doc_id int32 18 2.25M | text stringlengths 245 2.96k | source stringlengths 38 44 | __index_level_0__ int64 18 2.25M |
|---|---|---|---|
572,385 | The result was released in 1969 by Data General as the Nova. The Nova, like the PDP-8, used a simple accumulator-based architecture. It lacked general registers and the stack-pointer functionality of the more advanced PDP-11, as did competing products, such as the HP 1000; compilers used hardware-based memory locations in lieu of a stack pointer. Designed to be rack-mounted similarly to the later PDP-8 machines, it was packaged on four PCB cards and was thus smaller in height, while also including a number of features that made it run considerably faster. Announced as "the best small computer in the world", the Nova quickly gained a following, especially in scientific and educational markets, and made the company flush with cash. DEC sued for misappropriation of its trade secrets, but this ultimately went nowhere. With the initial success of the Nova, Data General went public in the fall of 1969. | https://en.wikipedia.org/wiki?curid=157959 | 572,092 |
525,225 | The medial superior olive is thought to help locate the azimuth of a sound, that is, the angle to the left or right where the sound source is located. Sound elevation cues are not processed in the olivary complex. The fusiform cells of the dorsal cochlear nucleus (DCN), which are thought to contribute to localization in elevation, bypass the SOC and project directly to the inferior colliculus. Only horizontal data is present, but it does come from two different ear sources, which aids in the localizing of sound on the azimuth axis. The way in which the superior olive does this is by measuring the differences in time between two ear signals recording the same stimulus. Traveling around the head takes about 700 μs, and the medial superior olive is able to distinguish time differences much smaller than this. In fact, it is observed that people can detect interaural differences down to 10 μs. The nucleus is tonotopically organized, but the azimuthal receptive field projection is "most likely a complex, nonlinear map". | https://en.wikipedia.org/wiki?curid=4302005 | 524,953 |
1,938,296 | Artificial antigen presenting cells (aAPCs) are engineered platforms for T-cell activation. aAPCs are used as a new technology and approach to cancer immunotherapy. Immunotherapy aims to utilize the body's own defense mechanism—the immune system—to recognize mutated cancer cells and to kill them the way the immune system would recognize and kill a virus or other micro-organisms causing infectious diseases. Antigen presenting cells are the sentinels of the immune system and patrol the body for pathogens . When they encounter foreign pathogens, the antigen presenting cells activate the T cells—“the soldiers of the immune system”— by delivering stimulatory signals that alert there is foreign material in the body with specific cell surface molecules (epitopes). aAPCs are synthetic versions of these sentinel cells and are made by attaching the specific T-cell stimulating signals to various macro and micro biocompatible surfaces like micron-sized beads. This can potentially reduce the cost while allowing control over generating large numbers of functional pathogen-specific T cells for therapy. Activated and stimulated T cells can be studied in this biomimetic contex and used for adoptive transfer as an immunotherapy. | https://en.wikipedia.org/wiki?curid=44370271 | 1,937,186 |
897,985 | The responsibility for failing to discover Brookhaven's tritium leak has been acknowledged by laboratory managers, and DOE admits it failed to properly oversee the laboratory's operations. Brookhaven officials repeatedly treated the need for installing monitoring wells that would have detected the tritium leak as a low priority despite public concern and the laboratory's agreement to follow local environmental regulations. DOE's on-site oversight office, the Brookhaven Group, was directly responsible for Brookhaven's performance, but it failed to hold the laboratory accountable for meeting all of its regulatory commitments, especially its agreement to install monitoring wells. Senior DOE leadership also shared responsibility because they failed to put in place an effective system that encourages all parts of DOE to work together to ensure that contractors meet their responsibilities on environmental, safety and health issues. Unclear responsibilities for environment, safety and health matters has been a recurring problem for DOE management. | https://en.wikipedia.org/wiki?curid=53299 | 897,511 |
1,436,232 | In 1864, laws on national isolation were still in effect in Japan, and Japanese people were not permitted to travel overseas without government permission. However, Niijima had read extensively on various rangaku topics, and was determined to come to America. At the age of 21, he entreated Captain William T. Savory, of Salem, Massachusetts, commander of the brig "Berlin", for safe passage to the United States, in order to further study Western science and Christianity. Captain Savory agreed to help him, so long as Niijima came on board at night, without assistance from the ship's crew. Knowing Niijima could be executed if apprehended, Savory hid him from customs officials in his stateroom. He then secured Niijima's passage from China to the United States on the "Wild Rover", commanded by Captain Horace Taylor of Chatham, Massachusetts. The "Wild Rover" was owned by Alpheus Hardy. | https://en.wikipedia.org/wiki?curid=528473 | 1,435,424 |
1,304,834 | Further research into the isothermal transformation of steels was a result of Bain and Davenport's discovery of a new microstructure consisting of an "acicular, dark etching aggregate." This microstructure was found to be "tougher for the same hardness than tempered Martensite". Commercial exploitation of bainitic steel was not rapid. Common heat-treating practices at the time featured continuous cooling methods and were not capable, in practice, of producing fully bainitic microstructures. The range of alloys available produced either mixed microstructures or excessive amounts of Martensite. The advent of low-carbon steels containing boron and molybdenum in 1958 allowed fully bainitic steel to be produced by continuous cooling. Commercial use of bainitic steel thus came about as a result of the development of new heat-treating methods, with those that involve a step in which the workpiece is held at a fixed temperature for a period of time sufficient to allow transformation becoming collectively known as austempering. | https://en.wikipedia.org/wiki?curid=17173535 | 1,304,118 |
1,504,955 | Three skeletons of a theropod were discovered in 1993 by Christopher Whittle near Cisco in the basal Yellow Cat Member of the Cedar Mountain Formation of Utah, dating to the Valanginian. These were subsequently studied and reported in 1995 by Kirkland, Britt, Madsen and Burge. Though in 1996 it had been announced that the taxon would be named "Nedcolbertia whittlei", in 1998 it was actually described and named by Kirkland, Whittle, Britt, Madsen and Burge as the type species "Nedcolbertia justinhofmanni". The generic name honours the American palaeontologist Edwin Harris Colbert, known as "Ned" to his friends. The specific name honoured Justin Hofmann, a six-year-old school boy from Newton, New Jersey, a participant of a contest for children by Discover Card, the winner having a dinosaur named after him. | https://en.wikipedia.org/wiki?curid=5199492 | 1,504,109 |
1,504,547 | Point of interest in the Martha's Vineyard study, conducted by William Labov in 1961, were the linguistic variables (ay) and (aw) in the speech of the islanders. The findings showed that the highest rate of centralization could be seen in the group of middle-age islanders from 31 to 45. Next highest rates were to be seen within the group of 46 to 60 years old. The age-stratified variation of the analyzed variables can be seen as an indicator of language change in progress, showing that the centralization of diphthongs on the island is about to decline in younger age groups. On the other hand, Labov discovered that young inhabitants, who left the island for work or study, showed an increase of centralizing diphthongs after they returned, which was explained by social factors. In fact, the study can rather be seen as a further point of intersection, where the apparent-time hypothesis comes across with the controversy of the hypothesis of age-graded variation, in which "individuals change their linguistic behavior throughout their lifetimes, but the community as a whole does not change.". | https://en.wikipedia.org/wiki?curid=12759556 | 1,503,701 |
1,875,101 | Finally, a solution has been found in the early 1980s to annihilate completely the electrothermal instability within MHD converters, thanks to non-homogeneous magnetic fields. A strong magnetic field implies a high Hall parameter, therefore a low electrical conductivity in the medium. So the idea is to make some "paths" linking an electrode to the other, "where the magnetic field is locally attenuated". Then the electric current tends to flow in these low B-field paths as thin plasma cords or "streamers", where the electron density and temperature increase. The plasma becomes locally Coulombian, and the local Hall parameter value falls, while its critical threshold rises. Experiments where streamers do not present any inhomogeneity have been obtained with this method. This effect, strongly nonlinear, was unexpected but led to a very effective system for streamer guidance. | https://en.wikipedia.org/wiki?curid=18935256 | 1,874,024 |
349,297 | Polonium was also part of brushes or more complex tools that eliminate static charges in photographic plates, textile mills, paper rolls, sheet plastics, and on substrates (such as automotive) prior to the application of coatings. Alpha particles emitted by polonium ionize air molecules that neutralize charges on the nearby surfaces. Some anti-static brushes contain up to of Po as a source of charged particles for neutralizing static electricity. In the US, devices with no more than of (sealed) Po per unit can be bought in any amount under a "general license", which means that a buyer need not be registered by any authorities. Polonium needs to be replaced in these devices nearly every year because of its short half-life; it is also highly radioactive and therefore has been mostly replaced by less dangerous beta particle sources. | https://en.wikipedia.org/wiki?curid=23325 | 349,115 |
