content
stringlengths
0
1.05M
origin
stringclasses
2 values
type
stringclasses
2 values
import os import lab_test def mean(list_a): return sum(list_a) / len(list_a) def create_md_file(path, bpp_mine, psnr_mine, ssim_mine, bpp_jpg, psnr_jpg, ssim_jpg): os.system('mkdir -p {}'.format(path)) file_p = os.path.join(path,'res.md') mdfile = open(file_p, 'w') res = [] res.append('MyModel: mean bpp is {:.4f}, mean psnr is {:.4f}, mean ssim is {:.4f}\n'.format(mean(bpp_mine), mean(psnr_mine), mean(ssim_mine))) res.append('JPEG: mean bpp is {:.4f}, mean psnr is {:.4f}, mean ssim is {:.4f}\n'.format(mean(bpp_jpg), mean(psnr_jpg), mean(ssim_jpg))) res.append('|BPP_Mine |PSNR_Mine |SSIM_Mine |BPP_JPG |PSNR_JPG |SSIM_JPG |\n') res.append('|----|----|----|----|-----|----|\n') comb = zip(bpp_mine, psnr_mine, ssim_mine,bpp_jpg, psnr_jpg, ssim_jpg) for i in range(len(psnr_mine)): str = '|{:.4f} | {:.4f} | {:.4f} | {:.4f}| {:.4f} | {:.4f} | \n'.format( bpp_mine[i], psnr_mine[i], ssim_mine[i], bpp_jpg[i], psnr_jpg[i], ssim_jpg[i] ) res.append(str) mdfile.writelines(res) def process(model, version, args, run = True): if run: lab_test.test_kodak(version, model) lab_test.test_jpg(int(args.jpg)) png_path = 'res/{}'.format(version) jpg_path = 'jpg_res/{}'.format(args.jpg) bpp_mine = lab_test.get_bpp('codes/{}'.format(version)) psnr_mine = lab_test.get_psnr(png_path) ssim_mine = lab_test.get_ssim(png_path) bpp_jpg = lab_test.get_bpp(jpg_path,jpeg=True) psnr_jpg = lab_test.get_psnr(jpg_path,jpeg=True) ssim_jpg = lab_test.get_ssim(jpg_path,jpeg=True) save_path = 'report/{}'.format(version) os.system('mkdir -p {}'.format(save_path)) create_md_file(save_path, bpp_mine, psnr_mine, ssim_mine, bpp_jpg, psnr_jpg, ssim_jpg) def CABAC_res(): os.system('touch CABAC.md') res1 = open('CABAC.txt','r') size1 = res1.readlines() res = [] res.append('|CABAC(kb) |Huffman(kb) |\n') res.append('|----|----|\n') i = 0 for x in size1: i += 1 if i < 10: n_id = '0' + str(i) else: n_id = str(i) res.append('|{} |{:d} |\n'.format(x.strip('\n'), os.path.getsize('codes/entropy-1/{}.npz'.format(n_id)))) md_file = open('CABAC.md','w') md_file.writelines(res) if __name__ == '__main__': import argparse parser = argparse.ArgumentParser() parser.add_argument('--model', '-m', required=True, type=str) parser.add_argument('--version', '-v', required=True, type=str) parser.add_argument('--jpg', '-j', required=True, type=str) args = parser.parse_args() process(args.model, args.version, args)
nilq/baby-python
python
#! /usr/bin/env python #coding: utf-8 ###################################################################################### #Script for download and convert to fastq SRA datasets serially. # #Authors: David Peris UW-Madison, Dept Genetics # #Usage: python download_SRA_serially.py INPUT OUTPUTFOLDER YES/NO # # # #INPUT a SRA accession number or a text file with a list of SRAs # #OUTPUTFOLDER the folder where your fastq will be saved # #YES or NO if your input is a list or just an accession number # ###################################################################################### import sys,os SRA_files = sys.argv[1] output_folder = sys.argv[2] list_file = sys.argv[3] downloaded_path = '~/ncbi/public/sra/' if list_file == "NO": SRA_list = [] SRA_list.append(SRA_files) else: SRA_list = open(SRA_files) def prefetch(SRA_file): #It is downloaded into the directory user/ncbi/public/sra/ cmdA = 'prefetch -v ' + SRA_file return cmdA def convert_fastq(SRA_file,output_folder): cmdB = 'fastq-dump --outdir ' + output_folder cmdB += ' --split-files ' + downloaded_path + SRA_file + '.sra' return cmdB for SRA_file in SRA_list: SRA_file = SRA_file.strip() os.system(prefetch(SRA_file)) os.system(convert_fastq(SRA_file,output_folder)) print "SRA files downloaded"
nilq/baby-python
python
#========================================================================== # # Copyright Insight Software Consortium # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0.txt # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # #==========================================================================*/ from __future__ import print_function import itk from sys import argv, stderr, exit itk.auto_progress(2) if len(argv) < 3: print(( "Missing Parameters \n Usage: AntiAliasBinaryImageFilter" " inputImage outputImage [RMS] [numberOfIterations]"), file=stderr) exit(1) inputFilename = argv[1] outputFilename = argv[2] maximumRMSError = 0.01 numberOfIterations = 50 if len(argv) > 3: maximumRMSError = float(argv[3]) if len(argv) > 4: numberOfIterations = int(argv[4]) CharPixelType = itk.UC RealPixelType = itk.F Dimension = 3 CharImageType = itk.Image[CharPixelType, Dimension] RealImageType = itk.Image[RealPixelType, Dimension] ReaderType = itk.ImageFileReader[CharImageType] WriterType = itk.ImageFileWriter[CharImageType] CastToRealFilterType = itk.CastImageFilter[CharImageType, RealImageType] RescaleFilter = itk.RescaleIntensityImageFilter[RealImageType, CharImageType] antiAliasFilter = itk.AntiAliasBinaryImageFilter[RealImageType, RealImageType] antiAliasFilter = antiAliasFilter.New() reader = ReaderType.New() writer = WriterType.New() toReal = CastToRealFilterType.New() rescale = RescaleFilter.New() reader.SetFileName(inputFilename) writer.SetFileName(outputFilename) rescale.SetOutputMinimum(0) rescale.SetOutputMaximum(255) toReal.SetInput(reader.GetOutput()) antiAliasFilter.SetInput(toReal.GetOutput()) antiAliasFilter.SetMaximumRMSError(maximumRMSError) antiAliasFilter.SetNumberOfIterations(numberOfIterations) antiAliasFilter.SetNumberOfLayers(2) rescale.SetInput(antiAliasFilter.GetOutput()) writer.SetInput(rescale.GetOutput()) writer.Update()
nilq/baby-python
python
from typing import Callable def test_hello_default(hello: Callable[..., str]) -> None: assert hello() == "Hello !" def test_hello_name(hello: Callable[..., str], name: str) -> None: assert hello(name) == "Hello {0}!".format(name)
nilq/baby-python
python
# -*- coding: utf-8 -*- """ equip.analysis.python ~~~~~~~~~~~~~~~~~~~~~ Python related information for analysis. :copyright: (c) 2014 by Romain Gaucher (@rgaucher) :license: Apache 2, see LICENSE for more details. """
nilq/baby-python
python
""" XVM (c) www.modxvm.com 2013-2017 """ ##################################################################### # MOD INFO XFW_MOD_INFO = { # mandatory 'VERSION': '0.9.19.0.1', 'URL': 'http://www.modxvm.com/', 'UPDATE_URL': 'http://www.modxvm.com/en/download-xvm/', 'GAME_VERSIONS': ['0.9.19.0.1'], # optional } ##################################################################### # imports import traceback import sys from math import degrees, pi import BigWorld import game import gui.shared.tooltips.vehicle as tooltips_vehicle from gun_rotation_shared import calcPitchLimitsFromDesc from helpers import i18n from gui import g_htmlTemplates from gui.shared import g_eventBus from gui.shared.formatters import text_styles from gui.shared.tooltips import formatters from gui.shared.gui_items import GUI_ITEM_TYPE from gui.Scaleform.locale.MENU import MENU from gui.shared.items_parameters import formatters as param_formatter from gui.shared.items_parameters.formatters import measureUnitsForParameter from gui.shared.items_parameters.params_helper import getParameters as getParameters_helper from gui.shared.items_parameters.params_helper import idealCrewComparator as idealCrewComparator_helper from gui.shared.utils.requesters.ItemsRequester import ItemsRequester from gui.Scaleform.genConsts.TOOLTIPS_CONSTANTS import TOOLTIPS_CONSTANTS from gui.Scaleform.locale.TOOLTIPS import TOOLTIPS from gui.Scaleform.framework.ToolTip import ToolTip from gui.Scaleform.daapi.view.battle.shared.consumables_panel import ConsumablesPanel from gui.Scaleform.daapi.view.meta.ModuleInfoMeta import ModuleInfoMeta from gui.shared.tooltips.module import ModuleBlockTooltipData from helpers import dependency from skeletons.gui.shared import IItemsCache from xfw import * import xvm_main.python.config as config from xvm_main.python.consts import * from xvm_main.python.logger import * from xvm_main.python.vehinfo import _getRanges from xvm_main.python.vehinfo_tiers import getTiers from xvm_main.python.xvm import l10n ##################################################################### # globals shells_vehicles_compatibility = {} carousel_tooltips_cache = {} styles_templates = {} toolTipDelayIntervalId = None weightTooHeavy = False p_replacement = None # will be something like <font size... color...> ##################################################################### # initialization/finalization def start(): g_eventBus.addListener(XVM_EVENT.CONFIG_LOADED, tooltips_clear_cache) BigWorld.callback(0, start) @registerEvent(game, 'fini') def fini(): g_eventBus.removeListener(XVM_EVENT.CONFIG_LOADED, tooltips_clear_cache) ##################################################################### # handlers # tooltip delay to resolve performance issue @overrideMethod(ToolTip, 'onCreateComplexTooltip') def ToolTip_onCreateComplexTooltip(base, self, tooltipId, stateType): # log('ToolTip_onCreateComplexTooltip') _createTooltip(self, lambda:_onCreateComplexTooltip_callback(base, self, tooltipId, stateType)) # tooltip delay to resolve performance issue # suppress carousel tooltips @overrideMethod(ToolTip, 'onCreateTypedTooltip') def ToolTip_onCreateTypedTooltip(base, self, type, *args): # log('ToolTip_onCreateTypedTooltip') try: if type == TOOLTIPS_CONSTANTS.CAROUSEL_VEHICLE and config.get('hangar/carousel/suppressCarouselTooltips'): return except Exception as ex: err(traceback.format_exc()) _createTooltip(self, lambda:_onCreateTypedTooltip_callback(base, self, type, *args)) # adds delay for tooltip appearance def _createTooltip(self, func): try: global toolTipDelayIntervalId self.xvm_hide() tooltipDelay = config.get('tooltips/tooltipsDelay', 0.4) toolTipDelayIntervalId = BigWorld.callback(tooltipDelay, func) except Exception as ex: err(traceback.format_exc()) def _onCreateTypedTooltip_callback(base, self, type, *args): # log('ToolTip_onCreateTypedTooltip_callback') global toolTipDelayIntervalId toolTipDelayIntervalId = None base(self, type, *args) def _onCreateComplexTooltip_callback(base, self, tooltipId, stateType): # log('_onCreateComplexTooltip_callback') global toolTipDelayIntervalId toolTipDelayIntervalId = None base(self, tooltipId, stateType) def _ToolTip_xvm_hide(self): # log('_ToolTip_xvm_hide') global toolTipDelayIntervalId if toolTipDelayIntervalId is not None: BigWorld.cancelCallback(toolTipDelayIntervalId) toolTipDelayIntervalId = None ToolTip.xvm_hide = _ToolTip_xvm_hide ############################# # carousel events @overrideMethod(tooltips_vehicle.VehicleInfoTooltipData, '_packBlocks') def VehicleInfoTooltipData_packBlocks(base, self, *args, **kwargs): result = base(self, *args, **kwargs) result = [item for item in result if item.get('data', {}).get('blocksData')] return result @overrideMethod(tooltips_vehicle.SimplifiedStatsBlockConstructor, 'construct') def SimplifiedStatsBlockConstructor_construct(base, self): if config.get('tooltips/hideSimplifiedVehParams'): return [] else: return base(self) @overrideMethod(tooltips_vehicle.AdditionalStatsBlockConstructor, 'construct') def AdditionalStatsBlockConstructor_construct(base, self): if config.get('tooltips/hideBottomText'): return [] else: return base(self) @overrideMethod(text_styles, "_getStyle") def text_styles_getStyle(base, style, ctx = None): if ctx is None: ctx = {} try: if style not in styles_templates: template = g_htmlTemplates['html_templates:lobby/textStyle'][style].source template_string = template if type(template) is str else template['text'] if "size='14'" in template_string and "face='$FieldFont'" in template_string: template_string = template_string \ .replace("size='14'", "size='%s'" % config.get('tooltips/fontSize', 14)) \ .replace("face='$FieldFont'", "face='%s'" % config.get('tooltips/fontName', '$FieldFont')) styles_templates[style] = template_string if type(template) is str else {'text': template_string} if type(styles_templates[style]) is str: return styles_templates[style] else: if ctx: return styles_templates[style]['text'] % ctx else: return base(style, ctx) except Exception as ex: err(traceback.format_exc()) return base(style, ctx) def tooltip_add_param(self, result, param0, param1): result.append(formatters.packTextParameterBlockData(name=text_styles.main(param0), value=text_styles.stats(param1), valueWidth=107, padding=formatters.packPadding(left=self.leftPadding, right=self.rightPadding))) def tooltip_with_units(value, units): return '%s %s' % (value, text_styles.standard(units)) def getParameterValue(paramName): return text_styles.main(i18n.makeString(MENU.tank_params(paramName))) + text_styles.standard(measureUnitsForParameter(paramName)) def formatNumber(value): if value > 99: value = round(value) elif value > 9: value = round(value, 1) else: value = round(value, 2) return str(BigWorld.wg_getNiceNumberFormat(value)) # replace <h>text1 <p>text2</p></h> with: text1 text_styles.standard(text2) def replace_p(text): global p_replacement if not p_replacement: p_replacement = text_styles.standard('').split('>', 1)[0] + '>' return text.replace('<p>', p_replacement).replace('</p>', '</font>').replace('<h>', '').replace('</h>', '') # overriding tooltips for tanks in hangar, configuration in tooltips.xc @overrideMethod(tooltips_vehicle.CommonStatsBlockConstructor, 'construct') def CommonStatsBlockConstructor_construct(base, self): try: self.leftPadding = -15 vehicle = self.vehicle cache_result = carousel_tooltips_cache.get(vehicle.intCD) if cache_result: return cache_result result = [] if not config.get('tooltips/hideSimplifiedVehParams'): result.append(formatters.packTitleDescBlock(text_styles.middleTitle(i18n.makeString(TOOLTIPS.TANKCARUSEL_MAINPROPERTY)), padding=formatters.packPadding(left=0, right=self.rightPadding, bottom=8))) params = self.configuration.params veh_descr = vehicle.descriptor gun = vehicle.gun.descriptor turret = vehicle.turret.descriptor comparator = idealCrewComparator_helper(vehicle) vehicleCommonParams = getParameters_helper(vehicle) veh_type_inconfig = vehicle.type.replace('AT-SPG', 'TD') clipGunInfoShown = False premium_shells = {} for shell in vehicle.shells: premium_shells[shell.intCompactDescr] = shell.isPremium if params: values = config.get('tooltips/%s' % veh_type_inconfig) if values and len(values): params_list = values # overriding parameters else: params_list = self.PARAMS.get(vehicle.type, 'default') # original parameters paramInfo = None for paramName in params_list: if paramName is None: continue if paramName == 'rateOfFire': paramName = 'reloadTime' elif paramName == 'traverseLimits': paramName = 'gunYawLimits' if 'gunYawLimits' in vehicleCommonParams else 'turretYawLimits' elif paramName == 'radioRange': paramName = 'radioDistance' elif paramName == 'reloadTimeSecs' and vehicle.gun.isClipGun(): paramName = 'clipFireRate' elif paramName == 'turretRotationSpeed' and not vehicle.hasTurrets: paramName = 'gunRotationSpeed' if paramName in vehicleCommonParams: paramInfo = comparator.getExtendedData(paramName) if paramName == 'turretArmor' and not vehicle.hasTurrets: continue #maxHealth elif paramName == 'maxHealth': tooltip_add_param(self, result, i18n.makeString('#menu:vehicleInfo/params/maxHealth'), formatNumber(veh_descr.maxHealth)) #battle tiers elif paramName == 'battleTiers': (minTier, maxTier) = getTiers(vehicle.level, vehicle.type, vehicle.name) tooltip_add_param(self, result, l10n('Battle tiers'), '%s..%s' % (minTier, maxTier)) #explosionRadius elif paramName == 'explosionRadius': explosionRadiusMin = 999 explosionRadiusMax = 0 for shot in gun['shots']: if 'explosionRadius' in shot['shell']: if shot['shell']['explosionRadius'] < explosionRadiusMin: explosionRadiusMin = shot['shell']['explosionRadius'] if shot['shell']['explosionRadius'] > explosionRadiusMax: explosionRadiusMax = shot['shell']['explosionRadius'] if explosionRadiusMax == 0: # no HE continue explosionRadius_str = formatNumber(explosionRadiusMin) if explosionRadiusMin != explosionRadiusMax: explosionRadius_str += '/%s' % gold_pad(formatNumber(explosionRadiusMax)) tooltip_add_param(self, result, getParameterValue(paramName), explosionRadius_str) #shellSpeedSummary elif paramName == 'shellSpeedSummary': shellSpeedSummary_arr = [] for shot in gun['shots']: shellSpeed_str = '%g' % round(shot['speed'] * 1.25) if premium_shells[shot['shell']['compactDescr']]: shellSpeed_str = gold_pad(shellSpeed_str) shellSpeedSummary_arr.append(shellSpeed_str) shellSpeedSummary_str = '/'.join(shellSpeedSummary_arr) tooltip_add_param(self, result, tooltip_with_units(l10n('shellSpeed'), l10n('(m/sec)')), shellSpeedSummary_str) #piercingPowerAvg elif paramName == 'piercingPowerAvg': piercingPowerAvg = formatNumber(veh_descr.shot['piercingPower'][0]) tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/avgPiercingPower')), piercingPowerAvg) #piercingPowerAvgSummary elif paramName == 'piercingPowerAvgSummary': piercingPowerAvgSummary_arr = [] for shot in gun['shots']: piercingPower_str = formatNumber(shot['piercingPower'][0]) if premium_shells[shot['shell']['compactDescr']]: piercingPower_str = gold_pad(piercingPower_str) piercingPowerAvgSummary_arr.append(piercingPower_str) piercingPowerAvgSummary_str = '/'.join(piercingPowerAvgSummary_arr) tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/avgPiercingPower')), piercingPowerAvgSummary_str) #damageAvgSummary elif paramName == 'damageAvgSummary': damageAvgSummary_arr = [] for shot in gun['shots']: damageAvg_str = formatNumber(shot['shell']['damage'][0]) if premium_shells[shot['shell']['compactDescr']]: damageAvg_str = gold_pad(damageAvg_str) damageAvgSummary_arr.append(damageAvg_str) damageAvgSummary_str = '/'.join(damageAvgSummary_arr) tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/avgDamage')), damageAvgSummary_str) #magazine loading # elif (paramName == 'reloadTimeSecs' or paramName == 'rateOfFire') and vehicle.gun.isClipGun(): # if clipGunInfoShown: # continue # (shellsCount, shellReloadingTime) = gun['clip'] # reloadMagazineTime = gun['reloadTime'] # shellReloadingTime_str = formatNumber(shellReloadingTime) # reloadMagazineTime_str = formatNumber(reloadMagazineTime) # tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/shellsCount')), shellsCount) # tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/shellReloadingTime')), shellReloadingTime_str) # tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/reloadMagazineTime')), reloadMagazineTime_str) # clipGunInfoShown = True #rate of fire # elif paramName == 'rateOfFire' and not vehicle.gun.isClipGun(): # rateOfFire_str = formatNumber(60 / gun['reloadTime']) # tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/reloadTime')), rateOfFire_str) # gun traverse limits # elif paramName == 'traverseLimits' and gun['turretYawLimits']: # (traverseMin, traverseMax) = gun['turretYawLimits'] # traverseLimits_str = '%g..+%g' % (round(degrees(traverseMin)), round(degrees(traverseMax))) # tooltip_add_param(self, result, l10n('traverseLimits'), traverseLimits_str) # elevation limits (front) # elif paramName == 'pitchLimits': # (pitchMax, pitchMin) = calcPitchLimitsFromDesc(0, gun['pitchLimits']) # pitchLimits_str = '%g..+%g' % (round(degrees(-pitchMin)), round(degrees(-pitchMax))) # tooltip_add_param(self, result, l10n('pitchLimits'), pitchLimits_str) # elevation limits (side) elif paramName == 'pitchLimitsSide': if gun['turretYawLimits'] and abs(degrees(gun['turretYawLimits'][0])) < 89: continue # can't look aside 90 degrees (pitchMax, pitchMin) = calcPitchLimitsFromDesc(pi / 2, gun['pitchLimits']) pitchLimits_str = '%g..+%g' % (round(degrees(-pitchMin)), round(degrees(-pitchMax))) tooltip_add_param(self, result, l10n('pitchLimitsSide'), pitchLimits_str) # elevation limits (rear) elif paramName == 'pitchLimitsRear': if gun['turretYawLimits']: continue # can't look back (pitchMax, pitchMin) = calcPitchLimitsFromDesc(pi, gun['pitchLimits']) pitchLimits_str = '%g..+%g' % (round(degrees(-pitchMin)), round(degrees(-pitchMax))) tooltip_add_param(self, result, l10n('pitchLimitsRear'), pitchLimits_str) # shooting range elif paramName == 'shootingRadius': viewRange, shellRadius, artiRadius = _getRanges(turret, gun, vehicle.nationName, vehicle.type) if vehicle.type == 'SPG': tooltip_add_param(self, result, tooltip_with_units(l10n('shootingRadius'), l10n('(m)')), artiRadius) elif shellRadius < 707: tooltip_add_param(self, result, tooltip_with_units(l10n('shootingRadius'), l10n('(m)')), shellRadius) #reverse max speed elif paramName == 'speedLimits': (speedLimitForward, speedLimitReverse) = veh_descr.physics['speedLimits'] speedLimits_str = str(int(speedLimitForward * 3.6)) + '/' + str(int(speedLimitReverse * 3.6)) tooltip_add_param(self, result, getParameterValue(paramName), speedLimits_str) #turret rotation speed # elif paramName == 'turretRotationSpeed' or paramName == 'gunRotationSpeed': # if not vehicle.hasTurrets: # paramName = 'gunRotationSpeed' # turretRotationSpeed_str = str(int(degrees(veh_descr.turret['rotationSpeed']))) # tooltip_add_param(self, result, tooltip_with_units(i18n.makeString('#menu:tank_params/%s' % paramName).rstrip(), i18n.makeString('#menu:tank_params/gps')), turretRotationSpeed_str) #terrain resistance elif paramName == 'terrainResistance': resistances_arr = [] for key in veh_descr.chassis['terrainResistance']: resistances_arr.append(formatNumber(key)) terrainResistance_str = '/'.join(resistances_arr) tooltip_add_param(self, result, l10n('terrainResistance'), terrainResistance_str) #radioRange # elif paramName == 'radioRange': # radioRange_str = '%s' % int(vehicle.radio.descriptor['distance']) # tooltip_add_param(self, result, replace_p(i18n.makeString('#menu:moduleInfo/params/radioDistance')), radioRange_str) #gravity elif paramName == 'gravity': gravity_str = formatNumber(veh_descr.shot['gravity']) tooltip_add_param(self, result, l10n('gravity'), gravity_str) #inner name, for example - ussr:R100_SU122A elif paramName == 'innerName': tooltip_add_param(self, result, vehicle.name, '') #custom text elif paramName.startswith('TEXT:'): customtext = paramName[5:] tooltip_add_param(self, result, l10n(customtext), '') elif paramInfo is not None and paramName in paramInfo.name: valueStr = str(param_formatter.formatParameter(paramName, paramInfo.value)) tooltip_add_param(self, result, getParameterValue(paramName), valueStr) if vehicle.isInInventory: # optional devices icons, must be in the end if 'optDevicesIcons' in params_list: optDevicesIcons_arr = [] for key in vehicle.optDevices: if key: imgPath = 'img://gui' + key.icon.lstrip('.') else: imgPath = 'img://gui/maps/icons/artefact/empty.png' optDevicesIcons_arr.append('<img src="%s" height="16" width="16">' % imgPath) optDevicesIcons_str = ' '.join(optDevicesIcons_arr) tooltip_add_param(self, result, optDevicesIcons_str, '') # equipment icons, must be in the end if 'equipmentIcons' in params_list: equipmentIcons_arr = [] for key in vehicle.eqs: if key: imgPath = 'img://gui' + key.icon.lstrip('.') else: imgPath = 'img://gui/maps/icons/artefact/empty.png' equipmentIcons_arr.append('<img src="%s" height="16" width="16">' % imgPath) equipmentIcons_str = ' '.join(equipmentIcons_arr) if config.get('tooltips/combineIcons') and optDevicesIcons_str: tmp_list = [] tooltip_add_param(self, tmp_list, equipmentIcons_str, '') result[-1]['data']['name'] += ' ' + tmp_list[0]['data']['name'] else: tooltip_add_param(self, result, equipmentIcons_str, '') # crew roles icons, must be in the end if 'crewRolesIcons' in params_list: imgPath = 'img://../mods/shared_resources/xvm/res/icons/tooltips/roles' crewRolesIcons_arr = [] for tankman_role in vehicle.descriptor.type.crewRoles: crewRolesIcons_arr.append('<img src="%s/%s.png" height="16" width="16">' % (imgPath, tankman_role[0])) crewRolesIcons_str = ''.join(crewRolesIcons_arr) tooltip_add_param(self, result, crewRolesIcons_str, '') if (len(result) > 30) and config.get('tooltips/hideBottomText'): # limitation result = result[:30] elif (len(result) > 29) and not config.get('tooltips/hideBottomText'): # limitation result = result[:29] carousel_tooltips_cache[vehicle.intCD] = result return result except Exception as ex: err(traceback.format_exc()) return base(self) # in battle, add tooltip for HE shells - explosion radius @overrideMethod(ConsumablesPanel, '_ConsumablesPanel__makeShellTooltip') def ConsumablesPanel__makeShellTooltip(base, self, descriptor, piercingPower): result = base(self, descriptor, piercingPower) try: if 'explosionRadius' in descriptor: key_str = i18n.makeString('#menu:tank_params/explosionRadius') result = result.replace('{/BODY}', '\n%s: %s{/BODY}' % (key_str, formatNumber(descriptor['explosionRadius']))) except Exception as ex: err(traceback.format_exc()) return result # show compatible vehicles for shells info window in warehouse and shop @overrideMethod(ModuleInfoMeta, 'as_setModuleInfoS') def ModuleInfoMeta_as_setModuleInfoS(base, self, moduleInfo): try: if moduleInfo.get('type') == 'shell': if not shells_vehicles_compatibility: relate_shells_vehicles() if self.moduleCompactDescr in shells_vehicles_compatibility: moduleInfo['compatible'].append({'type': i18n.makeString('#menu:moduleInfo/compatible/vehicles'), 'value': ', '.join(shells_vehicles_compatibility[self.moduleCompactDescr])}) except Exception as ex: err(traceback.format_exc()) base(self, moduleInfo) # # add '#menu:moduleInfo/params/weightTooHeavy' (red 'weight (kg)') # @overrideMethod(i18n, 'makeString') # def makeString(base, key, *args, **kwargs): # if key == '#menu:moduleInfo/params/weightTooHeavy': # global weightTooHeavy # if weightTooHeavy is None: # weightTooHeavy = '<h>%s</h>' % red_pad(strip_html_tags(i18n.makeString('#menu:moduleInfo/params/weight'))) # localized red 'weight (kg)' # return weightTooHeavy # return base(key, *args, **kwargs) ########################################################################## # paint 'weight (kg)' with red if module does not fit due to overweight @overrideMethod(param_formatter, 'formatModuleParamName') def formatters_formatModuleParamName(base, paramName): builder = text_styles.builder() if weightTooHeavy and paramName == 'weight': builder.addStyledText(text_styles.error, MENU.moduleinfo_params(paramName)) builder.addStyledText(text_styles.error, param_formatter.MEASURE_UNITS.get(paramName, '')) else: builder.addStyledText(text_styles.main, MENU.moduleinfo_params(paramName)) builder.addStyledText(text_styles.standard, param_formatter.MEASURE_UNITS.get(paramName, '')) return builder.render() @overrideMethod(ModuleBlockTooltipData, '_packBlocks') def ModuleBlockTooltipData_packBlocks(base, self, *args, **kwargs): try: global weightTooHeavy module = self.context.buildItem(*args, **kwargs) statusConfig = self.context.getStatusConfiguration(module) vehicle = statusConfig.vehicle slotIdx = statusConfig.slotIdx if vehicle is not None: isFit, reason = module.mayInstall(vehicle, slotIdx) weightTooHeavy = not isFit and reason == 'too heavy' except Exception as ex: err(traceback.format_exc()) return base(self, *args, **kwargs) ##################################################################### # Utility functions def h1_pad(text): return '<h1>%s</h1>' % text def gold_pad(text): return "<font color='%s'>%s</font>" % (config.get('tooltips/goldColor', '#FFC363'), text) def red_pad(text): return "<font color='#FF0000'>%s</font>" % text # make dict: shells => compatible vehicles def relate_shells_vehicles(): global shells_vehicles_compatibility try: shells_vehicles_compatibility = {} itemsCache = dependency.instance(IItemsCache) for vehicle in itemsCache.items.getVehicles().values(): if vehicle.name.find('_IGR') > 0 or vehicle.name.find('_training') > 0: continue for turrets in vehicle.descriptor.type.turrets: for turret in turrets: for gun in turret['guns']: for shot in gun['shots']: shell_id = shot['shell']['compactDescr'] if shell_id in shells_vehicles_compatibility: if vehicle.userName not in shells_vehicles_compatibility[shell_id]: shells_vehicles_compatibility[shell_id].append(vehicle.userName) else: shells_vehicles_compatibility[shell_id] = [vehicle.userName] except Exception as ex: err(traceback.format_exc()) shells_vehicles_compatibility = {} @registerEvent(ItemsRequester, '_invalidateItems') def ItemsRequester_invalidateItems(self, itemTypeID, uniqueIDs): try: if itemTypeID == GUI_ITEM_TYPE.VEHICLE: for veh_id in uniqueIDs: carousel_tooltips_cache[veh_id] = {} except Exception as ex: err(traceback.format_exc()) carousel_tooltips_cache.clear() @registerEvent(ItemsRequester, 'clear') def ItemsRequester_clear(*args, **kwargs): tooltips_clear_cache(*args, **kwargs) def tooltips_clear_cache(*args, **kwargs): carousel_tooltips_cache.clear() styles_templates.clear()
nilq/baby-python
python
import numpy as np import pandas as pd import pytest from dku_timeseries import WindowAggregator from recipe_config_loading import get_windowing_params @pytest.fixture def columns(): class COLUMNS: date = "Date" category = "country" aggregation = "value1_avg" return COLUMNS @pytest.fixture def df(columns): co2 = [315.58, 316.39, 316.79, 316.2] country = ["first", "first", "second", "second"] time_index = pd.date_range("1-1-1959", periods=4, freq="M") df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, columns.date: time_index}) return df @pytest.fixture def long_df(columns): co2 = [315.58, 316.39, 316.79, 316.2, 345, 234, 100, 299] country = ["first", "first", "first", "first", "second", "second", "second", "second"] time_index = pd.date_range("1-1-1959", periods=4, freq="D").append(pd.date_range("1-1-1959", periods=4, freq="D")) df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, columns.date: time_index}) return df @pytest.fixture def long_df_2(columns): co2 = [315.58, 316.39, 316.79, 316.2, 9, 10] country = ["first", "first", "second", "second", "third", "third"] country_2 = ["first", "first", "second", "second", "third", "third"] time_index = pd.date_range("1-1-1959", periods=2, freq="M").append(pd.date_range("1-1-1959", periods=2, freq="M")).append( pd.date_range("1-1-1959", periods=2, freq="M")) df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, "item": country_2, columns.date: time_index}) return df @pytest.fixture def long_df_3(columns): co2 = [315.58, 316.39, 316.79, 316.2, 9, 10, 2, 3] country = ["first", "first", "second", "second", "third", "third", "fourth", "fourth"] country_2 = ["first", "first", "second", "second", "third", "third", "fourth", "fourth"] country_3 = ["first", "first", "second", "second", "third", "third", "fourth", "fourth"] time_index = pd.date_range("1-1-1959", periods=2, freq="M").append(pd.date_range("1-1-1959", periods=2, freq="M")).append( pd.date_range("1-1-1959", periods=2, freq="M")).append(pd.date_range("1-1-1959", periods=2, freq="M")) df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, "item": country_2, "store": country_3, columns.date: time_index}) return df @pytest.fixture def long_df_4(columns): co2 = [315.58, 316.39, 316.79, 316.2, 9, 10, 2, 3] country = ["first", "first", "second", "second", "third", "third", "first", "first"] country_2 = ["first", "first", "second", "second", "third", "third", "second", "first"] country_3 = ["first", "first", "second", "second", "third", "third", "third", "fourth"] time_index = pd.date_range("1-1-2020", periods=2, freq="M").append(pd.date_range("1-1-2020", periods=2, freq="M")).append( pd.date_range("1-1-2020", periods=2, freq="M")).append(pd.date_range("1-1-2020", periods=2, freq="M")) df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, "item": country_2, "store": country_3, columns.date: time_index}) return df @pytest.fixture def long_df_numerical(columns): co2 = [315.58, 316.39, 316.79, 316.2, 345, 234, 100, 299] country = [1, 1, 1, 1, 2, 2, 2, 2] time_index = pd.date_range("1-1-1959", periods=4, freq="D").append(pd.date_range("1-1-1959", periods=4, freq="D")) df = pd.DataFrame.from_dict( {"value1": co2, "value2": co2, columns.category: country, columns.date: time_index}) return df @pytest.fixture def recipe_config(columns): config = {u'window_type': u'none', u'groupby_columns': [u'country'], u'closed_option': u'left', u'window_unit': u'days', u'window_width': 3, u'causal_window': True, u'datetime_column': u'Date', u'advanced_activated': True, u'aggregation_types': [u'retrieve', u'average'], u'gaussian_std': 1} return config @pytest.fixture def params(recipe_config): return get_windowing_params(recipe_config) @pytest.fixture def params_no_causal(recipe_config): recipe_config["causal_window"] = False return get_windowing_params(recipe_config) class TestWindowingLongFormat: def test_long_format(self, long_df, params, recipe_config,columns): window_aggregator = WindowAggregator(params) groupby_columns = [columns.category] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df, datetime_column, groupby_columns=groupby_columns) np.testing.assert_array_equal(np.round(output_df[columns.aggregation].values, 2), np.array([np.nan, 315.58, 315.98, 316.25, np.nan, 345., 289.5, 226.33])) np.testing.assert_array_equal(output_df.country.values, np.array(['first', 'first', 'first', 'first', 'second', 'second', 'second', 'second'])) def test_two_identifiers(self, long_df_2, params, recipe_config,columns): window_aggregator = WindowAggregator(params) groupby_columns = ["country", "item"] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df_2, datetime_column, groupby_columns=groupby_columns) np.testing.assert_array_equal(output_df[datetime_column].values, pd.DatetimeIndex(['1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000', '1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000', '1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000'])) def test_three_identifiers(self, long_df_3, params, recipe_config,columns): window_aggregator = WindowAggregator(params) groupby_columns = ["country", "item", "store"] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df_3, datetime_column, groupby_columns=groupby_columns) np.testing.assert_array_equal(output_df[datetime_column].values, pd.DatetimeIndex(['1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000', '1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000', '1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000', '1959-01-31T00:00:00.000000000', '1959-02-28T00:00:00.000000000'])) def test_mix_identifiers(self, long_df_4, params, recipe_config,columns): window_aggregator = WindowAggregator(params) groupby_columns = ["country", "item", "store"] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df_4, datetime_column, groupby_columns=groupby_columns) expected_dates = pd.DatetimeIndex(['2020-01-31T00:00:00.000000000', '2020-02-29T00:00:00.000000000', '2020-02-29T00:00:00.000000000', '2020-01-31T00:00:00.000000000', '2020-01-31T00:00:00.000000000', '2020-02-29T00:00:00.000000000', '2020-01-31T00:00:00.000000000', '2020-02-29T00:00:00.000000000']) np.testing.assert_array_equal(output_df[datetime_column].values, expected_dates) def test_empty_identifiers(self, df, params, recipe_config,columns): window_aggregator = WindowAggregator(params) datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(df, datetime_column, groupby_columns=[]) assert output_df.shape == (4, 5) output_df = window_aggregator.compute(df, datetime_column) assert output_df.shape == (4, 5) output_df = window_aggregator.compute(df, datetime_column, groupby_columns=None) assert output_df.shape == (4, 5) def test_long_format_no_causal(self, long_df, params_no_causal, recipe_config,columns): window_aggregator = WindowAggregator(params_no_causal) groupby_columns = ["country"] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df, datetime_column, groupby_columns=groupby_columns) np.testing.assert_array_equal(np.round(output_df[columns.aggregation].values, 2), np.array([np.nan, 316.25, 316.46, np.nan, np.nan, 226.33, 211., np.nan])) np.testing.assert_array_equal(output_df.country.values, np.array(['first', 'first', 'first', 'first', 'second', 'second', 'second', 'second'])) def test_long_format_numerical(self, long_df_numerical, params, recipe_config,columns): window_aggregator = WindowAggregator(params) groupby_columns = ["country"] datetime_column = recipe_config.get('datetime_column') output_df = window_aggregator.compute(long_df_numerical, datetime_column, groupby_columns=groupby_columns) np.testing.assert_array_equal(output_df.country.values, np.array([1, 1, 1, 1, 2, 2, 2, 2]))
nilq/baby-python
python
