content
stringlengths
0
1.05M
origin
stringclasses
2 values
type
stringclasses
2 values
import argparse import cv2 from glob import glob from itertools import product import numpy as np import os from tqdm import tqdm from scipy.special import erf import torch import torch.nn as nn from model.model import CompModel import arithmetic_coding as ac MAX_N = 65536 TINY = 1e-10 def load_img(path): img = cv2.imread(path).astype(np.float32)[..., ::-1] img = ((img / 255.) - 0.5) * 2. img = torch.from_numpy(img.transpose((2, 0, 1))).unsqueeze(0) _, _, h, w = img.size() h_, w_ = h, w if h % 16 != 0: h_ = (h // 16 + 1) * 16 if w % 16 != 0: w_ = (w // 16 + 1) * 16 img_ = torch.zeros((1, 3, h_, w_)) img_[:, :, :h, :w] = img return img_, h_ - h, w_ - w def load_model(args): args.device = 'cpu' comp_model = CompModel(args) state_dict = torch.load(args.model_path, map_location='cpu') comp_model.load_state_dict(state_dict['comp_model']) comp_model.eval() return comp_model def compress(args): comp_model = load_model(args) os.makedirs('outputs/binary', exist_ok=True) if os.path.isdir(args.image_path): pathes = glob(os.path.join(args.image_path, '*')) else: pathes = [args.image_path] for path in pathes: bitpath = "outputs/binary/{}.pth".format(os.path.basename(path).split('.')[0]) img, pad_h, pad_w = load_img(path) _, _, H, W = img.size() with torch.no_grad(): y_hat, p = comp_model.compress(img) _, yC, yH, yW = y_hat.size() min_val = int(torch.max(torch.abs(y_hat))) p = p.detach().numpy() p = np.reshape(p, (1, args.gmm_K, args.bottleneck*3, yH, yW)) y_mu = p[:, :, :args.bottleneck, :, :] + min_val y_std = np.abs(p[:, :, args.bottleneck:2*args.bottleneck, :, :]) y_w = p[:, :, 2*args.bottleneck:, :, :] y_w = np.exp(y_w) / np.sum(np.exp(y_w), axis=1) #softmax # store side information fileobj = open(bitpath, mode='wb') img_size = np.array([W, H], dtype=np.uint16) img_size.tofile(fileobj) pad_size = np.array([pad_w, pad_h], dtype=np.uint8) pad_size.tofile(fileobj) min_value = np.array([min_val], dtype=np.uint8) min_value.tofile(fileobj) fileobj.close() print('=============================================================') print(os.path.basename(path)) with open(bitpath, 'ab+') as fout: bit_out = ac.CountingBitOutputStream( bit_out=ac.BitOutputStream(fout)) enc = ac.ArithmeticEncoder(bit_out) samples = np.arange(0, min_val*2+1).reshape(-1, 1) with tqdm(product(range(yH), range(yW)), ncols=60, total=yH*yW) as qbar: for h, w in qbar: for ch in range(yC): weight = y_w[:, :, ch, h, w] mean = y_mu[:, :, ch, h, w] std = y_std[:, :, ch, h, w] high = weight * 0.5 * (1 + erf((samples + 0.5 - mean) / ((std + TINY) * 2 ** 0.5))) low = weight * 0.5 * (1 + erf((samples - 0.5 - mean) / ((std + TINY) * 2 ** 0.5))) pmf = np.sum(high - low, axis=1) pmf_clip = np.clip(pmf, 1.0/MAX_N, 1.0) pmf_clip = np.round(pmf_clip / np.sum(pmf_clip) * MAX_N).astype(np.uint32) symbol = np.int(y_hat[0, ch, h, w].item() + min_val) freq = ac.SimpleFrequencyTable(pmf_clip) enc.write(freq, symbol) enc.finish() bit_out.close() real_bpp = os.path.getsize(bitpath) * 8 print('bitrate : {0:.4}bpp'.format(real_bpp / H / W)) print('=============================================================\n') if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument('model_path') parser.add_argument('image_path') parser.add_argument('--bottleneck', type=int, default=32) parser.add_argument('--main_channel', type=int, default=192) parser.add_argument('--gmm_K', type=int, default=3) args = parser.parse_args() compress(args)
nilq/baby-python
python
# This code is generated by [Atcoder_base64](https://github.com/kyomukyomupurin/AtCoder_base64) from base64 import b85decode import subprocess from pathlib import Path from zlib import decompress binary = "c%0=~Z){uD6~DIg$7xf?EiD9ERs&&bS7PF}DJfls?ZoXfIB96o(v?4#7u$)w`A=p)mxLi^skEwB(nV7@`hiJB>;pr5fN4VefV!Xz#-wcuQ>P)pq>fQ7>Bh)3sImd^&VBEm=l8DPqZ`_{-N-rb{N6d|-h1xfbKbWivAs@*gJ5xyuMoyP+@kS8j-T78ivZR`THybUWD{uuzQG_T(q)I4y7hWAy&k8=i*yq)Q-^^z68lnaHB&--x*lt5YK?}b*7!{HIbQFQ%dF?*dS$Lx=JH4h*F%c^Yv8{Tj*GOPm}vv2Lzk2Ud;V~h#)~vY%oO$R1-&NnpBFEu2Y7vUemTqAixkJ<_Dp(o*UsBBiOx(qSDNgc?Ag`1Yp1`M_itC*<mIya1`n$8%&q7u_I^Fb*!!i(*iFwXr(dqV``Wh19Vh2MKKc9!ChH-!aU-M)o*Pt*mBR7Z#tmm%`|SF64u0z_@E91p*#iHyjr?5>Yy52+`4?>PlQ#G@Hug6YoPp+Yzm2@tMt+YCK4H@yHd;4>mxuU#!{x9I>Rn6PNzkiV^WsE+c~Ddm@on4K*zY2gj%V{ZT2$nMLMfrqkpY@W7Lw!XqLM6(4D@C4x#WmEnn`N!tlu0Nyk}VHjw@3W$!I*%lgQIY(urg)5@)Z5m7a9INJr&ja%VJ`R{8^xqks=9fnAg;sY3n{c$c7Yxu_gf<?}lxN{XgyG#l7K2Q<4h4Q3)-xO*&9DyF!}Ofd>}1M!qxph`hbD@9O@8~|(w)Sr&id{HSR<!m%QLL<Z7bm$(-CiY<ycgFK2h50Ow?ut*!R92FcX@xUm>71NNKMG!;Opd!UE2nd0Uo0B#quc%4{oUI0;lp%?f2ThXFtUWLG#CFhz|X0VqZ8JUwhA5a*X^jyo6-&G7ABSD<LXdlYx{(}{FIZe+$pZ3Z2hjA**nSQalgR*FUaT5gn)PPb7fM%372<!%{cP&Z5nMNwS9z@w+wiT0l#R#R~hgH1HRgTFB$Mw1HNp)*BEeI2kb0rGvH^rd^4%-m8_gI;4TCHoB?kz;4d0*<9YW}18&^!XAO9>0e{1QyA8N>?5}R=RO6*)ACZpFD$eS>bnNHuIa2K|093tIf&XorgYd-o6jNEeScP)y*BH;bwm7fyql{-mvN)^qM;On#xcH*VA7DJ|+TuBtznk%_ON%oqA7(u3%3@jN?*x8q2HP1Lk*2%%fO%=UcLv@ZWDQ^VJ_t&c*Q8TKIu%@qo%&(p637l5e@{6aDnHiILlj@A?Yz>_CsjUJ*sTixVj;vRbTTmeVCaFlSmn<P6p-kthK}=WhDg&J*k%s~yQJOo%4;eJQq}pk^Gknuc_9qKV>7DXrhBh-`^Z9&89dedQWN+P?1F)p+2eHgGBkAY-4!Muct2Ws^C7A7u5|3ZrJ<47bmI|L$@H2(sa5uFVtw9l2=qQ|+uW~0Q>u~10wcSZl?^aV{w8ghTB;Y@HkX-S<~RlUs8(s1k*zCIWl4JVZ+A(rF1sYh>(ZMm%6c%+$PKuw7su3kP`}(8g~pQ7?cmtn^NsK*RW2#5(5=hBEM%b*3n^&g>y0;ooa4bcq5j2hGPn5KHb0>b*Gy$;uEw=(CZYR6hoY6=hYp6I@3&rYvJsr_Tmd>9s(c!)T#0SHr26#LPhAV+pMpb=zpwZLZ=;D=<zKPNmHx^Hq3Zf~q+@dqY4;yWmzlfohfxeY7<wo~=VoeE{$q~MZFM$l`<Rr>Wb(K9?#mZ4iJKU<(X~h7>tPdAc?RgyKwkm+0?-AZUxtpahmpzvO#uG@bn^nx4A9#Ee+Q`I(C#s;I37Jf9Ftzh#@1%{jHB7haP{sA`r8ca&RU+34lZB*q*_%S>+$aOwBOyf`Vn`T+;zjAFYV~K8THwn@hy-uu4lF<Kfv^%KHOin5bd0Q1!PY%Anfrz>D=#WKjG^4_#R*7Y47uR!yb2NwPyEe`1zp!ekR-R@!scgt9AVZem!6}$!&bc8TPcFc11kC>4vap%ae_gr|U$M<moxqJm3iyJUt;#SIDy^?D2tISgk^B-zV^U80;AL@Bf#A=OLbdcqkd;8YAuI4|o<W^GzMkpbK38dd}ndi(wj`+c$8E=PkxlICnl;spc8Q`#qjDL4FwF88hoNHJhB_?ZY#)ozo4(TyQRy`8kAR{~V{d9`MY%j?<xLGcGlm+wJD{qdT$wFA%fb$5pL=4i2qwewlZ)%6V+p66Y`Q_y6R)@ofHI7Cnv>$`^SDc5%9w(?gt&ae9=~6UNQpa}>O1?d$8i)3@c|Xep<Ze1R_i4u4l?pro>a#{)h7uAPquw(=KOv*`k__gE};b}t>V#9c(O#2fVaX~rA%d1=O*^!aPXoAq%u<8FOEnDG{U-kI@L`usHGtMzqi##@QkVtib%nrAF=4>@Ovx9RKNjC;vNOMI=KH!$PtNN}|kevQ75nDO=c{$a*9Sk7M;xmI8AW*k<x*9x!2m1g|<I*cv*2J-i+h_ijb34X)<)z9%8Rh@Qn?^>U(&&q8!cJAPIW?IbnZjR3ic#Pvj@bf6IcSxu=r#{#F^LyM*P_XliDqlY?cI}^4<=2tNTE#ck^1o64*Uytbs&?wf_p<u`n!5IX%yF@u9tX2iKOZ`5@)*5pe0d%53iIJfCyP_-=TE<ym#EEuT=v5@c^-C7tTU{y(;Uw;JI?F$eGtoIHtk$-GQ560KIO2^pZwUy&WuxQ59V9(uJ|h(`QNJY_4~|Pr`CSaZ#O!v?F`!BMW=P1=i5$gTtxq0VKN|pc&!<K%BkUEd!Dta_YL#|_gj+VZ#k{=S08fuc`mQ#7G2i%Z*f`M*=~c!Z0r!0i1Ekcgzk&&4~Jru7E7Zvs^w=`h9}lTX*$mmN+e!Tib`p0%pWJU6c|;qG|p08MM7yJPscO)Q8_~sO1@B}a%qyp^Vx|^Qb{J@fVGrh8KN|m3k7+KCUZ(*ii{QHY?3BQ+3Xak7&tYtWfG-y?}5-jghmGYS$dA{8$3uO5(lOJ1BCW}bucs#?SpqF<%Ahfvr@Vf_V3+092ub_p>QlhjXAeq(3qH_$%L%Pghuy+ej=TtrD8H6q`kNX&vJnSig}una|taiSWC|dmOmq7Xh^XM#y?+zPpFxW4D_KpuaaOiX|k-HP1aKE8_yex6*FhzK+w@*5udH|kD|7kT#Oe>YTG_LQCpK`Q?EWTDUMlv3fL~qYn972H<b8`Q&~kG1*#M@n!=}a4oprEe=e^i{h@HQQ<29xH=Zl`M@#8UqBET!DwmRrDdJB|<-ndsm4f!>XtGdD=W`~8!n;B;BQrt%G?7tQmEbJ)=pWC+1I#M;uX@E_$g8v4pG@&3m`W6CoTjR+9!&$Ep$0jdj>Chh4g*R2unA;g!CGxV|6O76Alt%mf3*9~hQ%T9w-7A`Lw)f(mQRouuiXJbAMf`_JFcS7@())a219-Ed(;+=<Mmy<HV+alMn!#$7m${DhuJmXVbI5T@(?k9yTZ5v=^4RcqW>NuT8xSM7=Ix33GEj?Cz7udEoMa?;}oPrq}F~Xsqg=zMDr=?V?3kB(++d}V*j7u`eDvv+=CS3c&2}?g+9Aq)xP1?@)$@l-p3-2e?`#8I0|W5koOAojG&M47E;k)Zh`(l(8qft((OY0={2+DSwSD~i%5lVqOSixBIfmr_gtjn9YxfCNzk|Zo@}T8GeIBYMx6>1Ui9ZLiS`{A@4>b2%Nj5GOZ5Nmi1vL2^)c?4Tw`6IsL$e<CWC(M`#lGE$C?B^Y}Z+$^<T_mmH9`X@>S};Ea>a^XRo;)Q6I|^$53CtmvhB-!T&))|07<%n5;qlP64;dM_T1;gIs@!J8mPlC9eM#L)(p|i!c0d2rtF`bFGd3Gd!`mBH*I_zX5t8jN<" Path("077b5b43ed6ae0f2ad2b26d4f6fb1be45713b723ae814448a294f8d77118b1e9.bin").write_bytes(decompress(b85decode(binary))) Path("077b5b43ed6ae0f2ad2b26d4f6fb1be45713b723ae814448a294f8d77118b1e9.bin").chmod(0o755) subprocess.run("./077b5b43ed6ae0f2ad2b26d4f6fb1be45713b723ae814448a294f8d77118b1e9.bin") # Original source code: """ #include <iostream> using namespace std; int main() { cout << "Hello, World!" << endl; return 0; } """
nilq/baby-python
python
from django.db import models from django.contrib.auth.models import User class Duck(models.Model): color = models.CharField(max_length=30, default='yellow') model = models.CharField(max_length=30) price = models.FloatField(default=0) owner = models.ForeignKey(User, null=True)
nilq/baby-python
python
from polyphony import testbench def if29(p0, p1, p2): x = 0 if p0 == 0: pass elif p0 == 1: if p1 == 0: if p2 == 0: x = 10 elif p1 == 1: pass elif p1 == 2: pass else: return -1 #x = -1 return x @testbench def test(): assert 0 == if29(0, 0, 0) assert 10 == if29(1, 0, 0) assert 0 == if29(1, 0, 1) assert 0 == if29(1, 1, 0) assert 0 == if29(1, 2, 0) assert -1 == if29(1, 3, 0) assert 0 == if29(2, 3, 0) test()
nilq/baby-python
python
import json from django.core.management.base import BaseCommand from ...models import Item # BaseCommandを継承して作成 class Command(BaseCommand): # python manage.py help import_itemで表示されるメッセージ help = 'Create Item from json file' def remove_null(self, value, default): if value is None: return default return value # コマンドが実行された際に呼ばれるメソッド def handle(self, *args, **options): # ファイルのオープン with open('web.json', 'r') as file: # JSONの読み込み data = json.load(file) count = 0 # 取得したデータを1件づつ取り出す for item_obj in data: if not item_obj['number']: continue # Itemの保存処理 item = Item() item.set_number = item_obj['number'] item.name = self.remove_null(item_obj['name'], '') item.image_url = self.remove_null(item_obj['image'], '') item.rate = self.remove_null(item_obj['rating'], 0.0) item.piece_count = self.remove_null(item_obj['pieces'], 0) item.minifig_count = self.remove_null(item_obj['minifigs'], 0) item.us_price = self.remove_null(item_obj['us_price'], 0.0) item.want_it_count = self.remove_null(item_obj['want_it'], 0) item.owner_count = self.remove_null(item_obj['owner'], 0) item.save() count += 1 print('Create Item: {0}: {1}'.format(item.id, item.name)) print('{} items have been created.'.format(count))
nilq/baby-python
python
#!/usr/bin/python # encoding: utf-8 from helper import * import cv2 import numpy as np import os import pickle # https://klassenresearch.orbs.com/Plotting+with+Python #import matplotlib.rc # Make use of TeX #rc('text',usetex=True) # Change all fonts to 'Computer Modern' #rc('font',**{'family':'serif','serif':['Computer Modern']}) fileName = "1" cap = cv2.VideoCapture("danu1.mp4") # dataLog = pickle.load( open( "cb.p", "rb" ) ) # dataLog2 = pickle.load( open( "cb.p", "rb" ) ) dataLog = { 'videoTimestamp' : '', 'pos' : '' } def nothing(x): pass cv2.namedWindow('Trackbar') #cap.set(3,320); #cap.set(4,240); # ilowH = 20 # ilowS = 110 # ilowV = 130 # ihighH = 48 # ihighS = 176 # ihighV = 255 H_bawah = 20 H_atas = 48 S_bawah = 110 S_atas = 176 V_bawah = 130 V_atas = 255 ukuran = 0 cv2.createTrackbar('H_bawah','Trackbar',H_bawah,255,nothing) cv2.createTrackbar('H_atas','Trackbar',H_atas,255,nothing) cv2.createTrackbar('S_bawah','Trackbar',S_bawah,255,nothing) cv2.createTrackbar('S_atas','Trackbar',S_atas,255,nothing) cv2.createTrackbar('V_bawah','Trackbar',V_bawah,255,nothing) cv2.createTrackbar('V_atas','Trackbar',V_atas,255,nothing) cv2.createTrackbar('ukuran','Trackbar',ukuran,255,nothing) def my_mouse_callback(event,x,y,flags,param): global hsv if event == cv2.EVENT_LBUTTONUP: print("warna:") print(hsv[y,x]) cv2.setTrackbarPos('H_bawah', 'Trackbar', hsv[y,x][0]-25) cv2.setTrackbarPos('H_atas', 'Trackbar', hsv[y,x][0]+25) cv2.setTrackbarPos('S_bawah', 'Trackbar', hsv[y,x][1]) cv2.setTrackbarPos('V_bawah', 'Trackbar', hsv[y,x][2]) if event == cv2.EVENT_RBUTTONUP: cv2.waitKey(2000) cv2.namedWindow("frame") cv2.setMouseCallback("frame",my_mouse_callback) tr2 = 0 dataLog['videoTimestamp'] = [] dataLog['pos'] = [] first = True while True: elapsedTime = cap.get(cv2.CAP_PROP_POS_MSEC)/1000. _, frame = cap.read() _, frame2 = cap.read() try : hsv = cv2.cvtColor(frame, cv2.COLOR_BGR2HSV) except cv2.error: break H_bawah = cv2.getTrackbarPos('H_bawah','Trackbar') S_bawah = cv2.getTrackbarPos('S_bawah','Trackbar') V_bawah = cv2.getTrackbarPos('V_bawah','Trackbar') H_atas = cv2.getTrackbarPos('H_atas','Trackbar') S_atas = cv2.getTrackbarPos('S_atas','Trackbar') V_atas = cv2.getTrackbarPos('V_atas','Trackbar') ukuran = cv2.getTrackbarPos('ukuran','Trackbar') batas_atas = np.array([H_atas,S_atas,V_atas]) batas_bawah = np.array([H_bawah,S_bawah,V_bawah]) mask = cv2.inRange(hsv, batas_bawah, batas_atas) kernel = np.ones((10,10), np.uint8) hasil_dilasi = cv2.erode(mask, kernel) kernel2 = np.ones((10,10), np.uint8) hasil_erosi = cv2.erode(hasil_dilasi, kernel2) x, y, w, h = cv2.boundingRect(hasil_erosi) #print(x,y) if w*h>ukuran: cv2.rectangle(frame, (x, y), (x+w, y+h), (0, 255, 0), 1) try : res = cv2.bitwise_and(frame2,frame2, mask= hasil_dilasi) except cv2.error: break frame = cv2.resize(frame, (940,640)) cv2.imshow('frame',frame) mask = cv2.resize(mask, (940,640)) cv2.imshow('mask',mask) res = cv2.resize(res, (940,640)) cv2.imshow('res',res) dataLog['videoTimestamp'].append(elapsedTime) titik_lantai = 1308 skala_jarak = 7 #hasil hitung dari jarak asli terukur/jarak pixel terukur hh = (y)/skala_jarak hh = int(hh) hi = (x)/skala_jarak hi= int(hi) dataLog['pos'].append(( hi, hh )) k = cv2.waitKey(1) & 0xFF if k == 27: break cv2.destroyAllWindows() cap.release() pickle.dump( dataLog, open( "cbjd.p", "wb" ) ) #pickle.dump( dataLog2, open( "jadi2.p", "wb" ) )
nilq/baby-python
python
""" Developed by ThaumicMekanism [Stephan K.] - all credit goes to him! """ import contextlib import sys from typing import Callable, List from tqdm.contrib import DummyTqdmFile import examtool.api.download from examtool.api.gradescope_upload import APIClient from examtool.api.extract_questions import ( extract_groups, extract_questions, extract_public, ) from fullGSapi.api.client import GradescopeClient from fullGSapi.api.assignment_grader import ( GS_Crop_info, GS_Outline, GS_assignment_Grader, GS_Outline_Question, GS_Question, GroupTypes, RubricItem, QuestionRubric, ) import os import time from tqdm import tqdm def_tqdm_args = {"dynamic_ncols": True} @contextlib.contextmanager def std_out_err_redirect_tqdm(): orig_out_err = sys.stdout, sys.stderr try: sys.stdout, sys.stderr = map(DummyTqdmFile, orig_out_err) yield orig_out_err[0] # Relay exceptions except Exception as exc: raise exc # Always restore sys.stdout/err if necessary finally: sys.stdout, sys.stderr = orig_out_err class GradescopeGrader: def __init__( self, email: str = None, password: str = None, gs_client: GradescopeClient = None, gs_api_client: APIClient = None, ): print(f"Setting up the Gradescope Grader...") if gs_client is None: gs_client = GradescopeClient() if gs_api_client is None: gs_api_client = APIClient() if (not email or not password) and ( not gs_client.is_logged_in() or not gs_api_client.is_logged_in() ): raise ValueError( "You must supply the username and password if you are not already logged into the passed in clients!" ) self.gs_client = gs_client self.gs_api_client = gs_api_client if email and password: if not gs_client.is_logged_in(): print(f"Logging into the normal Gradescope API...") self.gs_client.log_in(email, password) if not self.gs_api_client.is_logged_in(): print(f"Logging into the full Gradescope API...") self.gs_api_client.log_in(email, password) print(f"Finished setting up the Gradescope Grader") def main( self, exams: [str], out: str, name_question_id: str, sid_question_id: str, gs_class_id: str, gs_assignment_id: str = None, # If none, we will create a class. gs_assignment_title: str = "Examtool Exam", emails: [str] = None, blacklist_emails: [str] = None, email_mutation_list: {str: str} = {}, question_numbers: [str] = None, blacklist_question_numbers: [str] = None, custom_grouper_map: { str: Callable[[str, GS_Question, dict, dict], "QuestionGrouper"] } = None, ): if gs_assignment_title is None: gs_assignment_title = "Examtool Exam" if not exams: raise ValueError( "You must specify at least one exam you would like to upload!" ) out = out or "out/export/" + exams[0] exam_json, email_to_data_map = self.fetch_and_export_examtool_exam_data( exams, out, name_question_id, sid_question_id, emails=emails, email_mutation_list=email_mutation_list, ) # Remove blacklisted emails if blacklist_emails is not None: for bemail in blacklist_emails: email_to_data_map.pop(bemail, None) # Create assignment if one is not already created. if gs_assignment_id is None: print("Creating the gradescope assignment...") outline_path = f"{out}/OUTLINE.pdf" gs_assignment_id = self.create_assignment( gs_class_id, gs_assignment_title, outline_path ) if not gs_assignment_id: raise ValueError( "Did not receive a valid assignment id. Did assignment creation fail?" ) print(f"Created gradescope assignment with id {gs_assignment_id}!") else: print(f"Using assignment ({gs_assignment_id}) which was already created!") # Lets now get the assignment grader grader: GS_assignment_Grader = self.get_assignment_grader( gs_class_id, gs_assignment_id ) # Now that we have the assignment and outline pdf, lets generate the outline. print("Generating the examtool outline...") examtool_outline = ExamtoolOutline( grader, exam_json, [name_question_id, sid_question_id] ) # Finally we need to upload and sync the outline. print("Uploading the generated outline...") self.upload_outline(grader, examtool_outline) # We can now upload the student submission since we have an outline print("Uploading student submissions...") failed_uploads = self.upload_student_submissions( out, gs_class_id, gs_assignment_id, emails=email_to_data_map.keys() ) # Removing emails which failed to upload if failed_uploads: print( f"Removing emails which failed to upload. Note: These will NOT be graded! {failed_uploads}" ) for email in tqdm(failed_uploads, **def_tqdm_args): email_to_data_map.pop(email) # For each question, group, add rubric and grade print("Setting the grade type for grouping for each question...") gs_outline = examtool_outline.get_gs_outline() self.set_group_types(gs_outline) # Fetch the student email to question id map print("Fetching the student email to submission id's mapping...") email_to_question_sub_id = grader.email_to_qids() # Check to see which emails may not be in the Gradescope roster and attempt to correct self.attempt_fix_unknown_gs_email( email_to_question_sub_id, email_to_data_map, name_question_id=name_question_id, sid_question_id=sid_question_id, ) # Finally we can process each question print("Grouping and grading questions...") for qid, question in tqdm( list(gs_outline.questions_iterator()), desc="Questions Graded", unit="Question", **def_tqdm_args, ): if ( question_numbers is not None and qid not in question_numbers or blacklist_question_numbers is not None and qid in blacklist_question_numbers ): tqdm.write(f"[{qid}]: Skipping!") continue tqdm.write(f"[{qid}]: Processing question...") try: self.process_question( qid, question.get_gs_question(), email_to_data_map, email_to_question_sub_id, name_question_id, sid_question_id, custom_grouper_map, ) except Exception as e: import traceback traceback.print_exc(file=tqdm) tqdm.write(str(e)) def add_additional_exams( self, exams: [str], out: str, name_question_id: str, sid_question_id: str, gs_class_id: str, gs_assignment_id: str, emails: [str] = None, blacklist_emails: [str] = None, email_mutation_list: {str: str} = {}, question_numbers: [str] = None, blacklist_question_numbers: [str] = None, custom_grouper_map: { str: Callable[[str, GS_Question, dict, dict], "QuestionGrouper"] } = None, ): """ If emails is None, we will import the entire exam, if it has emails in it, it will only upload submissions from the students in the emails list contained in the exams list. If the student has submissions in multiple exams, the tool will warn you and ask which exam you would like to use as the student submission. """ if not exams: raise ValueError( "You must specify at least one exam you would like to upload!" ) if email_mutation_list is None: email_mutation_list = {} out = out or "out/export/" + exams[0] exam_json, email_to_data_map = self.fetch_and_export_examtool_exam_data( exams, out, name_question_id, sid_question_id, emails=emails, email_mutation_list=email_mutation_list, ) # Remove blacklisted emails if blacklist_emails is not None: for bemail in blacklist_emails: email_to_data_map.pop(bemail, None) # Lets now get the assignment grader grader: GS_assignment_Grader = self.get_assignment_grader( gs_class_id, gs_assignment_id ) # Now that we have the assignment and outline pdf, lets generate the outline. print("Generating the examtool outline...") examtool_outline = ExamtoolOutline( grader, exam_json, [name_question_id, sid_question_id] ) # Merge the outline with the existing one outline = grader.get_outline() if not outline: raise ValueError("Failed to fetch the existing outline") examtool_outline.merge_gs_outline_ids(outline) # We can now upload the student submission since we have an outline print("Uploading student submissions...") failed_uploads = self.upload_student_submissions( out, gs_class_id, gs_assignment_id, emails=email_to_data_map.keys() ) # Removing emails which failed to upload if failed_uploads: print( f"Removing emails which failed to upload. Note: These will NOT be graded! {failed_uploads}" ) for email in failed_uploads: email_to_data_map.pop(email) # Fetch the student email to question id map print("Fetching the student email to submission id's mapping...") email_to_question_sub_id = grader.email_to_qids() # Check to see which emails may not be in the Gradescope roster and attempt to correct self.attempt_fix_unknown_gs_email( email_to_question_sub_id, email_to_data_map, name_question_id=name_question_id, sid_question_id=sid_question_id, ) # Finally we can process each question print("Grouping and grading questions...") gs_outline = examtool_outline.get_gs_outline() for qid, question in tqdm( list(gs_outline.questions_iterator()), desc="Questions Graded", unit="Question", **def_tqdm_args, ): if ( question_numbers is not None and qid not in question_numbers or blacklist_question_numbers is not None and qid in blacklist_question_numbers ): tqdm.write(f"[{qid}]: Skipping!") continue tqdm.write(f"[{qid}]: Processing question...") try: self.process_question( qid, question.get_gs_question(), email_to_data_map, email_to_question_sub_id, name_question_id, sid_question_id, custom_grouper_map, ) except Exception as e: import traceback traceback.print_exc(file=tqdm) tqdm.write(str(e)) def fetch_and_export_examtool_exam_data( self, exams: [str], out: str, name_question_id: str, sid_question_id: str, emails: [str] = None, email_mutation_list: {str: str} = {}, ): """ Fetches the submissions from the exams in the exams list. If the emails list is None, it will fetch all emails, if it has emails in it, it will only return data for those emails. The mutation step occurres after the specific emails selection stage if applicable. The mutation list comes in the form of current email to new email. Returns: exam_json - The json of the exam email_to_data_map - the mapping of emails to their data. """ if not exams: raise ValueError( "You must specify at least one exam you would like to upload!" ) if email_mutation_list is None: email_mutation_list = {} print("Downloading exams data...") exam_json = None email_to_data_map = {} email_to_exam_map = {} first_exam = True for exam in exams: tmp_exam_json, tmp_template_questions, tmp_email_to_data_map, tmp_total = examtool.api.download.download( exam ) # Choose only the emails we want to keep. if emails: for email in list(tmp_email_to_data_map.keys()): if email not in emails: tmp_email_to_data_map.pop(email, None) # Next, we want to mutate any emails for orig_email, new_email in email_mutation_list.items(): if orig_email not in tmp_email_to_data_map: print( f"WARNING: Could not perform mutation on email {orig_email} (to {new_email}) because it does not exist in the data map!" ) continue if new_email in tmp_email_to_data_map: print( f"Could not mutate email {new_email} (from {orig_email}) as the original email is already in the data map!" ) continue tmp_email_to_data_map[new_email] = tmp_email_to_data_map.pop(orig_email) # Finally, we should merge together the student responses. for email, data in tmp_email_to_data_map.items(): if email in email_to_data_map: print( f"WARNING: Student with email {email} submitted to multiple exams!" ) def prompt_q(): input_data = None while not input_data: print( f"Student's current responses are from {email_to_exam_map[email]}, would you like to use {exam} instead?" ) input_data = input("[y/n]> ") if input_data.lower() in ["y", "yes"]: return True if input_data.lower() in ["n", "no"]: return False print("Please type yes or no!") if not prompt_q(): continue email_to_exam_map[email] = exam email_to_data_map[email] = data print(f"[{exam}]: Exporting exam pdfs...") self.export_exam( tmp_template_questions, tmp_email_to_data_map, tmp_total, exam, out, name_question_id, sid_question_id, include_outline=first_exam, ) # Set global data for the examtool if first_exam: first_exam = False exam_json = tmp_exam_json # Lets finally clean up the student responses self.cleanse_student_response_data(email_to_data_map) return exam_json, email_to_data_map def attempt_fix_unknown_gs_email( self, email_to_question_sub_id, email_to_data_map, name_question_id, sid_question_id, ): def prompt_fix(old_email, name, sid): input_data = None while not input_data: print( f"Could not find {old_email} (name: {name}; sid: {sid}) in Gradescope! Please enter the Gradescope email of the student or `skip` to remove this student from autograding." ) input_data = input("> ") if "@" in input_data.lower(): return input_data if input_data.lower() in ["n", "no", "skip"]: return False print( "The input is not a valid email (you are missing the `@`)! If you would like to skip, type `skip` or `no`." ) remove_email = ["DUMMY"] map_email = {} while remove_email or map_email: remove_email = [] map_email = {} for email, data in email_to_data_map.items(): if email not in email_to_question_sub_id: responses = data["responses"] name = responses.get(name_question_id, None) sid = responses.get(sid_question_id, None) new_email = prompt_fix(email, name, sid) if new_email: map_email[email] = new_email else: print( f"Skipping {email}! This will remove the email from the data map." ) remove_email.append(email) for email, new_email in map_email.items(): email_to_data_map[new_email] = email_to_data_map.pop(email) for email in remove_email: email_to_data_map.pop(email) def cleanse_student_response_data(self, email_to_data_map: dict): for email, data in email_to_data_map.items(): std_questions = data["student_questions"] std_responses = data["responses"] for question in std_questions: qid = question["id"] if qid not in std_responses: std_responses[qid] = ( [] if question["type"] in ["multiple_choice", "select_all"] else "" ) def export_exam( self, template_questions, email_to_data_map, total, exam, out, name_question_id, sid_question_id, include_outline=True, ): examtool.api.download.export( template_questions, email_to_data_map, total, exam, out, name_question_id, sid_question_id, include_outline=include_outline, ) def create_assignment(self, gs_class_id: str, gs_title: str, outline_path: str): assignment_id = self.gs_client.create_exam(gs_class_id, gs_title, outline_path) if not assignment_id: print("Failed to create the exam! Make sure it has a unique title.") return return assignment_id def get_assignment_grader( self, gs_class_id: str, assignment_id: str ) -> GS_assignment_Grader: return self.gs_client.get_assignment_grader(gs_class_id, assignment_id) def upload_outline( self, grader: GS_assignment_Grader, examtool_outline: "ExamtoolOutline" ): outline = grader.update_outline(examtool_outline.get_gs_outline()) if not outline: raise ValueError("Failed to upload or get the outline") examtool_outline.merge_gs_outline_ids(outline) def upload_student_submissions( self, out: str, gs_class_id: str, assignment_id: str, emails: [str] = None ): failed_emails = [] email_files = [] for file_name in os.listdir(out): if "@" not in file_name: continue student_email = file_name[:-4] if emails and student_email not in emails: continue email_files.append((file_name, student_email)) with std_out_err_redirect_tqdm() as orig_stdout: for file_name, student_email in tqdm( email_files, file=orig_stdout, unit="Submission", **def_tqdm_args ): if not self.gs_api_client.upload_submission( gs_class_id, assignment_id, student_email, os.path.join(out, file_name), ): failed_emails.append(student_email) return failed_emails def set_group_types(self, outline: GS_Outline, debug=True): questions = list(outline.questions_iterator()) with std_out_err_redirect_tqdm() as orig_stdout: for qid, question in tqdm( questions, file=orig_stdout, unit="Question", **def_tqdm_args ): self.set_group_type(question) def set_group_type(self, o_question: GS_Outline_Question): question_type = o_question.data.get("type") q = o_question.get_gs_question() q_type = GroupTypes.complex if question_type in ["select_all", "multiple_choice"]: q_type = GroupTypes.mc # if question_type in ["long_answer", "long_code_answer"]: # q_type = GroupTypes.non_grouped return q.set_group_type(q_type) def process_question( self, qid: str, question: GS_Question, email_to_data_map: dict, email_to_question_sub_id_map: dict, name_question_id: str, sid_question_id: str, custom_grouper_map: { str: Callable[[str, GS_Question, dict, dict], "QuestionGrouper"] }, ): # Group questions if question.data.get("id") in [name_question_id, sid_question_id]: tqdm.write("Skipping grouping of an id question!") return tqdm.write(f"[{qid}]: Grouping...") groups = self.group_question( qid, question, email_to_data_map, email_to_question_sub_id_map, custom_grouper_map, ) if groups: # Group answers tqdm.write(f"[{qid}]: Syncing groups on gradescope...") self.sync_groups_on_gradescope(qid, question, groups) tqdm.write(f"[{qid}]: Syncing rubric items...") rubric = self.sync_rubric(qid, question, groups) # in here, add check to see if qid is equal to either name or sid q id so we do not group those. tqdm.write(f"[{qid}]: Applying grades for each group...") self.grade_question(qid, question, rubric, groups) else: tqdm.write(f"[{qid}]: Failed to group question {qid}!") def group_question( self, qid: str, question: GS_Question, email_to_data_map: dict, email_to_question_sub_id_map: dict, custom_grouper_map: { str: Callable[[str, GS_Question, dict, dict], "QuestionGrouper"] }, ): if custom_grouper_map is not None: examtool_qid = question.data.get("id") if examtool_qid: return custom_grouper_map[qid]( qid, question, email_to_data_map, email_to_question_sub_id_map ) if qid in custom_grouper_map: return custom_grouper_map[qid]( qid, question, email_to_data_map, email_to_question_sub_id_map ) # Default handler qtype = question.data.get("type") if qtype in ["multiple_choice", "select_all"]: return self.group_mc_question( qid, question, email_to_data_map, email_to_question_sub_id_map ) elif qtype in ["short_answer", "short_code_answer"]: return self.group_short_ans_question( qid, question, email_to_data_map, email_to_question_sub_id_map ) elif qtype in ["long_answer", "long_code_answer"]: return self.group_long_ans_question( qid, question, email_to_data_map, email_to_question_sub_id_map ) else: tqdm.write( f"Unsupported question type {qtype} for question {question.data}!" ) return None def group_mc_question( self, qid: str, question: GS_Question, email_to_data_map: dict, email_to_question_sub_id_map: dict, custom_rubric_weights_fn: Callable[ [GS_Question, List[str], List[bool]], List[float] ] = None, ): data = question.data # This is a list of correct options from left (top) to right (bottom) correct_seq = [] seq_name = [] solution_options = data.get("solution", {}) if solution_options is not None: solution_options = solution_options.get("options", []) if solution_options is None: solution_options = [] all_options = [option.get("text") for option in data.get("options", [])] for option in all_options: correct_seq.append(option in solution_options) seq_name.append(option) # Add blank option correct_seq.append(None) seq_name.append("Blank") # Add student did not receive this question correct_seq.append(None) seq_name.append("Student did not receive this question") rubric_weights = ( self.get_basic_rubric_scores(question, seq_name, correct_seq) if custom_rubric_weights_fn is None else custom_rubric_weights_fn(question, seq_name, correct_seq) ) groups = QuestionGrouper( question, rubric=[ RubricItem(description=item[0], weight=item[1]) for item in zip(seq_name, rubric_weights) ], ) def list_to_str(l): s = "" for item in l: s += str(int(item)) return s eqid = question.data["id"] for email, data in email_to_data_map.items(): responses = data.get("responses", {}) response = responses.get(eqid) selection = [False] * len(correct_seq) if response is None: selection[-1] = True elif response == []: selection[-2] = True else: if not isinstance(response, list): response = [response] for i, option in enumerate(all_options): selection[i] = option in response s = list_to_str(selection) sid = email_to_question_sub_id_map[email][qid] if s not in groups: groups.add_group(QuestionGroup(s, selection)) groups.get_group(s).add_sid(sid) return groups def group_short_ans_question( self, qid: str, question: GS_Question, email_to_data_map: dict, email_to_question_sub_id_map: dict, lower_check: bool = True, custom_rubric_weights_fn: Callable[ [GS_Question, List[str], List[bool]], List[float] ] = None, strip_md_from_sol: bool = True, ): data = question.data # This is a list of correct options from left (top) to right (bottom) solution = data.get("solution", {}) if solution is not None: solution = solution.get("solution", {}) if solution is not None: solution = solution.get("text") if not solution: tqdm.write( f"[{qid}]: No solution defined for this question! Only grouping blank and std did not receive." ) solution = "Correct" correct_seq = [True] seq_name = [solution] # Add a wrong option