932,927 | Most ground SINCGARS radios have the ability to control output power; however, most airborne SINCGARS radio sets are fixed power. Those RTs with power settings can vary transmission range from approximately 200 meters (660 feet) to 10 kilometers (km) (6.2 miles). Adding a power amplifier increases the line of sight (LOS) range to approximately 40 km (25 miles). (These ranges are for planning purposes only; terrain, weather, and antennae height have an effect on transmission range.) The variable output power level allows users to operate on the minimum power necessary to maintain reliable communications, thus lessening the electromagnetic signature given off by their radio sets. This ability is of particular importance at major command posts, which operate in multiple networks. | https://en.wikipedia.org/wiki?curid=160524 | 932,435 |
1,967,883 | Bacterial leaf streak (BLS), also known as black chaff, is a common bacterial disease of wheat. The disease is caused by the bacterial species "Xanthomonas translucens" pv. "undulosa". The pathogen is found globally, but is a primary problem in the US in the lower mid-south and can reduce yields by up to 40 percent. BLS is primarily seed-borne (the disease is transmitted by seed) and survives in and on the seed, but may also survive in crop residue in the soil in the off-season. During the growing season, the bacteria may transfer from plant to plant by contact, but it is primarily spread by rain, wind and insect contact. The bacteria thrives in moist environments, and produces a cream to yellow bacterial ooze, which, when dry, appears light colored and scale-like, resulting in a streak on the leaves. The invasion of the head of wheat causes bands of necrotic tissue on the awns, which is called Black Chaff. | https://en.wikipedia.org/wiki?curid=44596645 | 1,966,753 |
632,026 | Almost all data visualizations are created for human consumption. Knowledge of human perception and cognition is necessary when designing intuitive visualizations. Cognition refers to processes in human beings like perception, attention, learning, memory, thought, concept formation, reading, and problem solving. Human visual processing is efficient in detecting changes and making comparisons between quantities, sizes, shapes and variations in lightness. When properties of symbolic data are mapped to visual properties, humans can browse through large amounts of data efficiently. It is estimated that 2/3 of the brain's neurons can be involved in visual processing. Proper visualization provides a different approach to show potential connections, relationships, etc. which are not as obvious in non-visualized quantitative data. Visualization can become a means of data exploration. | https://en.wikipedia.org/wiki?curid=3461736 | 631,688 |
95,253 | Near-field communication (NFC) is a set of communication protocols that enables communication between two electronic devices over a distance of 4 cm (1 in) or less. NFC offers a low-speed connection through a simple setup that can be used to bootstrap more-capable wireless connections. Like other "proximity card" technologies, NFC is based on inductive coupling between two so-called antennas present on NFC-enabled devices—for example a smartphone and a printer—communicating in one or both directions, using a frequency of 13.56 MHz in the globally available unlicensed radio frequency ISM band using the ISO/IEC 18000-3 air interface standard at data rates ranging from 106 to 424 kbit/s. | https://en.wikipedia.org/wiki?curid=397763 | 95,212 |
442,573 | When used as an astronomical telescope mount, the biggest advantage of an alt-azimuth mount is the simplicity of its mechanical design. The primary disadvantage is its inability to follow astronomical objects in the night sky as the Earth spins on its axis. On the other hand, an equatorial mount only needs to be rotated about a single axis, at a constant rate, to follow the rotation of the night sky (diurnal motion). Altazimuth mounts need to be rotated about both axes at variable rates, achieved via microprocessor based two-axis drive systems, to track equatorial motion. This imparts an uneven rotation to the field of view that also has to be corrected via a microprocessor based counter rotation system. On smaller telescopes an equatorial platform is sometimes used to add a third "polar axis" to overcome these problems, providing an hour or more of motion in the direction of right ascension to allow for astronomical tracking. The design also does not allow for the use of mechanical setting circles to locate astronomical objects although modern digital setting circles have removed this shortcoming. | https://en.wikipedia.org/wiki?curid=1055255 | 442,358 |
1,560,964 | Bader was hired as an assistant professor and Regents' Lecturer in the electrical and computer engineering department at The University of New Mexico (UNM) in 1998. In 2003, he was elected chair of the IEEE Computer Society's technical committee on parallel processing. Bader remained at UNM until 2005, when he accepted a position with the College of Computing at Georgia Tech. Shortly after arriving at Georgia Tech, Bader began working, along with several other faculty members, to establish a School of Computational Science and Engineering at Georgia Tech. Two years later, in 2007, these efforts resulted in the school's establishment as an official academic unit, and Bader became a full professor in 2008 as one of the school's founding faculty. Richard M. Fujimoto was named the school's first chair, and Bader was later named the second chair of the school of CSE in July 2014. He served in that role until his term expired in June 2019. | https://en.wikipedia.org/wiki?curid=1759647 | 1,560,078 |
619,805 | In chemolithotrophs, the compounds - the electron donors - are oxidized in the cell, and the electrons are channeled into respiratory chains, ultimately producing ATP. The electron acceptor can be oxygen (in aerobic bacteria), but a variety of other electron acceptors, organic and inorganic, are also used by various species. Aerobic bacteria such as the nitrifying bacteria, "Nitrobacter", use oxygen to oxidize nitrite to nitrate. Some lithotrophs produce organic compounds from carbon dioxide in a process called chemosynthesis, much as plants do in photosynthesis. Plants use energy from sunlight to drive carbon dioxide fixation, but chemosynthesis can take place in the absence of sunlight (e.g., around a hydrothermal vent). Ecosystems establish in and around hydrothermal vents as the abundance of inorganic substances, namely hydrogen, are constantly being supplied via magma in pockets below the sea floor. Other lithotrophs are able to directly use inorganic substances, e.g., ferrous iron, hydrogen sulfide, elemental sulfur, thiosulfate, or ammonia, for some or all of their energy needs. | https://en.wikipedia.org/wiki?curid=3525665 | 619,490 |
178,311 | The Akademisches Kunstmuseum (English: 'Academic Museum of Antiquities') was founded in 1818 and has one of the largest collections of plaster casts of ancient Greek and Roman sculptures in the world. At this time collections of plaster casts were mainly used in the instruction of students at art academies. They were first used in the instruction of university students in 1763 by Christian Gottlob Heyne at University of Göttingen. The Akademisches Kunstmuseum in Bonn was the first of its kind, as at this time collections at other universities were scattered around universities libraries. The first director was Friedrich Gottlieb Welcker, who also held a professorship of archaeology. His tenure was from 1819 until his retirement in 1854. He was succeeded by Otto Jahn and Friedrich Wilhelm Ritschl, who shared the directorship. From 1870 to 1889 Reinhard Kekulé von Stradonitz, nephew of the famous organic chemist Friedrich August Kekulé von Stradonitz, was the director. In 1872 the museum moved to a new building that was formerly used by the department of anatomy. The building was constructed from 1823 to 1830 and designed by Karl Friedrich Schinkel and Hermann Friedrich Waesemann. Other directors of the museum were Georg Loeschcke (from 1889 to 1912), Franz Winter (from 1912 to 1929), Richard Delbrück (from 1929 to 1940), Ernst Langlotz (from 1944 to 1966), Nikolaus Himmelmann (from 1969 to 1994) and Harald Mielsch (since 1994). All directors, with the exception of Friedrich Wilhelm Ritschl held a professorship of archaeology at the university. | https://en.wikipedia.org/wiki?curid=89061 | 178,218 |
253,058 | Carbon-rich exhausts from kerosene-based fuels such as RP-1 are often orange in colour due to the black-body radiation of the unburnt particles, in addition to the blue Swan bands. Peroxide oxidiser-based rockets and hydrogen rocket jets contain largely steam and are nearly invisible to the naked eye but shine brightly in the ultraviolet and infrared ranges. Jets from solid-propellant rockets can be highly visible, as the propellant frequently contains metals such as elemental aluminium which burns with an orange-white flame and adds energy to the combustion process. Rocket engines which burn liquid hydrogen and oxygen will exhibit a nearly transparent exhaust, due to it being mostly superheated steam (water vapour), plus some unburned hydrogen. | https://en.wikipedia.org/wiki?curid=262135 | 252,925 |
1,173,100 | In air-gap MD, the evaporator channel resembles that in DCMD, whereas the permeate gap lies between the membrane and a cooled walling and is filled with air. The vapour passing through the membrane must additionally overcome this air gap before condensing on the cooler surface. The advantage of this method is the high thermal insulation towards the condenser channel, thus minimizing heat conduction losses. However, the disadvantage is that the air gap represents an additional barrier for mass transport, reducing the surface- related permeate output compared to DCMD. A further advantage over DCMD is that volatile substances with a low surface tension such as alcohol or other solvents can be separated from diluted solutions, due to the fact that there is no contact between the liquid permeate and the membrane with AGMD. AGMD is especially advantageous compared to alternatives at higher salinity. Variations on AGMD can include hydrophobic condensing surfaces for improved flux and energy efficiency. In AGMD, uniquely important design features include gap thickness, condensing surface hydrophobicity, gap spacer design, and tilt angle. | https://en.wikipedia.org/wiki?curid=34431098 | 1,172,481 |