#!/usr/bin/env python import pyinotify import os, sys import logging import json import thread, threading import time, datetime import hashlib import mimetypes import traceback # google stuff from ServiceProviders.Google import GoogleServiceProvider from apiclient.http import BatchHttpRequest from apiclient import errors #logging stuff class NotImplementedError(Exception): """mime.from_file(fp) Generic Exception for Placeholder Functions """ class GenericEventHandler(pyinotify.ProcessEvent): """ define every possible event type here overloads methods in parent class """ def process_IN_CREATE(self, event): self.logger.info("-> Creating: %s" % event.name) def process_IN_DELETE(self, event): self.logger.info("-> Removing: %s" % event.name) def process_default(self, event): self.logger.info("->Unknown event: %s" % event.maskname) class GoogleEventHandler(pyinotify.ProcessEvent): """ uploads to google drive """ def __init__(self, options_dict, watch_descriptors): """ options_dict contains all parameters necesary for the GoogleServiceProvider.__init__() method. """ self.sp = GoogleServiceProvider(**options_dict) self.credentials = self.sp.get_stored_credentials('testid') self.service = self.sp.build_service(self.credentials) self.http = self.service[0] self.service = self.service[1] self.options_dict = options_dict for key, value in watch_descriptors[0].items(): if value == 1: self.protected_dir = key self.descriptors = watch_descriptors self.descriptors_dict = {} for desc in self.descriptors: self.descriptors_dict.update(desc) ### logging stuff: self.logger = logging.getLogger('main') self.logger.setLevel(logging.DEBUG) # create console handler and set level to debug self.ch = logging.StreamHandler() self.ch.setLevel(logging.DEBUG) # create formatter formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s') logging.basicConfig(format='%(asctime)s - %(name)s - %(levelname)s - %(message)s', filename=options_dict['LOGFILE']) # add formatter to ch self.ch.setFormatter(formatter) # add ch to logger logging.addLevelName( logging.WARNING, "%s" % logging.getLevelName(logging.WARNING)) logging.addLevelName( logging.ERROR, "%s" % logging.getLevelName(logging.ERROR)) logging.addLevelName( logging.DEBUG, "%s" % logging.getLevelName(logging.DEBUG)) logging.addLevelName( logging.INFO, "%s" % logging.getLevelName(logging.INFO)) # we need this mutex for the files_dict dictionary self.mutex = threading.Lock() # this is by default the SyncThemAll folder on GoogleDrive if self.options_dict['DEFAULT_PARENT'] != 'root': self.default_pid = self.sp.query_entity(self.service,"title = '"+self.options_dict['DEFAULT_PARENT']+"'")[0]['id'] else: self.default_pid = 'root' # this will have to be loaded from json ## the structure of the json is: """ { 'folder_pathname' : { 'files' : { 'file1': {'md5sum': None, 'ownId': None, 'parent':None, 'alreadyUploaded': False, 'alreadyUpdated': False, 'upLoadinProgress': False, 'progressBar': int, 'fullpath':None, 'fileBody': {}, 'googleBody': {} } } }, 'file2': {'md5sum': None, 'ownId': None, 'parent':None, 'alreadyUploaded': False, 'alreadyUpdated': False, 'upLoadinProgress': False, 'progressBar': int, 'fullpath':None, 'fileBody': {}, 'googleBody': {} } } }, 'file3': {'md5sum': None, 'ownId': None, 'parent':None, 'alreadyUploaded': False, 'alreadyUpdated': False, 'upLoadinProgress': False, 'progressBar': int, 'fullpath':None, 'fileBody': {}, 'googleBody': {} } } } }, 'parent': None 'alreadyCreated': False, 'alreadyUpdated':False, 'grive': {'own_google_id':None, 'parent_google_id': None } 'folderBody': {} 'googleMetaData': {} }, } """ self.jsonfile = self.options_dict['treefile'] self.files_dict = {} if not os.path.exists(self.jsonfile): self.files_dict.update(self.descriptors_dict.fromkeys(self.descriptors_dict.keys(), {'files': {}, 'grive':{'own_google_id': None, 'parent_google_id': None}, 'folderBody':{}, 'googleMetaData':{} })) else: with open(self.jsonfile, 'r') as infile: try: self.files_dict = json.loads(infile.read()) infile.close() except ValueError as e: self.logger.info("Jsonfile %s not found or corrupted!\n Please remove, or stash it." % self.jsonfile) self.syncthread = thread.start_new_thread(self._save_to_json, ()) self.filesyncthread = thread.start_new_thread(self._synchronize_files, ()) # [thread.start_new_thread(self._synchronize_files, ()) for i in range(10)] def _save_to_json(self): while True: self.logger.info("%s save_to_json()" % datetime.datetime.now()) try: # logging.debug("Opening %s" % self.jsonfile) with open(self.jsonfile,'w') as outfile: # locking stuff here try: json.dump(self.files_dict, outfile) except Exception as e: self.logger.info("%s" % e) # release lock here outfile.close() except Exception as e: tb = traceback.self.logger.info_exc() t = (datetime.datetime.now(), tb, e) self.logger.info("%s" % t) time.sleep(10) def _synchronize_files(self): self.file_sp = GoogleServiceProvider(**self.options_dict) self.file_credentials = self.file_sp.get_stored_credentials('testid') self.file_service = self.file_sp.build_service(self.file_credentials)[1] while True: # self.logger.info("%s %s -> _synchronize_files() " % (datetime.datetime.now(), threading.current_thread())) for (fullpath, directory, file_list) in os.walk(self.protected_dir): try: if fullpath not in self.files_dict.keys(): continue for fisier in file_list: fp = os.path.join(fullpath, fisier) self.mutex.acquire() if fisier not in self.files_dict[fullpath]['files']: self.files_dict[fullpath]['files'][fisier] = { 'md5sum': hashlib.md5(open(fp).read()).hexdigest(), 'ownId': None, 'parent': fullpath, 'alreadyUploaded': False, 'alreadyUpdated': False, 'upLoadinProgress': False, 'progressBar': 0, 'fullpath': fp, 'fileBody': { 'title': fisier, 'description': fp, 'mimeType': mimetypes.guess_type(fp)[0] or 'text/plain', 'parents': [ { "kind": "drive#parentReference", "id": None, } ], }, 'googleBody': {}, } if self.files_dict[fullpath]['files'][fisier]['alreadyUploaded']: self.mutex.release() continue if os.path.getsize(fp) == 0: self.logger.info("%s is 0 bytes in size, skipping" % fp) self.mutex.release() continue if self.files_dict[fullpath]['grive']['own_google_id']: self.files_dict[fullpath]['files'][fisier]['fileBody']['parents'][0]['id'] = self.files_dict[fullpath]['grive']['own_google_id'] if self.files_dict[fullpath]['grive']['own_google_id'] is None and fullpath in self.descriptors[0]: self.files_dict[fullpath]['files'][fisier]['fileBody']['parents'][0]['id'] = self.default_pid self.mutex.release() for retry in range(5): try: self.logger.debug("Uploading file: %s" % fisier) googleReturnBody = self.file_sp.upload_file(fisier, self.files_dict[fullpath]['files'][fisier]['fullpath'], self.file_service, self.files_dict[fullpath]['files'][fisier]['fileBody']) break except Exception as e: self.logger.error("%s" % e) traceback.print_exc() if googleReturnBody: try: self.mutex.acquire() self.files_dict[fullpath]['files'][fisier]['googleBody'] = googleReturnBody self.files_dict[fullpath]['files'][fisier]['ownId'] = googleReturnBody['id'] self.files_dict[fullpath]['files'][fisier]['alreadyUploaded'] = True self.logger.info("Successfully uploaded file: %s " % fp) self.mutex.release() except KeyError as e: self.logger.info("File has already been deleted from the filesytem: %s" % e) self.mutex.release() continue except IOError as e: self.logger.info("File has already been deleted from the filesystem: %s " % e) self.mutex.release() continue # finally: # # if self.mutex._is_owned(): # self.mutex.release() time.sleep(self.options_dict['FILE_SYNC_INTERVAL']) def callb(request_id, response, exception): """ in case something went wrong, attempts to retransmit the batch request ( 5 times ) """ t = (request_id, self.batch._requests, exception) def upd(): self.files_dict[response['description']]['alreadyCreated'] = True self.files_dict[response['description']]['grive']['own_google_id'] = response['id'] self.files_dict[response['description']]['googleMetaData'].update(response) if exception is not None: self.logger.info("Error occured during BatchHttpRequest %s" % (t,)) else: self.mutex.acquire() upd() self.mutex.release() self.batch = BatchHttpRequest(callback=callb) def process_IN_CREATE(self, event): """ triggered by pyinotify when a file is created it only updates FILES inside files_dict """ t = {'event.pathname': event.pathname, 'event.maskname': event.maskname, 'event.wd': event.wd, 'event.dir': event.dir } self.logger.info("-> Creating: %s" % t) parent = os.path.abspath(os.path.join(event.pathname, os.pardir)) folderbody = {'files': {}, 'parent': parent, 'alreadyCreated': False, 'alreadyUpdated':False, 'grive': {'own_google_id':None, 'parent_google_id': None }, 'folderBody': { 'title': os.path.basename(event.pathname), 'description': event.pathname, 'mimeType': 'application/vnd.google-apps.folder', "parents": [{ "kind": "drive#parentReference", "id": None, }], }, 'googleMetaData': {}} if event.dir: # we populate the structure first self.mutex.acquire() try: if self.files_dict[event.pathname]['alreadyCreated']: self.mutex.release() return 0 except KeyError as e: self.files_dict[event.pathname] = folderbody self.mutex.release() # let's get the parent id if parent != self.protected_dir and parent in self.files_dict.keys(): pid = self.files_dict[parent]['grive']['own_google_id'] else: pid = None if parent == self.protected_dir: pid = self.default_pid self.mutex.acquire() # update structure first self.files_dict[event.pathname]['grive']['parent_google_id'] = pid self.files_dict[event.pathname]['folderBody']['parents'][0]['id'] = pid self.mutex.release() self.mutex.acquire() own_id = self.sp.create_folder(self.service, self.files_dict[event.pathname]['folderBody']) self.mutex.release() if own_id: self.mutex.acquire() t = (own_id['id'], own_id['title']) self.logger.info("Acquired own_id and title: %s" % (t,)) self.files_dict[event.pathname]['grive']['own_google_id'] = own_id['id'] self.files_dict[event.pathname]['googleMetaData'] = own_id self.files_dict[event.pathname]['alreadyCreated'] = True self.mutex.release() def process_IN_DELETE(self, event): t = {'event.pathname': event.pathname, 'event.maskname': event.maskname, 'event.wd': event.wd, 'event.dir': event.dir } self.logger.info("-> Removing: %s" % t) parent = os.path.abspath(os.path.join(event.pathname, os.pardir)) if event.dir: self.mutex.acquire() #if parent in self.files_dict.keys() and self.files_dict[event.pathname]['grive']['own_google_id']: if self.files_dict[event.pathname]['grive']['own_google_id']: for retry in range(5): try: self.service.files().delete(fileId=self.files_dict[event.pathname]['grive']['own_google_id']).execute() except errors.HttpError as e: self.logger.info("%s" % e) continue self.files_dict.pop(event.pathname) self.mutex.release() else: if parent in self.files_dict.keys(): self.mutex.acquire() try: if self.files_dict[parent]['files'][os.path.basename(event.pathname)]['ownId']: for retry in range(5): try: self.service.files().delete(fileId=self.files_dict[parent]['files'][os.path.basename(event.pathname)]['ownId']).execute() break except errors.HttpError as e: self.logger.info("%s" % e) continue except KeyError as e: self.mutex.release() return 0 # parent folder has been deleted try: self.files_dict[parent]['files'].pop(os.path.basename(event.pathname)) except KeyError as e: self.mutex.release() return 0 self.mutex.release() def process_IN_MODIFY(self, event): """ used when updating files """ t = {'event.pathname': event.pathname, 'event.maskname': event.maskname, 'event.wd': event.wd, 'event.dir': event.dir } self.logger.info("-> Modified: %s" % t) parent = os.path.abspath(os.path.join(event.pathname, os.pardir)) self.mutex.acquire() if event.name not in self.files_dict[parent]['files']: self.mutex.release() return 0 try: if not event.dir: if hashlib.md5(open(event.pathname).read()).hexdigest() != self.files_dict[parent]['files'][event.name]['md5sum']: self.files_dict[parent]['files'][event.name]['md5sum'] = hashlib.md5(open(event.pathname).read()).hexdigest() updated_file = self.sp.update_file(self.service, event.pathname, self.files_dict[parent]['files'][event.name]['ownId'], new_body=self.files_dict[parent]['files'][event.name]['fileBody']) except (KeyError, IOError) as e: self.mutex.release() self.logger.info("Modify error: %s" % e) return 0 self.mutex.release() def __del__(self): self.sp = None self.credentials = None self.service = None self.logger.info("Shutting down %s" % self.__class__.__name__)
nilq/baby-python
python
# CS4120 NLP, Northeastern University 2020 import spacy from tqdm import tqdm from spacy.analysis import Token, Doc, Span from data_management import output_filepath, input_filepath def main(): nlp = spacy.load("en_core_web_sm") docs = [] with open(input_filepath("samplesentences.txt")) as f: for line in tqdm(f, desc="Parsing dataset"): if line.isspace(): # skip blank lines continue else: doc: Doc = nlp(line) docs.append(doc) with open(input_filepath("training_tags_out.txt"), "w") as f: for doc in docs: # type: Doc def token_info_string(token: Token): return f"{token.tag_}/{token.ent_type_}" f.write(" ".join([token_info_string(token) for token in doc])) f.write("\n") if __name__ == "__main__": main()
nilq/baby-python
python
# -*- coding: utf-8 -*- """Tests for CommandChainDispatcher.""" from __future__ import absolute_import #----------------------------------------------------------------------------- # Imports #----------------------------------------------------------------------------- import nose.tools as nt from IPython.core.error import TryNext from IPython.core.hooks import CommandChainDispatcher #----------------------------------------------------------------------------- # Local utilities #----------------------------------------------------------------------------- # Define two classes, one which succeeds and one which raises TryNext. Each # sets the attribute `called` to True when it is called. class Okay(object): def __init__(self, message): self.message = message self.called = False def __call__(self): self.called = True return self.message class Fail(object): def __init__(self, message): self.message = message self.called = False def __call__(self): self.called = True raise TryNext(self.message) #----------------------------------------------------------------------------- # Test functions #----------------------------------------------------------------------------- def test_command_chain_dispatcher_ff(): """Test two failing hooks""" fail1 = Fail(u'fail1') fail2 = Fail(u'fail2') dp = CommandChainDispatcher([(0, fail1), (10, fail2)]) try: dp() except TryNext as e: nt.assert_equal(str(e), u'fail2') else: assert False, "Expected exception was not raised." nt.assert_true(fail1.called) nt.assert_true(fail2.called) def test_command_chain_dispatcher_fofo(): """Test a mixture of failing and succeeding hooks.""" fail1 = Fail(u'fail1') fail2 = Fail(u'fail2') okay1 = Okay(u'okay1') okay2 = Okay(u'okay2') dp = CommandChainDispatcher([(0, fail1), # (5, okay1), # add this later (10, fail2), (15, okay2)]) dp.add(okay1, 5) nt.assert_equal(dp(), u'okay1') nt.assert_true(fail1.called) nt.assert_true(okay1.called) nt.assert_false(fail2.called) nt.assert_false(okay2.called) def test_command_chain_dispatcher_eq_priority(): okay1 = Okay(u'okay1') okay2 = Okay(u'okay2') dp = CommandChainDispatcher([(1, okay1)]) dp.add(okay2, 1)
nilq/baby-python
python
from datetime import date import uuid from typing import Optional, List from pydantic import BaseModel, Field def generate_invoice_id(): return str(uuid.uuid4()) class InvoiceInfo(BaseModel): invoice_id: str = Field(default_factory=generate_invoice_id) issuer_name: str issuer_address: Optional[str] recipient_name: Optional[str] document_date: Optional[date] payment_date: Optional[date] due_date: Optional[date] currency: Optional[str] amount_total: float amount_paid: Optional[float] amount_tax: Optional[float] amount_due: Optional[float] amount_sum: Optional[float] num_items: Optional[int] class Config: orm_mode = True class InvoiceItem(BaseModel): invoice_id: str item_name: str sub_total: float class Config: orm_mode = True class Invoice(BaseModel): info: InvoiceInfo items: List[InvoiceItem]
nilq/baby-python
python
# Generated by Django 3.0.7 on 2020-07-17 15:52 import django.core.validators from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('judge', '0010_auto_20200717_1735'), ] operations = [ migrations.AlterField( model_name='problem', name='create_sql', field=models.CharField(blank=True, max_length=20000, null=True), ), migrations.AlterField( model_name='problem', name='insert_sql', field=models.CharField(blank=True, max_length=20000, null=True), ), migrations.AlterField( model_name='problem', name='text_md', field=models.CharField(blank=True, max_length=5000), ), migrations.AlterField( model_name='problem', name='title_md', field=models.CharField(blank=True, max_length=100), ), migrations.AlterField( model_name='selectproblem', name='solution', field=models.CharField(blank=True, max_length=5000, validators=[django.core.validators.MinLengthValidator(1)]), ), ]
nilq/baby-python
python
import sys import numpy as np import matplotlib.pyplot as plt # Load data #bf = np.loadtxt('data/times/brute_force.txt') #cp = np.loadtxt('data/times/closest_pair.txt') bf = np.loadtxt(sys.argv[1]) cp = np.loadtxt(sys.argv[2]) # Reshape data bf = bf.reshape(6, len(bf) // 6) cp = cp.reshape(6, len(cp) // 6) # Average times bf_mean = np.mean(bf[:,1:], axis=1) cp_mean = np.mean(cp[:,1:], axis=1) # N sims N = np.array([10**i for i in range(1, 7)]) # Plots plt.plot(N, bf_mean, "r-x", label="Brute Force") plt.plot(N, cp_mean, "b-o", label="Closest Pair") plt.plot(N,1e-8*N**2, "r-.", label=r"$O(n^2)$") plt.plot(N,1.5e-7*N*np.log(N)/np.log(2), "b-.", label=r"$O(n\log_2n)$") plt.xscale('log') plt.yscale('log') plt.xlabel("N Aircrafts") plt.ylabel("Time [s]") plt.grid(True) plt.legend() plt.show()
nilq/baby-python
python
from core.testing import APITestCase class TestAPITestCase(APITestCase): def test_tests(self): self.assertTrue(hasattr(self, 'pytestmark')) self.assertTrue(hasattr(self, 'mixer'))
nilq/baby-python
python
# NOT FINISHED, barely started import copy import time import random import math from typing import List import jax.numpy as np from pomdp_py.framework.basics import Action, Agent, POMDP, State, Observation,\ ObservationModel, TransitionModel, GenerativeDistribution, PolicyModel from pomdp_py.framework.planner import Planner from pomdp_py.representations.distribution.particles import Particles from pomdp_py.algorithms.po_uct import VNode, RootVNode, QNode, POUCT, RandomRollout from pomdp_py.algorithms.pomcp import VNodeParticles, RootVNodeParticles, POMCP def particle_reinvigoration(particles, num_particles, state_transform_func=None): """Note that particles should contain states that have already made the transition as a result of the real action. Therefore, they simply form part of the reinvigorated particles. At least maintain `num_particles` number of particles. If already have more, then it's ok. """ # If not enough particles, introduce artificial noise to existing particles (reinvigoration) new_particles = copy.deepcopy(particles) if len(new_particles) == 0: raise ValueError("Particle deprivation.") if len(new_particles) > num_particles: return new_particles print("Particle reinvigoration for %d particles" % (num_particles - len(new_particles))) while len(new_particles) < num_particles: # need to make a copy otherwise the transform affects states in 'particles' next_state = copy.deepcopy(particles.random()) # Add artificial noise if state_transform_func is not None: next_state = state_transform_func(next_state) new_particles.add(next_state) return new_particles def update_particles_belief( current_particles, real_action, real_observation=None, observation_model=None, transition_model=None, blackbox_model=None, state_transform_func=None, ): """ update_particles_belief(Particles current_particles, Action real_action, Observation real_observation=None, ObservationModel observation_model=None, TransitionModel transition_model=None, BlackboxModel blackbox_model=None, state_transform_func=None) This is the second case (update particles belief explicitly); Either BlackboxModel is not None, or TransitionModel and ObservationModel are not None. Note that you DON'T need to call this function if you are using POMCP. |TODO: not tested| Args: state_transform_func (State->State) is used to add artificial noise to the reinvigorated particles. """ for particle in current_particles.particles: # particle represents a state if blackbox_model is not None: # We're using a blackbox generator; (s',o,r) ~ G(s,a) result = blackbox_model.sample(particle, real_action) next_state = result[0] observation = result[1] else: # We're using explicit models next_state = transition_model.sample(particle, real_action) observation = observation_model.sample(next_state, real_action) # If observation matches real, then the next_state is accepted if observation == real_observation: filtered_particles.append(next_state) # Particle reinvigoration return particle_reinvigoration(Particles(filtered_particles), len(current_particles.particles), state_transform_func=state_transform_func) def sample_explicit_models(T, O, R, state, action, discount_factor=1.): # states, actions: batch, returns next_state, reward: batch next_state = T.sample(state, action) reward = R.sample(state, action, next_state) nsteps = 1 if O is not None: observation = O.sample(next_state, action) return next_state, observation, reward, nsteps else: return next_state, reward, nsteps class ParticlesJax(Particles): # represents a belief / distribution over states def __init__(self, values: List[State], weights: np.ndarray): self._values = values # used to convert from integer to State self._weights = weights # can be unnormalized, i.e. counts def add(self, particle, weight=1): # not sure we want to use this API self._weights = self._weights.at[particle].add(weight) #self._values.index(particle) #if isinstance(particle, State) #else particle #].add(weight) class PomcpJax(POMCP): """POMCP is POUCT + particle belief representation. This POMCP version only works for problems with action space that can be enumerated.""" def __init__(self, max_depth=5, planning_time=-1., num_sims=-1, discount_factor=0.9, exploration_const=math.sqrt(2), num_visits_init=0, value_init=0, rollout_policy=RandomRollout(), action_prior=None, show_progress=False, pbar_update_interval=5): super().__init__(max_depth=max_depth, planning_time=planning_time, num_sims=num_sims, discount_factor=discount_factor, exploration_const=exploration_const, num_visits_init=num_visits_init, value_init=value_init, rollout_policy=rollout_policy, action_prior=action_prior, show_progress=show_progress, pbar_update_interval=pbar_update_interval) # TODO: can remove all when convert to cython #self._show_progress = show_progress def plan(self, agent): # Only works if the agent's belief is particles if not isinstance(agent.belief, ParticlesJax): raise TypeError("Agent's belief is not represented in particles.\n"\ "POMCP not usable. Please convert it to particles.") return POUCT.plan(self, agent) def update(self, agent, real_action, real_observation, state_transform_func=None): """ Assume that the agent's history has been updated after taking real_action and receiving real_observation. `state_transform_func`: Used to add artificial transform to states during particle reinvigoration. Signature: s -> s_transformed """ if not isinstance(agent.belief, ParticlesJax): raise TypeError("agent's belief is not represented in particles.\n"\ "POMCP not usable. Please convert it to particles.") if not hasattr(agent, "tree"): print("Warning: agent does not have tree. Have you planned yet?") return if agent.tree[real_action][real_observation] is None: # Never anticipated the real_observation. No reinvigoration can happen. raise ValueError("Particle deprivation.") # Update the tree; Reinvigorate the tree's belief and use it # as the updated belief for the agent. agent.tree = RootVNodeParticles.from_vnode(agent.tree[real_action][real_observation], agent.history) tree_belief = agent.tree.belief agent.set_belief(particle_reinvigoration( tree_belief, len(agent.init_belief.particles), state_transform_func=state_transform_func)) # If observation was never encountered in simulation, then tree will be None; # particle reinvigoration will occur. if agent.tree is not None: agent.tree.belief = copy.deepcopy(agent.belief) def _search(self): if self._show_progress: if stop_by_sims: total = int(self._num_sims) else: total = self._planning_time pbar = tqdm(total=total) start_time = time.time() while True: ## Note: the tree node with () history will have ## the init belief given to the agent. state = self._agent.sample_belief() self._simulate(state, self._agent.history, self._agent.tree, None, None, 0) sims_count +=1 time_taken = time.time() - start_time if self._show_progress and sims_count % self._pbar_update_interval == 0: if stop_by_sims: pbar.n = sims_count else: pbar.n = time_taken pbar.refresh() if stop_by_sims: if sims_count >= self._num_sims: break else: if time_taken > self._planning_time: if self._show_progress: pbar.n = self._planning_time pbar.refresh() break if self._show_progress: pbar.close() best_action = self._agent.tree.argmax() return best_action, time_taken, sims_count def _simulate(self, state, history, root, parent, observation, depth): if depth > self._max_depth: return 0 if root is None: if self._agent.tree is None: root = self._VNode(agent=self._agent, root=True) self._agent.tree = root if self._agent.tree.history != self._agent.history: raise ValueError("Unable to plan for the given history.") else: root = self._VNode() if parent is not None: parent[observation] = root self._expand_vnode(root, history, state=state) rollout_reward = self._rollout(state, history, root, depth) return rollout_reward action = self._ucb(root) next_state, observation, reward, nsteps = sample_generative_model(self._agent, state, action) if nsteps == 0: # This indicates the provided action didn't lead to transition # Perhaps the action is not allowed to be performed for the given state # (for example, the state is not in the initiation set of the option, # or the state is a terminal state) return reward total_reward = reward + (self._discount_factor**nsteps)*self._simulate( next_state, history + ((action, observation),), root[action][observation], root[action], observation, depth+nsteps) root.num_visits += 1 root[action].num_visits += 1 root[action].value = root[action].value + (total_reward - root[action].value) / (root[action].num_visits) # POMCP simulate, need to update belief as well if depth == 1 and root is not None: root.belief.add(state) # belief update happens as simulation goes. return total_reward def _rollout(self, state, history, root, depth): while depth < self._max_depth: action = self._rollout_policy.rollout(state, history) next_state, observation, reward, nsteps = sample_generative_model(self._agent, state, action) history = history + ((action, observation),) depth += nsteps total_discounted_reward += reward * discount discount *= (self._discount_factor**nsteps) state = next_state return total_discounted_reward def _ucb(self, root): """UCB1""" best_action, best_value = None, float('-inf') for action in root.children: if root[action].num_visits == 0: val = float('inf') else: val = root[action].value + \ self._exploration_const * math.sqrt(math.log(root.num_visits + 1) / root[action].num_visits) if val > best_value: best_action = action best_value = val return best_action def _sample_generative_model(self, state, action): ''' (s', o, r) ~ G(s, a) ''' if self._agent.transition_model is None: next_state, observation, reward = self._agent.generative_model.sample(state, action) else: next_state = self._agent.transition_model.sample(state, action) observation = self._agent.observation_model.sample(next_state, action) reward = self._agent.reward_model.sample(state, action, next_state) return next_state, observation, reward def _VNode(self, agent=None, root=False, **kwargs): """Returns a VNode with default values; The function naming makes it clear that this function is about creating a VNode object.""" if root: # agent cannot be None. return RootVNodeParticles(self._num_visits_init, agent.history, belief=copy.deepcopy(agent.belief)) else: if agent is None: return VNodeParticles(self._num_visits_init, belief=Particles([])) else: return VNodeParticles(self._num_visits_init, belief=copy.deepcopy(agent.belief))
nilq/baby-python
python
# Generated by Django 3.2.3 on 2021-11-11 14:04 from django.db import migrations, models import django.db.models.deletion def copy_funding_instruments_from_calls_to_projects(apps, schema_editor): Project = apps.get_model('project_core', 'Project') for project in Project.objects.all(): project.funding_instrument = project.call.funding_instrument project.save() class Migration(migrations.Migration): dependencies = [ ('project_core', '0167_organisation_display_name'), ] operations = [ migrations.AddField( model_name='historicalproject', name='funding_instrument', field=models.ForeignKey(blank=True, db_constraint=False, help_text='Funding instrument to which the call belongs', null=True, on_delete=django.db.models.deletion.DO_NOTHING, related_name='+', to='project_core.fundinginstrument'), ), migrations.AddField( model_name='project', name='funding_instrument', field=models.ForeignKey(blank=True, help_text='Funding instrument to which the call belongs', null=True, on_delete=django.db.models.deletion.PROTECT, to='project_core.fundinginstrument'), ), migrations.RunPython( copy_funding_instruments_from_calls_to_projects ) ]
nilq/baby-python
python
import json import argparse def contains(splits): # Returns 1D binary map of images to take such that access is O(1) MAX, MIN = max([int(x.split('-')[-1]) for x in splits]), min([int(x.split('-')[0]) for x in splits]) A = [0 for _ in range(MAX-MIN+1)] for sp in splits: if '-' in sp: beg, end = [int(x) for x in sp.split('-')] else: beg = end = int(sp) for idx in range(beg-MIN, end+1-MIN): print (idx) A[idx] = 1 return A, MIN, MAX if __name__=='__main__': ap = argparse.ArgumentParser() ap.add_argument('json', help='Path to JSON dataset file') ap.add_argument('split', nargs='+', help='Dataset split for splitting') ap.add_argument('--out', help='Path to output JSON file', default='cut_dataset.json') args = ap.parse_args() with open(args.json, 'r') as f: obj = json.load(f) A, MIN, MAX = contains(args.split) imgs, anns = [], [] for img in obj['images']: if img['id'] >= MIN and img['id'] <= MAX: if A[img['id']-MIN]: ANN = [ann for ann in obj['annotations'] if ann['image_id']==img['id']] anns.extend(ANN) imgs.append(img) with open(args.out, 'w') as f: json.dump({'images': imgs, 'annotations': anns, 'classes': obj['classes'], 'categories': []}, f)
nilq/baby-python
python
from sklearn.base import BaseEstimator import numpy as np from sklearn.base import clone from .logs.loggers import get_logger import math class DeepModel(BaseEstimator): def __init__(self, estimator, depths, n_estimators=100, learning_rate=0.01, verbose=True, logging=None, logging_params={}): self.n_estimators = n_estimators self.learning_rate = learning_rate self.verbose = verbose self.depths = depths self.estimator = estimator self.logger = get_logger(logging, 'DeepModel', logging_params) def fit(self, X_train, y_train): self.models = [] self.logger('Training...') feed = y_train.copy() for depth in self.depths: self.logger(f"Depth: {depth}") model = clone(self.estimator) model.fit(X_train, feed) self.models.append(model) preds = model.predict(X_train) feed -= preds self.logger('%.15f' % np.mean(abs(feed))) def predict(self, X_test): preds = np.zeros(X_test.shape[0]) for model in self.models: preds += model.predict(X_test) return preds return preds class EarlyStoppingError(Exception): pass class EarlyStopping: def __init__(self, direction, patience=100, threshold=1e-3): self.best = -math.inf if direction == 'maximize' else math.inf self.fn = max if direction == 'maximize' else min self.count = 0 self.threshold = threshold self.patience = patience def __call__(self, value): new_value = self.fn(self.best, value) if abs(new_value - self.best) < self.threshold: self.count += 1 if self.count > self.patience: raise EarlyStoppingError() else: self.count = 0 self.best = new_value
nilq/baby-python
python
################################################################################ # COPYRIGHT(c) 2018 STMicroelectronics # # # # Redistribution and use in source and binary forms, with or without # # modification, are permitted provided that the following conditions are met: # # 1. Redistributions of source code must retain the above copyright notice, # # this list of conditions and the following disclaimer. # # 2. Redistributions in binary form must reproduce the above copyright # # notice, this list of conditions and the following disclaimer in the # # documentation and/or other materials provided with the distribution. # # 3. Neither the name of STMicroelectronics nor the names of its # # contributors may be used to endorse or promote products derived from # # this software without specific prior written permission. # # # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE # # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF # # SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # # POSSIBILITY OF SUCH DAMAGE. # ################################################################################ """ble_advertising_data_parser The ble_advertising_data_parser module contains tools to parse the advertising data coming from Bluetooth devices and recognized by the BlueSTSDK. """ # IMPORT import blue_st_sdk.node from blue_st_sdk.utils.blue_st_exceptions import InvalidBLEAdvertisingDataException # CLASSES class BLEAdvertisingDataParser(object): """Parse the advertising data sent by a device that follows the BlueST protocol. It raises an exception if the advertising data is not valid. """ # Note: the Bluepy library hides the field-type. ADVERTISING_DATA_MANUFACTURER_LENGTH_1 = 7 """Allowed length for the advertising data manufacturer in bytes.""" ADVERTISING_DATA_MANUFACTURER_LENGTH_2 = 13 """Allowed length for the advertising data manufacturer in bytes.""" VERSION_PROTOCOL_SUPPORTED_MIN = 0x01 """Minimum version protocol supported.""" VERSION_PROTOCOL_SUPPORTED_MAX = 0x01 """Maximum version protocol supported.""" _COMPLETE_LOCAL_NAME = 0x09 """Code identifier for the complete local name.""" _TX_POWER = 0x0A """Code identifier for the transmission power.""" _MANUFACTURER_SPECIFIC_DATA = 0xFF """Code identifier for themanufacturer data.""" _NAME_UNKNOWN = 'UNKNOWN' """Unknown name.""" def __init__(self, advertising_data): """Constructor. Args: advertising_data (str): BLE advertising_data. Raises: :exc:`blue_st_sdk.utils.blue_st_exceptions.InvalidBLEAdvertisingDataException` is raised if the advertising data is not well formed. """ # Device name (str). self._name = self._NAME_UNKNOWN # Device transmission power (int). self._tx_power = -1 # Device MAC address (str). self._address = None # Bitmask that keeps track of the available features (int). self._feature_mask = -1 # Device identifier (int). self._device_id = -1 # Device Protocol Version (int). self._protocol_version = -1 # Board's type (NodeType). self._board_type = None # Board in sleeping status (bool). self._board_sleeping = None # Manufacturer specific data (str). self._manufacturer_specific_data = None # Getting data. for data in advertising_data: if data[0] == self._COMPLETE_LOCAL_NAME: self._name = data[2].encode('utf-8') elif data[0] == self._TX_POWER: self._tx_power = data[2] elif data[0] == self._MANUFACTURER_SPECIFIC_DATA: self._manufacturer_specific_data = data[2] if self._manufacturer_specific_data is None: raise InvalidBLEAdvertisingDataException( ' ' + self._name + ': ' \ '"Manufacturer specific data" is mandatory: ' \ 'the advertising data does not contain it.' ) try: # Parse manufacturer specific data. self._parse_manufacturer_specific_data(self._manufacturer_specific_data) except InvalidBLEAdvertisingDataException as e: raise e def _parse_manufacturer_specific_data(self, manufacturer_specific_data): """Parse the manufacturer specific data. Args: manufacturer_specific_data (str): The manufacturer specific data. Raises: :exc:`blue_st_sdk.utils.blue_st_exceptions.InvalidBLEAdvertisingDataException` is raised if the advertising data is not well formed. """ length = len(manufacturer_specific_data.decode('hex')) + 1 # Adding 1 byte of the field-type, which is hidden by the Bluepy library. if length != self.ADVERTISING_DATA_MANUFACTURER_LENGTH_1 and length != self.ADVERTISING_DATA_MANUFACTURER_LENGTH_2: raise InvalidBLEAdvertisingDataException( ' ' + self._name + ': ' \ '"Manufacturer specific data" must be of length "' \ + str(self.ADVERTISING_DATA_MANUFACTURER_LENGTH_1) + '" or "' \ + str(self.ADVERTISING_DATA_MANUFACTURER_LENGTH_2) + '", not "' + str(length) + '".' ) self._protocol_version = int(manufacturer_specific_data[0:2], 16) if (self._protocol_version < self.VERSION_PROTOCOL_SUPPORTED_MIN) or \ (self._protocol_version > self.VERSION_PROTOCOL_SUPPORTED_MAX): raise InvalidBLEAdvertisingDataException( ' ' + self._name + ': ' \ 'Protocol version "' + str(self._protocol_version) + '" unsupported. ' \ 'Version must be in [' + str(self.VERSION_PROTOCOL_SUPPORTED_MIN) + '..' + str(self.VERSION_PROTOCOL_SUPPORTED_MAX) + '].' ) self._device_id = int(manufacturer_specific_data[2:4], 16) self._device_id = self._device_id & 0xFF if self._device_id & 0x80 == 0x80 else self._device_id & 0x1F try: self._board_type = self._get_node_type(self._device_id) except InvalidBLEAdvertisingDataException as e: raise e self._board_sleeping = self._get_node_sleeping_status(int(manufacturer_specific_data[2:4], 16)) self._feature_mask = int(manufacturer_specific_data[4:12], 16) self._address = manufacturer_specific_data[12:24] if length == self.ADVERTISING_DATA_MANUFACTURER_LENGTH_2 else None def _get_node_type(self, device_id): """Get the node's type. Args: device_id (int): Device identifier. Returns: :class:`blue_st_sdk.node.NodeType`: The node's type. Raises: :exc:`blue_st_sdk.utils.blue_st_exceptions.InvalidBLEAdvertisingDataException` is raised if the advertising data is not well formed. """ temp = int(device_id & 0xFF) if temp == 0x01: return blue_st_sdk.node.NodeType.STEVAL_WESU1 if temp == 0x02: return blue_st_sdk.node.NodeType.SENSOR_TILE if temp == 0x03: return blue_st_sdk.node.NodeType.BLUE_COIN if temp == 0x04: return blue_st_sdk.node.NodeType.STEVAL_IDB008VX if temp >= 0x80 and temp <= 0xFF: return blue_st_sdk.node.NodeType.NUCLEO return blue_st_sdk.node.NodeType.GENERIC @classmethod def _get_node_sleeping_status(self, node_type): """Parse the node type field to check whether the board is sleeping. Args: node_type (int): Node type. Returns: True if the board is sleeping, False otherwise. """ return ((node_type & 0x80) != 0x80 and ((node_type & 0x40) == 0x40)) def get_name(self): """Get the device name. Returns: str: The device name. """ return self._name def get_tx_power(self): """Get the device transmission power in mdb. Returns: int: The device transmission power in mdb. """ return self._tx_power def get_address(self): """Get the device MAC address. Returns: str: The device MAC address. """ return self._address def get_protocol_version(self): """Get the device protocol version. Returns: int: The device protocol version. """ return self._protocol_version def get_board_type(self): """Get the board's type. Returns: The board's type. """ return self._board_type def get_board_sleeping(self): """Get the sleeping status. Returns: True if the board is sleeping, False otherwise. """ return self._board_sleeping def get_device_id(self): """Get the device identifier. Returns: int: The device identifier. """ return self._device_id def get_feature_mask(self): """Get the bitmask that keeps track of the available features. Returns: The bitmask that keeps track of the available features. """ return self._feature_mask def __str__(self): """Print the advertising_data. Returns: str: A string that contains the advertising_data. """ return "Name: " + self._name + \ "\n\tTxPower: " + self._tx_power + \ "\n\tAddress: " + self._address + \ "\n\tFeature Mask: " + self._feature_mask + \ "\n\tProtocol Version: " + self._protocol_version
nilq/baby-python
python
from django.core.mail import send_mail from django.shortcuts import render,redirect,reverse from django.http import HttpResponse from django.contrib.auth.mixins import LoginRequiredMixin from django.views import generic from .models import AgentModel, LeadModel,CategoryModel from .forms import ( LeadCreationForm,UserCreationForm,AssignAgentForm, CategoryUpdateForm, ) from agents.mixin import OrganisorAndLoginRequiredMixin from django.views.generic import ( TemplateView,CreateView,ListView, UpdateView,DeleteView,DetailView, ) class LandingPageView(TemplateView): template_name="leads/index.html" class SignupView(CreateView): template_name="registration/signup.html" form_class=UserCreationForm def get_success_url(self): return reverse("login") def index(request): return render(request,"leads/index.html") class LeadListView(LoginRequiredMixin,ListView): template_name="leads/leads_list.html" context_object_name="leads" #""" #queryset=LeadModel.objects.all() def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation if user.is_organisor: queryset=LeadModel.objects.filter( organisation=user.userprofile, agent__isnull=False, ) else: queryset=LeadModel.objects.filter( organisation = user.agent.organisation, agent__isnull=False, ) #filter for the agent that is logged in queryset=queryset.filter(agent__user=user) return queryset def get_context_data(self,**kwargs): context=super(LeadListView,self).get_context_data(**kwargs) user=self.request.user if user.is_organisor: queryset=LeadModel.objects.filter( organisation=user.userprofile, agent__isnull=True, ) # context["'unassigned_leads'"]=queryset # return context context.update({ 'unassigned_leads':queryset }) return context #""" def LeadList(request): leads=LeadModel.objects.all() context={ "leads":leads } return render(request,"leads/leads_list.html",context) class LeadCreateView(OrganisorAndLoginRequiredMixin,CreateView): template_name="leads/leads_create.html" form_class=LeadCreationForm def get_success_url(self): return reverse("leads:leadlist") def form_valid(self,form): lead = form.save(commit=False) lead.organisation = self.request.user.userprofile lead.save() send_mail( subject="A lead has been created", message="Go to the site to see the new lead", from_email="test@test.com", recipient_list=['test2@test.com'] # recipient_list=["test2@test.com"] ) return super(LeadCreateView,self).form_valid(form) def LeadCreate(request): if request.POST: form =LeadCreationForm(request.POST) if form.is_valid(): form.save() return redirect("leadlist") context={ "LeadCreationForm":LeadCreationForm } return render(request,"leads/leads_create.html",context) class LeadDetailView(LoginRequiredMixin,DetailView): template_name="leads/leads_detail.html" context_object_name="lead" def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation if user.is_organisor: queryset=LeadModel.objects.filter(organisation=user.userprofile) else: queryset=LeadModel.objects.filter(organisation=user.agent.organisation) #filter for the agent that is logged in queryset=queryset.filte(agent__user=user) return queryset def LeadDetail(request,pk): lead=LeadModel.objects.get(id=pk) context={ "lead":lead } return render(request,"leads/leads_detail.html",context) class LeadUpdateView(OrganisorAndLoginRequiredMixin,UpdateView): template_name="leads/leads_update.html" #queryset=LeadModel.objects.all() form_class=LeadCreationForm context_object_name="lead" def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation queryset=LeadModel.objects.filter(organisation=user.userprofile) return queryset def get_success_url(self): return reverse("leads:leadlist") def LeadUpdate(request,pk): lead=LeadModel.objects.get(id=pk) form=LeadCreationForm(instance=lead) if request.POST: form =LeadCreationForm(request.POST,instance=lead) if form.is_valid(): form.save() return redirect("leadlist") context={ #"lead":lead, "form":form, "lead":lead, } return render(request,"leads/leads_update.html",context) class LeadDeleteView(LoginRequiredMixin,DeleteView): template_name="leads/leads_delete.html" def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation queryset=LeadModel.objects.filter(organisation=user.userprofile) def get_success_url(self): return reverse("leads:leadlist") def LeadDelete(request,pk): lead=LeadModel.objects.get(id=pk) lead.delete() return redirect("leads:leadlist") class AssignAgentView(OrganisorAndLoginRequiredMixin,generic.FormView): template_name="leads/assign_agent.html" form_class=AssignAgentForm def get_form_kwargs(self,**kwargs): kwargs=super(AssignAgentView,self).get_form_kwargs(**kwargs) kwargs.update({ "request":self.request }) return kwargs def form_valid(self, form): agent=form.cleaned_data["agents"] lead=LeadModel.objects.get(id=self.kwargs["pk"]) lead.agent=agent lead.save() return super(AssignAgentView,self).form_valid(form) def get_success_url(self): return reverse("leads:leadlist") class CategoryListView(LoginRequiredMixin,generic.ListView): template_name="leads/category_list.html" context_object_name="category_list" def get_context_data(self, **kwargs): context= super(CategoryListView,self).get_context_data(**kwargs) user=self.request.user if user.is_organisor: queryset=LeadModel.objects.filter(organisation=user.userprofile,) else: queryset=LeadModel.objects.filter(organisation = user.agent.organisation,) context.update({ "unassigned_lead_count":queryset.filter(category__isnull=True).count() }) return context def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation if user.is_organisor: queryset=CategoryModel.objects.filter(organisation=user.userprofile,) else: queryset=CategoryModel.objects.filter(organisation = user.agent.organisation,) return queryset class CategoryDetailView(LoginRequiredMixin,generic.DetailView): template_name="leads/category_detail.html" context_object_name="category" #direct relation query from models can used to achieve same result <category.leads.all> def get_context_data(self, **kwargs): context= super(CategoryDetailView,self).get_context_data(**kwargs) leads=self.get_object().leads.all() context.update({ "leads":leads }) return context def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation if user.is_organisor: queryset=CategoryModel.objects.filter(organisation=user.userprofile,) else: queryset=CategoryModel.objects.filter(organisation = user.agent.organisation,) return queryset class CategoryUpdateView(LoginRequiredMixin,generic.UpdateView): template_name="leads/category_update.html" form_class=CategoryUpdateForm context_object_name="lead" def get_queryset(self): user=self.request.user #queryset of leads for the entire organisation if user.is_organisor: queryset=LeadModel.objects.filter(organisation=user.userprofile,) else: queryset=LeadModel.objects.filter(organisation = user.agent.organisation,) return queryset def get_success_url(self): return reverse("leads:leaddetail",kwargs={"pk":self.get_object().id})
nilq/baby-python
python
# Copyright 2016 VMware, Inc. # # All Rights Reserved # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from neutron.services.qos import qos_plugin from oslo_config import cfg from oslo_log import log as logging from vmware_nsx._i18n import _ from vmware_nsx.common import exceptions as nsx_exc LOG = logging.getLogger(__name__) class NsxVQosPlugin(qos_plugin.QoSPlugin): """Service plugin for VMware NSX-v to implement Neutron's Qos API.""" supported_extension_aliases = ["qos"] def __init__(self): LOG.info("Loading VMware NSX-V Qos Service Plugin") super(NsxVQosPlugin, self).__init__() if not cfg.CONF.nsxv.use_dvs_features: error = _("Cannot use the NSX-V QoS plugin without " "enabling the dvs features") raise nsx_exc.NsxPluginException(err_msg=error)
nilq/baby-python
python
#!/usr/bin/env python # -*- coding: utf-8 -*- import subprocess import logging logger = logging.getLogger(__name__) class RestartHandler: def __init__(self, observer, command): self.observer = observer self.command = command def run(self): logger.info("Running restart handler") command_process = subprocess.Popen(self.command) while True: events = self.observer.observe_and_update() if events: logger.info("Restarting the process") command_process.terminate() command_process.wait() command_process = subprocess.Popen(self.command)