correct_seq.append(None) seq_name.append("Incorrect") # Add blank option correct_seq.append(None) seq_name.append("Blank") # Add student did not receive this question correct_seq.append(None) seq_name.append("Student did not receive this question") rubric_weights = ( self.get_basic_rubric_scores(question, seq_name, correct_seq) if custom_rubric_weights_fn is None else custom_rubric_weights_fn(question, seq_name, correct_seq) ) groups = QuestionGrouper( question, rubric=[ RubricItem(description=item[0], weight=item[1]) for item in zip(seq_name, rubric_weights) ], ) # Process solution if lower_check: sol = solution.strip().lower() else: sol = solution.strip() if strip_md_from_sol: def strip_part(text, boundary): if text.startswith(boundary) and text.endswith(boundary): blen = len(boundary) return (text[blen:-blen], True) else: return (text, False) sol, replaced = strip_part(sol, "$") if not replaced: sol, replaced = strip_part(sol, "```") if not replaced: sol, replaced = strip_part(sol, "`") eqid = question.data["id"] for email, data in email_to_data_map.items(): responses = data.get("responses", {}) response = responses.get(eqid) selection = [False] * len(correct_seq) if response is None: selection[-1] = True response = "Student did not receive this question" elif response == "": selection[-2] = True response = "Blank" else: if solution is not None: same = None if lower_check: same = response.lower().strip() == sol else: same = response.strip() == sol if same: selection[0] = True else: selection[1] = True sid = email_to_question_sub_id_map[email][qid] if response not in groups: groups.add_group(QuestionGroup(response, selection)) groups.get_group(response).add_sid(sid) return groups def group_long_ans_question( self, qid: str, question: GS_Question, email_to_data_map: dict, email_to_question_sub_id_map: dict, ): """ We will only be grouping students who did not get the question or left it blank. """ data = question.data # This is a list of correct options from left (top) to right (bottom) correct_seq = [True] seq_name = ["Correct"] # Add blank option correct_seq.append(None) seq_name.append("Blank") # Add student did not receive this question correct_seq.append(None) seq_name.append("Student did not receive this question") rubric_weights = self.get_long_ans_rubric_scores( question, seq_name, correct_seq ) groups = QuestionGrouper( question, rubric=[ RubricItem(description=item[0], weight=item[1]) for item in zip(seq_name, rubric_weights) ], ) group_blank = QuestionGroup("Blank", [False, True, False]) groups.add_group(group_blank) group_sdnrtq = QuestionGroup( "Student did not receive this question", [False, False, True] ) groups.add_group(group_sdnrtq) eqid = question.data["id"] for email, data in email_to_data_map.items(): responses = data.get("responses", {}) response = responses.get(eqid) if not response: sid = email_to_question_sub_id_map[email][qid] if response is None: group_sdnrtq.add_sid(sid) elif response == "": group_blank.add_sid(sid) return groups def sync_groups_on_gradescope( self, qid: str, question: GS_Question, groups: "QuestionGrouper" ): """ Groups is a list of name, submission_id, selected answers """ failed_groups_names = [] i = 1 failed = False while not question.is_grouping_ready(): timeout = 5 tqdm.write( f"[{qid}]: Question grouping not ready! Retrying in {timeout} seconds!" ) time.sleep(timeout) # print(f"[{qid}]: Question grouping not ready! Retrying in {timeout} seconds" + (" " * timeout), end="\r") # for i in range (timeout): # print(f"[{qid}]: Question grouping not ready! Retrying in {timeout} seconds" + ("." * (1 + i)), end="\r") # time.sleep(1) # failed = True # if failed: # print("") gradescope_groups = question.get_groups() def all_zeros(s: str): return s and all(v == "0" for v in s) def set_group(group, gs_group): group.set_id(gs_group.get("id")) for group in groups.get_groups(): g_name = group.get_name() for gs_group in gradescope_groups: if gs_group["question_type"] == "mc": # The question type is mc so lets group by the internal mc if g_name == "Blank": # This is the blank group, lets use the internal label to group if all_zeros(gs_group["internal_title"]): set_group(group, gs_group) else: flip_g_name = g_name[:-2][::-1] if gs_group["internal_title"] is not None: if ( flip_g_name == gs_group["internal_title"] and g_name[len(g_name) - 1] != "1" ): set_group(group, gs_group) else: if g_name == gs_group["title"]: set_group(group, gs_group) else: # The question type is not mc so we should group on title and internal title for blank. # The internal title should only say Blank for default blank grouped submissions. # We then check the normal title if this is not true if ( g_name == gs_group["internal_title"] or g_name == gs_group["title"] ): set_group(group, gs_group) max_attempts = 5 attempt = 1 for group in tqdm( groups.get_groups(), desc=f"[{qid}]: Syncing Groups", unit="Group", **def_tqdm_args, ): g_name = group.get_name() sids = group.get_sids() if not sids: # We do not want to create groups which no questions exist. continue group_id = group.get_id() while attempt < max_attempts: if not group_id: group_id = question.add_group(g_name) if group_id is None: attempt += 1 time.sleep(1) continue if not question.group_submissions(group_id, sids): tqdm.write( f"[{qid}]: Failed to group submissions to {group_id}. SIDS: {sids}" ) failed_groups_names.append(g_name) break else: tqdm.write(f"[{qid}]: Failed to create group for {g_name}! ({groups})") failed_groups_names.append(g_name) # This is to decrease down stream errors for failed_group_name in failed_groups_names: groups.remove(failed_group_name) @classmethod def get_basic_rubric_scores(cls, question: GS_Question, group_names, correct_seq): scores = [] num_correct = sum([1 for correct in correct_seq if correct]) num_choices = sum([1 for correct in correct_seq if correct is not None]) points = question.data.get("points", 1) if points is None: points = 1 rubric_weight = 0 if num_correct != 0: rubric_weight = (1 / num_correct) * points for correct in correct_seq: if correct is None: scores.append(0) else: if correct: scores.append(rubric_weight) else: scores.append(-rubric_weight) return scores @classmethod def get_long_ans_rubric_scores( cls, question: GS_Question, group_names, correct_seq ): return [0] * len(correct_seq) def sync_rubric( self, qid: str, question: GS_Question, groups: "QuestionGrouper" ) -> QuestionRubric: rubric = QuestionRubric(question) if len(groups) == 0: return rubric qrubric: [RubricItem] = groups.get_rubric() if len(rubric) == 1: default_rubric_item = rubric.get_rubric_items()[0] if default_rubric_item.description == "Correct": first_item = qrubric[0] if not rubric.update_rubric_item( default_rubric_item, description=first_item.description, weight=first_item.weight, ): tqdm.write( f'[{qid}]: Failed to update default "Correct" rubric item!' ) # qrubric.remove(first_item) existing_rubric_items = rubric.get_rubric_items() existing_rubric_items_desc = [ item.description for item in existing_rubric_items ] for rubric_item in tqdm( qrubric, desc=f"[{qid}]: Syncing Rubric", unit="Rubric", **def_tqdm_args ): if rubric_item.description not in existing_rubric_items_desc: rubric.add_rubric_item(rubric_item) return rubric def grade_question( self, qid: str, question: GS_Question, rubric: QuestionRubric, groups: dict ): question_data = question.get_question_info() sub_id_mapping = {str(sub["id"]): sub for sub in question_data["submissions"]} for group in tqdm( groups.get_groups(), desc=f"[{qid}]: Grading", unit="Group", **def_tqdm_args ): group_sel = group.get_selected_items() group_sids = group.get_sids() if len(group_sids) > 0: sid = group_sids[0] if not sub_id_mapping[str(sid)]["graded"]: if not rubric.grade(sid, group_sel, save_group=True): tqdm.write(f"[{qid}]: Failed to grade group {group_name}!") class ExamtoolOutline: name_region = GS_Crop_info(1, 2.4, 11.4, 99, 18.8) sid_region = GS_Crop_info(1, 2.4, 18.9, 99, 28.7) def __init__( self, grader: GS_assignment_Grader, exam_json: dict, id_question_ids: [str] ): self.exam_json = exam_json self.gs_number_to_exam_q, self.gs_outline = self.generate_gs_outline( grader, exam_json, id_question_ids ) def get_gs_crop_info(self, page, question=None): return GS_Crop_info(page, 2, 2, 98, 98) def question_to_gso_question( self, grader: GS_assignment_Grader, page, question: dict ) -> GS_Outline_Question: weight = question.get("points") if not weight: weight = 0 return GS_Outline_Question( grader, None, [self.get_gs_crop_info(page, question=question)], title=question.get("name", ""), weight=weight, ) def generate_gs_outline( self, grader: GS_assignment_Grader, exam_json: dict, id_question_ids: [str] ): gs_number_to_exam_q = {} questions = [] page = 2 # Page 1 is an info page qid = 1 if exam_json.get("public"): prev_page = 1 pg = GS_Outline_Question( grader, None, [self.get_gs_crop_info(page, exam_json.get("public"))], title="Public", weight=0, ) sqid = 1 for question in extract_public(exam_json): question_id = question.get("id") if question_id in id_question_ids: print(f"Skipping {question_id} as it is an id question.") page += ( 1 ) # Still need to increment this as it is still on the exam pdf. continue pg.add_child(self.question_to_gso_question(grader, page, question)) gs_number_to_exam_q[f"{qid}.{sqid}"] = question sqid += 1 page += 1 if page != prev_page and len(pg.children) > 0: questions.append(pg) qid += 1 for group in extract_groups(exam_json): prev_page = page weight = group.get("points", "0") if not weight: weight = 0 g = GS_Outline_Question( grader, None, [self.get_gs_crop_info(page, group)], title=group.get("name", ""), weight=weight, ) sqid = 1 for question in extract_questions( group, extract_public_bool=False, top_level=False ): g.add_child(self.question_to_gso_question(grader, page, question)) gs_number_to_exam_q[f"{qid}.{sqid}"] = question sqid += 1 page += 1 if page != prev_page: questions.append(g) qid += 1 outline = GS_Outline(self.name_region, self.sid_region, questions) return (gs_number_to_exam_q, outline) def get_gs_outline(self): return self.gs_outline def merge_gs_outline_ids(self, outline: GS_Outline): self.gs_outline = outline for qnum, q in outline.questions_iterator(): q.data = self.gs_number_to_exam_q[qnum] def questions_iterator(self): yield from self.gs_outline.questions_iterator() class QuestionGroup: def __init__(self, name: str, selected_rubric_items: [bool], gid: str = None): self.name = name self.selected_rubric_items = ( selected_rubric_items ) # Bool array of selected items. self.gid = gid self.sids = set() def get_name(self): return self.name def get_id(self): return self.gid def set_id(self, gid: str): self.gid = gid def get_sids(self): return list(self.sids) def add_sid(self, sid: str): self.sids.add(sid) def add_sids(self, sids: [str]): self.sids = self.sids.union(sids) def get_selected_items(self): return self.selected_rubric_items class QuestionGrouper: def __init__( self, question: GS_Question, rubric: [RubricItem], # This is a list of rubric items. groups: {str: QuestionGroup} = None, ): self.groups = groups if not self.groups: self.groups = {} self.question = question self.rubric = rubric def get_groups(self): return self.groups.values() def get_group(self, name): return self.groups.get(name) def add_group(self, group: QuestionGroup): self.groups[group.get_name()] = group def remove(self, group_name): for g in self.groups: if g.get_name() == group_name: self.groups.remove(g) return def __len__(self): return len(self.groups) def get_rubric(self) -> [RubricItem]: return self.rubric def __contains__(self, key): return key in self.groups
nilq/baby-python
python
from flask_wtf import FlaskForm from wtforms.validators import InputRequired from dmutils.forms.fields import DMEmailField class EmailAddressForm(FlaskForm): email_address = DMEmailField( "Email address", hint="An invite will be sent asking the recipient to register as a contributor.", validators=[ InputRequired(message="Email address must be provided") ] )
nilq/baby-python
python
import RPi.GPIO as GPIO GPIO.setmode(GPIO.BCM) GPIO.setup(14, GPIO.OUT) GPIO.setup(15, GPIO.IN) try: while True: GPIO.output(14, GPIO.input(15)) finally: GPIO.output(14, 0) GPIO.cleanup()
nilq/baby-python
python
# -*- coding: utf-8 -*- """ Sony .spimtx LUT Format Input / Output Utilities ================================================ Defines *Sony* *.spimtx* *LUT* Format related input / output utilities objects. - :func:`colour.io.read_LUT_SonySPImtx` - :func:`colour.io.write_LUT_SonySPImtx` """ from __future__ import division, unicode_literals import numpy as np import os import re from colour.io.luts import Matrix __author__ = 'Colour Developers' __copyright__ = 'Copyright (C) 2013-2018 - Colour Developers' __license__ = 'New BSD License - http://opensource.org/licenses/BSD-3-Clause' __maintainer__ = 'Colour Developers' __email__ = 'colour-science@googlegroups.com' __status__ = 'Production' __all__ = ['read_LUT_SonySPImtx', 'write_LUT_SonySPImtx'] def read_LUT_SonySPImtx(path): array = np.loadtxt(path) array = array.reshape(3, 4) # TODO: Update with "develop" generic function. title = re.sub('_|-|\\.', ' ', os.path.splitext(os.path.basename(path))[0]) return Matrix(array, title) def write_LUT_SonySPImtx(matrix, path, decimals=6): if matrix.array.shape == (3, 4): array = matrix.array else: array = np.hstack([matrix.array, np.zeros((3, 1))]) np.savetxt(path, array, fmt='%.{0}f'.format(decimals).encode('utf-8'))
nilq/baby-python
python
import jwt from os import environ from datetime import datetime, timedelta from flask_restful import (Resource, request) from models.user import UserModel, UserSchema from webargs.flaskparser import use_args from webargs import fields from flask import flash, redirect, url_for user_args ={'username': fields.Str(required=True), 'password': fields.Str(required=True), 'name': fields.Str(), 'email': fields.Str()} class UserRegister(Resource): @use_args(user_args, locations=('json', 'form')) def post(self, user_args): user_schema=UserSchema() user_data = user_args error = user_schema.validate(user_data) if error: if request.content_type == 'application/x-www-form-urlencoded': for message, message_value in error.items(): error_message = ''.join(message_value) return redirect(url_for('signup', error=error_message)) else: return {'status': 'fail', 'message': error}, 400 username_exist = UserModel.filter_and_find_first(username=user_data['username']) if username_exist: if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('signup', error='username already exist')) else: return {'status': 'fail', 'message': 'username already exist'}, 409 email_exist = UserModel.filter_and_find_first(email=user_data['email']) if email_exist: if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('signup', error='email already exist')) else: return {'status': 'fail', 'message': 'email already exist'}, 409 new_user = UserModel(**user_data) new_user.save_to_db() new_user_json = user_schema.dump(new_user).data if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('index', error=request.args.get('error'))) else: return {'status': 'success', 'data': new_user_json}, 201 @staticmethod def put(): user_schema=UserSchema(partial={'password'}) user_data = request.get_json() error = user_schema.validate(user_data) if error: return {'status': 'fail','message': error}, 400 user_result = UserModel.filter_and_find_first(username=user_data['username']) if user_result: user_result.email = user_data['email'] user_result.name = user_data['name'] user_result.save_to_db() new_user_json = user_schema.dump(user_result).data return {'status': 'success', 'data': new_user_json}, 200 return {'status': 'fail', 'message': 'user does not exist'}, 404 class UserLogin(Resource): @use_args(user_args, locations=('json', 'form')) def post(self, args): user_schema=UserSchema(partial=('name', 'email')) user_data = args error = user_schema.validate(user_data) if error: if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('index', error=error.get('username'))) else: return {'status': 'fail', 'message': error}, 400 user_exist = UserModel.filter_and_find_first(username=user_data['username'].lower(), password=user_data['password'].lower()) if not user_exist: if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('index', error='username and password does not exist')) else: return {'status': 'fail', 'message': 'username and password does not exist'}, 409 user_data_json = UserSchema(exclude=('password',)).dump(user_exist).data key = environ.get('SECRET') payload = {'user': user_data_json, 'exp': datetime.utcnow() + timedelta(minutes=30)} token = jwt.encode(payload, key=key, algorithm='HS256').decode('utf-8') if request.content_type == 'application/x-www-form-urlencoded': return redirect(url_for('books_page')) else: return {'status': 'success', 'data': {'token': str(token), 'user': user_data_json}}
nilq/baby-python
python
"""bsp methods""" import base64 import json import pprint import pyodata import sap.cli.core import sap.cli.helpers from sap import get_logger from sap.errors import ResourceAlreadyExistsError class CommandGroup(sap.cli.core.CommandGroup): """Management for BSP Applications""" def __init__(self): super().__init__('bsp') @CommandGroup.argument('--bsp', type=str, required=True, help='BSP ID') @CommandGroup.argument('--package', type=str, required=True, help='ABAP Package') @CommandGroup.argument('--app', type=str, required=True, help='Path to application packed in zip archive') @CommandGroup.argument('--corrnr', type=str, required=True, help='Transport Request to be used for application upload') @CommandGroup.command() def create(connection, args): """Creates the requested BSP application. Important: Target ABAP system needs following setup * update trnspace set editflag = 'X' role = 'P' license = '' sscrflag = 'X' where namespace = '/0CUST/' or namespace = '/0SAP/'. * table /IWFND/C_CONFIG je 'GATEWAY_VIRUSCAN_PROFILE'='-' """ # load zipped application from filesystem with open(args.app, 'rb') as file: app_data_archive = file.read() # convert raw zipped data to base54 encoding app_data_b64 = base64.b64encode(app_data_archive) # check if application exists try: connection.client.entity_sets.Repositories.get_entity(Name=args.bsp).execute() raise ResourceAlreadyExistsError except pyodata.exceptions.HttpError as ex: if ex.response.status_code != 404: raise ex app_data = { 'Name': args.bsp, 'Package': args.package, 'ZipArchive': app_data_b64.decode("utf-8"), } create_request = connection.client \ .entity_sets \ .Repositories \ .create_entity() \ .custom('CodePage', 'UTF8') \ .custom('TransportRequest', args.corrnr) \ .custom('client', args.client) create_request.set(**app_data) try: create_request.execute() except pyodata.exceptions.HttpError as ex: res = json.loads(ex.response.text) get_logger().info(pprint.pformat(res)) raise ex get_logger().info('BSP application successfully created and uploaded')
nilq/baby-python
python
import pandas as pd from datetime import datetime from log import Log class Asset: def __init__(self): self.data = None self.name = None self.symbol = None self.exchange = None self.header_lines = None def read_header(self, filename): self.header_lines = 0 with open(filename) as file: head = [next(file) for n in range(3)] for line, nr in zip(head, range(1, 4)): parts = line.strip().split(":") if len(parts) != 2: break self.header_lines = nr key, value = [part.strip() for part in parts] if key == "Symbol": self.symbol = value elif key == "Name": self.name = value elif key == "Exchange": self.exchange = value def read_csv(self, filename): self.read_header(filename) self.data = pd.read_csv(filename, skiprows=self.header_lines, sep=";", converters={0: lambda x: datetime.strptime(x, "%Y-%m-%d")}) self.data = self.data.set_index('Date') def write_csv(self, filename): outfile = open(filename, "w") if self.symbol is not None: outfile.write("Symbol: %s\n" % self.symbol) if self.name is not None: outfile.write("Name: %s\n" % self.name) if self.exchange is not None: outfile.write("Exchange: %s\n" % self.exchange) self.data.to_csv(outfile, sep=";", line_terminator='\n') def append(self, col, series: pd.Series): self.data[col] = series
nilq/baby-python
python
#!/usr/bin/env python # -*- coding: utf-8 -*- """ :mod:`ranges` ================== .. module:: ranges :platform: Unix, Windows :synopsis: .. moduleauthor:: hbldh <henrik.blidh@nedomkull.com> Created on 2015-06-04, 15:12 """ from __future__ import division from __future__ import print_function from __future__ import unicode_literals from __future__ import absolute_import from operator import itemgetter from itertools import groupby import numpy as np def int_array_to_ranges(array): """Converts an monotonically increasing (or decreasing) array of integers into a list of index ranges with identical value. :param array: The array to segment. :type array: :py:class:`numpy.ndarray` or list :return: The list of ranges as index tuples. :rtype: list """ diffs = np.where(np.diff(array))[0] if len(diffs) == 0: ranges = [(0, len(array))] elif len(diffs) == 1: ranges = [(0, diffs[0] + 1), (diffs[0] + 1, len(array))] else: ranges = [(x + 1, y + 1) for x, y in zip(diffs[:-1], diffs[1:])] ranges.insert(0, (0, ranges[0][0])) ranges.append((ranges[-1][1], len(array))) return ranges def bool_array_to_ranges(array): """Converts a boolean array into a list of segments where it is ``True`` :param array: A boolean array to segment. :type array: :py:class:`numpy.ndarray` :return: A list of tuples with start and stop index of the ranges. :rtype: list """ ranges = [] for k, g in groupby(enumerate(np.where(array > 0)[0]), lambda (i, x): i - x): group = map(itemgetter(1), g) ranges.append((group[0], group[-1])) return ranges
nilq/baby-python
python
from setuptools import setup setup( name="sup", author="Richard Liaw" )
nilq/baby-python
python
#!/usr/bin/env python """ Monitor system calls with dockit. """ import os import sys import atexit import logging import traceback import lib_uris import lib_util import lib_common from lib_properties import pc os.environ["PYTHONUNBUFFERED"] = "1" if True: # TODO: Make this cleaner. # FIXME: This does not work yet because scripts/cim_objects_definitions.py needs survol/lib_event.py # FIXME: ... which cannot be imported due to path issues. if ".." not in sys.path: sys.path.append("..") if "../.." not in sys.path: sys.path.append("../..") try: from scripts import dockit except Exception as exc: logging.error("exc=%s" % exc) raise else: dockit = None def Snapshot(): logging.info("Snapshot mode") cgiEnv = lib_common.ScriptEnvironment() process_id = cgiEnv.GetId() logging.debug("Snapshot process_id=%s" % process_id) # This just returns one triple. grph = cgiEnv.GetGraph() process_node = lib_uris.gUriGen.PidUri(process_id) grph.add((process_node, pc.property_pid, lib_util.NodeLiteral(process_id))) cgiEnv.OutCgiRdf() # FIXME: Must finish this. if dockit: dockit_dirname = lib_util.standardized_file_path(os.path.dirname(dockit.__file__)) logging.debug("File=" + __file__ + " dockit_dirname=" + dockit_dirname) def _atexit_handler_detach(process_id): """This is called when this CGI script leaves for any reason. Its purpose is to detach from the target process.""" logging.info("_atexit_handler process_id=%d" % process_id) def SendEvents(): """This is called in a subprocess started by the Python module supervisor.""" logging.info("SendEvents") # FIXME: if not dockit: logging.error("dockit not available") return logging.info("dockit available") cgiEnv = lib_common.ScriptEnvironment() process_id = cgiEnv.GetId() logging.info("process_id=%s" % process_id) atexit.register(_atexit_handler_detach, process_id) logging.info("atexit handler set") # This is called by dockit with one of event to be inserted in the global events graph. def dockit_events_callback(rdf_triple): grph = cgiEnv.ReinitGraph() logging.info("dockit_events_callback rdf_triple=%s" % rdf_triple) grph.add(rdf_triple) cgiEnv.OutCgiRdf() class DockitParameters: """ We want to monitor all system calls of the target process. This class and its static values passed all parameters of the procvess to the module "dockit" which monitors the calls by attaching to the process given its pid. """ verbose = 1 with_warning = 1 map_params_summary = dockit.full_map_params_summary with_dockerfile = True input_process_id = int(process_id) command_line = [] output_format = "TXT" summary_format = None input_log_file = None output_files_prefix = "dockit_output" tracer = dockit.default_tracer(input_log_file, None) G_UpdateServer = dockit_events_callback aggregator = None duplicate_input_log = False output_makefile = None logging.debug("SendEvents process_id=%s DockitParameters (s) created" % process_id) # TODO: How to release the target process when this leaves ? try: dockit.start_processing(DockitParameters) except Exception as exc: logging.error("SendEvents caught (stderr): %s" % exc) logging.info("SendEvents after processing") def Main(): if lib_util.is_snapshot_behaviour(): logging.debug("system calls snapshot") Snapshot() else: logging.debug("system calls events") try: SendEvents() except Exception as err: logging.error("Caught:%s" % err) raise if __name__ == '__main__': Main()
nilq/baby-python
python
from .video_resnet_triplet_attention import encoder as encoder_attention from .video_resnet_triplet_bilinear import encoder as encoder_bilinear from .video_resnet_triplet_gap import encoder as encoder_gap from .video_resnet_triplet_mxp import encoder as encoder_mxp from .video_resnet_triplet_frame_wise import encoder as encoder_frame_wise __all__ = [ 'encoder_attention', 'encoder_bilinear', 'encoder_gap', 'encoder_mxp', 'encoder_frame_wise' ]
nilq/baby-python
python
# -*- coding: utf-8 -*- # Copyright 2018 The Chromium OS Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Module for creating clang-tidy builds.""" from __future__ import print_function from chromite.cbuildbot import manifest_version from chromite.cbuildbot.builders import generic_builders from chromite.cbuildbot.stages import artifact_stages from chromite.cbuildbot.stages import build_stages from chromite.cbuildbot.stages import chrome_stages from chromite.cbuildbot.stages import sync_stages class ClangTidyBuilder(generic_builders.Builder): """Builder that creates builds for clang-tidy warnings in Chrome OS.""" def GetVersionInfo(self): """Returns the CrOS version info from the chromiumos-overlay.""" return manifest_version.VersionInfo.from_repo(self._run.buildroot) def GetSyncInstance(self): """Returns an instance of a SyncStage that should be run.""" return self._GetStageInstance(sync_stages.ManifestVersionedSyncStage) def RunStages(self): """Run stages for clang-tidy builder.""" assert len(self._run.config.boards) == 1 board = self._run.config.boards[0] self._RunStage(build_stages.UprevStage) self._RunStage(build_stages.InitSDKStage) self._RunStage(build_stages.SetupBoardStage, board) self._RunStage(chrome_stages.SyncChromeStage) self._RunStage(build_stages.BuildPackagesStage, board) self._RunStage(artifact_stages.GenerateTidyWarningsStage, board)
nilq/baby-python
python
from django.shortcuts import render from rest_framework import status, generics, viewsets, views from rest_framework.decorators import api_view from rest_framework.response import Response from django_filters.rest_framework import DjangoFilterBackend from .models import People, Companies from . import serializers class FruitsAndVegetablesViewset(viewsets.ReadOnlyModelViewSet): """ Given a person index (id, name or guid) returns a list of fruits and vegetables they like. """ queryset = People.objects.all() serializer_class = serializers.FruitsVegetablesSerializer filter_backends = (DjangoFilterBackend,) filter_fields = ('_id', 'name', 'guid', 'index') class CompanyEmployeesViewset(viewsets.ReadOnlyModelViewSet): """ Given a company index (or name) returns all its employees. """ queryset = Companies.objects.all() serializer_class = serializers.CompaniesEmployeesSerializer filter_backends = (DjangoFilterBackend,) filter_fields = ('index', 'company') class TwoPeopleView(views.APIView): """ Given 2 people, provides their information and the list of their friends in common which have brown eyes and are still alive. """ def get(self, request, pk1, pk2, format=None): people = People.objects.filter(index__in=(pk1, pk2)) if people.count() != 2: return Response({}) common_friends = people[0].friends.all().intersection(people[1].friends.all()) common_friends.filter(eyeColor='brown', has_died=False) twopeople = { 'person1': people[0], 'person2': people[1], 'common_friends': common_friends } serializer = serializers.TwoPeopleSerializer(twopeople) return Response(serializer.data)
nilq/baby-python
python
from django.db import models # Create your models here. class Locker(models.Model): is_using = models.BooleanField(default=False)
nilq/baby-python
python
# coding=utf-8 # Copyright 2014 Janusz Skonieczny """ Gra w kółko i krzyżyk """ import pygame import pygame.locals import logging # Konfiguracja modułu logowania, element dla zaawansowanych logging_format = '%(asctime)s %(levelname)-7s | %(module)s.%(funcName)s - %(message)s' logging.basicConfig(level=logging.DEBUG, format=logging_format, datefmt='%H:%M:%S') logging.getLogger().setLevel(logging.INFO) class Board(object): """ Plansza do gry. Odpowiada za rysowanie okna gry. """ def __init__(self, width): """ Konstruktor planszy do gry. Przygotowuje okienko gry. :param width: szerokość w pikselach """ self.surface = pygame.display.set_mode((width, width), 0, 32) pygame.display.set_caption('Tic-tac-toe') # Przed pisaniem tekstów, musimy zainicjować mechanizmy wyboru fontów PyGame pygame.font.init() font_path = pygame.font.match_font('arial') self.font = pygame.font.Font(font_path, 48) # tablica znaczników 3x3 w formie listy self.markers = [None] * 9 def draw(self, *args): """ Rysuje okno gry :param args: lista obiektów do narysowania """ background = (0, 0, 0) self.surface.fill(background) self.draw_net() self.draw_markers() self.draw_score() for drawable in args: drawable.draw_on(self.surface) # dopiero w tym miejscu następuje fatyczne rysowanie # w oknie gry, wcześniej tylko ustalaliśmy co i jak ma zostać narysowane pygame.display.update() def draw_net(self): """ Rysuje siatkę linii na planszy """ color = (255, 255, 255) width = self.surface.get_width() for i in range(1, 3): pos = width / 3 * i # linia pozioma pygame.draw.line(self.surface, color, (0, pos), (width, pos), 1) # linia pionowa pygame.draw.line(self.surface, color, (pos, 0), (pos, width), 1) def player_move(self, x, y): """ Ustawia na planszy znacznik gracza X na podstawie współrzędnych w pikselach """ cell_size = self.surface.get_width() / 3 x /= cell_size y /= cell_size self.markers[int(x) + int(y) * 3] = player_marker(True) def draw_markers(self): """ Rysuje znaczniki graczy """ box_side = self.surface.get_width() / 3 for x in range(3): for y in range(3): marker = self.markers[x + y * 3] if not marker: continue # zmieniamy współrzędne znacznika # na współrzędne w pikselach dla centrum pola center_x = x * box_side + box_side / 2 center_y = y * box_side + box_side / 2 self.draw_text(self.surface, marker, (center_x, center_y)) def draw_text(self, surface, text, center, color=(180, 180, 180)): """ Rysuje wskazany tekst we wskazanym miejscu """ text = self.font.render(text, True, color) rect = text.get_rect() rect.center = center surface.blit(text, rect) def draw_score(self): """ Sprawdza czy gra została skończona i rysuje właściwy komunikat """ if check_win(self.markers, True): score = u"Wygrałeś(aś)" elif check_win(self.markers, True): score = u"Przegrałeś(aś)" elif None not in self.markers: score = u"Remis!" else: return i = self.surface.get_width() / 2 self.draw_text(self.surface, score, center=(i, i), color=(255, 26, 26)) class TicTacToeGame(object): """ Łączy wszystkie elementy gry w całość. """ def __init__(self, width, ai_turn=False): """ Przygotowanie ustawień gry :param width: szerokość planszy mierzona w pikselach """ pygame.init() # zegar którego użyjemy do kontrolowania szybkości rysowania # kolejnych klatek gry self.fps_clock = pygame.time.Clock() self.board = Board(width) self.ai = Ai(self.board) self.ai_turn = ai_turn def run(self): """ Główna pętla gry """ while not self.handle_events(): # działaj w pętli do momentu otrzymania sygnału do wyjścia self.board.draw() if self.ai_turn: self.ai.make_turn() self.ai_turn = False self.fps_clock.tick(15) def handle_events(self): """ Obsługa zdarzeń systemowych, tutaj zinterpretujemy np. ruchy myszką :return True jeżeli pygame przekazał zdarzenie wyjścia z gry """ for event in pygame.event.get(): if event.type == pygame.locals.QUIT: pygame.quit() return True if event.type == pygame.locals.MOUSEBUTTONDOWN: if self.ai_turn: # jeśli jeszcze trwa ruch komputera to ignorujemy zdarzenia continue # pobierz aktualną pozycję kursora na planszy mierzoną w pikselach x, y = pygame.mouse.get_pos() self.board.player_move(x, y) self.ai_turn = True class Ai(object): """ Kieruje ruchami komputera na podstawie analizy położenia znaczników """ def __init__(self, board): self.board = board def make_turn(self): """ Wykonuje ruch komputera """ if not None in self.board.markers: # brak dostępnych ruchów return logging.debug("Plansza: %s" % self.board.markers) move = self.next_move(self.board.markers) self.board.markers[move] = player_marker(False) @classmethod def next_move(cls, markers): """ Wybierz następny ruch komputera na podstawie wskazanej planszy :param markers: plansza gry :return: index tablicy jednowymiarowe w której należy ustawić znacznik kółka """ # pobierz dostępne ruchy wraz z oceną moves = cls.score_moves(markers, False) # wybierz najlepiej oceniony ruch score, move = max(moves, key=lambda m: m[0]) logging.info("Dostępne ruchy: %s", moves) logging.info("Wybrany ruch: %s %s", move, score) return move @classmethod def score_moves(cls, markers, x_player): """ Ocenia rekurencyjne możliwe ruchy Jeśli ruch jest zwycięstwem otrzymuje +1, jeśli przegraną -1 lub 0 jeśli nie nie ma zwycięscy. Dla ruchów bez zwycięscy rekreacyjnie analizowane są kolejne ruchy a suma ich punktów jest wynikiem aktualnego ruchu. :param markers: plansza na podstawie której analizowane są następne ruchy :param x_player: True jeśli ruch dotyczy gracza X, False dla gracza O """ # wybieramy wszystkie możliwe ruchy na podstawie wolnych pól available_moves = (i for i, m in enumerate(markers) if m is None) for move in available_moves: from copy import copy # tworzymy kopię planszy która na której testowo zostanie # wykonany ruch w celu jego późniejszej oceny proposal = copy(markers) proposal[move] = player_marker(x_player) # sprawdzamy czy ktoś wygrywa gracz którego ruch testujemy if check_win(proposal, x_player): # dodajemy punkty jeśli to my wygrywamy # czyli nie x_player score = -1 if x_player else 1 yield score, move continue # ruch jest neutralny, # sprawdzamy rekurencyjne kolejne ruchy zmieniając gracza next_moves = list(cls.score_moves(proposal, not x_player)) if not next_moves: yield 0, move continue # rozdzielamy wyniki od ruchów scores, moves = zip(*next_moves) # sumujemy wyniki możliwych ruchów, to będzie nasz wynik yield sum(scores), move def player_marker(x_player): """ Funkcja pomocnicza zwracająca znaczniki graczy :param x_player: True dla gracza X False dla gracza O :return: odpowiedni znak gracza """ return "X" if x_player else "O" def check_win(markers, x_player): """ Sprawdza czy przekazany zestaw znaczników gry oznacza zwycięstwo wskazanego gracza :param markers: jednowymiarowa sekwencja znaczników w :param x_player: True dla gracza X False dla gracza O """ win = [player_marker(x_player)] * 3 seq = range(3) # definiujemy funkcję pomocniczą pobierającą znacznik # na podstawie współrzędnych x i y def marker(xx, yy): return markers[xx + yy * 3] # sprawdzamy każdy rząd for x in seq: row = [marker(x, y) for y in seq] if row == win: return True # sprawdzamy każdą kolumnę for y in seq: col = [marker(x, y) for x in seq] if col == win: return True # sprawdzamy przekątne diagonal1 = [marker(i, i) for i in seq] diagonal2 = [marker(i, abs(i-2)) for i in seq] if diagonal1 == win or diagonal2 == win: return True # Ta część powinna być zawsze na końcu modułu (ten plik jest modułem) # chcemy uruchomić naszą grę dopiero po tym jak wszystkie klasy zostaną zadeklarowane if __name__ == "__main__": game = TicTacToeGame(300) game.run()
nilq/baby-python