1,225,721 | In some cases, the results of vestibular tests are normal, yet the patient experiences vestibular symptoms, especially balance issues and dangerous falls. Some diagnoses that result in non-vestibular dizziness are concussions, Parkinson's disease, cerebellar ataxia, normal-pressure hydrocephalus, leukoaraiosis, progressive supranuclear palsy, and large-fiber peripheral neuropathy. There are also several disorders known as chronic situation-related dizziness disorders. For example, phobic postural vertigo (PPV) occurs when an individual with obsessive-compulsive characteristics experiences a sense of imbalance, despite the absence of balance issues. Chronic subjective dizziness (CSD) is a similar condition characterized by persistent vertigo, hypersensitivity to motion stimuli, and difficulty with precise visual tasks. Both phobic postural vertigo and chronic subjective dizziness may be treated with vestibular rehabilitation therapy or other therapeutic methods such as cognitive behavioral therapy and conditioning. | https://en.wikipedia.org/wiki?curid=58426250 | 1,225,061 |
440,171 | Squeezed states of light can be fully characterized by a photo-electric detector that is able to (subsequently) measure the electric field strengths at any phase formula_1. (The restriction to a certain band of modulation frequencies happens after the detection by electronic filtering.) The required detector is a balanced homodyne detector (BHD). It has two input ports for two light beams. One for the (squeezed) signal field, and another for the BHDs local oscillator (LO) having the same wavelength as the signal field. The LO is part of the BHD. Its purpose is to beat with the signal field and to optically amplify it. Further components of the BHD are a balanced beam splitter and two photo diodes (of high quantum efficiency). Signal beam and LO need to be overlapped at the beam splitter. The two interference results in the beam splitter output ports are detected and the difference signal recorded (Fig. 7). The LO needs to be much more intense than the signal field. In this case the differential signal from the photo diodes in the interval formula_72 is proportional to the quadrature amplitude formula_40. Changing the differential propagation length before the beam splitter sets the quadrature angle to an arbitrary value. (A change by a quarter of the optical wavelength changes the phase by formula_74.) | https://en.wikipedia.org/wiki?curid=56495427 | 439,957 |
258,005 | On the continents, the melting of glaciers would release massive amounts of glacial deposit, which would erode and weather. The resulting sediments supplied to the ocean would be high in nutrients such as phosphorus, which combined with the abundance of would trigger a cyanobacteria population explosion, which would cause a relatively rapid reoxygenation of the atmosphere, which may have contributed to the rise of the Ediacaran biota and the subsequent Cambrian explosion—a higher oxygen concentration allowing large multicellular lifeforms to develop. Although the positive feedback loop would melt the ice in geological short order, perhaps less than 1,000 years, replenishment of atmospheric oxygen and depletion of the levels would take further millennia. | https://en.wikipedia.org/wiki?curid=28982 | 257,871 |
1,212,544 | Nearly all of the seafloor is covered by marine sediments. They can vary in thickness from centimeters near ocean ridges to over 10 kilometers in deep trenches. In the mid-ocean, coccoliths and shells settling down from the surface form oozes, while near shore sediment is carried from the continents by rivers. Minerals from hydrothermal vents and wind-blown particles also contribute. As organic matter is deposited and buried, the more easily utilized compounds are depleted by microbial oxidation, leaving the more recalcitrant compounds. Thus, the energy available for life declines. In the top few meters, metabolic rates decline by 2 to 3 orders of magnitude, and throughout the sediment column cell numbers decline with depth. | https://en.wikipedia.org/wiki?curid=61218171 | 1,211,892 |
1,281,292 | Although the strike did not kill Saddam Hussein, what it did accomplish was to allow the coalition to seize the initiative. Also the EGBU-27 immediately became the F-117's premier weapon. According to Air Force data, 98 of them were delivered during the conflict, compared to only 11 of the traditional, predominantly laser versions. During Operation Iraqi Freedom, F-117 pilots flew more than 80 missions and dropped nearly 100 enhanced guided bomb units against key targets. Approximately 300 people deployed with the air package and provided direct support to the F-117 mission. | https://en.wikipedia.org/wiki?curid=16592751 | 1,280,596 |
1,573,105 | Butler earned his master's degree at Brigham Young University in 2003. His master's thesis was titled "Bounding the Number of Graphs Containing Very Long Induced Paths". He completed a doctorate at the University of California, San Diego in 2008, authoring the dissertation "Eigenvalues and Structures of Graphs", advised by Fan Chung. Upon completing his postdoctoral studies at the University of California, Los Angeles, Butler joined the Iowa State University faculty in 2011, and was named the Barbara J. Janson Professor in Mathematics in 2017. In 2015, Butler became the 512th (and so far final) person to have an Erdős number of 1, when he published a paper with Paul Erdős and Ronald Graham on Egyptian fractions. | https://en.wikipedia.org/wiki?curid=58673886 | 1,572,216 |
562,461 | Establishing the viral etiology took many decades due to the difficulty of growing the virus in cell culture. In the 1940s and 1950s in the United States and Japan, caliciviridae could not be grown in culture, but as an experiment bacterial free filtrate of diarrhea was given to volunteers to check if viruses were present in volunteers' stool. These experiments demonstrated that nonbacterial, filterable agents had the capability of causing enteric disease in humans. In 1968, an outbreak at a Norwalk elementary school (e.g. Norwalk virus) in Ohio led to stool samples again being given to volunteers and serially passaged to other people. Finally, in 1972, Kapikian and his colleagues isolated the Norwalk virus from volunteers using immune electron microscopy, a process that involves looking directly at antibody-antigen complexes. The classification of this one Norwalk virus strain served as the prototype for other species and small round structured viruses later known as Norovirus. | https://en.wikipedia.org/wiki?curid=1582736 | 562,172 |
676,253 | The campus has trained manpower, sophisticated facilities, structured systems and testing protocols for the development and testing of medical devices and biomaterials. The multi-disciplinary expertise available at the Institute in clinical, engineering, biomaterial, biological, veterinary, and Public Health sciences constitutes the bedrock for biomedical product development. The BMT Wing receives inputs relating to unmet clinical needs from the clinicians, develops technology that is functionally on par with the imported ones but cost-effective, evaluates these technologies based on international standards and regulatory guidelines, and eventually associates with industry for scale up and commercialisation. | https://en.wikipedia.org/wiki?curid=5614178 | 675,900 |
1,362,770 | In 2016, a group around John-Dylan Haynes in Berlin (Germany) determined the time window after the BP in which an intended motion could possibly be cancelled upon command. The authors tested whether human volunteers could win a "duel" against a BCI (brain–computer interface) designed to predict their movements in real-time from observations of their EEG activity (the BP). They aimed to determine the exact time at which cancellation (veto) of movements was not possible anymore (the point of no return). The computer was trained to predict by means of the BP when a proband would move. The point of no return was at 200 ms before the movement. However, even after that, when a pedal was already set in motion, the subjects were able to reschedule their action by not completing the already started behavior. The authors pointed out in their report that cancellation of self-initiated movements had already been reported by Libet in 1985. Thus, the new achievement was a more precise determination of the point of no return. | https://en.wikipedia.org/wiki?curid=1581427 | 1,362,017 |
1,307,856 | Emily Howard Jennings was born in Norwich Township, Oxford County, Ontario, as one of six daughters of farmers Hannah Howard and Solomon Jennings. While Solomon converted to Methodism, Hannah (who had been educated at a Quaker seminary in the United States) raised her daughters as Quakers in a community that encouraged women to participate and receive an education. She home-schooled Stowe and her five sisters and taught them skills in herbal healing. After teaching at local schools for seven years, her public struggle to achieve equality for women began in 1852, when she applied for admission to Victoria College, Cobourg, Ontario. Refused on the grounds that she was female, she applied to the Normal School for Upper Canada, which Egerton Ryerson had recently founded in Toronto. She entered in November 1853 and was graduated with first-class honours in 1854. Hired as principal of a Brantford, Ontario public school, she was the first woman to be a principal of a public school in Upper Canada. She taught there until her marriage in 1856 (see Marriage bar). | https://en.wikipedia.org/wiki?curid=567470 | 1,307,140 |