nilq/baby-python
python
# coding=utf-8 # *** WARNING: this file was generated by the Pulumi SDK Generator. *** # *** Do not edit by hand unless you're certain you know what you are doing! *** import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from .. import _utilities from ._enums import * __all__ = [ 'ConnectionAliasAssociation', 'ConnectionAliasTag', 'WorkspaceProperties', 'WorkspaceTag', ] @pulumi.output_type class ConnectionAliasAssociation(dict): @staticmethod def __key_warning(key: str): suggest = None if key == "associatedAccountId": suggest = "associated_account_id" elif key == "associationStatus": suggest = "association_status" elif key == "connectionIdentifier": suggest = "connection_identifier" elif key == "resourceId": suggest = "resource_id" if suggest: pulumi.log.warn(f"Key '{key}' not found in ConnectionAliasAssociation. Access the value via the '{suggest}' property getter instead.") def __getitem__(self, key: str) -> Any: ConnectionAliasAssociation.__key_warning(key) return super().__getitem__(key) def get(self, key: str, default = None) -> Any: ConnectionAliasAssociation.__key_warning(key) return super().get(key, default) def __init__(__self__, *, associated_account_id: Optional[str] = None, association_status: Optional['ConnectionAliasAssociationAssociationStatus'] = None, connection_identifier: Optional[str] = None, resource_id: Optional[str] = None): if associated_account_id is not None: pulumi.set(__self__, "associated_account_id", associated_account_id) if association_status is not None: pulumi.set(__self__, "association_status", association_status) if connection_identifier is not None: pulumi.set(__self__, "connection_identifier", connection_identifier) if resource_id is not None: pulumi.set(__self__, "resource_id", resource_id) @property @pulumi.getter(name="associatedAccountId") def associated_account_id(self) -> Optional[str]: return pulumi.get(self, "associated_account_id") @property @pulumi.getter(name="associationStatus") def association_status(self) -> Optional['ConnectionAliasAssociationAssociationStatus']: return pulumi.get(self, "association_status") @property @pulumi.getter(name="connectionIdentifier") def connection_identifier(self) -> Optional[str]: return pulumi.get(self, "connection_identifier") @property @pulumi.getter(name="resourceId") def resource_id(self) -> Optional[str]: return pulumi.get(self, "resource_id") @pulumi.output_type class ConnectionAliasTag(dict): def __init__(__self__, *, key: str, value: str): pulumi.set(__self__, "key", key) pulumi.set(__self__, "value", value) @property @pulumi.getter def key(self) -> str: return pulumi.get(self, "key") @property @pulumi.getter def value(self) -> str: return pulumi.get(self, "value") @pulumi.output_type class WorkspaceProperties(dict): @staticmethod def __key_warning(key: str): suggest = None if key == "computeTypeName": suggest = "compute_type_name" elif key == "rootVolumeSizeGib": suggest = "root_volume_size_gib" elif key == "runningMode": suggest = "running_mode" elif key == "runningModeAutoStopTimeoutInMinutes": suggest = "running_mode_auto_stop_timeout_in_minutes" elif key == "userVolumeSizeGib": suggest = "user_volume_size_gib" if suggest: pulumi.log.warn(f"Key '{key}' not found in WorkspaceProperties. Access the value via the '{suggest}' property getter instead.") def __getitem__(self, key: str) -> Any: WorkspaceProperties.__key_warning(key) return super().__getitem__(key) def get(self, key: str, default = None) -> Any: WorkspaceProperties.__key_warning(key) return super().get(key, default) def __init__(__self__, *, compute_type_name: Optional[str] = None, root_volume_size_gib: Optional[int] = None, running_mode: Optional[str] = None, running_mode_auto_stop_timeout_in_minutes: Optional[int] = None, user_volume_size_gib: Optional[int] = None): if compute_type_name is not None: pulumi.set(__self__, "compute_type_name", compute_type_name) if root_volume_size_gib is not None: pulumi.set(__self__, "root_volume_size_gib", root_volume_size_gib) if running_mode is not None: pulumi.set(__self__, "running_mode", running_mode) if running_mode_auto_stop_timeout_in_minutes is not None: pulumi.set(__self__, "running_mode_auto_stop_timeout_in_minutes", running_mode_auto_stop_timeout_in_minutes) if user_volume_size_gib is not None: pulumi.set(__self__, "user_volume_size_gib", user_volume_size_gib) @property @pulumi.getter(name="computeTypeName") def compute_type_name(self) -> Optional[str]: return pulumi.get(self, "compute_type_name") @property @pulumi.getter(name="rootVolumeSizeGib") def root_volume_size_gib(self) -> Optional[int]: return pulumi.get(self, "root_volume_size_gib") @property @pulumi.getter(name="runningMode") def running_mode(self) -> Optional[str]: return pulumi.get(self, "running_mode") @property @pulumi.getter(name="runningModeAutoStopTimeoutInMinutes") def running_mode_auto_stop_timeout_in_minutes(self) -> Optional[int]: return pulumi.get(self, "running_mode_auto_stop_timeout_in_minutes") @property @pulumi.getter(name="userVolumeSizeGib") def user_volume_size_gib(self) -> Optional[int]: return pulumi.get(self, "user_volume_size_gib") @pulumi.output_type class WorkspaceTag(dict): def __init__(__self__, *, key: str, value: str): pulumi.set(__self__, "key", key) pulumi.set(__self__, "value", value) @property @pulumi.getter def key(self) -> str: return pulumi.get(self, "key") @property @pulumi.getter def value(self) -> str: return pulumi.get(self, "value")
nilq/baby-python
python
import numpy as np from scipy.constants import mu_0 # TODO: make this to take a vector rather than a single frequency def rTEfunfwd(nlay, f, lamda, sig, chi, depth, HalfSwitch): """ Compute reflection coefficients for Transverse Electric (TE) mode. Only one for loop for multiple layers. Do not use for loop for lambda, which has 801 times of loops (actually, this makes the code really slow). """ Mtemp00 = np.zeros(lamda.size, dtype=complex) Mtemp10 = np.zeros(lamda.size, dtype=complex) Mtemp01 = np.zeros(lamda.size, dtype=complex) Mtemp11 = np.zeros(lamda.size, dtype=complex) M1sum00 = np.zeros(lamda.size, dtype=complex) M1sum10 = np.zeros(lamda.size, dtype=complex) M1sum01 = np.zeros(lamda.size, dtype=complex) M1sum11 = np.zeros(lamda.size, dtype=complex) thick = -np.diff(depth) w = 2*np.pi*f rTE = np.zeros(lamda.size, dtype=complex) utemp0 = np.zeros(lamda.size, dtype=complex) utemp1 = np.zeros(lamda.size, dtype=complex) const = np.zeros(lamda.size, dtype=complex) utemp0 = lamda utemp1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[0])*sig[0]) const = mu_0*utemp1/(mu_0*(1+chi[0])*utemp0) Mtemp00 = 0.5*(1+const) Mtemp10 = 0.5*(1-const) Mtemp01 = 0.5*(1-const) Mtemp11 = 0.5*(1+const) M00 = [] M10 = [] M01 = [] M11 = [] M0sum00 = Mtemp00 M0sum10 = Mtemp10 M0sum01 = Mtemp01 M0sum11 = Mtemp11 if HalfSwitch == True: M1sum00 = np.zeros(lamda.size, dtype=complex) M1sum10 = np.zeros(lamda.size, dtype=complex) M1sum01 = np.zeros(lamda.size, dtype=complex) M1sum11 = np.zeros(lamda.size, dtype=complex) M1sum00 = M0sum00 M1sum10 = M0sum10 M1sum01 = M0sum01 M1sum11 = M0sum11 else : for j in range (nlay-1): utemp0 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[j])*sig[j]) utemp1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[j+1])*sig[j+1]) const = mu_0*(1+chi[j])*utemp1/(mu_0*(1+chi[j+1])*utemp0) h0 = thick[j] Mtemp00 = 0.5*(1.+ const)*np.exp(-2.*utemp0*h0) Mtemp10 = 0.5*(1.- const) Mtemp01 = 0.5*(1.- const)*np.exp(-2.*utemp0*h0) Mtemp11 = 0.5*(1.+ const) M1sum00 = M0sum00*Mtemp00 + M0sum01*Mtemp10 M1sum10 = M0sum10*Mtemp00 + M0sum11*Mtemp10 M1sum01 = M0sum00*Mtemp01 + M0sum01*Mtemp11 M1sum11 = M0sum10*Mtemp01 + M0sum11*Mtemp11 M0sum00 = M1sum00 M0sum10 = M1sum10 M0sum01 = M1sum01 M0sum11 = M1sum11 rTE = M1sum01/M1sum11 return rTE def matmul(a00, a10, a01, a11, b00, b10, b01, b11): """ Compute 2x2 matrix mutiplication in vector way C = A*B C = [a00 a01] * [b00 b01] = [c00 c01] [a10 a11] [b10 b11] [c10 c11] """ c00 = a00*b00 + a01*b10 c10 = a10*b00 + a11*b10 c01 = a00*b01 + a01*b11 c11 = a10*b01 + a11*b11 return c00, c10, c01, c11 # TODO: make this to take a vector rather than a single frequency def rTEfunjac(nlay, f, lamda, sig, chi, depth, HalfSwitch): """ Compute reflection coefficients for Transverse Electric (TE) mode. Only one for loop for multiple layers. Do not use for loop for lambda, which has 801 times of loops (actually, this makes the code really slow). """ # Initializing arrays Mtemp00 = np.zeros(lamda.size, dtype=complex) Mtemp10 = np.zeros(lamda.size, dtype=complex) Mtemp01 = np.zeros(lamda.size, dtype=complex) Mtemp11 = np.zeros(lamda.size, dtype=complex) M1sum00 = np.zeros(lamda.size, dtype=complex) M1sum10 = np.zeros(lamda.size, dtype=complex) M1sum01 = np.zeros(lamda.size, dtype=complex) M1sum11 = np.zeros(lamda.size, dtype=complex) M0sum00 = np.zeros(lamda.size, dtype=complex) M0sum10 = np.zeros(lamda.size, dtype=complex) M0sum01 = np.zeros(lamda.size, dtype=complex) M0sum11 = np.zeros(lamda.size, dtype=complex) dMtemp00 = np.zeros(lamda.size, dtype=complex) dMtemp10 = np.zeros(lamda.size, dtype=complex) dMtemp01 = np.zeros(lamda.size, dtype=complex) dMtemp11 = np.zeros(lamda.size, dtype=complex) dj0temp00 = np.zeros(lamda.size, dtype=complex) dj0temp10 = np.zeros(lamda.size, dtype=complex) dj0temp01 = np.zeros(lamda.size, dtype=complex) dj0temp11 = np.zeros(lamda.size, dtype=complex) dj1temp00 = np.zeros(lamda.size, dtype=complex) dj1temp10 = np.zeros(lamda.size, dtype=complex) dj1temp01 = np.zeros(lamda.size, dtype=complex) dj1temp11 = np.zeros(lamda.size, dtype=complex) thick = -np.diff(depth) w = 2*np.pi*f rTE = np.zeros(lamda.size, dtype=complex) drTE = np.zeros((nlay, lamda.size) , dtype=complex) utemp0 = np.zeros(lamda.size, dtype=complex) utemp1 = np.zeros(lamda.size, dtype=complex) const = np.zeros(lamda.size, dtype=complex) utemp0 = lamda utemp1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[0])*sig[0]) const = mu_0*utemp1/(mu_0*(1+chi[0])*utemp0) # Compute M1 Mtemp00 = 0.5*(1+const) Mtemp10 = 0.5*(1-const) Mtemp01 = 0.5*(1-const) Mtemp11 = 0.5*(1+const) utemp0 = lamda utemp1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[0])*sig[0]) const = mu_0*utemp1/(mu_0*(1+chi[0])*utemp0) # Compute dM1du1 dj0Mtemp00 = 0.5*(mu_0/(mu_0*(1+chi[0])*utemp0)) dj0Mtemp10 = -0.5*(mu_0/(mu_0*(1+chi[0])*utemp0)) dj0Mtemp01 = -0.5*(mu_0/(mu_0*(1+chi[0])*utemp0)) dj0Mtemp11 = 0.5*(mu_0/(mu_0*(1+chi[0])*utemp0)) # TODO: for computing Jacobian M00 = [] M10 = [] M01 = [] M11 = [] dJ00 = [] dJ10 = [] dJ01 = [] dJ11 = [] M00.append(Mtemp00) M01.append(Mtemp01) M10.append(Mtemp10) M11.append(Mtemp11) M0sum00 = Mtemp00.copy() M0sum10 = Mtemp10.copy() M0sum01 = Mtemp01.copy() M0sum11 = Mtemp11.copy() if HalfSwitch == True: M1sum00 = np.zeros(lamda.size, dtype=complex) M1sum10 = np.zeros(lamda.size, dtype=complex) M1sum01 = np.zeros(lamda.size, dtype=complex) M1sum11 = np.zeros(lamda.size, dtype=complex) M1sum00 = M0sum00.copy() M1sum10 = M0sum10.copy() M1sum01 = M0sum01.copy() M1sum11 = M0sum11.copy() else: for j in range (nlay-1): dJ_10Mtemp00 = np.zeros(lamda.size, dtype=complex) dJ_10Mtemp10 = np.zeros(lamda.size, dtype=complex) dJ_10Mtemp01 = np.zeros(lamda.size, dtype=complex) dJ_10Mtemp11 = np.zeros(lamda.size, dtype=complex) dJ01Mtemp00 = np.zeros(lamda.size, dtype=complex) dJ01Mtemp10 = np.zeros(lamda.size, dtype=complex) dJ01Mtemp01 = np.zeros(lamda.size, dtype=complex) dJ01Mtemp11 = np.zeros(lamda.size, dtype=complex) utemp0 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[j])*sig[j]) utemp1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[j+1])*sig[j+1]) const = mu_0*(1+chi[j])*utemp1/(mu_0*(1+chi[j+1])*utemp0) h0 = thick[j] Mtemp00 = 0.5*(1.+ const)*np.exp(-2.*utemp0*h0) Mtemp10 = 0.5*(1.- const) Mtemp01 = 0.5*(1.- const)*np.exp(-2.*utemp0*h0) Mtemp11 = 0.5*(1.+ const) M1sum00, M1sum10, M1sum01, M1sum11 = matmul( M0sum00, M0sum10, M0sum01, M0sum11, Mtemp00, Mtemp10, Mtemp01, Mtemp11 ) M0sum00 = M1sum00 M0sum10 = M1sum10 M0sum01 = M1sum01 M0sum11 = M1sum11 # TODO: for Computing Jacobian dudsig = 0.5*1j*w*mu_0*(1+chi[j])/utemp0 if j==0: const1a = mu_0*(1+chi[j])*utemp1/(mu_0*(1+chi[j+1])*utemp0**2) const1b = const1a*utemp0 dj1Mtemp00 = -0.5*const1a*np.exp(-2.*utemp0*h0)-h0*(1+const1b)*np.exp(-2.*utemp0*h0) dj1Mtemp10 = 0.5*const1a dj1Mtemp01 = 0.5*const1a*np.exp(-2.*utemp0*h0)-h0*(1-const1b)*np.exp(-2.*utemp0*h0) dj1Mtemp11 = -0.5*const1a #Compute dM1dm1*M2 dJ_10Mtemp00, dJ_10Mtemp10, dJ_10Mtemp01, dJ_10Mtemp11 = matmul(dj0Mtemp00, dj0Mtemp10, dj0Mtemp01, dj0Mtemp11, Mtemp00, Mtemp10, Mtemp01, Mtemp11) #Compute M1*dM2dm1 dJ01Mtemp00, dJ01Mtemp10, dJ01Mtemp01, dJ01Mtemp11 = matmul(M00[j], M10[j], M01[j], M11[j], dj1Mtemp00, dj1Mtemp10, dj1Mtemp01, dj1Mtemp11) dJ00.append(dudsig*(dJ_10Mtemp00+dJ01Mtemp00)) dJ10.append(dudsig*(dJ_10Mtemp10+dJ01Mtemp10)) dJ01.append(dudsig*(dJ_10Mtemp01+dJ01Mtemp01)) dJ11.append(dudsig*(dJ_10Mtemp11+dJ01Mtemp11)) else: h_1 = thick[j-1] utemp_1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[j-1])*sig[j-1]) const0 = mu_0*(1+chi[j-1])/(mu_0*(1+chi[j])*utemp_1) dj0Mtemp00 = 0.5*(const0)*np.exp(-2.*utemp_1*h_1) dj0Mtemp10 = -0.5*(const0) dj0Mtemp01 = -0.5*(const0)*np.exp(-2.*utemp_1*h_1) dj0Mtemp11 = 0.5*(const0) const1a = mu_0*(1+chi[j])*utemp1/(mu_0*(1+chi[j+1])*utemp0**2) const1b = const1a*utemp0 dj1Mtemp00 = -0.5*const1a*np.exp(-2.*utemp0*h0)-h0*(1+const1b)*np.exp(-2.*utemp0*h0) dj1Mtemp10 = 0.5*const1a dj1Mtemp01 = 0.5*const1a*np.exp(-2.*utemp0*h0)-h0*(1-const1b)*np.exp(-2.*utemp0*h0) dj1Mtemp11 = -0.5*const1a #Compute dMjdmj*Mj+1 dJ_10Mtemp00, dJ_10Mtemp10, dJ_10Mtemp01, dJ_10Mtemp11 = matmul(dj0Mtemp00, dj0Mtemp10, dj0Mtemp01, dj0Mtemp11, Mtemp00, Mtemp10, Mtemp01, Mtemp11) #Compute Mj*dMj+1dmj dJ01Mtemp00, dJ01Mtemp10, dJ01Mtemp01, dJ01Mtemp11 = matmul(M00[j], M10[j], M01[j], M11[j], dj1Mtemp00, dj1Mtemp10, dj1Mtemp01, dj1Mtemp11) dJ00.append(dudsig*(dJ_10Mtemp00+dJ01Mtemp00)) dJ10.append(dudsig*(dJ_10Mtemp10+dJ01Mtemp10)) dJ01.append(dudsig*(dJ_10Mtemp01+dJ01Mtemp01)) dJ11.append(dudsig*(dJ_10Mtemp11+dJ01Mtemp11)) M00.append(Mtemp00) M01.append(Mtemp01) M10.append(Mtemp10) M11.append(Mtemp11) # rTE = M1sum01/M1sum11 if HalfSwitch == True: utemp0 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[0])*sig[0]) dudsig = 0.5*1j*w*mu_0*(1+chi[0])/utemp0 dJ1sum00 = np.zeros(lamda.size, dtype=complex) dJ1sum10 = np.zeros(lamda.size, dtype=complex) dJ1sum01 = np.zeros(lamda.size, dtype=complex) dJ1sum11 = np.zeros(lamda.size, dtype=complex) dJ1sum00 = dudsig*dj0Mtemp00 dJ1sum10 = dudsig*dj0Mtemp10 dJ1sum01 = dudsig*dj0Mtemp01 dJ1sum11 = dudsig*dj0Mtemp11 drTE = dJ1sum01/M1sum11 - M1sum01/(M1sum11**2)*dJ1sum11 else: #j = nlay utemp0 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[nlay-1])*sig[nlay-1]) dudsig = 0.5*1j*w*mu_0*(1+chi[j])/utemp0 h_1 = thick[nlay-2] utemp_1 = np.sqrt(lamda**2+1j*w*mu_0*(1+chi[nlay-2])*sig[nlay-2]) const0 = mu_0*(1+chi[nlay-2])/(mu_0*(1+chi[nlay-1])*utemp_1) dj0Mtemp00 = 0.5*(const0)*np.exp(-2.*utemp_1*h_1) dj0Mtemp10 = -0.5*(const0) dj0Mtemp01 = -0.5*(const0)*np.exp(-2.*utemp_1*h_1) dj0Mtemp11 = 0.5*(const0) dJ_10Mtemp00 = dj0Mtemp00 dJ_10Mtemp10 = dj0Mtemp10 dJ_10Mtemp01 = dj0Mtemp01 dJ_10Mtemp11 = dj0Mtemp11 dJ00.append(dudsig*dJ_10Mtemp00) dJ10.append(dudsig*dJ_10Mtemp10) dJ01.append(dudsig*dJ_10Mtemp01) dJ11.append(dudsig*dJ_10Mtemp11) for i in range (nlay): dJ0sum00 = np.zeros(lamda.size, dtype=complex) dJ0sum10 = np.zeros(lamda.size, dtype=complex) dJ0sum01 = np.zeros(lamda.size, dtype=complex) dJ0sum11 = np.zeros(lamda.size, dtype=complex) dJ1sum00 = np.zeros(lamda.size, dtype=complex) dJ1sum10 = np.zeros(lamda.size, dtype=complex) dJ1sum01 = np.zeros(lamda.size, dtype=complex) dJ1sum11 = np.zeros(lamda.size, dtype=complex) if i==0: for j in range (nlay-2): if j==0: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ00[i], dJ10[i], dJ01[i], dJ11[i], M00[j+2], M10[j+2], M01[j+2], M11[j+2] ) else: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, M00[j+2], M10[j+2], M01[j+2], M11[j+2] ) dJ0sum00 = dJ1sum00 dJ0sum10 = dJ1sum10 dJ0sum01 = dJ1sum01 dJ0sum11 = dJ1sum11 elif (i>0) & (i<nlay-1): dJ0sum00 = M00[0] dJ0sum10 = M10[0] dJ0sum01 = M01[0] dJ0sum11 = M11[0] for j in range (nlay-2): if j==i-1: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, dJ00[i], dJ10[i], dJ01[i], dJ11[i] ) elif j < i-1: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, M00[j+1], M10[j+1], M01[j+1], M11[j+1] ) elif j > i-1: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, M00[j+2], M10[j+2], M01[j+2], M11[j+2] ) dJ0sum00 = dJ1sum00 dJ0sum10 = dJ1sum10 dJ0sum01 = dJ1sum01 dJ0sum11 = dJ1sum11 elif i==nlay-1: dJ0sum00 = M00[0] dJ0sum10 = M10[0] dJ0sum01 = M01[0] dJ0sum11 = M11[0] for j in range (nlay-1): if j < nlay-2: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, M00[j+1], M10[j+1], M01[j+1], M11[j+1] ) elif j == nlay-2: dJ1sum00, dJ1sum10, dJ1sum01, dJ1sum11 = matmul( dJ0sum00, dJ0sum10, dJ0sum01, dJ0sum11, dJ00[i], dJ10[i], dJ01[i], dJ11[i] ) dJ0sum00 = dJ1sum00 dJ0sum10 = dJ1sum10 dJ0sum01 = dJ1sum01 dJ0sum11 = dJ1sum11 drTE[i, :] = dJ1sum01/M1sum11 - M1sum01/(M1sum11**2)*dJ1sum11 return drTE # return rTE, drTE
nilq/baby-python
python
from django.core.urlresolvers import reverse from django.http import HttpResponse, HttpResponseForbidden from django.shortcuts import get_object_or_404 from django.views.decorators.csrf import csrf_exempt from django.views.generic import TemplateView from rest_framework.renderers import JSONRenderer from rest_framework.parsers import JSONParser from . import models from . import serializers class JSONResponse(HttpResponse): """ An HttpResponse that renders its content into JSON. """ def __init__(self, data, **kwargs): content = JSONRenderer().render(data) kwargs['content_type'] = 'application/json' super(JSONResponse, self).__init__(content, **kwargs) def root(request): return JSONResponse({"name": "The DataShed Annotation Store.", "version": "0.0.1"}) @csrf_exempt def index_create(request): if request.method == "GET": annotations = models.Annotation.objects.all() serializer = serializers.AnnotationSerializer(annotations, many=True) return JSONResponse(serializer.data) if request.method == "POST": data = JSONParser().parse(request) serializer = serializers.AnnotationSerializer(data=data) if serializer.is_valid(): serializer.save() return JSONResponse(serializer.data, status=201) # TODO: The below is what *should* happen... response = HttpResponse(status=303) response["Location"] = reverse("read_update_delete", kwargs={"pk": serializer.data["id"]}) return response else: return HttpResponseForbidden(str(serializer.errors)) else: return HttpResponseForbidden() @csrf_exempt def read_update_delete(request, pk): if request.method == "GET": annotation = get_object_or_404(models.Annotation, pk=pk) serializer = serializers.AnnotationSerializer(annotation) return JSONResponse(serializer.data, status=200) elif request.method == "PUT": annotation = get_object_or_404(models.Annotation, pk=pk) data = JSONParser().parse(request) serializer = serializers.AnnotationSerializer(annotation, data=data) if serializer.is_valid(): serializer.save() return JSONResponse(serializer.data, status=200) # TODO: The below is what *should* happen... response = HttpResponse(status=303) response["Location"] = reverse("read_update_delete", kwargs={"pk": serializer.data["id"]}) return response elif request.method == "DELETE": annotation = get_object_or_404(models.Annotation, pk=pk) annotation.delete() return HttpResponse(status=204) else: return HttpResponseForbidden() def search(request): if request.method == "GET": query = {k: v for k, v in request.GET.items()} annotations = models.Annotation.objects.filter(**query) serializer = serializers.AnnotationSerializer(annotations, many=True) return JSONResponse({"total": len(serializer.data), "rows": serializer.data}) else: return HttpResponseForbidden() class DemoView(TemplateView): template_name = "demo.html"
nilq/baby-python
python
import cv2 as cv import numpy as np import math import time beg=time.time() def readimg (xmin,xmax,ymin,ymax): ymins=ymin n=(xmax-xmin+1)*(ymax-ymin+1)*21.25 target=0 while xmin<xmax : while ymin<ymax : target = target+img[xmin,ymin] ymin += 1 xmin += 1 ymin=ymins target=math.floor(target/n) return target def basicTransform(input): dictionary=['鑪','罚','朋','同','团','田','口','厂','十','一','、','。',','] goal=dictionary[input] return goal def imageTransform(xCharN,yCharN): xStep = size[1]/xCharN yStep = size[0]/yCharN print(xStep,yStep) i=0 j=0 finalstr='' while i < size[0]: while j < size[1] : finalstr=finalstr+basicTransform(readimg(math.ceil(i),math.ceil(i+xStep),math.ceil(j),math.ceil(j+yStep))) j=j+xStep i=i+yStep j=0 return finalstr def textwrite(name,msg): file_path = 'D:/TestFiles/' full_path = file_path + name + '.txt' file = open(full_path,'w') file.write(msg) file.close() print('Done') number=10000 while number <=13595: print(number) img = cv.imread("D:/[WPF]JJDown/Download/rua/"+str(number)+".jpg",cv.IMREAD_GRAYSCALE) size=np.shape(img) print (size) text = imageTransform(157,77) textwrite(str(number),text) number+=1 end=time.time() runTime=beg-end print(runTime)
nilq/baby-python
python
#!/usr/local/bin/python import ogr, osr import datetime print "Start: ", datetime.datetime.now() for i in range(10000): pointX = -84 pointY = 38 inputESPG = 4267 outputEPSG = 2246 point = ogr.Geometry(ogr.wkbPoint) point.AddPoint(pointX, pointY) inSpatialRef = osr.SpatialReference() inSpatialRef.ImportFromEPSG(inputESPG) outSpatialRef = osr.SpatialReference() outSpatialRef.ImportFromEPSGA(outputEPSG) coordTransform = osr.CoordinateTransformation(inSpatialRef, outSpatialRef) point.Transform(coordTransform) print "end: ", datetime.datetime.now() print point.GetX(), point.GetY()
nilq/baby-python
python
#!/usr/local/bin/python3 from MPL3115A2 import MPL3115A2 from si7021 import Si7021 from pms5003 import PMS5003 from smbus import SMBus import influxdb_client from influxdb_client import InfluxDBClient import time import logging hostname="indoors" logging.basicConfig(level=logging.DEBUG) mpl = MPL3115A2(1, fetchPressure=False) si = Si7021(SMBus(1)) pms5003 = PMS5003(device='/dev/ttyAMA0', baudrate=9600, pin_enable=22, pin_reset=27) influxdb = InfluxDBClient(url="http://filtr.home.rkas.net:9999", token="dyuhAG11e2qX7dAvsZx9DvmZT8kG006pgyaTnYQ62_I9uwHitjy7PnGW8gLEZctZGCLKbgqcsJKOuJYNfEvGnA==") influx_write_client = influxdb.write_api() def readMPL(): #print("🗻 Altitude is %.3f" % mpl.altitude) pressure = mpl.pressure temp = mpl.temperature print("🌬 Pressure is %.2f" % pressure) print("🌡 Temp is %.3f°C (%.3f°F)" % (temp, (temp * 1.8 + 32.0))) return [f"weather,host={hostname},sensor=MPL3115A2 pressure={pressure}", f"weather,host={hostname},sensor=MPL3115A2 temperature={temp}"] def readSi(): (humidity, temp) = si.read() print("🌡 Temp is %.3f°C (%.3f°F)" % (temp, (temp * 1.8 + 32.0))) print("🌫 Relative humidity is %0.2f%%" % humidity) data = [f"weather,host={hostname},sensor=Si7021 temperature={temp}"] # Filter out undiagnosed spikes of 100% humidity if humidity < 100: data += [f"weather,host={hostname},sensor=Si7021 humidity={humidity}"] return data def readPMS(): pmsdata = pms5003.read() pm10 = pmsdata.pm_ug_per_m3(1.0) pm25 = pmsdata.pm_ug_per_m3(2.5) pm100 = pmsdata.pm_ug_per_m3(10) print("✨ PM1.0 ug/m3: %d" % pm10) print("✨ PM2.5 ug/m3: %d" % pm25) print("✨ PM10 ug/m3: %d" % pm100) return [f"airquality,host={hostname},sensor=PMS5003 pm10={pm10}", f"airquality,host={hostname},sensor=PMS5003 pm25={pm25}", f"airquality,host={hostname},sensor=PMS5003 pm100={pm100}"] while True: print("-----") datapoints = [] try: datapoints += readMPL() except Exception as e: print(f"Exception: {e}") pass try: datapoints += readSi() except: print(f"Exception: {e}") pass try: datapoints += readPMS() except: print(f"Exception: {e}") pass print("Writing datapoints:\n%s" % ",\n".join(datapoints)) influx_write_client.write("FWAP", "farkhome", datapoints) print("-----") time.sleep(60)
nilq/baby-python
python
#! /usr/bin/env python #coding=utf8 import os import sys if __name__ == '__main__': if len(sys.argv) < 2: print 'USAGE: commit message' sys.exit() commit_msg = sys.argv[1] os.system('git pull origin master') os.system('git status') os.system('git add ./') os.system('git commit * -m "%s"'%commit_msg) os.system('git push origin master')
nilq/baby-python
python
#!/usr/bin/env python from csv import DictReader import numpy as np import matplotlib.pyplot as plt from PIL import Image from wordcloud import WordCloud from snli_cooccur import mkdirp_parent DEFAULT_COLOR_NAME = '#1f497d' DEFAULT_RELATIVE_SCALING = 1. DEFAULT_WIDTH = 800 DEFAULT_HEIGHT = 400 DEFAULT_MAX_WORDS = 50 DEFAULT_COLOR_MAP_RANGE = (0., 1.) def parse_color_map_range(s): t = tuple(map(float, s.split(','))) if len(t) != 2: raise ValueError('color map range must be two comma-delimited numbers') if t[0] > t[1]: raise ValueError('lower bound of color map range must be no greater ' 'than upper bound') if t[0] < 0 or t[1] > 1: raise ValueError('color map range must be within [0, 1]') return t def top_y_csv_to_word_cloud(input_path, query, x, output_path, mask_path=None, color_name=DEFAULT_COLOR_NAME, color_map_name=None, color_map_range=DEFAULT_COLOR_MAP_RANGE, relative_scaling=DEFAULT_RELATIVE_SCALING, background_color_name=None, max_words=DEFAULT_MAX_WORDS, width=DEFAULT_WIDTH, height=DEFAULT_HEIGHT): y_scores = dict() with open(input_path) as f: reader = DictReader(f) for row in reader: if row['query'] == query and row['x'] == x: y_scores[row['y']] = float(row['score']) if not y_scores: raise ValueError('found no rows matching query %s and row %s' % (query, x)) mask = None if mask_path is None else np.array(Image.open(mask_path)) cmap = None if color_map_name is None else plt.get_cmap(color_map_name) def color_func(word, font_size, position, orientation, font_path, random_state): if cmap is None: return color_name else: u = random_state.uniform(*color_map_range) (r, g, b, a) = 255 * np.array(cmap(u)) return 'rgb(%.0f, %.0f, %.0f)' % (r, g, b) wordcloud = WordCloud( max_words=max_words, stopwords=(), prefer_horizontal=0.9, width=width, height=height, margin=2, relative_scaling=relative_scaling, mode='RGBA', color_func=color_func, background_color=background_color_name, mask=mask, collocations=False, normalize_plurals=False, regexp=r'\S+', ) wordcloud.generate_from_frequencies(y_scores) image = wordcloud.to_image() mkdirp_parent(output_path) with open(output_path, 'wb') as f: image.save(f, format='png') def main(): from argparse import ArgumentParser, ArgumentDefaultsHelpFormatter parser = ArgumentParser( description='Generate word cloud from CSV top-y results', formatter_class=ArgumentDefaultsHelpFormatter) parser.add_argument('input_path', help='path to input CSV file') parser.add_argument('query', help='query for which top y will be visualized') parser.add_argument('x', help='x for which top y will be visualized ' '(must appear in specified query)') parser.add_argument('output_path', help='path to output PNG file') parser.add_argument('--mask-path', help='path to image mask PNG file') parser.add_argument('--background-color-name', help='name of background color (default: transparent)') parser.add_argument('--color-name', default=DEFAULT_COLOR_NAME, help='name of text color') parser.add_argument('--color-map-name', help='name of color map to select word colors from ' '(randomly) (default: use color-name for all ' 'words)') parser.add_argument('--color-map-range', type=parse_color_map_range, default=DEFAULT_COLOR_MAP_RANGE, help='range of color map to use (as two ' 'comma-delimited floats, a lower bound and an ' 'upper bound)') parser.add_argument('--max-words', type=int, default=DEFAULT_MAX_WORDS, help='number of words to display') parser.add_argument('--width', type=int, default=DEFAULT_WIDTH, help='width of image, in pixels') parser.add_argument('--height', type=int, default=DEFAULT_HEIGHT, help='height of image, in pixels') parser.add_argument('--relative-scaling', type=float, default=DEFAULT_RELATIVE_SCALING, help='degree to which score (rather than rank) is ' 'used to scale words') args = parser.parse_args() top_y_csv_to_word_cloud(args.input_path, args.query, args.x, args.output_path, mask_path=args.mask_path, background_color_name=args.background_color_name, color_name=args.color_name, color_map_name=args.color_map_name, color_map_range=args.color_map_range, width=args.width, height=args.height, relative_scaling=args.relative_scaling) if __name__ == '__main__': main()
nilq/baby-python
python
# -*- coding: utf-8 -*- from __future__ import absolute_import, division, print_function import os from unittest import TestCase from flaky import flaky from polyaxon_schemas.ops.build_job import BuildConfig from polyaxon_schemas.ops.environments.pods import EnvironmentConfig from polyaxon_schemas.ops.environments.resources import K8SResourcesConfig, PodResourcesConfig from polyaxon_schemas.ops.experiment.frameworks import ExperimentFramework from polyaxon_schemas.ops.group.early_stopping_policies import EarlyStoppingConfig from polyaxon_schemas.ops.group.hptuning import HPTuningConfig, SearchAlgorithms from polyaxon_schemas.ops.group.matrix import MatrixConfig from polyaxon_schemas.ops.logging import LoggingConfig from polyaxon_schemas.polyaxonfile import PolyaxonFile from polyaxon_schemas.specs.frameworks import TensorflowSpecification from polyaxon_schemas.utils import TaskType class TestPolyaxonfileDeprecation(TestCase): def test_simple_file_framework_passes(self): plxfile = PolyaxonFile(os.path.abspath('tests/fixtures/deprecated/simple_file_framework.yml')) spec = plxfile.specification spec.apply_context() assert spec.version == 1 assert spec.logging is None assert spec.tags is None assert spec.build.dockerfile == 'Dockerfile' assert spec.run.cmd == 'video_prediction_train --model=DNA --num_masks=1' assert spec.environment is not None assert spec.environment.resources.gpu.to_dict() == {'requests': 1, 'limits': 1} assert spec.environment.outputs.to_dict() == {'jobs': [111], 'experiments': None} assert spec.framework is not None assert spec.is_experiment is True def test_deprecated_advanced_file_passes(self): plxfile = PolyaxonFile(os.path.abspath('tests/fixtures/deprecated/advanced_file.yml')) spec = plxfile.specification spec.apply_context() assert spec.version == 1 assert isinstance(spec.logging, LoggingConfig) assert spec.is_experiment assert isinstance(spec.environment, EnvironmentConfig) assert spec.framework == ExperimentFramework.TENSORFLOW assert spec.config.tensorflow.n_workers == 5 assert spec.config.tensorflow.n_ps == 10 # check properties for returning worker configs and resources assert spec.config.tensorflow.worker_resources == {} assert spec.config.tensorflow.ps_resources == {} cluster, is_distributed = spec.cluster_def assert TensorflowSpecification.get_worker_resources( environment=spec.config.tensorflow, cluster=cluster, is_distributed=is_distributed ) == {} assert TensorflowSpecification.get_ps_resources( environment=spec.config.tensorflow, cluster=cluster, is_distributed=is_distributed ) == {} assert spec.cluster_def == ({TaskType.MASTER: 1, TaskType.WORKER: 5, TaskType.PS: 10}, True) def test_deprecated_notebook_job_with_node_selectors(self): plxfile = PolyaxonFile(os.path.abspath( 'tests/fixtures/deprecated/notebook_with_custom_environment.yml')) spec = plxfile.specification spec.apply_context() assert spec.version == 1 assert spec.is_notebook assert spec.is_notebook is True assert spec.backend is None assert spec.logging is None assert sorted(spec.tags) == sorted(['foo', 'bar']) assert isinstance(spec.build, BuildConfig) assert isinstance(spec.environment, EnvironmentConfig) assert spec.artifact_refs == ['outputs1'] assert spec.data_refs == ['data1', 'data2'] assert spec.config_map_refs == ['config_map1', 'config_map2'] node_selector = {'polyaxon.com': 'node_for_notebook_jobs'} assert spec.environment.node_selector == node_selector assert spec.node_selector == node_selector resources = { 'cpu': {'requests': 1, 'limits': 2}, 'memory': {'requests': 200, 'limits': 200}, } assert spec.environment.resources.to_dict() == resources assert spec.resources.to_dict() == resources affinity = { 'nodeAffinity': {'requiredDuringSchedulingIgnoredDuringExecution': {}} } assert spec.environment.affinity == affinity assert spec.affinity == affinity tolerations = [{'key': 'key', 'operator': 'Exists'}] assert spec.environment.tolerations == tolerations assert spec.tolerations == tolerations def test_deprecated_advanced_file_with_custom_configs_and_resources_passes(self): plxfile = PolyaxonFile(os.path.abspath( 'tests/fixtures/deprecated/advanced_file_with_custom_configs_and_resources.yml')) spec = plxfile.specification spec.apply_context() assert spec.version == 1 assert isinstance(spec.logging, LoggingConfig) assert spec.is_experiment assert isinstance(spec.environment, EnvironmentConfig) assert spec.framework == ExperimentFramework.TENSORFLOW assert spec.artifact_refs == ['outputs1'] assert spec.data_refs == ['data1', 'data2'] assert spec.config_map_refs == ['config_map1', 'config_map2'] assert spec.config.tensorflow.n_workers == 5 assert spec.config.tensorflow.n_ps == 10 assert isinstance(spec.environment.resources, PodResourcesConfig) assert isinstance(spec.environment.resources.cpu, K8SResourcesConfig) assert spec.environment.resources.cpu.requests == 1 assert spec.environment.resources.cpu.limits == 2 assert spec.config.tensorflow.default_worker_node_selector == { 'foo': True } assert spec.config.tensorflow.worker_resources == {} assert spec.config.tensorflow.worker_affinities == {} assert isinstance(spec.config.tensorflow.worker_node_selectors[3], dict) assert spec.config.tensorflow.worker_node_selectors[3] == { 'foo': False } assert isinstance(spec.config.tensorflow.worker_tolerations[4], list) assert spec.config.tensorflow.worker_tolerations[4] == [{ 'key': 'key', 'operator': 'Exists', 'effect': 'NoSchedule', }] assert isinstance(spec.config.tensorflow.default_ps_resources, PodResourcesConfig) assert isinstance(spec.config.tensorflow.default_ps_resources.cpu, K8SResourcesConfig) assert spec.config.tensorflow.default_ps_resources.cpu.requests == 2 assert spec.config.tensorflow.default_ps_resources.cpu.limits == 4 assert spec.config.tensorflow.ps_node_selectors == {} assert isinstance(spec.config.tensorflow.ps_tolerations[7], list) assert spec.config.tensorflow.ps_tolerations[7] == [{ 'operator': 'Exists' }] assert isinstance(spec.config.tensorflow.ps_affinities[7], dict) assert isinstance(spec.config.tensorflow.ps_resources[9], PodResourcesConfig) assert isinstance(spec.config.tensorflow.ps_resources[9].memory, K8SResourcesConfig) assert spec.config.tensorflow.ps_resources[9].memory.requests == 512 assert spec.config.tensorflow.ps_resources[9].memory.limits == 1024 # check that properties for return list of configs and resources is working cluster, is_distributed = spec.cluster_def worker_node_selectors = TensorflowSpecification.get_worker_node_selectors( environment=spec.config.tensorflow, cluster=cluster, is_distributed=is_distributed ) assert len(worker_node_selectors) == spec.config.tensorflow.n_workers assert set([i['foo'] for i in worker_node_selectors.values()]) == { spec.config.tensorflow.default_worker_node_selector['foo'], spec.config.tensorflow.worker_node_selectors[3]['foo']} assert TensorflowSpecification.get_worker_resources( environment=spec.config.tensorflow, cluster=cluster, is_distributed=is_distributed ) == {} ps_resources = TensorflowSpecification.get_ps_resources( environment=spec.config.tensorflow, cluster=cluster, is_distributed=is_distributed ) assert len(ps_resources) == spec.config.tensorflow.n_ps assert set(ps_resources.values()) == { spec.config.tensorflow.default_ps_resources, spec.config.tensorflow.ps_resources[9]} # Check total resources assert spec.total_resources == { 'cpu': {'requests': 1 + 2 * 9, 'limits': 2 + 4 * 9}, 'memory': {'requests': 512, 'limits': 1024}, } assert spec.cluster_def == ({TaskType.MASTER: 1, TaskType.WORKER: 5, TaskType.PS: 10}, True)
nilq/baby-python
python
#!/usr/bin/env python from typing import NamedTuple from hummingbot.market.market_base import MarketBase class ArbitrageMarketPair(NamedTuple): """ Specifies a pair of markets for arbitrage """ market_1: MarketBase market_1_trading_pair: str market_1_base_asset: str market_1_quote_asset: str market_2: MarketBase market_2_trading_pair: str market_2_base_asset: str market_2_quote_asset: str
nilq/baby-python
python
param_names = [\ 'Kon_IL13Rec', 'Rec_phosphorylation', 'pRec_intern', 'pRec_degradation', 'Rec_intern', 'Rec_recycle', 'JAK2_phosphorylation', 'pJAK2_dephosphorylation', 'STAT5_phosphorylation', 'pSTAT5_dephosphorylation', 'SOCS3mRNA_production', 'DecoyR_binding', 'JAK2_p_inhibition', 'SOCS3_translation', 'SOCS3_accumulation', 'SOCS3_degradation', 'CD274mRNA_production', # 'len_f_params'\ ] for idx,name in enumerate(param_names): exec('%s=%d'%(name,idx))
nilq/baby-python
python
import datetime import genshin async def test_diary(lclient: genshin.Client, genshin_uid: int): diary = await lclient.get_diary() assert diary.uid == genshin_uid == lclient.uids[genshin.Game.GENSHIN] assert diary.nickname == "sadru" assert diary.month == datetime.datetime.now().month assert diary.data.current_mora > 0 async def test_diary_log(lclient: genshin.Client, genshin_uid: int): log = lclient.diary_log(limit=10) data = await log.flatten() assert data[0].amount > 0 assert log.data.uid == genshin_uid == lclient.uids[genshin.Game.GENSHIN] assert log.data.nickname == "sadru" assert log.data.month == datetime.datetime.now().month
nilq/baby-python
python
""" A :class:`~miso.data.dataset_readers.dataset_reader.DatasetReader` reads a file and converts it to a collection of :class:`~miso.data.instance.Instance` s. The various subclasses know how to read specific filetypes and produce datasets in the formats required by specific models. """ # pylint: disable=line-too-long from .decomp import DecompDatasetReader
nilq/baby-python
python
import numpy as np from napari.components import Camera def test_camera(): """Test camera.""" camera = Camera() assert camera.center == (0, 0, 0) assert camera.zoom == 1 assert camera.angles == (0, 0, 90) center = (10, 20, 30) camera.center = center assert camera.center == center assert camera.angles == (0, 0, 90) zoom = 200 camera.zoom = zoom assert camera.zoom == zoom angles = (20, 90, 45) camera.angles = angles assert camera.angles == angles def test_calculate_view_direction_3d(): """Check that view direction is calculated properly from camera angles.""" # simple case camera = Camera(center=(0, 0, 0), angles=(90, 0, 0), zoom=1) assert np.allclose(camera.view_direction, (0, 1, 0)) # shouldn't change with zoom camera = Camera(center=(0, 0, 0), angles=(90, 0, 0), zoom=10) assert np.allclose(camera.view_direction, (0, 1, 0)) # shouldn't change with center camera = Camera(center=(15, 15, 15), angles=(90, 0, 0), zoom=1) assert np.allclose(camera.view_direction, (0, 1, 0)) def test_calculate_view_direction_nd(): """Check that nD view direction is calculated properly.""" camera = Camera(center=(0, 0, 0), angles=(90, 0, 0), zoom=1) # should return none if ndim == 2 view_direction = camera.calculate_nd_view_direction( ndim=2, dims_displayed=[0, 1] ) assert view_direction is None # should return 3d if ndim == 3 view_direction = camera.calculate_nd_view_direction( ndim=3, dims_displayed=[0, 1, 2] ) assert len(view_direction) == 3 assert np.allclose(view_direction, (0, 1, 0)) # should return nD with 3d embedded in nD if ndim > 3 view_direction = camera.calculate_nd_view_direction( ndim=5, dims_displayed=[0, 2, 4] ) assert len(view_direction) == 5 assert np.allclose(view_direction[[0, 2, 4]], (0, 1, 0))
nilq/baby-python
python
class APIError(Exception): """ Simple error handling """ codes = { 204: 'No Results', 400: 'Bad Request', 401: 'Unauthorized', 402: 'Unauthorized (Payment Required)', 403: 'Forbidden', 404: 'Not Found', 413: 'Too Much Data Given', 429: 'Too Many Requests (Rate Limiting)', 500: 'Internal Server Error', 501: 'Not Implemented', 503: 'Service Unavailable' } def __init__(self, msg, code=0): Exception.__init__(self) self.msg = msg self.code = code def __str__(self): return "HTTP error code %s: %s (%s)" % (self.code, self.codes.get(self.code, 'Communication Error'), self.msg)
nilq/baby-python
python
ta=[1,2,3] tb=[9,8,7] # cluster zipped=zip(ta,tb) print('zip(ta,tb)=',zip(ta,tb)) #decompose na,nb=zip(*zipped) print(na,nb)
nilq/baby-python
python
