text
stringlengths
0
1.05M
meta
dict
__all__ = [ "t" ] from Optizelle.Utility import * from Optizelle.Properties import * from Optizelle.Enumerated import * def allocateVectors(self,X,x): """Allocates memory for the state vectors""" self.x=X.init(x) self.grad=X.init(x) self.dx=X.init(x) self.x_old=X.init(x) self.grad_old=X.init(x) self.dx_old=X.init(x) class t(object): """Internal state of the optimization""" def __init__(self,X,x): """Constructor""" # Check our arguments checkVectorSpace("X",X) # Allocate memory for our vectors allocateVectors(self,X,x) # Create the state UnconstrainedStateCreate(self,X,x) # Create all of the properties eps_grad = createFloatProperty( "eps_grad", "Tolerance for the gradient stopping condition") eps_dx = createFloatProperty( "eps_dx", "Tolerance for the step length stopping criteria") algorithm_class = createEnumProperty( "algorihm_class", AlgorithmClass, "Algorithm class") stored_history = createNatProperty( "stored_history", "Number of control objects to store in a quasi-Newton method") iter = createNatProperty( "iter", "Current iteration") iter_max = createNatProperty( "iter_max", "Maximum number of optimization iterations") glob_iter = createNatProperty( "glob_iter", "Globalization iteration") glob_iter_max = createNatProperty( "glob_iter_max", "Maximum number of globalization iterations before we quit") glob_iter_total = createNatProperty( "glob_iter_total", "Total number of globalization iterations taken") opt_stop = createEnumProperty( "opt_stop", OptimizationStop, "Why we've stopped the optimization") trunc_iter = createNatProperty( "trunc_iter", "Current number of truncated-CG iterations taken") trunc_iter_max = createNatProperty( "trunc_iter_max", "Maximum number of iterations used by truncated CG") trunc_iter_total = createNatProperty( "trunc_iter_total", "Total number of truncated-CG iterations taken") trunc_orthog_storage_max = createNatProperty( "trunc_orthog_storage_max", "Maximum number of vectors we orthogonalize against in truncated CG") trunc_orthog_iter_max = createNatProperty( "trunc_orthog_iter_max", "Maximum number of orthogonalization iterations in truncated CG") trunc_stop = createEnumProperty( "trunc_stop", TruncatedStop, "Why truncated CG was last stopped") trunc_err = createFloatProperty( "trunc_err", "Relative error in truncated CG") eps_trunc = createFloatProperty( "eps_trunc", "Stopping tolerance for truncated CG") algorithm_class = createEnumProperty( "algorithm_class", AlgorithmClass, "Algorithm class") PH_type = createEnumProperty( "PH_type", Operators, "Preconditioner for the Hessian") H_type = createEnumProperty( "H_type", Operators, "Hessian approximation") norm_gradtyp = createFloatProperty( "norm_gradtyp", "Norm of a typical tradient") norm_dxtyp = createFloatProperty( "norm_dxtyp", "Norm of a typical trial step") x = createVectorProperty( "x", "Optimization variable") grad = createVectorProperty( "grad", ("Gradient, possibly of the objective, possibly of the Lagrangian. " "It depends on the context.")) dx = createVectorProperty( "dx", "Trial step") x_old = createVectorProperty( "x_old", "Old optimization variable") grad_old = createVectorProperty( "grad_old", "Old gradient") dx_old = createVectorProperty( "dx_old", "Old trial step") oldY = createVectorListProperty( "oldY", "Difference in prior gradients") oldS = createVectorListProperty( "oldS", "Difference in prior steps") f_x = createFloatProperty( "f_x", "Current value of the objective function") f_xpdx = createFloatProperty( "f_xpdx", "Objective function at the trial step") msg_level = createNatProperty( "msg_level", "Messaging level") safeguard_failed_max = createNatProperty( "safeguard_failed_max", "Number of failed safe-guard steps before quitting the method") safeguard_failed = createNatProperty( "safeguard_failed", "Number of failed safeguard steps during the last iteration") safeguard_failed_total = createNatProperty( "safeguard_failed_total", "Total number of failed safeguard steps") alpha_x = createFloatProperty( "alpha_x", ("Amount we truncate dx in order to maintain feasibility " " with respect to the safeguard, which probably relates to " "the inequality constraint")) alpha_x_qn = createFloatProperty( "alpha_x_qn", ("Amount we truncate dx_n in order to maintain feasibility " "with respect to the safeguard, which probably relates to " "the inequailty constraint")) delta = createFloatProperty( "delta", "Trust region radius") eta1 = createFloatProperty( "eta1", "Trust-region parameter for checking whether a step has been accepted") eta2 = createFloatProperty( "eta2", ("Trust-region parameter for checking whether we enlarge the " "trust-region radius")) ared = createFloatProperty( "ared", "Actual reduction") pred = createFloatProperty( "pred", "Predicted reduction") alpha0 = createFloatProperty( "alpha0", "Base line-search step length") alpha = createFloatProperty( "alpha", "Actual line-search step length") c1 = createFloatProperty( "c1", "Parameter that helps govern the sufficient decrease") ls_iter = createNatProperty( "ls_iter", "Current number of iterations used in the line-search") ls_iter_max = createNatProperty( "ls_iter_max", "Maximum number of iterations used in the line-search") ls_iter_total = createNatProperty( "ls_iter_total", "Total number of line-search iterations computed") eps_ls = createFloatProperty( "eps_ls", "Stopping tolerance for the line-search") dir = createEnumProperty( "dir", LineSearchDirection, "Search direction type") kind = createEnumProperty( "kind", LineSearchKind, "Type of line-search") f_diag = createEnumProperty( "f_diag", FunctionDiagnostics, "Function diagnostics on f") L_diag = createEnumProperty( "L_diag", FunctionDiagnostics, "Function diagnostics on the Lagrangian") x_diag = createEnumProperty( "x_diag", VectorSpaceDiagnostics, "Vector space diagnostics on X") dscheme = createEnumProperty( "dscheme", DiagnosticScheme, "Diagnostic scheme") eps_kind = createEnumProperty( "eps_kind", ToleranceKind, "Kind of stopping tolerance") def checkT(name,value): """Check that we have a state""" if not issubclass(type(value),t): raise TypeError( "The %s argument must have type Unconstrained.State.t." % (name))
{ "repo_name": "OptimoJoe/Optizelle", "path": "src/python/Optizelle/Unconstrained/State.py", "copies": "1", "size": "7613", "license": "bsd-2-clause", "hash": 5174906473665832000, "line_mean": 31.6738197425, "line_max": 79, "alpha_frac": 0.6203861815, "autogenerated": false, "ratio": 4.084227467811159, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5204613649311158, "avg_score": null, "num_lines": null }
__all__ = [ "t" ] import Optizelle.Unconstrained.Functions from Optizelle.Properties import * from Optizelle.Functions import * class t(Optizelle.Unconstrained.Functions.t): """All the functions required by an optimization algorithm""" def __init__(self): super(t,self).__init__() self._g=VectorValuedFunction() self._PSchur_left=Operator() self._PSchur_right=Operator() # Create all of the properties g = createVectorValuedFunctionProperty( "g", "Equality constraints") PSchur_left = createOperatorProperty( "PSchur_left", "Left preconditioner for the augmented system") PSchur_right = createOperatorProperty( "PSchur_right", "Right preconditioner for the augmented system") def checkT(name,value): """Check that we have a bundle of functions""" if not issubclass(type(value),t): raise TypeError( "The %s argument must have type EqualityConstrained.Functions.t." % (name))
{ "repo_name": "OptimoJoe/Optizelle", "path": "src/python/Optizelle/EqualityConstrained/Functions.py", "copies": "1", "size": "1026", "license": "bsd-2-clause", "hash": -7977901696843889000, "line_mean": 30.0909090909, "line_max": 77, "alpha_frac": 0.6530214425, "autogenerated": false, "ratio": 3.7859778597785976, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4938999302278598, "avg_score": null, "num_lines": null }
__all__ = [ "t" ] import Optizelle.Unconstrained.State from Optizelle.Utility import * from Optizelle.Properties import * from Optizelle.Enumerated import * def allocateVectors(self,X,Y,x,y): """Allocates memory for the state vectors""" self.y=Y.init(y) self.dy=Y.init(y) self.g_x=Y.init(y) self.gpxdxn_p_gx=Y.init(y) self.gpxdxt=Y.init(y) self.dx_n=X.init(x) self.dx_ncp=X.init(x) self.dx_t=X.init(x) self.dx_t_uncorrected=X.init(x) self.dx_tcp_uncorrected=X.init(x) self.H_dxn=X.init(x) self.W_gradpHdxn=X.init(x) self.H_dxtuncorrected=X.init(x) class t(Optizelle.Unconstrained.State.t): """Internal state of the optimization""" def __init__(self,X,Y,x,y): """Constructor""" # Check our arguments checkVectorSpace("X",X) checkVectorSpace("Y",Y) # Allocate memory for our vectors Optizelle.Unconstrained.State.allocateVectors(self,X,x) allocateVectors(self,X,Y,x,y) # Create the state EqualityConstrainedStateCreate(self,X,Y,x,y) # Create all of the properties y = createVectorProperty( "y", "Equality multiplier (dual variable or Lagrange multiplier)") dy = createVectorProperty( "dy", "Step in the equality multiplier") zeta = createFloatProperty( "zeta", "The fraction of the total trust-region used for the quasi-norm step") eta0 = createFloatProperty( "eta0", ("Trust-region parameter that bounds the error in the predicted " "reduction")) rho = createFloatProperty( "rho", "Penalty parameter for the augmented-Lagrangian") rho_old = createFloatProperty( "rho_old", "Penalty parameter from the last iteration") rho_bar = createFloatProperty( "rho_bar", "Fixed increase in the penalty parameter") eps_constr = createFloatProperty( "eps_constr", "Stopping tolerance for the norm of the constraints") xi_qn = createFloatProperty( "xi_qn", "Inexactness tolerance for the quasi-Newton step") xi_pg = createFloatProperty( "xi_pg", "Inexactness tolerance for the projection of the gradient") xi_proj = createFloatProperty( "xi_proj", "Inexactness tolerance for the null-space projection") xi_tang = createFloatProperty( "xi_tang", "Inexactness tolerance for the tangential step") xi_lmh = createFloatProperty( "xi_lmh", "Inexactness tolerance for the equality multiplier") def xi_all(self,value): """Sets all the inexactness tolerances: xi_qn, xi_pg, xi_proj, xi_tang, and xi_lmh""" self.xi_qn=value self.xi_pg=value self.xi_proj=value self.xi_tang=value self.xi_lmh=value xi_lmg = createFloatProperty( "xi_lmg", "Absolute tolerance on the residual of the equality multiplier solve") xi_4 = createFloatProperty( "xi_4", ("Tolerance for how much error is acceptable after computing the " "tangential step given the result from the tangential subproblem")) rpred = createFloatProperty( "rpred", "Residual term in the predicted reduction") PSchur_left_type = createEnumProperty( "PSchur_left_type", Operators, "Left preconditioner for the augmented system") PSchur_right_type = createEnumProperty( "PSchur_right_type", Operators, "Right preconditioner for the augmented system") augsys_iter_max = createNatProperty( "augsys_iter_max", "Maximum number of iterations used when solving the augmented system") augsys_rst_freq = createNatProperty( "augsys_rst_freq", ("How often we restart the augmented system solve")) augsys_qn_iter = createNatProperty( "augsys_qn_iter", ("Number of augmented system solve iterations used on the quasi-normal " "step")) augsys_pg_iter = createNatProperty( "augsys_pg_iter", ("Number of augmented system solve iterations used when projecting the " "gradient prior to the tangential subproblem")) augsys_proj_iter = createNatProperty( "augsys_proj_iter", ("Number of augmented system solve iterations used in the nullspace " "projection inside the tangential subproblem")) augsys_tang_iter = createNatProperty( "augsys_tang_iter", ("Number of augmented system solve iterations used in the tangential " "step")) augsys_lmh_iter = createNatProperty( "augsys_lmh_iter", ("Number of augmented system solve iterations used in the equality " "multiplier solve")) augsys_qn_iter_total = createNatProperty( "augsys_qn_iter_total", ("Total number of augmented system solve iterations used on the " "quasi-normal step")) augsys_pg_iter_total = createNatProperty( "augsys_pg_iter_total", ("Total number of augmented system solve iterations used when " "projecting the gradient prior to the tangential subproblem")) augsys_proj_iter_total = createNatProperty( "augsys_proj_iter_total", ("Total number of augmented system solve iterations used in the " "nullspace projection inside the tangential subproblem")) augsys_tang_iter_total = createNatProperty( "augsys_tang_iter_total", ("Total number of augmented system solve iterations used in the " "tangential step")) augsys_lmh_iter_total = createNatProperty( "augsys_lmh_iter_total", ("Total number of augmented system solve iterations used in the " "equality multiplier solve")) augsys_qn_err = createFloatProperty( "augsys_qn_err", ("Error in the augmented system solve used on the " "quasi-normal step")) augsys_pg_err = createFloatProperty( "augsys_pg_err", ("Error in the augmented system solve used when " "projecting the gradient prior to the tangential subproblem")) augsys_proj_err = createFloatProperty( "augsys_proj_err", ("Error in the augmented system solve used in the " "nullspace projection inside the tangential subproblem")) augsys_tang_err = createFloatProperty( "augsys_tang_err", ("Error in the augmented system solve used in the " "tangential step")) augsys_lmh_err = createFloatProperty( "augsys_lmh_err", ("Error in the augmented system solve used in the " "equality multiplier solve")) augsys_qn_err_target = createFloatProperty( "augsys_qn_err_target", ("Target error in the augmented system solve used on the " "quasi-normal step")) augsys_pg_err_target = createFloatProperty( "augsys_pg_err_target", ("Target error in the augmented system solve used when " "projecting the gradient prior to the tangential subproblem")) augsys_proj_err_target = createFloatProperty( "augsys_proj_err_target", ("Target error in the augmented system solve used in the " "nullspace projection inside the tangential subproblem")) augsys_tang_err_target = createFloatProperty( "augsys_tang_err_target", ("Target error in the augmented system solve used in the " "tangential step")) augsys_lmh_err_target = createFloatProperty( "augsys_lmh_err_target", ("Target error in the augmented system solve used in the " "equality multiplier solve")) augsys_iter_total = createNatProperty( "augsys_iter_total", ("Total number of augmented system solve iterations used in all " "solves")) augsys_qn_failed = createNatProperty( "augsys_qn_failed", ("Number of failed quasinormal augmented system solves")) augsys_pg_failed = createNatProperty( "augsys_pg_failed", ("Number of failed projected gradient augmented system solves")) augsys_proj_failed = createNatProperty( "augsys_proj_failed", ("Number of failed nullspace projection augmented system solves")) augsys_tang_failed = createNatProperty( "augsys_tang_failed", ("Number of failed tangential step augmented system solves")) augsys_lmh_failed = createNatProperty( "augsys_lmh_failed", ("Number of failed equality multiplier augmented system solves")) augsys_failed_total = createNatProperty( "augsys_failed_total", ("Total number of failed augmented system solves")) g_x = createVectorProperty( "g_x", ("Equality constraint evaluated at x. This is used in the quasinormal " "step as well as in the computation of the linear Taylor series at x " "in the direciton dx_n.")) norm_gxtyp = createFloatProperty( "norm_gxtyp", ("A typical norm for g(x). Generally, we just take the value at " "the first iteration.")) norm_gpsgxtyp = createFloatProperty( "norm_gpsgxtyp", ("A typical norm for g'(x)*g(x). Generally, we just take " "the value at the first iteration.")) gpxdxn_p_gx = createVectorProperty( "gpxdxn_p_gx", ("Linear Taylor series at x in the direction dx_n. This is used both " "in the predicted reduction as well as the residual predicted " "reduction.")) gpxdxt = createVectorProperty( "gpxdxt", ("Derivative of the constraint applied to the tangential step this is " "used in the residual predicted reduction.")) norm_gpxdxnpgx = createVectorProperty( "norm_gpxdxnpgx", ("Norm of gpxdxn_p_gx. This is used in the penalty parameter " "computation and predicted reduction.")) dx_n = createVectorProperty( "dx_n", "Normal step") dx_ncp = createVectorProperty( "dx_ncp", "Cauchy point for normal step") dx_t = createVectorProperty( "dx_t", "(Corrected) tangential step") dx_t_uncorrected = createVectorProperty( "dx_t_uncorrected", "Tangential step prior to correction") dx_tcp_uncorrected = createVectorProperty( "dx_tcp_uncorrected", "Cauchy point for tangential step prior to correction") H_dxn = createVectorProperty( "H_dxn", ("Hessian applied to the normal step. This is required by W_gradpHdxn " "as well as the predicted reduction.")) W_gradpHdxn = createVectorProperty( "W_gradpHdxn", ("Quantity grad f(x) + g'(x)*y + H dx_n projected into the null-space ", "of the constraints. This is required in the tangential subproblem " "and the predicted reduction.")) H_dxtuncorrected = createVectorProperty( "H_dxtuncorrected", ("Hessian applied to the uncorrected tangential step. This is needed " "in the predicted reduction.")) g_diag = createEnumProperty( "g_diag", FunctionDiagnostics, "Function diagnostics on g") y_diag = createEnumProperty( "y_diag", VectorSpaceDiagnostics, "Vector space diagnostics on Y") qn_stop = createEnumProperty( "qn_stop", QuasinormalStop, "Reason why the quasinormal problem exited") def checkT(name,value): """Check that we have a state""" if not issubclass(type(value),t): raise TypeError( "The %s argument must have type EqualityConstrained.State.t." % (name))
{ "repo_name": "OptimoJoe/Optizelle", "path": "src/python/Optizelle/EqualityConstrained/State.py", "copies": "1", "size": "11573", "license": "bsd-2-clause", "hash": 4637180416278640000, "line_mean": 39.044982699, "line_max": 93, "alpha_frac": 0.6446902273, "autogenerated": false, "ratio": 3.691547049441786, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4836237276741786, "avg_score": null, "num_lines": null }
__all__ = [ "t" ] import Optizelle.Unconstrained.State from Optizelle.Utility import * from Optizelle.Properties import * from Optizelle.Enumerated import * def allocateVectors(self,X,Z,x,z): """Allocates memory for the state vectors""" self.z=Z.init(z) self.dz=Z.init(z) self.h_x=Z.init(z) class t(Optizelle.Unconstrained.State.t): """Internal state of the optimization""" def __init__(self,X,Z,x,z): """Constructor""" # Check our arguments checkVectorSpace("X",X) checkEuclidean("Z",Z) # Allocate memory for our vectors Optizelle.Unconstrained.State.allocateVectors(self,X,x) allocateVectors(self,X,Z,x,z) # Create the state InequalityConstrainedStateCreate(self,X,Z,x,z) # Create all of the properties z = createVectorProperty( "z", "Inequality multiplier (dual variable or Lagrange multiplier)") dz = createVectorProperty( "dz", "Step in the inequality multiplier") h_x = createVectorProperty( "h_x", "The inequality constraint evaluated at x.") mu = createFloatProperty( "mu", "Interior point parameter") mu_est = createFloatProperty( "mu_est", "Current interior point estimate") mu_typ = createFloatProperty( "mu_typ", "Typical value for mu. Generally, the first estimated value for mu.") eps_mu = createFloatProperty( "eps_mu", "Relative stopping criteria for the interior point parameter") sigma = createFloatProperty( "sigma", ("The amount that we reduce the interior point parameter by everytime " "we approach the central path")) gamma = createFloatProperty( "gamma", "How close we move to the boundary during a single step") alpha_z = createFloatProperty( "alpha_z", ("Amount we truncate dx in order to maintain feasibility " " of the inequality multiplier")) h_diag = createEnumProperty( "h_diag", FunctionDiagnostics, "Function diagnostics on h") z_diag = createEnumProperty( "z_diag", VectorSpaceDiagnostics, "Vector space diagnostics on Z") def checkT(name,value): """Check that we have a state""" if not issubclass(type(value),t): raise TypeError( "The %s argument must have type InequalityConstrained.State.t." % (name))
{ "repo_name": "OptimoJoe/Optizelle", "path": "src/python/Optizelle/InequalityConstrained/State.py", "copies": "1", "size": "2465", "license": "bsd-2-clause", "hash": -8112444528863901000, "line_mean": 29.8125, "line_max": 79, "alpha_frac": 0.6267748479, "autogenerated": false, "ratio": 3.8098918083462134, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.49366666562462136, "avg_score": null, "num_lines": null }
__all__ = [ 'to_issue_dict' ] def to_issue_dict(issue): """ :rtype: ``dict`` """ split = issue.permalink().split(' - ', 1) url = split[0] if issue.fields.resolution: resolution = issue.fields.resolution.name else: resolution = None if issue.fields.reporter: reporter = issue.fields.reporter.displayName else: reporter = None if issue.fields.assignee: assignee = issue.fields.assignee.displayName else: assignee = None result = { 'id': issue.id, 'key': issue.key, 'url': url, 'summary': issue.fields.summary, 'description': issue.fields.description, 'status': issue.fields.status.name, 'resolution': resolution, 'labels': issue.fields.labels, 'reporter': reporter, 'assignee': assignee, 'created_at': issue.fields.created, 'updated_at': issue.fields.updated, 'resolved_at': issue.fields.resolutiondate } return result
{ "repo_name": "pinterb/st2contrib", "path": "packs/jira/actions/lib/formatters.py", "copies": "5", "size": "1035", "license": "apache-2.0", "hash": 240800907307637470, "line_mean": 23.0697674419, "line_max": 52, "alpha_frac": 0.5748792271, "autogenerated": false, "ratio": 3.791208791208791, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.6866088018308791, "avg_score": null, "num_lines": null }
__all__ = [ 'to_issue_dict', 'to_comment_dict' ] def to_issue_dict(issue): """ :rtype: ``dict`` """ split = issue.permalink().split(' - ', 1) url = split[0] if issue.fields.resolution: resolution = issue.fields.resolution.name else: resolution = None if issue.fields.reporter: reporter = issue.fields.reporter.displayName else: reporter = None if issue.fields.assignee: assignee = issue.fields.assignee.displayName else: assignee = None result = { 'id': issue.id, 'key': issue.key, 'url': url, 'summary': issue.fields.summary, 'description': issue.fields.description, 'status': issue.fields.status.name, 'resolution': resolution, 'labels': issue.fields.labels, 'reporter': reporter, 'assignee': assignee, 'created_at': issue.fields.created, 'updated_at': issue.fields.updated, 'resolved_at': issue.fields.resolutiondate } return result def to_comment_dict(comment): """ :rtype: ``dict`` """ result = { 'id': comment.id, 'body': comment.body } return result
{ "repo_name": "psychopenguin/st2contrib", "path": "packs/jira/actions/lib/formatters.py", "copies": "7", "size": "1221", "license": "apache-2.0", "hash": 4566777338414358000, "line_mean": 21.2, "line_max": 52, "alpha_frac": 0.5601965602, "autogenerated": false, "ratio": 3.7339449541284404, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.779414151432844, "avg_score": null, "num_lines": null }
__all__ = ( 'TokenList', ) import collections from .errors import TokenTypeError class TokenList(collections.Sized, collections.Iterable, collections.Container): def __init__(self, init=None, *, token_type=None): if token_type is None: token_type = object self._token_type = token_type self._tokens = collections.deque() if init: if not hasattr(init, '__iter__'): raise TypeError("invalid value {!r}: not an iterable".format(init)) for token in init: self.add(token) @property def token_type(self): return self._token_type def add(self, token, *, count=1): if not isinstance(token, self._token_type): raise TokenTypeError("invalid token {!r}: type is not {}".format(token, self._token_type.__name__)) for i in range(count): self._tokens.append(token) def pop(self): return self._tokens.popleft() def remove(self, token): for c, t in enumerate(self._tokens): if t is token: break else: return del self._tokens[c] #self._tokens.remove(token) def copy(self): return self.__class__(init=self, token_type=self.token_type) def __iter__(self): yield from self._tokens def __len__(self): return len(self._tokens) def clear(self): self._tokens.clear() def extend(self, values): if self._token_type is object: self._tokens.extend(values) else: for value in values: self.add(value) def __contains__(self, value): return value in self._tokens def __repr__(self): args = [] if self: args.append(repr(list(self._tokens))) if self._token_type is not object: args.append("token_type={}".format(self._token_type.__name__)) return "{}({})".format(self.__class__.__name__, ', '.join(args)) def __eq__(self, other): if isinstance(other, TokenList): if self._token_type != other.token_type: return False return self._tokens == other._tokens else: if len(self._tokens) != len(other): return False for a, b in zip(self._tokens, other): if a != b: return False return True
{ "repo_name": "simone-campagna/petra", "path": "petra/token_list.py", "copies": "1", "size": "2481", "license": "apache-2.0", "hash": 223850138077393380, "line_mean": 28.1882352941, "line_max": 111, "alpha_frac": 0.5272067715, "autogenerated": false, "ratio": 4.248287671232877, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.00609114015976761, "num_lines": 85 }
__all__ = [ 'TopoReader', 'GravObsReader', 'GravGradReader', 'MagObsReader', 'GeologyMapper', ] __displayname__ = 'General Tools' import numpy as np import pandas as pd import vtk from vtk.numpy_interface import dataset_adapter as dsa from .. import _helpers, interface from ..base import FilterPreserveTypeBase from ..readers import DelimitedPointsReaderBase ############################################################################### class TopoReader(DelimitedPointsReaderBase): """A reader to handle .topo files in UBC format to create a topography surface. """ __displayname__ = 'GIF Topo Reader' __category__ = 'reader' extensions = 'topo txt dat' description = 'PVGeo: UBC 3D Topo Files' def __init__(self, copy_z=True, **kwargs): DelimitedPointsReaderBase.__init__(self, copy_z=copy_z, **kwargs) self.set_has_titles(False) # kwargs.get('has_titles', False)) self.set_split_on_white_space(True) self.__3d = True # TODO: handle 2D topo files as well self.__npts = None # Simply override the extract titles functionality def _extract_header(self, content): """Internal helper to parse header details for UBC Topo files""" # No titles # Get number of points self.__npts = int(content[0].strip()) if len(content[1].split(self._get_delimiter())) != 3: raise _helpers.PVGeoError('Data improperly formatted') return ['X', 'Y', 'Z'], content[1::] ############################################################################### class GravObsReader(DelimitedPointsReaderBase): """Read `GIF Gravity Observations`_ file. .. _GIF Gravity Observations: https://giftoolscookbook.readthedocs.io/en/latest/content/fileFormats/gravfile.html """ __displayname__ = 'UBC Gravity Observations' __category__ = 'reader' extensions = 'grv txt dat' description = 'PVGeo: GIF Gravity Observations' def __init__(self, **kwargs): DelimitedPointsReaderBase.__init__(self, **kwargs) self.set_has_titles(False) self.set_split_on_white_space(True) self.__npts = None # Simply override the extract titles functionality def _extract_header(self, content): """Internal helper to parse header details for UBC Gravity Observation files""" # No titles # Get number of points self.__npts = int(content[0].strip()) # Now decide if it is single or multi component if len(content[1].split(self._get_delimiter())) != 5: raise _helpers.PVGeoError('Data improperly formatted') return ['X', 'Y', 'Z', 'Grav', 'Err'], content[1::] ############################################################################### class GravGradReader(DelimitedPointsReaderBase): """Read `GIF Gravity Gradiometry Observations`_ file. .. _GIF Gravity Gradiometry Observations: https://giftoolscookbook.readthedocs.io/en/latest/content/fileFormats/ggfile.html """ __displayname__ = 'GIF Gravity Gradiometry Observations' __category__ = 'reader' extensions = 'grv gg txt dat' description = 'PVGeo: GIF Gravity Gradiometry Observations' def __init__(self, **kwargs): DelimitedPointsReaderBase.__init__(self, **kwargs) self.set_has_titles(False) self.set_split_on_white_space(True) self.__npts = None # Simply override the extract titles functionality def _extract_header(self, content): """Internal helper to parse header details for UBC Gravity Gradiometry files""" # Get components comps = content[0].split('=')[1].split(',') # Get number of points self.__npts = int(content[1].strip()) titles = ['X', 'Y', 'Z'] for c in comps: titles.append(c) # Now decipher if it has stddevs num = len(content[2].split(self._get_delimiter())) if num != len(titles): if num != (len(titles) + len(comps)): raise _helpers.PVGeoError('Data improperly formatted') for c in comps: titles.append('Stn_%s' % c) return titles, content[2::] ############################################################################### class MagObsReader(DelimitedPointsReaderBase): """Read `GIF Magnetic Observations`_ file. .. _GIF Magnetic Observations: https://giftoolscookbook.readthedocs.io/en/latest/content/fileFormats/magfile.html """ __displayname__ = 'UBC Magnetic Observations' __category__ = 'reader' extensions = 'mag loc txt dat pre' description = 'PVGeo: GIF Magnetic Observations' def __init__(self, **kwargs): DelimitedPointsReaderBase.__init__(self, **kwargs) self.set_has_titles(False) self.set_split_on_white_space(True) self.__npts = None self.__incl = None self.__decl = None self.__geomag = None self.__ainc = None self.__adec = None self.__dir = None # Simply override the extract titles functionality def _extract_header(self, content): """Internal helper to parse header details for UBC Magnetic Observations files""" # No titles self.__incl, self.__decl, self.__geomag = ( float(val) for val in content[0].split(self._get_delimiter()) ) self.__ainc, self.__adec, self.__dir = ( float(val) for val in content[1].split(self._get_delimiter()) ) # Get number of points self.__npts = int(content[2].strip()) # Now decide if it is single or multi component row = content[3].split(self._get_delimiter()) num = len(row) if num == 3: # just locations self.set_copy_z(True) return ['X', 'Y', 'Z'], content[3::] elif num == 4: # single component return ['X', 'Y', 'Z', 'Mag'], content[3::] elif num == 5: # single component return ['X', 'Y', 'Z', 'Mag', 'Err'], content[3::] elif num == 7: # multi component return ['X', 'Y', 'Z', 'ainc_1', 'ainc_2', 'Mag', 'Err'], content[3::] else: raise _helpers.PVGeoError('Data improperly formatted.') @staticmethod def convert_vector(incl, decl, mag=1): """Converts inclination, declinations, and magntidue to an XYZ vector""" x = mag * np.cos(np.deg2rad(incl)) * np.cos(np.deg2rad(decl)) y = mag * np.cos(np.deg2rad(incl)) * np.sin(np.deg2rad(decl)) z = mag * np.sin(np.deg2rad(incl)) return (x, y, z) def RequestData(self, request, inInfo, outInfo): """Used by pipeline to get data for current timestep and populate the output data object. """ # Set points using parent DelimitedPointsReaderBase.RequestData(self, request, inInfo, outInfo) # Add field data to ouptput output = self.GetOutputData(outInfo, 0) # Add inducing magnetic field x, y, z = self.convert_vector(self.__incl, self.__decl, mag=self.__geomag) ind = vtk.vtkDoubleArray() ind.SetName('Inducing Magnetic Field') ind.SetNumberOfComponents(3) ind.InsertNextTuple3(x, y, z) output.GetFieldData().AddArray(ind) # Add Inclination and declination of the anomaly projection x, y, z = self.convert_vector(self.__ainc, self.__adec) anom = vtk.vtkDoubleArray() anom.SetName('Anomaly Projection') anom.SetNumberOfComponents(3) anom.InsertNextTuple3(x, y, z) output.GetFieldData().AddArray(anom) return 1 ############################################################################### class GeologyMapper(FilterPreserveTypeBase): """A filter to load a GIF geology definity file and map its values to a given data array in an input data object. """ __displayname__ = 'UBC Geology Mapper' __category__ = 'filter' description = 'PVGeo: UBC Geology Mapper' def __init__(self, filename=None, delimiter=',', **kwargs): FilterPreserveTypeBase.__init__(self, **kwargs) self.__filename = filename self.__deli = delimiter self.__input_array = [None, None] @staticmethod def _read_definitions(filename, delimiter): """Reades the geology definition file as a pandas DataFrame""" return pd.read_csv(filename, sep=delimiter) @staticmethod def _map_values(geol, arr): """Map the values defined by ``geol`` dataframe to the values in ``arr``. The first column (name should be ``Index``) will be used for the mapping. """ # TODO: check that geol table contains all indexs found in arr # Return the mapped table geol.set_index(geol.keys()[0]) return geol[geol.keys()[1::]].iloc[arr] def RequestData(self, request, inInfo, outInfo): """Used by pipeline to generate output""" # Get input/output of Proxy pdi = self.GetInputData(inInfo, 0, 0) pdo = self.GetOutputData(outInfo, 0) # Get input array field, name = self.__input_array[0], self.__input_array[1] # self.__range = NormalizeArray.get_array_range(pdi, field, name) wpdi = dsa.WrapDataObject(pdi) arr = _helpers.get_numpy_array(wpdi, field, name) #### Perfrom task #### geol = self._read_definitions(self.__filename, self.__deli) data = self._map_values(geol, arr) pdo.DeepCopy(pdi) interface.add_arrays_from_data_frame(pdo, field, data) return 1 #### Seters and Geters #### def SetInputArrayToProcess(self, idx, port, connection, field, name): """Used to set the input array(s) Args: idx (int): the index of the array to process port (int): input port (use 0 if unsure) connection (int): the connection on the port (use 0 if unsure) field (int): the array field (0 for points, 1 for cells, 2 for field, and 6 for row) name (int): the name of the array """ if self.__input_array[0] != field: self.__input_array[0] = field self.Modified() if self.__input_array[1] != name: self.__input_array[1] = name self.Modified() return 1 def SetFileName(self, filename): """Set the file name to read""" if self.__filename != filename: self.__filename = filename self.Modified() def set_file_name(self, filename): """Set the file name to read""" return self.SetFileName(filename) def set_delimiter(self, deli): """Set the delimiter of the ASCII file""" if self.__deli != deli: self.__deli = deli self.Modified()
{ "repo_name": "banesullivan/ParaViewGeophysics", "path": "PVGeo/ubc/general.py", "copies": "1", "size": "10897", "license": "bsd-3-clause", "hash": 6850066694521328000, "line_mean": 34.8453947368, "line_max": 127, "alpha_frac": 0.5795172983, "autogenerated": false, "ratio": 3.875177809388336, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9951839140147563, "avg_score": 0.0005711935081546725, "num_lines": 304 }
__all__ = ( 'translate_to_snakes', ) from petra.annotation import Vars, InputFlush, Test, Inhibitor, OutputFlush, Expr from petra.errors import TranslationError import snakes.nets as snakes_module def _input_annotation_to_snakes(snakes, annotation): if isinstance(annotation, Inhibitor): return snakes.Inhibitor() elif isinstance(annotation, InputFlush): return snakes.Flush(_input_annotation_to_snakes(snakes, annotation.wrapped_annotation)) elif isinstance(annotation, Test): return snakes.Test(_input_annotation_to_snakes(snakes, annotation.wrapped_annotation)) elif isinstance(annotation, Vars): variables = annotation.variables() if len(variables) > 1: return snakes.MultiArc([snakes.Variable(var) for var in variables]) else: return snakes.Variable(variables[0]) else: raise TranslationError("cannot translate {!r} to snakes".format(annotation)) def _output_annotation_to_snakes(snakes, annotation): if isinstance(annotation, Expr): return snakes.Expression(str(annotation.expression)) elif isinstance(annotation, OutputFlush): return snakes.Flush(_output_annotation_to_snakes(snakes, annotation.wrapped_annotation)) else: raise TranslationError("cannot translate {!r} to snakes".format(annotation)) def translate_to_snakes(net, snakes=None): if snakes is None: snakes = snakes_module s_net = snakes.PetriNet(net.name) ### add places: for place in net.places(): s_net.add_place(snakes.Place(place.name, tuple(place.tokens))) ### add transitions and arcs: for transition in net.transitions(): transition_guards = [] for input_arc in transition.input_arcs(): annotation = input_arc.annotation guard = getattr(annotation, 'guard', None) if guard is not None: transition_guards.append(guard) if hasattr(transition, 'guard'): guard = getattr(transition, 'guard', None) if guard is not None: transition_guards.append(guard) if transition_guards: s_guard = snakes.Expression(str(transition_guards[0])) for guard in transition_guards[1:]: s_guard = s_guard & snakes.Expression(str(guard)) else: s_guard = None # add transition: s_net.add_transition(snakes.Transition(transition.name, s_guard)) # add input arcs: for arc in transition.input_arcs(): s_net.add_input(arc.source.name, arc.target.name, _input_annotation_to_snakes(snakes, arc.annotation)) # add output arcs: for arc in transition.output_arcs(): s_net.add_output(arc.target.name, arc.source.name, _output_annotation_to_snakes(snakes, arc.annotation)) return s_net
{ "repo_name": "simone-campagna/petra", "path": "petra/utils/translate.py", "copies": "1", "size": "2917", "license": "apache-2.0", "hash": 2157462448963947500, "line_mean": 37.3815789474, "line_max": 116, "alpha_frac": 0.6465546795, "autogenerated": false, "ratio": 3.920698924731183, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.004951327673780312, "num_lines": 76 }
__all__ = ['ntriples_parser', 'nquads_parser', 'turtle_parser'] from collections import defaultdict, namedtuple, OrderedDict from lepl import * from lxml import etree import re from threading import local from urlparse import urljoin from pymantic.util import normalize_iri import pymantic.primitives def discrete_pairs(iterable): "s -> (s0,s1), (s2,s3), (s4, s5), ..." previous = None for v in iterable: if previous is None: previous = v else: yield (previous, v) previous = None unicode_re = re.compile(r'\\u([0-9A-Za-z]{4})|\\U([0-9A-Za-z]{8})') def nt_unescape(nt_string): """Un-do nt escaping style.""" output_string = u'' nt_string = nt_string.decode('utf-8') nt_string = nt_string.replace('\\t', u'\u0009') nt_string = nt_string.replace('\\n', u'\u000A') nt_string = nt_string.replace('\\r', u'\u000D') nt_string = nt_string.replace('\\"', u'\u0022') nt_string = nt_string.replace('\\\\', u'\u005C') def chr_match(matchobj): ordinal = matchobj.group(1) or matchobj.group(2) return unichr(int(ordinal, 16)) nt_string = unicode_re.sub(chr_match, nt_string) return nt_string class BaseLeplParser(object): def __init__(self, environment=None): self.env = environment or pymantic.primitives.RDFEnvironment() self.profile = self.env.createProfile() self._call_state = local() def make_datatype_literal(self, values): return self.env.createLiteral(value = values[0], datatype = values[1]) def make_language_literal(self, values): if len(values) == 2: return self.env.createLiteral(value = values[0], language = values[1]) else: return self.env.createLiteral(value = values[0]) def make_named_node(self, values): return self.env.createNamedNode(normalize_iri(values[0])) def make_blank_node(self, values): if values[0] not in self._call_state.bnodes: self._call_state.bnodes[values[0]] = self.env.createBlankNode() return self._call_state.bnodes[values[0]] def _prepare_parse(self, graph): self._call_state.bnodes = defaultdict(self.env.createBlankNode) self._call_state.graph = graph def _cleanup_parse(self): del self._call_state.bnodes del self._call_state.graph def _make_graph(self): return self.env.createGraph() def parse(self, f, sink = None): if sink is None: sink = self._make_graph() self._prepare_parse(sink) self.document.parse_file(f) self._cleanup_parse() return sink def parse_string(self, string, sink = None): if sink is None: sink = self._make_graph() self._prepare_parse(sink) self.document.parse(string) self._cleanup_parse() return sink class BaseNParser(BaseLeplParser): """Base parser that establishes common grammar rules and interfaces used for parsing both n-triples and n-quads.""" def __init__(self, environment=None): super(BaseNParser, self).__init__(environment) self.string = Regexp(r'(?:[ -!#-[\]-~]|\\[trn"\\]|\\u[0-9A-Fa-f]{4}|\\U[0-9A-Fa-f]{8})*') self.name = Regexp(r'[A-Za-z][A-Za-z0-9]*') self.absoluteURI = Regexp(r'(?:[ -=?-[\]-~]|\\[trn"\\]|\\u[0-9A-Fa-f]{4}|\\U[0-9A-Fa-f]{8})+') self.language = Regexp(r'[a-z]+(?:-[a-zA-Z0-9]+)*') self.uriref = ~Literal('<') & self.absoluteURI & ~Literal('>') \ > self.make_named_node self.datatypeString = ~Literal('"') & self.string & ~Literal('"') \ & ~Literal('^^') & self.uriref > self.make_datatype_literal self.langString = ~Literal('"') & self.string & ~Literal('"') \ & Optional(~Literal('@') & self.language) > self.make_language_literal self.literal = self.datatypeString | self.langString self.nodeID = ~Literal('_:') & self.name > self.make_blank_node self.object_ = self.uriref | self.nodeID | self.literal self.predicate = self.uriref self.subject = self.uriref | self.nodeID self.comment = Literal('#') & Regexp(r'[ -~]*') def make_named_node(self, values): return self.env.createNamedNode(normalize_iri(nt_unescape(values[0]))) def make_language_literal(self, values): if len(values) == 2: return self.env.createLiteral(value = nt_unescape(values[0]), language = values[1]) else: return self.env.createLiteral(value = nt_unescape(values[0])) class NTriplesParser(BaseNParser): def make_triple(self, values): triple = self.env.createTriple(*values) self._call_state.graph.add(triple) return triple def __init__(self, environment=None): super(NTriplesParser, self).__init__(environment) self.triple = self.subject & ~Plus(Space()) & self.predicate & \ ~Plus(Space()) & self.object_ & ~Star(Space()) & ~Literal('.') \ & ~Star(Space()) >= self.make_triple self.line = Star(Space()) & Optional(~self.triple | ~self.comment) & \ ~Literal('\n') self.document = Star(self.line) def _make_graph(self): return self.env.createGraph() def parse(self, f, graph=None): return super(NTriplesParser, self).parse(f, graph) ntriples_parser = NTriplesParser() class NQuadsParser(BaseNParser): def make_quad(self, values): quad = self.env.createQuad(*values) self._call_state.graph.add(quad) return quad def __init__(self, environment=None): super(NQuadsParser, self).__init__(environment) self.graph_name = self.uriref self.quad = self.subject & ~Plus(Space()) & self.predicate \ & ~Plus(Space()) & self.object_ & ~Plus(Space()) & self.graph_name \ & ~Star(Space()) & ~Literal('.') & ~Star(Space()) >= self.make_quad self.line = Star(Space()) & Optional(~self.quad | ~self.comment) \ & ~Literal('\n') self.document = Star(self.line) def _make_graph(self): return self.env.createDataset() def parse(self, f, dataset=None): return super(NQuadsParser, self).parse(f, dataset) nquads_parser = NQuadsParser() class ClassicTurtleParser(BaseLeplParser): def __init__(self, environment=None): super(ClassicTurtleParser, self).__init__(environment) self.absolute_uri_re = re.compile('^[^/]+:') # White space is significant in the following rules. hex_ = Any('0123456789ABCDEF') character_escape = Or(And(Literal('r\u'), hex_[4]), And(Literal(r'\U'), hex_[8]), Literal(r'\\')) character = Or(character_escape, Regexp(ur'[\u0020-\u005B\]-\U0010FFFF]')) echaracter = character | Any('\t\n\r') ucharacter = Or(character_escape, Regexp(ur'[\u0020-\u003D\u003F-\u005B\]-\U0010FFFF]')) | r'\>' scharacter = Or(character_escape, Regexp(ur'[\u0020-\u0021\u0023-\u005B\]-\U0010FFFF]')) | r'\"' lcharacter = echaracter | '\"' | '\u009' | '\u000A' | '\u000D' longString = ~Literal('"""') & lcharacter[:,...] & ~Literal('"""') string = ~Literal('"') & scharacter[:,...] & ~Literal('"') quotedString = longString | string > 'quotedString' relativeURI = ucharacter[...] prefixStartChar = Regexp(ur'[A-Z]') | Regexp(ur'[a-z]') | Regexp(ur'[\u00C0-\u00D6]') | Regexp(ur'[\u00D8-\u00F6]') | Regexp(ur'[\u00F8-\u02FF]') | Regexp(ur'[\u0370-\u037D]') | Regexp(ur'[\u037F-\u1FFF]') | Regexp(ur'[\u200C-\u200D]') | Regexp(ur'[\u2070-\u218F]') | Regexp(ur'[\u2C00-\u2FEF]') | Regexp(ur'[\u3001-\uD7FF]') | Regexp(ur'[\uF900-\uFDCF]') | Regexp(ur'[\uFDF0-\uFFFD]') | Regexp(ur'[\U00010000-\U000EFFFF]') nameStartChar = prefixStartChar | "_" nameChar = nameStartChar | '-' | Regexp(ur'[0-9]') | '\u00B7' | Regexp(ur'[\u0300-\u036F]') | Regexp(ur'[\u203F-\u2040]') name = (nameStartChar & nameChar[:])[...] > 'name' prefixName = (prefixStartChar & nameChar[:])[...] > 'prefixName' language = Regexp(r'[a-z]+ (?:-[a-z0-9]+)*') > 'language' qname = ((Optional(prefixName) & ~Literal(':') & Optional(name) > dict) > self.resolve_prefix) > 'qname' nodeID = ~Literal('_:') & name > self.make_blank_node self.comment = '#' & Regexp(r'[^\n\r]*') & Newline() # Whie space is not significant in the following rules. with Separator(~Star(Any(' \t\n\r'))): uriref = (And(~Literal('<'), relativeURI, ~Literal('>')) > self.resolve_relative_uri) > 'uriref' resource = (uriref | qname > dict) > self.make_named_node self.ws = ws = ~Whitespace() | ~self.comment blank = Delayed() integer = Regexp(r'(?:-|\+)?[0-9]+') > self.make_integer_literal decimal = Regexp(r'(?:-|\+)?(?:[0-9]+\.[0-9]*|\.(?:[0-9])+)') > self.make_decimal_literal exponent = r'[eE](?:-|\+)?[0-9]+' double = Regexp(r'(?:-|\+)?(?:[0-9]+\.[0-9]*' + exponent + r'|\.[0-9]+' + exponent + r'|[0-9]+' + exponent + ')') > self.make_double_literal boolean = Literal('true') | Literal('false') > self.make_boolean_literal datatypeString = quotedString & "^^" & (resource > 'dataType') > self.make_datatype_literal literal = Or ( datatypeString, quotedString & Optional(~Literal('@') & language) > self.make_language_literal, double, decimal, integer, boolean ) object_ = resource | blank | literal predicate = resource subject = resource | blank > 'subject' verb = predicate | Literal('a') > 'predicate' collection = ~Literal('(') & object_[:] & ~Literal(')') > self.make_collection objectList = (object_ & (~Literal(',') & object_)[:] > List) > 'objectList' predicateObjectList = ((verb & objectList > Node) & (~Literal(';') & (verb & objectList > Node))[:] & ~Optional(';') > List) > 'predicateObjectList' blank += Or (nodeID, collection, (~Literal('[') & ~Literal(']') > self.make_triples), (~Literal('[') & predicateObjectList & ~Literal(']') > self.make_triples) ) triples = subject & predicateObjectList > self.make_triples base = (~Literal('@base') & Plus(ws) & uriref > dict) > self.record_base prefixId = (~Literal('@prefix') & Plus(ws) & Optional(prefixName) & ~Literal(':') & uriref > dict) > self.record_prefix directive = prefixId | base statement = Or (directive & '.', triples & '.', Plus(ws)) self.document = Star(statement) def _prepare_parse(self, graph): super(TurtleParser, self)._prepare_parse(graph) self._call_state.prefixes = self.env.createPrefixMap(empty=True) self._call_state.base_uri = None def record_base(self, values): self._call_state.base_uri = values[0]['uriref'] return '' def record_prefix(self, values): prefix = values[0] self._call_state.prefixes[prefix.get('prefixName', '')] = prefix['uriref'] return '' def resolve_relative_uri(self, values): relative_uri = values[0] if self.absolute_uri_re.match(relative_uri): return relative_uri else: return self._call_state.base_uri + relative_uri def resolve_prefix(self, values): qname = values[0] return self._call_state.prefixes[qname.get('prefixName', '')] + qname.get('name', '') def make_named_node(self, values): resource = values[0] return super(TurtleParser, self).make_named_node( (resource.get('uriref') or resource.get('qname'),)) def make_triples(self, values): triples = dict(values) subject = triples.get('subject') if not subject: subject = self.env.createBlankNode() for predicate_object_node in triples.get('predicateObjectList', ()): predicate = predicate_object_node.predicate[0] for object_ in predicate_object_node.objectList[0]: self._call_state.graph.add(self.env.createTriple(subject, predicate, object_)) return subject def make_collection(self, values): prior = self.env.resolve('rdf:nil') for element in reversed(values): this = self.env.createBlankNode() self._call_state.graph.add(self.env.createTriple( subject=this, predicate=self.env.resolve('rdf:first'), object=element)) self._call_state.graph.add(self.env.createTriple( subject=this, predicate=self.env.resolve('rdf:rest'), object=prior)) prior = this return prior def _make_graph(self): return self.env.createGraph() def make_datatype_literal(self, values): datatyped = dict(values) return self.env.createLiteral(datatyped['quotedString'], datatype = datatyped['dataType']) def make_integer_literal(self, values): return self.env.createLiteral(values[0], datatype = self.env.resolve('xsd:integer')) def make_decimal_literal(self, values): return self.env.createLiteral(values[0], datatype = self.env.resolve('xsd:decimal')) def make_double_literal(self, values): return self.env.createLiteral(values[0], datatype = self.env.resolve('xsd:double')) def make_boolean_literal(self, values): return self.env.createLiteral(values[0], datatype = self.env.resolve('xsd:boolean')) def make_language_literal(self, values): languageable = dict(values) return self.env.createLiteral(languageable['quotedString'], language = languageable.get('language')) classic_turtle_parser = ClassicTurtleParser() TriplesClause = namedtuple('TriplesClause', ['subject', 'predicate_objects']) PredicateObject = namedtuple('PredicateObject', ['predicate', 'object']) BindPrefix = namedtuple('BindPrefix', ['prefix', 'iri']) SetBase = namedtuple('SetBase', ['iri']) NamedNodeToBe = namedtuple('NamedNodeToBe', ['iri']) LiteralToBe = namedtuple('LiteralToBe', ['value', 'datatype', 'language']) PrefixReference = namedtuple('PrefixReference', ['prefix', 'local']) class TurtleParser(BaseLeplParser): """Parser for turtle as described at: http://dvcs.w3.org/hg/rdf/raw-file/e8b1d7283925/rdf-turtle/index.html""" RDF_TYPE = 'http://www.w3.org/1999/02/22-rdf-syntax-ns#type' echar_map = OrderedDict(( ('\\', '\\'), ('t', '\t'), ('b', '\b'), ('n', '\n'), ('r', '\r'), ('f', '\f'), ('"', '"'), ("'", "'"), )) def __init__(self, environment=None): super(TurtleParser, self).__init__(environment) UCHAR = (Regexp(ur'\\u([0-9a-fA-F]{4})') |\ Regexp(ur'\\U([0-9a-fA-F]{8})')) >> self.decode_uchar ECHAR = Regexp(ur'\\([tbnrf\\"\'])') >> self.decode_echar PN_CHARS_BASE = Regexp(ur'[A-Za-z\u00C0-\u00D6\u00D8-\u00F6\u00F8-\u02FF' ur'\u0370-\u037D\u037F-\u1FFF\u200C-\u200D\u2070-\u218F' ur'\u2C00-\u2FEF\u3001-\uD7FF\uF900-\uFDCF\uFDF0-\uFFFD' ur'\U00010000-\U000EFFFF]') | UCHAR PN_CHARS_U = PN_CHARS_BASE | Literal('_') PN_CHARS = PN_CHARS_U | Regexp(ur'[\-0-9\u00B7\u0300-\u036F\u203F-\u2040]') PN_PREFIX = PN_CHARS_BASE & Optional(Star(PN_CHARS | Literal(".")) & PN_CHARS ) > ''.join PN_LOCAL = (PN_CHARS_U | Regexp('[0-9]')) & Optional(Star(PN_CHARS | Literal(".")) & PN_CHARS) > ''.join WS = Regexp(ur'[\t\n\r ]') ANON = ~(Literal('[') & Star(WS) & Literal(']')) NIL = Literal('(') & Star(WS) & Literal(')') STRING_LITERAL1 = (Literal("'") &\ Star(Regexp(ur"[^'\\\n\r]") | ECHAR | UCHAR ) &\ Literal("'")) > self.string_contents STRING_LITERAL2 = (Literal('"') &\ Star(Regexp(ur'[^"\\\n\r]') | ECHAR | UCHAR ) &\ Literal('"')) > self.string_contents STRING_LITERAL_LONG1 = (Literal("'''") &\ Star(Optional( Regexp("'|''")) &\ ( Regexp(ur"[^'\\]") | ECHAR | UCHAR ) ) &\ Literal("'''")) > self.string_contents STRING_LITERAL_LONG2 = (Literal('"""') &\ Star(Optional( Regexp(ur'"|""') ) &\ ( Regexp(ur'[^\"\\]') | ECHAR | UCHAR ) ) &\ Literal('"""')) > self.string_contents INTEGER = Regexp(ur'[+-]?[0-9]+') DECIMAL = Regexp(ur'[+-]?(?:[0-9]+\.[0-9]+|\.[0-9]+)') DOUBLE = Regexp(ur'[+-]?(?:[0-9]+\.[0-9]+|\.[0-9]+|[0-9]+)[eE][+-]?[0-9]+') IRI_REF = (~Literal('<') & (Star(Regexp(ur'[^<>"{}|^`\\\u0000-\u0020]') | UCHAR | ECHAR) > ''.join) & ~Literal('>')) PNAME_NS = Optional(PN_PREFIX) & Literal(":") PNAME_LN = PNAME_NS & PN_LOCAL BLANK_NODE_LABEL = ~Literal("_:") & PN_LOCAL LANGTAG = ~Literal("@") & (Literal('base') | Literal('prefix') |\ Regexp(ur'[a-zA-Z]+(?:-[a-zA-Z0-9]+)*')) intertoken = ~Regexp(ur'[ \t\r\n]+|#[^\r\n]+')[:] with Separator(intertoken): BlankNode = (BLANK_NODE_LABEL >> self.create_blank_node) |\ (ANON > self.create_anon_node) prefixID = (~Literal('@prefix') & PNAME_NS & IRI_REF) > self.bind_prefixed_name base = (~Literal('@base') & IRI_REF) >> self.set_base PrefixedName = (PNAME_LN | PNAME_NS) > self.resolve_prefixed_name IRIref = PrefixedName | (IRI_REF >> self.create_named_node) BooleanLiteral = (Literal('true') | Literal('false')) >> self.boolean_value String = STRING_LITERAL1 | STRING_LITERAL2 | STRING_LITERAL_LONG1 | STRING_LITERAL_LONG2 RDFLiteral = ((String & LANGTAG) > self.langtag_string) |\ ((String & ~Literal('^^') & IRIref) > self.typed_string) |\ (String > self.bare_string) literal = RDFLiteral | (INTEGER >> self.int_value) |\ (DECIMAL >> self.decimal_value) |\ (DOUBLE >> self.double_value) | BooleanLiteral object = Delayed() predicateObjectList = Delayed() blankNodePropertyList = ~Literal('[') & predicateObjectList & ~Literal(']') > self.make_blank_node_property_list collection = (~Literal('(') & object[:] & ~Literal(')')) > self.make_collection blank = BlankNode | blankNodePropertyList | collection subject = IRIref | blank predicate = IRIref object += IRIref | blank | literal verb = predicate | (~Literal('a') > self.create_rdf_type) objectList = ((object & (~Literal(',') & object)[:]) | object) > self.make_object predicateObjectList += ((verb & objectList &\ (~Literal(';') & Optional(verb & objectList))[:]) |\ (verb & objectList)) > self.make_object_list triples = (subject & predicateObjectList) > self.make_triples directive = prefixID | base statement = (directive | triples) & ~Literal('.') self.turtle_doc = intertoken & statement[:] & intertoken & Eos() self.turtle_doc.config.clear() def _prepare_parse(self, graph): super(TurtleParser, self)._prepare_parse(graph) self._call_state.base_iri = self._base self._call_state.prefixes = {} self._call_state.current_subject = None self._call_state.current_predicate = None def decode_uchar(self, uchar_string): return unichr(int(uchar_string, 16)) def decode_echar(self, echar_string): return self.echar_map[echar_string] def string_contents(self, string_chars): return ''.join(string_chars[1:-1]) def int_value(self, value): return LiteralToBe(value, language=None, datatype=NamedNodeToBe(self.profile.resolve('xsd:integer'))) def decimal_value(self, value): return LiteralToBe(value, language=None, datatype=NamedNodeToBe(self.profile.resolve('xsd:decimal'))) def double_value(self, value): return LiteralToBe(value, language=None, datatype=NamedNodeToBe(self.profile.resolve('xsd:double'))) def boolean_value(self, value): return LiteralToBe(value, language=None, datatype=NamedNodeToBe(self.profile.resolve('xsd:boolean'))) def langtag_string(self, values): return LiteralToBe(values[0], language=values[1], datatype=None) def typed_string(self, values): return LiteralToBe(values[0], language=None, datatype=values[1]) def bare_string(self, values): return LiteralToBe(values[0], language=None, datatype=NamedNodeToBe(self.profile.resolve('xsd:string'))) def create_named_node(self, iri): return NamedNodeToBe(iri) def create_blank_node(self, name=None): if name is None: return self.env.createBlankNode() return self._call_state.bnodes[name] def create_anon_node(self, anon_tokens): return self.env.createBlankNode() def create_rdf_type(self, values): return self.profile.resolve('rdf:type') def resolve_prefixed_name(self, values): if values[0] == ':': pname = '' local = values[1] if len(values) == 2 else '' elif values[-1] == ':': pname = values[0] local = '' else: pname = values[0] local = values[2] return NamedNodeToBe(PrefixReference(pname, local)) def bind_prefixed_name(self, values): iri = values.pop() assert values.pop() == ':' pname = values.pop() if values else '' return BindPrefix(pname, iri) def set_base(self, base_iri): return SetBase(base_iri) def make_object(self, values): return values def make_object_list(self, values): return list(discrete_pairs(values)) def make_blank_node_property_list(self, values): subject = self.env.createBlankNode() predicate_objects = [] for predicate, objects in values[0]: for obj in objects: predicate_objects.append(PredicateObject(predicate, obj)) return TriplesClause(subject, predicate_objects) def make_triples(self, values): subject = values[0] predicate_objects = [PredicateObject(predicate, obj) for predicate, objects in values[1] for obj in objects] return TriplesClause(subject, predicate_objects) def make_collection(self, values): prev_node = TriplesClause(self.profile.resolve('rdf:nil'), []) for value in reversed(values): prev_node = TriplesClause( self.env.createBlankNode(), [PredicateObject(self.profile.resolve('rdf:first'), value), PredicateObject(self.profile.resolve('rdf:rest'), prev_node)]) return prev_node def _interpret_parse(self, data, sink): for line in data: if isinstance(line, BindPrefix): self._call_state.prefixes[line.prefix] = urljoin( self._call_state.base_iri, line.iri, allow_fragments=False) elif isinstance(line, SetBase): self._call_state.base_iri = urljoin( self._call_state.base_iri, line.iri, allow_fragments=False) else: self._interpret_triples_clause(line) def _interpret_triples_clause(self, triples_clause): assert isinstance(triples_clause, TriplesClause) subject = self._resolve_node(triples_clause.subject) for predicate_object in triples_clause.predicate_objects: self._call_state.graph.add(self.env.createTriple( subject, self._resolve_node(predicate_object.predicate), self._resolve_node(predicate_object.object))) return subject def _resolve_node(self, node): if isinstance(node, NamedNodeToBe): if isinstance(node.iri, PrefixReference): return self.env.createNamedNode( self._call_state.prefixes[node.iri.prefix] + node.iri.local) else: return self.env.createNamedNode( urljoin(self._call_state.base_iri, node.iri, allow_fragments=False)) elif isinstance(node, TriplesClause): return self._interpret_triples_clause(node) elif isinstance(node, LiteralToBe): if node.datatype: return self.env.createLiteral( node.value, datatype=self._resolve_node(node.datatype)) else: return self.env.createLiteral(node.value, language=node.language) else: return node def parse(self, data, sink = None, base = ''): if sink is None: sink = self._make_graph() self._base = base self._prepare_parse(sink) self._interpret_parse(self.turtle_doc.parse(data), sink) self._cleanup_parse() return sink def parse_string(self, string, sink = None): return self.parse(string, sink) turtle_parser = TurtleParser() scheme_re = re.compile(r'[a-zA-Z](?:[a-zA-Z0-9]|\+|-|\.)*') class RDFXMLParser(object): RDF_TYPE = 'http://www.w3.org/1999/02/22-rdf-syntax-ns#type' def __init__(self): self.namespaces = {'rdf': 'http://www.w3.org/1999/02/22-rdf-syntax-ns#',} self._call_state = local() def clark(self, prefix, tag): return '{%s}%s' % (self.namespaces[prefix], tag) def parse(self, f, sink = None): self._call_state.bnodes = {} tree = etree.parse(f) if tree.getroot() != self.clark('rdf', 'RDF'): raise ValueError('Invalid XML document.') for element in tree.getroot(): self._handle_resource(element, sink) def _handle_resource(self, element, sink): from pymantic.primitives import BlankNode, NamedNode, Triple subject = self._determine_subject(element) if element.tag != self.clark('rdf', 'Description'): resource_class = self._resolve_tag(element) sink.add(Triple(subject, NamedNode(self.RDF_TYPE), resource_class)) for property_element in element: if property_element.tag == self.clark('rdf', 'li'): pass else: predicate = self._resolve_tag(property_element) if self.clark('rdf', 'resource') in property_element.attrib: object_ = self._resolve_uri( property_element, property_element.attrib[self.clark( 'rdf', 'resource')]) sink.add(Triple(subject, NamedNode(predicate), NamedNode(object_))) return subject def _resolve_tag(self, element): if element.tag[0] == '{': tag_bits = element[1:].partition('}') return NamedNode(tag_bits[0] + tag_bits[2]) else: return NamedNode(urljoin(element.base, element.tag)) def _determine_subject(self, element): if self.clark('rdf', 'about') not in element.attrib and\ self.clark('rdf', 'nodeID') not in element.attrib and\ self.clark('rdf', 'ID') not in element.attrib: return BlankNode() elif self.clark('rdf', 'nodeID') in element.attrib: node_id = element.attrib[self.clark('rdf', 'nodeID')] if node_id not in self._call_state.bnodes: self._call_state.bnodes[node_id] = BlankNode() return self._call_state.bnodes[node_id] elif self.clark('rdf', 'ID') in element.attrib: if not element.base: raise ValueError('No XML base for %r', element) return NamedNode(element.base + '#' +\ element.attrib[self.clark('rdf', 'ID')]) elif self.clark('rdf', 'about') in element.attrib: return self._resolve_uri(element, element.attrib[ self.clark('rdf', 'resource')]) def _resolve_uri(self, element, uri): if not scheme_re.match(uri): return NamedNode(urljoin(element.base, uri)) else: return NamedNode(uri)
{ "repo_name": "SYSTAP/blazegraph-python", "path": "pymantic/parsers.py", "copies": "4", "size": "29945", "license": "bsd-3-clause", "hash": -5999987292491661000, "line_mean": 41.3550212164, "line_max": 431, "alpha_frac": 0.5500417432, "autogenerated": false, "ratio": 3.7525062656641603, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.021410086282355204, "num_lines": 707 }
