APIs as well. self.assertTrue(innerMultiPrim.HasAPI(self.NestedInnerMultiApplyDerivedAPIType)) self.assertTrue(innerMultiPrim.HasAPI(self.NestedInnerMultiApplyBaseAPIType)) self.assertTrue(innerMultiPrim.HasAPI(self.NestedInnerMultiApplyDerivedAPIType, "foo")) self.assertTrue(innerMultiPrim.HasAPI(self.NestedInnerMultiApplyBaseAPIType, "foo")) # Properties come from all composed built-in APIs expectedPropNames = [ # Properties from TestNestedInnerMultiApplyDerivedAPI:foo "innerMulti:foo:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo "innerMulti:foo:int_attr", "innerMulti:foo:relationship", "innerMulti:foo:token_attr"] self.assertEqual(innerMultiPrim.GetPropertyNames(), expectedPropNames) # Verify that the attribute fallback values come from the API schemas # that define them. The attribute "innerMulti:foo:token_attr" is defined # in TestNestedInnerMultiApplyDerivedAPI and overrides the attr fallback # value defined in TestNestedInnerMultiApplyBaseAPI expectedAttrValues = { "innerMulti:foo:derived:int_attr" : 4, "innerMulti:foo:int_attr" : 3, "innerMulti:foo:token_attr" : "inner_derived"} _VerifyAttrValues(innerMultiPrim, expectedAttrValues) # Apply the TestNestedInnerMultiApplyDerivedAPI to the same prim again, # now with the instance "bar" innerMultiPrim.ApplyAPI(self.NestedInnerMultiApplyDerivedAPIType, "bar") self.assertEqual(innerMultiPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedInnerMultiApplyDerivedAPI:foo", "TestNestedInnerMultiApplyDerivedAPI:bar"]) # Now the same API schemas included "foo" are also included for "bar" expectedAPISchemas = [ "TestNestedInnerMultiApplyDerivedAPI:foo", "TestNestedInnerMultiApplyBaseAPI:foo", "TestNestedInnerMultiApplyDerivedAPI:bar", "TestNestedInnerMultiApplyBaseAPI:bar"] self.assertEqual(innerMultiPrim.GetAppliedSchemas(), expectedAPISchemas) # There are now also "bar" instances of all the same properties. expectedPropNames = [ "innerMulti:bar:derived:int_attr", "innerMulti:bar:int_attr", "innerMulti:bar:relationship", "innerMulti:bar:token_attr", "innerMulti:foo:derived:int_attr", "innerMulti:foo:int_attr", "innerMulti:foo:relationship", "innerMulti:foo:token_attr"] self.assertEqual(innerMultiPrim.GetPropertyNames(), expectedPropNames) # And the "bar" instances of the attributes have the same fallback # values. expectedAttrValues = { "innerMulti:foo:derived:int_attr" : 4, "innerMulti:foo:int_attr" : 3, "innerMulti:foo:token_attr" : "inner_derived", "innerMulti:bar:derived:int_attr" : 4, "innerMulti:bar:int_attr" : 3, "innerMulti:bar:token_attr" : "inner_derived"} _VerifyAttrValues(innerMultiPrim, expectedAttrValues) # Get the prim definition for the API schema and verify its applied # API schemas and properties are template versions of the proeperties. innerMultiApplyAPIDef = \ Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedInnerMultiApplyDerivedAPI") self.assertTrue(innerMultiApplyAPIDef) expectedAPISchemas = [ "TestNestedInnerMultiApplyDerivedAPI:__INSTANCE_NAME__", "TestNestedInnerMultiApplyBaseAPI:__INSTANCE_NAME__"] self.assertEqual(innerMultiApplyAPIDef.GetAppliedAPISchemas(), expectedAPISchemas) expectedPropNames = [ "innerMulti:__INSTANCE_NAME__:derived:int_attr", "innerMulti:__INSTANCE_NAME__:int_attr", "innerMulti:__INSTANCE_NAME__:relationship", "innerMulti:__INSTANCE_NAME__:token_attr"] self.assertEqual(sorted(innerMultiApplyAPIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(innerMultiApplyAPIDef.GetDocumentation(), "Test nested multi apply API schema: inner schema derived") # Add a prim with no type and apply the TestNestedOuterMultiApplyAPI # with the instance "foo". outerMultiPrim = stage.DefinePrim("/OuterMulti") outerMultiPrim.ApplyAPI(self.NestedOuterMultiApplyAPIType, "foo") # The authored applied API schemas for the prim is only the applied # TestNestedOuterMultiApplyAPI:foo. self.assertEqual(outerMultiPrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(outerMultiPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedOuterMultiApplyAPI:foo"]) # TestNestedOuterMultiApplyAPI's definition includes # TestNestedInnerMultiApplyDerivedAPI:builtin and # TestNestedInnerMultiApplyDerivedAPI:outerMulti. Thus, the composed # applied API schemas also contain both a "foo:builtin" and a # "foo:outerMulti" instance of TestNestedInnerMultiApplyDerivedAPI, # which in turn include "foo:builtin" and "foo:outerMulti" instances of # TestNestedInnerMultiApplyBaseAPI. Since TestNestedOuterMultiApplyAPI # also includes TestNestedInnerMultiApplyBaseAPI a "foo" instance of it # is included as well. self.assertEqual(outerMultiPrim.GetTypeName(), '') expectedAPISchemas = [ "TestNestedOuterMultiApplyAPI:foo", "TestNestedInnerMultiApplyDerivedAPI:foo:builtin", "TestNestedInnerMultiApplyBaseAPI:foo:builtin", "TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti", "TestNestedInnerMultiApplyBaseAPI:foo:outerMulti", "TestNestedInnerMultiApplyBaseAPI:foo"] self.assertEqual(outerMultiPrim.GetAppliedSchemas(), expectedAPISchemas) # Properties come from all composed built-in APIs expectedPropNames = sorted([ # Properties from TestNestedOuterMultiApplyAPI:foo "outerMulti:foo:int_attr", "outerMulti:foo:relationship", "outerMulti:foo:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:builtin "innerMulti:foo:builtin:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:builtin "innerMulti:foo:builtin:int_attr", "innerMulti:foo:builtin:relationship", "innerMulti:foo:builtin:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti "innerMulti:foo:outerMulti:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:outerMulti "innerMulti:foo:outerMulti:int_attr", "innerMulti:foo:outerMulti:relationship", "innerMulti:foo:outerMulti:token_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo "innerMulti:foo:int_attr", "innerMulti:foo:relationship", "innerMulti:foo:token_attr"]) self.assertEqual(outerMultiPrim.GetPropertyNames(), expectedPropNames) # Verify that the attribute fallback values come from the API schemas # that define them. The "innerMulti:foo:XXX:token_attr" values from # from TestNestedInnerMultiApplyDerivedAPI override the values from # TestNestedInnerMultiApplyBaseAPI. innerMulti:foo:token_attr uses # the BaseAPI value since this instance is from the BaseAPI being # included on its own. expectedAttrValues = { # Properties from TestNestedOuterMultiApplyAPI:foo "outerMulti:foo:int_attr" : 5, "outerMulti:foo:token_attr" : "outer", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:builtin "innerMulti:foo:builtin:derived:int_attr" : 4, "innerMulti:foo:builtin:token_attr" : "inner_derived", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:builtin "innerMulti:foo:builtin:int_attr" : 3, # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti "innerMulti:foo:outerMulti:derived:int_attr" : 4, "innerMulti:foo:outerMulti:token_attr" : "inner_derived", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:outerMulti "innerMulti:foo:outerMulti:int_attr" : 3, # Properties from TestNestedInnerMultiApplyBaseAPI:foo "innerMulti:foo:int_attr" : 3, "innerMulti:foo:token_attr" : "inner_base"} _VerifyAttrValues(outerMultiPrim, expectedAttrValues) # Get the prim definition for the API schema and verify its applied # API schemas and properties match what was imparted on the prim. outerMultiApplyAPIDef = \ Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedOuterMultiApplyAPI") self.assertTrue(outerMultiApplyAPIDef) # Note that the __INSTANCE_NAME__ is alway directly after the API # schema name even when it is included as an encapsulated subinstance. expectedAPISchemas = [ "TestNestedOuterMultiApplyAPI:__INSTANCE_NAME__", "TestNestedInnerMultiApplyDerivedAPI:__INSTANCE_NAME__:builtin", "TestNestedInnerMultiApplyBaseAPI:__INSTANCE_NAME__:builtin", "TestNestedInnerMultiApplyDerivedAPI:__INSTANCE_NAME__:outerMulti", "TestNestedInnerMultiApplyBaseAPI:__INSTANCE_NAME__:outerMulti", "TestNestedInnerMultiApplyBaseAPI:__INSTANCE_NAME__"] self.assertEqual(outerMultiApplyAPIDef.GetAppliedAPISchemas(), expectedAPISchemas) expectedPropNames = sorted([ # Properties from TestNestedOuterMultiApplyAPI "outerMulti:__INSTANCE_NAME__:int_attr", "outerMulti:__INSTANCE_NAME__:relationship", "outerMulti:__INSTANCE_NAME__:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:builtin "innerMulti:__INSTANCE_NAME__:builtin:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:builtin "innerMulti:__INSTANCE_NAME__:builtin:int_attr", "innerMulti:__INSTANCE_NAME__:builtin:relationship", "innerMulti:__INSTANCE_NAME__:builtin:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:outerMulti "innerMulti:__INSTANCE_NAME__:outerMulti:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:outerMulti "innerMulti:__INSTANCE_NAME__:outerMulti:int_attr", "innerMulti:__INSTANCE_NAME__:outerMulti:relationship", "innerMulti:__INSTANCE_NAME__:outerMulti:token_attr", # Properties from TestNestedInnerMultiApplyBaseAPI "innerMulti:__INSTANCE_NAME__:int_attr", "innerMulti:__INSTANCE_NAME__:relationship", "innerMulti:__INSTANCE_NAME__:token_attr"]) self.assertEqual(sorted(outerMultiApplyAPIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(outerMultiApplyAPIDef.GetDocumentation(), "Test nested multi apply API schema: outer schema") # Add a prim with no type and apply the # TestNestedMultiApplyInSingleApplyAPI. singleApplyPrim = stage.DefinePrim("/SingleApply") singleApplyPrim.ApplyAPI(self.NestedMultiApplyInSingleApplyAPIType) # The authored applied API schemas for the prim is only the applied # TestNestedMultiApplyInSingleApplyAPI. self.assertEqual(singleApplyPrim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(singleApplyPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedMultiApplyInSingleApplyAPI"]) # TestNestedMultiApplyInSingleApplyAPI includes # TestNestedOuterMultiApplyAPI:foo and # TestNestedInnerMultiApplyDerivedAPI:bar so "foo" and "bar" instances # of these multi apply schemas are fully expanded into the composed API # schemas udner TestNestedMultiApplyInSingleApplyAPI. self.assertEqual(singleApplyPrim.GetTypeName(), '') expectedAPISchemas = [ "TestNestedMultiApplyInSingleApplyAPI", # Expanded from TestNestedOuterMultiApplyAPI:foo "TestNestedOuterMultiApplyAPI:foo", "TestNestedInnerMultiApplyDerivedAPI:foo:builtin", "TestNestedInnerMultiApplyBaseAPI:foo:builtin", "TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti", "TestNestedInnerMultiApplyBaseAPI:foo:outerMulti", "TestNestedInnerMultiApplyBaseAPI:foo", # Expanded from TestNestedInnerMultiApplyDerivedAPI:bar "TestNestedInnerMultiApplyDerivedAPI:bar", "TestNestedInnerMultiApplyBaseAPI:bar"] self.assertEqual(singleApplyPrim.GetAppliedSchemas(), expectedAPISchemas) # Properties come from all composed built-in APIs expectedPropNames = sorted([ # Properties from TestNestedMultiApplyInSingleApplyAPI "int_attr", # Properties from TestNestedOuterMultiApplyAPI:foo "outerMulti:foo:int_attr", "outerMulti:foo:relationship", "outerMulti:foo:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:builtin "innerMulti:foo:builtin:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:builtin "innerMulti:foo:builtin:int_attr", "innerMulti:foo:builtin:relationship", "innerMulti:foo:builtin:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti "innerMulti:foo:outerMulti:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:outerMulti "innerMulti:foo:outerMulti:int_attr", "innerMulti:foo:outerMulti:relationship", "innerMulti:foo:outerMulti:token_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:foo "innerMulti:foo:int_attr", "innerMulti:foo:relationship", "innerMulti:foo:token_attr", # Properties from TestNestedInnerMultiApplyDerivedAPI:bar "innerMulti:bar:derived:int_attr", # Properties from TestNestedInnerMultiApplyBaseAPI:bar "innerMulti:bar:int_attr", "innerMulti:bar:relationship", "innerMulti:bar:token_attr"]) self.assertEqual(singleApplyPrim.GetPropertyNames(), expectedPropNames) # Verify that the attribute fallback values come from the API schemas # that define them. expectedAttrValues = { # Property only defined in TestNestedMultiApplyInSingleApplyAPI "int_attr" : 10, # Property from TestNestedInnerMultiApplyDerivedAPI:foo:builtin # overridden in TestNestedMultiApplyInSingleApplyAPI "innerMulti:foo:builtin:derived:int_attr" : 20, # Property from TestNestedInnerMultiApplyBaseAPI:bar overridden in # TestNestedMultiApplyInSingleApplyAPI "innerMulti:bar:int_attr" : 30, # Properties from TestNestedOuterMultiApplyAPI:foo "outerMulti:foo:int_attr" : 5, "outerMulti:foo:token_attr" : "outer", # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:builtin "innerMulti:foo:builtin:token_attr" : "inner_derived", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:builtin "innerMulti:foo:builtin:int_attr" : 3, # Properties from TestNestedInnerMultiApplyDerivedAPI:foo:outerMulti "innerMulti:foo:outerMulti:derived:int_attr" : 4, "innerMulti:foo:outerMulti:token_attr" : "inner_derived", # Properties from TestNestedInnerMultiApplyBaseAPI:foo:outerMulti "innerMulti:foo:outerMulti:int_attr" : 3, # Properties from TestNestedInnerMultiApplyBaseAPI:foo "innerMulti:foo:int_attr" : 3, "innerMulti:foo:token_attr" : "inner_base", # Properties from TestNestedInnerMultiApplyDerivedAPI:bar "innerMulti:bar:derived:int_attr" : 4, # Properties from TestNestedInnerMultiApplyBaseAPI:bar "innerMulti:bar:token_attr" : "inner_derived"} _VerifyAttrValues(singleApplyPrim, expectedAttrValues) # Get the prim definition for the API schema and verify its applied # API schemas and properties match what was imparted on the prim. This # is an exact match because this a single apply API schema that contains # specific instances of the multi apply API schemas. singleApplyAPIDef = \ Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedMultiApplyInSingleApplyAPI") self.assertTrue(singleApplyAPIDef) self.assertEqual(singleApplyAPIDef.GetAppliedAPISchemas(), expectedAPISchemas) self.assertEqual(sorted(singleApplyAPIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(singleApplyAPIDef.GetDocumentation(), "Test single apply API with builtin nested multi apply API schema " "instances") def test_NestedCycleAPISchema(self): """ Tests the application of API schemas that have nested built-in API schemas that would cause an inclusion cycle """ stage = Usd.Stage.CreateInMemory() # Simple helper for testing that a prim has expected attributes that # resolve to expected values. def _VerifyAttrValues(prim, expectedAttrValues): values = {name : prim.GetAttribute(name).Get() for name in expectedAttrValues.keys()} self.assertEqual(values, expectedAttrValues) # Test behavior when nested API schema form a cycle. In this example # TestNestedCycle1API includes TestNestedCycle2API which includes # TestNestedCycle3API which includes TestNestedCycle1API again. Create # three prims, each applying one of the API schemas. nestedCyclePrim1 = stage.DefinePrim("/Cycle1") nestedCyclePrim2 = stage.DefinePrim("/Cycle2") nestedCyclePrim3 = stage.DefinePrim("/Cycle3") nestedCyclePrim1.ApplyAPI(self.NestedCycle1APIType) nestedCyclePrim2.ApplyAPI(self.NestedCycle2APIType) nestedCyclePrim3.ApplyAPI(self.NestedCycle3APIType) # For each prim the authored applied API schemas for the prim are still # only the single API that was applied. self.assertEqual(nestedCyclePrim1.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(nestedCyclePrim1.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedCycle1API"]) self.assertEqual(nestedCyclePrim2.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(nestedCyclePrim2.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedCycle2API"]) self.assertEqual(nestedCyclePrim3.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(nestedCyclePrim3.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedCycle3API"]) # The composed applied API schemas all contain all three API schemas, # however the order is different based on which schema was actually # the authored one. Note that during API schema expansion we don't try # to include the same API schema more than once which allows us to # handle cycles in this way. self.assertEqual(nestedCyclePrim1.GetTypeName(), '') self.assertEqual(nestedCyclePrim1.GetAppliedSchemas(), [ "TestNestedCycle1API", "TestNestedCycle2API", "TestNestedCycle3API"]) self.assertEqual(nestedCyclePrim2.GetTypeName(), '') self.assertEqual(nestedCyclePrim2.GetAppliedSchemas(), [ "TestNestedCycle2API", "TestNestedCycle3API", "TestNestedCycle1API"]) self.assertEqual(nestedCyclePrim3.GetTypeName(), '') self.assertEqual(nestedCyclePrim3.GetAppliedSchemas(), [ "TestNestedCycle3API", "TestNestedCycle1API", "TestNestedCycle2API"]) # All three prims "has" all three built-in APIs as well. self.assertTrue(nestedCyclePrim1.HasAPI(self.NestedCycle1APIType)) self.assertTrue(nestedCyclePrim1.HasAPI(self.NestedCycle2APIType)) self.assertTrue(nestedCyclePrim1.HasAPI(self.NestedCycle3APIType)) self.assertTrue(nestedCyclePrim2.HasAPI(self.NestedCycle1APIType)) self.assertTrue(nestedCyclePrim2.HasAPI(self.NestedCycle2APIType)) self.assertTrue(nestedCyclePrim2.HasAPI(self.NestedCycle3APIType)) self.assertTrue(nestedCyclePrim3.HasAPI(self.NestedCycle1APIType)) self.assertTrue(nestedCyclePrim3.HasAPI(self.NestedCycle2APIType)) self.assertTrue(nestedCyclePrim3.HasAPI(self.NestedCycle3APIType)) # All three prims have all the same properties since they all have all # three API schemas applied. expectedPropNames = [ "cycle1:token_attr", "cycle2:token_attr", "cycle3:token_attr", "cycle:int_attr"] self.assertEqual(nestedCyclePrim1.GetPropertyNames(), expectedPropNames) self.assertEqual(nestedCyclePrim2.GetPropertyNames(), expectedPropNames) self.assertEqual(nestedCyclePrim3.GetPropertyNames(), expectedPropNames) # For the three token attributes, each is only defined in its respective # API schema so they have the same fallback in each prim. # 'cycle:int_attr' is defined in all three of the cycle API schemas but # with different default values. Here the order of the applied schemas # matters and the strongest applied API's value wins. expectedAttrValues = { "cycle1:token_attr" : "cycle1", "cycle2:token_attr" : "cycle2", "cycle3:token_attr" : "cycle3"} expectedAttrValues["cycle:int_attr"] = 1 _VerifyAttrValues(nestedCyclePrim1, expectedAttrValues) expectedAttrValues["cycle:int_attr"] = 2 _VerifyAttrValues(nestedCyclePrim2, expectedAttrValues) expectedAttrValues["cycle:int_attr"] = 3 _VerifyAttrValues(nestedCyclePrim3, expectedAttrValues) # Get the prim definitions for each of these API schemas and verify its # applied API schemas and properties match what was imparted on the # prims. cycle1APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedCycle1API") self.assertTrue(cycle1APIDef) self.assertEqual(cycle1APIDef.GetAppliedAPISchemas(), ["TestNestedCycle1API", "TestNestedCycle2API", "TestNestedCycle3API"]) self.assertEqual(sorted(cycle1APIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(cycle1APIDef.GetDocumentation(), "Test nested single apply API schema with a cycle #1") cycle2APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedCycle2API") self.assertTrue(cycle2APIDef) self.assertEqual(cycle2APIDef.GetAppliedAPISchemas(), ["TestNestedCycle2API", "TestNestedCycle3API", "TestNestedCycle1API"]) self.assertEqual(sorted(cycle2APIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(cycle2APIDef.GetDocumentation(), "Test nested single apply API schema with a cycle #2") cycle3APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedCycle3API") self.assertTrue(cycle3APIDef) self.assertEqual(cycle3APIDef.GetAppliedAPISchemas(), ["TestNestedCycle3API", "TestNestedCycle1API", "TestNestedCycle2API"]) self.assertEqual(sorted(cycle3APIDef.GetPropertyNames()), expectedPropNames) self.assertEqual(cycle3APIDef.GetDocumentation(), "Test nested single apply API schema with a cycle #3") def test_NestedMultiApplyCycleAPISchema(self): """ Tests the handling of inclusion cycles that are particular to how built-in multiple apply schemas are processed. """ stage = Usd.Stage.CreateInMemory() # Test behavior when nested API schema form a cycle. In this example we # have two types of cycles. # # The first is an "inheritance" cycle where # TestNestedMultiApplyCycle1API includes TestNestedMultiApplyCycle3API # directly which includes TestNestedMultiApplyCycle2API which comes # and includes TestNestedMultiApplyCycle1API again. Since these are # all "inheritance" style built-ins, these will all use the same # instance name and can be handled gracefully, like we do with single # apply built-in cycles, by always skipping duplicate API schemas when # expanding. # # The second type of cycle comes from encapsulated sub-instance built-in # API schemas, where TestNestedMultiApplyCycle1API includes a "cycle1" # sub-instance of TestNestedMultiApplyCycle2API which includes a # "cycle2" sub-instance of TestNestedMultiApplyCycle3API which then # includes a "cycle3" sub-instance of TestNestedMultiApplyCycle1API. # Because of the way instance names nest (e.g. applying Cycle1:foo # will include Cycle2:foo:cycle1 will include Cycle3:foo:cycle1:cycle2 # will include Cycle1:foo:cycle1:cycle2:cycle3 and so on) these kinds of # cycles will become infinite as every instance will be unique as we # expand. These types of cycles must be broken by making sure that we # don't add a built-in API if it is the same schema type as one of its # direct ancestors during the depth first expansion of included API # schemas. nestedCyclePrim1 = stage.DefinePrim("/Cycle1") nestedCyclePrim2 = stage.DefinePrim("/Cycle2") nestedCyclePrim3 = stage.DefinePrim("/Cycle3") nestedCyclePrim1.ApplyAPI(self.NestedMultiApplyCycle1APIType, "foo") nestedCyclePrim2.ApplyAPI(self.NestedMultiApplyCycle2APIType, "foo") nestedCyclePrim3.ApplyAPI(self.NestedMultiApplyCycle3APIType, "foo") # For each prim the authored applied API schemas for the prim are still # only the single API that was applied. self.assertEqual(nestedCyclePrim1.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual( nestedCyclePrim1.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle1API:foo"]) self.assertEqual(nestedCyclePrim2.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual( nestedCyclePrim2.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle2API:foo"]) self.assertEqual(nestedCyclePrim3.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual( nestedCyclePrim3.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle3API:foo"]) # The composed applied API schemas include all the possible instances # of all three API schemas that can be added before the cycle detection # stops the depth first traversal of the built-ins. The commented out # entries represent the schemas that trip the cycle detection and # therefore were not added when expanded halting their branch of API # schema expansion. self.assertEqual(nestedCyclePrim1.GetTypeName(), '') self.assertEqual(nestedCyclePrim1.GetAppliedSchemas(), [ "TestNestedMultiApplyCycle1API:foo", "TestNestedMultiApplyCycle2API:foo:cycle1", "TestNestedMultiApplyCycle3API:foo:cycle1:cycle2", # "TestNestedMultiApplyCycle1API:foo:cycle1:cycle2:cycle3", # "TestNestedMultiApplyCycle2API:foo:cycle1:cycle2", # "TestNestedMultiApplyCycle1API:foo:cycle1" "TestNestedMultiApplyCycle3API:foo", # "TestNestedMultiApplyCycle1API:foo:cycle3", "TestNestedMultiApplyCycle2API:foo", # "TestNestedMultiApplyCycle3API:foo:cycle2", # "TestNestedMultiApplyCycle1API:foo" ]) self.assertEqual(nestedCyclePrim2.GetTypeName(), '') self.assertEqual(nestedCyclePrim2.GetAppliedSchemas(), [ "TestNestedMultiApplyCycle2API:foo", "TestNestedMultiApplyCycle3API:foo:cycle2", "TestNestedMultiApplyCycle1API:foo:cycle2:cycle3", # "TestNestedMultiApplyCycle2API:foo:cycle2:cycle3:cycle1", # "TestNestedMultiApplyCycle3API:foo:cycle2:cycle3", # "TestNestedMultiApplyCycle2API:foo:cycle2" "TestNestedMultiApplyCycle1API:foo", # "TestNestedMultiApplyCycle2API:foo:cycle1", "TestNestedMultiApplyCycle3API:foo", # "TestNestedMultiApplyCycle1API:foo:cycle3", # "TestNestedMultiApplyCycle2API:foo" ]) self.assertEqual(nestedCyclePrim3.GetTypeName(), '') self.assertEqual(nestedCyclePrim3.GetAppliedSchemas(), [ "TestNestedMultiApplyCycle3API:foo", "TestNestedMultiApplyCycle1API:foo:cycle3", "TestNestedMultiApplyCycle2API:foo:cycle3:cycle1", # "TestNestedMultiApplyCycle3API:foo:cycle3:cycle1:cycle2", # "TestNestedMultiApplyCycle1API:foo:cycle3:cycle1", # "TestNestedMultiApplyCycle3API:foo:cycle3" "TestNestedMultiApplyCycle2API:foo", # "TestNestedMultiApplyCycle3API:foo:cycle2", "TestNestedMultiApplyCycle1API:foo", # "TestNestedMultiApplyCycle2API:foo:cycle1", # "TestNestedMultiApplyCycle3API:foo" ]) # Each of the three API schemas provides a "token_attr" so each of # prims has the prefixed "token_attr" for the API schemas that managed # to be included for each one. expectedPropNames = [ "cycle1:foo:token_attr", "cycle2:foo:cycle1:token_attr", "cycle2:foo:token_attr", "cycle3:foo:cycle1:cycle2:token_attr", "cycle3:foo:token_attr" ] self.assertEqual(nestedCyclePrim1.GetPropertyNames(), expectedPropNames) expectedPropNames = [ "cycle1:foo:cycle2:cycle3:token_attr", "cycle1:foo:token_attr", "cycle2:foo:token_attr", "cycle3:foo:cycle2:token_attr", "cycle3:foo:token_attr" ] self.assertEqual(nestedCyclePrim2.GetPropertyNames(), expectedPropNames) expectedPropNames = [ "cycle1:foo:cycle3:token_attr", "cycle1:foo:token_attr", "cycle2:foo:cycle3:cycle1:token_attr", "cycle2:foo:token_attr", "cycle3:foo:token_attr" ] self.assertEqual(nestedCyclePrim3.GetPropertyNames(), expectedPropNames) # Get the prim definitions for each of these API schemas and verify its # applied API schemas and properties match what was imparted on the # prims. cycle1APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedMultiApplyCycle1API") self.assertTrue(cycle1APIDef) self.assertEqual(cycle1APIDef.GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle1API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle2API:__INSTANCE_NAME__:cycle1", "TestNestedMultiApplyCycle3API:__INSTANCE_NAME__:cycle1:cycle2", "TestNestedMultiApplyCycle3API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle2API:__INSTANCE_NAME__"]) self.assertEqual(sorted(cycle1APIDef.GetPropertyNames()), ["cycle1:__INSTANCE_NAME__:token_attr", "cycle2:__INSTANCE_NAME__:cycle1:token_attr", "cycle2:__INSTANCE_NAME__:token_attr", "cycle3:__INSTANCE_NAME__:cycle1:cycle2:token_attr", "cycle3:__INSTANCE_NAME__:token_attr"]) cycle2APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedMultiApplyCycle2API") self.assertTrue(cycle2APIDef) self.assertEqual(cycle2APIDef.GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle2API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle3API:__INSTANCE_NAME__:cycle2", "TestNestedMultiApplyCycle1API:__INSTANCE_NAME__:cycle2:cycle3", "TestNestedMultiApplyCycle1API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle3API:__INSTANCE_NAME__"]) self.assertEqual(sorted(cycle2APIDef.GetPropertyNames()), ["cycle1:__INSTANCE_NAME__:cycle2:cycle3:token_attr", "cycle1:__INSTANCE_NAME__:token_attr", "cycle2:__INSTANCE_NAME__:token_attr", "cycle3:__INSTANCE_NAME__:cycle2:token_attr", "cycle3:__INSTANCE_NAME__:token_attr"]) cycle3APIDef = Usd.SchemaRegistry().FindAppliedAPIPrimDefinition( "TestNestedMultiApplyCycle3API") self.assertTrue(cycle3APIDef) self.assertEqual(cycle3APIDef.GetAppliedAPISchemas(), ["TestNestedMultiApplyCycle3API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle1API:__INSTANCE_NAME__:cycle3", "TestNestedMultiApplyCycle2API:__INSTANCE_NAME__:cycle3:cycle1", "TestNestedMultiApplyCycle2API:__INSTANCE_NAME__", "TestNestedMultiApplyCycle1API:__INSTANCE_NAME__"]) self.assertEqual(sorted(cycle3APIDef.GetPropertyNames()), ["cycle1:__INSTANCE_NAME__:cycle3:token_attr", "cycle1:__INSTANCE_NAME__:token_attr", "cycle2:__INSTANCE_NAME__:cycle3:cycle1:token_attr", "cycle2:__INSTANCE_NAME__:token_attr", "cycle3:__INSTANCE_NAME__:token_attr"]) def test_ConcreteTypeWithBuiltinNestedAPISchemas(self): """ Tests a concrete schema type with built-in API schemas that include other API schemas. """ stage = Usd.Stage.CreateInMemory() # Simple helper for testing that a prim has expected attributes that # resolve to expected values. def _VerifyAttrValues(prim, expectedAttrValues): values = {name : prim.GetAttribute(name).Get() for name in expectedAttrValues.keys()} self.assertEqual(values, expectedAttrValues) # Test a typed prim whose concrete typed schema has built-in API schemas # that nest other API schemas. typedPrim = stage.DefinePrim( "/TypedPrim", "TestWithBuiltinNestedAppliedSchema") # The prim has a type but no authored API schemas. self.assertEqual(typedPrim.GetPrimTypeInfo().GetTypeName(), "TestWithBuiltinNestedAppliedSchema") self.assertEqual(typedPrim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) # The composed API schemas are fully expanded from the two built-in API # schemas of the TestWithBuiltinNestedAppliedSchema type. expectedAPISchemas = [ # Expanded API schemas from built-in TestNestedOuterSingleApplyAPI "TestNestedOuterSingleApplyAPI", "TestMultiApplyAPI:foo", "TestNestedInnerSingleApplyAPI", "TestSingleApplyAPI", "TestMultiApplyAPI:bar", # Expanded API schemas from built-in TestNestedCycle1API "TestNestedCycle1API", "TestNestedCycle2API", "TestNestedCycle3API"] self.assertEqual(typedPrim.GetAppliedSchemas(), expectedAPISchemas) # Properties come from the type and all composed built-in APIs expectedPropNames = [ # Properties from expanded built-in TestNestedCycle1API "cycle1:token_attr", "cycle2:token_attr", "cycle3:token_attr", "cycle:int_attr", # Properties from expanded built-in TestNestedOuterSingleApplyAPI "innerSingle:int_attr", "innerSingle:relationship", "innerSingle:token_attr", "multi:bar:bool_attr", "multi:bar:relationship", "multi:bar:token_attr", "multi:foo:bool_attr", "multi:foo:relationship", "multi:foo:token_attr", "outerSingle:int_attr", "outerSingle:relationship", "outerSingle:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", # Properties from the prim type TestWithBuiltinNestedAppliedSchema "testAttr", "testRel"] self.assertEqual(typedPrim.GetPropertyNames(), expectedPropNames) # Get the prim definition for the concrete typed schema and verify its # applied API schemas and properties match what was imparted on the # prim. typedPrimDef = \ Usd.SchemaRegistry().FindConcretePrimDefinition( "TestWithBuiltinNestedAppliedSchema") self.assertTrue(typedPrimDef) self.assertEqual(typedPrimDef.GetAppliedAPISchemas(), expectedAPISchemas) self.assertEqual(sorted(typedPrimDef.GetPropertyNames()), expectedPropNames) self.assertEqual(typedPrimDef.GetDocumentation(), "Test with built-in nested API schemas") @unittest.skipIf(Tf.GetEnvSetting('USD_DISABLE_AUTO_APPLY_API_SCHEMAS'), "Auto apply API schemas are disabled") def test_APISchemasAutoAppliedToAPISchemas(self): """ Tests the behaviors of API schemas that are auto applied to other API schemas. """ stage = Usd.Stage.CreateInMemory() # Define a prim with an empty type name and apply TestAutoAppliedToAPI. # TestAutoAppliedToAPI includes other API schemas through a combination # of built-in APIs and auto applied APIs. prim = stage.DefinePrim("/Prim") prim.ApplyAPI(self.AutoAppliedToAPIType) self.assertEqual(prim.GetTypeName(), '') self.assertEqual(prim.GetAppliedSchemas(), [ # Authored applied API "TestAutoAppliedToAPI", # Built-in API of 'TestAutoAppliedToAPI' "TestMultiApplyAPI:builtin", # Defined in plugin metadata that 'TestMultiApplyAPI:autoFoo' auto # applies to 'TestAutoAppliedToAPI' "TestMultiApplyAPI:autoFoo", # 'TestSingleApplyAPI' defines in its schema def that it auto # applies to 'TestAutoAppliedToAPI' "TestSingleApplyAPI"]) self.assertTrue(prim.HasAPI(self.AutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "builtin")) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "autoFoo")) self.assertTrue(prim.HasAPI(self.SingleApplyAPIType)) # Prim's authored type is empty and its authored API schemas is just the # single authored schema. self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestAutoAppliedToAPI"]) # Prim's built-in properties come from all of the applied API schemas. self.assertEqual(prim.GetPropertyNames(), [ "multi:autoFoo:bool_attr", "multi:autoFoo:relationship", "multi:autoFoo:token_attr", "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Define a prim with an empty type name and apply # TestNestedAutoAppliedToAPI. # TestAutoAppliedToAPI auto applies to TestNestedAutoAppliedToAPI and # brings with it all of the API schemas that are built-in to it and auto # applied to it. prim = stage.DefinePrim("/Prim2") prim.ApplyAPI(self.NestedAutoAppliedToAPIType) self.assertEqual(prim.GetTypeName(), '') self.assertEqual(prim.GetAppliedSchemas(), [ # Authored applied API "TestNestedAutoAppliedToAPI", # Built-in API of 'TestNestedAutoAppliedToAPI' "TestMultiApplyAPI:foo", # 'TestAutoAppliedToAPI' defines in its schema def that it auto # applies to 'TestNestedAutoAppliedToAPI' "TestAutoAppliedToAPI", # Built-in API of 'TestAutoAppliedToAPI' "TestMultiApplyAPI:builtin", # Defined in plugin metadata that 'TestMultiApplyAPI:autoFoo' auto # applies to 'TestAutoAppliedToAPI' "TestMultiApplyAPI:autoFoo", # 'TestSingleApplyAPI' defines in its schema def that it auto # applies to 'TestAutoAppliedToAPI' "TestSingleApplyAPI"]) self.assertTrue(prim.HasAPI(self.NestedAutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.AutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "builtin")) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "autoFoo")) self.assertTrue(prim.HasAPI(self.SingleApplyAPIType)) # Prim's authored type is empty and its authored API schemas is just the # single authored schema. self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedAutoAppliedToAPI"]) # Prim's built-in properties come from all of the applied API schemas. self.assertEqual(prim.GetPropertyNames(), [ "multi:autoFoo:bool_attr", "multi:autoFoo:relationship", "multi:autoFoo:token_attr", "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "multi:foo:bool_attr", "multi:foo:relationship", "multi:foo:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) # Define a prim with type name TestNestedAutoAppliedToAPIAppliedToPrim. # TestNestedAutoAppliedToAPI is defined to auto apply to this prim type # and brings with it all of the API schemas that are built-in to it and # auto applied to it. prim = stage.DefinePrim("/Prim3", "TestNestedAutoAppliedToAPIAppliedToPrim") self.assertEqual(prim.GetTypeName(), 'TestNestedAutoAppliedToAPIAppliedToPrim') self.assertEqual(prim.GetAppliedSchemas(), [ # 'TestNestedAutoAppliedToAPI' defines in its schema def that it # auto applies to 'TestNestedAutoAppliedToAPIAppliedToPrim' "TestNestedAutoAppliedToAPI", # Built-in API of 'TestNestedAutoAppliedToAPI' "TestMultiApplyAPI:foo", # 'TestAutoAppliedToAPI' defines in its schema def that it auto # applies to 'TestNestedAutoAppliedToAPI' "TestAutoAppliedToAPI", # Built-in API of 'TestAutoAppliedToAPI' "TestMultiApplyAPI:builtin", # Defined in plugin metadata that 'TestMultiApplyAPI:autoFoo' auto # applies to 'TestAutoAppliedToAPI' "TestMultiApplyAPI:autoFoo", # 'TestSingleApplyAPI' defines in its schema def that it auto # applies to 'TestAutoAppliedToAPI' "TestSingleApplyAPI"]) # Prim's authored applied API schemas is empty as the API schemas are # part of the type (through auto apply). self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), 'TestNestedAutoAppliedToAPIAppliedToPrim') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) # Prim's built-in properties come from all of the applied API