python
from django.db import models # Create your models here. # Con este archivo creo lo necesario para importar luego otro archivo que finalizara creando una BD en postgres # Los metodos STR son los que van a mostrarse en la pagina en django class Domicilio(models.Model): calle = models.CharField(max_length=255) no_calle = models.IntegerField() pais = models.CharField(max_length=255) def __str__(self): cadena = f'Domicilio {self.id}: {self.calle} {self.no_calle} {self.pais}' return cadena class Persona(models.Model): nombre = models.CharField(max_length=255) apellido = models.CharField(max_length=255) email = models.CharField(max_length=255) domicilio = models.ForeignKey(Domicilio, on_delete=models.SET_NULL, null=True) #domicilio = models.ForeignKey(Domicilio, on_delete=models.CASCADE(), null=True) # Esto es para que si se borra de una tabla se borra en cascada en la otra def __str__(self): cadena = f'Persona {self.id}: {self.nombre} {self.apellido} {self.email}' return cadena
nilq/baby-python
python
from PyObjCTools.TestSupport import * from Foundation import * try: unicode except NameError: unicode = str class TestNSLinguisticTagger (TestCase): @min_os_level('10.7') def testConstants(self): self.assertIsInstance(NSLinguisticTagSchemeTokenType, unicode) self.assertIsInstance(NSLinguisticTagSchemeLexicalClass, unicode) self.assertIsInstance(NSLinguisticTagSchemeNameType, unicode) self.assertIsInstance(NSLinguisticTagSchemeNameTypeOrLexicalClass, unicode) self.assertIsInstance(NSLinguisticTagSchemeLemma, unicode) self.assertIsInstance(NSLinguisticTagSchemeLanguage, unicode) self.assertIsInstance(NSLinguisticTagSchemeScript, unicode) self.assertIsInstance(NSLinguisticTagWord, unicode) self.assertIsInstance(NSLinguisticTagPunctuation, unicode) self.assertIsInstance(NSLinguisticTagWhitespace, unicode) self.assertIsInstance(NSLinguisticTagOther, unicode) self.assertIsInstance(NSLinguisticTagNoun, unicode) self.assertIsInstance(NSLinguisticTagVerb, unicode) self.assertIsInstance(NSLinguisticTagAdjective, unicode) self.assertIsInstance(NSLinguisticTagAdverb, unicode) self.assertIsInstance(NSLinguisticTagPronoun, unicode) self.assertIsInstance(NSLinguisticTagDeterminer, unicode) self.assertIsInstance(NSLinguisticTagParticle, unicode) self.assertIsInstance(NSLinguisticTagPreposition, unicode) self.assertIsInstance(NSLinguisticTagNumber, unicode) self.assertIsInstance(NSLinguisticTagConjunction, unicode) self.assertIsInstance(NSLinguisticTagInterjection, unicode) self.assertIsInstance(NSLinguisticTagClassifier, unicode) self.assertIsInstance(NSLinguisticTagIdiom, unicode) self.assertIsInstance(NSLinguisticTagOtherWord, unicode) self.assertIsInstance(NSLinguisticTagSentenceTerminator, unicode) self.assertIsInstance(NSLinguisticTagOpenQuote, unicode) self.assertIsInstance(NSLinguisticTagCloseQuote, unicode) self.assertIsInstance(NSLinguisticTagOpenParenthesis, unicode) self.assertIsInstance(NSLinguisticTagCloseParenthesis, unicode) self.assertIsInstance(NSLinguisticTagWordJoiner, unicode) self.assertIsInstance(NSLinguisticTagDash, unicode) self.assertIsInstance(NSLinguisticTagOtherPunctuation, unicode) self.assertIsInstance(NSLinguisticTagParagraphBreak, unicode) self.assertIsInstance(NSLinguisticTagOtherWhitespace, unicode) self.assertIsInstance(NSLinguisticTagPersonalName, unicode) self.assertIsInstance(NSLinguisticTagPlaceName, unicode) self.assertIsInstance(NSLinguisticTagOrganizationName, unicode) self.assertEqual(NSLinguisticTaggerOmitWords, 1 << 0) self.assertEqual(NSLinguisticTaggerOmitPunctuation, 1 << 1) self.assertEqual(NSLinguisticTaggerOmitWhitespace, 1 << 2) self.assertEqual(NSLinguisticTaggerOmitOther, 1 << 3) self.assertEqual(NSLinguisticTaggerJoinNames, 1 << 4) @min_os_level('10.7') def testMethods(self): self.assertArgHasType(NSLinguisticTagger.orthographyAtIndex_effectiveRange_, 1, b'o^' + NSRange.__typestr__) self.assertArgIsBlock(NSLinguisticTagger.enumerateTagsInRange_scheme_options_usingBlock_, 3, b'v@' + NSRange.__typestr__ + NSRange.__typestr__ + b'o^' + objc._C_NSBOOL) self.assertArgHasType(NSLinguisticTagger.tagAtIndex_scheme_tokenRange_sentenceRange_, 2, b'o^' + NSRange.__typestr__) self.assertArgHasType(NSLinguisticTagger.tagAtIndex_scheme_tokenRange_sentenceRange_, 3, b'o^' + NSRange.__typestr__) self.assertArgHasType(NSLinguisticTagger.tagsInRange_scheme_options_tokenRanges_, 3, b'o^@') self.assertArgHasType(NSLinguisticTagger.possibleTagsAtIndex_scheme_tokenRange_sentenceRange_scores_, 2, b'o^' + NSRange.__typestr__) self.assertArgHasType(NSLinguisticTagger.possibleTagsAtIndex_scheme_tokenRange_sentenceRange_scores_, 3, b'o^' + NSRange.__typestr__) self.assertArgHasType(NSLinguisticTagger.possibleTagsAtIndex_scheme_tokenRange_sentenceRange_scores_, 4, b'o^@') self.assertArgIsOut(NSString.linguisticTagsInRange_scheme_options_orthography_tokenRanges_, 4) self.assertArgIsBlock(NSString.enumerateLinguisticTagsInRange_scheme_options_orthography_usingBlock_, 4, b'v@' + NSRange.__typestr__ + NSRange.__typestr__ + b'o^' + objc._C_NSBOOL) if __name__ == "__main__": main()
nilq/baby-python
python
# Written by Jeremy Lee, 2020-10-30 from django.conf import settings from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('umap', '0007_auto_20190416_1757'), migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.AlterField( model_name='map', name='share_status', field=models.SmallIntegerField(choices=[(1, 'everyone (public)'), (2, 'anyone with link'), (3, 'editors only'), (4, 'viewers and editors'), (5, 'authenticated'), (9, 'blocked')], default=1, verbose_name='share status'), ), migrations.AddField( model_name='map', name='viewers', field=models.ManyToManyField(blank=True, to=settings.AUTH_USER_MODEL, verbose_name='viewers', related_name='map_viewers'), ), migrations.AlterField( model_name='map', name='editors', field=models.ManyToManyField(blank=True, to=settings.AUTH_USER_MODEL, verbose_name='editors', related_name='map_editors'), ), ]
nilq/baby-python
python
from pyomo.core import * class Model: model = AbstractModel() model.T = Set() # Index Set for time steps of optimization horizon model.S = Set() # Index Set for time steps of optimization horizon ################################## PARAMETERS ################################# ################################################################################################ # definition of the PV model.P_PV = Param(model.S, model.T, within=NonNegativeReals) # PV PMPP forecast model.P_Load = Param(model.T, within=NonNegativeReals)
nilq/baby-python
python
""" This module contains event handlers related to the restart options after a Codenames game ends. """ from flask_socketio import emit, leave_room from flask_login import current_user from app import socketio, db from app.models.user_data import UserData from app.games.codenames.models import CodenamesTeams from app.utils import is_admin from .constants import NAMESPACE, STATE_KEYS, TEAMS, STATES, SPYMASTER from .utils import is_codenames_player, player_distribution_is_valid, create_word_list ######################################################################### # # # EVENT HANDLERS # # ================== # # # # EVENTS EXPLANATION # # # # restart Fired when the room admin chooses the # # "Start a new game" option. # # # # restart_with_same_teams Fired when the room admin chooses the # # restart with same teams option. # # # ######################################################################### @socketio.on("restart", namespace=NAMESPACE) @is_codenames_player @is_admin def on_restart(): """ Handles the restart_with_same_teams event. This is fired when the room admin choses to start a new game. """ if not current_user.room.codenames_room.state == STATES.GAME_OVER: return emit("set_state", {STATE_KEYS.GAME_STATE: STATES.JOIN}, room=current_user.room_id) team = CodenamesTeams.query.filter_by( room_id=current_user.room_id, team_name=TEAMS.NEUTRAL ).first() current_user.room.codenames_room.state = STATES.JOIN current_user.room.codenames_room.state_details = None team_list = dict() team_list["players"] = [] users = UserData.query.filter_by(room_id=current_user.room_id) for user in users: leave_room(user.room_id + user.codenames_player.team.team_name) user.codenames_player.team = team team_list["players"].append( {"id": user.id, "user": user.username, "team": TEAMS.NEUTRAL} ) if user.codenames_player.spymaster_of is not None: user.codenames_player.spymaster_of.spymaster = None db.session.commit() team_list["currentTeam"] = TEAMS.NEUTRAL team_list["state"] = STATES.JOIN team_list[TEAMS.BLUE + SPYMASTER] = None team_list[TEAMS.RED + SPYMASTER] = None emit("team_list", team_list, room=current_user.room_id) @socketio.on("restart_with_same_teams", namespace=NAMESPACE) @is_codenames_player @is_admin def on_restart_with_same_teams(): """ Handles the restart_with_same_teams event. This is fired when the room admin choses to start a new game with the same teams. """ if not current_user.room.codenames_room.state == STATES.GAME_OVER: return if ( current_user.room.codenames_room.state_details == TEAMS.BLUE + SPYMASTER or current_user.room.codenames_room.state_details == TEAMS.RED + SPYMASTER ): return if not player_distribution_is_valid: return current_user.room.codenames_room.state = STATES.STARTED current_user.room.codenames_room.turns_left = 0 db.session.commit() emit( "set_state", {STATE_KEYS.GAME_STATE: STATES.STARTED}, room=current_user.room_id ) create_word_list()
nilq/baby-python
python
from pyg_base import is_num, is_ts, df_concat import pandas as pd import numpy as np import numba @numba.njit def _p(x, y, vol = 0): if vol == 0: return 1. if x<y else -1. if x>y else 0.0 else: one_sided_tail = 0.5 * np.exp(-abs(y-x)/vol) return 1-one_sided_tail if x<y else one_sided_tail @numba.njit def _xrank(a, w, b, vol, scale = 0 , reweight = False): """ performs a cross-sectional rank a = np.random.normal(0,1,20) a[np.random.normal(0,1,20) > 1] = np.nan w = np.full(20, 1.) b = np.full(20, 1.) scale = 0; vol = -1; reweight = False a _xrank(a, w, b, vol) ranks a from -1 to +1 such that: i) a[i] < a[j] ==> rank[i] < rank[j] ii) rank[i] in (-1, 1) iii) \sum w[i] rank[i] = 0 Parameters ---------- a : TYPE DESCRIPTION. w : TYPE DESCRIPTION. b : TYPE DESCRIPTION. vol : TYPE DESCRIPTION. scale : TYPE, optional DESCRIPTION. The default is 0. reweight : TYPE, optional DESCRIPTION. The default is False. Returns ------- None. """ not_ok = np.isnan(a) ok = ~not_ok if np.max(not_ok): a = a.copy(); w = w.copy(); b = b.copy() a[not_ok] = 0.0 b[not_ok] = 0.0 w[not_ok] = 0.0 wb = w * b total_wb = np.sum(wb) if total_wb == 0: return np.full_like(a, np.nan) else: r = np.zeros_like(a) wb = wb / total_wb if vol < 0: wba = wb * a m1 = np.sum(wba) m2 = np.sum(wba * a) vol = (m2 - m1**2) ** 0.5 for i in range(a.shape[0]): if ok[i] and w[i]!=0: for j in range(i): if ok[j] and w[j]!=0: qq = _p(a[i], a[j], vol) pp = 1-qq r[i] += (2*pp-1) * wb[j] r[j] += (2*qq-1) * wb[i] if scale == 0: std = 1 elif scale == 1: # scale weightes so that total weight = 1 total_w = np.sum(w) w = w / total_w std = np.sum((w*r)**2*(1-b**2)) ** 0.5 r = r/std elif scale == 2: std = (np.sum(r**2) - np.sum(r)**2) ** 0.5 r = r/std elif scale == 3: total_w = np.sum(w) w = w / total_w std = np.sum(w*(r**2)) ** 0.5 r = r/std r[not_ok] = np.nan if reweight: r = r * w return r @numba.njit def _xrank_2d(a, w, b, vol, scale, reweight): res = np.empty_like(a) for i in range(a.shape[0]): res[i] = _xrank(a = a[i], w = w[i], b = b[i], vol = vol[i], scale = scale , reweight = reweight) return res def xrank(a, weight = None, beta = None, vol = True, scale = 0 , reweight = False, columns = None): """ performs a cross-sectional rank a = np.random.normal(0,1,20) a[np.random.normal(0,1,20) > 1] = np.nan w = np.full(20, 1.) b = np.full(20, 1.) scale = 0; vol = -1; reweight = False a _xrank(a, w, b, vol) ranks a from -1 to +1 such that: i) a[i] < a[j] ==> rank[i] < rank[j] ii) rank[i] in (-1, 1) iii) \sum w[i] rank[i] = 0 Parameters ---------- a : TYPE DESCRIPTION. w : TYPE DESCRIPTION. b : TYPE DESCRIPTION. vol : TYPE DESCRIPTION. scale : TYPE, optional DESCRIPTION. The default is 0. reweight : TYPE, optional DESCRIPTION. The default is False. Returns ------- None. :Example: --------- >>> a = pd.DataFrame(np.random.normal(0,1,(1000,20)), drange(-999)) >>> aa = cumsum(a) >>> aa.plot() >>> beta = weight = None >>> vol = True; scale = 0; columns = None >>> res = xrank(aa) >>> res.plot() """ a = df_concat(a, columns).ffill() index = a.index cols = a.columns a_ = a.values if weight is None: w = np.full_like(a_, 1.) elif is_num(weight): w = np.full_like(a_, weight) else: w = df_concat(weight, columns).reindex(index, method = 'ffill') if beta is None: b = np.full_like(a_, 1.) elif is_num(beta): b = np.full_like(a_, beta) else: b = df_concat(beta, columns).reindex(index, method = 'ffill') if vol is True: vol = -1 if is_ts(vol): vol - vol.reindex(index, method = 'ffill') if isinstance(vol, pd.DataFrame) and vol.shape[1] == 1: vol = vol.iloc[:,0] else: vol = np.full(a_.shape[0], vol) b, w, vol = [df.values if is_ts(df) else df for df in (b,w,vol)] res = _xrank_2d(a_, w, b, vol, scale, reweight) return pd.DataFrame(res, index, cols)
nilq/baby-python
python
from .data import * from .selector import * from .utils import * from .dataset import *
nilq/baby-python
python
# Search for lines that start 'X' followed by any non whitespace # characters and ':' then output the first group of non whitespace # characters that follows import re hand = open('mbox-short.txt') for line in hand: line = line.rstrip() x = re.findall('^X\S*: (\S+)', line) if not x: continue print(x)
nilq/baby-python
python
from datetime import datetime import numpy as np from multiprocessing import Pool, cpu_count import os import sys import torch import torch.nn as nn import torch.nn.functional as F from torch.utils.tensorboard import SummaryWriter from .utils.preprocess_conllu import * from .utils.helpers import * from .utils.tools import * from .models import * # TODO put this in a config file fcodebook = "/home/leo/projects/minibrain/predictors/sequence/text/utf8-codes/utf8_codebook_overfit_matrix_2seg_dim64.npy" utf8codematrix = "/home/leo/projects/minibrain/predictors/sequence/text/utf8-codes/utf8_code_matrix_2seg.npy" dataset_train = "/home/leo/projects/Datasets/text/UniversalDependencies/ud-treebanks-v2.5/traindev_np_batches_779000x3x1024_uint16.npy" BASE_DATA_DIR_UD_TREEBANK = "/home/leo/projects/Datasets/text/UniversalDependencies/ud-treebanks-v2.5" # cuda seems to reverse the GPU ids with CUDA id so ... mess # Cuda maps cuda:0 to my RTX 2080ti (GPU#1) and # Cuda maps cuda:1 to my GTX 1080 (GPU#0) device = torch.device("cuda:0" if torch.cuda.is_available() else "cpu") # device = torch.device("cuda:1" if torch.cuda.is_available() else "cpu") def train_test(model, checkpoint_path, base_name, max_seq_len=384, test_loss=True, test_accuracy=False, max_data=45): model = model.to(device) data_train = np.load(dataset_train) # optimizer = torch.optim.AdamW(model.parameters(), lr=1e-4, weight_decay=1e-4) optimizer = torch.optim.AdamW(model.parameters()) # loss_function = F.nll_loss loss_function = pos_loss_function epoch_size = 10000 batch_size = 50 # TODO tis is for testing purposes data = data_train # data = data_train[-1000 * batch_size:, :, :] # just for the trials, use the last 1000 batches only test_data = None if test_loss: test_data = load_test_data(BASE_DATA_DIR_UD_TREEBANK, max_data) epochs = chunks(data, epoch_size, dim=0) epoch_count = 1 for e in epochs: batches = chunks(e, batch_size, dim=0) train(model, optimizer, loss_function, batches, epoch_count, epoch_size, device, max_seq_len) torch.cuda.empty_cache() # checkpoint cid = f"{epoch_count:04}" # cid = str(epoch_count).zfill(4) model.save_checkpoint(checkpoint_path, base_name, cid) # TODO test loss and accuracy to be measured in CPU (or another GPU) # with batches bigger than 50 my GPU is out of memory if test_loss: test(model, loss_function, test_data, epoch_count, device, max_data, max_seq_len) torch.cuda.empty_cache() if test_accuracy: test_accuracy(model, test_data, epoch_count, device, max_data) torch.cuda.empty_cache() epoch_count += 1 # model.network.save_model("./trained_models/conv1dcol", "conv1dcol_nll-loss_epoch-{}".format(epoch_count)) def test_async(checkpoint_path, test_data_path, epoch_count, device, max_data, test_acc=False): # load checkpoint # model is hardcoded for the moment utf8codes = np.load(fcodebook) utf8codes = utf8codes.reshape(1987, 64) model = GatedConv1DPoS(utf8codes).to(device) model.load_checkpoint(checkpoint_path) test_data = load_test_data(test_data_path) print("launching test in CPU") test(model, pos_loss_function, test_data, epoch_count, device, max_data) if test_acc: print("launching Accuracy test in CPU") test_accuracy(model, test_data, epoch_count, device, max_data) def test_acc_async(checkpoint_path, test_data_path, epoch_count, device, max_data): # load checkpoint # model is hardcoded for the moment utf8codes = np.load(fcodebook) utf8codes = utf8codes.reshape(1987, 64) model = GatedConv1DPoS(utf8codes).to(device) model.load_checkpoint(checkpoint_path) test_data = load_test_data(test_data_path) print("launching Accuracy test in CPU") test_accuracy(model, test_data, epoch_count, device, max_data) def err_ckb(err): print("error with the subprocess ", err) # Note this is TOO slow, GPU test is 30-50 times faster than in CPU, so CPU not useful for practical purposes def train_cputest(model, checkpoint_path, base_name, test_accuracy=True, max_data=45): pool = Pool(cpu_count() - 2) model = model.to(device) data_train = np.load(dataset_train) # optimizer = torch.optim.AdamW(model.parameters(), lr=1e-4, weight_decay=1e-4) optimizer = torch.optim.AdamW(model.parameters()) # loss_function = F.nll_loss loss_function = pos_loss_function epoch_size = 10000 batch_size = 50 # TODO this is for testing purposes data = data_train # data = data_train[-1000*batch_size:, :, :] # just for the trials, use the last 1000 batches only epochs = chunks(data, epoch_size, dim=0) epoch_count = 1 for e in epochs: batches = chunks(e, batch_size, dim=0) train(model, optimizer, loss_function, batches, epoch_count, epoch_size, device) torch.cuda.empty_cache() # checkpoint cid = f"{epoch_count:04}" # cid = str(epoch_count).zfill(4) fchkpoint = model.save_checkpoint(checkpoint_path, base_name, cid) # test loss and accuracy to be measured in CPU (or another GPU) # with batches bigger than less than 50 my GPU is out of memory res_test = pool.apply_async(test_async, [fchkpoint, BASE_DATA_DIR_UD_TREEBANK, epoch_count, device, max_data], error_callback=err_ckb) if test_accuracy: res_acc = pool.apply_async(test_acc_async, [fchkpoint, BASE_DATA_DIR_UD_TREEBANK, epoch_count, device, max_data], error_callback=err_ckb) torch.cuda.empty_cache() epoch_count += 1 # model.network.save_model("./trained_models/conv1dcol", "conv1dcol_nll-loss_epoch-{}".format(epoch_count)) def old_main_conv1d(): utf8codes = np.load(fcodebook) utf8codes = utf8codes.reshape(1987, 64) model = OLD_Conv1DPoS(utf8codes) path = "./trained_models/conv1dcol" base_name = "conv1dcol_nll-loss" train_test(model, path, base_name) def old_main_gatedconv1d(): utf8codes = np.load(fcodebook) utf8codes = utf8codes.reshape(1987, 64) model = GatedConv1DPoS(utf8codes) path = "./trained_models/GatedConv1DCol" base_name = "GatedConv1DPoS_nll-loss" train_test(model, path, base_name) def main_conv1dcolnet(): utf8codes = np.load(utf8codematrix) # utf8codes = utf8codes.reshape(1987, 324) encoder = Conv1DColNet(transpose_output=True) # use default parameters decoder = LinearUposDeprelDecoder(transpose_input=False) model = NetContainer(utf8codes, encoder, decoder) path = "./trained_models/Conv1dColNet_try3" base_name = "Conv1dColNet_nll-loss" train_test(model, path, base_name) CONV1D_PRETRAIN_FILE = "/home/leo/projects/minibrain/predictors/sequence/text/trained_models/Conv1dColNet/Conv1dColNet_nll-loss_0078.state_dict.pth" def main_convattnet(conv1d_pretrain_file=CONV1D_PRETRAIN_FILE): utf8codes = np.load(utf8codematrix) # utf8codes = utf8codes.reshape(1987, 324) # the convolutional encoder must NOT be retrained (that is what I'm trying to test) with torch.no_grad(): conv1d_encoder = Conv1DColNet(transpose_output=False) # use default parameters conv1d_decoder = LinearUposDeprelDecoder(transpose_input=False) conv1d_model = NetContainer(utf8codes, conv1d_encoder, conv1d_decoder) # load pre-trained conv1dcolnet # conv1d_model.load_checkpoint(conv1d_pretrain_file) # cleanup things that we'll not use, we just need the encoder del conv1d_model del conv1d_decoder torch.cuda.empty_cache() # conv1d_encoder = Conv1DColNet(transpose_output=False) # use default parameters encoder = ConvAttColNet(conv1d_encoder, transpose_output=False) decoder = LinearUposDeprelDecoder(transpose_input=False) model = NetContainer(utf8codes, encoder, decoder) print("Starting training for model with column type ConvAttNetCol and pretrained Conv1dColNet") print("Parameter model details: ") print("conv1d_encoder parameters {} from which {} are trainable ". format(count_parameters(conv1d_encoder), count_parameters(conv1d_encoder))) print("ConvAttColNet parameters {} from which {} are trainable ". format(count_parameters(encoder), count_parameters(encoder))) print("decoder parameters {} from which {} are trainable ". format(count_parameters(decoder), count_parameters(decoder))) print("Total model parameters {} from which {} are trainable ". format(count_parameters(model), count_parameters(model))) path = "./trained_models/ConvAttNet" base_name = "ConvAttNet_nll-loss" train_test(model, path, base_name, max_seq_len=384, max_data=60)
nilq/baby-python
python
import sys, re from mk_yaml_ontology import ont_node, dump_yaml def replace_token(pattern, replacement, s): replacement = f' {replacement} ' s = re.sub(f' ?{pattern} ', replacement, s) s = re.sub(f' {pattern} ?', replacement, s) return s def mk_ont_node(line_string): fields = line_string.split("\t") assert(len(fields) >= 4) var_name = fields[0].strip() description = fields[3].strip() description = replace_token("C", "carbon", description) description = replace_token("CO2", "carbon dioxide", description) description = replace_token("CH2O", "formaldehyde", description) description = replace_token("N", "nitrogen", description) description = replace_token("NH3", "ammonia", description) description = replace_token("NH4", "ammonium", description) description = replace_token("NO3", "nitrate", description) description = replace_token("P", "phosphorus", description) return ont_node(var_name, [description], None, add_name = False) # the name isn't in a format we can use def main(): flat_file = sys.argv[1] ont_file = sys.argv[2] ont_name = sys.argv[3] with open(flat_file, "r") as f: _ = f.readline() # read header lines = [line.rstrip() for line in f.readlines()] nodes = [mk_ont_node(line) for line in lines] dump_yaml(nodes, ont_file, ont_name) main()
nilq/baby-python
python
import os import pytest from aztk.models.plugins import PluginConfiguration from aztk.models.plugins.internal import PluginManager from aztk.error import InvalidPluginReferenceError dir_path = os.path.dirname(os.path.realpath(__file__)) fake_plugin_dir = os.path.join(dir_path, "fake_plugins") def RequiredArgPlugin(req_arg): return PluginConfiguration(name="required-arg") def test_missing_plugin(): plugin_manager = PluginManager() message = "Cannot find a plugin with name .*" with pytest.raises(InvalidPluginReferenceError, match=message): plugin_manager.get_plugin("non-existing-plugin") def test_extra_args_plugin(): plugin_manager = PluginManager() message = "Plugin JupyterPlugin doesn't have an argument called 'invalid'" with pytest.raises(InvalidPluginReferenceError, match=message): plugin_manager.get_plugin("jupyter", args=dict(invalid="foo")) def test_missing_required_arg(): plugin_manager = PluginManager() plugin_manager.plugins["required-arg"] = RequiredArgPlugin message = "Missing a required argument req_arg for plugin RequiredArgPlugin" with pytest.raises(InvalidPluginReferenceError, match=message): plugin_manager.get_plugin("required-arg")
nilq/baby-python
python
from abt.cli import main
nilq/baby-python
python
import asyncio import logging from rsp1570serial.discovery import discover_source_aliases if __name__ == "__main__": logging.basicConfig( level=logging.INFO, format="%(asctime)s %(levelname)s:%(message)s" ) # asyncio.run(discover_source_aliases("socket://192.168.50.211:50002")) asyncio.run(discover_source_aliases())
nilq/baby-python
python
from copy import deepcopy class ensemble: def __init__(self, obj): self.vals = {None: (None,obj)} def get(self): if self.vals is None: return self.val if len(self.vals)==1: for nm in self.vals.values(): return nm[1] return self def add(self, guard, obj): if id(obj) in self.vals: (g,obj) = self.vals[id(obj)] self.vals[id(obj)] = (g|guard,obj) else: self.vals[id(obj)] = (guard,obj) def __call__(self): if self.vals is not None: self.val = self.vals[None][1] for (g,obj) in self.vals.values(): if g is None: continue if isinstance(obj,ensemble): obj=obj() self.val = g.if_else(obj,self.val) self.vals = None return self.val class values: def __init__(self): self.dic = {} def __getitem__(self, var): if not var in self.dic: raise NameError("name '" + var + "' is not always set") if isinstance(self.dic[var], ensemble): # print("ifthenelsing", var) # if self.dic[var].guard is not None: print("* ifthenelse", var, self.dic[var].guard, "?", self.dic[var].ifval, ":", self.dic[var].elseval) self.dic[var]=self.dic[var]() return self.dic[var] def get(self, var): if isinstance(self.dic[var], ensemble): return self.dic[var].get() else: return self.dic[var] def __setitem__(self, var, val): self.dic[var] = val def __delitem__(self, var): del self.dic[var] def __iter__(self): return self.dic.__iter__() def clear(self): self.dic = {} def copy(self): ret = values() ret.dic = dict(self.dic) return ret def __repr__(self): return repr(self.dic) def apply_to_label(vals, orig): if orig is None: return vals ifguard = vals["__guard"] ret = values() for nm in orig: if nm in vals: if (vif:=vals.get(nm)) is (velse:=orig.get(nm)): ret[nm] = vif elif isinstance(velse, ensemble): velse.add(ifguard, vif) ret[nm] = velse else: ret[nm] = ensemble(velse) ret.dic[nm].add(ifguard, vif) return ret def apply_to_labels(vals, orig1, orig2, cond): if cond is True: return [apply_to_label(vals, orig1), orig2] elif cond is False: return [orig1, apply_to_label(vals, orig2)] guard = vals["__guard"] guard1 = guard&cond guard2 = guard&(1-cond) vals["__guard"] = guard1 ret1 = apply_to_label(vals, orig1) if orig1 is None and orig2 is None: vals = vals.copy() vals["__guard"] = guard2 ret2 = apply_to_label(vals, orig2) ret1["__guard"] = guard1 # because may be overwritten to guard2 if we do not copy vals return [ret1,ret2] def values_new(): return values()
nilq/baby-python
python
''' Created on May 2, 2016 @author: damianpa '''
nilq/baby-python
python
import yaml import os import git import logging from .i_repository_parser import IRepositoryParser class RosdistroRepositoryParser(IRepositoryParser): """ Pulls the rosdistro-package and gets all urls from the rosdistro files. """ def __init__(self, settings: dict): """ Creates a new instance of the RosdistroRepositoryParser class :param settings: Settings containing information about rosdistro_workspace and rosdistro_url """ self.__settings = settings def __get_rosdistro_repository(self) -> None: """ Clones the repository from rosdistro_url into rosdistro_workspace (defined in settings) :return: None """ if not os.path.exists(self.__settings["rosdistro_workspace"]): os.makedirs(self.__settings["rosdistro_workspace"]) try: logging.info("[RosdistroRepositoryParser]: Cloning rosdistro repository...") git.Repo.clone_from(self.__settings["rosdistro_url"], self.__settings["rosdistro_workspace"]) except git.exc.GitCommandError: logging.warning("[RosdistroRepositoryParser]: Repository already exists, pulling changes...") repo = git.Repo(self.__settings["rosdistro_workspace"]) repo.remotes.origin.pull() logging.info("[RosdistroRepositoryParser]: Rosdistro up-to-date...") def __get_urls_from_file(self, file_path: str, repository_dict: dict) -> None: """ Gets the URLs from a distribution.yaml that adheres to rosdistro-specs. :param file_path: path to a distribution.yaml file :param repository_dict: dictionary with repository-type (git, svn, hg, ...) as key and the repo-url as value :return: None """ # Load file. file = open(file_path, 'r') rosdistro = yaml.load(file) # Iterate repositories and add them to the repository_dict. for repository in rosdistro["repositories"]: try: vcs_type = str(rosdistro["repositories"][repository]["doc"]["type"]) url = str(rosdistro["repositories"][repository]["doc"]["url"]) repository_dict[vcs_type].add(url) except KeyError: pass try: vcs_type = str(rosdistro["repositories"][repository]["doc"]["type"]) url = str(rosdistro["repositories"][repository]["source"]["url"]) repository_dict[vcs_type].add(url) except KeyError: pass try: # This has to be a git repository (required by bloom) repository_dict["git"].add(rosdistro["repositories"][repository]["release"]["url"]) except KeyError: pass def parse_repositories(self, repository_dict: dict) -> None: # Actually get the repository self.__get_rosdistro_repository() # Parse index.yaml index_file = open(self.__settings["rosdistro_workspace"] + "index.yaml", "r") index_yaml = yaml.load(index_file) # Get all urls from all distribution.yaml files for distribution in index_yaml["distributions"]: logging.info("Parsing distribution " + index_yaml["distributions"][distribution]["distribution"][0]) self.__get_urls_from_file(self.__settings["rosdistro_workspace"] + index_yaml["distributions"][distribution]["distribution"][0], repository_dict)
nilq/baby-python
python
import sklearn as sk import numpy as np import matplotlib.pyplot as plt from sklearn.datasets import fetch_olivetti_faces faces = fetch_olivetti_faces() print "DESCR" print faces.DESCR print "images.shape" print faces.images.shape print "data.shape" print faces.data.shape print "target.shape" print faces.target.shape
nilq/baby-python
python
import argparse if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("-p","--principal",action="store", type=float, help="Principal", default=10000, required=True) parser.add_argument("-r", "--rate", action="store", type=float, help="rate of interest", default=10, required=True) parser.add_argument("-t", "--time", action="store", type=int, help="time in years", default=1, required=True) args = parser.parse_args() principal = float(args.principal) rate = float(args.rate) time = int(args.time) si = principal * time * rate / 100 ci = principal * ( 1 + (rate/100))**time print(f"Simple Interest = {si} \nCompound Interest = {ci}")
nilq/baby-python
python
from ASTModels import Node memory_size = 30000 def execute(ast: [Node]) -> ([int],int): memory = [0]*memory_size mp = 0 for node in ast: memory, mp = _evaluate(node,memory,mp) print() return memory, mp def _evaluate(node: Node, memory: [int], mp: int) -> ([int],int): if node.node_type == "INCREMENT": memory[mp] += node.val if memory[mp] >= 256: memory[mp] -= 256 elif node.node_type == "DECREMENT": memory[mp] -= node.val if memory[mp] < 0: memory[mp] += 255 elif node.node_type == "INCREMENT_POINTER": mp += node.val if mp > memory_size: mp -= memory_size-1 elif node.node_type =="DECREMENT_POINTER": mp -= node.val if mp < 0: mp += memory_size-1 elif node.node_type == "OUTPUT": print(chr(memory[mp]),end='') elif node.node_type == "INPUT": i = '' while i == '': i = input() memory[mp] = ord(i[0]) elif node.node_type =="LOOP": while memory[mp] != 0: for block_node in node.nodes: memory, mp = _evaluate(block_node,memory,mp) return memory, mp