__all__ = [ "xlfunc", "xlret", "xlarg", "xlsub" ] def xlfunc(f = None, **kwargs): def inner(f): if not hasattr(f, "__xlfunc__"): xlf = f.__xlfunc__ = {} xlf = f.__xlfunc__ = {} xlf["name"] = f.__name__ xlf["sub"] = False xlf["xlwings"] = kwargs.get("xlwings", None) xlargs = xlf["args"] = [] xlargmap = xlf["argmap"] = {} nArgs = f.__code__.co_argcount if f.__code__.co_flags & 4: # function has an '*args' argument nArgs += 1 for vpos, vname in enumerate(f.__code__.co_varnames[:nArgs]): xlargs.append({ "name": vname, "pos": vpos, "marshal": "var", "vba": None, "range": False, "dtype": None, "dims": -1, "doc": "Positional argument " + str(vpos+1), "vararg": True if vpos == f.__code__.co_argcount else False }) xlargmap[vname] = xlargs[-1] xlf["ret"] = { "marshal": "var", "lax": True, "doc": f.__doc__ if f.__doc__ is not None else "Python function '" + f.__name__ + "' defined in '" + str(f.__code__.co_filename) + "'." } return f if f is None: return inner else: return inner(f) def xlsub(f = None, **kwargs): def inner(f): f = xlfunc(**kwargs)(f) f.__xlfunc__["sub"] = True return f if f is None: return inner else: return inner(f) xlretparams = set(("marshal", "lax", "doc")) def xlret(marshal=None, **kwargs): if marshal is not None: kwargs["marshal"] = marshal def inner(f): xlf = xlfunc(f).__xlfunc__ xlr = xlf["ret"] for k, v in kwargs.items(): if k in xlretparams: xlr[k] = v else: raise Exception("Invalid parameter '" + k + "'.") return f return inner xlargparams = set(("marshal", "dims", "dtype", "range", "doc", "vba")) def xlarg(arg, marshal=None, dims=None, **kwargs): if marshal is not None: kwargs["marshal"] = marshal if dims is not None: kwargs["dims"] = dims def inner(f): xlf = xlfunc(f).__xlfunc__ if arg not in xlf["argmap"]: raise Exception("Invalid argument name '" + arg + "'.") xla = xlf["argmap"][arg] for k, v in kwargs.items(): if k in xlargparams: xla[k] = v else: raise Exception("Invalid parameter '" + k + "'.") return f return inner udf_scripts = {} def udf_script(filename): import os.path filename = filename.lower() mtime = os.path.getmtime(filename) if filename in udf_scripts: mtime2, vars = udf_scripts[filename] if mtime == mtime2: return vars vars = {} with open(filename, "r") as f: exec(compile(f.read(), filename, "exec"), vars) udf_scripts[filename] = (mtime, vars) return vars
{ "repo_name": "Tusky/excelpython", "path": "addin/xlpython/__init__.py", "copies": "3", "size": "2555", "license": "bsd-2-clause", "hash": 174530615854132060, "line_mean": 24.0588235294, "line_max": 139, "alpha_frac": 0.5800391389, "autogenerated": false, "ratio": 2.642192347466391, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.47222314863663917, "avg_score": null, "num_lines": null }
__all__ = [ 'ubcMeshReaderBase', 'ModelAppenderBase', ] __displayname__ = 'Base Classes' # Outside Imports: import os import numpy as np import vtk from .. import _helpers, base ############################################################################### # UBC Mesh Reader Base class ubcMeshReaderBase(base.TwoFileReaderBase): """A base class for the UBC mesh readers""" __displayname__ = 'UBC Mesh Reader Base' __category__ = 'base' extensions = 'mesh msh dat txt text' def __init__(self, nOutputPorts=1, outputType='vtkUnstructuredGrid', **kwargs): base.TwoFileReaderBase.__init__( self, nOutputPorts=nOutputPorts, outputType=outputType, **kwargs ) self.__data_name = 'Data' self.__use_filename = True # flag on whether or not to use the model file # extension as data name # For keeping track of type (2D vs 3D) self.__sizeM = None def is_3d(self): """Returns true if mesh is spatially references in three dimensions""" return self.__sizeM.shape[0] >= 3 def is_2d(self): """Returns true if mesh is spatially references in only two dimensions""" return self.__sizeM.shape[0] == 1 @staticmethod def _ubc_mesh_2d_part(FileName): """Internal helper to read 2D mesh file""" # This is a helper method to read file contents of mesh try: fileLines = np.genfromtxt(FileName, dtype=str, delimiter='\n', comments='!') except (IOError, OSError) as fe: raise _helpers.PVGeoError(str(fe)) def _genTup(sft, n): # This reads in the data for a dimension pts = [] disc = [] for i in range(n): ln = fileLines[i + sft].split('!')[0].split() if i == 0: o = ln[0] pts.append(o) ln = [ln[1], ln[2]] pts.append(ln[0]) disc.append(ln[1]) return pts, disc # Get the number of lines for each dimension nx = int(fileLines[0].split('!')[0]) nz = int(fileLines[nx + 1].split('!')[0]) # Get the origins and tups for both dimensions xpts, xdisc = _genTup(1, nx) zpts, zdisc = _genTup(2 + nx, nz) return xpts, xdisc, zpts, zdisc def _read_extent(self): """Reads the mesh file for the UBC 2D/3D Mesh or OcTree format to get output extents. Computationally inexpensive method to discover whole output extent. Return: tuple(int) : This returns a tuple of the whole extent for the grid to be made of the input mesh file (0,n1-1, 0,n2-1, 0,n3-1). This output should be directly passed to set the whole output extent. """ # Read the mesh file as line strings, remove lines with comment = ! v = np.array(np.__version__.split('.')[0:2], dtype=int) FileName = self.get_mesh_filename() try: if v[0] >= 1 and v[1] >= 10: # max_rows in numpy versions >= 1.10 msh = np.genfromtxt( FileName, delimiter='\n', dtype=np.str, comments='!', max_rows=1 ) else: # This reads whole file :( msh = np.genfromtxt( FileName, delimiter='\n', dtype=np.str, comments='!' )[0] except (IOError, OSError) as fe: raise _helpers.PVGeoError(str(fe)) # Fist line is the size of the model self.__sizeM = np.array(msh.ravel()[0].split(), dtype=int) # Check if the mesh is a UBC 2D mesh if self.__sizeM.shape[0] == 1: # Read in data from file xpts, xdisc, zpts, zdisc = ubcMeshReaderBase._ubc_mesh_2d_part(FileName) nx = np.sum(np.array(xdisc, dtype=int)) + 1 nz = np.sum(np.array(zdisc, dtype=int)) + 1 return (0, nx, 0, 1, 0, nz) # Check if the mesh is a UBC 3D mesh or OcTree elif self.__sizeM.shape[0] >= 3: # Get mesh dimensions dim = self.__sizeM[0:3] ne, nn, nz = dim[0], dim[1], dim[2] return (0, ne, 0, nn, 0, nz) else: raise _helpers.PVGeoError('File format not recognized') @staticmethod def ubc_model_3d(FileName): """Reads the 3D model file and returns a 1D NumPy float array. Use the place_model_on_mesh() method to associate with a grid. Args: FileName (str) : The model file name(s) as an absolute path for the input model file in UBC 3D Model Model Format. Also accepts a `list` of string file names. Return: np.array : Returns a NumPy float array that holds the model data read from the file. Use the ``place_model_on_mesh()`` method to associate with a grid. If a list of file names is given then it will return a dictionary of NumPy float array with keys as the basenames of the files. """ # Check if recurssion needed if isinstance(FileName, (list, tuple)): out = {} for f in FileName: out[os.path.basename(f)] = ubcMeshReaderBase.ubc_model_3d(f) return out # Perform IO try: data = np.genfromtxt(FileName, dtype=np.float, comments='!') except (IOError, OSError) as fe: raise _helpers.PVGeoError(str(fe)) return data def set_use_filename(self, flag): """Set a flag on whether or not to use the filename as the data array name""" if self.__use_filename != flag: self.__use_filename = flag self.Modified(read_again_mesh=False, read_again_models=False) def set_data_name(self, name): """Set the data array name""" if name == '': self.__use_filename = True self.Modified(read_again_mesh=False, read_again_models=False) elif self.__data_name != name: self.__data_name = name self.__use_filename = False self.Modified(read_again_mesh=False, read_again_models=False) def get_data_name(self): """Get the data array name""" if self.__use_filename: mname = self.get_model_filenames(idx=0) return os.path.basename(mname) return self.__data_name ############################################################################### # UBC Model Appender Base class ModelAppenderBase(base.AlgorithmBase): """A base class for create mesh-model appenders on the UBC Mesh formats""" __displayname__ = 'Model Appender Base' __category__ = 'base' def __init__( self, inputType='vtkRectilinearGrid', outputType='vtkRectilinearGrid', **kwargs ): base.AlgorithmBase.__init__( self, nInputPorts=1, inputType=inputType, nOutputPorts=1, outputType=outputType, ) self._model_filenames = kwargs.get('model_files', []) self.__data_name = kwargs.get('dataname', 'Appended Data') self.__use_filename = True self._models = [] self.__need_to_read = True self._is_3D = None # For the VTK/ParaView pipeline self.__dt = kwargs.get('dt', 1.0) self.__timesteps = None self.__last_successfull_index = ( 0 # This is the index to use if the current timestep is unavailable ) def need_to_read(self, flag=None): """Ask self if the reader needs to read the files again Args: flag (bool): if the flag is set then this method will set the read status Return: bool: The status of the reader aspect of the filter. """ if flag is not None and isinstance(flag, (bool, int)): self.__need_to_read = flag self._update_time_steps() return self.__need_to_read def Modified(self, read_again=True): """Call modified if the files needs to be read again again.""" if read_again: self.__need_to_read = read_again base.AlgorithmBase.Modified(self) def modified(self, read_again=True): """Call modified if the files needs to be read again again.""" return self.Modified(read_again=read_again) def _update_time_steps(self): """For internal use only: appropriately sets the timesteps.""" # Use the inputs' timesteps: this merges the timesteps values ts0 = _helpers.get_input_time_steps(self, port=0) if ts0 is None: ts0 = np.array([]) ts1 = _helpers._calculate_time_range(len(self._model_filenames), self.__dt) tsAll = np.unique(np.concatenate((ts0, ts1), 0)) # Use both inputs' time steps self.__timesteps = _helpers.update_time_steps(self, tsAll, explicit=True) return 1 def _read_up_front(self): raise NotImplementedError() def _place_on_mesh(self, output, idx=0): raise NotImplementedError() def RequestData(self, request, inInfo, outInfo): """Used by pipeline to generate output""" # Get input/output of Proxy pdi = self.GetInputData(inInfo, 0, 0) output = self.GetOutputData(outInfo, 0) output.DeepCopy(pdi) # ShallowCopy if you want changes to propagate upstream # Get requested time index i = _helpers.get_requested_time(self, outInfo) # Perfrom task: if self.__need_to_read: self._read_up_front() # Place the model data for given timestep onto the mesh if len(self._models) > i: self._place_on_mesh(output, idx=i) self.__last_successfull_index = i else: # put the last array as a placeholder self._place_on_mesh(output, idx=self.__last_successfull_index) return 1 def RequestInformation(self, request, inInfo, outInfo): """Used by pipeline to handle time variance and update output extents""" self._update_time_steps() pdi = self.GetInputData(inInfo, 0, 0) # Determine if 2D or 3D and read if isinstance(pdi, vtk.vtkRectilinearGrid) and pdi.GetExtent()[3] == 1: self._is_3D = False else: self._is_3D = True return 1 #### Setters and Getters #### def has_models(self): """Return True if models are associated with this mesh""" return len(self._model_filenames) > 0 def get_time_step_values(self): """Use this in ParaView decorator to register timesteps.""" # if unset, force at least one attempt to set the timesteps if self.__timesteps is None: self._update_time_steps() return self.__timesteps if self.__timesteps is not None else None def clear_models(self): """Use to clear data file names.""" self._model_filenames = [] self._models = [] self.Modified(read_again=True) def add_model_file_name(self, filename): """Use to set the file names for the reader. Handles single string or list of strings. """ if filename is None: return # do nothing if None is passed by a constructor on accident elif isinstance(filename, (list, tuple)): for f in filename: self.add_model_file_name(f) self.Modified() elif filename not in self._model_filenames: self._model_filenames.append(filename) self.Modified() return 1 def get_model_filenames(self, idx=None): """Returns the list of file names or given and index returns a specified timestep's filename. """ if idx is None or not self.has_models(): return self._model_filenames return self._model_filenames[idx] def set_use_filename(self, flag): """Set a flag on whether or not to use the filename as the data array name""" if self.__use_filename != flag: self.__use_filename = flag self.Modified(read_again=False) def set_data_name(self, name): """Set the data array name""" if name == '': self.__use_filename = True self.Modified(read_again=False) elif self.__data_name != name: self.__data_name = name self.__use_filename = False self.Modified(read_again=False) def get_data_name(self): """Get the data array name""" if self.__use_filename: mname = self.get_model_filenames(idx=0) return os.path.basename(mname) return self.__data_name
{ "repo_name": "banesullivan/ParaViewGeophysics", "path": "PVGeo/ubc/two_file_base.py", "copies": "1", "size": "12901", "license": "bsd-3-clause", "hash": 2306600373077320700, "line_mean": 35.86, "line_max": 88, "alpha_frac": 0.5609642663, "autogenerated": false, "ratio": 3.9817901234567903, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5042754389756791, "avg_score": null, "num_lines": null }
__all__ = ["NullCrawler", "Random3Crawler"] from typing import Optional from nichtparasoup.core import Crawler, _CrawlerWeight, _IsImageAddable, _OnImageAdded from nichtparasoup.core.image import Image from nichtparasoup.core.imagecrawler import BaseImageCrawler class _LoggingCrawler(Crawler): def __init__(self, imagecrawler: BaseImageCrawler, weight: _CrawlerWeight, is_image_addable: Optional[_IsImageAddable] = None, on_image_added: Optional[_OnImageAdded] = None) -> None: super().__init__(imagecrawler, weight, is_image_addable, on_image_added) self.crawl_call_count = 0 self.reset_call_count = 0 def crawl(self) -> int: self.crawl_call_count += 1 return 0 def reset(self) -> None: self.reset_call_count += 1 class NullCrawler(_LoggingCrawler): pass class Random3Crawler(_LoggingCrawler): def crawl(self) -> int: super().crawl() for _ in range(3): self.images.add(Image(uri='test', source='test', is_generic=True)) return 3
{ "repo_name": "k4cg/nichtparasoup", "path": "tests/test_10_nichtparasoup/test_core/mockable_crawler.py", "copies": "1", "size": "1097", "license": "mit", "hash": 1188192445941171200, "line_mean": 28.6486486486, "line_max": 86, "alpha_frac": 0.643573382, "autogenerated": false, "ratio": 3.428125, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9568476769582985, "avg_score": 0.0006443224834029431, "num_lines": 37 }
__all__ = ['Null'] class NullType(object): '''An SQL-like Null object: allows most (if not all) operations on it to succeed. >>> repr(Null) '(Null)' >>> Null(3,x=3) (Null) >>> [Null==Null, Null!=None, Null<Null, Null>=3] [(Null), (Null), (Null), (Null)] >>> [Null[3], Null.foo] [(Null), (Null)] >>> Null[4] = 3 >>> del Null['bar'] >>> 2.5*Null + 3 (Null) >>> [4 not in Null, 'all' in Null] [True, False] >>> list(Null) [] >>> bool(Null) False >>> len(Null) 0 >>> [int(Null), long(Null), float(Null), complex(Null)] [0, 0, 0.0, 0j] >>> [oct(Null), hex(Null)] ['(Null)', '(Null)'] >>> type(Null)() is Null True >>> from pickle import dumps, loads >>> loads(dumps(Null)) is Null True ''' __singleton = None def __new__(cls, *args, **kwds): assert __name__ == '__main__', __name__ if cls.__singleton is None: cls.__singleton = super(NullType,cls).__new__(cls) return cls.__singleton def __len__(self): return 0 def __iter__(self): return; yield def __nonzero__ (self): return False def __contains__(self, item): return False def __repr__(self): return '(Null)' def __reduce__(self): return (type(self), ()) __oct__ = __hex__ = __repr__ __int__ = __long__ = __len__ def __float__(self): return 0.0 def __call__(self, *args, **kwds): return self __getitem__ = __getattr__ = __setitem__ = __setattr__ = __delitem__ = \ __delattr__ = __eq__ = __ne__ = __gt__ = __ge__ = __lt__ = __le__ = \ __neg__ = __pos__ = __abs__ = __invert__ = __add__ = __sub__ = \ __mul__ = __div__ = __truediv__ = __floordiv__ = __mod__ = \ __divmod__ = __pow__ = __lshift__ = __rshift__ = __and__ = __or__ = \ __xor__ = __radd__ = __rsub__ = __rmul__ = __rdiv__ = __rtruediv__ = \ __rfloordiv__ = __rmod__ = __rdivmod__ = __rpow__ = __rlshift__ = \ __rrshift__ = __rand__ = __ror__ = __rxor__ = __call__ Null = NullType() if __name__ == '__main__': from doctest import testmod testmod()
{ "repo_name": "ActiveState/code", "path": "recipes/Python/576562_Yet_another_Null_object/recipe-576562.py", "copies": "1", "size": "2137", "license": "mit", "hash": -5297756056126307000, "line_mean": 31.3787878788, "line_max": 85, "alpha_frac": 0.4576509125, "autogenerated": false, "ratio": 3.1519174041297937, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.41095683166297936, "avg_score": null, "num_lines": null }
__all__ = [ 'Unavailable', # Circuit breaker. 'TristateBreakers', 'NO_BREAK', # Rate limit. 'unlimited', 'TokenBucket', # Retry. 'no_retry', 'ExponentialBackoff', ] import collections import enum import logging import time from g1.asyncs.bases import timers from g1.bases import collections as g1_collections from g1.bases.assertions import ASSERT LOG = logging.getLogger(__name__) class Unavailable(Exception): """When rate limit is exceeded or circuit breaker disconnects.""" class CircuitBreaker: async def __aenter__(self): raise NotImplementedError async def __aexit__(self, exc_type, exc, traceback): raise NotImplementedError def notify_success(self): raise NotImplementedError def notify_failure(self): raise NotImplementedError class CircuitBreakers: def get(self, key: str) -> CircuitBreaker: raise NotImplementedError @enum.unique class _States(enum.Enum): GREEN = enum.auto() YELLOW = enum.auto() RED = enum.auto() class _EventLog: """Record when events happened.""" def __init__(self, capacity): self._log = collections.deque(maxlen=capacity) def add(self, t): if self._log: ASSERT.greater(t, self._log[-1]) self._log.append(t) def count(self, t0=None): """Return number of events after ``t0``.""" if t0 is None: return len(self._log) for i, t in enumerate(self._log): if t >= t0: return len(self._log) - i return 0 def clear(self): self._log.clear() class TristateBreaker(CircuitBreaker): """Tristate circuit breaker. It operates in three states: * GREEN: This is the initial state. When in this state, it lets all requests pass through. When there are ``failure_threshold`` failures consecutively in the last ``failure_period`` seconds, it changes the state to RED. * YELLOW: When in this state, it only lets one concurrent request pass through, and errs out on all others. When there are ``success_threshold`` successes consecutively, it changes the state to GREEN. When there is a failure, it changes the state to RED. * RED: When in this state, it lets no requests pass through. After ``failure_timeout`` seconds, it changes the state to YELLOW. """ def __init__( self, *, key, failure_threshold, failure_period, failure_timeout, success_threshold, ): self._key = key self._failure_threshold = ASSERT.greater(failure_threshold, 0) self._failure_period = ASSERT.greater(failure_period, 0) self._failure_timeout = ASSERT.greater(failure_timeout, 0) self._success_threshold = ASSERT.greater(success_threshold, 0) self._state = _States.GREEN # When state is GREEN, _event_log records failures; when state # is YELLOW, it records successes; when state is RED, it records # when the state was changed to RED. self._event_log = _EventLog(max(failure_threshold, success_threshold)) self._num_concurrent_requests = 0 async def __aenter__(self): if self._state is _States.GREEN: self._num_concurrent_requests += 1 return self if self._state is _States.RED: if ( self._event_log. count(time.monotonic() - self._failure_timeout) > 0 ): raise Unavailable( 'circuit breaker disconnected: %s' % self._key ) self._change_state_yellow() ASSERT.is_(self._state, _States.YELLOW) if self._num_concurrent_requests > 0: raise Unavailable( 'circuit breaker has not re-connected yet: %s' % self._key ) self._num_concurrent_requests += 1 return self async def __aexit__(self, exc_type, exc, traceback): self._num_concurrent_requests -= 1 def notify_success(self): if self._state is _States.GREEN: self._event_log.clear() elif self._state is _States.YELLOW: self._event_log.add(time.monotonic()) if self._event_log.count() >= self._success_threshold: self._change_state_green() else: ASSERT.is_(self._state, _States.RED) # Nothing to do here. def notify_failure(self): if self._state is _States.GREEN: now = time.monotonic() self._event_log.add(now) if ( self._event_log.count(now - self._failure_period) >= self._failure_threshold ): self._change_state_red(now) elif self._state is _States.YELLOW: self._change_state_red(time.monotonic()) else: ASSERT.is_(self._state, _States.RED) # Nothing to do here. def _change_state_green(self): LOG.info('TristateBreaker: change state to GREEN: %s', self._key) self._state = _States.GREEN self._event_log.clear() def _change_state_yellow(self): LOG.info('TristateBreaker: change state to YELLOW: %s', self._key) self._state = _States.YELLOW self._event_log.clear() def _change_state_red(self, now): LOG.info('TristateBreaker: change state to RED: %s', self._key) self._state = _States.RED self._event_log.clear() self._event_log.add(now) class TristateBreakers(CircuitBreakers): def __init__(self, **breaker_kwargs): self._breaker_kwargs = breaker_kwargs self._breakers = g1_collections.LruCache(128) def get(self, key): breaker = self._breakers.get(key) if breaker is None: # pylint: disable=missing-kwoa breaker = self._breakers[key] = TristateBreaker( key=key, **self._breaker_kwargs, ) return breaker class NeverBreaker(CircuitBreaker): async def __aenter__(self): return self async def __aexit__(self, exc_type, exc, traceback): pass def notify_success(self): pass def notify_failure(self): pass class NeverBreakers(CircuitBreakers): def __init__(self): self._no_break = NeverBreaker() def get(self, key): return self._no_break NO_BREAK = NeverBreakers() async def unlimited(): pass class TokenBucket: def __init__(self, token_rate, bucket_size, raise_when_empty): self._raise_when_empty = raise_when_empty self._token_rate = ASSERT.greater(token_rate, 0) self._token_period = 1 / self._token_rate self._bucket_size = ASSERT.greater(bucket_size, 0) self._num_tokens = 0 self._last_added = time.monotonic() async def __call__(self): self._add_tokens() if self._num_tokens < 1 and self._raise_when_empty: raise Unavailable('rate limit exceeded') while self._num_tokens < 1: await timers.sleep(self._token_period) self._add_tokens() self._num_tokens -= 1 def _add_tokens(self): now = time.monotonic() self._num_tokens = min( self._num_tokens + (now - self._last_added) * self._token_rate, self._bucket_size, ) self._last_added = now def no_retry(retry_count): # pylint: disable=useless-return del retry_count # Unused. return None class ExponentialBackoff: """Retry ``max_retries`` times with exponential backoff. NOTE: This retry policy does not implement jitter of delays; if you are using the ``Session`` object to write to a shared resource, you could suffer from write conflicts. In that case, you should use a retry policy with jitter. """ def __init__(self, max_retries, backoff_base): self._max_retries = ASSERT.greater(max_retries, 0) self._backoff_base = ASSERT.greater(backoff_base, 0) def __call__(self, retry_count): if retry_count >= self._max_retries: return None else: return self._backoff_base * 2**retry_count
{ "repo_name": "clchiou/garage", "path": "py/g1/http/clients/g1/http/clients/policies.py", "copies": "1", "size": "8292", "license": "mit", "hash": -2229832402979022300, "line_mean": 27.4948453608, "line_max": 78, "alpha_frac": 0.5933429812, "autogenerated": false, "ratio": 3.8765778401122017, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4969920821312202, "avg_score": null, "num_lines": null }
__all__ = [ "WBAPIUnauthorizedError", "WBAPI" ] import requests from requests.exceptions import HTTPError as WBAPIHTTPError from requests.packages.urllib3.util import Retry from requests.adapters import HTTPAdapter from urlparse import urljoin from functools import wraps class WBAPIUnauthorizedError(WBAPIHTTPError): pass def catch_api_http_exception(f): @wraps(f) def wrapper(*args, **kwds): try: r = f(*args, **kwds) except WBAPIHTTPError as e: if e.response.status_code in [401, 403]: raise WBAPIUnauthorizedError(response=e.response) else: raise return r return wrapper class FakeResponse(object): content = None status_code = None def json(self): return self.content class WBAPI(object): def __init__(self, base_uri, connect_timeout=5, read_timeout=30): self.__base_uri = base_uri self.__api_uri = urljoin(base_uri, "api/") self.__session = requests.Session() requests_http_adapter = HTTPAdapter( Retry(total=10, status_forcelist=[502, 500], backoff_factor=0.5)) self.__session.mount('https://', requests_http_adapter) self.__session.mount('http://', requests_http_adapter) self.__timeout = (connect_timeout, read_timeout) def get_token(self): try: return self.__session.headers['Authorization'].split()[1] except KeyError: return None def set_token(self, token): self.__session.headers['Authorization'] = "Token {}".format(token) @catch_api_http_exception def login(self, username, password): session = self.__session r = session.post( urljoin(self.__base_uri, "token/"), {"username": username, "password": password}, timeout=self.__timeout) try: r.raise_for_status() except WBAPIHTTPError as e: try: assert e.response.json()["non_field_errors"][0] == "Unable to log in with provided credentials." except: raise e fake_response = FakeResponse() fake_response.content = {"details": e.response.json()["non_field_errors"][0]} fake_response.status_code = 401 unauthed_exception = WBAPIUnauthorizedError(response=fake_response) raise unauthed_exception token = r.json()['token'] self.set_token(token) @catch_api_http_exception def get_apps(self): r = self.__session.get(urljoin(self.__api_uri, "apps/"), timeout=self.__timeout) r.raise_for_status() apps = r.json() return [ dict(a.items() + {"stages": {s["name"]: s for s in a["stages"]}}.items()) for a in apps ] @catch_api_http_exception def get_stages(self): r = self.__session.get(urljoin(self.__api_uri, "stages/"), timeout=self.__timeout) r.raise_for_status() return r.json() @catch_api_http_exception def deploy_app(self, app, stage, version): r = self.__session.put( urljoin(self.__api_uri, "apps/{}/stages/{}/version/{}/".format(app, stage, version)), timeout=self.__timeout) r.raise_for_status()
{ "repo_name": "hmrc/wristband-frontend", "path": "wb_api/__init__.py", "copies": "1", "size": "3302", "license": "apache-2.0", "hash": -2709421653575760000, "line_mean": 30.1509433962, "line_max": 112, "alpha_frac": 0.5899454876, "autogenerated": false, "ratio": 3.92627824019025, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.501622372779025, "avg_score": null, "num_lines": null }
__all__ = [ 'WePayWarning', 'WePayError', 'WePayHTTPError', 'WePayClientError', 'WePayServerError', 'WePayConnectionError' ] class WePayWarning(UserWarning): pass class WePayError(Exception): """Raised whenever WePay API call was not successfull. `WePay API Errors Documentation <https://www.wepay.com/developer/reference/errors>`_ """ def __init__(self, error, error_code, error_description): self._error = error self._error_code = error_code self._error_description = error_description super(WePayError, self).__init__() def __str__(self): return "%s (%s): %s" % (self.error, self.error_code, self.error_description) def __repr__(self): return "<%s> %s" % (self.__class__.__name__, self) @property def error(self): """Generic ``error`` category. Returned by WePay.""" return self._error @property def error_code(self): """A specific "error_code" that you can use to program responses to errors. Returned by WePay. """ return self._error_code @property def error_description(self): """A human readable ``error_description`` that explains why the error happened. Returned by WePay. """ return self._error_description class WePayHTTPError(WePayError): """This is a base http error""" def __init__(self, http_error, status_code, error=None, error_code=None, error_description=None): self._http_error = http_error self._status_code = status_code error = error or 'unknown' error_code = error_code or -1 error_description = error_description or "Unknown" super(WePayHTTPError, self).__init__(error, error_code, error_description) def __str__(self): return "HTTP %s - %s" % ( self.status_code, super(WePayHTTPError, self).__str__()) @property def status_code(self): """Error Code as specified by RFC 2616.""" return self._status_code @property def http_error(self): """Instance of :exc:`urllib.error.HTTPError` or :exc:`requests.exceptions.HTTPError`, depending on the library you chose. """ return self._http_error class WePayClientError(WePayHTTPError): """This is a 4xx type error, which, most of the time, carries important error information about the object of interest. """ class WePayServerError(WePayHTTPError): """This is a 5xx type error, which, most of the time, means there is an error in implemetation or some unknown WePay Error, in latter case there is a chance there will be no `error`, `error_code` or `error_description` from WePay. It is recommended this exception is to be ignored or handled separatly in production. """ class WePayConnectionError(Exception): """Raised in case there is a problem connecting to WePay servers, for instance when request times out. """ def __init__(self, error): self._error = error super(WePayConnectionError, self).__init__() def __str__(self): return "%s - %s" % (self.error.__class__.__name__, str(self.error)) def __repr__(self): return "<%s> %s" % (self.__class__.__name__, self) @property def error(self): """Original exception raised by `urllib` or `requests` library. It will be either :exc:`urllib.error.URLError` or a subclass of :exc:`requests.exceptions.RequestExeption`. See their corresponding documentation if necessary. """ return self._error
{ "repo_name": "lehins/python-wepay", "path": "wepay/exceptions.py", "copies": "1", "size": "3650", "license": "mit", "hash": -4276097600300843000, "line_mean": 28.9180327869, "line_max": 89, "alpha_frac": 0.6216438356, "autogenerated": false, "ratio": 4.078212290502793, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5199856126102793, "avg_score": null, "num_lines": null }
__all__ = ( 'Worker', ) import sys import time import logging import threading from Queue import Queue, Empty from pyramid.request import Request import model as M from .task import Task, Function log = logging.getLogger(__name__) exc_log = logging.getLogger('exc_logger') class Worker(object): def __init__( self, app, name, qnames, chapman_path, registry, num_threads=1, sleep=0.2, raise_errors=False): self._app = app self._name = name self._qnames = qnames self._chapman_path = chapman_path self._registry = registry self._num_threads = num_threads self._sleep = sleep Function.raise_errors = raise_errors self._handler_threads = [] self._num_active_messages = 0 self._send_event = threading.Event() self._shutdown = False # flag to indicate worker is shutting down def start(self): M.doc_session.db.collection_names() # force connection & auth sem = threading.Semaphore(self._num_threads) q = Queue() self._handler_threads = [ threading.Thread( name='dispatch', target=self.dispatcher, args=(sem, q))] self._handler_threads += [ threading.Thread( name='worker-%d' % x, target=self.worker, args=(sem, q)) for x in range(self._num_threads)] for t in self._handler_threads: t.setDaemon(True) t.start() def run(self): log.info('Entering event thread') conn = M.doc_session.bind.bind.conn conn.start_request() chan = M.Message.channel.new_channel() chan.pub('start', self._name) @chan.sub('ping') def handle_ping(chan, msg): data = msg['data'] if data['worker'] in (self._name, '*'): data['worker'] = self._name chan.pub('pong', data) @chan.sub('kill') def handle_kill(chan, msg): if msg['data'] in (self._name, '*'): log.error('Received %r, exiting', msg) sys.exit(0) @chan.sub('shutdown') def handle_shutdown(chan, msg): if msg['data'] in (self._name, '*'): log.error('Received %r, shutting down gracefully', msg) self._shutdown = True raise StopIteration() @chan.sub('send') def handle_send(chan, msg): self._send_event.set() while True: try: chan.handle_ready(await=True, raise_errors=True) except StopIteration: break time.sleep(self._sleep) for t in self._handler_threads: t.join() def _waitfunc(self): if self._shutdown: raise StopIteration() self._send_event.clear() self._send_event.wait(self._sleep) def dispatcher(self, sem, q): log.info('Entering dispatcher thread') while not self._shutdown: sem.acquire() try: msg, state = _reserve_msg( self._name, self._qnames, self._waitfunc) except StopIteration: break except Exception as err: exc_log.exception( 'Error reserving message: %r, waiting 5s and continuing', err) sem.release() time.sleep(5) continue self._num_active_messages += 1 q.put((msg, state)) log.info('Exiting dispatcher thread') def worker(self, sem, q): log.info('Entering chapmand worker thread') while not self._shutdown: try: msg, state = q.get(timeout=0.25) except Empty: continue try: log.info('Received %r', msg) task = Task.from_state(state) # task.handle(msg, 25) if task.path: req = Request.blank(task.path, method='CHAPMAN') else: req = Request.blank(self._chapman_path, method='CHAPMAN') req.registry = self._registry req.environ['chapmand.task'] = task req.environ['chapmand.message'] = msg for x in self._app(req.environ, lambda *a,**kw:None): pass except Exception as err: exc_log.exception('Unexpected error in worker thread: %r', err) time.sleep(self._sleep) finally: self._num_active_messages -= 1 sem.release() log.info('Exiting chapmand worker thread') def handle_messages(self): '''Handle messages until there are no more''' while True: msg, state = M.Message.reserve(self._name, self._qnames) if msg is None: return task = Task.from_state(state) task.handle(msg) def _reserve_msg(name, qnames, waitfunc): while True: msg, state = M.Message.reserve(name, qnames) if msg is None: waitfunc() continue if state is None: continue return msg, state
{ "repo_name": "synappio/chapman", "path": "chapman/worker.py", "copies": "1", "size": "5376", "license": "mit", "hash": 4127523853321743400, "line_mean": 30.6235294118, "line_max": 79, "alpha_frac": 0.51171875, "autogenerated": false, "ratio": 4.280254777070064, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5291973527070064, "avg_score": null, "num_lines": null }
__all__ = [ 'WriteRectilinearGridToUBC', 'WriteImageDataToUBC', ] __displayname__ = 'Writers' import os import numpy as np from .. import interface from ..base import WriterBase class ubcTensorMeshWriterBase(WriterBase): """A base class to assist in writing data bjects to the UBC Tensor Mesh format. """ __displayname__ = 'UBC Format Writer Base' __category__ = 'base' def __init__(self, inputType='vtkRectilinearGrid'): WriterBase.__init__(self, inputType=inputType, ext='msh') # These MUST be set by children self.xcells = None self.ycells = None self.zcells = None self.origin = None def write_mesh_3d(self, nx, ny, nz, filename): """Write 3D Tensor Mesh to the UBC format""" def arr2str(arr): return ' '.join(map(str, arr)) ox, oy, oz = self.origin # Write out grid / mesh with open(filename, 'w') as f: f.write('%d %d %d\n' % (nx, ny, nz)) f.write('%d %d %d\n' % (ox, oy, oz)) f.write('%s\n' % arr2str(self.xcells)) f.write('%s\n' % arr2str(self.ycells)) f.write('%s\n' % arr2str(self.zcells)) return def write_models(self, grd, filename): """Write cell data attributes to model files""" nx, ny, nz = grd.GetDimensions() nx -= 1 ny -= 1 nz -= 1 def reshape_model(model): # Swap axes because VTK structures the coordinates a bit differently # - This is absolutely crucial! # - Do not play with unless you know what you are doing! model = np.reshape(model, (nz, ny, nx)) model = np.swapaxes(model, 0, 2) model = np.swapaxes(model, 0, 1) # Now reverse Z axis model = model[:, :, ::-1] return model.flatten() # make up file names for models for i in range(grd.GetCellData().GetNumberOfArrays()): vtkarr = grd.GetCellData().GetArray(i) arr = interface.convert_array(vtkarr) arr = reshape_model(arr) path = os.path.dirname(filename) filename = '%s/%s.mod' % (path, vtkarr.GetName().replace(' ', '_')) np.savetxt( filename, arr, comments='! ', header='Mesh File: %s' % os.path.basename(filename), fmt=self.get_format(), ) return class WriteRectilinearGridToUBC(ubcTensorMeshWriterBase): """Writes a ``vtkRectilinearGrid`` data object to the UBC Tensor Mesh format. This file reader currently only handles 3D data. """ __displayname__ = 'Write ``vtkRectilinearGrid`` to UBC Tensor Mesh' __category__ = 'writer' def __init__(self): ubcTensorMeshWriterBase.__init__(self, inputType='vtkRectilinearGrid') def perform_write_out(self, input_data_object, filename, object_name): """Write out a ``vtkRectilinearGrid`` to the UBC file format""" # Get the input data object grd = input_data_object # Get grid dimensions nx, ny, nz = grd.GetDimensions() # get the points and convert to spacings xcoords = interface.convert_array(grd.GetXCoordinates()) ycoords = interface.convert_array(grd.GetYCoordinates()) zcoords = interface.convert_array(grd.GetZCoordinates()) # TODO: decide if 2D or 3D # Now get the cell sizes self.xcells = np.diff(xcoords) self.ycells = np.diff(ycoords) self.zcells = np.diff(zcoords) # find origin (top southwest corner): this works because of input type ox, oy, oz = np.min(xcoords), np.min(ycoords), np.max(zcoords) self.origin = (ox, oy, oz) # flip z self.zcells = self.zcells[::-1] # Write mesh self.write_mesh_3d(nx - 1, ny - 1, nz - 1, filename) # Now write out model data self.write_models(grd, filename) # Always return 1 from pipeline methods or seg-faults will occur return 1 class WriteImageDataToUBC(ubcTensorMeshWriterBase): """Writes a ``vtkImageData`` (uniform grid) data object to the UBC Tensor Mesh format. This file reader currently only handles 3D data. """ __displayname__ = 'Write ``vtkImageData`` to UBC Tensor Mesh' __category__ = 'writer' def __init__(self): ubcTensorMeshWriterBase.__init__(self, inputType='vtkImageData') def perform_write_out(self, input_data_object, filename, object_name): """Write out a ``vtkImageData`` to the UBC file format""" # Get the input data object grd = input_data_object # Get grid dimensions nx, ny, nz = grd.GetDimensions() nx -= 1 ny -= 1 nz -= 1 # get the points and convert to spacings dx, dy, dz = grd.GetSpacing() # Now make the cell arrays self.xcells = np.full(nx, dx) self.ycells = np.full(ny, dy) self.zcells = np.full(nz, dz) # find origin (top southwest corner) ox, oy, oz = grd.GetOrigin() oz += nz * dz self.origin = (ox, oy, oz) # TODO: decide if 2D or 3D # Write mesh self.write_mesh_3d(nx, ny, nz, filename) # Now write out model data self.write_models(grd, filename) # Always return 1 from pipeline methods or seg-faults will occur return 1
{ "repo_name": "banesullivan/ParaViewGeophysics", "path": "PVGeo/ubc/write.py", "copies": "1", "size": "5502", "license": "bsd-3-clause", "hash": 3906998049047916500, "line_mean": 30.2613636364, "line_max": 81, "alpha_frac": 0.5756088695, "autogenerated": false, "ratio": 3.577373211963589, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4652982081463589, "avg_score": null, "num_lines": null }
__all___ = [ 'YubicoError', 'StatusCodeError', 'InvalidClientIdError', 'InvalidValidationResponse', 'SignatureVerificationError' ] class YubicoError(Exception): """ Base class for Yubico related exceptions. """ pass class StatusCodeError(YubicoError): def __init__(self, status_code): self.status_code = status_code def __str__(self): return ('Yubico server returned the following status code: %s' % (self.status_code)) class InvalidClientIdError(YubicoError): def __init__(self, client_id): self.client_id = client_id def __str__(self): return 'The client with ID %s does not exist' % (self.client_id) class InvalidValidationResponse(YubicoError): def __init__(self, reason, response, parameters=None): self.reason = reason self.response = response self.parameters = parameters self.message = self.reason def __str__(self): return self.reason class SignatureVerificationError(YubicoError): def __init__(self, generated_signature, response_signature): self.generated_signature = generated_signature self.response_signature = response_signature def __str__(self): return repr('Server response message signature verification failed' + '(expected %s, got %s)' % (self.generated_signature, self.response_signature))
{ "repo_name": "Yubico/python-yubico-client-dpkg", "path": "yubico_client/yubico_exceptions.py", "copies": "1", "size": "1465", "license": "bsd-3-clause", "hash": 6885111900151873000, "line_mean": 27.7254901961, "line_max": 77, "alpha_frac": 0.628668942, "autogenerated": false, "ratio": 4.234104046242774, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5362772988242774, "avg_score": null, "num_lines": null }
__all___ = [ 'YubicoError', 'StatusCodeError', 'InvalidClientIdError', 'SignatureVerificationError' ] class YubicoError(Exception): """ Base class for Yubico related exceptions. """ pass class StatusCodeError(YubicoError): def __init__(self, status_code): self.status_code = status_code def __str__(self): return ('Yubico server returned the following status code: %s' % (self.status_code)) class InvalidClientIdError(YubicoError): def __init__(self, client_id): self.client_id = client_id def __str__(self): return 'The client with ID %s does not exist' % (self.client_id) class SignatureVerificationError(YubicoError): def __init__(self, generated_signature, response_signature): self.generated_signature = generated_signature self.response_signature = response_signature def __str__(self): return repr('Server response message signature verification failed' + '(expected %s, got %s)' % (self.generated_signature, self.response_signature))
{ "repo_name": "meddius/yubisaslauthd", "path": "yubico/yubico_exceptions.py", "copies": "1", "size": "1140", "license": "bsd-3-clause", "hash": -1026294211435872100, "line_mean": 28.2307692308, "line_max": 77, "alpha_frac": 0.6219298246, "autogenerated": false, "ratio": 4.1454545454545455, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5267384370054545, "avg_score": null, "num_lines": null }
__all__ = ['oagprop', 'staticproperty'] class oagprop(object): """Responsible for maitaining _oagcache on decorated properties""" def __init__(self, fget=None, fset=None, fdel=None, doc=None): self.fget = fget self.fset = fset self.fdel = fdel if doc is None and fget is not None: doc = fget.__doc__ self.__doc__ = doc def __get__(self, obj, searchwin=None, searchoffset=None, searchdesc=False, cache=True): if obj is None: return self if self.fget is None: raise AttributeError("unreadable attribute") try: if not cache: raise Exception("No cache check") return obj.cache.match(self.fget.__name__) except: subnode = self.fget(obj, searchwin=searchwin, searchoffset=searchoffset, searchdesc=searchdesc) if subnode is not None: from ._graph import OAG_RootNode if isinstance(subnode, OAG_RootNode): from ._rpc import reqcls reqcls(obj).register(subnode.rpc.url, self.fget.__name__) if cache: obj.cache.put(self.fget.__name__, subnode) return subnode def __set__(self, obj, value): pass class staticproperty(property): def __get__(self, cls, owner): return classmethod(self.fget).__get__(None, owner)()
{ "repo_name": "kchoudhu/openarc", "path": "openarc/_util.py", "copies": "1", "size": "1433", "license": "bsd-3-clause", "hash": 9122870412233465000, "line_mean": 36.7368421053, "line_max": 107, "alpha_frac": 0.5624563852, "autogenerated": false, "ratio": 3.9916434540389973, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5054099839238997, "avg_score": null, "num_lines": null }
__all__ = ['ObjectFeatureUnion', 'ListConcatTransformer'] from collections import OrderedDict import numpy as np from . import PureTransformer class ObjectFeatureUnion(PureTransformer): """Extract a given key from dictionary object.""" def __init__(self, *args, as_dict=True, **kwargs): kwargs.setdefault('nparray', True) kwargs.setdefault('nparray_dtype', np.object) super(ObjectFeatureUnion, self).__init__(**kwargs) self.as_dict = as_dict self.steps = OrderedDict() for (k, step) in args: self.steps[k] = step #end def def fit(self, *args, **fit_params): for k, step in self.steps.items(): step.fit(*args, **fit_params) return self #end def def _transform(self, X, y=None, **kwargs): if self.as_dict: transformed = [] first = True # zip(*[step.transform(X, **kwargs) for k, step in self.steps.items()]) for k, step in self.steps.items(): step_transformed = step.transform(X, **kwargs) for i, t in enumerate(step_transformed): if first: transformed.append({k: t}) else: transformed[i][k] = t #end for first = False #end for else: transformed = [] first = True for k, step in self.steps.items(): step_transformed = step.transform(X, y=y, **kwargs) for i, t in enumerate(step_transformed): if first: transformed.append([t]) else: transformed[i].append(t) #end for #end for #end if return transformed #end def #end class class ListConcatTransformer(PureTransformer): """Concatenate two lists for each instance.""" def __init__(self, steps=[], **kwargs): kwargs.setdefault('nparray', False) super(ListConcatTransformer, self).__init__(**kwargs) self.steps = steps #end def def fit(self, *args, **kwargs): for step in self.steps: step.fit(*args, **kwargs) return self #end def def _transform(self, X, *args, **kwargs): N = len(X) transformed = [[] for i in range(N)] for step in self.steps: transformed_step = step.transform(X, *args, **kwargs) assert len(transformed_step) == N for j in range(N): transformed[j] += transformed_step[j] #end for return transformed #end def #end class
{ "repo_name": "skylander86/ycml", "path": "ycml/transformers/union.py", "copies": "1", "size": "2719", "license": "apache-2.0", "hash": 6174945584202147000, "line_mean": 27.0309278351, "line_max": 83, "alpha_frac": 0.5211474807, "autogenerated": false, "ratio": 4.281889763779527, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5303037244479527, "avg_score": null, "num_lines": null }
__all__ = ('object_property', 'bool_property', 'array_property', 'set_property', 'dict_property') from objc import ivar, selector, _C_ID, _C_NSBOOL, _C_BOOL, NULL, _C_NSUInteger from objc import lookUpClass import collections from copy import copy as copy_func import sys NSSet = lookUpClass('NSSet') NSObject = lookUpClass('NSObject') if sys.version_info[0] == 2: range = xrange def _str(value): return value else: # pragma: no cover (py3k) long = int def _str(value): return value.decode('ascii') def attrsetter(prop, name, copy): if copy: def func(self, value): if isinstance(value, NSObject): setattr(self, name, value.copy()) else: setattr(self, name, copy_func(value)) else: def func(self, value): setattr(self, name, value) return func def attrgetter(name): def func(self): return getattr(self, name) return func def _return_value(value): def func(self): return value return func def _dynamic_getter(name): def getter(object): m = getattr(object.pyobjc_instanceMethods, name) return m() getter.__name__ = name return getter def _dynamic_setter(name): def setter(object, value): m = getattr(object.pyobjc_instanceMethods, name) return m(value) setter.__name__ = name return setter class object_property (object): def __init__(self, name=None, read_only=False, copy=False, dynamic=False, ivar=None, typestr=_C_ID, depends_on=None): self.__created = False self.__inherit = False self._name = name self._typestr = typestr self._ro = read_only self._copy = copy self._dynamic = dynamic self._ivar = ivar self._getter = None self._setter = None self._validate = None if depends_on is None: self._depends_on = None else: self._depends_on = set(depends_on) self.__getprop = None self.__setprop = None self.__parent = None def _clone(self): if self._depends_on is None: depends = None else: depends = self._depends_on.copy() v = type(self)(name=self._name, read_only=self._ro, copy=self._copy, dynamic=self._dynamic, ivar=self._ivar, typestr=self._typestr, depends_on=depends) v.__inherit = True v.__getprop = self.__getprop v.__setprop = self.__setprop v.__parent = self return v def __pyobjc_class_setup__(self, name, class_dict, instance_methods, class_methods): self.__created = True if self._name is None: self._name = name if self._ivar is not NULL: if self._ivar is None: ivname = '_' + self._name else: ivname = self._ivar if self.__parent is None: ivar_ref = ivar(name=ivname, type=self._typestr) class_dict[ivname] = ivar_ref if self._ro: self._setter = None else: setterName = b'set' + name[0].upper().encode('latin1') + name[1:].encode('latin1') + b':' signature = b'v@:' + self._typestr if self._setter is None: if self.__inherit: pass elif self._dynamic: dynSetterName = 'set' + name[0].upper() + name[1:] + '_' self.__setprop = _dynamic_setter(dynSetterName) instance_methods.add(setterName) else: if self._ivar is NULL: raise ValueError( "Cannot create default setter for property " "without ivar") setprop = selector( attrsetter(self._name, ivname, self._copy), selector=setterName, signature=signature ) setprop.isHidden = True instance_methods.add(setprop) # Use dynamic setter to avoid problems when subclassing self.__setprop = _dynamic_setter(_str(setterName)) else: setprop = selector( self._setter, selector=setterName, signature=signature ) setprop.isHidden = True instance_methods.add(setprop) # Use dynamic setter to avoid problems when subclassing self.__setprop = _dynamic_setter(_str(setterName)) if self._typestr in (_C_NSBOOL, _C_BOOL): getterName = b'is' + name[0].upper().encode('latin1') + name[1:].encode('latin1') else: getterName = self._name.encode('latin1') if self._getter is None: if self.__inherit: pass elif self._dynamic: if self._typestr in (_C_NSBOOL, _C_BOOL): dynGetterName = 'is' + name[0].upper() + name[1:] else: dynGetterName = self._name self.__getprop = _dynamic_getter(dynGetterName) instance_methods.add(getterName) else: if self._ivar is NULL: raise ValueError( "Cannot create default getter for property without ivar") self.__getprop = selector( attrgetter(ivname), selector=getterName, signature=self._typestr + b'@:') self.__getprop.isHidden=True instance_methods.add(self.__getprop) else: self.__getprop = getprop = selector( self._getter, selector=getterName, signature=self._typestr + b'@:') getprop.isHidden=True instance_methods.add(getprop) #self.__getprop = _dynamic_getter(getterName) if self._validate is not None: selName = b'validate' + self._name[0].upper().encode('latin') + self._name[1:].encode('latin') + b':error:' signature = _C_NSBOOL + b'@:N^@o^@' validate = selector( self._validate, selector=selName, signature=signature) class_dict[validate.selector] = validate instance_methods.add(validate) if self._depends_on: if self.__parent is not None: if self.__parent._depends_on: self._depends_on.update(self.__parent._depends_on.copy()) self._depends_on = self._depends_on affecting = selector( _return_value(NSSet.setWithArray_(list(self._depends_on))), selector = b'keyPathsForValuesAffecting' + self._name[0].upper().encode('latin1') + self._name[1:].encode('latin1'), signature = b'@@:', isClassMethod=True) class_dict[affecting.selector] = affecting class_methods.add(affecting) def __get__(self, object, owner): if object is None: return self return self.__getprop(object) def __set__(self, object, value): if self.__setprop is None: raise ValueError("setting read-only property " + self._name) return self.__setprop(object, value) def __delete__(self, object): raise TypeError("cannot delete property " + self._name) def depends_on(self, keypath): if self._depends_on is None: self._depends_on = set() self._depends_on.add(keypath) def getter(self, function): if self.__created: v = self._clone() v._getter = function return v self._getter = function return self def setter(self, function): if self.__created: v = self._clone() v._ro = False v._setter = function return v if self._ro: raise ValueError("Defining settter for read-only property") self._setter = function return self def validate(self, function): if self._ro: raise ValueError("Defining validator for read-only property") if self.__created: v = self._clone() v._validate = function return v self._validate = function return self class bool_property (object_property): def __init__(self, name=None, read_only=False, copy=False, dynamic=False, ivar=None, typestr=_C_NSBOOL): super(bool_property, self).__init__( name, read_only, copy, dynamic, ivar, typestr) NSIndexSet = lookUpClass('NSIndexSet') NSMutableIndexSet = lookUpClass('NSMutableIndexSet') NSKeyValueChangeSetting = 1 NSKeyValueChangeInsertion = 2 NSKeyValueChangeRemoval = 3 NSKeyValueChangeReplacement = 4 # Helper function for (not) pickling array_proxy instances # NOTE: Don't remove this function, it can be referenced from # pickle files. def _id(value): return value # FIXME: split into two: array_proxy and mutable_array_proxy class array_proxy (collections.MutableSequence): # XXX: The implemenation should be complete, but is currently not # tested. __slots__ = ('_name', '_parent', '__wrapped', '_ro') def __init__(self, name, parent, wrapped, read_only): self._name = name self._parent = parent self._ro = read_only self.__wrapped = wrapped @property def _wrapped(self): return self.__wrapped.__getvalue__(self._parent) def __indexSetForIndex(self, index): if isinstance(index, slice): result = NSMutableIndexSet.alloc().init() start, stop, step = index.indices(len(self._wrapped)) for i in range(start, stop, step): result.addIndex_(i) return result elif isinstance(index, (int, long)): if index < 0: v = len(self) + index if v < 0: raise IndexError(index) return NSIndexSet.alloc().initWithIndex_(v) else: return NSIndexSet.alloc().initWithIndex_(index) else: raise TypeError(index) def __repr__(self): return '<array proxy for property ' + self._name + ' ' + repr(self._wrapped) + '>' def __reduce__(self): # Ensure that the proxy itself doesn't get stored # in pickles. return _id, (self._wrapped,) def __getattr__(self, name): # Default: just defer to wrapped list return getattr(self._wrapped, name) def __len__(self): return self._wrapped.__len__() def __getitem__(self, index): return self._wrapped[index] def __setitem__(self, index, value): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) indexes = self.__indexSetForIndex(index) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeSetting, indexes, self._name) try: self._wrapped[index] = value finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) def __delitem__(self, index): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) indexes = self.__indexSetForIndex(index) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeRemoval, indexes, self._name) try: del self._wrapped[index] finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeRemoval, indexes, self._name) def append(self, value): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) index = len(self) indexes = NSIndexSet.alloc().initWithIndex_(index) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) try: self._wrapped.append(value) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) def insert(self, index, value): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) if isinstance(index, slice): raise TypeError("insert argument 1 is a slice") indexes = self.__indexSetForIndex(index) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) try: self._wrapped.insert(index, value) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) def pop(self, index=-1): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) if isinstance(index, slice): raise TypeError("insert argument 1 is a slice") indexes = self.__indexSetForIndex(index) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeRemoval, indexes, self._name) try: return self._wrapped.pop(index) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeRemoval, indexes, self._name) def extend(self, values): # XXX: This is suboptimal but correct if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) values = list(values) indexes = NSIndexSet.alloc().initWithIndexesInRange_((len(self), len(values))) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) try: self._wrapped.extend(values) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) def __iadd__(self, values): self.extend(values) return self def __add__(self, values): return self._wrapped + values def __mul__(self, count): return self._wrapped * count def __imul__(self, count): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) if not isinstance(count, (int, long)): raise TypeError(count) indexes = NSIndexSet.alloc().initWithIndexesInRange_((len(self), len(self)*(count-1))) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) try: self._wrapped.__imul__(count) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeInsertion, indexes, self._name) return self def __eq__(self, other): if isinstance(other, array_proxy): return self._wrapped == other._wrapped else: return self._wrapped == other def __ne__(self, other): if isinstance(other, array_proxy): return self._wrapped != other._wrapped else: return self._wrapped != other def __lt__(self, other): if isinstance(other, array_proxy): return self._wrapped < other._wrapped else: return self._wrapped < other def __le__(self, other): if isinstance(other, array_proxy): return self._wrapped <= other._wrapped else: return self._wrapped <= other def __gt__(self, other): if isinstance(other, array_proxy): return self._wrapped > other._wrapped else: return self._wrapped > other def __ge__(self, other): if isinstance(other, array_proxy): return self._wrapped >= other._wrapped else: return self._wrapped >= other if sys.version_info[0] == 2: def __cmp__(self, other): if isinstance(other, array_proxy): return cmp(self._wrapped, other._wrapped) else: return cmp(self._wrapped, other) if sys.version_info[0] == 2: def sort(self, cmp=None, key=None, reverse=False): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) indexes = NSIndexSet.alloc().initWithIndexesInRange_( (0, len(self._wrapped))) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) try: self._wrapped.sort(cmp=cmp, key=key, reverse=reverse) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) else: # pragma: no cover (py3k) def sort(self, key=None, reverse=False): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) indexes = NSIndexSet.alloc().initWithIndexesInRange_( (0, len(self._wrapped))) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) try: self._wrapped.sort(key=key, reverse=reverse) finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) def reverse(self): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) indexes = NSIndexSet.alloc().initWithIndexesInRange_( (0, len(self._wrapped))) self._parent.willChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) try: self._wrapped.reverse() finally: self._parent.didChange_valuesAtIndexes_forKey_( NSKeyValueChangeReplacement, indexes, self._name) def makeArrayAccessors(name): def countOf(self): return len(getattr(self, name)) def objectIn(self, idx): return getattr(self, name)[idx] def insert(self, value, idx): getattr(self, name).insert(idx, value) def replace(self, idx, value): getattr(self, name)[idx] = value def remove(self, idx): del getattr(self, name)[idx] return countOf, objectIn, insert, remove, replace class array_property (object_property): def __init__(self, name=None, read_only=False, copy=True, dynamic=False, ivar=None, depends_on=None): super(array_property, self).__init__(name, read_only=read_only, copy=copy, dynamic=dynamic, ivar=ivar, depends_on=depends_on) def __pyobjc_class_setup__(self, name, class_dict, instance_methods, class_methods): super(array_property, self).__pyobjc_class_setup__(name, class_dict, instance_methods, class_methods) # Insert (Mutable) Indexed Accessors # FIXME: should only do the mutable bits when we're actually a mutable property name = self._name Name = name[0].upper() + name[1:] countOf, objectIn, insert, remove, replace = makeArrayAccessors(self._name) countOf = selector(countOf, selector = ('countOf%s'%(Name,)).encode('latin1'), signature = _C_NSUInteger + b'@:', ) countOf.isHidden = True instance_methods.add(countOf) objectIn = selector(objectIn, selector = ('objectIn%sAtIndex:'%(Name,)).encode('latin1'), signature = b'@@:' + _C_NSUInteger, ) objectIn.isHidden = True instance_methods.add(objectIn) insert = selector(insert, selector = ('insertObject:in%sAtIndex:'%(Name,)).encode('latin1'), signature = b'v@:@' + _C_NSUInteger, ) insert.isHidden = True instance_methods.add(insert) remove = selector(remove, selector = ('removeObjectFrom%sAtIndex:'%(Name,)).encode('latin1'), signature = b'v@:' + _C_NSUInteger, ) remove.isHidden = True instance_methods.add(remove) replace = selector(replace, selector = ('replaceObjectIn%sAtIndex:withObject:'%(Name,)).encode('latin1'), signature = b'v@:' + _C_NSUInteger + b'@', ) replace.isHidden = True instance_methods.add(replace) def __set__(self, object, value): if isinstance(value, array_proxy): if value._name == self._name and value._parent is object: # attr.prop = attr.prop return if isinstance(value, array_proxy): value = list(value) super(array_property, self).__set__(object, value) def __get__(self, object, owner): v = object_property.__get__(self, object, owner) if v is None: v = list() object_property.__set__(self, object, v) return array_proxy(self._name, object, self, self._ro) def __getvalue__(self, object): v = object_property.__get__(self, object, None) if v is None: v = list() object_property.__set__(self, object, v) return v NSKeyValueUnionSetMutation = 1 NSKeyValueMinusSetMutation = 2 NSKeyValueIntersectSetMutation = 3 NSKeyValueSetSetMutation = 4 class set_proxy (collections.MutableSet): __slots__ = ('_name', '__wrapped', '_parent', '_ro') def __init__(self, name, parent, wrapped, read_only): self._name = name self._parent = parent self._ro = read_only self.__wrapped = wrapped def __repr__(self): return '<set proxy for property ' + self._name + ' ' + repr(self._wrapped) + '>' @property def _wrapped(self): return self.__wrapped.__getvalue__(self._parent) def __reduce__(self): # Ensure that the proxy itself doesn't get stored # in pickles. return _id, (self._wrapped,) def __getattr__(self, attr): return getattr(self._wrapped, attr) def __contains__(self, value): return self._wrapped.__contains__(value) def __iter__(self): return self._wrapped.__iter__() def __len__(self): return self._wrapped.__len__() def __eq__(self, other): if isinstance(other, set_proxy): return self._wrapped == other._wrapped else: return self._wrapped == other def __ne__(self, other): if isinstance(other, set_proxy): return self._wrapped != other._wrapped else: return self._wrapped != other def __lt__(self, other): if isinstance(other, set_proxy): return self._wrapped < other._wrapped else: return self._wrapped < other def __le__(self, other): if isinstance(other, set_proxy): return self._wrapped <= other._wrapped else: return self._wrapped <= other def __gt__(self, other): if isinstance(other, set_proxy): return self._wrapped > other._wrapped else: return self._wrapped > other def __ge__(self, other): if isinstance(other, set_proxy): return self._wrapped >= other._wrapped else: return self._wrapped >= other if sys.version_info[0] == 2: def __cmp__(self, other): raise TypeError('cannot compare sets using cmp()') def add(self, item): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, set([item]), ) try: self._wrapped.add(item) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, set([item]), ) def clear(self): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) object = set(self._wrapped) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, object ) try: self._wrapped.clear() finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, object ) def difference_update(self, *others): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) s = set() s.update(*others) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, s ) try: self._wrapped.difference_update(s) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, s ) def discard(self, item): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, {item} ) try: self._wrapped.discard(item) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, {item} ) def intersection_update(self, other): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) other = set(other) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueIntersectSetMutation, other ) try: self._wrapped.intersection_update(other) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueIntersectSetMutation, other ) def pop(self): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) try: v = next(iter(self)) except StopIteration: raise KeyError("Empty set") self.remove(v) return v def remove(self, item): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, set([item]) ) try: self._wrapped.remove(item) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, set([item]) ) def symmetric_difference_update(self, other): # NOTE: This method does not call the corresponding method # of the wrapped set to ensure that we generate the right # notifications. if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) other = set(other) to_add = set() to_remove = set() for o in other: if o in self: to_remove.add(o) else: to_add.add(o) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, to_remove ) try: self._wrapped.difference_update(to_remove) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueMinusSetMutation, to_remove ) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, to_add ) try: self._wrapped.update(to_add) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, to_add ) def update(self, *others): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) s = set() s.update(*others) self._parent.willChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, s ) try: self._wrapped.update(s) finally: self._parent.didChangeValueForKey_withSetMutation_usingObjects_( self._name, NSKeyValueUnionSetMutation, s ) def __or__(self, other): return self._wrapped | other def __and__(self, other): return self._wrapped & other def __xor__(self, other): return self._wrapped ^ other def __sub__(self, other): return self._wrapped - other def __ior__(self, other): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self.update(other) return self def __isub__(self, other): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self.difference_update(other) return self def __ixor__(self, other): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self.symmetric_difference_update(other) return self def __iand__(self, other): if self._ro: raise ValueError("Property '%s' is read-only"%(self._name,)) self.intersection_update(other) return self def makeSetAccessors(name): def countOf(self): return len(getattr(self, name)) def enumeratorOf(self): return iter(getattr(self, name)) def memberOf(self, value): collection = getattr(self, name) if value not in collection: return None for item in collection: if item == value: return item def add(self, value): getattr(self, name).add(value) def remove(self, value): getattr(self, name).discard(value) return countOf, enumeratorOf, memberOf, add, remove class set_property (object_property): def __init__(self, name=None, read_only=False, copy=True, dynamic=False, ivar=None, depends_on=None): super(set_property, self).__init__(name, read_only=read_only, copy=copy, dynamic=dynamic, ivar=ivar, depends_on=depends_on) def __get__(self, object, owner): v = object_property.__get__(self, object, owner) if v is None: v = set() object_property.__set__(self, object, v) return set_proxy(self._name, object, self, self._ro) def __set__(self, object, value): if isinstance(value, set_proxy): if value._name == self._name and value._parent is object: # attr.prop = attr.prop return if isinstance(value, set_proxy): value = list(value) super(set_property, self).__set__(object, value) def __getvalue__(self, object): v = object_property.__get__(self, object, None) if v is None: v = set() object_property.__set__(self, object, v) return v def __pyobjc_class_setup__(self, name, class_dict, instance_methods, class_methods): super(set_property, self).__pyobjc_class_setup__(name, class_dict, instance_methods, class_methods) # (Mutable) Unordered Accessors # FIXME: should only do the mutable bits when we're actually a mutable property name = self._name Name = name[0].upper() + name[1:] countOf, enumeratorOf, memberOf, add, remove = makeSetAccessors(self._name) countOf = selector(countOf, selector = ('countOf%s'%(Name,)).encode('latin1'), signature = _C_NSUInteger + b'@:', ) countOf.isHidden = True instance_methods.add(countOf) enumeratorOf = selector(enumeratorOf, selector = ('enumeratorOf%s'%(Name,)).encode('latin1'), signature = b'@@:', ) enumeratorOf.isHidden = True instance_methods.add(enumeratorOf) memberOf = selector(memberOf, selector = ('memberOf%s:'%(Name,)).encode('latin'), signature = b'@@:@', ) memberOf.isHidden = True instance_methods.add(memberOf) add1 = selector(add, selector = ('add%s:'%(Name,)).encode('latin'), signature = b'v@:@', ) add1.isHidden = True instance_methods.add(add1) add2 = selector(add, selector = ('add%sObject:'%(Name,)).encode('latin1'), signature = b'v@:@', ) add2.isHidden = True instance_methods.add(add2) remove1 = selector(remove, selector = ('remove%s:'%(Name,)).encode('latin1'), signature = b'v@:@', ) remove1.isHidden = True instance_methods.add(remove1) remove2 = selector(remove, selector = ('remove%sObject:'%(Name,)).encode('latin'), signature = b'v@:@', ) remove2.isHidden = True instance_methods.add(remove2) NSMutableDictionary = lookUpClass('NSMutableDictionary') class dict_property (object_property): def __get__(self, object, owner): v = object_property.__get__(self, object, owner) if v is None: v = NSMutableDictionary.alloc().init() object_property.__set__(self, object, v) return object_property.__get__(self, object, owner)
{ "repo_name": "ariabuckles/pyobjc-core", "path": "Lib/objc/_properties.py", "copies": "3", "size": "35435", "license": "mit", "hash": -5151348366853060000, "line_mean": 29.7062391681, "line_max": 136, "alpha_frac": 0.5395512911, "autogenerated": false, "ratio": 4.276490465846005, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0038890857272857442, "num_lines": 1154 }