596,409 | Silver nanoparticles can prevent bacteria from growing on or adhering to the surface. This can be especially useful in surgical settings where all surfaces in contact with the patient must be sterile. Silver nanoparticles can be incorporated on many types of surfaces including metals, plastic, and glass. In medical equipment, it has been shown that silver nano particles lower the bacterial count on devices used compared to old techniques. However, the problem arises when the procedure is over and a new one must be done. In the process of washing the instruments a large portion of the silver nano particles become less effective due to the loss of silver ions. They are more commonly used in skin grafts for burn victims as the silver nano particles embedded with the graft provide better antimicrobial activity and result in significantly less scarring of the victim.These new applications are direct decedents of older practices that used silver nitrate to treat conditions such as skin ulcers. Now, silver nanoparticles are used in bandages and patches to help heal certain burns and wounds. An alternative approach is to use AgNP to sterilise biological dressings (for example, tilapia fish skin) for burn and wound management. | https://en.wikipedia.org/wiki?curid=23891367 | 596,104 |
14,425 | Recent studies have begun to explore the developmental origins and trajectories of the Big Five among children and adolescents, especially those that relate to temperament. Many researchers have sought to distinguish between personality and temperament. Temperament often refers to early behavioral and affective characteristics that are thought to be driven primarily by genes. Models of temperament often include four trait dimensions: surgency/sociability, negative emotionality, persistence/effortful control, and activity level. Some of these differences in temperament are evident at, if not before, birth. For example, both parents and researchers recognize that some newborn infants are peaceful and easily soothed while others are comparatively fussy and hard to calm. Unlike temperament, however, many researchers view the development of personality as gradually occurring throughout childhood. Contrary to some researchers who question whether children have stable personality traits, Big Five or otherwise, most researchers contend that there are significant psychological differences between children that are associated with relatively stable, distinct, and salient behavior patterns. | https://en.wikipedia.org/wiki?curid=1284664 | 14,420 |
6,792 | As part of the festival, a projection of the tall Saturn V rocket was displayed on the east face of the tall Washington Monument from July 16 through the 20th from 9:30pm until 11:30pm (EDT). The program also included a 17-minute show that combined full-motion video projected on the Washington Monument to recreate the assembly and launch of the Saturn V rocket. The projection was joined by a wide recreation of the Kennedy Space Center countdown clock and two large video screens showing archival footage to recreate the time leading up to the moon landing. There were three shows per night on July 19–20, with the last show on Saturday, delayed slightly so the portion where Armstrong first set foot on the Moon would happen exactly 50 years to the second after the actual event. | https://en.wikipedia.org/wiki?curid=662 | 6,789 |
43,393 | On 13 July 2008, in a press conference on the eve of the opening of the Farnborough Airshow, Bombardier Aerospace formally launched the CSeries, with a letter of interest from Lufthansa for 60 aircraft, including 30 options, at a US$46.7 million list price. The aircraft fuel efficiency would be per passenger in a dense seating. The final assembly of the aircraft would be done in Mirabel, wings would be developed and manufactured in Belfast and the aft fuselage and cockpit would be manufactured in Saint-Laurent, Quebec. The center fuselage was to be built by China Aviation Industry Corporation (AVIC)'s affiliate Shenyang Aircraft Corporation. Bombardier estimated the market for the 100- to 149-seat market segment of the CSeries to be 6,300 units over 20 years, representing more than $250 billion revenue over the next 20 years; the company expects to capture up to half of this market. | https://en.wikipedia.org/wiki?curid=1567474 | 43,377 |
366,391 | The W.2B/23C engines upon which the Welland was based produced of thrust each, giving the aircraft a maximum speed of at and a range of . It incorporated a hydraulically driven engine starter developed by Rolls-Royce, which was automated following the press of a starter button in the cockpit. The engines also drove hydraulic and vacuum pumps as well as a generator via a Rotol gearbox fixed on the forward wing spar; the cockpit was also heated by bleed air from one of the engines. The acceleration rate of the engines was manually controlled by the pilot; rapid engine acceleration would frequently induce compressor stalls early on; the likelihood of compressor stalls was effectively eliminated upon further design refinements of both the Welland engine and the Meteor itself. At high speeds the Meteor had a tendency to lose directional stability, often during unfavourable weather conditions, leading to a 'snaking' motion; this could be easily resolved by throttling back to reduce speed. | https://en.wikipedia.org/wiki?curid=42702 | 366,199 |
1,572,708 | In 2004, some professional robotic telescopes were characterized by a lack of design creativity and a reliance on closed source and proprietary software. The software is usually unique to the telescope it was designed for and cannot be used on any other system. Often, robotic telescope software developed at universities becomes impossible to maintain and ultimately obsolete because the graduate students who wrote it move on to new positions, and their institutions lose their knowledge. Large telescope consortia or government funded laboratories don't tend to have this same loss of developers as experienced by universities. Professional systems generally feature very high observing efficiency and reliability. There is also an increasing tendency to adopt ASCOM technology at a few professional facilities (see following section). The need for proprietary software is usually driven by the competition for research dollars between institutions. | https://en.wikipedia.org/wiki?curid=970131 | 1,571,820 |
661,387 | Soranus was a Greek physician born in Ephesus, who lived during the reigns of Trajan and Hadrian (98–138 AD). According to the Suda, he trained at the Alexandria School of Medicine and practiced in Rome. Soranus was a part of the Methodic school of Asclepiades, which fostered the ideals of the Hippocratic doctrine. He was the chief representative of the Methodic school of physicians. Soranus's most notable work was his book gynaecology, in which he discussed many topics that are considered modern ideas such as birth control, pregnancy, midwife's duties, and post-childbirth care. His treatise "Gynaecology" is extant (first published in 1838, later by V. Rose, in 1882, with a 6th-century Latin translation by Muscio, a physician of the same school). He accounts for the internal difficulties that could arise during labor from both the mother and the fetus. He also did work with fractures, surgery, and embryology. | https://en.wikipedia.org/wiki?curid=9543979 | 661,042 |
443,773 | The Advanced Virgo is 10 times more sensitive than the initial Virgo. According to the Advanced Virgo Technical Design Report VIR–0128A–12 of 2012, advanced Virgo keeps the same vacuum infrastructure as Virgo, with four additional cryotraps located at both ends of both three-kilometre-long arms to trap residual particles coming from the mirror towers, but the remainder of the interferometer has been significantly upgraded. The new mirrors are larger (350 mm in diameter, with a weight of 40 kg), and their optical performances have been improved. The critical optical elements used to control the interferometer are under vacuum on suspended benches. A system of adaptive optics was to be installed to correct the mirror aberrations "in-situ". In the final Advanced Virgo configuration, the laser power will be 200 W. | https://en.wikipedia.org/wiki?curid=6762618 | 443,558 |
171,704 | Though in 1914 French naval doctrine was dominated by Mahan's theory of sea power, the course of World War I changed ideas about the place of the navy. The refusal of the German fleet to engage in a decisive battle, the Dardanelles expedition of 1915, the development of submarine warfare, and the organization of convoys all showed the French Navy's new role in combined operations with the French Army. The Navy's part in securing victory was not fully understood by French public opinion in 1918, but a synthesis of old and new ideas arose from the lessons of the war, especially by Admiral Raoul Castex (1878–1968), who synthesized in his five-volume "Théories Stratégiques" the classical and materialist schools of naval theory. He reversed Mahan's theory that command of the sea precedes maritime communications and foresaw the enlarged roles of aircraft and submarines in naval warfare. | https://en.wikipedia.org/wiki?curid=210133 | 171,613 |
15,667 | From 1986, the CIA began supplying the Afghan rebels with newer Stinger shoulder-launched, heat-seeking SAMs. These were a marked improvement over earlier weapons. Unlike the Redeye and SA-7, which only locked on onto infrared emissions, the Stinger could lock onto both infrared and ultraviolet emissions. This enabled the operator to engage an aircraft from all angles rather than just the tail and made it significantly more resistant to countermeasures like flares. In addition the Mil helicopters, particularly the Mi-24, suffered from a design flaw in the configuration of their engines that made them highly vulnerable to the Stinger. The Mi-24, along with the related Mi-8 and Mi-17 helicopters, had its engines placed in an inline configuration in an attempt to streamline the helicopter to increase speed and minimize the aircraft's overall frontal profile to incoming fire in a head on attack. However this had the opposite effect of leaking all the exhaust gasses from the Mi-24's engines directly out the side of the aircraft and away from the helicopter's rotor wash, creating two massive sources of heat and ultraviolet radiation for the Stinger to lock onto. The inline placement of the engines was seen as so problematic in this regard that Mil designers abandoned the configuration on the planned successor to the Mi-24, the Mil Mi-28, in favour of an engine placement more akin to Western attack helicopters which vents the exhaust gasses into the helicopter's main rotor wash to dissipate heat. | https://en.wikipedia.org/wiki?curid=384591 | 15,662 |