schemas. self.assertTrue(prim.HasAPI(self.NestedAutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.AutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "foo")) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "builtin")) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "autoFoo")) self.assertTrue(prim.HasAPI(self.SingleApplyAPIType)) self.assertEqual(prim.GetPropertyNames(), [ "multi:autoFoo:bool_attr", "multi:autoFoo:relationship", "multi:autoFoo:token_attr", "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "multi:foo:bool_attr", "multi:foo:relationship", "multi:foo:token_attr", "single:bool_attr", "single:relationship", "single:token_attr", "testAttr", "testRel"]) @unittest.skipIf(not Tf.GetEnvSetting('USD_DISABLE_AUTO_APPLY_API_SCHEMAS'), "Auto apply API schemas are NOT disabled") def test_APISchemasAutoAppliedToAPISchemas_AutoApplyDisabled(self): """ Tests the behaviors of API schemas that are auto applied to other API schemas. """ stage = Usd.Stage.CreateInMemory() # Define a prim with an empty type name and apply TestAutoAppliedToAPI. # TestAutoAppliedAPI includes other API schemas through a combination of # built-in APIs and auto applied APIs. The auto applied schemas are # disabled in the this test case. prim = stage.DefinePrim("/Prim") prim.ApplyAPI(self.AutoAppliedToAPIType) self.assertEqual(prim.GetTypeName(), '') self.assertEqual(prim.GetAppliedSchemas(), [ # Authored applied API "TestAutoAppliedToAPI", # Built-in API of 'TestAutoAppliedToAPI' "TestMultiApplyAPI:builtin" # 'TestMultiApplyAPI:autoFoo' and 'TestSingleApplyAPI' would be # auto applied so they do not show up when auto apply is disabled ]) self.assertTrue(prim.HasAPI(self.AutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "builtin")) self.assertFalse(prim.HasAPI(self.MultiApplyAPIType, "autoFoo")) self.assertFalse(prim.HasAPI(self.SingleApplyAPIType)) # Prim's authored type is empty and its authored API schemas is just the # single authored schema. self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestAutoAppliedToAPI"]) # Prim's built-in properties come from all of the applied API schemas. self.assertEqual(prim.GetPropertyNames(), [ "multi:builtin:bool_attr", "multi:builtin:relationship", "multi:builtin:token_attr", "testAttr", "testRel"]) # Define a prim with an empty type name and apply # TestNestedAutoAppliedToAPI. # TestAutoAppliedAPI auto applies to TestNestedAutoAppliedToAPI but # auto apply is disabled in this test case. prim = stage.DefinePrim("/Prim2") prim.ApplyAPI(self.NestedAutoAppliedToAPIType) self.assertEqual(prim.GetTypeName(), '') self.assertEqual(prim.GetAppliedSchemas(), [ # Authored applied API "TestNestedAutoAppliedToAPI", # Built-in API of 'TestNestedAutoAppliedToAPI' "TestMultiApplyAPI:foo", # 'TestAutoAppliedToAPI' would be auto applied it doesn't show up # when auto apply is disabled, nor do any of the API schemas that # would be included by it. ]) self.assertTrue(prim.HasAPI(self.NestedAutoAppliedToAPIType)) self.assertFalse(prim.HasAPI(self.AutoAppliedToAPIType)) self.assertTrue(prim.HasAPI(self.MultiApplyAPIType, "foo")) self.assertFalse(prim.HasAPI(self.MultiApplyAPIType, "builtin")) self.assertFalse(prim.HasAPI(self.MultiApplyAPIType, "autoFoo")) self.assertFalse(prim.HasAPI(self.SingleApplyAPIType)) # Prim's authored type is empty and its authored API schemas is just the # single authored schema. self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), '') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), ["TestNestedAutoAppliedToAPI"]) # Prim's built-in properties come from all of the applied API schemas. self.assertEqual(prim.GetPropertyNames(), [ "multi:foo:bool_attr", "multi:foo:relationship", "multi:foo:token_attr"]) # Define a prim with type name TestNestedAutoAppliedToAPIAppliedToPrim. # TestNestedAutoAppliedToAPI is defined to auto apply to this prim type # auto apply is disabled in this test case. prim = stage.DefinePrim("/Prim3", "TestNestedAutoAppliedToAPIAppliedToPrim") self.assertEqual(prim.GetTypeName(), 'TestNestedAutoAppliedToAPIAppliedToPrim') # 'TestNestedAutoAppliedToAPI' would be auto applied so it doesn't show # up when auto apply is disabled, nor do any of the API schemas that # would be included by it. self.assertEqual(prim.GetAppliedSchemas(), []) self.assertEqual(prim.GetPrimTypeInfo().GetTypeName(), 'TestNestedAutoAppliedToAPIAppliedToPrim') self.assertEqual(prim.GetPrimTypeInfo().GetAppliedAPISchemas(), []) self.assertEqual(prim.GetPropertyNames(), []) @unittest.skipIf(Tf.GetEnvSetting('USD_DISABLE_AUTO_APPLY_API_SCHEMAS'), "Auto apply API schemas are disabled") def test_PropertyTypeConflicts(self): """ Test the resolution of property type conflicts between prim type and API schema prim definitions when API schemas are applied to prims. """ stage = Usd.Stage.CreateInMemory() # Helper for verifying the attribute types and computed values of # any arbitrary set of attributes on the prim. The arguments are the # prim followed by any number of keyword arguments of the form: # <attrName> = (<attrTypeNameStr>, <attrValue>, <docStr>) # For each keyword arg, it verifies that the prim has an attribute # named <attrName> whose typeName computes to <attrTypeNameStr> and # computed valued computes to <attrValue>. Also verifies that the # attribute's documentation matches <docStr> def _VerifyAttrTypes(prim, **kwargs): for name, (attrTypeNameStr, attrValue, docStr) in kwargs.items(): attr = prim.GetAttribute(name) self.assertEqual(attr.GetTypeName(), attrTypeNameStr) self.assertEqual(attr.Get(), attrValue) self.assertEqual(attr.GetDocumentation(), docStr) # Helper for verifying that an arbitrary set of properties is or isn't # a relationship. The arguments are the prim followed by any number of # keyword arguments of the form: # <propertyName> = (<isRelationship>, <docStr>) # For each keyword arg, it verifies that the prim has a property # named <propertyName> that is a relationship iff <isRelationship> is # True. Also verifies that the property's documentation matches <docStr> def _VerifyIsRel(prim, **kwargs): for name, (isRelationship, docStr) in kwargs.items(): prop = prim.GetProperty(name) self.assertTrue(prop) if isRelationship: self.assertTrue(prim.GetRelationship(name)) else: self.assertFalse(prim.GetRelationship(name)) self.assertEqual(prop.GetDocumentation(), docStr) # We've defined 3 API schema types for applying directly to a prim authoredOneAPIName = "TestPropTypeConflictAuthoredOneAPI" authoredTwoAPIName = "TestPropTypeConflictAuthoredTwoAPI" nestedAPIName = "TestPropTypeConflictNestedAuthoredAPI" # We also typed prim type for this test case that includes a separate # built-in API schema type. conflictPrimTypeName = "TestPropTypeConflictsPrim" builtinAPIName = "TestPropTypeConflictBuiltinAPI" # Each of the defined schema types above uses a single doc string for # all of it properties which we can use to help verify which schemas # the property definitions come from. authoredOneAPIDocStr = "From TestPropTypeConflictAuthoredOneAPI" authoredTwoAPIDocStr = "From TestPropTypeConflictAuthoredTwoAPI" nestedAPIDocStr = "From TestPropTypeConflictNestedAuthoredAPI" conflictPrimTypeDocStr = "From TestPropTypeConflictsPrim" builtinAPIDocStr = "From TestPropTypeConflictBuiltinAPI" # Test 1: Prim with no type name; apply the authoredOneAPI and # authoredTwoAPI schemas in that strength order. untypedPrim = stage.DefinePrim("/UntypedPrim") untypedPrim.AddAppliedSchema(authoredOneAPIName) untypedPrim.AddAppliedSchema(authoredTwoAPIName) self.assertEqual(untypedPrim.GetAppliedSchemas(), [authoredOneAPIName, authoredTwoAPIName]) # Only the authoredOneAPI defines attr1 and attr2 # Only the authoredTwoAPI defines attr3 and attr4 # Both define attr5 and attr6, so authoredOneAPI's version of those # attributes are used since it's stronger. _VerifyAttrTypes(untypedPrim, attr1 = ("int", 0, authoredOneAPIDocStr), attr2 = ("double", 0.0, authoredOneAPIDocStr), attr3 = ("int", 10, authoredTwoAPIDocStr), attr4 = ("string", "foo", authoredTwoAPIDocStr), attr5 = ("point3f", Gf.Vec3f(0, 0, 0), authoredOneAPIDocStr), attr6 = ("int", 20, authoredOneAPIDocStr)) # Both define rel1 and rel2, but since authoredOneAPI is stronger, it wins # and only rel2 is a relationship. _VerifyIsRel(untypedPrim, rel1 = (False, authoredOneAPIDocStr), rel2 = (True, authoredOneAPIDocStr)) # Test 2: Prim with no type name; apply the authoredTwoAPI and builtAPI # schemas in that strength order. This is the reverse order of Test 1 untypedPrim = stage.DefinePrim("/UntypedPrim2") untypedPrim.AddAppliedSchema(authoredTwoAPIName) untypedPrim.AddAppliedSchema(authoredOneAPIName) self.assertEqual(untypedPrim.GetAppliedSchemas(), [authoredTwoAPIName, authoredOneAPIName]) # Only the authoredOneAPI defines attr1 and attr2 (same as Test 1) # Only the authoredTwoAPI defines attr3 and attr4 (same as Test 1) # Both define attr5 and attr6, but now authoredTwoAPI is stronger so # its version of those attributes are used. Note that this leads to a # different type and default value for attr5 and just a different # default value for attr6. _VerifyAttrTypes(untypedPrim, attr1 = ("int", 0, authoredOneAPIDocStr), attr2 = ("double", 0.0, authoredOneAPIDocStr), attr3 = ("int", 10, authoredTwoAPIDocStr), attr4 = ("string", "foo", authoredTwoAPIDocStr), attr5 = ("float3", Gf.Vec3f(1, 2, 3), authoredTwoAPIDocStr), attr6 = ("int", 10, authoredTwoAPIDocStr)) # Both define rel1 and rel2, but now since authoredTwoAPI is stronger, # it wins and only rel1 is a relationship (opposite of Test 1). _VerifyIsRel(untypedPrim, rel1 = (True, authoredTwoAPIDocStr), rel2 = (False, authoredTwoAPIDocStr)) # Test 3: Prim with type name set to the conflictPrimType; no authored # applied API schemas. The conflictPrimType has a single built-in API # schema builtinAPI. prim = stage.DefinePrim("/TypedPrim", conflictPrimTypeName) self.assertEqual(prim.GetAppliedSchemas(), [builtinAPIName]) # The conflictPrimType schema defines all of attr1-6 attributes EXCEPT # attr4. It also defines rel1 and rel2. So outside of attr4, the typed # schema's version of these properties are used. # For attr4, it is defined in the builtinAPI schema so that attribute's # opinion comes from the builtinAPI. Note that builtinAPI does define # attr2, rel1, and rel2 (all with different types than the # conflictPrimType schema) but the stronger conflictPrimType still wins # over its built-in APIs. _VerifyAttrTypes(prim, attr1 = ("int", 1, conflictPrimTypeDocStr), attr2 = ("int", 2, conflictPrimTypeDocStr), attr3 = ("int", 3, conflictPrimTypeDocStr), attr4 = ("int", 4, builtinAPIDocStr), attr5 = ("color3f", Gf.Vec3f(1, 1, 1), conflictPrimTypeDocStr), attr6 = ("int", 6, conflictPrimTypeDocStr)) _VerifyIsRel(prim, rel1 = (True, conflictPrimTypeDocStr), rel2 = (False, conflictPrimTypeDocStr)) # Test 4: Take the same prim from Test 3 above, with type name set to # the conflictPrimType, and author authoredOneAPI and authoredTwoAPI # applied schemas in that strength order (like in Test 1). prim.AddAppliedSchema(authoredOneAPIName) prim.AddAppliedSchema(authoredTwoAPIName) self.assertEqual(prim.GetAppliedSchemas(), [authoredOneAPIName, authoredTwoAPIName, builtinAPIName]) _VerifyAttrTypes(prim, # attr1 is defined in authoredOneAPI which is now the strongest # opinion. Since its type name matches attr1's type name in the prim # type's definition, it can be used for attr1 in the composed prim # definition. attr1 = ("int", 0, authoredOneAPIDocStr), # attr2 is defined in authoredOneAPI which would be the strongest # opinion. However, its type name is "double" which doesn't match # the existing prim type's definition of the attribute which has it # as "int". We use the prim type's definition for this attribute # ignoring the API schema. attr2 = ("int", 2, conflictPrimTypeDocStr), # attr3 is defined in authoredTwoAPI (and not authoredOneAPI) which # makes it the strongest opinion. Since its type name matches # attr3's type name in the prim type's definition, it can be used # for attr3 in the composed prim definition. attr3 = ("int", 10, authoredTwoAPIDocStr), # attr4 is defined in authoredTwoAPI (and not authoredOneAPI) which # would be the strongest opinion. However, its type name is "string" # which doesn't match the existing prim type's definition of the # attribute which has it as "int". We use the prim type's definition # for this attribute ignoring the API schema. Note the prim type's # definition actually gets its opinion on attr4 from the builtinAPI # (as the typed schema itself doesn't define attr4). The builtinAPI # attr4 opinion is part of the composed prim type definition which # is type wins over any applied API schemas authored over the prim. attr4 = ("int", 4, builtinAPIDocStr), # attr5 is defined in both authoredOneAPI and authoredTwoAPI which # makes authoredOneAPI the strongest opiniion. However its type of # "point3f" doesn't match the prim type's opinion of the type name # "color3f". Even though the default values for these types are # stored as GfVec3f, the type name mismatch means we still used the # prim type's version in the composed prim definition. attr5 = ("color3f", Gf.Vec3f(1, 1, 1), conflictPrimTypeDocStr), # attr6 is defined in both authoredOneAPI and authoredTwoAPI which # makes authoredOneAPI the strongest opiniion. And since its type # name matches the prim type definition's attr6 type name, we use # the attr6 from authoredOneAPI. attr6 = ("int", 20, authoredOneAPIDocStr)) # For rel1 and rel2, authoredOneAPI, authoredTwoAPI and the prim type # all define them both. Both authoredTwoAPI and the prim type definition # define rel1 as a relationship and rel2 as an attribute, but # authoredOneAPI defines the reverse with rel2 as the relationship. # Since authoredOneAPI is stronger than authoredTwoAPI, its opinions for # these properties override the ones from authoredTwoAPI. However, since # the property types of these strongest opinions don't match match the # property types from the prim type definition, they fall back to the # prim type definition's opinions of these properties in the composed # prim definition. _VerifyIsRel(prim, rel1 = (True, conflictPrimTypeDocStr), rel2 = (False, conflictPrimTypeDocStr)) # Test 5: Prim with no type name; apply the nestedAPI schema only to # the prim. The nestedAPI has authoredOneAPI included as a built-in and # authoredTwoAPI auto-applied to it. So all three schemas end up as # applied schemas on the prim. nestedAPIPrim = stage.DefinePrim("/NestedAPIPrim") nestedAPIPrim.AddAppliedSchema(nestedAPIName) self.assertEqual(nestedAPIPrim.GetAppliedSchemas(), [nestedAPIName, authoredOneAPIName, authoredTwoAPIName]) # The nestedAPI schema defines its own opinions for all of attr1-6 # attributes as well as rel1 and rel2. Since it is stronger than all its # built-in API schemas, its version of all these properties win for this # prim, regardless of the property and attributes types. _VerifyAttrTypes(nestedAPIPrim, attr1 = ("int", 1, nestedAPIDocStr), attr2 = ("int", 2, nestedAPIDocStr), attr3 = ("int", 3, nestedAPIDocStr), attr4 = ("int", 4, nestedAPIDocStr), attr5 = ("color3f", Gf.Vec3f(1, 1, 1), nestedAPIDocStr), attr6 = ("token", "bar", nestedAPIDocStr)) _VerifyIsRel(nestedAPIPrim, rel1 = (True, nestedAPIDocStr), rel2 = (False, nestedAPIDocStr)) # Test 6: Prim with no type name; apply the bultinAPI, authoredTwoAPI, # and nestedAPI schemas to the prim in that strength order. The same # three schemas are applied to the prim as in Test 5, but now the # strength order is different. nestedAPIPrim2 = stage.DefinePrim("/NestedAPIPrim2") nestedAPIPrim2.AddAppliedSchema(authoredOneAPIName) nestedAPIPrim2.AddAppliedSchema(authoredTwoAPIName) nestedAPIPrim2.AddAppliedSchema(nestedAPIName) self.assertEqual(nestedAPIPrim2.GetAppliedSchemas(), [authoredOneAPIName, authoredTwoAPIName, nestedAPIName, authoredOneAPIName, authoredTwoAPIName]) # Only the authoredOneAPI and nestedAPI define attr1 and attr2; # authoredOneAPI is stronger and wins # Only the authoredTwoAPI and nestedAPI define attr3 and attr4; # authoredTwoAPI is stronger and wins # All define attr5 and attr6, so authoredOneAPI's version of those # attributes are used since it's strongest. _VerifyAttrTypes(nestedAPIPrim2, attr1 = ("int", 0, authoredOneAPIDocStr), attr2 = ("double", 0.0, authoredOneAPIDocStr), attr3 = ("int", 10, authoredTwoAPIDocStr), attr4 = ("string", "foo", authoredTwoAPIDocStr), attr5 = ("point3f", Gf.Vec3f(0, 0, 0), authoredOneAPIDocStr), attr6 = ("int", 20, authoredOneAPIDocStr)) # All define rel1 and rel2, but since authoredOneAPI is strongest, it # wins and only rel2 is a relationship. _VerifyIsRel(nestedAPIPrim2, rel1 = (False, authoredOneAPIDocStr), rel2 = (True, authoredOneAPIDocStr)) # Test 7: Prim with type name set to the conflictPrimType; author the # nestedAPI schema on this prim. nestedAPI still brings in the # authoredOneAPI and authoredTwoAPI as its own built-ins to the applied # API schemas which will be stronger than the prim type definition # itself. prim = stage.DefinePrim("/TypedPrim2", conflictPrimTypeName) prim.AddAppliedSchema(nestedAPIName) self.assertEqual(prim.GetAppliedSchemas(), [nestedAPIName, authoredOneAPIName, authoredTwoAPIName, builtinAPIName]) # nestedAPI defines all same properties as the prim type definition, # is the strongest opinion, and, with the exception of attr6, uses the # same property types and type names as the prim type definition. So # all properties except attr6 in the composed definition use property # definitions from nestedAPI. # For attr6, the strongest opinion from nestedAPI has the type name # "token" which doesn't match the type name "int" in the prim type # definition. So, we have to use the opinion from the prim type # definition. Note that both authoredOneAPI and authoredTwoAPI are # technically stronger than prim type definition in this case AND have # the attribute type of "int" for attr6. However, we still fall back to # the prim type definition's opinion as we only consider the strongest # opinion from the authored applied API schemas. _VerifyAttrTypes(prim, attr1 = ("int", 1, nestedAPIDocStr), attr2 = ("int", 2, nestedAPIDocStr), attr3 = ("int", 3, nestedAPIDocStr), attr4 = ("int", 4, nestedAPIDocStr), attr5 = ("color3f", Gf.Vec3f(1, 1, 1), nestedAPIDocStr), attr6 = ("int", 6, conflictPrimTypeDocStr)) _VerifyIsRel(prim, rel1 = (True, nestedAPIDocStr), rel2 = (False, nestedAPIDocStr)) # Now also apply authoredOneAPI and authoredTwoAPI directly to the same # prim (previously they were included as built-ins under nestedAPI). # These are still weaker than nestedAPI but this means they're also now # siblings of nestedAPI in the composed definition as opposed to # built-in to nestedAPI's own prim definition. prim.AddAppliedSchema(authoredOneAPIName) prim.AddAppliedSchema(authoredTwoAPIName) self.assertEqual(prim.GetAppliedSchemas(), [nestedAPIName, authoredOneAPIName, authoredTwoAPIName, authoredOneAPIName, authoredTwoAPIName, builtinAPIName]) # This extra condition changes nothing about the composed prim # definition but is here to verify that the same behavior for attr6 # above (where only the strongest authored API schema opinion for an # attribute is considered) still hold for sibling applied API schemas. _VerifyAttrTypes(prim, attr1 = ("int", 1, nestedAPIDocStr), attr2 = ("int", 2, nestedAPIDocStr), attr3 = ("int", 3, nestedAPIDocStr), attr4 = ("int", 4, nestedAPIDocStr), attr5 = ("color3f", Gf.Vec3f(1, 1, 1), nestedAPIDocStr), attr6 = ("int", 6, conflictPrimTypeDocStr)) _VerifyIsRel(prim, rel1 = (True, nestedAPIDocStr), rel2 = (False, nestedAPIDocStr)) # Test 8: Prim with type name set to the conflictPrimType; author the # authoredOneAPI, authoredTwoAPI, and nestedAPI schemas on this prim in # that strength order. This brings in the same 3 applied API schemas as # Test 7, but now authoredOneAPI and authoredTwoAPI are stronger than # when they were just brought in as built-ins of nestedAPI. prim = stage.DefinePrim("/TypedPrim3", conflictPrimTypeName) prim.AddAppliedSchema(authoredOneAPIName) prim.AddAppliedSchema(authoredTwoAPIName) prim.AddAppliedSchema(nestedAPIName) self.assertEqual(prim.GetAppliedSchemas(), [authoredOneAPIName, authoredTwoAPIName, nestedAPIName, authoredOneAPIName, authoredTwoAPIName, builtinAPIName]) # The results of this test case are identical to Test 4 above as # builtAPI is the strongest opinion and authoredTwoAPI is next and the # same property type conflicts exist. Even though nestedAPI is stronger # than the prim type definition and has opinions for attr2, attr4, # attr5, rel1, and rel2 of the matching property/attribute type, these # are never the strongest API schema property opinion and are not # considered. _VerifyAttrTypes(prim, attr1 = ("int", 0, authoredOneAPIDocStr), attr2 = ("int", 2, conflictPrimTypeDocStr), attr3 = ("int", 10, authoredTwoAPIDocStr), attr4 = ("int", 4, builtinAPIDocStr), attr5 = ("color3f", Gf.Vec3f(1, 1, 1), conflictPrimTypeDocStr), attr6 = ("int", 20, authoredOneAPIDocStr)) _VerifyIsRel(prim, rel1 = (True, conflictPrimTypeDocStr), rel2 = (False, conflictPrimTypeDocStr)) if __name__ == "__main__": unittest.main()
nilq/baby-python
python
#! /usr/bin/env python3 # Copyright 2019 Samsung Research America # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import sys import time from action_msgs.msg import GoalStatus from geometry_msgs.msg import PoseStamped, PoseWithCovarianceStamped from nav2_msgs.action import FollowWaypoints from nav2_msgs.srv import ManageLifecycleNodes from nav2_msgs.srv import GetCostmap from nav2_msgs.msg import Costmap from nav_msgs.msg import OccupancyGrid from nav_msgs.msg import Odometry import rclpy from rclpy.action import ActionClient from rclpy.node import Node from rclpy.qos import QoSDurabilityPolicy, QoSHistoryPolicy, QoSReliabilityPolicy from rclpy.qos import QoSProfile from enum import Enum import numpy as np import math OCC_THRESHOLD = 10 MIN_FRONTIER_SIZE = 5 class Costmap2d(): class CostValues(Enum): FreeSpace = 0 InscribedInflated = 253 LethalObstacle = 254 NoInformation = 255 def __init__(self, map): self.map = map def getCost(self, mx, my): return self.map.data[self.__getIndex(mx, my)] def getSize(self): return (self.map.metadata.size_x, self.map.metadata.size_y) def getSizeX(self): return self.map.metadata.size_x def getSizeY(self): return self.map.metadata.size_y def __getIndex(self, mx, my): return my * self.map.metadata.size_x + mx class OccupancyGrid2d(): class CostValues(Enum): FreeSpace = 0 InscribedInflated = 100 LethalObstacle = 100 NoInformation = -1 def __init__(self, map): self.map = map def getCost(self, mx, my): return self.map.data[self.__getIndex(mx, my)] def getSize(self): return (self.map.info.width, self.map.info.height) def getSizeX(self): return self.map.info.width def getSizeY(self): return self.map.info.height def mapToWorld(self, mx, my): wx = self.map.info.origin.position.x + (mx + 0.5) * self.map.info.resolution wy = self.map.info.origin.position.y + (my + 0.5) * self.map.info.resolution return (wx, wy) def worldToMap(self, wx, wy): if (wx < self.map.info.origin.position.x or wy < self.map.info.origin.position.y): raise Exception("World coordinates out of bounds") mx = int((wx - self.map.info.origin.position.x) / self.map.info.resolution) my = int((wy - self.map.info.origin.position.y) / self.map.info.resolution) if (my > self.map.info.height or mx > self.map.info.width): raise Exception("Out of bounds") return (mx, my) def __getIndex(self, mx, my): return my * self.map.info.width + mx class FrontierCache(): cache = {} def getPoint(self, x, y): idx = self.__cantorHash(x, y) if idx in self.cache: return self.cache[idx] self.cache[idx] = FrontierPoint(x, y) return self.cache[idx] def __cantorHash(self, x, y): return (((x + y) * (x + y + 1)) / 2) + y def clear(self): self.cache = {} class FrontierPoint(): def __init__(self, x, y): self.classification = 0 self.mapX = x self.mapY = y def centroid(arr): arr = np.array(arr) length = arr.shape[0] sum_x = np.sum(arr[:, 0]) sum_y = np.sum(arr[:, 1]) return sum_x/length, sum_y/length def findFree(mx, my, costmap): fCache = FrontierCache() bfs = [fCache.getPoint(mx, my)] while len(bfs) > 0: loc = bfs.pop(0) if costmap.getCost(loc.mapX, loc.mapY) == OccupancyGrid2d.CostValues.FreeSpace.value: return (loc.mapX, loc.mapY) for n in getNeighbors(loc, costmap, fCache): if n.classification & PointClassification.MapClosed.value == 0: n.classification = n.classification | PointClassification.MapClosed.value bfs.append(n) return (mx, my) def getFrontier(pose, costmap, logger): fCache = FrontierCache() fCache.clear() mx, my = costmap.worldToMap(pose.position.x, pose.position.y) freePoint = findFree(mx, my, costmap) start = fCache.getPoint(freePoint[0], freePoint[1]) start.classification = PointClassification.MapOpen.value mapPointQueue = [start] frontiers = [] while len(mapPointQueue) > 0: p = mapPointQueue.pop(0) if p.classification & PointClassification.MapClosed.value != 0: continue if isFrontierPoint(p, costmap, fCache): p.classification = p.classification | PointClassification.FrontierOpen.value frontierQueue = [p] newFrontier = [] while len(frontierQueue) > 0: q = frontierQueue.pop(0) if q.classification & (PointClassification.MapClosed.value | PointClassification.FrontierClosed.value) != 0: continue if isFrontierPoint(q, costmap, fCache): newFrontier.append(q) for w in getNeighbors(q, costmap, fCache): if w.classification & (PointClassification.FrontierOpen.value | PointClassification.FrontierClosed.value | PointClassification.MapClosed.value) == 0: w.classification = w.classification | PointClassification.FrontierOpen.value frontierQueue.append(w) q.classification = q.classification | PointClassification.FrontierClosed.value newFrontierCords = [] for x in newFrontier: x.classification = x.classification | PointClassification.MapClosed.value newFrontierCords.append(costmap.mapToWorld(x.mapX, x.mapY)) if len(newFrontier) > MIN_FRONTIER_SIZE: frontiers.append(centroid(newFrontierCords)) for v in getNeighbors(p, costmap, fCache): if v.classification & (PointClassification.MapOpen.value | PointClassification.MapClosed.value) == 0: if any(costmap.getCost(x.mapX, x.mapY) == OccupancyGrid2d.CostValues.FreeSpace.value for x in getNeighbors(v, costmap, fCache)): v.classification = v.classification | PointClassification.MapOpen.value mapPointQueue.append(v) p.classification = p.classification | PointClassification.MapClosed.value return frontiers def getNeighbors(point, costmap, fCache): neighbors = [] for x in range(point.mapX - 1, point.mapX + 2): for y in range(point.mapY - 1, point.mapY + 2): if (x > 0 and x < costmap.getSizeX() and y > 0 and y < costmap.getSizeY()): neighbors.append(fCache.getPoint(x, y)) return neighbors def isFrontierPoint(point, costmap, fCache): if costmap.getCost(point.mapX, point.mapY) != OccupancyGrid2d.CostValues.NoInformation.value: return False hasFree = False for n in getNeighbors(point, costmap, fCache): cost = costmap.getCost(n.mapX, n.mapY) if cost > OCC_THRESHOLD: return False if cost == OccupancyGrid2d.CostValues.FreeSpace.value: hasFree = True return hasFree class PointClassification(Enum): MapOpen = 1 MapClosed = 2 FrontierOpen = 4 FrontierClosed = 8 class WaypointFollowerTest(Node): def __init__(self): super().__init__(node_name='nav2_waypoint_tester', namespace='') self.waypoints = None self.readyToMove = True self.currentPose = None self.lastWaypoint = None self.action_client = ActionClient(self, FollowWaypoints, 'FollowWaypoints') self.initial_pose_pub = self.create_publisher(PoseWithCovarianceStamped, 'initialpose', 10) self.costmapClient = self.create_client(GetCostmap, '/global_costmap/get_costmap') while not self.costmapClient.wait_for_service(timeout_sec=1.0): self.info_msg('service not available, waiting again...') self.initial_pose_received = False self.goal_handle = None pose_qos = QoSProfile( durability=QoSDurabilityPolicy.RMW_QOS_POLICY_DURABILITY_TRANSIENT_LOCAL, reliability=QoSReliabilityPolicy.RMW_QOS_POLICY_RELIABILITY_RELIABLE, history=QoSHistoryPolicy.RMW_QOS_POLICY_HISTORY_KEEP_LAST, depth=1) self.model_pose_sub = self.create_subscription(Odometry, '/odom', self.poseCallback, pose_qos) # self.costmapSub = self.create_subscription(Costmap(), '/global_costmap/costmap_raw', self.costmapCallback, pose_qos) self.costmapSub = self.create_subscription(OccupancyGrid(), '/map', self.occupancyGridCallback, pose_qos) self.costmap = None self.get_logger().info('Running Waypoint Test') def occupancyGridCallback(self, msg): self.costmap = OccupancyGrid2d(msg) def moveToFrontiers(self): frontiers = getFrontier(self.currentPose, self.costmap, self.get_logger()) if len(frontiers) == 0: self.info_msg('No More Frontiers') return location = None largestDist = 0 for f in frontiers: dist = math.sqrt(((f[0] - self.currentPose.position.x)**2) + ((f[1] - self.currentPose.position.y)**2)) if dist > largestDist: largestDist = dist location = [f] #worldFrontiers = [self.costmap.mapToWorld(f[0], f[1]) for f in frontiers] self.info_msg(f'World points {location}') self.setWaypoints(location) action_request = FollowWaypoints.Goal() action_request.poses = self.waypoints self.info_msg('Sending goal request...') send_goal_future = self.action_client.send_goal_async(action_request) try: rclpy.spin_until_future_complete(self, send_goal_future) self.goal_handle = send_goal_future.result() except Exception as e: self.error_msg('Service call failed %r' % (e,)) if not self.goal_handle.accepted: self.error_msg('Goal rejected') return self.info_msg('Goal accepted') get_result_future = self.goal_handle.get_result_async() self.info_msg("Waiting for 'FollowWaypoints' action to complete") try: rclpy.spin_until_future_complete(self, get_result_future) status = get_result_future.result().status result = get_result_future.result().result except Exception as e: self.error_msg('Service call failed %r' % (e,)) #self.currentPose = self.waypoints[len(self.waypoints) - 1].pose self.moveToFrontiers() def costmapCallback(self, msg): self.costmap = Costmap2d(msg) unknowns = 0 for x in range(0, self.costmap.getSizeX()): for y in range(0, self.costmap.getSizeY()): if self.costmap.getCost(x, y) == 255: unknowns = unknowns + 1 self.get_logger().info(f'Unknowns {unknowns}') self.get_logger().info(f'Got Costmap {len(getFrontier(None, self.costmap, self.get_logger()))}') def dumpCostmap(self): costmapReq = GetCostmap.Request() self.get_logger().info('Requesting Costmap') costmap = self.costmapClient.call(costmapReq) self.get_logger().info(f'costmap resolution {costmap.specs.resolution}') def setInitialPose(self, pose): self.init_pose = PoseWithCovarianceStamped() self.init_pose.pose.pose.position.x = pose[0] self.init_pose.pose.pose.position.y = pose[1] self.init_pose.header.frame_id = 'map' self.currentPose = self.init_pose.pose.pose self.publishInitialPose() time.sleep(5) def poseCallback(self, msg): self.info_msg('Received amcl_pose') self.currentPose = msg.pose.pose self.initial_pose_received = True def setWaypoints(self, waypoints): self.waypoints = [] for wp in waypoints: msg = PoseStamped() msg.header.frame_id = 'map' msg.pose.position.x = wp[0] msg.pose.position.y = wp[1] msg.pose.orientation.w = 1.0 self.waypoints.append(msg) def run(self, block): if not self.waypoints: rclpy.error_msg('Did not set valid waypoints before running test!') return False while not self.action_client.wait_for_server(timeout_sec=1.0): self.info_msg("'FollowWaypoints' action server not available, waiting...") action_request = FollowWaypoints.Goal() action_request.poses = self.waypoints self.info_msg('Sending goal request...') send_goal_future = self.action_client.send_goal_async(action_request) try: rclpy.spin_until_future_complete(self, send_goal_future) self.goal_handle = send_goal_future.result() except Exception as e: self.error_msg('Service call failed %r' % (e,)) if not self.goal_handle.accepted: self.error_msg('Goal rejected') return False self.info_msg('Goal accepted') if not block: return True get_result_future = self.goal_handle.get_result_async() self.info_msg("Waiting for 'FollowWaypoints' action to complete") try: rclpy.spin_until_future_complete(self, get_result_future) status = get_result_future.result().status result = get_result_future.result().result except Exception as e: self.error_msg('Service call failed %r' % (e,)) if status != GoalStatus.STATUS_SUCCEEDED: self.info_msg('Goal failed with status code: {0}'.format(status)) return False if len(result.missed_waypoints) > 0: self.info_msg('Goal failed to process all waypoints,' ' missed {0} wps.'.format(len(result.missed_waypoints))) return False self.info_msg('Goal succeeded!') return True def publishInitialPose(self): self.initial_pose_pub.publish(self.init_pose) def shutdown(self): self.info_msg('Shutting down') self.action_client.destroy() self.info_msg('Destroyed FollowWaypoints action client') transition_service = 'lifecycle_manager_navigation/manage_nodes' mgr_client = self.create_client(ManageLifecycleNodes, transition_service) while not mgr_client.wait_for_service(timeout_sec=1.0): self.info_msg(transition_service + ' service not available, waiting...') req = ManageLifecycleNodes.Request() req.command = ManageLifecycleNodes.Request().SHUTDOWN future = mgr_client.call_async(req) try: rclpy.spin_until_future_complete(self, future) future.result() except Exception as e: self.error_msg('%s service call failed %r' % (transition_service, e,)) self.info_msg('{} finished'.format(transition_service)) transition_service = 'lifecycle_manager_localization/manage_nodes' mgr_client = self.create_client(ManageLifecycleNodes, transition_service) while not mgr_client.wait_for_service(timeout_sec=1.0): self.info_msg(transition_service + ' service not available, waiting...') req = ManageLifecycleNodes.Request() req.command = ManageLifecycleNodes.Request().SHUTDOWN future = mgr_client.call_async(req) try: rclpy.spin_until_future_complete(self, future) future.result() except Exception as e: self.error_msg('%s service call failed %r' % (transition_service, e,)) self.info_msg('{} finished'.format(transition_service)) def cancel_goal(self): cancel_future = self.goal_handle.cancel_goal_async() rclpy.spin_until_future_complete(self, cancel_future) def info_msg(self, msg: str): self.get_logger().info(msg) def warn_msg(self, msg: str): self.get_logger().warn(msg) def error_msg(self, msg: str): self.get_logger().error(msg) def main(argv=sys.argv[1:]): rclpy.init() # wait a few seconds to make sure entire stacks are up #time.sleep(10) wps = [[-0.52, -0.54], [0.58, -0.55], [0.58, 0.52]] starting_pose = [-2.0, -0.5] test = WaypointFollowerTest() #test.dumpCostmap() test.setWaypoints(wps) retry_count = 0 retries = 2 while not test.initial_pose_received and retry_count <= retries: retry_count += 1 test.info_msg('Setting initial pose') test.setInitialPose(starting_pose) test.info_msg('Waiting for amcl_pose to be received') rclpy.spin_once(test, timeout_sec=1.0) # wait for poseCallback while test.costmap == None: test.info_msg('Getting initial map') rclpy.spin_once(test, timeout_sec=1.0) test.moveToFrontiers() rclpy.spin(test) # result = test.run(True) # assert result # # preempt with new point # test.setWaypoints([starting_pose]) # result = test.run(False) # time.sleep(2) # test.setWaypoints([wps[1]]) # result = test.run(False) # # cancel # time.sleep(2) # test.cancel_goal() # # a failure case # time.sleep(2) # test.setWaypoints([[100.0, 100.0]]) # result = test.run(True) # assert not result # result = not result # test.shutdown() # test.info_msg('Done Shutting Down.') # if not result: # test.info_msg('Exiting failed') # exit(1) # else: # test.info_msg('Exiting passed') # exit(0) if __name__ == '__main__': main()