"""Allocators determine which flights should be bundled in a formation.""" from lib.intervals import Interval, group from lib import sim, debug from lib.debug import print_line as p from models import Formation import config from lib.geo.segment import Segment class FormationAllocator(object): """Abstract Allocator. Creates one giant formation.""" def __init__(self): self.aircraft_queue = [] self.formations = [] def allocate(self, aircraft): # No filtering, put all aircraft in one big formation. self.formations = [self.aircraft_queue] def find_formation(self, aircraft): self.allocate(aircraft) """Finds the formation having the aircraft requested""" for formation in self.formations: if aircraft in formation: return formation raise Exception("No formation having %s found" % aircraft) def add_aircraft(self, aircraft): self.aircraft_queue.append(aircraft) def remove_aircraft(self, aircraft): try: self.aircraft_queue.remove(aircraft) except ValueError: p('Could not remove %s from queue because not present' % aircraft) class FormationAllocatorEtah(FormationAllocator): """Uses interval overlapping to group aircraft into formations""" def allocate(self, aircraft): p('debug', 'Starting formation allocation for %s' % aircraft) # Do not perform allocation if no hub exists in the flight route. if len(aircraft.route.segments) == 0: return self.formations = [] intervals = [] candidates = self.aircraft_queue hub = aircraft.route.waypoints[0] # This is bad. We don't want to filter anything. # @todo: pre-process at a higher level. # Only consider other aircraft flying to the same hub candidates = filter(lambda a: a.route.waypoints[0] is hub, candidates) p('debug', 'Full candidate set: %s' % candidates) # Only consider aircraft having a maximum heading difference between # the hub and their destination segment = Segment(aircraft.hub, aircraft.destination) leader_heading = segment.get_initial_bearing() def heading_filter(buddy): segment = Segment(buddy.hub, buddy.destination) buddy_heading = segment.get_initial_bearing() phi_obs = abs(leader_heading - buddy_heading) p( 'debug', 'delta phi observed for %s (phi: %.2f) against %s (phi: %.2f)' ': %.2f degrees' % ( aircraft, leader_heading, buddy, buddy_heading, phi_obs ) ) return phi_obs <= (config.phi_max/2) candidates = filter(heading_filter, candidates) # Other interesting filters if 'same-airline' in config.restrictions: airline = aircraft.label[0:2] candidates = filter(lambda a: a.label[0:2] == airline, candidates) if 'same-aircraft-type' in config.restrictions: aircraft_type = aircraft.aircraft_type candidates = filter(lambda a: a.aircraft_type == aircraft_type, candidates) p('debug', 'Reduced candidate set: %s' % candidates) for candidate in candidates: # Quick and dirty: recalc position. Instead, pull eta from var. candidate.controller.update_position() tth = candidate.time_to_waypoint() # time to hub hub_eta = sim.time + tth # From the moment the aircraft enters the lock area, the slack # decreases linearly to zero upon hub arrival. if tth < config.lock_time: slack = tth * config.etah_slack / config.lock_time else: slack = config.etah_slack p('Time = %s, Hub (= %s) eta %s for candidate %s' %\ (sim.time, hub, hub_eta, candidate)) intervals.append(Interval( candidate, int(hub_eta) - slack, int(hub_eta) + slack )) for interval_group in group(intervals): formation = Formation() for interval in interval_group: formation.append(interval.obj) self.formations.append(formation)
{ "repo_name": "mauzeh/formation-flight", "path": "formation_flight/formation/allocators.py", "copies": "1", "size": "4534", "license": "mit", "hash": -7763255979906869000, "line_mean": 36.1639344262, "line_max": 78, "alpha_frac": 0.5805028672, "autogenerated": false, "ratio": 4.1749539594843466, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5255456826684346, "avg_score": null, "num_lines": null }
''' AllocModel.py ''' from __future__ import division class AllocModel(object): ######################################################### Constructors ######################################################### def __init__(self, inferType): self.inferType = inferType def set_prior(self, **kwargs): pass ######################################################### Accessors ######################################################### def get_keys_for_memoized_local_params(self): ''' Return list of string names of the LP fields that this object needs to memoize across visits to a particular batch ''' return list() def requireMergeTerms(self): ''' Return boolean indicator for whether this model requires precomputed merge terms ''' return True ######################################################### Local Params ######################################################### def calc_local_params( self, Data, LP ): ''' ''' pass ######################################################### Suff Stats ######################################################### def get_global_suff_stats( self, Data, SS, LP ): ''' ''' pass ######################################################### Global Params ######################################################### def update_global_params( self, SS, rho=None, **kwargs ): ''' Update (in-place) global parameters for this allocation model object, given the provided suff stats object SS This is the M-step of EM/VB algorithm ''' self.K = SS.K if self.inferType == 'EM': self.update_global_params_EM(SS) elif self.inferType == 'VB' or self.inferType == "moVB": self.update_global_params_VB(SS, **kwargs) elif self.inferType == 'soVB': if rho is None or rho==1: self.update_global_params_VB(SS, **kwargs) else: self.update_global_params_soVB(SS, rho, **kwargs) else: raise ValueError( 'Unrecognized Inference Type! %s' % (self.inferType) ) ######################################################### Evidence ######################################################### def calc_evidence(self): pass ######################################################### IO Utils ######################################################### for humans def get_info_string( self): ''' Returns one-line human-readable terse description of this object ''' pass ######################################################### IO Utils ######################################################### for machines def to_dict_essential(self): PDict = dict(name=self.__class__.__name__, inferType=self.inferType) if hasattr(self,'K'): PDict['K'] = self.K return PDict def to_dict(self): pass def from_dict(self): pass def get_prior_dict(self): pass
{ "repo_name": "daeilkim/refinery", "path": "refinery/bnpy/bnpy-dev/bnpy/allocmodel/AllocModel.py", "copies": "1", "size": "2941", "license": "mit", "hash": -5028250390491278000, "line_mean": 30.9673913043, "line_max": 78, "alpha_frac": 0.4243454607, "autogenerated": false, "ratio": 4.959527824620573, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5883873285320573, "avg_score": null, "num_lines": null }
# All of Django's wonderful imports from django.shortcuts import render_to_response, redirect, HttpResponse from django.template import RequestContext from django.conf import settings from django.core.exceptions import ObjectDoesNotExist from django.template.defaultfilters import slugify from django.template.loader import render_to_string from django import template from django.contrib.auth.decorators import login_required from django.contrib.sites.models import Site from django.utils.hashcompat import sha_constructor from django.core.files.uploadedfile import UploadedFile from django.utils.encoding import force_unicode, smart_str # Imports from this app and other SPC apps from scipy_central.person.views import create_new_account_internal from scipy_central.filestorage.models import FileSet from scipy_central.tagging.views import get_and_create_tags from scipy_central.utils import (send_email, paginated_queryset, highlight_code, ensuredir) from scipy_central.rest_comments.views import compile_rest_to_html from scipy_central.pages.views import page_404_error from scipy_central.pagehit.views import create_hit, get_pagehits from scipy_central.submission.templatetags.core_tags import top_authors import models import forms # Python imports from hashlib import md5 from collections import namedtuple import random import logging import os import re import datetime import shutil import zipfile import tempfile import mimetypes; mimetypes.init() from pygments.lexers import guess_lexer_for_filename from pygments.util import ClassNotFound logger = logging.getLogger('scipycentral') logger.debug('Initializing submission::views.py') def get_items_or_404(view_function): """ Decorator for views that ensures the revision and submission requested actually exist. If not, throws a 404, else, it calls the view function with the required inputs. """ def decorator(request, item_id, rev_id=None, slug=None, filename=None): """Retrieves the ``Submission`` and ``Revision`` objects when given, at a minimum the submission's primary key (``item_id``). Since the submission can have more than 1 revision, we can get a specific revision, ``rev_id``, otherwise we will always get the latest revision. ``slug`` is ignored for now - just used to create good SEO URLs. """ try: # Use the Submissions manager's ``all()`` function the_submission = models.Submission.objects.all().filter(id=item_id) except ObjectDoesNotExist: return page_404_error(request, 'You request a non-existant item') if len(the_submission) == 0: return page_404_error(request, 'This item does not exist yet') the_submission = the_submission[0] the_revision = the_submission.last_revision if rev_id: # can be None or '': all_revisions = the_submission.revisions.all() rev_index = int(rev_id)-1 if rev_index < 0: rev_index = len(all_revisions)-1 try: the_revision = all_revisions[rev_index] except (ValueError, IndexError): return page_404_error(request, ('The requested revision is ' 'non-existant.')) # Don't return revisions that are not approved for display yet if not isinstance(the_revision, models.Revision) or\ not(the_revision.is_displayed): return page_404_error(request, "That revision isn't available yet.") # Is the URL of the form: "..../NN/MM/edit"; if so, then edit the item path_split = request.path.split('/') if len(path_split)>4 and path_split[4] in ['edit', 'download', 'show']: if path_split[4] == 'show' and len(path_split)>=6: return view_function(request, the_submission, the_revision, filename=path_split[5:]) else: return view_function(request, the_submission, the_revision) # Is the URL not the canonical URL for the item? .... redirect the user else: if rev_id is None: rev_id_str = '0' do_redirect = True else: rev_id_str = str(the_revision.rev_id+1) do_redirect = False if slug is None or the_revision.slug != slug or do_redirect: return redirect('/'.join(['/item', item_id, rev_id_str, the_revision.slug]), permanent=True) return view_function(request, the_submission, the_revision) return decorator def get_form(request, form_class, field_order, bound=False): """ Generic function. Used for all submission types. Specify the ``form_class`` that's given in ``forms.py``. The ``field_order`` is a list of strings that indicates the linear order of the fields in the form. A ``bound`` form is a function of the object assigned to ``bound`` (see below). An unbound form is simply an empty form. """ if bound: if isinstance(bound, models.Revision): tags = ','.join([str(tag) for tag in bound.tags.all()]) fields = {'item_url': bound.item_url, 'title': bound.title, 'description': bound.description, 'sub_tags': tags, 'snippet_code': bound.item_code, 'sub_type': 'snippet', 'sub_license': bound.sub_license_id, } if bound.entry.sub_type == 'link': fields['sub_type'] = 'link' elif bound.entry.sub_type == 'package': fields['sub_type'] = 'package' elif bound.entry.sub_type == 'code': fields['sub_type'] = 'snippet' form_output = form_class(fields) else: if request.POST['sub_type'] == 'package': # Create a fake "UploadedFile" object, so the user can resume # editing or finish their submission, without being told # they have to reenter this field. zip_hash = request.POST.get('package_hash', '') zip_file = models.ZipFile.objects.filter(zip_hash=zip_hash) if zip_file: zip_name = zip_file[0].raw_zip_file.name uploaded_file = UploadedFile(zip_name, name=zip_name, content_type='application/zip', size=zip_file[0].raw_zip_file.size) uploaded_file.skip_validation = True # see ``forms.py`` request.FILES['package_file'] = uploaded_file form_output = form_class(request.POST, request.FILES) if request.POST['sub_type'] == 'package' and zip_file: form_output.fields['package_file'].initial = uploaded_file else: form_output = form_class() # Rearrange the form order form_output.fields.keyOrder = field_order index = 1 for field_name, field in form_output.fields.iteritems(): field.widget.attrs['tabindex'] = str(index) index += 1 if request.user.is_authenticated(): # Email field not required for signed-in users form_output.fields.pop('email') return form_output def create_or_edit_submission_revision(request, item, is_displayed, user, submission=None, commit=False): """ Creates a new ``Submission`` (only if not given) and ``Revision`` instances. Returns these in a tuple. """ # NOTE: the ``user`` will always be a valid entry in our database. Code # posted by users that have not yet validated themselves is not displayed # until they do so. new_submission = False if submission is None: # A new submission new_submission = True submission = models.Submission.objects.create_without_commit( created_by=user, sub_type=item.cleaned_data['sub_type']) sub = submission # Process any tags tag_list = get_and_create_tags(item.cleaned_data['sub_tags']) # Create a ``Revision`` instance. Must always have a ``title``, # ``created_by``, and ``description`` fields; the rest are set according # to the submission type, ``sub.sub_type`` hash_id = '' if sub.sub_type == 'link': sub_license = None item_url = item.cleaned_data['item_url'] item_code = None elif sub.sub_type == 'snippet': sub_license = item.cleaned_data['sub_license'] item_url = None item_code = item.cleaned_data['snippet_code'] elif sub.sub_type == 'package': sub_license = item.cleaned_data['sub_license'] item_url = None item_code = None # Handle the ZIP file more completely only when the user commits. # ZIP file has been validated: OK to save it to the server # However, this might be the second time around, so skip saving it # (happens after preview, or if user resumes editing submission) if not hasattr(request.FILES['package_file'], 'skip_validation'): zip_f = models.ZipFile(raw_zip_file=request.FILES['package_file'], zip_hash=request.POST.get('package_hash', '')) zip_f.save() # Convert the raw ReST description to HTML using Sphinx: could include # math, paragraphs, <tt>, bold, italics, bullets, hyperlinks, etc. description_html = compile_rest_to_html(item.cleaned_data['description']) item_highlighted_code = highlight_code(item.cleaned_data.get(\ 'snippet_code', None)) rev = models.Revision.objects.create_without_commit( entry=sub, title=item.cleaned_data['title'], created_by=user, sub_license=sub_license, description=item.cleaned_data['description'], description_html=description_html, hash_id=hash_id, item_url=item_url, item_code=item_code, item_highlighted_code=item_highlighted_code, is_displayed=is_displayed, ) user_url = settings.SPC['short_URL_root'] + 'user/' + str(user.id) if commit: # Save the submission, then the revision. If we are editing a # previous submission, then do not save the submission # (because the Submission object has fields that will never # change once it has been first created). if new_submission: # Sets the primary key sub.save() rev.entry_id = sub.id if not is_displayed: rev.validation_hash = create_validation_code(rev) rev.save() # Storage location: if we do save files it will be here datenow = datetime.datetime.now() year, month = datenow.strftime('%Y'), datenow.strftime('%m') repo_path = os.path.join(year, month, '%06d'% sub.id) full_repo_path = os.path.join(settings.SPC['storage_dir'], repo_path) if sub.sub_type == 'package': # Save the uploaded file to the server. At this point we are sure # it's a valid ZIP file, has no malicious filenames, and can be # unpacked to the hard drive. See validation in ``forms.py``. if os.path.exists(full_repo_path) and sub.fileset.repo_path == \ repo_path: # Make a temporary directory and copy the existing package # repository to that location temp_dir = tempfile.mkdtemp(prefix='tmp_spc_') src = os.path.join(full_repo_path, '.' + \ settings.SPC['revisioning_backend']) shutil.move(src, temp_dir) shutil.rmtree(full_repo_path, ignore_errors=True) else: temp_dir = None # Create/ensure destination directory exists ensuredir(full_repo_path) # Copy ZIP file zip_file = request.FILES['package_file'] dst = os.path.join(full_repo_path, zip_file.name) src = os.path.join(settings.MEDIA_ROOT, settings.SPC['ZIP_staging'], zip_file.name) shutil.copyfile(src, dst) # os.remove(src) Keep the original ZIP file, for now # Remove the entry from the database zip_hash = request.POST.get('package_hash', '') zip_objs = models.ZipFile.objects.filter(zip_hash=zip_hash) if zip_objs: zip_objs[0].delete() # Unzip file and commit contents to the repo zip_f = zipfile.ZipFile(dst, 'r') zip_f.extractall(full_repo_path) zip_f.close() os.remove(dst) # but delete the copy # Delete common RCS directories that might have been in the ZIP for path, dirs, files in os.walk(full_repo_path): if os.path.split(path)[1] in settings.SPC['common_rcs_dirs']: shutil.rmtree(path, ignore_errors=True) if temp_dir: src = os.path.join(temp_dir, '.' + \ settings.SPC['revisioning_backend']) dst = os.path.join(full_repo_path , '.' + \ settings.SPC['revisioning_backend']) try: os.rename(src, dst) except os.error, e: # For cases when /tmp is on a different filesystem # (usually production servers) import errno if e.errno == errno.EXDEV: shutil.copytree(src, dst, symlinks=True) shutil.rmtree(src) else: raise shutil.rmtree(temp_dir, ignore_errors=True) repo = sub.fileset.get_repo() else: # Create the repo sub.fileset = FileSet.objects.create(repo_path=repo_path) repo = sub.fileset.create_empty() sub.save() # Then add all files from the ZIP file to the repo. Add directories # at a time rather than file-by-file. for path, dirs, files in os.walk(full_repo_path): if os.path.split(path)[1] == '.' + \ settings.SPC['revisioning_backend']: for entry in dirs[:]: dirs.remove(entry) continue all_files = [] for name in files: all_files.append(os.path.join(path, name)) if all_files: repo.add(patterns=all_files, ignore_errors=True) # Add "DESCRIPTION.txt" descrip_name = os.path.join(full_repo_path, 'DESCRIPTION.txt') descrip_file = file(descrip_name, 'w') descrip_file.write(rev.description) descrip_file.close() sub.fileset.add_file(descrip_name, user=user_url, commit_msg=('Added/updated files from web-uploaded ' 'ZIP file. Added DESCRIPTION.txt also.')) if sub.sub_type == 'snippet': fname = rev.slug.replace('-', '_') + '.py' if new_submission: # Create a new repository for the files sub.fileset = FileSet.objects.create(repo_path=repo_path) sub.save() commit_msg = ('Add "%s" to the repo ' 'based on the web submission by user "%s"') %\ (fname, user_url) else: commit_msg = ('Update of file(s) in the repo ' 'based on the web submission by user "%s"') %\ (user_url) sub.fileset.add_file_from_string(fname, request.POST['snippet_code'], user=user_url, commit_msg=commit_msg) if sub.sub_type in ['snippet', 'package']: license_file = settings.SPC['license_filename'] license_text = get_license_text(rev) sub.fileset.add_file_from_string(license_file, license_text, user="SciPy Central", commit_msg="SPC: added/updated license file" ) rev.hash_id = sub.fileset.get_hash() # Once you have the revision you can add tags through the intermediate # model instance (which tracks the user that added the tag and when). for tag in tag_list: tag_intermediate = models.TagCreation(created_by=user, revision=rev, tag=tag) tag_intermediate.save() logger.debug('User "%s" added tag "%s" to rev.id=%d' % ( user.profile.slug, str(tag), rev.id)) # Update the search index so that the tags are included in the search rev.save() # log the new submission and revision logger.info('New %s: %s [id=%d] and revision id=%d' % ( sub.sub_type, item.cleaned_data['title'], sub.id, rev.id)) return sub, rev, tag_list #------------------------------------------------------------------------------ # Licensing def get_license_text(rev): """ Generates and returns the license text for the given revision. Uses these revision and authorship information from previous revisions, if necessary, to create the license. """ # See http://wiki.creativecommons.org/CC0_FAQ for all the details if rev.entry.num_revisions > 1: update_list = ['', 'Subsequent updates by:'] else: update_list = [] for idx, item in enumerate(rev.entry.revisions.all()): if idx > 0: url = settings.SPC['short_URL_root'] + 'user/' url += str(item.created_by.id) + '/' date = datetime.datetime.strftime(item.date_created, '%d %B %Y') update_list.append('%s on %s' % (url, date)) update_string = '\n'.join(update_list) if rev.sub_license.slug == 'cc0': return """%s ----- Originally written on %s by %s %s To the extent possible under law, the author(s) have dedicated all copyright and related and neighboring rights to this software to the public domain worldwide. This software is distributed without any warranty. You should have received a copy of the CC0 Public Domain Dedication along with this software (see below). Also see http://creativecommons.org/publicdomain/zero/1.0/ ----- %s """ % \ (rev.title, datetime.datetime.strftime(rev.entry.date_created, '%d %B %Y'), settings.SPC['short_URL_root'] + 'users/' +\ rev.entry.created_by.profile.slug, update_string, rev.sub_license.text_template) if rev.sub_license.slug == 'bsd': creator_url = settings.SPC['short_URL_root'] + 'user/' + \ str(rev.created_by.id) + '/' text = ('{{title}}\n' 'Copyright holder: {{copyright_holder}} (full details at this page)\n' '-----\n') + rev.sub_license.text_template context = {} context['title'] = rev.title context['copyright_holder'] = creator_url context['year'] = datetime.datetime.now().year resp = template.Template(text) return resp.render(template.Context(context)) #------------------------------------------------------------------------------ # All submissions: have a form associated with them, as well as a number of # fields that must appear in a certain order Item = namedtuple('Item', 'form field_order') SUBS = {'snippet': Item(forms.SnippetForm, field_order=['title', 'snippet_code', 'description', 'sub_tags', 'sub_license', 'email', 'sub_type']), 'package': Item(forms.PackageForm, field_order=['title', 'description', 'sub_license', 'package_file', 'package_hash', 'sub_tags', 'email', 'sub_type']), 'link': Item(forms.LinkForm, field_order=['title', 'description', 'item_url', 'sub_tags', 'email', 'sub_type']), } def new_or_edit_submission(request, item_type, bound_form=False, submission=None): """ Users wants to submit a new link item, or continue editing a submission. There are multiple possible paths through the logic here. Careful about making changes. """ # User is going to edit their submission sub_type = None if isinstance(bound_form, models.Revision): new_item_or_edit = True sub_type = bound_form.entry.sub_type # for later on... # Cancel button, or a GET request elif request.POST.has_key('spc-cancel'): return redirect('spc-main-page') else: new_item_or_edit = False commit = False if request.POST.has_key('spc-edit'): new_item_or_edit = True bound_form = True if request.POST.has_key('spc-submit'): bound_form = True commit = True if request.POST.has_key('spc-preview'): bound_form = True buttontext_extra = '' if item_type == 'snippet' and request.method == 'GET': itemtype = 'snippet' new_item_or_edit = True elif item_type == 'package' and request.method == 'GET': itemtype = 'package' buttontext_extra = '(Upload ZIP file on next page)' new_item_or_edit = True #return not_implemented_yet(request, 48) elif item_type == 'link' and request.method == 'GET': itemtype = 'link' new_item_or_edit = True else: itemtype = request.POST.get('sub_type', sub_type) # Important: make a copy of ``field_order``, since it may be altered field_order = SUBS[itemtype].field_order[:] theform = get_form(request, form_class=SUBS[itemtype].form, field_order=field_order, bound=bound_form) # OK, having all that out of the way, lets process the user's submission # 0. Use the built-in forms checking to validate the fields. if new_item_or_edit or not(theform.is_valid()): return render_to_response('submission/new-item.html', {}, context_instance=RequestContext(request, {'item': theform, 'buttontext': 'Preview your submission', 'buttontext_extra': buttontext_extra, 'autocomplete_field': 'id_sub_tags', 'autocomplete_url': r'"spc-tagging-ajax"', 'pagetitle': 'Create a new submission'})) # 1. Create user account, if required if request.user.is_authenticated(): user = request.user authenticated = True else: user = create_new_account_internal(\ theform.cleaned_data['email']) authenticated = False # 2. Create the submission and revision or update an existing submission # with a new revision _, rev, tag_list = create_or_edit_submission_revision(request, item=theform, is_displayed=authenticated, user=user, submission=submission, commit=commit) # i.e. just previewing ... if not(commit): # 3. Create a Cancel/Edit/Submit form via a template to account for # hyperlinks and CSRF context = RequestContext(request) context['item'] = theform context['finish_button_text'] = 'Finish submission' # %% is required in below string to correctly format html = ("""<div id="spc-preview-edit-submit" class="spc-form"> <form action="{%% url spc-new-submission item_type='%s' %%}" method="POST" enctype="multipart/form-data">\n {%% csrf_token %%}\n {{item.as_hidden}} <div id="spc-preview-edit-submit-button-group"> <input class="btn btn-primary" type="submit" name="spc-cancel" value="Cancel" id="spc-item-cancel" />\n <input class="btn btn-primary" type="submit" name="spc-edit" value="Resume editing" id="spc-item-edit" />\n <input class="btn btn-success" type="submit" name="spc-submit" value="{{ finish_button_text }}" id="spc-item-submit"/>\n </div></form></div>""" % itemtype) resp = template.Template(html) extra_html = resp.render(template.Context(context)) return render_to_response('submission/item.html', {}, context_instance=RequestContext(request, {'item': rev, 'tag_list': tag_list, 'extra_html': extra_html, 'preview': True, })) else: # 4. Thank user and return with any extra messages, and send an email ctx_dict = {'user': user, 'item': rev, 'site': Site.objects.get_current() } # User is signed in if authenticated: show_url = True extra_messages = 'A confirmation email has been sent to you.' message = render_to_string('submission/email_user_thanks.txt', ctx_dict) else: show_url = False extra_messages = ('You have been sent an email to ' '<i>confirm your submission</i> and to create ' 'an account (if you do not have one ' 'already). <p>Unconfirmed submissions ' 'cannot be accepted, and <b>will be ' 'deleted</b> after %d days. Please sign in ' 'to avoid having to confirm your ' 'valuable submissions in the future.') % \ settings.SPC['unvalidated_subs_deleted_after'] # User is not signed in, but they have validated their email address if user.profile.is_validated: message = render_to_string(\ 'submission/email_validated_user_unvalidated_submission.txt', ctx_dict) else: # User is told they first need to create account before their # submission shows in the website message = render_to_string(\ 'submission/email_unvalidated_user_unvalidated_submission.txt', ctx_dict) send_email((user.email,), ("Thank you for your contribution " "to SciPy Central"), message=message) message = render_to_string('submission/email_website_admin.txt', ctx_dict) send_email((settings.SERVER_EMAIL,), ('A new/edited submission was ' 'made on SciPy Central'), message=message) return render_to_response('submission/thank-user.html', ctx_dict, context_instance=RequestContext(request, {'extra_message': extra_messages, 'show_url': show_url})) def create_validation_code(revision): """ From BSD licensed code, James Bennett https://bitbucket.org/ubernostrum/django-registration/src/58eef8330b0f/ registration/models.py """ salt = sha_constructor(str(random.random())).hexdigest()[:5] slug = revision.slug if isinstance(slug, unicode): slug = slug.encode('utf-8') return sha_constructor(salt+slug).hexdigest() @login_required def validate_submission(request, code): """ Validate a submission (via an emailed link to the user). From BSD licensed code, James Bennett https://bitbucket.org/ubernostrum/django-registration/src/58eef8330b0f/registration/models.py """ SHA1_RE = re.compile('^[a-f0-9]{40}$') if SHA1_RE.search(code): try: rev = models.Revision.objects.get(validation_hash=code) except ObjectDoesNotExist: return page_404_error(request, ('That validation code was invalid' ' or used already.')) rev.is_displayed = True rev.validation_hash = None rev.save() return redirect(rev.get_absolute_url()) else: return page_404_error(request, ('That validation code is invalid.')) #------------------------------------------------------------------------------ # View and download existing submissions: @get_items_or_404 def view_item(request, submission, revision): """ Shows a submitted item to web users. The ``slug`` is always ignored, but appears in the URLs for the sake of search engines. The revision, if specified >= 0 will show the particular revision of the item, rather than the latest revision (default). """ create_hit(request, submission) permalink = settings.SPC['short_URL_root'] + str(submission.id) + '/' + \ str(revision.rev_id+1) + '/' latest_link = settings.SPC['short_URL_root'] + str(submission.id) + '/' pageviews = get_pagehits('submission', start_date=datetime.datetime.now()\ -datetime.timedelta(days=settings.SPC['hit_horizon']), item_pk=submission.id) package_files = [] if submission.sub_type == 'package': # Update the repo to the version required submission.fileset.checkout_revision(revision.hash_id) package_files = list(submission.fileset.list_iterator()) return render_to_response('submission/item.html', {}, context_instance=RequestContext(request, {'item': revision, 'tag_list': revision.tags.all(), 'permalink': permalink, 'latest_link': latest_link, 'pageviews': pageviews, 'pageview_days': settings.SPC['hit_horizon'], 'package_files': package_files, })) def get_display(submission, revision, filename): """ Determines how to display a filetype, given its name """ fname = filename[-1] mime_guess = mimetypes.guess_type(fname)[0] mime_type, mime_file = mime_guess.split('/') # Set the repo to the correct revision repo = submission.fileset.checkout_revision(revision.hash_id) src = os.path.join(repo.local_dir, *filename) if str(mime_type).startswith('image'): # We only dislay certain image types VALID_IMAGE_TYPES = ['gif', 'jpeg', 'png', 'bmp'] if mime_file in VALID_IMAGE_TYPES: disp_type = 'image' # Copy image over to media location; we must make a copy, incase # a later user views a different revision of the document dirname = force_unicode(datetime.datetime.now().strftime( smart_str(settings.SPC['resized_image_dir']))) disp_obj = os.path.normpath(os.path.join(dirname, fname)) dst = os.path.join(settings.SPC['storage_dir'], disp_obj) idx = 1 while os.path.exists(dst): disp_obj = disp_obj.split(fname)[0] + '%s_%d.%s' % \ (fname.lower().split('.'+mime_file)[0], idx, mime_file) dst = os.path.join(settings.SPC['storage_dir'], disp_obj) idx += 1 # Finally, copy the file across to the web storage area shutil.copy2(src, dst) return disp_type, disp_obj if not repo: # Something went wrong when checking out the repo logger.error('Could not checked out revision "%s" for ' 'rev.id=%d' % (revision.hash_id, revision.id)) return 'none', None if str(mime_type).startswith('text'): # Read the first 10kb to send to the lexer guessing mechanism if os.path.exists(src): fh = open(src, 'rb') file_content = fh.readlines(10*1024) amount_read = fh.tell() fh.close() else: return 'none', None try: lexer = guess_lexer_for_filename(fname.lower(), ''.join(file_content)) except ClassNotFound: pass else: disp_type = 'html' # Only re-read the file if we didn't read it all the first time if os.path.getsize(src) == amount_read: file_content = ''.join(file_content) else: fh = open(src, 'rb') file_content = fh.read() fh.close() # TODO(KGD): consider wrapping long text lines for text files # Return the highlighted code, if we know the lexer return disp_type, highlight_code(file_content, lexer=lexer.mimetypes[0]) # All other file types are assumed to be binary disp_type = 'binary' #disp_obj = link to file (add this capability to ``FileSet``) return disp_type, disp_obj @get_items_or_404 def show_file(request, submission, revision, filename): """ Display a ``filename`` from a given ``submission`` and ``revision`` """ key_parts = [str(submission.id), str(revision.id)] key_parts.extend(filename) key = md5('-'.join(key_parts)).hexdigest() display = models.DisplayFile.objects.filter(fhash=key) if display: # Get the displayed item from the database rather than checking out # the repository, determining the file type and HTML to display obj = display[0] else: # Create the displayed item and store it in the database disp_type, disp_obj = get_display(submission, revision, filename) obj = models.DisplayFile.objects.create(fhash=key, display_type=disp_type, display_obj=disp_obj) # Now return ``obj`` if obj.display_type == 'image': return HttpResponse(u'<img = ...') elif obj.display_type == 'html': return HttpResponse(obj.display_obj) elif obj.display_type == 'binary': return HttpResponse(u'<a href="%s">%s</a>' % (obj.display_obj, filename[-1])) elif obj.display_type == 'none': return HttpResponse(filename[-1]) @get_items_or_404 def download_submission(request, submission, revision): create_hit(request, submission, extra_info="download") if submission.sub_type == 'snippet': response = HttpResponse(mimetype="application/x-python") fname = submission.slug.replace('-', '_') + '.py' response["Content-Disposition"] = "attachment; filename=%s" % fname source = Site.objects.get_current().domain + \ submission.get_absolute_url() response.write('# Source: ' + source + '\n\n' + revision.item_code) return response if submission.sub_type == 'package': zip_dir = os.path.join(settings.MEDIA_ROOT, settings.SPC['ZIP_staging'], 'download') ensuredir(zip_dir) response = HttpResponse(mimetype="attachment; application/zip") zip_name = '%s-%d-%d.zip' % (submission.slug, submission.id, revision.rev_id_human) response['Content-Disposition'] = 'filename=%s' % zip_name full_zip_file = os.path.join(zip_dir, zip_name) if not os.path.exists(full_zip_file): # Set the repo's state to the state when that particular revision # existed out = submission.fileset.checkout_revision(revision.hash_id) if out: logger.info('Checked out revision "%s" for rev.id=%d' % \ (revision.hash_id, revision.id)) else: logger.error('Could not checked out revision "%s" for ' 'rev.id=%d' % (revision.hash_id, revision.id)) return page_404_error(request, ('Could not create the ZIP ' 'file. This error has been ' 'reported.')) zip_f = zipfile.ZipFile(full_zip_file, "w", zipfile.ZIP_DEFLATED) src_dir = os.path.join(settings.SPC['storage_dir'], submission.fileset.repo_path) for path, dirs, files in os.walk(src_dir): for name in files: file_name = os.path.join(path, name) file_h = open(file_name, "r") zip_f.write(file_name, file_name.partition(src_dir)[2]) file_h.close() for file_h in zip_f.filelist: file_h.create_system = 0 zip_f.close() # Return the repo checkout back to the most recent revision out = submission.fileset.checkout_revision(submission.\ last_revision.hash_id) # Return the ZIP file zip_data = open(full_zip_file, "rb") response.write(zip_data.read()) zip_data.close() return response #------------------------------------------------------------------------------ # Editing submissions: decorator order is important! @login_required @get_items_or_404 def edit_submission(request, submission, revision): if submission.sub_type in ['link', 'package'] and \ request.user != submission.created_by: return page_404_error(request, ('You are not authorized to edit that ' 'submission. Only the original author ' 'may edit it.')) # if by POST, we are in the process of editing, so don't send the revision if request.POST: return new_or_edit_submission(request, submission.sub_type, bound_form=False, submission=submission) else: return new_or_edit_submission(request, submission.sub_type, bound_form=revision, submission=submission) #------------------------------------------------------------------------------ def sort_items_by_page_views(all_items, item_module_name): # TODO(KGD): Cache this reordering of ``items`` for a period of time today = datetime.datetime.now() start_date = today - datetime.timedelta(days=settings.SPC['hit_horizon']) page_order = get_pagehits(item_module_name, start_date=start_date, end_date=today) page_order.sort(reverse=True) #``page_order`` is a list of tuples; the 2nd entry in each tuple is the # primary key, that must exist in ``items_pk``. all_items = list(all_items) items_pk = [item.pk for item in all_items] entry_order = [] count_list = [] for count, pk in page_order: try: idx = items_pk.index(pk) except ValueError: pass else: items_pk[idx] = None entry_order.append(all_items[idx]) count_list.append(count) # Items that have never been viewed get added to the bottom: for idx, pk in enumerate(items_pk): if pk is not None: entry_order.append(all_items[idx]) count_list.append(0) return entry_order, count_list def show_items(request, what_view='', extra_info=''): """ Show different views onto all **revision** items (not submissions) """ what_view = what_view.lower() extra_info = extra_info.lower() entry_order = [] page_title = '' template_name = 'submission/show-entries.html' if what_view == 'tag': all_revs = models.Revision.objects.most_recent().\ filter(tags__slug=slugify(extra_info)) page_title = 'All entries tagged' entry_order = list(all_revs) elif what_view == 'show' and extra_info == 'all-tags': page_title = 'All tags' template_name = 'submission/show-tag-cloud.html' elif what_view == 'show' and extra_info == 'all-revisions': # Show all submissions in reverse time order all_revs = models.Revision.objects.all().order_by('-date_created') page_title = 'All revisions' extra_info = '' entry_order = list(all_revs) elif what_view == 'show' and extra_info == 'all-unique-revisions': all_subs = models.Submission.objects.all().order_by('-date_created') page_title = 'All submissions' extra_info = ' (only showing the latest revision)' entry_order = [sub.last_revision for sub in all_subs if sub.last_revision.is_displayed] elif what_view == 'sort' and extra_info == 'most-viewed': page_title = 'All submissions in order of most views' extra_info = '' all_subs = set() for rev in models.Revision.objects.all(): all_subs.add(rev.entry) entry_order, _ = sort_items_by_page_views(all_subs, 'submission') entry_order = [entry.last_revision for entry in entry_order] elif what_view == 'show' and extra_info == 'top-contributors': page_title = 'Top contributors' extra_info = '' entry_order = top_authors('', 0) elif what_view == 'validate': return validate_submission(request, code=extra_info) entries = paginated_queryset(request, entry_order) return render_to_response(template_name, {}, context_instance=RequestContext(request, {'entries': entries, 'page_title': page_title, 'extra_info': extra_info, 'what_view' : what_view,}))
{ "repo_name": "oswalpalash/OctaveCodeShare", "path": "scipy_central/submission/views.py", "copies": "1", "size": "44356", "license": "bsd-3-clause", "hash": -5858101192499315000, "line_mean": 42.4011741683, "line_max": 101, "alpha_frac": 0.5369510326, "autogenerated": false, "ratio": 4.40695479384004, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.544390582644004, "avg_score": null, "num_lines": null }
__all__ = ['Offset'] import os import sys import mmap import struct class Offset(object): ''' Offset is class that finds out position of row at given index ''' def __init__(self, sstable, t, path=None): self.sstable = sstable self.t = t self.mm = None self.f = None def __getitem__(self, i): return self._read_sstable_pos(i) def get_path(self): filename = 'offset-%s.data' % self.t path = os.path.join(self.sstable.table.get_path(), filename) return path def open(self): ''' Open file for reading. ''' self.f = open(self.get_path(), 'r+b') self.mm = mmap.mmap(self.f.fileno(), 0) def close(self): ''' Open file for reading. ''' self.mm.close() self.f.close() def w_open(self): ''' Open file for writing. ''' self.f = open(self.get_path(), 'wb') def w_close(self): ''' Close file for writing. ''' self.f.close() def _read_sstable_pos(self, i): offset_pos = i * 8 sstable_pos, = struct.unpack_from('!Q', self.mm, offset_pos) return sstable_pos def _write_sstable_pos(self, sstable_pos): pos_blob = struct.pack('!Q', sstable_pos) self.f.write(pos_blob)
{ "repo_name": "yadb/yadb", "path": "backup/store/offset.py", "copies": "1", "size": "1356", "license": "mit", "hash": 753632426339009200, "line_mean": 21.6166666667, "line_max": 68, "alpha_frac": 0.5221238938, "autogenerated": false, "ratio": 3.476923076923077, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.949248131415742, "avg_score": 0.0013131313131313133, "num_lines": 60 }
"""All of our database stuff. """ import sqlite3 import os # Makes/opens database relative to this file. db_path = os.path.join(os.path.dirname(os.path.realpath(__file__)), "wrestlers.db3") conn = sqlite3.connect(db_path) cursor = conn.cursor() # When we first init this module, create what we need. cursor.execute("""CREATE TABLE IF NOT EXISTS wrestlers ( name text NOT NULL UNIQUE, brawn integer, finesse integer, wins integer, losses integer );""") conn.commit() def cleanup(): """Call when it's time to close and cleanup the database. """ cursor.close() conn.close() def create_wrestler(**stats): """Create a new wrestler in the database. """ try: cursor.execute( """INSERT INTO wrestlers VALUES ('{0[name]}', {0[brawn]}, {0[finesse]}, {0[wins]}, {0[losses]}) """.format(stats)) conn.commit() except sqlite3.IntegrityError as err: # reraise error so that external things don't need to know about # the database error types. raise ValueError("Wrestler already exists: %s" % err) def update_wrestler(**stats): """Create a new wrestler in the database. """ try: cursor.execute( """UPDATE wrestlers SET brawn={0[brawn]}, finesse={0[finesse]}, wins={0[wins]}, losses={0[losses]} WHERE name='{0[name]}' """.format(stats)) conn.commit() except sqlite3.Error as err: # reraise error so that external things don't need to know about # the database error types. raise ValueError("Something Bad Happened in update_wrestler: %s" % err) def get_wrestlers(): """Returns a the raw data of wrestlers as a dictionary. """ results = [] try: cursor.execute("""SELECT * FROM wrestlers""") fieldnames = map(lambda x: x[0], cursor.description) for wrestler in cursor: # Compress with field names and turn into a dictionary wrestler = dict(zip(fieldnames, wrestler)) results.append(wrestler) except sqlite3.Error as err: print "ERROR in get_wrestlers: %s" % err # Make sure we always return a list. return results
{ "repo_name": "jeremyosborne/python", "path": "general/wrestling/db.py", "copies": "1", "size": "2283", "license": "mit", "hash": -7282393078876713000, "line_mean": 25.2413793103, "line_max": 84, "alpha_frac": 0.6009636443, "autogenerated": false, "ratio": 3.7860696517412937, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.980317949116266, "avg_score": 0.016770760975726683, "num_lines": 87 }
import os, time, re import sublime import sublime_plugin import glob import os import shutil import pprint from xml.etree import ElementTree current_path = None class CreateJrubyfxProjectCommand(sublime_plugin.WindowCommand): def run(self): self.doCommand() def doCommand(self): if not self.find_root(): self.construct_excluded_pattern() self.build_dir_paths() self.build_file_paths() self.select_dir() else: self.construct_excluded_pattern() self.build_dir_paths() self.build_file_paths() self.move_current_directory_to_top() self.select_dir() def find_root(self): folders = self.window.folders() if len(folders) == 0: from os.path import expanduser self.root = unicode(expanduser("~")) self.rel_path_start = len(self.root) + 1 return False self.root = folders[0] self.rel_path_start = len(self.root) + 1 return True def construct_excluded_pattern(self): patterns = [pat.replace('|', '\\') for pat in self.get_setting('excluded_dir_patterns')] self.excluded = re.compile('^(?:' + '|'.join(patterns) + ')$') def get_setting(self, key): settings = None view = self.window.active_view() if view: settings = self.window.active_view().settings() if settings and settings.has('JRubyFXML') and key in settings.get('JRubyFXML'): # Get project-specific setting results =settings.get('JRubyFXML')[key] else: # Get user-specific or default setting settings = sublime.load_settings('JRubyFXML.sublime-settings') results = settings.get(key) return results def build_dir_paths(self): self.dir_paths = [] self.dir_paths = [["../", "Go up one level in the directory structure"]] self.selected_dir = "" for base, dirs, files in os.walk(self.root): dirs_copy = dirs[:] [dirs.remove(dir) for dir in dirs_copy if self.excluded.search(dir)] for dir in dirs: dir_path = os.path.join(base, dir)[self.rel_path_start:] self.dir_paths.append(dir_path) def build_file_paths(self): self.directory_files = [] directory = self.root + "/" + self.selected_dir for base, dirs, files in os.walk(directory): files_copy = files[:] # for file in files: # self.directory_files.append(file) def move_current_directory_to_top(self): view = self.window.active_view() if view: cur_dir = os.path.dirname(view.file_name())[self.rel_path_start:] for path in self.dir_paths: if path == cur_dir: i = self.dir_paths.index(path) self.dir_paths.insert(1, self.dir_paths.pop(i)) break def select_dir(self): self.window.show_quick_panel(self.dir_paths, self.dir_selected, sublime.MONOSPACE_FONT) def dir_selected(self, selected_index): if selected_index != -1: if selected_index == 0: self.up_one_level() else: self.selected_dir = self.dir_paths[selected_index] self.build_file_paths() # Add aditional menu options self.directory_files.insert(0, ["Browse Directories", "go back to browsing directories"]) self.directory_files.insert(1, ["New JRubyFX Project", "new project in the current directory"]) # Open window to choose desired action self.window.show_quick_panel(self.directory_files, self.file_selected, sublime.MONOSPACE_FONT) def file_selected(self, selected_index): if selected_index != -1: if selected_index == 0: self.select_dir() elif selected_index == 1: self.new_dir() def up_one_level(self): self.root = os.path.abspath(os.path.join(self.root, os.path.pardir)) self.rel_path_start = len(self.root) + 1 self.build_dir_paths() self.build_file_paths() self.move_current_directory_to_top() self.select_dir() def new_dir(self): self.window.show_input_panel("New project name:", '', self.new_dir_action, None, None) def new_dir_action(self, dir_name): full_path = os.path.join(self.root, self.selected_dir, dir_name) if os.path.lexists(full_path): sublime.error_message('Directory already exists:\n%s' % full_path) return else: os.mkdir(full_path) os.mkdir(full_path + os.sep + "src") os.mkdir(full_path + os.sep + "dist") os.mkdir(full_path + os.sep + "package") os.mkdir(full_path + os.sep + "package" + os.sep + "linux") os.mkdir(full_path + os.sep + "package" + os.sep + "macosx") os.mkdir(full_path + os.sep + "package" + os.sep + "windows") os.mkdir(full_path + os.sep + "build") file_name = dir_name + ".sublime-project" self.create_project_file(file_name, full_path) # self.remove_window_folders() project_file_loc = os.path.join(full_path, file_name) sublime_command_line(['-a', project_file_loc]) def create_project_file(self, file_name, full_path): string_full_path = str(full_path).replace("\\","\\\\") prj_file_contents = ("{\n" " \"folders\":\n" " [\n" " {\n" " \"path\": \"%s\"\n" " }\n" " ]\n" "}\n" % string_full_path) self.project_file = os.path.join(full_path, file_name) file_ref = open(self.project_file, "w") file_ref.write((prj_file_contents)); file_ref.close() def remove_window_folders(self): folders_to_remove = self.window.folders() self.window.run_command('remove_folder', {"dirs":folders_to_remove}) # hack to add folders to sidebar (stolen from wbond) def get_sublime_path(): if sublime.platform() == 'osx': return '/Applications/Sublime Text 2.app/Contents/SharedSupport/bin/subl' elif sublime.platform() == 'linux': return open('/proc/self/cmdline').read().split(chr(0))[0] elif sublime.platform() == "windows": return 'sublime_text.exe' else: return sys.executable def sublime_command_line(args): import subprocess args.insert(0, get_sublime_path()) return subprocess.Popen(args) class CreateFxmlTemplateCommand(sublime_plugin.WindowCommand): ROOT_DIR_PREFIX = '[root: ' ROOT_DIR_SUFFIX = ']' INPUT_PANEL_CAPTION = 'File name:' def run(self): if not self.find_root(): return self.find_templates() self.window.show_quick_panel(self.templates, self.template_selected) def refresh_folders(self): try: sublime.set_timeout(lambda:sublime.active_window().run_command('refresh_folder_list'), 200); sublime.set_timeout(lambda:sublime.active_window().run_command('refresh_folder_list'), 600); sublime.set_timeout(lambda:sublime.active_window().run_command('refresh_folder_list'), 1300); sublime.set_timeout(lambda:sublime.active_window().run_command('refresh_folder_list'), 2300); except: pass def create_and_open_file(self, path): if not os.path.exists(os.path.dirname(path)): os.makedirs(os.path.dirname(path)) open(path, 'w') global template template = { 'content': self.replace_variables(self.get_content(path)), 'filename': os.path.basename(path), 'path': os.path.dirname(path) } global current_path view = self.window.open_file(path) current_path = view.file_name() if not view.is_loading(): populate_file(view) self.refresh_folders() def get_content(self, path): content = '' try: content = self.template.find("content").text except: pass try: path = os.path.abspath(os.path.join(os.path.dirname(self.template_path), self.template.find("file").text)) content = open(path).read() print content except: pass return content def find_root(self): folders = self.window.folders() if len(folders) == 0: sublime.error_message('Could not find project root') return False self.root = folders[0] self.rel_path_start = len(self.root) + 1 return True def construct_excluded_pattern(self): patterns = [pat.replace('|', '\\') for pat in self.get_setting('excluded_dir_patterns')] self.excluded = re.compile('^(?:' + '|'.join(patterns) + ')$') def get_setting(self, key): settings = None view = self.window.active_view() if view: settings = self.window.active_view().settings() if settings and settings.has('FileTemplates') and key in settings.get('FileTemplates'): # Get project-specific setting results = settings.get('FileTemplates')[key] else: # Get user-specific or default setting settings = sublime.load_settings('JRubyFXML.sublime-settings') results = settings.get(key) return results def find_templates(self): self.templates = [] self.template_paths = [] for root, dirnames, filenames in os.walk(sublime.packages_path()): for filename in filenames: if filename.endswith(".fxml-template"): self.template_paths.append(os.path.join(root, filename)) self.templates.append(os.path.basename(root) + ": " + os.path.splitext(filename)[0]) def template_selected(self, selected_index): if selected_index != -1: self.template_path = self.template_paths[selected_index] #print self.template_path from elementtree import SimpleXMLTreeBuilder ElementTree.XMLTreeBuilder = SimpleXMLTreeBuilder.TreeBuilder tree = ElementTree.parse(open(self.template_path)) self.template = tree self.construct_excluded_pattern() self.build_relative_paths() #self.move_current_directory_to_top() self.window.show_quick_panel(self.relative_paths, self.dir_selected) def build_relative_paths(self): self.relative_paths = [] try: path = self.template.find("path").text except: path = "" if len(path) > 0: self.relative_paths = [ "Default: " + self.template.find("path").text ] self.relative_paths.append( self.ROOT_DIR_PREFIX + os.path.split(self.root)[-1] + self.ROOT_DIR_SUFFIX ) for base, dirs, files in os.walk(self.root): dirs_copy = dirs[:] [dirs.remove(dir) for dir in dirs_copy if self.excluded.search(dir)] for dir in dirs: relative_path = os.path.join(base, dir)[self.rel_path_start:] self.relative_paths.append(relative_path) def move_current_directory_to_top(self): view = self.window.active_view() if view: cur_dir = os.path.dirname(view.file_name())[self.rel_path_start:] for path in self.relative_paths: if path == cur_dir: i = self.relative_paths.index(path) self.relative_paths.insert(0, self.relative_paths.pop(i)) break def dir_selected(self, selected_index): if selected_index != -1: self.selected_dir = self.relative_paths[selected_index] filename = '' if len(self.template.find("filename").text) > 0: filename = self.template.find("filename").text try: self.arguments = list(self.template.find("arguments")) except: self.arguments = [] self.variables = {} self.next_argument() def next_argument(self): if len(self.arguments) > 0 : self.argument = self.arguments.pop(0) caption = self.argument.text self.window.show_input_panel(caption, '', self.process_argument, None, None) else: self.file_name_input() def process_argument(self, value): self.variables[self.argument.tag] = value self.next_argument() def replace_variables(self, text): for variable in self.variables.keys(): text = text.replace( "$" + variable, self.variables[variable] ) return text def file_name_input(self): file_name = self.template.find("filename").text file_name = self.replace_variables(file_name) dir = self.selected_dir if self.selected_dir.startswith(self.ROOT_DIR_PREFIX): dir = '' if self.selected_dir.startswith("Default: "): dir = self.template.find("path").text dir = self.replace_variables(dir) full_path = os.path.join(self.root, dir, file_name) if os.path.lexists(full_path): sublime.error_message('File already exists:\n%s' % full_path) return else: self.create_and_open_file(full_path) class FileTemplatesListener(sublime_plugin.EventListener): def on_load(self, view): global current_path if view.file_name() == current_path: populate_file(view) current_path = None def populate_file(view): global template view.run_command("insert_snippet", {'contents': template["content"]}) view.window().run_command("refresh_folder_list") class BuildAndDeployCommand(sublime_plugin.WindowCommand): def run(self, cmd = [], file_regex = "", line_regex = "", working_dir = "", encoding = "utf-8", env = {}, quiet = False, kill = False, # Catches "path" and "shell" **kwargs): self.window.run_command("exec", {"cmd": cmd, "working_dir": working_dir}) class WindowShowOverlayCommand(sublime_plugin.WindowCommand): """Wrap show_overlay command because I can't call this from a build system. """ def run(self, *args, **kwargs): self.window.run_command('show_overlay', kwargs)