nilq/baby-python
python
from __future__ import print_function from __future__ import absolute_import from __future__ import division import os import sys import tensorflow as tf import numpy as np from tensorflow.python.client import timeline with tf.device("/cpu:0"): a = tf.Variable([1],) with tf.device("/cpu:1"): b = tf.Variable([2],) with tf.device("/cpu:2"): c = tf.Variable([3],) with tf.device("/cpu:3"): d = tf.Variable([4],) with tf.device("/cpu:0"): total_a = tf.add_n([a, b]) with tf.device("/cpu:1"): total_b = tf.add_n([a, b, c]) with tf.device("/cpu:2"): total_c = tf.add_n([b, c, d]) with tf.device("/cpu:3"): total_d = tf.add_n([c, d]) graph = tf.add_n([total_a, total_b, total_c, total_d]) config = tf.ConfigProto(device_count={"CPU": 4}) with tf.Session(config=config) as sess: sess.run(tf.global_variables_initializer()) options = tf.RunOptions(trace_level=tf.RunOptions.FULL_TRACE) run_metadata = tf.RunMetadata() sess.run([total_a, total_b, total_c, total_d, graph], options=options, run_metadata=run_metadata) fetched_timeline = timeline.Timeline(run_metadata.step_stats) chrome_trace = fetched_timeline.generate_chrome_trace_format() with open('timeline_01.json', 'w') as f: f.write(chrome_trace)
nilq/baby-python
python
class Vehicle: def __init__(self, vin): self.vin=vin def GetVin(self): return self.vin class Car(Vehicle): def Accelerate(self): print("Car accelerating...") class Truck(Vehicle): def Accelerate(self): print("Truck accelerating...") def main(): cars=[Car("A123456890"), Car("B123456890"), Truck("C123456890"), Truck("D123456890"), Car("E123456890")] for car in cars: car.Accelerate() # polymorphic site if __name__ == "__main__": main()
nilq/baby-python
python
# -*- coding: utf-8 -*- import webapp2 from webapp2_extras import routes import json from api import routes as apiRoutes from fetch import routes as fetchRoutes class MainPage(webapp2.RequestHandler): def get(self): self.response.headers['Content-Type'] = 'text/plain' self.response.write('QCurrency is working.') app = webapp2.WSGIApplication([ routes.PathPrefixRoute('/api', apiRoutes), routes.PathPrefixRoute('/fetch', fetchRoutes), ('/', MainPage), ], debug=True)
nilq/baby-python
python
# -*- coding:utf-8 -*- import unittest from simple_ml.classify_data import DataCollector, get_iris import numpy as np class TestDataCollector(unittest.TestCase): def test_get_iris(self): dc = DataCollector() x = dc.fetch_handled_data("iris") self.assertIsInstance(x, np.ndarray) self.assertEqual(x.shape[0], 150) self.assertEqual(x.shape[1], 6) def test_build_in_get_iris(self): x, y = get_iris() self.assertEqual(len(x.shape), 2) self.assertEqual(len(y.shape), 1) if __name__ == '__main__': unittest.main()
nilq/baby-python
python
#!/usr/bin/env python # -*- coding: utf-8 -*- ################# # Module-Import # ################# #eegpy-modules try: import eegpy from eegpy.events import EventTable from eegpy.misc import FATALERROR from eegpy.ui.widgets.windowwidgets import EegpyBaseWin from eegpy.ui.icon import image_from_eegpy_stock, eegpy_logo except ImportError: raise FATALERROR('Your installation of EegPy seems to be incomplete.\nMaybe you need to set the PYTHONPATH environment-variable adequatly.') #from eegpy.filter.filt_misc import filterRecursively #Third-party try: import numpy from scipy.signal import lfilter, butter except ImportError: raise FATALERROR('SciPy or NumPy not found!\nPlease visit www.scipy.org or numeric.scipy.org for more information.') try: import pygtk pygtk.require('2.0') import gobject import gtk except ImportError: raise FATALERROR('GTK cannot be imported.') #try: # from matplotlib.axes import Subplot # # uncomment to select /GTK/GTKAgg/GTKCairo # from matplotlib.backends.backend_gtk import FigureCanvasGTK as FigureCanvas # from matplotlib.backends.backend_gtk import NavigationToolbar2GTK as NavigationToolbar # import matplotlib # #from matplotlib.backends.backend_tkagg import FigureCanvasTkAgg, NavigationToolbar2TkAgg, NavigationToolbar # from matplotlib.figure import Figure, SubplotParams # from matplotlib.axis import Axis # import matplotlib.cm #except ImportError: # raise FATALERROR('Error while importing matplotib. Please visit http://matplotlib.sf.net for more information.') #native python import sys import os import pickle class EventManager(gtk.Frame): _et = None _fn = None _keylist = None def __init__(self, label=""): gtk.Frame.__init__(self,label) self.vbox=gtk.VBox() self.tb_box = gtk.HBox() self.add(self.vbox) self.vbox.pack_start(self.tb_box,expand=False) self.tb = gtk.Toolbar() self.tooltips = gtk.Tooltips() self.tb.set_style(gtk.TOOLBAR_ICONS) self.add_toolbutton_from_stock(gtk.STOCK_OPEN, 'Load', 'Load an EventTable from a file', 'Private', self.load_et) self.add_toolbutton_from_stock(gtk.STOCK_SAVE, 'Save', 'Save the EventTable back to the original file', 'Private', self.save_et, False) self.add_toolbutton_from_stock(gtk.STOCK_SAVE_AS, 'Save to', 'Save the EventTable to a file, choose new file', 'Private', self.save_et, True) self.tb.insert(gtk.SeparatorToolItem(),-1) self.add_toolbutton_eegpy("add_trigger_type", "Add type", "Add a new trigger type", 'Private', self.cb_add_trigger_type, None) self.add_toolbutton_eegpy("add_trigger", "Add trigger", "Add a new trigger", 'Private', self.cb_add_trigger, None) self.tb_box.pack_start(self.tb,expand=True) self.lb_fn = gtk.Label("New EventTable...") self.lb_fn.set_max_width_chars(50) self.lb_fn.set_justify(gtk.JUSTIFY_RIGHT) self.tb_box.pack_end(self.lb_fn, expand=False) #HBox für _keylist/triggerlist self.pane_kl = gtk.HPaned() self.vbox.pack_end(self.pane_kl) self.setup_trees() self._et = EventTable() def setup_trees(self): #First: Keys self.tvsw_keys = gtk.ScrolledWindow() self.tvsw_keys.set_policy(gtk.POLICY_AUTOMATIC,gtk.POLICY_AUTOMATIC) self.tree_keys = gtk.TreeStore(gobject.TYPE_STRING) #self.treeS = gtk.TreeModelSort(self.tree) self.tv_keys = gtk.TreeView(self.tree_keys) self.tv_keys.get_selection().connect("changed",self.key_selected) #self.tv_keys.get_selection().set_mode(gtk.SELECTION_MULTIPLE) #renderer = gtk.CellRendererText() #self.col1 = gtk.TreeViewColumn("File ...", renderer,text=0) self.tv_keys.append_column(gtk.TreeViewColumn("Key", gtk.CellRendererText(),text=0)) #self.tv_keys.show() self.tvsw_keys.add(self.tv_keys) self.pane_kl.add1(self.tvsw_keys) #Second: Triggers self.tvsw_tr = gtk.ScrolledWindow() self.tvsw_tr.set_policy(gtk.POLICY_AUTOMATIC,gtk.POLICY_AUTOMATIC) self.tree_tr = gtk.TreeStore(gobject.TYPE_INT) #self.treeS = gtk.TreeModelSort(self.tree) self.tv_tr = gtk.TreeView(self.tree_tr) self.tv_tr.get_selection().set_mode(gtk.SELECTION_MULTIPLE) #renderer = gtk.CellRendererText() #self.col1 = gtk.TreeViewColumn("File ...", renderer,text=0) self.tv_tr.append_column(gtk.TreeViewColumn("Timepoint", gtk.CellRendererText(),text=0)) #self.tv_keys.show() #Setting up drag'n'drop self.tv_tr.enable_model_drag_source( gtk.gdk.BUTTON1_MASK, [('INT',0,0)], gtk.gdk.ACTION_DEFAULT| gtk.gdk.ACTION_MOVE) self.tv_tr.enable_model_drag_dest([('INT',0,0)], gtk.gdk.ACTION_DEFAULT) self.tv_tr.connect("drag_data_get", self.tr_drag_get) self.tv_tr.connect("drag_data_received", self.tr_drag_received) self.tv_keys.connect("key_press_event", self.cb_key_pressed) self.tv_tr.connect("key_press_event", self.cb_key_pressed) self.tvsw_tr.add(self.tv_tr) self.pane_kl.add2(self.tvsw_tr) def add_toolbutton_eegpy(self, icon_name, text, tip_text, tip_private, clicked_function, clicked_param1=None): iconSize = gtk.ICON_SIZE_SMALL_TOOLBAR iconw = eegpy.ui.icon.image_from_eegpy_stock(icon_name) toolitem = gtk.ToolButton(iconw, text) #toolitem = gtk.ToolButton(iconw) toolitem.set_icon_widget(iconw) toolitem.show_all() toolitem.set_tooltip(self.tooltips, tip_text, tip_private) toolitem.connect("clicked", clicked_function, clicked_param1) #toolitem.connect("scroll_event", clicked_function) self.tb.insert(toolitem, -1) def add_toolbutton_from_stock(self, icon_name, text, tip_text, tip_private, clicked_function, clicked_param1=None): iconSize = gtk.ICON_SIZE_SMALL_TOOLBAR iconw = gtk.Image() iconw.set_from_stock(icon_name, iconSize) toolitem = gtk.ToolButton(iconw, text) #toolitem = gtk.ToolButton(iconw) toolitem.set_icon_widget(iconw) toolitem.show_all() toolitem.set_tooltip(self.tooltips, tip_text, tip_private) toolitem.connect("clicked", clicked_function, clicked_param1) #toolitem.connect("scroll_event", clicked_function) self.tb.insert(toolitem, -1) def load_et(self,event,data): dialog = gtk.FileChooserDialog("Open EventTable from file..", None, gtk.FILE_CHOOSER_ACTION_OPEN, (gtk.STOCK_CANCEL, gtk.RESPONSE_CANCEL, gtk.STOCK_OPEN, gtk.RESPONSE_OK)) dialog.set_default_response(gtk.RESPONSE_OK) filter = gtk.FileFilter() filter.set_name("eegpy EventTable or similar") filter.add_pattern("*.evt") filter.add_pattern("*.vmrk") dialog.add_filter(filter) filter = gtk.FileFilter() filter.set_name("All files") filter.add_pattern("*") dialog.add_filter(filter) response = dialog.run() if response == gtk.RESPONSE_OK: self.set_filename(dialog.get_filename()) #print dialog.get_filename(), 'selected' elif response == gtk.RESPONSE_CANCEL: print 'Closed, no files selected' dialog.destroy() def save_et(self, event, do_save_as = True): if do_save_as == False: self._et.save(self._fn) else: dialog = gtk.FileChooserDialog("Save EventTable to file...", None, gtk.FILE_CHOOSER_ACTION_SAVE, (gtk.STOCK_CANCEL, gtk.RESPONSE_CANCEL, gtk.STOCK_SAVE, gtk.RESPONSE_OK)) dialog.set_default_response(gtk.RESPONSE_OK) filter = gtk.FileFilter() filter.set_name("eegpy EventTable") filter.add_pattern("*.evt") dialog.add_filter(filter) filter = gtk.FileFilter() filter.set_name("All files") filter.add_pattern("*") dialog.add_filter(filter) response = dialog.run() if response == gtk.RESPONSE_OK: fn = dialog.get_filename() print fn, 'selected' dialog.destroy() self._fn = fn #Now save... self._et.save(self._fn) lbtext = "" if len(fn)>40: lbtext = "..."+fn[-37:] self.lb_fn.set_text(lbtext) #fh.close() else:# response == gtk.RESPONSE_CANCEL: dialog.destroy() print 'Closed, no files selected' pass def set_filename(self,fn): print fn, "selected for opening" #success = False try: if not os.path.exists(fn): raise ValueError("File doesn't exist") self._et = EventTable(fn) if len(self._et.keys())==0: print self._et.keys() raise ValueError("EventTable empty!") self._fn = fn except ValueError, e: print "Error opening EventTable", e self._et=None self._fn=None return False lbtext = "" if len(fn)>40: lbtext = "..."+fn[-37:] self.lb_fn.set_text(lbtext) self.setup_keylist() def setup_keylist(self): #if self._tv!=None: # try: # self._keylist.hide() # self._keylist.destroy() # except Exception,e: # print "Cannot destroy keylist" #TODO: Real functionalityself.tvsw_keys = gtk.ScrolledWindow() keys = self._et.keys() keys.sort() self.tree_keys.clear() for k in keys: iter = self.tree_keys.append(None) self.tree_keys.set(iter, 0, k) self.tree_keys.set_sort_column_id(0,gtk.SORT_ASCENDING) self.show_all() def setup_triggerlist(self, key): self.tree_tr.clear() for tr in self._et[key]: #print tr iter = self.tree_tr.append(None) self.tree_tr.set(iter, 0, int(tr)) self.tree_tr.set_sort_column_id(0,gtk.SORT_ASCENDING) def key_selected(self,treeselection,*args): #print tv, path, col, args, self.tree_keys.get(self.tree_keys.get_iter(path),0)[0] self.tv_tr.get_selection().unselect_all() #self.tree_tr.clear() paths = treeselection.get_selected_rows()[1] if len(paths)>0: iter = self.tree_keys.get_iter(paths[0]) key = self.tree_keys.get(iter,0)[0] self.setup_triggerlist(key) def cb_add_trigger_type(self,event,data): dialog_label = gtk.Dialog("Choose name...", None, gtk.DIALOG_MODAL | gtk.DIALOG_DESTROY_WITH_PARENT, (gtk.STOCK_CANCEL, gtk.RESPONSE_REJECT, gtk.STOCK_OK, gtk.RESPONSE_OK)) entry1 = gtk.Entry() entry1.set_text("Trigger") dialog_label.vbox.pack_start(entry1) entry1.show() response = dialog_label.run() print response if response == gtk.RESPONSE_OK: trig_name = entry1.get_text() print trig_name else: print "Adding trigger-type aborted by user." dialog_label.destroy() return False dialog_label.destroy() self.add_trigger_type(trig_name, []) def cb_add_trigger(self,event,data): dialog_label = gtk.Dialog("Add trigger...", None, gtk.DIALOG_MODAL | gtk.DIALOG_DESTROY_WITH_PARENT, (gtk.STOCK_CANCEL, gtk.RESPONSE_REJECT, gtk.STOCK_OK, gtk.RESPONSE_OK)) dialog_label.vbox.pack_start(gtk.Label("Timepoint:")) sb_time = gtk.SpinButton(gtk.Adjustment(0,0,100000000,1,1000)) dialog_label.vbox.pack_start(sb_time) dialog_label.vbox.show_all() response = dialog_label.run() print response if response == gtk.RESPONSE_OK: time = sb_time.get_value() print time else: print "Adding trigger aborted by user." dialog_label.destroy() return False dialog_label.destroy() self.add_trigger(time) def add_trigger_type(self,key,ts=[]): if not self._et.has_key(key): self._et.add_trigger_type(key, ts) self.setup_keylist() self.tree_tr.clear() def add_trigger(self,time): #find out key path = self.tv_keys.get_selection().get_selected_rows()[1][0] iter = self.tree_keys.get_iter(path) k = self.tree_keys.get(iter,0)[0] if self._et.has_key(k): self._et.add_trigger(k, time) self.setup_triggerlist(k) def tr_drag_get(self, treeview, context, selection, target_id, etime): pathlist = treeview.get_selection().get_selected_rows()[1] model = treeview.get_model() iterlist = [model.get_iter(row) for row in pathlist] datalist = [model.get(iter,0)[0] for iter in iterlist] #print datalist selection.set(selection.target,8,pickle.dumps(datalist)) #print "Drag_get: ", treeview, context, selection, target_id, etime def tr_drag_received(self, treeview, context, x, y, selection, info, etime): #print pickle.loads(selection.data) datalist = pickle.loads(selection.data) self.add_trigger(datalist[0]) #print "Drag_received:", treeview, context, x, y, selection, info, etime def cb_key_pressed(self, widget, event, data=None): keyname = gtk.gdk.keyval_name(event.keyval) #print "Key %s (%d) was pressed in widget %s" % (keyname, event.keyval, str(widget)) if keyname == "Delete": #find out key path = self.tv_keys.get_selection().get_selected_rows()[1][0] iter = self.tree_keys.get_iter(path) k = self.tree_keys.get(iter,0)[0] if widget==self.tv_keys: self._et.remove(k) self.setup_keylist() self.tv_keys.get_selection().unselect_all() self.tree_tr.clear() if widget==self.tv_tr: pathlist = self.tv_tr.get_selection().get_selected_rows()[1] iterlist = [self.tree_tr.get_iter(row) for row in pathlist] datalist = [self.tree_tr.get(iter,0)[0] for iter in iterlist] for tr in datalist: self._et.remove(k,tr) self.setup_triggerlist(k) class EventTableEditorWin(EegpyBaseWin): programName = "eegpy: Frequency-Filtering" # Konstruktor def __init__(self): EegpyBaseWin.__init__(self) self.inner_pane.set_position(300) self.em1 = EventManager("EventTable 1") self.em1.tv_tr.get_selection().connect("changed",self.cb_plot_marks)#, "blue") self.em2 = EventManager("EventTable 2") self.em2.tv_tr.get_selection().connect("changed",self.cb_plot_marks)#, "red") self.pane_edit = gtk.HPaned() self.upper_hbox.pack_start(self.pane_edit) self.pane_edit.add1(self.em1) self.pane_edit.pack2(self.em2,False) self.pane_edit.set_position(self.get_size()[0]/2) #self.setupOptions() self.show_all() #self.setupGUI() def setupGUI(self): EegpyBaseWin.setupGUI(self) def cb_plot_marks(self, treeselection, *args): #print "Color", color self.a.cla() pathlist = self.em1.tv_tr.get_selection().get_selected_rows()[1] iterlist = [self.em1.tree_tr.get_iter(row) for row in pathlist] datalist1 = [self.em1.tree_tr.get(iter,0)[0] for iter in iterlist] pathlist = self.em2.tv_tr.get_selection().get_selected_rows()[1] iterlist = [self.em2.tree_tr.get_iter(row) for row in pathlist] datalist2 = [self.em2.tree_tr.get(iter,0)[0] for iter in iterlist] #print datalist1, datalist2 for i in datalist1: # print i, self.a.axvline(i, lw=1, color="blue", ymin=0.5, ymax=1) #self.a.plot(datalist1,numpy.zeros(len(datalist1)),"bD") #self.a.plot(datalist2,numpy.ones(len(datalist2)),"rD") #print "" for i in datalist2: # print i, self.a.axvline(i, lw=1, color="red", ymin=0, ymax=0.5) #print "" # if len(datalist1) == 1: # self.a.set_xlim(datalist1[0]-1000,datalist1[0]+1000) # elif len(datalist2)==1: # self.a.set_xlim(datalist2[0]-1000,datalist2[0]+1000) # else: # self.a.autoscale_view() # elif: # xlim0 = max(min(datalist1),min(datalist2))-500 # xlim1 = min(max(datalist1),max(datalist2))+500 # if xlim1<xlim0: # xlim0 = min(min(datalist1),min(datalist2))-500 # xlim1 = max(max(datalist1),max(datalist2))+500 # self.a.set_xlim(xlim0,xlim1) #self.a.set_xlim(numpy.array(datalist1+datalist2).min()-1000,numpy.array(datalist1+datalist2).max()+1000) self.a.set_ylim(0,1) self.a.set_yticks([]) self.canvas.draw() def main(): gtk.main() return 0 if __name__ == "__main__": etew = EventTableEditorWin() main()
nilq/baby-python
python
#!/usr/bin/env python3 """ Prepares the test environment prior to starting hyperglass. """ import os import glob import shutil from logzero import logger working_directory = os.path.dirname(os.path.abspath(__file__)) parent_directory = os.path.dirname(working_directory) def ci_copy_config(): """Copies test configuration files to usable config files""" logger.info("Migrating test config files...") config_dir = os.path.join(parent_directory, "hyperglass/configuration/") test_files = glob.iglob(os.path.join(working_directory, "*.toml")) config_files = glob.iglob(os.path.join(config_dir, "*.toml")) logger.debug(config_dir) logger.debug(working_directory) logger.debug(parent_directory) status = False for file in config_files: if os.path.exists(file): logger.debug(f"{file} already exists") os.remove(file) logger.info(f"Deleted {file}") for file in test_files: try: shutil.copy(file, config_dir) logger.debug(f"Copied {file}") logger.debug(os.listdir(config_dir)) logger.info("Successfully migrated test config files") status = True except: logger.error(f"Failed to migrate {file}") raise return status if __name__ == "__main__": ci_copy_config()
nilq/baby-python
python
# Version: @VERSIONEER-VERSION@ """The Versioneer - like a rocketeer, but for versions. @README@ """ # pylint:disable=invalid-name,import-outside-toplevel,missing-function-docstring # pylint:disable=missing-class-docstring,too-many-branches,too-many-statements # pylint:disable=raise-missing-from,too-many-lines,too-many-locals,import-error # pylint:disable=too-few-public-methods,redefined-outer-name,consider-using-with # pylint:disable=attribute-defined-outside-init,too-many-arguments import configparser import errno import json import os import re import subprocess import sys from typing import Callable, Dict class VersioneerConfig: """Container for Versioneer configuration parameters.""" def get_root(): """Get the project root directory. We require that all commands are run from the project root, i.e. the directory that contains setup.py, setup.cfg, and versioneer.py . """ root = os.path.realpath(os.path.abspath(os.getcwd())) setup_py = os.path.join(root, "setup.py") versioneer_py = os.path.join(root, "versioneer.py") if not (os.path.exists(setup_py) or os.path.exists(versioneer_py)): # allow 'python path/to/setup.py COMMAND' root = os.path.dirname(os.path.realpath(os.path.abspath(sys.argv[0]))) setup_py = os.path.join(root, "setup.py") versioneer_py = os.path.join(root, "versioneer.py") if not (os.path.exists(setup_py) or os.path.exists(versioneer_py)): err = ("Versioneer was unable to run the project root directory. " "Versioneer requires setup.py to be executed from " "its immediate directory (like 'python setup.py COMMAND'), " "or in a way that lets it use sys.argv[0] to find the root " "(like 'python path/to/setup.py COMMAND').") raise VersioneerBadRootError(err) try: # Certain runtime workflows (setup.py install/develop in a setuptools # tree) execute all dependencies in a single python process, so # "versioneer" may be imported multiple times, and python's shared # module-import table will cache the first one. So we can't use # os.path.dirname(__file__), as that will find whichever # versioneer.py was first imported, even in later projects. my_path = os.path.realpath(os.path.abspath(__file__)) me_dir = os.path.normcase(os.path.splitext(my_path)[0]) vsr_dir = os.path.normcase(os.path.splitext(versioneer_py)[0]) if me_dir != vsr_dir: print("Warning: build in %s is using versioneer.py from %s" % (os.path.dirname(my_path), versioneer_py)) except NameError: pass return root def get_config_from_root(root): """Read the project setup.cfg file to determine Versioneer config.""" # This might raise OSError (if setup.cfg is missing), or # configparser.NoSectionError (if it lacks a [versioneer] section), or # configparser.NoOptionError (if it lacks "VCS="). See the docstring at # the top of versioneer.py for instructions on writing your setup.cfg . setup_cfg = os.path.join(root, "setup.cfg") parser = configparser.ConfigParser() with open(setup_cfg, "r") as cfg_file: parser.read_file(cfg_file) VCS = parser.get("versioneer", "VCS") # mandatory # Dict-like interface for non-mandatory entries section = parser["versioneer"] cfg = VersioneerConfig() cfg.VCS = VCS cfg.style = section.get("style", "") cfg.versionfile_source = section.get("versionfile_source") cfg.versionfile_build = section.get("versionfile_build") cfg.tag_prefix = section.get("tag_prefix") if cfg.tag_prefix in ("''", '""'): cfg.tag_prefix = "" cfg.parentdir_prefix = section.get("parentdir_prefix") cfg.verbose = section.get("verbose") return cfg class NotThisMethod(Exception): """Exception raised if a method is not valid for the current scenario.""" # these dictionaries contain VCS-specific tools LONG_VERSION_PY: Dict[str, str] = {} HANDLERS: Dict[str, Dict[str, Callable]] = {} def register_vcs_handler(vcs, method): # decorator """Create decorator to mark a method as the handler of a VCS.""" def decorate(f): """Store f in HANDLERS[vcs][method].""" HANDLERS.setdefault(vcs, {})[method] = f return f return decorate
nilq/baby-python
python
from dj_rest_auth.serializers import PasswordResetSerializer from django.conf import settings class PasswordResetSerializerFrontendHost(PasswordResetSerializer): """ Serializer for requesting a password reset e-mail. """ def save(self): if "allauth" in settings.INSTALLED_APPS: from allauth.account.forms import default_token_generator else: from django.contrib.auth.tokens import default_token_generator request = self.context.get("request") # Set some values to trigger the send_email method. opts = { "use_https": request.is_secure(), "from_email": getattr(settings, "DEFAULT_FROM_EMAIL"), "request": None, # None triggers to use the host from site object "token_generator": default_token_generator, } opts.update(self.get_email_options()) self.reset_form.save(**opts)
nilq/baby-python
python
#!/usr/bin/env python # -*- coding: utf-8 -*- #2018-05-29 08-49 # Standard Modules import logging # Extra Modules dependencies_missing = False try: import teradata except ImportError: dependencies_missing = True from metasploit import module, login_scanner # Metasploit Metadata metadata = { 'name': 'Teradata ODBC Login Scanner Module', 'description': ''' Login scanner module for ODBC connections to Teradata databases. Port specification (TCP 1025 by default) is not necessary for ODBC connections. Blank passwords are not supported by ODBC connections. Requires ODBC driver and Python Teradata module. ''', 'authors': [ 'Ted Raffle (actuated)' ], 'date': '2018-03-30', 'license': 'MSF_LICENSE', 'references': [ {'type': 'url', 'ref': 'https://developer.teradata.com/tools/reference/teradata-python-module'}, {'type': 'url', 'ref': 'https://downloads.teradata.com/download/connectivity/odbc-driver/linux'} ], 'type': 'single_host_login_scanner', 'options': { 'rhost': {'type': 'address', 'description': 'Host to target', 'required': True}, 'rport': {'type': 'port', 'description': 'Port to target, ignored by the ODBC driver', 'required': True, 'default': 1025}, 'userpass': {'type': 'string', 'description': 'A list of username/password combinations to try', 'required': False}, 'sleep_interval': {'type': 'float', 'description': 'Time in seconds to wait between login attempts', 'required': False} }, 'service_name': 'teradata', 'notes': { 'AKA': ['Teradata ODBC Login Scanner'] } } def valid_login(udaExec, host, user, password): try: udaExec.connect(method="odbc", system=host, username=user, password=password) except teradata.api.Error as e: return False else: return True def run(args): if dependencies_missing: module.log('Python Teradata module missing, cannot continue', level=error) return # Define UdaExec ODBC connection "application" globally, must be before LogHandler udaExec = teradata.UdaExec(appName="Auth", version="1.0", logConsole=False, configureLogging=False) module.LogHandler.setup(msg_prefix='{}:{} - '.format(args['rhost'], 1025)) scanner = login_scanner.make_scanner(lambda host, port, username, password: valid_login(udaExec, host, username, password)) scanner(args) if __name__ == '__main__': module.run(metadata, run)
nilq/baby-python
python
import itertools import discord from discord.ext import commands from bot.constants import Colours with open('bot/resources/evergreen/python_facts.txt') as file: FACTS = itertools.cycle(list(file)) COLORS = itertools.cycle([Colours.python_blue, Colours.python_yellow]) class PythonFacts(commands.Cog): """Sends a random fun fact about Python.""" def __init__(self, bot: commands.Bot) -> None: self.bot = bot @commands.command(name='pythonfact', aliases=['pyfact']) async def get_python_fact(self, ctx: commands.Context) -> None: """Sends a Random fun fact about Python.""" embed = discord.Embed(title='Python Facts', description=next(FACTS), colour=next(COLORS)) embed.add_field(name='Suggestions', value="Suggest more facts [here!](https://github.com/python-discord/meta/discussions/93)") await ctx.send(embed=embed) def setup(bot: commands.Bot) -> None: """Load PythonFacts Cog.""" bot.add_cog(PythonFacts(bot))
nilq/baby-python
python
from django.core.management.base import BaseCommand, CommandError from ghu_main.email import EmailAPI class Command(BaseCommand): """This command refers to the API in email.py for sending emails in-app""" def __init__(self): super(Command, self).__init__() def add_arguments(self, parser): parser.add_argument('subject', type=str) parser.add_argument('body', type=str) parser.add_argument('recipients', type=str) def handle(self, *args, **options): EmailAPI.send_email(options['subject'], options['body'], options['recipients'].split(','))
nilq/baby-python
python
#!/usr/bin/python # # Copyright (c) 2016 Juniper Networks, Inc. All rights reserved. # import os import sys import argparse import ConfigParser import requests from netaddr.ip import IPNetwork from vnc_api.vnc_api import * class ProvisionVgwInterface(object): def __init__(self, args_str=None): self._args = None if not args_str: args_str = ' '.join(sys.argv[1:]) self._parse_args(args_str) headers = {'content-type': 'application/json'} url = "http://localhost:9091/gateway" if self._args.oper == "create": print "Creating virtual-gateway ..." with open("/proc/sys/net/ipv4/ip_forward", "w") as file: file.write("1") vif_command = '/usr/bin/vif --create ' + self._args.interface vif_command += ' --mac 00:00:5e:00:01:00' self.execute_command(vif_command) ifconfig_command = 'ifconfig ' + self._args.interface + ' up' self.execute_command(ifconfig_command) for subnet in self._args.subnets: route_command = 'route add -net ' + subnet route_command += ' dev ' + self._args.interface self.execute_command(route_command) subnet_list = [] first = True subnets_str = "\"subnets\":[" for subnet in self._args.subnets: net = IPNetwork(subnet) if not first: subnets_str += "," first = False subnets_str += "{\"ip-address\":\"%s\", \"prefix-len\":%d}" % (str(net.ip), net.prefixlen) subnets_str += "]" route_list = [] first = True routes_str = "\"routes\":[" for subnet in self._args.routes: net = IPNetwork(subnet) if not first: routes_str += "," first = False routes_str += "{\"ip-address\":\"%s\", \"prefix-len\":%d}" % (str(net.ip), net.prefixlen) routes_str += "]" gw_str = "[{\"interface\":\"%s\", \"routing-instance\":\"%s\", %s, %s}]" %(self._args.interface, self._args.vrf, subnets_str, routes_str) try: r = requests.post(url, data=gw_str, headers=headers) except ConnectionError: print "Error: Error adding VGW interface" return if r.status_code != 200: print "Failed to Add VGW interface" return print "Done creating virtual-gateway..." else: print "Deleting virtual-gateway ..." gw_str = "[{\"interface\":\"%s\"}]" % (self._args.interface) try: r = requests.delete(url, data=gw_str, headers=headers) except ConnectionError: print "Error: Error deleting VGW interface" return if r.status_code != 200: print "Failed to Delete VGW interface" return for subnet in self._args.subnets: route_command = 'route del -net ' + subnet route_command += ' dev ' + self._args.interface self.execute_command(route_command) ifconfig_command = 'ifconfig ' + self._args.interface + ' down' self.execute_command(ifconfig_command) interface_index = self.get_interface_index(self._args.interface) if interface_index != -1: vif_command = '/usr/bin/vif --delete ' + interface_index self.execute_command(vif_command) del_cmd = 'ip link del ' + self._args.interface self.execute_command(del_cmd) print "Done deleting virtual-gateway..." # end __init__ def execute_command(self, cmd): print cmd out = os.system(cmd) if out != 0: print "Error executing : " + cmd #end execute_command def get_interface_index(self, interface): import subprocess proc = subprocess.Popen(["/usr/bin/vif", "--list"], stdout=subprocess.PIPE) vif_list, err = proc.communicate() vif_match = 'OS: ' + interface lines = [line for line in vif_list.split('\n') if line.endswith(vif_match)] for line in lines: lineitems = line.split(' ') first = lineitems[0] index = first.split('/') return index[1] return -1 #end get_interface_index def _parse_args(self, args_str): ''' Eg. python provision_vgw_interface.py --oper <create | delete> --interface vgw1 --subnets 1.2.3.0/24 7.8.9.0/24 --routes 8.8.8.0/24 9.9.9.0/24 --vrf default-domain:admin:vn1:vn1 ''' # Source any specified config/ini file # Turn off help, so we print all options in response to -h conf_parser = argparse.ArgumentParser(add_help=False) args, remaining_argv = conf_parser.parse_known_args(args_str.split()) defaults = { 'oper': 'create', 'interface': '', 'subnets': [], 'routes': [], 'vrf': '', } # Don't surpress add_help here so it will handle -h parser = argparse.ArgumentParser( # Inherit options from config_parser parents=[conf_parser], # print script description with -h/--help description=__doc__, # Don't mess with format of description formatter_class=argparse.RawDescriptionHelpFormatter, ) parser.set_defaults(**defaults) parser.add_argument( "--oper", help="Operation : create / delete") parser.add_argument( "--interface", help="Name of the gateway interface") parser.add_argument( "--subnets", nargs='+', help="List of subnets in virtual-network configured for gateway (Ex: 1.1.1.0/24 2.2.2.0/24)") parser.add_argument( "--routes", nargs='+', help="List of public routes injected into virtual-network routing-instance (Ex: 8.8.8.0/24 9.9.9.0/24)") parser.add_argument( "--vrf", help="Routing instance for virtual-network configured for gateway (as FQDN)") self._args = parser.parse_args(remaining_argv) if not self._args.interface: parser.error('Missing argument interface') if not self._args.subnets: parser.error('Missing argument subnets') if self._args.oper == "create": if not self._args.routes: parser.error('Missing argument routes') if not self._args.vrf: parser.error('Missing argument vrf') # end _parse_args # end class ProvisionVgwInterface def main(args_str=None): ProvisionVgwInterface(args_str) # end main if __name__ == "__main__": main()
nilq/baby-python
python
#!/usr/bin/env python def plain_merge(array_a: list, array_b: list) -> list: pointer_a, pointer_b = 0, 0 length_a, length_b = len(array_a), len(array_b) result = [] while pointer_a < length_a and pointer_b < length_b: if array_a[pointer_a] <= array_b[pointer_b]: result.append(array_a[pointer_a]) pointer_a += 1 else: result.append(array_b[pointer_b]) pointer_b += 1 if pointer_a != length_a: result += array_a[pointer_a:] elif pointer_b != length_b: result += array_b[pointer_b:] return result
nilq/baby-python
python
class RuleWriterMount(type): def __init__(cls, name, bases, attrs): if not hasattr(cls, 'rule_writers'): cls.rule_writers = {} else: cls.register_rule_writer(cls) def register_rule_writer(cls, rule_writer): instance = rule_writer() cls.rule_writers[instance.rule_name] = instance class RuleWriter(metaclass=RuleWriterMount): pass
nilq/baby-python
python
#!/usr/bin/env python import os import re import shutil import subprocess import sys toplevel = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) re_setup = re.compile(r'setup\(') re_version = re.compile(r'(?<=\bversion=[\'"])([0-9a-zA-Z._+-]+)') def update_version(gitversion, foundversion): """Chooses version string to write to setup.py. """ return gitversion def make_pkg(): # Get version from git describe version = subprocess.check_output(['git', 'describe', '--always', '--tags'], cwd=toplevel).strip() dest = os.path.join(toplevel, 'dist') if not os.path.exists(dest): os.mkdir(dest) #for project in ('reprozip', 'reprounzip', 'reprounzip-docker', # 'reprounzip-vagrant', 'reprounzip-vistrails'): project = 'reprozip' pdir = os.path.join(toplevel, project) setup_py = os.path.join(pdir, 'setup.py') # Update setup.py file with open(setup_py, 'rb') as fp: lines = fp.readlines() i = 0 setup_found = False while i < len(lines): line = lines[i] if not setup_found and re_setup.search(line): setup_found = True if setup_found: m = re_version.search(line) if m is not None: version = update_version(version, m.group(1)) lines[i] = re_version.sub(version, line) break i += 1 with open(setup_py, 'wb') as fp: for line in lines: fp.write(line) # Run sdist subprocess.check_call([sys.executable, setup_py, 'sdist']) # Run bdist_wheel try: __import__('wheel') except ImportError: pass else: subprocess.check_call([sys.executable, setup_py, 'bdist_wheel']) # Move output to top-level dist/ for f in os.listdir(os.path.join(pdir, 'dist')): shutil.copyfile(os.path.join(pdir, 'dist', f), os.path.join(dest, f)) if __name__ == '__main__': make_pkg()