import os, logging, math import numpy as np import torch import torch.nn as nn from volsim.base_models import * from volsim.simulation_dataset import * from volsim.params import * class DistanceModel(nn.Module): def __init__(self, modelParams:Params, useGPU:bool=True): super(DistanceModel, self).__init__() self.hp = modelParams self.useGPU = useGPU if "multiScale" in self.hp.mBase: base = self.hp.mBase.split("_") try: layers = int(base[1]) except ValueError: layers = 12 try: width = float(base[2]) except ValueError: width = 1 useSkip = "Skip" in self.hp.mBase self.basenet = MultiScaleNet(widthFactor=width, layers=layers, firstChannels=3, useSkip=useSkip) elif "alex" in self.hp.mBase: base = self.hp.mBase.split("_") try: layers = int(base[1]) except ValueError: layers = 5 try: width = float(base[2]) except ValueError: width = 1 convKernel, maxPoolKernel, firstStride = (12, 4, 4) self.basenet = AlexNetLike(widthFactor=width, layers=layers, convKernel=convKernel, maxPoolKernel=maxPoolKernel, firstStride=firstStride) else: raise ValueError('Unknown base network type.') self.normAcc = [] #for normMode max self.normM2 = [] #for normMode mean for i in range(self.basenet.layers): if self.useGPU: self.normAcc += [torch.tensor([0.0], requires_grad=False).cuda()] self.normM2 += [torch.tensor([0.0], requires_grad=False).cuda()] else: self.normAcc += [torch.tensor([0.0], requires_grad=False)] self.normM2 += [torch.tensor([0.0], requires_grad=False)] self.normCount = [0] * self.basenet.layers #for normMode avg self.avgs = [] self.avg0 = self.avgLayer(self.basenet.channels[0])#, self.basenet.featureMapSize[0]) self.avgs += [self.avg0] if self.basenet.layers > 1: self.avg1 = self.avgLayer(self.basenet.channels[1])#, self.basenet.featureMapSize[1]) self.avgs += [self.avg1] if self.basenet.layers > 2: self.avg2 = self.avgLayer(self.basenet.channels[2])#, self.basenet.featureMapSize[2]) self.avgs += [self.avg2] if self.basenet.layers > 3: self.avg3 = self.avgLayer(self.basenet.channels[3])#, self.basenet.featureMapSize[3]) self.avgs += [self.avg3] if self.basenet.layers > 4: self.avg4 = self.avgLayer(self.basenet.channels[4])#, self.basenet.featureMapSize[4]) self.avgs += [self.avg4] if self.basenet.layers > 5: self.avg5 = self.avgLayer(self.basenet.channels[5])#, self.basenet.featureMapSize[5]) self.avgs += [self.avg5] if self.basenet.layers > 6: self.avg6 = self.avgLayer(self.basenet.channels[6])#, self.basenet.featureMapSize[6]) self.avgs += [self.avg6] if self.basenet.layers > 7: self.avg7 = self.avgLayer(self.basenet.channels[7])#, self.basenet.featureMapSize[7]) self.avgs += [self.avg7] if self.basenet.layers > 8: self.avg8 = self.avgLayer(self.basenet.channels[8])#, self.basenet.featureMapSize[8]) self.avgs += [self.avg8] if self.basenet.layers > 9: self.avg9 = self.avgLayer(self.basenet.channels[9])#, self.basenet.featureMapSize[9]) self.avgs += [self.avg9] if self.basenet.layers > 10: self.avg10 = self.avgLayer(self.basenet.channels[10])#, self.basenet.featureMapSize[10]) self.avgs += [self.avg10] if self.basenet.layers > 11: self.avg11 = self.avgLayer(self.basenet.channels[11])#, self.basenet.featureMapSize[11]) self.avgs += [self.avg11] if self.basenet.layers > 12: self.avg12 = self.avgLayer(self.basenet.channels[12])#, self.basenet.featureMapSize[12]) self.avgs += [self.avg12] if self.basenet.layers > 13: self.avg13 = self.avgLayer(self.basenet.channels[13])#, self.basenet.featureMapSize[13]) self.avgs += [self.avg13] if self.basenet.layers > 14: self.avg14 = self.avgLayer(self.basenet.channels[14])#, self.basenet.featureMapSize[14]) self.avgs += [self.avg14] if self.basenet.layers > 15: self.avg15 = self.avgLayer(self.basenet.channels[15])#, self.basenet.featureMapSize[15]) self.avgs += [self.avg15] if self.basenet.layers > 16: self.avg16 = self.avgLayer(self.basenet.channels[16])#, self.basenet.featureMapSize[16]) self.avgs += [self.avg16] if self.basenet.layers > 17: self.avg17 = self.avgLayer(self.basenet.channels[17])#, self.basenet.featureMapSize[17]) self.avgs += [self.avg17] if self.basenet.layers > 18: self.avg18 = self.avgLayer(self.basenet.channels[18])#, self.basenet.featureMapSize[18]) self.avgs += [self.avg18] if self.basenet.layers > 19: self.avg19 = self.avgLayer(self.basenet.channels[19])#, self.basenet.featureMapSize[19]) self.avgs += [self.avg19] # initialize learned average weight layers for avgLayer in self.avgs: for layer in avgLayer: if isinstance(layer, nn.Conv3d): layer.weight.data.fill_(self.hp.mLinInit) if self.useGPU: self.cuda() @classmethod def load(cls, path:str, useGPU:bool=True): if useGPU: print('Loading model from %s' % path) loaded = torch.load(path) else: print('CPU - Loading model from %s' % path) loaded = torch.load(path, map_location=torch.device('cpu')) params = Params.fromDict(loaded['hyperparams']) stateDict = loaded['stateDict'] model = cls(params, useGPU) model.load_state_dict(stateDict) model.eval() if params.mNormMode != "norm": model.normAcc = loaded['normAcc'] model.normM2 = loaded['normM2'] model.normCount = loaded['normCount'] return model def forward(self, x:dict) -> Tuple[torch.Tensor, list]: full = x["data"].cuda() if self.useGPU else x["data"] idxA = x["indexA"][0,x["idxMin"]:x["idxMax"]].long() #only use index of first batch element for entire batch idxB = x["indexB"][0,x["idxMin"]:x["idxMax"]].long() idxA = idxA.cuda() if self.useGPU else idxA idxB = idxB.cuda() if self.useGPU else idxB dataA = torch.index_select(full, 1, idxA) dataB = torch.index_select(full, 1, idxB) dataA = dataA.view(-1,full.shape[2],full.shape[3],full.shape[4],full.shape[5]) dataB = dataB.view(-1,full.shape[2],full.shape[3],full.shape[4],full.shape[5]) dataA = dataA.permute(0,4,1,2,3) # change shape to [batch*sampleSlice,3,128,128,128] dataB = dataB.permute(0,4,1,2,3) self.clampWeights() outBaseA = self.basenet(dataA) outBaseB = self.basenet(dataB) result = torch.tensor([[0.0]]).cuda() if self.useGPU else torch.tensor([[0.0]]) for i in range( len(outBaseA) ): if i in self.hp.mIgnoreLayers: continue #print(outBaseA[i].shape) normalized1 = self.normalizeTensor(outBaseA[i], i) normalized2 = self.normalizeTensor(outBaseB[i], i) if self.hp.mFeatDist == "L1": diff = torch.abs(normalized2 - normalized1) elif self.hp.mFeatDist == "L2" or self.hp.mFeatDist == "L2Sqrt": diff = (normalized2 - normalized1)**2 else: raise ValueError('Unknown feature distance.') weightedDiff = self.avgs[i](diff) result = result + torch.mean(weightedDiff, dim=[2,3,4]) if self.hp.mFeatDist == "L2Sqrt": result = torch.sqrt(result) return torch.squeeze(result, dim=1).view(full.shape[0],-1) # input two numpy arrays with shape [width, height, depth, channel] or shape # [batch, width, height, depth, channel] where channel = 1 or channel = 3 # and return a distance of shape [1] or [batch] # If true, normalize performs a normalization to the models native data range jointly for the full data batch # If true, interpolate performs a spatial interpolation to the models native data size jointly for the full data batch def computeDistance(self, input1:np.ndarray, input2:np.ndarray, normalize:bool, interpolate:bool) -> np.ndarray: assert (not self.training), "Distance computation should happen in evaluation mode!" assert (input1.shape == input2.shape), "Input shape mismatch!" in1 = input1[None,...] if input1.ndim == 4 else input1 in2 = input2[None,...] if input2.ndim == 4 else input2 data_transform = TransformsInference("single", 3, self.hp) if not normalize: data_transform.normalize = "none" if not interpolate: data_transform.outputSize = -1 data = np.concatenate([in1, in2], axis=0) # stack along param dimension dataDict = {"data": data, "path": None, "distance": None, "indexA" : None, "indexB" : None, "idxMin" : None, "idxMax" : None} data = data_transform(dataDict)["data"] nPairs = in1.shape[0] distance = torch.from_numpy(np.zeros(nPairs, dtype=np.float32)) indexA = torch.from_numpy(np.arange(nPairs, dtype=np.int32)) indexB = torch.from_numpy(np.arange(nPairs, dtype=np.int32) + nPairs) path = np.array([""]*nPairs) sample = {"data": data[None,...], "path": path, "distance": distance[None,...], "indexA" : indexA[None,...], "indexB" : indexB[None,...], "idxMin" : 0, "idxMax" : nPairs} output = self(sample) output = output.cpu().detach().view(-1).numpy() return output # ensures that avg layer weights are greater or equal to zero def clampWeights(self): for avgLayer in self.avgs: for layer in avgLayer: if isinstance(layer, nn.Conv3d): layer.weight.data = torch.clamp(layer.weight.data, min=0) # 1x1 convolution layer to scale feature maps channel-wise def avgLayer(self, channelsIn:int) -> nn.Sequential: if self.hp.mLinDropout: return nn.Sequential( nn.Dropout(), nn.Conv3d(channelsIn, 1, 1, stride=1, padding=0, bias=False), ) else: return nn.Sequential( nn.Conv3d(channelsIn, 1, 1, stride=1, padding=0, bias=False), ) # preprocessing step that updates internal accumulators for feature map normalization def updateNorm(self, sample:dict): full = sample["data"].cuda() if self.useGPU else sample["data"] for i in range(full.shape[1]): # do not use index here, only iterate over all data once data = full[:, i] data = data.permute(0,4,1,2,3) # change shape to [batch,3,128,128,128] self.clampWeights() outBase = self.basenet(data) for j in range( len(outBase) ): self.normalizeTensor(outBase[j], j, updateAcc=True) # normalizes feature map tensor along channel dimension with different methods def normalizeTensor(self, tensorIn:torch.Tensor, layer:int, epsilon:float=1e-10, updateAcc:bool=False) -> torch.Tensor: size = tensorIn.size() # unit normalize tensor in channel dimension if self.hp.mNormMode == "normUnit": norm = torch.sqrt( torch.sum(tensorIn**2,dim=1) ) norm = norm.view(size[0], 1, size[2], size[3], size[4]) return tensorIn / (norm.expand_as(tensorIn) + epsilon) elif self.hp.mNormMode == "normMeanLayerGlobal": if updateAcc: self.normCount[layer] = self.normCount[layer] + size[0] delta = tensorIn - self.normAcc[layer].expand_as(tensorIn) self.normAcc[layer] = self.normAcc[layer] + torch.sum( torch.mean(delta / self.normCount[layer], dim=1) , dim=0) self.normM2[layer] = self.normM2[layer] + torch.sum( torch.mean(delta *(tensorIn - self.normAcc[layer].expand_as(tensorIn)), dim=1) , dim=0) # rescale norm accumulators for differently sized inputs if size[2] != self.normAcc[layer].shape[0] or size[3] != self.normAcc[layer].shape[1] or size[4] != self.normAcc[layer].shape[2]: up = nn.Upsample(size=(size[2], size[3], size[4]), mode="trilinear", align_corners=True) normAcc = torch.squeeze(up( torch.unsqueeze(torch.unsqueeze(self.normAcc[layer].detach(), dim=0), dim=0) )) normM2 = torch.squeeze(up( torch.unsqueeze(torch.unsqueeze(self.normM2[layer].detach(), dim=0), dim=0) )) mean = normAcc mean = mean.view(1, 1, size[2], size[3], size[4]) std = torch.sqrt( normM2 / (self.normCount[layer] - 1) ) std = std.view(1, 1, size[2], size[3], size[4]) # directly use norm accumulators for matching input size else: mean = self.normAcc[layer] mean = mean.view(1, 1, size[2], size[3], size[4]) std = torch.sqrt( self.normM2[layer] / (self.normCount[layer] - 1) ) std = std.view(1, 1, size[2], size[3], size[4]) normalized = (tensorIn - mean.expand_as(tensorIn)) / (std.expand_as(tensorIn) + epsilon) normalized2 = normalized / (math.sqrt(size[1]) - 1) return normalized2 elif self.hp.mNormMode == "normNone": return tensorIn else: raise ValueError('Unknown norm mode.') def printModelInfo(self): parameters = filter(lambda p: p.requires_grad, self.parameters()) params = sum([np.prod(p.size()) for p in parameters]) print("Trainable parameters: %d" % params) print(self) print("") logging.info("Trainable parameters: %d" % params) logging.info(self) logging.info("") def save(self, path:str, override:bool=False, noPrint:bool=False): if not noPrint: print('Saving model to %s' % path) if not override and os.path.isfile(path): raise ValueError("Override warning!") else: saveDict = {'stateDict' : self.state_dict(), 'hyperparams' : self.hp.asDict(),} if self.hp.mNormMode != "norm": saveDict['normAcc'] = self.normAcc saveDict['normM2'] = self.normM2 saveDict['normCount'] = self.normCount torch.save(saveDict, path) def resume(self, path:str): if self.useGPU: print('Resuming model from %s' % path) loaded = torch.load(path) else: print('CPU - Resuming model from %s' % path) loaded = torch.load(path, map_location=torch.device('cpu')) self.load_state_dict(loaded['stateDict']) self.hp = Params().fromDict(loaded['hyperparams']) if self.hp.mNormMode != "norm": self.normAcc = loaded['normAcc'] self.normM2 = loaded['normM2'] self.normCount = loaded['normCount']
nilq/baby-python
python
"""Add hostname column to the resources table Revision ID: 58a12e45663e Revises: 06ce06e9bb85 Create Date: 2020-10-20 18:24:40.267394 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = '58a12e45663e' down_revision = '06ce06e9bb85' branch_labels = None depends_on = None def upgrade(): with op.batch_alter_table('resources') as batch_op: batch_op.add_column(sa.Column('hostname', sa.String(length=64), nullable=True)) def downgrade(): with op.batch_alter_table('resources') as batch_op: batch_op.drop_column('hostname')
nilq/baby-python
python
from cantoolz.module import * from cantoolz.uds import * import json class control_ecu_doors(CANModule): name = "Doors trigger for vircar" help = """ This module emulating lock control. Init params (example): { 'id_report': {0x91:'Left', 0x92:'Right'}, 'id_command': 0x81, 'commands': { 'lock':'1000', 'unlock':'10ff', 'init': '00ff', }, 'reports': { 'Locked': '2000', 'Unlocked': '20ff' } } """ _active = True def do_init(self, params): self._status2 = params self.frames = [] self._doors = {} self._cmdList['status'] = Command("Get doors status", 0, "", self.control_get_status, True) self._cmdList['central_lock'] = Command("Lock doors", 0, "", self.control_lock, True) self._cmdList['central_unlock'] = Command("Unlock doors", 0, "", self.control_unlock, True) def control_lock(self, flag): self.frames.append(CANMessage(self._status2['id_command'],int(len(self._status2['commands']['lock'])/2),bytes.fromhex(self._status2['commands']['lock']),False, CANMessage.DataFrame)) return "" def control_unlock(self, flag): self.frames.append(CANMessage(self._status2['id_command'],int(len(self._status2['commands']['unlock'])/2),bytes.fromhex(self._status2['commands']['unlock']),False, CANMessage.DataFrame)) return "" def control_get_status(self, flag): json_string = json.dumps({'status': self._doors}) return json_string # Effect (could be fuzz operation, sniff, filter or whatever) def do_effect(self, can_msg, args): if args['action'] == 'read' and can_msg.CANData: # READ if can_msg.CANFrame.frame_id in self._status2.get('id_report', {}).keys(): for status, code in self._status2['reports'].items(): if can_msg.CANFrame.frame_length == int(len(code)/2) and code == self.get_hex(can_msg.CANFrame.frame_raw_data): self._doors.update( {self._status2['id_report'][can_msg.CANFrame.frame_id]: status} ) if args['action'] == 'write' and not can_msg.CANData: if len(self.frames) > 0: can_msg.CANFrame = self.frames.pop(0) can_msg.CANData = True can_msg.bus = self._bus return can_msg
nilq/baby-python
python
# Under MIT licence, see LICENCE.txt import random from typing import List from Util import Pose, Position from Util.ai_command import MoveTo from Util.constant import BALL_RADIUS, ROBOT_RADIUS, POSITION_DEADZONE, ANGLE_TO_HALT from Util.geometry import compare_angle from ai.GameDomainObjects.player import Player from ai.STA.Tactic.tactic import Tactic from ai.states.game_state import GameState ORIENTATION_DEADZONE = 0.2 DISTANCE_TO_KICK_REAL = ROBOT_RADIUS * 3.4 DISTANCE_TO_KICK_SIM = ROBOT_RADIUS + BALL_RADIUS COMMAND_DELAY = 1.5 class GoToRandomPosition(Tactic): def __init__(self, game_state: GameState, player: Player, args: List[str]=None, center_of_zone=Position(0, 0), height_of_zone=800, width_of_zone=800): super().__init__(game_state, player, args=args) self.current_state = self.main_state self.next_state = self.main_state self.center_of_zone = center_of_zone self.height_of_zone = height_of_zone self.width_of_zone = width_of_zone self.bottom_left_corner = Position(self.center_of_zone[0] - self.width_of_zone / 2, self.center_of_zone[1] - self.height_of_zone / 2) self.grid_of_positions = [] discretisation = 100 for i in range(int(self.width_of_zone / discretisation)): for j in range(int(self.height_of_zone / discretisation)): self.grid_of_positions.append(self.bottom_left_corner + Position(discretisation * i, discretisation * j)) self.current_position_index_to_go = random.randint(0, len(self.grid_of_positions) - 1) self.current_position_to_go = self.grid_of_positions[self.current_position_index_to_go] self.current_angle_to_go = 0 #random.randint(0, 100) * np.pi / 100. self.next_pose = Pose(self.current_position_to_go, self.current_angle_to_go) def main_state(self): if self.check_success(): self.current_position_index_to_go = random.randint(0, len(self.grid_of_positions) - 1) self.current_position_to_go = self.grid_of_positions[self.current_position_index_to_go] #self.current_angle_to_go = random.randint(-1, 1) * np.pi / 100. self.next_pose = Pose(self.current_position_to_go, self.current_angle_to_go) return MoveTo(self.next_pose, cruise_speed=2) def check_success(self): distance = (self.player.pose.position - self.next_pose.position).norm if distance < POSITION_DEADZONE and compare_angle(self.player.pose.orientation, self.next_pose.orientation, abs_tol=ANGLE_TO_HALT): return True return False
nilq/baby-python
python
import factory import json from django.test import TestCase, Client from django.urls import reverse from django.test import RequestFactory from django.contrib.auth.models import AnonymousUser from movies.models import Movie from movies.views import home from movies.forms import SearchMovieForm from movie_database.users.models import User class MovieFactory(factory.DjangoModelFactory): class Meta: model = Movie django_get_or_create = ('title',) title = 'Spiderman' # data = json.dumps({'Year': '2001'}) class FavouriteTests(TestCase): def setUp(self): self.movie = MovieFactory() self.factory = RequestFactory() self.user = User.objects.create_user( username='jacob', email='jacob@gmail.com', password='topsecret' ) self.client = Client() def test_home_page(self): self.client.force_login(user=self.user) response = self.client.get(reverse('home')) self.assertEqual(response.status_code, 200) self.assertIsInstance(response.context['form'], SearchMovieForm) self.assertTemplateUsed(response, template_name="pages/home.html") def test_home_page_form(self): data = {'title': 'Spiderman'} form = SearchMovieForm(data=data) self.assertTrue(form.is_valid())
nilq/baby-python
python
import spatialfacet import numpy as np from matplotlib import pyplot as plt from shapely.geometry import Polygon, Point U = Polygon([[-1,-1], [-1,1], [0,1], [0,-1], [-1,-1]]) V = Polygon([[0,-1], [0,1], [1,1], [1,-1], [0,-1]]) U_minus = Polygon([[-1,0.75], [-1,1], [0,1], [0,0.75], [-1,0.75]]) print(U) s = spatialfacet.SpatialFacetMiner() s.add_database("databases/simple","german") s.query("red blue",1,20,1000) c0, c1, docs,wt = s.getSpyData(); v1,values = s.getSpyStringData(); print(c0) print("="*50) print(c1) print("="*50) print(docs) print("="*50) print(wt) print("="*50) print(v1) print("="*50) print(values) print("="*50) plt.scatter(c0,c1, s=(15*wt)**2+5) plt.savefig("test.png") ## facet def get_facet (c0,c1,U): return ([rowid for x,y,rowid in zip(c0,c1,range(c0.shape[0])) if Point([x,y]).within(U)]) facet = { "U": get_facet(c0,c1,U), "V": get_facet(c0,c1,V), "U-": get_facet(c0,c1,U_minus), } print(facet) ## now propose query terms out = s.augment("red", [1,2,3], 5) print(out) print(s.query_with_data("red green",1,10,1)) print(s.query("red green",1,10,1))
nilq/baby-python
python
import numpy def diff(features1, features2): pixelMap1 = numpy.asarray(features1) pixelMap2 = numpy.asarray(features2) return numpy.linalg.norm(pixelMap1-pixelMap2) def highOrSober(soberFeatures, highFeatures, queryFeatures): if(diff(soberFeatures, queryFeatures) < diff(highFeatures, queryFeatures)): return "sober" else: return "high"
nilq/baby-python
python
try: from setuptools import setup except ImportError: from distutils.core import setup config = { 'description': 'A tiny Python/C library for loading MIAS images from file.', 'author': 'Samuel Jackson', 'url': 'http://github.com/samueljackson92/mias-loader', 'download_url': 'http://github.com/samueljackson92/mias-loader', 'author_email': 'samueljackson@outlook.com', 'version': '0.1.0', 'install_requires': [ 'numpy' ], 'py_modules': ['mias_load'], 'name': 'mias_loader' } setup(**config)
nilq/baby-python
python
from PIL import Image import gym import gym_pacman import time env = gym.make('BerkeleyPacmanPO-v0') env.seed(1) done = False while True: done = False env.reset() i = 0 while i < 100: i += 1 s_, r, done, info = env.step(env.action_space.sample()) env.render() print("Iteration over")
nilq/baby-python
python
from asyncio import sleep from requests import get from main import bot, reg_handler, des_handler, par_handler async def diss(message, args, origin_text): await message.edit("获取中 . . .") status = False for _ in range(20): req = get("https://nmsl.shadiao.app/api.php?level=min&from=tntcrafthim") if req.status_code == 200: res = req.text await message.edit(res, parse_mode='html') status = True break else: continue if status == False: await message.edit("出错了呜呜呜 ~ 试了好多好多次都无法访问到 API 服务器 。") await sleep(2) await message.delete() async def biss(message, args, origin_text): await message.edit("获取中 . . .") status = False for _ in range(20): req = get("https://nmsl.shadiao.app/api.php?from=tntcrafthim") if req.status_code == 200: res = req.text await message.edit(res, parse_mode='html') status = True break else: continue if status == False: await message.edit("出错了呜呜呜 ~ 试了好多好多次都无法访问到 API 服务器 。") await sleep(2) await message.delete() reg_handler('diss', diss) reg_handler('biss', biss) des_handler('diss', "儒雅随和版祖安语录。") des_handler('diss', '加带力度版祖安语录。') par_handler('diss', '') par_handler('biss', '')
nilq/baby-python
python
# Generated by Django 2.1 on 2018-10-03 01:54 from django.db import migrations class Migration(migrations.Migration): dependencies = [ ('unlabel_backend', '0021_auto_20180625_1904'), ] operations = [ migrations.DeleteModel( name='Article', ), migrations.DeleteModel( name='Capability', ), migrations.RemoveField( model_name='client', name='city', ), migrations.RemoveField( model_name='client', name='country', ), migrations.RemoveField( model_name='client', name='description', ), migrations.RemoveField( model_name='client', name='image', ), migrations.RemoveField( model_name='client', name='slug', ), migrations.RemoveField( model_name='client', name='state', ), migrations.RemoveField( model_name='client', name='url', ), ]
nilq/baby-python
python
#!/usr/bin/env python # vim:set ts=2 sw=2 expandtab: # # the pre.py script permits the reconstruction to specify the server, user # name, and password used for connection. This is achieved by setting # the parameters in a dictionary named jobArgs. # # Optional output variable : jobArgs # # Default dictionary; only those being changed need to be specified. # # jobArgs = { 'machines' : ('ip address 1', 'ip address 2'), # 'user' : 'reconuser', # 'keyfile' : None } (Which implies id_recon next to autorec.py) print("********* Entering pre.py *************") print("# Objects present at pre.py:") for x in sorted(locals().keys()): print("# {0:20} : {1}".format(x, locals()[x])) print("") # To override the DEFAULT_MACHINES_LIST for this reconstruction, for example: #jobArgs = { 'machines' : ('127.0.0.1',) } # Note trailing ',' if only one. print("********* Exiting pre.py *************")
nilq/baby-python
python
class Solution(object): def findLongestWord(self, s, d): """ :type s: str :type d: List[str] :rtype: str """ newD = sorted(d, key=len, reverse=True) tempList = [] for word in newD: if len(tempList) != 0 and len(word) != len(tempList[-1]): return sorted(tempList)[0] if self.scanWord(s, word): tempList.append(word) if len(tempList) != 0: return sorted(tempList)[0] else: return "" def scanWord(self, sIn, s): if len(s) > len(sIn): return False i2 = 0 for i1 in range(len(sIn)): if sIn[i1] == s[i2]: i2 += 1 if i2 == len(s): return True return False a = Solution() print(a.findLongestWord("abpcplea", [ "ale", "apple", "monkey", "plea"])) # apple print(a.findLongestWord("abpcplea", ["a", "b", "c"])) # a print(a.findLongestWord("apple", ["zxc", "vbn"])) # ""
nilq/baby-python
python
""" @author: Andrea Domenico Giuliano @contact: andreadomenico.giuliano@studenti.unipd.it @organization: University of Padua """ import datetime import math from collections import defaultdict #File contenente le funzioni riguardanti la creazione dei dict rigurandanti i gruppi degli items e degli users def Nr_items(c): c.execute('select count(id) as co from items'); nr_it = 0; for r in c: nr_it = int(r['co']); return nr_it; def Jobroles_list(c): c.execute('select * from us_jobroles'); jbr_l = []; for r in c: l_par = []; l_par.append(int(r['user_id'])); l_par.append(int(r['jobrole'])); jbr_l.append(l_par); return jbr_l; def Jobroles_Dist_list(c): c.execute('select DISTINCT jobrole as jb from us_jobroles'); job_roles_l = []; for r in c: job_roles_l.append(int(r['jb'])); return job_roles_l; """ # Versione senza divisione temporale def Jobroles_d_creation(c,jbr_l,items_upop_score_d): #print "Inizio calcolo Jobroles"; a = datetime.datetime.now(); jobroles_d = {}; jbr_d_l = Jobroles_Dist_list(c); items_upop_sc_d = defaultdict(lambda: 0); if (len(jbr_d_l)>0): for i in range(0,len(jbr_d_l)): jobroles_d[jbr_d_l[i]] = [int(0),[],items_upop_sc_d.copy()]; if (len(jbr_l)>0): for i in range(0,len(jbr_l)): if jbr_l[i][0] not in jobroles_d[jbr_l[i][1]][1]: jobroles_d[jbr_l[i][1]][0] += 1; l = jobroles_d[jbr_l[i][1]][1]; l.append(jbr_l[i][0]); jobroles_d[jbr_l[i][1]][1] = l; for key in jobroles_d: if (jobroles_d[key][0]>0): jobroles_d[key][0] = float(1.00/jobroles_d[key][0]); b = datetime.datetime.now(); #print "Fine calcolo Jobroles"; #print (b-a); return jobroles_d; """ def Jobroles_d_creation(c,jbr_l): #print "Inizio calcolo Jobroles"; a = datetime.datetime.now(); jobroles_d = {}; jbr_d_l = Jobroles_Dist_list(c); #items_upop_sc_d = defaultdict(lambda: 0); if (len(jbr_d_l)>0): for i in range(0,len(jbr_d_l)): p = {}; for k in range(1,7): p[k] = defaultdict(lambda: 0.0); jobroles_d[jbr_d_l[i]] = [int(0),[],p]; if (len(jbr_l)>0): for i in range(0,len(jbr_l)): if jbr_l[i][0] not in jobroles_d[jbr_l[i][1]][1]: jobroles_d[jbr_l[i][1]][0] += 1; l = jobroles_d[jbr_l[i][1]][1]; l.append(jbr_l[i][0]); jobroles_d[jbr_l[i][1]][1] = l; for key in jobroles_d: if (jobroles_d[key][0]>0): jobroles_d[key][0] = float(1.00/jobroles_d[key][0]); b = datetime.datetime.now(); #print "Fine calcolo Jobroles"; #print (b-a); return jobroles_d; def Fos_list(c): c.execute('select * from us_fos'); fos_l = []; for r in c: l_par = []; l_par.append(int(r['user_id'])); l_par.append(int(r['fos'])); fos_l.append(l_par); return fos_l; def Fos_Dist_list(c): c.execute('select DISTINCT fos as f from us_fos'); f_l = []; for r in c: f_l.append(int(r['f'])); return f_l; """ # Versione senza divisione temporale def Fos_d_creation(c,fos_l,items_upop_score_d): #print "Inizio calcolo Fos"; a = datetime.datetime.now(); fos_d = {}; fos_di_l = Fos_Dist_list(c); items_upop_sc_d = defaultdict(lambda: 0); if (len(fos_di_l)>0): for i in range(0,len(fos_di_l)): fos_d[fos_di_l[i]] = [int(0),[],items_upop_sc_d.copy()]; if (len(fos_l)>0): for i in range(0,len(fos_l)): if fos_l[i][0] not in fos_d[fos_l[i][1]][1]: fos_d[fos_l[i][1]][0] += 1; l = fos_d[fos_l[i][1]][1]; l.append(fos_l[i][0]); fos_d[fos_l[i][1]][1] = l; for key in fos_d: if (fos_d[key][0]>0): fos_d[key][0] = float(1.00/fos_d[key][0]); b = datetime.datetime.now(); #print "Fine calcolo Fos"; #print (b - a); return fos_d; """ def Fos_d_creation(c,fos_l): #print "Inizio calcolo Fos"; a = datetime.datetime.now(); fos_d = {}; fos_di_l = Fos_Dist_list(c); if (len(fos_di_l)>0): for i in range(0,len(fos_di_l)): p = {}; for k in range(1,7): p[k] = defaultdict(lambda: 0.0); fos_d[fos_di_l[i]] = [int(0),[],p]; if (len(fos_l)>0): for i in range(0,len(fos_l)): if fos_l[i][0] not in fos_d[fos_l[i][1]][1]: fos_d[fos_l[i][1]][0] += 1; l = fos_d[fos_l[i][1]][1]; l.append(fos_l[i][0]); fos_d[fos_l[i][1]][1] = l; for key in fos_d: if (fos_d[key][0]>0): fos_d[key][0] = float(1.00/fos_d[key][0]); b = datetime.datetime.now(); #print "Fine calcolo Fos"; #print (b - a); return fos_d; def Tag_Not_used(c): c.execute('select max(tag) as t from it_tags where tag != ""'); n_u_t = int(0); for r in c: n_u_t = int(r['t']); n_u_t += 1; return n_u_t; def Tags_Dist_list(c,n_u_t): c.execute('select DISTINCT tag as t from it_tags'); t_l = []; for r in c: if (str(r['t']) != ''): t_l.append(int(r['t'])); t_l.append(n_u_t); return t_l; def Tags_list(c,n_u_t): c.execute('select * from it_tags'); tags_l = []; for r in c: l_par = []; l_par.append(int(r['item_id'])); if (str(r['tag']) == ''): l_par.append(n_u_t); else: l_par.append(int(r['tag'])); tags_l.append(l_par); return tags_l; def Tags_d_creation(c,tags_l,n_u_t,nr_items): #print "Inizio calcolo Tags"; a = datetime.datetime.now(); tags_d = {}; tags_di_l = Tags_Dist_list(c,n_u_t); if (len(tags_di_l)>0): for i in range(0,len(tags_di_l)): tf_idf_sc = float(0.0); tags_d[tags_di_l[i]] = [int(0),[],tf_idf_sc]; if (len(tags_l)>0): for i in range(0,len(tags_l)): if tags_l[i][0] not in tags_d[tags_l[i][1]][1]: tags_d[tags_l[i][1]][0] += 1; l = tags_d[tags_l[i][1]][1]; l.append(tags_l[i][0]); tags_d[tags_l[i][1]][1] = l; for tag_id in tags_d: nr_users_group = tags_d[tag_id][0]; if (nr_users_group > 0): idf = math.log(nr_items/nr_users_group); tags_d[tag_id][2] = idf; b = datetime.datetime.now(); #print "Fine calcolo Tags"; #print (b - a); return tags_d; def Title_Not_used(c): c.execute('select max(title) as t from it_titles where title != ""'); n_u_t = int(0); for r in c: n_u_t = int(r['t']); n_u_t += 1; return n_u_t; def Titles_Dist_list(c,n_u_t): c.execute('select DISTINCT title as t from it_titles'); t_l = []; for r in c: if (str(r['t']) != ''): t_l.append(int(r['t'])); t_l.append(int(0)); return t_l; def Titles_list(c,n_u_t): c.execute('select * from it_titles'); titles_l = []; for r in c: l_par = []; l_par.append(int(r['item_id'])); if (str(r['title']) == ''): l_par.append(int(0)); else: l_par.append(int(r['title'])); titles_l.append(l_par); #print titles_l; return titles_l; def Titles_d_creation(c,titles_l,n_u_t,nr_items): #print "Inizio calcolo Titles"; a = datetime.datetime.now(); titles_d = {}; t_di_l = Titles_Dist_list(c,n_u_t); if (len(t_di_l)>0): for i in range(0,len(t_di_l)): tf_idf_sc = float(0.0); titles_d[t_di_l[i]] = [int(0),[],tf_idf_sc]; if (len(titles_l)>0): for i in range(0,len(titles_l)): if titles_l[i][0] not in titles_d[titles_l[i][1]][1]: titles_d[titles_l[i][1]][0] += 1; l = titles_d[titles_l[i][1]][1]; l.append(titles_l[i][0]); titles_d[titles_l[i][1]][1] = l; for title_id in titles_d: nr_users_group = titles_d[title_id][0]; if (nr_users_group > 0): idf = math.log(nr_items / nr_users_group); titles_d[title_id][2] = idf; b = datetime.datetime.now(); #print "Fine calcolo Titles"; #print (b - a); return titles_d;
nilq/baby-python
python
import logging import os import shutil import numpy as np import torch from pytorch_metric_learning.utils import common_functions as pml_cf from sklearn.model_selection import train_test_split from torchmetrics.functional import accuracy as tmf_accuracy from ..adapters import Finetuner from ..containers import Models, Optimizers from ..datasets import DataloaderCreator, SourceDataset from ..models import Discriminator from ..utils import common_functions as c_f from ..utils.savers import Saver from .accuracy_validator import AccuracyValidator from .base_validator import BaseValidator from .score_history import ScoreHistory class DeepEmbeddedValidator(BaseValidator): """ Implementation of [Towards Accurate Model Selection in Deep Unsupervised Domain Adaptation](http://proceedings.mlr.press/v97/you19a.html) """ def __init__( self, temp_folder, layer="features", num_workers=0, batch_size=32, error_fn=None, error_layer="logits", framework_cls=None, **kwargs, ): super().__init__(**kwargs) self.temp_folder = temp_folder self.layer = layer self.num_workers = num_workers self.batch_size = batch_size self.error_fn = c_f.default( error_fn, torch.nn.CrossEntropyLoss(reduction="none") ) self.error_layer = error_layer self.framework_cls = framework_cls if self.framework_cls is None: from ..frameworks.ignite import Ignite self.framework_cls = Ignite self.D_accuracy_val = None self.D_accuracy_test = None self.mean_error = None self._DEV_recordable = ["D_accuracy_val", "D_accuracy_test", "mean_error"] pml_cf.add_to_recordable_attributes(self, list_of_names=self._DEV_recordable) def compute_score(self, src_train, src_val, target_train): init_logging_level = c_f.LOGGER.level c_f.LOGGER.setLevel(logging.WARNING) weights, self.D_accuracy_val, self.D_accuracy_test = get_weights( src_train[self.layer], src_val[self.layer], target_train[self.layer], self.num_workers, self.batch_size, self.temp_folder, self.framework_cls, ) error_per_sample = self.error_fn(src_val[self.error_layer], src_val["labels"]) output = get_dev_risk(weights, error_per_sample[:, None]) self.mean_error = torch.mean(error_per_sample).item() c_f.LOGGER.setLevel(init_logging_level) return -output def extra_repr(self): x = super().extra_repr() x += f"\n{c_f.extra_repr(self, self._DEV_recordable)}" return x ######################################################################### #### ADAPTED FROM https://github.com/thuml/Deep-Embedded-Validation ##### ######################################################################### def get_dev_risk(weight, error): """ :param weight: shape [N, 1], the importance weight for N source samples in the validation set :param error: shape [N, 1], the error value for each source sample in the validation set (typically 0 for correct classification and 1 for wrong classification) """ if torch.any(weight < 0) or torch.any(error < 0): raise ValueError("weights and errors must be positive") weight = pml_cf.to_numpy(weight) error = pml_cf.to_numpy(error) N, d = weight.shape _N, _d = error.shape assert N == _N and d == _d, "dimension mismatch!" weighted_error = weight * error cov = np.cov(np.concatenate((weighted_error, weight), axis=1), rowvar=False)[0][1] var_w = np.var(weight, ddof=1) eta = -cov / (var_w + 1e-6) return np.mean(weighted_error) + eta * np.mean(weight) - eta def get_weights( source_feature, validation_feature, target_feature, num_workers, batch_size, temp_folder, framework_cls, ): """ :param source_feature: shape [N_tr, d], features from training set :param validation_feature: shape [N_v, d], features from validation set :param target_feature: shape [N_te, d], features from test set :return: """ device = source_feature.device source_feature = pml_cf.to_numpy(source_feature) validation_feature = pml_cf.to_numpy(validation_feature) target_feature = pml_cf.to_numpy(target_feature) N_s, d = source_feature.shape N_t, _d = target_feature.shape source_feature = source_feature.copy() target_feature = target_feature.copy() all_feature = np.concatenate((source_feature, target_feature)) all_label = np.asarray([1] * N_s + [0] * N_t, dtype=np.int64) ( feature_for_train, feature_for_test, label_for_train, label_for_test, ) = train_test_split(all_feature, all_label, train_size=0.8) train_set = SourceDataset( pml_cf.EmbeddingDataset(feature_for_train, label_for_train) ) val_set = SourceDataset(pml_cf.EmbeddingDataset(feature_for_test, label_for_test)) decays = [1e-1, 3e-2, 1e-2, 3e-3, 1e-3, 3e-4, 1e-4, 3e-5, 1e-5] val_acc, trainers, savers, folders = [], [], [], [] epochs = 100 patience = 2 for i, decay in enumerate(decays): torch.cuda.empty_cache() curr_folder = os.path.join(temp_folder, f"DeepEmbeddedValidation{i}") models = Models( { "G": torch.nn.Identity(), "C": Discriminator(d, h=d, out_size=2).to(device), } ) optimizers = Optimizers( (torch.optim.Adam, {"lr": 0.001, "weight_decay": decay}) ) trainer = Finetuner(models=models, optimizers=optimizers) validator = AccuracyValidator( torchmetric_kwargs={"average": "macro", "num_classes": 2} ) validator = ScoreHistory(validator) saver = Saver(folder=curr_folder) trainer = framework_cls( trainer, validator=validator, saver=saver, with_pbars=False ) datasets = {"train": train_set, "src_val": val_set} bs = int(np.min([len(train_set), len(val_set), batch_size])) acc, _ = trainer.run( datasets, dataloader_creator=DataloaderCreator( num_workers=num_workers, batch_size=bs ), max_epochs=epochs, validation_interval=1, patience=patience, ) val_acc.append(acc) trainers.append(trainer) savers.append(saver) folders.append(curr_folder) torch.cuda.empty_cache() D_accuracy_val = max(val_acc) index = val_acc.index(D_accuracy_val) labels = torch.ones(len(validation_feature), dtype=int) validation_set = SourceDataset(pml_cf.EmbeddingDataset(validation_feature, labels)) trainer, saver = trainers[index], savers[index] saver.load_adapter(trainer.adapter, "best") bs = min(len(validation_set), batch_size) dataloader = torch.utils.data.DataLoader( validation_set, num_workers=num_workers, batch_size=bs ) domain_out = trainer.get_all_outputs(dataloader, "val") domain_out = domain_out["val"]["preds"] weights = (domain_out[:, :1] / domain_out[:, 1:]) * (float(N_s) / N_t) [shutil.rmtree(f) for f in folders] D_accuracy_test = tmf_accuracy(domain_out, labels.to(domain_out.device)).item() return weights, D_accuracy_val, D_accuracy_test
nilq/baby-python
python
#!/usr/bin/env python # $Id$ """ Abstract base class for driver classes""" import exceptions class DriverError(exceptions.Exception): def __init__(self, arg): exceptions.Exception.__init__(self,arg) class Driver: mount_delay = 0 def fileno(self): raise NotImplementedError def tell(self): raise NotImplementedError def open(self, device, mode,retry_count=10): raise NotImplementedError def flush(self, device): raise NotImplementedError def close(self): raise NotImplementedError def rewind(self): raise NotImplementedError def seek(self, where, eot_ok=0): raise NotImplementedError def skipfm(self, n): raise NotImplementedError def get_status(self): raise NotImplementedError def verify_label(self, volume_label, mode, expected_length=80): raise NotImplementedError def set_mode(self, density=None, compression=None, blocksize=None): raise NotImplementedError def rates(self): raise NotImplementedError def get_cleaning_bit(self): return 0
nilq/baby-python
python
# # Copyright (c) 2015-2016 Erik Derr [derr@cs.uni-saarland.de] # # Licensed under the Apache License, Version 2.0 (the "License"); you may not use this # file except in compliance with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software distributed under # the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the specific language governing # permissions and limitations under the License. # #!/usr/bin/python # # Crawler for libraries hosted at mvn central # Retrieves jar|aar files along with some meta data import json import urllib2 import datetime import os import errno import zipfile import traceback from retrying import retry # may require "pip install retrying" ## functions ## def unix2Date(unixTime): unixTime = int(str(unixTime)[:-3]) return datetime.datetime.fromtimestamp(unixTime).strftime('%d.%m.%Y') def make_sure_path_exists(path): try: os.makedirs(path) except OSError as exception: if exception.errno != errno.EEXIST: raise def write_library_description(fileName, libName, category, version, date, comment): make_sure_path_exists(os.path.dirname(fileName)) # write lib description in xml format with open(fileName, "w") as desc: desc.write("<?xml version=\"1.0\"?>\n") desc.write("<library>\n") desc.write(" <!-- library name -->\n") desc.write(" <name>{}</name>\n".format(libName)) desc.write("\n") desc.write(" <!-- Advertising, Analytics, Android, SocialMedia, Cloud, Utilities -->\n") desc.write(" <category>{}</category>\n".format(category)) desc.write("\n") desc.write(" <!-- optional: version string -->\n") desc.write(" <version>{}</version>\n".format(version)) desc.write("\n") desc.write(" <!-- optional: date (format: DD/MM/YYYY) -->\n") desc.write(" <releasedate>{}</releasedate>\n".format(date)) desc.write("\n") desc.write(" <!-- optional: comment -->\n") desc.write(" <comment>{}</comment>\n".format(comment)) desc.write("</library>\n") # TODO: decorator does not work @retry(urllib2.URLError, tries=3, delay=3, backoff=1) def urlopen_with_retry(URL): return urllib2.urlopen(URL) def downloadFile(targetDir, groupid, artefactid, version, filetype): make_sure_path_exists(os.path.dirname(targetDir + "/")) # assemble download URL baseURL = "http://search.maven.org/remotecontent?filepath=" artefactid_r = artefactid.replace(".","/") groupid_r = groupid.replace(".","/") URL = baseURL + groupid_r + "/" + artefactid_r + "/" # sometimes it just returns the type "bundle", we then access the jar file if filetype == "bundle": filetype = "jar" fileName = artefactid_r + "-" + version + "." + filetype URL = URL + version + "/" + fileName # retrieve and save file targetFile = targetDir + "/" + fileName try: libFile = urllib2.urlopen(URL) with open(targetFile,'wb') as output: output.write(libFile.read()) # if filetype is aar unzip classes.jar (since WALA currently does not handle aar's directly) if filetype == "aar": fh = open(targetFile, 'rb') z = zipfile.ZipFile(fh) for f in z.namelist(): if f == "classes.jar": z.extract(f, targetDir) fh.close() return 0 except urllib2.HTTPError as e: print 'HTTPError = ' + str(e.code) return 1 except urllib2.URLError as e: print 'URLError = ' + str(e.reason) return 1 except Exception, excp: print 'Download failed (' + str(excp) + ')' return 1 def updateLibrary(libName, category, comment, groupId, artefactId): # replace all blanks with dash libName = libName.replace(" ", "-") print " # check library " + libName + " [" + category + "] (g:\"" + groupId + "\" AND a:\"" + artefactId + "\")" baseDirName = rootDir + category + "/" + libName + "/" dir = os.path.dirname(baseDirName) make_sure_path_exists(dir); # Assemble mvn central search URL and retrieve meta data try: mvnSearchURL = "http://search.maven.org/solrsearch/select?q=g:%22" + groupId + "%22+AND+a:%22" + artefactId + "%22&rows=100&core=gav" response = urllib2.urlopen(mvnSearchURL) data = json.loads(response.read()) except urllib2.URLError, e: print 'URLError = ' + str(e.reason) return except Exception, excp: print 'Could not retrieve meta data for ' + libName + ' [SKIP] (' + str(excp) + ')' return # DEBUG: pretty print json #print json.dumps(data, indent=4, sort_keys=True) #print numberOfVersions = data["response"]["numFound"] print " - retrieved meta data for " + str(numberOfVersions) + " versions:" numberOfUpdates = 0 if numberOfVersions > 0: for version in data["response"]["docs"]: # skip lib version if already existing if not os.path.isfile(baseDirName + "/" + version["v"] + "/" + libDescriptorFileName): numberOfUpdates += 1 date = unix2Date(version["timestamp"]) targetDir = baseDirName + version["v"] print " - update version: {} type: {} date: {} target-dir: {}".format(version["v"], version["p"], date, targetDir) result = downloadFile(targetDir, groupId, artefactId, version["v"], version["p"]) if result == 0: # write lib description fileName = targetDir + "/" + "library.xml" write_library_description(fileName, libName, category, version["v"], date, comment) if numberOfUpdates == 0: print " -> all versions up-to-date" ## Main functionality ## inputFile = "libraries-ILC.json" libDescriptorFileName = "library.xml" rootDir = "E:\gradute\libs-ILC/" ### change this directory to your lib-sdks dir ### print "== mvn central crawler ==" # load iterate over lib json with open(inputFile) as ifile: data = json.load(ifile) # update each lib for lib in data["libraries"]: updateLibrary(lib["name"], lib["category"], lib["comment"], lib["groupid"], lib["artefactid"])
nilq/baby-python
python
def train_interupter(): with open('train_interupter.ini', 'r', encoding='utf-8') as f: flag = f.read().strip() if flag == '0': return False elif flag == '1': with open('train_interupter.ini', 'w', encoding='utf-8') as f: f.write('0') return True else: raise ValueError('Wrong flag value.')