{ "repo_name": "edubkendo/SublimeJRubyFXML", "path": "JRubyFXML.py", "copies": "1", "size": "15922", "license": "mit", "hash": 1589108028923368000, "line_mean": 35.6045977011, "line_max": 118, "alpha_frac": 0.5884939078, "autogenerated": false, "ratio": 3.9101178781925343, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.49986117859925344, "avg_score": null, "num_lines": null }
# Copyright (c) 2012 Nick Lloyd # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. from zope.interface import implements from sub_collab.peer import base from twisted.internet import reactor, protocol, error, interfaces from twisted.protocols import basic from sub_collab import registry, status_bar from sub_collab import event as collab_event import sublime import logging, threading, sys, socket, struct, os, re, time, functools # in bytes MAX_CHUNK_SIZE = 1024 REGION_PATTERN = re.compile('(\d+), (\d+)') class ViewMonitorThread(threading.Thread): logger = logging.getLogger('SubliminalCollaborator.ViewMonitor') def __init__(self, peer): threading.Thread.__init__(self) self.peer = peer self.lastViewCenterLine = None self.shutdown = False def grabAndSendViewPosition(self): """ Separate function to be called from the sublime main thread... because the view.visible_region() function demands that. """ # calculate the center-most line in the view # this will match most closely with the true center of the view viewRegionLines = self.peer.view.split_by_newlines(self.peer.view.visible_region()) lineIdx = len(viewRegionLines) / 2 - 1 if lineIdx < 0: lineIdx = 0 viewCenterRegion = viewRegionLines[lineIdx] if not viewCenterRegion == self.lastViewCenterLine: self.lastViewCenterLine = viewCenterRegion self.peer.sendViewPositionUpdate(viewCenterRegion) def sendViewSize(self): self.peer.sendMessage(base.VIEW_SYNC, payload=str(self.peer.view.size())) def run(self): self.logger.info('Monitoring view') count = 0 # we must be the host and connected while (self.peer.role == base.HOST_ROLE) \ and (self.peer.state == base.STATE_CONNECTED) \ and (not self.shutdown): if not self.peer.view == None: sublime.set_timeout(self.grabAndSendViewPosition, 0) if count == 10: count = 0 sublime.set_timeout(self.sendViewSize, 0) time.sleep(0.5) count += 1 self.logger.info('Stopped monitoring view') def destroy(self): self.shutdown = True # build off of the Int32StringReceiver to leverage its unprocessed buffer handling class BasicPeer(base.BasePeer, basic.Int32StringReceiver, protocol.ClientFactory, protocol.ServerFactory): """ One side of a peer-to-peer collaboration connection. This is a direct connection with another peer endpoint for sending view data and events. """ logger = logging.getLogger('SubliminalCollaborator.BasicPeer') # Message header structure in struct format: # '!HBB' # elements: # - magicNumber: 9, http://futurama.wikia.com/wiki/Number_9_man # - messageType: see constants below # - messageSubType: see constants below, 0 in all but edit-messages messageHeaderFmt = '!HBB' messageHeaderSize = struct.calcsize(messageHeaderFmt) def __init__(self, username, parentNegotiator): base.BasePeer.__init__(self, username, parentNegotiator) # connection can be an IListeningPort or IConnector self.connection = None self.host = None self.port = None # CLIENT or SERVER self.peerType = None # HOST_ROLE or PARTNER_ROLE self.role = None # STATE_CONNECTING, STATE_CONNECTED, STATE_DISCONNECTED self.state = None self.view = None # queue of 2 or 3 part tuples self.toDoToViewQueue = [] self.toDoToViewQueueLock = threading.Lock() # thread for polling host-side view and periodically checking view sync state self.viewMonitorThread = ViewMonitorThread(self) # last collected command tuple (str, dict, int) self.lastViewCommand = ('', {}, 0) # flag to inform EventListener if Proxy plugin is sending events # relates to a selection update issue around the cut command self.isProxyEventPublishing = False def hostConnect(self, port = 0, ipaddress=''): """ Initiate a peer-to-peer session as the host by listening on the given port for a connection. @param port: C{int} port number to listen on, defaults to 0 (system will pick one) @return: the connected port number """ self.peerType = base.SERVER self.role = base.HOST_ROLE self.state = base.STATE_CONNECTING self.connection = reactor.listenTCP(port, self, backlog=1, interface=ipaddress) self.port = self.connection.getHost().port self.logger.info('Listening for peers at %s:%d' % (ipaddress, self.port)) return self.port def clientConnect(self, host, port): """ Initiate a peer-to-peer session as the partner by connecting to the host peer with the given host and port. @param host: ip address of the host Peer @param port: C{int} port number of the host Peer """ self.logger.info('Connecting to peer at %s:%d' % (host, port)) self.host = host self.port = port self.peerType = base.CLIENT self.role = base.PARTNER_ROLE self.state = base.STATE_CONNECTING self.connection = reactor.connectTCP(self.host, self.port, self, timeout=5) def disconnect(self): """ Disconnect from the peer-to-peer session. """ self.stopCollab() if self.state == base.STATE_DISCONNECTED: # already disconnected! return earlierState = self.state self.state = base.STATE_DISCONNECTING if self.transport != None: self.sendMessage(base.DISCONNECT) if self.peerType == base.SERVER: self.logger.debug('Closing server-side connection') # self.connection.stopListening() reactor.callFromThread(self.connection.stopListening) elif self.peerType == base.CLIENT: self.logger.debug('Closing client-side connection') # self.connection.disconnect() reactor.callFromThread(self.connection.disconnect) def onDisconnect(self): """ Callback method if we are disconnected. """ if self.peerType == base.CLIENT: self.logger.debug('Disconnecting from peer at %s:%d' % (self.host, self.port)) else: self.logger.debug('Disconnecting from peer at %d' % self.port) self.disconnect() self.state = base.STATE_DISCONNECTED self.logger.info('Disconnected from peer %s' % self.sharingWithUser) status_bar.status_message('Stopped sharing with %s' % self.sharingWithUser) def startCollab(self, view): """ Send the provided C{sublime.View} contents to the connected peer. """ self.view = view self.view.set_read_only(True) viewName = self.view.file_name() if not viewName == None: viewName = os.path.basename(viewName) else: viewName = 'NONAME' totalToSend = self.view.size() begin = 0 end = MAX_CHUNK_SIZE # now we make sure we are connected... better way to do this? while not self.state == base.STATE_CONNECTED: time.sleep(1.0) if (self.state == base.STATE_DISCONNECTING) or (self.state == base.STATE_DISCONNECTED): self.logger.error('While waiting to share view over a connection the peer was disconnected!') self.disconnect() return self.logger.info('Sharing view %s with %s' % (self.view.file_name(), self.sharingWithUser)) self.toAck = [] self.sendMessage(base.SHARE_VIEW, payload=('%s|%s' % (viewName, totalToSend))) while begin < totalToSend: chunkToSend = self.view.substr(sublime.Region(begin, end)) self.toAck.append(len(chunkToSend)) self.sendMessage(base.VIEW_CHUNK, payload=chunkToSend) begin = begin + MAX_CHUNK_SIZE end = end + MAX_CHUNK_SIZE status_bar.progress_message("sending view to %s" % self.sharingWithUser, begin, totalToSend) self.sendMessage(base.END_OF_VIEW, payload=view.settings().get('syntax')) self.view.set_read_only(False) # start the view monitoring thread self.viewMonitorThread.start() def resyncCollab(self): """ Resync the shared editor contents between the host and the partner. """ status_bar.status_message('RESYNCING VIEW CONTENT WITH PEER') self.view.set_read_only(True) totalToSend = self.view.size() begin = 0 end = MAX_CHUNK_SIZE # now we make sure we are connected... better way to do this? while not self.state == base.STATE_CONNECTED: time.sleep(1.0) if (self.state == base.STATE_DISCONNECTING) or (self.state == base.STATE_DISCONNECTED): self.logger.error('While waiting to resync view over a connection the peer was disconnected!') self.disconnect() return view_name = self.view.file_name() if not view_name: view_name = self.view.name() self.logger.info('Resyncing view %s with %s' % (view_name, self.sharingWithUser)) self.toAck = [] self.sendMessage(base.RESHARE_VIEW, payload=str(totalToSend)) while begin < totalToSend: chunkToSend = self.view.substr(sublime.Region(begin, end)) self.toAck.append(len(chunkToSend)) self.sendMessage(base.VIEW_CHUNK, payload=chunkToSend) begin = begin + MAX_CHUNK_SIZE end = end + MAX_CHUNK_SIZE status_bar.progress_message("sending view to %s" % self.sharingWithUser, begin, totalToSend) self.sendMessage(base.END_OF_VIEW, payload=self.view.settings().get('syntax')) self.view.set_read_only(False) # send view position as it stands now so the partner view is positioned appropriately post-resync viewRegionLines = self.view.split_by_newlines(self.view.visible_region()) lineIdx = len(viewRegionLines) / 2 - 1 if lineIdx < 0: lineIdx = 0 viewCenterRegion = viewRegionLines[lineIdx] self.sendViewPositionUpdate(viewCenterRegion) # start the view monitoring thread if not already running if not self.viewMonitorThread.is_alive(): self.viewMonitorThread.start() def onStartCollab(self): """ Callback method informing the peer that we have received the view. """ self.logger.debug('collaboration session with view started!') registry.registerSessionByView(self.view, self) # self.notify(collab_event.RECVD_VIEW, self) def stopCollab(self): """ Notify the connected peer that we are terminating the collaborating session. """ if (self.peerType == base.CLIENT) and (self.view != None): self.view.set_read_only(False) self.view = None status_bar.status_message('stopped sharing with %s' % self.str()) def onStopCollab(self): """ Callback method informing the peer that we are terminating a collaborating session. """ self.stopCollab() def swapRole(self): """ Request a role swap with the connected peer. """ if self.view is None: self.logger.warn('Request to swap role when no view is being shared!') return if self.role == base.HOST_ROLE: self.logger.debug('Stopping ViewMonitorThread until role swap is decided') self.viewMonitorThread.destroy() self.viewMonitorThread.join() self.sendMessage(base.SWAP_ROLE) def onSwapRole(self): """ Callback method to respond to role swap requests from the connected peer. """ if self.view is None: self.logger.warn('Request from %s to swap role when no view is being shared!' % self.str()) return if self.role == base.HOST_ROLE: self.logger.debug('Stopping ViewMonitorThread until role swap is decided') self.viewMonitorThread.destroy() self.viewMonitorThread.join() message = None view_name = self.view.file_name() if not view_name or (len(view_name) == 0): view_name = self.view.name() if not view_name or (len(view_name) == 0): view_name = 'untitled' if self.role == base.HOST_ROLE: message = '%s sharing %s with you wants to host...' % (self.str(), view_name) else: message = '%s sharing %s with you wants you to host...' % (self.str(), view_name) swapping_roles = sublime.ok_cancel_dialog(message) if swapping_roles: if self.role == base.HOST_ROLE: self.role = base.PARTNER_ROLE self.view.set_read_only(True) else: self.role = base.HOST_ROLE self.view.set_read_only(False) self.viewMonitorThread = ViewMonitorThread(self) self.viewMonitorThread.start() self.sendMessage(base.SWAP_ROLE_ACK) else: self.sendMessage(base.SWAP_ROLE_NACK) self.logger.info('session %s with %s role now changed to %s' % (view_name, self.str(), self.role)) # wait for the swap to complete on the client side... 0.5 second because the message is tiny time.sleep(0.5) def onSwapRoleAck(self): """ Callback method to respond to accepted role swap response from the connected peer. The caller of swapRole() waits for this method before actually swapping roles on its side. """ if self.role == base.HOST_ROLE: self.role = base.PARTNER_ROLE self.view.set_read_only(True) else: self.role = base.HOST_ROLE self.view.set_read_only(False) self.viewMonitorThread = ViewMonitorThread(self) self.viewMonitorThread.start() view_name = self.view.file_name() if not view_name or (len(view_name) == 0): view_name = self.view.name() if not view_name or (len(view_name) == 0): view_name = 'untitled' self.logger.info('session %s with %s role now changed to %s' % (view_name, self.str(), self.role)) def onSwapRoleNAck(self): """ Callback method to respond to rejected role swap response from the connected peer. The caller of swapRole() may have this called if the connected peer rejects a swap role request. """ if self.role == base.HOST_ROLE: self.viewMonitorThread = ViewMonitorThread() self.viewMonitorThread.start() sublime.message_dialog('%s sharing %s did not want to swap roles' % (self.str(), self.view.file_name())) def sendViewPositionUpdate(self, centerOnRegion): """ Send a window view position update to the peer so they know what we are looking at. @param centerOnRegion: C{sublime.Region} of the central-most line of the current visible portion of the view to send to the peer. """ status_bar.heartbeat_message('sharing with %s' % self.str()) self.sendMessage(base.POSITION, payload=str(centerOnRegion)) def recvViewPositionUpdate(self, centerOnRegion): """ Callback method for handling view position updates from the peer. @param centerOnRegion: C{sublime.Region} to set as the current center of the view. """ self.view.show_at_center(centerOnRegion.begin()) def sendSelectionUpdate(self, selectedRegions): """ Send currently selected regions to the peer. @param selectedRegions: C{sublime.RegionSet} of all selected regions in the current view. """ status_bar.heartbeat_message('sharing with %s' % self.str()) self.sendMessage(base.SELECTION, payload=str(selectedRegions)) def recvSelectionUpdate(self, selectedRegions): """ Callback method for handling selected regions updates from the peer. @param selectedRegions: C{sublime.RegionSet} of all selected regions to be set. """ self.view.add_regions(self.sharingWithUser, selectedRegions, 'comment', sublime.DRAW_OUTLINED) def sendEdit(self, editType, content=None): """ Send an edit event to the peer. @param editType: C{str} edit type (see above) @param content: C{Array} contents of the edit (None-able) """ status_bar.heartbeat_message('sharing with %s' % self.str()) self.logger.debug('sending edit: %s %s' %(base.numeric_to_symbolic[editType], content)) if (editType == base.EDIT_TYPE_INSERT) \ or (editType == base.EDIT_TYPE_INSERT_SNIPPET) \ or (editType == base.EDIT_TYPE_PASTE): self.sendMessage(base.EDIT, editType, payload=content) else: self.sendMessage(base.EDIT, editType) def recvEdit(self, editType, content): """ Callback method for handling edit events from the peer. @param editType: C{str} edit type (see above) @param content: C{Array} contents of the edit (None if delete editType) """ self.view.set_read_only(False) if editType == base.EDIT_TYPE_INSERT: self.view.run_command('insert', { 'characters': content }) elif editType == base.EDIT_TYPE_INSERT_SNIPPET: self.view.run_command('insert_snippet', { 'contents': content }) elif editType == base.EDIT_TYPE_LEFT_DELETE: self.view.run_command('left_delete') elif editType == base.EDIT_TYPE_RIGHT_DELETE: self.view.run_command('right_delete') elif editType == base.EDIT_TYPE_CUT: # faux cut since we are recieving the commands instead of invoking them directly self.view.run_command('left_delete') elif editType == base.EDIT_TYPE_COPY: # we dont actually want to do anything here pass elif editType == base.EDIT_TYPE_PASTE: # faux cut since we are recieving the commands instead of invoking them directly # we actually have to handle this as a direct view.replace() call to avoid # autoindent which occurs if we use the view.run_command('insert', ...) call paste_edit = self.view.begin_edit() for region in self.view.sel(): self.view.replace(paste_edit, region, content) self.view.end_edit(paste_edit) elif editType == base.EDIT_TYPE_UNDO: self.view.run_command('undo') elif editType == base.EDIT_TYPE_REDO: self.view.run_command('redo') elif editType == base.EDIT_TYPE_REDO_OR_REPEAT: self.view.run_command('redo_or_repeat') elif editType == base.EDIT_TYPE_SOFT_UNDO: self.view.run_command('soft_undo') elif editType == base.EDIT_TYPE_SOFT_REDO: self.view.run_command('soft_redo') self.view.set_read_only(True) def handleViewChanges(self): """ Runs on the main UI event loop. Goes through the list of events queued up to modify the shared view and applies them to the associated view. """ self.toDoToViewQueueLock.acquire() while len(self.toDoToViewQueue) > 0: toDo = self.toDoToViewQueue.pop(0) if len(toDo) == 2: self.logger.debug('Handling view change %s with size %d payload' % (base.numeric_to_symbolic[toDo[0]], len(toDo[1]))) if (toDo[0] == base.SHARE_VIEW) or (toDo[0] == base.RESHARE_VIEW): self.totalNewViewSize = 0 if toDo[0] == base.SHARE_VIEW: self.view = sublime.active_window().new_file() payloadBits = toDo[1].split('|') if payloadBits[0] == 'NONAME': self.view.set_name('SHARING-WITH-%s' % self.sharingWithUser) else: self.view.set_name(payloadBits[0]) self.totalNewViewSize = int(payloadBits[1]) else: # resync event, purge the old view in preparation for the fresh content self.logger.debug('resyncing view') self.lastResyncdPosition = 0 self.totalNewViewSize = int(toDo[1]) self.view.set_read_only(True) self.view.set_scratch(True) status_bar.progress_message("receiving view from %s" % self.sharingWithUser, self.view.size(), self.totalNewViewSize) elif toDo[0] == base.VIEW_CHUNK: self.view.set_read_only(False) self.viewPopulateEdit = self.view.begin_edit() # if we are a resync chunk... if hasattr(self, 'lastResyncdPosition'): self.view.replace(self.viewPopulateEdit, \ sublime.Region(self.lastResyncdPosition, self.lastResyncdPosition + len(toDo[1])), \ toDo[1]) self.lastResyncdPosition += len(toDo[1]) else: self.view.insert(self.viewPopulateEdit, self.view.size(), toDo[1]) self.view.end_edit(self.viewPopulateEdit) self.viewPopulateEdit = None self.view.set_read_only(True) status_bar.progress_message("receiving view from %s" % self.sharingWithUser, self.view.size(), self.totalNewViewSize) elif toDo[0] == base.END_OF_VIEW: self.view.set_syntax_file(toDo[1]) if hasattr(self, 'lastResyncdPosition'): del self.lastResyncdPosition status_bar.progress_message("receiving view from %s" % self.sharingWithUser, self.view.size(), self.totalNewViewSize) # view is populated and configured, lets share! self.onStartCollab() elif toDo[0] == base.SELECTION: status_bar.heartbeat_message('sharing with %s' % self.str()) regions = [] for regionMatch in REGION_PATTERN.finditer(toDo[1]): regions.append(sublime.Region(int(regionMatch.group(1)), int(regionMatch.group(2)))) self.recvSelectionUpdate(regions) elif toDo[0] == base.POSITION: status_bar.heartbeat_message('sharing with %s' % self.str()) regionMatch = REGION_PATTERN.search(toDo[1]) if regionMatch: self.recvViewPositionUpdate(sublime.Region(int(regionMatch.group(1)), int(regionMatch.group(2)))) elif len(toDo) == 3: status_bar.heartbeat_message('sharing with %s' % self.str()) # edit event assert toDo[0] == base.EDIT # make the shared selection the ACTUAL selection self.view.sel().clear() for region in self.view.get_regions(self.sharingWithUser): self.view.sel().add(region) self.view.erase_regions(self.sharingWithUser) self.recvEdit(toDo[1], toDo[2]) self.toDoToViewQueueLock.release() def checkViewSyncState(self, peerViewSize): """ Compares a received view size with this sides' view size.... if they don't match a resync event is triggered. """ if self.view.size() != peerViewSize: self.logger.info('view out of sync!') self.sendMessage(base.VIEW_RESYNC) def recvd_CONNECTED(self, messageSubType, payload): """ Callback method for the connection confirmation handshake between client and server. """ if self.peerType == base.CLIENT: if self.state == base.STATE_CONNECTING: self.state = base.STATE_CONNECTED self.logger.info('Connected to peer: %s' % self.sharingWithUser) else: self.logger.error('Received CONNECTED message from server-peer when in state %s' % self.state) else: ## server/initiator side of the wire... # client is connected, send ACK and set our state to be connected self.sendMessage(base.CONNECTED) self.state = base.STATE_CONNECTED self.logger.info('Connected to peer: %s' % self.sharingWithUser) self.notify(collab_event.ESTABLISHED_SESSION, self) def recvd_DISCONNECT(self, messageSubType=None, payload=''): self.onDisconnect() def recvd_SHARE_VIEW(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.SHARE_VIEW, payload)) self.toDoToViewQueueLock.release() self.sendMessage(base.SHARE_VIEW_ACK) self.handleViewChanges() def recvd_RESHARE_VIEW(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.RESHARE_VIEW, payload)) self.toDoToViewQueueLock.release() self.sendMessage(base.SHARE_VIEW_ACK) self.handleViewChanges() def recvd_SHARE_VIEW_ACK(self, messageSubType, payload): self.ackdChunks = [] def recvd_VIEW_CHUNK(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.VIEW_CHUNK, payload)) self.toDoToViewQueueLock.release() self.sendMessage(base.VIEW_CHUNK_ACK, payload=str(len(payload))) self.handleViewChanges() def recvd_VIEW_CHUNK_ACK(self, messageSubType, payload): ackdChunkSize = int(payload) self.ackdChunks.append(ackdChunkSize) def recvd_END_OF_VIEW(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.END_OF_VIEW, payload)) self.toDoToViewQueueLock.release() self.sendMessage(base.END_OF_VIEW_ACK) self.handleViewChanges() def recvd_END_OF_VIEW_ACK(self, messageSubType, payload): if self.toAck == self.ackdChunks: self.toAck = None self.ackdChunks = None else: self.logger.error('Sent %s chunks of data to peer but peer received %s chunks of data' % (self.toAck, self.ackdChunks)) self.toAck = None self.ackdChunks = None self.sendMessage(base.BAD_VIEW_SEND) self.disconnect() def recvd_SELECTION(self, messageSubType, payload): # self.logger.debug('selection change: %s' % payload) self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.SELECTION, payload)) self.toDoToViewQueueLock.release() self.handleViewChanges() def recvd_POSITION(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.POSITION, payload)) self.toDoToViewQueueLock.release() self.handleViewChanges() def recvd_EDIT(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() self.toDoToViewQueue.append((base.EDIT, messageSubType, payload)) self.toDoToViewQueueLock.release() self.handleViewChanges() def recvd_SWAP_ROLE(self, messageSubType, payload): self.onSwapRole() def recvd_SWAP_ROLE_ACK(self, messageSubType, payload): self.onSwapRoleAck() def recvd_SWAP_ROLE_NACK(self, messageSubType, payload): self.onSwapRoleNAck() def recvd_VIEW_SYNC(self, messageSubType, payload): self.toDoToViewQueueLock.acquire() # no pending edits... safe to check if len(self.toDoToViewQueue) == 0: self.checkViewSyncState(int(payload)) self.toDoToViewQueueLock.release() def recvd_VIEW_RESYNC(self, messageSubType, payload): self.resyncCollab() def recvdUnknown(self, messageType, messageSubType, payload): self.logger.warn('Received unknown message: %s, %s, %s' % (messageType, messageSubType, payload)) def stringReceived(self, data): magicNumber, msgTypeNum, msgSubTypeNum = struct.unpack(self.messageHeaderFmt, data[:self.messageHeaderSize]) assert magicNumber == base.MAGIC_NUMBER msgType = base.numeric_to_symbolic[msgTypeNum] msgSubType = base.numeric_to_symbolic[msgSubTypeNum] payload = data[self.messageHeaderSize:] self.logger.debug('RECVD: %s-%s[%s]' % (msgType, msgSubType, payload)) method = getattr(self, "recvd_%s" % msgType, None) if method is not None: method(msgSubTypeNum, payload) else: self.recvdUnknown(msgType, msgSubType, payload) def connectionLost(self, reason): registry.removeSession(self) if self.peerType == base.CLIENT: # ignore this, clientConnectionLost() below will also be called return self.state = base.STATE_DISCONNECTED if error.ConnectionDone == reason.type: self.disconnect() else: status_bar.heartbeat_message('lost share session with %s' % self.str()) # may want to reconnect, but for now lets print why self.logger.error('Connection lost: %s - %s' % (reason.type, reason.value)) #*** internet.base.BaseProtocol (via basic.Int32StringReceiver) method implementations ***# def connectionMade(self): if self.peerType == base.CLIENT: pass else: pass #*** protocol.Factory method implementations ***# def buildProtocol(self, addr): self.logger.debug('building protocol for %s' % self.peerType) if self.peerType == base.CLIENT: self.logger.debug('Connected to peer at %s:%d' % (self.host, self.port)) self.sendMessage(base.CONNECTED) return self #*** protocol.ClientFactory method implementations ***# def clientConnectionLost(self, connector, reason): registry.removeSession(self) self.state = base.STATE_DISCONNECTED if error.ConnectionDone == reason.type: self.disconnect() else: status_bar.status_message('lost share session with %s' % self.str()) # may want to reconnect, but for now lets print why self.logger.error('Connection lost: %s - %s' % (reason.type, reason.value)) def clientConnectionFailed(self, connector, reason): self.logger.error('Connection failed: %s - %s' % (reason.type, reason.value)) registry.removeSession(self) self.state = base.STATE_DISCONNECTED if (error.ConnectionRefusedError == reason.type) or (error.TCPTimedOutError == reason.type) or (error.TimeoutError == reason.type): if self.peerType == base.CLIENT: self.notify(collab_event.FAILED_SESSION, self.sharingWithUser) self.disconnect() #*** helper functions ***# def sendMessage(self, messageType, messageSubType=base.EDIT_TYPE_NA, payload=''): self.logger.debug('SEND: %s-%s[bytes: %d]' % (base.numeric_to_symbolic[messageType], base.numeric_to_symbolic[messageSubType], len(payload))) reactor.callFromThread(self.sendString, struct.pack(self.messageHeaderFmt, base.MAGIC_NUMBER, messageType, messageSubType) + payload.encode())
{ "repo_name": "nlloyd/SubliminalCollaborator", "path": "libs/sub_collab/peer/basic.py", "copies": "1", "size": "33047", "license": "apache-2.0", "hash": -8426019828940414000, "line_mean": 41.1517857143, "line_max": 150, "alpha_frac": 0.6201168033, "autogenerated": false, "ratio": 3.992147861802368, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5112264665102367, "avg_score": null, "num_lines": null }
# All of the functions allow formats to be a dtype __all__ = ['record', 'recarray', 'format_parser'] import numeric as sb from defchararray import chararray import numerictypes as nt import types import os import sys ndarray = sb.ndarray _byteorderconv = {'b':'>', 'l':'<', 'n':'=', 'B':'>', 'L':'<', 'N':'=', 'S':'s', 's':'s', '>':'>', '<':'<', '=':'=', '|':'|', 'I':'|', 'i':'|'} # formats regular expression # allows multidimension spec with a tuple syntax in front # of the letter code '(2,3)f4' and ' ( 2 , 3 ) f4 ' # are equally allowed numfmt = nt.typeDict _typestr = nt._typestr def find_duplicate(list): """Find duplication in a list, return a list of duplicated elements""" dup = [] for i in range(len(list)): if (list[i] in list[i+1:]): if (list[i] not in dup): dup.append(list[i]) return dup class format_parser: def __init__(self, formats, names, titles, aligned=False, byteorder=None): self._parseFormats(formats, aligned) self._setfieldnames(names, titles) self._createdescr(byteorder) def _parseFormats(self, formats, aligned=0): """ Parse the field formats """ if formats is None: raise ValueError, "Need formats argument" if isinstance(formats, list): if len(formats) < 2: formats.append('') formats = ','.join(formats) dtype = sb.dtype(formats, aligned) fields = dtype.fields if fields is None: dtype = sb.dtype([('f1', dtype)], aligned) fields = dtype.fields keys = dtype.names self._f_formats = [fields[key][0] for key in keys] self._offsets = [fields[key][1] for key in keys] self._nfields = len(keys) def _setfieldnames(self, names, titles): """convert input field names into a list and assign to the _names attribute """ if (names): if (type(names) in [types.ListType, types.TupleType]): pass elif (type(names) == types.StringType): names = names.split(',') else: raise NameError, "illegal input names %s" % `names` self._names = [n.strip() for n in names[:self._nfields]] else: self._names = [] # if the names are not specified, they will be assigned as # "f0, f1, f2,..." # if not enough names are specified, they will be assigned as "f[n], # f[n+1],..." etc. where n is the number of specified names..." self._names += ['f%d' % i for i in range(len(self._names), self._nfields)] # check for redundant names _dup = find_duplicate(self._names) if _dup: raise ValueError, "Duplicate field names: %s" % _dup if (titles): self._titles = [n.strip() for n in titles[:self._nfields]] else: self._titles = [] titles = [] if (self._nfields > len(titles)): self._titles += [None]*(self._nfields-len(titles)) def _createdescr(self, byteorder): descr = sb.dtype({'names':self._names, 'formats':self._f_formats, 'offsets':self._offsets, 'titles':self._titles}) if (byteorder is not None): byteorder = _byteorderconv[byteorder[0]] descr = descr.newbyteorder(byteorder) self._descr = descr class record(nt.void): def __repr__(self): return self.__str__() def __str__(self): return str(self.item()) def __getattribute__(self, attr): if attr in ['setfield', 'getfield', 'dtype']: return nt.void.__getattribute__(self, attr) try: return nt.void.__getattribute__(self, attr) except AttributeError: pass fielddict = nt.void.__getattribute__(self, 'dtype').fields res = fielddict.get(attr, None) if res: obj = self.getfield(*res[:2]) # if it has fields return a recarray, # if it's a string ('SU') return a chararray # otherwise return the object try: dt = obj.dtype except AttributeError: return obj if dt.fields: return obj.view(obj.__class__) if dt.char in 'SU': return obj.view(chararray) return obj else: raise AttributeError, "'record' object has no "\ "attribute '%s'" % attr def __setattr__(self, attr, val): if attr in ['setfield', 'getfield', 'dtype']: raise AttributeError, "Cannot set '%s' attribute" % attr fielddict = nt.void.__getattribute__(self, 'dtype').fields res = fielddict.get(attr, None) if res: return self.setfield(val, *res[:2]) else: if getattr(self,attr,None): return nt.void.__setattr__(self, attr, val) else: raise AttributeError, "'record' object has no "\ "attribute '%s'" % attr def pprint(self): # pretty-print all fields names = self.dtype.names maxlen = max([len(name) for name in names]) rows = [] fmt = '%% %ds: %%s' %maxlen for name in names: rows.append(fmt%(name, getattr(self, name))) return "\n".join(rows) # The recarray is almost identical to a standard array (which supports # named fields already) The biggest difference is that it can use # attribute-lookup to find the fields and it is constructed using # a record. # If byteorder is given it forces a particular byteorder on all # the fields (and any subfields) class recarray(ndarray): def __new__(subtype, shape, dtype=None, buf=None, offset=0, strides=None, formats=None, names=None, titles=None, byteorder=None, aligned=False): if dtype is not None: descr = sb.dtype(dtype) else: descr = format_parser(formats, names, titles, aligned, byteorder)._descr if buf is None: self = ndarray.__new__(subtype, shape, (record, descr)) else: self = ndarray.__new__(subtype, shape, (record, descr), buffer=buf, offset=offset, strides=strides) return self def __getattribute__(self, attr): try: return object.__getattribute__(self, attr) except AttributeError: # attr must be a fieldname pass fielddict = ndarray.__getattribute__(self,'dtype').fields try: res = fielddict[attr][:2] except (TypeError, KeyError): raise AttributeError, "record array has no attribute %s" % attr obj = self.getfield(*res) # if it has fields return a recarray, otherwise return # normal array if obj.dtype.fields: return obj if obj.dtype.char in 'SU': return obj.view(chararray) return obj.view(ndarray) # Save the dictionary # If the attr is a field name and not in the saved dictionary # Undo any "setting" of the attribute and do a setfield # Thus, you can't create attributes on-the-fly that are field names. def __setattr__(self, attr, val): newattr = attr not in self.__dict__ try: ret = object.__setattr__(self, attr, val) except: fielddict = ndarray.__getattribute__(self,'dtype').fields or {} if attr not in fielddict: exctype, value = sys.exc_info()[:2] raise exctype, value else: fielddict = ndarray.__getattribute__(self,'dtype').fields or {} if attr not in fielddict: return ret if newattr: # We just added this one try: # or this setattr worked on an internal # attribute. object.__delattr__(self, attr) except: return ret try: res = fielddict[attr][:2] except (TypeError,KeyError): raise AttributeError, "record array has no attribute %s" % attr return self.setfield(val, *res) def __getitem__(self, indx): obj = ndarray.__getitem__(self, indx) if (isinstance(obj, ndarray) and obj.dtype.isbuiltin): return obj.view(ndarray) return obj def field(self, attr, val=None): if isinstance(attr, int): names = ndarray.__getattribute__(self,'dtype').names attr = names[attr] fielddict = ndarray.__getattribute__(self,'dtype').fields res = fielddict[attr][:2] if val is None: obj = self.getfield(*res) if obj.dtype.fields: return obj if obj.dtype.char in 'SU': return obj.view(chararray) return obj.view(ndarray) else: return self.setfield(val, *res) def view(self, obj): try: if issubclass(obj, ndarray): return ndarray.view(self, obj) except TypeError: pass dtype = sb.dtype(obj) if dtype.fields is None: return self.__array__().view(dtype) return ndarray.view(self, obj) def fromarrays(arrayList, dtype=None, shape=None, formats=None, names=None, titles=None, aligned=False, byteorder=None): """ create a record array from a (flat) list of arrays >>> x1=N.array([1,2,3,4]) >>> x2=N.array(['a','dd','xyz','12']) >>> x3=N.array([1.1,2,3,4]) >>> r = fromarrays([x1,x2,x3],names='a,b,c') >>> print r[1] (2, 'dd', 2.0) >>> x1[1]=34 >>> r.a array([1, 2, 3, 4]) """ arrayList = [sb.asarray(x) for x in arrayList] if shape is None or shape == 0: shape = arrayList[0].shape if isinstance(shape, int): shape = (shape,) if formats is None and dtype is None: # go through each object in the list to see if it is an ndarray # and determine the formats. formats = '' for obj in arrayList: if not isinstance(obj, ndarray): raise ValueError, "item in the array list must be an ndarray." formats += _typestr[obj.dtype.type] if issubclass(obj.dtype.type, nt.flexible): formats += `obj.itemsize` formats += ',' formats = formats[:-1] if dtype is not None: descr = sb.dtype(dtype) _names = descr.names else: parsed = format_parser(formats, names, titles, aligned, byteorder) _names = parsed._names descr = parsed._descr # Determine shape from data-type. if len(descr) != len(arrayList): raise ValueError, "mismatch between the number of fields "\ "and the number of arrays" d0 = descr[0].shape nn = len(d0) if nn > 0: shape = shape[:-nn] for k, obj in enumerate(arrayList): nn = len(descr[k].shape) testshape = obj.shape[:len(obj.shape)-nn] if testshape != shape: raise ValueError, "array-shape mismatch in array %d" % k _array = recarray(shape, descr) # populate the record array (makes a copy) for i in range(len(arrayList)): _array[_names[i]] = arrayList[i] return _array # shape must be 1-d if you use list of lists... def fromrecords(recList, dtype=None, shape=None, formats=None, names=None, titles=None, aligned=False, byteorder=None): """ create a recarray from a list of records in text form The data in the same field can be heterogeneous, they will be promoted to the highest data type. This method is intended for creating smaller record arrays. If used to create large array without formats defined r=fromrecords([(2,3.,'abc')]*100000) it can be slow. If formats is None, then this will auto-detect formats. Use list of tuples rather than list of lists for faster processing. >>> r=fromrecords([(456,'dbe',1.2),(2,'de',1.3)],names='col1,col2,col3') >>> print r[0] (456, 'dbe', 1.2) >>> r.col1 array([456, 2]) >>> r.col2 chararray(['dbe', 'de'], dtype='|S3') >>> import cPickle >>> print cPickle.loads(cPickle.dumps(r)) [(456, 'dbe', 1.2) (2, 'de', 1.3)] """ nfields = len(recList[0]) if formats is None and dtype is None: # slower obj = sb.array(recList, dtype=object) arrlist = [sb.array(obj[...,i].tolist()) for i in xrange(nfields)] return fromarrays(arrlist, formats=formats, shape=shape, names=names, titles=titles, aligned=aligned, byteorder=byteorder) if dtype is not None: descr = sb.dtype(dtype) else: descr = format_parser(formats, names, titles, aligned, byteorder)._descr try: retval = sb.array(recList, dtype = descr) except TypeError: # list of lists instead of list of tuples if (shape is None or shape == 0): shape = len(recList) if isinstance(shape, (int, long)): shape = (shape,) if len(shape) > 1: raise ValueError, "Can only deal with 1-d array." _array = recarray(shape, descr) for k in xrange(_array.size): _array[k] = tuple(recList[k]) return _array else: if shape is not None and retval.shape != shape: retval.shape = shape res = retval.view(recarray) res.dtype = sb.dtype((record, res.dtype)) return res def fromstring(datastring, dtype=None, shape=None, offset=0, formats=None, names=None, titles=None, aligned=False, byteorder=None): """ create a (read-only) record array from binary data contained in a string""" if dtype is None and formats is None: raise ValueError, "Must have dtype= or formats=" if dtype is not None: descr = sb.dtype(dtype) else: descr = format_parser(formats, names, titles, aligned, byteorder)._descr itemsize = descr.itemsize if (shape is None or shape == 0 or shape == -1): shape = (len(datastring)-offset) / itemsize _array = recarray(shape, descr, buf=datastring, offset=offset) return _array def get_remaining_size(fd): try: fn = fd.fileno() except AttributeError: return os.path.getsize(fd.name) - fd.tell() st = os.fstat(fn) size = st.st_size - fd.tell() return size def fromfile(fd, dtype=None, shape=None, offset=0, formats=None, names=None, titles=None, aligned=False, byteorder=None): """Create an array from binary file data If file is a string then that file is opened, else it is assumed to be a file object. >>> from tempfile import TemporaryFile >>> a = N.empty(10,dtype='f8,i4,a5') >>> a[5] = (0.5,10,'abcde') >>> >>> fd=TemporaryFile() >>> a = a.newbyteorder('<') >>> a.tofile(fd) >>> >>> fd.seek(0) >>> r=fromfile(fd, formats='f8,i4,a5', shape=10, byteorder='<') >>> print r[5] (0.5, 10, 'abcde') >>> r.shape (10,) """ if (shape is None or shape == 0): shape = (-1,) elif isinstance(shape, (int, long)): shape = (shape,) name = 0 if isinstance(fd, str): name = 1 fd = open(fd, 'rb') if (offset > 0): fd.seek(offset, 1) size = get_remaining_size(fd) if dtype is not None: descr = sb.dtype(dtype) else: descr = format_parser(formats, names, titles, aligned, byteorder)._descr itemsize = descr.itemsize shapeprod = sb.array(shape).prod() shapesize = shapeprod*itemsize if shapesize < 0: shape = list(shape) shape[ shape.index(-1) ] = size / -shapesize shape = tuple(shape) shapeprod = sb.array(shape).prod() nbytes = shapeprod*itemsize if nbytes > size: raise ValueError( "Not enough bytes left in file for specified shape and type") # create the array _array = recarray(shape, descr) nbytesread = fd.readinto(_array.data) if nbytesread != nbytes: raise IOError("Didn't read as many bytes as expected") if name: fd.close() return _array def array(obj, dtype=None, shape=None, offset=0, strides=None, formats=None, names=None, titles=None, aligned=False, byteorder=None, copy=True): """Construct a record array from a wide-variety of objects. """ if isinstance(obj, (type(None), str, file)) and (formats is None) \ and (dtype is None): raise ValueError("Must define formats (or dtype) if object is "\ "None, string, or an open file") kwds = {} if dtype is not None: dtype = sb.dtype(dtype) elif formats is not None: dtype = format_parser(formats, names, titles, aligned, byteorder)._descr else: kwds = {'formats': formats, 'names' : names, 'titles' : titles, 'aligned' : aligned, 'byteorder' : byteorder } if obj is None: if shape is None: raise ValueError("Must define a shape if obj is None") return recarray(shape, dtype, buf=obj, offset=offset, strides=strides) elif isinstance(obj, str): return fromstring(obj, dtype, shape=shape, offset=offset, **kwds) elif isinstance(obj, (list, tuple)): if isinstance(obj[0], (tuple, list)): return fromrecords(obj, dtype=dtype, shape=shape, **kwds) else: return fromarrays(obj, dtype=dtype, shape=shape, **kwds) elif isinstance(obj, recarray): if dtype is not None and (obj.dtype != dtype): new = obj.view(dtype) else: new = obj if copy: new = new.copy() return new elif isinstance(obj, file): return fromfile(obj, dtype=dtype, shape=shape, offset=offset) elif isinstance(obj, ndarray): if dtype is not None and (obj.dtype != dtype): new = obj.view(dtype) else: new = obj if copy: new = new.copy() res = new.view(recarray) if issubclass(res.dtype.type, nt.void): res.dtype = sb.dtype((record, res.dtype)) return res else: interface = getattr(obj, "__array_interface__", None) if interface is None or not isinstance(interface, dict): raise ValueError("Unknown input type") obj = sb.array(obj) if dtype is not None and (obj.dtype != dtype): obj = obj.view(dtype) res = obj.view(recarray) if issubclass(res.dtype.type, nt.void): res.dtype = sb.dtype((record, res.dtype)) return res
{ "repo_name": "santisiri/popego", "path": "envs/ALPHA-POPEGO/lib/python2.5/site-packages/numpy-1.0.4-py2.5-linux-x86_64.egg/numpy/core/records.py", "copies": "1", "size": "19390", "license": "bsd-3-clause", "hash": 1869564355852155400, "line_mean": 31.9761904762, "line_max": 84, "alpha_frac": 0.5484270242, "autogenerated": false, "ratio": 4.0095119933829615, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5057939017582962, "avg_score": null, "num_lines": null }
#All of the graphs-related functionality for MapGeist #Based on NetworkX, the Python library for dealing with #graphs from networkx import (Graph, minimum_spanning_tree,) def generate_complete_graph(nodes, distance_matrix): """ Returns a NetworkX 'Graph' instance given the following- 1. The list of nodes to include in the graph. 2. Distance matrix having distances between nodes- as a dict of dicts The complete map does NOT contain self loops at any node. """ #First generate an empty graph graph = Graph() #Make a list of edges, with appropriate weights graph_edges = [] for i in range(len(nodes)-1): for j in range(i+1, len(nodes)): word1 = nodes[i] word2 = nodes[j] weight = distance_matrix[word1][word2] graph_edges.append((word1, word2, weight)) #Construct the graph from the edge list graph.add_weighted_edges_from(graph_edges) #return graph return graph def generate_mst(graph): """ Wrapper for minimum spanning tree computation """ return minimum_spanning_tree(graph)
{ "repo_name": "sachinrjoglekar/MapGeist", "path": "mapgeist/graphs/graph_functions.py", "copies": "1", "size": "1124", "license": "mit", "hash": -8380887761824499000, "line_mean": 27.1, "line_max": 64, "alpha_frac": 0.6663701068, "autogenerated": false, "ratio": 4.014285714285714, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5180655821085713, "avg_score": null, "num_lines": null }
"""All of the kinds of traces in UConnRCMPy""" # System imports # Third-party imports import numpy as np import cantera as ct from scipy import signal as sig from scipy.interpolate import UnivariateSpline from scipy.stats import linregress # Local imports from .constants import (one_atm_in_bar, one_atm_in_torr, one_bar_in_pa, ) class VoltageTrace(object): """Voltage signal from a single experiment. Parameters ---------- file_path : `pathlib.Path` `~pathlib.Path` object associated with the particular experiment Attributes ---------- signal : `numpy.ndarray` 2-D array containing the raw signal from the experimental text file. First column is the time, second column is the voltage. time : `numpy.ndarray` The time loaded from the signal trace frequency : `int` The sampling frequency of the pressure trace filtered_voltage : `numpy.ndarray` The voltage trace after filtering Note ---- The first sample of the voltage is set equal to the mean of the first 200 points to eliminate DAQ startup effects seen in some data. """ def __init__(self, file_path): self.file_path = file_path self.signal = np.genfromtxt(str(self.file_path)) self.time = self.signal[:, 0] self.frequency = np.rint(1/self.time[1]) self.filter_frequency = None self.signal[0, 1] = np.mean(self.signal[:200, 1]) self.filtered_voltage = self.filtering(self.signal[:, 1]) def __repr__(self): return 'VoltageTrace(file_path={self.file_path!r})'.format(self=self) @property def filter_frequency(self): """The cutoff frequency for the low-pass filter When setting the frequency, if the ``value`` is `None`, determines the optimal cutoff frequency for a first-order Butterworth low-pass filter by analyzing the root-mean-squared residuals for a sequence of cutoff frequencies. The residuals plotted as a function of the cutoff frequency tend to have a linear portion for a range of cutoff frequencies. Analysis of typical data files from our RCM has shown this range to start near ``nyquist_freq*0.05``. The end point is determined by looping through values from ``nyquist_freq*0.5`` to ``nyquist_freq*0.1`` and finding the location where the coefficient of determination of a linear fit is maximized. A line is fit to this portion of the residuals curve and the intersection point of a horizontal line through the y-intercept of the fit and the residuals curve is used to determine the optimal cutoff frequency (see Figure 2 in Yu et al. [1]_). The methodology is described by Yu et al. [1]_, and the code is modifed from Duarte [2]_. References ---------- .. [1] B. Yu, D. Gabriel, L. Noble, and K.N. An, "Estimate of the Optimum Cutoff Frequency for the Butterworth Low-Pass Digital Filter", Journal of Applied Biomechanics, Vol. 15, pp. 318-329, 1999. DOI: `10.1123/jab.15.3.318 <http://dx.doi.org/10.1123/jab.15.3.318>`_ .. [2] M. Duarte, "Residual Analysis", v.3 2014/06/13, http://nbviewer.ipython.org/github/demotu/BMC/blob/master/notebooks/ResidualAnalysis.ipynb """ return self._filter_frequency @filter_frequency.setter def filter_frequency(self, value): if value is None: nyquist_freq = self.frequency/2.0 n_freqs = 101 freqs = np.linspace(nyquist_freq/n_freqs, nyquist_freq, n_freqs) resid = np.zeros(n_freqs) for i, fc in enumerate(freqs): b, a = sig.butter(1, fc/nyquist_freq) yf = sig.filtfilt(b, a, self.signal[:, 1]) resid[i] = np.sqrt(np.mean((yf - self.signal[:, 1])**2)) end_points = np.linspace(0.5, 0.1, 9) r_sq = np.zeros(len(end_points)) intercepts = np.zeros(len(end_points)) for i, end_point in enumerate(end_points): # The indices of the frequencies used for fitting the straight line fit_freqs = np.arange(np.nonzero(freqs >= nyquist_freq*0.05)[0][0], np.nonzero(freqs >= nyquist_freq*end_point)[0][0] + 1) _, intercepts[i], r, _, _ = linregress(freqs[fit_freqs], resid[fit_freqs]) r_sq[i] = r**2 intercept = intercepts[np.argmax(r_sq)] # The UnivariateSpline with s=0 forces the spline fit through every # data point in the array. The residuals are shifted down by the # intercept so that the root of the spline is the optimum cutoff # frequency try: self._filter_frequency = UnivariateSpline(freqs, resid - intercept, s=0).roots()[0] except IndexError: self._filter_frequency = float(input( 'Automatic setting of the filter frequency failed. Please input a frequency; ' 'typical values are between 1000-5000 Hz: ')) else: self._filter_frequency = value def change_filter_freq(self, value): """Change the filter frequency This method is intended to be used after the `VoltageTrace` has already been created. It sets the `~VoltageTrace.filter_frequency` attribute and then runs the filtering. Parameters ---------- value : `float` or `None` Value for the filter frequency. If `None`, an optimal frequency will be estimated by the procedure detailed in the documentation for the `~VoltageTrace.filter_frequency` attribute. """ self.filter_frequency = value self.filtered_voltage = self.filtering(self.signal[:, 1]) def savetxt(self, filename, **kwargs): """Save a text file output of the voltage trace. Save a text file with the time in the first column and the filtered voltage in the second column. The keyword arguments are the same as `numpy.savetxt`. Parameters ---------- filename : `str` Filename of the output file """ np.savetxt(fname=filename, X=np.vstack(self.time, self.filtered_voltage).T, **kwargs) def filtering(self, data): """Filter the input using a low-pass filter. The filter is a first-order Butterworth filter, with the cutoff frequency taken from the instance attribute `~VoltageTrace.filter_frequency`. Parameters ---------- data : `numpy.ndarray` The data that should be filtered Returns ------- `numpy.ndarray` 1-D array of the same length as the input data """ nyquist_freq = self.frequency/2.0 b, a = sig.butter(1, (self.filter_frequency)/nyquist_freq) return sig.filtfilt(b, a, data, padtype='odd', padlen=101, method='pad') class ExperimentalPressureTrace(object): """Pressure trace from a single experiment. Parameters ---------- voltage_trace : `VoltageTrace` Instance of class containing the voltage trace of the experiment. initial_pressure_in_torr : `float` The initial pressure of the experiment, in units of Torr factor : `float` The factor set on the charge amplifier Attributes ---------- pressure : `numpy.ndarray` The pressure trace computed from the filtered voltage trace time : `numpy.ndarray` A 1-D array containting the time. Copied from `VoltageTrace.time` frequency : `int` Integer sampling frequency of the experiment. Copied from `VoltageTrace.frequency` p_EOC : `float` Pressure at the end of compression EOC_idx : `int` Integer index in the `pressure` and `time` arrays of the end of compression. is_reactive : `bool` Boolean if the pressure trace represents a reactive or or non-reactive experiment derivative : `numpy.ndarray` 1-D array containing the raw derivative computed from the `pressure` trace. zeroed_time : `numpy.ndarray` 1-D array containing the time, with the zero point set at the end of compression. """ def __init__(self, voltage_trace, initial_pressure_in_torr, factor): initial_pressure_in_bar = initial_pressure_in_torr*one_atm_in_bar/one_atm_in_torr self.pressure = (voltage_trace.filtered_voltage - voltage_trace.filtered_voltage[0]) self.pressure *= factor self.pressure += initial_pressure_in_bar self.raw_pressure = (voltage_trace.signal[:, 1] - voltage_trace.signal[0, 1]) self.raw_pressure *= factor self.raw_pressure += initial_pressure_in_bar self.time = voltage_trace.time self.frequency = voltage_trace.frequency self.p_EOC, self.EOC_idx, self.is_reactive = self.find_EOC() self.derivative = self.calculate_derivative(self.pressure, self.time) # Smooth the derivative with a moving average 151 points wide self.derivative = sig.fftconvolve(self.derivative, np.ones(151)/151, mode='same') self.zeroed_time = self.time - self.time[self.EOC_idx] def __repr__(self): return ('ExperimentalPressureTrace(p_EOC={self.p_EOC!r}, ' 'is_reactive={self.is_reactive!r})').format(self=self) def savetxt(self, filename, **kwargs): """Save a text file output of the pressure trace. Save a text file with the time in the first column and the filtered pressure in the second column. The keyword arguments are the same as `numpy.savetxt`. Parameters ---------- filename : `str` Filename of the output file """ np.savetxt(fname=filename, X=np.vstack(self.time, self.pressure).T, **kwargs) def pressure_fit(self, comptime=0.08): """Fit a line to the pressure trace before compression starts. Parameters ---------- comptime : `float`, optional Desired compression time, computed from the EOC, to when the pressure fit should start Returns ------- `numpy.polyfit` Numpy object containing the parameters of the fit """ beg_compress = int(np.floor(self.EOC_idx - comptime*self.frequency)) time = np.linspace(0, (beg_compress - 1)/self.frequency, beg_compress) fit_pres = self.pressure[:beg_compress] fit_pres[0:9] = fit_pres[10] linear_fit = np.polyfit(time, fit_pres, 1) return linear_fit def change_EOC_time(self, time, is_reactive=True): """Change the EOC time for an experiment Parameters ---------- time : `float` The new value of the EOC time is_reactive : `boolean` The experiment is reactive or not """ offset = int(round(time/1000*self.frequency, 0)) self.EOC_idx += offset if self.EOC_idx <= 0 or self.EOC_idx >= len(self.pressure): raise ValueError('EOC index out of range, please check the EOC time on the plot') else: self.p_EOC = self.pressure[self.EOC_idx] self.is_reactive = is_reactive self.zeroed_time = self.time - self.time[self.EOC_idx] def find_EOC(self): """Find the index and pressure at the end of compression. Returns ------- `tuple` Returns a tuple with types (`float`, `int`, `bool`) representing the pressure at the end of compression, the index of the end of compression relative to the start of the pressure trace, and a boolean that is True if the case is reactive and False otherwise, respectively Notes ----- The EOC is found by moving backwards from the maximum pressure point and testing the values of the pressure. When the test value becomes greater than the previous pressure, we have reached the minimum pressure before ignition, in the case of a reactive experiment. Then, the EOC is the maximum of the pressure before this minimum point. If the pressure at the minimum is close to the initial pressure, assume the case is non-reactive and set the EOC pressure and the index to the max pressure point. """ is_reactive = True max_p = np.amax(self.pressure) max_p_idx = np.argmax(self.pressure) min_p_idx = max_p_idx - 100 while self.pressure[min_p_idx] >= self.pressure[min_p_idx - 50]: min_p_idx -= 1 p_EOC = np.amax(self.pressure[0:min_p_idx]) p_EOC_idx = np.argmax(self.pressure[0:min_p_idx]) diff = abs(self.pressure[p_EOC_idx] - self.pressure[15]) if diff < 5.0: p_EOC, p_EOC_idx = max_p, max_p_idx is_reactive = False return p_EOC, p_EOC_idx, is_reactive def calculate_derivative(self, dep_var, indep_var): """Calculate the derivative. Parameters ---------- dep_var : `numpy.ndarray` Dependent variable (e.g., the pressure) indep_var : `numpy.ndarray` Independent variable (e.g., the time) Returns ------- `numpy.ndarray` 1-D array containing the derivative Notes ----- The derivative is calculated by a second-order forward method and any places where the derivative is infinite are set to zero. """ m = len(dep_var) ddt = np.zeros(m) ddt[:m-2] = (-3*dep_var[:m-2] + 4*(dep_var[1:m-1]) - dep_var[2:m])/(2*np.diff(indep_var[:m-1])) # NOQA ddt[np.isinf(ddt)] = 0 return ddt class AltExperimentalPressureTrace(ExperimentalPressureTrace): """Process an alternate experimental pressure trace. These pressure traces do not have an associated voltage trace, but the machinery in the VoltageTrace class is useful for filtering. """ def __init__(self, file_path, initial_pressure_in_torr): # This is not a real voltage trace pressure_trace = VoltageTrace(file_path) self.time = pressure_trace.time self.frequency = pressure_trace.frequency self.filter_frequency = pressure_trace.filter_frequency self.pressure = pressure_trace.filtered_voltage pressure_start = np.mean(self.pressure[20:500]) self.pressure -= pressure_start self.pressure += initial_pressure_in_torr*one_atm_in_bar/one_atm_in_torr self.raw_pressure = pressure_trace.signal[:, 1] raw_pressure_start = np.mean(self.raw_pressure[20:500]) self.raw_pressure -= raw_pressure_start self.raw_pressure += initial_pressure_in_torr*one_atm_in_bar/one_atm_in_torr self.p_EOC, self.EOC_idx, self.is_reactive = self.find_EOC() self.derivative = self.calculate_derivative(self.pressure, self.time) self.zeroed_time = self.time - self.time[self.EOC_idx] def __repr__(self): return ('AltExperimentalPressureTrace(p_EOC={self.p_EOC!r}, ' 'is_reactive={self.is_reactive!r})').format(self=self) class PressureFromVolume(object): """Create a pressure trace given a volume trace. Using Cantera to evaluate the thermodynamic properties, compute a pressure trace from a volume trace. Parameters ---------- volume : `numpy.ndarray` 1-D array containing the reactor volume p_initial : `float` Initial pressure of the experiment, in bar T_initial : `float`, optional Initial temperature of the experiment, in Kelvin. Optional for Cantera versions greater than 2.2.0. chem_file : `str`, optional Filename of the chemistry file to be used Attributes ---------- pressure : `numpy.ndarray` The pressure trace Notes ----- The pressure is computed in a `cantera.Solution` object by setting the volume and the entropy according to an isentropic process using the given volume trace. """ def __init__(self, volume, p_initial, T_initial, chem_file='species.cti', cti_source=None): if cti_source is None: gas = ct.Solution(chem_file) else: gas = ct.Solution(source=cti_source) gas.TP = T_initial, p_initial initial_volume = gas.volume_mass initial_entropy = gas.entropy_mass self.pressure = np.zeros((len(volume))) for i, v in enumerate(volume): gas.SV = initial_entropy, v*initial_volume self.pressure[i] = gas.P/one_bar_in_pa def __repr__(self): return 'PressureFromVolume(pressure={self.pressure!r})'.format(self=self) class VolumeFromPressure(object): r"""Create a volume trace given a pressure trace. Using Cantera to evaluate the thermodynamic properties, compute a volume trace from a pressure trace. Parameters ---------- pressure : `numpy.ndarray` 1-D array containing the reactor pressure v_initial : `float` Initial volume of the experiment, in m**3 T_initial : `float`, optional Initial temperature of the experiment, in Kelvin. Optional for Cantera versions greater than 2.2.0. chem_file : `str`, optional Filename of the chemistry file to be used Attributes ---------- volume : `numpy.ndarray` The volume trace Notes ----- The volume is computed according to the formula .. math:: v_i = v_{initial}*\rho_{initial}/\rho_i where the index :math:`i` indicates the current point. The state is set at each point by setting the pressure from the input array and the entropy to be constant. The volume is computed by the isentropic relationship described above. """ def __init__(self, pressure, v_initial, T_initial, chem_file='species.cti', cti_source=None): if cti_source is None: gas = ct.Solution(chem_file) else: gas = ct.Solution(source=cti_source) gas.TP = T_initial, pressure[0]*one_bar_in_pa initial_entropy = gas.entropy_mass initial_density = gas.density self.volume = np.zeros((len(pressure))) for i, p in enumerate(pressure): gas.SP = initial_entropy, p*one_bar_in_pa self.volume[i] = v_initial*initial_density/gas.density def __repr__(self): return 'VolumeFromPressure(volume={self.volume!r})'.format(self=self) class TemperatureFromPressure(object): """Create a temperature trace given a pressure trace. Using Cantera to evaluate the thermodynamic properties, compute a pressure trace from a volume trace. Parameters ---------- pressure : `numpy.ndarray` 1-D array containing the pressure T_initial : `float` Initial temperature of the experiment, in Kelvin. Optional for Cantera versions greater than 2.2.0. chem_file : `str`, optional Filename of the chemistry file to be used Attributes ---------- temperature : `numpy.ndarray` The temperature trace Notes ----- The temperature is computed in a `cantera.Solution` object by setting the pressure and the entropy according to an isentropic process using the given pressure trace. """ def __init__(self, pressure, T_initial, chem_file='species.cti', cti_source=None): if cti_source is None: gas = ct.Solution(chem_file) else: gas = ct.Solution(source=cti_source) gas.TP = T_initial, pressure[0]*one_bar_in_pa initial_entropy = gas.entropy_mass self.temperature = np.zeros((len(pressure))) for i, p in enumerate(pressure): gas.SP = initial_entropy, p*one_bar_in_pa self.temperature[i] = gas.T def __repr__(self): return 'TemperatureFromPressure(temperature={self.temperature!r})'.format(self=self)
{ "repo_name": "bryanwweber/UConnRCMPy", "path": "uconnrcmpy/traces.py", "copies": "1", "size": "20363", "license": "bsd-3-clause", "hash": 1302995466280997000, "line_mean": 36.6395563771, "line_max": 111, "alpha_frac": 0.6166085547, "autogenerated": false, "ratio": 3.953212968355659, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0004555325956553884, "num_lines": 541 }
#All of the non-trivial parts of this program (the frequency extraction) is code from Justin Peel #At http://stackoverflow.com/questions/2648151/python-frequency-detection Thanks a bunch! import pyaudio import wave import numpy as np from notes import note_map import logging import time logging.basicConfig(level=logging.DEBUG) LOG = logging.getLogger() chunk = 2048 file_name = 'hum.wav' wf = wave.open(file_name, 'rb') swidth = wf.getsampwidth() RATE = wf.getframerate() # use a Blackman window window = np.blackman(chunk) def extract_tone_from_chunk(data): #again, to reiterate, not my code. # Obtained from http://stackoverflow.com/questions/2648151/python-frequency-detection # unpack the data and times by the hamming window indata = np.array(wave.struct.unpack("%dh"%(len(data)/swidth),\ data))*window # Take the fft and square each value fftData=abs(np.fft.rfft(indata))**2 # find the maximum which = fftData[1:].argmax() + 1 # use quadratic interpolation around the max if which != len(fftData)-1: y0,y1,y2 = np.log(fftData[which-1:which+2:]) x1 = (y2 - y0) * .5 / (2 * y1 - y2 - y0) # find the frequency and output it thefreq = (which+x1)*RATE/chunk #name your god and bleed thefreq LOG.info("Chunk freq is %f Hz." % (thefreq)) return thefreq else: thefreq = which*RATE/chunk return thefreq LOG.info("Chunk freq is %f Hz." % (thefreq)) def auto_tune(raw_freq): min_diff = 100000 note = None freq = None for name, f in note_map.items(): d = abs(f-raw_freq) if d < min_diff: min_diff = d freq = f note = name LOG.info("auto tuning %s to %s: %s " % (raw_freq, freq, note)) return freq def simplify(milli_per_note, frequencies): s_frequencies = [] s_millis = [] cur_val = frequencies[0] milli_count = milli_per_note for f in frequencies: if f != cur_val: if cur_val is not None: s_frequencies.append(cur_val) s_millis.append(milli_count) cur_val = f milli_count = milli_per_note else: milli_count += milli_per_note return s_frequencies, s_millis def format_arduino_array(array_name, vals): s = "PROGMEM short %s[] = {" % array_name for f in vals[:-1]: s += (str(int(round(f))) + ", ") s += str(int(round(vals[-1]))) + "};" return s def main(): # open stream p = pyaudio.PyAudio() frequencies = [] # read some data data = wf.readframes(chunk) while len(data) == chunk * swidth: frequencies.append(auto_tune(extract_tone_from_chunk(data))) data = wf.readframes(chunk) wf.close() p.terminate() milli_per_sample = int(round((chunk/float(RATE)) * 1000)) LOG.info("%s milliseconds per sample " % milli_per_sample) s_frequencies, milli_per_note = simplify(milli_per_sample, frequencies) LOG.info("%s simplified notes and %s millisecond per note entries (These better match!)" % (len(s_frequencies), len(milli_per_note))) time.sleep(1) print format_arduino_array("maria_freqs", s_frequencies) print format_arduino_array("maria_millis", milli_per_note) if __name__ == '__main__': main()