nilq/baby-python
python
import discord import youtube_dl import os #import ffprobe from discord.ext import commands from discord.utils import get from discord import FFmpegPCMAudio from os import system from packages.CRITICAL.CLIENT import client from packages.CRITICAL.VERSION import EJ_DJ_VERSION import asyncio import subprocess import urllib.request import re #regulare expression from shutil import copyfile from commands.data import FOOTER, BOT_CHANNELS # @client.event # async def on_raw_reaction_add(payload): # print("SOMEONE REACTED") # @client.command(pass_context=True, aliases=["Update"]) # async def update(ctx): # if ctx.channel.name in BOT_CHANNELS.channels: # pfp = client.user.avatar_url # update_embed = discord.Embed( # colour=discord.Colour.green(), # title="UPDATE", # description=f"EJ DJ V{EJ_DJ_VERSION}") # update_embed.set_author(name="Trinity", icon_url=(pfp)) # update_embed.set_thumbnail(url=(pfp)) # update_embed.add_field(name="NEW:", value=""" # -PROFILES!!!\n # -Changed the radio stop command to " stop radio ".\n # -Updated the help channel. # """, inline=True) # update_embed.add_field(name="FIXED:", value=""" # -Fixed the stop command from sometimes causing file leaks. # """, inline=True) # update_embed.add_field(name="KNOWN BUGS:", value=""" # -Their is a known bug when trying to play 2 songs at the same time. # """, inline=True) # update_embed.add_field(name="Report:", value=""" # If you find a bug and wish to report it, please contact\n@EJ Studios#3379 or @Happypat900#8268 # """, inline=False) # update_embed.set_footer(text=f"{FOOTER.footer}") # await ctx.send(embed = update_embed) @client.command(pass_context=True, aliases=["Update"]) async def update(ctx): pfp = client.user.avatar_url pages = 3 cur_page = 2 #Change this to the current update !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! info_1 = discord.Embed( colour=discord.Colour.green(), title="UPDATE", description=f"EJ DJ V0.0.0") info_1.set_author(name="EJ DJ", icon_url=(pfp)) info_1.set_thumbnail(url=(pfp)) info_1.add_field(name="NEW:", value=""" -PROFILES!!!\n -Changed the radio stop command to " stop radio ".\n -Updated the help channel. """, inline=True) info_1.add_field(name="FIXED:", value=""" -Fixed the stop command from sometimes causing file leaks. """, inline=True) info_1.add_field(name="KNOWN BUGS:", value=""" -Their is a known bug when trying to play 2 songs at the same time. """, inline=True) info_1.add_field(name="Report:", value=""" If you find a bug and wish to report it, please contact\n@EJ Studios#3379 """, inline=False) info_1.set_footer(text=f"Page 1/{pages} \n{FOOTER.footer}") info_2 = discord.Embed( colour=discord.Colour.green(), title="UPDATE", description=f"EJ DJ V0.0.1") info_2.set_author(name="EJ DJ", icon_url=(pfp)) info_2.set_thumbnail(url=(pfp)) info_2.add_field(name="NEW:", value=""" -Redone the whole update command to make it more modern while still keeping it user friendly.\n -Added a server restart for times when the bot gets completely emotional... (ADMIN ONLY)\n """, inline=True) info_2.add_field(name="FIXED:", value=""" -Fixed a bug that caused the automatic status changes to pause if the internet went out or was weak. """, inline=True) info_2.add_field(name="KNOWN BUGS:", value=""" -No known bugs at this time! """, inline=True) info_2.add_field(name="Report:", value=""" If you find a bug and wish to report it, please contact\n@EJ Studios#3379 """, inline=False) info_2.set_footer(text=f"Page 2/{pages} \n{FOOTER.footer}") info_3 = discord.Embed( colour=discord.Colour.green(), title="UPDATE", description=f"EJ DJ V0.0.2 BETA") info_3.set_author(name="EJ DJ", icon_url=(pfp)) info_3.set_thumbnail(url=(pfp)) info_3.add_field(name="Whats next?", value=""" -We are still looking at what to improve for our next update, check back soon! """, inline=True) info_3.add_field(name="Have an idea?", value=""" please contact: @EJ Studios#3379 """, inline=False) info_3.set_footer(text=f"Page 3/{pages} \n{FOOTER.footer}") message = await ctx.send(embed = info_2) #Change this to the current update !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! # getting the message object for editing and reacting await message.add_reaction("◀️") await message.add_reaction("▶️") #adds reactions. def check(reaction, user): return user == ctx.author and str(reaction.emoji) in ["◀️", "▶️"] # This makes sure nobody except the command sender can interact with the "menu" while True: try: reaction, user = await client.wait_for("reaction_add", timeout=60, check=check) # waiting for a reaction to be added - times out after x seconds, 60 in this # example if str(reaction.emoji) == "▶️" and cur_page != pages: cur_page += 1 if cur_page == 1: await message.edit(embed=info_1) elif cur_page == 2: await message.edit(embed=info_2) elif cur_page == 3: await message.edit(embed=info_3) # await message.edit(embed=info) await message.remove_reaction(reaction, user) elif str(reaction.emoji) == "◀️" and cur_page > 1: cur_page -= 1 if cur_page == 1: await message.edit(embed=info_1) elif cur_page == 2: await message.edit(embed=info_2) elif cur_page == 3: await message.edit(embed=info_3) #await message.edit(content=f"Page {cur_page}/{pages}:\n{contents[cur_page-1]}") await message.remove_reaction(reaction, user) else: await message.remove_reaction(reaction, user) # removes reactions if the user tries to go forward on the last page or # backwards on the first page except asyncio.TimeoutError: await message.delete() break # ending the loop if user doesn't react after x seconds
nilq/baby-python
python
from applications_superstaq._init_vars import API_URL, API_VERSION from applications_superstaq.superstaq_exceptions import ( SuperstaQException, SuperstaQModuleNotFoundException, SuperstaQNotFoundException, SuperstaQUnsuccessfulJobException, ) from . import converters from . import finance from . import logistics from . import qubo from . import superstaq_client from . import superstaq_exceptions from . import user_config __all__ = [ "API_URL", "API_VERSION", "SuperstaQException", "SuperstaQModuleNotFoundException", "SuperstaQNotFoundException", "SuperstaQUnsuccessfulJobException", "converters", "finance", "logistics", "qubo", "superstaq_client", "superstaq_exceptions", "user_config", ]
nilq/baby-python
python
# -*- coding: utf-8 -*- #------------------------------------------------------------------------------ # pycreviewer: source_file_parser.py # Dromar [https://github.com/dromar-soft] # License: MIT #------------------------------------------------------------------------------ from pycparser import parse_file, c_generator, c_ast import os def parse(filepath:str, cpp_args:list): """ Parse c source file by pycparser, and return AST object. """ ast = parse_file(filepath, use_cpp=True, cpp_path='gcc', cpp_args=cpp_args) return ast
nilq/baby-python
python
import random import sc2 from sc2 import Race, Difficulty from sc2.constants import * from sc2.player import Bot, Computer from sc2.position import Point2, Point3 class RampWallBot(sc2.BotAI): async def on_step(self, iteration): cc = self.units(COMMANDCENTER) if not cc.exists: return else: cc = cc.first if self.can_afford(SCV) and self.workers.amount < 16 and cc.noqueue: await self.do(cc.train(SCV)) # Raise depos when enemies are nearby for depo in self.units(SUPPLYDEPOT).ready: for unit in self.known_enemy_units.not_structure: if unit.position.to2.distance_to(depo.position.to2) < 15: break else: await self.do(depo(MORPH_SUPPLYDEPOT_LOWER)) # Lower depos when no enemies are nearby for depo in self.units(SUPPLYDEPOTLOWERED).ready: for unit in self.known_enemy_units.not_structure: if unit.position.to2.distance_to(depo.position.to2) < 10: await self.do(depo(MORPH_SUPPLYDEPOT_RAISE)) break depot_placement_positions = self.main_base_ramp.corner_depots # Uncomment the following if you want to build 3 supplydepots in the wall instead of a barracks in the middle + 2 depots in the corner # depot_placement_positions = self.main_base_ramp.corner_depots | {self.main_base_ramp.depot_in_middle} barracks_placement_position = None barracks_placement_position = self.main_base_ramp.barracks_correct_placement # If you prefer to have the barracks in the middle without room for addons, use the following instead # barracks_placement_position = self.main_base_ramp.barracks_in_middle depots = self.units(SUPPLYDEPOT) | self.units(SUPPLYDEPOTLOWERED) # Filter locations close to finished supply depots if depots: depot_placement_positions = {d for d in depot_placement_positions if depots.closest_distance_to(d) > 1} # Build depots if self.can_afford(SUPPLYDEPOT) and not self.already_pending(SUPPLYDEPOT): if len(depot_placement_positions) == 0: return # Choose any depot location target_depot_location = depot_placement_positions.pop() ws = self.workers.gathering if ws: # if workers were found w = ws.random await self.do(w.build(SUPPLYDEPOT, target_depot_location)) # Build barracks if depots.ready.exists and self.can_afford(BARRACKS) and not self.already_pending(BARRACKS): if self.units(BARRACKS).amount + self.already_pending(BARRACKS) > 0: return ws = self.workers.gathering if ws and barracks_placement_position: # if workers were found w = ws.random await self.do(w.build(BARRACKS, barracks_placement_position)) def main(): sc2.run_game(sc2.maps.get("OdysseyLE"), [ Bot(Race.Terran, RampWallBot()), Computer(Race.Zerg, Difficulty.Hard) ], realtime=False) if __name__ == '__main__': main()
nilq/baby-python
python
from django.conf import settings from django.contrib.contenttypes.fields import GenericForeignKey from django.contrib.contenttypes.models import ContentType from django.db import models from django.utils.encoding import force_str from django.utils.translation import gettext_lazy as _ from .managers import MetaTagManager from .utils import get_cache_backend, check_caching_enabled class MetaTag(models.Model): url = models.CharField(_('URL-path'), max_length=100, blank=True, db_index=True) content_type = models.ForeignKey(ContentType, on_delete=models.CASCADE, null=True) object_id = models.PositiveIntegerField(null=True) content_object = GenericForeignKey() title = models.CharField(_('title'), max_length=80, blank=True) keywords = models.CharField(_('keywords'), max_length=250, blank=True) description = models.TextField(_('description'), blank=True) objects = MetaTagManager() class Meta: ordering = ['id'] db_table = 'metatags' unique_together = ['content_type', 'object_id'] verbose_name = _('meta tags') verbose_name_plural = _('meta tags') def __str__(self): if self.content_object is not None: return force_str(self.content_object) return self.title def save(self, *args, **kwargs): is_inserted = not bool(self.pk) super().save(*args, **kwargs) if not is_inserted and check_caching_enabled(): self._invalidate_cache() def _asdict(self): return { 'title': self.title, 'keywords': self.keywords, 'description': self.description, } @staticmethod def _compose_cache_key(identifier): return '{cache_key_prefix}:{identifier}'.format( cache_key_prefix=getattr(settings, 'METATAGS_CACHE_KEY_PREFIX', 'metatags'), identifier=identifier, ) def _get_cache_key(self): if self.content_object is not None: identifier = '{}:{}'.format(self.content_object._meta.label_lower, self.content_object.pk) else: identifier = self.url return self._compose_cache_key(identifier) def _rebuild_cache(self): cache = get_cache_backend() cache.set( key=self._get_cache_key(), value=self, timeout=getattr(settings, 'METATAGS_CACHE_TIMEOUT', None), ) def _invalidate_cache(self): cache = get_cache_backend() cache.delete(self._get_cache_key())
nilq/baby-python
python
import torch import torch.nn as nn def weights_init(m): if isinstance(m, nn.Conv2d) or isinstance(m, nn.Linear): nn.init.xavier_uniform_(m.weight.data) nn.init.constant_(m.bias, 0.1) class PNet(nn.Module): ''' PNet ''' def __init__(self, ): super(PNet, self).__init__() # backend self.pre_layer = nn.Sequential( nn.Conv2d(3, 10, kernel_size=3, stride=1), # conv1 nn.PReLU(), # PReLU1 nn.MaxPool2d(kernel_size=2, stride=2), # pool1 nn.Conv2d(10, 16, kernel_size=3, stride=1), # conv2 nn.PReLU(), # PReLU2 nn.Conv2d(16, 32, kernel_size=3, stride=1), # conv3 nn.PReLU() # PReLU3 ) # detection self.conv4_1 = nn.Conv2d(32, 1, kernel_size=1, stride=1) # only for forground and background # bounding box regresion self.conv4_2 = nn.Conv2d(32, 4, kernel_size=1, stride=1) # landmark localization # self.conv4_3 = nn.Conv2d(32, 10, kernel_size=1, stride=1) # weight initiation with xavier self.apply(weights_init) def forward(self, x): x = self.pre_layer(x) logits = self.conv4_1(x) # batch, 2, 1, 1 offset = self.conv4_2(x) return logits, offset
nilq/baby-python
python
from bayesnet.tensor.constant import Constant from bayesnet.tensor.tensor import Tensor from bayesnet.function import Function class Negative(Function): """ element-wise negative y = -x """ def forward(self, x): x = self._convert2tensor(x) self.x = x if isinstance(self.x, Constant): return Constant(-x.value) return Tensor(-x.value, function=self) def backward(self, delta): dx = -delta self.x.backward(dx) def negative(x): """ element-wise negative """ return Negative().forward(x)
nilq/baby-python
python
""" This script takes the LIRICAL output TSV and converts it to a format that can be uploaded to seqr (pending implementation of https://github.com/broadinstitute/seqr/issues/2742). """ import argparse import pandas as pd import re from utils.gene_ids import get_entrez_to_ensembl_id_map def main(): p = argparse.ArgumentParser() p.add_argument("--max-results", default=200, type=int, help="Output at most this many LIRICAL results") p.add_argument("--output-suffix", default="for_seqr", help="This suffix will be added to the input filename to make the output filename") p.add_argument("lirical_tsv", nargs="+", help="One or more LIRICAL output .tsv files") args = p.parse_args() gene_id_map = get_entrez_to_ensembl_id_map() for lirical_tsv in args.lirical_tsv: with open(lirical_tsv) as f: next(f) sample_id_line = next(f) sample_id = sample_id_line.rstrip().replace("! Sample: ", "") df = pd.read_table(lirical_tsv, comment="!", dtype=str) #print(f"Read {len(df)} rows from {lirical_tsv}") output_rows = [] for _, row in df.iterrows(): entrez_gene_id = str(int(re.sub("^NCBIGene:", "", row.entrezGeneId))) ensemble_gene_id = gene_id_map.get(entrez_gene_id) if not ensemble_gene_id: print(f"WARNING: Entrez gene Id {row.entrezGeneId} doesn't have a matching Ensembl gene Id") if int(row["rank"]) > args.max_results: #print(f"Skipping row(s) after row #{args.max_results}: {row.to_dict()}") continue output_rows.append({ "tool": "lirical", "sampleId": sample_id, "rank": int(row["rank"]), "geneId": ensemble_gene_id, "diseaseId": row.diseaseCurie, # "OMIM:130720" "diseaseName": row.diseaseName, # "Lateral meningocele syndrome" "scoreName1": "post_test_probability", "score1": float(row.posttestprob.strip("%")), "scoreName2": "compositeLR", "score2": float(row.compositeLR.replace(",", "")), "scoreName3": None, "score3": None, }) output_path = re.sub(".tsv", f".{args.output_suffix}.tsv", lirical_tsv) output_df = pd.DataFrame(output_rows) output_df.to_csv(output_path, sep="\t", index=False, header=True) print(f"Wrote {len(output_df)} rows to {output_path}") if __name__ == "__main__": main()
nilq/baby-python
python
import discord from discord.ext import commands from discord.ext.commands import cooldown from discord.ext.commands.cooldowns import BucketType import time import asyncio import asyncpg from datetime import datetime, timedelta from random import randint from random import choice import psutil import os import sys colors = [0xe56b6b,0xdd5151,0xba3434,0xab1f1f,0x940808] online = '<:online_status:506963324391653387>' offline = '<:offline_status:506963324521414661>' dnd = '<:dnd_status:506963324634791936>' idle = '<:idle_status:506963324529803264>' class misc: def __init__(self, bot): self.bot = bot @commands.command(description='Give someone a slap', brief='Slap', usage='slap [user]') async def slap(self, ctx, *, user: discord.Member): embed = discord.Embed(colour=choice(colors)) embed.set_author(name=f"{ctx.author.name} slapped {user.name}! Ouch!") embed.set_image(url="https://media.giphy.com/media/RXGNsyRb1hDJm/giphy.gif") await ctx.send(embed=embed) @commands.command(description='Give someone a hug! Awwww', brief='Hug', usage='hug [user]') async def hug(self, ctx, *, user: discord.Member): embed = discord.Embed(colour=choice(colors)) embed.set_author(name=f"{ctx.author.name} gave {user.name} hug! How cute!") embed.set_image(url="https://media.giphy.com/media/lXiRKBj0SAA0EWvbG/giphy.gif") await ctx.send(embed=embed) @commands.command(aliases=['pong'],description='Check the bots latency to Discord Websockets',brief='Check the bots ping',usage='ping') async def ping(self, ctx): t_1 = time.perf_counter() await ctx.trigger_typing() t_2 = time.perf_counter() time_delta = round((t_2-t_1)*1000) await ctx.send(f':ping_pong: Websocket: {round(self.bot.latency*1000)} ms. Typing: {time_delta} ms') @commands.command(aliases=["avy"],description='Get a users or your avatar',usage='avatar [user]',brief='Get a users or your avatar') async def avatar(self, ctx,*,user:discord.Member=None): user = user or ctx.author embed = discord.Embed(colour=0x7289da,description=f"[Link]({user.avatar_url})") embed.set_author(name=f"{user.name}'s avatar",url=user.avatar_url) embed.set_image(url=user.avatar_url_as(static_format="png")) await ctx.send(embed=embed) @commands.command(aliases=['about'],description='Get stats about the bot',brief='Check bot stats',usage='info') async def info(self, ctx): cmds_used = await self.bot.pool.fetchval('''SELECT * FROM commands_used;''') uwulonian = await self.bot.pool.fetchval("SELECT count(user_id) FROM user_settings;") delta_uptime = datetime.utcnow() - self.bot.launch_time hours, remainder = divmod(int(delta_uptime.total_seconds()),3600) minutes, seconds = divmod(remainder,60) days, hours = divmod(hours,24) member_count = 0 offline_members = set() idle_members = set() dnd_members = set() online_members = set() cpu_usage = self.bot.process.cpu_percent() cpu_count = psutil.cpu_count() memory_usage = self.bot.process.memory_full_info().uss / (1024 ** 2) version = sys.version_info for g in self.bot.guilds: member_count += g.member_count for m in g.members: if m.status is discord.Status.offline: offline_members.add(m.id) if m.status is discord.Status.idle: idle_members.add(m.id) if m.status is discord.Status.dnd: dnd_members.add(m.id) if m.status is discord.Status.online: online_members.add(m.id) offline_count = len(offline_members) idle_count = len(idle_members) dnd_count = len(dnd_members) online_count = len(online_members) user_count = len(self.bot.users) embed = discord.Embed(color=0x7289da) embed.set_author(name='Bot Stats') embed.add_field(name='Owner',value=f'<@300088143422685185> (mellowmarshe#0001)') embed.add_field(name='Library',value=f'[discord.py\\[rewrite\\]](https://github.com/Rapptz/discord.py/tree/rewrite)') embed.add_field(name='Language',value=f'Python {version.major}.{version.minor}.{version.micro}') embed.add_field(name='Uptime',value=f'{days}d {hours}h {minutes}m') embed.add_field(name='Servers', value=len(self.bot.guilds)) embed.add_field(name='Process',value=f'Memory {round(memory_usage, 2)}MiB\nCPU {cpu_usage/cpu_count}%') embed.add_field(name='Bot Usage',value=f'{cmds_used} commands used\n{uwulonian} uwulonians') embed.add_field(name='Members',value=f'{online}{online_count} {idle}{idle_count} {dnd}{dnd_count} {offline}{offline_count}') embed.add_field(name='Links',value='[Invite](https://discordapp.com/oauth2/authorize?client_id=508725128427995136&scope=bot&permissions=201718983) | [Support](https://discord.gg/494uEhN) | [Donate](https://www.patreon.com/mellOwO?alert=2) | [Vote](https://discordbots.org/bot/508725128427995136/vote)') await ctx.send(embed=embed) @commands.command(description="Get the link to the support server") async def support(self,ctx): await ctx.send("The link to the support server is https://discord.gg/494uEhN") @commands.command(description="Check our lovely Patrons!") async def patrons(self,ctx): e = discord.Embed(color=0x7289da, description="Patreon https://www.patreon.com/mellOwO?alert=2") e.set_author(name="Our awesome Patrons") e.add_field(name="Capn", value= """ Supporter since 11/19/18 at 20:42:35 UTC - [His bot](https://discordapp.com/oauth2/authorize?&client_id=448915931507458048&scope=bot&permissions=8) """, inline=False) e.add_field(name="Arika", value= """ Supporter since 11/28/18 at 02:06:13 UTC """, inline=False) e.add_field(name="Mary Johanna", value= """ Awesome since 11/29/18 at 17:21:28 UTC """, inline=False) e.add_field(name="XiuhcoatlSlayer", value= """ Supporter since 11/30/18 at 02:14:11 UTC """, inline=False) await ctx.send(embed=e) @commands.command(description="Send voting link") async def vote(self,ctx): await ctx.send("You can vote for me here! https://discordbots.org/bot/508725128427995136/vote I greatly appreciate voting as it helps the bot a lot") @commands.command(description="Bot rules", aliases=['tos']) async def rules(self, ctx): await ctx.send( """ uwu rules. You must follow these or we will take action `-` Don't spam or abuse commands with the intent to harm or slow the bot down. We want the best experience for our users anything to harm this is a problem. `-` Don't rename or create an uwulonian with a harmful, racist, or any name that can offend someone. We will most likely delete your uwulonian if you do this. `-` The use of scripts or anything to gain an advantage is forbidden. `-` DM staff if you are having problems with the bot don't DM regular members unless they say you can. """) def setup(bot): bot.add_cog(misc(bot))
nilq/baby-python
python
from numbers import Number class TresholdEqual: """ Implementation of numeric objects considered equal when within a specified tolerance. The optional 'tolerance' parameter defaults to 1. Only comparison operators are implemented. Attempt to compare with objects of different types raises TypeError exception. When two TresholdEqual objects have different tolerances the smaller one takes precendence. """ def __init__(self, number, tolerance=1): if not isinstance(number, Number): raise TypeError else: self.number = number if not isinstance(tolerance, Number): raise TypeError else: self.tolerance = tolerance def __eq__(self, other): if isinstance(other, type(self)): tolerance = min(self.tolerance, other.tolerance) return abs(self.number - other.number) <= tolerance else: raise TypeError def __ne__(self, other): return not self == other def __lt__(self, other): return self != other and self.number < other.number def __gt__(self, other): return self != other and self.number > other.number def __le__(self, other): return self == other or self < other def __ge__(self, other): return self == other or self > other
nilq/baby-python
python
# -*- coding: utf-8 -*- """ Created on Tue Dec 24 20:43:09 2019 @author: elif.ayvali """ import sys import gym import pandas as pd import numpy as np import matplotlib.collections as mc import matplotlib.pyplot as plt from helpers import create_uniform_grid,discretize,visualize_samples class QLearningAgent: """Q-Learning agent that can act on a continuous state space by discretizing it.""" def __init__(self, env, state_grid, alpha=0.02, gamma=0.99, epsilon=1.0, epsilon_decay_rate=0.9995, min_epsilon=.01, seed=505): """Initialize variables, create grid for discretization.""" # Environment info self.env = env self.state_grid = state_grid self.state_size = tuple(len(splits) + 1 for splits in self.state_grid) # n-dimensional state space self.action_size = self.env.action_space.n # 1-dimensional discrete action space self.seed = np.random.seed(seed) print("Environment:", self.env) print("State space size:", self.state_size) print("Action space size:", self.action_size) # Learning parameters self.alpha = alpha # learning rate self.gamma = gamma # discount factor self.epsilon = self.initial_epsilon = epsilon # initial exploration rate self.epsilon_decay_rate = epsilon_decay_rate # how quickly should we decrease epsilon self.min_epsilon = min_epsilon # Create Q-table self.q_table = np.zeros(shape=(self.state_size + (self.action_size,))) print("Q table size:", self.q_table.shape) def preprocess_state(self, state): """Map a continuous state to its discretized representation.""" return tuple(discretize(state,self.state_grid)) def reset_episode(self, state): """Reset variables for a new episode.""" # Gradually decrease exploration rate self.epsilon *= self.epsilon_decay_rate self.epsilon = max(self.epsilon, self.min_epsilon) # Decide initial action self.last_state = self.preprocess_state(state) self.last_action = np.argmax(self.q_table[self.last_state]) return self.last_action def reset_exploration(self, epsilon=None): """Reset exploration rate used when training.""" self.epsilon = epsilon if epsilon is not None else self.initial_epsilon def act(self, state, reward=None, done=None, mode='train'): """Pick next action and update internal Q table (when mode != 'test').""" state = self.preprocess_state(state) if mode == 'test': # Test mode: Simply produce an action action = np.argmax(self.q_table[state]) else: # Train mode (default): Update Q table, pick next action # Note: We update the Q table entry for the *last* (state, action) pair with current state, reward self.q_table[self.last_state + (self.last_action,)] += self.alpha * \ (reward + self.gamma * max(self.q_table[state]) - self.q_table[self.last_state + (self.last_action,)]) # Exploration vs. exploitation do_exploration = np.random.uniform(0, 1) < self.epsilon if do_exploration: # Pick a random action action = np.random.randint(0, self.action_size) else: # Pick the best action from Q table action = np.argmax(self.q_table[state]) # Roll over current state, action for next step self.last_state = state self.last_action = action return action def run(agent, env, num_episodes=20000, mode='train'): """Run agent in given reinforcement learning environment and return scores.""" scores = [] max_avg_score = -np.inf for i_episode in range(1, num_episodes+1): # Initialize episode state = env.reset() action = agent.reset_episode(state) total_reward = 0 done = False # Roll out steps until done while not done: state, reward, done, info = env.step(action) total_reward += reward action = agent.act(state, reward, done, mode) # Save final score scores.append(total_reward) # Print episode stats if mode == 'train': if len(scores) > 100: avg_score = np.mean(scores[-100:]) if avg_score > max_avg_score: max_avg_score = avg_score if i_episode % 100 == 0: print("\rEpisode {}/{} | Max Average Score: {}".format(i_episode, num_episodes, max_avg_score), end="") sys.stdout.flush() return scores def plot_scores(scores, rolling_window=100): """Plot scores and optional rolling mean using specified window.""" plt.plot(scores); plt.title("Scores"); rolling_mean = pd.Series(scores).rolling(rolling_window).mean() plt.plot(rolling_mean); return rolling_mean def plot_q_table(q_table): """Visualize max Q-value for each state and corresponding action. Q-table is of size MxNxA, where (M, N) is the size of the state space, and A is the size of the action space. We are interested in the maximum Q-value for each state, and the corresponding (best) action associated with that value.""" q_image = np.max(q_table, axis=2) # max Q-value for each state q_actions = np.argmax(q_table, axis=2) # best action for each state fig, ax = plt.subplots(figsize=(10, 10)) cax = ax.imshow(q_image, cmap='jet'); cbar = fig.colorbar(cax) for x in range(q_image.shape[0]): for y in range(q_image.shape[1]): ax.text(x, y, q_actions[x, y], color='white', horizontalalignment='center', verticalalignment='center') ax.grid(False) ax.set_title("Q-table, size: {}".format(q_table.shape)) ax.set_xlabel('position') ax.set_ylabel('velocity') # Create an environment env = gym.make('MountainCar-v0') # Create a grid to discretize the state space of the RL problem low = [-1.0, -5.0] high = [1.0, 5.0] state_grid = create_uniform_grid(env.observation_space.low, env.observation_space.high, bins=(10, 10)) q_agent = QLearningAgent(env, state_grid) scores = run(q_agent, env) # Plot scores obtained per episode plt.plot(scores); plt.title("Scores") #If the scores are noisy, it might be difficult to tell whether your agent is actually learning. # To find the underlying trend, plot a rolling mean of the scores. rolling_mean = plot_scores(scores) # Run in test mode and analyze scores obtained test_scores = run(q_agent, env, num_episodes=100, mode='test') print("[TEST] Completed {} episodes with avg. score = {}".format(len(test_scores), np.mean(test_scores))) _ = plot_scores(test_scores) plot_q_table(q_agent.q_table) #Improve the agent by increasing state space state_grid_new = create_uniform_grid(env.observation_space.low, env.observation_space.high, bins=(20, 20)) q_agent_new = QLearningAgent(env, state_grid_new) q_agent_new.scores = [] # initialize a list to store scores for this agent #This line can be run multiple times, and scores will get accumulated q_agent_new.scores += run(q_agent_new, env, num_episodes=50000) # accumulate scores rolling_mean_new = plot_scores(q_agent_new.scores) # Run in test mode and analyze scores obtained test_scores = run(q_agent_new, env, num_episodes=100, mode='test') print("[TEST] Completed {} episodes with avg. score = {}".format(len(test_scores), np.mean(test_scores))) _ = plot_scores(test_scores) # Visualize the learned Q-table plot_q_table(q_agent_new.q_table)
nilq/baby-python
python
import numpy as np from dgl.frame import Frame, FrameRef from dgl.utils import Index, toindex import backend as F import dgl import unittest N = 10 D = 5 def check_fail(fn): try: fn() return False except: return True def create_test_data(grad=False): c1 = F.randn((N, D)) c2 = F.randn((N, D)) c3 = F.randn((N, D)) if grad: c1 = F.attach_grad(c1) c2 = F.attach_grad(c2) c3 = F.attach_grad(c3) return {'a1' : c1, 'a2' : c2, 'a3' : c3} def test_create(): data = create_test_data() f1 = Frame(num_rows=N) for k, v in data.items(): f1.update_column(k, v) print(f1.schemes) assert f1.keys() == set(data.keys()) assert f1.num_columns == 3 assert f1.num_rows == N f2 = Frame(data) assert f2.keys() == set(data.keys()) assert f2.num_columns == 3 assert f2.num_rows == N f1.clear() assert len(f1.schemes) == 0 assert f1.num_rows == 0 def test_column1(): # Test frame column getter/setter data = create_test_data() f = Frame(data) assert f.num_rows == N assert len(f) == 3 assert F.allclose(f['a1'].data, data['a1']) f['a1'] = data['a2'] assert F.allclose(f['a2'].data, data['a2']) # add a different length column should fail def failed_add_col(): f['a4'] = F.zeros([N+1, D]) assert check_fail(failed_add_col) # delete all the columns del f['a1'] del f['a2'] assert len(f) == 1 del f['a3'] assert len(f) == 0 def test_column2(): # Test frameref column getter/setter data = Frame(create_test_data()) f = FrameRef(data, toindex([3, 4, 5, 6, 7])) assert f.num_rows == 5 assert len(f) == 3 assert F.allclose(f['a1'], F.narrow_row(data['a1'].data, 3, 8)) # set column should reflect on the referenced data f['a1'] = F.zeros([5, D]) assert F.allclose(F.narrow_row(data['a1'].data, 3, 8), F.zeros([5, D])) # add new partial column should fail with error initializer f.set_initializer(lambda shape, dtype : assert_(False)) def failed_add_col(): f['a4'] = F.ones([5, D]) assert check_fail(failed_add_col) def test_append1(): # test append API on Frame data = create_test_data() f1 = Frame() f2 = Frame(data) f1.append(data) assert f1.num_rows == N f1.append(f2) assert f1.num_rows == 2 * N c1 = f1['a1'] assert tuple(F.shape(c1.data)) == (2 * N, D) truth = F.cat([data['a1'], data['a1']], 0) assert F.allclose(truth, c1.data) # append dict of different length columns should fail f3 = {'a1' : F.zeros((3, D)), 'a2' : F.zeros((3, D)), 'a3' : F.zeros((2, D))} def failed_append(): f1.append(f3) assert check_fail(failed_append) def test_append2(): # test append on FrameRef data = Frame(create_test_data()) f = FrameRef(data) assert f.is_contiguous() assert f.is_span_whole_column() assert f.num_rows == N # append on the underlying frame should not reflect on the ref data.append(data) assert f.is_contiguous() assert not f.is_span_whole_column() assert f.num_rows == N # append on the FrameRef should work f.append(data) assert not f.is_contiguous() assert not f.is_span_whole_column() assert f.num_rows == 3 * N new_idx = list(range(N)) + list(range(2*N, 4*N)) assert F.array_equal(f._index.tousertensor(), F.copy_to(F.tensor(new_idx, dtype=F.int64), F.cpu())) assert data.num_rows == 4 * N def test_append3(): # test append on empty frame f = Frame(num_rows=5) data = {'h' : F.ones((3, 2))} f.append(data) assert f.num_rows == 8 ans = F.cat([F.zeros((5, 2)), F.ones((3, 2))], 0) assert F.allclose(f['h'].data, ans) # test append with new column data = {'h' : 2 * F.ones((3, 2)), 'w' : 2 * F.ones((3, 2))} f.append(data) assert f.num_rows == 11 ans1 = F.cat([ans, 2 * F.ones((3, 2))], 0) ans2 = F.cat([F.zeros((8, 2)), 2 * F.ones((3, 2))], 0) assert F.allclose(f['h'].data, ans1) assert F.allclose(f['w'].data, ans2) def test_row1(): # test row getter/setter data = create_test_data() f = FrameRef(Frame(data)) # getter # test non-duplicate keys rowid = Index(F.tensor([0, 2])) rows = f[rowid] for k, v in rows.items(): assert tuple(F.shape(v)) == (len(rowid), D) assert F.allclose(v, F.gather_row(data[k], F.tensor(rowid.tousertensor()))) # test duplicate keys rowid = Index(F.tensor([8, 2, 2, 1])) rows = f[rowid] for k, v in rows.items(): assert tuple(F.shape(v)) == (len(rowid), D) assert F.allclose(v, F.gather_row(data[k], F.tensor(rowid.tousertensor()))) # setter rowid = Index(F.tensor([0, 2, 4])) vals = {'a1' : F.zeros((len(rowid), D)), 'a2' : F.zeros((len(rowid), D)), 'a3' : F.zeros((len(rowid), D)), } f[rowid] = vals for k, v in f[rowid].items(): assert F.allclose(v, F.zeros((len(rowid), D))) # setting rows with new column should raise error with error initializer f.set_initializer(lambda shape, dtype : assert_(False)) def failed_update_rows(): vals['a4'] = F.ones((len(rowid), D)) f[rowid] = vals assert check_fail(failed_update_rows) def test_row2(): # test row getter/setter autograd compatibility data = create_test_data(grad=True) f = FrameRef(Frame(data)) with F.record_grad(): # getter c1 = f['a1'] # test non-duplicate keys rowid = Index(F.tensor([0, 2])) rows = f[rowid] y = rows['a1'] F.backward(y, F.ones((len(rowid), D))) assert F.allclose(F.grad(c1)[:,0], F.tensor([1., 0., 1., 0., 0., 0., 0., 0., 0., 0.])) f['a1'] = F.attach_grad(f['a1']) with F.record_grad(): c1 = f['a1'] # test duplicate keys rowid = Index(F.tensor([8, 2, 2, 1])) rows = f[rowid] y = rows['a1'] F.backward(y, F.ones((len(rowid), D))) assert F.allclose(F.grad(c1)[:,0], F.tensor([0., 1., 2., 0., 0., 0., 0., 0., 1., 0.])) f['a1'] = F.attach_grad(f['a1']) with F.record_grad(): # setter c1 = f['a1'] rowid = Index(F.tensor([0, 2, 4])) vals = {'a1' : F.attach_grad(F.zeros((len(rowid), D))), 'a2' : F.attach_grad(F.zeros((len(rowid), D))), 'a3' : F.attach_grad(F.zeros((len(rowid), D))), } f[rowid] = vals c11 = f['a1'] F.backward(c11, F.ones((N, D))) assert F.allclose(F.grad(c1)[:,0], F.tensor([0., 1., 0., 1., 0., 1., 1., 1., 1., 1.])) assert F.allclose(F.grad(vals['a1']), F.ones((len(rowid), D))) assert F.is_no_grad(vals['a2']) def test_row3(): # test row delete data = Frame(create_test_data()) f = FrameRef(data) assert f.is_contiguous() assert f.is_span_whole_column() assert f.num_rows == N del f[toindex(F.tensor([2, 3]))] assert not f.is_contiguous() assert not f.is_span_whole_column() # delete is lazy: only reflect on the ref while the # underlying storage should not be touched assert f.num_rows == N - 2 assert data.num_rows == N newidx = list(range(N)) newidx.pop(2) newidx.pop(2) newidx = toindex(newidx) for k, v in f.items(): assert F.allclose(v, data[k][newidx]) @unittest.skipIf(dgl.backend.backend_name == "tensorflow", reason="TF doesn't support inplace update") def test_row4(): # test updating row with empty frame but has preset num_rows f = FrameRef(Frame(num_rows=5)) rowid = Index(F.tensor([0, 2, 4])) f[rowid] = {'h' : F.ones((3, 2))} ans = F.zeros((5, 2)) ans[F.tensor([0, 2, 4])] = F.ones((3, 2)) assert F.allclose(f['h'], ans) @unittest.skipIf(dgl.backend.backend_name == "tensorflow", reason="TF doesn't support inplace update") def test_sharing(): data = Frame(create_test_data()) f1 = FrameRef(data, index=toindex([0, 1, 2, 3])) f2 = FrameRef(data, index=toindex([2, 3, 4, 5, 6])) # test read for k, v in f1.items(): assert F.allclose(F.narrow_row(data[k].data, 0, 4), v) for k, v in f2.items(): assert F.allclose(F.narrow_row(data[k].data, 2, 7), v) f2_a1 = f2['a1'] # test write # update own ref should not been seen by the other. f1[Index(F.tensor([0, 1]))] = { 'a1' : F.zeros([2, D]), 'a2' : F.zeros([2, D]), 'a3' : F.zeros([2, D]), } assert F.allclose(f2['a1'], f2_a1) # update shared space should been seen by the other. f1[Index(F.tensor([2, 3]))] = { 'a1' : F.ones([2, D]), 'a2' : F.ones([2, D]), 'a3' : F.ones([2, D]), } F.narrow_row_set(f2_a1, 0, 2, F.ones([2, D])) assert F.allclose(f2['a1'], f2_a1) @unittest.skipIf(dgl.backend.backend_name == "tensorflow", reason="TF doesn't support inplace update") def test_slicing(): data = Frame(create_test_data(grad=True)) f1 = FrameRef(data, index=toindex(slice(1, 5))) f2 = FrameRef(data, index=toindex(slice(3, 8))) # test read for k, v in f1.items(): assert F.allclose(F.narrow_row(data[k].data, 1, 5), v) f2_a1 = f2['a1'] # is a tensor # test write f1[Index(F.tensor([0, 1]))] = { 'a1': F.zeros([2, D]), 'a2': F.zeros([2, D]), 'a3': F.zeros([2, D]), } assert F.allclose(f2['a1'], f2_a1) f1[Index(F.tensor([2, 3]))] = { 'a1': F.ones([2, D]), 'a2': F.ones([2, D]), 'a3': F.ones([2, D]), } F.narrow_row_set(f2_a1, 0, 2, 1) assert F.allclose(f2['a1'], f2_a1) f1[toindex(slice(2, 4))] = { 'a1': F.zeros([2, D]), 'a2': F.zeros([2, D]), 'a3': F.zeros([2, D]), } F.narrow_row_set(f2_a1, 0, 2, 0) assert F.allclose(f2['a1'], f2_a1) def test_add_rows(): data = Frame() f1 = FrameRef(data) f1.add_rows(4) x = F.randn((1, 4)) f1[Index(F.tensor([0]))] = {'x': x} ans = F.cat([x, F.zeros((3, 4))], 0) assert F.allclose(f1['x'], ans) f1.add_rows(4) f1[toindex(slice(4, 8))] = {'x': F.ones((4, 4)), 'y': F.ones((4, 5))} ans = F.cat([ans, F.ones((4, 4))], 0) assert F.allclose(f1['x'], ans) ans = F.cat([F.zeros((4, 5)), F.ones((4, 5))], 0) assert F.allclose(f1['y'], ans) @unittest.skipIf(dgl.backend.backend_name == "tensorflow", reason="TF doesn't support inplace update") def test_inplace(): f = FrameRef(Frame(create_test_data())) print(f.schemes) a1addr = id(f['a1']) a2addr = id(f['a2']) a3addr = id(f['a3']) # column updates are always out-of-place f['a1'] = F.ones((N, D)) newa1addr = id(f['a1']) assert a1addr != newa1addr a1addr = newa1addr # full row update that becomes column update f[toindex(slice(0, N))] = {'a1' : F.ones((N, D))} assert id(f['a1']) != a1addr # row update (outplace) w/ slice f[toindex(slice(1, 4))] = {'a2' : F.ones((3, D))} newa2addr = id(f['a2']) assert a2addr != newa2addr a2addr = newa2addr # row update (outplace) w/ list f[toindex([1, 3, 5])] = {'a2' : F.ones((3, D))} newa2addr = id(f['a2']) assert a2addr != newa2addr a2addr = newa2addr # row update (inplace) w/ slice f.update_data(toindex(slice(1, 4)), {'a2' : F.ones((3, D))}, True) newa2addr = id(f['a2']) assert a2addr == newa2addr # row update (inplace) w/ list f.update_data(toindex([1, 3, 5]), {'a2' : F.ones((3, D))}, True) newa2addr = id(f['a2']) assert a2addr == newa2addr if __name__ == '__main__': test_create() test_column1() test_column2() test_append1() test_append2() test_append3() test_row1() test_row2() test_row3() test_row4() test_sharing() test_slicing() test_add_rows() test_inplace()