nilq/baby-python
python
# The MIT License (MIT) # Copyright (c) 2021 Jonah Yolles-Murphy (TG-Techie) # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. import builtins from typing import * __version__ = "0.1.0" T = TypeVar("T") Sliceable = Union["Slice[T]", MutableSequence[T]] class _SliceConstructor(Generic[T]): """ An intermediate constructor that holds the sequence to be sliced and allows for a more flexible `.slice(...)` or `.slice[...]` syntax. """ __slots__ = {"_seq"} def __init__(self, seq: Sliceable) -> None: self._seq = seq def __getitem__(self, s: Union[int, builtins.slice]) -> "Slice[T]": # allow single item slicing with Slice(...)[n] syntax if isinstance(s, int) or hasattr(s, "__index__"): index = s.__index__() s = builtins.slice(index, index + 1) assert ( s.step is None ), f"slicing cannot be non-contiguous (got `{s.step!r}` for step)" seq = self._seq start = s.start stop = s.stop if start is None: start = 0 while start < 0: start += len(seq) if stop is None: stop = len(seq) while stop < 0: stop += len(seq) return self( start=start, length=stop - start, ) def __call__(self, *, length, start) -> "Slice[T]": return Slice(self._seq, start=start, length=length) class Slice(Generic[T]): """ A more tradition slice of sequences where the created slice mutates the sliced object. When using a Slice to mutate the base Sequence the Slice assumes the base will not change size ex: ``` ls = [0, 3, -1, 1, 4] slc = Slice(ls)[1:4] slc[0] = 1 slc[2] = 3 assert ls == [0, 1, -1, 3, 4] ``` By default, slicing Slice object will return whatever slicing the base object would normally be. ``` assert type(slc[0:1]) == list # evaluates as True ``` If you want a "sub slice" use .slice to make a further slice ``` sub = slc.slice[1:2] sub[0] = 2 assert ls == [0, 1, 2, 3, 4] ``` """ Self = Union["Slice"] _seq: Sliceable _start: int _length: int _constructor: Optional[_SliceConstructor[T]] __slots__ = {"_seq", "_start", "_length", "_constructor"} def __new__( cls: Type[Self], seq: Sliceable, start=None, length=None, ): if start is not None and length is not None: return super(Slice, cls).__new__(cls) # type: ignore elif start is None and length is None: return _SliceConstructor(seq) else: raise ValueError( f"{cls.__name__} cannot be called with only one of start= and length=, " f"got only {'start=' if start is not None else 'length='}" ) def __init__( self, seq: Sliceable, *, start=None, # type: ignore length=None, # type: ignore ) -> None: # sanitize the inputs, as they must be integers start = start.__index__() length = length.__index__() # verify that the given start and length are in bounds if not length >= 1: raise ValueError( f"Slices cannot be created with lengths less than 1, got {length}" ) if not (0 <= start < len(seq)): raise ValueError(f"start index out of bounds, got {start}") if not ((start + length) <= len(seq)): raise ValueError( f"slice out of bounds. starting at {start}, a slice of length {length} extends" f" past the end of the sliced sequence " ) # if this is slicing a slice, instead driectly slice the original object if isinstance(seq, Slice): self._seq = seq._seq start += seq._start else: self._seq = seq self._start = start self._length = length # sanitization assert hasattr(start, "__index__"), ( "start must be an integer, " + f"got {start!r}" ) assert hasattr(length, "__index__"), ( "length must be an integer, " + f"got {length!r}" ) # this will be lazily evaluated later self._constructor = None @property def slice(self) -> _SliceConstructor[T]: # lazily create a constructor for sub slices of this slice constructor = self._constructor if constructor is None: self._constructor = constructor = _SliceConstructor(self) return constructor def _isinited(self) -> bool: return hasattr(self, "_start") and hasattr(self, "_length") def __getitem__(self, index: Union[int, builtins.slice]): if isinstance(index, int) or hasattr(index, "__index__"): return self._get_item(index.__index__()) # type: ignore # idk to test for SupportsIndex in 3.6 yet elif isinstance(index, slice): return self._get_slice(index) else: raise TypeError( f"{type(self).__name__} indices must be integers or slices, " f"not {type(index).__name__}" ) def __setitem__(self, index: Union[int, builtins.slice], value: T) -> None: # check for slice assignment as it is not yet supported if isinstance(index, builtins.slice): offset = self._start self._seq.__setitem__( builtins.slice( index.start + offset, index.stop + offset, index.step, ), value, ) return elif isinstance(index, int) or hasattr(index, "__index__"): index = self._bounds_check_and_mod(index) self._seq[self._start + index] = value else: raise NotImplementedError() def _get_slice(self, s: builtins.slice) -> MutableSequence[T]: offset = self._bounds_check_and_mod(self._start) stop = s.stop % self._length return self._seq[s.start + offset : stop + offset : s.step] def _get_item(self, index: int) -> T: # check that the index is in range assuming the base sequence has not changed index = self._bounds_check_and_mod(index) return self._seq[self._start + index] def __len__(self) -> int: assert self._isinited() return self._length def __iter__(self) -> Generator[T, None, None]: seq = self._seq for index in range(self._start, self._start + self._length): yield seq[index] else: return None def __repr__(self) -> str: return f"${self._seq[self._start : self._start+self._length]}" def _bounds_check_and_mod(self, index: int) -> int: if index >= self._length: raise IndexError( f"Slice index out of range, got [{index}] in slice of length {self._length}" ) elif index < 0: index %= self._length else: pass return index def sort(self, **kwargs) -> None: for index, value in enumerate(sorted(self, **kwargs)): self[index] = value if __name__ == "__main__": # test basic sicing ls = [0, 3, -1, 1, 4] slc = Slice(ls)[1:4] slc[0] = 1 slc[2] = 3 assert ls == [0, 1, -1, 3, 4] # test sub-slicing sub = slc.slice[1:2] sub[0] = 2 assert ls == [0, 1, 2, 3, 4] # test slicing types ls = [*range(8)] # test default start and stop slc = Slice(ls)[:] assert [*slc] == ls # test negative end slc = Slice(ls)[0:-1] assert [*slc] == ls[0:-1] # test negative start slc = Slice(ls)[-8:] assert [*slc] == ls[-8:] # test slice sorting ls = [0, 4, 3, 2, 1, 5] slc = Slice(ls)[1:-1] assert [*slc] == [4, 3, 2, 1] slc.sort() assert ls == [0, 1, 2, 3, 4, 5]
nilq/baby-python
python
import argparse import logging from sqlalchemy.orm import Session from ...db import yield_connection_from_env_ctx from ..indices import update_installation_default_indices from ..models import SlackOAuthEvent logging.basicConfig(level=logging.INFO) logger = logging.getLogger(__name__) def upgrade_one( db_session: Session, bot_installation: SlackOAuthEvent ) -> SlackOAuthEvent: update_installation_default_indices(db_session, bot_installation) bot_installation.version = 2 db_session.add(bot_installation) db_session.commit() return bot_installation def main(args: argparse.Namespace) -> None: with yield_connection_from_env_ctx() as db_session: query = ( db_session.query(SlackOAuthEvent) .filter(SlackOAuthEvent.version == 1) .filter(SlackOAuthEvent.deleted is not False) ) if args.workspace is not None: query = query.filter(SlackOAuthEvent.team_id == args.workspace) installations_for_upgrade = query.all() for bot_installation in installations_for_upgrade: logger.info( f"Upgrading installation {bot_installation.id} for team {bot_installation.team_id} " f"({bot_installation.team_name}) to version 2" ) upgrade_one(db_session, bot_installation) logger.info("Done!") if __name__ == "__main__": parser = argparse.ArgumentParser( description="Set up default search indices for fresh @bugout slack installations" ) parser.add_argument( "-w", "--workspace", required=False, type=str, default=None, help="ID for the bot installation", ) args = parser.parse_args() main(args)
nilq/baby-python
python
from extractors.blockextractor import BlockExtractor from extractors.characterfactory import CharacterFactory from extractors.emojiextractor import EmojiExtractor from extractors.mathcollectionextractor import MathExtractor from extractors.nerdextractor import NerdExtractor if __name__ == "__main__": character_factory = CharacterFactory() EmojiExtractor().extract() BlockExtractor(character_factory).extract() MathExtractor(character_factory).extract() NerdExtractor().extract()
nilq/baby-python
python
"""AnimeSuki Media models""" from django.db import models from django.urls import reverse from django.utils import timezone from django.utils.text import slugify from animesuki.core.models import ArtworkModel from animesuki.core.utils import DatePrecision from animesuki.history.models import HistoryModel class Media(HistoryModel): class Type: ANIME = 1 MANGA = 2 NOVEL = 3 choices = ( (ANIME, 'Anime'), (MANGA, 'Manga'), (NOVEL, 'Novel'), ) class SubType: UNKNOWN = 0 # Anime TV = 1 OVA = 2 MOVIE = 3 WEB = 4 SPECIAL = 5 MUSIC = 6 # Manga MANGA = 7 MANHUA = 8 MANHWA = 9 WEB_MANGA = 10 ONE_SHOT = 11 DOUJIN = 12 # Novel LIGHT_NOVEL = 13 WEB_NOVEL = 14 NOVEL = 15 choices = ( (UNKNOWN, 'Unknown'), ('Anime', ( (TV, 'TV'), (OVA, 'OVA'), (MOVIE, 'Movie'), (WEB, 'Web'), (SPECIAL, 'Special'), (MUSIC, 'Music'), )), ('Manga', ( (MANGA, 'Manga'), (MANHUA, 'Manhua'), (MANHWA, 'Manhwa'), (WEB_MANGA, 'Web Manga'), (ONE_SHOT, 'One Shot'), (DOUJIN, 'Doujin'), )), ('Novel', ( (LIGHT_NOVEL, 'Light Novel'), (WEB_NOVEL, 'Web Novel'), (NOVEL, 'Novel'), )) ) class Status: AUTO = 1 HIATUS = 2 CANCELLED = 3 choices = ( (AUTO, 'Automatic'), (HIATUS, 'On Hiatus'), (CANCELLED, 'Cancelled') ) class Season: WINTER = 1 SPRING = 2 SUMMER = 3 FALL = 4 choices = ( (WINTER, 'Winter'), (SPRING, 'Spring'), (SUMMER, 'Summer'), (FALL, 'Fall') ) title = models.CharField('title', max_length=250, blank=True) media_type = models.PositiveSmallIntegerField('type', choices=Type.choices, default=Type.ANIME) sub_type = models.PositiveSmallIntegerField('sub Type', choices=SubType.choices, default=SubType.UNKNOWN) status = models.PositiveSmallIntegerField('status', choices=Status.choices, default=Status.AUTO) is_adult = models.BooleanField('r-18', default=False) episodes = models.IntegerField('episodes', null=True, blank=True) duration = models.IntegerField('duration', null=True, blank=True) volumes = models.IntegerField('volumes', null=True, blank=True) chapters = models.IntegerField('chapters', null=True, blank=True) start_date = models.DateField('start date', null=True, blank=True) start_precision = models.PositiveSmallIntegerField('precision', choices=DatePrecision.choices, default=DatePrecision.FULL) end_date = models.DateField('end date', null=True, blank=True) end_precision = models.PositiveSmallIntegerField('precision', choices=DatePrecision.choices, default=DatePrecision.FULL) season_year = models.IntegerField('season year', null=True, blank=True) season = models.PositiveSmallIntegerField('season', choices=Season.choices, null=True, blank=True) description = models.TextField('description', blank=True) synopsis = models.TextField('synopsis', blank=True) artwork_active = models.ForeignKey('MediaArtwork', related_name='media_artwork', on_delete=models.SET_NULL, null=True, blank=True, default=None) HISTORY_MODERATE_FIELDS = ('title', 'media_type', 'sub_type', 'is_adult') def __str__(self): return self.title def get_status(self): if self.status != self.Status.AUTO: return self.get_status_display() status = { self.Type.ANIME: { 'future': 'Not yet aired', 'present': 'Currently airing', 'past': 'Finished' }, self.Type.MANGA: { 'future': 'Not yet published', 'present': 'Currently publishing', 'past': 'Finished' }, } status[self.Type.NOVEL] = status[self.Type.MANGA] now = timezone.now().date() if self.end_date and self.end_date <= now: return status[self.media_type]['past'] elif not self.start_date or self.start_date > now: return status[self.media_type]['future'] else: return status[self.media_type]['present'] def get_absolute_url(self, view='media:detail'): return reverse(view, args=[slugify(self.get_media_type_display()), self.pk, slugify(self.title)]) class Meta: db_table = 'media' verbose_name_plural = 'media' class MediaArtwork(ArtworkModel): media = models.ForeignKey(Media, on_delete=models.PROTECT) ARTWORK_FOLDER = 'media' ARTWORK_SIZES = ((75, 75, 't75'), (150, 150, 't150'), (225, 225, 't225'), (450, 450, 't450'), (292, 600, '292w'), (352, 800, '352w'), (438, 1000, '438w'), (528, 1200, '528w'), (584, 1200, '584w'), (704, 1400, '704w')) def sub_folder(self): return self.media.pk class Meta: db_table = 'media_artwork'
nilq/baby-python
python
# -*- coding: utf-8 -*- # Generated by Django 1.11.15 on 2019-06-12 07:41 from __future__ import unicode_literals import bluebottle.files.fields import bluebottle.utils.fields from decimal import Decimal from django.conf import settings from django.db import migrations, models import django.db.models.deletion import djmoney.models.fields class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('files', '0001_initial'), ('funding', '0007_auto_20190605_1639'), ] operations = [ migrations.CreateModel( name='BudgetLine', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('description', models.CharField(default=b'', max_length=255, verbose_name='description')), ('amount_currency', djmoney.models.fields.CurrencyField(choices=[(b'EUR', 'Euro')], default='EUR', editable=False, max_length=3)), ('amount', bluebottle.utils.fields.MoneyField(currency_choices="[('EUR', u'Euro')]", decimal_places=2, default=Decimal('0.0'), max_digits=12)), ('created', models.DateTimeField(auto_now_add=True)), ('updated', models.DateTimeField(auto_now=True)), ], options={ 'verbose_name': 'budget line', 'verbose_name_plural': 'budget lines', }, ), migrations.CreateModel( name='Fundraiser', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('title', models.CharField(max_length=255, verbose_name='title')), ('description', models.TextField(blank=True, verbose_name='description')), ('amount_currency', djmoney.models.fields.CurrencyField(choices=[(b'EUR', 'Euro')], default='EUR', editable=False, max_length=3)), ('amount', bluebottle.utils.fields.MoneyField(currency_choices="[('EUR', u'Euro')]", decimal_places=2, default=Decimal('0.0'), max_digits=12, verbose_name='amount')), ('deadline', models.DateTimeField(null=True)), ('created', models.DateTimeField(auto_now_add=True)), ('updated', models.DateTimeField(auto_now=True)), ], options={ 'verbose_name': 'fundraiser', 'verbose_name_plural': 'fundraisers', }, ), migrations.CreateModel( name='Reward', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('amount_currency', djmoney.models.fields.CurrencyField(choices=[(b'EUR', 'Euro')], default='EUR', editable=False, max_length=3)), ('amount', bluebottle.utils.fields.MoneyField(currency_choices="[('EUR', u'Euro')]", decimal_places=2, default=Decimal('0.0'), max_digits=12, verbose_name='Amount')), ('title', models.CharField(max_length=200, verbose_name='Title')), ('description', models.CharField(max_length=500, verbose_name='Description')), ('limit', models.IntegerField(blank=True, help_text='How many of this rewards are available', null=True, verbose_name='Limit')), ('created', models.DateTimeField(auto_now_add=True)), ('updated', models.DateTimeField(auto_now=True)), ], options={ 'ordering': ['-project__created', 'amount'], 'verbose_name': 'Gift', 'verbose_name_plural': 'Gifts', 'permissions': (('api_read_reward', 'Can view reward through the API'), ('api_add_reward', 'Can add reward through the API'), ('api_change_reward', 'Can change reward through the API'), ('api_delete_reward', 'Can delete reward through the API'), ('api_read_own_reward', 'Can view own reward through the API'), ('api_add_own_reward', 'Can add own reward through the API'), ('api_change_own_reward', 'Can change own reward through the API'), ('api_delete_own_reward', 'Can delete own reward through the API')), }, ), migrations.AlterField( model_name='donation', name='amount', field=bluebottle.utils.fields.MoneyField(currency_choices="[('EUR', u'Euro')]", decimal_places=2, default=Decimal('0.0'), max_digits=12), ), migrations.AlterField( model_name='donation', name='amount_currency', field=djmoney.models.fields.CurrencyField(choices=[(b'EUR', 'Euro')], default='EUR', editable=False, max_length=3), ), migrations.AlterField( model_name='funding', name='target', field=bluebottle.utils.fields.MoneyField(blank=True, currency_choices="[('EUR', u'Euro')]", decimal_places=2, default=None, max_digits=12, null=True), ), migrations.AlterField( model_name='funding', name='target_currency', field=djmoney.models.fields.CurrencyField(choices=[(b'EUR', 'Euro')], default='EUR', editable=False, max_length=3), ), migrations.AddField( model_name='reward', name='activity', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='funding.Funding', verbose_name='Activity'), ), migrations.AddField( model_name='fundraiser', name='activity', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='fundraisers', to='funding.Funding', verbose_name='activity'), ), migrations.AddField( model_name='fundraiser', name='image', field=bluebottle.files.fields.ImageField(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, to='files.Image'), ), migrations.AddField( model_name='fundraiser', name='owner', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='funding_fundraisers', to=settings.AUTH_USER_MODEL), ), migrations.AddField( model_name='budgetline', name='activity', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='funding.Funding'), ), ]
nilq/baby-python
python
from __future__ import annotations import subprocess import sys def test_same_version(): """ Test the the version in setup.py matches the version in __init__.py """ res = subprocess.run( [sys.executable, '-m', 'pip', 'show', 'cptk'], stdout=subprocess.PIPE, check=True, encoding='utf8', ) fields = { line.partition(':')[0]: line.partition(':')[-1].strip() for line in res.stdout.split('\n') } from cptk import __version__ assert __version__ == fields['Version']
nilq/baby-python
python
# coding=utf-8 ##以utf-8编码储存中文字符 import jieba.analyse import codecs,sys import itertools from work import match from io import BufferedReader from work import simplyParticiple def Synonym(): #同义词函数 seperate_word = {} dict1={} i=0 file = codecs.open("same_word.txt","r","utf-8") # 这是同义词库 lines = file.readlines() # 读取全部内容 for line in lines: seperate_word[i] = line.split() # 同义词放入字典seperate_word中 i = i + 1 x1 = len(lines) for i in range(0, x1): x2 = {k: seperate_word[i][0] for k in seperate_word[i]} # 这是同义词字典,不同键,相同值 dict1 = dict(dict1, **x2) # 将多个字典合并为一个 return dict1 def _synonym(txt): # synonym函数将列表中的同义词函数替换 # final_sentence="" list_prim=[] line = simplyParticiple. participle(txt) line_2 =line.split("/") dict1 = Synonym() for word in line_2: if word in dict1: word = dict1[word] list_prim.append(word) else: list_prim.append(word) return list_prim def getkeyword(list_A,list_B): # getkeyword 的作为是从分词去停用词同义词过后的原始关键词中于关键词列表进行匹配,找出最后的关键词 list_C=[] for each_itema in list_A: for item in list_B: if(each_itema==item): list_C.append(item) break return list_C def combination(the_list): str="" for each_item in the_list: str += each_item return str with open("final_keyword.txt",encoding="utf_8") as fp:#list_keyword用于保存初步匹配关键词 list_keyword=[] for lines in fp.readlines(): lines=lines.split() list_keyword=list_keyword+lines fp.close() def result(txt): # list_final保存全排列后字符串,list_prim保存与知识点关键词匹配后的关键词,list_mid保存全排列后关键词列表 # list_final=[] list_prim = getkeyword(_synonym(txt), list_keyword) # print(_synonym(txt)) # print(list_prim) # list_mid=(list(itertools.permutations(list_prim, len(list_prim)))) # for item in list_mid: # list_final.append(combination(item)) # return list_final return list_prim # c = result('进制的转换觉得有点难。') # print(c)
nilq/baby-python
python
from .common import ( AskHandler, CommonHandler, AskCommutativeHandler, TautologicalHandler, test_closed_group, ) __all__ = [ "AskHandler", "CommonHandler", "AskCommutativeHandler", "TautologicalHandler", "test_closed_group", ]
nilq/baby-python
python
from matching_algorithm import matching_algorithm import json import copy class top_trading_cycle(matching_algorithm): def group_1_optimal(self): return self.match(copy.deepcopy(self.group_1), copy.deepcopy(self.group_2), 'top_trading_cycle', False) def group_2_optimal(self): return self.match(copy.deepcopy(self.group_2), copy.deepcopy(self.group_1), 'top_trading_cycle', False) def get_top_trading_cycle(file_name): with open(file_name) as f: algorithm = top_trading_cycle(json.load(f), ('group_1', 'group_2')) a, b = algorithm.group_1_optimal(), algorithm.group_2_optimal() return a, b
nilq/baby-python
python
from setuptools import find_packages, setup setup( name="Skaak", packages=find_packages(include=["skaak"]), version="0.12.5", description="A Python Chess Library", author="George Munyoro", license="MIT", install_requires=[], setup_requires=["pytest-runner"], tests_require=["pytest==6.1.1"], test_suite="tests", )
nilq/baby-python
python
""" Ticket numbers usually consist of an even number of digits. A ticket number is considered lucky if the sum of the first half of the digits is equal to the sum of the second half. Given a ticket number n, determine if it's lucky or not. Example For n = 1230, the output should be solution(n) = true; For n = 239017, the output should be solution(n) = false. """ def solution(n): list_num = list(str(n)) split_len = int(len(list_num)/2) first_part = 0 last_part = 0 for i in range(split_len): first_part+= int(list_num[i]) for i in range(split_len): last_part += int(list_num[i+split_len]) if first_part == last_part: return True else: return False print(solution(239017))
nilq/baby-python
python
import graphene from ipam import filtersets, models from netbox.graphql.scalars import BigInt from netbox.graphql.types import BaseObjectType, OrganizationalObjectType, PrimaryObjectType __all__ = ( 'ASNType', 'AggregateType', 'FHRPGroupType', 'FHRPGroupAssignmentType', 'IPAddressType', 'IPRangeType', 'PrefixType', 'RIRType', 'RoleType', 'RouteTargetType', 'ServiceType', 'VLANType', 'VLANGroupType', 'VRFType', ) class ASNType(PrimaryObjectType): asn = graphene.Field(BigInt) class Meta: model = models.ASN fields = '__all__' filterset_class = filtersets.ASNFilterSet class AggregateType(PrimaryObjectType): class Meta: model = models.Aggregate fields = '__all__' filterset_class = filtersets.AggregateFilterSet class FHRPGroupType(PrimaryObjectType): class Meta: model = models.FHRPGroup fields = '__all__' filterset_class = filtersets.FHRPGroupFilterSet def resolve_auth_type(self, info): return self.auth_type or None class FHRPGroupAssignmentType(BaseObjectType): class Meta: model = models.FHRPGroupAssignment fields = '__all__' filterset_class = filtersets.FHRPGroupAssignmentFilterSet class IPAddressType(PrimaryObjectType): class Meta: model = models.IPAddress fields = '__all__' filterset_class = filtersets.IPAddressFilterSet def resolve_role(self, info): return self.role or None class IPRangeType(PrimaryObjectType): class Meta: model = models.IPRange fields = '__all__' filterset_class = filtersets.IPRangeFilterSet def resolve_role(self, info): return self.role or None class PrefixType(PrimaryObjectType): class Meta: model = models.Prefix fields = '__all__' filterset_class = filtersets.PrefixFilterSet class RIRType(OrganizationalObjectType): class Meta: model = models.RIR fields = '__all__' filterset_class = filtersets.RIRFilterSet class RoleType(OrganizationalObjectType): class Meta: model = models.Role fields = '__all__' filterset_class = filtersets.RoleFilterSet class RouteTargetType(PrimaryObjectType): class Meta: model = models.RouteTarget fields = '__all__' filterset_class = filtersets.RouteTargetFilterSet class ServiceType(PrimaryObjectType): class Meta: model = models.Service fields = '__all__' filterset_class = filtersets.ServiceFilterSet class VLANType(PrimaryObjectType): class Meta: model = models.VLAN fields = '__all__' filterset_class = filtersets.VLANFilterSet class VLANGroupType(OrganizationalObjectType): class Meta: model = models.VLANGroup fields = '__all__' filterset_class = filtersets.VLANGroupFilterSet class VRFType(PrimaryObjectType): class Meta: model = models.VRF fields = '__all__' filterset_class = filtersets.VRFFilterSet
nilq/baby-python
python
from utils import * import matplotlib.pyplot as plt # import matplotlib.colors from sklearn.preprocessing import StandardScaler from skimage.transform import resize from PIL import Image path_save = "./results/face_glasses_separation2/" if not os.path.exists(path_save): os.makedirs(path_save) # color_map = matplotlib.colors.hsv_to_rgb(plt.cm.hsv) # plt.cm.bwr #--> plt.cm.brg, plt.cm.hsv # color_map = plt.cm.bwr path_1 = "C:/Users/benya/Desktop/my_PhD/QQE/codes/4_results/17_face_glasses_transform_inputSpace/run2_good/algorithm_files/class_" + str(0) + "/fuzzy_QQplot/" X0 = load_variable(name_of_variable="X_matched_initial", path=path_1) path_1 = "C:/Users/benya/Desktop/my_PhD/QQE/codes/4_results/17_face_glasses_transform_inputSpace/run2_good/algorithm_files/class_" + str(1) + "/fuzzy_QQplot/" X1 = load_variable(name_of_variable="X_matched_initial", path=path_1) X = np.column_stack((X0, X1)) y = [0]*X0.shape[1] + [1]*X1.shape[1] y = np.asarray(y) for i, plot_name in enumerate(["X_matched_iteration_0", "X_matched_iteration_20", "X_matched_iteration_30", "X_matched_iteration_10"]): if i <= 2: class_index_of_plot = 0 else: class_index_of_plot = 1 path_1 = "C:/Users/benya/Desktop/my_PhD/QQE/codes/4_results/17_face_glasses_transform_inputSpace/run2_good/algorithm_files/class_" + str(class_index_of_plot) + "/fuzzy_QQplot/iterations_numpy/" X_class = load_variable(name_of_variable=plot_name, path=path_1) if i != 0: X[:, y==class_index_of_plot] = X_class # plt.scatter(X[0, :], X[1, :], c=y, cmap=color_map, edgecolors='k') markers = ["v", "o"] colors = ["r", "b"] for class_index in range(2): sample_of_this_class = X[:, y == class_index] # c = class_index * np.ones((sample_of_this_class.shape[1],)) plt.scatter(sample_of_this_class[0, :], sample_of_this_class[1, :], s=30, color=colors[class_index], alpha=1.0, marker=markers[class_index]) plt.xticks(fontsize=20) plt.yticks(fontsize=20) # plt.show() plt.savefig(path_save + str(i) + ".png") plt.clf() plt.close() evaluate_embedding(embedding=X.T, labels=y, path_save_accuracy_of_test_data=path_save, k_list=[1, 2, 4, 8, 16], name=str(i))
nilq/baby-python
python
from flask_apscheduler import APScheduler from actions import * from context import * from config import Config class Executor: """ An Executor drives a pipeline which composed by a sequence of actions with a context """ def __init__(self, config: Config, pipeline_name, pipeline): self.config = config self.pipeline_name = pipeline_name self.pipeline = pipeline self.__context = Context() from logger import Logger # Each Executor has its own log file self.logger = Logger("%s.log" % pipeline_name).get_logger() def start(self): pass def get_context(self): return self.__context def execute(self, args): """ """ self.__on_execute(args) def __on_execute(self, args): """ """ # self.logger.info(self.pipeline_name, self.pipeline) action_name = Config.get_start_action_name(self.pipeline) while action_name: action_config = Config.get_action_config(self.pipeline, action_name) if not action_config: break if 'type' not in action_config: print("No action type for ", action_name) exit(0) action_type = action_config['type'] action_type = action_config['type'] action = BaseAction.create_action(action_type, action_config) print(action_name, action) action.try_execute(self.get_context()) action_name = action.get_next()
nilq/baby-python
python
#!/usr/bin/env python import os try: import cplex except ImportError: cplex = None import numpy as np from mapel.voting.metrics.inner_distances import hamming # FOR SUBELECTIONS def solve_lp_voter_subelection(election_1, election_2, metric_name='0'): """ LP solver for voter subelection problem """ cp = cplex.Cplex() cp.parameters.threads.set(1) # OBJECTIVE FUNCTION cp.objective.set_sense(cp.objective.sense.maximize) objective = [] names = [] for v1 in range(election_1.num_voters): for v2 in range(election_2.num_voters): names.append('N' + str(v1) + '_' + str(v2)) objective.append(1.) cp.variables.add(obj=objective, names=names, types=[ cp.variables.type.binary] * election_1.num_voters * election_2.num_voters) # FIRST CONSTRAINT FOR VOTERS lin_expr = [] for v1 in range(election_1.num_voters): ind = [] for v2 in range(election_2.num_voters): ind.append('N' + str(v1) + '_' + str(v2)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * election_2.num_voters)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['L'] * election_1.num_voters, rhs=[1.0] * election_1.num_voters, names=['C1_' + str(i) for i in range(election_1.num_voters)]) # SECOND CONSTRAINT FOR VOTERS lin_expr = [] for v2 in range(election_2.num_voters): ind = [] for v1 in range(election_1.num_voters): ind.append('N' + str(v1) + '_' + str(v2)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * election_1.num_voters)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['L'] * election_2.num_voters, rhs=[1.0] * election_2.num_voters, names=['C2_' + str(i) for i in range(election_2.num_voters)]) # ADD VARIABLES FOR CANDIDATES names = [] for c1 in range(election_1.num_candidates): for c2 in range(election_2.num_candidates): names.append('M' + str(c1) + '_' + str(c2)) cp.variables.add(names=list(names), types=[ cp.variables.type.binary] * election_1.num_candidates * election_2.num_candidates) # FIRST CONSTRAINT FOR CANDIDATES lin_expr = [] for c1 in range(election_1.num_candidates): ind = [] for c2 in range(election_2.num_candidates): ind.append('M' + str(c1) + '_' + str(c2)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * election_2.num_candidates)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * election_1.num_candidates, rhs=[1.0] * election_1.num_candidates, names=['C3_' + str(i) for i in range(election_1.num_candidates)]) # SECOND CONSTRAINT FOR CANDIDATES lin_expr = [] for c2 in range(election_2.num_candidates): ind = [] for c1 in range(election_1.num_candidates): ind.append('M' + str(c1) + '_' + str(c2)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * election_1.num_candidates)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * election_2.num_candidates, rhs=[1.0] * election_2.num_candidates, names=['C4_' + str(i) for i in range(election_2.num_candidates)]) # MAIN CONSTRAINT FOR VOTES lin_expr = [] for v1 in range(election_1.num_voters): for v2 in range(election_2.num_voters): ind = [] val = [] for c1 in range(election_1.num_candidates): for c2 in range(election_2.num_candidates): ind.append('M' + str(c1) + '_' + str(c2)) if abs(election_1.potes[v1][c1] - election_2.potes[v2][c2]) <= int(metric_name): val.append(1.) else: val.append(0.) ind.append('N' + str(v1) + '_' + str(v2)) val.append(-election_1.num_candidates) lin_expr.append(cplex.SparsePair(ind=ind, val=val)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['G'] * election_1.num_voters * election_2.num_voters, rhs=[0.0] * election_1.num_voters * election_2.num_voters, names=['C5_' + str(i) for i in range(election_1.num_voters * election_2.num_voters)]) # cp.write('new.lp') # SOLVE THE ILP cp.set_results_stream(None) try: cp.solve() except: # cplex.CplexSolverError: print("Exception raised while solving") return objective_value = cp.solution.get_objective_value() return objective_value def solve_lp_candidate_subelections(lp_file_name, election_1, election_2): """ LP solver for candidate subelection problem """ # PRECOMPUTING # """ P = np.zeros([election_1.num_voters, election_2.num_voters, election_1.num_candidates, election_2.num_candidates, election_1.num_candidates, election_2.num_candidates]) for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): for d2 in range(election_2.num_candidates): if (election_1.potes[v][c1] > election_1.potes[v][c2] and election_2.potes[u][d1] > election_2.potes[u][d2]) or \ (election_1.potes[v][c1] < election_1.potes[v][c2] and election_2.potes[u][d1] < election_2.potes[u][d2]): P[v][u][c1][d1][c2][d2] = 1 # print(P) # """ # CREATE LP FILE lp_file = open(lp_file_name, 'w') lp_file.write("Maximize\nobj: ") first = True for c in range(election_1.num_candidates): for d in range(election_2.num_candidates): if not first: lp_file.write(" + ") first = False lp_file.write(" M_" + str(c) + "_" + str(d)) lp_file.write("\n") """ first = True for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue if P[v][u][c1][d1][c2][d2] == 1: if not first: lp_file.write(" + ") first = False lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) lp_file.write("\n") """ lp_file.write("Subject To\n") ctr_c = 0 # FIRST CONSTRAINT FOR VOTERS for v in range(election_1.num_voters): lp_file.write("c" + str(ctr_c) + ":") first = True for u in range(election_2.num_voters): if not first: lp_file.write(" +") first = False lp_file.write(" N_" + str(v) + "_" + str(u)) lp_file.write(" = 1" + "\n") ctr_c += 1 # SECOND CONSTRAINT FOR VOTERS for u in range(election_2.num_voters): lp_file.write("c" + str(ctr_c) + ":") first = True for v in range(election_1.num_voters): if not first: lp_file.write(" +") first = False lp_file.write(" N_" + str(v) + "_" + str(u)) lp_file.write(" = 1" + "\n") ctr_c += 1 # FIRST CONSTRAINT FOR CANDIDATES for c in range(election_1.num_candidates): lp_file.write("c" + str(ctr_c) + ":") first = True for d in range(election_2.num_candidates): if not first: lp_file.write(" +") first = False lp_file.write(" M_" + str(c) + "_" + str(d)) lp_file.write(" <= 1" + "\n") ctr_c += 1 # SECOND CONSTRAINT FOR CANDIDATES for d in range(election_2.num_candidates): lp_file.write("c" + str(ctr_c) + ":") first = True for c in range(election_1.num_candidates): if not first: lp_file.write(" +") first = False lp_file.write(" M_" + str(c) + "_" + str(d)) lp_file.write(" <= 1" + "\n") ctr_c += 1 # FIRST CONSTRAINT FOR P for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue # if P[v][u][c1][d1][c2][d2] == 1: lp_file.write("c" + str(ctr_c) + ":") lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) lp_file.write(" - 0.34 N_" + str(v) + "_" + str(u)) lp_file.write(" - 0.34 M_" + str(c1) + "_" + str(d1)) lp_file.write(" - 0.34 M_" + str(c2) + "_" + str(d2)) lp_file.write(" <= 0" + "\n") ctr_c += 1 # SECOND CONSTRAINT FOR P for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue # if P[v][u][c1][d1][c2][d2] == 1: lp_file.write("c" + str(ctr_c) + ":") lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) # lp_file.write(" + 1") lp_file.write(" - 0.34 N_" + str(v) + "_" + str(u)) lp_file.write(" - 0.34 M_" + str(c1) + "_" + str(d1)) lp_file.write(" - 0.34 M_" + str(c2) + "_" + str(d2)) lp_file.write(" > -1" + "\n") ctr_c += 1 # THIRD CONSTRAINT FOR P for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue # if P[v][u][c1][d1][c2][d2] == 1: lp_file.write("c" + str(ctr_c) + ":") lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) lp_file.write(" <= " + str(P[v][u][c1][d1][c2][d2]) + "\n") ctr_c += 1 """ # NEW 1 for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): lp_file.write("c" + str(ctr_c) + ":") first = True for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue if P[v][u][c1][d1][c2][d2] == 1: if not first: lp_file.write(" +") first = False lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) lp_file.write(' - ' + str((magic_param-1)*election_1.num_voters) + ' M_' + str(c1) + '_' + str(d1) + ' = 0' + "\n") ctr_c += 1 # NEW 2 for v in range(election_1.num_voters): for u in range(election_2.num_voters): lp_file.write("c" + str(ctr_c) + ":") first = True for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue if P[v][u][c1][d1][c2][d2] == 1: if not first: lp_file.write(" +") first = False lp_file.write(" P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2)) lp_file.write(' - ' + str((magic_param-1)*2) + ' N_' + str(v) + '_' + str(u) + ' = 0' + "\n") ctr_c += 1 """ lp_file.write("Binary\n") for v in range(election_1.num_voters): for u in range(election_2.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_2.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_2.num_candidates): if d1 == d2: continue # if P[v][u][c1][d1][c2][d2] == 1: lp_file.write("P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str( d2) + "\n") for v in range(election_1.num_voters): for u in range(election_2.num_voters): lp_file.write("N_" + str(v) + "_" + str(u) + "\n") for c in range(election_1.num_candidates): for d in range(election_2.num_candidates): lp_file.write("M_" + str(c) + "_" + str(d) + "\n") lp_file.write("End\n") lp_file.close() ### SECOND PART cp_lp = cplex.Cplex(lp_file_name) cp_lp.parameters.threads.set(1) cp_lp.set_results_stream(None) try: cp_lp.solve() except: # cplex.CplexSolverError: print("Exception raised during solve") return ########################## ########################## result = np.zeros([election_1.num_candidates, election_1.num_candidates]) for i in range(election_1.num_candidates): for j in range(election_1.num_candidates): name = 'M_' + str(i) + '_' + str(j) result[i][j] = cp_lp.solution.get_values(name) # print('M', result) """ result_2 = np.zeros([election_1.num_voters, election_1.num_voters]) for i in range(election_1.num_voters): for j in range(election_1.num_voters): election_id = 'N_' + str(i) + '_' + str(j) result_2[i][j] = cp_lp.solution.get_values(election_id) print('N', result_2) total = 0 for v in range(election_1.num_voters): for u in range(election_1.num_voters): for c1 in range(election_1.num_candidates): for d1 in range(election_1.num_candidates): for c2 in range(election_1.num_candidates): if c1 == c2: continue for d2 in range(election_1.num_candidates): if d1 == d2: continue #if P[v][u][c1][d1][c2][d2] == 1: election_id = "P_" + str(v) + "_" + str(u) + "_" + str(c1) + "_" + str(d1) + "_" + str(c2) + "_" + str(d2) value = cp_lp.solution.get_values(election_id) #print(value) if value == 1: print(election_id) total += value print(total) """ ########################## ########################## # objective_value = cp_lp.solution.get_objective_value() # print('O-V: ', objective_value) # print(sum(sum(result))) return sum(sum(result)) # FOR METRICS def solve_lp_matching_vector_with_lp(cost_table, length): """ LP solver for vectors' matching """ # print(cost_table) cp = cplex.Cplex() cp.parameters.threads.set(1) # OBJECTIVE FUNCTION cp.objective.set_sense(cp.objective.sense.minimize) objective = [] names = [] pos = 0 for i in range(length): for j in range(length): names.append('x' + str(pos)) objective.append(cost_table[i][j]) pos += 1 cp.variables.add(obj=objective, names=names, types=[cp.variables.type.binary] * length ** 2) # FIRST GROUP OF CONSTRAINTS lin_expr = [] for i in range(length): ind = [] for j in range(length): pos = i * length + j ind.append('x' + str(pos)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * length)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * length, rhs=[1.0] * length) # SECOND GROUP OF CONSTRAINTS lin_expr = [] for j in range(length): ind = [] for i in range(length): pos = i * length + j ind.append('x' + str(pos)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * length)) cp.