{ "repo_name": "parkercoleman/home_tweet_home", "path": "audio_parser.py", "copies": "1", "size": "3377", "license": "mit", "hash": 6064977294938241000, "line_mean": 28.1206896552, "line_max": 97, "alpha_frac": 0.6106011253, "autogenerated": false, "ratio": 3.3535253227408144, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.44641264480408144, "avg_score": null, "num_lines": null }
# All of the other examples directly embed the Javascript and CSS code for # Bokeh's client-side runtime into the HTML. This leads to the HTML files # being rather large. An alternative is to ask Bokeh to produce HTML that # has a relative link to the Bokeh Javascript and CSS. This is easy to # do; you just pass in a few extra arguments to the output_file() command. import numpy as np from bokeh.plotting import figure, show, output_file N = 100 x = np.linspace(0, 4*np.pi, N) y = np.sin(x) output_file("relative_paths.html", title="Relative path example", mode="relative") p = figure(tools="pan,wheel_zoom,box_zoom,reset,save") p.circle(x,y, alpha=0.5, color="tomato", radius=0.1) show(p) # By default, the URLs for the Javascript and CSS will be relative to # the current directory, i.e. the directory in which the HTML file is # generated. You can provide a different "root" directory from which # the relative paths will be computed: # # output_file("relative_paths.html", title="Relative path example", # resources="relative", rootdir="some/other/path")
{ "repo_name": "matbra/bokeh", "path": "examples/plotting/file/relative_paths.py", "copies": "45", "size": "1085", "license": "bsd-3-clause", "hash": 7441038244425854000, "line_mean": 37.75, "line_max": 82, "alpha_frac": 0.730875576, "autogenerated": false, "ratio": 3.4227129337539433, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0011041470464066509, "num_lines": 28 }
"""All of the various asynchronous message producers.""" import json from messaging import config from messaging.message_producer import MessageProducer from messaging.singleton_mixin import SingletonMixin class CommandProducer(SingletonMixin): """Forwards commands.""" def __init__(self): super(CommandProducer, self).__init__() self._producer = MessageProducer(config.COMMAND_EXCHANGE) def start(self): """Send the start command.""" self._producer.publish('start') def stop(self): """Send the stop command.""" self._producer.publish('stop') def reset(self): """Send the reset command.""" self._producer.publish('reset') def calibrate_compass(self): """Send the calibrate_compass command.""" self._producer.publish('calibrate-compass') def set_max_throttle(self, throttle): """Send the set max throttle command.""" self._producer.publish('set-max-throttle={}'.format(throttle)) class TelemetryProducer(SingletonMixin): """Forwards telemetry messages.""" def __init__(self): super(TelemetryProducer, self).__init__() self._producer = MessageProducer(config.TELEMETRY_EXCHANGE) def gps_reading( self, latitude_d, longitude_d, accuracy_m, heading_d, speed_m_s, timestamp_s, device_id ): """Sends a GPS reading.""" self._producer.publish(json.dumps({ 'latitude_d': latitude_d, 'longitude_d': longitude_d, 'accuracy_m': accuracy_m, 'heading_d': heading_d, 'speed_m_s': speed_m_s, 'timestamp_s': timestamp_s, 'device_id': device_id, })) def compass_reading(self, compass_d, confidence, device_id): """Sends a compass reading.""" self._producer.publish(json.dumps({ 'compass_d': compass_d, 'confidence': confidence, 'device_id': device_id, })) def accelerometer_reading( self, acceleration_g_x, acceleration_g_y, acceleration_g_z, device_id ): """Sends an accelerometer reading.""" self._producer.publish(json.dumps({ 'acceleration_g_x': acceleration_g_x, 'acceleration_g_y': acceleration_g_y, 'acceleration_g_z': acceleration_g_z, 'device_id': device_id, })) class CommandForwardProducer(SingletonMixin): """Forwards commands to another exchange.""" # This is a complete hack. I couldn't figure out how to do multiple # consumers, but I only need it for one producer (command) and I only have # two consumers, so I'll just manually forward them. I know this is fragile # and tightly coupled, because handlers shouldn't need to or know about # forwarding messages. # TODO(skari): Implement multi consumer def __init__(self): super(CommandForwardProducer, self).__init__() self._producer = MessageProducer(config.COMMAND_FORWARDED_EXCHANGE) def forward(self, message): """Forwards the message.""" self._producer.publish(message) class WaypointProducer(SingletonMixin): """Forwards waypoint commands to another exchange.""" def __init__(self): super(WaypointProducer, self).__init__() self._producer = MessageProducer(config.WAYPOINT_EXCHANGE) def load_kml_file(self, kml_file_name): """Loads some waypoints from a KML file.""" self._producer.publish( json.dumps({ 'command': 'load', 'file': kml_file_name }) )
{ "repo_name": "bskari/sparkfun-avc", "path": "messaging/async_producers.py", "copies": "1", "size": "3765", "license": "mit", "hash": -4989430901875622000, "line_mean": 30.375, "line_max": 79, "alpha_frac": 0.592563081, "autogenerated": false, "ratio": 4.174057649667406, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5266620730667405, "avg_score": null, "num_lines": null }
#All of this can be performed with inbuilt functions #Basically this is an useless program, written only for #learning purposes count = raw_input("Enter the number of values to be computed on:") count = int(count) #Here are the function declarations def maximumNo(uList): largestNo = None for item in uList: if largestNo == None or largestNo < item: largestNo = item return largestNo def minimumNo(uList): smallestNo = None for item in uList: if smallestNo == None or smallestNo > item: smallestNo = item return smallestNo def sumOfList(uList): sumoflist = 0 for item in uList: sumoflist = sumoflist + item return sumoflist def countOfList(uList): countoflist = 0 for item in uList: countoflist = countoflist + 1 return countoflist def average(uList): avg = 0 for items in uList: userList = [] #Getting the inputs t = count while t > 0: uip = raw_input("Enter number:") uip = int(uip); userList.append(uip) t = t - 1 print "The maximum no in the list is: " + str(maximumNo(userList)) print "The minimum no in the list is: " + str(minimumNo(userList)) print "The sum of nos in the list is: " + str(sumOfList(userList)) print "The count of nos in the list is: " + str(countOfList(userList)) print "Average of the list: " + str(average(userList)) print "Results from inbuilt functions" print "The maximum no in the list is: " + str(max(userList)) print "The minimum no in the list is: " + str(min(userList)) print "The sum of nos in the list is: " + str(sum(userList)) print "The count of nos in the list is: " + str(len(userList))
{ "repo_name": "ashgang/RandomAlgos", "path": "Python/minMaxSum.py", "copies": "1", "size": "1571", "license": "apache-2.0", "hash": -180249006893982140, "line_mean": 26.0862068966, "line_max": 70, "alpha_frac": 0.7148313176, "autogenerated": false, "ratio": 2.9810246679316887, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9032503830000527, "avg_score": 0.03267043110623222, "num_lines": 58 }
#All of this code is awful and needs to be re-written at some point. #The line drawing functions have been reimplemented in other modules, #so I'm not entirely sure how often these are called. class line_diag: def __init__(self, start, end): self.path = [] if start == end: return None self.start = list(start) self.end = list(end) self.steep = abs(self.end[1]-self.start[1]) > abs(self.end[0]-self.start[0]) if self.steep: self.start = self.swap(self.start[0],self.start[1]) self.end = self.swap(self.end[0],self.end[1]) if self.start[0] > self.end[0]: self.start[0],self.end[0] = self.swap(self.start[0],self.end[0]) self.start[1],self.end[1] = self.swap(self.start[1],self.end[1]) dx = self.end[0] - self.start[0] dy = abs(self.end[1] - self.start[1]) error = 0 try: derr = dy/float(dx) except: return None ystep = 0 y = self.start[1] if self.start[1] < self.end[1]: ystep = 1 else: ystep = -1 for x in range(self.start[0],self.end[0]+1): if self.steep: self.path.append((y,x)) else: self.path.append((x,y)) error += derr if error >= 0.5: y += ystep error -= 1.0 if not self.path[0] == (start[0],start[1]): self.path.reverse() def swap(self,n1,n2): return [n2,n1] def diag_line(start, end): _l = line_diag(start,end) return _l.path def draw_3d_line(pos1,pos2): _xchange = pos2[0]-pos1[0] _ychange = pos2[1]-pos1[1] _zchange = pos2[2]-pos1[2] _line = [tuple(pos1)] if abs(_xchange) >= abs(_ychange) and abs(_xchange) >= abs(_zchange): _xnegative = False _ynegative = False _znegative = False if _ychange < 0: _ynegative = True if _xchange < 0: _xnegative = True if _zchange < 0: _znegative = True _x = pos1[0] _y = pos1[1] _z = pos1[2] try: _ystep = abs(_ychange/float(_xchange)) except: _ystep = abs(_ychange) try: _zstep = abs(_zchange/float(_xchange)) except: _zstep = abs(_zchange) for x in range(1,abs(_xchange)): if _xnegative: x = -x if _ynegative: _y -= _ystep else: _y += _ystep if _znegative: _z -= _zstep else: _z += _zstep _line.append((_x+x,int(round(_y)),int(round(_z)))) elif abs(_ychange) >= abs(_xchange) and abs(_ychange) >= abs(_zchange): _xnegative = False _ynegative = False _znegative = False if _ychange < 0: _ynegative = True if _xchange < 0: _xnegative = True if _zchange < 0: _znegative = True _x = pos1[0] _y = pos1[1] _z = pos1[2] _xstep = abs(_xchange/float(_ychange)) _zstep = abs(_zchange/float(_ychange)) for y in range(1,abs(_ychange)): if _ynegative: y = -y if _xnegative: _x -= _xstep else: _x += _xstep if _znegative: _z -= _zstep else: _z += _zstep _line.append((int(round(_x)),_y+y,int(round(_z)))) elif abs(_zchange) > abs(_xchange) and abs(_zchange) > abs(_ychange): _xnegative = False _ynegative = False _znegative = False if _zchange < 0: _znegative = True if _xchange < 0: _xnegative = True if _ychange < 0: _ynegative = True _x = pos1[0] _y = pos1[1] _z = pos1[2] _xstep = abs(_xchange/float(_zchange)) _ystep = abs(_ychange/float(_zchange)) for z in range(1,abs(_zchange)): if _znegative: z = -z if _xnegative: _x -= _xstep else: _x += _xstep if _ynegative: _y -= _ystep else: _y += _ystep _line.append((int(round(_x)),int(round(_y)),_z+z)) _line.append(tuple(pos2)) return _line def draw_circle(at, size): Circle = 0 width=size height=size CenterX=(width/float(2)) CenterY=(height/float(2)) circle = [] for i in range(height+1): for j in range(width+1): Circle = (((i-CenterY)*(i-CenterY))/((float(height)/2)*(float(height)/2)))+((((j-CenterX)*(j-CenterX))/((float(width)/2)*(float(width)/2)))); if Circle>0 and Circle<1.1: circle.append((at[0]+(j-(width/2)),at[1]+(i-(height/2)))) if not at in circle: circle.append(at) return circle
{ "repo_name": "flags/Reactor-3", "path": "drawing.py", "copies": "1", "size": "4086", "license": "mit", "hash": 6114127590774948000, "line_mean": 18.9365853659, "line_max": 144, "alpha_frac": 0.5736661772, "autogenerated": false, "ratio": 2.4718693284936477, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.3545535505693648, "avg_score": null, "num_lines": null }
# all of us from cmd import * from Database import sql_database from FileManagement.filehandler import * from graph import * import sys class Interpreter(Cmd): # Kris def __init__(self, database_name): Cmd.__init__(self) self.file_handler = FileHandler() self.database = sql_database.SQLDatabase(database_name) self.graph = Graph(self.database) self.graphs = [] # Kris # Pull data from database def do_display_data(self, args): self.database.display_data() # Kris Little # - This function loads and saves data to the database def do_load_from_file(self, args): args = args.split(' ') if len(args) == 1: file_path = args[0] data = self.file_handler.load_file(file_path) data_to_add = self.file_handler.validate(data) print("adding data") print(data_to_add) self.database.write_to_database(data_to_add) elif len(args) == 2: file_path = args[1] optn = args[0] if "-d" in optn: data = self.file_handler.load_file(file_path) data_to_add = self.file_handler.validate(data) self.database.write_to_database(data_to_add) elif "-g" in optn: print("creating graph") else: print("Invalid option. Refer to help file") # Kris Little # backup the database. This could be changed to use the pickle # function brendan makes soon def do_backup_database(self, args): args = args.split(' ') msg = "" data = self.database.backup_database() can_create = True if "-o" in args[0]: if os.path.isfile(args[1]): can_create = False msg = "File already exists. Try a different filename." else: msg = "Incorrect option. Refer to help." can_create = False print(can_create) if can_create: if len(args) > 1: self.file_handler.write_file(args[1], data) else: self.file_handler.write_file(args[0], data) else: print(msg) # Kris # This gets all data from the database def do_get_data(self, sql): self.database.execute_sql(sql) return self.database.cursor.fetchall() # Brendan Holt # get data by calling the command execute_sql # data should be returned as an array holding tuples, keep this in mind # feel free to add other graph commands e.g. def do_display_piechart(self, args) # (args being data) # default value 'new_graph' is only set when called from creategraph which will return it by reference # the default value will be used should the user call the function from the command line def do_display_graph(self, args, my_graph=None): try: argss = [] args = getopt.getopt(args, "t:o:", ["graph-type=", "option="]) # if new graph is none then create argss as regular else append args from create_graph if my_graph is None: argss = args[1].split() else: argss.append(args[1][0]) argss.append(args[1][1]) if len(argss) > 2 or len(argss) < 2: raise TypeError if argss[0] == 'pie' and argss[1] != 'gender' and argss[1] != 'bmi' and argss[1] != 'age' \ or argss[0] == 'bar' and argss[1] != 'salary-by-gender' and argss[1] != 'salary-by-age': raise ValueError except TypeError: print('This functions takes exactly one parameters') return except ValueError: print('Ensure Graph Value Option Parameter is correctly spelt') return if my_graph is None: my_graph = self.graph.build_graph(argss) self.graph.print_graph(my_graph) del my_graph else: self.graph.print_graph(my_graph) # Brendan Holt # Used to create a graph by calling collecting user defined arguments - # and passing them to build_graph in the graph class def do_create_graph(self, args): try: args = getopt.getopt(args, "t:o:", ["graph-type=", "option="]) argss = args[1].split() # Raises exception if the incorrect amount of args have been entered if len(argss) > 2 or len(argss) < 2: raise TypeError # Raises exception if the args have been incorrectly typed if argss[0] == 'pie' and argss[1] != 'gender' and argss[1] != 'bmi' and argss[1] != 'age' \ or argss[0] == 'bar' and argss[1] != 'salary-by-gender' and argss[1] != 'salary-by-age': raise ValueError except TypeError: print('This functions takes exactly two parameters') return except ValueError: print('Ensure Parameters are correctly spelt') return # new graph is temp and is created to be appended to the graph list then destroyed self.graphs.append(self.graph.build_graph(argss)) # Brendan Holt # User called function to list graphs currenltly loaded in the interpreters graph list def do_list_graphs(self, args): try: args = getopt.getopt(args, "t:o:", ["graph-type="]) argss = args[1].split() # If there are arguments if len(argss) > 0: # Raises exception if the incorrect amount of args have been entered if len(argss) > 1 or len(argss) < 0: raise TypeError # Raises exception if the args have been incorrectly typed if argss[0] != 'pie' and argss[0] != 'bar': raise ValueError # Raises exception should there be no graphs inside the iterators graph list if len(self.graphs) == 0: raise IndexError except TypeError: print('This functions takes exactly one or no parameters') return except ValueError: print('Ensure Parameters are correctly spelt') return except IndexError: print('There are currently no graphs loaded') return if len(argss) > 0: print(argss[0]) for g in range(len(self.graphs)): # NEW Brendan changed self.graph[0].data to self.graph[g].title # Checks args length for type of graph user selects if len(argss) > 0: if argss[0] == self.graphs[g].type: print(g, self.graphs[g].title + " " + self.graphs[g].time) # If not args are found the graph is listed to the output without regardless of type else: print(g, self.graphs[g].title + " " + self.graphs[g].time) while True: selection = input("Select graph number to display graph or press enter to continue >>> ") try: if selection == "": return elif int(selection) not in range(len(self.graphs)): raise ValueError except ValueError: print('Graph selection is outside of range') continue break self.graph.print_graph(self.graphs[int(selection)]) # Brendan Holt # Pickles the currently loaded graphs in the list self.graph by calling the file handlers pack_pickle # Args is currently not used but kept to implement user defined files should the need arise def do_save_graphs(self, args): try: if len(self.graphs) < 1: raise ValueError except ValueError: print('There is currently no graphs to be saved') return self.file_handler.pack_pickle(self.graphs) # Brendan Holt # Unpickles the default pickle file (see unpack_pickle in the file handler) to the graphs list # Args is currently not used but kept to implement user defined files should the need arise def do_load_graphs(self, args): # Should the file not exist an exception is raised in the file handler filepath = os.path.dirname(os.path.realpath(sys.argv[0])) + "\\files\\pickle.dat" # Ensure graph list is cleared self.graphs = [] # Reload graph list self.graphs = self.file_handler.unpack_pickle(filepath) # Brendan Holt # Pickles and backs up the entire database # Args is currently not used but kept to implement user defined files should the need arise def do_pickle(self, args): data = self.database.backup_database() print('The above has been pickled to a backup file') self.file_handler.pickle_all(data) # Help Commands - Kate # For each of the do_ commands above, print help info about them # Following this format: help_function # e.g. help_write_data(self): # for info on what each function does, check out the help.doc file @staticmethod def do_about(args): """ This about command shows user some information about this application """ print("Welcome to Interterpreter \n" + " This application able to read, store and display data \n" + "in a given format \n") @staticmethod def help_display_data(): print("Display data is a simple command that shows all " "the data from the database in text form.\n" + "USAGE: display_data\n" + "OPTIONS and ARGUMENTS: This command takes no options or arguments.") @staticmethod def help_load_from_file(): print("Load data from a file and save it to the database.\n" + "USAGE: load_from_file -option filepath\n" + "OPTIONS:\n" + " -g: Create a graph with the data\n" + " -d: Save data to the database. This is the default option.\n" + "ARGUMENTS:\n" + " filepath: Supply a filename or file path to the file that you want to load.") @staticmethod def help_backup_database(): print("This command saves data to a file.\n" + "USAGE: backup_database -option filepath\n" + "OPTIONS:\n" + " -o: Overwrite existing file\n" + "ARGUMENTS:\n" + " filepath: Supply a filename or file path to where you want to save the database.") @staticmethod def help_create_graph(): print("Create a bar or pie graph that visually represents data.\n" + "USAGE: create_graph <chart-type> <data>\n" + "OPTIONS: this command takes no options.\n" + "ARGUMENTS:\n" + " chart-type: the type of graph you want to create. Can be 'pie' or 'graph'\n" + " data: the data you want to show. For 'pie' " "it can be 'gender, bmi or age', for 'bar' it can be 'salary-by-gender'") @staticmethod def help_display_graph(): print("Create a bar or pie graph that visually represents data.\n" + "USAGE: display_graph <chart-type> <data>\n" + "OPTIONS: this command takes no options.\n" + "ARGUMENTS:\n" + " chart-type: the type of graph you want to create. Can be 'pie' or 'graph'\n" + " data: the data you want to show. For 'pie'" " it can be 'gender, bmi or age', for 'bar' it can be 'salary-by-gender'") @staticmethod def help_list_graphs(): print("Display a list of graphs. Use this if you need to load a specific " "graph that is active in the system.\n" + "USAGE: list_graphs <graph-type>\n" + "OPTIONS: This function takes no options.\n" + "ARGUMENTS:\n" + " graph-type: Supply the type of graph you want to list. Can be 'pie' or 'bar'.") @staticmethod def help_load_graphs(): print("Load graphs that have been saved.\n" + "USAGE: load_graphs\n" + "OPTIONS: This function takes no options.\n" + "ARGUMENTS:This function takes no arguments\n") @staticmethod def help_save_graphs(): print("Save existing graphs to a file so they can be loaded again.\n" + "USAGE: save_graphs\n" + "OPTIONS: This function takes no options.\n" + "ARGUMENTS:This function takes no arguments\n") @staticmethod def help_pickle(): print("Encrypt database\n" + "USAGE: pickle\n" + "OPTIONS: This function takes no options.\n" + "ARGUMENTS:This function takes no arguments\n") def emptyline(self): pass
{ "repo_name": "Comikris/Assignment_Interpreter", "path": "interpreter.py", "copies": "1", "size": "13219", "license": "apache-2.0", "hash": 6336291241495619000, "line_mean": 40.2332268371, "line_max": 108, "alpha_frac": 0.5588168545, "autogenerated": false, "ratio": 4.23821737736454, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0009784125006542497, "num_lines": 313 }
#All of visualization code for MapGeist from time import sleep import pygraphviz as PG import os def _is_tree(G): """ Checks if the NetworkX Graph G is a tree. """ from networkx import (number_of_nodes, number_of_edges, is_connected) if number_of_nodes(G) != number_of_edges(G) + 1: return False return is_connected(G) def _construct_subtree_2G(G, tree, node, added_nodes): """ Constructs the subtree of 'tree' that begins at 'node'. G is the pygraphwiz AGraph instance. Assumes that 'node' is already connected to its parents. 'added_nodes' is a set of strings specifying nodes already added to the visualized tree. """ #Iterating over every neighbour of the root of this subtree for neighbour in tree.neighbors(node): #Make sure the neighbour is not a parent if neighbour not in added_nodes: #Make a note of the node being added added_nodes.add(neighbour) #Add the edge between root and neighbour(child) G.add_edge(node, neighbour) #Call this function recursively on the child _construct_subtree_2G(G, tree, neighbour, added_nodes) def visualize_tree_2D(tree, root, filepath): """ Visualizes a NetworkX tree using PyGraphWiz. The graph is rendered as a '.ps' named after the root, in the folder specified by 'foldername'. 'tree' is a NetworkX Graph instance, root is a string that appears in 'tree'. """ #Check is the Graph is infact a tree if not _is_tree(tree): raise ValueError("Given Graph is not a tree!") G = PG.AGraph(directed=True, strict=True) added_nodes = set([root]) #Call recursive function to build rest of the tree _construct_subtree_2G(G, tree, root, added_nodes) #Prepare the file with necessary settings G.layout(prog='dot') G.draw(filepath, format='png')
{ "repo_name": "sachinrjoglekar/MapGeist", "path": "mapgeist/visualization/functions.py", "copies": "1", "size": "1958", "license": "mit", "hash": -5994442372613942000, "line_mean": 30.5806451613, "line_max": 66, "alpha_frac": 0.6475995914, "autogenerated": false, "ratio": 3.7653846153846153, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9892267584019412, "avg_score": 0.0041433245530406206, "num_lines": 62 }
__all__ = ['oldtype2dtype', 'convtypecode', 'convtypecode2', 'oldtypecodes'] import numpy as N oldtype2dtype = {'1': N.dtype(N.byte), 's': N.dtype(N.short), # 'i': N.dtype(N.intc), # 'l': N.dtype(int), # 'b': N.dtype(N.ubyte), 'w': N.dtype(N.ushort), 'u': N.dtype(N.uintc), # 'f': N.dtype(N.single), # 'd': N.dtype(float), # 'F': N.dtype(N.csingle), # 'D': N.dtype(complex), # 'O': N.dtype(object), # 'c': N.dtype('c'), None:N.dtype(int) } # converts typecode=None to int def convtypecode(typecode, dtype=None): if dtype is None: try: return oldtype2dtype[typecode] except: return N.dtype(typecode) else: return dtype #if both typecode and dtype are None # return None def convtypecode2(typecode, dtype=None): if dtype is None: if typecode is None: return None else: try: return oldtype2dtype[typecode] except: return N.dtype(typecode) else: return dtype _changedtypes = {'B': 'b', 'b': '1', 'h': 's', 'H': 'w', 'I': 'u'} class _oldtypecodes(dict): def __getitem__(self, obj): char = N.dtype(obj).char try: return _changedtypes[char] except KeyError: return char oldtypecodes = _oldtypecodes()
{ "repo_name": "santisiri/popego", "path": "envs/ALPHA-POPEGO/lib/python2.5/site-packages/numpy-1.0.4-py2.5-linux-x86_64.egg/numpy/oldnumeric/typeconv.py", "copies": "1", "size": "1595", "license": "bsd-3-clause", "hash": -8861997918272358000, "line_mean": 25.5833333333, "line_max": 76, "alpha_frac": 0.4595611285, "autogenerated": false, "ratio": 3.6085972850678734, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4568158413567873, "avg_score": null, "num_lines": null }
__all__ = ['OligoAnnealing'] def annealing_score_n(x,y): if (x=='A' and y=='T') or (x=='T' and y=='A'): return 2 elif (x=='G' and y=='C') or (x=='C' and y=='G'): return 4 else: return 0 class AnnealingState: def __init__(self, p, q, score, index, scores): self.p = p self.q = q self.score = score self.scores = scores self.index = index def get_bar(self): i = self.index p = self.p q = self.q spc = ' '*abs(i) ss = self.scores bar = ''.join(['|' if s>0 else ' ' for s in ss]) if i>0: return [spc+"5'-%s-3'"%p, spc+" <"+bar+">", "3'-%s-5'"%q[::-1] ] else: return ["5'-%s-3'"%p, spc+" <"+bar+">", spc+"3'-%s-5'"%q[::-1] ] def write_html(self, w): w.push('div',style='annealing') w.insert('p','score=%s, index=%s'%(self.score,self.index)) w.push('pre') w.text('\n'.join(self.get_bar())) w.pop() w.pop() def annealing_score(p,q): """ >>> fw = 'GAAGGAGACCCAAATTCAAAGTT' >>> rv = 'CCTTTCTCCCTTCGTAGGT' >>> annealing_score(fw, rv) ((18, -7, [2, 4, 4, 0, 2, 0, 0, 0, 0, 0, 0, 0, 2, 4, 0, 0]), (10, -7, [2, 4, 4, 0, 2, 0, 0, 0, 0, 0, 0, 0, 2, 4, 0, 0])) >>> annealing_score(fw, fw) ((24, 6, [4, 2, 2, 0, 0, 0, 4, 0, 0, 0, 4, 0, 0, 0, 2, 2, 4]), (4, -18, [2, 2, 0, 2, 2])) """ sv = annealing_score_n p = str(p).upper() q = str(q).upper() w = p v = q[::-1] n = len(w) m = len(v) def ea(ss): ret = 0 for n in ss: if n==0: return ret ret += n return ret def ea_l(ss): return ea(ss) def ea_r(ss): return ea(ss[::-1]) def ea_lr(ss): return max(ea_l(ss),ea_r(ss)) ea_v = (-1, None, None) def u_ea(score, index, scores): nonlocal ea_v os,oi,oss = ea_v if os < score: ea_v = (score, index, scores) a_v = (-1, None, None) def u_a(score, index, scores): nonlocal a_v os,oi,oss = a_v if os < score: a_v = (score, index, scores) if n<=m: assert m-n >= 0 for k in range(-(n-1),m-1 +1): if k<=0: # 5'- w[0]....w[-k]....w[n-1] -3' # 3'- v[0].....v[n+k-1]....v[m-1] -5' ss = [sv(w[-k+i],v[i]) for i in range(n+k)] u_a(sum(ss),k,ss) u_ea(ea_lr(ss),k,ss) elif k<=m-n: # w[0]....w[n-1] # v[0]....v[k]....v[k+n-1].....v[m-1] ss = [sv(w[0+i],v[k+i]) for i in range(n)] u_a(sum(ss),k,ss) u_ea(ea_r(ss),k,ss) else: # w[0]...w[m-k-1]....w[n-1] # v[0]...v[k]...v[m-1] ss = [sv(w[i],v[k+i]) for i in range(m-k)] u_a(sum(ss),k,ss) else: assert m-n <= 0 for k in range(-(n-1),m-1 +1): if k<=m-n: # w[0]....w[-k]....w[n-1] # v[0].....v[n+k-1]....v[m-1] ss = [sv(w[-k+i],v[i]) for i in range(n+k)] u_a(sum(ss),k,ss) u_ea(ea_lr(ss),k,ss) elif k<=0: # w[0]....w[k]....w[m-k-1].....w[n-1] # v[0]....v[m-1] ss = [sv(w[k+i],v[0+i]) for i in range(m)] u_a(sum(ss),k,ss) u_ea(ea_l(ss),k,ss) else: # w[0]...w[m-k-1]....w[n-1] # v[0]...v[k]...v[m-1] ss = [sv(w[i],v[k+i]) for i in range(m-k)] u_a(sum(ss),k,ss) return a_v, ea_v class OligoAnnealing: def __init__(self, p, q): a_v, ea_v = annealing_score(p,q) self.max_annealing = AnnealingState(p, q, a_v[0], a_v[1], a_v[2]) self.end_annealing = AnnealingState(p, q, ea_v[0], ea_v[1], ea_v[2])
{ "repo_name": "mizuy/seqtool", "path": "seqtool/nucleotide/annealing.py", "copies": "1", "size": "4044", "license": "mit", "hash": 5311961299929754000, "line_mean": 29.4060150376, "line_max": 124, "alpha_frac": 0.3746290801, "autogenerated": false, "ratio": 2.5417976115650536, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.8328619069462841, "avg_score": 0.017561524440442556, "num_lines": 133 }
__all__ = 'Once', 'For', 'Every', 'Hertz', 'After', 'Continu', 'Model' from collections import defaultdict def test(): m = Model(3*1000) out = [] d = out.append count = 0 def add(): nonlocal count count += 1 m.add_action(lambda:d(m.steps), Once()) m.add_action(lambda:d(m.steps), Every(3)) m.add_action(lambda:d(m.steps), After(3)) m.add_action(lambda:d(m.steps), For(2)) m.add_action(add , Continu()) m.simulate_ms(12) correct = [0, 0, 1, 2, 3, 4, 5, 9, 9, 18, 27] assert out == correct assert count == m.steps class Once: def register_action(self, model, phase, action): def once(): action() return False # do not call again phase.add_action(once, 0) class For: def __init__(self, ms): self.ms = ms def register_action(self, model, phase, action): count = model.ms_to_steps(self.ms) def for_(): nonlocal count action() count -= 1 if count < 1: return False else: return 0 phase.add_action(for_, 0) class Every: def __init__(self, ms, immediate=False): self.ms = ms self.imm = immediate def register_action(self, model, phase, action): steps = model.ms_to_steps(self.ms) def every(): action() return steps # call again after `steps` steps if self.imm: phase.add_action(every, 0) else: phase.add_action(every, steps) class Hertz(Every): def __init__(self, hz, imm=False): super().__init__(1000/hz, imm) class After: def __init__(self, ms): self.ms = ms def register_action(self, model, phase, action): steps = model.ms_to_steps(self.ms) def after(): action() return False phase.add_action(after, steps) class Continu: def register_action(self, model, phase, action): def continu(): action() return 0 phase.add_action(continu, 0) def nearest(n): return int(n+.5) class Model: def __init__(self, f=5000, dt=None): self.phases_by_name = {} self.phases_sorted = [] self.steps = 0 if dt is None: self.steps_per_second = f self.dt = 1/f elif f == 5000: raise ArgumentException("can't set f and dt") else: self.dt = dt self.steps_per_second = 1/dt self.logs = defaultdict(list) def ms_to_steps(self, ms): return nearest(ms * self.steps_per_second / 1000) def halftime(self, ms): return 0.5 ** (1/self.ms_to_steps(ms)) def add_action(self, action, pattern=Once(), phase="default"): if phase not in self.phases_by_name: self.add_phase(phase) phase_ = self.phases_by_name[phase] action_ = pattern.register_action(self, phase_, action) def add_log(self, name, get_val): log = self.logs[name] self.add_action(lambda:log.append(get_val()), Continu(), "log") def add_phase(self, *names): for name in names: if name in self.phases_by_name: continue phase = Phase(name) self.phases_sorted.append(phase) self.phases_by_name[name] = phase def remove_phase(self, *names): names = set(names) for name in names: if name in self.phases_by_name: del self.phases_by_name[name] self.phases_sorted[:] = [phase for phase in self.phases_sorted if phase.name not in names] def step(self): for phase in self.phases_sorted: phase.execute() self.steps += 1 def simulate_ms(self, ms): steps = nearest(self.steps_per_second * ms / 1000) for _ in range(steps): self.step() def simulate_seconds(self, seconds): steps = nearest(self.steps_per_second * seconds) for _ in range(steps): self.step() def show(self): import matplotlib.pyplot as plt xs = [x/self.steps_per_second for x in range(self.steps)] for name in sorted(self.logs.keys()): plt.plot(xs, self.logs[name], label=name) plt.legend() plt.show() class Phase: def __init__(self, name): self.actions = [] # (steps_left,action) self.name = name def add_action(self, action, after=0): self.actions.append([after,action]) def execute(self): to_delete = [] for i, (steps_left,action) in enumerate(self.actions): if steps_left < 1: again_after = action() if again_after is False: to_delete.append(i) else: self.actions[i][0] = again_after self.actions[i][0] -= 1 while to_delete: # reverse traversal to preserve indices self.actions.pop(to_delete.pop())
{ "repo_name": "lennart96/neurons", "path": "model.py", "copies": "1", "size": "5109", "license": "isc", "hash": -2665846652795409400, "line_mean": 27.3833333333, "line_max": 71, "alpha_frac": 0.5325895479, "autogenerated": false, "ratio": 3.6649928263988523, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4697582374298852, "avg_score": null, "num_lines": null }
__all__ = ['on', 'when', 'decode_escapes', 'get_dict_path'] import re import codecs import copy ESCAPE_SEQUENCE_RE = re.compile(r''' ( \\U........ # 8-digit hex escapes | \\u.... # 4-digit hex escapes | \\x.. # 2-digit hex escapes | \\[0-7]{1,3} # Octal escapes | \\N\{[^}]+\} # Unicode characters by name | \\[\\'"abfnrtv] # Single-character escapes )''', re.UNICODE | re.VERBOSE) def decode_escapes(s): def decode_match(match): return codecs.decode(match.group(0), 'unicode-escape') return ESCAPE_SEQUENCE_RE.sub(decode_match, s) def get_dict_path(dic, path): def callback(accumulator, key): obj, keys = accumulator if isinstance(obj, dict): if key in obj: keys.append(key) return obj[key], keys path_string = '/'.join(keys) raise Exception('Object "./{}" has no key "{}"'.format(path_string, key)) try: path = path.strip(' ./').replace('.', '/') if not path: return dic, None result, _ = reduce(callback, path.split('/'), (dic, [])) return copy.copy(result), None except Exception, e: return None, e.message def get_position(string, index): line = string.count('\n', 0, index) + 1 if line == 1: col = index + 1 else: col = index - string.rindex('\n', 0, index) return line, col
{ "repo_name": "AlexYukikaze/JSONx", "path": "JSONx/utils.py", "copies": "1", "size": "1442", "license": "mit", "hash": 4844074744746173000, "line_mean": 27.2745098039, "line_max": 81, "alpha_frac": 0.5353675451, "autogenerated": false, "ratio": 3.534313725490196, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.45696812705901957, "avg_score": null, "num_lines": null }
"""AlloPred - Predict allosteric pockets on proteins Usage: python $ALLOPRED_DIR/run_allopred.py in_file act_res.txt Arguments are the input file prefix and the active site residue file. The working directory must contain the input PDB file (in_file.pdb) and the fpocket output directory (in_file_out). The environmental variables $ALLOPRED_DIR and $SVM_LIGHT_DIR have to be defined - they refer to the AlloPred and SVM-light directories respectively. See the AlloPred README for more information. """ # PARAMETERS # # these can be adjusted, but bear in mind the SVM is optimised on the default parameters # # proportion to increase the spring constant by at a chosen pocket - default is 1.5 # this parameter represents the reduction in flexibility of a pocket on modulator binding spring_frac = 1.5 # atoms to use for normal mode calculation - default is 'calpha' but other options are 'backbone' and 'all' # choosing 'backbone' will increase computation time; choosing 'all' will increase computation time significantly nma_atoms = 'calpha' # cutoff in Angstrom for ANM normal mode calculation; default is 15 nma_cutoff = 15 # check whether to print instructions and exit import sys if len(sys.argv) != 3: print __doc__ sys.exit() # check whether environmental variables are set import os try: allopred_dir = os.environ['ALLOPRED_DIR'] except KeyError: print 'Environmental variable ALLOPRED_DIR cannot be found - see the AlloPred README' sys.exit() try: svm_light_dir = os.environ['SVM_LIGHT_DIR'] except KeyError: print 'Environmental variable SVM_LIGHT_DIR cannot be found - see the AlloPred README' sys.exit() import re from operator import itemgetter from prody import * # import custom functions from functions.pocket_methods import * from functions.nma_methods import * # read arguments input_prefix, act_res_filepath = sys.argv[1:] pdb_file = input_prefix+'.pdb' pocket_folder = input_prefix+'_out' print '- Running AlloPred -' print 'PDB file:', pdb_file print 'Active site residue file:', act_res_filepath print 'Pocket directory:', pocket_folder # read PDB file print 'Reading PDB file' pro = parsePDB(pdb_file) calphas = pro.select('calpha') nma_selection = pro.select(nma_atoms) # read active site residues from file print 'Reading active site residue file' act_res_file = open(act_res_filepath) act_res_lines = act_res_file.readlines() act_res_file.close() active_res = re.split(r',',act_res_lines[0]) print 'Active site residues:', act_res_lines[0].rstrip() # extract active site residue indices act_sel_list = [] for res in active_res: info = re.split(r':',res) if len(info) == 2: act_sel_list.append('(chain '+info[1].strip()+' and resnum '+info[0].strip()+')') act_selector = str(' or '.join(act_sel_list)) no_act_res = len(act_sel_list) if no_act_res > 0: try: act_res_indices = calphas.select(act_selector).getResindices() except AttributeError: print 'No residues found matching your active residues' sys.exit() else: print 'No active residues could be detected - please ensure that the format is correct, including chain labels' sys.exit() # check all active residues are included if len(act_res_indices) != len(active_res): print 'One or more active site residues could not be read, or is missing in the PDB file; continuing anyway' # fpocket information pocket_info_list = [ 'Score :', 'Druggability Score :', 'Number of Alpha Spheres :', 'Total SASA :', 'Polar SASA :', 'Apolar SASA :', 'Volume :', 'Mean local hydrophobic density :', 'Mean alpha sphere radius :', 'Mean alp. sph. solvent access :', 'Apolar alpha sphere proportion :', 'Hydrophobicity score:', 'Volume score:', 'Polarity score:', 'Charge score :', 'Proportion of polar atoms:', 'Alpha sphere density :', 'Cent. of mass - Alpha Sphere max dist:', 'Flexibility :' ] print 'Extracting pocket information' # extract pocket information into a dictionary pockets_info = extract_info('',input_prefix,pocket_info_list) # extract pocket residues into a dictionary pockets_res, pockets_res_name = extract_pockets('',input_prefix,calphas) # extract distances of each pocket to the active site into a dictionary pockets_dist = dist_to_active(calphas,act_res_indices,pockets_res) # RUN NMA # calculate normal modes without perturbation print 'Calculating NMA without perturbation' anm = ANM('normal') anm.buildHessian(nma_selection,cutoff=nma_cutoff,gamma=1) anm.calcModes(n_modes=None) anm_used, sel_active = sliceModel(anm,nma_selection,act_selector) # iterate over each pocket and perturb the normal modes print 'Calculating NMA with perturbation' results = {} for pocket_no in pockets_res: # calculate normal modes with perturbation to residues in pocket anm_mod = ANM('modified') # do not perturb active residues directly indices_to_perturb = [i for i in pockets_res[pocket_no] if i not in act_res_indices] anm_mod.buildHessian(nma_selection,cutoff=nma_cutoff,gamma=GammaResidue(nma_selection,res_nos=indices_to_perturb,frac_change=spring_frac)) anm_mod.calcModes(n_modes=None) anm_mod_used, sel_mod_active = sliceModel(anm_mod,nma_selection,act_selector) # measure the change in the normal modes diff_100 = quantify_difference(anm_used,anm_mod_used,no_modes=100) diff_200 = quantify_difference(anm_used,anm_mod_used,no_modes=200) diff_all = quantify_difference(anm_used,anm_mod_used,no_modes=len(anm)) # add results to results dictionary results[pocket_no] = [diff_100,diff_200,diff_all] # form title line title_string = 'fpocket_rank\tpocket_size\tdist_to_active\tno_pockets\tC_100\tE_100\tC_200\tE_200\tC_all\tE_all' clean_string = title_string for info_id in pocket_info_list: title_string += '\t'+info_id clean_string += '\tfpocket_'+re.sub('[:.\-\s+]','',info_id) title_string += '\tresidues' clean_string += '\tresidues' # form output line for each pocket lines = [] for pocket_no in range(len(pockets_res)): # write fpocket rank line = str(pocket_no) # write pocket size line += '\t'+str(len(pockets_res[pocket_no])) # write distance to active site line += '\t'+str(pockets_dist[pocket_no]) # write number of pockets line += '\t'+str(len(pockets_res)) # write combined NM output for 100 modes line += '\t'+str(results[pocket_no][0]) line += '\t'+str(results[pocket_no][0]/len(pockets_res[pocket_no])) # write combined NM output for 200 modes line += '\t'+str(results[pocket_no][1]) line += '\t'+str(results[pocket_no][1]/len(pockets_res[pocket_no])) # write combined NM output for all modes line += '\t'+str(results[pocket_no][2]) line += '\t'+str(results[pocket_no][2]/len(pockets_res[pocket_no])) # write pocket information for info_id in pocket_info_list: line += '\t'+str(pockets_info[pocket_no][info_id]) # write residues in pocket line += '\t'+','.join(pockets_res_name[pocket_no]) lines.append(line) # FORM SVM INPUT FILE # optimal SVM features and the ranges in the training set svm_features = [ ['Number of Alpha Spheres :_r','raw'], ['E_200','ranked'], ['Score :_r','raw'], ['E_all','ranked'], ['dist_to_active_r','raw'], ['pocket_size_r','raw'], ['fpocket_rank_r','raw'] ] svm_features_range = { 'Number of Alpha Spheres :_r':(36.0, 2276.0), 'Score :_r':(-6.782, 70.118), 'dist_to_active_r':(0.1, 110.6), 'pocket_size_r':(2.0, 275.0), 'fpocket_rank_r':(0.0, 83.0), } # split output lines for SVM sorting print 'Forming SVM input file' breaks = [] for line in lines: split = re.split(r'\t+',line.rstrip()) # convert to float for sorting; ignore residue names split = [float(i) for i in split[:-1]] # convert to int for readability split[0] = int(split[0]) breaks.append(split) title_break = re.split(r'\t+',title_string.rstrip()) # form dictionary for SVM features pocket_info = {} for i in range(len(breaks)): pocket_info[str(breaks[i][0])] = {} for feature in svm_features: # find column to sort by index = 'not_found' for column in title_break: if feature[1] == 'ranked' and column == feature[0]: index = title_break.index(column) break elif feature[1] == 'raw' and column+'_r' == feature[0]: index = title_break.index(column) break if index != 'not_found': # sort by correct column breaks.sort(key=itemgetter(index),reverse=True) # cycle through pockets for i in range(len(breaks)): if feature[1] == 'ranked': # append fractional ranking pocket_info[str(breaks[i][0])][feature[0]] = round((i + 1) / float(len(breaks)),4) elif feature[1] == 'raw': # scale value using min and max to be between 0 and 1 scaled_value = (breaks[i][index] - svm_features_range[feature[0]][0]) / float(svm_features_range[feature[0]][1] - svm_features_range[feature[0]][0]) pocket_info[str(breaks[i][0])][feature[0]] = round(scaled_value,4) # write SVM input file svm_in_file = open(input_prefix+'.svm','w') for j in range(len(pocket_info)): line = '0 ' for i in range(len(svm_features)): if svm_features[i][0] in pocket_info[str(j)]: # feature ID is an integer for SVMlight input line += ' '+str(i+1)+':'+str(pocket_info[str(j)][svm_features[i][0]]) svm_in_file.write(line+'\n') svm_in_file.close() # RUN SVM print 'Running SVM' svm_classify_cmd = svm_light_dir+'/svm_classify '+input_prefix+'.svm '+allopred_dir+'/svm_model.txt '+input_prefix+'.pred' os.system(svm_classify_cmd) # FORM OUTPUT FILE # read and sort prediction file print 'Forming output file' svm_pred_file = open(input_prefix+'.pred') svm_pred_lines = svm_pred_file.readlines() svm_pred_file.close() ordering = [] for i in range(len(svm_pred_lines)): ordering.append([i,svm_pred_lines[i].rstrip()]) ordering.sort(key=itemgetter(1),reverse=True) # remove prediction file os.system('rm '+input_prefix+'.pred') # write tab-delimited output file out_file = open(input_prefix+'.out','w') out_file.write('# - AlloPred output -\n') out_file.write('#\n') out_file.write('# PDB file: '+pdb_file+'\n') out_file.write('# Active site residue file: '+act_res_filepath+'\n') out_file.write('# Active site residues: '+act_res_lines[0].rstrip()+'\n') out_file.write('# Pocket directory: '+pocket_folder+'\n') out_file.write('#\n') out_file.write('# C_n is the NMA effect over n modes; E_n is the NMA effect per perturbed residue over n modes\n') out_file.write('#\n') out_file.write('# AlloPred_rank\t'+clean_string+'\n') out_file.write('#\n') # write pocket lines in order of AlloPred ranking for i in range(len(ordering)): line = str(i)+'\t'+lines[ordering[i][0]] out_file.write(line+'\n') out_file.close() print 'Output file written' # finish print 'AlloPred finished successfully'
{ "repo_name": "jgreener64/allopred", "path": "run_allopred.py", "copies": "1", "size": "11049", "license": "mit", "hash": 3582375095768818700, "line_mean": 33.1018518519, "line_max": 164, "alpha_frac": 0.6766223188, "autogenerated": false, "ratio": 3.1027801179443975, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4279402436744397, "avg_score": null, "num_lines": null }
__all__ = ['optimalSVHT'] import numpy as np def optimalSVHT(matrix): """ Returns the optimal threshold of the singular values of a matrix, i.e., it computes the optimal number of singular values to keep or the optimal rank of the matrix. Given a matrix Y=X+sigma*Z, with Y the observed matrix, X the matrix that we want to find, Z an matrix whose elements are iid Gaussian random numbers with zero mean and unit variance and sigma is the standard deviation of the noise, the matrix X can be recovered in the least squares sense using a truncated SVD (compute the SVD of the matrix, keep only the relevant singular values and reconstruct the matrix). The problem is estimate the number of such singular values to keep. This function uses the theory of Gavish & Donoho (2014) that is valid for matrices with sizes larger than its rank, i.e., for low-rank matrices Input: matrix: matrix to estimate the rank Output: thrKnownNoise: in case sigma is known, multiply this value with sigma and this gives the threshold thrUnknownNoise: returns the threshold directly noiseEstimation: returns the estimation of the noise sv: returns the singular values of the matrix """ m, n = matrix.shape beta = 1.0 * m / n w = (8.0 * beta) / (beta + 1 + np.sqrt(beta**2 + 14 * beta +1)) lambdaStar = np.sqrt(2.0 * (beta + 1) + w) omega = 0.56*beta**3 - 0.95*beta**2 + 1.82*beta + 1.43 uSVD, wSVD, vSVD = np.linalg.svd(matrix) medianSV = np.median(wSVD) thrKnownNoise = lambdaStar * np.sqrt(n) thrUnknownNoise = omega * medianSV muSqrt = lambdaStar / omega noiseEstimation = medianSV / (np.sqrt(n) * muSqrt) return thrKnownNoise, thrUnknownNoise, noiseEstimation, wSVD if __name__ == "__main__": # Generate a matrix of given rank rank = 3 m = 80 n = 80 sigma = 0.02 X1 = np.random.randn(m,rank) X2 = np.random.randn(rank,n) Y = np.dot(X1, X2) + sigma * np.random.randn(m,n) thrKnownNoise, thrUnknownNoise, noiseEstimation, wSVD = optimalSVHT(Y) rankKnownNoise = len(np.where(wSVD > thrKnownNoise*sigma)[0]) rankUnknownNoise = len(np.where(wSVD > thrUnknownNoise)[0]) print "Known sigma : {0} - rank={1}".format(thrKnownNoise * sigma, rankKnownNoise) print "Unknown sigma : {0} - rank={1} - sigmaNoise={2}".format(thrUnknownNoise, rankUnknownNoise, noiseEstimation)
{ "repo_name": "aasensio/pyAndres", "path": "optimalSVHT.py", "copies": "1", "size": "2312", "license": "mit", "hash": 5771860972406984000, "line_mean": 38.2033898305, "line_max": 135, "alpha_frac": 0.7197231834, "autogenerated": false, "ratio": 3.1327913279132793, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4352514511313279, "avg_score": null, "num_lines": null }
__all__ = ['Option', 'Configuration', 'option'] from typing import Type, FrozenSet, Dict, Any import attr import logging from . import exceptions logger = logging.getLogger(__name__) # type: logging.Logger logger.setLevel(logging.DEBUG) @attr.s(frozen=True) class Option(object): """ Describes a configuration option in terms of its type and legal values. """ name = attr.ib(type=str) typ = attr.ib(type=Type) @property def _field(self) -> str: return "__{}".format(self.name) @attr.s(frozen=True) class Builder(object): typ = attr.ib(type=Type) def build(self, name: str) -> 'Option': return Option(name, self.typ) def option(*args, **kwargs) -> Option.Builder: return Option.Builder(*args, **kwargs) class ConfigurationMeta(type): def __new__(mcl, cls_name: str, bases, # FIXME ns: Dict[str, Any] ): # collect and build option definitions builders = {} # type: Dict[str, Option.Builder] for name in ns: if isinstance(ns[name], Option.Builder): logger.debug("found option: %s", name) builders[name] = ns[name] logger.debug("building options") options = frozenset( b.build(name) for (name, b) in builders.items() ) # type: FrozenSet[Option] logger.debug("built options: %s", options) logger.debug("storing options in options property") ns['options'] = options logger.debug("stored options in options property") logger.debug("constructing options") for option in options: getter = lambda self, f=option._field: getattr(self, f) ns[option.name] = property(getter) logger.debug("constructed options") return super().__new__(mcl, cls_name, bases, ns) class Configuration(object, metaclass=ConfigurationMeta): @classmethod def from_dict(cls: Type['Configuration'], dkt: Dict[str, Any] ) -> 'Configuration': return cls(**dkt) def __init__(self, *args, **kwargs) -> None: cls_name = self.__class__.__name__ options = self.__class__.options # type: FrozenSet[Option] # were any positional arguments passed to the constructor? if args: msg = "constructor [{}] accepts no positional arguments but {} {} given" # noqa: pycodestyle msg = msg.format(cls_name, "was" if len(args) == 1 else "were", len(args)) raise TypeError(msg) # set values for each option for opt in options: try: val = kwargs[opt.name] except KeyError: msg = "missing keyword argument [{}] to constructor [{}]" msg = msg.format(opt.name, cls_name) raise TypeError(msg) setattr(self, opt._field, val) # were any unexpected keyword arguments provided? if len(kwargs) > len(options): actual_args = set(n for n in kwargs) expected_args = set(opt.name for opt in options) unexpected_arguments = list(actual_args - expected_args) msg = "unexpected keyword arguments [{}] supplied to constructor [{}]" # noqa: pycodestyle msg = msg.format('; '.join(unexpected_arguments), cls_name) raise TypeError(msg) def __getitem__(self, name: str) -> Any: # FIXME use frozendict try: options = self.__class__.options opt = next(opt for opt in options if opt.name == name) except StopIteration: msg = "no option [{}] in state [{}]" msg.format(name, self.__class__.__name__) raise KeyError(msg) return getattr(self, opt._field) def __hash__(self) -> int: all_opts = [self[opt.name] for opt in self.__class__.options] all_opts.insert(0, self.__class__.__name__) return hash(tuple(all_opts)) def __eq__(self, other: 'Configuration') -> bool: if type(self) != type(other): msg = "illegal comparison of configurations: [{}] vs. [{}]" msg = msg.format(self.__class__.__name__, other.__class__.__name__) raise exceptions.HoustonException(msg) return self.__dict__ == other.__dict__ def to_dict(self) -> Dict[str, Any]: fields = {} # type: Dict[str, Any] for opt in self.__class__.options: fields[opt.name] = getattr(self, opt._field) return fields def __repr__(self) -> str: fields = self.to_dict() for (name, val) in fields.items(): if isinstance(val, float): s = "{:.3f}".format(val) else: s = str(val) fields[name] = val s = '; '.join(["{}: {}".format(k, v) for (k, v) in fields.items()]) s = "{}({})".format(self.__class__.__name__, s) return s
{ "repo_name": "squaresLab/Houston", "path": "houston/configuration.py", "copies": "1", "size": "5071", "license": "mit", "hash": 2108550771146111500, "line_mean": 33.7328767123, "line_max": 105, "alpha_frac": 0.5450601459, "autogenerated": false, "ratio": 4.073092369477911, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5118152515377912, "avg_score": null, "num_lines": null }
__all__ = ['OrderedDict'] # For bootstrapping reasons, the collection ABCs are defined in _abcoll.py. # They should however be considered an integral part of collections.py. from _abcoll import * import _abcoll __all__ += _abcoll.__all__ from operator import itemgetter as _itemgetter, eq as _eq from itertools import repeat as _repeat, chain as _chain, starmap as _starmap, \ ifilter as _ifilter, imap as _imap try: from thread import get_ident except ImportError: from dummy_thread import get_ident def _recursive_repr(user_function): 'Decorator to make a repr function return "..." for a recursive call' repr_running = set() def wrapper(self): key = id(self), get_ident() if key in repr_running: return '...' repr_running.add(key) try: result = user_function(self) finally: repr_running.discard(key) return result # Can't use functools.wraps() here because of bootstrap issues wrapper.__module__ = getattr(user_function, '__module__') wrapper.__doc__ = getattr(user_function, '__doc__') wrapper.__name__ = getattr(user_function, '__name__') return wrapper ################################################################################ ### OrderedDict ################################################################################ class OrderedDict(dict, MutableMapping): 'Dictionary that remembers insertion order' # An inherited dict maps keys to values. # The inherited dict provides __getitem__, __len__, __contains__, and get. # The remaining methods are order-aware. # Big-O running times for all methods are the same as for regular dictionaries. # The internal self.__map dictionary maps keys to links in a doubly linked list. # The circular doubly linked list starts and ends with a sentinel element. # The sentinel element never gets deleted (this simplifies the algorithm). # Each link is stored as a list of length three: [PREV, NEXT, KEY]. globalNodeList = [] def __init__(self, *args, **kwds): '''Initialize an ordered dictionary. Signature is the same as for regular dictionaries, but keyword arguments are not recommended because their insertion order is arbitrary. ''' if len(args) > 1: raise TypeError('expected at most 1 arguments, got %d' % len(args)) try: self.__root except AttributeError: self.__root = root = [None, None, None] # sentinel node PREV = 0 NEXT = 1 root[PREV] = root[NEXT] = root self.__map = {} self.update(*args, **kwds) def __setitem__(self, key, value, PREV=0, NEXT=1, dict_setitem=dict.__setitem__): 'od.__setitem__(i, y) <==> od[i]=y' # Setting a new item creates a new link which goes at the end of the linked # list, and the inherited dictionary is updated with the new key/value pair. if key not in self: root = self.__root last = root[PREV] last[NEXT] = root[PREV] = self.__map[key] = [last, root, key] dict_setitem(self, key, value) def __delitem__(self, key, PREV=0, NEXT=1, dict_delitem=dict.__delitem__): 'od.__delitem__(y) <==> del od[y]' # Deleting an existing item uses self.__map to find the link which is # then removed by updating the links in the predecessor and successor nodes. dict_delitem(self, key) link = self.__map.pop(key) link_prev = link[PREV] link_next = link[NEXT] link_prev[NEXT] = link_next link_next[PREV] = link_prev def __iter__(self, NEXT=1, KEY=2): 'od.__iter__() <==> iter(od)' # Traverse the linked list in order. root = self.__root curr = root[NEXT] while curr is not root: yield curr[KEY] curr = curr[NEXT] def __reversed__(self, PREV=0, KEY=2): 'od.__reversed__() <==> reversed(od)' # Traverse the linked list in reverse order. root = self.__root curr = root[PREV] while curr is not root: yield curr[KEY] curr = curr[PREV] def __reduce__(self): 'Return state information for pickling' items = [[k, self[k]] for k in self] tmp = self.__map, self.__root del self.__map, self.__root inst_dict = vars(self).copy() self.__map, self.__root = tmp if inst_dict: return (self.__class__, (items,), inst_dict) return self.__class__, (items,) def clear(self): 'od.clear() -> None. Remove all items from od.' try: for node in self.__map.itervalues(): del node[:] self.__root[:] = [self.__root, self.__root, None] self.__map.clear() except AttributeError: pass dict.clear(self) setdefault = MutableMapping.setdefault update = MutableMapping.update pop = MutableMapping.pop keys = MutableMapping.keys values = MutableMapping.values items = MutableMapping.items iterkeys = MutableMapping.iterkeys itervalues = MutableMapping.itervalues iteritems = MutableMapping.iteritems __ne__ = MutableMapping.__ne__ def viewkeys(self): "od.viewkeys() -> a set-like object providing a view on od's keys" return KeysView(self) def viewvalues(self): "od.viewvalues() -> an object providing a view on od's values" return ValuesView(self) def viewitems(self): "od.viewitems() -> a set-like object providing a view on od's items" return ItemsView(self) def popitem(self, last=True): '''od.popitem() -> (k, v), return and remove a (key, value) pair. Pairs are returned in LIFO order if last is true or FIFO order if false. ''' if not self: raise KeyError('dictionary is empty') key = next(reversed(self) if last else iter(self)) value = self.pop(key) return key, value @_recursive_repr def __repr__(self): 'od.__repr__() <==> repr(od)' if not self: return '%s()' % (self.__class__.__name__,) return '%s(%r)' % (self.__class__.__name__, self.items()) def copy(self): 'od.copy() -> a shallow copy of od' return self.__class__(self) @classmethod def fromkeys(cls, iterable, value=None): '''OD.fromkeys(S[, v]) -> New ordered dictionary with keys from S and values equal to v (which defaults to None). ''' d = cls() for key in iterable: d[key] = value return d def __eq__(self, other): '''od.__eq__(y) <==> od==y. Comparison to another OD is order-sensitive while comparison to a regular mapping is order-insensitive. ''' if isinstance(other, OrderedDict): return len(self)==len(other) and \ all(_imap(_eq, self.iteritems(), other.iteritems())) return dict.__eq__(self, other)
{ "repo_name": "baseblack/ReproWeb", "path": "3rdParty/python/ordereddict.py", "copies": "1", "size": "7155", "license": "bsd-2-clause", "hash": -5961520905938475000, "line_mean": 34.9547738693, "line_max": 85, "alpha_frac": 0.5693920335, "autogenerated": false, "ratio": 4.198943661971831, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.007527596076596198, "num_lines": 199 }