1,771,691 | "R. capsulatus" is a phototrophic bacterium with some distinctive characteristics. They can grow either as rods or as motile coccobacilli, which is dependent on their environment. At pH levels below 7, the bacterium is spherical and forms chains. When the pH rises above 7, they switch to rod morphology. The length of the rod shaped bacteria is dependent on the pH as well; the cells elongate as the pH rises. In their rod shape, they also often form chains that are bent in nature. The original paper describes them as "zigzaggy" in shape. In response to the stress put on the cell at a pH of 8 or above, the cells display pleiomorphism, or abnormal, filamentous growth, and they produce a slimy substance for protection. Anaerobic culturing of the organism produces a brown color, on the spectrum of yellow-brown to burgundy. In media containing malonate, the reddish-brown, or burgundy, color is observed. When the organism is grown aerobically, a red color is produced. This species will not grow above 30 °C, and it will grow within 6 and 8.5 pH, although specific temperature and pH optima are not explicitly stated in the characterization paper. Although most "Rhodobacter" species are freshwater and have little salt tolerance, some strains of "R. capsulatus" appear to tolerate up to 0.3 M NaCl depending on their source of nitrogen. | https://en.wikipedia.org/wiki?curid=48759785 | 1,770,694 |
782,553 | The early feminist movement began to argue for the improvement of women's education in the 1860s: Emily Davies and Barbara Bodichon met through their activism at the Society for the Employment of Women and the "Englishwoman's Review". They shared the aim of securing women's admission to university. In particular, they wanted to determine whether girls could be admitted at Oxford or Cambridge to sit the Senior and Junior Local Examinations. Davies and Bodichon set up a committee to that effect in 1862. In 1865, with the help of Henry Tomkinson, Trinity College alumnus and owner of an insurance company with good contacts within the University, 91 female students entered the Cambridge Local Examination. This first concession to women's educational rights met relatively little resistance, as admission to the examination did not imply residence of women at the university site. | https://en.wikipedia.org/wiki?curid=457564 | 782,134 |
1,485,761 | An expedition in Turkey resulted in the discovery of a late Bronze Age shipwreck at Gelidonya, for which Frost is credited as having realised its significance. The wreck had been previously discovered by Turkish diver Mustafa Kapkin and U.S. photo-journalist Peter Throckmorton in 1959. However, it was Frost who recognised that the wreck was not Mycenean, but Phoenician, thus providing the first evidence that Phoenicians had been trading on the seas before the Iron Age. She convinced Joan du Plat Taylor, whom she had met at the Institute of Archaeology in London, to become co-director of the excavation at Gelidonya. It was later the site of George Bass's and Peter Throckmorton's first work in underwater archaeology at Cape Gelidonya in the Antalya region of southern Turkey. The Bronze Age shipwreck, which dated to the 12th century BC, was the oldest known shipwreck in the world at that time. The excavation of this wreck is of special significance, as it was the first to be conducted following a rigorous scientific approach. | https://en.wikipedia.org/wiki?curid=29245764 | 1,484,923 |
215,313 | Notable fighters developed during the late 1930s and early 1940s were the Bell P-39 Airacobra (first flown April 1938), Curtiss P-40 Warhawk (October 1938), Lockheed P-38 Lightning (January 1939), North American P-51 Mustang (October 1940), and Republic P-47 Thunderbolt (May 1941). Technological development of fighters occurred so rapidly that by December 1941 both the P-39 and P-40 were approaching obsolescence, even though both had been in production less than 18 months. Bombers developed during this period were the Douglas A-20 Havoc (first flown October 1938), North American B-25 Mitchell (January 1939), Consolidated B-24 Liberator (December 1939), and Martin B-26 Marauder (November 1940). Except for the B-24, P-47, and P-51, all of these had production deliveries that began before the AAF came into being in June 1941. Three other long-range bombers began development during this period, though only mock-ups were produced before World War II: the B-29 (study begun in 1938), the Consolidated B-32 Dominator (June 1940), and the Convair B-36 Peacemaker (April 1941). | https://en.wikipedia.org/wiki?curid=23869026 | 215,205 |
1,224,974 | From June 2010 to November 2011, a unique ground-based space analog study took place that was called the Mars 500 Program. Mars 500 was designed to simulate a 520-day round-trip expedition to Mars, including periods of time where the crew functioned under high autonomy conditions and experienced communication delays with outside monitoring personnel in mission control. Six men were confined in a simulator that was located at the Institute for Biomedical Problems in Moscow. The lower floor consisted of living and laboratory modules for the international crew, and the upper floor contained a mock-up of the Mars surface on which the crew conducted simulated geological and other planetary activities. | https://en.wikipedia.org/wiki?curid=40399131 | 1,224,314 |
112,293 | Satyendra Nath Bose, along with Saha, presented several papers in theoretical physics and pure mathematics from 1918 onwards. In 1924, while working as a Reader (Professor without a chair) at the Physics Department of the University of Dhaka, Bose wrote a paper deriving Planck's quantum radiation law without any reference to classical physics by using a novel way of counting states with identical particles. This paper was seminal in creating the important field of quantum statistics. Though not accepted at once for publication, he sent the article directly to Albert Einstein in Germany. Einstein, recognising the importance of the paper, translated it into German himself and submitted it on Bose's behalf to the prestigious "Zeitschrift für Physik". As a result of this recognition, Bose was able to work for two years in European X-ray and crystallography laboratories, during which he worked with Louis de Broglie, Marie Curie, and Einstein. | https://en.wikipedia.org/wiki?curid=71777 | 112,248 |
329,619 | Achondroplasia can be detected before birth by prenatal ultrasound, although signs are often subtle and not apparent before the 24th week of pregnancy. A DNA test can be performed before birth to detect homozygosity, wherein two copies of the mutant gene are inherited, a lethal condition leading to stillbirths. Postnatal diagnosis of achondroplasia is typically uncomplicated, involving an assessment of physical and radiographic features. Clinical features include megalocephaly, short limbs, prominent forehead, thoracolumbar kyphosis and mid-face hypoplasia. Complications like dental malocclusion, hydrocephalus and repeated otitis media can be observed. The risk of death in infancy is increased due to the likelihood of compression of the spinal cord with or without upper airway obstruction. | https://en.wikipedia.org/wiki?curid=56579 | 329,444 |
1,310,536 | IL-21 was approved for Phase 1 clinical trials in metastatic melanoma (MM) and renal cell carcinoma (RCC) patients. It was shown to be safe for administration with flu-like symptoms as side effects. Dose-limiting toxicities included low lymphocyte, neutrophil, and thrombocyte count as well as hepatotoxicity. According to the Response Evaluation Criteria in Solid Tumors (RECIST) response scale, 2 out of 47 MM patients and 4 out of 19 RCC patients showed complete and partial responses, respectively. In addition, there was an increase of perforin, granzyme B, IFN-γ, and CXCR3 mRNA in peripheral NK cells and CD8 T cells. This suggested that IL-21 enhances the CD8 effector functions thus leading to anti-tumor response. IL-21 proceeded to Phase 2 clinical trials where it was administered alone or coupled with drugs as sorafinib and rituximab. | https://en.wikipedia.org/wiki?curid=7807280 | 1,309,818 |
1,744,682 | In July 2009, the battalion deployed task-organized elements to conduct construction missions in Bulgaria and Israel. Recent construction missions include a platoon-sized deployment to Romania and the 500th EN CO improving roads on multiple training areas in USAREUR. In late October 2010, the 15th EN BN (292nd EN DET/ OHARNG) conducted a first in decades. It deployed forward to a combat zone. The battalion executed extensive theater construction support missions in the Kuwait AOR and recon assets to the Kingdom of Jordan. As the Theater Reserve Engineer Force, the 15th was charged with providing engineering support across the entire CENTCOM AOR. This placed pressure on the battalion. As the "Drive On" spirit was displayed, Commanders and soldiers alike excelled at forward deploying elements into Afghanistan to provide combat commander construction support. The 15th redeployed to USAREUR in late October 2011 to resume its duties supporting USAREUR and NATO in the training of international forces. | https://en.wikipedia.org/wiki?curid=17862539 | 1,743,698 |
1,345,680 | The process was described in a treatise published in Prague in 1574. It was again invented by Johann Nussbaum of Magdeburg, who began operations at Nuremberg (with partners) in 1601. The process was patented in England by William Ellyot and Mathias Meysey in 1614. At that date, the "invention" could consist merely of the introduction of a new industry or product, or even a mere monopoly. They evidently soon transferred the patent to Sir Basil Brooke, but he was forced to surrender it in 1619. A clause in the patent prohibiting the import of steel was found to be undesirable because he could not supply as much good steel as was needed. Brooke's furnaces were probably in his manor of Madeley at Coalbrookdale (which certainly existed before the English Civil War) where two cementation furnaces have been excavated. He probably used bar iron from the Forest of Dean, where he was a partner in farming the King's ironworks in two periods. | https://en.wikipedia.org/wiki?curid=975309 | 1,344,939 |