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * length, rhs=[1.0] * length) # c.write('new.lp') # SOLVE THE ILP cp.set_results_stream(None) try: cp.solve() except: # cplex.CplexSolverError: print("Exception raised while solving") return # UNPACK THE RESULTS """ result = [0.] * length ** 2 for i in range(len(result)): result[i] = c.solution.get_values('x' + str(i)) matching = [0] * length ctr = 0 for i in range(len(result)): if result[i] == 1: matching[ctr] = i % length ctr += 1 """ objective_value = cp.solution.get_objective_value() return objective_value def solve_lp_matching_interval(cost_table, length_1, length_2): precision = length_1 * length_2 # print(cost_table) c = cplex.Cplex() c.parameters.threads.set(1) # OBJECTIVE FUNCTION c.objective.set_sense(c.objective.sense.minimize) c.objective.set_name("Obj") objective = [] names = [] pos = 0 for i in range(length_1): for j in range(length_2): names.append('x' + str(pos)) objective.append(cost_table[i][j]) pos += 1 c.variables.add(obj=objective, names=names, types=[c.variables.type.integer] * precision) # FIRST GROUP OF CONSTRAINTS lin_expr = [] c_names = [] for i in range(length_1): ind = [] for j in range(length_2): pos = i * length_2 + j ind.append('x' + str(pos)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * length_2)) c_names.append('c1_' + str(i)) c.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * length_1, rhs=[length_2] * length_1, names=c_names) # SECOND GROUP OF CONSTRAINTS lin_expr = [] c_names = [] for j in range(length_2): ind = [] for i in range(length_1): pos = i * length_2 + j ind.append('x' + str(pos)) lin_expr.append(cplex.SparsePair(ind=ind, val=[1.0] * length_1)) c_names.append('c2_' + str(j)) c.linear_constraints.add(lin_expr=lin_expr, senses=['E'] * length_2, rhs=[length_1] * length_2, names=c_names) c.write('interval.lp') c.write('interval.mps') # SOLVE THE ILP c.set_results_stream(None) try: c.solve() except: # cplex.CplexSolverError: print("Exception raised while solving") return result = c.solution.get_objective_value() / precision return result # DODGSON SCORE def generate_lp_file_dodgson_score(lp_file_name, N=None, e=None, D=None): lp_file = open(lp_file_name, 'w') lp_file.write("Minimize\nobj: ") first = True for i in range(len(N)): for j in range(1, len(D)): if not first: lp_file.write(" + ") first = False lp_file.write(str(j) + " y" + str(i) + "_" + str(j)) lp_file.write("\n") lp_file.write("Subject To\n") ctr_c = 0 for i in range(len(N)): lp_file.write("c" + str(ctr_c) + ":") lp_file.write(" y" + str(i) + "_" + str(0) + " = " + str(N[i]) + "\n") ctr_c += 1 # """ for k in range(len(D)): lp_file.write("c" + str(ctr_c) + ":") first = True for i in range(len(N)): for j in range(1, len(D)): # print(i,j,k) # print(e[i][j][k], e[i][j-1][k]) if not first: lp_file.write(" +") first = False lp_file.write(" " + str(e[i][j][k] - e[i][j - 1][k]) + " y" + str(i) + "_" + str(j)) lp_file.write(" >= " + str(D[k]) + "\n") ctr_c += 1 # """ # """ for i in range(len(N)): for j in range(1, len(D)): lp_file.write("c" + str(ctr_c) + ":") lp_file.write( " y" + str(i) + "_" + str(j - 1) + " - y" + str(i) + "_" + str(j) + " >= 0" + "\n") ctr_c += 1 # """ # """ # chyba nie potrzeba bo integer zalatwia sprawe... for i in range(len(N)): for j in range(len(D)): lp_file.write("c" + str(ctr_c) + ":") lp_file.write(" y" + str(i) + "_" + str(j) + " >= 0" + "\n") ctr_c += 1 # """ # """ lp_file.write("General\n") for i in range(len(N)): for j in range(len(D)): lp_file.write("y" + str(i) + "_" + str(j) + "\n") ctr_c += 1 # """ lp_file.write("End\n") def solve_lp_dodgson_score(lp_file_name): """ this function ...""" cp_lp = cplex.Cplex(lp_file_name) cp_lp.parameters.threads.set(1) cp_lp.set_results_stream(None) try: cp_lp.solve() except: # cplex.CplexSolverError: print("Exception raised during solve") return """ import numpy as np result = np.zeros([len(N), len(D)]) for i in range(len(N)): for j in range(len(D)): result[i] = cp_lp.solution.get_values('y' + str(i) + '_' + str(j)) """ return cp_lp.solution.get_objective_value() # FOR WINNERS - needs update def generate_lp_file_borda_owa(owa, lp_file_name, params, votes): """ this function generates lp file""" lp_file = open(lp_file_name, 'w') lp_file.write("Maximize\nobj: ") pos = 0 first = True for i in range(params['voters']): for j in range(params['orders']): for k in range(params['candidates']): if not first and owa[j] >= 0.: lp_file.write(" + ") first = False lp_file.write(str(owa[j]) + " x" + str(pos)) pos += 1 lp_file.write("\n") lp_file.write("Subject To\n") lp_file.write("c0:") first = True for i in range(params['candidates']): if not first: lp_file.write(" +") first = False lp_file.write(" y" + str(i)) lp_file.write(' = ' + str(params['orders']) + '\n') for i in range(params['voters']): for j in range(params['candidates']): lp_file.write("c" + str(i * params['candidates'] + j + 1) + ": ") pos = i * params['orders'] * params['candidates'] + j first = True for k in range(params['orders']): if not first: lp_file.write(" +") first = False lp_file.write(" x" + str(pos + params['candidates'] * k)) for k in range(0, j + 1): lp_file.write(" - y" + str(int(votes[i][k]))) lp_file.write(" <= 0 \n") lp_file.write("Binary\n") for i in range(params['voters'] * params['orders'] * params['candidates']): lp_file.write("x" + str(i) + "\n") for i in range(params['candidates']): lp_file.write("y" + str(i) + "\n") lp_file.write("End\n") def generate_lp_file_bloc_owa(owa, lp_file_name, params, votes, t_bloc): """ this function generates lp file""" lp_file = open(lp_file_name, 'w') lp_file.write("Maximize\nobj: ") pos = 0 first = True for i in range(params['voters']): for j in range(params['orders']): for k in range(params['candidates']): if not first: if k == t_bloc - 1: lp_file.write(" + ") first = False if k == t_bloc - 1: lp_file.write(str(owa[j]) + " x" + str(pos)) pos += 1 lp_file.write("\n") lp_file.write("Subject To\n") lp_file.write("c0:") first = True for i in range(params['candidates']): if not first: lp_file.write(" +") first = False lp_file.write(" y" + str(i)) lp_file.write(' = ' + str(params['orders']) + '\n') for i in range(params['voters']): for j in range(params['candidates']): lp_file.write("c" + str(i * params['candidates'] + j + 1) + ": ") pos = i * params['orders'] * params['candidates'] + j first = True for k in range(params['orders']): if not first: lp_file.write(" +") first = False lp_file.write(" x" + str(pos + params['candidates'] * k)) for k in range(0, j + 1): lp_file.write(" - y" + str(int(votes[i][k]))) lp_file.write(" <= 0 \n") lp_file.write("Binary\n") for i in range(params['voters'] * params['orders'] * params['candidates']): lp_file.write("x" + str(i) + "\n") for i in range(params['candidates']): lp_file.write("y" + str(i) + "\n") lp_file.write("End\n") def get_winners_from_lp(tmp_file, params, candidates): """ this function ...""" cp_lp = cplex.Cplex(tmp_file) cp_lp.parameters.threads.set(1) cp_lp.set_results_stream(None) try: cp_lp.solve() except cplex.CplexSolverError: print("Exception raised during solve") return result = [0.] * params['candidates'] for i in range(params['candidates']): result[i] = cp_lp.solution.get_values('y' + str(i)) # print(result) params['pure'] = True winner_id = 0 winners = [0.] * params['orders'] for i in range(params['candidates']): if result[i] == 1.: if params['pure']: winners[winner_id] = i else: winners[winner_id] = candidates[i] winner_id += 1 winners = sorted(winners) return winners """ def generate_lp_file_matching_matrix_half(lp_file_name, matrix_1, matrix_2, length): # [1, 4, 6, 9, 11] # [1, 5, 6, 9, 11] print(matrix_1) print(matrix_2) lp_file = open(lp_file_name, 'w') lp_file.write("Minimize\n") # obj: ") first = True for k in range(length): for l in range(length): for i in range(k+1, length): for j in range(l+1, length): if not first: lp_file.write(" + ") first = False weight = abs(matrix_1[k][i] - matrix_2[l][j])#**2 print(weight) lp_file.write(str(weight) + " P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write("\n") lp_file.write("Subject To\n") for k in range(length): for l in range(length): for i in range(k+1, length): for j in range(l+1, length): lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "M" + "i" + str(i) + "j" + str(j) + " <= 0" + "\n") lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "M" + "i" + str(k) + "j" + str(l) + " <= 0" + "\n") for i in range(length): first = True for j in range(length): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") for j in range(length): first = True for i in range(length): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # Not sure about this part # for k in range(length): for i in range(k+1, length): if k == i: continue first = True for l in range(length): for j in range(l+1, length): if l == j: continue if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # Not sure about this part # for l in range(length): for j in range(l+1, length): if l == j: continue first = True for k in range(length): for i in range(k+1, length): if k == i: continue if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") lp_file.write("Binary\n") for k in range(length): for l in range(length): for i in range(k+1, length): for j in range(l+1, length): lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j) + "\n") for i in range(length): for j in range(length): lp_file.write("M" + "i" + str(i) + "j" + str(j) + "\n") lp_file.write("End\n") """ def generate_lp_file_matching_matrix(lp_file_name, matrix_1, matrix_2, length, inner_distance): lp_file = open(lp_file_name, 'w') lp_file.write("Minimize\n") first = True for k in range(length): for l in range(length): for i in range(length): if i == k: continue for j in range(length): if j == l: continue if not first: lp_file.write(" + ") first = False weight = inner_distance(matrix_1[k][i], matrix_2[l][j]) lp_file.write( str(weight) + " P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str( j)) lp_file.write("\n") lp_file.write("Subject To\n") for k in range(length): for l in range(length): for i in range(length): if i == k: continue for j in range(length): if j == l: continue lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "M" + "i" + str(i) + "j" + str(j) + " <= 0" + "\n") lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "M" + "i" + str(k) + "j" + str(l) + " <= 0" + "\n") for i in range(length): first = True for j in range(length): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") for j in range(length): first = True for i in range(length): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # Not sure about this part # for k in range(length): for i in range(length): if k == i: continue first = True for l in range(length): for j in range(length): if l == j: continue if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # Not sure about this part # for l in range(length): for j in range(length): if l == j: continue first = True for k in range(length): for i in range(length): if k == i: continue if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") lp_file.write("Binary\n") for k in range(length): for l in range(length): for i in range(length): if i == k: continue for j in range(length): if j == l: continue lp_file.write( "P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j) + "\n") for i in range(length): for j in range(length): lp_file.write("M" + "i" + str(i) + "j" + str(j) + "\n") lp_file.write("End\n") def solve_lp_matrix(lp_file_name, matrix_1, matrix_2, length): cp_lp = cplex.Cplex(lp_file_name) cp_lp.set_results_stream(None) cp_lp.parameters.threads.set(1) # cp_lp.parameters.mip.tolerances.mipgap = 0.0001 # cp_lp.parameters.mip.strategy.probe.set(3) try: cp_lp.solve() except: print("Exception raised during solve") return """ for k in range(length): for l in range(length): for i in range(k+1, length): if k == i: continue for j in range(l+1, length): if l == j: continue A = "P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j) if int(cp_lp.solution.get_values(A)) == 1: print(A) """ """ for i in range(length): for j in range(length): A = "M" + "i" + str(i) + "j" + str(j) if int(cp_lp.solution.get_values(A)) == 1: print(A) """ # print(cp_lp.solution.get_objective_value()) return cp_lp.solution.get_objective_value() # SPEARMAN - old def generate_ilp_distance(lp_file_name, votes_1, votes_2, params, metric_name): lp_file = open(lp_file_name, 'w') lp_file.write("Minimize\n") # obj: ") first = True for k in range(params['voters']): for l in range(params['voters']): vote_1 = votes_1[k] vote_2 = votes_2[l] if metric_name == 'spearman': pote_1 = [0] * params['candidates'] pote_2 = [0] * params['candidates'] for i in range(params['candidates']): pote_1[vote_1[i]] = i pote_2[vote_2[i]] = i for i in range(params['candidates']): for j in range(params['candidates']): if not first: lp_file.write(" + ") first = False if metric_name == "spearman": weight = abs(pote_1[i] - pote_2[j]) elif metric_name == "alt": weight = float(abs(pote_1[i] - pote_2[j]) ** (2)) / float( 1. + min(pote_1[i], pote_2[j])) elif metric_name == 'hamming': weight = hamming(vote_1, vote_2) else: weight = 0 lp_file.write( str(weight) + " P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str( j)) lp_file.write("\n") lp_file.write("Subject To\n") for k in range(params['voters']): for l in range(params['voters']): for i in range(params['candidates']): for j in range(params['candidates']): lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "M" + "i" + str(i) + "j" + str(j) + " <= 0" + "\n") lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" - " + "N" + "k" + str(k) + "l" + str(l) + " <= 0" + "\n") for k in range(params['voters']): first = True for l in range(params['voters']): if not first: lp_file.write(" + ") first = False lp_file.write("N" + "k" + str(k) + "l" + str(l)) lp_file.write(" = 1" + "\n") for l in range(params['voters']): first = True for k in range(params['voters']): if not first: lp_file.write(" + ") first = False lp_file.write("N" + "k" + str(k) + "l" + str(l)) lp_file.write(" = 1" + "\n") for i in range(params['candidates']): first = True for j in range(params['candidates']): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") for j in range(params['candidates']): first = True for i in range(params['candidates']): if not first: lp_file.write(" + ") first = False lp_file.write("M" + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # IMPORTANT # for k in range(params['voters']): for i in range(params['candidates']): first = True for l in range(params['voters']): for j in range(params['candidates']): if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") # IMPORTANT # for l in range(params['voters']): for j in range(params['candidates']): first = True for k in range(params['voters']): for i in range(params['candidates']): if not first: lp_file.write(" + ") first = False lp_file.write("P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j)) lp_file.write(" = 1" + "\n") lp_file.write("Binary\n") for k in range(params['voters']): for l in range(params['voters']): for i in range(params['candidates']): for j in range(params['candidates']): lp_file.write( "P" + "k" + str(k) + "l" + str(l) + "i" + str(i) + "j" + str(j) + "\n") for k in range(params['voters']): for l in range(params['voters']): lp_file.write("N" + "k" + str(k) + "l" + str(l) + "\n") for i in range(params['candidates']): for j in range(params['candidates']): lp_file.write("M" + "i" + str(i) + "j" + str(j) + "\n") lp_file.write("End\n") def solve_ilp_distance(lp_file_name, votes_1, votes_2, params, metric_name): cp_lp = cplex.Cplex(lp_file_name) cp_lp.set_results_stream(None) # cp_lp.parameters.threads.set(1) # cp_lp.parameters.timelimit.set(60) try: cp_lp.solve() except cplex.CplexSolverError: print("Exception raised during solve") return total = cp_lp.solution.get_objective_value() return total def spearman_cost(single_votes_1, single_votes_2, params, perm): pote_1 = [0] * params['candidates'] pote_2 = [0] * params['candidates'] for i in range(params['candidates']): id_1 = int(perm[0][single_votes_1[i]]) pote_1[id_1] = i id_2 = int(perm[1][single_votes_2[i]]) pote_2[id_2] = i total_diff = 0. for i in range(params['candidates']): local_diff = float(abs(pote_1[i] - pote_2[i])) total_diff += local_diff return total_diff def spearman_cost_per_cand(single_votes_1, single_votes_2, params, perm): pote_1 = [0] * params['candidates'] pote_2 = [0] * params['candidates'] for i in range(params['candidates']): id_1 = int(perm[0][single_votes_1[i]]) pote_1[id_1] = i id_2 = int(perm[1][single_votes_2[i]]) pote_2[id_2] = i cand_diff = [0] * params['candidates'] for i in range(params['candidates']): cand_diff[i] = float(abs(pote_1[i] - pote_2[i])) return cand_diff def remove_lp_file(path): """ Safely remove lp file """ try: os.remove(path) except: pass
nilq/baby-python
python
# -*- coding: utf-8 -*- # Author : Jesse Wei # LastUpdate : 2020/10/04 # Impact : Jobs generated by SQLG # Message : Humanity towards others, we live by sharing. Fear can hold you prisoner, only hope can set you free. # from __future__ import print_function import logging import re import airflow import pendulum from datetime import datetime, timedelta from airflow.operators.sensors import ExternalTaskSensor from airflow.operators.python_operator import PythonOperator from airflow.operators.bash_operator import BashOperator from airflow.contrib.sensors.file_sensor import FileSensor from airflow import models from airflow.models import Variable, DagModel, DagBag from airflow.operators.python_operator import BranchPythonOperator from airflow.operators.dummy_operator import DummyOperator # For ODP platform # from acme.operators.sqlg_oracle import OracleOperatorWithTemplatedParams # from airflow.operators.oracle_operator import OracleOperator from acme.operators.sqlg_mssql import MsSqlOperatorWithTemplatedParams from airflow.operators.mssql_operator import MsSqlOperator # DB_NAME = 'DWH' # for future xDB operator proj_start_date = pendulum.datetime(2021, 1, 1, tzinfo="Etc/GMT-8") tmpl_search_path = Variable.get("sql_path") data_stage_imp_ptn = '_ODS_' data_stage = [] # list for standard internval order sequence std_interval = { '@once' :1, '@hourly' :2, '0 5 * * *' :3, '0 5 * * 0' :4, '0 5 1 * *' :5, '0 5 1 */3 *' :6, '0 5 1 1 *' :7, } # function to sync execution for diff frequency def sqlg_exec_date_fn(dt, context): var_date = Variable.get("sqlg_execution_date") ti = context['ti'] dag = context['dag'] ti_exec_date = context['execution_date'] schedule_interval = dag.schedule_interval # if wait INIT and standard freq then set as default {{ ds }} # set in planner # else use dag own execution date if ti.task.external_dag_id == 'D_STG_INIT' and schedule_interval[0] == '@': exec_date = pendulum.parse(var_date) else: exec_date = ti_exec_date print("sqlg_exec_date_fn::DEBUG:external_dag_id, exec_date:", ti.task.external_dag_id, exec_date) return exec_date args = { "owner": "SPA010038", 'start_date': proj_start_date, 'provide_context': True } # XSLT:loop: declaration: END} # XSLT:loop: JOB_FLOW_NAME: START{ job_flow_name = "D_ODS_SCM" data_stage = job_flow_name.split('_') tags = data_stage D_ODS_SCM = airflow.DAG( "D_ODS_SCM", tags=tags, schedule_interval="0 5 * * *", dagrun_timeout=timedelta(minutes=60*4), template_searchpath=tmpl_search_path, default_args=args, # start_date=proj_start_date, max_active_runs=1 ) job_flow_name = "D_DM_SCM" data_stage = job_flow_name.split('_') tags = data_stage D_DM_SCM = airflow.DAG( "D_DM_SCM", tags=tags, schedule_interval="0 5 * * *", dagrun_timeout=timedelta(minutes=60*4), template_searchpath=tmpl_search_path, default_args=args, # start_date=proj_start_date, max_active_runs=1 ) job_flow_name = "D_INT_SCM" data_stage = job_flow_name.split('_') tags = data_stage D_INT_SCM = airflow.DAG( "D_INT_SCM", tags=tags, schedule_interval="0 5 * * *", dagrun_timeout=timedelta(minutes=60*4), template_searchpath=tmpl_search_path, default_args=args, # start_date=proj_start_date, max_active_runs=1 ) # XSLT:loop: JOB_FLOW_NAME: END} # JOB_TYPE=ODS-MAIN my_taskid = "PNL_Revenue_Cost_A" PNL_Revenue_Cost_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "NRE_Summary" NRE_Summary = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "Daily_Revenue_F" Daily_Revenue_F = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "RFQ_Master" RFQ_Master = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "Inventory_A" Inventory_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DOI_Actual" DOI_Actual = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_ODS_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_PNL_Revenue_Cost_A" DM_PNL_Revenue_Cost_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_NRE_Summary" DM_NRE_Summary = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_Daily_Revenue_F" DM_Daily_Revenue_F = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_RFQ_Master" DM_RFQ_Master = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_Inventory_A" DM_Inventory_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "DM_DOI_Actual" DM_DOI_Actual = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_DM_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_PNL_Revenue_Cost_A" INT_PNL_Revenue_Cost_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_NRE_Summary" INT_NRE_Summary = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_Daily_Revenue_F" INT_Daily_Revenue_F = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_RFQ_Master" INT_RFQ_Master = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_Inventory_A" INT_Inventory_A = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) # JOB_TYPE=ODS-MAIN my_taskid = "INT_DOI_Actual" INT_DOI_Actual = MsSqlOperatorWithTemplatedParams( auto_commit=True, task_id=my_taskid, pool = "sql_pool", dag=D_INT_SCM, # parameters=({":END_DT_CHAR":"{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}"}), timeout=60*60*3, sql= "EXECUTE SQLEXT." + my_taskid + "_SP "+ "{{ (execution_date.astimezone('Asia/Taipei')).strftime('%Y%m%d') }}" + ";" ) ExternalTaskSensor.ui_color = 'white' ExternalTaskSensor.ui_fgcolor = 'blue' # tmpl_search_path = Variable.get("sql_path") # XSLT:loop: JOB_FLOW_NAME-and-PRE_JOB: External:START{{ def branch_D_ODS_SCMxD_STG_INIT__SYS_STS_STG(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_STG_INIT") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG","D_ODS_SCMxD_STG_INIT__SYS_STS_STG"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG","D_ODS_SCMxD_STG_INIT__SYS_STS_STG"] return ["proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG"] my_taskid = "BRANCH_D_ODS_SCMxD_STG_INIT__SYS_STS_STG" BRANCH_D_ODS_SCMxD_STG_INIT__SYS_STS_STG= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_ODS_SCMxD_STG_INIT__SYS_STS_STG, dag=D_ODS_SCM, provide_context=True, ) my_taskid = "proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG" proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_ODS_SCM, ) # Cross dag sensor my_taskid = "D_ODS_SCMxD_STG_INIT__SYS_STS_STG" D_ODS_SCMxD_STG_INIT__SYS_STS_STG= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_STG_INIT", external_task_id="SYS_STS_STG", mode="reschedule", dag=D_ODS_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG) BRANCH_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(D_ODS_SCMxD_STG_INIT__SYS_STS_STG) D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG) def branch_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A","D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A","D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A" BRANCH_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A" proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A" D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_PNL_Revenue_Cost_A", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A) BRANCH_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A.set_downstream(D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A) D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A) def branch_D_DM_SCMxD_INT_SCM__INT_NRE_Summary(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary","D_DM_SCMxD_INT_SCM__INT_NRE_Summary"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary","D_DM_SCMxD_INT_SCM__INT_NRE_Summary"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_NRE_Summary" BRANCH_D_DM_SCMxD_INT_SCM__INT_NRE_Summary= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_NRE_Summary, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary" proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_NRE_Summary" D_DM_SCMxD_INT_SCM__INT_NRE_Summary= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_NRE_Summary", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_NRE_Summary.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary) BRANCH_D_DM_SCMxD_INT_SCM__INT_NRE_Summary.set_downstream(D_DM_SCMxD_INT_SCM__INT_NRE_Summary) D_DM_SCMxD_INT_SCM__INT_NRE_Summary.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary) def branch_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F","D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F","D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F" BRANCH_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F" proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F" D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_Daily_Revenue_F", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F) BRANCH_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F.set_downstream(D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F) D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F) def branch_D_DM_SCMxD_INT_SCM__INT_RFQ_Master(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master","D_DM_SCMxD_INT_SCM__INT_RFQ_Master"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master","D_DM_SCMxD_INT_SCM__INT_RFQ_Master"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_RFQ_Master" BRANCH_D_DM_SCMxD_INT_SCM__INT_RFQ_Master= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_RFQ_Master, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master" proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_RFQ_Master" D_DM_SCMxD_INT_SCM__INT_RFQ_Master= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_RFQ_Master", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_RFQ_Master.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master) BRANCH_D_DM_SCMxD_INT_SCM__INT_RFQ_Master.set_downstream(D_DM_SCMxD_INT_SCM__INT_RFQ_Master) D_DM_SCMxD_INT_SCM__INT_RFQ_Master.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master) def branch_D_DM_SCMxD_INT_SCM__INT_Inventory_A(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A","D_DM_SCMxD_INT_SCM__INT_Inventory_A"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A","D_DM_SCMxD_INT_SCM__INT_Inventory_A"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_Inventory_A" BRANCH_D_DM_SCMxD_INT_SCM__INT_Inventory_A= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_Inventory_A, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A" proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_Inventory_A" D_DM_SCMxD_INT_SCM__INT_Inventory_A= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_Inventory_A", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_Inventory_A.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A) BRANCH_D_DM_SCMxD_INT_SCM__INT_Inventory_A.set_downstream(D_DM_SCMxD_INT_SCM__INT_Inventory_A) D_DM_SCMxD_INT_SCM__INT_Inventory_A.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A) def branch_D_DM_SCMxD_INT_SCM__INT_DOI_Actual(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_INT_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual","D_DM_SCMxD_INT_SCM__INT_DOI_Actual"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual","D_DM_SCMxD_INT_SCM__INT_DOI_Actual"] return ["proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual"] my_taskid = "BRANCH_D_DM_SCMxD_INT_SCM__INT_DOI_Actual" BRANCH_D_DM_SCMxD_INT_SCM__INT_DOI_Actual= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_DM_SCMxD_INT_SCM__INT_DOI_Actual, dag=D_DM_SCM, provide_context=True, ) my_taskid = "proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual" proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_DM_SCM, ) # Cross dag sensor my_taskid = "D_DM_SCMxD_INT_SCM__INT_DOI_Actual" D_DM_SCMxD_INT_SCM__INT_DOI_Actual= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_INT_SCM", external_task_id="INT_DOI_Actual", mode="reschedule", dag=D_DM_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_DM_SCMxD_INT_SCM__INT_DOI_Actual.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual) BRANCH_D_DM_SCMxD_INT_SCM__INT_DOI_Actual.set_downstream(D_DM_SCMxD_INT_SCM__INT_DOI_Actual) D_DM_SCMxD_INT_SCM__INT_DOI_Actual.set_downstream(proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual) def branch_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A","D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A","D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A"] return ["proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A" BRANCH_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A" proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A" D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="PNL_Revenue_Cost_A", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A) BRANCH_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A.set_downstream(D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A) D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A) def branch_D_INT_SCMxD_ODS_SCM__NRE_Summary(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary","D_INT_SCMxD_ODS_SCM__NRE_Summary"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary","D_INT_SCMxD_ODS_SCM__NRE_Summary"] return ["proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__NRE_Summary" BRANCH_D_INT_SCMxD_ODS_SCM__NRE_Summary= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__NRE_Summary, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary" proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__NRE_Summary" D_INT_SCMxD_ODS_SCM__NRE_Summary= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="NRE_Summary", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__NRE_Summary.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary) BRANCH_D_INT_SCMxD_ODS_SCM__NRE_Summary.set_downstream(D_INT_SCMxD_ODS_SCM__NRE_Summary) D_INT_SCMxD_ODS_SCM__NRE_Summary.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary) def branch_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F","D_INT_SCMxD_ODS_SCM__Daily_Revenue_F"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F","D_INT_SCMxD_ODS_SCM__Daily_Revenue_F"] return ["proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F" BRANCH_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F" proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__Daily_Revenue_F" D_INT_SCMxD_ODS_SCM__Daily_Revenue_F= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="Daily_Revenue_F", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F) BRANCH_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F.set_downstream(D_INT_SCMxD_ODS_SCM__Daily_Revenue_F) D_INT_SCMxD_ODS_SCM__Daily_Revenue_F.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F) def branch_D_INT_SCMxD_ODS_SCM__RFQ_Master(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master","D_INT_SCMxD_ODS_SCM__RFQ_Master"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master","D_INT_SCMxD_ODS_SCM__RFQ_Master"] return ["proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__RFQ_Master" BRANCH_D_INT_SCMxD_ODS_SCM__RFQ_Master= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__RFQ_Master, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master" proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__RFQ_Master" D_INT_SCMxD_ODS_SCM__RFQ_Master= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="RFQ_Master", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__RFQ_Master.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master) BRANCH_D_INT_SCMxD_ODS_SCM__RFQ_Master.set_downstream(D_INT_SCMxD_ODS_SCM__RFQ_Master) D_INT_SCMxD_ODS_SCM__RFQ_Master.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master) def branch_D_INT_SCMxD_ODS_SCM__Inventory_A(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__Inventory_A","D_INT_SCMxD_ODS_SCM__Inventory_A"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__Inventory_A","D_INT_SCMxD_ODS_SCM__Inventory_A"] return ["proxy_D_INT_SCMxD_ODS_SCM__Inventory_A"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__Inventory_A" BRANCH_D_INT_SCMxD_ODS_SCM__Inventory_A= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__Inventory_A, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__Inventory_A" proxy_D_INT_SCMxD_ODS_SCM__Inventory_A= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__Inventory_A" D_INT_SCMxD_ODS_SCM__Inventory_A= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="Inventory_A", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__Inventory_A.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__Inventory_A) BRANCH_D_INT_SCMxD_ODS_SCM__Inventory_A.set_downstream(D_INT_SCMxD_ODS_SCM__Inventory_A) D_INT_SCMxD_ODS_SCM__Inventory_A.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__Inventory_A) def branch_D_INT_SCMxD_ODS_SCM__DOI_Actual(**context): mydag = context["dag"] dagbag = DagBag() upstream = dagbag.get_dag("D_ODS_SCM") # print("branch::DEBUG:upstream.latest_execution_date:", upstream.latest_execution_date) # print("branch::DEBUG:mydag.execution_date:", context['execution_date']) up_sch_interval = std_interval.get(upstream.schedule_interval) my_sch_interval = std_interval.get(mydag.schedule_interval) if up_sch_interval is None or my_sch_interval is None: if (up_sch_interval is None and my_sch_interval is None) and (upstream.schedule_interval == mydag.schedule_interval): return ["proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual","D_INT_SCMxD_ODS_SCM__DOI_Actual"] elif std_interval[upstream.schedule_interval] >= std_interval[mydag.schedule_interval]: if upstream.latest_execution_date == context["execution_date"]: return ["proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual","D_INT_SCMxD_ODS_SCM__DOI_Actual"] return ["proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual"] my_taskid = "BRANCH_D_INT_SCMxD_ODS_SCM__DOI_Actual" BRANCH_D_INT_SCMxD_ODS_SCM__DOI_Actual= BranchPythonOperator( task_id=my_taskid, python_callable=branch_D_INT_SCMxD_ODS_SCM__DOI_Actual, dag=D_INT_SCM, provide_context=True, ) my_taskid = "proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual" proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual= DummyOperator( task_id=my_taskid, trigger_rule="none_failed_or_skipped", dag=D_INT_SCM, ) # Cross dag sensor my_taskid = "D_INT_SCMxD_ODS_SCM__DOI_Actual" D_INT_SCMxD_ODS_SCM__DOI_Actual= ExternalTaskSensor( pool = "sensor_pool", task_id=my_taskid, external_dag_id="D_ODS_SCM", external_task_id="DOI_Actual", mode="reschedule", dag=D_INT_SCM, check_existence=True, timeout=60*60*1, retries=5, retry_delay=timedelta(minutes=3), execution_date_fn=sqlg_exec_date_fn ) BRANCH_D_INT_SCMxD_ODS_SCM__DOI_Actual.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual) BRANCH_D_INT_SCMxD_ODS_SCM__DOI_Actual.set_downstream(D_INT_SCMxD_ODS_SCM__DOI_Actual) D_INT_SCMxD_ODS_SCM__DOI_Actual.set_downstream(proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual) # XSLT:loop: JOB_FLOW_NAME-and-PRE_JOB: External: END}} # XSLT:loop: JOB_FLOW_NAME: START{ # XSLT:loop: Rows-by-JOB_FLOW_NAME: JOB_NAME: START{{ # FLOW: D_ODS_SCM.PNL_Revenue_Cost_A proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(PNL_Revenue_Cost_A) proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(NRE_Summary) proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(Daily_Revenue_F) proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(RFQ_Master) proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(Inventory_A) proxy_D_ODS_SCMxD_STG_INIT__SYS_STS_STG.set_downstream(DOI_Actual) # XSLT:loop: Rows-by-JOB_FLOW_NAME: JOB_NAME: START{{ # FLOW: D_DM_SCM.DM_PNL_Revenue_Cost_A proxy_D_DM_SCMxD_INT_SCM__INT_PNL_Revenue_Cost_A.set_downstream(DM_PNL_Revenue_Cost_A) proxy_D_DM_SCMxD_INT_SCM__INT_NRE_Summary.set_downstream(DM_NRE_Summary) proxy_D_DM_SCMxD_INT_SCM__INT_Daily_Revenue_F.set_downstream(DM_Daily_Revenue_F) proxy_D_DM_SCMxD_INT_SCM__INT_RFQ_Master.set_downstream(DM_RFQ_Master) proxy_D_DM_SCMxD_INT_SCM__INT_Inventory_A.set_downstream(DM_Inventory_A) proxy_D_DM_SCMxD_INT_SCM__INT_DOI_Actual.set_downstream(DM_DOI_Actual) # XSLT:loop: Rows-by-JOB_FLOW_NAME: JOB_NAME: START{{ # FLOW: D_INT_SCM.INT_PNL_Revenue_Cost_A proxy_D_INT_SCMxD_ODS_SCM__PNL_Revenue_Cost_A.set_downstream(INT_PNL_Revenue_Cost_A) proxy_D_INT_SCMxD_ODS_SCM__NRE_Summary.set_downstream(INT_NRE_Summary) proxy_D_INT_SCMxD_ODS_SCM__Daily_Revenue_F.set_downstream(INT_Daily_Revenue_F) proxy_D_INT_SCMxD_ODS_SCM__RFQ_Master.set_downstream(INT_RFQ_Master) proxy_D_INT_SCMxD_ODS_SCM__Inventory_A.set_downstream(INT_Inventory_A) proxy_D_INT_SCMxD_ODS_SCM__DOI_Actual.set_downstream(INT_DOI_Actual)
nilq/baby-python
python
from segmentTree import SumSegmentTree, MinSegmentTree import numpy as np import matplotlib.pyplot as plt class RingBuffer(object): def __init__(self, maxlen, shape, dtype='int32'): self.maxlen = maxlen self.data = np.zeros((maxlen,) + shape).astype(dtype) self.next_idx = 0 def append(self, v): self.data[self.next_idx] = v self.next_idx = (self.next_idx+1) % self.maxlen def __getitem__(self, idx): if idx < 0 or idx >= self.maxlen: raise KeyError() return self.data[idx] def array_min2d(x): x = np.array(x) if x.ndim >= 2: return x return x.reshape(-1, 1) class Buffer(object): def __init__(self, limit, content_shape): self.next_idx = 0 self.limit = limit self.length = 0 self.contents = {} for content, shape in content_shape.items(): self.contents[content] = RingBuffer(limit, shape=shape) def append(self, buffer_item): for name, value in self.contents.items(): value.append(buffer_item[name]) self.next_idx = (self.next_idx+1) % self.limit if self.length < self.limit: self.length += 1 class PrioritizedGoalBuffer(Buffer): def __init__(self, limit, alpha): self.content = {'goal': (1,)} self.alpha = alpha super(PrioritizedGoalBuffer, self).__init__(limit, self.content) it_capacity = 1 while it_capacity < limit: it_capacity *= 2 self._it_sum = SumSegmentTree(it_capacity) self._max_priority = 1.0 def append(self, buffer_item, priority=None): """See ReplayBuffer.store_effect""" idx = self.next_idx super().append(buffer_item) if priority is None: self._it_sum[idx] = self._max_priority ** self.alpha else: self._it_sum[idx] = priority def sample_proportional_idx(self): sum = self._it_sum.sum() mass = np.random.random() * sum idx = self._it_sum.find_prefixsum_idx(mass) return idx def sample(self): # Draw such that we always have a proceeding element. idx = self.sample_proportional_idx() result = {} for name, value in self.contents.items(): result[name] = array_min2d(value[idx]) return idx, result def update_priority(self, idx, priority): self._it_sum[idx] = priority ** self.alpha self._max_priority = max(self._max_priority, priority) def _demo(): buffer = PrioritizedGoalBuffer(11, 1) samples = np.zeros((100000), dtype=int) for i in range(15): buffer_item = {'goal': i} buffer.append(buffer_item, i) for j in range(100000): idx, sample = buffer.sample() samples[j] = int(sample['goal']) bins = np.bincount(samples) plt.plot(range(bins.shape[0]), bins) plt.show() buffer.update_priority(6,100) for j in range(100000): idx, sample = buffer.sample() samples[j] = int(sample['goal']) bins = np.bincount(samples) plt.plot(range(bins.shape[0]), bins) plt.show() if __name__ == "__main__": _demo()