__all__ = ['OrderedDict'] # For bootstrapping reasons, the collection ABCs are defined in _abcoll.py. # They should however be considered an integral part of collections.py. from _abcoll import * import _abcoll __all__ += _abcoll.__all__ from operator import itemgetter as _itemgetter from keyword import iskeyword as _iskeyword try: from thread import get_ident as _get_ident except ImportError: from dummy_thread import get_ident as _get_ident ################################################################################ ### OrderedDict ################################################################################ class OrderedDict(dict): 'Dictionary that remembers insertion order' # An inherited dict maps keys to values. # The inherited dict provides __getitem__, __len__, __contains__, and get. # The remaining methods are order-aware. # Big-O running times for all methods are the same as regular dictionaries. # The internal self.__map dict maps keys to links in a doubly linked list. # The circular doubly linked list starts and ends with a sentinel element. # The sentinel element never gets deleted (this simplifies the algorithm). # Each link is stored as a list of length three: [PREV, NEXT, KEY]. def __init__(self, *args, **kwds): '''Initialize an ordered dictionary. The signature is the same as regular dictionaries, but keyword arguments are not recommended because their insertion order is arbitrary. ''' if len(args) > 1: raise TypeError('expected at most 1 arguments, got %d' % len(args)) try: self.__root except AttributeError: self.__root = root = [] # sentinel node root[:] = [root, root, None] self.__map = {} self.__update(*args, **kwds) def __setitem__(self, key, value, PREV=0, NEXT=1, dict_setitem=dict.__setitem__): 'od.__setitem__(i, y) <==> od[i]=y' # Setting a new item creates a new link at the end of the linked list, # and the inherited dictionary is updated with the new key/value pair. if key not in self: root = self.__root last = root[PREV] last[NEXT] = root[PREV] = self.__map[key] = [last, root, key] dict_setitem(self, key, value) def __delitem__(self, key, PREV=0, NEXT=1, dict_delitem=dict.__delitem__): 'od.__delitem__(y) <==> del od[y]' # Deleting an existing item uses self.__map to find the link which gets # removed by updating the links in the predecessor and successor nodes. dict_delitem(self, key) link_prev, link_next, key = self.__map.pop(key) link_prev[NEXT] = link_next link_next[PREV] = link_prev def __iter__(self): 'od.__iter__() <==> iter(od)' # Traverse the linked list in order. NEXT, KEY = 1, 2 root = self.__root curr = root[NEXT] while curr is not root: yield curr[KEY] curr = curr[NEXT] def __reversed__(self): 'od.__reversed__() <==> reversed(od)' # Traverse the linked list in reverse order. PREV, KEY = 0, 2 root = self.__root curr = root[PREV] while curr is not root: yield curr[KEY] curr = curr[PREV] def clear(self): 'od.clear() -> None. Remove all items from od.' for node in self.__map.itervalues(): del node[:] root = self.__root root[:] = [root, root, None] self.__map.clear() dict.clear(self) # -- the following methods do not depend on the internal structure -- def keys(self): 'od.keys() -> list of keys in od' return list(self) def values(self): 'od.values() -> list of values in od' return [self[key] for key in self] def items(self): 'od.items() -> list of (key, value) pairs in od' return [(key, self[key]) for key in self] def iterkeys(self): 'od.iterkeys() -> an iterator over the keys in od' return iter(self) def itervalues(self): 'od.itervalues -> an iterator over the values in od' for k in self: yield self[k] def iteritems(self): 'od.iteritems -> an iterator over the (key, value) pairs in od' for k in self: yield (k, self[k]) update = MutableMapping.update __update = update # let subclasses override update without breaking __init__ __marker = object() def pop(self, key, default=__marker): '''od.pop(k[,d]) -> v, remove specified key and return the corresponding value. If key is not found, d is returned if given, otherwise KeyError is raised. ''' if key in self: result = self[key] del self[key] return result if default is self.__marker: raise KeyError(key) return default def setdefault(self, key, default=None): 'od.setdefault(k[,d]) -> od.get(k,d), also set od[k]=d if k not in od' if key in self: return self[key] self[key] = default return default def popitem(self, last=True): '''od.popitem() -> (k, v), return and remove a (key, value) pair. Pairs are returned in LIFO order if last is true or FIFO order if false. ''' if not self: raise KeyError('dictionary is empty') key = next(reversed(self) if last else iter(self)) value = self.pop(key) return key, value def __repr__(self, _repr_running={}): 'od.__repr__() <==> repr(od)' call_key = id(self), _get_ident() if call_key in _repr_running: return '...' _repr_running[call_key] = 1 try: if not self: return '%s()' % (self.__class__.__name__,) return '%s(%r)' % (self.__class__.__name__, self.items()) finally: del _repr_running[call_key] def __reduce__(self): 'Return state information for pickling' items = [[k, self[k]] for k in self] inst_dict = vars(self).copy() for k in vars(OrderedDict()): inst_dict.pop(k, None) if inst_dict: return (self.__class__, (items,), inst_dict) return self.__class__, (items,) def copy(self): 'od.copy() -> a shallow copy of od' return self.__class__(self) @classmethod def fromkeys(cls, iterable, value=None): '''OD.fromkeys(S[, v]) -> New ordered dictionary with keys from S. If not specified, the value defaults to None. ''' self = cls() for key in iterable: self[key] = value return self def __eq__(self, other): '''od.__eq__(y) <==> od==y. Comparison to another OD is order-sensitive while comparison to a regular mapping is order-insensitive. ''' if isinstance(other, OrderedDict): return len(self)==len(other) and self.items() == other.items() return dict.__eq__(self, other) def __ne__(self, other): 'od.__ne__(y) <==> od!=y' return not self == other # -- the following methods support python 3.x style dictionary views -- def viewkeys(self): "od.viewkeys() -> a set-like object providing a view on od's keys" return KeysView(self) def viewvalues(self): "od.viewvalues() -> an object providing a view on od's values" return ValuesView(self) def viewitems(self): "od.viewitems() -> a set-like object providing a view on od's items" return ItemsView(self)
{ "repo_name": "enthought/depsolver", "path": "depsolver/compat/_collections.py", "copies": "1", "size": "7765", "license": "bsd-3-clause", "hash": 1244417524683258400, "line_mean": 33.2070484581, "line_max": 85, "alpha_frac": 0.5577591758, "autogenerated": false, "ratio": 4.099788806758184, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0009598452064689465, "num_lines": 227 }
__all__ = ('OrderedDict',) try: from collections import OrderedDict except ImportError: # http://code.activestate.com/recipes/576693/ from UserDict import DictMixin class OrderedDict(dict, DictMixin): def __init__(self, *args, **kwds): if len(args) > 1: raise TypeError('expected at most 1 arguments, got %d' % len(args)) try: self.__end except AttributeError: self.clear() self.update(*args, **kwds) def clear(self): self.__end = end = [] end += [None, end, end] # sentinel node for doubly linked list self.__map = {} # key --> [key, prev, next] dict.clear(self) def __setitem__(self, key, value): if key not in self: end = self.__end curr = end[1] curr[2] = end[1] = self.__map[key] = [key, curr, end] dict.__setitem__(self, key, value) def __delitem__(self, key): dict.__delitem__(self, key) key, prev, next = self.__map.pop(key) prev[2] = next next[1] = prev def __iter__(self): end = self.__end curr = end[2] while curr is not end: yield curr[0] curr = curr[2] def __reversed__(self): end = self.__end curr = end[1] while curr is not end: yield curr[0] curr = curr[1] def popitem(self, last=True): if not self: raise KeyError('dictionary is empty') key = reversed(self).next() if last else iter(self).next() value = self.pop(key) return key, value def __reduce__(self): items = [[k, self[k]] for k in self] tmp = self.__map, self.__end del self.__map, self.__end inst_dict = vars(self).copy() self.__map, self.__end = tmp if inst_dict: return (self.__class__, (items,), inst_dict) return self.__class__, (items,) def keys(self): return list(self) setdefault = DictMixin.setdefault update = DictMixin.update pop = DictMixin.pop values = DictMixin.values items = DictMixin.items iterkeys = DictMixin.iterkeys itervalues = DictMixin.itervalues iteritems = DictMixin.iteritems def __repr__(self): if not self: return '%s()' % (self.__class__.__name__,) return '%s(%r)' % (self.__class__.__name__, self.items()) def copy(self): return self.__class__(self) @classmethod def fromkeys(cls, iterable, value=None): d = cls() for key in iterable: d[key] = value return d def __eq__(self, other): if isinstance(other, OrderedDict): return len(self)==len(other) and \ all(p==q for p, q in zip(self.items(), other.items())) return dict.__eq__(self, other) def __ne__(self, other): return not self == other
{ "repo_name": "r3gis3r/android2po", "path": "android2po/compat.py", "copies": "1", "size": "3293", "license": "bsd-2-clause", "hash": 3718322584942820000, "line_mean": 30.6730769231, "line_max": 83, "alpha_frac": 0.4691770422, "autogenerated": false, "ratio": 4.355820105820106, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0009293753008373216, "num_lines": 104 }
__all__ = ('override_settings',) try: from django.test.utils import override_settings except ImportError: # we are in Django 1.3 from django.conf import settings, UserSettingsHolder from django.utils.functional import wraps class override_settings(object): """ Acts as either a decorator, or a context manager. If it's a decorator it takes a function and returns a wrapped function. If it's a contextmanager it's used with the ``with`` statement. In either event entering/exiting are called before and after, respectively, the function/block is executed. This class was backported from Django 1.5 As django.test.signals.setting_changed is not supported in 1.3, it's not sent on changing settings. """ def __init__(self, **kwargs): self.options = kwargs self.wrapped = settings._wrapped def __enter__(self): self.enable() def __exit__(self, exc_type, exc_value, traceback): self.disable() def __call__(self, test_func): from django.test import TransactionTestCase if isinstance(test_func, type): if not issubclass(test_func, TransactionTestCase): raise Exception( "Only subclasses of Django SimpleTestCase " "can be decorated with override_settings") original_pre_setup = test_func._pre_setup original_post_teardown = test_func._post_teardown def _pre_setup(innerself): self.enable() original_pre_setup(innerself) def _post_teardown(innerself): original_post_teardown(innerself) self.disable() test_func._pre_setup = _pre_setup test_func._post_teardown = _post_teardown return test_func else: @wraps(test_func) def inner(*args, **kwargs): with self: return test_func(*args, **kwargs) return inner def enable(self): override = UserSettingsHolder(settings._wrapped) for key, new_value in self.options.items(): setattr(override, key, new_value) settings._wrapped = override def disable(self): settings._wrapped = self.wrapped
{ "repo_name": "treyhunner/django-crispy-forms", "path": "crispy_forms/tests/utils.py", "copies": "25", "size": "2494", "license": "mit", "hash": -4779961259839020000, "line_mean": 35.6764705882, "line_max": 77, "alpha_frac": 0.5609462711, "autogenerated": false, "ratio": 4.899803536345776, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0, "num_lines": 68 }
__all__ = ('override_settings', 'setup') try: from django import setup except ImportError: def setup(): pass try: from django.test.runner import DiscoverRunner except ImportError: # Django 1.5 or earlier. Fallback to a patched version of the old runner. # Should be removed when dropping 1.4 and 1.5 support. from django.test.simple import DjangoTestSuiteRunner class DiscoverRunner(DjangoTestSuiteRunner): def run_tests(self, tests, *args, **kwargs): tests = [ test.replace('crispy_forms.tests.', 'crispy_forms.') for test in tests ] return super(DiscoverRunner, self).run_tests(tests, *args, **kwargs) try: from django.template import engines def get_template_from_string(s): return engines['django'].from_string(s) except ImportError: # Old template loading private API in Django < 1.8. # Remove this when dropping 1.4 and 1.7 support. from django.template import loader def get_template_from_string(s): return loader.get_template_from_string(s) try: from django.test.utils import override_settings except ImportError: # we are in Django 1.3 from django.conf import settings, UserSettingsHolder from django.utils.functional import wraps class override_settings(object): """ Acts as either a decorator, or a context manager. If it's a decorator it takes a function and returns a wrapped function. If it's a contextmanager it's used with the ``with`` statement. In either event entering/exiting are called before and after, respectively, the function/block is executed. This class was backported from Django 1.5 As django.test.signals.setting_changed is not supported in 1.3, it's not sent on changing settings. """ def __init__(self, **kwargs): self.options = kwargs self.wrapped = settings._wrapped def __enter__(self): self.enable() def __exit__(self, exc_type, exc_value, traceback): self.disable() def __call__(self, test_func): from django.test import TransactionTestCase if isinstance(test_func, type): if not issubclass(test_func, TransactionTestCase): raise Exception( "Only subclasses of Django SimpleTestCase " "can be decorated with override_settings") original_pre_setup = test_func._pre_setup original_post_teardown = test_func._post_teardown def _pre_setup(innerself): self.enable() original_pre_setup(innerself) def _post_teardown(innerself): original_post_teardown(innerself) self.disable() test_func._pre_setup = _pre_setup test_func._post_teardown = _post_teardown return test_func else: @wraps(test_func) def inner(*args, **kwargs): with self: return test_func(*args, **kwargs) return inner def enable(self): override = UserSettingsHolder(settings._wrapped) for key, new_value in self.options.items(): setattr(override, key, new_value) settings._wrapped = override def disable(self): settings._wrapped = self.wrapped
{ "repo_name": "uranusjr/django-crispy-forms-ng", "path": "crispy_forms/tests/utils.py", "copies": "1", "size": "3572", "license": "mit", "hash": 6399384676496187000, "line_mean": 32.6981132075, "line_max": 80, "alpha_frac": 0.5904255319, "autogenerated": false, "ratio": 4.591259640102828, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5681685172002827, "avg_score": null, "num_lines": null }
# allowable multiple choice node and edge features allowable_features = { 'possible_atomic_num_list' : list(range(1, 119)) + ['misc'], 'possible_chirality_list' : [ 'CHI_UNSPECIFIED', 'CHI_TETRAHEDRAL_CW', 'CHI_TETRAHEDRAL_CCW', 'CHI_OTHER' ], 'possible_degree_list' : [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 'misc'], 'possible_formal_charge_list' : [-5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5, 'misc'], 'possible_numH_list' : [0, 1, 2, 3, 4, 5, 6, 7, 8, 'misc'], 'possible_number_radical_e_list': [0, 1, 2, 3, 4, 'misc'], 'possible_hybridization_list' : [ 'SP', 'SP2', 'SP3', 'SP3D', 'SP3D2', 'misc' ], 'possible_is_aromatic_list': [False, True], 'possible_is_in_ring_list': [False, True], 'possible_bond_type_list' : [ 'SINGLE', 'DOUBLE', 'TRIPLE', 'AROMATIC', 'misc' ], 'possible_bond_stereo_list': [ 'STEREONONE', 'STEREOZ', 'STEREOE', 'STEREOCIS', 'STEREOTRANS', 'STEREOANY', ], 'possible_is_conjugated_list': [False, True], } def safe_index(l, e): """ Return index of element e in list l. If e is not present, return the last index """ try: return l.index(e) except: return len(l) - 1 # # miscellaneous case # i = safe_index(allowable_features['possible_atomic_num_list'], 'asdf') # assert allowable_features['possible_atomic_num_list'][i] == 'misc' # # normal case # i = safe_index(allowable_features['possible_atomic_num_list'], 2) # assert allowable_features['possible_atomic_num_list'][i] == 2 def atom_to_feature_vector(atom): """ Converts rdkit atom object to feature list of indices :param mol: rdkit atom object :return: list """ atom_feature = [ safe_index(allowable_features['possible_atomic_num_list'], atom.GetAtomicNum()), allowable_features['possible_chirality_list'].index(str(atom.GetChiralTag())), safe_index(allowable_features['possible_degree_list'], atom.GetTotalDegree()), safe_index(allowable_features['possible_formal_charge_list'], atom.GetFormalCharge()), safe_index(allowable_features['possible_numH_list'], atom.GetTotalNumHs()), safe_index(allowable_features['possible_number_radical_e_list'], atom.GetNumRadicalElectrons()), safe_index(allowable_features['possible_hybridization_list'], str(atom.GetHybridization())), allowable_features['possible_is_aromatic_list'].index(atom.GetIsAromatic()), allowable_features['possible_is_in_ring_list'].index(atom.IsInRing()), ] return atom_feature # from rdkit import Chem # mol = Chem.MolFromSmiles('Cl[C@H](/C=C/C)Br') # atom = mol.GetAtomWithIdx(1) # chiral carbon # atom_feature = atom_to_feature_vector(atom) # assert atom_feature == [5, 2, 4, 5, 1, 0, 2, 0, 0] def get_atom_feature_dims(): return list(map(len, [ allowable_features['possible_atomic_num_list'], allowable_features['possible_chirality_list'], allowable_features['possible_degree_list'], allowable_features['possible_formal_charge_list'], allowable_features['possible_numH_list'], allowable_features['possible_number_radical_e_list'], allowable_features['possible_hybridization_list'], allowable_features['possible_is_aromatic_list'], allowable_features['possible_is_in_ring_list'] ])) def bond_to_feature_vector(bond): """ Converts rdkit bond object to feature list of indices :param mol: rdkit bond object :return: list """ bond_feature = [ safe_index(allowable_features['possible_bond_type_list'], str(bond.GetBondType())), allowable_features['possible_bond_stereo_list'].index(str(bond.GetStereo())), allowable_features['possible_is_conjugated_list'].index(bond.GetIsConjugated()), ] return bond_feature # uses same molecule as atom_to_feature_vector test # bond = mol.GetBondWithIdx(2) # double bond with stereochem # bond_feature = bond_to_feature_vector(bond) # assert bond_feature == [1, 2, 0] def get_bond_feature_dims(): return list(map(len, [ allowable_features['possible_bond_type_list'], allowable_features['possible_bond_stereo_list'], allowable_features['possible_is_conjugated_list'] ])) def atom_feature_vector_to_dict(atom_feature): [atomic_num_idx, chirality_idx, degree_idx, formal_charge_idx, num_h_idx, number_radical_e_idx, hybridization_idx, is_aromatic_idx, is_in_ring_idx] = atom_feature feature_dict = { 'atomic_num': allowable_features['possible_atomic_num_list'][atomic_num_idx], 'chirality': allowable_features['possible_chirality_list'][chirality_idx], 'degree': allowable_features['possible_degree_list'][degree_idx], 'formal_charge': allowable_features['possible_formal_charge_list'][formal_charge_idx], 'num_h': allowable_features['possible_numH_list'][num_h_idx], 'num_rad_e': allowable_features['possible_number_radical_e_list'][number_radical_e_idx], 'hybridization': allowable_features['possible_hybridization_list'][hybridization_idx], 'is_aromatic': allowable_features['possible_is_aromatic_list'][is_aromatic_idx], 'is_in_ring': allowable_features['possible_is_in_ring_list'][is_in_ring_idx] } return feature_dict # # uses same atom_feature as atom_to_feature_vector test # atom_feature_dict = atom_feature_vector_to_dict(atom_feature) # assert atom_feature_dict['atomic_num'] == 6 # assert atom_feature_dict['chirality'] == 'CHI_TETRAHEDRAL_CCW' # assert atom_feature_dict['degree'] == 4 # assert atom_feature_dict['formal_charge'] == 0 # assert atom_feature_dict['num_h'] == 1 # assert atom_feature_dict['num_rad_e'] == 0 # assert atom_feature_dict['hybridization'] == 'SP3' # assert atom_feature_dict['is_aromatic'] == False # assert atom_feature_dict['is_in_ring'] == False def bond_feature_vector_to_dict(bond_feature): [bond_type_idx, bond_stereo_idx, is_conjugated_idx] = bond_feature feature_dict = { 'bond_type': allowable_features['possible_bond_type_list'][bond_type_idx], 'bond_stereo': allowable_features['possible_bond_stereo_list'][bond_stereo_idx], 'is_conjugated': allowable_features['possible_is_conjugated_list'][is_conjugated_idx] } return feature_dict # # uses same bond as bond_to_feature_vector test # bond_feature_dict = bond_feature_vector_to_dict(bond_feature) # assert bond_feature_dict['bond_type'] == 'DOUBLE' # assert bond_feature_dict['bond_stereo'] == 'STEREOE' # assert bond_feature_dict['is_conjugated'] == False
{ "repo_name": "snap-stanford/ogb", "path": "ogb/utils/features.py", "copies": "1", "size": "6795", "license": "mit", "hash": 8965827276664335000, "line_mean": 39.9397590361, "line_max": 108, "alpha_frac": 0.6441501104, "autogenerated": false, "ratio": 3.181179775280899, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4325329885680899, "avg_score": null, "num_lines": null }
# Allow access to command-line arguments import sys import pyrow # Import the core and GUI elements of Qt from PyQt4.Qt import * class PM3(QWidget): def __init__(self): super(PM3,self).__init__() self.pmCount = 0 self.strokeCount = 0 self.display = "" self.distance =0 def paintEvent(self, event): qp = QPainter() font = QFont("times") fm = QFontMetrics(font) qp.begin(self) wnd = qp.window() w = wnd.width() h = wnd.height() qp.setBrush(QColor(127,127,192 )) qp.drawRect(0,0,w-1,h-1) qp.drawText(10, 10, self.display) bw = w /6 # 6 buoys on the screen dw = self.distance % 10 offset = (dw/10) *bw for ix in range(0,10): qp.drawEllipse(ix * bw +offset, h/4, 5,5) qp.drawEllipse(ix * bw +offset, h/2, 5,5) qp.drawText(ix * bw +offset, h/4-20, str(10* ((ix -3) + int(self.distance/10)))) qp.end() class RaspiRowMain(QMainWindow): def __init__(self, parent = None): super(RaspiRowMain, self).__init__(parent) ergs = pyrow.find() if len(ergs) == 0: exit("No ergs found.") self.erg = pyrow.pyrow(ergs[0]) self.initUI() def onStrokeTime(self): self.pm3.strokeCount = self.pm3.strokeCount +1 def onPmRefresh(self): results = self.erg.getMonitor(True) cstate = results['strokestate'] & 0xF s = "Stroke : " + str(results['spm']) + "\r\n" s = s+ "Distance : " + str(results['distance']) + "\r\n" s = s + "Time : " + str(results['time']) + "\r\n" s = s + "Power : " + str(results['power']) +"\r\n" s = s + "Calories/hour : " + str(results['calhr'])+"\r\n" s = s + "Calories : " + str(results['calories'])+"\r\n" s = s + "Pace : " + str(results['pace'])+"\r\n" self.pm3.distance = results['distance'] self.pm3.display = s self.pm3.pmCount = self.pm3.pmCount +1 self.pm3.update() def initUI(self): openUserAction = QAction('&Open user', self) openUserAction.setShortcut('Ctrl+O') openUserAction.setStatusTip('CHoose or create a user') # openUserAction.triggered.connect(qApp.quit) exitAction = QAction('E&xit', self) exitAction.setShortcut('Ctrl+Q') exitAction.setStatusTip('Exit application') exitAction.triggered.connect(qApp.quit) menuBar = self.menuBar() fileMenu = menuBar.addMenu('&File') fileMenu.addAction(openUserAction) fileMenu.addSeparator() fileMenu.addAction(exitAction) self.toolbar = self.addToolBar('Main') self.toolbar.setFloatable(False) self.toolbar.addAction(openUserAction) self.toolbar.addSeparator() self.toolbar.addAction(exitAction) self.statusBar().showMessage('Ready') self.mainBody = QVBoxLayout() self.pm3 = PM3() self.pm3.setGeometry(10,10,100,100) self.mainBody.addWidget(self.pm3) centralWidget = QWidget() centralWidget.setLayout(self.mainBody) self.setCentralWidget(centralWidget) self.setGeometry(50,50,640,480) self.setWindowTitle('RaspiRow') # Add some timers self.strokeTime = QTimer(self) self.strokeTime.timeout.connect(self.onStrokeTime) self.strokeTime.start(2000) self.pmRefresh = QTimer(self) self.pmRefresh.timeout.connect(self.onPmRefresh) self.pmRefresh.start(50) self.show() print "after the show" print self.rect() def main(): app = QApplication(sys.argv) mw = RaspiRowMain() sys.exit(app.exec_()) if __name__ == '__main__': main()
{ "repo_name": "chrisreynolds/RaspiRow", "path": "RaspiRowMain.py", "copies": "1", "size": "3782", "license": "bsd-2-clause", "hash": -5584557144017902000, "line_mean": 32.7678571429, "line_max": 92, "alpha_frac": 0.5780010576, "autogenerated": false, "ratio": 3.300174520069808, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9298143132158658, "avg_score": 0.016006489102229775, "num_lines": 112 }
"""Allow a simple way to ensure execution is confined to one thread. This module defines the Affinity data type that runs code on a single thread. An instance of the class will execute functions only on the thread that made the object in the first place. The class is useful in a GUI's main loop.""" __author__ = 'Stephen "Zero" Chappell <Noctis.Skytower@gmail.com>' __date__ = '4 June 2012' __version__ = 1, 0, 0 ################################################################################ import sys import _thread import queue ################################################################################ def slots(names=''): "Sets the __slots__ variable in the calling context with private names." sys._getframe(1).f_locals['__slots__'] = \ tuple('__' + name for name in names.replace(',', ' ').split()) ################################################################################ class Affinity: "Affinity() -> Affinity instance" slots('thread, action') def __init__(self): "Initializes instance with thread identity and job queue." self.__thread = _thread.get_ident() self.__action = queue.Queue() def __call__(self, func, *args, **kwargs): "Executes function on creating thread and returns result." if _thread.get_ident() == self.__thread: while not self.__action.empty(): self.__action.get_nowait()() return func(*args, **kwargs) delegate = _Delegate(func, args, kwargs) self.__action.put_nowait(delegate) return delegate.value ################################################################################ class _Delegate: "_Delegate(func, args, kwargs) -> _Delegate instance" slots('func, args, kwargs, mutex, value, error') def __init__(self, func, args, kwargs): "Initializes instance from arguments and prepares to run." self.__func = func self.__args = args self.__kwargs = kwargs self.__mutex = _thread.allocate_lock() self.__mutex.acquire() def __call__(self): "Executes code with arguments and allows value retrieval." try: self.__value = self.__func(*self.__args, **self.__kwargs) self.__error = False except: self.__value = sys.exc_info()[1] self.__error = True self.__mutex.release() @property def value(self): "Waits for value availability and raises or returns data." self.__mutex.acquire() if self.__error: raise self.__value return self.__value
{ "repo_name": "ActiveState/code", "path": "recipes/Python/578151_affinitypy/recipe-578151.py", "copies": "1", "size": "2633", "license": "mit", "hash": -7013793165825529000, "line_mean": 32.3291139241, "line_max": 80, "alpha_frac": 0.5267755412, "autogenerated": false, "ratio": 4.603146853146853, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5629922394346853, "avg_score": null, "num_lines": null }
"""allow bash-completion for argparse with argcomplete if installed needs argcomplete>=0.5.6 for python 3.2/3.3 (older versions fail to find the magic string, so _ARGCOMPLETE env. var is never set, and this does not need special code. Function try_argcomplete(parser) should be called directly before the call to ArgumentParser.parse_args(). The filescompleter is what you normally would use on the positional arguments specification, in order to get "dirname/" after "dirn<TAB>" instead of the default "dirname ": optparser.add_argument(Config._file_or_dir, nargs='*' ).completer=filescompleter Other, application specific, completers should go in the file doing the add_argument calls as they need to be specified as .completer attributes as well. (If argcomplete is not installed, the function the attribute points to will not be used). SPEEDUP ======= The generic argcomplete script for bash-completion (/etc/bash_completion.d/python-argcomplete.sh ) uses a python program to determine startup script generated by pip. You can speed up completion somewhat by changing this script to include # PYTHON_ARGCOMPLETE_OK so the the python-argcomplete-check-easy-install-script does not need to be called to find the entry point of the code and see if that is marked with PYTHON_ARGCOMPLETE_OK INSTALL/DEBUGGING ================= To include this support in another application that has setup.py generated scripts: - add the line: # PYTHON_ARGCOMPLETE_OK near the top of the main python entry point - include in the file calling parse_args(): from _argcomplete import try_argcomplete, filescompleter , call try_argcomplete just before parse_args(), and optionally add filescompleter to the positional arguments' add_argument() If things do not work right away: - switch on argcomplete debugging with (also helpful when doing custom completers): export _ARC_DEBUG=1 - run: python-argcomplete-check-easy-install-script $(which appname) echo $? will echo 0 if the magic line has been found, 1 if not - sometimes it helps to find early on errors using: _ARGCOMPLETE=1 _ARC_DEBUG=1 appname which should throw a KeyError: 'COMPLINE' (which is properly set by the global argcomplete script). """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import sys from glob import glob class FastFilesCompleter(object): "Fast file completer class" def __init__(self, directories=True): self.directories = directories def __call__(self, prefix, **kwargs): """only called on non option completions""" if os.path.sep in prefix[1:]: prefix_dir = len(os.path.dirname(prefix) + os.path.sep) else: prefix_dir = 0 completion = [] globbed = [] if "*" not in prefix and "?" not in prefix: # we are on unix, otherwise no bash if not prefix or prefix[-1] == os.path.sep: globbed.extend(glob(prefix + ".*")) prefix += "*" globbed.extend(glob(prefix)) for x in sorted(globbed): if os.path.isdir(x): x += "/" # append stripping the prefix (like bash, not like compgen) completion.append(x[prefix_dir:]) return completion if os.environ.get("_ARGCOMPLETE"): try: import argcomplete.completers except ImportError: sys.exit(-1) filescompleter = FastFilesCompleter() def try_argcomplete(parser): argcomplete.autocomplete(parser, always_complete_options=False) else: def try_argcomplete(parser): pass filescompleter = None
{ "repo_name": "pfctdayelise/pytest", "path": "src/_pytest/_argcomplete.py", "copies": "4", "size": "3724", "license": "mit", "hash": -1166359100735830500, "line_mean": 33.1651376147, "line_max": 74, "alpha_frac": 0.6922663802, "autogenerated": false, "ratio": 4.1331853496115425, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0, "num_lines": 109 }
"""Allow bash-completion for argparse with argcomplete if installed. Needs argcomplete>=0.5.6 for python 3.2/3.3 (older versions fail to find the magic string, so _ARGCOMPLETE env. var is never set, and this does not need special code). Function try_argcomplete(parser) should be called directly before the call to ArgumentParser.parse_args(). The filescompleter is what you normally would use on the positional arguments specification, in order to get "dirname/" after "dirn<TAB>" instead of the default "dirname ": optparser.add_argument(Config._file_or_dir, nargs='*').completer=filescompleter Other, application specific, completers should go in the file doing the add_argument calls as they need to be specified as .completer attributes as well. (If argcomplete is not installed, the function the attribute points to will not be used). SPEEDUP ======= The generic argcomplete script for bash-completion (/etc/bash_completion.d/python-argcomplete.sh) uses a python program to determine startup script generated by pip. You can speed up completion somewhat by changing this script to include # PYTHON_ARGCOMPLETE_OK so the python-argcomplete-check-easy-install-script does not need to be called to find the entry point of the code and see if that is marked with PYTHON_ARGCOMPLETE_OK. INSTALL/DEBUGGING ================= To include this support in another application that has setup.py generated scripts: - Add the line: # PYTHON_ARGCOMPLETE_OK near the top of the main python entry point. - Include in the file calling parse_args(): from _argcomplete import try_argcomplete, filescompleter Call try_argcomplete just before parse_args(), and optionally add filescompleter to the positional arguments' add_argument(). If things do not work right away: - Switch on argcomplete debugging with (also helpful when doing custom completers): export _ARC_DEBUG=1 - Run: python-argcomplete-check-easy-install-script $(which appname) echo $? will echo 0 if the magic line has been found, 1 if not. - Sometimes it helps to find early on errors using: _ARGCOMPLETE=1 _ARC_DEBUG=1 appname which should throw a KeyError: 'COMPLINE' (which is properly set by the global argcomplete script). """ import argparse import os import sys from glob import glob from typing import Any from typing import List from typing import Optional class FastFilesCompleter: """Fast file completer class.""" def __init__(self, directories: bool = True) -> None: self.directories = directories def __call__(self, prefix: str, **kwargs: Any) -> List[str]: # Only called on non option completions. if os.path.sep in prefix[1:]: prefix_dir = len(os.path.dirname(prefix) + os.path.sep) else: prefix_dir = 0 completion = [] globbed = [] if "*" not in prefix and "?" not in prefix: # We are on unix, otherwise no bash. if not prefix or prefix[-1] == os.path.sep: globbed.extend(glob(prefix + ".*")) prefix += "*" globbed.extend(glob(prefix)) for x in sorted(globbed): if os.path.isdir(x): x += "/" # Append stripping the prefix (like bash, not like compgen). completion.append(x[prefix_dir:]) return completion if os.environ.get("_ARGCOMPLETE"): try: import argcomplete.completers except ImportError: sys.exit(-1) filescompleter: Optional[FastFilesCompleter] = FastFilesCompleter() def try_argcomplete(parser: argparse.ArgumentParser) -> None: argcomplete.autocomplete(parser, always_complete_options=False) else: def try_argcomplete(parser: argparse.ArgumentParser) -> None: pass filescompleter = None
{ "repo_name": "RonnyPfannschmidt/pytest", "path": "src/_pytest/_argcomplete.py", "copies": "4", "size": "3810", "license": "mit", "hash": 6918198904568441000, "line_mean": 31.5641025641, "line_max": 82, "alpha_frac": 0.698687664, "autogenerated": false, "ratio": 4.061833688699361, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.676052135269936, "avg_score": null, "num_lines": null }
"""Allow basic operations with XML""" import xml.etree.ElementTree as ET import os COLLADA_SCHEMA_TEXT = "{http://www.collada.org/2005/11/COLLADASchema}" INPUT_DIRECTORY = os.path.dirname(os.path.realpath(__file__)) + "/input/" OUTPUT_DIRECTORY = os.path.dirname(os.path.realpath(__file__)) + "/output/" TREE = 0 ROOT = 0 def generate_skeletons_blender(input_dir, output_dir): """ Generate a skeleton for every file in the input folder """ for file in get_dae_files(): global TREE global ROOT global INPUT_DIRECTORY global OUTPUT_DIRECTORY INPUT_DIRECTORY = input_dir OUTPUT_DIRECTORY = output_dir TREE = ET.parse(INPUT_DIRECTORY + file) ROOT = TREE.getroot() save_skeleton_file() def generate_skeletons(): """ Generate a skeleton for every file in the input folder """ for file in get_dae_files(): global TREE global ROOT TREE = ET.parse(INPUT_DIRECTORY + file) ROOT = TREE.getroot() save_skeleton_file() def get_dae_files(): """ Returns a list of dae files in the input directory """ files = [] for file in os.listdir(INPUT_DIRECTORY): if ".dae" not in file: continue files.append(file) return files def get_bone_names(): """ Get the name of the bones inside of the dae file. """ bone_list = [] node = ROOT.find(COLLADA_SCHEMA_TEXT + "library_controllers/" + COLLADA_SCHEMA_TEXT + "controller/" + COLLADA_SCHEMA_TEXT + "skin/"+ COLLADA_SCHEMA_TEXT + "source/" ) bone_list = node.text.split() return bone_list def get_armature_name(): "Gets the name of the armature" node = ROOT.find(COLLADA_SCHEMA_TEXT + "library_visual_scenes/" + COLLADA_SCHEMA_TEXT + "visual_scene/") return node.attrib.get("name") def is_a_skeleton_node(xml_node): """Defines wether the node belongs to the skeleton or not""" return not COLLADA_SCHEMA_TEXT + "node" == xml_node.tag def get_skeleton_bones(recursive_function): """ Returns a string in 0ad format containing all the bones with their hierarchy""" current_path = (COLLADA_SCHEMA_TEXT + "library_visual_scenes/" + COLLADA_SCHEMA_TEXT + "visual_scene/" + COLLADA_SCHEMA_TEXT + "node/") string = "" node = ROOT.findall(current_path) for subnode in node: if is_a_skeleton_node(subnode): continue string += recursive_function(subnode.findall("./"), subnode) return string def get_sub_nodes(xml_node, xml_node_path): """ Returns a string containing the child nodes recursively""" subnode_text = "" for xml_subnode in xml_node: xml_subnodes = xml_subnode.findall(xml_node_path) subnode_text += recursive_load(xml_subnodes, xml_subnode) return subnode_text def get_sub_nodes_target(xml_node, xml_node_path): """ Returns a string containing the child nodes recursively""" subnode_text = "" for xml_subnode in xml_node: xml_subnodes = xml_subnode.findall(xml_node_path) subnode_text += recursive_load_target(xml_subnodes, xml_subnode) return subnode_text def recursive_load(xml_node, xml_node_root): """Recursively load all nodes""" if is_a_skeleton_node(xml_node_root): return "" if "prop" in xml_node_root.attrib['id']: return "" if "IK" in xml_node_root.attrib['id']: return "" return ("<bone name=\"" + xml_node_root.attrib["name"].replace(get_armature_name() + '_', '') + "\">" + get_sub_nodes(xml_node, "./") + "</bone>") def recursive_load_target(xml_node, xml_node_root): """Recursively load all nodes""" if is_a_skeleton_node(xml_node_root): return "" if "prop" in xml_node_root.attrib['id']: return "" if "IK" in xml_node_root.attrib['id']: return "" return ("<bone name=\"" + xml_node_root.attrib["name"].replace(get_armature_name() + '_', '') + "\"><target>"+ xml_node_root.attrib["name"].replace(get_armature_name() + '_', '') + "</target>" + get_sub_nodes_target(xml_node, "./") + "</bone>") def write_xml(): """Returns the skeleton xml string""" string = "<?xml version='1.0' encoding='utf8'?>" string += "<skeletons>" string += "<standard_skeleton title=\""+ get_armature_name().replace("_", " ") + "\" id=\"" string += get_armature_name().replace(" ", "_") +"\">" string += get_skeleton_bones(recursive_load) string += "</standard_skeleton>" string += "<skeleton title=\""+ get_armature_name().replace('_', ' ') + "\" target=\"" string += get_armature_name().replace(" ", "_") + "\">" string += "<identifier><root>" + get_root_bone().replace(get_armature_name() + '_', '') + "</root></identifier>" string += get_skeleton_bones(recursive_load_target) string += "</skeleton>" string += "</skeletons>" return string def save_skeleton_file(): """Save the final skeleton file""" file_tree = ET.fromstring(write_xml()) indent(file_tree) document = ET.ElementTree(file_tree) document.write(OUTPUT_DIRECTORY + get_armature_name() + ".xml", encoding='utf-8', xml_declaration=True, short_empty_elements=True) print("Done generating file: " + OUTPUT_DIRECTORY + get_armature_name() +".xml") def get_root_bone(): """Get the root bone """ nodes = ROOT.findall(COLLADA_SCHEMA_TEXT + "library_visual_scenes/" + COLLADA_SCHEMA_TEXT + "visual_scene/" + COLLADA_SCHEMA_TEXT + "node/") for node in nodes: if is_a_skeleton_node(node): continue return node.attrib["name"] return "" def indent(elem, level=0): i = "\n" + level*" " if len(elem): if not elem.text or not elem.text.strip(): elem.text = i + " " if not elem.tail or not elem.tail.strip(): elem.tail = i for elem in elem: indent(elem, level+1) if not elem.tail or not elem.tail.strip(): elem.tail = i else: if level and (not elem.tail or not elem.tail.strip()): elem.tail = i generate_skeletons()
{ "repo_name": "StanleySweet/0AD-Skeleton-Generator", "path": "skeleton_generator.py", "copies": "1", "size": "6313", "license": "mit", "hash": -2284567141942363400, "line_mean": 34.8693181818, "line_max": 134, "alpha_frac": 0.5930619357, "autogenerated": false, "ratio": 3.550618672665917, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.46436806083659166, "avg_score": null, "num_lines": null }
"""allow deleting of rooms Revision ID: f8f1883f81af Revises: ff700db83195 Create Date: 2019-10-10 15:24:33.797124 """ from alembic import op import sqlalchemy as sa import pycroft # revision identifiers, used by Alembic. revision = 'f8f1883f81af' down_revision = 'ff700db83195' branch_labels = None depends_on = None def upgrade(): # ### commands auto generated by Alembic - please adjust! ### op.drop_constraint('host_room_id_fkey', 'host', type_='foreignkey') op.create_foreign_key('host_room_id_fkey', 'host', 'room', ['room_id'], ['id'], ondelete='SET NULL') op.drop_constraint('patch_port_room_id_fkey', 'patch_port', type_='foreignkey') op.create_foreign_key('patch_port_room_id_fkey', 'patch_port', 'room', ['room_id'], ['id'], ondelete='CASCADE') op.drop_constraint('room_log_entry_room_id_fkey', 'room_log_entry', type_='foreignkey') op.create_foreign_key('room_log_entry_room_id_fkey', 'room_log_entry', 'room', ['room_id'], ['id'], ondelete='CASCADE') # ### end Alembic commands ### def downgrade(): # ### commands auto generated by Alembic - please adjust! ### op.drop_constraint('room_log_entry_room_id_fkey', 'room_log_entry', type_='foreignkey') op.create_foreign_key('room_log_entry_room_id_fkey', 'room_log_entry', 'room', ['room_id'], ['id']) op.drop_constraint('patch_port_room_id_fkey', 'patch_port', type_='foreignkey') op.create_foreign_key('patch_port_room_id_fkey', 'patch_port', 'room', ['room_id'], ['id']) op.drop_constraint('host_room_id_fkey', 'host', type_='foreignkey') op.create_foreign_key('host_room_id_fkey', 'host', 'room', ['room_id'], ['id']) # ### end Alembic commands ###
{ "repo_name": "agdsn/pycroft", "path": "pycroft/model/alembic/versions/f8f1883f81af_allow_deleting_of_rooms.py", "copies": "1", "size": "1685", "license": "apache-2.0", "hash": -9169940880612791000, "line_mean": 42.2051282051, "line_max": 123, "alpha_frac": 0.6617210682, "autogenerated": false, "ratio": 3.0143112701252237, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.916273817387149, "avg_score": 0.0026588328907470207, "num_lines": 39 }
"""Allow dragging tabs or pressing keys to change their order.""" from __future__ import annotations import tkinter from functools import partial from porcupine import get_main_window, get_tab_manager, tabs def on_drag(event: tkinter.Event[tabs.TabManager]) -> str | None: if event.widget.identify(event.x, event.y) == "label": # type: ignore[no-untyped-call] destination_index = event.widget.index(f"@{event.x},{event.y}") # type: ignore[no-untyped-call] event.widget.insert(destination_index, event.widget.select()) # type: ignore[no-untyped-call] return "break" return None def select_tab_n(n: int, event: tkinter.Event[tkinter.Misc]) -> str | None: try: get_tab_manager().select(n - 1) return "break" except tkinter.TclError: # index out of bounds return None def select_left_or_right(diff: int) -> str | None: selected_tab = get_tab_manager().select() if selected_tab is None: return None new_index = get_tab_manager().index(selected_tab) + diff # type: ignore[no-untyped-call] try: get_tab_manager().select(new_index) return "break" except tkinter.TclError: # index out of bounds return None def move_left_or_right(diff: int) -> str | None: selected_tab = get_tab_manager().select() if selected_tab is None: return None destination_index = get_tab_manager().index(selected_tab) + diff # type: ignore[no-untyped-call] try: get_tab_manager().insert(destination_index, selected_tab) # type: ignore[no-untyped-call] return "break" except tkinter.TclError: # index out of bounds return None # bigger value --> less sensitive MACOS_WHEEL_STEP = 2.5 # ignore mouse wheeling when mouse is below this height WHEEL_Y_MAX = 50 def wheel_callback(diff: int, event: tkinter.Event[tkinter.Misc]) -> None: # It's possible to trigger this somewhere else than at top of tab manager if event.y < 50: select_left_or_right(diff) def switch_tabs_on_mouse_wheel() -> None: tabmanager = get_tab_manager() if tabmanager.tk.call("tk", "windowingsystem") == "x11": tabmanager.bind("<Button-4>", partial(wheel_callback, -1), add=True) tabmanager.bind("<Button-5>", partial(wheel_callback, 1), add=True) elif tabmanager.tk.call("tk", "windowingsystem") == "aqua": # Handle smooth scrolling accumulator = 0.0 def reset(event: tkinter.Event[tkinter.Misc]) -> None: nonlocal accumulator accumulator = 0 def scroll(event: tkinter.Event[tkinter.Misc]) -> None: nonlocal accumulator accumulator += event.delta if accumulator > MACOS_WHEEL_STEP: accumulator -= MACOS_WHEEL_STEP wheel_callback(-1, event) elif accumulator < -MACOS_WHEEL_STEP: accumulator += MACOS_WHEEL_STEP wheel_callback(1, event) tabmanager.bind("<MouseWheel>", scroll, add=True) tabmanager.bind("<Leave>", reset, add=True) else: # Windows def real_callback(event: tkinter.Event[tkinter.Misc]) -> None: if event.delta > 0: wheel_callback(-1, event) else: wheel_callback(1, event) tabmanager.bind("<MouseWheel>", real_callback, add=True) def setup() -> None: get_tab_manager().bind("<Button1-Motion>", on_drag, add=True) # This doesn't use enable_traversal() because we want more bindings than it creates. # The bindings also need to be configurable. get_main_window().bind( "<<TabOrder:SelectLeft>>", (lambda event: select_left_or_right(-1)), add=True ) get_main_window().bind( "<<TabOrder:SelectRight>>", (lambda event: select_left_or_right(1)), add=True ) get_main_window().bind( "<<TabOrder:MoveLeft>>", (lambda event: move_left_or_right(-1)), add=True ) get_main_window().bind( "<<TabOrder:MoveRight>>", (lambda event: move_left_or_right(1)), add=True ) for n in range(1, 10): get_main_window().bind(f"<<TabOrder:SelectTab{n}>>", partial(select_tab_n, n), add=True) switch_tabs_on_mouse_wheel()
{ "repo_name": "Akuli/porcupine", "path": "porcupine/plugins/tab_order.py", "copies": "1", "size": "4244", "license": "mit", "hash": 7622730780100572000, "line_mean": 33.2258064516, "line_max": 104, "alpha_frac": 0.6267672008, "autogenerated": false, "ratio": 3.5396163469557966, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9661148199634431, "avg_score": 0.0010470696242732187, "num_lines": 124 }
"""Allow dragging tabs out of the Porcupine window.""" from __future__ import annotations import logging import os import pickle import subprocess import sys import tempfile import threading import tkinter from typing import Any, Tuple, Union from porcupine import get_main_window, get_parsed_args, get_tab_manager, menubar, pluginloader, settings, tabs log = logging.getLogger(__name__) class SpecialState: pass NO_TABS = SpecialState() NOT_POPPABLE = SpecialState() NOT_DRAGGING = SpecialState() def is_on_window(event: tkinter.Event[tkinter.Misc]) -> bool: window = event.widget.winfo_toplevel() window_left = window.winfo_x() window_right = window_left + window.winfo_width() window_top = window.winfo_y() window_bottom = window_top + window.winfo_height() window_top -= 50 # menu bar and window border return ((window_left < event.x_root < window_right) and (window_top < event.y_root < window_bottom)) class PopManager: def __init__(self) -> None: self._window = tkinter.Toplevel() self._window.withdraw() self._window.overrideredirect(True) # this is not ttk because i want it to look yellowish self._label = tkinter.Label(self._window, fg='#000', bg='#ffc') self._label.pack() self._dragged_state: Union[SpecialState, Tuple[tabs.Tab, Any]] = NOT_DRAGGING def _show_tooltip(self, event: tkinter.Event[tkinter.Misc]) -> None: if self._window.state() == 'withdrawn': self._window.deiconify() left = event.x_root - (self._label.winfo_reqwidth() // 2) # centered top = event.y_root - self._label.winfo_reqheight() # above cursor self._window.geometry(f'+{left}+{top}') # no need to return 'break' imo, other plugins are free to follow # drags and drops def on_drag(self, event: tkinter.Event[tkinter.Misc]) -> None: if is_on_window(event): self._window.withdraw() return if self._dragged_state is NOT_DRAGGING: tab = get_tab_manager().select() if tab is None: # no tabs to pop up self._dragged_state = NO_TABS self._window.withdraw() return state = tab.get_state() if state is None: self._dragged_state = NOT_POPPABLE self._label.config(text="This tab cannot\nbe popped up.") else: self._dragged_state = (tab, state) self._label.config(text="Drop the tab here\nto pop it up...") self._show_tooltip(event) def on_drop(self, event: tkinter.Event[tkinter.Misc]) -> None: self._window.withdraw() if not (is_on_window(event) or isinstance(self._dragged_state, SpecialState)): log.info("popping off a tab") tab, state = self._dragged_state # At least 600x400, bigger if necessary. Can't use # get_main_window.winfo_reqwidth because that's huge # when there's a lot of tabs. width = max(600, tab.winfo_reqwidth()) height = max(400, get_main_window().winfo_reqheight()) # Center the window x = event.x_root - round(width/2) y = event.y_root - round(height/2) # Make sure it's not off screen screen_width = get_main_window().winfo_screenwidth() screen_height = get_main_window().winfo_screenheight() width = min(width, screen_width) height = min(height, screen_height) x = min(x, screen_width - width) y = min(y, screen_height - height) x = max(0, x) y = max(0, y) self.pop(tab, state, f'{width}x{height}+{x}+{y}') self._dragged_state = NOT_DRAGGING def pop(self, tab: tabs.Tab, state: Any, geometry: str) -> None: log.info(f"Popping {repr(tab)} to {geometry} begins") message = (type(tab), state, geometry) with tempfile.NamedTemporaryFile(delete=False) as file: log.info(f"writing pickled state to {file.name}") pickle.dump(message, file) settings.save() # let the new process use up-to-date settings # The subprocess must be called so that it has a sane sys.path. # In particular, import or don't import from current working # directory exactly like the porcupine that is currently running. # Importing from current working directory is bad if it contains # e.g. queue.py (#31), but good when that's where porcupine is # meant to be imported from (#230). code = f'import sys; sys.path[:] = {sys.path}; from porcupine.__main__ import main; main()' args = [sys.executable, '-c', code] args.append('--without-plugins') args.append(','.join({ info.name for info in pluginloader.plugin_infos if info.status == pluginloader.Status.DISABLED_ON_COMMAND_LINE } | { # these plugins are not suitable for popups # TODO: geometry and restart stuff don't get saved 'restart', 'geometry', })) if get_parsed_args().verbose_logger is not None: args.append('--verbose-logger') args.append(get_parsed_args().verbose_logger) process = subprocess.Popen( args, env={**os.environ, 'PORCUPINE_POPPINGTABS_STATE_FILE': file.name}) log.debug(f"started subprocess with PID {process.pid}") get_tab_manager().close_tab(tab) # don't exit python until the subprocess exits, also log stuff threading.Thread(target=self._waiting_thread, args=[process]).start() def pop_next_to_current_window(self) -> None: tab = get_tab_manager().select() assert tab is not None state = tab.get_state() assert state is not None # Popup goes on the half of screen where the current main window is not window_center = get_main_window().winfo_rootx() + get_main_window().winfo_width()/2 half_screen_width = round(get_main_window().winfo_screenwidth() / 2) screen_height = get_main_window().winfo_screenheight() if window_center > half_screen_width: geometry = f'{half_screen_width}x{screen_height}+0+0' else: geometry = f'{half_screen_width}x{screen_height}+{half_screen_width}+0' self.pop(tab, state, geometry) def _waiting_thread(self, process: subprocess.Popen[bytes]) -> None: status = process.wait() if status == 0: log.debug(f"subprocess with PID {process.pid} exited successfully") else: log.warning(f"subprocess with PID {process.pid} exited with status {status}") def open_tab_from_state_file() -> None: try: path = os.environ.pop('PORCUPINE_POPPINGTABS_STATE_FILE') except KeyError: return with open(path, 'rb') as file: (tabtype, state, geometry) = pickle.load(file) get_main_window().geometry(geometry) get_tab_manager().add_tab(tabtype.from_state(get_tab_manager(), state)) # the state file is not removed earlier because if anything above # fails, it still exists and can be recovered somehow # # most of the time this should "just work", so user-unfriendy recovery # is not a huge problem os.remove(path) def setup() -> None: manager = PopManager() get_tab_manager().bind('<Button1-Motion>', manager.on_drag, add=True) get_tab_manager().bind('<ButtonRelease-1>', manager.on_drop, add=True) menubar.get_menu("View").add_command(label="Pop Tab", command=manager.pop_next_to_current_window) menubar.set_enabled_based_on_tab("View/Pop Tab", (lambda tab: tab is not None and tab.get_state() is not None)) open_tab_from_state_file()
{ "repo_name": "Akuli/editor", "path": "porcupine/plugins/poppingtabs.py", "copies": "1", "size": "7905", "license": "mit", "hash": -1896532285347874800, "line_mean": 37.0048076923, "line_max": 115, "alpha_frac": 0.6107526882, "autogenerated": false, "ratio": 3.7446707721459025, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.48554234603459023, "avg_score": null, "num_lines": null }
# Allow flashing of the RPi LED # Provided the following have been run as root on the command line: # echo none > /sys/class/leds/led0/trigger # chmod a+w /sys/class/leds/led0/brightness import os.path import time def has_led_control(): return os.path.isfile('/sys/class/leds/led0/brightness') def led_on(): if has_led_control(): with open('/sys/class/leds/led0/brightness', 'w') as f: print('1', file=f) def led_off(): if has_led_control(): with open('/sys/class/leds/led0/brightness', 'w') as f: print('0', file=f) def set_led(b): if b: led_on() else: led_off() def is_led_on(): if has_led_control(): with open('/sys/class/leds/led0/brightness', 'r') as f: status = f.readline().strip() print("STATUS IS " + status) return status is not '0' def blink_led(sec: int, frequency: float, onTime: float, numBlinks: int): offTime = frequency - onTime * (2 * numBlinks - 1) iterations = int(float(sec) / float(frequency)) for i in range(iterations): led_off() time.sleep(offTime) for j in range(numBlinks): led_on() time.sleep(onTime) if j < numBlinks - 1: led_off() time.sleep(onTime) led_off() # while we're updating status: give a few quick blinks def blink_led_updating(sec: int): blink_led(sec, frequency=0.2, onTime=0.1, numBlinks=1) # this is called when the internet is down: slow flash def blink_led_internet_down(sec: int): blink_led(sec, frequency=1, onTime=1, numBlinks=1) # this is called when the router is down: two quick blinks def blink_led_router_down(sec: int): blink_led(sec, frequency=0.5, onTime=0.1, numBlinks=2) # this is called when the modem is unreachable: three quick blinks def blink_led_modem_down(sec: int): blink_led(sec, frequency=0.5, onTime=0.1, numBlinks=3) # keep LED on for this long, then turn it back off def show_led(sec: int): # Retry turning on every second since LED doesn't reliably turn on for long durations after certain flash patterns led_off() time.sleep(0.5) led_on() time.sleep(sec) led_off()
{ "repo_name": "jhclark/tattletale", "path": "tattletaleled.py", "copies": "1", "size": "2230", "license": "apache-2.0", "hash": -7881620281091023000, "line_mean": 29.9722222222, "line_max": 118, "alpha_frac": 0.6255605381, "autogenerated": false, "ratio": 3.0801104972375692, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4205671035337569, "avg_score": null, "num_lines": null }
"""Allow for Spring and Intro eval relationships Revision ID: 5615d58892a1 Revises: 6f6b843e2b8f Create Date: 2017-04-27 15:40:40.640402 """ # revision identifiers, used by Alembic. revision = '5615d58892a1' down_revision = '6f6b843e2b8f' from alembic import op import sqlalchemy as sa def upgrade(): ### commands auto generated by Alembic - please adjust! ### op.add_column('conditional', sa.Column('i_evaluation', sa.Integer(), nullable=True)) op.add_column('conditional', sa.Column('s_evaluation', sa.Integer(), nullable=True)) op.drop_constraint('conditional_evaluation_fkey', 'conditional', type_='foreignkey') op.create_foreign_key(None, 'conditional', 'spring_evals', ['s_evaluation'], ['id']) op.create_foreign_key(None, 'conditional', 'freshman_eval_data', ['i_evaluation'], ['id']) op.drop_column('conditional', 'evaluation') ### end Alembic commands ### def downgrade(): ### commands auto generated by Alembic - please adjust! ### op.add_column('conditional', sa.Column('evaluation', sa.INTEGER(), autoincrement=False, nullable=True)) op.drop_constraint(None, 'conditional', type_='foreignkey') op.drop_constraint(None, 'conditional', type_='foreignkey') op.create_foreign_key('conditional_evaluation_fkey', 'conditional', 'spring_evals', ['evaluation'], ['id']) op.drop_column('conditional', 's_evaluation') op.drop_column('conditional', 'i_evaluation') ### end Alembic commands ###
{ "repo_name": "RamZallan/conditional", "path": "migrations/versions/5615d58892a1_.py", "copies": "2", "size": "1467", "license": "mit", "hash": 6487796911301676000, "line_mean": 39.75, "line_max": 111, "alpha_frac": 0.6973415133, "autogenerated": false, "ratio": 3.4845605700712587, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5181902083371259, "avg_score": null, "num_lines": null }
"""Allow FRB populations to be explored interactively. Can be run with: $ bokeh serve --show code/plot.py --args <pop_example.csv> in which all csv-files with populations can be given after ``--args``, and as well as the optional arguments of ``-noshow`` and ``-notns``, to respectively not show the resulting plot, and to not overplot tns """ import numpy as np import os import pandas as pd import sys from bokeh.io import curdoc from bokeh.layouts import layout, column from bokeh.models import ColumnDataSource, HoverTool, Div, Panel, Tabs from bokeh.models.widgets import Select from bokeh.palettes import Category10, viridis from bokeh.plotting import figure from frbpoppy.tns import TNS from frbpoppy.do_hist import histogram from frbpoppy.misc import pprint from frbpoppy import unpickle class Tab(): """Gather all elements needed for a plot.""" def __init__(self): """Initializing.""" self.fig = None self.sources = [] self.name = '' class Plot(): """Gather plotting options.""" def __init__(self, files=[], tns=True): """Initializing.""" # From arguments self.files = files self.tns = tns # Predefined self.height = 700 # Plot height self.width = 700 # Plot width # Initializing arguments set later in the code self.x_axis = None self.y_axis = None self.n_df = 0 self.dfs = [] self.tabs = [] self.labels = [] # Set parameters self.params = {'Comoving Distance (Gpc)': 'dist_co', 'Declination (°)': 'dec', 'Dispersion Measure - Host (pc/cm^3)': 'dm_host', 'Dispersion Measure - IGM (pc/cm^3)': 'dm_igm', 'Dispersion Measure - Milky Way (pc/cm^3)': 'dm_mw', 'Dispersion Measure (pc/cm^3)': 'dm', 'Fluence (Jy*ms)': 'fluence', 'Galactic Latitude (°)': 'gb', 'Galactic Longitude (°)': 'gl', 'Galactic X (Gpc)': 'gx', 'Galactic Y (Gpc)': 'gy', 'Galactic Z (Gpc)': 'gz', 'Luminosity - Bolometric (10^30 ergs/s)': 'lum_bol', 'Peak Flux Density (Jy)': 's_peak', 'Pulse Width - Effective (ms)': 'w_eff', 'Pulse Width - Intrinsic (ms)': 'w_int', 'Redshift': 'z', 'Right Ascension (°)': 'ra', 'Spectral Index': 'si', 'Signal to Noise Ratio': 'snr', 'Time (days)': 'time'} # Running plotting self.set_colours() self.set_widgets() self.get_data() self.make_scatter() self.make_histogram(kind='lin') self.make_histogram(kind='log') self.make_histogram(kind='cum') self.set_layout() def set_colours(self): """Determine which colours need to be used.""" # Ensure number of overplots is known n = len(self.files) if self.tns: n += 1 if n > 10: self.colours = viridis(n) else: self.colours = Category10[10][:n] def get_data(self): """Read in populations.""" # Read in files for f in self.files: # Check whether file exists if os.path.isfile(f): try: df = unpickle(f).frbs.to_df() except ValueError: pprint(f'Unpacking {f} seemed to have failed.') continue if '.' in f: name = '.'.join(f.split('/')[-1].split('.')[:-1]) if '_for_plotting' in name: name = name.split('_for_plotting')[0] if len(name) > 15: name = name.split('_')[-1] else: name = f # If things haven't worked if df is None: m = 'Skipping population {} - contains no sources'.format(f) pprint(m) continue # Downsample population size if it's too large if df.shape[0] > 10000: pprint(f'Downsampling population {f} (else too big to plot)') df = df.sample(n=10000) df['color'] = self.colours[self.n_df] df['lum_bol'] = df['lum_bol'] / 1e30 # Sidestepping Bokeh issue if df.empty: m = 'Skipping population {} - contains no sources'.format(f) pprint(m) continue else: self.dfs.append(df) self.labels.append(name) self.n_df += 1 # Add on tns if self.tns: df = TNS(frbpoppy=True).df # Filter by survey if wished if isinstance(self.tns, str): if not df[df.survey == self.tns].empty: df = df[df.survey == self.tns] elif not df[df.telescope == self.tns].empty: df = df[df.telescope == self.tns] else: m = 'Your chosen input for tns is not found.' raise ValueError(m) df['color'] = self.colours[len(self.dfs)] self.dfs.append(df) self.labels.append(f'tns {self.tns}') def set_widgets(self): """Set up widget details.""" self.x_axis = Select(title='', options=sorted(self.params.keys()), value='Right Ascension (°)') self.y_axis = Select(title='', options=sorted(self.params.keys()), value='Declination (°)') def make_scatter(self): """Set up a scatter plot.""" # Initializing plot tab = Tab() tab.name = 'Scatter' # Set up interactive tools props = [("x", "@x"), ("y", "@y")] # ("pop", "@label") hover = HoverTool(tooltips=props) tools = ['box_zoom', 'pan', 'save', hover, 'reset', 'wheel_zoom'] # Create scatter plot tab.fig = figure(plot_height=self.height, plot_width=self.width, active_scroll='wheel_zoom', toolbar_location='right', tools=tools) # Stop labels falling off tab.fig.min_border_left = 80 # Create Column Data Sources for interacting with the plot props = dict(x=[], y=[], color=[]) tab.sources = [ColumnDataSource(props) for df in self.dfs] # Plot scatter plot of FRB populations for i, source in enumerate(tab.sources): tab.fig.circle(x='x', y='y', source=source, size=7, alpha=0.6, color='color', legend_label=self.labels[i]) self.tabs.append(tab) def make_histogram(self, kind='lin'): """Set up a histogram plot.""" # Initializing plot tab = Tab() if kind == 'lin': tab.name = 'Hist (Lin)' axis_type = 'linear' log = False cum = False elif kind == 'log': tab.name = 'Hist (Log)' axis_type = 'log' log = True cum = False elif kind == 'cum': tab.name = 'Hist (Cum)' axis_type = 'log' log = True cum = True # Set up interactive tools tools = ['box_zoom', 'pan', 'save', 'reset', 'wheel_zoom'] # Create histogram plot tab.fig = figure(plot_height=self.height, plot_width=self.width, active_scroll='wheel_zoom', toolbar_location='right', tools=tools, x_axis_type=axis_type, y_axis_type="log") # Create Column Data Sources for interacting with the plot hists = histogram(self.dfs, log=log, cum=cum) props = dict(x=[], y=[]) tab.sources = [ColumnDataSource(props) for hist in hists] # Plot histogram values for i, source in enumerate(tab.sources): tab.fig.step(x='x', y='y', color=self.colours[i], legend_label=self.labels[i], alpha=0.8, line_width=2.5, source=source, mode='before') if kind == 'lin': self.hists_lin = hists elif kind == 'log': self.hists_log = hists elif kind == 'cum': self.hists_cum = hists self.tabs.append(tab) def update(self): """Update plots when interacted with.""" for tab in self.tabs: x_abr = self.params[self.x_axis.value] y_abr = self.params[self.y_axis.value] tab.fig.xaxis.axis_label = self.x_axis.value tab.fig.yaxis.axis_label = self.y_axis.value if tab.name.startswith('Hist'): tab.fig.yaxis.axis_label = 'Fraction' for i, source in enumerate(tab.sources): cols = [f'{x_abr}_x', f'{x_abr}'] if tab.name == 'Scatter': cols = [x_abr, y_abr, 'color'] dfs = self.dfs elif tab.name == "Hist (Lin)": dfs = self.hists_lin elif tab.name == "Hist (Log)": dfs = self.hists_log elif tab.name == "Hist (Cum)": dfs = self.hists_cum # Ensure columns are present in each population if (x_abr not in dfs[i] or (tab.name == 'Scatter' and y_abr not in dfs[i])): df = pd.DataFrame(np.nan, index=[0], columns=cols) else: # Clean up data df = dfs[i][cols] df = df.replace('None', np.nan) df = df.dropna() # Update data if tab.name == 'Scatter': source.data = dict(x=df[x_abr], y=df[y_abr], color=df['color']) else: source.data = dict(x=df[f'{x_abr}_x'], y=df[f'{x_abr}']) def set_layout(self): """Create the plot layout.""" # What to interact with for control in [self.x_axis, self.y_axis]: control.on_change('value', lambda attr, old, new: self.update()) # Set up sidebar cwd = os.path.dirname(__file__) def path(p): d = os.path.join(cwd, 'plot_config/{}.html'.format(p)) return open(d).read() text_top = Div(text=path('text_top')) text_bottom = Div(text=path('text_bottom')) sidebar = [text_top, self.x_axis, self.y_axis, text_bottom] s = column(sidebar, width=380) # Set up tabs panels = [] for tab in self.tabs: panels.append(Panel(child=tab.fig, title=tab.name)) tab.fig.legend.click_policy = 'hide' tabs = Tabs(tabs=panels, width=self.width) # Add sidebar and tabs L = layout([[s, tabs]]) # Initial load of data self.update() # Showtime curdoc().title = 'frbpoppy' curdoc().add_root(L) # Parse system arguments # (I know ArgumentParser is nicer, but bokeh only works with argv) args = sys.argv # Whether to plot the tns population if '-tns' in args: tns = args[args.index('-tns') + 1] if tns == 'True': tns = True elif tns == 'False': tns = False else: frcat = True # Which files to plot files = [] for a in args: a = a.strip('"') if a.endswith('.p'): files.append(a) # Check whether populations have been given as input if len(files) == 0: pprint('Nothing to plot: plot arguments are empty') else: Plot(files=files, tns=tns)