nilq/baby-python
python
# Open The Text File & 'Read' It # Insert The File Path Between The Brackets & Quotation Marks with open(" ", "r") as file: # Read The File & Write The First Replace Method remove_1 = file.read().replace(" .", ".") # Remaining Replace Methods remove_2 = remove_1.replace(" , ", ", ") remove_3 = remove_2.replace(" ( ", " (") remove_4 = remove_3.replace(" )", ")") remove_5 = remove_4.replace(" ? ", "? ") remove_6 = remove_5.replace(" ‘ ", " ‘") remove_7 = remove_6.replace(" ’ ", "’ ") remove_8 = remove_7.replace(" : ", ": ") remove_9 = remove_8.replace(" (yellow) ", "") remove_10 = remove_9.replace("Highlight-","") # 'Write' To A New Text File (Or Update Existing) # Insert The File Path Between The Brackets & Quotation Marks with open (" ", "w") as file: # Call The Last Replace Method file.write(remove_10)
nilq/baby-python
python
import os,re,sys # initializing bad_chars_list bad_chars = [',', ';', ':', '!', '.', '(', ')', '"', "*"] #filename="mat2vec-1a5b3240-abstracts-head.csv" filename=sys.argv[1] #"mat2vec-1a5b3240-abstracts.csv" print(filename) filename_w="cleaned_"+filename with open( filename_w, 'a+') as corpus_w: with open(filename,"r") as corpus: data=corpus.readlines() for line in data: #words=line.split(',') #(" ") #split_again=str(words[0]).split(".") #year=split_again[3] #if int(year)>2020 or int(year)<1900: # year=split_again[2] #filename_i=os.path.join("corpus_by_year",str(year)+".csv") #words_j='' #for j in range(1,len(words)): # words_j +=words[j] #words_jj=re.split('.|,|"|:', str(words_j)) #words_k='' #for k in range(0,len(words_jj)): # words_k += words_jj[k] # remove bad_chars for ii in bad_chars : words = line.replace(ii, '') corpus_w.write(words + '\n')
nilq/baby-python
python
### INTERACTIVE NAPLPS DEMO ### ### Interact with NAPLPS Client (PP3) over a serial connection ### ### John Durno, January 2017 ### ### Added auto-advance April 2017 ### ### Added chunks April 2017 ### ### Added quit (q) April 2017 ### ### Added timeout (auto=M) May 2017 ### ## Imports ### import collections import serial import time from threading import Thread from Queue import Queue import sys ### Data dictionary ### def rec_dd(): return collections.defaultdict(rec_dd) j = rec_dd() # DICT PARAMs # # fn - name of file to load # auto - auto-advance to the next slide? Values Y, N, M # Y=Yes, N=No, M=Maybe [if no input received before timeout] # goto - cmd to invoke for auto-advance, refers to numbers in NAPLPS frames # renderwait - interval to pause after file is sent, in seconds # inputwait - how long to wait for input when auto=M # chunk - number of bytes to send before pausing, 0=send whole file with no breaks # chunkwait - pause interval before sending the next chunk in seconds, 0=no wait # cmd - nested dict of one or more commands indicating file to move to next # NOTES re PARAMS # cmd can be entered either by auto-advance(goto) or through user input # files that exceed some undetermined maximum size have transmission problems # use chunk feature to sends parts of files as chunks # use chunkwait to specify delays between chunks # wait and chunkwait values are based on manual timings of file renderings ### INTERACTIVE NAPLPS DEMO ### j['idemo010']['fn'] = 'idemo.010' j['idemo010']['auto'] = 'N' j['idemo010']['goto'] = '1' j['idemo010']['renderwait'] = 4 j['idemo010']['inputwait'] = 0 j['idemo010']['chunksize'] = 0 j['idemo010']['chunkwait'] = 0 j['idemo010']['cmd']['1'] = 'idemo021' j['idemo010']['cmd']['2'] = 'idemo022' j['idemo021']['fn'] = 'idemo.021' j['idemo021']['auto'] = 'Y' j['idemo021']['goto'] = '1' j['idemo021']['renderwait'] = 4 j['idemo021']['inputwait'] = 0 j['idemo021']['chunksize'] = 0 j['idemo021']['chunkwait'] = 0 j['idemo021']['cmd']['1'] = 'idemo023' j['idemo022']['fn'] = 'idemo.022' j['idemo022']['auto'] = 'Y' j['idemo022']['goto'] = '1' j['idemo022']['renderwait'] = 6 j['idemo022']['inputwait'] = 0 j['idemo022']['chunksize'] = 0 j['idemo022']['chunkwait'] = 0 j['idemo022']['cmd']['1'] = 'idemo010' j['idemo023']['fn'] = 'idemo.023' j['idemo023']['auto'] = 'Y' j['idemo023']['goto'] = '1' j['idemo023']['renderwait'] = 5 j['idemo023']['inputwait'] = 0 j['idemo023']['chunksize'] = 78 j['idemo023']['chunkwait'] = 6 j['idemo023']['cmd']['1'] = 'idemo024' j['idemo024']['fn'] = 'idemo.024' j['idemo024']['auto'] = 'M' j['idemo024']['goto'] = '2' j['idemo024']['renderwait'] = 1 j['idemo024']['inputwait'] = 10 j['idemo024']['chunksize'] = 0 j['idemo024']['chunkwait'] = 0 j['idemo024']['cmd']['1'] = 'idemo025' j['idemo024']['cmd']['2'] = 'boom' j['idemo025']['fn'] = 'idemo.025' j['idemo025']['auto'] = 'Y' j['idemo025']['goto'] = '1' j['idemo025']['renderwait'] = 5 j['idemo025']['inputwait'] = 0 j['idemo025']['chunksize'] = 0 j['idemo025']['chunkwait'] = 0 j['idemo025']['cmd']['1'] = 'idemo030' j['boom']['fn'] = 'boom.nap' j['boom']['auto'] = 'Y' j['boom']['goto'] = '1' j['boom']['renderwait'] = 15 j['boom']['inputwait'] = 0 j['boom']['chunksize'] = 0 j['boom']['chunkwait'] = 0 j['boom']['cmd']['1'] = 'idemo030' j['idemo030']['fn'] = 'idemo.030' j['idemo030']['auto'] = 'N' j['idemo030']['goto'] = '1' j['idemo030']['renderwait'] = 6 j['idemo030']['inputwait'] = 0 j['idemo030']['chunksize'] = 0 j['idemo030']['chunkwait'] = 0 j['idemo030']['cmd']['1'] = 'idemo041' j['idemo030']['cmd']['2'] = 'idemo042' j['idemo030']['cmd']['3'] = 'idemo043' j['idemo041']['fn'] = 'idemo.041' j['idemo041']['auto'] = 'Y' j['idemo041']['goto'] = '1' j['idemo041']['renderwait'] = 4 j['idemo041']['inputwait'] = 0 j['idemo041']['chunksize'] = 0 j['idemo041']['chunkwait'] = 0 j['idemo041']['cmd']['1'] = 'idemo030' j['idemo042']['fn'] = 'idemo.042' j['idemo042']['auto'] = 'Y' j['idemo042']['goto'] = '1' j['idemo042']['renderwait'] = 4 j['idemo042']['inputwait'] = 0 j['idemo042']['chunksize'] = 0 j['idemo042']['chunkwait'] = 0 j['idemo042']['cmd']['1'] = 'idemo050' j['idemo043']['fn'] = 'idemo.043' j['idemo043']['auto'] = 'N' j['idemo043']['goto'] = '1' j['idemo043']['renderwait'] = 6 j['idemo043']['inputwait'] = 0 j['idemo043']['chunksize'] = 0 j['idemo043']['chunkwait'] = 0 j['idemo043']['cmd']['1'] = 'idemo010' j['idemo043']['cmd']['2'] = 'idemo050' j['idemo050']['fn'] = 'idemo.050' j['idemo050']['auto'] = 'N' j['idemo050']['goto'] = '1' j['idemo050']['renderwait'] = 6 j['idemo050']['inputwait'] = 0 j['idemo050']['chunksize'] = 0 j['idemo050']['chunkwait'] = 0 j['idemo050']['cmd']['1'] = 'idemo010' ### Serial Connection Settings ### ser = serial.Serial() ser.port = "/dev/tnt1" ser.baudrate = 1200 ser.bytesize = serial.EIGHTBITS #number of bits per bytes ser.parity = serial.PARITY_NONE #set parity check: no parity ser.stopbits = serial.STOPBITS_ONE #number of stop bits ser.xonxoff = None #software flow control ser.rtscts = None #hardware (RTS/CTS) flow control ser.dsrdtr = None #hardware (DSR/DTR) flow control ser.timeout = 0 #read timeout, non-blocking mode ser.writeTimeout = 1000 #timeout for write - needs a nice long one ### Send File Function ### def sendFile (ser,fname, renderwait, chunk, chunkwait): if ser.isOpen(): ser.flushInput() f = open(fname, "rb") try: byte = f.read(1) bytecount = 1 while byte != "": ser.write(byte) bytecount += 1 if bytecount == chunk: print "Sent " + str(chunk) + " bytes" print "Pausing " + str(chunkwait) + " seconds" time.sleep(chunkwait) bytecount = 1 byte = f.read(1) finally: ser.write(byte) f.close() print "End of File" print "Waiting " + str(renderwait) + " seconds for render" time.sleep(renderwait) return ### Listen Function (Listen for commands)### def listen (ser,cmds): print "listening ... " keepgoing = 1 while keepgoing: for cmd in ser.read(): print "got " + str(cmd) if (cmd in cmds) or (cmd == "*") or (cmd == "q"): print "Recieved: " + str(cmd) keepgoing = 0 return cmd ### Listen for a while (like above, but with timeout) ### def listen_awhile(ser,cmds,goto,q1): print "listening for a while ..." while q1.qsize() < 1: for cmd in ser.read(): print "got " + str(cmd) if (cmd in cmds) or (cmd == "*") or (cmd == "q"): print "Recieved: " + str(cmd) q1.put("hello") #ends while loop print "returning input " + str(cmd) return cmd print "returning default " + str(goto) return goto ### Timeout function ### def timeout(q1,t1): time.sleep(t1) q1.put('timedout') print "Timed out" ### Open Serial Connection ### print "Initiating ..." print "Opening serial connection ..." try: ser.open() except Exception, e: print "error open serial port: " + str(e) exit() print "Connection opened" print "Waiting for client connection" ### Parse commands & dictionary and figure out what to do next ### while True: cmds = list(j[str(next)]['cmd'].keys()) print " " print "Commands: " + str(cmds) auto = j[str(next)]['auto'] inputwait = j[str(next)]['inputwait'] goto = j[str(next)]['goto'] #if we want to automatically advance to the next frame if auto == "M": #auto = maybe [if no input received in time] #so we need a timer, ie the timeout function above q1 = Queue(maxsize = 0) worker1 = Thread(target=timeout, args=(q1,inputwait)) worker1.setDaemon(True) worker1.start() #returns either user input cmd or goto [default] if it times out cmd = listen_awhile(ser,cmds,goto,q1) elif auto == "Y": #just go automatically, don't wait for input cmd = goto #otherwise listen for user input to determine where to go next else: cmd = listen(ser,cmds) # "*" starts the presentation if cmd == "*": next = 'idemo010' #first frame elif cmd == "q": print "Shutting down now ..." exit() else: next = j[str(next)]['cmd'][cmd] # sendFile needs to know some things renderwait = j[str(next)]['renderwait'] chunk = j[str(next)]['chunksize'] chunkwait = j[str(next)]['chunkwait'] fname = j[str(next)]['fn'] print "Initiating send with " + cmd print "Sending " + str(fname) sendFile(ser, fname, renderwait, chunk, chunkwait)
nilq/baby-python
python
from flask import Flask, abort, jsonify, request from flask_restful import Resource, reqparse from flask_cors import CORS app = Flask(__name__) CORS(app) ## DUMMY DATA ## currencies = [ { "name": "btc", "balance": "0.65448", "address": "1BvBMSEYstWetqTFn5Au4m4GFg7xJaNVN2", "seeds": "slim sugar lizard predict state cute awkward asset inform blood civil sugar" }, { "name": "tft", "balance": "742", "address": "019314d28462f0c15bc900c47afeb456e1db234418eccf17c913260386d73a736f097130677a5b", "seeds": "nut blossom milk special answer best school joke tree ice enhance trend spoil fabric cereal display nurse axis champion hill enough cigar evidence rigid" }, { "name": "eth", "balance": "3.14785", "address": "0xe99356bde974bbe08721d77712168fa070aa8da4", "seeds": "gravity trophy shrimp suspect sheriff avocado label trust dove tragic pitch title network myself spell task protect smooth sword diary brain blossom under bulb" }, { "name": "xrp", "balance": "2541", "address": "rG1QQv2nh2gr7RCZ1P8YYcBUKCCN633jCn", "seeds": "avoid theory group elder tennis dentist wheat machine motion settle valid alter balcony deliver clog pipe antenna clutch route debate screen tomato obey keen" } ] wallets = [ ] orders = [ { "id":"0", "currencyBuy":"tft", "currencySell":"btc", "amountBuy":"100", "amountSell":"0.1" }, { "id":"1", "currencyBuy":"eth", "currencySell":"btc", "amountBuy":"12", "amountSell":"4" }, { "id":"2", "currencyBuy":"btc", "currencySell":"tft", "amountBuy":"1", "amountSell":"10000" }, { "id":"3", "currencyBuy":"xrp", "currencySell":"eth", "amountBuy":"1000", "amountSell":"5" } ] ## CURRENCY ## @app.route('/<string:cur>/balance', methods=['GET']) def get_currency_balance(cur): # return a JSON with specific currency balance ## method for testing with dummy data ## for c in currencies: if(cur == c["name"]): return jsonify({'balance' : c['balance']}) @app.route('/<string:cur>/address', methods=['GET']) def get_currency_address(cur): # return a JSON with specific currency address ## method for testing with dummy data ## for c in currencies: if(cur == c["name"]): return jsonify({'address' : c['address']}) ## WALLET ## @app.route('/<string:cur>/wallet', methods=['GET']) def get_currency_wallet(cur): # return a JSON with # a url to download an encrypted file # with the specified currency wallet seeds # and a randomly generated decryption password ## method for testing with dummy data ## for c in currencies: if(cur == c["name"]): return jsonify({'key':'randomlyGeneratedSuperStrongPassword', 'url':'/download/14548745642sdwe'}) return abort(404) @app.route('/<string:cur>/wallet', methods=['POST']) def create_currency_wallet(cur): # decrypts seed file in JSON using key # recovers specified currency wallet from seeds ## method for testing with dummy data ## if not request.json or not 'key' in request.json or not 'file' in request.json: abort(400) for c in currencies: if(cur == c["name"]): wallet = { 'key': request.json['key'], 'file': request.json['file'], } wallets.append(wallet) return jsonify({"wallet": wallet}), 201 return abort(404) ## ORDERS ## @app.route('/orders', methods=['GET']) def get_orders(): # return JSON with array of orders return jsonify({'orders': orders}) @app.route('/orders', methods=['POST']) def create_order(): # creates order in orderbook with # currencyBuy (the currency that the user creating the order wants) # currencySell (the currency that the user creating the order has) # amountBuy (the amount of currencyBuy the user wants) # amountSell (the amount of currencySell the user is offering) ## method for testing with dummy data ## if not request.json or not 'currencyBuy' in request.json: abort(400) order = { 'currencyBuy': request.json['currencyBuy'], 'currencySell': request.json['currencySell'], 'amountBuy': request.json['amountBuy'], 'amountSell': request.json['amountSell'] } orders.append(order) return jsonify({'order': order}), 201 @app.route('/orders/<string:order_id>', methods=['GET']) def get_order(order_id): # returns a JSON of order matching order ID ## method for testing with dummy data ## for o in orders: if(order_id == o["id"]): return jsonify({'order':o}) return abort(404) app.run(debug=True)
nilq/baby-python
python
import os import copy import random import functools from datetime import datetime import torch import torch.nn as nn import torch.nn.functional as F import torch.optim as optim import torch.utils.data as data import torch.utils.tensorboard as tensorboard from core.model import NAC from core.metric import AverageMetric, MovingAverageMetric from core.genotypes import Genotype from core.dataset.database import DataBase from core.dataset.architecture.common_nas import PRIMITIVES from core.dataset.utils import ControllerDataset from core.dataset.seq2arch import seq2arch_fn from core.dataset.tensorize import tensorize_fn, nasbench_tensor2arch from core.controller import NASBenchController from core.config import args from core.utils import * def single_batchify(*items): return [item.unsqueeze(0) for item in items] best_iters = -1 def train_controller(max_iter: int, database: DataBase, entropy_coeff: float, grad_clip: int, controller: NASBenchController, nac: NAC, optimizer: optim.Optimizer, writer: tensorboard.SummaryWriter, alternate_train, alternate_evaluate, random_baseline=False, log_frequence: int = 10, search_space=None): controller.train() nac.eval() optimizer.zero_grad() policy_loss_avg = MovingAverageMetric() entropy_mavg = MovingAverageMetric() logp_mavg = MovingAverageMetric() score_avg = MovingAverageMetric() pseudo_architecture_set = None with torch.no_grad(): *arch_seq, _, _ = controller(force_uniform=True) raw_arch = seq2arch_fn(arch_seq) baseline_arch = [tensorize_fn(raw_arch, device=device)] best_collect_archs = [arch_seq] for iter_ in range(max_iter): if iter_ % args.n_iteration_update_pseudoset == 0 and args.pseudo_ratio != 0: if pseudo_architecture_set is None: pseudo_architecture_set = \ generate_architecture_with_pseudo_labels( nac, controller, 2*int(args.pseudo_ratio*args.train_batch_size), int(args.pseudo_ratio*args.train_batch_size)) else: pseudo_architecture_set = list_concat( pseudo_architecture_set, generate_architecture_with_pseudo_labels( nac, controller, 2*args.n_sample_architectures, args.n_sample_architectures) ) epoch = args.nac_epochs + iter_ accuracy, rank_loss = alternate_train(epoch=epoch, pseudo_set=pseudo_architecture_set) writer.add_scalar("nac/train_accuracy", accuracy, epoch) writer.add_scalar("nac/loss", rank_loss, epoch) KTau = alternate_evaluate(epoch=epoch) writer.add_scalar("nac/ktau", KTau, epoch) *arch_seq, logp, entropy = controller() with torch.no_grad(): sample_arch = [tensorize_fn(seq2arch_fn(arch_seq), device=device)] score = nac(batchify(sample_arch), batchify(baseline_arch)) score = score.mean().item() policy_loss = -logp * score - entropy_coeff * entropy optimizer.zero_grad() if grad_clip is not None: nn.utils.clip_grad_norm_(controller.parameters(), grad_clip) policy_loss.backward() optimizer.step() policy_loss_avg.update(policy_loss) entropy_mavg.update(entropy) logp_mavg.update(logp) score_avg.update(score) if iter_ % log_frequence == 0: logger.info( ", ".join([ "Policy Learning", f"iter={iter_:03d}", f"policy loss={policy_loss_avg.compute():.4f}", f"entropy={entropy_mavg.compute():.4f}", f"logp={logp_mavg.compute():.4f}", ]) ) writer.add_scalar("policy_learning/loss", policy_loss_avg.compute(), iter_) writer.add_scalar("policy_learning/entropy", entropy_mavg.compute(), iter_) writer.add_scalar("policy_learning/logp", logp_mavg.compute(), iter_) writer.add_scalar("policy_learning/reward", score_avg.compute(), iter_) if iter_ % args.evaluate_controller_freq == 0: baseline_arch, best_collect_archs = derive(iter_, controller, nac, 10, database, writer, best_collect_archs, random_baseline, search_space) torch.save(controller.state_dict(), os.path.join(args.output,f"controller-{iter_}.path")) def generate_architecture_with_pseudo_labels(nac, controller, total, k): with torch.no_grad(): arch_seqs = [controller()[:-2] for _ in range(total)] sample_archs = [seq2arch_fn(seq) for seq in arch_seqs] arch0 = [tensorize_fn(arch, device=device) for arch in sample_archs] arch0 = batchify(arch0) if not isinstance(arch0, (list, tuple)): arch0 = [arch0] arch1 = shuffle(*arch0) # import ipdb; ipdb.set_trace() p = nac(arch0, arch1) select_p, index = torch.topk(p, k=k) arch0 = list_select(arch0, index) arch1 = list_select(arch1, index) labels = (select_p > 0.5).float() return arch0, arch1, labels def derive(iter_, controller: NASBenchController, nac: NAC, n_derive: int, database, writer, best_collect_archs, random_baseline=False, search_space=None): controller.eval() with torch.no_grad(): arch_seqs = [controller()[:-2] for _ in range(n_derive)] sample_archs = [seq2arch_fn(seq) for seq in arch_seqs] arch_tensor = [tensorize_fn(arch, device=device) for arch in sample_archs] if random_baseline: location = random.choice(list(range(len(arch_tensor)))) else: outputs = cartesian_traverse(arch_tensor, arch_tensor, nac) outputs.fill_diagonal_(0) max_p, location = outputs.sum(dim=1).max(dim=0, keepdim=True) max_p = max_p.view([]).item() / n_derive location = location.view([]).item() if database is not None: arch = database.fetch_by_spec(sample_archs[location]) writer.add_scalar("policy_learning/besttop", arch.rank/database.size*100, iter_) history_arch_seqs = arch_seqs + best_collect_archs history_arch_tensor = arch_tensor + [tensorize_fn(seq2arch_fn(arch), device=device) for arch in best_collect_archs] his_outputs = cartesian_traverse(history_arch_tensor, history_arch_tensor, nac) his_outputs.fill_diagonal_(0) his_max_p, his_location = his_outputs.sum(dim=1).max(dim=0, keepdim=True) his_max_p = his_max_p.view([]).item() / (n_derive-1) his_location = his_location.view([]).item() global best_iters if his_location < n_derive: best_iters = iter_ if database is not None: his_best_arch = database.fetch_by_spec(seq2arch_fn(history_arch_seqs[his_location])) writer.add_scalar("policy_learning/history_top", his_best_arch.rank/database.size*100, iter_) if search_space == "nasbench": logger.info( ", ".join([ "DERIVE", f"iters={iter_}", f"derive {n_derive} archs, the best arch id = {location:02d}, p={max_p*100:.2f}%", f"test acc={arch.test_accuracy*100:.2f}%", f"rank={arch.rank}/{database.size}({arch.rank/database.size*100:.4f}%)", f"history best sampled in {best_iters} iters", f"test acc={his_best_arch.test_accuracy*100:.2f}%", f"rank={his_best_arch.rank}/{database.size}({his_best_arch.rank/database.size*100:.4f}%)", ]) ) elif search_space == "darts": best_geno = Genotype.from_ordinal_arch(ordinal_normal_arch=arch_seqs[location][0], ordinal_reduced_arch=arch_seqs[location][1], primitives=PRIMITIVES) his_best_geno = Genotype.from_ordinal_arch(ordinal_normal_arch=history_arch_seqs[his_location][0], ordinal_reduced_arch=history_arch_seqs[his_location][1], primitives=PRIMITIVES) logger.info( ", ".join([ f"DERIVE", f"iters={iter_}", f"derive {n_derive} archs, the best arch id = {location:02d}, p={max_p*100:.2f}%", f"genotype={best_geno}", f"history best sampled in {best_iters} iters", f"genotype={his_best_geno}", ]) ) elif search_space == "mobilespace": best_arch = arch_seqs[location] his_best_arch = history_arch_seqs[his_location] logger.info( ", ".join([ f"DERIVE", f"iters={iter_}", f"derive {n_derive} archs, the best arch id = {location:02d}, p={max_p*100:.2f}%", f"best_arch={best_arch}", f"history best sampled in {best_iters} iters", f"his_best_arch={his_best_arch}", ]) ) os.makedirs(os.path.join(args.output, "controllers"), exist_ok=True) torch.save(controller.state_dict(), os.path.join(args.output, "controllers", f"controller-{iter_}.pth")) return [arch_tensor[location]], [history_arch_seqs[his_location]]
nilq/baby-python
python
from crowd_sim.envs.utils.agent import Agent from crowd_sim.envs.utils.state import JointState class Human(Agent): # see Agent class in agent.py for details!!! def __init__(self, config, section): super().__init__(config, section) self.isObstacle = False # whether the human is a static obstacle (part of wall) or a moving agent def act(self, ob): """ The state for human is its full state and all other agents' observable states :param ob: :return: """ state = JointState(self.get_full_state(), ob) action = self.policy.predict(state) return action
nilq/baby-python
python
# _*_ coding: utf-8 _*_ import multiprocessing from gensim.test.utils import datapath from gensim.models.word2vec import LineSentence from gensim.models.word2vec import PathLineSentences from gensim.models import word2vec from gensim.models import Word2Vec from gensim.models import KeyedVectors from gensim.utils.util import SplitSentences class Word2Vector(object): def __init__(self, src_file, dst_file, size=300, window=5, min_count=10, sg=0, learning_rate=0.025): self.src_file = src_file self.model_file = dst_file self.size = size self.window = window self.min_count = min_count self.sg = sg # 1 : skip-gram, 0: CBOW self.alpha = learning_rate self.workers = multiprocessing.cpu_count() def train(self, sentences): model = Word2Vec(sentences, size=self.size, window=self.window, min_count=self.min_count, sg=self.sg, workers=self.workers) model.save(self.model_file) model.save_word2vec_format(self.model_file + '.bin', binary=True) def train_model(self): sentences = LineSentence(self.src_file) self.train(sentences) def train_dir_model(self, custom=True): if custom: sentences = SplitSentences(self.src_file) else: sentences = PathLineSentences(self.src_file) self.train(sentences) def load_model(self, model_name): self.model = word2vec.Word2Vec.load(model_name) def load_google_model(self, model_name, binary=True): self.model = KeyedVectors.load_word2vec_format(datapath(model_name), binary=binary) def show_similarity(self, word1, word2): return self.model.wv.similarity(word1, word2) def show_similarity_by_word(self, word, topn=10): return self.model.wv.similar_by_word(word, topn)
nilq/baby-python
python
""" This package contains utilities that are only used when developing drms in a copy of the source repository. These files are not installed, and should not be assumed to exist at runtime. """
nilq/baby-python
python
#!/usr/bin/env python ## # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # pylint: disable=invalid-name # To disable 'invalid constant name' warnings. # pylint: disable=import-error # Testing environment may not have all dependencies. """ This script uses Jenkins REST api to collect test result(s) of given build/builds and generates flakyness data about unittests. Print help: report-flakies.py -h """ import argparse import logging import os import time from collections import OrderedDict from jinja2 import Template import requests import findHangingTests parser = argparse.ArgumentParser() parser.add_argument( '--urls', metavar='URL', action='append', required=True, help='Urls to analyze, which can refer to simple projects, multi-configuration projects or ' 'individual build run.') parser.add_argument('--excluded-builds', metavar='n1,n2', action='append', help='List of build numbers to exclude (or "None"). Not required, ' 'but if specified, number of uses should be same as that of --urls ' 'since the values are matched.') parser.add_argument('--max-builds', metavar='n', action='append', type=int, help='The maximum number of builds to use (if available on jenkins). Specify ' '0 to analyze all builds. Not required, but if specified, number of uses ' 'should be same as that of --urls since the values are matched.') parser.add_argument( "--mvn", action="store_true", help="Writes two strings for including/excluding these flaky tests using maven flags. These " "strings are written to files so they can be saved as artifacts and easily imported in " "other projects. Also writes timeout and failing tests in separate files for " "reference.") parser.add_argument("-v", "--verbose", help="Prints more logs.", action="store_true") args = parser.parse_args() logging.basicConfig() logger = logging.getLogger(__name__) if args.verbose: logger.setLevel(logging.INFO) def get_bad_tests(build_url): """ Given url of an executed build, analyzes its console text, and returns [list of all tests, list of timeout tests, list of failed tests]. Returns None if can't get console text or if there is any other error. """ logger.info("Analyzing %s", build_url) response = requests.get(build_url + "/api/json").json() if response["building"]: logger.info("Skipping this build since it is in progress.") return {} console_url = build_url + "/consoleText" build_result = findHangingTests.get_bad_tests(console_url) if not build_result: logger.info("Ignoring build %s", build_url) return return build_result def expand_multi_config_projects(cli_args): """ If any url is of type multi-configuration project (i.e. has key 'activeConfigurations'), get urls for individual jobs. """ job_urls = cli_args.urls excluded_builds_arg = cli_args.excluded_builds max_builds_arg = cli_args.max_builds if excluded_builds_arg is not None and len(excluded_builds_arg) != len(job_urls): raise Exception("Number of --excluded-builds arguments should be same as that of --urls " "since values are matched.") if max_builds_arg is not None and len(max_builds_arg) != len(job_urls): raise Exception("Number of --max-builds arguments should be same as that of --urls " "since values are matched.") final_expanded_urls = [] for (i, job_url) in enumerate(job_urls): max_builds = 10000 # Some high number if max_builds_arg is not None and max_builds_arg[i] != 0: max_builds = int(max_builds_arg[i]) excluded_builds = [] if excluded_builds_arg is not None and excluded_builds_arg[i] != "None": excluded_builds = [int(x) for x in excluded_builds_arg[i].split(",")] response = requests.get(job_url + "/api/json").json() if response.has_key("activeConfigurations"): for config in response["activeConfigurations"]: final_expanded_urls.append({'url':config["url"], 'max_builds': max_builds, 'excludes': excluded_builds}) else: final_expanded_urls.append({'url':job_url, 'max_builds': max_builds, 'excludes': excluded_builds}) return final_expanded_urls # Set of timeout/failed tests across all given urls. all_timeout_tests = set() all_failed_tests = set() all_hanging_tests = set() # Contains { <url> : { <bad_test> : { 'all': [<build ids>], 'failed': [<build ids>], # 'timeout': [<build ids>], 'hanging': [<builds ids>] } } } url_to_bad_test_results = OrderedDict() # Iterates over each url, gets test results and prints flaky tests. expanded_urls = expand_multi_config_projects(args) for url_max_build in expanded_urls: url = url_max_build["url"] excludes = url_max_build["excludes"] json_response = requests.get(url + "/api/json").json() if json_response.has_key("builds"): builds = json_response["builds"] logger.info("Analyzing job: %s", url) else: builds = [{'number' : json_response["id"], 'url': url}] logger.info("Analyzing build : %s", url) build_id_to_results = {} num_builds = 0 build_ids = [] build_ids_without_tests_run = [] for build in builds: build_id = build["number"] if build_id in excludes: continue result = get_bad_tests(build["url"]) if not result: continue if len(result[0]) > 0: build_id_to_results[build_id] = result else: build_ids_without_tests_run.append(build_id) num_builds += 1 build_ids.append(build_id) if num_builds == url_max_build["max_builds"]: break # Collect list of bad tests. bad_tests = set() for build in build_id_to_results: [_, failed_tests, timeout_tests, hanging_tests] = build_id_to_results[build] all_timeout_tests.update(timeout_tests) all_failed_tests.update(failed_tests) all_hanging_tests.update(hanging_tests) # Note that timedout tests are already included in failed tests. bad_tests.update(failed_tests.union(hanging_tests)) # For each bad test, get build ids where it ran, timed out, failed or hanged. test_to_build_ids = {key : {'all' : set(), 'timeout': set(), 'failed': set(), 'hanging' : set(), 'bad_count' : 0} for key in bad_tests} for build in build_id_to_results: [all_tests, failed_tests, timeout_tests, hanging_tests] = build_id_to_results[build] for bad_test in test_to_build_ids: is_bad = False if all_tests.issuperset([bad_test]): test_to_build_ids[bad_test]["all"].add(build) if timeout_tests.issuperset([bad_test]): test_to_build_ids[bad_test]['timeout'].add(build) is_bad = True if failed_tests.issuperset([bad_test]): test_to_build_ids[bad_test]['failed'].add(build) is_bad = True if hanging_tests.issuperset([bad_test]): test_to_build_ids[bad_test]['hanging'].add(build) is_bad = True if is_bad: test_to_build_ids[bad_test]['bad_count'] += 1 # Calculate flakyness % and successful builds for each test. Also sort build ids. for bad_test in test_to_build_ids: test_result = test_to_build_ids[bad_test] test_result['flakyness'] = test_result['bad_count'] * 100.0 / len(test_result['all']) test_result['success'] = (test_result['all'].difference( test_result['failed'].union(test_result['hanging']))) for key in ['all', 'timeout', 'failed', 'hanging', 'success']: test_result[key] = sorted(test_result[key]) # Sort tests in descending order by flakyness. sorted_test_to_build_ids = OrderedDict( sorted(test_to_build_ids.iteritems(), key=lambda x: x[1]['flakyness'], reverse=True)) url_to_bad_test_results[url] = sorted_test_to_build_ids if len(sorted_test_to_build_ids) > 0: print "URL: {}".format(url) print "{:>60} {:10} {:25} {}".format( "Test Name", "Total Runs", "Bad Runs(failed/timeout/hanging)", "Flakyness") for bad_test in sorted_test_to_build_ids: test_status = sorted_test_to_build_ids[bad_test] print "{:>60} {:10} {:7} ( {:4} / {:5} / {:5} ) {:2.0f}%".format( bad_test, len(test_status['all']), test_status['bad_count'], len(test_status['failed']), len(test_status['timeout']), len(test_status['hanging']), test_status['flakyness']) else: print "No flaky tests founds." if len(build_ids) == len(build_ids_without_tests_run): print "None of the analyzed builds have test result." print "Builds analyzed: {}".format(build_ids) print "Builds without any test runs: {}".format(build_ids_without_tests_run) print "" all_bad_tests = all_hanging_tests.union(all_failed_tests) if args.mvn: includes = ",".join(all_bad_tests) with open("./includes", "w") as inc_file: inc_file.write(includes) excludes = ["**/{0}.java".format(bad_test) for bad_test in all_bad_tests] with open("./excludes", "w") as exc_file: exc_file.write(",".join(excludes)) with open("./timeout", "w") as timeout_file: timeout_file.write(",".join(all_timeout_tests)) with open("./failed", "w") as failed_file: failed_file.write(",".join(all_failed_tests)) dev_support_dir = os.path.dirname(os.path.abspath(__file__)) with open(os.path.join(dev_support_dir, "flaky-dashboard-template.html"), "r") as f: template = Template(f.read()) with open("dashboard.html", "w") as f: datetime = time.strftime("%m/%d/%Y %H:%M:%S") f.write(template.render(datetime=datetime, bad_tests_count=len(all_bad_tests), results=url_to_bad_test_results))