nilq/baby-python
python
""" Merge the tools Consider the following: A string, s, of length n. An integer, k, where k is a factor of n. We can split s into n/k subsegments where each subsegment, t(i), consists of a contiguous block of k characters in s. Then, use each t(i) to create string u(i) such that: The characters in u(i) are a subsequence of the characters in t(i). Any repeat occurrence of a character is removed from the string such that each character in u(i) occurs exactly once. In other words, if the character at some index j in t(i) occurs at a previous index < j in t(i), then do not include the character in string u(i). Given s and k, print n/k lines where each line i denotes string u(i). Input Format The first line contains a single string denoting s. The second line contains an integer, k, denoting the length of each subsegment. Output Format Print n/k lines where each line i contains string u(i). Sample Input AABCAAADA 3 Sample Output AB CA AD """ import textwrap def merge_the_tools(string, k): for i in textwrap.wrap(string, k): d = dict() print(''.join([ d.setdefault(c, c) for c in i if c not in d ])) if __name__ == '__main__': string, k = input(), int(input()) merge_the_tools(string, k)
nilq/baby-python
python
import string def is_pangram(sentence: str) -> bool: """ Determine if a given string contains all the characters from a to z. sentence -- Any string. returns -- true/false for if string contains all letters from a to z. """ letters = set(string.ascii_lowercase) return letters.issubset(sentence.lower())
nilq/baby-python
python
import numpy as np from scipy.linalg import solve from js.geometry.quaternion import Quaternion for path in [ "../data/gazebo_winter/", "../data/mountain_plain/", "../data/gazebo_summer/" ]: #for path in [ "../data/stairs/", "../data/apartment/", "../data/wood_summer/" ]: with open(path+"pose_scanner_leica.csv") as f: f.readline() x = np.loadtxt(f,delimiter=",") for i in range(x.shape[0]): T_wc = np.reshape(x[i,2:],(4,4)) R_wc = T_wc[:3,:3] q_wc = Quaternion() q_wc.fromRot3(R_wc) t_wc = T_wc[:3,3] print t_wc, q_wc with open(path+"pose_{}.csv".format(i),"w") as fout: fout.write("q_w q_x q_y q_z t_x t_y t_z\n") fout.write("{} {} {} {} {} {} {}".format(q_wc.q[0],\ q_wc.q[1],q_wc.q[2],q_wc.q[3],t_wc[0],t_wc[1],t_wc[2]))
nilq/baby-python
python
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2013 Rackspace Hosting # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import logging from django.template.defaultfilters import title from django.core.urlresolvers import reverse from django.utils.translation import ugettext_lazy as _ from horizon import tables from horizon.utils.filters import replace_underscores from trove_dashboard import api from django.core import urlresolvers LOG = logging.getLogger(__name__) ACTIVE_STATES = ("COMPLETED", "FAILED") def date(string): """Strip off the T from the datetime string""" return string.replace('T', ' ') class LaunchLink(tables.LinkAction): name = "create" verbose_name = _("Create Backup") url = "horizon:project:database_backups:create" classes = ("btn-launch", "ajax-modal") def allowed(self, request, datum): return True # The action should always be displayed class RestoreLink(tables.LinkAction): name = "restore" verbose_name = _("Restore Backup") url = "horizon:project:databases:launch" classes = ("btn-launch", "ajax-modal") def get_link_url(self, datam): url = urlresolvers.reverse(self.url) return url + '?backup=%s' % datam.id class DeleteBackup(tables.BatchAction): name = "delete" action_present = _("Delete") action_past = _("Scheduled deletion of") data_type_singular = _("Backup") data_type_plural = _("Backups") classes = ('btn-danger', 'btn-terminate') def allowed(self, request, instance=None): return True def action(self, request, obj_id): api.trove.backup_delete(request, obj_id) class UpdateRow(tables.Row): ajax = True def get_data(self, request, backup_id): backup = api.trove.backup_get(request, backup_id) try: backup.instance = api.trove.instance_get(request, backup.instance_id) except: pass return backup def db_link(obj): if not hasattr(obj, 'instance'): return if hasattr(obj.instance, 'name'): return reverse( 'horizon:project:databases:detail', kwargs={'instance_id': obj.instance_id}) def db_name(obj): if hasattr(obj.instance, 'name'): return obj.instance.name return obj.instance_id class BackupsTable(tables.DataTable): STATUS_CHOICES = ( ("BUILDING", None), ("COMPLETED", True), ("DELETE_FAILED", False), ("FAILED", False), ("NEW", None), ("SAVING", None), ) name = tables.Column("name", link=("horizon:project:database_backups:detail"), verbose_name=_("Name")) created = tables.Column("created", verbose_name=_("Created At"), filters=[date]) location = tables.Column(lambda obj: _("Download"), link=lambda obj: obj.locationRef, verbose_name=_("Backup File")) instance = tables.Column(db_name, link=db_link, verbose_name=_("Database")) status = tables.Column("status", filters=(title, replace_underscores), verbose_name=_("Status"), status=True, status_choices=STATUS_CHOICES) class Meta: name = "backups" verbose_name = _("Backups") status_columns = ["status"] row_class = UpdateRow table_actions = (LaunchLink, DeleteBackup) row_actions = (RestoreLink, DeleteBackup)
nilq/baby-python
python
nome = str(input('Digite seu nome: ')).strip().upper() print(f'Seu nome tem SILVA: ','SILVA' in nome)
nilq/baby-python
python
from .clip import * from .esresnet import * from .audioclip import AudioCLIP from .audioclip_finetune import AudioCLIPFinetune
nilq/baby-python
python
loan_amount = eval(input('Loan Amount: ')) r = eval(input('Annual Interest Rate: ')) n = eval(input('Loan Duration in Months: ')) payment = (r*loan_amount)/(1-((1+r)**-n)) print('$', payment)
nilq/baby-python
python
from .settings import * INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'myapp', ] # Uncomment if you want to use a mysql/mariadb database. Don't forget to change docker-compose.yml! # DATABASES = { # 'default': { # 'NAME': 'mydjango', # 'ENGINE': 'django.db.backends.mysql', # 'USER': 'root', # 'PASSWORD': 'root', # 'HOST': 'db', # 'PORT': 3306, # 'OPTIONS': { # 'init_command': "SET sql_mode='STRICT_TRANS_TABLES'", # }, # 'CONN_MAX_AGE': 550, # } # } # ... add more settings, will override default settings.py
nilq/baby-python
python
# coding:utf-8 """ 以tushare为源的市场数据表 """ import loguru import random import time import datetime import tushare as ts import pandas as pd import matplotlib.pyplot as plt from .sqldata import SqlDayManager, SqlBaseManager import sys,os sys.path.append(os.path.abspath("../timedata")) import settings from loguru import logger class StockBasics(SqlBaseManager): """ 获取此刻有意义的股票列表 依据 tushare的get_stock_basic 同时去掉 暂停上市的,终止上市的,风险警示 """ def stock_basic_fun(self): pro = ts.pro_api() data = pro.stock_basic() if type(data) != pd.DataFrame: logger.info('从tushare获取stock_basic数据更新失败') return None if data.empty: logger.info('数据为空,从tushare获取stock_basic数据更新失败') return None return data def __init__(self): SqlBaseManager.__init__(self) self.table_name = 'stock_basics' self.data_fun = self.stock_basic_fun # class StockMeaning(SqlBaseManager): # """日常有用的stock,运行正常的stock # """ # def stock_meaning_fun(self, THRESHOLD=50): # sb = StockBasics() # sb_data = sb.read() # filter_stock = [] # # 过滤规则 # # 近2个月有交易,最后一个交易日价格在50以下 # start_day = datetime.datetime.now() - datetime.timedelta(days=14) # start_day_str = start_day.strftime('%Y-%m-%d') # hd = HistData() # for code in sb_data.code: # temp = hd.read(code, start=start_day_str) # if not temp.empty: # if 5 < temp.iloc[0]['high'] < THRESHOLD: # filter_stock.append(code) # print code # result = sb_data[sb_data.code.isin(filter_stock)] # return result # def __init__(self): # SqlBaseManager.__init__(self) # self.table_name = 'stock_meaning' # self.data_fun = self.stock_meaning_fun class HistData(SqlDayManager): """ 以tushare为数据源的历史天的数据 数据源是Hist_DATA """ def __init__(self): SqlDayManager.__init__(self) self.table_name = 'hist_data' pro = ts.pro_api() self.get_data_fun = pro.daily def add_all(self): """遍历所有code,把所有数据新增 """ sb = StockBasics() AllStocks = sb.read() no_data_code = [] # 没有数据,或者没有更新数据的code for code in AllStocks.ts_code: logger.debug(u"add %s" % code) is_success = self.add(code) if not is_success: no_data_code.append(code) sleeptime=random.randint(0, 15) time.sleep(sleeptime) return no_data_code # def plot_code_box(self, code, start='2015-11-01',end=None,): # """画出code的时间蜡烛图 # Args: # code: str| 代码code # flag: str or list of str| code返回数据中指定的列名 # start_day: str|样式'2017-01-01'|开始时间 # end_day: str|样式'2017-01-01'|结束时间 # eg: # dm = DataManager() # dm.plot_code_line('300254') # """ # data = self.read(code, start, end) # data.get(['open','high','close','low']).T.plot.box() # plt.show() # class IndustryClassified( SqlBaseManager): # """工业分类的类 # """ # def __init__(self): # SqlBaseManager.__init__(self) # self.table_name = 'industry_classified' # self.data_fun = ts.get_industry_classified
nilq/baby-python
python
from localstack.dashboard import infra from localstack.config import USE_SSL def test_infra_graph_generation(): try: graph = infra.get_graph() except Exception as e: if USE_SSL: print('TODO: the Web UI in combination with USE_SSL=true is currently broken.') return assert 'nodes' in graph assert 'edges' in graph # TODO add more tests/assertions
nilq/baby-python
python
from typing import Optional from ..helpers.const import * class ConfigData: name: str host: str port: int username: Optional[str] password: Optional[str] password_clear_text: Optional[str] unit: int update_entities_interval: int update_api_interval: int monitored_devices: list monitored_interfaces: list device_trackers: list log_level: str log_incoming_messages: bool consider_away_interval: int def __init__(self): self.name = DEFAULT_NAME self.host = "" self.port = 0 self.username = None self.password = None self.password_clear_text = None self.unit = ATTR_BYTE self.update_entities_interval = DEFAULT_UPDATE_ENTITIES_INTERVAL self.update_api_interval = DEFAULT_UPDATE_API_INTERVAL self.monitored_devices = [] self.monitored_interfaces = [] self.device_trackers = [] self.log_level = "" self.log_incoming_messages = False self.store_debug_files = False self.consider_away_interval = DEFAULT_CONSIDER_AWAY_INTERVAL @property def unit_size(self): return ALLOWED_UNITS[self.unit] @property def has_credentials(self): has_username = self.username and len(self.username) > 0 has_password = self.password_clear_text and len(self.password_clear_text) > 0 has_credentials = has_username or has_password return has_credentials @property def url(self): url = API_URL_TEMPLATE.format(self.host) return url def __repr__(self): obj = { CONF_NAME: self.name, CONF_HOST: self.host, CONF_USERNAME: self.username, CONF_PASSWORD: self.password, CONF_UNIT: self.unit, CONF_UPDATE_API_INTERVAL: self.update_api_interval, CONF_UPDATE_ENTITIES_INTERVAL: self.update_entities_interval, CONF_MONITORED_DEVICES: self.monitored_devices, CONF_MONITORED_INTERFACES: self.monitored_interfaces, CONF_TRACK_DEVICES: self.device_trackers, CONF_LOG_LEVEL: self.log_level, CONF_LOG_INCOMING_MESSAGES: self.log_incoming_messages, CONF_CONSIDER_AWAY_INTERVAL: self.consider_away_interval, } to_string = f"{obj}" return to_string
nilq/baby-python
python
# Generated by Django 3.2.8 on 2021-11-30 17:55 from django.conf import settings import django.core.validators from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name='Address', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('active', models.CharField(choices=[(0, 'Active'), (1, 'Inactive'), (2, 'Archived')], max_length=1, verbose_name='Activate Account')), ('role', models.CharField(choices=[('shipping', 'Shipping Address'), ('billing', 'Billing Address'), ('both', 'Billing/Shipping')], max_length=10, verbose_name='Role')), ('created_on', models.DateField(auto_now_add=True, verbose_name='Created Date')), ('last_modified', models.DateTimeField(auto_now_add=True, verbose_name='Last Modified Date')), ('address_1', models.CharField(max_length=50, verbose_name='Address 1')), ('address_2', models.CharField(max_length=50, verbose_name='Address 2')), ('city', models.CharField(max_length=50, verbose_name='City')), ('state', models.CharField(choices=[('AL', 'Alabama'), ('AK', 'Alaska'), ('AS', 'American Samoa'), ('AZ', 'Arizona'), ('AR', 'Arkansas'), ('CA', 'California'), ('CO', 'Colorado'), ('CT', 'Connecticut'), ('DE', 'Delaware'), ('DC', 'District of Columbia'), ('FL', 'Florida'), ('GA', 'Georgia'), ('GU', 'Guam'), ('HI', 'Hawaii'), ('ID', 'Idaho'), ('IL', 'Illinois'), ('IN', 'Indiana'), ('IA', 'Iowa'), ('KS', 'Kansas'), ('KY', 'Kentucky'), ('LA', 'Louisiana'), ('ME', 'Maine'), ('MD', 'Maryland'), ('MA', 'Massachusetts'), ('MI', 'Michigan'), ('MN', 'Minnesota'), ('MS', 'Mississippi'), ('MO', 'Missouri'), ('MT', 'Montana'), ('NE', 'Nebraska'), ('NV', 'Nevada'), ('NH', 'New Hampshire'), ('NJ', 'New Jersey'), ('NM', 'New Mexico'), ('NY', 'New York'), ('NC', 'North Carolina'), ('ND', 'North Dakota'), ('MP', 'Northern Mariana Islands'), ('OH', 'Ohio'), ('OK', 'Oklahoma'), ('OR', 'Oregon'), ('PA', 'Pennsylvania'), ('PR', 'Puerto Rico'), ('RI', 'Rhode Island'), ('SC', 'South Carolina'), ('SD', 'South Dakota'), ('TN', 'Tennessee'), ('TX', 'Texas'), ('UT', 'Utah'), ('VT', 'Vermont'), ('VI', 'Virgin Islands'), ('VA', 'Virginia'), ('WA', 'Washington'), ('WV', 'West Virginia'), ('WI', 'Wisconsin'), ('WY', 'Wyoming')], max_length=50, verbose_name='State')), ('zip_code', models.CharField(max_length=50, verbose_name='Zip Code')), ('phone', models.CharField(max_length=15, validators=[django.core.validators.RegexValidator('^(\\d{10}$)', 'Please use numerical format without any spaces or special characters')], verbose_name='Phone')), ('country', models.CharField(max_length=2, verbose_name='Country')), ], options={ 'verbose_name_plural': 'Addresses', }, ), migrations.CreateModel( name='Contact', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=50, verbose_name='Name')), ('position', models.CharField(max_length=50, verbose_name='Position or Role')), ('description', models.TextField(verbose_name='Contact Notes')), ('phone_1', models.CharField(max_length=15, validators=[django.core.validators.RegexValidator('^(\\d{10}$)', 'Please use numerical format without any spaces or special characters')], verbose_name='Phone 1')), ('phone_2', models.CharField(max_length=15, validators=[django.core.validators.RegexValidator('^(\\d{10}$)', 'Please use numerical format without any spaces or special characters')], verbose_name='Phone 2')), ('email_1', models.EmailField(max_length=254, verbose_name='')), ('email_2', models.EmailField(max_length=254, verbose_name='')), ], ), migrations.CreateModel( name='Customer', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('role', models.CharField(choices=[('customer', 'Customer'), ('client', 'Client'), ('vendor', 'Vendor'), ('employee', 'Employee')], max_length=50, verbose_name='Role')), ('dba', models.CharField(max_length=50, verbose_name='dba')), ('name', models.CharField(max_length=50, verbose_name='Legal Business Entity')), ('start_date', models.DateField(verbose_name='Start Date')), ('end_date', models.DateField(blank=True, null=True, verbose_name='End Date')), ('active', models.CharField(choices=[(0, 'Active'), (1, 'Inactive'), (2, 'Archived')], max_length=1, verbose_name='Active')), ('created_date', models.DateTimeField(auto_now_add=True, verbose_name='Created Date')), ('ein', models.CharField(max_length=50, verbose_name='EIN')), ('industry', models.CharField(choices=[('agriculture', 'Agriculture'), ('arts entertainment', 'Arts & Entertainment'), ('construction', 'Construction'), ('education', 'Education'), ('energy', 'Energy'), ('food', 'Food & Hospitality'), ('finance', 'Finance and Insurance'), ('healthcare', 'Healthcare'), ('manufacturing', 'Manufacturing'), ('mining', 'Mining'), ('other', 'Other Services'), ('services', 'Professional, Scientific, and Tech Services'), ('real estate', 'Real Estate'), ('retail', 'Retail'), ('transportation', 'Transportation & Logistics'), ('utilities', 'Utilities'), ('wholesale', 'Wholesale')], max_length=100, verbose_name='Industry')), ('website', models.URLField(verbose_name='Webiste')), ('account_manager', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.PROTECT, related_name='customer_Account', to=settings.AUTH_USER_MODEL, verbose_name='Account Manager')), ('billing_address', models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, related_name='customer_billing', to='customer.address', verbose_name='Address')), ('contact', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.PROTECT, related_name='customer_employee', to='customer.contact', verbose_name='Contact')), ('created_by', models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, related_name='created_by_customer', to=settings.AUTH_USER_MODEL, verbose_name='Created by')), ('shipping_address', models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, related_name='customer_location', to='customer.address', verbose_name='Address')), ], options={ 'verbose_name_plural': 'Customers', }, ), migrations.AddField( model_name='contact', name='employer', field=models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, related_name='contact_employer', to='customer.customer', verbose_name='Employer'), ), ]
nilq/baby-python
python
from user.models import CourseRegistration # TODO: # send mail with formatted relevant student test results to course adviser # generate a list of courses registered buy a student for the current semester and session def get_registered_courses(student, session, semester): reg = CourseRegistration.objects.filter(student=student, session=session, semester=semester) return reg def get_current_registered_courses(student, semester): reg = CourseRegistration.objects.filter(student=student, session__is_current=True, semester=semester) return reg
nilq/baby-python
python
from output.models.ms_data.regex.re_l32_xsd.re_l32 import ( Regex, Doc, ) __all__ = [ "Regex", "Doc", ]
nilq/baby-python
python
from app import app ''' set debug=False bellow when deploying to prod ''' app.run(host='0.0.0.0', debug=True)
nilq/baby-python
python
#!/usr/bin/python3 # -*- mode: python -*- """ s3_gateway: bottle/boto3 interface to view an s3 bucket in a web browser. 2021-02-15 slg - updated to use anonymous s3 requests, per https://stackoverflow.com/questions/34865927/can-i-use-boto3-anonymously 2021-02-20 slg - add support for database queries to augment what's in S3 """ import json import logging import mimetypes import os import sys import urllib.parse from os.path import dirname import boto3 import botocore import botocore.exceptions from botocore import UNSIGNED from botocore.client import Config import bottle #from botocore.exceptions import ClientError from bottle import request, response, redirect import db_lookup DESCRIPTION=""" This is the testing program for the gateway that allows S3 files to be accessed from the website. """ DEFAULT_BUCKET = 'digitalcorpora' BYPASS_URL = 'https://digitalcorpora.s3.amazonaws.com/' USE_BYPASS = True IGNORE_FILES = ['.DS_Store', 'Icon'] # Specify files in the runtime environment S3_TEMPLATE_FILENAME = os.path.join(dirname(__file__), "templates/s3_index.tpl") S3_ERROR_404_FILENAME = os.path.join(dirname(__file__), "templates/error_404.tpl") # Create the S3_INDEX bottle SimpleTemplate here, outside of the # s3_list_prefix_v1, so that it gets read when s3_gateway.py is imported. # This causes bottle to compile it ONCE and repeatedly serve it out S3_INDEX = bottle.SimpleTemplate( open( S3_TEMPLATE_FILENAME ).read()) ERROR_404 = bottle.SimpleTemplate( open( S3_TEMPLATE_FILENAME ).read()) def s3_get_dirs_files(bucket_name, prefix): """ Returns a tuple of the s3 objects of the 'dirs' and the 'files' Makes an unauthenticated call :param bucket_name: bucket to read :param prefix: prefix to examine :return: (prefixes,keys) - a list of prefixes under `prefix`, and keys under `prefix`. """ s3client = boto3.client('s3', config=Config(signature_version=UNSIGNED)) paginator = s3client.get_paginator('list_objects_v2') pages = paginator.paginate( Bucket=bucket_name, Prefix=prefix, Delimiter='/') dirs = [] files = [] for page in pages: for obj in page.get('CommonPrefixes', []): dirs.append(obj) for obj in page.get('Contents', []): files.append(obj) if (not dirs) and (not files): raise FileNotFoundError(prefix) return (dirs, files) def s3_to_link(obj): """Given a s3 object, return a link to it""" # pylint: disable=R1705 if 'Prefix' in obj: name = obj['Prefix'].split("/")[-2]+"/" return request.url + urllib.parse.quote(name) elif 'Key' in obj: return BYPASS_URL + urllib.parse.quote(obj['Key']) else: raise RuntimeError("obj: "+json.dumps(obj, default=str)) def s3_list_prefix(bucket_name, prefix, auth=None): """The revised s3_list_prefix implementation: uses the Bottle template system to generate HTML. Get a list of the sub-prefixes (dirs) and the objects with this prefix (files), and then construct the dirs[] and files[] arrays. Elements of dirs are strings (one for each prefix). Elements of files[] are (url,name, size,sha256,sha3) tuples. :param bucket_name: the bucket to list :param path: the path within the bucket (no leading /) """ path = '/' paths = [] for part in prefix.split('/')[:-1]: part += '/' path += part paths.append((path, part)) (s3_dirs, s3_files) = s3_get_dirs_files(bucket_name, prefix) dirs = [obj['Prefix'].split('/')[-2]+'/' for obj in s3_dirs] if auth is not None and s3_files: db_lookup.annotate_s3files(auth, s3_files) files = [{'a': s3_to_link(obj), 'basename': os.path.basename(obj['Key']), 'size': "{:,}".format(obj['Size']), 'ETag': obj['ETag'], 'sha2_256': obj.get('sha2_256','n/a'), 'sha3_256': obj.get('sha3_256','n/a') } for obj in s3_files] return S3_INDEX.render(prefix=prefix, paths=paths, files=files, dirs=dirs, sys_version=sys.version) def s3_app(*, bucket, quoted_prefix, auth=None): """ Fetching a file. Called from bottle. :param bucket: - the bucket that we are serving from :param quoted_prefix: - the path to display. :param auth: - Database authenticator """ prefix = urllib.parse.unquote(quoted_prefix) logging.warning("bucket=%s quoted_prefix=%s prefix=%s", bucket, quoted_prefix, prefix) if prefix.endswith("/"): try: return s3_list_prefix(bucket, prefix, auth=auth) except FileNotFoundError as e: logging.warning("e:%s", e) response.status = 404 return ERROR_404.render(bucket=bucket,prefix=prefix) # If the prefix does not end with a '/' and there is object there, see if it is a prefix try: obj = boto3.client('s3', config=Config( signature_version=UNSIGNED)).get_object(Bucket=bucket, Key=prefix) except botocore.exceptions.ClientError as e: try: return s3_list_prefix(bucket, prefix+"/", auth=auth) except FileNotFoundError as e: # No object and not a prefix response.status = 404 return ERROR_404.render(bucket=bucket,prefix=prefix) # If we are using the bypass, redirect if USE_BYPASS: logging.info("redirect to %s", BYPASS_URL + prefix) redirect(BYPASS_URL + prefix) # Otherwise download directly try: response.content_type = mimetypes.guess_type(prefix)[0] except (TypeError,ValueError,KeyError) as e: response.content_type = 'application/octet-stream' return obj['Body'] if __name__ == "__main__": import argparse parser = argparse.ArgumentParser(formatter_class=argparse.ArgumentDefaultsHelpFormatter, description=DESCRIPTION) parser.add_argument("--bucket", default=DEFAULT_BUCKET, help='which bucket to use.') parser.add_argument('--prefix', help='specify prefix') args = parser.parse_args() if args.prefix: print(s3_app(bucket=args.bucket, quoted_prefix=args.prefix))
nilq/baby-python
python
from torch import Tensor, _VF # noqa: F401 from torch.nn.utils.rnn import PackedSequence import torch import warnings from typing import List, Optional, Tuple class QuantizedLinear(torch.jit.ScriptModule): __constants__ = ['scale', 'zero_point'] def __init__(self, other): super(QuantizedLinear, self).__init__() self.in_features = other.in_features self.out_features = other.out_features # Quantize weight and discard the original self.weight, self.col_offsets, self.scale, self.zero_point = torch.fbgemm_linear_quantize_weight( other.weight.clone(memory_format=torch.contiguous_format).float()) self.weight = torch.nn.Parameter(self.weight, requires_grad=False) self.col_offsets = torch.nn.Parameter(self.col_offsets, requires_grad=False) assert other.bias is not None, 'QuantizedLinear requires a bias' self.bias = torch.nn.Parameter(other.bias.clone(memory_format=torch.contiguous_format).float(), requires_grad=False) self.register_buffer( 'packed_tensor_ptr', torch.fbgemm_pack_quantized_matrix(self.weight.clone(memory_format=torch.contiguous_format))) @torch.jit.script_method def _unpack(self): self.packed_tensor_ptr.set_( torch.fbgemm_pack_quantized_matrix(self.weight)) @torch.jit.script_method def _pack(self): self.packed_tensor_ptr.set_( torch.zeros(torch.jit.annotate(List[int], []), dtype=torch.uint8).detach()) @torch.jit.script_method def forward(self, input): out = torch.fbgemm_linear_int8_weight_fp32_activation( input.float(), self.weight, self.packed_tensor_ptr, self.col_offsets, self.scale, self.zero_point, self.bias) return out.to(input.dtype) def extra_repr(self): repr = 'in_features={in_features}, out_features={out_features}, ' \ 'scale={scale}, zero_point={zero_point}'.format(**self.__dict__) return repr # FP16 weights class QuantizedLinearFP16(torch.jit.ScriptModule): def __init__(self, other): super(QuantizedLinearFP16, self).__init__() self.in_features = other.in_features self.out_features = other.out_features self.original_weight = other.weight self.weight = torch.fbgemm_pack_gemm_matrix_fp16( other.weight.clone(memory_format=torch.contiguous_format).float()) assert other.bias is not None, 'QuantizedLinearFP16 requires a bias' self.bias = torch.nn.Parameter(other.bias.clone(memory_format=torch.contiguous_format).float(), requires_grad=False) self.register_buffer('packed_weight', self.weight) @torch.jit.script_method def _unpack(self): self.packed_weight.set_( torch.fbgemm_pack_gemm_matrix_fp16( self.original_weight)) @torch.jit.script_method def _pack(self): self.packed_weight.set_( torch.zeros(torch.jit.annotate(List[int], []), dtype=torch.uint8).detach()) @torch.jit.script_method def forward(self, input): out = torch.fbgemm_linear_fp16_weight_fp32_activation( input.float(), self.packed_weight, self.bias) return out def extra_repr(self): repr = 'in_features={in_features}, out_features={out_features}, '.format(**self.__dict__) return repr # Quantized RNN cell implementations class QuantizedRNNCellBase(torch.jit.ScriptModule): __constants__ = ['input_size', 'hidden_size', 'bias', 'scale_hh', 'scale_ih', 'zero_point_ih', 'zero_point_hh'] def __init__(self, other): super(QuantizedRNNCellBase, self).__init__() self.input_size = other.input_size self.hidden_size = other.hidden_size self.bias = other.bias if not self.bias: raise ValueError("Quantized RNN cells require bias terms") weight_ih, col_offsets_ih, self.scale_ih, self.zero_point_ih = \ torch.fbgemm_linear_quantize_weight(other.weight_ih.clone(memory_format=torch.contiguous_format).float()) self.register_buffer('weight_ih', weight_ih) self.register_buffer('col_offsets_ih', col_offsets_ih) weight_hh, col_offsets_hh, self.scale_hh, self.zero_point_hh = \ torch.fbgemm_linear_quantize_weight(other.weight_hh.clone(memory_format=torch.contiguous_format).float()) self.register_buffer('weight_hh', weight_hh) self.register_buffer('col_offsets_hh', col_offsets_hh) packed_ih = torch.fbgemm_pack_quantized_matrix(self.weight_ih) self.register_buffer('packed_ih', packed_ih) packed_hh = torch.fbgemm_pack_quantized_matrix(self.weight_hh) self.register_buffer('packed_hh', packed_hh) self.bias_ih = torch.nn.Parameter(other.bias_ih.clone(memory_format=torch.contiguous_format).float(), requires_grad=False) self.bias_hh = torch.nn.Parameter(other.bias_hh.clone(memory_format=torch.contiguous_format).float(), requires_grad=False) def extra_repr(self): s = '{input_size}, {hidden_size}' if 'bias' in self.__dict__ and self.bias is not True: s += ', bias={bias}' if 'nonlinearity' in self.__dict__ and self.nonlinearity != "tanh": s += ', nonlinearity={nonlinearity}' return s.format(**self.__dict__) @torch.jit.script_method def check_forward_input(self, input): if input.size(1) != self.input_size: raise RuntimeError( "input has inconsistent input_size: got {}, expected {}".format( input.size(1), self.input_size)) @torch.jit.script_method def check_forward_hidden(self, input: Tensor, hx: Tensor, hidden_label: str = '') -> None: if input.size(0) != hx.size(0): raise RuntimeError( "Input batch size {} doesn't match hidden{} batch size {}".format( input.size(0), hidden_label, hx.size(0))) if hx.size(1) != self.hidden_size: raise RuntimeError( "hidden{} has inconsistent hidden_size: got {}, expected {}".format( hidden_label, hx.size(1), self.hidden_size)) # TODO: for some reason weak_script_method causes a destruction of the # module to occur, which in turn frees the packed_ih object via its DataPtr # deleter. This is bizarre and should probably get fixed. # @torch._jit_internal.weak_script_method @torch.jit.script_method def _unpack(self): self.packed_ih.set_(torch.fbgemm_pack_quantized_matrix(self.weight_ih)) self.packed_hh.set_(torch.fbgemm_pack_quantized_matrix(self.weight_hh)) # @torch._jit_internal.weak_script_method @torch.jit.script_method def _pack(self): self.packed_ih.set_( torch.zeros(torch.jit.annotate(List[int], []), dtype=torch.uint8).detach()) self.packed_hh.set_( torch.zeros(torch.jit.annotate(List[int], []), dtype=torch.uint8).detach()) class QuantizedRNNCell(QuantizedRNNCellBase): __constants__ = ['input_size', 'hidden_size', 'bias', 'scale_hh', 'scale_ih', 'zero_point_ih', 'zero_point_hh', 'nonlinearity'] def __init__(self, other): super(QuantizedRNNCell, self).__init__(other) self.nonlinearity = other.nonlinearity @torch.jit.script_method def forward(self, input: Tensor, hx: Optional[Tensor] = None) -> Tensor: self.check_forward_input(input) if hx is None: hx = torch.zeros(input.size(0), self.hidden_size, dtype=input.dtype, device=input.device) self.check_forward_hidden(input, hx, '') if self.nonlinearity == "tanh": ret = _VF.quantized_rnn_tanh_cell( input, hx, self.weight_ih, self.weight_hh, self.bias_ih, self.bias_hh, self.packed_ih, self.packed_hh, self.col_offsets_ih, self.col_offsets_hh, self.scale_ih, self.scale_hh, self.zero_point_ih, self.zero_point_hh ) elif self.nonlinearity == "relu": ret = _VF.quantized_rnn_relu_cell( input, hx, self.weight_ih, self.weight_hh, self.bias_ih, self.bias_hh, self.packed_ih, self.packed_hh, self.col_offsets_ih, self.col_offsets_hh, self.scale_ih, self.scale_hh, self.zero_point_ih, self.zero_point_hh ) else: ret = input # TODO: remove when jit supports exception flow raise RuntimeError( "Unknown nonlinearity: {}".format(self.nonlinearity)) return ret class QuantizedLSTMCell(QuantizedRNNCellBase): def __init__(self, other): super(QuantizedLSTMCell, self).__init__(other) @torch.jit.script_method def forward(self, input: Tensor, hx: Optional[Tuple[Tensor, Tensor]] = None) -> Tuple[Tensor, Tensor]: self.check_forward_input(input) if hx is None: zeros = torch.zeros(input.size(0), self.hidden_size, dtype=input.dtype, device=input.device) hx = (zeros, zeros) self.check_forward_hidden(input, hx[0], '[0]') self.check_forward_hidden(input, hx[1], '[1]') return _VF.quantized_lstm_cell( input, hx, self.weight_ih, self.weight_hh, self.bias_ih, self.bias_hh, self.packed_ih, self.packed_hh, self.col_offsets_ih, self.col_offsets_hh, self.scale_ih, self.scale_hh, self.zero_point_ih, self.zero_point_hh ) class QuantizedGRUCell(QuantizedRNNCellBase): def __init__(self, other): super(QuantizedGRUCell, self).__init__(other) @torch.jit.script_method def forward(self, input: Tensor, hx: Optional[Tensor] = None) -> Tensor: self.check_forward_input(input) if hx is None: hx = torch.zeros(input.size(0), self.hidden_size, dtype=input.dtype, device=input.device) self.check_forward_hidden(input, hx, '') return _VF.quantized_gru_cell( input, hx, self.weight_ih, self.weight_hh, self.bias_ih, self.bias_hh, self.packed_ih, self.packed_hh, self.col_offsets_ih, self.col_offsets_hh, self.scale_ih, self.scale_hh, self.zero_point_ih, self.zero_point_hh ) def apply_permutation(tensor: Tensor, permutation: Tensor, dim: int = 1) -> Tensor: return tensor.index_select(dim, permutation) class QuantizedRNNBase(torch.jit.ScriptModule): __constants__ = ['mode', 'input_size', 'hidden_size', 'num_layers', 'bias', 'batch_first', 'dropout', 'bidirectional', 'dtype'] def __init__(self, other, dtype=torch.int8): super(QuantizedRNNBase, self).