941,091 | The USMLE parent organizations, including the AAFP, AMSA, and AAMC wrote letters to the USMLE recommended broad, systemic changes to the medical program including changing Step 1 to Pass/Fail. "The current overemphasis on USMLE Step 1 is having an overwhelmingly negative impact on students. This should be addressed immediately. A Pass/Fail score will help provide a more meaningful learning environment, improved emotional climate, and better student-student interactions, which can lead to better academic performance that includes USMLE tests (see Cause or effect?). Additionally, it will decrease racial bias for programs that use USMLE Step 1 scores to grant interviews." Further, they supported the move to Step 1 Pass/Fail citing unintentional negative impact of a single standardized exam on career exploration and selection. | https://en.wikipedia.org/wiki?curid=2555114 | 940,589 |
611,798 | The second EVA of STS-134 was conducted on flight day 7 by Drew Feustel and Mike Fincke. The spacewalk, the sixth-longest in the history of spaceflight at the time, lasted 8 hours and 7 minutes, significantly longer than the planned 6 hours and 30 minutes. The excursion also marked the second-longest spacewalk conducted from the ISS. During the spacewalk, Fincke and Feustel hooked up a jumper to transfer of ammonia to the Port 6 Photovoltaic Thermal Control System (PVTCS), lubricated the Solar Alpha Rotary Joint (SARJ) and one of the "hands" on Dextre, and installed a stowage beam on the Starboard 1 (S1) truss. During the lubrication task on the Port SARJ, some of the bolts on one of the thermal blankets came free, and one was lost. Commander Mark Kelly documented the spacewalk with still and video cameras, while mission specialist Greg Chamitoff assisted Feustel and Fincke. The spacewalk was the seventh for Fincke and the fifth for Feustel. Fincke had conducted his previous six spacewalks in Russian Orlan suits. | https://en.wikipedia.org/wiki?curid=18089765 | 611,487 |
1,825,997 | Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3. | https://en.wikipedia.org/wiki?curid=13544333 | 1,824,959 |
2,031,644 | Established in 1922, research at the lab has historically been focused on marine invertebrates. A small island, Hatakejima, belongs to the laboratory and serves as an experimental field site in southeastern Tanabe Bay. The Shirahama Aquarium, open to the public, is located next to the research laboratories and operated by SMBL. In 2003, Kyoto University combined SMBL with the Maizuru Fisheries Research Station, University Forests, and the Subtropical Plant Institute into an administrative unit named the Field Science Education and Research Center (FSERC). The scientific journal "Publications of the Seto Marine Biological Laboratory" has been published by SMBL since 1949. The building reopened in July 2014 after renovation work including earthquake resistance. | https://en.wikipedia.org/wiki?curid=31633276 | 2,030,475 |
896,862 | By 1893, the reference standards for customary units had become unreliable. Moreover, the United States, being a signatory of the Metre Convention was in possession of national prototype metres and kilograms that were calibrated against those in use elsewhere in the world. This led to the Mendenhall Order which redefined the customary units by referring to the national metric prototypes, but used the conversion factors of the 1866 act. In 1896 a bill that would make the metric system mandatory in the United States was presented to Congress. Twenty-three of the 29 people who gave evidence before the congressional committee who were considering the bill were in favor of it, but six were against. Four of these six dissenters represented manufacturing interests and the other two were from the United States Revenue service. The grounds cited were the cost and inconvenience of the change-over. The bill was not enacted. Subsequent bills suffered a similar fate. | https://en.wikipedia.org/wiki?curid=20353 | 896,390 |
611,356 | PLATO (Programmed Logic for Automatic Teaching Operations) was the first generalized computer-assisted instruction system. Starting in 1960, it ran on the University of Illinois' ILLIAC I computer. By the late 1970s, it supported several thousand graphics terminals distributed worldwide, running on nearly a dozen different networked mainframe computers. Many modern concepts in multi-user computing were originally developed on PLATO, including forums, message boards, online testing, e-mail, chat rooms, picture languages, instant messaging, remote screen sharing, and multiplayer video games. | https://en.wikipedia.org/wiki?curid=1000474 | 611,045 |
1,894,245 | Critics of MECC discuss inefficiencies of the process, installation, materials, and potential setbacks that may result in economic losses. Although MECC is projected to be cheaper than other existing carbon capture techniques, it is considerably more expensive (on the order of 800 times more expensive) than present wastewater treatment technology and therefore faces a substantial barrier to implementation in public and private wastewater treatment plants. Furthermore, the efficiency of Microbial Fuel Cell technology, which is analogous to the microbial system used within MECC, has been criticized for its unpredictability due to relying upon the chemical and nutrient content of varying wastewater, as well as the health of living microbes. Inefficient MFCs lead to greater operation costs as cost offset fluctuates with departure from maximum efficiency of the system. | https://en.wikipedia.org/wiki?curid=59031826 | 1,893,161 |
1,663,382 | The car's second race meeting at Goodwood a month later was considerably more encouraging despite very wet conditions, with Reg Parnell winning not only the minor Woodcote Cup but also the full Formula One Goodwood Trophy later that same day. "All we need now is a little longer time to develop it and then we hope to show the continent what we really can do" said Parnell after the race, but in truth the cold conditions had masked overheating problems that would later come back to haunt the team. The final outing for 1950 came with a two car entry at the Penya Rhin Grand Prix, but after qualifying fourth and fifth Parnell was out early when his supercharger's drive shaft snapped before Peter Walker retired at two-thirds distance because of an oil leak in his gearbox. | https://en.wikipedia.org/wiki?curid=15177130 | 1,662,447 |
134,412 | The newest fighter jet that fits the definition of 'multi-role' is the Lockheed Martin F-35 Lightning II/Joint Strike Fighter, designed to perform stealth-based ground/naval strike, fighter, reconnaissance and electronic warfare roles. Like a modern-day F-4, 3 variants of this aircraft fulfill the various strike and air defense roles among its joint service requirements: the standard variant is intended to eventually replace the F-16 and A-10 in the USAF and other Western air forces, a STOVL version intended to replace the Harrier in US Marine Corps, British Royal Air Force and Royal Navy service, and a carrier variant intended to eventually replace the older F/A-18C/D for the US Navy and other F/A-18 operators. The F-35's design goal can be compared to its larger and more air superiority-focused cousin, the F-22 Raptor. | https://en.wikipedia.org/wiki?curid=8137250 | 134,357 |
653,242 | John Wheeler's original discussion of the possibility of a delayed choice quantum appeared in an essay entitled "Law Without Law," which was published in a book he and Wojciech Hubert Zurek edited called "Quantum Theory and Measurement", pp 182–213. He introduced his remarks by reprising the argument between Albert Einstein, who wanted a comprehensible reality, and Niels Bohr, who thought that Einstein's concept of reality was too restricted. Wheeler indicates that Einstein and Bohr explored the consequences of the laboratory experiment that will be discussed below, one in which light can find its way from one corner of a rectangular array of semi-silvered and fully silvered mirrors to the other corner, and then can be made to reveal itself not only as having gone halfway around the perimeter by a single path and then exited, but also as having gone both ways around the perimeter and then to have "made a choice" as to whether to exit by one port or the other. Not only does this result hold for beams of light, but also for single photons of light. Wheeler remarked: | https://en.wikipedia.org/wiki?curid=3474980 | 652,899 |
1,008,921 | One alternative theory to structuralism, to which Titchener took offense, was functionalism (functional psychology). Functionalism was developed by William James in contrast to structuralism. It stressed the importance of empirical, rational thought over an experimental, trial-and-error philosophy. James in his theory included introspection (i.e., the psychologist's study of his own states of mind), but also included things like analysis (i.e., the logical criticism of precursor and contemporary views of the mind), experiment (e.g., in hypnosis or neurology), and comparison (i.e., the use of statistical means to distinguish norms from anomalies) which gave it somewhat of an edge. Functionalism also differed in that it focused on the how useful certain processes were in the brain to the environment you were in and not the processes and other detail like in structuralism. | https://en.wikipedia.org/wiki?curid=25306680 | 1,008,400 |
95,189 | Popper died of "complications of cancer, pneumonia and kidney failure" in Kenley at the age of 92 on 17 September 1994. He had been working continuously on his philosophy until two weeks before when he suddenly fell terminally ill. After cremation, his ashes were taken to Vienna and buried at Lainzer cemetery adjacent to the ORF Centre, where his wife Josefine Anna Popper (called "Hennie") had already been buried. Popper's estate is managed by his secretary and personal assistant Melitta Mew and her husband Raymond. Popper's manuscripts went to the Hoover Institution at Stanford University, partly during his lifetime and partly as supplementary material after his death. Klagenfurt University has Popper's library, including his precious bibliophilia, as well as hard copies of the original Hoover material and microfilms of the supplementary material. The remaining parts of the estate were mostly transferred to The Karl Popper Charitable Trust. In October 2008 Klagenfurt University acquired the copyrights from the estate. | https://en.wikipedia.org/wiki?curid=16623 | 95,148 |