nilq/baby-python
python
/home/runner/.cache/pip/pool/9d/74/0a/c53d742787105b6eebdef5c502cadfb8aaf2c96273099593c4c552f563
nilq/baby-python
python
from .tictactoe import * from .connectfour import *
nilq/baby-python
python
from django.urls import path from . import views urlpatterns = [ path('users/', views.usersView.get, name='usersUrl'), path('users/search', views.usersView.search, name='usersSearchUrl'), path('users/<str:username>/', views.usersView.selected, name="selectedUserUrl"), path('repos/', views.reposView.get, name='reposUrl'), path('repos/search', views.reposView.search, name='reposSearchUrl'), path('repos/<int:id>/', views.reposView.selected, name="selectedRepoUrl"), path('repos/<int:id>/commits/<str:hash>', views.commitView.get, name="selectedRepoCommitUrl"), path('repos/<int:id>/issues/', views.reposView.issues, name="repoIssuesUrl"), path('repos/<int:id>/issues/<str:title>', views.reposView.issueSelected, name="selectedRepoIssueUrl"), path('repos/<int:id>/commits/<str:hash>/files/<str:filename>', views.commitView.commitSelected, name="selectedRepoCommitFileUrl"), path('orgs/', views.orgsView.get, name='orgsUrl'), path('orgs/search', views.orgsView.search, name='orgsSearchUrl'), path('orgs/<str:org_name>/', views.orgsView.selected, name="selectedOrgUrl"), path('orgs/<str:org_name>/teams/', views.orgsView.teams, name='orgTeamsUrl'), path('orgs/<str:org_name>/teams/<str:team_name>', views.orgsView.teamSelected, name="selectedOrgTeamUrl"), path('', views.indexView.index, name='indexUrl'), path('contact/', views.contactView.contact, name='contactUrl'), path('stats/', views.statsView.get, name='statsUrl') ]
nilq/baby-python
python
import argparse from core import compat, app, utils, colors from core.ctrl import api compat.check_version() app.mode = 'cli' parser = argparse.ArgumentParser( description="CTRL command line tool", epilog="All accessible arguments listed above" ) parser.add_argument('method', help="Specify API method") parser.add_argument('-id', type=str) parser.add_argument('-username', type=str) parser.add_argument('-email', type=str) parser.add_argument('-firstname', type=str) parser.add_argument('-lastname', type=str) parser.add_argument('-role', type=str) parser.add_argument('-filter', type=str, nargs='+') parser.add_argument('-ulc', type=str) parser.add_argument('-pin', type=int) parser.add_argument('-sort', type=str, nargs='+') parser.add_argument('-domain', type=str) parser.add_argument('-ssh_key', type=str) parser.add_argument('-ssh_pwd', type=str) parser.add_argument('-ipv4', type=str) parser.add_argument('-ip', type=str) parser.add_argument('-name', type=str) parser.add_argument('-http_origin', type=str) args, unknown = parser.parse_known_args() data_pass = utils.validate_data_pass(dict(vars(args))) method = data_pass.pop('method', None) # for key, value in data_pass.items(): if method != None and method in dir(api) and method in app.config['api']['cli']: app.config['user'] = api.get_system_user() #data_pass['config'] = app.config result = getattr(api, str(method))(data_pass) if type(result) == dict: status = True message = 'completed' if 'status' in result: status = result['status'] result.pop('status', None) if 'message' in result: message = result['message'] result.pop('message', None) print(utils.format_response(status, message)) for key, value in result.items(): print(f"{colors.blue(key)} : {str(value)}") if type(result) == list or type(result) == tuple or type(result) == set: for value in result: print(str(value)) else: print(utils.format_response(False, f"Method {method} is not allowed"))
nilq/baby-python
python
from k5test import * plugin = os.path.join(buildtop, "plugins", "hostrealm", "test", "hostrealm_test.so") # Disable the "dns" module (we can't easily test TXT lookups) and # arrange the remaining modules in an order which makes sense for most # tests. conf = {'plugins': {'hostrealm': {'module': ['test1:' + plugin, 'test2:' + plugin], 'enable_only': ['test2', 'profile', 'domain', 'test1']}}, 'domain_realm': {'.x': 'DOTMATCH', 'x': 'MATCH', '.1': 'NUMMATCH'}} realm = K5Realm(krb5_conf=conf, create_kdb=False) def test(realm, args, expected_realms, msg, env=None): out = realm.run(['./hrealm'] + args, env=env) if out.split('\n') != expected_realms + ['']: fail(msg) def test_error(realm, args, expected_error, msg, env=None): realm.run(['./hrealm'] + args, env=env, expected_code=1, expected_msg=expected_error) def testh(realm, host, expected_realms, msg, env=None): test(realm, ['-h', host], expected_realms, msg, env=env) def testf(realm, host, expected_realms, msg, env=None): test(realm, ['-f', host], expected_realms, msg, env=env) def testd(realm, expected_realm, msg, env=None): test(realm, ['-d'], [expected_realm], msg, env=env) def testh_error(realm, host, expected_error, msg, env=None): test_error(realm, ['-h', host], expected_error, msg, env=env) def testf_error(realm, host, expected_error, msg, env=None): test_error(realm, ['-f', host], expected_error, msg, env=env) def testd_error(realm, expected_error, msg, env=None): test_error(realm, ['-d'], expected_error, msg, env=env) ### ### krb5_get_host_realm tests ### # The test2 module returns a fatal error on hosts beginning with 'z', # and an answer on hosts begining with 'a'. mark('test2 module') testh_error(realm, 'zoo', 'service not available', 'host_realm test2 z') testh(realm, 'abacus', ['a'], 'host_realm test2 a') # The profile module gives answers for hostnames equal to or ending in # 'X', due to [domain_realms]. There is also an entry for hostnames # ending in '1', but hostnames which appear to be IP or IPv6 addresses # should instead fall through to test1. mark('profile module') testh(realm, 'x', ['MATCH'], 'host_realm profile x') testh(realm, '.x', ['DOTMATCH'], 'host_realm profile .x') testh(realm, 'b.x', ['DOTMATCH'], 'host_realm profile b.x') testh(realm, '.b.c.x', ['DOTMATCH'], 'host_realm profile .b.c.x') testh(realm, 'b.1', ['NUMMATCH'], 'host_realm profile b.1') testh(realm, '4.3.2.1', ['4', '3', '2', '1'], 'host_realm profile 4.3.2.1') testh(realm, 'b:c.x', ['b:c', 'x'], 'host_realm profile b:c.x') # hostname cleaning should convert "X." to "x" before matching. testh(realm, 'X.', ['MATCH'], 'host_realm profile X.') # The test1 module returns a list of the hostname components. mark('test1 module') testh(realm, 'b.c.d', ['b', 'c', 'd'], 'host_realm test1') # If no module returns a result, we should get the referral realm. mark('no result') testh(realm, '', [''], 'host_realm referral realm') ### ### krb5_get_fallback_host_realm tests ### # Return a special environment with realm_try_domains set to n. def try_env(realm, testname, n): conf = {'libdefaults': {'realm_try_domains': str(n)}} return realm.special_env(testname, False, krb5_conf=conf) # The domain module will answer with the uppercased parent domain, # with no special configuration. mark('fallback: domain module') testf(realm, 'a.b.c', ['B.C'], 'fallback_realm domain a.b.c') # With realm_try_domains = 0, the hostname itself will be looked up as # a realm and returned if found. mark('fallback: realm_try_domains = 0') try0 = try_env(realm, 'try0', 0) testf(realm, 'krbtest.com', ['KRBTEST.COM'], 'fallback_realm try0', env=try0) testf(realm, 'a.b.krbtest.com', ['B.KRBTEST.COM'], 'fallback_realm try0 grandparent', env=try0) testf(realm, 'a.b.c', ['B.C'], 'fallback_realm try0 nomatch', env=try0) # With realm_try_domains = 2, the parent and grandparent will be # checked as well, but it stops there. mark('fallback: realm_try_domains = 2') try2 = try_env(realm, 'try2', 2) testf(realm, 'krbtest.com', ['KRBTEST.COM'], 'fallback_realm try2', env=try2) testf(realm, 'a.b.krbtest.com', ['KRBTEST.COM'], 'fallback_realm try2 grandparent', env=try2) testf(realm, 'a.b.c.krbtest.com', ['B.C.KRBTEST.COM'], 'fallback_realm try2 great-grandparent', env=try2) # The test1 module answers with a list of components. Use an IPv4 # address to bypass the domain module. mark('fallback: test1 module') testf(realm, '1.2.3.4', ['1', '2', '3', '4'], 'fallback_realm test1') # If no module answers, the default realm is returned. The test2 # module returns an error when we try to look that up. mark('fallback: default realm') testf_error(realm, '', 'service not available', 'fallback_realm default') ### ### krb5_get_default_realm tests ### # The test2 module returns an error. mark('default_realm: test2 module') testd_error(realm, 'service not available', 'default_realm test2') # The profile module returns the default realm from the profile. # Disable test2 to expose this behavior. mark('default_realm: profile module') disable_conf = {'plugins': {'hostrealm': {'disable': 'test2'}}} notest2 = realm.special_env('notest2', False, krb5_conf=disable_conf) testd(realm, 'KRBTEST.COM', 'default_realm profile', env=notest2) # The test1 module returns a list of two realms, of which we can only # see the first. Remove the profile default_realm setting to expose # this behavior. mark('default_realm: test1 module') remove_default = {'libdefaults': {'default_realm': None}} # Python 3.5+: nodefault_conf = {**disable_conf, **remove_default} nodefault_conf = dict(list(disable_conf.items()) + list(remove_default.items())) nodefault = realm.special_env('nodefault', False, krb5_conf=nodefault_conf) testd(realm, 'one', 'default_realm test1', env=nodefault) success('hostrealm interface tests')
nilq/baby-python
python
""" @brief: fill queue with new tasks read from tasks file. """ import pika import sys from .ip_provider import get_valid_ip def create_new_tasks(fn,broker): tasks=[] with open(fn,"r") as f: for line in f: tasks.append(line) connection = pika.BlockingConnection(pika.ConnectionParameters(host=get_valid_ip(broker))) channel = connection.channel() channel.queue_declare(queue='task_queue', durable=True) for task in tasks: task = task.strip("\n") channel.basic_publish( exchange='', routing_key='task_queue', body=task, properties=pika.BasicProperties( delivery_mode=2, # make message persisten )) print(" [x] Sent %r" % task) connection.close()
nilq/baby-python
python
''' @file: MPNCOV.py @author: Jiangtao Xie @author: Peihua Li Copyright (C) 2018 Peihua Li and Jiangtao Xie All rights reserved. ''' import torch import numpy as np from torch.autograd import Function class Covpool(Function): @staticmethod def forward(ctx, input): x = input batchSize = x.data.shape[0] dim = x.data.shape[1] h = x.data.shape[2] w = x.data.shape[3] M = h*w x = x.reshape(batchSize,dim,M) I_hat = (-1./M/M)*torch.ones(M,M,device = x.device) + (1./M)*torch.eye(M,M,device = x.device) I_hat = I_hat.view(1,M,M).repeat(batchSize,1,1).type(x.dtype) y = x.bmm(I_hat).bmm(x.transpose(1,2)) ctx.save_for_backward(input,I_hat) return y @staticmethod def backward(ctx, grad_output): input,I_hat = ctx.saved_tensors x = input batchSize = x.data.shape[0] dim = x.data.shape[1] h = x.data.shape[2] w = x.data.shape[3] M = h*w x = x.reshape(batchSize,dim,M) grad_input = grad_output + grad_output.transpose(1,2) grad_input = grad_input.bmm(x).bmm(I_hat) grad_input = grad_input.reshape(batchSize,dim,h,w) return grad_input class Sqrtm(Function): @staticmethod def forward(ctx, input, iterN): x = input batchSize = x.data.shape[0] dim = x.data.shape[1] dtype = x.dtype I3 = 3.0*torch.eye(dim,dim,device = x.device).view(1, dim, dim).repeat(batchSize,1,1).type(dtype) normA = (1.0/3.0)*x.mul(I3).sum(dim=1).sum(dim=1) A = x.div(normA.view(batchSize,1,1).expand_as(x)) Y = torch.zeros(batchSize, iterN, dim, dim, requires_grad = False, device = x.device) Z = torch.eye(dim,dim,device = x.device).view(1,dim,dim).repeat(batchSize,iterN,1,1) if iterN < 2: ZY = 0.5*(I3 - A) Y[:,0,:,:] = A.bmm(ZY) else: ZY = 0.5*(I3 - A) Y[:,0,:,:] = A.bmm(ZY) Z[:,0,:,:] = ZY for i in range(1, iterN-1): ZY = 0.5*(I3 - Z[:,i-1,:,:].bmm(Y[:,i-1,:,:])) Y[:,i,:,:] = Y[:,i-1,:,:].bmm(ZY) Z[:,i,:,:] = ZY.bmm(Z[:,i-1,:,:]) ZY = 0.5*Y[:,iterN-2,:,:].bmm(I3 - Z[:,iterN-2,:,:].bmm(Y[:,iterN-2,:,:])) y = ZY*torch.sqrt(normA).view(batchSize, 1, 1).expand_as(x) ctx.save_for_backward(input, A, ZY, normA, Y, Z) ctx.iterN = iterN return y @staticmethod def backward(ctx, grad_output): input, A, ZY, normA, Y, Z = ctx.saved_tensors iterN = ctx.iterN x = input batchSize = x.data.shape[0] dim = x.data.shape[1] dtype = x.dtype der_postCom = grad_output*torch.sqrt(normA).view(batchSize, 1, 1).expand_as(x) der_postComAux = (grad_output*ZY).sum(dim=1).sum(dim=1).div(2*torch.sqrt(normA)) I3 = 3.0*torch.eye(dim,dim,device = x.device).view(1, dim, dim).repeat(batchSize,1,1).type(dtype) if iterN < 2: der_NSiter = 0.5*(der_postCom.bmm(I3 - A) - A.bmm(der_sacleTrace)) else: dldY = 0.5*(der_postCom.bmm(I3 - Y[:,iterN-2,:,:].bmm(Z[:,iterN-2,:,:])) - Z[:,iterN-2,:,:].bmm(Y[:,iterN-2,:,:]).bmm(der_postCom)) dldZ = -0.5*Y[:,iterN-2,:,:].bmm(der_postCom).bmm(Y[:,iterN-2,:,:]) for i in range(iterN-3, -1, -1): YZ = I3 - Y[:,i,:,:].bmm(Z[:,i,:,:]) ZY = Z[:,i,:,:].bmm(Y[:,i,:,:]) dldY_ = 0.5*(dldY.bmm(YZ) - Z[:,i,:,:].bmm(dldZ).bmm(Z[:,i,:,:]) - ZY.bmm(dldY)) dldZ_ = 0.5*(YZ.bmm(dldZ) - Y[:,i,:,:].bmm(dldY).bmm(Y[:,i,:,:]) - dldZ.bmm(ZY)) dldY = dldY_ dldZ = dldZ_ der_NSiter = 0.5*(dldY.bmm(I3 - A) - dldZ - A.bmm(dldY)) grad_input = der_NSiter.div(normA.view(batchSize,1,1).expand_as(x)) grad_aux = der_NSiter.mul(x).sum(dim=1).sum(dim=1) for i in range(batchSize): grad_input[i,:,:] += (der_postComAux[i] \ - grad_aux[i] / (normA[i] * normA[i])) \ *torch.ones(dim,device = x.device).diag() return grad_input, None class Triuvec(Function): @staticmethod def forward(ctx, input): x = input batchSize = x.data.shape[0] dim = x.data.shape[1] dtype = x.dtype x = x.reshape(batchSize, dim*dim) I = torch.ones(dim,dim).triu().t().reshape(dim*dim) index = I.nonzero() y = torch.zeros(batchSize,dim*(dim+1)/2,device = x.device) for i in range(batchSize): y[i, :] = x[i, index].t() ctx.save_for_backward(input,index) return y @staticmethod def backward(ctx, grad_output): input,index = ctx.saved_tensors x = input batchSize = x.data.shape[0] dim = x.data.shape[1] dtype = x.dtype grad_input = torch.zeros(batchSize,dim,dim,device = x.device,requires_grad=False) grad_input = grad_input.reshape(batchSize,dim*dim) for i in range(batchSize): grad_input[i,index] = grad_output[i,:].reshape(index.size(),1) grad_input = grad_input.reshape(batchSize,dim,dim) return grad_input def CovpoolLayer(var): return Covpool.apply(var) def SqrtmLayer(var, iterN): return Sqrtm.apply(var, iterN) def TriuvecLayer(var): return Triuvec.apply(var)
nilq/baby-python
python
# Copyright 2013 Nebula Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # """Object client""" import logging from openstackclient.common import utils LOG = logging.getLogger(__name__) API_NAME = 'object-store' API_VERSIONS = { '1': 'openstackclient.object.client.ObjectClientv1', } def make_client(instance): """Returns an object service client.""" object_client = utils.get_client_class( API_NAME, instance._api_version[API_NAME], API_VERSIONS) if instance._url: endpoint = instance._url else: endpoint = instance.get_endpoint_for_service_type(API_NAME) LOG.debug('instantiating object client') client = object_client( endpoint=endpoint, token=instance._token, ) return client class ObjectClientv1(object): def __init__( self, endpoint_type='publicURL', endpoint=None, token=None, ): self.endpoint_type = endpoint_type self.endpoint = endpoint self.token = token
nilq/baby-python
python
import pytest from constants.pipelines import OperationStatuses, PipelineStatuses from factories.factory_pipelines import OperationRunFactory from pipelines.celery_task import ClassBasedTask, OperationTask from polyaxon.celery_api import app as celery_app from tests.utils import BaseTest @pytest.mark.pipelines_mark class TestOperationTask(BaseTest): def setUp(self): self.operation_run = OperationRunFactory() self.pipeline_run = self.operation_run.pipeline_run # Manually set status to scheduled self.operation_run.on_scheduled() return super().setUp() def test_task_without_operation_run_raises(self): @celery_app.task(base=OperationTask, shared=False) def dummy_task(): return with self.assertRaises(TypeError): dummy_task.apply_async() def test_task_with_operation_run_succeeds(self): @celery_app.task(base=OperationTask, shared=False) def dummy_task(operation_run_id): return kwargs = {'operation_run_id': self.operation_run.id} dummy_task.apply_async(kwargs=kwargs) self.operation_run.refresh_from_db() assert self.operation_run.succeeded is True assert set(self.operation_run.statuses.values_list('status', flat=True)) == { OperationStatuses.CREATED, OperationStatuses.SCHEDULED, OperationStatuses.RUNNING, OperationStatuses.SUCCEEDED, } self.pipeline_run.refresh_from_db() assert self.operation_run.pipeline_run.last_status == PipelineStatuses.FINISHED assert set(self.operation_run.pipeline_run.statuses.values_list('status', flat=True)) == { PipelineStatuses.CREATED, PipelineStatuses.SCHEDULED, PipelineStatuses.RUNNING, PipelineStatuses.FINISHED, } def test_task_with_error_fails(self): @celery_app.task(base=OperationTask, shared=False) def raising_task(operation_run_id): raise KeyError kwargs = {'operation_run_id': self.operation_run.id} raising_task.apply_async(kwargs=kwargs) self.operation_run.refresh_from_db() assert self.operation_run.failed is True assert set(self.operation_run.statuses.values_list('status', flat=True)) == { OperationStatuses.CREATED, OperationStatuses.SCHEDULED, OperationStatuses.RUNNING, OperationStatuses.FAILED, } self.pipeline_run.refresh_from_db() assert self.operation_run.pipeline_run.last_status == PipelineStatuses.FINISHED assert set(self.operation_run.pipeline_run.statuses.values_list('status', flat=True)) == { PipelineStatuses.CREATED, PipelineStatuses.SCHEDULED, PipelineStatuses.RUNNING, PipelineStatuses.FINISHED, } def test_task_retries_for_specified_exception(self): class RetryTask(ClassBasedTask): retry_for = (KeyError, ) @staticmethod def _run(task_bind, *args, **kwargs): raise KeyError @celery_app.task(base=OperationTask, bind=True, shared=False) def retry_task(task_bind, operation_run_id): assert task_bind.max_retries == 2 assert task_bind.countdown == 0 RetryTask.run(task_bind=task_bind, operation_run_id=operation_run_id) # Add retries and count to the operation self.operation_run.operation.max_retries = 2 self.operation_run.operation.retry_delay = 0 self.operation_run.operation.save() kwargs = {'operation_run_id': self.operation_run.id} retry_task.apply_async(kwargs=kwargs) self.operation_run.refresh_from_db() assert self.operation_run.last_status == OperationStatuses.RETRYING assert set(self.operation_run.statuses.values_list('status', flat=True)) == { OperationStatuses.CREATED, OperationStatuses.SCHEDULED, OperationStatuses.RUNNING, OperationStatuses.RETRYING, } self.pipeline_run.refresh_from_db() assert self.operation_run.pipeline_run.last_status == PipelineStatuses.RUNNING assert set(self.operation_run.pipeline_run.statuses.values_list('status', flat=True)) == { PipelineStatuses.CREATED, PipelineStatuses.SCHEDULED, PipelineStatuses.RUNNING, }
nilq/baby-python
python
import os import pygame from game_defines import DIRECTIONS ASSET_BASE = os.path.join(os.path.dirname(__file__), "assets") class Actor(object): @staticmethod def asset(name): return os.path.join(ASSET_BASE, name) def __init__(self, name, image_path, actor_type, startx, starty): self.image = pygame.image.load(Actor.asset(image_path)) self.name = name self.x = startx self.y = starty self.actor_type = actor_type self.map_object = None def process(self, sensor_input): raise AssertionError("Process Needs to be overriden") def get_image(self): return self.image def get_type(self): return self.actor_type def get_x(self): return self.x def get_y(self): return self.y def set_map(self, map_object): self.map_object = map_object def move(self, move_to): x_offset = 0 y_offset = 0 if move_to == DIRECTIONS.UP: x_offset = 0 y_offset = -1 elif move_to == DIRECTIONS.UPRIGHT: x_offset = 1 y_offset = -1 elif move_to == DIRECTIONS.UPLEFT: x_offset = -1 y_offset = -1 elif move_to == DIRECTIONS.RIGHT: x_offset = 1 y_offset = 0 elif move_to == DIRECTIONS.DOWN: x_offset = 0 y_offset = 1 elif move_to == DIRECTIONS.DOWNRIGHT: x_offset = 1 y_offset = 1 elif move_to == DIRECTIONS.DOWNLEFT: x_offset = -1 y_offset = 1 elif move_to == DIRECTIONS.LEFT: x_offset = -1 y_offset = 0 if self.map_object.is_blocked(self.x + x_offset, self.y + y_offset): return False self.x += x_offset self.y += y_offset return True
nilq/baby-python
python
""" File: 240.py Title: Search a 2D Matrix II Difficulty: Medium URL: https://leetcode.com/problems/search-a-2d-matrix-ii/ """ import unittest from typing import List class Solution: def searchMatrix(self, matrix: List[List[int]], target: int) -> bool: m = len(matrix) n = len(matrix[0]) i = 0 j = m - 1 while (i < n) and (j >= 0): if matrix[j][i] == target: return True if matrix[j][i] > target: j -= 1 else: i += 1 return False class SolutionTestCase(unittest.TestCase): def test_example1(self): # Input matrix = [[1, 4, 7, 11, 15], [2, 5, 8, 12, 19], [3, 6, 9, 16, 22], [10, 13, 14, 17, 24], [18, 21, 23, 26, 30]] target = 5 # Output output = True solution = Solution() self.assertEqual(solution.searchMatrix(matrix, target), output) def test_example2(self): # Input matrix = [[1, 4, 7, 11, 15], [2, 5, 8, 12, 19], [3, 6, 9, 16, 22], [10, 13, 14, 17, 24], [18, 21, 23, 26, 30]] target = 20 # Output output = False solution = Solution() self.assertEqual(solution.searchMatrix(matrix, target), output) if __name__ == "__main__": unittest.main()
nilq/baby-python
python
# -*- coding: utf-8 -*- """ safedun-server Created on Sun Oct 13 00:00:00 2019 Author: Adil Rahman GitHub: https://github.com/adildsw/safedun-server """ import argparse import socket from backend import safedun from flask import Flask, render_template, request, send_file app = Flask(__name__) @app.route('/') def index(): return render_template('index.html') @app.route('/execute', methods=['POST']) def execute(): mode = request.form['mode'] key = request.form['key'] cycle = int(request.form['cycle']) file = request.files['file'] scrambler = safedun() output_file = scrambler.generate(mode, cycle, key, file) return send_file(output_file, as_attachment=True, attachment_filename="output.png") if __name__ == "__main__": host_ip = socket.gethostbyname(socket.gethostname()) parser = argparse.ArgumentParser(description="safedun Server Option Description") parser.add_argument("-H", "--host", help="specify IP address to host server", required=False, default=host_ip) parser.add_argument("-p", "--port", help="specify Port number to host server", required=False, default="5000") parser.add_argument("-d", "--debug", help="specify whether the server will run on debug mode", required=False, default=False) parser.add_argument("-l", "--local", help="host server in localhost", required=False, default=False) argument = parser.parse_args() if not argument.local == False: argument.host = '127.0.0.1' app.run(host=argument.host, port=argument.port, debug=argument.debug)
nilq/baby-python
python
"""The Policy can use these classes to communicate with Vizier.""" import abc import collections import dataclasses import datetime from typing import Dict, Iterable, List, Optional from vizier import pyvizier as vz @dataclasses.dataclass(frozen=True) class MetadataDelta: """Carries cumulative delta for a batch metadata update. Attributes: on_study: Updates to be made on study-level metadata. on_trials: Maps trial id to updates. """ on_study: vz.Metadata = dataclasses.field(default_factory=vz.Metadata) on_trials: Dict[int, vz.Metadata] = dataclasses.field( default_factory=lambda: collections.defaultdict(vz.Metadata)) class _MetadataUpdateContext: """Metadata update context. Usage: # All metadata updates in the context are queued, not immediately applied. # Upon exit, supporter handles all metadata updates in a batch. with pythia2._MetadataUpdateContext(policy_supporter) as mu: # Study-level metadata. mu.assign('namespace', 'key', 'value') # Trial-level metadata. mu.assign('namespace', 'key', 'value', trial_id=1) # Same as above but with a side effect. After this line the following # line is True: # trial.metadata.ns('namespace')['key'] == 'value' mu.assign('namespace', 'key', 'value', trial) """ def __init__(self, supporter: 'PolicySupporter'): self._supporter = supporter self._delta = MetadataDelta() # pylint: disable=invalid-name def assign(self, namespace: str, key: str, value: vz.MetadataValue, trial: Optional[vz.Trial] = None, *, trial_id: Optional[int] = None): """Assigns metadata. Args: namespace: Namespace of the metadata. See vz.Metadata doc for more details. key: value: trial: If specified, `trial_id` must be None. It behaves the same as when `trial_id=trial.id`, except that `trial` is immediately modified. trial_id: If specified, `trial` must be None. If both `trial` and `trial_id` are None, then the key-value pair will be assigned to the study. Raises: ValueError: """ if trial is None and trial_id is None: self._delta.on_study.ns(namespace)[key] = value elif trial is not None and trial_id is not None: raise ValueError( 'At most one of `trial` and `trial_id` can be specified.') elif trial is not None: self._delta.on_trials[trial.id].ns(namespace)[key] = value trial.metadata.ns(namespace)[key] = value elif trial_id is not None: self._delta.on_trials[trial_id].ns(namespace)[key] = value def __enter__(self): return self def __exit__(self, *args): """upon exit, sends a batch update request.""" self._supporter.SendMetadata(self._delta) class PolicySupporter(abc.ABC): """Used by Policy instances to communicate with Vizier.""" # TODO: Change to GetStudyDescriptor. @abc.abstractmethod def GetStudyConfig(self, study_guid: Optional[str] = None) -> vz.StudyConfig: """Requests a StudyConfig from Vizier. This sends a PythiaToVizier.trial_selector packet and waits for the response(s). You can call this multiple times, and it is thread-friendly, so you can even overlap calls. Args: study_guid: The GUID of the study whose StudyConfig you want. Note that access control applies. By default, use the current study's GUID. Returns: The requested StudyConfig proto. Raises: CancelComputeError: (Do not catch.) PythiaProtocolError: (Do not catch.) VizierDatabaseError: If the database operation raises an error, e.g. if $study_guid refers to a nonexistent or inaccessible study. """ @abc.abstractmethod def GetTrials( self, *, study_guid: Optional[str] = None, trial_ids: Optional[Iterable[int]] = None, min_trial_id: Optional[int] = None, max_trial_id: Optional[int] = None, status_matches: Optional[vz.TrialStatus] = None, include_intermediate_measurements: bool = True) -> List[vz.Trial]: """Requests Trials from Vizier. Args: study_guid: The GUID of the study to get Trials from. Default is None, which means the current Study. trial_ids: a list of Trial id numbers to acquire. min_trial_id: Trials in [min_trial_id, max_trial_id] are selected, if at least one of the two is not None. max_trial_id: Trials in [min_trial_id, max_trial_id] are selected, if at least one of the two is not None. status_matches: If not None, filters for Trials where Trial.status==status_matches. The default passes all types of Trial. include_intermediate_measurements: If True (default), the returned Trials must have all measurements. Note that the final Measurement is always included for COMPLETED Trials. If False, PolicySupporter _may_ leave `measurements` field empty in the returned Trials in order to optimize speed, but it is not required to do so. Returns: Trials obtained from Vizier. Raises: CancelComputeError: (Do not catch.) PythiaProtocolError: (Do not catch.) VizierDatabaseError: If the database operation raises an error, e.g. if $study_guid refers to a nonexistent or inaccessible study. NOTE: if $trial_ids is set, $min_trial_id, $max_trial_id, and $status_matches will be ignored. """ def CheckCancelled(self, note: Optional[str] = None) -> None: """Throws a CancelComputeError on timeout or if Vizier cancels. This should be called occasionally by any long-running computation. Raises an exception if the interaction has been cancelled by the Vizier side of the protocol; the exception shuts down the Pythia server. Args: note: for debugging. Raises: CancelComputeError: (Do not catch.) """ pass def TimeRemaining(self) -> datetime.timedelta: """The time remaining to compute a result. Returns: The remaining time before the RPC is considered to have timed out; it returns datetime.timedelta.max if no deadline was specified in the RPC. This is an alternative to calling CheckCancelled(); both have the goal of terminating runaway computations. If your computation times out, you should raise TemporaryPythiaError (if you want a retry) or InactivateStudyError (if not). """ return datetime.timedelta(hours=1.0) def MetadataUpdate(self) -> _MetadataUpdateContext: """Queues metadata updates, then passes them to UpdateMetadata(). Usage: ps = PolicySupporter() with ps.MetadataUpdate() as mu: # Study-level metadata. mu.assign('namespace', 'key', 'value') # Trial-level metadata. mu.assign('namespace', 'key', 'value', trial_id=1) Returns: A _MetadataUpdateContext instance to use as a context. Raises: CancelComputeError: (Do not catch.) PythiaProtocolError: (Do not catch.) VizierDatabaseError: If the database operation raises an error. """ return _MetadataUpdateContext(self) @abc.abstractmethod def SendMetadata(self, delta: MetadataDelta) -> None: """Updates the Study's metadata in Vizier's database. The MetadataUpdate() method is preferred for normal use. Args: delta: Metadata to be uploaded to the Vizier database. Raises: CancelComputeError: (Do not catch.) PythiaProtocolError: (Do not catch.) VizierDatabaseError: If the database operation raises an error. """
nilq/baby-python
python
from django.conf.urls import url from . import views from django.contrib.auth import views as auth_views urlpatterns = [ url(r'^$', views.home, name='home'), url(r'^sponsor/$', views.sponsor, name='sponsor'), url(r'^hospitality/$', views.hospitality, name='hospitality'), url(r'^transport/$', views.transport, name='transport'), url(r'^accomodation/$', views.accomodation, name='accomodation'), url(r'^events/technical/$',views.technical, name='technical'), url(r'^events/sports/$',views.sports, name='sports'), url(r'^events/cultural/$',views.cultural, name='cultural'), url(r'^events/register/$',views.event_register, name='event_register'), url(r'^accomodation/register/$', views.accom_register, name='accom_register'), url(r'^events/register2/$',views.event_register2, name='event_register2'), url(r'^accomodation/register2/$',views.accom_register2, name='accom_register2'), url(r'^events/(?P<category>\w+)/(?P<subcategory>\w+)/$', views.specificEventView, name='specificView'), url(r'^events/(?P<category>\w+)/$', views.specificEventView, name='specificView'), url(r'^pronights/', views.pronights, name='pronights'), url(r'^forgotPassMail/', views.forgotmail, name='forgotmail'), url(r'^forgotPassword/(?P<hashkey>\w+)', views.forgot, name='forgot'), url(r'^me/', views.profile, name='profile'), url(r'^login/', views.login1, name='login'), url(r'^register/', views.register, name='register'), url(r'^logout/$', auth_views.logout, {'next_page': '/'}), ]
nilq/baby-python
python