__init__() self.mode = other.mode self.input_size = other.input_size self.hidden_size = other.hidden_size self.num_layers = other.num_layers self.bias = other.bias self.batch_first = other.batch_first if self.mode != 'GRU': assert not self.batch_first self.dropout = other.dropout self.bidirectional = other.bidirectional num_directions = 2 if self.bidirectional else 1 self.dtype = dtype assert self.bias # TODO: support more than just LSTM if self.mode != 'LSTM' and self.mode != 'GRU': raise RuntimeError('Only LSTM or GRU is supported for QuantizedRNN') if dtype != torch.int8 and dtype != torch.float16: raise RuntimeError('Unsupported dtype: {}'.format(dtype)) self.all_weights = [] # type: ignore for layer in range(self.num_layers): for direction in range(num_directions): layer_input_size = self.input_size if layer == 0 else self.hidden_size * num_directions suffix = '_reverse' if direction == 1 else '' def get_weight_bias(ihhh): weight_name = 'weight_{}_l{}{}'.format(ihhh, layer, suffix) bias_name = 'bias_{}_l{}{}'.format(ihhh, layer, suffix) weight = getattr(other, weight_name) bias = getattr(other, bias_name) return weight, bias weight_ih, bias_ih = get_weight_bias('ih') weight_hh, bias_hh = get_weight_bias('hh') if dtype == torch.int8: cell_params = torch.ops.quantized.make_quantized_cell_params( weight_ih, weight_hh, bias_ih, bias_hh) else: packed_ih = torch.ops.quantized.linear_prepack_fp16( weight_ih.float(), bias_ih) packed_hh = torch.ops.quantized.linear_prepack_fp16( weight_hh.float(), bias_hh) cell_params = torch.ops.quantized.make_quantized_cell_params_fp16( packed_ih, packed_hh) setattr(self, 'cell_params_{}_{}'.format(layer, suffix), cell_params) self.all_weights.append(cell_params) @torch.jit.script_method def check_input(self, input: Tensor, batch_sizes: Optional[Tensor]) -> None: expected_input_dim = 2 if batch_sizes is not None else 3 if input.dim() != expected_input_dim: raise RuntimeError( 'input must have {} dimensions, got {}'.format( expected_input_dim, input.dim())) if self.input_size != input.size(-1): raise RuntimeError( 'input.size(-1) must be equal to input_size. Expected {}, got {}'.format( self.input_size, input.size(-1))) @torch.jit.script_method def get_expected_hidden_size(self, input: Tensor, batch_sizes: Optional[Tensor]) -> Tuple[int, int, int]: if batch_sizes is not None: mini_batch = int(batch_sizes[0]) else: mini_batch = input.size(0) if self.batch_first else input.size(1) num_directions = 2 if self.bidirectional else 1 expected_hidden_size = (self.num_layers * num_directions, mini_batch, self.hidden_size) return expected_hidden_size @torch.jit.script_method def check_hidden_size(self, hx: Tensor, expected_hidden_size: Tuple[int, int, int], msg: str = 'Expected hidden size {}, got {}') -> None: if hx.size() != expected_hidden_size: raise RuntimeError(msg.format(expected_hidden_size, list(hx.size()))) @torch.jit.script_method def check_forward_args(self, input: Tensor, hidden: Tensor, batch_sizes: Optional[Tensor]) -> None: self.check_input(input, batch_sizes) expected_hidden_size = self.get_expected_hidden_size(input, batch_sizes) self.check_hidden_size(hidden, expected_hidden_size, msg='Expected hidden size {}, got {}') @torch.jit.script_method def permute_hidden(self, hx: Tensor, permutation: Optional[Tensor]) -> Tensor: if permutation is None: return hx return apply_permutation(hx, permutation) class QuantizedLSTM(QuantizedRNNBase): __overloads__ = {'forward': ['forward_packed', 'forward_tensor']} def __init__(self, other, dtype): super(QuantizedLSTM, self).__init__(other, dtype) @torch.jit.script_method def forward_impl(self, input: Tensor, hx: Optional[Tuple[Tensor, Tensor]], batch_sizes: Optional[Tensor], max_batch_size: int, sorted_indices: Optional[Tensor]) -> Tuple[Tensor, Tuple[Tensor, Tensor]]: # noqa if hx is None: num_directions = 2 if self.bidirectional else 1 zeros = torch.zeros(self.num_layers * num_directions, max_batch_size, self.hidden_size, dtype=input.dtype, device=input.device) hx = (zeros, zeros) else: # Each batch of the hidden state should match the input sequence that # the user believes he/she is passing in. hx = self.permute_hidden(hx, sorted_indices) self.check_forward_args(input, hx, batch_sizes) assert batch_sizes is None result = torch.quantized_lstm(input, hx, self.all_weights, self.bias, self.num_layers, float(self.dropout), self.training, self.bidirectional, self.batch_first, dtype=self.dtype, use_dynamic=False) output = result[0] hidden = result[1:] return output, hidden @torch.jit.script_method def forward_tensor(self, input: Tensor, hx: Optional[Tuple[Tensor, Tensor]] = None) -> Tuple[Tensor, Tuple[Tensor, Tensor]]: batch_sizes = None max_batch_size = input.size(0) if self.batch_first else input.size(1) sorted_indices = None unsorted_indices = None output, hidden = self.forward_impl(input, hx, batch_sizes, max_batch_size, sorted_indices) return output, self.permute_hidden(hidden, unsorted_indices) @torch.jit.script_method def forward_packed(self, input: PackedSequence, hx: Optional[Tuple[Tensor, Tensor]] = None ) -> Tuple[PackedSequence, Tuple[Tensor, Tensor]]: input, batch_sizes, sorted_indices, unsorted_indices = input max_batch_size = batch_sizes[0] max_batch_size = int(max_batch_size) output, hidden = self.forward_impl(input, hx, batch_sizes, max_batch_size, sorted_indices) output = PackedSequence(output, batch_sizes, sorted_indices, unsorted_indices) return output, self.permute_hidden(hidden, unsorted_indices) @torch.jit.script_method def permute_hidden(self, hx: Tuple[Tensor, Tensor], permutation: Optional[Tensor]) -> Tuple[Tensor, Tensor]: if permutation is None: return hx return apply_permutation(hx[0], permutation), apply_permutation(hx[1], permutation) @torch.jit.script_method def check_forward_args(self, input: Tensor, hidden: Tuple[Tensor, Tensor], batch_sizes: Optional[Tensor]) -> None: self.check_input(input, batch_sizes) expected_hidden_size = self.get_expected_hidden_size(input, batch_sizes) self.check_hidden_size(hidden[0], expected_hidden_size, 'Expected hidden[0] size {}, got {}') self.check_hidden_size(hidden[1], expected_hidden_size, 'Expected hidden[1] size {}, got {}') def forward(self, input, hx=None): if isinstance(input, PackedSequence): return self.forward_packed(input, hx) else: return self.forward_tensor(input, hx) class QuantizedGRU(QuantizedRNNBase): __overloads__ = {'forward': ['forward_packed', 'forward_tensor']} @torch.jit.script_method def forward_impl(self, input: Tensor, hx: Optional[Tensor], batch_sizes: Optional[Tensor], max_batch_size: int, sorted_indices: Optional[Tensor]) -> Tuple[Tensor, Tensor]: # noqa if hx is None: num_directions = 2 if self.bidirectional else 1 hx = torch.zeros(self.num_layers * num_directions, max_batch_size, self.hidden_size, dtype=input.dtype, device=input.device) else: # Each batch of the hidden state should match the input sequence that # the user believes he/she is passing in. hx = self.permute_hidden(hx, sorted_indices) self.check_forward_args(input, hx, batch_sizes) if batch_sizes is None: result = torch.quantized_gru(input, hx, self.all_weights, self.bias, self.num_layers, float(self.dropout), self.training, self.bidirectional, self.batch_first) else: result = torch.quantized_gru(input, batch_sizes, hx, self.all_weights, self.bias, self.num_layers, float(self.dropout), self.training, self.bidirectional) output = result[0] hidden = result[1] return output, hidden @torch.jit.script_method def forward_tensor(self, input: Tensor, hx: Optional[Tensor] = None) -> Tuple[Tensor, Tensor]: batch_sizes = None max_batch_size = input.size(0) if self.batch_first else input.size(1) sorted_indices = None unsorted_indices = None output, hidden = self.forward_impl(input, hx, batch_sizes, max_batch_size, sorted_indices) return output, self.permute_hidden(hidden, unsorted_indices) @torch.jit.script_method def forward_packed(self, input: PackedSequence, hx: Optional[Tensor] = None) -> Tuple[PackedSequence, Tensor]: input, batch_sizes, sorted_indices, unsorted_indices = input max_batch_size = batch_sizes[0] max_batch_size = int(max_batch_size) output, hidden = self.forward_impl(input, hx, batch_sizes, max_batch_size, sorted_indices) output = PackedSequence(output, batch_sizes, sorted_indices, unsorted_indices) return output, self.permute_hidden(hidden, unsorted_indices) def forward(self, input, hx=None): if isinstance(input, PackedSequence): return self.forward_packed(input, hx) else: return self.forward_tensor(input, hx) def quantize_rnn_cell_modules(module): warnings.warn("quantize_rnn_cell_modules function has been deprecated. " "Please use torch.quantization.quantize_dynamic API instead.") reassign = {} for name, mod in module.named_modules(): if mod is module: continue new_mod = quantize_rnn_cell_modules(mod) if new_mod is not mod: reassign[name] = new_mod for name, mod in reassign.items(): setattr(module, name, mod) if isinstance(module, torch.nn.LSTMCell): return QuantizedLSTMCell(module) if isinstance(module, torch.nn.GRUCell): return QuantizedGRUCell(module) if isinstance(module, torch.nn.RNNCell): return QuantizedRNNCell(module) return module def quantize_linear_modules(module, dtype=torch.int8): warnings.warn("quantize_linear_modules function has been deprecated. " "Please use torch.quantization.quantize_dynamic API instead.") reassign = {} for name, mod in module.named_modules(): if mod is module: continue new_mod = quantize_linear_modules(mod, dtype) if new_mod is not mod: reassign[name] = new_mod for name, mod in reassign.items(): setattr(module, name, mod) if isinstance(module, torch.nn.Linear): if dtype == torch.int8: return QuantizedLinear(module) elif dtype == torch.float16: return QuantizedLinearFP16(module) else: raise RuntimeError( "Unsupported dtype: {}".format(dtype)) return module def quantize_rnn_modules(module, dtype=torch.int8): warnings.warn("quantize_rnn_modules function has been deprecated. " "Please use torch.quantization.quantize_dynamic API instead.") reassign = {} for name, mod in module.named_modules(): if mod is module: continue new_mod = quantize_rnn_modules(mod, dtype) if new_mod is not mod: reassign[name] = new_mod for name, mod in reassign.items(): setattr(module, name, mod) if isinstance(module, torch.nn.LSTM): if dtype != torch.int8 and dtype != torch.float16: raise RuntimeError("Unsupported dtype: {}".format(dtype)) return QuantizedLSTM(module, dtype) if isinstance(module, torch.nn.GRU): return QuantizedGRU(module) return module
nilq/baby-python
python
import argparse import os import json import xml.etree.cElementTree as ET import logging import numpy as np import sys sys.path.insert(0,'common') from transforms3dbatch import * from utils.quaternion import * def parse_motions(path): xml_tree = ET.parse(path) xml_root = xml_tree.getroot() xml_motions = xml_root.findall('Motion') motions = [] if len(xml_motions) > 1: logging.warn('more than one <Motion> tag in file "%s", only parsing the first one', path) motions.append(_parse_motion(xml_motions[0], path)) return motions def _parse_motion(xml_motion, path): xml_joint_order = xml_motion.find('JointOrder') if xml_joint_order is None: raise RuntimeError('<JointOrder> not found') joint_names = [] joint_indexes = [] for idx, xml_joint in enumerate(xml_joint_order.findall('Joint')): name = xml_joint.get('name') if name is None: raise RuntimeError('<Joint> has no name') joint_indexes.append(idx) joint_names.append(name) frames = {'root_pos':[], 'root_rot':[], 'joint_pos':[]} xml_frames = xml_motion.find('MotionFrames') if xml_frames is None: raise RuntimeError('<MotionFrames> not found') for xml_frame in xml_frames.findall('MotionFrame'): root_pos, root_rot, joint_pos = _parse_frame(xml_frame, joint_indexes) frames['root_pos'].append(root_pos) frames['root_rot'].append(root_rot) frames['joint_pos'].append(joint_pos) return joint_names, frames def _parse_frame(xml_frame, joint_indexes): xml_root_pos = xml_frame.find('RootPosition') xml_root_rot = xml_frame.find('RootRotation') n_joints = len(joint_indexes) xml_joint_pos = xml_frame.find('JointPosition') if xml_joint_pos is None: raise RuntimeError('<JointPosition> not found') root_pos = _parse_list(xml_root_pos, 3) root_rot = _parse_list(xml_root_rot, 3) joint_pos = _parse_list(xml_joint_pos, n_joints, joint_indexes) return root_pos, root_rot, joint_pos def _parse_list(xml_elem, length, indexes=None): if indexes is None: indexes = range(length) elems = [float(x) for idx, x in enumerate(xml_elem.text.rstrip().split(' ')) if idx in indexes] if len(elems) != length: raise RuntimeError('invalid number of elements') return elems def mmm2csv(src): joint_names, mmm_dict = parse_motions(src.as_posix())[0] root_pos = np.array(mmm_dict['root_pos'], dtype=np.float) * 0.001 / 0.056444 root_rot = np.array(mmm_dict['root_rot'], dtype=np.float) joint_pos = np.array(mmm_dict['joint_pos'], dtype=np.float) joint_dict = {} for idx, name in enumerate(joint_names): if name.split('_')[0][-1] != 't': xyz = name.split('_')[0][-1] joint = name.split('_')[0][:-1] else: xyz = 'y' joint = name.split('_')[0] if joint not in joint_dict: joint_dict[joint] = dict() joint_dict[joint][xyz] = joint_pos[:, idx] joints = [] values = [] for cnt, joint in enumerate(joint_dict): joint_vals = [] joints.append(joint) for axes in ['x', 'y', 'z']: if axes in joint_dict[joint]: joint_vals.append(joint_dict[joint][axes]) else: joint_vals.append(np.zeros_like(root_pos[:, 0])) values.append(np.stack(joint_vals, axis=1)) values = np.stack(values, axis=0) return joints, root_pos, root_rot, values, joint_dict def mmm2amc(src, dest): joints, root_pos, root_rot, values, joint_dict = mmm2csv(src) axesMap = {'x':'x', 'y':'y', 'z':'z'} root_pos = root_pos[..., [0,2,1]] ## convert to quaternion and back by changing the axes order root_rot = quat2eulerbatch(qinv_np(euler2quatbatch(root_rot, 'sxyz')[...,[0, 1, 3, 2]]), 'sxyz') * 180/np.pi values = quat2eulerbatch(qinv_np(euler2quatbatch(values, 'sxyz')[..., [0, 1, 3, 2]]), 'sxyz') * 180/np.pi joint_pos = [] for cnt, joint in enumerate(joints): for axes_num, axes in enumerate(['x', 'y', 'z']): if axesMap[axes] in joint_dict[joint]: joint_dict[joint][axesMap[axes]] = values[cnt, :, axes_num] lines = ["#!OML:ASF H:", ":FULLY-SPECIFIED", ":DEGREES"] for idx in range(root_pos.shape[0]): lines.append('{}'.format(idx+1)) lines.append('root' + (' {}'*6).format(root_pos[idx, 0], root_pos[idx, 1], root_pos[idx, 2], root_rot[idx, 0], root_rot[idx, 1], root_rot[idx, 2])) for cnt, joint in enumerate(joint_dict): format_str = '{} ' * (len(joint_dict[joint])+1) format_str = format_str[:-1] joint_vals = [] for axes in ['x', 'y', 'z']: if axes in joint_dict[joint]: joint_vals.append(joint_dict[joint][axes][idx]) lines.append(format_str.format(*([joint] + joint_vals))) lines = '\n'.join(lines) + '\n' os.makedirs(dest.parent, exist_ok=True) with open(dest, 'w') as fp: fp.writelines(lines)
nilq/baby-python
python
from django.apps import apps as django_apps default_app_config = 'scrapyd_dash.apps.ScrapydDashConfig'
nilq/baby-python
python
__all__ = ['auth', 'constants', 'controllers', 'forms']
nilq/baby-python
python
#!/bin/python import sys S = raw_input().strip() try: r = int(S) print r except ValueError: print "Bad String"
nilq/baby-python
python
#!/usr/bin/env python3 # coding: utf-8 """Automatic EcoFlex sequences annotation pipeline. Edits: - Recolor all AmpR with the same color as YTK parts - Add AmpR terminator feature with standard color """ import copy import io import itertools import json import re import os import warnings import sys import bs4 as bs import fs.path import six import tqdm import requests from Bio.Alphabet import IUPAC from Bio.Seq import Seq, translate from Bio.SeqFeature import ( SeqFeature, FeatureLocation, CompoundLocation, Reference, ) from Bio.SeqIO import read, write from Bio.SeqRecord import SeqRecord from Bio.Restriction import BsaI from fs.zipfs import ReadZipFS from moclo.record import CircularRecord from moclo.regex import DNARegex ZIP_URL = "https://media.addgene.org/cms/filer_public/1a/00/1a00a9f1-608f-453a-937a-7f46cf872dfc/ecoflex-kit-genbank-files.zip" URL = "https://www.addgene.org/cloning/moclo/freemont-ecoflex/" UA = "Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/54.0.2840.99 Safari/537.36" # Part sequence for automatic annotation / annotation relocation AMPR_TERM = DNARegex("gattatcaaaaaggatctt") # Reverse 3' of AmpR terminator BB_PREFIX = DNARegex("gaattcgcggccgcttctag") CMR_PROMOTER = DNARegex( 'tttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgcccgatcaa') CMR_TERMINATOR = DNARegex( 'accaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaa') AMPR_PROMOTER = DNARegex( 'actcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctg') AMPR_TERMINATOR = DNARegex( 'gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacag') NAME_REGEX = re.compile(r"([^ ]*) \(([^\)]*)\)(_[A-Z]{2})") COLOR_REGEX = re.compile(r"color: (#[0-9a-fA-F]{6})") FULL_SEQUENCES = { "pBP-BBa_B0034": "https://www.addgene.org/72980/sequences/", "pBP-SJM901": "https://www.addgene.org/72966/sequences/", } # Partial sequences from the reference EcoFlex paper PROMOTERS = { "pBP-SJM901": "CTATTTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGCGTAC", "pBP-SJM902": "CTATTTTACAGCTAGCTCAGTCCTAGGGATTATGCTAGCGTAC", "pBP-SJM903": "CTATCTTATAGCTAGCTCAGTCCTTGGGATTATGCTAGCGTAC", "pBP-SJM905": "CTATTTTATAGCTAGCTCAGTCCTTGGGATTATGCTAGCGTAC", "pBP-SJM906": "CTATTTGATGGCTAGCTCAGTCCTAGGGATTGTGCTAGCGTAC", "pBP-SJM908": "CTATTTTATAGCTAGCTCAGCCCTTGGTATTATGCTAGCGTAC", "pBP-SJM910": "CTATTTGATGGCTAGCTCAGTCCTTGGTATTATGCTAGCGTAC", "pBP-SJM911": "CTATTTGACAGCTAGCTCAGTCCTTGGTACTGTGCTAGCGTAC", "pBP-SJM912": "CTATTTGATAGCTAGCTCAGTCCTAGGTACTATGCTAGCGTAC", "pBP-SJM914": "CTATTTGATGGCTAGCTCAGTCCTAGGGATTGTGCTAGCGTAC", "pBP-SJM915": "CTATTTTATGGCTAGCTCAGTCCTTGGTATTATGCTAGCGTAC", } def translate_color(feature): notes = feature.qualifiers.get("note", []) color_note = next((n for n in notes if n.startswith("color: #")), None) if color_note is None: return hex_color = COLOR_REGEX.match(color_note).group(1).lower() feature.qualifiers["note"].remove(color_note) feature.qualifiers.update( { "ApEinfo_fwdcolor": [hex_color], "ApEinfo_revcolor": [hex_color], "ApEinfo_graphicformat": [ "arrow_data {{0 1 2 0 0 -1} {} 0} width 5 offset 0" ], } ) if __name__ == "__main__": warnings.simplefilter("ignore") session = requests.Session() # load the kit inventory page with session.get(URL) as res: soup = bs.BeautifulSoup(res.text, "html.parser") # load the zip archive with session.get(ZIP_URL) as res: archive = ReadZipFS(six.BytesIO(res.content)).opendir( "/EcoFlex - GenBank/" ) # load inventory inventory = soup.find("table", class_="kit-inventory-table") it = tqdm.tqdm(inventory.find_all("tr")[1:]) for row in it: # extract each row row_text = row.find("a").text # get antibiotics resistances resistance = row.find("span", class_="resistance-spacing").text.strip() name = id_ = row_text.strip() # Update the progress bar it.set_description(id_) # TODO: entry vector not supported if id_ in ('pBP', 'pBP-ORF', 'pBP-lacZ'): continue elif id_ == "pBP-T7_RBS-His6-Thrombin": name = id_ = "pBP-T7-RBS-His6" elif id_.startswith("pBP-T7_"): name = id_ = id_.replace("_", "-") elif id_.startswith("pBP-ORF-"): name = id_ = id_.replace("pBP-ORF-", "pBP-") elif id_ == "pBP-HexHis": name = id_ = "pBP-His6" elif id_.startswith("pBP_BBa"): name = id_ = id_.replace("pBP_BBa", "pBP-BBa") # extract info info = { "resistance": resistance, # "name": id_, "id": id_, # "type": type_, "location": row.find("b").text.strip().replace(" / ", ""), "addgene_id": row.find("a").get("href").strip("/"), } # get the online full sequence if id_ in FULL_SEQUENCES: # Load the AddGene sequences page and get the full sequence with requests.get(FULL_SEQUENCES[id_]) as res: soup = bs.BeautifulSoup(res.text, "html.parser") section = soup.find("section", id="depositor-full") gb_url = soup.find("a", class_="genbank-file-download").get('href') # Get the Genbank file with requests.get(gb_url) as res: gb = CircularRecord(read(io.StringIO(res.text), "gb")) # get the pBP-SJM901 sequence and patch it elif id_.startswith("pBP-SJM"): # get pBP-SJM # Load the AddGene sequences page and get the full sequence with requests.get(FULL_SEQUENCES["pBP-SJM901"]) as res: soup = bs.BeautifulSoup(res.text, "html.parser") section = soup.find("section", id="depositor-full") gb_url = soup.find("a", class_="genbank-file-download").get('href') # Get the Genbank file with requests.get(gb_url) as res: gb = CircularRecord(read(io.StringIO(res.text), "gb")) # replace the target sequence gb.seq = Seq( str(gb.seq.upper()).replace(PROMOTERS["pBP-SJM901"], PROMOTERS[id_]) ) gb.description = gb.description.replace("SJM901", id_[4:]) gb.keywords = [id_[4:]] # get the ZIP sequence else: path = next( ( f for f in archive.walk.files('/') if fs.path.basename(f).lower() == '{}.gb'.format(id_).lower() ), None, ) if id_ == "pBP-His6": path = "/Level 0/Tags/pBP-His6_tag.gb" elif id_ == "pBP-T7-RBS-His6": path = "/Level 0/T7 parts/pBP-T7_RBS_His6.gb" elif id_ == "pBP-T7-RBS": path = "/Level 0/T7 parts/pBP-T7_RBS.gb" elif id_ == "pBP-Strep(II)": path = "/Level 0/Tags/pBP-StrepII_tag.gb" elif id_ == "pBP-pET-RBS": path = "/Level 0/RBS/pBP-PET_RBS.gb" elif id_ == "pBP-BBa_B0034": path = "/Level 0/Promoters/pBP_BBa_B0034.gb" if path is None: print("COULD NOT FIND", id_) continue with archive.open(path) as f: gb = CircularRecord(read(f, "gb")) # Copy well documented information from one record to the other gb.seq = gb.seq.upper() gb.seq.alphabet = IUPAC.unambiguous_dna gb.id = id_ gb.name = name gb.annotations['references'].clear() # FIXME ? # quick feature accessor def get_features_from_label(label): return ( f for f in gb.features if label in f.qualifiers.get("label", []) ) def get_features_from_note(note): return ( f for f in gb.features if note in f.qualifiers.get("note", []) ) def get_features(name): return itertools.chain( get_features_from_label(name), get_features_from_note(name), ) # Correct overlapping features by setting the origin just before the # biobrick prefix pref = next(itertools.chain( get_features("BioBrick prefix"), get_features_from_note("BioBrick prefix") )) if pref.location is None: match = BB_PREFIX.search(gb) pref.location = FeatureLocation( start=match.start(), end=match.end(), strand=1, ) gb <<= pref.location.start - 1 # AmpR recolor and annotations ampr = next(get_features("AmpR"), None) if ampr is not None: ampr.qualifiers = { "label": "AmpR", "codon_start": 1, "gene": "bla", "product": "beta-lactamase", "function": "ampicilin and caribenicillin resistance", "translation": ampr.extract(gb.seq).translate(), "note": ["color: #9F4240"], "db_xref": [ "GO:0005515", "GO:0008800", "GO:0016787", "GO:0030655", "GO:0046677", "InterPro:IPR000871", "InterPro:IPR023650", "InterPro:IPR012338", "PDB:1ZG4", "UniProtKB/Swiss-Prot:P62593", ], "EC_number": "3.5.2.6", } old_prom = next(get_features_from_note('AmpR promoter'), None) if old_prom is not None: gb.features.remove(old_prom) ampr_prom = next(get_features_from_label("AmpR promoter"), None) if ampr_prom is None: start, end = AMPR_PROMOTER.search(gb.seq).span() ampr_prom = SeqFeature(FeatureLocation(start, end, -1)) gb.features.append(ampr_prom) ampr_prom.type = "promoter" ampr_prom.qualifiers["label"] = ["AmpR Promoter"] ampr_prom.qualifiers["note"] = ["color: #ff6666"] ampr_term = next(get_features_from_label("AmpR terminator"), None) if ampr_term is None: start, end = AMPR_TERMINATOR.search(gb.seq).span() ampr_term = SeqFeature(FeatureLocation(start, end, -1)) gb.features.append(ampr_term) ampr_term.type = 'terminator' ampr_term.qualifiers['label'] = 'AmpR Terminator' ampr_term.qualifiers['note'] = ['color: #ff6666'] # CmR recolor and annotations cmr = next(get_features('CmR'), None) if cmr is not None: cmr.qualifiers.update( { "codon_start": [1], "gene": ["cat"], "product": ["chloramphenicol acetyltransferase"], "label": ["CmR"], "function": ["chloramphenicol resistance"], "note": ["color: #0000ff; direction: LEFT"], "EC_number": ["2.3.1.28"], "db_xref": [ "UniProtKB/Swiss-Prot:P62577", "GO:0008811", "GO:0016740", "GO:0016746", "GO:0046677", "PFAM:PF00302", ], } ) cmr_prom = next(get_features("CamR Promoter"), None) if cmr_prom is None: start, end = CMR_PROMOTER.search(gb.seq).span() cmr_prom = SeqFeature(location=FeatureLocation(start, end, -1)) gb.features.append(cmr_prom) cmr_prom.type = "promoter" cmr_prom.qualifiers.update( { "label": ["CmR Promoter"], "note": ["color: #66ccff; direction: LEFT"], } ) cmr_term = next(get_features_from_label("CamR Terminator"), None) if cmr_term is None: start, end = CMR_TERMINATOR.search(gb.seq).span() cmr_term = SeqFeature(location=FeatureLocation(start, end, -1)) gb.features.append(cmr_term) cmr_term.type = "terminator" cmr_term.qualifiers.update( { "label": ["CmR Terminator"], "note": ["color: #66ccff; direction: LEFT"], } ) old_term = next(get_features_from_note('lambda t0 terminator'), None) if old_term is not None: gb.features.remove(old_term) # GFP recolor and annotations gfp = next(get_features_from_label("GFP"), None) if gfp is not None: gfp.qualifiers.update( { "label": "GFP", "note": ["color: #34ff03"], "product": ["green fluorescent protein"], "gene": ["GFP"], "db_xref": [ "PDB:1H6R", "InterPro:IPR009017", "InterPro:IPR011584", "InterPro:IPR000786", "PFAM:PF01353", "GO:0008218", "GO:0006091", "GO:0018298", "UniProtKB/Swiss-Prot:P42212", ], "inference": [ "DESCRIPTION:alignment:blastx:UniProtKB/Swiss-Prot:P42212" ], } ) # mRFP1 recolor and annotations rfp = next(get_features_from_label("mRFP1"), None) if rfp is not None: rfp.qualifiers.update( { "label": "mRFP", "product": "mRFP1", "note": [ "monomeric derivative of DsRed (Campbell et al., 2002)", "iGEM Part: BBa_E1010", "color: #c16969", ], "db_xref": [ "UniProtKB/Swiss-Prot:Q9U6Y8", "GO:0008218", "GO:0006091", "GO:0018298", "PDB:2H5R", ], } ) # patch pBP-SJM promoters if id_.startswith("pBP-SJM"): promoter = next(get_features_from_label("J23119 promoter")) promoter.type = "promoter" promoter.qualifiers.update({ "function": ["strong constitutive promoter"], "note": ["color: #00a1ee; direction: RIGHT"], }) if id_ == "pBP-SJM901": promoter.qualifiers['label'] = "J23119 Promoter" promoter.qualifiers['note'].insert(0, "Anderson series consensus promoter") else: promoter.qualifiers['label'] = "{} Promoter".format(id_[4:]) promoter.qualifiers['note'].insert(0, "derived from pBP-SJM901 (BBa_J23119)") # if any(f.location is None for f in gb.features): # continue for f in gb.features: if f.location is None: print(gb, f) # sort features by start location, source always first gb.features.sort( key=lambda f: (-len(gb.seq)) * (f.type == "source") + f.location.start ) # translate color from notes to ApEinfo for feature in gb.features: translate_color(feature) # Add an EcoFlex article reference ref = Reference() ref.authors = 'Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS.' ref.title = 'EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.' ref.journal = 'ACS Synth Biol 2016;5:1059-1069.' ref.pubmed_id = '27096716' gb.annotations['references'].append(ref) # Fix the direct submission reference ref = Reference() # ref = gb.annotations["references"][-1] ref.authors = "Larralde M" ref.title = "Direct Submission" ref.journal = "Distributed with the MoClo Python library\nhttps://github.com/althonos/moclo" gb.annotations['references'].append(ref) # write the final record dst_dir = os.path.abspath( os.path.join( __file__, "..", "..", "moclo-ecoflex", "registry", "ecoflex" ) ) dst_file = os.path.join(dst_dir, "{}.gb").format(info["id"]) write(gb, dst_file, "gb")
nilq/baby-python
python
# hsrp parameters ng_order = (3072,) _ng_const = ( # 3072 ( """\ FFFFFFFFFFFFFFFFC90FDAA22168C234C4C6628B80DC1CD129024E08\ 8A67CC74020BBEA63B139B22514A08798E3404DDEF9519B3CD3A431B\ 302B0A6DF25F14374FE1356D6D51C245E485B576625E7EC6F44C42E9\ A637ED6B0BFF5CB6F406B7EDEE386BFB5A899FA5AE9F24117C4B1FE6\ 49286651ECE45B3DC2007CB8A163BF0598DA48361C55D39A69163FA8\ FD24CF5F83655D23DCA3AD961C62F356208552BB9ED529077096966D\ 670C354E4ABC9804F1746C08CA18217C32905E462E36CE3BE39E772C\ 180E86039B2783A2EC07A28FB5C55DF06F4C52C9DE2BCBF695581718\ 3995497CEA956AE515D2261898FA051015728E5A8AAAC42DAD33170D\ 04507A33A85521ABDF1CBA64ECFB850458DBEF0A8AEA71575D060C7D\ B3970F85A6E1E4C7ABF5AE8CDB0933D71E8C94E04A25619DCEE3D226\ 1AD2EE6BF12FFA06D98A0864D87602733EC86A64521F2B18177B200C\ BBE117577A615D6C770988C0BAD946E208E24FA074E5AB3143DB5BFC\ E0FD108E4B82D120A93AD2CAFFFFFFFFFFFFFFFF""", "5", ), ) def get_srp_context(ng_group_len, hashfunc, salt_len=16, secret_len=32): group = _ng_const[ng_order.index(ng_group_len)] ctx = { "hashfunc": hashfunc, "N": int(group[0], 16), "g": int(group[1], 16), "N_len": ng_group_len, "salt_len": salt_len, "secret_len": secret_len, } return ctx
nilq/baby-python
python
import random import kivy from kivy.app import App from kivy.uix.boxlayout import BoxLayout kivy.require('1.9.0') class MyRoot(BoxLayout): def __init__(self): super(MyRoot, self).__init__() def generate_affirmation(self): affirmations = ["I am the architect of my life; \nI build its foundation and choose its contents.", "I am brimming with energy and \noverflowing with joy.", "My body is healthy; my mind is brilliant; \nmy soul is tranquil.", "I forgive those who have harmed me in my past and \npeacefully detach from them.", "A river of compassion washes away my anger \nand replaces it with love.", "Creative energy surges through me and leads \nme to new and brilliant ideas.", "The only thing to fear is fear itself.", "My ability to exceed my goals is limitless; \nmy potential to succeed is infinite.", "I acknowledge my own self-worth; \nmy confidence is soaring.", "Everything that is happening now is \nhappening for my ultimate good.", "I woke up today with strength in my \nheart and clarity in my mind."] rand_num = random.randint(0, len(affirmations)-1) self.rand_aff.text = affirmations[rand_num] class RandAffirmations(App): def build(self): return MyRoot() randAffirmations = RandAffirmations() randAffirmations.run()
nilq/baby-python
python
# Copyright 2020 Regents of the University of Minnesota. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import pytest from mtap import GenericLabel, Location, Document from mtap.data._label_indices import presorted_label_index document = Document('plaintext', text='blah') @pytest.fixture def tested(): return presorted_label_index([ GenericLabel(0, 5, document=document, i=7), GenericLabel(0, 7, document=document, i=6), GenericLabel(2, 6, document=document, i=5), GenericLabel(6, 7, document=document, i=4), GenericLabel(6, 8, document=document, i=3), GenericLabel(9, 10, document=document, i=2), GenericLabel(9, 13, document=document, i=1), GenericLabel(9, 13, document=document, i=0), ]).descending() def test_getitem(tested): assert tested[3] == GenericLabel(6, 8, document=document, i=3) def test_getitem_first(tested): assert tested[0] == GenericLabel(9, 13, document=document, i=0) def test_getitem_last(tested): assert tested[7] == GenericLabel(0, 5, document=document, i=7) def test_getitem_negative(tested): assert tested[-4] == GenericLabel(6, 7, document=document, i=4) def test_getitem_last_negative(tested): assert tested[-1] == GenericLabel(0, 5, document=document, i=7) def test_getitem_slice(tested): sliced = tested[2:4] assert sliced == [ GenericLabel(9, 10, document=document, i=2), GenericLabel(6, 8, document=document, i=3), ] def test_getitem_slice_end(tested): assert tested[4:8] == [ GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), GenericLabel(0, 5, document=document, i=7), ] def test_getitem_slice_open_left(tested): assert tested[:4] == [ GenericLabel(9, 13, document=document, i=0), GenericLabel(9, 13, document=document, i=1), GenericLabel(9, 10, document=document, i=2), GenericLabel(6, 8, document=document, i=3), ] def test_getitem_slice_open_right(tested): assert tested[4:] == [ GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), GenericLabel(0, 5, document=document, i=7), ] def test_getitem_slice_neg_right(tested): assert tested[4:-1] == [ GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), ] def test_getitem_slice_neg_left(tested): assert tested[-4:-1] == [ GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), ] def test_getitem_not_idx_slice(tested): with pytest.raises(TypeError): tested['foo'] def tested_getitem_slice_step_not_one(tested): slice = tested[1:4:2] assert slice == ([ GenericLabel(9, 13, document=document, i=1), GenericLabel(6, 8, document=document, i=3), ]) def test_at(tested): assert tested.at(GenericLabel(2, 6, document=document))[0] == GenericLabel(2, 6, document=document, i=5) def test_at_location(tested): assert tested.at(Location(2, 6))[0] == GenericLabel(2, 6, document=document, i=5) def test_at_location_multiple(tested): assert tested.at(Location(9, 13)) == [ GenericLabel(9, 13, document=document, i=0), GenericLabel(9, 13, document=document, i=1), ] def test_at_location_not_found(tested): assert tested.at(Location(10, 10)) == [] def test_len(tested): assert len(tested) == 8 def test_covering(tested): covering = tested.covering(2, 4) assert list(covering) == [ GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), GenericLabel(0, 5, document=document, i=7), ] def test_covering_empty(tested): assert tested.covering(4, 10) == [] def test_empty_covering(tested): covering = tested.covering(4, 10) assert list(covering) == [] def test_inside(tested): inside = tested.inside(1, 8) assert list(inside) == [ GenericLabel(6, 8, document=document, i=3), GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), ] def test_inside_before(tested): inside = tested.inside(0, 3) assert list(inside) == [] def test_inside_after(tested): inside = tested.inside(15, 20) assert list(inside) == [] def test_inside_many(tested): tested = presorted_label_index([ GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(0, 3, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(2, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 6, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), GenericLabel(6, 10, document=document), ]) inside = tested.inside(3, 6) assert inside == [ GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(3, 5, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), ] inside = inside.inside(5, 6) assert inside == [ GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), GenericLabel(5, 6, document=document), ] def test_begins_inside(tested): inside = tested.beginning_inside(1, 9) assert list(inside) == [ GenericLabel(6, 8, document=document, i=3), GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), ] def test_begins_inside_empty(tested): inside = tested.beginning_inside(3, 5) assert inside == [] def test_ascending(tested): ascending = tested.ascending() assert ascending == [ GenericLabel(0, 5, document=document, i=7), GenericLabel(0, 7, document=document, i=6), GenericLabel(2, 6, document=document, i=5), GenericLabel(6, 7, document=document, i=4), GenericLabel(6, 8, document=document, i=3), GenericLabel(9, 10, document=document, i=2), GenericLabel(9, 13, document=document, i=1), GenericLabel(9, 13, document=document, i=0), ] def test_descending(tested): descending = tested.descending() assert descending == tested def test_before(tested): before = tested.before(8) assert before == [ GenericLabel(6, 8, document=document, i=3), GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), GenericLabel(0, 7, document=document, i=6), GenericLabel(0, 5, document=document, i=7), ] def test_before_start(tested): before = tested.before(3) assert before == [] def test_after(tested): after = tested.after(2) assert after == [ GenericLabel(9, 13, document=document, i=0), GenericLabel(9, 13, document=document, i=1), GenericLabel(9, 10, document=document, i=2), GenericLabel(6, 8, document=document, i=3), GenericLabel(6, 7, document=document, i=4), GenericLabel(2, 6, document=document, i=5), ] def test_contains_true(tested): assert GenericLabel(9, 13, document=document, i=0) in tested def test_contains_false_location_in(tested): assert GenericLabel(9, 13, document=document) not in tested def test_contains_false_location_not_in(tested): assert GenericLabel(0, 4, document=document) not in tested def test_contains_false_not_label(tested): assert "blub" not in tested def test_reversed(tested): l = list(reversed(tested)) assert l == [ GenericLabel(0, 5, document=document, i=7), GenericLabel(0, 7, document=document, i=6), GenericLabel(2, 6, document=document, i=5), GenericLabel(6, 7, document=document, i=4), GenericLabel(6, 8, document=document, i=3), GenericLabel(9, 10, document=document, i=2), GenericLabel(9, 13, document=document, i=1), GenericLabel(9, 13, document=document, i=0), ] def test_count_in(tested): assert tested.count(GenericLabel(2, 6, document=document, i=5)) == 1 def test_count_multiple(tested): index = presorted_label_index([ GenericLabel(2, 6, document=document, i=2), GenericLabel(6, 7, document=document, i=3), GenericLabel(6, 8, document=document, i=4), GenericLabel(9, 10, document=document, i=5), GenericLabel(9, 13, document=document, i=6), GenericLabel(9, 13, document=document, i=7), GenericLabel(9, 13, document=document, i=6) ]).descending() assert index.count(GenericLabel(9, 13, document=document, i=6)) == 2 def test_count_different_label(tested): assert tested.count(GenericLabel(9, 13, document=document, x=2)) == 0 def test_count_not_label(tested): assert tested.count("blub") == 0 def test_count_location_not_in(tested): assert tested.count(GenericLabel(4, 5, document=document)) == 0 def test_filter(tested): assert tested.filter(lambda x: x.i % 2 == 0) == [ GenericLabel(9, 13, document=document, i=0), GenericLabel(9, 10, document=document, i=2), GenericLabel(6, 7, document=document, i=4), GenericLabel(0, 7, document=document, i=6), ]
nilq/baby-python