nilq/baby-python
python
from .plots import Plot,PlotError,PlotState from .. import context from .. import items from .. import maps from .. import randmaps from .. import waypoints from .. import monsters from .. import dialogue from .. import services from .. import teams from .. import characters from .. import namegen import random from .. import cutscene from .. import worlds # BARDIC_DUNGEON # This subplot will generate a dungeon of a given type. All these subplots # should be unique in order to prevent dungeon types from repeating. # - Generate dungeon # - Generate connection to previous dungeon # - Install dungeon # - Add chapter resources, as appropriate class BardicCaves( Plot ): LABEL = "BARDIC_DUNGEON" NAME_PATTERNS = ( "Caverns of {0}", "Caves of {0}", "{0} Grotto", "{0} Chasm" ) DUNGEON_PATTERN = (context.HAB_CAVE,) UNIQUE = True scope = True active = True def custom_init( self, nart ): """Load dungeon levels, and connect this dungeon to the adventure.""" # Decide on a good name. Do this first in case we want to generate an antagonist # or boss monster to include in the dungeon. The name generator will generate # this antagonist, and it will be passed on to the levels of the dungeon. self.elements[ "ANTAGONIST" ] = False self.dname = self.gen_name() # Generate the levels self.levels = self.get_dungeon_levels( nart, self.DUNGEON_PATTERN, self.chapter.start_rank, self.chapter.end_rank ) # Connect all the levels, and name them. self.add_sub_plot( nart, "BARDIC_CONNECTION", PlotState(elements={"LEVELS":self.levels,"DNAME":self.dname}, rank=self.chapter.start_rank).based_on( self ) ) # Set the LAST_DUNGEON element, for use by the next dungeon. self.register_element( "LAST_DUNGEON", self.levels[-1] ) return True def gen_name( self ): return random.choice( self.NAME_PATTERNS ).format( namegen.random_style_name() ) class BardicCrypt( BardicCaves ): LABEL = "BARDIC_DUNGEON" NAME_PATTERNS = ( "Crypt of {0}", "Tomb of {0}", "{0} Boneyard", "{0} Catacombs" ) DUNGEON_PATTERN = (context.HAB_TUNNELS,context.GEN_UNDEAD) UNIQUE = True class AntagonisticForest( BardicCaves ): LABEL = "BARDIC_DUNGEON" NAME_PATTERNS = ( "Forest","Woods","Wilds" ) DUNGEON_PATTERN = (context.HAB_FOREST,) UNIQUE = True def gen_name( self ): Antagonist = self.register_element( "ANTAGONIST", teams.AntagonistFaction(dungeon_type=self.NAME_PATTERNS) ) return Antagonist.name class AntagonisticCaves( BardicCaves ): LABEL = "BARDIC_DUNGEON" NAME_PATTERNS = ( "Caves","Caverns","Grotto","Chasm" ) DUNGEON_PATTERN = (context.HAB_CAVE,) UNIQUE = True def gen_name( self ): Antagonist = self.register_element( "ANTAGONIST", teams.AntagonistFaction(dungeon_type=self.NAME_PATTERNS) ) return Antagonist.name class AntagonisticTunnels( BardicCaves ): LABEL = "BARDIC_DUNGEON" NAME_PATTERNS = ( "Hideout", "Tunnels", "Catacombs" ) DUNGEON_PATTERN = (context.HAB_CAVE,) UNIQUE = True def gen_name( self ): Antagonist = self.register_element( "ANTAGONIST", teams.AntagonistFaction(dungeon_type=self.NAME_PATTERNS) ) return Antagonist.name # BARDIC_CONNECTION # This subplot will add a connection for the new bardic dungeon from the # previous one. If no dungeons have yet been added, it will just connect to # the city scene. Otherwise, it will likely add a boss encounter to the # previous dungeon and a new set of resources (shops, etc) for the new level. # # DUTIES: # - To activate the chapter # - To connect the next dungeon to the previous # - Provide access to needed resources: shops, temple, etc. # - Provide rumours regarding the previous/current chapter. class BC_DirectConnection( Plot ): """The first dungeon gets directly connected to the LOCALE scene.""" LABEL = "BARDIC_CONNECTION" scope = True active = True @classmethod def matches( self, pstate ): """Requires LOCALE to exist, but no LAST_DUNGEON.""" return pstate.elements.get( "LOCALE" ) and not pstate.elements.get( "LAST_DUNGEON" ) def custom_init( self, nart ): """Install the dungeon.""" self.install_dungeon( nart, self.elements[ "LEVELS" ], self.elements[ "LOCALE" ], self.elements["DNAME"] ) self._ready = True return True ### TESTING CUTSCENES HERE- FOR TESTING ONLY do_cutscene = False def t_START( self, explo ): if self._ready: self.chapter.activate() self._ready = False #explo.alert("[PORTENT]") explo.alert("They say that a journey of a thousand miles begins with a single step. Today your journey begins as you prepare to leave the city of [city] and begin your adventure.") # Print message, activate chapter upon entering city the first time. if self.do_cutscene: explo.alert( "You enter a ." ) cs1=cutscene.Say( "This place stinks of death...", species=(characters.Human,characters.Elf,characters.Fuzzy,characters.Hurthling), children= [ cutscene.Say( "You say that like it's a bad thing.", job=(characters.Necromancer,) ), cutscene.Say( "Yes, it reminds me of my mother's cooking.", species=(characters.Orc,) ), cutscene.Say( "The sooner we get this job finished, the sooner we can get out of here.", job=(characters.Warrior,) ), ]) cutscene.roll_cutscene( explo, [cs1,] ) #self.do_cutscene = False def get_dialogue_grammar( self, npc, explo ): if self.chapter.active: dname = self.elements.get("DNAME") mygram = { "[RUMOUR]": ["[rumourleadin] there are [monsters] coming from the {}.".format( dname )], } city = self.elements["LOCALE"] anti = self.elements.get( "ANTAGONIST" ) if anti: mygram["[HOWAREYOU]"] = ["Heavens save {} from the {}.".format(city,anti),] mygram["[RUMOUR]"].append( "[rumourleadin] {} lives in fear of the {}.".format( city, anti ) ) return mygram class BC_DwarvenCity( Plot ): LABEL = "BARDIC_CONNECTION" UNIQUE = True scope = True active = True NAME_PATTERNS = ( "{0} Deep", "{0} Halls" ) _ready = True @classmethod def matches( self, pstate ): """Requires LAST_DUNGEON to exist and to not go up, and the next dungeon to go down.""" return ( pstate.elements.get( "LAST_DUNGEON" ) and context.MAP_GOUP not in pstate.elements["LAST_DUNGEON"].desctags and context.MAP_GODOWN in pstate.elements["LEVELS"][0].desctags ) def custom_init( self, nart ): """Install the dungeon.""" # Create the intermediary level. interior = maps.Scene( 65,65, sprites={maps.SPRITE_WALL: "terrain_wall_cave.png", maps.SPRITE_GROUND: "terrain_ground_under.png", maps.SPRITE_FLOOR: "terrain_floor_gravel.png" }, biome=context.HAB_TUNNELS, setting=self.setting, desctags=(context.MAP_DUNGEON,context.MAP_GODOWN) ) igen = randmaps.SubtleMonkeyTunnelScene( interior ) self.register_scene( nart, interior, igen, ident="_LAIR" ) # Create the guardian. btype = monsters.choose_monster_type(self.rank,self.rank+2,{(context.DES_EARTH,context.MTY_FIGHTER,context.MTY_CONSTRUCT):True,context.DES_EARTH:context.MAYBE}) boss = self.register_element( "_BOSS", monsters.generate_boss( btype, self.rank+3 ) ) interior.name = "{0}'s Lair".format( boss ) # Connect to previous level. self.add_sub_plot( nart, "CONNECT", PlotState( elements={"PREV":self.elements["LAST_DUNGEON"],"NEXT":interior} ).based_on( self ) ) # Create the goal room. team = teams.Team(default_reaction=-999, rank=self.rank, strength=150, habitat=interior.get_encounter_request(), respawn=False, boss=boss ) int_goalroom = randmaps.rooms.SharpRoom( tags=(context.GOAL,), parent=interior ) int_goalroom.contents.append( team ) int_goalroom.contents.append( boss ) boss.team = team stairs_1 = waypoints.SpiralStairsDown() int_goalroom.contents.append( stairs_1 ) # Create the Dwarven City. myscene = maps.Scene( 65, 65, sprites={maps.SPRITE_WALL: "terrain_wall_cave.png", maps.SPRITE_GROUND: "terrain_ground_under.png", maps.SPRITE_FLOOR: "terrain_floor_gravel.png"}, biome=context.HAB_BUILDING, setting=self.setting, name=random.choice( self.NAME_PATTERNS ).format( namegen.DWARF.gen_word() ), desctags=(context.MAP_DUNGEON,context.DES_CIVILIZED,context.MAP_GODOWN) ) mymapgen = randmaps.CaveScene( myscene ) self.register_scene( nart, myscene, mymapgen, ident="LOCALE" ) castle = self.register_element( "CITY", randmaps.rooms.VillageRoom( width=35,height=35,tags=(context.CIVILIZED,context.ROOM_PUBLIC), parent=myscene ) ) myroom = randmaps.rooms.FuzzyRoom( tags=(context.ENTRANCE,), parent=castle ) myteam = teams.Team( strength=0, default_reaction=characters.SAFELY_FRIENDLY) castle.contents.append( myteam ) stairs_2 = waypoints.SpiralStairsUp() myroom.contents.append( stairs_2 ) myroom.contents.append( monsters.generate_npc(species=characters.Dwarf, team=myteam) ) myroom.contents.append( monsters.generate_npc(species=characters.Dwarf, team=myteam) ) # Connect the stairs. self.move_element( myscene, interior ) stairs_1.destination = myscene stairs_1.otherside = stairs_2 stairs_2.destination = interior stairs_2.otherside = stairs_1 # Add some city services. self.add_sub_plot( nart, "CITY_GENERALSTORE" ) self.add_sub_plot( nart, "CITY_LIBRARY" ) self.add_sub_plot( nart, "CITY_INN" ) self.add_sub_plot( nart, "CITY_TEMPLE" ) self.add_sub_plot( nart, "CITY_EXTRASHOP" ) # Install the dungeon in the city. self.install_dungeon( nart, self.elements[ "LEVELS" ], self.elements[ "LOCALE" ], self.elements["DNAME"] ) return True def t_START( self, explo ): # Print message, activate chapter upon entering city the first time. if explo.scene is self.elements["LOCALE"] and self._ready: explo.alert( "You step into a bustling dwarven city." ) self.chapter.activate() self._ready = False def get_dialogue_grammar( self, npc, explo ): dname = self.elements.get("DNAME") city = self.elements.get("LOCALE") monster = self.elements.get("_BOSS") if self.chapter.prev and self.chapter.prev.active: mygram = { "[RUMOUR]": ["[rumourleadin] the dwarves of {} protect the world from {}.".format( city, dname ), "[rumourleadin] {} is now under siege from {} the {}.".format( city, monster, monster.monster_name ) ], } return mygram elif self.chapter.active: mygram = { "[RUMOUR]": ["[rumourleadin] beneath {} lies {}.".format( city, dname )], } return mygram class BC_AdvanceAgent( Plot ): # Fight an agent of next chapter's ANTAGONIST. LABEL = "BARDIC_CONNECTION" scope = True active = True _ready = True @classmethod def matches( self, pstate ): """Requires LAST_DUNGEON and ANTAGONIST to exist""" return ( pstate.elements.get( "LAST_DUNGEON" ) and pstate.elements.get( "ANTAGONIST" ) ) def custom_init( self, nart ): """Install the dungeon.""" # Create the intermediary level. interior = maps.Scene( 65,65, sprites={maps.SPRITE_WALL: "terrain_wall_darkbrick.png", maps.SPRITE_GROUND: "terrain_ground_under.png", maps.SPRITE_FLOOR: "terrain_floor_tile.png" }, fac=self.elements["ANTAGONIST"], biome=context.HAB_TUNNELS, setting=self.setting, desctags=(context.MAP_DUNGEON,) ) igen = randmaps.SubtleMonkeyTunnelScene( interior ) self.register_scene( nart, interior, igen, ident="LOCALE" ) # Create the goal room. team = teams.Team(default_reaction=-999, rank=self.rank, strength=50, habitat=interior.get_encounter_request(), fac=self.elements["ANTAGONIST"], respawn=False ) int_goalroom = randmaps.rooms.SharpRoom( tags=(context.GOAL,), parent=interior ) int_goalroom.contents.append( team ) # Create the guardian. boss = self.register_element( "_BOSS", monsters.generate_npc(team=team,upgrade=True,rank=self.rank+3) ) self.enemy_defeated = False interior.name = "{}'s Chamber".format( boss ) int_goalroom.contents.append( boss ) for t in range( random.randint(2,4) ): self.add_sub_plot( nart, "ENCOUNTER" ) # Connect to previous level. self.add_sub_plot( nart, "CONNECT", PlotState( elements={"PREV":self.elements["LAST_DUNGEON"],"NEXT":interior} ).based_on( self ) ) # Add a BARDIC_FRESHSTART to install the dungeon somewhere else. sp = self.add_sub_plot( nart, "BARDIC_FRESHSTART" ) self.register_element( "DESTINATION", sp.elements.get( "LOCALE" ) ) return True def _BOSS_DEATH( self, explo ): self.enemy_defeated = True def t_COMBATOVER( self, explo ): if self.enemy_defeated: # Activate the resolution, whatever that is. explo.alert( "You discover that {} was carrying a map leading to {}. That should be your next destination.".format(self.elements["_BOSS"],self.elements["DESTINATION"]) ) explo.alert( "New world map location discovered." ) self.chapter.activate() self.active = False def get_dialogue_grammar( self, npc, explo ): dname = self.elements.get("DNAME") enemy = self.elements.get("ANTAGONIST") olddname = self.elements["LAST_DUNGEON"].dname monster = self.elements.get("_BOSS") newloc = self.elements.get("DESTINATION") if self.chapter.prev and self.chapter.prev.active: mygram = { "[RUMOUR]": ["[rumourleadin] the {} is in league with the {}.".format( olddname, enemy )], } return mygram elif self.chapter.active: mygram = { "[RUMOUR]": ["[rumourleadin] the {} is near {}.".format( dname, newloc )], } return mygram # # BARDIC_FRESHSTART # This subplot opens up a new world map scene in which to place the next dungeon. # Because of this, it installs the dungeon... normally BARDIC_CONNECTION is # supposed to do that, but it can pawn off the responsibility to this subplot. # # The world map entrance should get activated when the chapter is activated. # That scene should be stored as element LOCALE, in case the connection needs # to do anything with it. # class BF_ForestVillage( Plot ): """A new world map scene, set in a forest.""" LABEL = "BARDIC_FRESHSTART" scope = True active = True @classmethod def matches( self, pstate ): """Requires LEVELS[0] to be forest or not MAP_WILDERNESS.""" dungeon = pstate.elements.get( "LEVELS" ) return dungeon and ( dungeon[0].biome is context.HAB_FOREST or context.MAP_WILDERNESS not in dungeon[0].desctags ) def custom_init( self, nart ): # Add the forest itself. myscene = maps.Scene( min( 95 + self.rank * 3, 129 ), min( 95 + self.rank * 3, 129 ), sprites={maps.SPRITE_WALL: "terrain_wall_woodfort.png", maps.SPRITE_GROUND: "terrain_ground_forest.png", maps.SPRITE_FLOOR: "terrain_floor_gravel.png" }, biome=context.HAB_FOREST, setting=self.setting, fac=None, desctags=(context.MAP_WILDERNESS,) ) mymapgen = randmaps.ForestScene( myscene ) self.register_scene( nart, myscene, mymapgen, ident="LOCALE" ) # Add a village. castle = self.register_element( "CITY", randmaps.rooms.VillageRoom( width=35, height=35,tags=(context.CIVILIZED,context.ROOM_PUBLIC,context.MAP_ON_EDGE), parent=myscene ) ) myroom = randmaps.rooms.FuzzyRoom( tags=(context.ENTRANCE,), parent=castle ) myteam = teams.Team( strength=0, default_reaction=characters.SAFELY_FRIENDLY) castle.contents.append( myteam ) myent = waypoints.Well() myroom.contents.append( myent ) myroom.contents.append( monsters.generate_npc(species=characters.Elf, team=myteam) ) myroom.contents.append( monsters.generate_npc(species=characters.Elf, team=myteam) ) self.add_sub_plot( nart, "CITY_GENERALSTORE" ) self.add_sub_plot( nart, "CITY_LIBRARY" ) self.add_sub_plot( nart, "CITY_INN" ) self.add_sub_plot( nart, "CITY_EXTRASHOP" ) # Add world map entrance. self._entrance = self.chapter.world.add_entrance( myscene, myscene.name, worlds.W_VILLAGE, myent, False ) for t in range( random.randint(2+min(self.rank//3,6),4+min(self.rank//2,6)) ): self.add_sub_plot( nart, "ENCOUNTER" ) self.add_sub_plot( nart, "SPECIAL_FEATURE" ) # Install the dungeon here. self.install_dungeon( nart, self.elements[ "LEVELS" ], myscene, self.elements["DNAME"] ) self._ready = True return True def t_START( self, explo ): # When the chapter activates, show the world map entrance. if self.chapter.active: self._entrance.visible = True self.active = False # BARDIC_CONCLUSION # This subplot will feature a big boss battle to take place after the LAST_DUNGEON. class StraightBardicBalrog( Plot ): """Fight a boss encounter.""" LABEL = "BARDIC_CONCLUSION" active = True scope = True def custom_init( self, nart ): """Create the final dungeon, boss encounter, and resolution.""" btype = monsters.choose_monster_type(self.rank+2,self.rank+4,{context.MTY_BOSS:True,context.MTY_LEADER:context.MAYBE}) boss = monsters.generate_boss( btype, self.rank+5 ) #print( "{0} the {1}".format( boss, boss.monster_name ) ) interior = maps.Scene( 65,65, sprites={maps.SPRITE_WALL: "terrain_wall_darkbrick.png", maps.SPRITE_FLOOR: "terrain_floor_dungeon.png", }, biome=context.HAB_BUILDING, setting=self.setting, desctags=(context.MAP_DUNGEON,context.MTY_HUMANOID) ) igen = randmaps.SubtleMonkeyTunnelScene( interior ) interior.name = "{0}'s Lair".format( boss ) self.register_scene( nart, interior, igen, ident="_LAIR" ) self.add_sub_plot( nart, "CONNECT", PlotState( elements={"PREV":self.elements["LAST_DUNGEON"],"NEXT":interior} ).based_on( self ) ) team = teams.Team(default_reaction=-999, rank=self.rank, strength=200, habitat=interior.get_encounter_request(), respawn=False, boss=boss ) int_goalroom = randmaps.rooms.SharpRoom( tags=(context.GOAL,), parent=interior ) int_goalroom.contents.append( team ) boss.team = team self.register_element( "_LAIR_ROOM", int_goalroom ) self.register_element( "ENEMY", boss, "_LAIR_ROOM" ) self.add_sub_plot( nart, "DUNGEON_ARMORY", PlotState( elements={"LOCALE":interior} ).based_on( self ) ) self.enemy_defeated = False return True def ENEMY_DEATH( self, explo ): self.enemy_defeated = True def t_COMBATOVER( self, explo ): if self.enemy_defeated: # Activate the resolution, whatever that is. explo.alert( "With {0} defeated, peace soon returns to the land.".format( self.elements["ENEMY"] ) ) explo.alert( "Thanks for playing Dungeon Monkey Eternal. You can follow development at www.gearheadrpg.com, or via @Pyrro12 on Twitter." ) self.active = False def get_dialogue_grammar( self, npc, explo ): if self.active: boss = self.elements["ENEMY"] mygram = { "[HOWAREYOU]": ["Heavens save us from {0}.".format(boss)], "[monsters]": ["{0}'s minions".format(boss)], "[RUMOUR]": ["[rumourleadin] {0} the {1} is the cause of our problems.".format( boss, boss.monster_name )], } city = self.elements.get( "LOCALE" ) if city: mygram["[RUMOUR]"].append( "[rumourleadin] {0} the {1} plans to destroy {2}.".format( boss, boss.monster_name,city ) ) return mygram
nilq/baby-python
python
from datetime import datetime, date, timezone import dateutil from dateutil.relativedelta import relativedelta import re from .util import calculate_price, DELIM_VALUE_REGEX, DOT_VALUE_REGEX from isodate import parse_duration, parse_datetime import pytz def create_default_context(numeric, responseMetadata): def cff_yeardiff(datestr1, datestr2): if type(datestr1) is not str or type(datestr2) is not str: return 0 d1 = datetime.strptime(datestr1, "%Y-%m-%d") d2 = datetime.strptime(datestr2, "%Y-%m-%d") return relativedelta(d1, d2).years def cff_nthOfNextMonth(datestr, n, maxDayDiff=None): """Returns nth day of the next month after datestr. If the return date is less than maxDayDiff away from date, then go to the next month. """ if type(datestr) is not str or type(n) is not int or n <= 0: return None date = datetime.strptime(datestr, "%Y-%m-%d") new_date = (date + relativedelta(months=1)).replace(day=n) if maxDayDiff and (new_date - date).days < maxDayDiff: new_date = new_date + relativedelta(months=1) return new_date.strftime("%Y-%m-%d") # def cff_countArray(array, expression): # return len([item for item in array if calculate_price(expression, item)]) def cff_countArray(*args): # TODO: fix py-expression-eval so that the method signature above is called. # Same applies to cff_addDuration. array = list(args) expression = array.pop(-1) if type(array) is not list: return 0 return len( [ item for item in array if calculate_price(expression, item, numeric, responseMetadata) ] ) def cff_today(): return date.today().strftime("%Y-%m-%d") def cff_addDuration(dt, duration): if type(dt) is not str: return None dt = datetime.strptime(dt, "%Y-%m-%d") duration = parse_duration(duration) new_time = dt + relativedelta( months=int(getattr(duration, "months", 0)), days=int(getattr(duration, "days", 0)), years=int(getattr(duration, "years", 0)), ) return new_time.strftime("%Y-%m-%d") def cff_createdBetween(datestr1, datestr2): if type(datestr1) is not str or type(datestr2) is not str: return 0 datestr1 = re.sub( DOT_VALUE_REGEX, ".", re.sub(DELIM_VALUE_REGEX, ":", datestr1) ) datestr2 = re.sub( DOT_VALUE_REGEX, ".", re.sub(DELIM_VALUE_REGEX, ":", datestr2) ) d1 = parse_datetime(datestr1) d2 = parse_datetime(datestr2) date_created = responseMetadata.get("date_created", None) date_created = ( parse_datetime(date_created) if date_created is not None else datetime.now() ) # Convert date_created from a naive to an aware datetime, # so that it can be compared with the naive datetimems d1 and d2. # PyMongo always stores naive datetimes in UTC, so this is ok. date_created = date_created.replace(tzinfo=pytz.utc) return (date_created >= d1) and (date_created <= d2) DEFAULT_CONTEXT = { "cff_yeardiff": cff_yeardiff, "cff_nthOfNextMonth": cff_nthOfNextMonth, "cff_countArray": cff_countArray, "cff_addDuration": cff_addDuration, "cff_today": cff_today, "cff_createdBetween": cff_createdBetween, } return DEFAULT_CONTEXT
nilq/baby-python
python
import container_crawler.utils import mock import unittest class TestUtils(unittest.TestCase): @mock.patch('container_crawler.utils.InternalClient') @mock.patch('container_crawler.utils.os') def test_internal_client_path(self, os_mock, ic_mock): os_mock.path.exists.return_value = True os_mock.path.join.side_effect = lambda *x: '/'.join(x) conf = {'internal_client_logname': 'TestClient', 'internal_client_path': '/etc/swift/internal-client.conf'} container_crawler.utils.create_internal_client(conf, '/etc/swift') ic_mock.assert_called_once_with(conf['internal_client_path'], conf['internal_client_logname'], 3) @mock.patch('container_crawler.utils.ConfigString') @mock.patch('container_crawler.utils.InternalClient') @mock.patch('container_crawler.utils.os') def test_internal_client_path_not_found(self, os_mock, ic_mock, conf_mock): os_mock.path.exists.return_value = False os_mock.path.join.side_effect = lambda *x: '/'.join(x) conf_string = mock.Mock() conf_mock.return_value = conf_string conf = {'internal_client_logname': 'TestClient', 'internal_client_path': '/etc/swift/internal-client.conf'} container_crawler.utils.create_internal_client(conf, '/etc/swift') os_mock.path.exists.assert_called_once_with( conf['internal_client_path']) conf_mock.assert_called_once_with( container_crawler.utils.INTERNAL_CLIENT_CONFIG) ic_mock.assert_called_once_with( conf_string, conf['internal_client_logname'], 3)
nilq/baby-python
python
import random from random import sample import argparse import numpy as np import os import pickle from tqdm import tqdm from collections import OrderedDict from sklearn.metrics import roc_auc_score from sklearn.metrics import roc_curve from sklearn.metrics import precision_recall_curve from sklearn.covariance import LedoitWolf from scipy.spatial.distance import mahalanobis from scipy.ndimage import gaussian_filter from skimage import morphology from skimage.segmentation import mark_boundaries import matplotlib.pyplot as plt import matplotlib import torch import torch.nn.functional as F from torch.utils.data import DataLoader from torchvision.models import wide_resnet50_2, resnet18 import datasets.mvtec as mvtec # device setup use_cuda = torch.cuda.is_available() device = torch.device('cuda' if use_cuda else 'cpu') def parse_args(): parser = argparse.ArgumentParser('PaDiM') parser.add_argument('--data_path', type=str, default='./datasets') parser.add_argument('--save_path', type=str, default='./fundus_result') parser.add_argument('--arch', type=str, choices=['resnet18', 'wide_resnet50_2'], default='resnet18') return parser.parse_args() _layer1 = 'layer2' _layer2 = 'layer3' _layer3 = 'layer3' def main(): args = parse_args() # load model if args.arch == 'resnet18': model = resnet18(pretrained=True, progress=True) t_d = 384 d = 100 elif args.arch == 'wide_resnet50_2': model = wide_resnet50_2(pretrained=True, progress=True) t_d = 1792 d = 550 model.to(device) model.eval() random.seed(1024) torch.manual_seed(1024) if use_cuda: torch.cuda.manual_seed_all(1024) idx = torch.tensor(sample(range(0, t_d), d)) # print(f'--> {idx.shape}') # set model's intermediate outputs outputs = [] def hook(module, input, output): outputs.append(output) model.layer2[-1].register_forward_hook(hook) model.layer3[-1].register_forward_hook(hook) # model.layer3[-1].register_forward_hook(hook) os.makedirs(os.path.join(args.save_path, 'temp_%s' % args.arch), exist_ok=True) fig, ax = plt.subplots(1, 2, figsize=(20, 10)) fig_img_rocauc = ax[0] fig_pixel_rocauc = ax[1] total_roc_auc = [] total_pixel_roc_auc = [] for class_name in mvtec.CLASS_NAMES: train_dataset = mvtec.MVTecDataset(args.data_path, class_name=class_name, is_train=True) train_dataloader = DataLoader(train_dataset, batch_size=32, pin_memory=True) test_dataset = mvtec.MVTecDataset(args.data_path, class_name=class_name, is_train=False) test_dataloader = DataLoader(test_dataset, batch_size=32, pin_memory=True) train_outputs = OrderedDict([(_layer1, []), (_layer2, [])]) test_outputs = OrderedDict([(_layer1, []), (_layer2, [])]) # train_outputs = OrderedDict([('layer2', []), ('layer3', []), ('layer4', [])]) # test_outputs = OrderedDict([('layer2', []), ('layer3', []), ('layer4', [])]) # extract train set features train_feature_filepath = os.path.join(args.save_path, 'temp_%s' % args.arch, 'train_%s.pkl' % class_name) if not os.path.exists(train_feature_filepath): for (x, _, _) in tqdm(train_dataloader, '| feature extraction | train | %s |' % class_name): # model prediction with torch.no_grad(): _ = model(x.to(device)) # get intermediate layer outputs for k, v in zip(train_outputs.keys(), outputs): train_outputs[k].append(v.cpu().detach()) # initialize hook outputs outputs = [] for k, v in train_outputs.items(): train_outputs[k] = torch.cat(v, 0) # Embedding concat embedding_vectors = train_outputs[_layer1] for layer_name in [_layer2]: embedding_vectors = embedding_concat(embedding_vectors, train_outputs[layer_name]) print(f'--> {embedding_vectors.shape}') # randomly select d dimension embedding_vectors = torch.index_select(embedding_vectors, 1, idx) # calculate multivariate Gaussian distribution B, C, H, W = embedding_vectors.size() embedding_vectors = embedding_vectors.view(B, C, H * W) mean = torch.mean(embedding_vectors, dim=0).numpy() cov = torch.zeros(C, C, H * W).numpy() I = np.identity(C) for i in range(H * W): # cov[:, :, i] = LedoitWolf().fit(embedding_vectors[:, :, i].numpy()).covariance_ cov[:, :, i] = np.cov(embedding_vectors[:, :, i].numpy(), rowvar=False) + 0.01 * I # save learned distribution train_outputs = [mean, cov] with open(train_feature_filepath, 'wb') as f: pickle.dump(train_outputs, f) else: print('load train set feature from: %s' % train_feature_filepath) with open(train_feature_filepath, 'rb') as f: train_outputs = pickle.load(f) gt_list = [] gt_mask_list = [] test_imgs = [] # extract test set features for (x, y, mask) in tqdm(test_dataloader, '| feature extraction | test | %s |' % class_name): test_imgs.extend(x.cpu().detach().numpy()) gt_list.extend(y.cpu().detach().numpy()) gt_mask_list.extend(mask.cpu().detach().numpy()) # model prediction with torch.no_grad(): _ = model(x.to(device)) # get intermediate layer outputs for k, v in zip(test_outputs.keys(), outputs): test_outputs[k].append(v.cpu().detach()) # initialize hook outputs outputs = [] for k, v in test_outputs.items(): test_outputs[k] = torch.cat(v, 0) # Embedding concat embedding_vectors = test_outputs[_layer1] for layer_name in [_layer2]: embedding_vectors = embedding_concat(embedding_vectors, test_outputs[layer_name]) # randomly select d dimension embedding_vectors = torch.index_select(embedding_vectors, 1, idx) # calculate distance matrix B, C, H, W = embedding_vectors.size() embedding_vectors = embedding_vectors.view(B, C, H * W).numpy() dist_list = [] for i in range(H * W): mean = train_outputs[0][:, i] conv_inv = np.linalg.inv(train_outputs[1][:, :, i]) dist = [mahalanobis(sample[:, i], mean, conv_inv) for sample in embedding_vectors] dist_list.append(dist) dist_list = np.array(dist_list).transpose(1, 0).reshape(B, H, W) # upsample dist_list = torch.tensor(dist_list) score_map = F.interpolate(dist_list.unsqueeze(1), size=x.size(2), mode='bilinear', align_corners=False).squeeze().numpy() # apply gaussian smoothing on the score map for i in range(score_map.shape[0]): score_map[i] = gaussian_filter(score_map[i], sigma=4) # Normalization max_score = score_map.max() min_score = score_map.min() scores = (score_map - min_score) / (max_score - min_score) # calculate image-level ROC AUC score img_scores = scores.reshape(scores.shape[0], -1).max(axis=1) gt_list = np.asarray(gt_list) fpr, tpr, _ = roc_curve(gt_list, img_scores) img_roc_auc = roc_auc_score(gt_list, img_scores) total_roc_auc.append(img_roc_auc) print('image ROCAUC: %.3f' % (img_roc_auc)) fig_img_rocauc.plot(fpr, tpr, label='%s img_ROCAUC: %.3f' % (class_name, img_roc_auc)) # get optimal threshold gt_mask = np.asarray(gt_mask_list) precision, recall, thresholds = precision_recall_curve(gt_mask.flatten(), scores.flatten()) a = 2 * precision * recall b = precision + recall f1 = np.divide(a, b, out=np.zeros_like(a), where=b != 0) threshold = thresholds[np.argmax(f1)] # # calculate per-pixel level ROCAUC # fpr, tpr, _ = roc_curve(gt_mask.flatten(), scores.flatten()) # per_pixel_rocauc = roc_auc_score(gt_mask.flatten(), scores.flatten()) # total_pixel_roc_auc.append(per_pixel_rocauc) # print('pixel ROCAUC: %.3f' % (per_pixel_rocauc)) # fig_pixel_rocauc.plot(fpr, tpr, label='%s ROCAUC: %.3f' % (class_name, per_pixel_rocauc)) save_dir = args.save_path + '/' + f'pictures_{args.arch}' os.makedirs(save_dir, exist_ok=True) plot_fig(test_imgs, scores, gt_mask_list, threshold, save_dir, class_name) print('Average ROCAUC: %.3f' % np.mean(total_roc_auc)) fig_img_rocauc.title.set_text('Average image ROCAUC: %.3f' % np.mean(total_roc_auc)) fig_img_rocauc.legend(loc="lower right") # print('Average pixel ROCUAC: %.3f' % np.mean(total_pixel_roc_auc)) # fig_pixel_rocauc.title.set_text('Average pixel ROCAUC: %.3f' % np.mean(total_pixel_roc_auc)) # fig_pixel_rocauc.legend(loc="lower right") fig.tight_layout() fig.savefig(os.path.join(args.save_path, 'roc_curve.png'), dpi=100) def plot_fig(test_img, scores, gts, threshold, save_dir, class_name): num = len(scores) vmax = scores.max() * 255. vmin = scores.min() * 255. for i in range(num): img = test_img[i] img = denormalization(img) # gt = gts[i].transpose(1, 2, 0).squeeze() heat_map = scores[i] * 255 mask = scores[i] mask[mask > threshold] = 1 mask[mask <= threshold] = 0 kernel = morphology.disk(4) mask = morphology.opening(mask, kernel) mask *= 255 vis_img = mark_boundaries(img, mask, color=(1, 0, 0), mode='thick') fig_img, ax_img = plt.subplots(1, 5, figsize=(12, 3)) fig_img.subplots_adjust(right=0.9) norm = matplotlib.colors.Normalize(vmin=vmin, vmax=vmax) for ax_i in ax_img: ax_i.axes.xaxis.set_visible(False) ax_i.axes.yaxis.set_visible(False) ax_img[0].imshow(img) ax_img[0].title.set_text('Image') # ax_img[1].imshow(gt, cmap='gray') ax_img[1].title.set_text('GroundTruth') ax = ax_img[2].imshow(heat_map, cmap='jet', norm=norm) ax_img[2].imshow(img, cmap='gray', interpolation='none') ax_img[2].imshow(heat_map, cmap='jet', alpha=0.5, interpolation='none') ax_img[2].title.set_text('Predicted heat map') ax_img[3].imshow(mask, cmap='gray') ax_img[3].title.set_text('Predicted mask') ax_img[4].imshow(vis_img) ax_img[4].title.set_text('Segmentation result') left = 0.92 bottom = 0.15 width = 0.015 height = 1 - 2 * bottom rect = [left, bottom, width, height] cbar_ax = fig_img.add_axes(rect) cb = plt.colorbar(ax, shrink=0.6, cax=cbar_ax, fraction=0.046) cb.ax.tick_params(labelsize=8) font = { 'family': 'serif', 'color': 'black', 'weight': 'normal', 'size': 8, } cb.set_label('Anomaly Score', fontdict=font) fig_img.savefig(os.path.join(save_dir, class_name + '_{}'.format(i)), dpi=100) plt.close() def denormalization(x): mean = np.array([0.485, 0.456, 0.406]) std = np.array([0.229, 0.224, 0.225]) x = (((x.transpose(1, 2, 0) * std) + mean) * 255.).astype(np.uint8) return x def embedding_concat(x, y): B, C1, H1, W1 = x.size() _, C2, H2, W2 = y.size() s = int(H1 / H2) x = F.unfold(x, kernel_size=s, dilation=1, stride=s) x = x.view(B, C1, -1, H2, W2) z = torch.zeros(B, C1 + C2, x.size(2), H2, W2) for i in range(x.size(2)): z[:, :, i, :, :] = torch.cat((x[:, :, i, :, :], y), 1) z = z.view(B, -1, H2 * W2) z = F.fold(z, kernel_size=s, output_size=(H1, W1), stride=s) return z if __name__ == '__main__': main()
nilq/baby-python
python
""" A QUANTIDADE DE UMA LETRA, A PRIMEIRA E A ÚLTIMA VEZ QUE APARECERAM NA FRASE! """ frase = str(input('Digite uma frase: ')).strip() frase = frase.upper() print('A quantidade de A é {} '.format(frase.count('A'))) print('A primeira vez que A apareceu foi: {} '.format(frase.find('A')+1)) print('A última vez que A apareceu foi: {} '.format(frase.rfind('A')+1)) ''' dividido = frase.split() print(dividido)] print(''.format(dividido[].count(['a']))) '''
nilq/baby-python
python
ll=range(5, 20, 5) for i in ll: print(i) print (ll) x = 'Python' for i in range(len(x)) : print(x[i])
nilq/baby-python
python
from typing import Sequence, Union from PIL import Image class BaseTransform: """ Generic image transform type class """ slug: Union[None, str] = None # unique string that identifies a given transform @staticmethod def apply_transform( img: Image.Image, parameters: Sequence[Union[str, int]] ) -> Image.Image: raise NotImplementedError @staticmethod def derive_parameters(query: str) -> Sequence[Union[str, int]]: raise NotImplementedError
nilq/baby-python
python
from collections import Counter input_data = open("day12.input").read().split("\n") input_data = [tuple(a.split("-")) for a in input_data] connections = [] for (a, b) in input_data: if a != 'start': connections.append((b, a)) connections += input_data connections.sort() def part1(path, b): return b not in path def part2(path, b): count = Counter(path + [b]) lower2 = 0 for key in count.keys(): if key in ['start', 'end'] and count[key] > 1: return False if key.islower() and count[key] > 1: if count[key] < 3: lower2 += 1 else: return False return lower2 <= 1 start_paths = [['start']] end_paths = [] while True: new_paths = [] for path in start_paths: for (a, b) in connections: if path[-1] == a and b == 'end': end_paths.append(path + [b]) elif path[-1] == a and (b.isupper() or part2(path, b)): new_paths.append(path + [b]) if len(new_paths) > 0: start_paths = new_paths else: break print('Result') for path in end_paths: print(path) print(len(end_paths))
nilq/baby-python
python
import os import numpy as np import pandas as pd from typing import Any, Dict, List, Optional, Tuple, NoReturn import skfuzzy as fuzz import skfuzzy.control as ctrl from aggregation import OWA_T1 import matplotlib.pyplot as plt class FLST1Model(object): def __init__(self, rules_path:str, expert_mode:str): self.antecedent = {} self.consequent = {} self.expert_mode = expert_mode self.build_model() self.system = self.build_rules(rules_dir=rules_path) self.fuzz_inf = ctrl.ControlSystemSimulation(self.system, flush_after_run=10) def build_model(self)->NoReturn: # ANTECENDENT self.antecedent = {} ### Acceleration self.antecedent['Acceleration'] = ctrl.Antecedent(universe=np.linspace(0,10, 11), label='Acceleration') self.antecedent['Acceleration']['small'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [0., 0., 3., 4.]) self.antecedent['Acceleration']['medium'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [3., 4., 6., 7.]) self.antecedent['Acceleration']['large'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [6., 7., 10., 10.]) ### Deceleration self.antecedent['Deceleration'] = ctrl.Antecedent(universe=np.linspace(0,10, 11), label='Deceleration') self.antecedent['Deceleration']['small'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [0., 0., 3., 4.]) self.antecedent['Deceleration']['medium'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [3., 4., 6., 7.]) self.antecedent['Deceleration']['large'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [6., 7., 10., 10.]) ### Lateral Jerk self.antecedent['LateralJerk'] = ctrl.Antecedent(universe=np.linspace(0,16, 17), label='LateralJerk') self.antecedent['LateralJerk']['small'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [0., 0., 4., 6.]) self.antecedent['LateralJerk']['medium'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [4., 6., 10., 12.]) self.antecedent['LateralJerk']['large'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [10., 12., 16., 16.]) ### Velocity self.antecedent['Velocity'] = ctrl.Antecedent(universe=np.linspace(0,100, 101), label='Velocity') self.antecedent['Velocity']['very_slow'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [0., 0., 15., 20.]) self.antecedent['Velocity']['slow'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [15., 20., 30., 35.]) self.antecedent['Velocity']['normal'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [30., 35., 50., 55.]) self.antecedent['Velocity']['fast'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [50., 55., 70., 75.]) self.antecedent['Velocity']['very_fast'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [70., 75., 100., 100.]) # CONSEQUENT ### Behavior (Driving Style) self.consequent['Behavior'] = ctrl.Consequent(universe=np.linspace(0,1., 11), label='Behavior') self.consequent['Behavior']['calm'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0., 0., 0.2, 0.4]) self.consequent['Behavior']['moderate'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0.2, 0.4, 0.6, 0.8]) self.consequent['Behavior']['aggressive'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0.6, 0.8, 1., 1.]) def build_rules(self, rules_dir:str)->ctrl.ControlSystem: assert os.path.exists(rules_dir),\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' rules_dir not found!{}').format(rules_dir) rules_files = os.listdir(rules_dir) rules = None if self.expert_mode=='single': rules_files[0] = 'rules_0.csv' print('[Fuzzy Logic System T1 mode][build rules]', end='') print(f' single expert system! (rule:{rules_files[0]})') rules = self._single_expert_rules(os.path.join(rules_dir, rules_files[0])) elif self.expert_mode=='multiple': print('[Fuzzy Logic System - T1][build_rules]', end='') print(f' multiple expert system: (n_e: {len(rules_files)})') rules = self._multiple_expert_rules(rules_files, root_dir=rules_dir) else: assert False,\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' expert_mode invalid! {}').format(self.expert_mode) assert rules is not None,\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' error while building rules..') system = ctrl.ControlSystem(rules=rules) return system def _single_expert_rules(self, rule_file:str)->List: rules = pd.read_csv(rule_file) assert rules.shape[1] == 5,\ ('[Fuzzy Logic System T1 model][build_rules] wrong rule_file shape' '{} != (m, 5)'.format(rules.shape)) domain = {'calm':'calm', 'more_calm_than_moderate':'calm', 'between_calm_and_moderate':'moderate', 'more_moderate_than_calm':'moderate', 'moderate':'moderate', 'more_moderate_than_aggressive':'moderate', 'between_moderate_and_aggressive':'aggressive', 'more_aggressive_than_moderate':'aggressive', 'aggressive':'aggressive'} #self._check_rules(rules=rules) fuzz_rules = [] for line in rules.iterrows(): index, r = line[0], line[1] xs = domain[r['driving_style']] fr = ctrl.Rule(antecedent=(self.antecedent['Velocity'][r['velocity']] &\ self.antecedent['Acceleration'][r['acceleration']] &\ self.antecedent['Deceleration'][r['deceleration']] &\ self.antecedent['LateralJerk'][r['lateral_jerk']]), consequent=self.consequent['Behavior'][xs], label=f'rule - {index}') fuzz_rules.append(fr) return fuzz_rules def _multiple_expert_function(self, label:str)->float: domain = {'calm':1, 'more_calm_than_moderate':2, 'between_calm_and_moderate':3, 'more_moderate_than_calm':4, 'moderate':5, 'more_moderate_than_aggressive':6, 'between_moderate_and_aggressive':7, 'more_aggressive_than_moderate':8, 'aggressive':9} return (1./9.)*domain[label] def _multiple_expert_rules(self, rules_files:List[str], root_dir:str)->NoReturn: rules = None #get rules decisions = [] for rule_file in rules_files: _file = pd.read_csv(os.path.join(root_dir,rule_file)) decisions.append(_file['driving_style'].values) rules = _file[['velocity', 'acceleration', 'deceleration', 'lateral_jerk']] decisions = np.asarray(decisions).T #aggregate decisions y = [] for d in decisions: #print(d, end="") xs = np.array([self._multiple_expert_function(label=l) for l in d]) value = OWA_T1(X=xs,kind=2) memb_value, set_labels = self._fuzz_driving_style(value=value) y.append(set_labels[np.argmax(memb_value)]) #print(y[-1]) #create rules fuzz_rules = [] for line, _y in zip(rules.iterrows(), y): index, r = line[0], line[1] fr = ctrl.Rule(antecedent=(self.antecedent['Velocity'][r['velocity']] &\ self.antecedent['Acceleration'][r['acceleration']] &\ self.antecedent['Deceleration'][r['deceleration']] &\ self.antecedent['LateralJerk'][r['lateral_jerk']]), consequent=self.consequent['Behavior'][_y], label=f'rule - {index}') fuzz_rules.append(fr) return fuzz_rules def _fuzz_driving_style(self,value:float)->Tuple: memb_value = [] set_labels = [] for label, term in self.consequent['Behavior'].terms.items(): mi =fuzz.interp_membership(self.consequent['Behavior'].universe, term.mf, value) memb_value.append(mi) set_labels.append(label) return memb_value, set_labels def inference(self, observation:Dict) -> Dict: """ perform inference at the fuzzy system """ vel = observation['velocity']*3.6 #m/s -> Km/h acc = observation['acceleration'] #m/s^2 dec = observation['deceleration'] #m/s^2 ljk = observation['lateral_jerk'] #std (m/s^3) self.fuzz_inf.input['Acceleration'] = acc self.fuzz_inf.input['Deceleration'] = dec self.fuzz_inf.input['LateralJerk'] = ljk self.fuzz_inf.input['Velocity'] = vel self.fuzz_inf.compute() y = self.fuzz_inf.output['Behavior'] memb_value, set_labels = self._fuzz_driving_style(value=y) result = {} result['value'] = y result['membership_values'] = np.asarray(memb_value) result['set_labels']=set_labels return result def plot(self)-> NoReturn: self.antecedent['Acceleration'].view() self.antecedent['Deceleration'].view() self.antecedent['Velocity'].view() self.consequent['Behavior'].view() plt.show()