import numpy as np import math import pandas as pd ####################################################################### """ These functions are applied to hierarchically classify the images. level_n(x): determines the prediction at level n. If there is no prediction to be made at level n, the function returns nan. level_n_p(x): determines the probability associated with the prediction at level n. This probability is needed to classify the sequences using the top-k method. """ def level_1(x): if x['blank'] > x['not_blank']: return 'blank' else: return 'not_blank' def level_1_p(x): if x['blank'] > x['not_blank']: return x['blank'] else: return x['not_blank'] def level_2(x): if x['level_1'] == 'not_blank': if x['animal'] > x['no_animal']: return 'animal' else: return 'no_animal' else: return math.nan def level_2_p(x): if x['animal'] > x['no_animal']: return x['animal'] else: return x['no_animal'] def level_3(x): if x['level_2'] == 'animal': if x['bird'] > x['mammal']: return 'bird' else: return 'mammal' elif x['level_2'] == 'no_animal': if x['human'] > x['pickup']: return 'human' else: return 'pickup' else: return math.nan def level_3_p(x): if x['level_2'] == 'animal': if x['bird'] > x['mammal']: return x['bird'] else: return x['mammal'] elif x['level_2'] == 'no_animal': if x['human'] > x['pickup']: return x['human'] else: return x['pickup'] else: return math.nan def level_4(x): if x['level_3'] == 'mammal': if x['small_mammal'] > x['large_mammal']: return 'small_mammal' else: return 'large_mammal' else: return math.nan def level_4_p(x): if x['level_3'] == 'mammal': if x['small_mammal'] > x['large_mammal']: return x['small_mammal'] else: return x['large_mammal'] else: return math.nan def level_5(x,pred): if x['level_4'] == 'small_mammal': p = int(pred.iloc[x.name,[9,5,6,14]].idxmax()) return p elif x['level_4'] == 'large_mammal': p = int(pred.iloc[x.name,[0,7,11,1,4,12,13,15,16]].idxmax()) return p else: return math.nan def level_5_p(x,pred): if x['level_4'] == 'small_mammal': p = np.asarray(pred.iloc[x.name,[9,5,6,14]]).max(axis=0) return p elif x['level_4'] == 'large_mammal': p = np.asarray(pred.iloc[x.name,[0,7,11,1,4,12,13,15,16]]).max(axis=0) return p else: return math.nan ######################################################################## def top_predictions(data, data_hierarchy): """ This function determines the prediction of the sequences based on the top-k predictions at every level. """ sequences = data_hierarchy['sequence'].drop_duplicates() data_seq_top = pd.DataFrame(columns=['sequence','level_1','level_1_p','level_2','level_2_p','level_3','level_3_p','level_4','level_4_p','level_5','level_5_p']) for s, seq in enumerate(sequences): data_sequence = data_hierarchy[data_hierarchy['sequence'] == seq] pred_sequence = data.loc[:,'0':'16'].loc[data['sequence'] == seq] #Level 1 p_l1 = max([data_sequence['blank'].mean(), data_sequence['not_blank'].mean()]) l1 = ['blank', 'not_blank'][np.argmax([data_sequence['blank'].mean(), data_sequence['not_blank'].mean()])] #level 2 if l1 == 'not_blank': p_l2 = max([data_sequence['animal'].mean(), data_sequence['no_animal'].mean()]) l2 = ['animal', 'no_animal'][np.argmax([data_sequence['animal'].mean(), data_sequence['no_animal'].mean()])] else: p_l2 = math.nan l2 = math.nan #Level 3 if l2 == 'animal': p_l3 = max([data_sequence['bird'].mean(), data_sequence['mammal'].mean()]) l3 = ['bird', 'mammal'][np.argmax([data_sequence['bird'].mean(), data_sequence['mammal'].mean()])] elif l2 == 'no_animal': p_l3 = max([data_sequence['human'].mean(), data_sequence['pickup'].mean()]) l3 = ['human', 'pickup'][np.argmax([data_sequence['human'].mean(), data_sequence['pickup'].mean()])] else: p_l3 = math.nan l3 = math.nan #Level 4 if l3 == 'mammal': p_l4 = max([data_sequence['small_mammal'].mean(), data_sequence['large_mammal'].mean()]) l4 = ['small_mammal', 'large_mammal'][np.argmax([data_sequence['small_mammal'].mean(), data_sequence['large_mammal'].mean()])] else: p_l4 = math.nan l4 = math.nan #Level 5 if l4 == 'small_mammal': p_l5 = max(pred_sequence.iloc[:,[9,5,6,14]].mean()) l5 = int(np.argmax(pred_sequence.iloc[:,[9,5,6,14]].mean())) elif l4 == 'large_mammal': large = pred_sequence.iloc[:,[0,7,11,1,4,12,13,15,16]] top5_p = [] top5_pred = [] #Top-5 for every image for i, row in large.iterrows(): top5_p += np.sort(row.values.tolist())[-5:].tolist() top5_pred += np.array([0,7,11,1,4,12,13,15,16])[np.argsort(row.values.tolist())[-5:].tolist()].tolist() df_top5 = pd.DataFrame({'top5_p': top5_p, 'top5_pred':top5_pred}) top5_seq = df_top5.groupby('top5_pred').sum().divide(len(data_sequence)).sort_values('top5_p',ascending=False)[:5] p_l5 = top5_seq.max()[0] l5 = int(top5_seq.idxmax()[0]) else: p_l5 = math.nan l5 = math.nan data_seq_top.loc[s] = [seq, l1, p_l1, l2, p_l2, l3, p_l3, l4, p_l4, l5, p_l5] return data_seq_top ######################################################################################### def hierarchical_predictions(data): """ This function determines the hierarchical prediction for the individual images, based on the output of the neural network. These predictions can then be used to classify a sequence. """ predictions = data.loc[:,'0':'16'] index_small = [9,5,6,14] index_large = [0,7,11,1,4,12,13,15,16] hierarchy = pd.DataFrame() hierarchy['blank'] = predictions.iloc[:,3] hierarchy['small_mammal'] = predictions.iloc[:,index_small].sum(axis=1) hierarchy['large_mammal'] = predictions.iloc[:,index_large].sum(axis=1) hierarchy['mammal'] = hierarchy['small_mammal'] + hierarchy['large_mammal'] hierarchy['bird'] = predictions.iloc[:,2] hierarchy['animal'] = hierarchy['bird'] + hierarchy['mammal'] hierarchy['human'] = predictions.iloc[:,8] hierarchy['pickup'] = predictions.iloc[:,10] hierarchy['no_animal'] = hierarchy['human'] + hierarchy['pickup'] hierarchy['not_blank'] = hierarchy['no_animal'] + hierarchy['animal'] hierarchy['level_1'] = hierarchy.apply(level_1, axis=1) hierarchy['level_1_p'] = hierarchy.apply(level_1_p, axis=1) hierarchy['level_2'] = hierarchy.apply(level_2, axis=1) hierarchy['level_2_p'] = hierarchy.apply(level_2_p, axis=1) hierarchy['level_3'] = hierarchy.apply(level_3, axis=1) hierarchy['level_3_p'] = hierarchy.apply(level_3_p, axis=1) hierarchy['level_4'] = hierarchy.apply(level_4, axis=1) hierarchy['level_4_p'] = hierarchy.apply(level_4_p, axis=1) mammals = pd.DataFrame() mammals['small_pred_max'] = np.asarray(predictions.iloc[:,index_small]).argmax(axis=1) mammals['large_pred_max'] = np.asarray(predictions.iloc[:,index_large]).argmax(axis=1) mammals['small_max_p'] = np.asarray(predictions.iloc[:,index_small]).max(axis=1) mammals['large_max_p'] = np.asarray(predictions.iloc[:,index_large]).max(axis=1) hierarchy['level_5'] = hierarchy.apply(level_5, pred = predictions, axis=1) hierarchy['level_5_p'] = hierarchy.apply(level_5_p, pred = predictions, axis=1) return hierarchy ############################################################################################ def bottom_hierarchical_prediction(x): """ This function determines the final prediction for a sequence, based on the hierarchical prediction at every level. """ if pd.isnull(x['level_5']) == False: label = x['level_5'] elif pd.isnull(x['level_3']) == False: label = x['level_3'] if label == 'bird': label = 2 elif label == 'human': label = 8 else: label = 10 else: label = 3 #blank labels = ['Ass','Beech Marten','Bird','Blank','Cat','Squirrel','Hare','Horse','Human','Mouse','PickupSetup','Fox','Dog','Mouflon','Hedgehog','Roe Deer','Wild Boar'] label = labels[label] return label
nilq/baby-python
python
from django.http import HttpResponseRedirect from django.shortcuts import get_object_or_404, render from django.urls import reverse from django.utils import timezone from django.views import generic from .models import Choice, Question # Create your views here. class IndexView(generic.ListView): template_name = 'polls/index.html' context_object_name = 'latest_question_list' def get_queryset_rev(self): return Question.objects.order_by('-pub_date').reverse()[1:] def get_queryset(self): """ Return the last five published questions (not including those set to be published in the future). """ return Question.objects.filter(pub_date__lte=timezone.now()).order_by('-pub_date')[:5] class DetailView(generic.DetailView): model = Question template_name = 'polls/detail.html' def get_queryset(self): """ Excludes any questions that aren't published yet. """ return Question.objects.filter(pub_date__lte=timezone.now()) class ResultsView(generic.DetailView): model = Question template_name = 'polls/results.html' def summary(request): summary = {} for choice in Choice.objects.all(): q_text = choice.question.question_text c_text = choice.choice_text votes = choice.votes if not q_text in summary.keys(): summary[q_text] = {c_text: votes} else: summary[q_text][c_text] = votes return render(request, 'polls/summary.html', { 'summary': summary }) def vote(request, pk): question = get_object_or_404(Question, pk=pk) try: selected_choice = question.choice_set.get(pk=request.POST['choice']) except (KeyError, Choice.DoesNotExist): return render(request, 'polls/detail.html', { 'question': question, 'error_message' :"You didn't select a choice.", }) else: selected_choice.votes += 1 selected_choice.save() return HttpResponseRedirect(reverse('polls:results', args=(question.id, )))
nilq/baby-python
python
#!/usr/bin/env python import sys from os import listdir def proc_files(files): fs = [] for f in files: try: fs.append(open(f, "r")) except Exception as exct: print("Failed to read file {:s}".format(f)) sys.exit(1) done = False result = [] while not done: index = "NONE" val_sum = 0 for f in fs: try: line = f.__next__() except Exception: done = True break sline = line.split() assert(len(sline) == 2) index, value = sline value = float(value) val_sum += value # print(sline) else: val_avg = val_sum/len(fs) result.append("{:s}\t{:f}".format(index, val_avg)) result.append("") return result def proc_dirs(dirs): first_dir = dirs[0] for f in listdir(first_dir): avg_out = proc_files(["{:s}/{:s}".format(d, f) for d in dirs]) with open(f, "w") as outfile: outfile.write("\n".join(avg_out)) def main(): proc_dirs(sys.argv[1:]) # proc_files(sys.argv[1:]) if __name__ == "__main__": main()
nilq/baby-python
python
"""Define language independent properties at the module level""" from adam.language.lexicon import LexiconEntry, LexiconProperty from adam.language.dependency import MorphosyntacticProperty # Define universal morphosyntactic properties FIRST_PERSON = MorphosyntacticProperty("1p") SECOND_PERSON = MorphosyntacticProperty("2p") THIRD_PERSON = MorphosyntacticProperty("3p") NOMINATIVE = MorphosyntacticProperty("nom") ACCUSATIVE = MorphosyntacticProperty("acc") # Define universal lexicon properties MASS_NOUN = LexiconProperty("mass-noun") ALLOWS_DITRANSITIVE = LexiconProperty("allows-ditransitive")
nilq/baby-python
python
# -*- coding: utf-8 -*- """ Created on Wed Jan 6 16:31:59 2021 @author: msantamaria """ # Redes Neuronales Artificiales # Parte 1 - Pre procesado de datos # Importar las librerías import numpy as np import matplotlib.pyplot as plt import pandas as pd # Importar el data set dataset = pd.read_csv("Churn_Modelling.csv") X = dataset.iloc[:,3:13].values y = dataset.iloc[:,13].values # Codificar datos categóricos from sklearn.preprocessing import LabelEncoder, OneHotEncoder labelEncoder_X_1 = LabelEncoder() X[:,1] = labelEncoder_X_1.fit_transform(X[:,1]) labelEncoder_X_2 = LabelEncoder() X[:,2] = labelEncoder_X_2.fit_transform(X[:,2]) from sklearn.compose import ColumnTransformer ct = ColumnTransformer( [('one_hot_encoder', OneHotEncoder(categories='auto'), [1])], # The column numbers to be transformed (here is [0] but can be [0, 1, 3]) remainder='passthrough' # Leave the rest of the columns untouched ) X = np.array(ct.fit_transform(X), dtype=np.float) X = X[:,1:] # Dividir el dataset en conjunto de entrenamiento y en conjunto de testing from sklearn.model_selection import train_test_split X_train, X_test, y_train, y_test = train_test_split(X,y,test_size=0.20,random_state = 0) # Escalado de variables from sklearn.preprocessing import StandardScaler sc_X = StandardScaler() X_train = sc_X.fit_transform(X_train) X_test = sc_X.transform(X_test) # Parte 2 - Construir la RNA # Importar Keras y librerías adicionales import keras from keras.models import Sequential from keras.layers import Dense # Inicializar la RNA classifier = Sequential() # Añadir las capas de entrada y primera capa oculta classifier.add(Dense(units=6, kernel_initializer="uniform", activation="relu", input_dim=11)) # Añadir la segunda capa oculta classifier.add(Dense(units=6, kernel_initializer="uniform", activation="relu")) # Añadir la capa de salida classifier.add(Dense(units=1, kernel_initializer="uniform", activation="sigmoid")) # Compilar la RNA classifier.compile(optimizer="adam", loss="binary_crossentropy", metrics=["accuracy"]) # Ajustamos la RNA al Conjunto de Entrenamiento classifier.fit(X_train, y_train, batch_size=10, epochs=100) # How to build the same neural network for Regression? # Initialising the ANN # regressor = Sequential() # # Adding the input layer and the first hidden layer # regressor.add(Dense(units = 6, # kernel_initializer = ’uniform’, # activation = 'relu', # input_dim = 11)) # # Adding the second hidden layer # regressor.add(Dense(units = 6, # kernel_initializer = 'uniform', # activation = 'relu')) # # Adding the output layer # regressor.add(Dense(units = 1, # kernel_initializer = 'uniform')) # # Compiling the ANN # regressor.compile(optimizer = 'adam', # loss = 'mean_squared_error') # # Fitting the ANN to the Training set # regressor.fit(X_train, # y_train, # batch_size = 10, # epochs = 100) # Parte 3 - Evaluar el modelo y calcular predicciones finales # Predicción de los resultados con el Conjunto de Testing y_pred = classifier.predict(X_test) y_pred = (y_pred > 0.5) # Elaborar una matriz de confusión from sklearn.metrics import confusion_matrix cm = confusion_matrix(y_test,y_pred)
nilq/baby-python
python
# -*- coding: utf-8 -*- # Generated by Django 1.10.8 on 2018-01-29 08:44 from __future__ import unicode_literals from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ ('codenerix_products', '0008_auto_20180126_1711'), ('codenerix_invoicing', '0003_auto_20180129_0941'), ] operations = [ migrations.CreateModel( name='SalesLines', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')), ('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')), ('removed', models.BooleanField(default=False, editable=False, verbose_name='Removed')), ('price_recommended', models.DecimalField(decimal_places=2, max_digits=10, verbose_name='Recomended price base')), ('quantity', models.FloatField(verbose_name='Quantity')), ('subtotal', models.DecimalField(decimal_places=2, default=0, editable=False, max_digits=10, verbose_name='Subtotal')), ('discounts', models.DecimalField(decimal_places=2, default=0, editable=False, max_digits=10, verbose_name='Discounts')), ('taxes', models.DecimalField(decimal_places=2, default=0, editable=False, max_digits=10, verbose_name='Taxes')), ('equivalence_surcharges', models.DecimalField(blank=True, decimal_places=2, default=0, max_digits=10, null=True, verbose_name='Equivalence surcharge')), ('total', models.DecimalField(decimal_places=2, default=0, editable=False, max_digits=10, verbose_name='Total')), ('code', models.CharField(blank=True, default=None, max_length=250, null=True, verbose_name='Code')), ('description_basket', models.CharField(blank=True, max_length=256, null=True, verbose_name='Description')), ('price_base_basket', models.DecimalField(decimal_places=2, max_digits=10, verbose_name='Price base')), ('discount_basket', models.DecimalField(decimal_places=2, default=0, max_digits=10, verbose_name='Discount (%)')), ('tax_basket', models.FloatField(blank=True, default=0, null=True, verbose_name='Tax (%)')), ('equivalence_surcharge_basket', models.FloatField(blank=True, default=0, null=True, verbose_name='Equivalence surcharge (%)')), ('tax_label_basket', models.CharField(blank=True, max_length=250, null=True, verbose_name='Tax Name')), ('notes_basket', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('description_order', models.CharField(blank=True, max_length=256, null=True, verbose_name='Description')), ('price_base_order', models.DecimalField(decimal_places=2, max_digits=10, verbose_name='Price base')), ('discount_order', models.DecimalField(decimal_places=2, default=0, max_digits=10, verbose_name='Discount (%)')), ('tax_order', models.FloatField(blank=True, default=0, null=True, verbose_name='Tax (%)')), ('equivalence_surcharge_order', models.FloatField(blank=True, default=0, null=True, verbose_name='Equivalence surcharge (%)')), ('tax_label_order', models.CharField(blank=True, max_length=250, null=True, verbose_name='Tax Name')), ('notes_order', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('notes_albaran', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('description_ticket', models.CharField(blank=True, max_length=256, null=True, verbose_name='Description')), ('price_base_ticket', models.DecimalField(decimal_places=2, max_digits=10, verbose_name='Price base')), ('discount_ticket', models.DecimalField(decimal_places=2, default=0, max_digits=10, verbose_name='Discount (%)')), ('tax_ticket', models.FloatField(blank=True, default=0, null=True, verbose_name='Tax (%)')), ('equivalence_surcharge_ticket', models.FloatField(blank=True, default=0, null=True, verbose_name='Equivalence surcharge (%)')), ('tax_label_ticket', models.CharField(blank=True, max_length=250, null=True, verbose_name='Tax Name')), ('notes_ticket', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('notes_ticket_rectification', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('description_invoice', models.CharField(blank=True, max_length=256, null=True, verbose_name='Description')), ('price_base_invoice', models.DecimalField(decimal_places=2, max_digits=10, verbose_name='Price base')), ('discount_invoice', models.DecimalField(decimal_places=2, default=0, max_digits=10, verbose_name='Discount (%)')), ('tax_invoice', models.FloatField(blank=True, default=0, null=True, verbose_name='Tax (%)')), ('equivalence_surcharge_invoice', models.FloatField(blank=True, default=0, null=True, verbose_name='Equivalence surcharge (%)')), ('tax_label_invoice', models.CharField(blank=True, max_length=250, null=True, verbose_name='Tax Name')), ('notes_invoice', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('notes_invoice_rectification', models.CharField(blank=True, max_length=256, null=True, verbose_name='Notes')), ('albaran', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesAlbaran', verbose_name='Albaran')), ('basket', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesBasket', verbose_name='Basket')), ('invoice', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesInvoice', verbose_name='Invoice')), ('invoice_rectification', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesInvoiceRectification', verbose_name='Invoice rectification')), ('order', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesOrder', verbose_name='Sales order')), ('product_final', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_products.ProductFinal', verbose_name='Product')), ('product_unique', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_products.ProductUnique', verbose_name='Product Unique')), ('ticket', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesTicket', verbose_name='Ticket')), ('ticket_rectification', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, related_name='lines_sales', to='codenerix_invoicing.SalesTicketRectification', verbose_name='Ticket rectification')), ], options={ 'default_permissions': ('add', 'change', 'delete', 'view', 'list'), 'abstract': False, }, ), ]
nilq/baby-python
python
# %% from sklearn.metrics import r2_score import pandas as pd import numpy as np import matplotlib.pyplot as pl from sklearn.model_selection import train_test_split from sklearn.linear_model import LinearRegression # %% # Other type of file could be used which contains tabular data advertising = pd.read_csv("advertising.csv") # Target column must be last to work below all cell's code correctly, If you don't have your target colum last then make necessary changes to below two lines of code TV = 'TV' Radio = "Radio" Newspaper = 'Newspaper' Sales = 'Sales' X = advertising.iloc[:, :1] y = advertising.iloc[:, -1] # %% X_train, X_test, y_train, y_test = train_test_split( X, y, test_size=0.3, random_state=100 ) # %% X_train # %% model = LinearRegression( normalize=True, fit_intercept=True, n_jobs=-1).fit(X_train, y_train) # %% y_predicted = model.predict(X_test) # %% r2_score(y_predicted, y_test) # %%
nilq/baby-python
python
# -*- coding: utf-8 -*- from collections import OrderedDict import os import re from lxml import etree from django.db.models import Count, Prefetch from selections.models import PreProcessFragment from stats.utils import get_label_properties_from_cache, prepare_label_cache from .models import Corpus, Tense, Alignment, Source, Annotation, Fragment, Sentence, Word def get_next_alignment(user, language_from, language_to, corpus=None): """ Retrieves a random Alignment from the database. :param user: The current User :param language_from: The source language :param language_to: The target language :param corpus: (if supplied) The Corpus where to draw an Alignment from (otherwise: select from the available Corpora for a user) :return: A random Alignment object """ target_words = Sentence.objects. \ prefetch_related(Prefetch('word_set', queryset=Word.objects.filter(is_target=True))) alignments = Alignment.objects \ .filter(original_fragment__language=language_from) \ .filter(translated_fragment__language=language_to) \ .filter(annotation=None) \ .select_related('original_fragment__document') \ .prefetch_related(Prefetch('original_fragment__sentence_set', queryset=target_words, to_attr='targets_prefetched'),) corpora = [corpus] if corpus else get_available_corpora(user) alignments = alignments.filter(original_fragment__document__corpus__in=corpora) for corpus in corpora: if corpus.current_subcorpus: alignments = alignments.filter(original_fragment__in=corpus.current_subcorpus.get_fragments()) if not alignments: return None elif corpora[0].random_next_item: return alignments.order_by('?').first() else: # Sort by Document title and the xml_id of the first target Word return sorted(alignments, key=lambda a: (a.original_fragment.document.title, a.original_fragment.sort_key_target()))[0] def get_available_corpora(user): """ Returns the available Corpora for a User. A superuser can see data from all corpora, other users are limited to corpora where they are an annotator. :param user: The current User :return: The available Corpora for this User """ if user.is_superuser: return Corpus.objects.all() elif user.is_authenticated: return user.corpus_set.all() else: return Corpus.objects.filter(is_public=True) def get_most_frequent_tenses(language): """ Returns the most frequently annotated tenses for a language. :param language: The given Language :return: A list of tenses """ most_frequent_by_language = Annotation.objects \ .filter(alignment__translated_fragment__language=language) \ .values('tense') \ .annotate(Count('tense')) \ .order_by('-tense__count') return Tense.objects.filter(pk__in=[t.get('tense') for t in most_frequent_by_language]) def get_tenses(language): """ Returns tenses for a language. :param language: The given Language :return: A list of tenses """ return [t.title for t in Tense.objects.filter(language=language).order_by('title')] def update_dialogue(in_dialogue, fragment=None, sentence=None, word_range=None): """ Updates the dialogue marking for Words and Fragments. :param in_dialogue: whether the Words should be in_dialogue :param fragment: a Fragment for which to change the dialogue marking :param sentence: a Sentence for which to change the dialogue marking :param word_range: a Word range for which to change the dialogue marking """ words = Word.objects.none() if not any([fragment, sentence, word_range]): raise ValueError('No words selected') if fragment: words |= Word.objects.filter(sentence__fragment=fragment) if sentence: words |= Word.objects.filter(sentence=sentence) if word_range: words |= Word.objects.filter(pk__in=word_range) fragments = set() for word in words: word.is_in_dialogue = in_dialogue word.is_in_dialogue_prob = 1.0 if in_dialogue else 0.0 word.save() fragments.add(word.sentence.fragment) for fragment in fragments: fragment.save() XML_ID_REGEX = re.compile(r'w?(\d[\.\d]*)') def is_before(xml_id1, xml_id2): result = False match1 = re.match(XML_ID_REGEX, xml_id1) match2 = re.match(XML_ID_REGEX, xml_id2) if match1 and match2: parts1 = [int(i) for i in match1.group(1).split('.')] parts2 = [int(i) for i in match2.group(1).split('.')] for p1, p2 in zip(parts1, parts2): if p1 < p2: result = True break return result def sort_key(xml_id, xml_tag): result = [xml_id] if xml_id.isdigit(): result = int(xml_id) else: if xml_id[0] == xml_tag and xml_id[1:].split('.'): result = list(map(int, xml_id[1:].split('.'))) return result def natural_sort_key(s, _nsre=re.compile('([0-9]+)')): """ Allows natural sorting, e.g. 2.xml is before 16.xml """ return [int(text) if text.isdigit() else text.lower() for text in _nsre.split(s)] def get_xml_sentences(fragment, limit): """ Retrieves sentences in the XML in the vicinity of the given xml_id """ try: source = Source.objects.get(document=fragment.document, language=fragment.language) except Source.DoesNotExist: source = None results = [] if source and source.xml_file and os.path.exists(source.xml_file.path): xml_id = fragment.xml_ids() # TODO: this works, as source Fragments have only one Sentence # TODO: limit to Fragments that are the source of an Alignment related_fragments = Fragment.objects.filter( document=fragment.document, language=fragment.language, preprocessfragment=None, ) related_fragments = related_fragments.exclude(original=None) # Loop over p/head/s elements prev_el = [] found = False added = 0 for _, el in etree.iterparse(source.xml_file.path, tag=['p', 'head', 's']): if el.get('id') == xml_id: found = True if found: if added <= limit: position = 'current' if added == 0 else 'after' results.append(add_element(el, fragment, related_fragments, position)) if el.tag == 's': added += 1 else: break else: prev_el.append(el) # Inserts previous elements before the results added = 0 for el in list(reversed(prev_el)): results.insert(0, add_element(el, fragment, related_fragments, 'before')) if el.tag == 's': added += 1 if added == limit: break return results def add_element(el, current_fragment, related_fragments, position): sentence = None sentence_content_xml = None if el.tag == 's': # For s elements, look up the Sentence in the same Corpus as the current Fragment sentences = Sentence.objects.filter( xml_id=el.get('id'), fragment__in=related_fragments ).select_related('fragment').prefetch_related('word_set') if sentences: xml_id = None fragment_pks = [] words = OrderedDict() for s in sentences: xml_id = s.xml_id fragment_pks.append(s.fragment.pk) is_current = current_fragment == s.fragment for w in s.word_set.all(): if w.xml_id in words: words[w.xml_id]['is_target'] |= w.is_target and is_current words[w.xml_id]['is_other_target'] |= w.is_target and not is_current else: word = { 'word': w.word, 'xml_id': w.xml_id, 'pos': w.pos, 'lemma': w.lemma, 'is_in_dialogue': w.is_in_dialogue, 'is_target': w.is_target and is_current, 'is_other_target': w.is_target and not is_current, } words[w.xml_id] = word fragment_pks.sort(reverse=True) sentence = { 'xml_id': xml_id, 'fragment_pks': fragment_pks, 'words': list(words.values()), } # If the Sentence is not there, create a mock Sentence from the XML else: words = [] for w in el.xpath('.//w'): word = { 'word': w.text, 'xml_id': w.get('id'), 'pos': w.get('tree') or w.get('pos') or w.get('hun') or '?', 'lemma': w.get('lem'), 'is_in_dialogue': float(w.get('dialog', 0)) > 0, } words.append(word) sentence_content_xml = { 'xml_id': el.get('id'), 'words': words } return {'tag': el.tag, 'id': el.get('id'), 'position': position, 'content': sentence, 'content_xml': sentence_content_xml, } def bind_annotations_to_xml(source): # Retrieve the Annotations annotations = Annotation.objects. \ filter(alignment__translated_fragment__language=source.language, alignment__translated_fragment__document=source.document). \ select_related('alignment__original_fragment', 'tense'). \ prefetch_related('labels', 'words') # Only include correct Annotations annotations = annotations.filter(is_no_target=False, is_translation=True) tree = etree.parse(source.xml_file) label_cache = prepare_label_cache(source.document.corpus) labels = set() failed_lookups = [] words_by_xml_id = dict() all_w_elements = tree.xpath('//w') if annotations: # Attach Annotations to the XML tree for annotation in annotations: label, color, _ = get_label_properties_from_cache( annotation.get_labels(as_pk=True, include_labels=True), label_cache, len(labels)) labels.add(label) words = annotation.words.all() for w in words: words_by_xml_id[w.xml_id] = dict(annotation=annotation, label=label, color=color, found=False) for xml_w in all_w_elements: word = words_by_xml_id.get(xml_w.get('id')) if word: annotation = word['annotation'] label = word['label'] color = word['color'] xml_w.set('annotation-pk', str(annotation.pk)) xml_w.set('fragment-pk', str(annotation.alignment.original_fragment.pk)) xml_w.set('label', label) xml_w.set('color', color) del words_by_xml_id[xml_w.get('id')] else: # Assume we are dealing with a source language here # Retrieve the fragments target_words = Sentence.objects. \ prefetch_related(Prefetch('word_set', queryset=Word.objects.filter(is_target=True))) pp_fragments = PreProcessFragment.objects.filter(language=source.language, document=source.document) fragments = Fragment.objects.filter(language=source.language, document=source.document). \ exclude(pk__in=pp_fragments). \ select_related('tense'). \ prefetch_related('labels', Prefetch('sentence_set', queryset=target_words, to_attr='targets_prefetched')) # Attach Fragments to the XML tree for fragment in fragments: label, color, _ = get_label_properties_from_cache( fragment.get_labels(as_pk=True, include_labels=True), label_cache, len(labels)) labels.add(label) sentences = fragment.targets_prefetched for s in sentences: for w in s.word_set.all(): words_by_xml_id[w.xml_id] = dict(fragment=fragment, label=label, color=color, found=False) for xml_w in all_w_elements: word = words_by_xml_id.get(xml_w.get('id')) if word: fragment = word['fragment'] label = word['label'] color = word['color'] xml_w.set('fragment-pk', str(fragment.pk)) xml_w.set('label', label) xml_w.set('color', color) del words_by_xml_id[xml_w.get('id')] for word in words_by_xml_id.values(): # all words that were assigned to the xml tree were removed from words_by_xml_id failed_lookups.append(word.get('fragment', word.get('annotation'))) return tree, failed_lookups def labels_to_choices(queryset): return [(label['pk'], '{}:{}'.format(label['key__title'], label['title'])) for label in queryset.values('pk', 'key__title', 'title')]
nilq/baby-python
python
from math import exp import torch import torch.nn as nn import torch.nn.functional as F import torchvision.models as models # from kornia.color import rgb_to_yuv from torch.nn.modules.loss import _Loss import numpy as np def gaussian(window_size, sigma): gauss = torch.Tensor([exp(-(x - window_size//2)**2/float(2*sigma**2)) for x in range(window_size)]) return gauss/gauss.sum() def create_window(window_size, channel=1): _1D_window = gaussian(window_size, 1.5).unsqueeze(1) _2D_window = _1D_window.mm(_1D_window.t()).float().unsqueeze(0).unsqueeze(0) window = _2D_window.expand(channel, 1, window_size, window_size).contiguous() return window def ssim(img1, img2, window_size=11, window=None, size_average=True, full=False, val_range=None): # Value range can be different from 255. Other common ranges are 1 (sigmoid) and 2 (tanh). if val_range is None: if torch.max(img1) > 128: max_val = 255 else: max_val = 1 if torch.min(img1) < -0.5: min_val = -1 else: min_val = 0 L = max_val - min_val else: L = val_range padd = 0 (_, channel, height, width) = img1.size() if window is None: real_size = min(window_size, height, width) window = create_window(real_size, channel=channel).to(img1.device) mu1 = F.conv2d(img1, window, padding=padd, groups=channel) mu2 = F.conv2d(img2, window, padding=padd, groups=channel) mu1_sq = mu1.pow(2) mu2_sq = mu2.pow(2) mu1_mu2 = mu1 * mu2 sigma1_sq = F.conv2d(img1 * img1, window, padding=padd, groups=channel) - mu1_sq sigma2_sq = F.conv2d(img2 * img2, window, padding=padd, groups=channel) - mu2_sq sigma12 = F.conv2d(img1 * img2, window, padding=padd, groups=channel) - mu1_mu2 C1 = (0.01 * L) ** 2 C2 = (0.03 * L) ** 2 v1 = 2.0 * sigma12 + C2 v2 = sigma1_sq + sigma2_sq + C2 cs = torch.mean(v1 / v2) # contrast sensitivity ssim_map = ((2 * mu1_mu2 + C1) * v1) / ((mu1_sq + mu2_sq + C1) * v2) if size_average: ret = ssim_map.mean() else: ret = ssim_map.mean(1).mean(1).mean(1) if full: return ret, cs return ret def msssim(img1, img2, window_size=11, size_average=True, val_range=None, normalize=False): device = img1.device weights = torch.FloatTensor([0.0448, 0.2856, 0.3001, 0.2363, 0.1333]).to(device) levels = weights.size()[0] mssim = [] mcs = [] for _ in range(levels): sim, cs = ssim(img1, img2, window_size=window_size, size_average=size_average, full=True, val_range=val_range) mssim.append(sim) mcs.append(cs) img1 = F.avg_pool2d(img1, (2, 2)) img2 = F.avg_pool2d(img2, (2, 2)) mssim = torch.stack(mssim) mcs = torch.stack(mcs) # Normalize (to avoid NaNs during training unstable models, not compliant with original definition) if normalize: mssim = (mssim + 1) / 2 mcs = (mcs + 1) / 2 pow1 = mcs ** weights pow2 = mssim ** weights # From Matlab implementation https://ece.uwaterloo.ca/~z70wang/research/iwssim/ output = torch.prod(pow1[:-1] * pow2[-1]) return output # Classes to re-use window class SSIM(torch.nn.Module): def __init__(self, window_size=11, size_average=True, val_range=None): super(SSIM, self).__init__() self.window_size = window_size self.size_average = size_average self.val_range = val_range # Assume 1 channel for SSIM self.channel = 1 self.window = create_window(window_size) def forward(self, img1, img2): (_, channel, _, _) = img1.size() if channel == self.channel and self.window.dtype == img1.dtype: window = self.window else: window = create_window(self.window_size, channel).to(img1.device).type(img1.dtype) self.window = window self.channel = channel return ssim(img1, img2, window=window, window_size=self.window_size, size_average=self.size_average) class MSSSIM(torch.nn.Module): def __init__(self, window_size=11, size_average=True, channel=3): super(MSSSIM, self).__init__() self.window_size = window_size self.size_average = size_average self.channel = channel def forward(self, img1, img2): # TODO: store window between calls if possible return msssim(img1, img2, window_size=self.window_size, size_average=self.size_average) class MeanShift(nn.Conv2d): def __init__(self, rgb_range, rgb_mean, rgb_std, sign=-1): super(MeanShift, self).__init__(3, 3, kernel_size=1) std = torch.Tensor(rgb_std) self.weight.data = torch.eye(3).view(3, 3, 1, 1) self.weight.data.div_(std.view(3, 1, 1, 1)) self.bias.data = sign * rgb_range * torch.Tensor(rgb_mean) self.bias.data.div_(std) self.requires_grad = False class VGG(torch.nn.Module): def __init__(self, conv_index, rgb_range=1): super(VGG, self).__init__() vgg_features = models.vgg19(pretrained=True).features modules = [m for m in vgg_features] if conv_index == '22': self.vgg = nn.Sequential(*modules[:8]) elif conv_index == '54': self.vgg = nn.Sequential(*modules[:35]) vgg_mean = (0.485, 0.456, 0.406) vgg_std = (0.229 * rgb_range, 0.224 * rgb_range, 0.225 * rgb_range) self.sub_mean = MeanShift(rgb_range, vgg_mean, vgg_std) self.vgg.requires_grad = False def forward(self, sr, hr): def _forward(x): x = self.sub_mean(x) x = self.vgg(x) return x vgg_sr = _forward(sr) with torch.no_grad(): vgg_hr = _forward(hr.detach()) loss = F.l1_loss(vgg_sr, vgg_hr) return loss def color_loss(out, target): out_yuv = rgb_to_yuv(out) out_u = out_yuv[:, 1, :, :] out_v = out_yuv[:, 2, :, :] target_yuv = rgb_to_yuv(target) target_u = target_yuv[:, 1, :, :] target_v = target_yuv[:, 2, :, :] return torch.div(torch.mean((out_u - target_u).pow(1)).abs() + torch.mean((out_v - target_v).pow(1)).abs(), 2) class BurstLoss(_Loss): def __init__(self, size_average=None, reduce=None, reduction='mean'): super(BurstLoss, self).__init__(size_average, reduce, reduction) self.reduction = reduction use_cuda = torch.cuda.is_available() device = torch.device("cuda:0" if use_cuda else "cpu") prewitt_filter = 1 / 6 * np.array([[1, 0, -1], [1, 0, -1], [1, 0, -1]]) self.prewitt_filter_horizontal = torch.nn.Conv2d(in_channels=1, out_channels=1, kernel_size=prewitt_filter.shape, padding=prewitt_filter.shape[0] // 2).to(device) self.prewitt_filter_horizontal.weight.data.copy_(torch.from_numpy(prewitt_filter).to(device)) self.prewitt_filter_horizontal.bias.data.copy_(torch.from_numpy(np.array([0.0])).to(device)) self.prewitt_filter_vertical = torch.nn.Conv2d(in_channels=1, out_channels=1, kernel_size=prewitt_filter.shape, padding=prewitt_filter.shape[0] // 2).to(device) self.prewitt_filter_vertical.weight.data.copy_(torch.from_numpy(prewitt_filter.T).to(device)) self.prewitt_filter_vertical.bias.data.copy_(torch.from_numpy(np.array([0.0])).to(device)) def get_gradients(self, img): img_r = img[:, 0:1, :, :] img_g = img[:, 1:2, :, :] img_b = img[:, 2:3, :, :] grad_x_r = self.prewitt_filter_horizontal(img_r) grad_y_r = self.prewitt_filter_vertical(img_r) grad_x_g = self.prewitt_filter_horizontal(img_g) grad_y_g = self.prewitt_filter_vertical(img_g) grad_x_b = self.prewitt_filter_horizontal(img_b) grad_y_b = self.prewitt_filter_vertical(img_b) grad_x = torch.stack([grad_x_r[:, 0, :, :], grad_x_g[:, 0, :, :], grad_x_b[:, 0, :, :]], dim=1) grad_y = torch.stack([grad_y_r[:, 0, :, :], grad_y_g[:, 0, :, :], grad_y_b[:, 0, :, :]], dim=1) grad = torch.stack([grad_x, grad_y], dim=1) return grad def forward(self, input, target): input_grad = self.get_gradients(input) target_grad = self.get_gradients(target) return F.l1_loss(input_grad, target_grad, reduction=self.reduction)