python
from rpcb.message_dispatch import MessageDispatch from rpcb.service import Service import threading import time import random import pika import queue import logging import pika.adapters.blocking_connection """ 消息调度器实现,用于批处理数据,多个数据来了会打包为一个batch输入到模型中,从而提高整体的吞吐量 """ class BatchMessageDispatcher(MessageDispatch): def __init__(self, callback, max_queue_size:int=32, max_waiting_time:float=0.1, service:Service=None, max_batch_size=10): self.safe_queue = queue.Queue(maxsize=max_queue_size) # 线程安全队列,用于存放数据 self.message_send_and_ack = callback # 回调函数 self.service = service guard = GuardThread(max_waiting_time=max_waiting_time,safe_queue=self.safe_queue, compute=self.compute, max_batch_size=max_batch_size) guard.start() def compute(self, status): """ 开始调用算法进行计算 """ status = True batch = list() batch_size = min(10, self.safe_queue.qsize()) for i in range(batch_size): batch.append(self.safe_queue.get()) # 提取body信息 service_needed_batch = [item['body'] for item in batch] pre_time = time.time() result = self.service(service_needed_batch) # [body1,body2....] logging.info("service 用时"+str(time.time()-pre_time)) # 发送消息到队列中 for i in range(len(batch)): correlation_id = batch[i]['correlation_id'] reply_to = batch[i]['reply_to'] delivery_tag = batch[i]['delivery_tag'] self.message_send_and_ack(result[i], correlation_id, reply_to, delivery_tag) status = False logging.info("batch size大小:"+str(len(result))) return result def deliver_message(self, body:bytes, properties:pika.BasicProperties, delivery_tag:str) -> None: """ 将消息递交给消息管理器管理 :params body: 传来的数据 properties: 传来消息的属性,用于回调消息 delivery_tag: 用于ack答复 :returns None """ message = {'body': body, 'correlation_id':properties.correlation_id, 'reply_to':properties.reply_to, 'delivery_tag':delivery_tag} self.safe_append_queue(message=message) logging.debug("添加一个消息入队") def safe_append_queue(self, message): """ 安全的入队 """ if self.safe_queue is None: raise Exception("消息队列为空") if self.safe_queue.full(): logging.warning(self.safe_queue.qsize()) # TODO wait until queue is not full logging.error("队列长度超出范围") self.safe_queue.put(message) def check_channel(self): """ 检查channel是否可用 """ if self.channel is None: return False return True class GuardThread(threading.Thread): """ 守护进程,用于监听消息是否已经超过指定时间,从而分发数据到服务中 """ def __init__(self, max_waiting_time:float=0.1, safe_queue=None, compute=None,max_batch_size=10): threading.Thread.__init__(self, daemon=True) self.safe_queue = safe_queue self.activate = False # 处理器激活,当有消息来的时候通知消息调度器可以开始处理了,开启一个计时器 self.is_running = False # 算法正在处理 self.max_waiting_time = max_waiting_time # 最大等待时间,单位秒 self.max_batch_size = max_batch_size # 算法最大batch size self.start_time = time.time() # 第一个算法开始时间 self.compute = compute def run(self): """ 开始处理消息 """ # 监听循环 while(True): # 判断queue是否有数据,如果没有,就继续loop 开始计时,保证一定时间内一定处理 if self.safe_queue.qsize() == 0: self.activate = False if (self.safe_queue.qsize() > 0) and not self.is_running: # 如果静默状态突然有消息到达,或者运行状态结束队列又存在消息时,开启计时 if(not self.activate): self.start_time = time.time() self.activate = True # 如果到达时间大于最大等待时间 if self.activate and time.time()-self.start_time > self.max_waiting_time: self.activate = False logging.info(" 等待时间:"+ str(time.time()-self.start_time)) # TODO self.is_running 无用,因为计算是阻塞式,计算完成之前,不可能进行新计算,考虑到将来多线程拓展,有必要引入此变量 self.compute(self.is_running) # 如果队列元素超过最大batch size,并且处于非运行状态直接计算 if self.safe_queue.qsize() >= self.max_batch_size and not self.is_running: self.activate = False logging.info(" 等待时间:"+ str(time.time()-self.start_time)) self.compute(self.is_running) # logging.debug("队列大小"+ str(self.safe_queue.qsize())) time.sleep(0.01) # 每隔10ms检测一次 if __name__ == '__main__': from base.service import AsrService logging.basicConfig(level=logging.DEBUG, format='%(levelname) -10s %(asctime)s %(name) -20s %(funcName) -25s %(lineno) -5d: %(message)s') message_disaptcher = BatchMessageDispatcher(None, max_queue_size=32, max_waiting_time=0.1, service=AsrService()) class Prop: correlation_id = "correlation_id" reply_to = "reply_to" pre_time = time.time() for i in range(200): message_disaptcher.deliver_message(bytes("hello"+str(i), encoding='utf-8'), properties=Prop(), delivery_tag="delivery_tag") sleep_time = float(random.randint(2, 25))/1000 time.sleep(sleep_time) logging.info("计算总时长为: "+ str(time.time()-pre_time))
nilq/baby-python
python
import vcs import cdms2 import os x = vcs.init() f = cdms2.open(os.path.join(vcs.sample_data, 'clt.nc')) u = f("u") v = f("v") V = x.createvector() V.linecolor = 242 V.scale = 5. V.type = "arrows" V.reference = 6. V.list() x.plot(u[::2], v[::2], V) x.png("vectors") x.interact()
nilq/baby-python
python
# OpenWeatherMap API Key api_key = "Goes here if needed"
nilq/baby-python
python
# Note that only the currently used fields are shown unless show_all is set to True. import os import pandas as pd import anytree from anytree.search import find from anytree.exporter import DotExporter import collections PolicyTuple = collections.namedtuple('PolicyTuple','layer_id agg_id calc_rules') CalcRuleTuple = collections.namedtuple('CalcRuleTuple', 'policytc_id calcrule_id is_step trig_start trig_end') def load_df(path, required_file=None): if path: return pd.read_csv(path) else: if required_file: raise FileNotFoundError(f"Required File does not exist: {required_file}") else: return None def create_fm_tree(fm_programme_df, fm_policytc_df, fm_profile_df, fm_summary_df): missing_node_link = False def get_policy_tc(agg_id, level_id): policytc = fm_policytc_df.loc[ (fm_policytc_df['agg_id'] == agg_id) & (fm_policytc_df['level_id'] == level_id) ] policy_list = [] for _, policy in policytc.iterrows(): # Find calc_rule profile = fm_profile_df.loc[fm_profile_df.policytc_id == policy.policytc_id] calc_rules = [] for _, step in profile.iterrows(): trig_start = step.trigger_start if hasattr(step, 'trigger_start') else 0 trig_end = step.trigger_end if hasattr(step, 'trigger_end') else 0 is_step_rule = (trig_end > 0 or trig_start > 0) calc_rules.append(CalcRuleTuple( policytc_id=int(policy.policytc_id), calcrule_id=int(step.calcrule_id), is_step=is_step_rule, trig_start=trig_start, trig_end=trig_end, )) policy_list.append( PolicyTuple( layer_id=int(policy.layer_id), agg_id=int(policy.agg_id), calc_rules=calc_rules, ) ) return len(policytc), policy_list level_ids = sorted(list(fm_programme_df.level_id.unique()), reverse=True) root = anytree.Node('Insured Loss', agg_id=1, level_id=max(level_ids)+1, policy_tc=None) for level in level_ids: agg_id_idxs = list(fm_programme_df[fm_programme_df.level_id == level].drop_duplicates(subset=['level_id','to_agg_id'], keep="first").index) for node_idx in agg_id_idxs: node_info = fm_programme_df.iloc[node_idx] layer_max, policy_list = get_policy_tc(node_info.to_agg_id, node_info.level_id) # Set parent node as root or find based on level/agg ids if level == max(level_ids): parent_node = root else: try: matched_id = fm_programme_df.loc[(fm_programme_df.level_id == level+1) & (fm_programme_df.from_agg_id == node_info.to_agg_id)].to_agg_id.item() parent_node = find(root, filter_=lambda node: node.level_id == level+1 and node.agg_id == matched_id) except ValueError: missing_node_link = True print('Missing node link: agg_id={}, level_id={}'.format(node_info.to_agg_id,level+1)) # Set node names based on attrs in FM files if level >= 3: node_name = "policy term {} \nlevel: {}".format( node_info.to_agg_id, node_info.level_id ) elif level == 2: node_name = "loc term {} ".format(node_info.to_agg_id) else: node_name = "cov term {}".format(node_info.to_agg_id) for policy in policy_list: node_name += "\n\nlayer_id: {}".format(policy.layer_id) for rule in policy.calc_rules: if rule.is_step: node_name += "\n policytc_id {}: step_rule:{}, start:{} end:{}".format( rule.policytc_id, rule.calcrule_id, rule.trig_start, rule.trig_end ) else: node_name += "\npolicytc_id: {} \ncalc_rule: {}".format( rule.policytc_id, rule.calcrule_id, ) # Create Node in FM tree node = anytree.Node( node_name, agg_id=node_info.to_agg_id, level_id=level, parent=parent_node, layer_max=layer_max, policy_tc=policy_list, ) # Add item level data item_agg_idx = list(fm_summary_df[['agg_id']].drop_duplicates().index) for item in item_agg_idx: item_info = fm_summary_df.iloc[item] matched_id = fm_programme_df.loc[(fm_programme_df.level_id == 1) & (fm_programme_df.from_agg_id == item_info.agg_id)].to_agg_id.item() parent_node = find(root, filter_=lambda node: node.level_id == 1 and node.agg_id == matched_id) node_name = "\n".join([ "item {}\n".format(int(item_info.agg_id)), "locnumber: {}".format(item_info.locnumber), "accnumber: {}".format(item_info.accnumber), "polnumber: {}".format(item_info.polnumber), "portnumber: {}".format(item_info.portnumber), "cov_type: {}".format(item_info.coverage_type_id), "peril_id: {}".format(item_info.peril_id), "tiv: {}".format(item_info.tiv), ]) node = anytree.Node( node_name, agg_id=item_info.agg_id, level_id=0, parent=parent_node, locnumber=item_info.locnumber, accnumber=item_info.accnumber, polnumber=item_info.polnumber, portnumber=item_info.polnumber, tiv=item_info.tiv, coverage_id=item_info.coverage_id, coverage_type=item_info.coverage_type_id, peril_id=item_info.peril_id, ) return root, missing_node_link def render_fm_tree(root_node, filename='tree.png'): # Function to format nodes in FM tree def format_box(node): # https://graphviz.org/doc/info/shapes.html if node.level_id == 0: # Item Level Node return "fixedsize=false, shape=rect, fillcolor=lightgrey, style=filled" else: if not node.policy_tc: # Error? missing policy_tc entry for this Node return "fixedsize=false, shape=ellipse, fillcolor=pink, style=filled" elif len(node.policy_tc) > 1: # Node with multiple layers return "fixedsize=false, shape=rect, fillcolor=orange, style=filled" else: # Cov or loc nodes return "fixedsize=false, shape=ellipse, fillcolor=lightblue, style=filled" # Function to add weighted 'by layer number' edges def layered_edge(node, child): # https://anytree.readthedocs.io/en/latest/tricks/weightededges.html if hasattr(child, 'layer_max'): if child.layer_max > 1: return 'dir=back, style=bold, label=" {} Layers"'.format(child.layer_max) return "dir=back" # Render tree to png dot_data = DotExporter( root_node, edgeattrfunc=layered_edge, nodeattrfunc=format_box) dot_data.to_picture(filename)
nilq/baby-python
python
# -*- coding: utf-8 -*- import os from Crypto import Random from Crypto.Cipher import AES from Crypto.Hash import SHA256 from common import xJiPZbUzlGCIdemowYnQNONypdeudgmd, ckAjUaLEXnferbefRGpQeOZRysoqlffQ FFVGFOvcuiKjdGKFcTRNoKJcuBaGjGEf = 'b14ce95fa4c33ac2803782d18341869f' class LVPFsEGShJELnCwtpptaZvXDbVmShyns(Exception): pass def NmtIKYiMrjhKpKqWnTKDAJlAKWDTPVIy(OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp, FRIUnJhVUpQceKKKwrGdGufEFeSRdAAs=AES.block_size): kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh = (FRIUnJhVUpQceKKKwrGdGufEFeSRdAAs - (len(OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp) % FRIUnJhVUpQceKKKwrGdGufEFeSRdAAs)) return OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp + (chr(kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh)*kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh) def GwAonSsUlHwhDnYTFlqQhOKBVLcSheYV(OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp): kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh = OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp[-1] if OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp.endswith(kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh*ord(kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh)): return OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp[:-ord(kWFtuPcTzhXQsxkZcspaKNvhNllUXCxh)] raise LVPFsEGShJELnCwtpptaZvXDbVmShyns("PKCS7 improper padding {}".format(repr(OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp[-32:]))) def ZHmaXjmaptcjOuQWzIYmNcRFyCaggAdR(sock, server=True, bits=2048): gFsSukpmrcgWJfrmLhgayqqAVmsbyWUi = 0xFFFFFFFFFFFFFFFFC90FDAA22168C234C4C6628B80DC1CD129024E088A67CC74020BBEA63B139B22514A08798E3404DDEF9519B3CD3A431B302B0A6DF25F14374FE1356D6D51C245E485B576625E7EC6F44C42E9A637ED6B0BFF5CB6F406B7EDEE386BFB5A899FA5AE9F24117C4B1FE649286651ECE45B3DC2007CB8A163BF0598DA48361C55D39A69163FA8FD24CF5F83655D23DCA3AD961C62F356208552BB9ED529077096966D670C354E4ABC9804F1746C08CA18217C32905E462E36CE3BE39E772C180E86039B2783A2EC07A28FB5C55DF06F4C52C9DE2BCBF6955817183995497CEA956AE515D2261898FA051015728E5A8AACAA68FFFFFFFFFFFFFFFF; adZcabjFPtBsWTrudsVIVsDshBtgiUsQ = 2 adrCPWbaRPWXrGfZTxfXAtVEFHttGCMF = ckAjUaLEXnferbefRGpQeOZRysoqlffQ(os.urandom(32)) DPSXmPpMUYVABlOJsKMoPltwubSXAvTt = pow(adZcabjFPtBsWTrudsVIVsDshBtgiUsQ, adrCPWbaRPWXrGfZTxfXAtVEFHttGCMF, gFsSukpmrcgWJfrmLhgayqqAVmsbyWUi) if server: sock.send(xJiPZbUzlGCIdemowYnQNONypdeudgmd(DPSXmPpMUYVABlOJsKMoPltwubSXAvTt)) b = ckAjUaLEXnferbefRGpQeOZRysoqlffQ(sock.recv(4096)) else: b = ckAjUaLEXnferbefRGpQeOZRysoqlffQ(sock.recv(4096)) sock.send(xJiPZbUzlGCIdemowYnQNONypdeudgmd(DPSXmPpMUYVABlOJsKMoPltwubSXAvTt)) OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp = pow(b, adrCPWbaRPWXrGfZTxfXAtVEFHttGCMF, gFsSukpmrcgWJfrmLhgayqqAVmsbyWUi) return SHA256.new(xJiPZbUzlGCIdemowYnQNONypdeudgmd(OPGQtyHoGVjbssyoAyqrdJvFlGoiAQYp)).digest() def gcbCoqAgZztElhuzHlCRVsaXiDmrxjeQ(vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx, KEY): vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx = NmtIKYiMrjhKpKqWnTKDAJlAKWDTPVIy(vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx) VMJrviwEuDZCQAKsDTVcZeWibgUxuOuU = Random.new().read(AES.block_size) omtoDzoHpDngJrwwtkYkmrGaWwwGAHVK = AES.new(KEY, AES.MODE_CBC, VMJrviwEuDZCQAKsDTVcZeWibgUxuOuU) return VMJrviwEuDZCQAKsDTVcZeWibgUxuOuU + omtoDzoHpDngJrwwtkYkmrGaWwwGAHVK.encrypt(vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx) def zcqgzrNhhMMrepGKrXzOYcYeaRymVspf(ciphertext, KEY): VMJrviwEuDZCQAKsDTVcZeWibgUxuOuU = ciphertext[:AES.block_size] omtoDzoHpDngJrwwtkYkmrGaWwwGAHVK = AES.new(KEY, AES.MODE_CBC, VMJrviwEuDZCQAKsDTVcZeWibgUxuOuU) vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx = omtoDzoHpDngJrwwtkYkmrGaWwwGAHVK.decrypt(ciphertext[AES.block_size:]) return GwAonSsUlHwhDnYTFlqQhOKBVLcSheYV(vKpdSqEzIxjyGuerXAIFZMYvfWbEQyYx)
nilq/baby-python
python
#!/usr/bin/env python3 import os import re import sys LOWP_SEARCH = "lowp" MEDIUMP_SEARCH = "mediump" HIGHP_SEARCH = "highp" VERTEX_SHADER_EXT = ".vsh.glsl" FRAG_SHADER_EXT = ".fsh.glsl" GLES3_PREFIX = "GLES3_" GLES3_SHADER_PREFIX = "gles3_" SHADERS_LIB_COMMON_PATTERN = "// Common" SHADERS_LIB_VS_PATTERN = "// VS" SHADERS_LIB_FS_PATTERN = "// FS" SHADERS_LIB_COMMON_INDEX = 0 SHADERS_LIB_VS_INDEX = 1 SHADERS_LIB_FS_INDEX = 2 def format_shader_source_name(shader_file_name): shader_source_name = shader_file_name return shader_source_name.replace(".glsl", "").replace(".", "_").upper() def read_index_file(file_path, programs_order): gpu_programs = dict() with open(file_path, 'r') as f: index = 0 for line in f: line_parts = line.strip().split() if len(line_parts) != 3: print("Incorrect GPU program definition : " + line) exit(10) if line_parts[0] != programs_order[index]: print("Incorrect GPU program order or name : " + line) exit(11) vertex_shader = next(f for f in line_parts if f.endswith(VERTEX_SHADER_EXT)) fragment_shader = next(f for f in line_parts if f.endswith(FRAG_SHADER_EXT)) if not vertex_shader: print("Vertex shader not found in GPU program definition : " + line) exit(12) if not fragment_shader: print("Fragment shader not found in GPU program definition : " + line) exit(13) if line_parts[0] in gpu_programs.keys(): print("More than one definition of %s gpu program" % line_parts[0]) exit(14) gpu_programs[index] = (vertex_shader, fragment_shader, line_parts[0]) index += 1 return gpu_programs def read_programs_file(file_path): gpu_programs = [] with open(file_path, 'r') as f: found = False for line in f: if not found and line.find('enum class Program') >= 0: found = True continue if found and line.find('}') >= 0: break if found and line.find('{') == -1: line_parts = re.split(',|=', line) name = line_parts[0].strip() if name and name != 'ProgramsCount': gpu_programs.append(name) return gpu_programs def read_shaders_lib_file(file_path): shaders_library = ['', '', ''] with open(file_path, 'r') as f: shaders_lib_content = f.read() if len(shaders_lib_content) == 0: return shaders_library common_index = shaders_lib_content.find(SHADERS_LIB_COMMON_PATTERN) if common_index < 0: print("Common functions block is not found in " + file_path) exit(14) vs_index = shaders_lib_content.find(SHADERS_LIB_VS_PATTERN) if vs_index < 0: print("Vertex shaders functions block is not found in " + file_path) exit(15) fs_index = shaders_lib_content.find(SHADERS_LIB_FS_PATTERN) if fs_index < 0: print("Vertex shaders functions block is not found in " + file_path) exit(16) if not (common_index < vs_index < fs_index): print("Order of functions block is incorrect in " + file_path) exit(17) shaders_library[SHADERS_LIB_COMMON_INDEX] = shaders_lib_content[common_index:vs_index - 1] shaders_library[SHADERS_LIB_VS_INDEX] = shaders_lib_content[vs_index:fs_index - 1] shaders_library[SHADERS_LIB_FS_INDEX] = shaders_lib_content[fs_index:] return shaders_library def generate_shader_indexes(shaders): return dict((v, k) for k, v in enumerate(shaders)) def write_definition_file(defines_file, generation_dir): with open(os.path.join(generation_dir, defines_file), 'w') as output_file: output_file.write("#pragma once\n\n") output_file.write("#include \"shaders/programs.hpp\"\n") output_file.write("#include \"shaders/gl_program_info.hpp\"\n\n") output_file.write("#include \"drape/drape_global.hpp\"\n\n") output_file.write("namespace gpu\n") output_file.write("{\n") output_file.write("extern char const * GL3_SHADER_VERSION;\n") output_file.write("extern char const * GLES3_SHADER_VERSION;\n\n") output_file.write("extern GLProgramInfo GetProgramInfo(dp::ApiVersion apiVersion, Program program);\n") output_file.write("} // namespace gpu\n") def write_shader_gles_header(output_file): output_file.write(" #ifdef GL_ES \\n\\\n") output_file.write(" #ifdef GL_FRAGMENT_PRECISION_HIGH \\n\\\n") output_file.write(" #define MAXPREC highp \\n\\\n") output_file.write(" #else \\n\\\n") output_file.write(" #define MAXPREC mediump \\n\\\n") output_file.write(" #endif \\n\\\n") output_file.write(" precision MAXPREC float; \\n\\\n") output_file.write(" #define LOW_P lowp \\n\\\n") output_file.write(" #define MEDIUM_P mediump \\n\\\n") output_file.write(" #define HIGH_P highp \\n\\\n") output_file.write(" #else \\n\\\n") output_file.write(" #define LOW_P \\n\\\n") output_file.write(" #define MEDIUM_P \\n\\\n") output_file.write(" #define HIGH_P \\n\\\n") output_file.write(" #endif \\n\\\n") def get_shaders_lib_content(shader_file, shaders_library): lib_content = shaders_library[SHADERS_LIB_COMMON_INDEX] if shader_file.find(VERTEX_SHADER_EXT) >= 0: lib_content += shaders_library[SHADERS_LIB_VS_INDEX] elif shader_file.find(FRAG_SHADER_EXT) >= 0: lib_content += shaders_library[SHADERS_LIB_FS_INDEX] return lib_content def write_shader_line(output_file, line, convert_to_gles3, is_fragment_shader): if line.lstrip().startswith("//") or line == '\n' or len(line) == 0: return if line.find(LOWP_SEARCH) >= 0: print("Incorrect shader. Do not use lowp in shader, use LOW_P instead.") exit(2) if line.find(MEDIUMP_SEARCH) >= 0: print("Incorrect shader. Do not use mediump in shader, use MEDIUM_P instead.") exit(2) if line.find(HIGHP_SEARCH) >= 0: print("Incorrect shader. Do not use highp in shader, use HIGH_P instead.") exit(2) output_line = line.rstrip() if convert_to_gles3: output_line = output_line.replace("attribute", "in") if is_fragment_shader: output_line = output_line.replace("varying", "in") else: output_line = output_line.replace("varying", "out") output_line = output_line.replace("texture2D", "texture") output_line = output_line.replace("gl_FragColor", "v_FragColor") output_file.write(" %s \\n\\\n" % output_line) def write_shader_body(output_file, shader_file, shader_dir, shaders_library, convert_to_gles3): is_fragment_shader = shader_file.find(FRAG_SHADER_EXT) >= 0 lib_content = get_shaders_lib_content(shader_file, shaders_library) for line in open(os.path.join(shader_dir, shader_file)): if line.lstrip().startswith("void main"): for lib_line in lib_content.splitlines(): write_shader_line(output_file, lib_line, convert_to_gles3, is_fragment_shader) if convert_to_gles3 and is_fragment_shader: output_file.write(" out vec4 v_FragColor; \\n\\\n") write_shader_line(output_file, line, convert_to_gles3, is_fragment_shader) output_file.write("\";\n\n") def write_shader(output_file, shader_file, shader_dir, shaders_library): output_file.write("char const %s[] = \" \\\n" % (format_shader_source_name(shader_file))) write_shader_gles_header(output_file) write_shader_body(output_file, shader_file, shader_dir, shaders_library, False) def write_gles3_shader(output_file, shader_file, shader_dir, shaders_library): output_file.write("char const %s[] = \" \\\n" % (GLES3_PREFIX + format_shader_source_name(shader_file))) write_shader_gles_header(output_file) if os.path.exists(os.path.join(shader_dir, GLES3_SHADER_PREFIX + shader_file)): write_shader_body(output_file, GLES3_SHADER_PREFIX + shader_file, shader_dir, shaders_library, False) else: write_shader_body(output_file, shader_file, shader_dir, shaders_library, True) def write_gpu_programs_map(file, programs_def, source_prefix): for program in programs_def.keys(): vertex_shader = programs_def[program][0] vertex_source_name = source_prefix + format_shader_source_name(vertex_shader) fragment_shader = programs_def[program][1] fragment_source_name = source_prefix + format_shader_source_name(fragment_shader) file.write(" GLProgramInfo(\"%s\", \"%s\", %s, %s),\n" % ( vertex_source_name, fragment_source_name, vertex_source_name, fragment_source_name)) def write_implementation_file(programs_def, shader_index, shader_dir, impl_file, def_file, generation_dir, shaders_library): with open(os.path.join(generation_dir, impl_file), 'w') as file: file.write("#include \"shaders/%s\"\n\n" % (def_file)) file.write("#include \"base/assert.hpp\"\n\n") file.write("#include \"std/target_os.hpp\"\n\n") file.write("#include <array>\n\n") file.write("namespace gpu\n") file.write("{\n") file.write("char const * GL3_SHADER_VERSION = \"#version 150 core \\n\";\n") file.write("char const * GLES3_SHADER_VERSION = \"#version 300 es \\n\";\n\n") for shader in shader_index.keys(): write_shader(file, shader, shader_dir, shaders_library) write_gles3_shader(file, shader, shader_dir, shaders_library) file.write("GLProgramInfo GetProgramInfo(dp::ApiVersion apiVersion, Program program)\n") file.write("{\n") file.write(" if (apiVersion == dp::ApiVersion::OpenGLES2)\n") file.write(" {\n") file.write(" static std::array<GLProgramInfo, static_cast<size_t>(Program::ProgramsCount)> gpuIndex = {{\n") write_gpu_programs_map(file, programs_def, '') file.write(" }};\n") file.write(" return gpuIndex[static_cast<size_t>(program)];\n") file.write(" }\n") file.write(" else if (apiVersion == dp::ApiVersion::OpenGLES3)\n") file.write(" {\n") file.write(" static std::array<GLProgramInfo, static_cast<size_t>(Program::ProgramsCount)> gpuIndex = {{\n") write_gpu_programs_map(file, programs_def, GLES3_PREFIX) file.write(" }};\n") file.write(" return gpuIndex[static_cast<size_t>(program)];\n") file.write(" }\n") file.write(" CHECK(false, (\"Unsupported API version.\"));\n") file.write(" return {};\n") file.write("}\n") file.write("} // namespace gpu\n") if __name__ == '__main__': if len(sys.argv) < 6: print("Usage : " + sys.argv[0] + " <shader_dir> <index_file> <programs_file> <shaders_lib> <generation_dir> <generated_file>") exit(1) shader_dir = sys.argv[1] index_file_name = sys.argv[2] programs_file_name = sys.argv[3] shaders_lib_file = sys.argv[4] generation_dir = sys.argv[5] defines_file = sys.argv[6] + ".hpp" impl_file = sys.argv[6] + ".cpp" shaders = [file for file in os.listdir(shader_dir) if os.path.isfile(os.path.join(shader_dir, file)) and ( file.endswith(VERTEX_SHADER_EXT) or file.endswith(FRAG_SHADER_EXT))] shaderIndex = generate_shader_indexes(shaders) programs_order = read_programs_file(os.path.join(shader_dir, '..', programs_file_name)) programDefinition = read_index_file(os.path.join(shader_dir, index_file_name), programs_order) shaders_library = read_shaders_lib_file(os.path.join(shader_dir, shaders_lib_file)) write_definition_file(defines_file, generation_dir) write_implementation_file(programDefinition, shaderIndex, shader_dir, impl_file, defines_file, generation_dir, shaders_library)
nilq/baby-python
python
#!/usr/bin/env python3.8 # Copyright 2019 The Fuchsia Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import argparse import json import os import platform import sys def main(): parser = argparse.ArgumentParser() # TODO(fxbug.dev/5535): make this argument required. parser.add_argument( '--reference', help='Path to the golden API file', required=False) parser.add_argument( '--manifest', help='Path to the SDK manifest', required=True) parser.add_argument( '--updated', help='Path to the API file to compute', required=True) parser.add_argument( '--warn', help='Whether API changes should only cause warnings', action='store_true') args = parser.parse_args() if not args.reference: # Nothing to do. with open(args.updated, 'w') as updated_file: updated_file.write('No API verification for this SDK :/') return 0 with open(args.manifest, 'r') as manifest_file: manifest = json.load(manifest_file) ids = [a['id'] for a in manifest['atoms']] # Ignore images which are very architecture-dependent. # TODO(fxbug.dev/5824): remove this exception when obsolete. ids = [i for i in ids if not (i.startswith('sdk://images'))] with open(args.updated, 'w') as updated_file: updated_file.write('\n'.join(ids)) with open(args.reference, 'r') as reference_file: old_ids = [l.strip() for l in reference_file.readlines()] # tools/arm64 should not exist on mac hosts # TODO(fxbug.dev/42999): remove when SDK transition is complete. if platform.mac_ver()[0]: old_ids = [i for i in old_ids if not i.startswith('sdk://tools/arm64')] ids = filter(lambda i: not i.startswith('sdk://fidl/zx'), ids) old_ids = filter(lambda i: not i.startswith('sdk://fidl/zx'), old_ids) ids = filter(lambda i: not i.startswith('sdk://fidl/zx'), ids) old_ids = filter(lambda i: not i.startswith('sdk://fidl/zx'), old_ids) new_id_set = set(ids) old_id_set = set(old_ids) added_ids = new_id_set - old_id_set removed_ids = old_id_set - new_id_set if added_ids: print('Elements added to SDK:') for id in sorted(added_ids): print(' - %s' % id) if removed_ids: print('Elements removed from SDK:') for id in sorted(removed_ids): print(' - %s' % id) if removed_ids or added_ids: type = 'Warning' if args.warn else 'Error' print('%s: SDK contents have changed!' % type) print('Please acknowledge this change by running:') print( ' cp ' + os.path.abspath(args.updated) + ' ' + os.path.abspath(args.reference)) if not args.warn: return 1 return 0 if __name__ == '__main__': sys.exit(main())
nilq/baby-python
python
import filecmp import os def exists(path): return os.path.isfile(path) class FileApprover(object): def verify(self, namer, writer, reporter): base = namer.get_basename() approved = namer.get_approved_filename(base) received = namer.get_received_filename(base) writer.write_received_file(received) ok = self.verify_files(approved, received, reporter) if not ok: return "Approval Mismatch" return None def verify_files(self, approved_file, received_file, reporter): if self.are_files_the_same(approved_file, received_file): os.remove(received_file) return True reporter.report(received_file, approved_file) return False @staticmethod def are_files_the_same(approved_file, received_file): if not exists(approved_file) or not exists(received_file): return False if os.stat(approved_file).st_size != os.stat(received_file).st_size: return False else: return filecmp.cmp(approved_file, received_file)
nilq/baby-python
python
import socket import serial from config import DEFAULT_VELOCITY from config import TIME_INTERVAL import time import math import os class Robot: def __init__(self, mac: str, color: str, com: str): if os.name == 'posix': self.socket = socket.socket( socket.AF_BLUETOOTH, socket.SOCK_STREAM, socket.BTPROTO_RFCOMM) print("Input 1234 code in system bluetooth window") self.socket.connect((mac, 1)) else: self.serial = serial.Serial(com) self.last_update = time.time() self.color = color self.user_time = time.time() self.user_age = 15 self.user_id = 0 def send_speed_command(self, left, right): cmd = '[={},{}]'.format(left, right) if os.name == 'posix': self.socket.send(bytes(cmd, 'UTF-8')) else: self.serial.write(bytes(cmd, 'UTF-8')) self.last_update = time.time() print(cmd) def forward(self): self.send_speed_command(self.velocity(), self.velocity()) def reverse(self): self.send_speed_command(-self.velocity(), -self.velocity()) def left(self): self.send_speed_command(0, math.ceil(self.velocity()/2)) def right(self): self.send_speed_command(math.ceil(self.velocity()/2), 0) def stop(self): self.send_speed_command(0, 0) def is_time_exceeded(self): return (time.time() - self.last_update) > TIME_INTERVAL def age(self): return (time.time() - self.user_time) def velocity(self): if self.user_age < 10: return math.ceil(DEFAULT_VELOCITY/2) elif self.user_age > 20: return DEFAULT_VELOCITY else: return math.ceil(self.user_age / 20 * DEFAULT_VELOCITY)
nilq/baby-python
python
# THIS FILE IS GENERATED FROM KIVY SETUP.PY __version__ = '1.11.0.dev0' __hash__ = '9b90467ec9efea3891e07be92c9bb4ba638a7ca0' __date__ = '20190329'
nilq/baby-python
python
# Tara O'Kelly - G00322214 # Emerging Technologies, Year 4, Software Development, GMIT. # Problem set: Python fundamentals # 6. Write a function that returns the largest and smallest elements in a list. user_list = [] # get user input n = int(input('How many numbers: ')) for x in range(n): numbers = int(input('Enter number: \n')) user_list.append(numbers) # use min and max functions # https://docs.python.org/3/library/functions.html#max # https://docs.python.org/3/library/functions.html#min print("Largest element in the list is :", max(user_list), "\nSmallest element in the list is :", min(user_list))
nilq/baby-python
python