{ "repo_name": "davidgardenier/frbpoppy", "path": "frbpoppy/plot.py", "copies": "1", "size": "12466", "license": "mit", "hash": 7143589314570015000, "line_mean": 31.8759894459, "line_max": 77, "alpha_frac": 0.4737560193, "autogenerated": false, "ratio": 3.991031390134529, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9964787409434529, "avg_score": 0, "num_lines": 379 }
"""Allow index to be used for comment sorting Revision ID: 8c2635571571 Revises: 664a23bbc217 Create Date: 2018-10-21 17:47:05.349531 """ # revision identifiers, used by Alembic. revision = '8c2635571571' down_revision = '664a23bbc217' from alembic import op # lgtm[py/unused-import] import sqlalchemy as sa # lgtm[py/unused-import] def upgrade(): # ### commands auto generated by Alembic - please adjust! ### op.create_index('ind_charcomment_targetid_commentid', 'charcomment', ['targetid', 'commentid'], unique=False) op.drop_index('ind_charcomment_targetid', table_name='charcomment') op.create_index('ind_comments_target_sub_commentid', 'comments', ['target_sub', 'commentid'], unique=False, postgresql_where=sa.text(u'target_sub IS NOT NULL')) op.create_index('ind_comments_target_user_commentid', 'comments', ['target_user', 'commentid'], unique=False, postgresql_where=sa.text(u'target_user IS NOT NULL')) op.drop_index('ix_comments_target_sub', table_name='comments') op.drop_index('ix_comments_target_user', table_name='comments') op.create_index('ind_journalcomment_targetid_commentid', 'journalcomment', ['targetid', 'commentid'], unique=False) op.drop_index('ind_journalcomment_settings', table_name='journalcomment') op.drop_index('ind_journalcomment_targetid', table_name='journalcomment') op.drop_index('ind_journalcomment_targetid_settings', table_name='journalcomment') # ### end Alembic commands ### def downgrade(): # ### commands auto generated by Alembic - please adjust! ### op.create_index('ind_journalcomment_targetid_settings', 'journalcomment', ['targetid', 'settings'], unique=False) op.create_index('ind_journalcomment_targetid', 'journalcomment', ['targetid'], unique=False) op.create_index('ind_journalcomment_settings', 'journalcomment', ['settings'], unique=False) op.drop_index('ind_journalcomment_targetid_commentid', table_name='journalcomment') op.create_index('ix_comments_target_user', 'comments', ['target_user'], unique=False) op.create_index('ix_comments_target_sub', 'comments', ['target_sub'], unique=False) op.drop_index('ind_comments_target_user_commentid', table_name='comments') op.drop_index('ind_comments_target_sub_commentid', table_name='comments') op.create_index('ind_charcomment_targetid', 'charcomment', ['targetid'], unique=False) op.drop_index('ind_charcomment_targetid_commentid', table_name='charcomment') # ### end Alembic commands ###
{ "repo_name": "Weasyl/weasyl", "path": "libweasyl/libweasyl/alembic/versions/8c2635571571_allow_index_to_be_used_for_comment_.py", "copies": "1", "size": "2503", "license": "apache-2.0", "hash": -5556658209213680000, "line_mean": 55.8863636364, "line_max": 167, "alpha_frac": 0.721534159, "autogenerated": false, "ratio": 3.319628647214854, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4541162806214854, "avg_score": null, "num_lines": null }
"""Allowing reporting_start_end_dates to be null Revision ID: 9acf8cc4e454 Revises: df2f541291a5 Create Date: 2017-07-11 14:14:03.356183 """ # revision identifiers, used by Alembic. revision = '9acf8cc4e454' down_revision = 'df2f541291a5' branch_labels = None depends_on = None from alembic import op import sqlalchemy as sa def upgrade(engine_name): globals()["upgrade_%s" % engine_name]() def downgrade(engine_name): globals()["downgrade_%s" % engine_name]() def upgrade_data_broker(): ### commands auto generated by Alembic - please adjust! ### op.alter_column('submission', 'reporting_end_date', existing_type=sa.DATE(), nullable=True, server_default=None) op.alter_column('submission', 'reporting_start_date', existing_type=sa.DATE(), nullable=True, server_default=None) ### end Alembic commands ### op.execute("UPDATE submission SET reporting_start_date = NULL " "WHERE reporting_start_date = '1970-01-01'") op.execute("UPDATE submission SET reporting_end_date = NULL " "WHERE reporting_end_date = '1970-01-01'") def downgrade_data_broker(): op.execute("UPDATE submission SET reporting_start_date = '1970-01-01' " "WHERE reporting_start_date IS NULL") op.execute("UPDATE submission SET reporting_end_date = '1970-01-01' " "WHERE reporting_end_date IS NULL") ### commands auto generated by Alembic - please adjust! ### op.alter_column('submission', 'reporting_start_date', existing_type=sa.DATE(), nullable=False, server_default="1970-01-01") op.alter_column('submission', 'reporting_end_date', existing_type=sa.DATE(), nullable=False, server_default="1970-01-01") ### end Alembic commands ###
{ "repo_name": "fedspendingtransparency/data-act-broker-backend", "path": "dataactcore/migrations/versions/9acf8cc4e454_allowing_reporting_start_end_dates_to_.py", "copies": "1", "size": "1912", "license": "cc0-1.0", "hash": 3374500906245179000, "line_mean": 29.3492063492, "line_max": 75, "alpha_frac": 0.6208158996, "autogenerated": false, "ratio": 3.763779527559055, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4884595427159055, "avg_score": null, "num_lines": null }
"""allowlist rename Revision ID: eeb702f77d7d Revises: 8a44a4364f5a Create Date: 2020-10-15 13:29:38.853574 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = 'eeb702f77d7d' down_revision = '8a44a4364f5a' branch_labels = None depends_on = None def upgrade(engine_name): globals()["upgrade_%s" % engine_name]() def downgrade(engine_name): globals()["downgrade_%s" % engine_name]() def upgrade_registrar(): # ### commands auto generated by Alembic - please adjust! ### pass # ### end Alembic commands ### def downgrade_registrar(): # ### commands auto generated by Alembic - please adjust! ### pass # ### end Alembic commands ### def upgrade_cloud_verifier(): # ### commands auto generated by Alembic - please adjust! ### op.alter_column('verifiermain', 'ima_whitelist', new_column_name='allowlist', existing_type=sa.Text(length=429400000), existing_nullable=True) # ### end Alembic commands ### def downgrade_cloud_verifier(): # ### commands auto generated by Alembic - please adjust! ### op.alter_column('verifiermain', 'allowlist', new_column_name='ima_whitelist', existing_type=sa.Text(length=429400000), existing_nullable=True) # ### end Alembic commands ###
{ "repo_name": "mit-ll/python-keylime", "path": "keylime/migrations/versions/eeb702f77d7d_allowlist_rename.py", "copies": "1", "size": "1286", "license": "bsd-2-clause", "hash": -5445349523617915000, "line_mean": 25.7916666667, "line_max": 146, "alpha_frac": 0.6874027994, "autogenerated": false, "ratio": 3.447721179624665, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.46351239790246646, "avg_score": null, "num_lines": null }
"""Allow parameters when extending. Based on https://djangosnippets.org/snippets/447/. Modified for use with variables. """ from django import template from django.template.loader_tags import do_extends import tokenize import io register = template.Library() class XExtendsNode(template.Node): """Allow parameters when extending.""" def __init__(self, node, kwargs): """Allow parameters when extending.""" self.node = node self.kwargs = kwargs def render(self, context): """Allow parameters when extending.""" # for k in list(self.kwargs.keys()): # self.kwargs[k] = self.kwargs[k].resolve(context) context.update(self.kwargs) try: return self.node.render(context) finally: context.pop() def do_xextends(parser, token): """Allow parameters when extending.""" bits = token.contents.split() kwargs = {} if 'with' in bits: pos = bits.index('with') argslist = bits[pos+1:] bits = bits[:pos] for i in argslist: try: a, b = i.split('=', 1) a = a.strip() b = b.strip() keys = list( tokenize.generate_tokens(io.StringIO(a).readline)) if keys[0][0] == tokenize.NAME: kwargs[str(a)] = template.Variable(b) else: raise ValueError except ValueError: raise template.TemplateSyntaxError token.contents = " ".join(bits) # let the orginal do_extends parse the tag, and wrap the ExtendsNode return XExtendsNode(do_extends(parser, token), kwargs) register.tag('xextends', do_xextends)
{ "repo_name": "jscott1989/happening", "path": "src/happening/templatetags/xextends.py", "copies": "2", "size": "1752", "license": "mit", "hash": -8312010145151559000, "line_mean": 26.8095238095, "line_max": 72, "alpha_frac": 0.573630137, "autogenerated": false, "ratio": 4.141843971631205, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5715474108631206, "avg_score": null, "num_lines": null }
"""Allow safety to be executable through `python -m safety`.""" from __future__ import absolute_import import os import sys import sysconfig LIBPATH = os.path.join(os.path.dirname(os.path.abspath(__file__)), "lib") def get_site_packages(): prefixes = {sys.prefix, sysconfig.get_config_var('prefix')} try: prefixes.add(sys.real_prefix) except AttributeError: pass form = sysconfig.get_path('purelib', expand=False) py_version_short = '{0[0]}.{0[1]}'.format(sys.version_info) return { form.format(base=prefix, py_version_short=py_version_short) for prefix in prefixes } def insert_before_site_packages(*paths): site_packages = get_site_packages() index = None for i, path in enumerate(sys.path): if path in site_packages: index = i break if index is None: sys.path += list(paths) else: sys.path = sys.path[:index] + list(paths) + sys.path[index:] if __name__ == "__main__": insert_before_site_packages(LIBPATH) yaml_lib = 'yaml{0}'.format(sys.version_info[0]) locals()[yaml_lib] = __import__(yaml_lib) sys.modules['yaml'] = sys.modules[yaml_lib] from safety.cli import cli cli(prog_name="safety")
{ "repo_name": "kennethreitz/pipenv", "path": "tasks/vendoring/safety/__main__.py", "copies": "1", "size": "1256", "license": "mit", "hash": -8426330673509959000, "line_mean": 26.9111111111, "line_max": 73, "alpha_frac": 0.6265923567, "autogenerated": false, "ratio": 3.4600550964187327, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4586647453118733, "avg_score": null, "num_lines": null }
"""Allow safety to be executable through `python -m safety`.""" from __future__ import absolute_import import os import sys import sysconfig PATCHED_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) PIPENV_DIR = os.path.dirname(PATCHED_DIR) VENDORED_DIR = os.path.join("PIPENV_DIR", "vendor") def get_site_packages(): prefixes = {sys.prefix, sysconfig.get_config_var('prefix')} try: prefixes.add(sys.real_prefix) except AttributeError: pass form = sysconfig.get_path('purelib', expand=False) py_version_short = '{0[0]}.{0[1]}'.format(sys.version_info) return { form.format(base=prefix, py_version_short=py_version_short) for prefix in prefixes } def insert_before_site_packages(*paths): site_packages = get_site_packages() index = None for i, path in enumerate(sys.path): if path in site_packages: index = i break if index is None: sys.path += list(paths) else: sys.path = sys.path[:index] + list(paths) + sys.path[index:] def insert_pipenv_dirs(): insert_before_site_packages(os.path.dirname(PIPENV_DIR), PATCHED_DIR, VENDORED_DIR) if __name__ == "__main__": # pragma: no cover insert_pipenv_dirs() yaml_lib = "pipenv.patched.yaml{0}".format(sys.version_info[0]) locals()[yaml_lib] = __import__(yaml_lib) sys.modules["yaml"] = sys.modules[yaml_lib] from safety.cli import cli cli(prog_name="safety")
{ "repo_name": "kennethreitz/pipenv", "path": "pipenv/patched/safety/__main__.py", "copies": "1", "size": "1485", "license": "mit", "hash": -5411513497470724000, "line_mean": 28.1176470588, "line_max": 87, "alpha_frac": 0.6430976431, "autogenerated": false, "ratio": 3.2781456953642385, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.44212433384642386, "avg_score": null, "num_lines": null }
# Allows a mentor to ssh into a DigitalOcean droplet. This is designed to be # executed on the target machine. # # This script takes the username of the mentor as an argument: # # $ python3 add_mentor.py <mentor's username> # # Alternatively you can pass in --remove to remove their SSH key from the # machine: # # $ python3 add_mentor.py --remove <mentor's username> import os import re import socket import sys from argparse import ArgumentParser from typing import List import requests parser = ArgumentParser(description="Give a mentor ssh access to this machine.") parser.add_argument("username", help="GitHub username of the mentor.") parser.add_argument("--remove", help="Remove his/her key from the machine.", action="store_true") # Wrap keys with line comments for easier key removal. append_key = """\ #<{username}>{{{{ {key} #}}}}<{username}> """ def get_mentor_keys(username: str) -> List[str]: url = f"https://api.github.com/users/{username}/keys" r = requests.get(url) if r.status_code != 200: print("Cannot connect to GitHub...") sys.exit(1) keys = r.json() if not keys: print(f'Mentor "{username}" has no public key.') sys.exit(1) return [key["key"] for key in keys] if __name__ == "__main__": args = parser.parse_args() authorized_keys = os.path.expanduser("~/.ssh/authorized_keys") if args.remove: remove_re = re.compile( "#<{0}>{{{{.+}}}}<{0}>(\n)?".format(args.username), re.DOTALL | re.MULTILINE ) with open(authorized_keys, "r+") as f: old_content = f.read() new_content = re.sub(remove_re, "", old_content) f.seek(0) f.write(new_content) f.truncate() print(f"Successfully removed {args.username}' SSH key!") else: keys = get_mentor_keys(args.username) with open(authorized_keys, "a") as f: for key in keys: f.write(append_key.format(username=args.username, key=key)) print(f"Successfully added {args.username}'s SSH key!") print("Can you let your mentor know that they can connect to this machine with:\n") print(f" $ ssh zulipdev@{socket.gethostname()}\n")
{ "repo_name": "eeshangarg/zulip", "path": "tools/droplets/add_mentor.py", "copies": "6", "size": "2243", "license": "apache-2.0", "hash": -5965207919732918000, "line_mean": 28.9066666667, "line_max": 97, "alpha_frac": 0.6272848863, "autogenerated": false, "ratio": 3.488335925349922, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.7115620811649922, "avg_score": null, "num_lines": null }
# Allows a mentor to ssh into a Digital Ocean droplet. This is designed to be # executed on the target machine. # # This script takes the username of the mentor as an argument: # # $ python3 add_mentor.py <mentor's username> # # Alternatively you can pass in --remove to remove their ssh key from the # machine: # # $ python3 add_mentor.py --remove <mentor's username> import os import re import socket import sys from argparse import ArgumentParser from typing import List import requests parser = ArgumentParser(description='Give a mentor ssh access to this machine.') parser.add_argument('username', help='Github username of the mentor.') parser.add_argument('--remove', help='Remove his/her key from the machine.', action='store_true', default=False) # Wrap keys with line comments for easier key removal. append_key = """\ #<{username}>{{{{ {key} #}}}}<{username}> """ def get_mentor_keys(username: str) -> List[str]: url = f'https://api.github.com/users/{username}/keys' r = requests.get(url) if r.status_code != 200: print('Cannot connect to Github...') sys.exit(1) keys = r.json() if not keys: print(f'Mentor "{username}" has no public key.') sys.exit(1) return [key['key'] for key in keys] if __name__ == '__main__': args = parser.parse_args() authorized_keys = os.path.expanduser('~/.ssh/authorized_keys') if args.remove: remove_re = re.compile('#<{0}>{{{{.+}}}}<{0}>(\n)?'.format(args.username), re.DOTALL | re.MULTILINE) with open(authorized_keys, 'r+') as f: old_content = f.read() new_content = re.sub(remove_re, '', old_content) f.seek(0) f.write(new_content) f.truncate() print(f'Successfully removed {args.username}\' SSH key!') else: keys = get_mentor_keys(args.username) with open(authorized_keys, 'a') as f: for key in keys: f.write(append_key.format(username=args.username, key=key)) print(f'Successfully added {args.username}\'s SSH key!') print('Can you let your mentor know that they can connect to this machine with:\n') print(f' $ ssh zulipdev@{socket.gethostname()}\n')
{ "repo_name": "shubhamdhama/zulip", "path": "tools/droplets/add_mentor.py", "copies": "3", "size": "2289", "license": "apache-2.0", "hash": -7705882464026787000, "line_mean": 29.9324324324, "line_max": 91, "alpha_frac": 0.619921363, "autogenerated": false, "ratio": 3.5324074074074074, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0007523189225152357, "num_lines": 74 }
# Allows a mentor to ssh into a DigitalOcean droplet. This is designed to be # executed on the target machine. # # This script takes the username of the mentor as an argument: # # $ python3 add_mentor.py <mentor's username> # # Alternatively you can pass in --remove to remove their SSH key from the # machine: # # $ python3 add_mentor.py --remove <mentor's username> import os import re import socket import sys from argparse import ArgumentParser from typing import List import requests parser = ArgumentParser(description='Give a mentor ssh access to this machine.') parser.add_argument('username', help='GitHub username of the mentor.') parser.add_argument('--remove', help='Remove his/her key from the machine.', action='store_true') # Wrap keys with line comments for easier key removal. append_key = """\ #<{username}>{{{{ {key} #}}}}<{username}> """ def get_mentor_keys(username: str) -> List[str]: url = f'https://api.github.com/users/{username}/keys' r = requests.get(url) if r.status_code != 200: print('Cannot connect to GitHub...') sys.exit(1) keys = r.json() if not keys: print(f'Mentor "{username}" has no public key.') sys.exit(1) return [key['key'] for key in keys] if __name__ == '__main__': args = parser.parse_args() authorized_keys = os.path.expanduser('~/.ssh/authorized_keys') if args.remove: remove_re = re.compile('#<{0}>{{{{.+}}}}<{0}>(\n)?'.format(args.username), re.DOTALL | re.MULTILINE) with open(authorized_keys, 'r+') as f: old_content = f.read() new_content = re.sub(remove_re, '', old_content) f.seek(0) f.write(new_content) f.truncate() print(f'Successfully removed {args.username}\' SSH key!') else: keys = get_mentor_keys(args.username) with open(authorized_keys, 'a') as f: for key in keys: f.write(append_key.format(username=args.username, key=key)) print(f'Successfully added {args.username}\'s SSH key!') print('Can you let your mentor know that they can connect to this machine with:\n') print(f' $ ssh zulipdev@{socket.gethostname()}\n')
{ "repo_name": "showell/zulip", "path": "tools/droplets/add_mentor.py", "copies": "2", "size": "2273", "license": "apache-2.0", "hash": 5640861156219217000, "line_mean": 29.7162162162, "line_max": 91, "alpha_frac": 0.6190057193, "autogenerated": false, "ratio": 3.529503105590062, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5148508824890062, "avg_score": null, "num_lines": null }
# Allows a mentor to ssh into a Digital Ocean droplet. This is designed to be # executed on the target machine. # # This script takes the username of the mentor as an argument: # # $ python3 add_mentor.py <mentor's username> # # Alternatively you can pass in --remove to remove their ssh key from the # machine: # # $ python3 add_mentor.py --remove <mentor's username> import os import sys from argparse import ArgumentParser from typing import List import socket import re import requests parser = ArgumentParser(description='Give a mentor ssh access to this machine.') parser.add_argument('username', help='Github username of the mentor.') parser.add_argument('--remove', help='Remove his/her key from the machine.', action='store_true', default=False) # Wrap keys with line comments for easier key removal. append_key = """\ #<{username}>{{{{ {key} #}}}}<{username}> """ def get_mentor_keys(username: str) -> List[str]: url = 'https://api.github.com/users/{}/keys'.format(username) r = requests.get(url) if r.status_code != 200: print('Cannot connect to Github...') sys.exit(1) keys = r.json() if not keys: print('Mentor "{}" has no public key.'.format(username)) sys.exit(1) return [key['key'] for key in keys] if __name__ == '__main__': args = parser.parse_args() authorized_keys = os.path.expanduser('~/.ssh/authorized_keys') if args.remove: remove_re = re.compile('#<{0}>{{{{.+}}}}<{0}>(\n)?'.format(args.username), re.DOTALL | re.MULTILINE) with open(authorized_keys, 'r+') as f: old_content = f.read() new_content = re.sub(remove_re, '', old_content) f.seek(0) f.write(new_content) f.truncate() print('Successfully removed {}\' SSH key!'.format(args.username)) else: keys = get_mentor_keys(args.username) with open(authorized_keys, 'a') as f: for key in keys: f.write(append_key.format(username=args.username, key=key)) print('Successfully added {}\'s SSH key!'.format(args.username)) print('Can you let your mentor know that they can connect to this machine with:\n') print(' $ ssh zulipdev@{}\n'.format(socket.gethostname()))
{ "repo_name": "mahim97/zulip", "path": "tools/droplets/add_mentor.py", "copies": "16", "size": "2330", "license": "apache-2.0", "hash": 5087274952683895000, "line_mean": 30.0666666667, "line_max": 91, "alpha_frac": 0.6197424893, "autogenerated": false, "ratio": 3.579109062980031, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.0007422880035483658, "num_lines": 75 }
"""Allows creation and manipulation of python objects representing html, css and javascript elements. Available predefined objects for html elements: <html>, <head>, <body>, <title>, <meta>, <link>, <p>, <h1> to <h6>, <a>, <div>, <script>, <img>, <ul>, <ol>, <li>, <table>, <tr>, <th>, <td>, <hr>, <br>, <style>, <center> Available predefined objects for css elements: element selector, id selector, class selector Available predefined objects for javascript elements: Todo: * Add js element support * Expand list of predefined html elements (video, ) * Add a way to parse dicts * Add descriptions to ValueErrors * Add custom defined attributes for some html tags (meta (charset, ), div (id, class, ), video (dimensions(width, height), ), ) * Create a TextNode class that replaces html special symbols with their representation e.g. '<' to '&lt;' * """ import platform import webbrowser import os.path class List: """Class that imitates some behaviours of python lists.""" def __init__(self, *args): self.contents = list(args) def __getitem__(self, item): return self.contents[item] def __setitem__(self, key, value): self.contents[key] = value def __delitem__(self, key): del(self.contents[key]) def __len__(self): return len(self.contents) def __call__(self, *args): for arg in args: self.contents.append(arg) class Dict: """Class that imitates some behaviours of python dictionaries.""" def __init__(self, **kwargs): self.contents = kwargs def __getitem__(self, item): return self.contents[item] def __setitem__(self, key, value): self.contents[key] = value def __delitem__(self, key): del (self.contents[key]) def __len__(self): return len(self.contents) def __call__(self, **kwargs): self.contents = {**self.contents, **kwargs} class File: def __init__(self, path, filename, extension): self.filename = filename self.path = path self.extension = extension def build(self): f = open(self.filepath(), 'w') f.write(str(self)) f.close() def filepath(self): """Returns the formatted file path with filename and extension.""" return f'{self.path}{self.filename}.{self.extension}' class FileHTML(File): """Class representing an HTML file""" def __init__(self, path, filename, html, doctype='<!doctype html>'): File.__init__(self, path, filename, 'html') self.doctype = doctype self.html = html def openhtml(self): webbrowser.open_new(self.filepath()) def parse(self, text): pass def __str__(self): return f'{self.doctype}\n' \ f'{self.html.__str__(self.filepath())}\n' class FileCSS(File): """Class representing a CSS file""" def __init__(self, path, filename, css, *args): File.__init__(self, path, filename, 'css') self.css = css def __str__(self): if isinstance(self.css, list): css_text = '' if len(self.css) != 0: for element in self.css: css_text += f'\n{str(element)}\n' return css_text else: return str(self.css) class FileJS(File): """Class representing a Javascript file""" def __init__(self, path, filename, js, *args): File.__init__(self, path, filename, 'js') self.js = js def __str__(self): if isinstance(self.js, list): js_text = '' if len(self.js) != 0: for element in self.js: js_text += f'\n{str(element)}\n' return js_text else: return str(self.js) def compare_path(path_main, path_other): abs_main = os.path.normpath(os.path.dirname(os.path.abspath(path_main))) abs_other = os.path.normpath(os.path.abspath(path_other)) return os.path.relpath(abs_other, abs_main) # ========== HTML related code ========== # class ElementHTML(List): """Class that handles html elements.""" def __init__(self, tag, *args, end_tag=True, **kwargs): super().__init__(*args) self.tag = tag self.newlines = True self.end_tag = end_tag self._attributes = kwargs def attributes(self, **kwargs): self._attributes = kwargs def __str__(self, holder_filepath=''): """Return html valid representation of self. holder_filepath is propagated through the chain of elements and only those that need it use it """ text_inline, text_attributes, nl = '', '', '' if self.newlines: nl = '\n' if len(self.contents) != 0: for element in self.contents: if isinstance(element, str): text_inline += element else: text_inline += nl + element.__str__(holder_filepath=holder_filepath) + nl text_inline.replace('\n\n', '\n') if len(self._attributes) != 0: text_attributes = ' ' for key in self._attributes.keys(): text_attributes += f'{key}=\"{self._attributes[key]}\"' if self.end_tag: return f'<{self.tag}{text_attributes}>{text_inline}</{self.tag}>' else: return f'<{self.tag}{text_attributes}>' def custom_tag(tagtxt): """Allows to create a custom wrapper class of ElementHTML.""" class CustomTag(ElementHTML): def __init__(self, *args, **kwargs): super().__init__(tagtxt, *args, **kwargs) return CustomTag class HTML(ElementHTML): """Wrapper class of ElementHTML for creating html element.""" def __init__(self, *args, **kwargs): super().__init__('html', *args, **kwargs) class Head(ElementHTML): """Wrapper class of ElementHTML for creating head html element.""" def __init__(self, *args, **kwargs): super().__init__('head', *args, **kwargs) class Body(ElementHTML): """Wrapper class of ElementHTML for creating body html element.""" def __init__(self, *args, **kwargs): super().__init__('body', *args, **kwargs) class Title(ElementHTML): """Wrapper class of ElementHTML for creating title html element.""" def __init__(self, *args, **kwargs): super().__init__('title', *args, **kwargs) class Meta(ElementHTML): """Wrapper class of ElementHTML for creating meta html element.""" def __init__(self, *args, **kwargs): super().__init__('meta', *args, end_tag=False, **kwargs) class Link(ElementHTML): """Wrapper class of ElementHTML for creating link html element.""" def __init__(self, *args, **kwargs): super().__init__('link', *args, end_tag=False, **kwargs) self.oldstr = ElementHTML.__str__ def __str__(self, holder_filepath=''): # holder_filepath is passed in FileHTML.__str__ if 'href' in self._attributes.keys() and \ isinstance(self._attributes['href'], File): if holder_filepath == '': raise ValueError('') # Add description to ValueError new_href = compare_path(holder_filepath, self._attributes['href'].filepath()) self._attributes['href'] = new_href return self.oldstr(self) class P(ElementHTML): """Wrapper class of ElementHTML for creating paragraph html element.""" def __init__(self, *args, **kwargs): super().__init__('p', *args, **kwargs) class H(ElementHTML): """Wrapper class of ElementHTML for creating header html element.""" def __init__(self, *args, size=1, **kwargs): super().__init__(f'h{size}', *args, **kwargs) class A(ElementHTML): """Wrapper class of ElementHTML for creating anchor html element.""" def __init__(self, *args, **kwargs): super().__init__('a', *args, **kwargs) self.oldstr = ElementHTML.__str__ def __str__(self, holder_filepath=''): # holder_filepath is passed in FileHTML.__str__ if 'href' in self._attributes.keys() and \ isinstance(self._attributes['href'], FileHTML): if holder_filepath == '': raise ValueError('') # Add description to ValueError new_href = compare_path(holder_filepath, self._attributes['href'].filepath()) self._attributes['href'] = new_href return self.oldstr(self) class Div(ElementHTML): """Wrapper class of ElementHTML for creating division html element.""" def __init__(self, *args, **kwargs): super().__init__('div', *args, **kwargs) class Script(ElementHTML): """Wrapper class of ElementHTML for creating script html element.""" def __init__(self, *args, **kwargs): super().__init__('script', *args, **kwargs) self.oldstr = ElementHTML.__str__ def __str__(self, holder_filepath=''): # holder_filepath is passed in FileHTML.__str__ if 'src' in self._attributes.keys() and \ isinstance(self._attributes['src'], File): if holder_filepath == '': raise ValueError('') # Add description to ValueError new_src = compare_path(holder_filepath, self._attributes['src'].filepath()) self._attributes['src'] = new_src return self.oldstr(self) class Img(ElementHTML): """Wrapper class of ElementHTML for creating image html element.""" def __init__(self, *args, **kwargs): super().__init__('img', *args, end_tag=False, **kwargs) self.oldstr = ElementHTML.__str__ def __str__(self, holder_filepath=''): # holder_filepath is passed in FileHTML.__str__ if 'src' in self._attributes.keys() and \ isinstance(self._attributes['src'], File): if holder_filepath == '': raise ValueError('') # Add description to ValueError new_src = compare_path(holder_filepath, self._attributes['src'].filepath()) self._attributes['src'] = new_src return self.oldstr(self) class Ul(ElementHTML): """Wrapper class of ElementHTML for creating unordered list html element.""" def __init__(self, *args, **kwargs): super().__init__('ul', *args, **kwargs) @classmethod def from_list(cls, list_, _no_ul_tag=False): """Converts a python list into `Ul` object.""" if _no_ul_tag: # Returns a python list containing `Li` class objects items = [] for item in list_: if isinstance(item, list): items.append(cls.from_list(item)) elif isinstance(item, dict): items.append(*cls.from_dict(item, _part_of_list=True)) else: items.append(Li(item)) return items else: # Returns a `Ul` class object temp_ul = cls() for item in list_: if isinstance(item, list): temp_ul(cls.from_list(item)) elif isinstance(item, dict): temp_ul(*cls.from_dict(item, _part_of_list=True)) else: temp_ul(Li(item)) return temp_ul @classmethod def from_dict(cls, dict_, _part_of_list=False): keys = list(dict_.keys()) keys.sort() items = [] for key in keys: items.append(key) if isinstance(dict_[key], list): items.append(dict_[key]) else: items.append([dict_[key]]) return cls.from_list(items, _no_ul_tag=_part_of_list) class Ol(ElementHTML): """Wrapper class of ElementHTML for creating ordered list html element.""" def __init__(self, *args, **kwargs): super().__init__('ol', *args, **kwargs) @classmethod def from_list(cls, list_, _no_ul_tag=False): """Converts a python list into `Ul` object.""" if _no_ul_tag: # Returns a python list containing `Li` class objects items = [] for item in list_: if isinstance(item, list): items.append(cls.from_list(item)) elif isinstance(item, dict): items.append(*cls.from_dict(item, _part_of_list=True)) else: items.append(Li(item)) return items else: # Returns a `Ul` class object temp_ul = cls() for item in list_: if isinstance(item, list): temp_ul(cls.from_list(item)) elif isinstance(item, dict): temp_ul(*cls.from_dict(item, _part_of_list=True)) else: temp_ul(Li(item)) return temp_ul @classmethod def from_dict(cls, dict_, _part_of_list=False): keys = list(dict_.keys()) keys.sort() items = [] for key in keys: items.append(key) if isinstance(dict_[key], list): items.append(dict_[key]) else: items.append([dict_[key]]) return cls.from_list(items, _no_ul_tag=_part_of_list) class Li(ElementHTML): """Wrapper class of ElementHTML for creating list item html element.""" def __init__(self, *args, **kwargs): super().__init__('li', *args, **kwargs) self.newlines = False class Table(ElementHTML): """Wrapper class of ElementHTML for creating table html element.""" def __init__(self, *args, **kwargs): super().__init__('table', *args, **kwargs) @classmethod def from_list(cls, list_): """Converts a python list into `Table` object.""" if isinstance(list_[0], list): cols = len(list_[0]) else: raise ValueError('Insert only nested lists.') for row in list_: if isinstance(row, list): if not len(row) == cols: raise ValueError('All rows in the table must be of same length.') else: row = [row] row.extend([''] * (cols - 1)) temp_table = cls() header_row = Tr() temp_table(header_row) for header in list_[0]: header_row(Th(header)) for row in list_[1:]: temp_row = Tr() temp_table(temp_row) for cell in row: temp_row(Td(cell)) return temp_table class Tr(ElementHTML): """Wrapper class of ElementHTML for creating table row html element.""" def __init__(self, *args, **kwargs): super().__init__('tr', *args, **kwargs) self.newlines = False class Th(ElementHTML): """Wrapper class of ElementHTML for creating table header html element.""" def __init__(self, *args, **kwargs): super().__init__('th', *args, **kwargs) self.newlines = False class Td(ElementHTML): """Wrapper class of ElementHTML for creating table cell html element.""" def __init__(self, *args, **kwargs): super().__init__('td', *args, **kwargs) self.newlines = False class Hr(ElementHTML): """Wrapper class of ElementHTML for creating thematic break html element.""" def __init__(self, *args, **kwargs): super().__init__('hr', *args, end_tag=False, **kwargs) class Br(ElementHTML): """Wrapper class of ElementHTML for creating thematic break html element.""" def __init__(self, *args, **kwargs): super().__init__('br', *args, end_tag=False, **kwargs) class Style(ElementHTML): """Wrapper class of ElementHTML for creating style html element.""" def __init__(self, *args, **kwargs): super().__init__('style', *args, **kwargs) class Center(ElementHTML): """Wrapper class of ElementHTML for creating center html element.""" def __init__(self, *args, **kwargs): super().__init__('center', *args, **kwargs) # - - - - - # ========== CSS related code ========== # def custom_attr_setter(attr_text): """Return a wrapper function that sets self[attr_text] to passed value. This function is used to create custom wrapper methods in Declarations class. """ def attr_setter(self, value: str): self[attr_text] = value return attr_setter class _CSSDeclarations: """Class that contains custom wrapper methods for adding pre-defined declarations to ElementCSS instances.""" color = custom_attr_setter('color') direction = custom_attr_setter('direction') letter_spacing = custom_attr_setter('letter-spacing') word_spacing = custom_attr_setter('word-spacing') line_height = custom_attr_setter('line-height') txt_align = custom_attr_setter('text-align') vertical_align = custom_attr_setter('vertical-align') txt_deco = custom_attr_setter('text-decoration') txt_indent = custom_attr_setter('text-indent') txt_shadow = custom_attr_setter('text-shadow') txt_transform = custom_attr_setter('text-transform') txt_overflow = custom_attr_setter('text-overflow') unicode = custom_attr_setter('unicode-bidi') whitespace = custom_attr_setter('white-space') font = custom_attr_setter('font') font_family = custom_attr_setter('font-family') font_size = custom_attr_setter('font-size') font_style = custom_attr_setter('font-style') font_variant = custom_attr_setter('font-variant') font_weight = custom_attr_setter('font-weight') bg = custom_attr_setter('background') bg_color = custom_attr_setter('background-color') bg_img = custom_attr_setter('background-image') bg_repeat = custom_attr_setter('background-repeat') bg_attachment = custom_attr_setter('background-attachment') bg_pos = custom_attr_setter('background-position') border = custom_attr_setter('border') border_b = custom_attr_setter('border-bottom') border_l = custom_attr_setter('border-left') border_r = custom_attr_setter('border-right') border_t = custom_attr_setter('border-top') border_color = custom_attr_setter('border-color') border_radius = custom_attr_setter('border-radius') border_style = custom_attr_setter('border-style') border_width = custom_attr_setter('border-width') border_collapse = custom_attr_setter('border-collapse') border_spacing = custom_attr_setter('border-spacing') caption_side = custom_attr_setter('caption-side') empty_cells = custom_attr_setter('empty-cells') table_layout = custom_attr_setter('table-layout') margin = custom_attr_setter('margin') margin_b = custom_attr_setter('margin-bottom') margin_l = custom_attr_setter('margin-left') margin_t = custom_attr_setter('margin-top') margin_r = custom_attr_setter('margin-right') padding = custom_attr_setter('padding') padding_b = custom_attr_setter('padding-bottom') padding_l = custom_attr_setter('padding-left') padding_t = custom_attr_setter('padding-top') padding_r = custom_attr_setter('padding-right') height = custom_attr_setter('height') max_height = custom_attr_setter('max-height') min_height = custom_attr_setter('min-height') width = custom_attr_setter('width') max_width = custom_attr_setter('max-width') min_width = custom_attr_setter('min-width') outline = custom_attr_setter('outline') outline_color = custom_attr_setter('outline-color') outline_off = custom_attr_setter('outline-offset') outline_style = custom_attr_setter('outline-style') outline_width = custom_attr_setter('outline-width') list_style = custom_attr_setter('list-style') list_style_img = custom_attr_setter('list-style-image') list_style_pos = custom_attr_setter('list-style-position') list_style_type = custom_attr_setter('list-style-type') display = custom_attr_setter('display') visible = custom_attr_setter('visibility') pos = custom_attr_setter('position') bottom = custom_attr_setter('bottom') left = custom_attr_setter('left') top = custom_attr_setter('top') right = custom_attr_setter('right') clip = custom_attr_setter('clip') z_ind = custom_attr_setter('z-index') overflow = custom_attr_setter('overflow') overflowX = custom_attr_setter('overflow-x') overflowY = custom_attr_setter('overflow-y') clear = custom_attr_setter('clear') float = custom_attr_setter('float') class ElementCSS(Dict, _CSSDeclarations): """Class that handles css elements.""" def __init__(self, selector, **kwargs): Dict.__init__(self, **kwargs) _CSSDeclarations.__init__(self) self.selector = selector def __str__(self): declarations_text = '' if len(self.contents) != 0: for key in self.contents.keys(): declarations_text += f'\t{key}: {self.contents[key]};\n' return f'{self.selector} {"{"}\n' \ f'{declarations_text}' \ f'{"}"}' class SelectorElement(ElementCSS): """Wrapper class of ElementCSS for creating css element selectors.""" def __init__(self, selector, **kwargs): super().__init__(selector, **kwargs) class SelectorId(ElementCSS): """Wrapper class of ElementCSS for creating css id selectors.""" def __init__(self, selector, **kwargs): super().__init__(f'#{selector}', **kwargs) class SelectorClass(ElementCSS): """Wrapper class of ElementCSS for creating css class selectors.""" def __init__(self, selector, **kwargs): super().__init__(f'.{selector}', **kwargs) # - - - - - # ========== Javascript related code ========== # class ElementJS(List): """Class that handles javascript elements.""" def __init__(self, *args): super().__init__(*args) # - - - - -
{ "repo_name": "mikister/webgen", "path": "webgen/dom.py", "copies": "1", "size": "21958", "license": "mit", "hash": 7141873671371173000, "line_mean": 30.5488505747, "line_max": 113, "alpha_frac": 0.5828399672, "autogenerated": false, "ratio": 3.9699873440607485, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5052827311260748, "avg_score": null, "num_lines": null }
"""Allow selecting multiple lines and indenting them all at once.""" from porcupine import get_tab_manager, tabs, utils setup_before = ['tabs2spaces'] # see tabs2spaces.py def on_tab_key(event, shifted): try: start_index, end_index = map(str, event.widget.tag_ranges('sel')) except ValueError as e: # nothing selected, allow doing other stuff return None start = int(start_index.split('.')[0]) end = int(end_index.split('.')[0]) if end_index.split('.')[1] != '0': # something's selected on the end line, let's indent/dedent it too end += 1 for lineno in range(start, end): if shifted: event.widget.dedent('%d.0' % lineno) else: # if the line is empty or it contains nothing but # whitespace, don't touch it content = event.widget.get( '%d.0' % lineno, '%d.0 lineend' % lineno) if not (content.isspace() or not content): event.widget.indent('%d.0' % lineno) # select only the lines we indented but everything on them event.widget.tag_remove('sel', '1.0', 'end') event.widget.tag_add('sel', '%d.0' % start, '%d.0' % end) def on_new_tab(event): if isinstance(event.data_widget, tabs.FileTab): utils.bind_tab_key(event.data_widget.textwidget, on_tab_key, add=True) def setup(): utils.bind_with_data(get_tab_manager(), '<<NewTab>>', on_new_tab, add=True)
{ "repo_name": "PurpleMyst/porcupine", "path": "porcupine/plugins/indent_block.py", "copies": "1", "size": "1466", "license": "mit", "hash": -3346402221056442400, "line_mean": 33.0930232558, "line_max": 79, "alpha_frac": 0.6002728513, "autogenerated": false, "ratio": 3.4988066825775657, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.45990795338775653, "avg_score": null, "num_lines": null }
'''Allows executing and formatting ReQL queries and JSON responses''' from __future__ import print_function import json import datetime import traceback import os import sys import termios import tty import re import functools import base64 from pygments import highlight from pygments.lexers import JsonLexer, PythonLexer from pygments.formatters import Terminal256Formatter from pygments.styles import STYLE_MAP import rethinkdb as r class ReQLExecution(object): def __init__(self, querystring, files, connection, output): self.querystring = querystring self.conn = connection self.output = output self.results = None self._query = None self.environment = files self.environment.update({ 'r': r, '__builtins__': { 'True': True, 'False': False, 'None': None, } }) @property def query(self): '''The compiled query from the input query string''' if self._query is None: self._query = r.expr(eval(self.querystring, self.environment)) return self._query def __call__(self): '''Executes the query and sends it to the output''' try: self.results = self.query.run( self.conn, binary_format=self.output.binary_format, time_format=self.output.time_format) self.output(self.results, self.query) except r.RqlError as e: self.output.error(e) except NameError as ne: self.output.error(ne.message) except SyntaxError as se: exc_list = traceback.format_exception_only(type(se), se)[1:] exc_list[0] = self.output.python_format(exc_list[0]) self.output.error('\n', ''.join(exc_list)) except AttributeError as ae: self.output.error(ae.message) except KeyboardInterrupt: pass def filename_to_var(filename): '''Transforms a filename into a usable variable name''' return re.sub(r'\W', '_', os.path.basename(filename).split('.', 1)[0]) def binary_patch(func): '''decorator to monkey patch the json encoder so it doesn't accidentally try to print out binaries (which may have null bytes in them)''' real_encoder = json.encoder.encode_basestring def reql_encode_basestring(s): if isinstance(s, r.ast.RqlBinary): return '"' + base64.b64encode(s) + '"' else: return real_encoder(s) @functools.wraps(func) def _wrapper(*args, **kwargs): orig = json.encoder.encode_basestring json.encoder.encode_basestring = reql_encode_basestring try: return func(*args, **kwargs) finally: json.encoder.encode_basestring = orig return _wrapper class DateJSONEncoder(json.JSONEncoder): '''Will format datetimes as iso8601''' def default(self, obj): if isinstance(obj, datetime.datetime): return obj.isoformat() class Output(object): '''Centralizes output behavior''' input_stream = sys.stdin output_stream = sys.stdout error_stream = sys.stderr @staticmethod def make(format, style, pagesize): '''Factory method to create the appropriate output''' is_atty = os.isatty(sys.stdout.fileno()) if format == 'color' or format == 'auto' and is_atty: return ColorOutput(style, pagesize) elif format == 'newline' or format == 'auto' and not is_atty: return NewlineOutput() elif format == 'array': return ArrayOutput() else: raise Exception('{} {} {} is illegal!'.format( format, style, pagesize)) @binary_patch def format(self, doc): '''Dumps a json value according to the current format''' return json.dumps( doc, indent=None if self.compact else 4, sort_keys=not self.compact, separators=(',', ':') if self.compact else (', ', ': '), cls=json.JSONEncoder if self.compact else DateJSONEncoder, ensure_ascii=False, ) def python_format(self, obj): return obj def print(self, *args, **kwargs): '''Print a value to stdout''' kwargs.setdefault('file', self.output_stream) print(*args, **kwargs) def fprint(self, value, **kwargs): '''Format string equivalent of printf''' kwargs.setdefault('file', self.output_stream) print(self.format(value), **kwargs) def error(self, value, *args, **kwargs): '''Print a value to stderr''' kwargs.setdefault('file', self.error_stream) print(value, *args, **kwargs) def getch(self): """getch() -> key character Read a single keypress from stdin and return the resulting character. Nothing is echoed to the console. This call will block if a keypress is not already available, but will not wait for Enter to be pressed. If the pressed key was a modifier key, nothing will be detected; if it were a special function key, it may return the first character of of an escape sequence, leaving additional characters in the buffer. From http://code.activestate.com/recipes/577977-get-single-keypress/ """ fd = self.input_stream.fileno() old_settings = termios.tcgetattr(fd) try: tty.setraw(fd) ch = self.input_stream.read(1) finally: termios.tcsetattr(fd, termios.TCSADRAIN, old_settings) return ch class ColorOutput(Output): '''User friendly output''' time_format = 'native' binary_format = 'native' compact = False def __init__(self, style, pagesize): self.style = style if style in STYLE_MAP else 'monokai' self.pagesize = pagesize def format(self, doc): doc = super(ColorOutput, self).format(doc) return highlight( doc, JsonLexer(), Terminal256Formatter(style=self.style)) def primitive_array(self, docs): '''Whether a document is an array of primitives''' primitives = (int, float, bool, basestring) return isinstance(docs, list) and \ all(isinstance(x, primitives) for x in docs) def python_format(self, obj): '''Colorizes python strings''' return highlight(str(obj), PythonLexer(), Terminal256Formatter(style=self.style)) def __call__(self, docs, query): if isinstance(docs, dict) and 'first_error' in docs: # Detect errors that don't raise exceptions self.error(docs['first_error'].replace('\t', ' ')) return if self.primitive_array(docs): self.compact = True if isinstance(docs, (dict, int, float, bool, basestring)) or \ self.primitive_array(docs): # Print small things directly self.fprint(docs) self.print('Ran:\n', self.python_format(query)) return i = 0 # in case no results for i, doc in enumerate(docs, start=1): self.fprint(doc) if i % self.pagesize == 0: self.print('Running:', self.python_format(query)) self.print('[%s] Hit any key to continue (or q to quit)...' % i) char = self.getch() if char.lower() == 'q': raise SystemExit() self.print('Total docs:', i) self.print('Ran:\n', self.python_format(query)) class NewlineOutput(Output): '''Newline separated compact json document output''' time_format = 'raw' binary_format = 'raw' compact = True def __call__(self, docs, _): if isinstance(docs, dict): self.fprint(docs) else: for doc in docs: self.fprint(doc) class ArrayOutput(Output): '''JSON array output. Can be parsed by any JSON interpreter''' time_format = 'raw' binary_format = 'raw' compact = True def print(self, *args, **kwargs): super(ArrayOutput, self).print(*args, **kwargs) self.output_stream.flush() def __call__(self, docs, _): if isinstance(docs, dict): self.fprint(docs) elif isinstance(docs, r.Cursor): first = True self.print('[', end='') try: for doc in docs: if not first: self.print(',', sep='', end='') else: first = False self.fprint(doc, sep='', end='') finally: self.print(']') else: self.fprint(docs)
{ "repo_name": "deontologician/reql_cli", "path": "reqlcli/__init__.py", "copies": "1", "size": "8840", "license": "mit", "hash": -6249369954303568000, "line_mean": 30.9133574007, "line_max": 80, "alpha_frac": 0.5771493213, "autogenerated": false, "ratio": 4.227642276422764, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5304791597722763, "avg_score": null, "num_lines": null }
#Allows for creation of new inputs and outputs from mongoobject import RecursiveMongoObject import uuid from bson.objectid import ObjectId class IO(RecursiveMongoObject): @staticmethod def create(): return { "_id": ObjectId(uuid.uuid4().hex[:24]), "meta": {}, #Metadata of the entire io "io": {} #The document containing all registers } #Allows for modification of the metadata associated with an io def getMeta(self): return self.getChild("meta") def setMeta(self,m): self["meta"] = m meta = property(getMeta,setMeta) def getIo(self): return self.getChild("io",1) def setIo(self,i): self["io"] = i io = property(getIo,setIo) if (__name__=="__main__"): from pymongo import MongoClient db = MongoClient().testing.test #Clear the database db.remove() v = IO.create() val = v["_id"] db.insert(v) v = IO(db,{"_id": val},autocommit=False) assert str(v.meta)=="({})[{}]" v.meta = {"word":"up","gg":"game"} #WARNING: if autocommit is off, need to manually commit after setting meta v.commit() assert str(v.meta)=="({'gg': 'game', 'word': 'up'})[{}]" v.meta["hi"]=5 v.meta["word"] = "down" assert str(v.meta) == "({'gg': 'game', 'word': 'up'})[{'hi': 5, 'word': 'down'}]" v.commit() assert str(v.meta) == "({'gg': 'game', 'hi': 5, 'word': 'down'})[{}]" assert str(db.find_one()["meta"]) == "{u'gg': u'game', u'hi': 5, u'word': u'down'}" assert len(v.io)==0 v.io["light1"]={"type": "bool"} v.io["light2"]={"type": "bool"} v.io["light3"]={"type": "bool"} assert len(v.io)==0 v.commit() assert len(v.io)==3 assert "light2" in v.io assert not "light8" in v.io v.io.delete("light2") v.io.commit() assert not "light2" in v.io assert str(db.find_one()["io"]) == "{u'light3': {u'type': u'bool'}, u'light1': {u'type': u'bool'}}" assert v.io["light1"]["type"] == "bool" v.io["light1"]["type"] = "int" assert str(v.io["light1"]) == "({'type': 'bool'})[{'type': 'int'}]" v.io.commit() assert str(v.io["light1"]) == "({'type': 'int'})[{}]"
{ "repo_name": "dkumor/meDB", "path": "datastore/users/inputoutput.py", "copies": "1", "size": "2228", "license": "mit", "hash": -4258496223690594000, "line_mean": 25.843373494, "line_max": 103, "alpha_frac": 0.5408438061, "autogenerated": false, "ratio": 3.111731843575419, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.8994345980234272, "avg_score": 0.031645933888229616, "num_lines": 83 }
# Allows for Note objects to initialized via a given frequency and volume # Imported for use in the module Note_Library.py # Taken from < https://gist.github.com/ohsqueezy/6540433 > ############################################################## # Generate a 440 Hz square waveform in Pygame by building an array of samples and play # it for 5 seconds. Change the hard-coded 440 to another value to generate a different # pitch. # # Run with the following command: # python pygame-play-tone.py from array import array from time import sleep import pygame import pygame.mixer as pm from pygame.mixer import Sound class Note(Sound): def __init__(self, frequency, volume=0.1): self.frequency = frequency Sound.__init__(self, buffer=self.build_samples()) self.set_volume(volume) def build_samples(self): period = int(round(pm.get_init()[0] / self.frequency)) samples = array("h", [0] * period) amplitude = 2 ** (abs(pm.get_init()[1]) - 1) - 1 for time in range(period): #Originally xrange if time < period / 2: samples[time] = amplitude else: samples[time] = -amplitude return samples #An example of the Note object being used if __name__ == "__main__": pm.pre_init(44100, -16, 1, 1024) #Required init for Windows 10 # pm.init() #Required init for other OS's? #TODO Research this further to confirm test = Note(440) test.play(-1) sleep(5)
{ "repo_name": "cornell-cup/cs-minibot-platform", "path": "python-interface/src/MiniBotFramework/Sound/pygame_play_tone.py", "copies": "1", "size": "1497", "license": "apache-2.0", "hash": 6682653252137785000, "line_mean": 32.2666666667, "line_max": 87, "alpha_frac": 0.6205744823, "autogenerated": false, "ratio": 3.770780856423174, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.48913553387231734, "avg_score": null, "num_lines": null }
"""Allows for quick movement between git branches, for long branch names.""" import argparse import subprocess import sys from contextlib import contextmanager from enum import Enum from typing import List from typing import Optional from typing import Tuple from ..core import color from ..core import git from ..exceptions import GitfuException class BranchNotFoundError(GitfuException): pass class ExcessivelyBroadQueryError(GitfuException): pass class BranchChangeStrategy(Enum): DISCARD = 1 OVERWRITE_DEST = 2 SAVE = 3 def main(*argv: str) -> int: args = parse_args(*argv) if not args.name: print(show_git_branches()) return 0 try: dest_branch = get_branch(args.name) except BranchNotFoundError: print( ( f'{color.colorize("ERROR", color.AnsiColor.RED)}: ' 'No branch found with that query.' ), file=sys.stderr, ) return 1 except ExcessivelyBroadQueryError as e: error = f'{color.colorize("ERROR", color.AnsiColor.RED)}: ' error += 'Multiple git branches found:\n - ' error += '\n - '.join(e.args[0]) error += '\n\nTry a different query.' print(error, file=sys.stderr) return 1 options = {} if args.force: options['should_force'] = True branch_change_strategy = None if args.force: branch_change_strategy = BranchChangeStrategy.DISCARD elif args.stash: branch_change_strategy = BranchChangeStrategy.OVERWRITE_DEST elif args.commit: branch_change_strategy = BranchChangeStrategy.SAVE try: switch_branch(dest_branch, strategy=branch_change_strategy) except subprocess.CalledProcessError as e: print(e.stderr, file=sys.stderr) return 1 return 0 def parse_args(*argv: str) -> argparse.Namespace: parser = argparse.ArgumentParser(description=__doc__) parser.add_argument( 'name', nargs='?', help='Branch identifier to switch to.', ) group = parser.add_mutually_exclusive_group() group.add_argument( '-f', '--force', action='store_true', help=( 'Forcefully changes branches, by **discarding** any local changes and ' 'removing any untracked files.' ), ) group.add_argument( '-s', '--stash', action='store_true', help=( 'Forcefully changes branches, but **preserves** changes by stashing them ' 'and overwriting the files after the branch change.' ), ) group.add_argument( '-c', '--commit', action='store_true', help=( 'Forcefully changes branches, by **committing** them to the current branch ' 'as a WIP commit, so it can be restored when you come back to this branch.' ), ) # NOTE: `None` is needed to print the help string. return parser.parse_args(argv or None) def show_git_branches() -> str: output = 'These are the branches you can switch to:\n' output += git.run('branch') return output def get_branch(name: str) -> str: branches = [ candidate.strip('* ') for candidate in git.run('branch', colorize=False).splitlines() if name in candidate ] if not branches: raise BranchNotFoundError if len(branches) > 1: raise ExcessivelyBroadQueryError(branches) return branches[0] def switch_branch(name: str, *, strategy: Optional[BranchChangeStrategy] = None) -> None: try: git.run('checkout', name) except subprocess.CalledProcessError as e: if not strategy: raise error = e.stderr handler = { BranchChangeStrategy.DISCARD: resolve_errors_through_discard, BranchChangeStrategy.OVERWRITE_DEST: resolve_errors_through_preservation, BranchChangeStrategy.SAVE: resolve_errors_through_commit, }.get(strategy) with handler(error): git.run('checkout', name) last_commit_message = git.run( 'log', '--pretty=format:"%s"', '-1', colorize=False, ) if last_commit_message == 'WIP: switch-branch-cache': git.run('reset', 'HEAD~1') @contextmanager def resolve_errors_through_discard(error: str): tracked_files, untracked_files = _get_blocking_files(error) # TODO: git reset all tracked files (unstage them, if staged) # TODO: git checkout all tracked files (discard changes) # TODO: remove all untracked files (discard changes) yield @contextmanager def resolve_errors_through_preservation(error: str): tracked_files, untracked_files = _get_blocking_files(error) # TODO: git stash (and see what that resolves) # TODO: rename untracked files to `.bak` yield # TODO: rename untracked files back to original @contextmanager def resolve_errors_through_commit(error: str): tracked_files, untracked_files = _get_blocking_files(error) git.run('add', *tracked_files, *untracked_files) git.run('commit', '-m', 'WIP: switch-branch-cache') yield def _get_blocking_files(error: str) -> Tuple[List[str], List[str]]: # NOTE: From trial and error, there are several error messages that may appear at once. # These are the scenarios I've encountered: # 1. staged file that would be overwritten by checkout # 2. modified files (but not staged) that would be overwritten by checkout # 3. untracked files that would be overwritten by checkout tracked_files = [] untracked_files = [] collection = None for line in error.splitlines(): if line == ( 'error: Your local changes to the following files would be overwritten by checkout:' ): collection = tracked_files elif line == ( 'error: The following untracked working tree files would be overwritten by checkout:' ): collection = untracked_files elif line not in { 'Please commit your changes or stash them before you switch branches.', 'Please move or remove them before you switch branches.', 'Aborting', }: collection.append(line.strip()) return tracked_files, untracked_files if __name__ == '__main__': sys.exit(main())
{ "repo_name": "domanchi/gitfu", "path": "gitfu/standalone/switch_git_branch.py", "copies": "1", "size": "6411", "license": "mit", "hash": -7860603707468189000, "line_mean": 27.6205357143, "line_max": 97, "alpha_frac": 0.6268912806, "autogenerated": false, "ratio": 4.099104859335038, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5225996139935039, "avg_score": null, "num_lines": null }