nilq/baby-python
python
from rvsml.align import dtw2, OPW_w from rvsml.EvaluateRVSML import EvaluateRVSML_dtw from rvsml.NNClassifier import NNClassifier_dtw from rvsml.RVSML_OT_Learning import RVSML_OT_Learning_dtw
nilq/baby-python
python
import sys class Foobar: def __init__(self, foobar="foobar"): self.foobar = foobar def __repr__(self): return(self.foobar)
nilq/baby-python
python
import os import json import requests import telegram def custom_alert_slack(message): text = "" text = "%s" % message requests.post(os.getenv('SLACK_WEBHOOK'), data=json.dumps({"text": text}), headers={'Content-type': 'application/json'}) def publish_on_telegram_channel(chat_id, message, token=None, image=None): if not token: token = os.getenv('TelegramBotsToken') bot = telegram.Bot(token=token) if image is None: bot.send_message(chat_id=chat_id, text=message, parse_mode='HTML', disable_web_page_preview="true") else: bot.send_photo(chat_id=chat_id, photo=open(image, 'rb'), caption=message, parse_mode='HTML', disable_web_page_preview="true")
nilq/baby-python
python
#!/usr/bin/env python # -*- coding: utf-8 -*- """ @author Eric Bullen <ebullen@linkedin.com> @application jtune.py @version 4.0.1 @abstract This tool will give detailed information about the running JVM in real-time. It produces useful information that can further assist the user in debugging and optimization. @license Copyright 2015 LinkedIn Corp. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. """ import atexit import datetime import getpass import locale import logging import math import os import re import resource import shlex import socket import subprocess as sp import sys import textwrap import time from decimal import Decimal from itertools import zip_longest, count import argparse import multiprocessing as mp try: locale.setlocale(locale.LC_ALL, 'en_US') except locale.Error: # Try UTF8 variant before failing locale.setlocale(locale.LC_ALL, 'en_US.utf8') handler = logging.StreamHandler() handler.setFormatter(logging.Formatter('%(asctime)s: "%(name)s" (line: %(lineno)d) - %(levelname)s: %(message)s')) logger = logging.getLogger() logger.setLevel(logging.INFO) logger.addHandler(handler) # For me to use in PyCharm to read flight recorder files DEBUG = False class Display(object): def __init__(self, textwrap_offset=80): self.display_output = [] self.textwrap_offset = textwrap_offset def render(self, message=None, keep_newline=True, save_output=True): """Basically wraps the print function so that it will also save the output to an array for pasting Keyword arguments: message -- the message to print keep_newline -- if this is True, then print it, otherwise, print with no newline (like print with a comma at the end) save_output -- if this is false, do not save the output to an array for pasting """ if save_output: self.add(message) if message.endswith("\n"): message = message[:-1] if keep_newline: print(message) else: print(message, end=" ") def add(self, message): """Append message to output items.""" self.display_output.append(message) class GCRecord(object): """Object definition for a single gc record.""" _version = "1.0" def __init__(self, raw_gc_record=None): if raw_gc_record: self.raw_gc_record = raw_gc_record else: self.raw_gc_record = list() self.is_cms_gc = False self.is_stw_gc = False self.cms_sweep_time = None self.valid_record = False self.record_timestamp = None self.jvm_running_time = None self.gc_type = None self.desired_survivor_size = None self.curr_threshold = None self.max_threshold = None self.ages = list() self.young_size_before_gc = None self.young_size_after_gc = None self.young_size_total = None self.young_gc_time = 0 self.total_heap_before_gc = None self.total_heap_after_gc = None self.total_heap = None self.total_gc_time = 0 self.og_used = None self.stw_time = 0 self._parse_record() def __repr__(self): """This prints out the gc record so that it looks as though it came straight from the logs.""" output = list() output.append("{0} Runtime: {1} GC Type: {2}".format(self.record_timestamp, self.jvm_running_time, self.gc_type)) output.append("Desired Survivor Size: {0}, Curr Threshold: {1} (Max: {2})".format(self.desired_survivor_size, self.curr_threshold, self.max_threshold)) for age in self.ages: if age[1] > -1 or age[2] > -1: output.append("- Age {0}: {1:>10} bytes, {2:>10} total".format(age[0], age[1], age[2])) output.append("YG Before GC: {0}K, YG After GC: {1}K (Total: {2}K), {3} secs".format(self.young_size_before_gc, self.young_size_after_gc, self.young_size_total, self.young_gc_time)) output.append("Total Heap Before GC: {0}K, Total Heap After GC: {1}K (Total: {2}K), {3} secs".format(self.total_heap_before_gc, self.total_heap_after_gc, self.total_heap, self.total_gc_time)) return "\n".join(output) def _parse_record(self): """This loops through record_array to set the class variables that make up the record.""" self.record_timestamp, record_array = self.raw_gc_record ############################################################# # Capture STW (Full GC, remarks, etc.). Yeah, I could combine # these three, but this is good enough for now. if any("CMS Initial Mark" in line for line in record_array): match = re.search(r", ([\d\.]+) secs\] ", record_array[-1]) if match: self.gc_type = "CMS-STW" self.is_stw_gc = True self.valid_record = True self.stw_time += float(match.group(1)) if any("CMS Final Remark" in line for line in record_array): match = re.search(r", ([\d\.]+) secs\] ", record_array[-1]) if match: self.gc_type = "CMS-STW" self.is_stw_gc = True self.valid_record = True self.stw_time += float(match.group(1)) if any("Full GC" in line for line in record_array): match = re.search(r", ([\d\.]+) secs\] ", record_array[-1]) if match: self.gc_type = "FULL" self.is_stw_gc = True self.valid_record = True self.stw_time += float(match.group(1)) if not self.is_stw_gc: for line in record_array: if "CMS-concurrent-sweep: " in line: match = re.match(r"^\d+-\d+-\d+T\d+:\d+:[\d\.]+[+-]\d+: ([\d\.]+): \[CMS-concurrent-sweep: [\d\.]+/([\d\.]+) secs", line) if match: self.is_cms_gc = True self.valid_record = True self.gc_type = "CMS" self.jvm_running_time = float(match.group(1)) self.cms_sweep_time = float(match.group(2)) break if not (self.jvm_running_time or self.gc_type): match = re.match(r"^\d+-\d+-\d+T\d+:\d+:[\d\.]+[+-]\d+: ([\d\.]+): .*\[(\S+)", line) if match: self.jvm_running_time = float(match.group(1)) self.gc_type = match.group(2) if not (self.desired_survivor_size or self.curr_threshold or self.max_threshold): match = re.match(r"^Desired survivor size (\d+) bytes, new threshold (\d+) \(max (\d+)\)", line) if match: self.valid_record = True self.desired_survivor_size = int(match.group(1)) self.curr_threshold = int(match.group(2)) self.max_threshold = int(match.group(3)) # Here I set the survivor size beforehand, for any that # may be missing as I want all the ages even if they aren't # being used for comparison between GCs for age in range(1, self.max_threshold + 1): self.ages.append((age, -1, -1)) continue ################################################ # Skipping records when the JVM has been running # for less than 300 seconds if self.jvm_running_time < 300: self.valid_record = False break ############################# # Capture survivor ages, etc. match = re.match(r"^- age\s+(\d+):\s+(\d+) bytes,\s+(\d+) total", line) if match: ############################################################ # This while logic block catches any ages that were # fully reaped, and fills them with zeros. This is important # as the analytics needs to know this to determine survivor # death rates/ratios age = int(match.group(1)) curr_size = int(match.group(2)) max_size = int(match.group(3)) self.ages[age - 1] = (age, curr_size, max_size) continue ############################### # Capture gc reallocation stats match = re.match(r"^: (\d+)\w->(\d+)\w\((\d+)\w\), ([\d\.]+) secs\] (\d+)\w->(\d+)\w\((\d+)\w\), ([\d\.]+) secs\]", line) if match: self.young_size_before_gc = int(match.group(1)) * 1024 self.young_size_after_gc = int(match.group(2)) * 1024 self.young_size_total = int(match.group(3)) * 1024 self.young_gc_time = Decimal(match.group(4)) self.total_heap_before_gc = int(match.group(5)) * 1024 self.total_heap_after_gc = int(match.group(6)) * 1024 self.total_heap = int(match.group(7)) * 1024 self.total_gc_time = Decimal(match.group(8)) self.og_used = self.total_heap_after_gc - self.young_size_after_gc def liverun(cmd=None): """Run cmd, and return an iterator of said cmd. Keyword arguments: cmd -- the command to run """ global subproc env = dict(os.environ) # Combining stdout and stderr. I can't find a way to keep both separate # while getting the data 'live'. itertools.izip_longest seemed like it'd # almost do it, but it caches the results before sending it out... subproc = sp.Popen(shlex.split(cmd), stdout=sp.PIPE, stderr=sp.STDOUT, env=env) return iter(subproc.stdout.readline, b'') def reduce_seconds(secs=None): """Return a compressed representation of time in seconds Keyword arguments: secs -- a float/int representing the seconds to be 'compressed' """ # The nested if statements keep it from being too long, # by lopping off the non significant values retval = "" secs = int(float(secs)) mins, secs = divmod(secs, 60) hours, mins = divmod(mins, 60) days, hours = divmod(hours, 24) secs = int("{0:0.0f}".format(secs)) if days: retval += "{0}d".format(days) if hours: retval += "{0}h".format(hours) if days > 0: return retval if mins: retval += "{0}m".format(mins) if hours or days: return retval if secs: retval += "{0:}s".format(secs) return retval def sec_diff(first_time=None, second_time=None): """Return the number of seconds between two datetime objects Keyword arguments: first_time -- The (typically) older time of the two second_time -- The (typically) newer time of the two """ time_delta = second_time - first_time return time_delta.days * 86400 + time_delta.seconds + Decimal(str(time_delta.microseconds / float(1000000))) def _min(values=None): """A wrapper around the min() function so that it does not error on an empty list""" try: return min(values) except ValueError: return 0 def _max(values=None): """A wrapper around the max() function so that it does not error on an empty list""" try: return max(values) except ValueError: return 0 def median(values=None): """Return the median of 'values' Keyword arguments: values -- the list of numbers """ sorts = sorted(values) length = len(sorts) result = None if not values: result = 0 # raise ValueError, "I can't find the median of an empty list." elif not length % 2: result = (sorts[(length // 2)] + sorts[(length // 2) - 1]) / 2.0 else: result = sorts[length // 2] return result def mean(values=None, _length=None): """Return the mean of 'values' Keyword arguments: values -- the list of numbers _length -- mostly not usable for end-users, needed by the stdev function """ result = None if not _length: _length = len(values) if _length > 0: result = Decimal(str(sum(values))) / _length else: result = 0 return result def stdev(values=None): """Return the standard deviation of values Keyword arguments: values -- The poorly named argument that contains the list of numbers """ values_mean = mean(values) variance = [math.pow(Decimal(str(x)) - values_mean, 2) for x in values] return math.sqrt(mean(variance, len(variance) - 1)) def percentile(values=None, pct=None): """Return the percentile of a given values Keyword arguments: values -- The list of numbers to be analyzed pct -- The percentile (can be a float) to be used (100 == 100%, not 1 = 100%, etc.) """ watermark_index = int(round((float(pct) / 100) * len(values) + .5)) watermark = sorted(values)[watermark_index - 1] return [element for element in values if element <= watermark] def ord_num(number=None): return str(number) + ("th" if 4 <= number % 100 <= 20 else {1: "st", 2: "nd", 3: "rd"}.get(number % 10, "th")) def reduce_k(size=None, precision=2, short_form=True, _place_holder=0): """Return a compressed representation of a given number of bytes Keyword arguments: size -- the size in bytes precision -- what precision should be used (places to the right of the decimal) short_form -- (true/false). Use 'K' instead of 'KiB', etc. """ if not isinstance(size, Decimal): size = Decimal(str(size)) # You know.. just in case we ever get to a yottabyte if short_form: iec_scale = ['K', 'M', 'G', 'T', 'P', 'E', 'Z', 'Y'] else: iec_scale = ['KiB', 'MiB', 'GiB', 'TiB', 'PiB', 'EiB', 'ZiB', 'YiB'] if not isinstance(size, Decimal): size = Decimal(str(size)) if abs(size) >= 1024: _place_holder += 1 return reduce_k(size / Decimal("1024.0"), precision=precision, short_form=short_form, _place_holder=_place_holder) else: value = Decimal("{0:.{1}f}".format(size, precision)) if Decimal(str(int(value))) == value: value = int(value) if short_form: return "{0}{1}".format(value, iec_scale[_place_holder]) else: return "{0} {1}".format(value, iec_scale[_place_holder]) def _run_analysis(gc_data=None, jmap_data=None, jstat_data=None, proc_details=None, optimized_for_ygcs_rate=None): """The meat-and-potatoes of this tool. This takes in numerous data structures, and prints out a report of the analysis of them.""" # Formulas to get the JVM configuration just from JMap: # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # eden_size == (newsize * survivor_ratio)/(2 + survivor_ratio) # survivor_size == eden_size * (1/survivor_ratio) # og_size == max_heap_size - eden_size - survivor_size # og_used == heap_used - eden_used if not gc_data: logger.error("I can't do any analysis for this sample period because there wasn't enough data in the GC log. Exiting.") sys.exit(1) ############################################################ # Get some summary data that doesn't require GC log analysis # Loop through the GC data array to find all CMS events, and capture # how long they took. cms_times = [record.cms_sweep_time for record in gc_data if record.is_cms_gc] display.render("\n") display.render("Meta:\n") display.render("~~~~~\n") sample_time_secs = sec_diff(gc_data[0].record_timestamp, gc_data[-1].record_timestamp) if sample_time_secs < 60: display.render("GC Sample Time: {0} seconds\n".format(sample_time_secs)) else: display.render("GC Sample Time: {0} ({1} seconds)\n".format(reduce_seconds(sample_time_secs), sample_time_secs)) display.render("GC Sample Time from {0} to {1}\n".format(gc_data[0].record_timestamp, gc_data[-1].record_timestamp)) if proc_details: cpu_count = mp.cpu_count() cpu_uptime = cpu_count * proc_details['sys_uptime_seconds'] proc_utime_pct = proc_details['proc_utime_seconds'] / cpu_uptime proc_stime_pct = proc_details['proc_stime_seconds'] / cpu_uptime display.render("System Uptime: {0}\n".format(reduce_seconds(proc_details['sys_uptime_seconds']))) display.render("Proc Uptime: {0}\n".format(reduce_seconds(proc_details['proc_uptime_seconds']))) display.render("Proc Usertime: {0} ({1:0.2%})\n".format(reduce_seconds(proc_details['proc_utime_seconds']), proc_utime_pct)) display.render("Proc Systime: {0} ({1:0.2%})\n".format(reduce_seconds(proc_details['proc_stime_seconds']), proc_stime_pct)) display.render("Proc RSS: {0}\n".format(reduce_k(proc_details['proc_rss_bytes'] / 1024))) display.render("Proc VSize: {0}\n".format(reduce_k(proc_details['proc_vsize_bytes'] / 1024))) display.render("Proc # Threads: {0}\n".format(proc_details['num_threads'])) display.render("\n") # Exit out as I don't have enough gc_data to do any analysis on if len(gc_data) < 2: display.render("\n") display.render("* NOTE: There wasn't enough data to do any analysis. Please let the tool\n") display.render(" gather at least 2 complete gc.log records (found {0}).\n".format(len(gc_data))) return False survivor_info = dict() young_gc_count_delta = len([record.is_stw_gc for record in gc_data if not record.is_stw_gc]) full_gc_count_delta = len([record.is_stw_gc for record in gc_data if record.is_stw_gc]) sample_gc_time = sum(record.total_gc_time for record in gc_data) sample_gc_load = (sample_gc_time / Decimal(str(sample_time_secs))) * 100 ####################################################### # Get young gen allocation rates over the sample period yg_rates = list() for first_gc, second_gc in zip(gc_data, gc_data[1:]): if any([second_gc.is_stw_gc, first_gc.is_stw_gc, first_gc.is_cms_gc, second_gc.is_cms_gc]): continue # Iterate over the gc logs 2 at a time # [1, 2, 3, 4] -> # [(1, 2), (2, 3), (3, 4)] # time_delta = sec_diff(first_gc.record_timestamp, second_gc.record_timestamp) try: yg_size_delta = second_gc.young_size_before_gc - first_gc.young_size_after_gc yg_growth_delta = second_gc.young_size_after_gc - first_gc.young_size_after_gc except TypeError: display.render("\n".join(textwrap.wrap("Warning: Something is really wrong with this JVM; I couldn't get correct GC data for it.", display.textwrap_offset))) display.render("") yg_size_delta = 0 yg_growth_delta = 0 # These are in KiB/s yg_alloc_rate = yg_size_delta / time_delta yg_growth_rate = yg_growth_delta / time_delta yg_rates.append((yg_alloc_rate, yg_growth_rate)) ##################################################### # Get old gen promotion rates over the sample period og_rates = list() for first_gc, second_gc in zip(gc_data, gc_data[1:]): if any([second_gc.is_stw_gc, first_gc.is_stw_gc, first_gc.is_cms_gc, second_gc.is_cms_gc]): continue time_delta = sec_diff(first_gc.record_timestamp, second_gc.record_timestamp) # These are in KiB/s og_allocation_delta = (second_gc.og_used - first_gc.og_used) / Decimal("1024") og_allocation_rate = og_allocation_delta / time_delta ############################################################################ # I only want when the old gen is growing. If it's decreasing, it's probably # b/c there was a FGC, and space is being reclaimed. if og_allocation_delta > 0: # This is in KiB/s og_rates.append(og_allocation_rate) ############################ # Calc survivor death ratios gc_survivor_death_rates = list() for first_gc, second_gc in zip(gc_data, gc_data[1:]): if any([second_gc.is_stw_gc, first_gc.is_stw_gc, first_gc.is_cms_gc, second_gc.is_cms_gc]): continue survivor_death_rates = list() for first_age, second_age in zip(first_gc.ages, second_gc.ages[1:]): # The second age CAN be bigger than the first age. I verified # this in the gc.logs (still not sure how/why) # ID 0 is the age number # ID 1 is bytes in that age # ID 2 is the total bytes for that age if second_age[1] == -1: # I don't think I want to capture any changes if # the survivor space didn't exist (-1 as a default value- see above) continue # survivor_death_rates.append(Decimal(0)) else: survivor_death_rates.append(1 - (Decimal(second_age[1]) / first_age[1])) gc_survivor_death_rates.append(survivor_death_rates) ################################################################################# # Since I have 2 in-scope valid GCs, I'm going to calculate some needed JVM sizes # the sizes will be fixed if I have a fixed heap size (which we do in prod) jvm_mem_cfg = dict() try: jvm_mem_cfg["og_size"] = (first_gc.total_heap - first_gc.young_size_total) * 1024 except TypeError: display.render("\n".join(textwrap.wrap("Error: I could not find a non CMS/FGC GC record for analysis. Exiting.", display.textwrap_offset))) display.render("") sys.exit(1) jvm_mem_cfg["survivor_size"] = (first_gc.desired_survivor_size * 2) jvm_mem_cfg["eden_size"] = (first_gc.young_size_total * 1024) - jvm_mem_cfg["survivor_size"] jvm_mem_cfg["total_heap"] = (first_gc.total_heap * 1024) + jvm_mem_cfg["survivor_size"] jvm_mem_cfg["new_size"] = (jvm_mem_cfg["eden_size"] + (jvm_mem_cfg["survivor_size"] * 2)) ######################################################### # Now that I have a crap-ton of curated data, report out. # This grabs the first part of the tuple (which is # the total allocation for that gc (not growth!) yg_alloc_rates = [entry[0] for entry in yg_rates] min_yg_rate, mean_yg_rate, max_yg_rate = _min(yg_alloc_rates), mean(yg_alloc_rates), _max(yg_alloc_rates) display.render("YG Allocation Rates*:\n") display.render("~~~~~~~~~~~~~~~~~~~~~\n") display.render("per sec (min/mean/max): {0:>13} {1:>13} {2:>13}\n".format(reduce_k(min_yg_rate) + "/s", reduce_k(mean_yg_rate) + "/s", reduce_k(max_yg_rate) + "/s")) display.render("per hr (min/mean/max): {0:>13} {1:>13} {2:>13}\n".format(reduce_k(min_yg_rate * 3600) + "/h", reduce_k(mean_yg_rate * 3600) + "/h", reduce_k(max_yg_rate * 3600) + "/h")) display.render("\n") # This grabs the second part of the tuple (which is # the total growth for that gc (not allocation rate!) min_og_rate, mean_og_rate, max_og_rate = _min(og_rates), mean(og_rates), _max(og_rates) display.render("OG Promotion Rates:\n") display.render("~~~~~~~~~~~~~~~~~~~\n") display.render("per sec (min/mean/max): {0:>13} {1:>13} {2:>13}\n".format(reduce_k(min_og_rate) + "/s", reduce_k(mean_og_rate) + "/s", reduce_k(max_og_rate) + "/s")) display.render("per hr (min/mean/max): {0:>13} {1:>13} {2:>13}\n".format(reduce_k(min_og_rate * 3600) + "/h", reduce_k(mean_og_rate * 3600) + "/h", reduce_k(max_og_rate * 3600) + "/h")) display.render("\n") ################################################ # Survivor Lengths- wanted to make a nested list # comprehension, but I suppose that's a bit ugly # to debug/read display.render("Survivor Death Rates:\n") display.render("~~~~~~~~~~~~~~~~~~~~~\n") survivor_lengths = list() for sub_arr in gc_survivor_death_rates: survivor_lengths.append(len([elem for elem in sub_arr if elem > 0])) display.render("Lengths (min/mean/max): {0}/{1:0.1f}/{2}\n".format(_min(survivor_lengths), mean(survivor_lengths), _max(survivor_lengths))) display.render("Death Rate Breakdown:\n") cuml_pct = 1 death_ages = list() for survivor_num, pct_list in enumerate(zip_longest(*gc_survivor_death_rates, fillvalue=0), 1): min_pct = min(pct_list) mean_pct = mean(pct_list) max_pct = max(pct_list) cuml_pct *= 1 - mean_pct death_ages.append(mean_pct) survivor_info[survivor_num] = min_pct, mean_pct, max_pct display.render(" Age {0}: {1:>5} / {2:>5} / {3:>5} / {4:>5} (min/mean/max/cuml alive %)\n".format(survivor_num, "{0:0.1%}".format(min_pct), "{0:0.1%}".format(mean_pct), "{0:0.1%}".format(max_pct), "{0:0.1%}".format(cuml_pct))) ################################## # GC Times young_gc_times = [record.young_gc_time * 1000 for record in gc_data if not record.is_stw_gc] full_gc_times = [record.stw_time * 1000 for record in gc_data if record.is_stw_gc] if sample_time_secs: if young_gc_count_delta: ygc_rate = (young_gc_count_delta / sample_time_secs) * 60 else: ygc_rate = 0 if full_gc_count_delta: fgc_rate = (full_gc_count_delta / sample_time_secs) * 60 else: fgc_rate = 0 display.render("\n") display.render("GC Information:\n") display.render("~~~~~~~~~~~~~~~\n") display.render("YGC/FGC Count: {0}/{1} (Rate: {2:0.2f}/min, {3:0.2f}/min)\n".format(young_gc_count_delta, full_gc_count_delta, ygc_rate, fgc_rate)) display.render("\n") display.render("Sample Period GC Load: {0:0.2f}%\n".format(sample_gc_load)) display.render("") display.render("CMS Sweep Times: {0:0.3f}s / {1:0.3f}s / {2:0.3f}s / {3:0.2f} (min/mean/max/stdev)\n".format(_min(cms_times), mean(cms_times), _max(cms_times), stdev(cms_times))) display.render("YGC Times: {0:0.0f}ms / {1:0.0f}ms / {2:0.0f}ms / {3:0.2f} (min/mean/max/stdev)\n".format(_min(young_gc_times), mean(young_gc_times), _max(young_gc_times), stdev(young_gc_times))) display.render("FGC Times: {0:0.0f}ms / {1:0.0f}ms / {2:0.0f}ms / {3:0.2f} (min/mean/max/stdev)\n".format(_min(full_gc_times), mean(full_gc_times), _max(full_gc_times), stdev(full_gc_times))) agg_ygc_time = sum(young_gc_times) agg_fgc_time = sum(full_gc_times) display.render("Agg. YGC Time: {0:0.0f}ms\n".format(agg_ygc_time)) display.render("Agg. FGC Time: {0:0.0f}ms\n".format(agg_fgc_time)) display.render("\n") if og_rates: display.render( "Est. Time Between FGCs (min/mean/max): {0:>10} {1:>10} {2:>10}\n".format(reduce_seconds(jvm_mem_cfg["og_size"] / min_og_rate), reduce_seconds(jvm_mem_cfg["og_size"] / mean_og_rate), reduce_seconds(jvm_mem_cfg["og_size"] / max_og_rate))) else: display.render("Est. Time Between FGCs (min/mean/max): {0:>10} {1:>10} {2:>10}\n".format("n/a", "n/a", "n/a")) display.render("Est. OG Size for 1 FGC/hr (min/mean/max): {0:>10} {1:>10} {2:>10}\n".format(reduce_k(min_og_rate * 3600), reduce_k(mean_og_rate * 3600), reduce_k(max_og_rate * 3600))) display.render("\n") display.render("Overall JVM Efficiency Score*: {0:0.3f}%\n".format(100 - sample_gc_load)) display.render("\n") ################################### # JMap Data display.render("Current JVM Mem Configuration:\n") display.render("~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n") if jmap_data: for k, v in jmap_data.items(): if "Size" in k: v = reduce_k(v / 1024) display.render("{0:>17}: {1}\n".format(k, v)) else: for k, v in jvm_mem_cfg.items(): display.render("{0:>17}: {1}\n".format(k, reduce_k(v / 1024))) display.render("\n") ###################### # Show recommendations _show_recommendations(death_ages, young_gc_times, full_gc_times, fgc_rate, ygc_rate, yg_alloc_rates, og_rates, jvm_mem_cfg, jmap_data, jstat_data, gc_data, cms_times, survivor_info, optimized_for_ygcs_rate, proc_details) display.render("~~~\n") display.render("* The allocation rate is the increase in usage before a GC done. Growth rate\n") display.render(" is the increase in usage after a GC is done.\n") display.render("\n") display.render("* The JVM efficiency score is a convenient way to quantify how efficient the\n") display.render(" JVM is. The most efficient JVM is 100% (pretty much impossible to obtain).\n") if full_gc_count_delta == 0: display.render("\n") display.render("* There were no full GCs during this sample period. This reporting will\n") display.render(" be less useful/accurate as a result.\n") display.render("\n") display.render("* A copy of the critical data used to generate this report is stored\n") display.render(" in /tmp/jtune_data-{0}.bin.bz2. Please copy this to your homedir if you\n".format(user)) display.render(" want to save/analyze this further.\n") def _get_survivor_info(death_ages=None, survivor_info=None, gc_data=None, survivor_problem_pct=None, curr_ng_size=None, adj_ng_size=None): """This looks at the survivor info data structure, and will return the max tenuring size, and max tenuring age that it feels is needed.""" # This is roughly how much larger the survivor space should be to counteract the increase # in the frequency of ygcs caused from the smaller NG size as it pushes data into the # survivor space more often. I don't need to change the MaxTenuringThreshold as that is # mostly constant depending on how data ages. # # I'm adjusting the size of the survivor space based on the eden change. It MAY be better # adjusting this based on time of how frequent the ygcs are happening. ng_size_delta = curr_ng_size - adj_ng_size # Going to use this to change the maxtenuringtrheshold parameter. The reason is that # ygcs will happen less/more often if I change the ng size, and I'll need to counter # that by increasing/decreasing the tenuring threshold to keep things in balance. ng_size_delta_pct = adj_ng_size / curr_ng_size # Changing the 'survivor_problem_pct' which is the watermark # for objects still alive. If it's over that amount, then the # tenuring threshold needs to be increased, if it's less, then # the age is good. HOWEVER, I use death rate, so[-1] a 85% death # rate is a 15% survivor rate. survivor_watermark = 100 - survivor_problem_pct # Get the max survivor age allowed per the jvm configuration max_survivor_age = gc_data[0].max_threshold # The survivor_info structure is the decrease in size for that # age going into the next, so if the max here is 6, the actual max # survivor size used is 7. longest_used_ratio = len(survivor_info) + 1 # Survivor percentage of surviving objects age_objects_still_alive = list() current_percentage = 100 for key in sorted(survivor_info): # [1] is the average, [2] is the max mean_death_rate_pct = survivor_info[key][1] current_percentage *= 1 - mean_death_rate_pct age_objects_still_alive.append(current_percentage) error_msg = None if max_survivor_age < 15: if longest_used_ratio == max_survivor_age: if age_objects_still_alive[-1] > ((100 - survivor_watermark) / 100.0): error_msg = "The survivor ratio of {0} is too small as {1:0.1f}% of the objects are still alive. Try increasing the MaxTenuringThreshold (Max: 15) parameter, and running this analysis again.".format( longest_used_ratio, age_objects_still_alive[-1]) elif not survivor_info: error_msg = "For the examined sample period, I could not retrieve any meaningful survivor statistics from the gc.log. This JVM is either sick, or the sample period was too short." elif not survivor_info: error_msg = "For the examined sample period, I could not retrieve any meaningful survivor statistics from the gc.log. This JVM is either sick, or the sample period was too short." elif not survivor_info: error_msg = "For the examined sample period, I could not retrieve any meaningful survivor statistics from the gc.log. This JVM is either sick, or the sample period was too short." if error_msg: raise ValueError(error_msg) ########################################################### # Don't confuse the 'min()' with the 'max' variable. I want # the first age where it's less than survivor_problem_pct try: max_tenuring_age = min([k for k, v in enumerate(age_objects_still_alive, 1) if v <= survivor_problem_pct]) except ValueError: max_tenuring_age = 0 if not max_tenuring_age: # Not sure if I like this algorithm, but it seems close enough below_threshold_ct = len([death_pct for death_pct in death_ages if death_pct <= Decimal(".04")]) below_threshold_pct = below_threshold_ct / float(len(death_ages)) # If more than 33% of the ages are at or below 4%, make a note of it. if below_threshold_pct > .33: # It's speculative that I should add to the heap any objects that aren't reaped # after cutting off the MaxTenuringThrehold, but since it's not getting reaped anyway, # it may not change anything, so not adjusting for the time being. # We're using all the available ages, but objects are still alive... if max_survivor_age == len(death_ages): display.render("\n".join(textwrap.wrap( "* Warning: It looks like your tenuring threshold is too high - {0:0.0%} of your ages are reaping at or below 4% of the objects. We could make it easier for the JVM if we reduce your MaxTenuringThreshold by {1} to {2} instead of {3}.".format( below_threshold_pct, below_threshold_ct, len(death_ages) - below_threshold_ct, max_survivor_age)))) else: display.render("\n".join(textwrap.wrap( "* Warning: It looks like your tenuring threshold is too high - {0:0.0%} of your ages are reaping at or below 4% of the objects. We could make it easier for the JVM if we reduce your MaxTenuringThreshold by {1} to {2} instead of {3}. BE CAREFUL - your max *used* age in the gc.logs of {4} is less than the configured max age of {3} - make sure that you used a large enough sample size, and let the JVM go through 3 FGCs (option: '-s 3') and is being checked during peak traffic.".format( below_threshold_pct, below_threshold_ct, len(death_ages) - below_threshold_ct, max_survivor_age, len(death_ages))))) max_tenuring_age = len(death_ages) - below_threshold_ct else: display.render("\n".join(textwrap.wrap( "* Warning: Your survivor age is too short, your last age of {0} has {1:0.2f}% of its objects still alive. Because of this, I'm unable to reliably determine how your objects are aging. Unset or increase the MaxTenuringThreshold (max: 15) to mitigate this problem.".format( len(age_objects_still_alive), age_objects_still_alive[-1])))) tenure_sizes = list() for gc_record in gc_data: try: tenure_sizes.append(gc_record.ages[max_tenuring_age - 1][2]) except IndexError: # I saw a gc record that doesn't have that age # level, so skip it. pass # It's recommended to have the tenuring size 2x the max tenure size, I then # add in the change in newgen (ng_size_delta) to offset the decrease/increase # in newgen as calculated in this parent's function. The 'ng_size_delta / 2' is # such that I increase the whole max_tenuring_size by ng_size_delta, but since # there are two survivor spaces, I need to split the ng_size_delta by 2 for each # survivor space max_tenuring_size = (max(tenure_sizes) * 2) + (ng_size_delta / 2) survivor_ratio = adj_ng_size / max_tenuring_size # Checking if survivor space is LARGER than the newgen size if survivor_ratio < 1: display.render("\n".join(textwrap.wrap( "* Warning: The calculated recommended survivor ratio of {0:0.2f} is less than 1. This is not possible, so I increased the size of newgen by {1}, and set the survivor ratio to 1. Try the tuning suggestions, and watch closely.\n".format( survivor_ratio, reduce_k((max_tenuring_size - adj_ng_size) / 1024)), display.textwrap_offset)) + "\n\n") # This is close, but still wrong. If I run into this condition, then I need to # also fix the newgen size b/c the tenured size is based off of the newgen # size before I knew there was an issue. I think this is probably close enough # for now. survivor_ratio = 1 adj_ng_size = max_tenuring_size else: adj_ng_size += max_tenuring_size # Now, change the max tenuring age/threshold max_tenuring_age *= (1 / ng_size_delta_pct) return adj_ng_size, survivor_ratio, max_tenuring_size, max_tenuring_age def _show_recommendations(death_ages=None, young_gc_times=None, full_gc_times=None, fgc_rate=None, ygc_rate=None, yg_alloc_rates=None, og_rates=None, jvm_mem_cfg=None, jmap_data=None, jstat_data=None, gc_data=None, cms_times=None, survivor_info=None, optimized_for_ygcs_rate=None, proc_details=None): """This is where any jvm tuning recommendations happens.""" ########################################################################### # The basis of these recommendations are as follows: # # 1) More frequent YGCs which take less time is almost always better # than less frequent YGCs, but taking longer; consistently slow is # better than periodically slower # 2) YGC times should have a low standard deviation(<= 5) # 3) YGC times should be low (<= 50ms, ideally) display.render("Recommendation Summary:\n") display.render("~~~~~~~~~~~~~~~~~~~~~~~\n") # This is how many ygcs/sec should be happening, if the mean ygc # times are higher than desired ygc_time_goal_ms = 50 ygc_stdev_goal = 5 # YGC mean ms percentile - lop off the worst offenders # I am changing it instead of a mean of the 99p, doing a # max of the 75p; may be better ygc_pctile = 75 # This is just for analysis purposes; need a decent sample set count ygc_count_goal = 10 fgc_count_goal = 3 # Marker for indicating if current config is good for # the Java G1 garbage collector ready_for_g1 = False survivor_problem_pct = 10 ygc_stdev = stdev(percentile(young_gc_times, ygc_pctile)) ygc_mean_ms = float(max(percentile(young_gc_times, ygc_pctile))) if jmap_data: curr_ng_size = jmap_data['NewSize'] curr_og_size = jmap_data['OldSize'] # Not using b/c this data is not in the GC logs (and # really doesn't need to be tuned... # if "PermSize" in jmap_data: # curr_pg_ms_size = jmap_data['PermSize'] # else: # curr_pg_ms_size = jmap_data['MetaspaceSize'] max_heap_size = jmap_data['MaxHeapSize'] else: curr_ng_size = jvm_mem_cfg["new_size"] curr_og_size = jvm_mem_cfg["og_size"] max_heap_size = jvm_mem_cfg["total_heap"] adj_ng_size = curr_ng_size ######################################################################################################### # This is an estimate. Because we use CMS for FGCs, it's an iterative process, and while the CMS reset is # happening, more objects are being tenured into OG. The best we can do (I think) is to find the minimum # size of OU, and go from there. This is why it's super important to have more than 2 FGCs to look at. # # This is tricky. I need to find the first record where the previous og size is bigger than # the current. This identifies when the first CMS runs, and from there, I can find the minimum normal_gc_data = [x for x in gc_data if x.og_used > 0] try: record_num = [record_num for record_num, first_gc, second_gc in zip(count(), normal_gc_data, normal_gc_data[1:]) if first_gc.og_used > second_gc.og_used][0] except IndexError: live_data_size_bytes = None else: live_data_size_bytes = _min(record.og_used for record in normal_gc_data[record_num:]) if proc_details and proc_details['proc_uptime_seconds'] < 300: display.render("\n".join(textwrap.wrap( "Warning: The process I'm doing the analysis on has been up for {0}, and may not be in a steady-state. It's best to let it be up for more than 5 minutes to get more realistic results.