#%% import numpy as np import pandas as pd # Load the data data = pd.read_csv('./input/2021-02-11_REL606_NCM3722_diauxie.csv') # DO some serious tidying melted = data.melt('Cycle Nr.') # Get the time indices time = melted[melted['Cycle Nr.']=='Time [s]'] time.sort_values(by='variable', inplace=True) time = time['value'].values # Get the temperature indices temp = melted[melted['Cycle Nr.']=='Temp. [°C]'] temp.sort_values(by='variable', inplace=True) temp = temp['value'].values # get the well info dfs = [] _melted = melted[(melted['Cycle Nr.'] != 'Time [s]') & (melted['Cycle Nr.'] != 'Temp. [°C]')] for g, d in _melted.groupby(['Cycle Nr.']): d.sort_values(by='variable', inplace=True) d['time_s'] = time d['temp_C'] = temp d.rename(columns={'Cycle Nr.': 'well', 'value':'od_600nm'}, inplace=True) d.drop(columns=['variable'], inplace=True) dfs.append(d) tidy = pd.concat(dfs, sort=False) # Add identifier for the strain tidy['strain'] = 'blank' tidy['medium'] = 'blank' for n in range(4, 10): if n <= 6: medium = '10 mM glucose + 30 mM acetate' else: medium = '0.61 mM glucose + 30 mM acetate' for letter, strain in zip(['D', 'E'], ['NCM3722', 'REL606']): tidy.loc[tidy['well'] == f'{letter}{n}', 'strain'] = strain tidy.loc[tidy['well'] == f'{letter}{n}', 'medium'] = medium # Add replicate information. for g, d in tidy.groupby(['strain', 'medium']): mapper = {w:r + 1 for r, w in enumerate(d['well'].unique())} for k, v in mapper.items(): tidy.loc[tidy['well']==k, 'replicate'] = v tidy['replicate'] = tidy['replicate'].astype(int) # Save the tidy dataframe to disk for further processing tidy.to_csv('./output/2021-02-11_NCM_REL_diauxie_tidy.csv', index=False) # %% # %%
nilq/baby-python
python
"""Library for CIM sparql queries""" __version__ = "1.9.0"
nilq/baby-python
python
# -*- coding: utf-8 -*- """ Script to make test """ from indeed import params def test_indeed_params(): assert params('my_username', 'my_password') == ('my_username', 'my_password') assert params('your_username', 'your_password') == ('your_username', 'your_password')
nilq/baby-python
python
# # Copyright 2017-2018 Amazon.com, Inc. and its affiliates. All Rights Reserved. # # Licensed under the MIT License. See the LICENSE accompanying this file # for the specific language governing permissions and limitations under # the License. # import mount_efs import os import pytest from datetime import datetime from mock import MagicMock try: import ConfigParser except ImportError: from configparser import ConfigParser FS_ID = 'fs-deadbeef' AP_ID = 'fsap-fedcba9876543210' REGION = 'us-east-1' COMMON_NAME = 'fs-deadbeef.efs.us-east-1.amazonaws.com' MOUNT_NAME = 'fs-deadbeef.mount.dir.12345' ACCESS_KEY_ID_VAL = 'FAKE_AWS_ACCESS_KEY_ID' SECRET_ACCESS_KEY_VAL = 'FAKE_AWS_SECRET_ACCESS_KEY' SESSION_TOKEN_VAL = 'FAKE_SESSION_TOKEN' CREDENTIALS = { 'AccessKeyId': ACCESS_KEY_ID_VAL, 'SecretAccessKey': SECRET_ACCESS_KEY_VAL, 'Token': SESSION_TOKEN_VAL } FIXED_DT = datetime(2000, 1, 1, 12, 0, 0) @pytest.fixture(autouse=True) def setup_method(mocker): mocker.patch('mount_efs.get_region', return_value=REGION) mocker.patch('mount_efs.get_region_helper', return_value=REGION) mocker.patch('mount_efs.get_aws_security_credentials', return_value=CREDENTIALS) mocker.patch('mount_efs.get_utc_now', return_value=FIXED_DT) mocker.patch('socket.gethostbyname') def _get_config(): try: config = ConfigParser.SafeConfigParser() except AttributeError: config = ConfigParser() config.add_section(mount_efs.CONFIG_SECTION) config.set(mount_efs.CONFIG_SECTION, 'state_file_dir_mode', '750') config.set(mount_efs.CONFIG_SECTION, 'dns_name_format', '{fs_id}.efs.{region}.amazonaws.com') return config def _get_ca_conf_body(config_path, common_name, directory, private_key, date, region, fs_id, iam, ap_id): ca_conf_str = mount_efs.create_ca_conf(config_path, common_name, directory, private_key, date, region, fs_id, iam, ap_id) return ca_conf_str def _get_mock_config(dns_name_format='{fs_id}.efs.{region}.amazonaws.com'): def config_get_side_effect(section, field): if section == mount_efs.CONFIG_SECTION and field == 'state_file_dir_mode': return '0755' elif section == mount_efs.CONFIG_SECTION and field == 'dns_name_format': return dns_name_format else: raise ValueError('Unexpected arguments') mock_config = MagicMock() mock_config.get.side_effect = config_get_side_effect return mock_config def _get_mock_private_key_path(mocker, tmpdir): pk_path = os.path.join(str(tmpdir), 'privateKey.pem') mocker.patch('mount_efs.get_private_key_path', return_value=pk_path) return pk_path def test_certificate_without_iam_with_ap_id(mocker, tmpdir): config = _get_mock_config() pk_path = _get_mock_private_key_path(mocker, tmpdir) tls_dict = mount_efs.tls_paths_dictionary(MOUNT_NAME, str(tmpdir)) tmp_config_path = os.path.join(str(tmpdir), MOUNT_NAME, 'tmpConfig') mount_efs.create_certificate(config, MOUNT_NAME, COMMON_NAME, REGION, FS_ID, False, ap_id=AP_ID, base_path=str(tmpdir)) with open(os.path.join(tls_dict['mount_dir'], 'config.conf')) as f: conf_body = f.read() assert conf_body == _get_ca_conf_body(tmp_config_path, COMMON_NAME, tls_dict['mount_dir'], pk_path, FIXED_DT, REGION, FS_ID, False, AP_ID) assert os.path.exists(pk_path) assert not os.path.exists(os.path.join(tls_dict['mount_dir'], 'publicKey.pem')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'request.csr')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'certificate.pem')) def test_certificate_with_iam_with_ap_id(mocker, tmpdir): config = _get_mock_config() pk_path = _get_mock_private_key_path(mocker, tmpdir) tls_dict = mount_efs.tls_paths_dictionary(MOUNT_NAME, str(tmpdir)) tmp_config_path = os.path.join(str(tmpdir), MOUNT_NAME, 'tmpConfig') mount_efs.create_certificate(config, MOUNT_NAME, COMMON_NAME, REGION, FS_ID, True, ap_id=AP_ID, base_path=str(tmpdir)) with open(os.path.join(tls_dict['mount_dir'], 'config.conf')) as f: conf_body = f.read() assert conf_body == _get_ca_conf_body(tmp_config_path, COMMON_NAME, tls_dict['mount_dir'], pk_path, FIXED_DT, REGION, FS_ID, True, AP_ID) assert os.path.exists(pk_path) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'publicKey.pem')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'request.csr')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'certificate.pem')) def test_certificate_with_iam_without_ap_id(mocker, tmpdir): config = _get_mock_config() pk_path = _get_mock_private_key_path(mocker, tmpdir) tls_dict = mount_efs.tls_paths_dictionary(MOUNT_NAME, str(tmpdir)) tmp_config_path = os.path.join(str(tmpdir), MOUNT_NAME, 'tmpConfig') mount_efs.create_certificate(config, MOUNT_NAME, COMMON_NAME, REGION, FS_ID, True, ap_id=None, base_path=str(tmpdir)) with open(os.path.join(tls_dict['mount_dir'], 'config.conf')) as f: conf_body = f.read() assert conf_body == _get_ca_conf_body(tmp_config_path, COMMON_NAME, tls_dict['mount_dir'], pk_path, FIXED_DT, REGION, FS_ID, True, None) assert os.path.exists(pk_path) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'publicKey.pem')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'request.csr')) assert os.path.exists(os.path.join(tls_dict['mount_dir'], 'certificate.pem')) def test_create_ca_supporting_dirs(tmpdir): config = _get_config() tls_dict = mount_efs.tls_paths_dictionary(MOUNT_NAME, str(tmpdir)) mount_efs.ca_dirs_check(config, tls_dict['database_dir'], tls_dict['certs_dir']) assert os.path.exists(tls_dict['database_dir']) assert os.path.exists(tls_dict['certs_dir']) def test_create_ca_supporting_files(tmpdir): config = _get_config() tls_dict = mount_efs.tls_paths_dictionary(MOUNT_NAME, str(tmpdir)) index = tls_dict['index'] index_attr = tls_dict['index_attr'] serial = tls_dict['serial'] rand = tls_dict['rand'] mount_efs.ca_dirs_check(config, tls_dict['database_dir'], tls_dict['certs_dir']) mount_efs.ca_supporting_files_check(index, index_attr, serial, rand) with open(index_attr, 'r') as index_attr_file: index_attr_content = index_attr_file.read() with open(serial, 'r') as serial_file: serial_content = serial_file.read() assert os.path.exists(index) assert os.path.exists(index_attr) assert os.path.exists(serial) assert os.path.exists(rand) assert 'unique_subject = no' == index_attr_content assert '00' == serial_content def test_create_canonical_request_without_token(): public_key_hash = 'fake_public_key_hash' canonical_request_out = mount_efs.create_canonical_request(public_key_hash, FIXED_DT, ACCESS_KEY_ID_VAL, REGION, FS_ID) assert 'GET\n/\nAction=Connect&PublicKeyHash=fake_public_key_hash&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=' \ 'FAKE_AWS_ACCESS_KEY_ID%2F20000101%2Fus-east-1%2Felasticfilesystem%2Faws4_request&X-Amz-Date=20000101T120000Z&' \ 'X-Amz-Expires=86400&X-Amz-SignedHeaders=host\nhost:fs-deadbeef\nhost\n' \ 'e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855' == canonical_request_out def test_create_canonical_request_with_token(mocker): mocker.patch('mount_efs.get_utc_now', return_value=FIXED_DT) public_key_hash = 'fake_public_key_hash' canonical_request_out = mount_efs.create_canonical_request(public_key_hash, FIXED_DT, ACCESS_KEY_ID_VAL, REGION, FS_ID, SESSION_TOKEN_VAL) assert 'GET\n/\nAction=Connect&PublicKeyHash=fake_public_key_hash&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=' \ 'FAKE_AWS_ACCESS_KEY_ID%2F20000101%2Fus-east-1%2Felasticfilesystem%2Faws4_request&X-Amz-Date=20000101T120000Z&' \ 'X-Amz-Expires=86400&X-Amz-Security-Token=FAKE_SESSION_TOKEN&X-Amz-SignedHeaders=host\nhost:fs-deadbeef\nhost' \ '\ne3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855' == canonical_request_out def test_get_public_key_sha1(tmpdir): fake_public_key_filename = 'fake_public_key.pem' fake_public_key_path = os.path.join(str(tmpdir), fake_public_key_filename) public_key_body = '-----BEGIN PUBLIC KEY-----\nMIIBojANBgkqhkiG9w0BAQEFAAOCAY8AMIIBigKCAYEArGJgJTTwefL+jHV8A9EM\npX56n3Z' \ 'JczM+4iPPSnledJzBcUO1VF+j6TOzy39BWBtvRjSs0nqd5wqw+1xHawhh\ndJF5KsqMNGcP/y9fLi9Bm1vInHfQVan4NhXWh8S' \ 'NbRZM1tNZV5/k+VnFur6ACHwq\neWppGXkGBASL0zG0MiCbOVMkwfv/E69APVC6ljnPXBWaDuggAClYheTv5RIU4wD1\nc1nohR' \ 'b0ZHyfZjELjnqLfY0eOqY+msQXzP0eUmZXCMvUkGxi5DJnNVKhw5y96QbB\nRFO5ImQXpNsQmp8F9Ih1RIxNsl4csaEuK+/Zo' \ 'J68vR47oQNtPp1PjdIwcnQ3cOvO\nHMxulMX21Fd/e9TsnqISOTOyebmYFgaHczg4JVu5lV699+7QWJm1a7M4ab0WgVVR\nz27J0' \ 'Lx/691MZB4TbGoEIFza30/sk6uTPxAzebzCaroXzT7uA6TIRtRpxt4X9a+4\n6GhfgR5RJfFMb8rPGmaKWqA2YkTsZzRGHhbAzs' \ 'J/nEstAgMBAAE=\n-----END PUBLIC KEY-----' tmpdir.join(fake_public_key_filename).write(public_key_body) sha1_result = mount_efs.get_public_key_sha1(fake_public_key_path) assert sha1_result == 'd9c2a68f2c4de49982e310d95e539a89abd6bc13' def test_create_string_to_sign(): canonical_request = 'canonical_request' string_to_sign_output = mount_efs.create_string_to_sign(canonical_request, FIXED_DT, REGION) assert 'AWS4-HMAC-SHA256\n20000101T120000Z\n20000101/us-east-1/elasticfilesystem/aws4_request\n' \ '572b1e335109068b81e4def81524c5fe5d0e385143b5656cbf2f7c88e5c1a51e' == string_to_sign_output def test_calculate_signature(): string_to_sign = 'string_to_sign' signature_output = mount_efs.calculate_signature(string_to_sign, FIXED_DT, SECRET_ACCESS_KEY_VAL, REGION) assert '6aa643803d4a1b07c5ac87bff96347ef28dab1cb5a5c5d63969c90ca11454c4a' == signature_output
nilq/baby-python
python
from chibi.units.base import Unit from unittest import TestCase class Test_unit( TestCase ): def setUp( self ): self.unit = Unit( 10 ) def test_should_print_the_value_when_is_str( self ): self.assertIn( '10', str( self.unit ) ) def test_when_add_a_int_should_work( self ): r = 10 + self.unit self.assertEqual( r.value, 20 ) r = self.unit + 10 self.assertEqual( r.value, 20 ) def test_when_add_a_float_should_work( self ): r = 10.10 + self.unit self.assertEqual( r.value, 20.1 ) r = self.unit + 10.1 self.assertEqual( r.value, 20.1 ) def test_when_sub_a_int_should_work( self ): r = 10 - self.unit self.assertEqual( r.value, 0 ) r = self.unit - 10 self.assertEqual( r.value, 0 ) def test_when_sub_a_float_should_work( self ): r = 10.10 - self.unit self.assertAlmostEqual( r.value, -0.1, delta=0.01 ) r = self.unit - 10.10 self.assertAlmostEqual( r.value, -0.1, delta=0.01 ) def test_when_mul_a_int_should_work( self ): r = 10 * self.unit self.assertEqual( r.value, 100 ) r = self.unit * 10 self.assertEqual( r.value, 100 ) def test_when_mul_a_float_should_work( self ): r = 10.1 * self.unit self.assertEqual( r.value, 101.0 ) r = self.unit * 10.1 self.assertEqual( r.value, 101.0 ) def test_when_div_a_int_should_work( self ): r = 10 / self.unit self.assertEqual( r.value, 1 ) r = self.unit / 10 self.assertEqual( r.value, 1 ) def test_when_div_a_float_should_work( self ): r = 10.10 / self.unit self.assertAlmostEqual( r.value, 0.99, delta=0.001 ) r = self.unit / 10.10 self.assertAlmostEqual( r.value, 0.99, delta=0.001 ) def test_when_div_int_a_int_should_work( self ): r = 10 // self.unit self.assertEqual( r.value, 1 ) r = self.unit // 10 self.assertEqual( r.value, 1 ) def test_when_div_int_a_float_should_work( self ): r = 10.10 // self.unit self.assertEqual( r.value, 0 ) r = self.unit // 10.10 self.assertEqual( r.value, 0 ) def test_when_pow_a_int_should_work( self ): r = 10 ** self.unit self.assertEqual( r.value, 10000000000 ) r = self.unit ** 10 self.assertEqual( r.value, 10000000000 ) def test_when_pow_float_a_float_should_work( self ): r = 10.10 ** self.unit self.assertEqual( r.value, 12589254117.941662 ) r = self.unit ** 10.10 self.assertEqual( r.value, 12589254117.941662 )
nilq/baby-python
python
################################################################################################################### # Uses a trained network to predict the class for an input image # Notes - Run train.py first before this script # Basic usage: python predict.py /path/to/image checkpoint # Options: # Return top KK most likely classes: python predict.py input checkpoint --top_k 3 # Use a mapping of categories to real names: python predict.py input checkpoint --category_names cat_to_name.json # Use GPU for inference: python predict.py input checkpoint --gpu # Typical run: python predict.py --gpu --category_names cat_to_name.json --top_k 3 check_point.pt ##################################################################################################################### ########################################### # Get the arguments from the command line ########################################### import argparse parser = argparse.ArgumentParser() parser.add_argument('image_checkpoint', metavar='image_checkpoint', help='/path/to/image_checkpoint') parser.add_argument('--category_names', action="store", dest="category_names", default='cat_to_name.json', help='a mapping of categories to real names ') parser.add_argument('--top_k', metavar='top_k', default=3, type=int, help='top KK most likely classes (default: 3)') parser.add_argument('--gpu', dest='use_gpu', action="store_true", default=False, help='Use GPU for training (default: True)') parser.add_argument('--version', action='version', version='%(prog)s 1.0 There is NO warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.') # Decided to pull some wording from GCC parser.add_argument('--load_dir', action="store", dest="load_dir", default='./', help='directory_to_saved_checkpoints') parser.add_argument('--test_image_dir', action="store", dest="test_image_dir", default='./flowers/test/10', help='directory location to image used to test prediction') parser.add_argument('--test_image', action="store", dest="test_image", default='image_07104.jpg', help='Image file used to test prediction') args = parser.parse_args() ### DEBUG ### print(vars(args)) print(args.use_gpu) ######################### # Various Python imports ######################### import os import sys import numpy as np import torch import time import torchvision from torchvision import datasets, models, transforms import matplotlib.pyplot as plt #%matplotlib inline from torch import nn from torch import optim import torch.nn.functional as F import torchvision.models as models from PIL import Image import json from matplotlib.ticker import FormatStrFormatter from collections import OrderedDict image_checkpoint = args.image_checkpoint category_names = args.category_names top_k = args.top_k use_gpu = args.use_gpu load_dir = args.load_dir test_image_dir = args.test_image_dir test_image = args.test_image device = torch.device('cuda' if torch.cuda.is_available() and use_gpu else 'cpu') if use_gpu: ############################# # Check if CUDA is available ############################# train_on_gpu = torch.cuda.is_available() if not train_on_gpu: print('CUDA is not available. Exiting ...') sys.exit() else: print('CUDA is available! Training on GPU ...') ### DEBUG ### #print('Passed GPU Check') ########################## # Possible models to use ########################## structures = {"densenet121" : 1024, "alexnet" : 9216} def model_setup(structure='densenet121',dropout=0.5, hidden_layer1 = 120,lr = 0.001): #def model_setup(structure='densenet121',dropout=0.5, hidden_layer1 = 512,lr = 0.01): ### DEBUG ### #print('Model Setup Function...') if structure == 'densenet121': model = models.densenet121(pretrained=True) elif structure == 'alexnet': model = models.alexnet(pretrained = True) else: print("Im sorry but {} is not a valid model. Did you mean densenet121 or alexnet?".format(structure)) sys.exit() classifier = nn.Sequential(OrderedDict([ ('dropout',nn.Dropout(dropout)), ('inputs', nn.Linear(structures[structure], hidden_layer1)), ('relu1', nn.ReLU()), ('hidden_layer1', nn.Linear(hidden_layer1, 90)), ('relu2',nn.ReLU()), ('hidden_layer2',nn.Linear(90,80)), ('relu3',nn.ReLU()), ('hidden_layer3',nn.Linear(80,102)), ('output', nn.LogSoftmax(dim=1)) ])) for param in model.parameters(): param.requires_grad = False model.classifier = classifier criterion = nn.NLLLoss() optimizer = optim.Adam(model.classifier.parameters(), lr )# Observe that all parameters are being optimized if use_gpu: model.cuda() return model, optimizer, criterion, structure #################################################################### # Loads a checkpoint and rebuilds the model #################################################################### def load_model(path='./',file_name='check_point.pt'): ### DEBUG ### #print('Load Model Function...') checkpoint = torch.load((path + file_name)) structure = checkpoint['structure'] hidden_layer1 = checkpoint['hidden_layer1'] model,_,_,_ = model_setup(structure , 0.5,hidden_layer1) model.class_to_idx = checkpoint['class_to_idx'] model.load_state_dict(checkpoint['state_dict']) ### DEBUG ### #print('Exiting Load Model Function...') return model ############# # Load Model ############# model2 = load_model(path=load_dir,file_name=image_checkpoint) ### DEBUG ### #print(model2) #print(model2.state_dict()) ########################### # Label mapping for DEBUG ########################### with open(category_names, 'r') as f: cat_to_name = json.load(f) ####################### # Image Preprocessing ####################### def process_image(image): ''' Scales, crops, and normalizes a PIL image for a PyTorch model, returns an Numpy array ''' ### DEBUG ### #print('Image Preprocessing Function...') img_pil = Image.open(image) adjustments = transforms.Compose([ transforms.Resize(256), transforms.CenterCrop(224), transforms.ToTensor(), transforms.Normalize(mean=[0.485, 0.456, 0.406], std=[0.229, 0.224, 0.225]) ]) img_tensor = adjustments(img_pil) return img_tensor #################### # Class Prediction #################### #model.class_to_idx =train_data.class_to_idx ### DEBUG ### #print('Pre Class Prediction') ctx = model2.class_to_idx #use_gpu = True def predict(image_path, model, topk=5): ''' Predict the class (or classes) of an image using a trained deep learning model. ''' # if use_gpu: # model.to('cuda:0') # else: # model.to('cpu') model.to(device) img_torch = process_image(image_path) img_torch = img_torch.unsqueeze_(0) img_torch = img_torch.float() with torch.no_grad(): if use_gpu: output = model.forward(img_torch.cuda()) else: output = model.forward(img_torch) probability = F.softmax(output.data,dim=1) ############################ # Pulled from check_sanity() ############################ probabilities = probability.topk(topk) #b = [cat_to_name[str(index + 1)] for index in np.array(probabilities[1][0])] idx_to_class = {val: key for key, val in model.class_to_idx.items()} b = [cat_to_name[idx_to_class[index]] for index in np.array(probabilities[1][0])] print(b) return probability.topk(topk) # Implement the code to predict the class from an image file #################### # Get an test image #################### #data_dir = 'flowers' #img = (data_dir + '/test' + '/10/' + 'image_07104.jpg') img = os.path.join(test_image_dir,test_image) val1, val2 = predict(img, model2, top_k) print(val1) print(val2)
nilq/baby-python
python
from datetime import datetime import hashlib import uuid from google.cloud import firestore SONG_TEMPLATE = '{verse}\n\n{pre_chorus}\n\n{chorus}\n\n{pre_chorus}\n\n{chorus}\n\n{bridge}' class Song: collection_name = 'songs' def __init__(self, id, chorus_id=None, pre_chorus_id=None, verse_id=None, bridge_id=None, created=None, modified=None): now = datetime.utcnow() self.db = firestore.Client() self.id = id self.chorus_id = chorus_id self.pre_chorus_id = pre_chorus_id self.verse_id = verse_id self.bridge_id = bridge_id self.created = created or now self.modified = modified or now @classmethod def get_id(cls, chorus, pre_chorus, verse, bridge): id_base = f'{chorus}|{pre_chorus}|{verse}|{bridge}' hasher = hashlib.sha1() hasher.update(id_base.encode('utf8')) song_id = hasher.hexdigest()[:7] return song_id @classmethod def get(cls, song_id): db = firestore.Client() results = [ item for item in db.collection(cls.collection_name).where('id', '==', song_id).stream() ] if results: return cls(song_id).populate(**(results[0].to_dict())) else: return None @classmethod def get_all(cls): db = firestore.Client() return [ cls(item.id).populate(**item.to_dict()) for item in db.collection(cls.collection_name).stream() ] def populate(self, **kwargs): for key, val in kwargs.items(): if hasattr(self, key): setattr(self, key, val) return self def save(self): doc_ref = self.db.collection(self.collection_name).document(self.id) doc_ref.set({ 'id': self.id, 'chorus_id': self.chorus_id, 'pre_chorus_id': self.pre_chorus_id, 'verse_id': self.verse_id, 'bridge_id': self.bridge_id, 'created': self.created, 'modified': datetime.utcnow(), })
nilq/baby-python
python
"""This module contains various decorators. There are two kinds of decorators defined in this module which consists of either two or three nested functions. The former are decorators without and the latter with arguments. For more information on decorators, see this `guide`_ on https://realpython.com which provides a comprehensive overview. .. _guide: https://realpython.com/primer-on-python-decorators/ """ import functools import warnings from typing import NamedTuple import numpy as np import pandas as pd from estimagic.exceptions import get_traceback from estimagic.parameters.process_constraints import process_constraints from estimagic.parameters.reparametrize import reparametrize_from_internal def numpy_interface(func=None, *, params=None, constraints=None, numpy_output=False): """Convert x to params. This decorated function receives a NumPy array of parameters and converts it to a :class:`pandas.DataFrame` which can be handled by the user's criterion function. For convenience, the decorated function can also be called directly with a params DataFrame. In that case, the decorator does nothing. Args: func (callable): The function to which the decorator is applied. params (pandas.DataFrame): See :ref:`params`. constraints (list of dict): Contains constraints. numpy_output (bool): Whether pandas objects in the output should also be converted to numpy arrays. Returns: callable """ constraints = [] if constraints is None else constraints pc, pp = process_constraints(constraints, params) fixed_values = pp["_internal_fixed_value"].to_numpy() pre_replacements = pp["_pre_replacements"].to_numpy().astype(int) post_replacements = pp["_post_replacements"].to_numpy().astype(int) def decorator_numpy_interface(func): @functools.wraps(func) def wrapper_numpy_interface(x, *args, **kwargs): if isinstance(x, pd.DataFrame): p = x elif isinstance(x, np.ndarray): p = reparametrize_from_internal( internal=x, fixed_values=fixed_values, pre_replacements=pre_replacements, processed_constraints=pc, post_replacements=post_replacements, params=params, return_numpy=False, ) else: raise ValueError( "x must be a numpy array or DataFrame with 'value' column." ) criterion_value = func(p, *args, **kwargs) if isinstance(criterion_value, (pd.DataFrame, pd.Series)) and numpy_output: criterion_value = criterion_value.to_numpy() return criterion_value return wrapper_numpy_interface if callable(func): return decorator_numpy_interface(func) else: return decorator_numpy_interface def catch( func=None, *, exception=Exception, exclude=(KeyboardInterrupt, SystemExit), onerror=None, default=None, warn=True, reraise=False, ): """Catch and handle exceptions. This decorator can be used with and without additional arguments. Args: exception (Exception or tuple): One or several exceptions that are caught and handled. By default all Exceptions are caught and handled. exclude (Exception or tuple): One or several exceptionts that are not caught. By default those are KeyboardInterrupt and SystemExit. onerror (None or Callable): Callable that takes an Exception as only argument. This is called when an exception occurs. default: Value that is returned when as the output of func when an exception occurs. Can be one of the following: - a constant - "__traceback__", in this case a string with a traceback is returned. - callable with the same signature as func. warn (bool): If True, the exception is converted to a warning. reraise (bool): If True, the exception is raised after handling it. """ def decorator_catch(func): @functools.wraps(func) def wrapper_catch(*args, **kwargs): try: res = func(*args, **kwargs) except exclude: raise except exception as e: if onerror is not None: onerror(e) if reraise: raise e tb = get_traceback() if warn: msg = f"The following exception was caught:\n\n{tb}" warnings.warn(msg) if default == "__traceback__": res = tb elif callable(default): res = default(*args, **kwargs) else: res = default return res return wrapper_catch if callable(func): return decorator_catch(func) else: return decorator_catch def unpack(func=None, symbol=None): def decorator_unpack(func): if symbol is None: @functools.wraps(func) def wrapper_unpack(arg): return func(arg) elif symbol == "*": @functools.wraps(func) def wrapper_unpack(arg): return func(*arg) elif symbol == "**": @functools.wraps(func) def wrapper_unpack(arg): return func(**arg) return wrapper_unpack if callable(func): return decorator_unpack(func) else: return decorator_unpack def switch_sign(func): """Switch sign of all outputs of a function.""" @functools.wraps(func) def wrapper(*args, **kwargs): unswitched = func(*args, **kwargs) if isinstance(unswitched, dict): switched = {key: -val for key, val in unswitched.items()} elif isinstance(unswitched, (tuple, list)): switched = [] for entry in unswitched: if isinstance(entry, dict): switched.append({key: -val for key, val in entry.items()}) else: switched.append(-entry) if isinstance(unswitched, tuple): switched = tuple(switched) else: switched = -unswitched return switched return wrapper class AlgoInfo(NamedTuple): primary_criterion_entry: str name: str parallelizes: bool disable_cache: bool needs_scaling: bool is_available: bool def mark_minimizer( func=None, *, primary_criterion_entry="value", name=None, parallelizes=False, disable_cache=False, needs_scaling=False, is_available=True, ): """Decorator to mark a function as internal estimagic minimizer and add information. Args: func (callable): The function to be decorated primary_criterion_entry (str): One of "value", "contributions", "root_contributions" or "dict". Default: "value". This decides which part of the output of the user provided criterion function is needed by the internal optimizer. name (str): The name of the internal algorithm. parallelizes (bool): Must be True if an algorithm evaluates the criterion, derivative or criterion_and_derivative in parallel. disable_cache (bool): If True, no caching for the criterion function or its derivatives are used. needs_scaling (bool): Must be True if the algorithm is not reasonable independent of the scaling of the parameters. is_available (bool): Whether the algorithm is available. This is needed for algorithms that require optional dependencies. """ if name is None: raise TypeError( "mark_minimizer() missing 1 required keyword-only argument: 'name'" ) elif not isinstance(name, str): raise TypeError("name must be a string.") valid_entries = ["value", "dict", "contributions", "root_contributions"] if primary_criterion_entry not in valid_entries: raise ValueError( f"primary_criterion_entry must be one of {valid_entries} not " f"{primary_criterion_entry}." ) if not isinstance(parallelizes, bool): raise TypeError("parallelizes must be a bool.") if not isinstance(disable_cache, bool): raise TypeError("disable_cache must be a bool.") if not isinstance(needs_scaling, bool): raise TypeError("needs_scaling must be a bool.") if not isinstance(is_available, bool): raise TypeError("is_available must be a bool.") algo_info = AlgoInfo( primary_criterion_entry=primary_criterion_entry, name=name, parallelizes=parallelizes, disable_cache=disable_cache, needs_scaling=needs_scaling, is_available=is_available, ) def decorator_mark_minimizer(func): @functools.wraps(func) def wrapper_mark_minimizer(*args, **kwargs): return func(*args, **kwargs) wrapper_mark_minimizer._algorithm_info = algo_info return wrapper_mark_minimizer if callable(func): return decorator_mark_minimizer(func) else: return decorator_mark_minimizer
nilq/baby-python
python
from typing import Tuple, List import pytest from predicates.state import State from predicates import guards, actions from predicates.guards import AlwaysTrue, AlwaysFalse from model.model import the_model, Model from model.operation import Operation, Transition from planner.plan import plan # --------------------------------------------------------------------------- # ... # --------------------------------------------------------------------------- g = guards.from_str a = actions.from_str def test_simple_planner_1(): """ This test checks the implementation of the planner with a simple model """ initial_state = State( v1 = False, v2 = 0 ) o1 = Operation( name=f"o1", # enabled when v1 is false precondition=Transition("pre", g("!v1"), ()), # the guard of the postcondition is only used when running the operation, not when planning postcondition=Transition("post", AlwaysTrue, a(f"v1")), # the effects are only used when planning to simulate changes of sensors effects=(), ) o2 = Operation( name=f"o2", precondition=Transition("pre", g("v1 && v2 == 0"), ()), postcondition=Transition("post", AlwaysTrue, a(f"v2 += 1")), effects=(), ) o3 = Operation( name=f"o3", precondition=Transition("pre", g("v1 && v2 == 0"), ()), postcondition=Transition("post", AlwaysTrue, a(f"v2 += 2")), effects=(), ) o4 = Operation( name=f"o4", precondition=Transition("pre", g("v1 && v2 == 2"), ()), postcondition=Transition("post", AlwaysTrue, a(f"v2 += 1")), effects=(), ) o5 = Operation( name=f"o5", precondition=Transition("pre", g("v1"), ()), postcondition=Transition("post", AlwaysTrue, a(f"v2 <- 0")), effects=(), ) simple_model = Model(initial_state, { o1.name: o1, o2.name: o2, o3.name: o3, o4.name: o4, o5.name: o5, }) goal = g("v2 == 3") p = plan(initial_state, goal, simple_model) assert p != None assert len(p) != 0 assert p == [o1.name, o3.name, o4.name] goal = g("v2 == 1") p = plan(initial_state, goal, simple_model) assert p == [o1.name, o2.name] def test_simple_planner_2(): """ This test checks the implementation of the planner with a simple model """ initial_state = State( v1 = False, v2 = 0 ) ops = {} for i in range(100): ops[f"o{i}"] = Operation( name=f"o{i}", # enabled when v1 is false precondition=Transition("pre", g("!v1"), ()), # the guard of the postcondition is only used when running the operation, not when planning postcondition=Transition("post", AlwaysTrue, a(f"v1")), # the effects are only used when planning to simulate changes of sensors effects=(), ) ops["final"] = Operation( name=f"final", precondition=Transition("pre", g("v1 && v2 == 0"), ()), postcondition=Transition("post", AlwaysTrue, a(f"v2 += 1")), effects=(), ) model = Model(initial_state, ops) goal = g("v2 == 1") p = plan(initial_state, goal, model) print(p) assert p != None assert len(p) == 2 assert p[1] == "final" def test_simple_planner_3(): """ This test checks the implementation of the planner with a simple model """ initial_state = State( v1 = False, v2 = 0 ) ops = {} for i in range(100): ops[f"o{i}"] = Operation( name=f"o{i}", # enabled when v1 is false precondition=Transition("pre", g(f"v2 == {i}"), ()), # the guard of the postcondition is only used when running the operation, not when planning postcondition=Transition("post", AlwaysTrue, a(f"v2 +=1")), # the effects are only used when planning to simulate changes of sensors effects=(), ) model = Model(initial_state, ops) goal = g("v2 == 100") p = plan(initial_state, goal, model, 120) print(p) assert p != None assert len(p) == 100 # Use this test when you are working with the model def test_planner_real_model_1(): """This method creates the test the planner that you will use for just a simple case""" m = the_model() goal = g("in_pos1 == empty") assert plan(m.initial_state, goal, m) == [] goal = g("in_pos1 != empty") p = plan(m.initial_state, goal, m) print(f"plan: {p}") assert p == ['add_cube', 'to_input', 'pick_at_input', 'to_pos1', 'place_at_pos1'] goal = g("in_pos1 != empty && in_pos2 != empty && in_pos3 != empty") p = plan(m.initial_state, goal, m) print(f"plan long: {p}") assert p != None assert len(p) == 15 # here you should create more tests to check your model ...
nilq/baby-python
python