"""Allows for triggering GPIO lines on FTDI based boards.""" import time import pylibftdi class FtdiButtons: """Allows for triggering GPIO lines on FTDI based boards.""" def __init__(self, ftdi_serial_number, button_map, polarity=False): """Initializes the FtdiButtons with the properties provided. The ftdi_serial_number is needed to unique identify the FTDI device to control as there may be more than one FTDI device available. The button map defines the interfaces and pin (bit) to set for each button and should look like this: some_button_map = {"a_button": {"interface": 1, "pin": 3}, "b_button": {"interface": 2, "pin": 5}} Args: ftdi_serial_number (str): FTDI serial number to use button_map (dict): button to pin (bit) mapping. polarity (bool): GPIO pin polarity to use (True to push button). """ self._button_map = button_map self._button_down = {} self._ftdi_serial_number = ftdi_serial_number self._polarity = polarity self._sub_process = None self._bb_map = {} self._bitbang_device_init = False self.bitbang_device_init() def __del__(self): self.close() def close(self): """Release any held buttons on close.""" for button in list(self._button_down): self.release(button) for interface in self._bb_map: ftdi_device = self._bb_map[interface] ftdi_device.close() self._bb_map.clear() self._bitbang_device_init = False def is_valid(self, button): """Return True if button specified is in the list of valid buttons. Args: button (str): button identifier. Returns: bool: True if button specified is in button map provided """ return button in list(self._button_map.keys()) def bitbang_device_init(self): """Creates BitBangDevices for each button and initializes to 'off'.""" for button in list(self._button_map.keys()): interface = self._button_map[button]["interface"] pin = self._button_map[button]["pin"] if interface not in self._bb_map: ftdi_device = pylibftdi.BitBangDevice( device_id=self._ftdi_serial_number, interface_select=interface, direction=(1 << pin)) ftdi_device.port = 0 if self._polarity else 255 self._bb_map[interface] = ftdi_device else: self._bb_map[interface].direction |= (1 << pin) self._button_down[button] = False self._bitbang_device_init = True def press(self, button, wait=0.0): """Presses button and waits for the time specified. Note: You must call release or close to release the button later. Args: button (str): identify which button to press wait (float): seconds to wait before returning Raises: ValueError: invalid button or wait given. """ if not self._bitbang_device_init: self.bitbang_device_init() if button not in self._button_map: raise ValueError("Invalid button {} specified".format(button)) elif wait < 0.0: raise ValueError("Invalid wait {} specified".format(wait)) elif not self._button_down[button]: self._gpio(button, -1, active_high=self._polarity) time.sleep(wait) def click(self, button, duration=.5): """Presses the button specified and holds it for the specified duration. Args: button (str): button to click. duration (float): seconds to wait before releasing the button. Raises: ValueError: invalid button or duration given. """ if not self._bitbang_device_init: self.bitbang_device_init() if button not in self._button_map: raise ValueError("Invalid button {} specified".format(button)) elif duration <= 0.0: raise ValueError("Invalid duration {} specified".format(duration)) else: self._gpio(button, duration, active_high=self._polarity) def release(self, button): """Releases the button specified if it was previously pressed. Args: button (str): button to click. Raises: ValueError: invalid button given. """ if not self._bitbang_device_init: self.bitbang_device_init() if button not in self._button_map: raise ValueError("Invalid button {} specified".format(button)) elif self._button_down[button]: self._gpio(button, -1, active_high=self._polarity) def read_pin(self, interface, pin): """Returns True if the bit is high for the given pin, False otherwise. Args: interface (int): the port on the FTDI chip containing the GPIO pin (int): the bit representing the GPIO to read Return: bool: True if pin is high, False if low. """ if not self._bitbang_device_init: self.bitbang_device_init() return (self._bb_map[interface].port & (1 << pin)) != 0 def valid_buttons(self): """Returns a list of valid button names. Returns: list: A list of valid button name strings """ return list(self._button_map.keys()) def _gpio(self, button, duration, active_high): """Drive the GPIO of the button specified for the duration provided. Args: button (str): button to be toggled duration (float): seconds to wait between the two toggles. If negative, only one toggle will be performed (either a press or release). active_high (bool): drive the pin high if True otherwise drive active_low. """ if not self._bitbang_device_init: self.bitbang_device_init() interface = self._button_map[button]["interface"] bb = self._bb_map[interface] self.__toggle(button, bb, active_high) if duration >= 0.0: time.sleep(duration) self.__toggle(button, bb, active_high) def __toggle(self, button, bb, active_high): """Toggles the button specified based on its previous state. Args: button (str): button to be toggled bb (BitBangDevice): performs the toggle. active_high (bool): drive the pin high if True, otherwise drive active_low. """ if not self._bitbang_device_init: self.bitbang_device_init() pin = self._button_map[button]["pin"] if self._button_down[button]: # Release button if active_high: self.__clear_pin(bb, pin) else: self.__set_pin(bb, pin) self._button_down[button] = False else: # Set button if active_high: self.__set_pin(bb, pin) else: self.__clear_pin(bb, pin) self._button_down[button] = True @staticmethod def __clear_pin(bb, pin): """Clear the bit of the given pin. Args: bb (BitBangDevice): performs the work pin (int): the bit representing the GPIO to clear """ bb.port &= 255 ^ (1 << pin) @staticmethod def __set_pin(bb, pin): """Sets the bit for the given pin. Args: bb (BitBangDevice): performs the work pin (int): the bit representing the GPIO to clear """ bb.port |= (1 << pin)
{ "repo_name": "google/gazoo-device", "path": "gazoo_device/switchboard/ftdi_buttons.py", "copies": "1", "size": "7041", "license": "apache-2.0", "hash": 7502745569071379000, "line_mean": 30.5739910314, "line_max": 76, "alpha_frac": 0.6321545235, "autogenerated": false, "ratio": 3.8224755700325734, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.4954630093532574, "avg_score": null, "num_lines": null }
"""Allows livesettings to be "locked down" and no longer use the settings page or the database for settings retrieval. """ import logging from django.conf import settings as djangosettings from django.contrib.sites.models import Site __all__ = ['get_overrides'] def _safe_get_siteid(site): if not site: try: site = Site.objects.get_current() siteid = site.id except: siteid = djangosettings.SITE_ID else: siteid = site.id return siteid def get_overrides(siteid=-1): """Check to see if livesettings is allowed to use the database. If not, then it will only use the values in the dictionary, LIVESETTINGS_OPTIONS[SITEID]['SETTINGS'], this allows 'lockdown' of a live site. The LIVESETTINGS dict must be formatted as follows:: LIVESETTINGS_OPTIONS = { 1 : { 'DB' : False, # or True 'SETTINGS' : { 'GROUPKEY' : {'KEY', val, 'KEY2', val}, 'GROUPKEY2' : {'KEY', val, 'KEY2', val}, } } } In the settings dict above, the "val" entries must exactly match the format stored in the database for a setting, which is a string representation of the value. Do not use e.g. a literal True or an integer. The easiest way to get a right formated expression is by the URL http://your.site/settings/export/ Returns a tuple (DB_ALLOWED, SETTINGS) """ overrides = (True, {}) if hasattr(djangosettings, 'LIVESETTINGS_OPTIONS'): if siteid == -1: siteid = _safe_get_siteid(None) opts = djangosettings.LIVESETTINGS_OPTIONS if opts.has_key(siteid): opts = opts[siteid] overrides = (opts.get('DB', True), opts['SETTINGS']) return overrides
{ "repo_name": "oblalex/django-xlivesettings", "path": "xlivesettings/overrides.py", "copies": "1", "size": "1864", "license": "bsd-3-clause", "hash": -6474655173163482000, "line_mean": 31.701754386, "line_max": 94, "alpha_frac": 0.5971030043, "autogenerated": false, "ratio": 3.899581589958159, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.49966845942581595, "avg_score": null, "num_lines": null }
"""Allows livesettings to be "locked down" and no longer use the settings page or the database for settings retrieval. """ from django.conf import settings as djangosettings from django.contrib.sites.models import Site import logging __all__ = ['get_overrides'] def _safe_get_siteid(site): if not site: try: site = Site.objects.get_current() siteid = site.id except: siteid = djangosettings.SITE_ID else: siteid = site.id return siteid def get_overrides(siteid=-1): """Check to see if livesettings is allowed to use the database. If not, then it will only use the values in the dictionary, LIVESETTINGS_OPTIONS[SITEID]['SETTINGS'], this allows 'lockdown' of a live site. The LIVESETTINGS dict must be formatted as follows:: LIVESETTINGS_OPTIONS = { 1 : { 'DB' : False, # or True 'SETTINGS' : { 'GROUPKEY' : {'KEY', val, 'KEY2', val}, 'GROUPKEY2' : {'KEY', val, 'KEY2', val}, } } } In the settings dict above, the "val" entries must exactly match the format stored in the database for a setting, which is a string representation of the value. Do not use e.g. a literal True or an integer. The easiest way to get a right formated expression is by the URL http://your.site/settings/export/ Returns a tuple (DB_ALLOWED, SETTINGS) """ overrides = (True, {}) if hasattr(djangosettings, 'LIVESETTINGS_OPTIONS'): if siteid == -1: siteid = _safe_get_siteid(None) opts = djangosettings.LIVESETTINGS_OPTIONS if opts.has_key(siteid): opts = opts[siteid] overrides = (opts.get('DB', True), opts['SETTINGS']) return overrides
{ "repo_name": "pombredanne/django-livesettings", "path": "livesettings/overrides.py", "copies": "3", "size": "1873", "license": "bsd-3-clause", "hash": -4129011167181125600, "line_mean": 31.8596491228, "line_max": 94, "alpha_frac": 0.5942338494, "autogenerated": false, "ratio": 3.918410041841004, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.005806608549790559, "num_lines": 57 }
# allows modules to be imported from the ./dependencies directory import sys sys.path.insert(0, './dependencies') # for calling external APIs import requests import json def lambda_handler(event, context): """ Route the incoming request based on type (LaunchRequest, IntentRequest, etc.) The JSON body of the request is provided in the event parameter. """ print("event.session.application.applicationId=" + event['session']['application']['applicationId']) if event['session']['new']: on_session_started({'requestId': event['request']['requestId']}, event['session']) if event['request']['type'] == "LaunchRequest": return on_launch(event['request'], event['session']) elif event['request']['type'] == "IntentRequest": return on_intent(event['request'], event['session']) elif event['request']['type'] == "SessionEndedRequest": return on_session_ended(event['request'], event['session']) def on_session_started(session_started_request, session): """ Called when the session starts """ print("on_session_started requestId=" + session_started_request['requestId'] + ", sessionId=" + session['sessionId']) def on_launch(launch_request, session): """ Called when the user launches the skill without specifying what they want """ print("on_launch requestId=" + launch_request['requestId'] + ", sessionId=" + session['sessionId']) # Dispatch to your skill's launch return get_welcome_response() def on_intent(intent_request, session): """ Called when the user specifies an intent for this skill """ print("on_intent requestId=" + intent_request['requestId'] + ", sessionId=" + session['sessionId']) intent = intent_request['intent'] intent_name = intent_request['intent']['name'] print("intent name was: " + intent_name) if intent_name == "streamers": return get_response() elif intent_name == "AMAZON.HelpIntent": return get_welcome_response() else: raise ValueError("Invalid intent") def on_session_ended(session_ended_request, session): """ Called when the user ends the session. Is not called when the skill returns should_end_session=true """ print("on_session_ended requestId=" + session_ended_request['requestId'] + ", sessionId=" + session['sessionId']) # add cleanup logic here # --------------- Functions that control the skill's behavior ------------------ def get_welcome_response(): """ If we wanted to initialize the session to have some attributes we could add those here """ session_attributes = {} card_title = "Welcome" speech_output = "To hear what's streaming on Twitch, say 'what is live right now?'" # If the user either does not reply to the welcome message or says something # that is not understood, they will be prompted again with this text. reprompt_text = "Sorry, I didn't understand what you said." should_end_session = False return build_response(session_attributes, build_speechlet_response( card_title, speech_output, reprompt_text, should_end_session)) def build_speechlet_response(title, output, reprompt_text, should_end_session): return { 'outputSpeech': { 'type': 'PlainText', 'text': output }, 'card': { 'type': 'Simple', 'title': 'SessionSpeechlet - ' + title, 'content': 'SessionSpeechlet - ' + output }, 'reprompt': { 'outputSpeech': { 'type': 'PlainText', 'text': reprompt_text } }, 'shouldEndSession': should_end_session } def build_response(session_attributes, speechlet_response): return { 'version': '1.0', 'sessionAttributes': session_attributes, 'response': speechlet_response } def get_response(): streamers = get_followed_streamers() names = keep_live_users(streamers) speech_output = '' if (len(streamers) == 0): speech_output = 'No one is streaming right now.' else: speech_output = ' and'.join(names) + ' are streaming right now.' return build_response({}, build_speechlet_response(title='Streamers', output=speech_output, reprompt_text="Please try again.", should_end_session=True)) # takes in [(user id, display name)] # returns list of users currently streaming def keep_live_users(streamers): ids = [ streamer[0] for streamer in streamers ] headers = { 'Client-ID': 'fb8brzjsgp1lsl7vnj6clt4ozvuz8c' } url = 'https://api.twitch.tv/helix/streams?user_id=' + '&user_id='.join(ids) response = requests.get(url) live_ids = [] if response.status_code == 200: json_response = json.loads(response.content) live_ids = [ stream.user_id for stream in json_response['data'] ] return [ streamer[1] for streamer in streamers if streamer[0] in live_ids ] # returns list of tuples of people we follow def get_followed_streamers(): headers = { 'Client-ID': 'fb8brzjsgp1lsl7vnj6clt4ozvuz8c' } url = 'https://api.twitch.tv/helix/users/follows?from_id=167211639' response = requests.get(url) usernames = [] if response.status_code == 200: json_response = json.loads(response.content) usernames = [ (follow.id, follow.display_name) for follow in json_response['data'] ] return usernames
{ "repo_name": "ikottman/alexa-skills", "path": "is_streaming/main.py", "copies": "1", "size": "5663", "license": "unlicense", "hash": -664783094762002200, "line_mean": 33.962962963, "line_max": 103, "alpha_frac": 0.6208723292, "autogenerated": false, "ratio": 3.9490934449093444, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.008748516059265429, "num_lines": 162 }
# allows modules to be imported from the ./dependencies directory import sys sys.path.insert(0, './dependencies') # for calling external APIs import requests import json # for handling KMS secret decryption import os import boto3 from base64 import b64decode # get and decode secrets from KMS ENCRYPTED_KEY = os.environ['google_api_key'] ENCRYPTEED_LOCATION = os.environ['location'] GOOGLE_API_KEY = boto3.client('kms').decrypt(CiphertextBlob=b64decode(ENCRYPTED_KEY))['Plaintext'] LOCATION = boto3.client('kms').decrypt(CiphertextBlob=b64decode(ENCRYPTEED_LOCATION))['Plaintext'] def lambda_handler(event, context): """ Route the incoming request based on type (LaunchRequest, IntentRequest, etc.) The JSON body of the request is provided in the event parameter. """ print("event.session.application.applicationId=" + event['session']['application']['applicationId']) """ Uncomment this if statement and populate with your skill's application ID to prevent someone else from configuring a skill that sends requests to this function. """ # if (event['session']['application']['applicationId'] != # "amzn1.echo-sdk-ams.app.[unique-value-here]"): # raise ValueError("Invalid Application ID") if event['session']['new']: on_session_started({'requestId': event['request']['requestId']}, event['session']) if event['request']['type'] == "LaunchRequest": return on_launch(event['request'], event['session']) elif event['request']['type'] == "IntentRequest": return on_intent(event['request'], event['session']) elif event['request']['type'] == "SessionEndedRequest": return on_session_ended(event['request'], event['session']) def on_session_started(session_started_request, session): """ Called when the session starts """ print("on_session_started requestId=" + session_started_request['requestId'] + ", sessionId=" + session['sessionId']) def on_launch(launch_request, session): """ Called when the user launches the skill without specifying what they want """ print("on_launch requestId=" + launch_request['requestId'] + ", sessionId=" + session['sessionId']) # Dispatch to your skill's launch return get_welcome_response() def on_intent(intent_request, session): """ Called when the user specifies an intent for this skill """ print("on_intent requestId=" + intent_request['requestId'] + ", sessionId=" + session['sessionId']) intent = intent_request['intent'] intent_name = intent_request['intent']['name'] print("intent name was: " + intent_name) if intent_name == "Place": return Maps.is_place_open(intent) elif intent_name == "AMAZON.HelpIntent": return get_welcome_response() else: raise ValueError("Invalid intent") def on_session_ended(session_ended_request, session): """ Called when the user ends the session. Is not called when the skill returns should_end_session=true """ print("on_session_ended requestId=" + session_ended_request['requestId'] + ", sessionId=" + session['sessionId']) # add cleanup logic here # --------------- Functions that control the skill's behavior ------------------ def get_welcome_response(): """ If we wanted to initialize the session to have some attributes we could add those here """ session_attributes = {} card_title = "Welcome" speech_output = "To see if a business is open, say: ask office hours if Taco Bell is open." # If the user either does not reply to the welcome message or says something # that is not understood, they will be prompted again with this text. reprompt_text = "Sorry, I didn't understand what you said." should_end_session = False return build_response(session_attributes, build_speechlet_response( card_title, speech_output, reprompt_text, should_end_session)) def build_speechlet_response(title, output, reprompt_text, should_end_session): return { 'outputSpeech': { 'type': 'PlainText', 'text': output }, 'card': { 'type': 'Simple', 'title': 'SessionSpeechlet - ' + title, 'content': 'SessionSpeechlet - ' + output }, 'reprompt': { 'outputSpeech': { 'type': 'PlainText', 'text': reprompt_text } }, 'shouldEndSession': should_end_session } def build_response(session_attributes, speechlet_response): return { 'version': '1.0', 'sessionAttributes': session_attributes, 'response': speechlet_response } class Maps: @staticmethod def is_place_open(intent): # call google places to find the nearest location for the search print(intent) place = intent['slots']['name']['value'] # search for the place name within a 50,000 meter (roughly 31 mile) radius of the specified gps coordinates. api_url = "https://maps.googleapis.com/maps/api/place/nearbysearch/json?location=" + \ LOCATION + "&name=" + place + "&rankby=distance&key=" + GOOGLE_API_KEY response = requests.get(api_url) speech_output = "Sorry, couldn't find anything for " + place if response is not None and response.content is not None and response.status_code == 200: json_response = json.loads(response.content) if len(json_response['results']) > 0: result = json_response['results'][0] if result['opening_hours']['open_now']: speech_output = result['name'] + " at " + result['vicinity'] + " is open." else: speech_output = result['name'] + " at " + result['vicinity'] + " is closed." return build_response({}, build_speechlet_response(title=intent['name'], output=speech_output, reprompt_text="Please try again.", should_end_session=True))
{ "repo_name": "ikottman/alexa-skills", "path": "office_hours/office_hours.py", "copies": "1", "size": "6237", "license": "unlicense", "hash": -4367586624101451000, "line_mean": 36.8, "line_max": 116, "alpha_frac": 0.6185666186, "autogenerated": false, "ratio": 4.152463382157124, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.004038850814947601, "num_lines": 165 }
"""Allows mouse wheel to work within matplotlib http://stackoverflow.com/questions/11551049/matplotlib-plot-zooming-with-scroll-wheel """ from matplotlib.pyplot import figure, show import numpy class ZoomPan: def __init__(self): self.press = None self.cur_xlim = None self.cur_ylim = None self.x0 = None self.y0 = None self.x1 = None self.y1 = None self.xpress = None self.ypress = None def zoom_factory(self, ax, base_scale = 2.): def zoom(event): cur_xlim = ax.get_xlim() cur_ylim = ax.get_ylim() xdata = event.xdata # get event x location ydata = event.ydata # get event y location if event.button == 'down': # deal with zoom in scale_factor = 1 / base_scale elif event.button == 'up': # deal with zoom out scale_factor = base_scale else: # deal with something that should never happen scale_factor = 1 print(event.button) new_width = (cur_xlim[1] - cur_xlim[0]) * scale_factor new_height = (cur_ylim[1] - cur_ylim[0]) * scale_factor relx = (cur_xlim[1] - xdata)/(cur_xlim[1] - cur_xlim[0]) rely = (cur_ylim[1] - ydata)/(cur_ylim[1] - cur_ylim[0]) ax.set_xlim([xdata - new_width * (1-relx), xdata + new_width * (relx)]) ax.set_ylim([ydata - new_height * (1-rely), ydata + new_height * (rely)]) ax.figure.canvas.draw() fig = ax.get_figure() # get the figure of interest fig.canvas.mpl_connect('scroll_event', zoom) return zoom def pan_factory(self, ax): def onPress(event): if event.inaxes != ax: return self.cur_xlim = ax.get_xlim() self.cur_ylim = ax.get_ylim() self.press = self.x0, self.y0, event.xdata, event.ydata self.x0, self.y0, self.xpress, self.ypress = self.press def onRelease(event): self.press = None ax.figure.canvas.draw() def onMotion(event): if self.press is None: return if event.inaxes != ax: return dx = event.xdata - self.xpress dy = event.ydata - self.ypress self.cur_xlim -= dx self.cur_ylim -= dy ax.set_xlim(self.cur_xlim) ax.set_ylim(self.cur_ylim) ax.figure.canvas.draw() fig = ax.get_figure() # get the figure of interest # attach the call back fig.canvas.mpl_connect('button_press_event',onPress) fig.canvas.mpl_connect('button_release_event',onRelease) fig.canvas.mpl_connect('motion_notify_event',onMotion) #return the function return onMotion def example(): fig = figure() ax = fig.add_subplot(111, xlim=(0,1), ylim=(0,1), autoscale_on=False) ax.set_title('Click to zoom') x,y,s,c = numpy.random.rand(4,200) s *= 200 ax.scatter(x,y,s,c) scale = 1.1 zp = ZoomPan() figZoom = zp.zoom_factory(ax, base_scale = scale) figPan = zp.pan_factory(ax) show()
{ "repo_name": "biokit/biokit", "path": "biokit/dev/mpl_focus.py", "copies": "1", "size": "3225", "license": "bsd-2-clause", "hash": -7794963521827931000, "line_mean": 29.7142857143, "line_max": 85, "alpha_frac": 0.5457364341, "autogenerated": false, "ratio": 3.5092491838955384, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.45549856179955384, "avg_score": null, "num_lines": null }
# Allows player to choose their next move from show import * def chooser(x_or_o, board): while True: show(board) try: x_or_o_input = input("Select a spot[%s]> " % x_or_o) x_or_o_input = int(x_or_o_input) # Subtract 1 to accomodate for indexing vs regular # human sensibility x_or_o_input -= 1 if board[x_or_o_input] == 'x' or board[x_or_o_input] == 'o': cleanup() print "This spot has already been taken:" continue else: board[x_or_o_input] = x_or_o break except IndexError: continue except ValueError: print("That is not a number on the board.") continue except TypeError: print("That is not a number on the board.") continue except IndexError: print("That is not a number on the board.") continue except SyntaxError: print("That is not a number on the board.") continue except NameError: print("That is not a number on the board.") continue def _test(): import doctest doctest.testmod()
{ "repo_name": "jessebikman/Tictactoe-colorama", "path": "chooser.py", "copies": "1", "size": "1263", "license": "mit", "hash": 5985769104496948000, "line_mean": 30.575, "line_max": 72, "alpha_frac": 0.5106888361, "autogenerated": false, "ratio": 4.370242214532872, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.027815934065934068, "num_lines": 40 }
""" Allows production of cutlists for a given set of required pieces, given a set of available stock sizes. """ import collections from .stock import Stock # simple structure to keep track of a specific piece Piece = collections.namedtuple('Piece', 'id, length') class Planner(object): """ Object that can produce a cutlist (plan) for cutting stock. """ def __init__(self, sizes, needed, loss=0.25): self.stock = [] self.stock_sizes = sorted(sizes) self.pieces_needed = [Piece(i, s) for i, s in enumerate(needed)] self.pieces_needed.reverse() self.cut_loss = loss self.cur_stock = None # set the algorithm to use, hard code for now self.apply_algo = self.apply_next_fit @property def largest_stock(self): """ Returns the size of the largest available stock.""" return self.stock_sizes[-1] def cut_piece(self, piece): """ Record the cut for the given piece """ self.cur_stock.cut(piece, self.cut_loss) def finalize_stock(self): """ Takes current stock out of use, attempts to shrink """ # shrink as much as possible for smaller in self.stock_sizes[-2::-1]: if self.cur_stock.shrink(smaller) is None: break self.stock.append(self.cur_stock) def apply_next_fit(self, piece): """ Cut from current stock until unable, then move to new stock """ if self.cur_stock.remaining_length < piece.length + self.cut_loss: # finalize current stock and get fresh stock self.finalize_stock() self.cur_stock = Stock(self.largest_stock) self.cur_stock.cut(piece, self.cut_loss) def make_cuts(self): """ Apply the cutting algorithm to generate a cut list.""" self.cur_stock = Stock(self.largest_stock) while self.pieces_needed: piece = self.pieces_needed.pop() self.apply_algo(piece) self.finalize_stock()
{ "repo_name": "alanc10n/py-cutplanner", "path": "cutplanner/planner.py", "copies": "1", "size": "2004", "license": "mit", "hash": 2501005921870436400, "line_mean": 31.8524590164, "line_max": 75, "alpha_frac": 0.621257485, "autogenerated": false, "ratio": 3.9140625, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5035319985, "avg_score": null, "num_lines": null }
"""Allows reading temperatures from ecoal/esterownik.pl controller.""" from homeassistant.components.sensor import SensorEntity from homeassistant.const import TEMP_CELSIUS from . import AVAILABLE_SENSORS, DATA_ECOAL_BOILER def setup_platform(hass, config, add_entities, discovery_info=None): """Set up the ecoal sensors.""" if discovery_info is None: return devices = [] ecoal_contr = hass.data[DATA_ECOAL_BOILER] for sensor_id in discovery_info: name = AVAILABLE_SENSORS[sensor_id] devices.append(EcoalTempSensor(ecoal_contr, name, sensor_id)) add_entities(devices, True) class EcoalTempSensor(SensorEntity): """Representation of a temperature sensor using ecoal status data.""" def __init__(self, ecoal_contr, name, status_attr): """Initialize the sensor.""" self._ecoal_contr = ecoal_contr self._name = name self._status_attr = status_attr self._state = None @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def unit_of_measurement(self): """Return the unit of measurement.""" return TEMP_CELSIUS def update(self): """Fetch new state data for the sensor. This is the only method that should fetch new data for Home Assistant. """ # Old values read 0.5 back can still be used status = self._ecoal_contr.get_cached_status() self._state = getattr(status, self._status_attr)
{ "repo_name": "w1ll1am23/home-assistant", "path": "homeassistant/components/ecoal_boiler/sensor.py", "copies": "5", "size": "1632", "license": "apache-2.0", "hash": -8282250350400701000, "line_mean": 30.3846153846, "line_max": 78, "alpha_frac": 0.6507352941, "autogenerated": false, "ratio": 3.76036866359447, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0, "num_lines": 52 }
"""Allows reading temperatures from ecoal/esterownik.pl controller.""" from homeassistant.const import TEMP_CELSIUS from homeassistant.helpers.entity import Entity from . import AVAILABLE_SENSORS, DATA_ECOAL_BOILER def setup_platform(hass, config, add_entities, discovery_info=None): """Set up the ecoal sensors.""" if discovery_info is None: return devices = [] ecoal_contr = hass.data[DATA_ECOAL_BOILER] for sensor_id in discovery_info: name = AVAILABLE_SENSORS[sensor_id] devices.append(EcoalTempSensor(ecoal_contr, name, sensor_id)) add_entities(devices, True) class EcoalTempSensor(Entity): """Representation of a temperature sensor using ecoal status data.""" def __init__(self, ecoal_contr, name, status_attr): """Initialize the sensor.""" self._ecoal_contr = ecoal_contr self._name = name self._status_attr = status_attr self._state = None @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def unit_of_measurement(self): """Return the unit of measurement.""" return TEMP_CELSIUS def update(self): """Fetch new state data for the sensor. This is the only method that should fetch new data for Home Assistant. """ # Old values read 0.5 back can still be used status = self._ecoal_contr.get_cached_status() self._state = getattr(status, self._status_attr)
{ "repo_name": "tboyce021/home-assistant", "path": "homeassistant/components/ecoal_boiler/sensor.py", "copies": "9", "size": "1617", "license": "apache-2.0", "hash": -8390926505367633000, "line_mean": 30.0961538462, "line_max": 78, "alpha_frac": 0.6474953618, "autogenerated": false, "ratio": 3.7430555555555554, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.8890550917355556, "avg_score": null, "num_lines": null }
"""Allows reading temperatures from ecoal/esterownik.pl controller.""" import logging from homeassistant.components.ecoal_boiler import ( DATA_ECOAL_BOILER, AVAILABLE_SENSORS, ) from homeassistant.const import TEMP_CELSIUS from homeassistant.helpers.entity import Entity _LOGGER = logging.getLogger(__name__) DEPENDENCIES = ['ecoal_boiler'] def setup_platform(hass, config, add_entities, discovery_info=None): """Set up the ecoal sensors.""" if discovery_info is None: return devices = [] ecoal_contr = hass.data[DATA_ECOAL_BOILER] for sensor_id in discovery_info: name = AVAILABLE_SENSORS[sensor_id] devices.append(EcoalTempSensor(ecoal_contr, name, sensor_id)) add_entities(devices, True) class EcoalTempSensor(Entity): """Representation of a temperature sensor using ecoal status data.""" def __init__(self, ecoal_contr, name, status_attr): """Initialize the sensor.""" self._ecoal_contr = ecoal_contr self._name = name self._status_attr = status_attr self._state = None @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def unit_of_measurement(self): """Return the unit of measurement.""" return TEMP_CELSIUS def update(self): """Fetch new state data for the sensor. This is the only method that should fetch new data for Home Assistant. """ # Old values read 0.5 back can still be used status = self._ecoal_contr.get_cached_status() self._state = getattr(status, self._status_attr)
{ "repo_name": "HydrelioxGitHub/home-assistant", "path": "homeassistant/components/ecoal_boiler/sensor.py", "copies": "2", "size": "1749", "license": "apache-2.0", "hash": 7123816952604687000, "line_mean": 29.1551724138, "line_max": 78, "alpha_frac": 0.653516295, "autogenerated": false, "ratio": 3.697674418604651, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0, "num_lines": 58 }
"""Allows reading temperatures from ecoal/esterownik.pl controller.""" import logging from homeassistant.const import TEMP_CELSIUS from homeassistant.helpers.entity import Entity from . import AVAILABLE_SENSORS, DATA_ECOAL_BOILER _LOGGER = logging.getLogger(__name__) DEPENDENCIES = ['ecoal_boiler'] def setup_platform(hass, config, add_entities, discovery_info=None): """Set up the ecoal sensors.""" if discovery_info is None: return devices = [] ecoal_contr = hass.data[DATA_ECOAL_BOILER] for sensor_id in discovery_info: name = AVAILABLE_SENSORS[sensor_id] devices.append(EcoalTempSensor(ecoal_contr, name, sensor_id)) add_entities(devices, True) class EcoalTempSensor(Entity): """Representation of a temperature sensor using ecoal status data.""" def __init__(self, ecoal_contr, name, status_attr): """Initialize the sensor.""" self._ecoal_contr = ecoal_contr self._name = name self._status_attr = status_attr self._state = None @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def unit_of_measurement(self): """Return the unit of measurement.""" return TEMP_CELSIUS def update(self): """Fetch new state data for the sensor. This is the only method that should fetch new data for Home Assistant. """ # Old values read 0.5 back can still be used status = self._ecoal_contr.get_cached_status() self._state = getattr(status, self._status_attr)
{ "repo_name": "jamespcole/home-assistant", "path": "homeassistant/components/ecoal_boiler/sensor.py", "copies": "1", "size": "1705", "license": "apache-2.0", "hash": -2432014744900283000, "line_mean": 28.3965517241, "line_max": 78, "alpha_frac": 0.6504398827, "autogenerated": false, "ratio": 3.698481561822126, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9848921444522125, "avg_score": 0, "num_lines": 58 }
# Allows rendering a given tilespec from multiple_tiles_affine_renderer import MultipleTilesAffineRenderer from single_tile_affine_renderer import SingleTileAffineRenderer import json import numpy as np import sys sys.path.append('../') import models class TilespecAffineRenderer: def __init__(self, tilespec): self.single_tiles = [SingleTileAffineRenderer( tile_ts["mipmapLevels"]["0"]["imageUrl"].replace("file://", ""), tile_ts["width"], tile_ts["height"], compute_distances=True) for tile_ts in tilespec] # Add the corresponding transformation for tile_ts, tile in zip(tilespec, self.single_tiles): for t in tile_ts["transforms"]: transform = models.Transforms.from_tilespec(t) tile.add_transformation(transform.get_matrix()[:2]) self.multi_renderer = MultipleTilesAffineRenderer(self.single_tiles, blend_type="LINEAR") def render(self): return self.multi_renderer.render() def crop(self, from_x, from_y, to_x, to_y): return self.multi_renderer.crop(from_x, from_y, to_x, to_y) def add_transformation(self, transform_matrix): """Adds a transformation to all tiles""" for single_tile in self.single_tiles: single_tile.add_transformation(transform_matrix[:2])
{ "repo_name": "Rhoana/rh_aligner", "path": "old/renderer/tilespec_affine_renderer.py", "copies": "1", "size": "1375", "license": "mit", "hash": -1797301617322527500, "line_mean": 37.1944444444, "line_max": 157, "alpha_frac": 0.6516363636, "autogenerated": false, "ratio": 3.9173789173789175, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5069015280978917, "avg_score": null, "num_lines": null }
# Allows rendering a given tilespec from multiple_tiles_renderer import MultipleTilesRenderer from single_tile_renderer import SingleTileRenderer import json import numpy as np import sys sys.path.append('../') import models class TilespecRenderer: def __init__(self, tilespec): self.single_tiles = [SingleTileRenderer( tile_ts["mipmapLevels"]["0"]["imageUrl"].replace("file://", ""), tile_ts["width"], tile_ts["height"], compute_distances=True) for tile_ts in tilespec] # Add the corresponding transformation for tile_ts, tile in zip(tilespec, self.single_tiles): for t in tile_ts["transforms"]: model = models.Transforms.from_tilespec(t) tile.add_transformation(model) self.multi_renderer = MultipleTilesRenderer(self.single_tiles, blend_type="LINEAR") def render(self): return self.multi_renderer.render() def crop(self, from_x, from_y, to_x, to_y): return self.multi_renderer.crop(from_x, from_y, to_x, to_y) def add_transformation(self, model): """Adds a transformation to all tiles""" for single_tile in self.single_tiles: single_tile.add_transformation(model)
{ "repo_name": "Rhoana/rh_aligner", "path": "old/renderer/tilespec_renderer.py", "copies": "1", "size": "1280", "license": "mit", "hash": 3278240346951653000, "line_mean": 34.5555555556, "line_max": 157, "alpha_frac": 0.63671875, "autogenerated": false, "ratio": 3.9628482972136223, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.5099567047213622, "avg_score": null, "num_lines": null }
"""Allows running Celery tasks asynchronously using the Tornado IOLoop.""" from tornado import concurrent from tornado import ioloop from tornado import stack_context import logging import time logger = logging.getLogger(__name__) class CeleryPoller(object): def __init__(self, poll_freq): self._poll_freq = poll_freq self._results_callbacks = [] @concurrent.return_future def run_task(self, task, *args, **kwargs): callback = kwargs["callback"] del kwargs["callback"] # Wrap the callback it takes the result and raises exceptions in the # correct stack context. def result_callback(result): callback(result.get()) result_callback = stack_context.wrap(result_callback) logger.info("Starting task (should be fast)...") self._results_callbacks.append((task.delay(*args, **kwargs), result_callback)) logger.info("... task started") self._poll_tasks() def _poll_tasks(self): logger.debug("Polling Celery tasks") results_callbacks = [] t = time.time() logger.info("Starting task poll (should be fast)...") for result, callback in self._results_callbacks: if result.ready(): logger.info("Finished task") # Exception should never be raised here or bad things will # happen. callback(result) else: logger.debug("Task is still pending") results_callbacks.append((result, callback)) t = time.time() - t logger.info("... polled {} task(s) in {}ms" .format(len(self._results_callbacks), int(t * 1000))) self._results_callbacks = results_callbacks if len(self._results_callbacks) > 0: logger.debug("Tasks are still pending, scheduling next poll") ioloop.IOLoop.instance().add_timeout(self._poll_freq, self._poll_tasks) else: logger.debug("All tasks are complete, no polling necessary")
{ "repo_name": "tdryer/feeder", "path": "feedreader/celery_poller.py", "copies": "1", "size": "2139", "license": "mit", "hash": 3463264437872493600, "line_mean": 36.5263157895, "line_max": 76, "alpha_frac": 0.5848527349, "autogenerated": false, "ratio": 4.590128755364807, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0, "num_lines": 57 }
# Allows the admin to close individual opened ports from django # Delete rule from table.filter chain input # Add the deny rule import iptc # Delete the input rule from table def delete_identical_rule(client_ip, service_port): chain = iptc.Chain(iptc.Table(iptc.Table.FILTER), "INPUT") for rule in chain.rules: ipList = rule.src.split('/') currSrcIP = ipList[0] for match in rule.matches: currAllowedPort = int(match.dport) currTarget = rule.target.name if currSrcIP == client_ip and currAllowedPort == service_port and currTarget == "ACCEPT": chain.delete_rule(rule) # Delete any forms of drop from input table def delete_existing_drop(client_ip, service_port): chain = iptc.Chain(iptc.Table(iptc.Table.FILTER), "INPUT") for rule in chain.rules: ipList = rule.src.split('/') currSrcIP = ipList[0] for match in rule.matches: currAllowedPort = int(match.dport) currTarget = rule.target.name if currSrcIP == client_ip and currAllowedPort == service_port and currTarget == "DROP": chain.delete_rule(rule) def add_deny_rule(client_ip, service_port): rule = iptc.Rule() rule.in_interface = "wlan0" rule.out_interface = "eth0" rule.src = client_ip rule.protocol = "udp" match = iptc.Match(rule, "udp") match.dport = "%d" % service_port rule.add_match(match) rule.target = iptc.Target(rule, "DROP") chain = iptc.Chain(iptc.Table(iptc.Table.FILTER), "INPUT") chain.insert_rule(rule) return def close_service_port(client_ip, service_port): delete_existing_drop(client_ip, service_port) delete_identical_rule(client_ip, service_port) add_deny_rule(client_ip, service_port) return
{ "repo_name": "bb111189/CryptoKnocker", "path": "CryptoKnocker/libs/port_operations/closeIndividualPort.py", "copies": "2", "size": "1798", "license": "mit", "hash": -1553334561083069200, "line_mean": 31.1071428571, "line_max": 97, "alpha_frac": 0.6568409344, "autogenerated": false, "ratio": 3.431297709923664, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.9997011791796939, "avg_score": 0.018225370505344996, "num_lines": 56 }
"""Allows the creation of a sensor that breaks out state_attributes.""" from __future__ import annotations import voluptuous as vol from homeassistant.components.sensor import ( DEVICE_CLASSES_SCHEMA, DOMAIN as SENSOR_DOMAIN, ENTITY_ID_FORMAT, PLATFORM_SCHEMA, SensorEntity, ) from homeassistant.const import ( ATTR_ENTITY_ID, CONF_DEVICE_CLASS, CONF_ENTITY_PICTURE_TEMPLATE, CONF_FRIENDLY_NAME, CONF_FRIENDLY_NAME_TEMPLATE, CONF_ICON, CONF_ICON_TEMPLATE, CONF_NAME, CONF_SENSORS, CONF_STATE, CONF_UNIQUE_ID, CONF_UNIT_OF_MEASUREMENT, CONF_VALUE_TEMPLATE, ) from homeassistant.core import HomeAssistant, callback from homeassistant.exceptions import TemplateError from homeassistant.helpers import config_validation as cv, template from homeassistant.helpers.entity import async_generate_entity_id from .const import ( CONF_ATTRIBUTE_TEMPLATES, CONF_ATTRIBUTES, CONF_AVAILABILITY, CONF_AVAILABILITY_TEMPLATE, CONF_OBJECT_ID, CONF_PICTURE, CONF_TRIGGER, ) from .template_entity import TemplateEntity from .trigger_entity import TriggerEntity LEGACY_FIELDS = { CONF_ICON_TEMPLATE: CONF_ICON, CONF_ENTITY_PICTURE_TEMPLATE: CONF_PICTURE, CONF_AVAILABILITY_TEMPLATE: CONF_AVAILABILITY, CONF_ATTRIBUTE_TEMPLATES: CONF_ATTRIBUTES, CONF_FRIENDLY_NAME_TEMPLATE: CONF_NAME, CONF_FRIENDLY_NAME: CONF_NAME, CONF_VALUE_TEMPLATE: CONF_STATE, } SENSOR_SCHEMA = vol.Schema( { vol.Optional(CONF_NAME): cv.template, vol.Required(CONF_STATE): cv.template, vol.Optional(CONF_ICON): cv.template, vol.Optional(CONF_PICTURE): cv.template, vol.Optional(CONF_AVAILABILITY): cv.template, vol.Optional(CONF_ATTRIBUTES): vol.Schema({cv.string: cv.template}), vol.Optional(CONF_UNIT_OF_MEASUREMENT): cv.string, vol.Optional(CONF_DEVICE_CLASS): DEVICE_CLASSES_SCHEMA, vol.Optional(CONF_UNIQUE_ID): cv.string, } ) LEGACY_SENSOR_SCHEMA = vol.All( cv.deprecated(ATTR_ENTITY_ID), vol.Schema( { vol.Required(CONF_VALUE_TEMPLATE): cv.template, vol.Optional(CONF_ICON_TEMPLATE): cv.template, vol.Optional(CONF_ENTITY_PICTURE_TEMPLATE): cv.template, vol.Optional(CONF_FRIENDLY_NAME_TEMPLATE): cv.template, vol.Optional(CONF_AVAILABILITY_TEMPLATE): cv.template, vol.Optional(CONF_ATTRIBUTE_TEMPLATES, default={}): vol.Schema( {cv.string: cv.template} ), vol.Optional(CONF_FRIENDLY_NAME): cv.string, vol.Optional(CONF_UNIT_OF_MEASUREMENT): cv.string, vol.Optional(CONF_DEVICE_CLASS): DEVICE_CLASSES_SCHEMA, vol.Optional(ATTR_ENTITY_ID): cv.entity_ids, vol.Optional(CONF_UNIQUE_ID): cv.string, } ), ) def extra_validation_checks(val): """Run extra validation checks.""" if CONF_TRIGGER in val: raise vol.Invalid( "You can only add triggers to template entities if they are defined under `template:`. " "See the template documentation for more information: https://www.home-assistant.io/integrations/template/" ) if CONF_SENSORS not in val and SENSOR_DOMAIN not in val: raise vol.Invalid(f"Required key {SENSOR_DOMAIN} not defined") return val def rewrite_legacy_to_modern_conf(cfg: dict[str, dict]) -> list[dict]: """Rewrite a legacy sensor definitions to modern ones.""" sensors = [] for object_id, entity_cfg in cfg.items(): entity_cfg = {**entity_cfg, CONF_OBJECT_ID: object_id} for from_key, to_key in LEGACY_FIELDS.items(): if from_key not in entity_cfg or to_key in entity_cfg: continue val = entity_cfg.pop(from_key) if isinstance(val, str): val = template.Template(val) entity_cfg[to_key] = val if CONF_NAME not in entity_cfg: entity_cfg[CONF_NAME] = template.Template(object_id) sensors.append(entity_cfg) return sensors PLATFORM_SCHEMA = vol.All( PLATFORM_SCHEMA.extend( { vol.Optional(CONF_TRIGGER): cv.match_all, # to raise custom warning vol.Required(CONF_SENSORS): cv.schema_with_slug_keys(LEGACY_SENSOR_SCHEMA), } ), extra_validation_checks, ) @callback def _async_create_template_tracking_entities( async_add_entities, hass, definitions: list[dict], unique_id_prefix: str | None ): """Create the template sensors.""" sensors = [] for entity_conf in definitions: # Still available on legacy object_id = entity_conf.get(CONF_OBJECT_ID) state_template = entity_conf[CONF_STATE] icon_template = entity_conf.get(CONF_ICON) entity_picture_template = entity_conf.get(CONF_PICTURE) availability_template = entity_conf.get(CONF_AVAILABILITY) friendly_name_template = entity_conf.get(CONF_NAME) unit_of_measurement = entity_conf.get(CONF_UNIT_OF_MEASUREMENT) device_class = entity_conf.get(CONF_DEVICE_CLASS) attribute_templates = entity_conf.get(CONF_ATTRIBUTES, {}) unique_id = entity_conf.get(CONF_UNIQUE_ID) if unique_id and unique_id_prefix: unique_id = f"{unique_id_prefix}-{unique_id}" sensors.append( SensorTemplate( hass, object_id, friendly_name_template, unit_of_measurement, state_template, icon_template, entity_picture_template, availability_template, device_class, attribute_templates, unique_id, ) ) async_add_entities(sensors) async def async_setup_platform(hass, config, async_add_entities, discovery_info=None): """Set up the template sensors.""" if discovery_info is None: _async_create_template_tracking_entities( async_add_entities, hass, rewrite_legacy_to_modern_conf(config[CONF_SENSORS]), None, ) return if "coordinator" in discovery_info: async_add_entities( TriggerSensorEntity(hass, discovery_info["coordinator"], config) for config in discovery_info["entities"] ) return _async_create_template_tracking_entities( async_add_entities, hass, discovery_info["entities"], discovery_info["unique_id"], ) class SensorTemplate(TemplateEntity, SensorEntity): """Representation of a Template Sensor.""" def __init__( self, hass: HomeAssistant, object_id: str | None, friendly_name_template: template.Template | None, unit_of_measurement: str | None, state_template: template.Template, icon_template: template.Template | None, entity_picture_template: template.Template | None, availability_template: template.Template | None, device_class: str | None, attribute_templates: dict[str, template.Template], unique_id: str | None, ) -> None: """Initialize the sensor.""" super().__init__( attribute_templates=attribute_templates, availability_template=availability_template, icon_template=icon_template, entity_picture_template=entity_picture_template, ) if object_id is not None: self.entity_id = async_generate_entity_id( ENTITY_ID_FORMAT, object_id, hass=hass ) self._name: str | None = None self._friendly_name_template = friendly_name_template # Try to render the name as it can influence the entity ID if friendly_name_template: friendly_name_template.hass = hass try: self._name = friendly_name_template.async_render(parse_result=False) except template.TemplateError: pass self._unit_of_measurement = unit_of_measurement self._template = state_template self._state = None self._device_class = device_class self._unique_id = unique_id async def async_added_to_hass(self): """Register callbacks.""" self.add_template_attribute("_state", self._template, None, self._update_state) if self._friendly_name_template and not self._friendly_name_template.is_static: self.add_template_attribute("_name", self._friendly_name_template) await super().async_added_to_hass() @callback def _update_state(self, result): super()._update_state(result) self._state = None if isinstance(result, TemplateError) else result @property def name(self): """Return the name of the sensor.""" return self._name @property def unique_id(self): """Return the unique id of this sensor.""" return self._unique_id @property def state(self): """Return the state of the sensor.""" return self._state @property def device_class(self) -> str | None: """Return the device class of the sensor.""" return self._device_class @property def unit_of_measurement(self): """Return the unit_of_measurement of the device.""" return self._unit_of_measurement class TriggerSensorEntity(TriggerEntity, SensorEntity): """Sensor entity based on trigger data.""" domain = SENSOR_DOMAIN extra_template_keys = (CONF_STATE,) @property def state(self) -> str | None: """Return state of the sensor.""" return self._rendered.get(CONF_STATE)
{ "repo_name": "home-assistant/home-assistant", "path": "homeassistant/components/template/sensor.py", "copies": "2", "size": "9782", "license": "apache-2.0", "hash": 6994978403340724000, "line_mean": 30.9673202614, "line_max": 119, "alpha_frac": 0.6274790431, "autogenerated": false, "ratio": 3.9926530612244897, "config_test": false, "has_no_keywords": false, "few_assignments": false, "quality_score": 1, "avg_score": 0.00032625696796168653, "num_lines": 306 }
"""Allows the creation of a sensor that breaks out state_attributes.""" import logging from typing import Optional import voluptuous as vol from homeassistant.components.sensor import ( DEVICE_CLASSES_SCHEMA, ENTITY_ID_FORMAT, PLATFORM_SCHEMA, ) from homeassistant.const import ( ATTR_ENTITY_ID, ATTR_FRIENDLY_NAME, ATTR_UNIT_OF_MEASUREMENT, CONF_DEVICE_CLASS, CONF_ENTITY_PICTURE_TEMPLATE, CONF_FRIENDLY_NAME_TEMPLATE, CONF_ICON_TEMPLATE, CONF_SENSORS, CONF_VALUE_TEMPLATE, EVENT_HOMEASSISTANT_START, MATCH_ALL, ) from homeassistant.core import callback from homeassistant.exceptions import TemplateError import homeassistant.helpers.config_validation as cv from homeassistant.helpers.entity import Entity, async_generate_entity_id from homeassistant.helpers.event import async_track_state_change from . import extract_entities, initialise_templates from .const import CONF_AVAILABILITY_TEMPLATE CONF_ATTRIBUTE_TEMPLATES = "attribute_templates" _LOGGER = logging.getLogger(__name__) SENSOR_SCHEMA = vol.Schema( { vol.Required(CONF_VALUE_TEMPLATE): cv.template, vol.Optional(CONF_ICON_TEMPLATE): cv.template, vol.Optional(CONF_ENTITY_PICTURE_TEMPLATE): cv.template, vol.Optional(CONF_FRIENDLY_NAME_TEMPLATE): cv.template, vol.Optional(CONF_AVAILABILITY_TEMPLATE): cv.template, vol.Optional(CONF_ATTRIBUTE_TEMPLATES, default={}): vol.Schema( {cv.string: cv.template} ), vol.Optional(ATTR_FRIENDLY_NAME): cv.string, vol.Optional(ATTR_UNIT_OF_MEASUREMENT): cv.string, vol.Optional(CONF_DEVICE_CLASS): DEVICE_CLASSES_SCHEMA, vol.Optional(ATTR_ENTITY_ID): cv.entity_ids, } ) PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend( {vol.Required(CONF_SENSORS): cv.schema_with_slug_keys(SENSOR_SCHEMA)} ) async def async_setup_platform(hass, config, async_add_entities, discovery_info=None): """Set up the template sensors.""" sensors = [] for device, device_config in config[CONF_SENSORS].items(): state_template = device_config[CONF_VALUE_TEMPLATE] icon_template = device_config.get(CONF_ICON_TEMPLATE) entity_picture_template = device_config.get(CONF_ENTITY_PICTURE_TEMPLATE) availability_template = device_config.get(CONF_AVAILABILITY_TEMPLATE) friendly_name = device_config.get(ATTR_FRIENDLY_NAME, device) friendly_name_template = device_config.get(CONF_FRIENDLY_NAME_TEMPLATE) unit_of_measurement = device_config.get(ATTR_UNIT_OF_MEASUREMENT) device_class = device_config.get(CONF_DEVICE_CLASS) attribute_templates = device_config[CONF_ATTRIBUTE_TEMPLATES] templates = { CONF_VALUE_TEMPLATE: state_template, CONF_ICON_TEMPLATE: icon_template, CONF_ENTITY_PICTURE_TEMPLATE: entity_picture_template, CONF_FRIENDLY_NAME_TEMPLATE: friendly_name_template, CONF_AVAILABILITY_TEMPLATE: availability_template, } initialise_templates(hass, templates, attribute_templates) entity_ids = extract_entities( device, "sensor", device_config.get(ATTR_ENTITY_ID), templates, attribute_templates, ) sensors.append( SensorTemplate( hass, device, friendly_name, friendly_name_template, unit_of_measurement, state_template, icon_template, entity_picture_template, availability_template, entity_ids, device_class, attribute_templates, ) ) async_add_entities(sensors) return True class SensorTemplate(Entity): """Representation of a Template Sensor.""" def __init__( self, hass, device_id, friendly_name, friendly_name_template, unit_of_measurement, state_template, icon_template, entity_picture_template, availability_template, entity_ids, device_class, attribute_templates, ): """Initialize the sensor.""" self.hass = hass self.entity_id = async_generate_entity_id( ENTITY_ID_FORMAT, device_id, hass=hass ) self._name = friendly_name self._friendly_name_template = friendly_name_template self._unit_of_measurement = unit_of_measurement self._template = state_template self._state = None self._icon_template = icon_template self._entity_picture_template = entity_picture_template self._availability_template = availability_template self._icon = None self._entity_picture = None self._entities = entity_ids self._device_class = device_class self._available = True self._attribute_templates = attribute_templates self._attributes = {} async def async_added_to_hass(self): """Register callbacks.""" @callback def template_sensor_state_listener(entity, old_state, new_state): """Handle device state changes.""" self.async_schedule_update_ha_state(True) @callback def template_sensor_startup(event): """Update template on startup.""" if self._entities != MATCH_ALL: # Track state change only for valid templates async_track_state_change( self.hass, self._entities, template_sensor_state_listener ) self.async_schedule_update_ha_state(True) self.hass.bus.async_listen_once( EVENT_HOMEASSISTANT_START, template_sensor_startup ) @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def icon(self): """Return the icon to use in the frontend, if any.""" return self._icon @property def device_class(self) -> Optional[str]: """Return the device class of the sensor.""" return self._device_class @property def entity_picture(self): """Return the entity_picture to use in the frontend, if any.""" return self._entity_picture @property def unit_of_measurement(self): """Return the unit_of_measurement of the device.""" return self._unit_of_measurement @property def available(self) -> bool: """Return if the device is available.""" return self._available @property def device_state_attributes(self): """Return the state attributes.""" return self._attributes @property def should_poll(self): """No polling needed.""" return False async def async_update(self): """Update the state from the template.""" try: self._state = self._template.async_render() self._available = True except TemplateError as ex: self._available = False if ex.args and ex.args[0].startswith( "UndefinedError: 'None' has no attribute" ): # Common during HA startup - so just a warning _LOGGER.warning( "Could not render template %s, the state is unknown.", self._name ) else: self._state = None _LOGGER.error("Could not render template %s: %s", self._name, ex) attrs = {} for key, value in self._attribute_templates.items(): try: attrs[key] = value.async_render() except TemplateError as err: _LOGGER.error("Error rendering attribute %s: %s", key, err) self._attributes = attrs templates = { "_icon": self._icon_template, "_entity_picture": self._entity_picture_template, "_name": self._friendly_name_template, "_available": self._availability_template, } for property_name, template in templates.items(): if template is None: continue try: value = template.async_render() if property_name == "_available": value = value.lower() == "true" setattr(self, property_name, value) except TemplateError as ex: friendly_property_name = property_name[1:].replace("_", " ") if ex.args and ex.args[0].startswith( "UndefinedError: 'None' has no attribute" ): # Common during HA startup - so just a warning _LOGGER.warning( "Could not render %s template %s, the state is unknown.", friendly_property_name, self._name, ) continue try: setattr(self, property_name, getattr(super(), property_name)) except AttributeError: _LOGGER.error( "Could not render %s template %s: %s", friendly_property_name, self._name, ex, )
{ "repo_name": "postlund/home-assistant", "path": "homeassistant/components/template/sensor.py", "copies": "4", "size": "9527", "license": "apache-2.0", "hash": 8923949257607735000, "line_mean": 32.4280701754, "line_max": 86, "alpha_frac": 0.5847591057, "autogenerated": false, "ratio": 4.447712418300654, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.7032471524000654, "avg_score": null, "num_lines": null }
"""Allows the creation of a sensor that breaks out state_attributes.""" import logging from typing import Optional import voluptuous as vol from homeassistant.core import callback from homeassistant.components.sensor import ENTITY_ID_FORMAT, \ PLATFORM_SCHEMA, DEVICE_CLASSES_SCHEMA from homeassistant.const import ( ATTR_FRIENDLY_NAME, ATTR_UNIT_OF_MEASUREMENT, CONF_VALUE_TEMPLATE, CONF_ICON_TEMPLATE, CONF_ENTITY_PICTURE_TEMPLATE, ATTR_ENTITY_ID, CONF_SENSORS, EVENT_HOMEASSISTANT_START, CONF_FRIENDLY_NAME_TEMPLATE, MATCH_ALL, CONF_DEVICE_CLASS) from homeassistant.exceptions import TemplateError import homeassistant.helpers.config_validation as cv from homeassistant.helpers.entity import Entity, async_generate_entity_id from homeassistant.helpers.event import async_track_state_change _LOGGER = logging.getLogger(__name__) SENSOR_SCHEMA = vol.Schema({ vol.Required(CONF_VALUE_TEMPLATE): cv.template, vol.Optional(CONF_ICON_TEMPLATE): cv.template, vol.Optional(CONF_ENTITY_PICTURE_TEMPLATE): cv.template, vol.Optional(CONF_FRIENDLY_NAME_TEMPLATE): cv.template, vol.Optional(ATTR_FRIENDLY_NAME): cv.string, vol.Optional(ATTR_UNIT_OF_MEASUREMENT): cv.string, vol.Optional(CONF_DEVICE_CLASS): DEVICE_CLASSES_SCHEMA, vol.Optional(ATTR_ENTITY_ID): cv.entity_ids }) PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend({ vol.Required(CONF_SENSORS): cv.schema_with_slug_keys(SENSOR_SCHEMA), }) async def async_setup_platform(hass, config, async_add_entities, discovery_info=None): """Set up the template sensors.""" sensors = [] for device, device_config in config[CONF_SENSORS].items(): state_template = device_config[CONF_VALUE_TEMPLATE] icon_template = device_config.get(CONF_ICON_TEMPLATE) entity_picture_template = device_config.get( CONF_ENTITY_PICTURE_TEMPLATE) friendly_name = device_config.get(ATTR_FRIENDLY_NAME, device) friendly_name_template = device_config.get(CONF_FRIENDLY_NAME_TEMPLATE) unit_of_measurement = device_config.get(ATTR_UNIT_OF_MEASUREMENT) device_class = device_config.get(CONF_DEVICE_CLASS) entity_ids = set() manual_entity_ids = device_config.get(ATTR_ENTITY_ID) invalid_templates = [] for tpl_name, template in ( (CONF_VALUE_TEMPLATE, state_template), (CONF_ICON_TEMPLATE, icon_template), (CONF_ENTITY_PICTURE_TEMPLATE, entity_picture_template), (CONF_FRIENDLY_NAME_TEMPLATE, friendly_name_template), ): if template is None: continue template.hass = hass if manual_entity_ids is not None: continue template_entity_ids = template.extract_entities() if template_entity_ids == MATCH_ALL: entity_ids = MATCH_ALL # Cut off _template from name invalid_templates.append(tpl_name[:-9]) elif entity_ids != MATCH_ALL: entity_ids |= set(template_entity_ids) if invalid_templates: _LOGGER.warning( 'Template sensor %s has no entity ids configured to track nor' ' were we able to extract the entities to track from the %s ' 'template(s). This entity will only be able to be updated ' 'manually.', device, ', '.join(invalid_templates)) if manual_entity_ids is not None: entity_ids = manual_entity_ids elif entity_ids != MATCH_ALL: entity_ids = list(entity_ids) sensors.append( SensorTemplate( hass, device, friendly_name, friendly_name_template, unit_of_measurement, state_template, icon_template, entity_picture_template, entity_ids, device_class) ) if not sensors: _LOGGER.error("No sensors added") return False async_add_entities(sensors) return True class SensorTemplate(Entity): """Representation of a Template Sensor.""" def __init__(self, hass, device_id, friendly_name, friendly_name_template, unit_of_measurement, state_template, icon_template, entity_picture_template, entity_ids, device_class): """Initialize the sensor.""" self.hass = hass self.entity_id = async_generate_entity_id(ENTITY_ID_FORMAT, device_id, hass=hass) self._name = friendly_name self._friendly_name_template = friendly_name_template self._unit_of_measurement = unit_of_measurement self._template = state_template self._state = None self._icon_template = icon_template self._entity_picture_template = entity_picture_template self._icon = None self._entity_picture = None self._entities = entity_ids self._device_class = device_class async def async_added_to_hass(self): """Register callbacks.""" @callback def template_sensor_state_listener(entity, old_state, new_state): """Handle device state changes.""" self.async_schedule_update_ha_state(True) @callback def template_sensor_startup(event): """Update template on startup.""" if self._entities != MATCH_ALL: # Track state change only for valid templates async_track_state_change( self.hass, self._entities, template_sensor_state_listener) self.async_schedule_update_ha_state(True) self.hass.bus.async_listen_once( EVENT_HOMEASSISTANT_START, template_sensor_startup) @property def name(self): """Return the name of the sensor.""" return self._name @property def state(self): """Return the state of the sensor.""" return self._state @property def icon(self): """Return the icon to use in the frontend, if any.""" return self._icon @property def device_class(self) -> Optional[str]: """Return the device class of the sensor.""" return self._device_class @property def entity_picture(self): """Return the entity_picture to use in the frontend, if any.""" return self._entity_picture @property def unit_of_measurement(self): """Return the unit_of_measurement of the device.""" return self._unit_of_measurement @property def should_poll(self): """No polling needed.""" return False async def async_update(self): """Update the state from the template.""" try: self._state = self._template.async_render() except TemplateError as ex: if ex.args and ex.args[0].startswith( "UndefinedError: 'None' has no attribute"): # Common during HA startup - so just a warning _LOGGER.warning('Could not render template %s,' ' the state is unknown.', self._name) else: self._state = None _LOGGER.error('Could not render template %s: %s', self._name, ex) for property_name, template in ( ('_icon', self._icon_template), ('_entity_picture', self._entity_picture_template), ('_name', self._friendly_name_template)): if template is None: continue try: setattr(self, property_name, template.async_render()) except TemplateError as ex: friendly_property_name = property_name[1:].replace('_', ' ') if ex.args and ex.args[0].startswith( "UndefinedError: 'None' has no attribute"): # Common during HA startup - so just a warning _LOGGER.warning('Could not render %s template %s,' ' the state is unknown.', friendly_property_name, self._name) continue try: setattr(self, property_name, getattr(super(), property_name)) except AttributeError: _LOGGER.error('Could not render %s template %s: %s', friendly_property_name, self._name, ex)
{ "repo_name": "molobrakos/home-assistant", "path": "homeassistant/components/template/sensor.py", "copies": "7", "size": "8662", "license": "apache-2.0", "hash": 4834357881655330000, "line_mean": 37.3274336283, "line_max": 79, "alpha_frac": 0.5864696375, "autogenerated": false, "ratio": 4.388044579533942, "config_test": true, "has_no_keywords": false, "few_assignments": false, "quality_score": 0.8474514217033942, "avg_score": null, "num_lines": null }