\n".format( reduce_seconds(proc_details['proc_uptime_seconds'])))) + "\n\n") ################################################# # Find the recommended NewGen size if len(young_gc_times) < ygc_count_goal: display.render("\n".join( textwrap.wrap("Warning: There were only {0} YGC entries to do the analysis on. It's better to have > {1} to get more realistic results.\n".format(len(young_gc_times), ygc_count_goal), display.textwrap_offset)) + "\n\n") if ygc_stdev > ygc_stdev_goal * 4: comment = "VERY inconsistent" elif ygc_stdev > ygc_stdev_goal * 2: comment = "pretty inconsistent" elif ygc_stdev > ygc_stdev_goal: comment = "somewhat consistent" ready_for_g1 = True else: comment = "very consistent" ready_for_g1 = True messages = list() # This logic block goes through different optimizaion scenarios that it # uses to find an optimal setting. # messages.append("- The mean YGC rate is {0:0.2f}/min, and the max {1} percentile YGC time is {2:0.0f}ms (stdev of {3:0.2f} which is {4}). It's best to have the mean YGC time be at or below {5}ms, and the YGC stdev at or below {6} if possible.".format(ygc_rate, ord_num(ygc_pctile), ygc_mean_ms, ygc_stdev, comment, ygc_time_goal_ms, ygc_stdev_goal)) # TODO: Too much repetition in this code block if (optimized_for_ygcs_rate > ygc_rate) and (ygc_stdev > ygc_stdev_goal or ygc_mean_ms > ygc_time_goal_ms): adj_ng_size = curr_ng_size * (ygc_rate / optimized_for_ygcs_rate) ###################################################################### # Figure out Tenuring Threshold & size for the survivor spaces, basing # it on the last age where below 10% still live try: new_adj_ng_size, survivor_ratio, max_tenuring_size, max_tenuring_age = _get_survivor_info(death_ages, survivor_info, gc_data, survivor_problem_pct, curr_ng_size, adj_ng_size) # Go ahead and set it regardless adj_ng_size = new_adj_ng_size except ValueError as msg: display.render("\n" + "\n".join(textwrap.wrap("* Error: {0}".format(msg), display.textwrap_offset)) + "\n\n") display.render("") return False messages.append( "- With a mean YGC time goal of {0:0.0f}ms, the suggested (optimized for a YGC rate of {1:0.2f}/min) size of NewGen (including adjusting for calculated max tenuring size) considering the above criteria should be {2:0.0f} MiB (currently: {3:0.0f} MiB).".format( ygc_time_goal_ms, optimized_for_ygcs_rate, float(adj_ng_size) / 1024.0 / 1024.0, float(curr_ng_size) / 1024.0 / 1024.0)) if new_adj_ng_size < curr_ng_size: messages.append( "- Because we're decreasing the size of NewGen, it can have an impact on system load due to increased memory management requirements. There's not an easy way to predict the impact to the application, so watch this after it's tuned.") elif ygc_mean_ms > ygc_time_goal_ms: adj_ng_size = curr_ng_size * (ygc_time_goal_ms / ygc_mean_ms) ###################################################################### # Figure out Tenuring Threshold & size for the survivor spaces, basing # it on the last age where below 10% still live try: new_adj_ng_size, survivor_ratio, max_tenuring_size, max_tenuring_age = _get_survivor_info(death_ages, survivor_info, gc_data, survivor_problem_pct, curr_ng_size, adj_ng_size) # Go ahead and set it regardless adj_ng_size = new_adj_ng_size except ValueError as msg: display.render("\n" + "\n".join(textwrap.wrap("* Error: {0}".format(msg), display.textwrap_offset)) + "\n\n") display.render("") return False messages.append( "- With a mean YGC time goal of {0:0.0f}ms, the suggested (optimized for YGC time) size of NewGen (including adjusting for calculated max tenuring size) considering the above criteria should be {1:0.0f} MiB (currently: {2:0.0f} MiB).".format( ygc_time_goal_ms, float(adj_ng_size) / 1024.0 / 1024.0, float(curr_ng_size) / 1024.0 / 1024.0)) if new_adj_ng_size < curr_ng_size: messages.append( "- Because we're decreasing the size of NewGen, it can have an impact on system load due to increased memory management requirements. There's not an easy way to predict the impact to the application, so watch this after it's tuned.") else: adj_ng_size = curr_ng_size ###################################################################### # Figure out Tenuring Threshold & size for the survivor spaces, basing # it on the last age where below 10% still alive try: new_adj_ng_size, survivor_ratio, max_tenuring_size, max_tenuring_age = _get_survivor_info(death_ages, survivor_info, gc_data, survivor_problem_pct, curr_ng_size, adj_ng_size) # Go ahead and set it regardless adj_ng_size = new_adj_ng_size except ValueError as msg: display.render("\n" + "\n".join(textwrap.wrap("* Error: {0}".format(msg), display.textwrap_offset)) + "\n\n") display.render("") return False messages.append("- The mean YGC rate is {0:0.2f}/min, and the mean YGC time is {1:0.0f}ms (stdev of {2:0.2f} which is {3}).".format(ygc_rate, ygc_mean_ms, ygc_stdev, comment)) for message in messages: display.render("\n".join(textwrap.wrap(message)) + "\n") ################################################# # Find the recommended PermGen size # # Removing this block b/c permgen/metaspace usage isn't in the gc.logs # ############################################ # Find out what the survivor ratio should be display.render("\n".join( textwrap.wrap("- Looking at the worst (max) survivor percentages for all the ages, it looks like a TenuringThreshold of {0:0.0f} is ideal.".format(max_tenuring_age), display.textwrap_offset)) + "\n") display.render("\n".join(textwrap.wrap( "- The survivor size should be 2x the max size for tenuring threshold of {0:0.0f} given above. Given this, the survivor size of {1:0.0f}M is ideal.".format(max_tenuring_age, max_tenuring_size / 1024 / 1024), display.textwrap_offset)) + "\n") display.render("\n".join(textwrap.wrap("- To ensure enough survivor space is allocated, a survivor ratio of {0:0.0f} should be used.".format(survivor_ratio), display.textwrap_offset)) + "\n") ################################################# # Find the recommended max heap size if len(full_gc_times) < fgc_count_goal: display.render("\n" + "\n".join(textwrap.wrap( "* Error: You really need to have at least {0} (preferably more) FGCs happen (I found {1}) before doing any OG size recommendation analysis. Stopping any further analysis.\n".format( fgc_count_goal, len(full_gc_times)), display.textwrap_offset)) + "\n\n") display.render("\n") return False recommended_max_heap_size = 3.5 * float(live_data_size_bytes) + float(max_tenuring_size + adj_ng_size) if max_heap_size != recommended_max_heap_size: display.render("\n".join(textwrap.wrap( "- It's recommended to have the max heap size 3-4x the size of the live data size (OldGen + PermGen), and adjusted to include the recommended survivor and newgen size. New recommended size is {0:0.0f}MiB (currently: {1:0.0f}MiB).".format( float(recommended_max_heap_size) / 1024.0 / 1024.0, float(max_heap_size) / 1024.0 / 1024.0), display.textwrap_offset)) + "\n") ################################################# # Figure out the occupancy fraction max_cms_time = float(_max(cms_times)) # Not doing the MAX, but a max of a percentile of the og rates- I think that's better # maybe doing a mean of a percentile? pct_number = 99 # KiB -> B max_og_rate = float(_max(percentile(og_rates, pct_number))) * 1024 oldgen_offset = curr_og_size - (float(_max(yg_alloc_rates) / 1024) * max_cms_time) - (max_cms_time * max_og_rate) occ_fraction = math.floor((float(oldgen_offset) / curr_og_size) * 100) display.render("\n".join(textwrap.wrap( "- With a max {0} percentile OG promotion rate of {1}/s, and the max CMS sweep time of {2}s, you should not have a occupancy fraction any higher than {3:0.0f}.".format(ord_num(pct_number), reduce_k(Decimal(str( max_og_rate / 1024.0))), max_cms_time, occ_fraction), display.textwrap_offset)) + "\n") # Java 7 G1 Stuff display.render("\n") display.render("Java G1 Settings:\n") display.render("~~~~~~~~~~~~~~~~~~~\n") if ready_for_g1: display.render("\n".join(textwrap.wrap( "- With a max ygc stdev of {0:0.2f}, and a {1} percentile ygc mean ms of {2:0.0f}ms, your config is good enough to move to the G1 garbage collector.".format(ygc_stdev, ord_num(pct_number), ygc_mean_ms), display.textwrap_offset)) + "\n") display.render("\n".join(textwrap.wrap("- Since G1 uses one space for everything, the consolidated heap size should be {0:0.0f}MiB.".format(float(recommended_max_heap_size) / 1024.0 / 1024.0), display.textwrap_offset)) + "\n") else: display.render("\n".join(textwrap.wrap( "- With a max ygc stdev of {0:0.2f}, and a {1} percentile ygc mean ms of {2:0.0f}ms, your config is probably not ready to move to the G1 garbage collector. Try tuning the JVM, and see if that improves things first.".format( ygc_stdev, ord_num(pct_number), ygc_mean_ms), display.textwrap_offset)) + "\n") display.render("\n") display.render("The JVM arguments from the above recommendations:\n") display.render("~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n") display.render("\n".join(textwrap.wrap("-Xmx{0:0.0f}m -Xms{0:0.0f}m -Xmn{1:0.0f}m -XX:SurvivorRatio={2:0.0f} -XX:MaxTenuringThreshold={3:0.0f} -XX:CMSInitiatingOccupancyFraction={4:0.0f}".format(recommended_max_heap_size / 1024.0 / 1024.0, float(adj_ng_size) / 1024.0 / 1024.0, survivor_ratio, max_tenuring_age, occ_fraction), display.textwrap_offset)) + "\n") if ready_for_g1: display.render("\n") display.render("The JVM arguments for G1:\n") display.render("~~~~~~~~~~~~~~~~~~~~~~~~~\n") display.render("\n".join(textwrap.wrap("-XX:+UseG1GC -XX:MaxGCPauseMillis={0:0.0f} -Xms{1:0.0f}m -Xmx{1:0.0f}m ".format(ygc_mean_ms, recommended_max_heap_size / 1024.0 / 1024.0), display.textwrap_offset)) + "\n") def get_proc_info(pid=None): """Return a data structure with details of the given process id Keyword arguments: pid -- the process id of the process to be checked """ details = dict() try: cpu_ticks_per_sec = int(os.sysconf(os.sysconf_names['SC_CLK_TCK'])) bytes_per_page = resource.getpagesize() details['gc_file_rotation'] = False for line in liverun("readlink /proc/{0}/cwd".format(pid)): line = line.decode() details['proc_cwd'] = line.strip() with open("/proc/{0}/cmdline".format(pid), "r") as _file: for blob in _file: for line in blob.split("\0"): if "-Xloggc" in line: gc_path = line.split(":", 1)[1] if gc_path.startswith("/"): details['gc_log_path'] = gc_path else: details['gc_log_path'] = details['proc_cwd'] + "/" + gc_path elif "/bin/java" in line: details['java_path'] = os.path.dirname(line) elif "-XX:+UseGCLogFileRotation" in line: details['gc_file_rotation'] = True elif "-Xms" in line: details['min_heap_size'] = line.split("ms")[1] elif "-Xmx" in line: details['max_heap_size'] = line.split("mx")[1] elif "-XX:+PrintGCDateStamps" in line: details['print_gc_date_stamps'] = True elif "-XX:+PrintGCDetails" in line: details['print_gc_details'] = True elif "-XX:+PrintTenuringDistribution" in line: details['print_tenuring_distribution'] = True elif "-XX:SurvivorRatio=" in line: details['survivor_ratio'] = line.split("SurvivorRatio=")[1] elif "-XX:+UseConcMarkSweepGC" in line: details['use_cms'] = True elif "-XX:+UseParNewGC" in line: details['use_parnew'] = True if 'java_path' not in details: details['java_path'] = ''.join(liverun("which java")).strip().replace("/java", "") with open("/proc/uptime", "r") as _file: for line in _file: details['sys_uptime_seconds'] = Decimal(line.split()[0]) break with open("/proc/{0}/stat".format(pid), "r") as _file: for line in _file: field = line.split() utime_ticks = int(field[13]) stime_ticks = int(field[14]) num_threads = int(field[19]) uptime_ticks = int(field[21]) vsize_bytes = int(field[22]) rss_bytes = int(field[23]) * bytes_per_page details['proc_uptime_seconds'] = (details['sys_uptime_seconds']) - Decimal(str(uptime_ticks / float(cpu_ticks_per_sec))) details['proc_utime_seconds'] = utime_ticks / Decimal(cpu_ticks_per_sec) details['proc_stime_seconds'] = stime_ticks / Decimal(cpu_ticks_per_sec) details['proc_rss_bytes'] = rss_bytes details['proc_vsize_bytes'] = vsize_bytes details['num_threads'] = num_threads break for line in liverun("{0}/java -version".format(details['java_path'])): line = line.decode() if "java version" in line: line = line.strip().replace("\"", "") fields = line.split() details['java_build_version'] = fields[-1] match = re.match(r"^(\d+)\.(\d+)\.(\d+)", details['java_build_version']) details['java_ver_int'] = match.group(2) break except IOError: # The data structure will be empty, and I'll catch it when # I get a key error on accessing it pass return details def process_gclog(log_file=None, log_file_pos=0): """Pretty basic function that iterates through a gc log, and returns a data structure of the log data. Keyword arguments: log_file -- the gc log file to be read log_file_pos -- the offset of the log file from whence to start (as bytes) """ gc_log_queue = list() try: line_num = 0 print() print("* Reading gc.log file...", end=" ") current_size = os.stat(log_file).st_size if current_size < log_file_pos: print("log file was truncated/rotated; reading from the start", end=" ") log_file_pos = 0 start_time = datetime.datetime.now() with open(log_file, "r") as _file: _file.seek(log_file_pos) for line in _file: gc_log_queue.append(line) line_num += 1 elapsed_time = sec_diff(start_time, datetime.datetime.now()) print("done. Scanned {0} lines in {1:0.4f} seconds.".format(line_num, elapsed_time)) except IOError: # I don't want/need to check the exception. If it fails, it fails. pass else: gc_log_queue.append("END_OF_FILE") return gc_log_queue def _run_jmap(pid=None, procdetails=None): """Rung jmap for the given process id, and java path, returning a data structure with the information""" jmap_data = dict() java_path = procdetails['java_path'] try: for line in liverun("{0}/jmap -J-Xmx128M -heap {1}".format(java_path, pid)): line = line.decode() field = line.split() if "MinHeapFreeRatio" in line: jmap_data['MinHeapFreeRatio'] = int(field[2]) elif "MaxHeapFreeRatio" in line: jmap_data['MaxHeapFreeRatio'] = int(field[2]) elif "MaxHeapSize" in line: jmap_data['MaxHeapSize'] = int(field[2]) elif "NewSize" in line: jmap_data['NewSize'] = int(field[2]) elif "MaxNewSize" in line: jmap_data['MaxNewSize'] = int(field[2]) elif "OldSize" in line: # JMap seems to be scaled wrong. Comparing it to jstat, it shows that # it's off by about 1000 (1024). There's a bug in Java6 where this is in KB # not bytes like the others. Appears to be fixed in Java8 (maybe Java7, too) java_int = int(procdetails['java_ver_int']) if java_int < 8: jmap_data['OldSize'] = int(field[2]) * 1024 else: jmap_data['OldSize'] = int(field[2]) elif "NewRatio" in line: jmap_data['NewRatio'] = int(field[2]) elif "SurvivorRatio" in line: jmap_data['SurvivorRatio'] = int(field[2]) elif "PermSize" in line: jmap_data['PermSize'] = int(field[2]) elif "MaxPermSize" in line: jmap_data['MaxPermSize'] = int(field[2]) elif "MaxMetaspaceSize" in line: if "MB" in line: jmap_data['MaxMetaspaceSize'] = int(field[2]) * 1024 * 1024 else: jmap_data['MaxMetaspaceSize'] = int(field[2]) elif "MetaspaceSize" in line: jmap_data['MetaspaceSize'] = int(field[2]) except (IOError, KeyboardInterrupt): pass return jmap_data def run_jstat(pid=None, java_path=None, no_jstat_output=None, fgc_stop_count=None, max_count=None, ygc_stop_count=None): """Rung jstat, and outputs the data in a nice column and aligned layout. Keyword arguments: pid -- the process pid to run jstat against java_path -- the path to use to run jstat no_jstat_output -- true/false that tells this function to not output any data fgc_stop_count -- the integer value that tells this function to stop at this number of full (cms) gcs max_count -- the max number of lines the function should display ygc_stop_count -- the integer value that tells this function to stop at this number of young gcs """ global subproc jstat_data = dict() jstat_data['TIME_STAMP'] = list() # This is how the columns will be displayed in order. ordered_fields = ["EC", "EP", "EU", "S0C/S1C", "S0C", "S1C", "S0U", "S1U", "OC", "OP", "OU", "MC", "MU", "PC", "PU", "YGC", "YGCD", "FGC", "FGCD"] displayed_output = False combined_survivors = False field_map = dict() line_num = 0 field_widths = dict() first_fgc_ct = None prev_fgc_ct = None last_fgc_ct = None total_fgcs = None total_ygcs = None short_fields = True # Being able to use python3's print function that I could override would # work much better here; instead I have to do this ghetto way... display.render("#" * 5 + "\n") display.render("# Start Time: {0} GMT\n".format(datetime.datetime.now())) display.render("# Host: {0}\n".format(socket.getfqdn())) display.render("#" * 5 + "\n") if max_count > 0: cmd = "{0}/jstat -J-Xmx128M -gc {1} 1000 {2}".format(java_path, pid, max_count) else: cmd = "{0}/jstat -J-Xmx128M -gc {1} 1000".format(java_path, pid) try: for line in liverun(cmd): line = line.decode() timestamp = datetime.datetime.now() line = line.strip() ####################################################################### # Print the header, and first two lines should be printed. After that, # the logic block at the end (to see if there's been a fgc or not) # takes over, and prints the line conditionally with decoration field_num = 0 for field in line.split(): if line_num == 0: jstat_data[field] = list() field_map[field_num] = field else: field_name = field_map[field_num] if field_name in ['YGCT', 'FGCT', 'GCT']: jstat_data[field_name].append(Decimal(field)) else: # Minding sigfigs- no decimal needed for large numbers; that's # just silly jstat_data[field_name].append(Decimal("{0:0.0f}".format(Decimal(field)))) field_num += 1 if jstat_data['OC'] and jstat_data['OU']: # Better to handle the percentage-awareness here instead # of making a unique conditional later on if "OP" not in jstat_data: jstat_data['OP'] = list() jstat_data['OP'].append("{0:0.1%}".format(jstat_data['OU'][-1] / jstat_data['OC'][-1])) if jstat_data['EC'] and jstat_data['EU']: # Better to handle the percentage-awareness here instead # of making a unique conditional later on if "EP" not in jstat_data: jstat_data['EP'] = list() jstat_data['EP'].append("{0:0.1%}".format(jstat_data['EU'][-1] / jstat_data['EC'][-1])) if jstat_data['GCT']: if "YGCD" not in jstat_data: jstat_data['YGCD'] = list() if "FGCD" not in jstat_data: jstat_data['FGCD'] = list() # Young gc count delta try: if jstat_data['YGC'][-1] > jstat_data['YGC'][-2]: delta = "+" + str(jstat_data['YGC'][-1] - jstat_data['YGC'][-2]) else: delta = "-" except IndexError: delta = "-" jstat_data['YGCD'].append(delta) # full gc count delta try: if jstat_data['FGC'][-1] > jstat_data['FGC'][-2]: delta = "+" + str(jstat_data['FGC'][-1] - jstat_data['FGC'][-2]) else: delta = "-" except IndexError: delta = "-" jstat_data['FGCD'].append(delta) ################################## # I need at least two lines to get # historical data if line_num >= 2: # Keep a timestamp for each record (to get sub-second granularity) first_fgc_ct = jstat_data['FGC'][0] first_ygc_ct = jstat_data['YGC'][0] prev_fgc_ct = jstat_data['FGC'][-2] last_fgc_ct = jstat_data['FGC'][-1] last_ygc_ct = jstat_data['YGC'][-1] total_fgcs = last_fgc_ct - first_fgc_ct total_ygcs = last_ygc_ct - first_ygc_ct ############################################# # line 1 is actual data, 0 is just the header if line_num > 0: jstat_data['TIME_STAMP'].append(timestamp) #################################################### # See if I can combine the S0C/S1C fields (probably) if jstat_data['S0C'][-1] == jstat_data['S1C'][-1]: if "S0C/S1C" not in jstat_data: jstat_data['S0C/S1C'] = list() jstat_data['S0C/S1C'].append(jstat_data['S0C'][-1]) combined_survivors = True else: # This is redundant as I catch it earlier. Leaving it here for now. logger.error("Looks like you're not running with the CMS garbage collector. You can enable this option by setting your JVM arguments to use '-XX:+UseConcMarkSweepGC'.") sys.exit(1) if not field_widths: field_widths = _get_widths(jstat_data, short_fields) if not displayed_output: displayed_output = True ############################################# # Don't display any output, just continue to # the next iteration. Ick, double-negative.. if no_jstat_output: continue # Print the column header display.render(" ", keep_newline=False) for field in ordered_fields: if combined_survivors and field != "S0C" and field != "S1C": if field in field_widths: width = field_widths[field] display.render("{0:>{1}}".format(field, width + 1), keep_newline=False) display.render("\n") # Print a nice line spacer all even-like display.render(" ", keep_newline=False) for field in ordered_fields: if combined_survivors and field != "S0C" and field != "S1C": if field in field_widths: width = field_widths[field] display.render("{0:>{1}}".format("~" * width, width + 1), keep_newline=False) display.render("\n") # Print the first row of data that was cached so it can # be used to determine field widths display.render(" ", keep_newline=False) for field in ordered_fields: if field in field_widths: width = field_widths[field] # Get the last value if combined_survivors and field != "S0C" and field != "S1C": value = jstat_data[field][0] if short_fields and field not in ['EP', 'OP', 'YGC', 'YGCT', 'FGC', 'FGCT', 'GCT', 'FGCD', 'YGCD']: value = reduce_k(value, precision=1) display.render("{0:>{1}}".format(value, width + 1), keep_newline=False) display.render("\n") else: ################################# # Don't display any output, just # continue to the next iteration. if no_jstat_output: if last_fgc_ct > prev_fgc_ct: display.render("* ", keep_newline=False) else: display.render(" ", keep_newline=False) # Now print the actual numbers for field in ordered_fields: if field in field_widths: width = field_widths[field] # Get the last value if combined_survivors and field != "S0C" and field != "S1C": value = jstat_data[field][-1] if short_fields and field not in ['EP', 'OP', 'YGC', 'YGCT', 'FGC', 'FGCT', 'GCT', 'FGCD', 'YGCD']: value = reduce_k(value, precision=1) display.render("{0:>{1}}".format(value, width + 1), keep_newline=False) display.render("\n") else: if last_fgc_ct > prev_fgc_ct: display.render("* ", keep_newline=False) else: display.render(" ", keep_newline=False) # Now print the actual numbers for field in ordered_fields: if field in field_widths: width = field_widths[field] # Get the last value if combined_survivors and field != "S0C" and field != "S1C": value = jstat_data[field][-1] if short_fields and field not in ['EP', 'OP', 'YGC', 'YGCT', 'FGC', 'FGCT', 'GCT', 'FGCD', 'YGCD']: value = reduce_k(value, precision=1) display.render("{0:>{1}}".format(value, width + 1), keep_newline=False) display.render("\n") if 0 < fgc_stop_count <= total_fgcs: break if 0 < ygc_stop_count <= total_ygcs: break line_num += 1 except (IOError, KeyboardInterrupt): # This triggers if I exit the 'liverun' pass finally: if subproc and subproc.poll() is None: # The process hasn't terminated subproc.terminate() return jstat_data def _get_widths(jstat_data=None, short_fields=False): """Function that returns the recommended field widths of the jstat output""" widths = dict() for field in jstat_data: max_width = max(list(map(len, list(map(str, jstat_data[field]))))) field_width = len(field) if field_width > max_width: widths[field] = field_width else: widths[field] = max_width ################################################################## # Special handling for survivor spaces (S0C, S1C, S0U, S1U) should # all be the same width, and b/c S{01}U alternate, it's better to # set the width from S{01}C if short_fields: # The '5' accounts for 'x.xxN' (3.23K/M/G), etc. survivor_max = 6 newgen_max = 6 oldgen_max = 6 else: survivor_max = max(widths['S0C'], widths['S1C'], widths['S0U'], widths['S1U']) newgen_max = max(widths['EC'], widths['EU']) oldgen_max = max(widths['OC'], widths['OU']) widths['OC'] = oldgen_max widths['OU'] = oldgen_max widths['EC'] = newgen_max widths['EU'] = newgen_max widths['S0C'] = survivor_max widths['S1C'] = survivor_max widths['S0U'] = survivor_max widths['S1U'] = survivor_max widths['EP'] = 6 widths['OP'] = 6 return widths def _at_exit(raw_gc_log=None, jmap_data=None, jstat_data=None, proc_details=None, optimized_for_ygcs_rate=None): """The exit function that is called when the user presses ctrl-c, or when it exits after X number of jstat iterations. It calls various functions to display useful information to the end-user.""" gc_data = list() in_stanza = False date_time = None entry = list() # I don't know if I like this, but I wouldn't get to # this point unless I asked for GC data from stdin... if not raw_gc_log: raw_gc_log = sys.stdin for line in raw_gc_log: ############################################################################# # Since I'm using the timestamp as the record stanza delimiter, I may as well # convert it to a datetime object here instead of doing it later. match = re.match(r"^(\d+)-(\d+)-(\d+)T(\d+):(\d+):([\d\.]+)[+-]\d+: ([\d\.]+):", line) if match: in_stanza = True # If I'm at the start of a new block, save the previous block if date_time and entry: gc_record = GCRecord((date_time, entry)) if gc_data: prev_gc_record = gc_data[-1] if gc_record.jvm_running_time and prev_gc_record.jvm_running_time > gc_record.jvm_running_time: logger.warning("The JVM restarted at {0}. Re-initing the internal datastructures.".format(gc_record.record_timestamp)) gc_data = list() if gc_record.valid_record: gc_data.append(gc_record) entry = list() year = int(match.group(1)) month = int(match.group(2)) day = int(match.group(3)) hour = int(match.group(4)) minute = int(match.group(5)) second = Decimal(match.group(6)) # up_time = Decimal(match.group(7)) date_time = datetime.datetime.strptime("{0}-{1}-{2} {3}:{4}:{5}".format(year, month, day, hour, minute, second), "%Y-%m-%d %H:%M:%S.%f") if in_stanza: entry.append(line) _run_analysis(gc_data, jmap_data, jstat_data, proc_details, optimized_for_ygcs_rate) def get_rotated_log_file(gc_log_file): """Function will scan existing log files to determine latest rotated log, if none found will return non rotated file name. """ log_number = 0 while os.path.isfile("{0}.{1}".format(gc_log_file, log_number)): log_number += 1 if log_number: gc_log_file = "{0}.{1}".format(gc_log_file, (log_number - 1)) else: logger.debug("\n".join( textwrap.wrap( "Was not able to find a rotated GC log for this process, defaulting to gc log from process.", display.textwrap_offset))) return gc_log_file def get_gc_log_file(procdetails): gc_log_file = procdetails['gc_log_path'] if not gc_log_file: logger.error("\n".join( textwrap.wrap( "I was not able to find a GC log for this process. Is the instance up?", display.textwrap_offset))) sys.exit(1) if procdetails['gc_file_rotation']: return get_rotated_log_file(gc_log_file) else: return gc_log_file def get_jmap_data(pid=None, procdetails=None): """Function that runs jmap, only needed b/c jmap may not start, and this retries on failure.""" jmap_data = None for seconds in [x * 2 for x in range(1, 8)]: jmap_data = _run_jmap(pid, procdetails) if "NewSize" in jmap_data: break else: logger.warning("Couldn't connect to jvm via jmap to get valid data. Sleeping {0:0.0f} seconds, and trying again.".format(seconds)) time.sleep(seconds) return jmap_data ################################################################ # Main user = os.environ.get("SUDO_USER", None) if not user: user = getpass.getuser() subproc = None display = Display() def main(): parser = argparse.ArgumentParser(description="Analytics tool for tuning and analyzing GC behavior.") parser.add_argument('-o', '--optimize', help='Optimize for latency or throughput (range 0-11, 0 = ygc @ 180/min, 11 = ygc @ 1/min). Floats allowed.', type=Decimal, required=False, default=9) parser.add_argument('-s', '--fgc-stop-count', help='How many full gcs should happen before I stop (very important for analytics)', type=int, default=0) parser.add_argument('-y', '--ygc-stop-count', help='How many young gcs should happen before I stop', type=int, default=0) parser.add_argument('-c', '--stop-count', help='How many iterations of jstat to run before stopping', type=int, default=0) parser.add_argument('-n', '--no-jstat-output', help='Do not show jstat output - only print summary', action="store_true") if DEBUG: group = parser.add_mutually_exclusive_group(required=False) else: group = parser.add_mutually_exclusive_group(required=True) group.add_argument('-p', '--pid', help='Which java PID should I attach to', type=int) group.add_argument('--gc-stdin', help='Read GC log data from stdin', action="store_true") cmd_args = parser.parse_args() raw_gc_log_data = list() jmap_data = list() jstat_data = list() proc_details = list() if not (cmd_args.pid or cmd_args.gc_stdin): logger.error("Please specify -p (pid) or --gc-stdin") sys.exit(1) # A ygc of 180/min (3/sec) ygc_upper_rate_per_min = 180 # Validate the optimize range if 0 <= cmd_args.optimize <= 11: # You won't have to change this function if you want # to change the ygc upper/lower bounds later on # # Convert from rate/min to rate/sec optimized_for_ygcs_rate = ((-Decimal(ygc_upper_rate_per_min - 1) / 11) * Decimal(str(cmd_args.optimize)) + ygc_upper_rate_per_min) else: logger.error("The optimize range must be between 0 and 11.") sys.exit(1) ###################################################################### # This should be done w/ argparse, but I haven't dedicated enough time # to figure it out if cmd_args.no_jstat_output and not (cmd_args.ygc_stop_count or cmd_args.stop_count or cmd_args.fgc_stop_count): logger.error("You must specify -s, -y, or -c arguments for this option to work.") sys.exit(1) if not cmd_args.gc_stdin: try: config_error = False proc_details = get_proc_info(cmd_args.pid) java_path = proc_details['java_path'] if proc_details.get("min_heap_size", 0) != proc_details.get("max_heap_size", 1): config_error = True logger.error( "It looks like either you didn't specify your min and max heap size (-Xms & -Xmx respectively), or they are set to two different sizes. They need to be set to the same for jtune.py to work properly.") if not proc_details.get("print_gc_date_stamps", False): config_error = True logger.error("You need to include the '-XX:PrintGCDateStamps' option to the JVM for JTune to work correctly.") if not proc_details.get("print_gc_details", False): config_error = True logger.error("You need to include the '-XX:PrintGCDetails' option to the JVM for JTune to work correctly.") if not proc_details.get("print_tenuring_distribution", False): config_error = True logger.error("You need to include the '-XX:+PrintTenuringDistribution' option to the JVM for JTune to work correctly.") if not proc_details.get("survivor_ratio", False): logger.warning("You probably want to include the '-XX:SurvivorRatio=<num>' option to the JVM for JTune to work correctly.") if not proc_details.get("use_cms", False): config_error = True logger.error("You need to include the '-XX:+UseConcMarkSweepGC' option to the JVM for JTune to work correctly.") if not proc_details.get("use_parnew", False): config_error = True logger.error("You need to include the '-XX:+UseParNewGC' option to the JVM for JTune to work correctly.") if config_error: logger.error("Exiting.") sys.exit(1) except (TypeError, KeyError): logger.error("I was not able to get the process data for pid {0}".format(cmd_args.pid)) sys.exit(1) ########################################### # Start the gc log watching in a subprocess gc_log_file = get_gc_log_file(proc_details) if not gc_log_file: logger.error("\n".join(textwrap.wrap("I was not able to find a GC log for this process. Is the instance up?", display.textwrap_offset))) sys.exit(1) #################################################### # Get the file offset before starting jstat, so # I can use it after jstat runs to read the log file gc_log_file_pos = os.stat(gc_log_file).st_size jmap_data = get_jmap_data(cmd_args.pid, proc_details) if cmd_args.no_jstat_output: jstat_data = dict() else: jstat_data = run_jstat(cmd_args.pid, java_path, cmd_args.no_jstat_output, cmd_args.fgc_stop_count, cmd_args.stop_count, cmd_args.ygc_stop_count) # This basically hits after the user ctrl-c's raw_gc_log_data = process_gclog(gc_log_file, gc_log_file_pos) atexit.register(_at_exit, raw_gc_log_data, jmap_data, jstat_data, proc_details, optimized_for_ygcs_rate) if __name__ == '__main__': main()
nilq/baby-python
python
import os base_dir = os.getcwd() project_name = '{{cookiecutter.project_name}}' project_path = f'{project_name}' # https://github.com/cookiecutter/cookiecutter/issues/955 for root, dirs, files in os.walk(base_dir): for filename in files: # read file content with open(os.path.join(root, filename)) as f: content = f.read() # replace tag by install path content = content.replace('replace_me.base_dir', base_dir) # replace file content with open(os.path.join(root, filename), 'w') as f: f.write(content) print(f'\033[0;32mSuccessfully generated {project_path}\033[0m') print('\033[0;33mTo make the utility functions available in your shell, source utils.sh. e.g.\033[0m') print(f'\techo "source {project_path}/utils.sh" >> ~/.bashrc') print() print('\033[0;33mTo setup git hooks run the following:\033[0m') print(f'\tln -s {project_path}/githooks/commit-msg {project_name}/.git/hooks/commit-msg')
nilq/baby-python
python
import unittest from parameterized import parameterized as p from solns.combinationSum3.combinationSum3 import * class UnitTest_CombinationSum3(unittest.TestCase): @p.expand([ [] ]) def test_naive(self): pass
nilq/baby-python
python
import pymongo class Database(object): # Database class inherits all attributes from object class URI = "mongodb://127.0.0.1:27017" # class attributes which defines a value for every class instance DATABASE = None @staticmethod def initialize(): # method that creates path to desired mongodb database client = pymongo.MongoClient(Database.URI) Database.DATABASE = client['tooldraft'] @staticmethod def insert(collection, data): Database.DATABASE[collection].insert(data) @staticmethod def find(collection, query): return Database.DATABASE[collection].find(query) @staticmethod def find_one(collection, query): return Database.DATABASE[collection].find_one(query)
nilq/baby-python
python
from talon import Context, actions ctx = Context() ctx.matches = r""" app: mintty """ ctx.tags = ['terminal', 'user.file_manager', 'user.generic_terminal', 'user.git', 'user.kubectl'] @ctx.action_class('user') class UserActions: def file_manager_open_parent(): actions.insert('cd ..') actions.key('enter') @ctx.action_class('edit') class EditActions: def paste(): actions.key('shift-insert') def copy(): actions.key('ctrl-insert') def delete_line(): actions.key('ctrl-u')
nilq/baby-python
python