nilq/baby-python
python
from distutils.core import setup from Cython.Build import cythonize setup(ext_modules = cythonize('fasterloop.pyx'))
nilq/baby-python
python
#!/usr/bin/env python3 # -*- coding:utf-8 -*- from enum import Enum, unique @unique class AnalyzeFieldIdx(Enum): IDX_MODULE_NAME = 0 IDX_ANALYE_NAME = 1 IDX_COLUMN_INFO = 2 IDX_IS_EXECUTE = 3
nilq/baby-python
python
import unittest from . import day01 class TestDay1(unittest.TestCase): def test_basic(self): self.assertEqual('hello', 'hello') def test_fuel_is_calculated_correctly_for_given_examples(self): self.assertEqual(day01.get_fuel_required(module_mass=12), 2) self.assertEqual(day01.get_fuel_required(module_mass=14), 2) self.assertEqual(day01.get_fuel_required(module_mass=1969), 654) self.assertEqual(day01.get_fuel_required(module_mass=100756), 33583) def test_fuel_for_fuel_is_calculated_correctly_for_given_examples(self): self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=2), 0) self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=654), 966-654) self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=33583), 50346-33583) if __name__ == "__main__": unittest.main()
nilq/baby-python
python
# Code by JohnXdator n,k = map(int,input().split()) ups = list(map(int,input().split())) count = 0 for i in range(n): if ups[k-1] == 0 and ups[i] == ups[k-1]: count>=count+0 elif ups[k-1] <= ups[i]: count=count+1 else: count=count+0 print(count)
nilq/baby-python
python
from django.test import TestCase from django.core.management import call_command class TestUi(TestCase): def setUp(self): call_command('loaddata', 'user', verbosity=0) call_command('loaddata', 'init', verbosity=0) call_command('loaddata', 'test/testWorld', verbosity=0) def test_ui(self): response = self.client.post('/ui/login/', {'username': 'admin', 'password': 'admin1379'}) self.assertEqual(response.status_code, 200) def test_wrong_pwd(self): response = self.client.post('/ui/login/', {'username': 'admin', 'password': 'admin137xxx'}) self.assertEqual(response.status_code, 401) def test_bad_user(self): response = self.client.post('/ui/login/', {'username': 'adminxxx', 'password': 'admin1379'}) self.assertEqual(response.status_code, 401)
nilq/baby-python
python
import math import warnings from torch import Tensor import torch.nn as nn def zeros_(): """Return the initializer filling the input Tensor with the scalar zeros""" def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.zeros_(tensor) return initializer def ones_(): """Return the initializer filling the input Tensor with the scalar ones""" def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.ones_(tensor) return initializer def uniform_(a: float = 0., b: float = 1.): r"""Return the initializer filling the input Tensor with values drawn from the uniform distribution :math:`\mathcal{U}(a, b)`. Args: a (float): the lower bound of the uniform distribution. Defaults 0.0. b (float): the upper bound of the uniform distribution. Defaults 1.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.uniform_(tensor, a, b) return initializer def normal_(mean: float = 0., std: float = 1.): r"""Return the initializer filling the input Tensor with values drawn from the normal distribution .. math:: \mathcal{N}(\text{mean}, \text{std}^2) Args: mean (float): the mean of the normal distribution. Defaults 0.0. std (float): the standard deviation of the normal distribution. Defaults 1.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.normal_(tensor, mean, std) return initializer def trunc_normal_(mean: float = 0., std: float = 1., a: float = -2., b: float = 2.): r"""Return the initializer filling the input Tensor with values drawn from a truncated normal distribution. The values are effectively drawn from the normal distribution :math:`\mathcal{N}(\text{mean}, \text{std}^2)` with values outside :math:`[a, b]` redrawn until they are within the bounds. The method used for generating the random values works best when :math:`a \leq \text{mean} \leq b`. Args: mean (float): the mean of the normal distribution. Defaults 0.0. std (float): the standard deviation of the normal distribution. Defaults 1.0. a (float): the minimum cutoff value. Defaults -2.0. b (float): the maximum cutoff value. Defaults 2.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.trunc_normal_(tensor, mean, std, a, b) return initializer def kaiming_uniform_(a=0, mode='fan_in', nonlinearity='leaky_relu'): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Delving deep into rectifiers: Surpassing human-level performance on ImageNet classification` - He, K. et al. (2015), using a uniform distribution. The resulting tensor will have values sampled from :math:`\mathcal{U}(-\text{bound}, \text{bound})` where .. math:: \text{bound} = \text{gain} \times \sqrt{\frac{3}{\text{fan_mode}}} Also known as 'He initialization'. Args: a (int): the negative slope of the rectifier used after this layer (only used with ``'leaky_relu'``). mode (str, optional): either ``'fan_in'`` (default) or ``'fan_out'``. Choosing ``'fan_in'`` preserves the magnitude of the variance of the weights in the forward pass. Choosing ``'fan_out'`` preserves the magnitudes in the backwards pass. nonlinearity (str, optional): the non-linear function (`nn.functional` name), recommended to use only with ``'relu'`` or ``'leaky_relu'`` (default). """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): if 0 in tensor.shape: warnings.warn("Initializing zero-element tensors is a no-op") return tensor if mode == 'fan_in': assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in elif mode == 'fan_out': assert fan_out is not None, 'Fan_out is not provided.' fan = fan_out else: raise ValueError(f'Invalid initialization mode \'{mode}\'') std = nn.init.calculate_gain(nonlinearity, a) / math.sqrt(fan) bound = math.sqrt(3.) * std return nn.init.uniform_(tensor, -bound, bound) return initializer def kaiming_normal_(a=0, mode='fan_in', nonlinearity='leaky_relu'): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Delving deep into rectifiers: Surpassing human-level performance on ImageNet classification` - He, K. et al. (2015), using a normal distribution. The resulting tensor will have values sampled from :math:`\mathcal{N}(0, \text{std}^2)` where .. math:: \text{std} = \frac{\text{gain}}{\sqrt{\text{fan_mode}}} Also known as 'He initialization'. Args: a (int): the negative slope of the rectifier used after this layer (only used with ``'leaky_relu'``). mode (str, optional): either ``'fan_in'`` (default) or ``'fan_out'``. Choosing ``'fan_in'`` preserves the magnitude of the variance of the weights in the forward pass. Choosing ``'fan_out'`` preserves the magnitudes in the backwards pass. nonlinearity (str, optional): the non-linear function (`nn.functional` name), recommended to use only with ``'relu'`` or ``'leaky_relu'`` (default). """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): if 0 in tensor.shape: warnings.warn("Initializing zero-element tensors is a no-op") return tensor if mode == 'fan_in': assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in elif mode == 'fan_out': assert fan_out is not None, 'Fan_out is not provided.' fan = fan_out else: raise ValueError(f'Invalid initialization mode \'{mode}\'') std = nn.init.calculate_gain(nonlinearity, a) / math.sqrt(fan) return nn.init.normal_(tensor, 0, std) return initializer def xavier_uniform_(a: float = math.sqrt(3.), scale: float = 2., gain: float = 1.): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Understanding the difficulty of training deep feedforward neural networks` - Glorot, X. & Bengio, Y. (2010), using a uniform distribution. The resulting tensor will have values sampled from :math:`\mathcal{U}(-a, a)` where .. math:: a = \text{gain} \times \sqrt{\frac{6}{\text{fan_in} + \text{fan_out}}} Also known as 'Glorot initialization'. Args: a (float, optional): an optional scaling factor used to calculate uniform bounds from standard deviation. Defaults ``math.sqrt(3.)``. scale (float, optional): an optional scaling factor used to calculate standard deviation. Defaults 2.0. gain (float, optional): an optional scaling factor. Defaults 1.0. """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in if fan_out is not None: fan += fan_out std = gain * math.sqrt(scale / float(fan)) bound = a * std return nn.init.uniform_(tensor, -bound, bound) return initializer def xavier_normal_(scale: float = 2., gain: float = 1.): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Understanding the difficulty of training deep feedforward neural networks` - Glorot, X. & Bengio, Y. (2010), using a normal distribution. The resulting tensor will have values sampled from :math:`\mathcal{N}(0, \text{std}^2)` where .. math:: \text{std} = \text{gain} \times \sqrt{\frac{2}{\text{fan_in} + \text{fan_out}}} Also known as 'Glorot initialization'. Args: scale (float, optional): an optional scaling factor used to calculate standard deviation. Defaults 2.0. gain (float, optional): an optional scaling factor. Defaults 1.0. """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in if fan_out is not None: fan += fan_out std = gain * math.sqrt(scale / float(fan)) return nn.init.normal_(tensor, 0., std) return initializer def lecun_uniform_(): # adapted from jax.nn.initializers def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' var = 1.0 / fan_in bound = math.sqrt(3 * var) return nn.init.uniform_(tensor, -bound, bound) return initializer def lecun_normal_(): # adapted from jax.nn.initializers def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' std = math.sqrt(1.0 / fan_in) return nn.init.trunc_normal_(tensor, std=std / .87962566103423978) return initializer
nilq/baby-python
python
#!/usr/bin/python # Filename: mysqlfunc.py # Purpose: All the mysql functions # !!! need to encapsulate a cur with something like a using statement # Database errors import MySQLdb, pdb, logger, dnsCheck from MySQLdb import Error #All the variables for paths from variables import * def create_dbConnection(): try: # trying to create a connection with the proceeding connection a = MySQLdb.connect(user=databaseUser, passwd=databasePasswd, db=databaseName, unix_socket="/opt/lampp/var/mysql/mysql.sock") return a except Error as e: print(e) return None def sqlExeCommit(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) conn.commit() def sqlCommit(conn): conn.commit() # Only execute def sqlExe(cur, statem): cur.execute(statem) # Execute return def sqlExeRet(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) return cur.fetchall() def sqlExeRetOne(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) return cur.fetchone() # Returns the domains based on the domainRangeId def domainsBydomainRangeId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainName FROM Domains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for column in cur.fetchall(): results.append(column[0]) return results # Returns the domains based on the domainRangeId def domainIdsBydomainRangeId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainId FROM Domains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for column in cur.fetchall(): results.append(int(column[0])) return results # Returns the domains based on the domainRangeId def domainNameByDomainId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainName FROM Domains WHERE domainId = %s"%str(id) cur.execute(statem) return cur.fetchone()[0] # Return the domainRange value associated with the rangeId def domainRangeByrangeId(cur, id): statem = "SELECT domainRange FROM InScope WHERE domainRangeId = %s"%str(id) cur.execute(statem) return cur.fetchone()[0] # Return all scope Ids def AllScopeIds(self): conn = mysqlfunc.create_dbConnection() cur = conn.cursor() # Saving the programI ScopeIds = [] # Grab all the InScopeIds based on the programName statem = "SELECT domainRangeId FROM InScope" cur.execute(statem) for column in cur.fetchall(): ScopeIds.append(int(column[0])) return ScopeIds #Good for iterates on own commit def insertDomain(domain, domainRangeId): conn = create_dbConnection() cur = conn.cursor() # checkInternet if dnsCheck.checkHostByName(domain): # pdb catch in case something goes wrong # Find ips try: # Insert into Domains statem = "INSERT IGNORE INTO Domains(domainRangeId, domainName, dateFound) VALUES (%s, \"%s\", CURDATE())"%(domainRangeId, domain) cur.execute(statem) print '[+] New Domain:',domain logger.logNewDomain(domain) except Exception,e: print e pdb.set_trace() # Commit conn.commit() def removeDomain(domain): conn = create_dbConnection() cur = conn.cursor() cur.execute('DELETE FROM Domains WHERE domainName like \'%s\''%(domain)) conn.commit() def removeDomainArray(domainArray): conn = create_dbConnection() cur = conn.cursor() for domain in domainArray: cur.execute('DELETE FROM Ips WHERE domainId = (SELECT domainId FROM Domains where domainName = \'%s\')'%(domain)) cur.execute('DELETE FROM Domains WHERE domainName like \'%s\''%(domain)) conn.commit() def returnAllDomains(cur): statem = "SELECT domainName FROM Domains" cur.execute(statem) results = [] for column in cur.fetchall(): results.append(column[0]) return results # Returns an Array of inScope Ids based onthe program # oldName: returnInScopeIds def InScopeIdsByProgramName(program): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainRangeId FROM InScope WHERE programId = (SELECT programId FROM Programs WHERE name = \"%s\")"%(program) results = [] cur.execute(statem) for a in cur.fetchall(): results.append(int(a[0])) return results def programNameByProgramId(programId): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT name from Programs WHERE programId = %s"%programId cur.execute(statem) return cur.fetchone()[0] def ProgramIdByProgramName(programName): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT programId from Programs WHERE Programs = %s"%programId cur.execute(statem) return cur.fetchone()[0] def blacklistedByDomainRangeId(cur, id): statem = "SELECT blacklistedContent FROM BlacklistedDomains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for a in cur.fetchall(): results.append(a[0]) return results
nilq/baby-python
python
#!/usr/bin/env python import functools import os import os.path from datetime import timedelta from functools import update_wrapper from flask import Flask, abort, current_app, jsonify, make_response, request import psycopg2 DATABASE = os.environ['POSTGRES_DB'] USERNAME = os.environ['POSTGRES_USER'] PASSWORD = os.environ['POSTGRES_PASSWORD'] QUERY_FORMAT = """ SELECT elect_div FROM com_elb WHERE ST_Contains(geom, ST_SetSRID(ST_Point({longitude:f}, {latitude:f}), 4283)) """ app = Flask(__name__) if not app.debug: import logging from logging.handlers import RotatingFileHandler logfile = os.path.expanduser('/home/docker/logs/division.log') file_handler = RotatingFileHandler(logfile) file_handler.setLevel(logging.INFO) app.logger.addHandler(file_handler) translation_table = str.maketrans('', '', " -'") def crossdomain(origin=None, methods=None, headers=None, max_age=21600, attach_to_all=True, automatic_options=True): if methods is not None: methods = ', '.join(sorted(x.upper() for x in methods)) if headers is not None and not isinstance(headers, str): headers = ', '.join(x.upper() for x in headers) if not isinstance(origin, str): origin = ', '.join(origin) if isinstance(max_age, timedelta): max_age = max_age.total_seconds() def get_methods(): if methods is not None: return methods options_resp = current_app.make_default_options_response() return options_resp.headers['allow'] def decorator(f): def wrapped_function(*args, **kwargs): if automatic_options and request.method == 'OPTIONS': resp = current_app.make_default_options_response() else: resp = make_response(f(*args, **kwargs)) if not attach_to_all and request.method != 'OPTIONS': return resp h = resp.headers h['Access-Control-Allow-Origin'] = origin h['Access-Control-Allow-Methods'] = get_methods() h['Access-Control-Max-Age'] = str(max_age) if headers is not None: h['Access-Control-Allow-Headers'] = headers return resp f.provide_automatic_options = False return update_wrapper(wrapped_function, f) return decorator @app.route('/division', methods=['GET', 'POST', 'OPTIONS']) @crossdomain(origin='*', headers=['Content-Type', 'X-Requested-With']) def division_lookup(): if request.json is None and request.method == 'POST': abort(400, "Must provide JSON (did you set Content-type?)") elif request.method == 'POST': args = request.json else: args = request.args if 'latitude' not in args: abort(400, "Most provide latitude and longitude") if 'longitude' not in args: abort(400, "Most provide latitude and longitude") conn = psycopg2.connect(host='postgres', database=DATABASE, user=USERNAME, password=PASSWORD) cursor = conn.cursor() cursor.execute(QUERY_FORMAT.format(latitude=float(args['latitude']), longitude=float(args['longitude']))) result = cursor.fetchone() if result is None: name = None else: name = result[0].lower().translate(translation_table) return jsonify({'division': name}) if __name__ == '__main__': app.run(debug=True)
nilq/baby-python
python
from botcity.core import DesktopBot # Uncomment the line below for integrations with BotMaestro # Using the Maestro SDK # from botcity.maestro import * class Bot(DesktopBot): def action(self, execution=None): # Fetch the Activity ID from the task: # task = self.maestro.get_task(execution.task_id) # activity_id = task.activity_id # Opens the BotCity website. self.browse("http://www.botcity.dev") # Uncomment to mark this task as finished on BotMaestro # self.maestro.finish_task( # task_id=execution.task_id, # status=AutomationTaskFinishStatus.SUCCESS, # message="Task Finished OK." # ) def not_found(self, label): print(f"Element not found: {label}") if __name__ == '__main__': Bot.main()
nilq/baby-python
python
import os from ibm_cloud_sdk_core.authenticators import IAMAuthenticator from ibm_watson import PersonalityInsightsV3 from services.base import BaseService, BaseServiceResult class IBMWatson(BaseService): """ IBM Watson service wrapper """ def __init__(self, service_wrapper, service_url): """ Initiate the service engine :param service_wrapper: IBM Watson service engine :type service_wrapper: PersonalityInsightsV3 :param service_url: IBM Watson service URL address :type service_url: str """ super().__init__("ibm", service_url) self.service = service_wrapper def get_personality_scores(self, text_content): """ Get personality scores from textual content :param text_content: Textual data of minimum 100 words :type text_content: str :return: Results from service engine :rtype: dict """ result = self.service.profile( {"contentItems": [{"content": text_content}]}, accept="application/json", raw_scores=True, consumption_preferences=True, ).get_result() return BaseServiceResult(200, result) PERSONALITY_API_KEY = os.getenv("PERSONALITY_API_KEY") PERSONALITY_URL = os.getenv("PERSONALITY_URL") PERSONALITY_ENGINE = PersonalityInsightsV3( version="2017-10-13", authenticator=IAMAuthenticator(apikey=PERSONALITY_API_KEY) ) PERSONALITY_ENGINE.set_service_url(PERSONALITY_URL) IBMWatsonService = IBMWatson(PERSONALITY_ENGINE, PERSONALITY_URL)
nilq/baby-python
python
#!/usr/bin/python3 # creates the SQLite database file - run this first import sqlite3 # create db file con = sqlite3.connect('./db/ic_log1_2020-06-30_manual.db') cur = con.cursor() # create table cur.execute('''CREATE TABLE IF NOT EXISTS iclog (date real, ic integer, note text)''') # close the connection con.close() ''' Legend: date: a UNIX timestamp ic: internet connection boolean true or false, 1 | 0 error: short description of the problem '''
nilq/baby-python
python
# -*- coding: utf-8 -*- def main(): n, m = map(int, input().split()) summed = 4 * n - m xy = list() # 2x + 3y + 4z = M # x + y + z = N を解く # See: # https://atcoder.jp/contests/abc006/submissions/1112016 # WAの原因:成立しない条件の境界値を0以下だと思っていた,2項目の条件に気がつけなかった if summed < 0: print(-1, -1, -1) exit() # xを決め打ち for x in range(summed // 2 + 1): y = summed - 2 * x if y >= 0: xy.append((x, y)) for x, y in xy: z = n - (x + y) if z >= 0: print(x, y, z) exit() print(-1, -1, -1) if __name__ == '__main__': main()
nilq/baby-python
python
#!/usr/bin/env python """ -------------------------------------------------------------------------------- Created: Jackson Lee 7/8/14 This script reads in a fasta or fastq and filters for sequences greater or less than a threshold length Input fastq file @2402:1:1101:1392:2236/2 GATAGTCTTCGGCGCCATCGTCATCCTCTACACCCTCAAGGCGAGCGGCGCGATGGAGACAATCCAGTGGGGCATGCAGCAGGTGACACCGGACTCCCGGATCCA + @@CFFFFFGHHHHIJJIIJIHIJIIIIJIIGEIJJIJJJJJIIIJHFFDDBD8BBD>BCBCCDDDCDCCCDBDDDDDDDDDDD<CDDDDDDDDBBCDDBD<<BDD -------------------------------------------------------------------------------- usage: filter_fasta_by_len.py -i sequence.fasta -g filter_greater_than -l filter_less_than """ #------------------------------------------------------------------------------- #Header - Linkers, Libs, Constants from string import strip from Bio import SeqIO from argparse import ArgumentParser, RawDescriptionHelpFormatter #------------------------------------------------------------------------------- #function declarations def process_and_generate(input_iterator, threshold, greaterflag): """Reusable function that processes a record, then generates each record. input_iterator is an iterator that returns one record at a time process_function is a function that takes one record and does some processing on it """ for rec in input_iterator: if greaterflag: if len(rec.seq) <= threshold: yield rec else: if len(rec.seq) >= threshold: yield rec #------------------------------------------------------------------------------- #Body print "Running..." if __name__ == '__main__': parser = ArgumentParser(usage = "filter_fasta_by_len.py -i sequence.fasta -g filter_greater_than -l filter_less_than", description=__doc__, formatter_class=RawDescriptionHelpFormatter) parser.add_argument("-i", "--input_fastq", action="store", dest="inputfilename", help="fastq file of input sequences") parser.add_argument("-g", "--filter_greater_than", action="store", type=int, dest="greaterthan", help="filter out sequences greater than or equal to \ this size") parser.add_argument("-l", "--filter_less_than", action="store", type=int, dest="lessthan", help="filter out sequences less than or equal this size") options = parser.parse_args() mandatories = ["inputfilename"] for m in mandatories: if not options.__dict__[m]: print "\nError: Missing Arguments\n" parser.print_help() exit(-1) inputfilename = options.inputfilename left, __, right = inputfilename.rpartition('.') fasta =['fa','fasta','faa','fas', 'fna'] fastq =['fq','fastq'] if right in fasta: ext = "fasta" elif right in fastq: ext = "fastq" print "Processing read file: " + inputfilename with open(inputfilename,'U') as infile: parse_iterator = SeqIO.parse(infile, ext) if options.greaterthan == None and options.lessthan == None: print "\nError: Missing Comparison Value\n" parser.print_help() exit(-1) elif options.greaterthan == None and options.lessthan != None: lessthan = options.lessthan print "and filtering out sequences less than ", lessthan outputfilename = left + '.filtered.lessthan.' + str(lessthan) + "." + right with open(outputfilename, 'w') as outfile: record_generator = process_and_generate(parse_iterator, lessthan, False) SeqIO.write(record_generator, outfile, ext) elif options.greaterthan != None and options.lessthan == None: greaterthan = options.greaterthan print "and filtering out sequences greater than ", greaterthan outputfilename = left + '.filtered.greaterthan.' + str(greaterthan) + "." + right with open(outputfilename, 'w') as outfile: record_generator = process_and_generate(parse_iterator, greaterthan, True) SeqIO.write(record_generator, outfile, ext) elif options.greaterthan != None and options.lessthan != None: greaterthan = options.greaterthan lessthan = options.lessthan print "and filtering out sequences less than ", lessthan, " and greater than ", greaterthan outputfilename = left + '.filtered.greaterthan.' + str(greaterthan) + ".filtered.lessthan." + str(lessthan) + '.' + right with open(outputfilename, 'w') as outfile: pre_record_generator = process_and_generate(parse_iterator, greaterthan, True) record_generator = process_and_generate(pre_record_generator, lessthan, False) SeqIO.write(record_generator, outfile, ext) print "Done!"
nilq/baby-python
python
import numpy as np from os import listdir from os.path import join #def random_shift_events(events, max_shift=20, resolution=(180, 240)): def random_shift_events(events, f, max_shift=20, resolution=(195, 346)): H, W = resolution x_shift, y_shift = np.random.randint(-max_shift, max_shift+1, size=(2,)) #print('rm -rf ~/cachefs/erl/' + f) #print(events.shape) #print(events[:,0]) #print(events[:,1]) events[:,0] += x_shift events[:,1] += y_shift valid_events = (events[:,0] >= 0) & (events[:,0] < W) & (events[:,1] >= 0) & (events[:,1] < H) events = events[valid_events] return events #def random_flip_events_along_x(events, resolution=(180, 240), p=0.5): def random_flip_events_along_x(events, resolution=(195, 346), p=0.5): H, W = resolution if np.random.random() < p: events[:,0] = W - 1 - events[:,0] return events class NCaltech101: def __init__(self, root, augmentation=False): self.classes = listdir(root) self.files = [] self.labels = [] self.augmentation = augmentation for i, c in enumerate(self.classes): new_files = [join(root, c, f) for f in listdir(join(root, c))] self.files += new_files self.labels += [i] * len(new_files) def __len__(self): return len(self.files) def __getitem__(self, idx): """ returns events and label, loading events from aedat :param idx: :return: x,y,t,p, label """ label = self.labels[idx] f = self.files[idx] #print('rm -rf ~/cachefs/erl/' + f) events = np.load(f).astype(np.float32) if self.augmentation: events = random_shift_events(events, f) events = random_flip_events_along_x(events) return events, label
nilq/baby-python
python
import json import cryptography.fernet from django.conf import settings from django.utils.encoding import force_bytes, force_text from django_pgjson.fields import get_encoder_class import six # Allow the use of key rotation if isinstance(settings.FIELD_ENCRYPTION_KEY, (tuple, list)): keys = [ cryptography.fernet.Fernet(k) for k in settings.FIELD_ENCRYPTION_KEY ] elif isinstance(settings.FIELD_ENCRYPTION_KEY, dict): # allow the keys to be indexed in a dictionary keys = [ cryptography.fernet.Fernet(k) for k in settings.FIELD_ENCRYPTION_KEY.values() ] else: # else turn the single key into a list of one keys = [cryptography.fernet.Fernet(settings.FIELD_ENCRYPTION_KEY), ] crypter = cryptography.fernet.MultiFernet(keys) def no_op_encrypt_values(data, encrypter=None, skip_keys=None): """ A noop function with the same call signature of `encrypt_values`. Returns: obj - returns the data parameter unaltered. """ return data def pick_encrypter(key, keys, encrypter): """ Returns encrypting function. To facilitate skipping keys during encryption we need to pick between the encrypting function or a noop funciton. Returns: function """ if key in keys: return no_op_encrypt_values return encrypter def encrypt_values(data, encrypter=None, skip_keys=None): """ Returns data with values it contains recursively encrypted. Note that this will use `json.dumps` to convert the data to a string type. The encoder class will be the value of `PGJSON_ENCODER_CLASS` in the settings or `django.core.serializers.json.DjangoJSONEncoder`. Arguments: data (object): the data to decrypt. encrypter (function): the decryption function to use. If not specified it will use the cryptography.fernet.MultiFernetMultiFernet.encrypt method with the keys being taken from settings.FIELD_ENCRYPTION_KEY skip_keys (list[str]): a list of keys that should not be encrypted Returns: object """ if skip_keys is None: skip_keys = [] encrypter = encrypter or crypter.encrypt if isinstance(data, (list, tuple, set)): return [encrypt_values(x, encrypter, skip_keys) for x in data] if isinstance(data, dict): return { key: pick_encrypter(key, skip_keys, encrypt_values)( value, encrypter, skip_keys) for key, value in six.iteritems(data) } if isinstance(data, six.string_types): return force_text(encrypter(data.encode('unicode_escape'))) return force_text(encrypter( force_bytes(json.dumps(data, cls=get_encoder_class())) )) def decrypt_values(data, decrypter=None): """ Returns data with values it contains recursively decrypted. Note that this will use `json.loads` to convert the decrypted data to its most likely python type. Arguments: data (object): the data to decrypt. decrypter (function): the decryption function to use. If not specified it will use the cryptography.fernet.MultiFernetMultiFernet.decrypt method with the keys being taken from settings.FIELD_ENCRYPTION_KEY Returns: object """ decrypter = decrypter or crypter.decrypt if isinstance(data, (list, tuple, set)): return [decrypt_values(x, decrypter) for x in data] if isinstance(data, dict): return { key: decrypt_values(value, decrypter) for key, value in six.iteritems(data) } if isinstance(data, six.string_types): # string data! if we got a string or unicode convert it to # bytes first, as per http://stackoverflow.com/a/11174804. # # Note 1: This is required for the decrypter, it only accepts bytes. # Note 2: this is primarily needed because the decrypt method is called # on the value during the save as well as during the read, by the # django ORM. data = data.encode('unicode_escape') try: # decrypt the bytes data value = decrypter(data) except TypeError: # Not bytes data??! probably from a django field calling # to_python during value assignment value = data except cryptography.fernet.InvalidToken: # Either the data is corrupted, e.g. a lost key or the data # was never encrypted, this could be from django calling to_python # during value assignment. value = data try: # undo the unicode mess from earlier value = value.decode('unicode_escape') except AttributeError: pass try: return json.loads(value) except (ValueError, TypeError): # Not valid json, just return the value return value
nilq/baby-python
python
from pptx import Presentation from pptx.util import Inches import pyexcel as pe print(""" Exemplo de criação de apresentação PPTX em loop utilizando dados de Excel Vish, o bagulho foi loko pra conseguir criar este aplicativo mano -> agora aprendi, já era Day 24 Code Python - 23/05/2018 """) dadosExcel = pe.iget_records(file_name="apresentacao_automatica.xlsx") # tentar criar uma função prs = Presentation() # se for ler um PPTX, passar como parâmetro title_only_slide_layout = prs.slide_layouts[5] slide = prs.slides.add_slide(title_only_slide_layout) shapes = slide.shapes shapes.title.text = 'Idades -> Feito com Python' # configuração de colunas e celulas --> ainda preciso descobrir como automatizar estes tamanhos porque o bagulho tá loko rows = 5 cols = 2 left = top = Inches(2.0) width = Inches(6.0) height = Inches(0.8) table = shapes.add_table(rows, cols, left, top, width, height).table # tamanho das colunas table.columns[0].width = Inches(3.0) table.columns[1].width = Inches(2.0) # nome das colunas - fixo na posição 0 table.cell(0, 0).text = 'Nome' table.cell(0, 1).text = 'Idade' nome = [] idade = [] cont = 1 for itens in dadosExcel: # escrevendo os dados na células if cont > 0: # o 0 sempre será o header, e este é fixo. table.cell(cont, 0).text = str(itens['nome']) table.cell(cont, 1).text = str(itens['idade']) cont += 1 # liberando o recurso, iiirraaaaa pe.free_resources() # salvando o arquivo pptx prs.save('apresentacao_tabela_automatica.pptx') print('-' * 34) print('APRESENTAÇÃO CRIADA COM SUCESSO.')
nilq/baby-python
python
""" This sample shows how to create a list in json of all items in a group Python 2.x/3.x ArcREST 3.5,6 """ from __future__ import print_function from __future__ import absolute_import import arcrest import os import json from arcresthelper import orgtools, common import csv import sys from arcresthelper.packages import six def trace(): """ trace finds the line, the filename and error message and returns it to the user """ import traceback, inspect,sys tb = sys.exc_info()[2] tbinfo = traceback.format_tb(tb)[0] filename = inspect.getfile(inspect.currentframe()) # script name + line number line = tbinfo.split(", ")[1] # Get Python syntax error # synerror = traceback.format_exc().splitlines()[-1] return line, filename, synerror def _unicode_convert(obj): """ converts unicode to anscii """ if isinstance(obj, dict): return {_unicode_convert(key): _unicode_convert(value) for key, value in obj.items()} elif isinstance(obj, list): return [_unicode_convert(element) for element in obj] elif isinstance(obj, str): return obj elif isinstance(obj, six.text_type): return obj.encode('utf-8') elif isinstance(obj, six.integer_types): return obj else: return obj if __name__ == "__main__": proxy_port = None proxy_url = None securityinfo = {} securityinfo['security_type'] = 'Portal'#LDAP, NTLM, OAuth, Portal, PKI securityinfo['username'] = ""#<UserName> securityinfo['password'] = ""#<Password> securityinfo['org_url'] = "http://www.arcgis.com" securityinfo['proxy_url'] = proxy_url securityinfo['proxy_port'] = proxy_port securityinfo['referer_url'] = None securityinfo['token_url'] = None securityinfo['certificatefile'] = None securityinfo['keyfile'] = None securityinfo['client_id'] = None securityinfo['secret_id'] = None groups = ["Demographic Content"] #Name of groups outputlocation = r"C:\TEMP" outputfilename = "group.json" outputitemID = "id.csv" try: orgt = orgtools.orgtools(securityinfo) groupRes = [] if orgt.valid: fileName = os.path.join(outputlocation,outputfilename) csvFile = os.path.join(outputlocation,outputitemID) iconPath = os.path.join(outputlocation,"icons") if not os.path.exists(iconPath): os.makedirs(iconPath) if sys.version_info[0] == 2: access = 'wb+' kwargs = {} else: access = 'wt+' kwargs = {'newline':''} file = open(fileName, "w") with open(fileName, access, **kwargs) as csvFile: idwriter = csv.writer(csvFile) for groupName in groups: results = orgt.getGroupContent(groupName=groupName, onlyInOrg=True, onlyInUser=True) if not results is None: for result in results: idwriter.writerow([result['title'],result['id']]) thumbLocal = orgt.getThumbnailForItem(itemId=result['id'], fileName=result['title'], filePath=iconPath) result['thumbnail']=thumbLocal groupRes.append(result) if len(groupRes) > 0: print ("%s items found" % str(len(groupRes))) groupRes = _unicode_convert(groupRes) file.write(json.dumps(groupRes, ensure_ascii=False, sort_keys=True, indent=4, separators=(',', ': '))) file.close() except (common.ArcRestHelperError) as e: print ("error in function: %s" % e[0]['function']) print ("error on line: %s" % e[0]['line']) print ("error in file name: %s" % e[0]['filename']) print ("with error message: %s" % e[0]['synerror']) if 'arcpyError' in e[0]: print ("with arcpy message: %s" % e[0]['arcpyError']) except: line, filename, synerror = trace() print ("error on line: %s" % line) print ("error in file name: %s" % filename) print ("with error message: %s" % synerror)
nilq/baby-python
python
def get_customized_mapping(cls): mapping = { "name": { "type": "text", "copy_to": [ "all" ] }, "is_public": { "type": "boolean" }, "taxid": { "type": "integer" }, "genes": { "properties": { "mygene_id": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "symbol": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "ncbigene": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "ensemblgene": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "uniprot": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "name": { "type": "text" } } }, "reactome": { "properties": { "id": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword", "copy_to": [ "all" ] }, "geneset_name": { "type": "text" } } } } return mapping
nilq/baby-python
python