1,489,780 | EWAS Atlas (http://bigd.big.ac.cn/ewas) is a curated knowledgebase of EWAS that provides a comprehensive collection of EWAS knowledge. Unlike extant data-oriented epigenetic resources, EWAS Atlas features manual curation of EWAS knowledge from extensive publications. In the current implementation, EWAS Atlas focuses on DNA methylation—one of the key epigenetic marks; it integrates a large number of 388,851 high-quality EWAS associations, involving 126 tissues/cell lines and covering 351 traits, 2,230 cohorts and 390 ontology entities, which are completely based on manual curation from 649 studies reported in 495 publications. In addition, it is equipped with a powerful trait enrichment analysis tool, which is capable of profiling trait-trait and trait-epigenome relationships. Future developments include regular curation of recent EWAS publications, incorporation of more epigenetic marks and possible integration of EWAS with GWAS. Collectively, EWAS Atlas is dedicated to the curation, integration and standardization of EWAS knowledge and has the great potential to help researchers dissect molecular mechanisms of epigenetic modifications associated with biological traits. | https://en.wikipedia.org/wiki?curid=53362498 | 1,488,941 |
334,991 | Subsequent explorations of the Solar System by space probes made it possible to obtain precise measurements of the relative positions of the inner planets and other objects by means of radar and telemetry. As with all radar measurements, these rely on measuring the time taken for photons to be reflected from an object. Because all photons move at the speed of light in vacuum, a fundamental constant of the universe, the distance of an object from the probe is calculated as the product of the speed of light and the measured time. However, for precision the calculations require adjustment for things such as the motions of the probe and object while the photons are transiting. In addition, the measurement of the time itself must be translated to a standard scale that accounts for relativistic time dilation. Comparison of the ephemeris positions with time measurements expressed in Barycentric Dynamical Time (TDB) leads to a value for the speed of light in astronomical units per day (of ). By 2009, the IAU had updated its standard measures to reflect improvements, and calculated the speed of light at (TDB). | https://en.wikipedia.org/wiki?curid=1210 | 334,813 |
2,011,411 | It is conceived on a "hub and spokes" model, with different institutions offering different kinds of provision in different locations. The CUC central administration is based at Trevenson House in Pool, Cornwall, and the "rim" sites have been placed at a number of different locations. There are in fact two "hubs". One is the Tremough campus, originally developed for the Falmouth College of Arts (now Falmouth University). Here, degrees are offered by Falmouth University and by the University of Exeter, Cornwall Campus; the University of Exeter has international-standard research teams located here. Halls of residence are provided, and the campus attracts students on a national and international basis, though it is also intended to be attractive to local students. The second hub is the "health spa" at the Royal Cornwall Hospital, Treliske site, which provides facilities for the Peninsula Medical School (a joint operation of the University of Exeter, the University of Plymouth, and the National Health Service in Devon and Cornwall), and for the Institute of Health Studies of the University of Plymouth, which teaches nursing and other subjects allied to medicine. | https://en.wikipedia.org/wiki?curid=3759283 | 2,010,258 |
283,995 | Primary care paramedics (PCP) are the entry-level of paramedic practice in Canadian provinces. The scope of practice includes performing semi-automated external defibrillation, interpretation of 4-lead ECGs, administration of symptom relief medications for a variety of emergency medical conditions (these include oxygen, epinephrine, dextrose, glucagon, salbutamol, ASA and nitroglycerine), performing trauma immobilization (including cervical immobilization), and other fundamental basic medical care. Primary care paramedics may also receive additional training in order to perform certain skills that are normally in the scope of practice of advanced care paramedics. This is regulated both provincially (by statute) and locally (by the medical director), and ordinarily entails an aspect of medical oversight by a specific body or group of physicians. This is often referred to as "medical control", or a role played by a base hospital. For example, in the provinces of Ontario, Quebec and Newfoundland and Labrador, many paramedic services allow primary care paramedics to perform 12-lead ECG interpretation, or initiate intravenous therapy to deliver a few additional medications. | https://en.wikipedia.org/wiki?curid=75005 | 283,842 |
1,412,376 | An example of one cycle of Bott-Duffin synthesis is shown in the figures. The four terms in this expression are, respectively, a PRF (formula_90 in the diagram), an inductance, formula_91, in parallel with it, another PRF (formula_92 in the diagram), and a capacitance, formula_93, in parallel with it. A pair of critical frequencies on the formula_5 axis is then extracted from each of the two new PRFs (details not given here) each realised as a resonant circuit. The two residual PRFs (formula_95 and formula_96 in the diagram) are each two degrees lower than formula_1. The same procedure is then repeatedly applied to the new PRFs generated until just a single element remains. Since the number of PRFs generated doubles with each cycle, the number of elements synthesised will grow exponentially. Although the Bott-Duffin method avoids the use of transformers and can be applied to any expression capable of realisation as a passive network, it has limited practical use due to the high component count required. | https://en.wikipedia.org/wiki?curid=59441761 | 1,411,581 |
630,605 | Upon exposure to amatoxins, the liver is the principal organ affected as it is the organ which is first encountered after absorption in the gastrointestinal tract. There is no evidence that amatoxins are absorbed through skin. One study done on mice shows that alpha-Amanitin is not absorbed through skin and therefore can not have any toxic effects. More specifically, exposure to amatoxins may cause irritation of the respiratory tract, headache, dizziness, nausea, shortness of breath, coughing, insomnia, diarrhea, gastrointestinal disturbances, back pain, urinary frequency, liver and kidney damage, or death if ingested or inhaled. For β-amanitin, there has been no full toxicological study. However, safety data sheets indicate that if it comes in contact with skin, it may cause irritation, burns, redness, severe pain, and could be absorbed through the skin, causing similar effects to exposure via inhalation and ingestion. Contact with the eyes may result in irritation, corneal burns, and eye damage. Persons with pre-existing skin, eye, or central nervous systems disorders, impaired liver, kidney, or pulmonary function may be more susceptible to the effects of this substance. | https://en.wikipedia.org/wiki?curid=3134457 | 630,267 |
591,516 | Midori gave her first public performance at the age of six, playing one of the 24 Caprices of Paganini in her native Osaka. In 1982 she and her mother moved to New York City, where Midori started violin studies with Dorothy DeLay at Pre-College Division of Juilliard School and the Aspen Music Festival and School. As her audition piece, Midori performed Bach's thirteen-minute-long Chaconne, generally considered one of the most difficult solo violin pieces. In the same year, she made her concert debut with the New York Philharmonic under Zubin Mehta, a conductor with whom she would later record on the Sony Classical label. In 1986 came her legendary performance of Leonard Bernstein's "Serenade" at Tanglewood, conducted by Bernstein. During the performance, she broke the E string on her violin, then again on the concertmaster's Stradivarius after she borrowed it. She finished the performance with the associate concertmaster's Guadagnini and received a standing ovation. The next day's "The New York Times" front page carried the headline, "Girl, 14, Conquers Tanglewood with 3 Violins". | https://en.wikipedia.org/wiki?curid=698233 | 591,214 |
1,487,413 | The IOC works with developed and developing countries to monitor and document changes in order to aid in the design of adaptation and mitigation strategies. Through GOOS, the IOC monitors the physical, chemical and biological aspects and changes in the world's ocean. This unified network permits the design of adaptation and mitigation strategies and provides information and data for governments, industry, scientists and the general public. The IOC is also actively pushing to convince decision makers of the importance of sound scientific knowledge in designing policy on integrated coastal management, HABs, and ocean acidification (through blue carbon research and initiatives). Ocean acidification is of particular concern to the IOC, as increasing levels in the ocean are associated with coral bleaching, changes in marine biodiversity, and other related problems. | https://en.wikipedia.org/wiki?curid=478797 | 1,486,575 |
1,675,482 | Foreign chemicals introduced into the ecosystem have the potential to interfere with the arthropod's chemical receptors. Insecticide run-off from agricultural applications has been shown to inhibit communication in crayfish. Neonicotinoids are widely used systemic insecticides that act as a neurotoxin to most arthropods that are water soluble and frequently make it into various waterways. Neonicotinoids bind to nicotinic acetylcholine receptors (nAChR), which kills insects by overstimulating them. nAChRs can be found in the interneurons of the brain, neuromuscular junctions, and the olfactory bulb. Neonicotinoids binding to these receptors prevents the chemicals involved in communication from binding to their proper receptors. As a result, crayfish exposed to these insecticides at sublethal doses lose their ability to detect certain cues. Crayfish will fail to recognize individuals that they have had previous encounters with, as well as their hierarchical status. Crayfish also will fail to find food, and lab experiments show that they display no preference for environments with or without food. | https://en.wikipedia.org/wiki?curid=4565131 | 1,674,540 |
1,007,196 | In this same time period, the more use-flexible Type 13 was also being designed. Operating at 2.0 m (150 MHz) and with a peak power of 10 kW, this set included a major advancement. A unit duplexer had been developed to allow the use of a common antenna. With a weight of (a small fraction of that of the Type 11), this system could be readily used on shipboard as well as at land stations. Its detection range was about the same as the Type 12. It was placed into service in late 1942, and by 1944 it had also been adapted for use on surfaced submarines. With some 1,000 sets eventually being built, the Type 13 was by far the most used air- and surface-search radar of the Imperial Navy. | https://en.wikipedia.org/wiki?curid=27693223 | 1,006,676 |
661,032 | At a second interview, Mr. Cooke told Wheatstone of his intention to bring out a working telegraph, and explained his method. Wheatstone, according to his own statement, remarked to Cooke that the method would not act, and produced his own experimental telegraph. Finally, Cooke proposed that they should enter into a partnership, but Wheatstone was at first reluctant to comply. He was a well-known man of science, and had meant to publish his results without seeking to make capital of them. Cooke, on the other hand, declared that his sole object was to make a fortune from the scheme. In May they agreed to join their forces, Wheatstone contributing the scientific, and Cooke the administrative talent. The deed of partnership was dated 19 November 1837. A joint patent was taken out for their inventions, including the five-needle telegraph of Wheatstone, and an alarm worked by a relay, in which the current, by dipping a needle into mercury, completed a local circuit, and released the detent of a clockwork. | https://en.wikipedia.org/wiki?curid=79836 | 660,687 |
1,849,680 | Situated on the upper part of Dragon Bone Hill, this cave was discovered in 1930, and excavated from 1933–34, during which time the roof and north-facing opening were removed. Excavations found evidence of human habitation in the cave dating back to 10,000 to 20,000 years ago. The cave was divided into an upper-level living quarters, and a lower-level burial ground, while a small recess on the lower level acted as a natural animal trap. Finds unearthed included three human skulls, and other remains from at least eight individuals identified as archaic "Homo sapiens", tools and ornaments made from stone and bone, and numerous animal bones, including complete skeletons of large mammals caught in the lower-level trap. Also, white powder sprinkled around the remains on the lower level indicated the inhabitants practiced burial rites. | https://en.wikipedia.org/wiki?curid=677012 | 1,848,622 |
1,199,557 | The observational history of the Uranian atmosphere is long and full of error and frustration. Uranus is a relatively faint object, and its visible angular diameter is smaller than 5″. The first spectra of Uranus were observed through a prism in 1869 and 1871 by Angelo Secchi and William Huggins, who found a number of broad dark bands, which they were unable to identify. They also failed to detect any solar Fraunhofer lines—the fact later interpreted by Norman Lockyer as indicating that Uranus emitted its own light as opposed to reflecting light from the Sun. In 1889 however, astronomers observed solar Fraunhofer lines in photographic ultraviolet spectra of the planet, proving once and for all that Uranus was shining by reflected light. The nature of the broad dark bands in its visible spectrum remained unknown until the fourth decade of the twentieth century. | https://en.wikipedia.org/wiki?curid=13062770 | 1,198,916 |
1,138,327 | CIPN symptoms manifest themselves as deficits in sensory, motor, and/or autonomic functions of varying intensity, and they can significantly reduce a patient's functional quality of life. Sensory symptoms affecting the hands and feet generally develop first. Sensory side effects are caused when nerves in the most distal parts of the limbs are damaged. Patients may experience numbness, tingling, altered touch sensation, gait and balance disturbances, burning pain, thermal allodynia or hyperalgesia, impaired vibration sense, extreme temperature sensitivity, paresthesia, and/or dysesthesia as part of sensory damage. On the other hand, motor symptoms are less frequently seen as sensory symptoms. Motor symptoms of CIPN can include cramping, distal weakness, difficulty handling small objects, and impaired movements. In severe cases, motor symptoms can lead to complete immobilization and severe disability. Finally, autonomic symptoms usually involve orthostatic hypotension, constipation, and altered urinary function. A patient experiencing CIPN symptoms may have difficulty performing daily functionalities like walking, dressing themselves, writing, typing, and other activities related to the hands and feet. | https://en.wikipedia.org/wiki?curid=32843140 | 1,137,734 |
865,205 | Plato writes that the Form (or Idea) of the Good is the origin of knowledge although it is not knowledge itself, and from the Good, things that are just and true, gain their usefulness and value. Humans are compelled to pursue the good, but no one can hope to do this successfully without philosophical reasoning. According to Plato, true knowledge is conversant, not about those material objects and imperfect intelligences which we meet within our daily interactions with all mankind, but rather it investigates the nature of those purer and more perfect patterns which are the models after which all created beings are formed. Plato supposes these perfect types to exist from all eternity and calls them the "Forms" or "Ideas". As these Forms cannot be perceived by human senses, whatever knowledge we attain of the Forms must be seen through the mind's eye (cf. "Parmenides" 132a), while ideas derived from the concrete world of flux are ultimately unsatisfactory and uncertain (see the "Theaetetus"). He maintains that degree of skepticism which denies all permanent authority to the evidence of sense. In essence, Plato suggests that justice, truth, equality, beauty, and many others ultimately derive from the Form of the Good. | https://en.wikipedia.org/wiki?curid=314412 | 864,745 |
1,795,432 | This timeline of ankylosaur research is a chronological listing of events in the history of paleontology focused on the ankylosaurs, quadrupedal herbivorous dinosaurs who were protected by a covering bony plates and spikes and sometimes by a clubbed tail. Although formally trained scientists did not begin documenting ankylosaur fossils until the early 19th century, Native Americans had a long history of contact with these remains, which were generally interpreted through a mythological lens. The Delaware people have stories about smoking the bones of ancient monsters in a magic ritual to have wishes granted and ankylosaur fossils are among the local fossils that may have been used like this. The Native Americans of the modern southwestern United States tell stories about an armored monster named Yeitso that may have been influenced by local ankylosaur fossils. Likewise, ankylosaur remains are among the dinosaur bones found along the Red Deer River of Alberta, Canada where the Piegan people believe that the Grandfather of the Buffalo once lived. | https://en.wikipedia.org/wiki?curid=46674596 | 1,794,423 |
2,116,834 | Proteins that bind cyclic nucleotides (cAMP or cGMP) share a structural domain of about 120 residues. The best studied of these proteins is the prokaryotic catabolite gene activator (also known as the cAMP receptor protein) (gene crp) where such a domain is known to be composed of three alpha-helices and a distinctive eight-stranded, antiparallel beta-barrel structure. There are six invariant amino acids in this domain, three of which are glycine residues that are thought to be essential for maintenance of the structural integrity of the beta-barrel. cAMP- and cGMP-dependent protein kinases (cAPK and cGPK) contain two tandem copies of the cyclic nucleotide-binding domain. The cAPK's are composed of two different subunits, a catalytic chain and a regulatory chain, which contains both copies of the domain. The cGPK's are single chain enzymes that include the two copies of the domain in their N-terminal section. Vertebrate cyclic nucleotide-gated ion-channels also contain this domain. Two such cations channels have been fully characterized, one is found in rod cells where it plays a role in visual signal | https://en.wikipedia.org/wiki?curid=24009569 | 2,115,617 |
1,653,697 | ISG15-deficiency is a very rare genetic disorder caused by mutations of the ISG15 gene. It is inherited with an autosomal recessive pattern and is classified as a primary immunodeficiency or inborn error of immunity. Patients present in childhood with infectious, neurologic or dermatologic features. Basal ganglia calcification is observed in all patients reported to date and represents the underlying autoinflammatory disease of excessive IFN-I activity, known as type I interferonopathy. The basal ganglia calcifications may cause epileptic seizures but often are asymptomatic. The IFN-I inflammation may also manifest early in life as ulcerative skin lesions in the armpit, groin and neck regions. Finally, ISG15-deficiency leads to mendelian susceptibility to mycobacterial disease, although with incomplete penetrance. These infections present as fistulizing lymphadenopathies and respiratory symptoms following BCG vaccination. | https://en.wikipedia.org/wiki?curid=14156559 | 1,652,765 |
339,857 | "Allosaurus" itself is based on YPM 1930, a small collection of fragmentary bones including parts of three vertebrae, a rib fragment, a tooth, a toe bone, and, most useful for later discussions, the shaft of the right humerus (upper arm). Othniel Charles Marsh gave these remains the formal name "Allosaurus fragilis" in 1877. "Allosaurus" comes from the Greek "/", meaning "strange" or "different" and "/", meaning "lizard" or "reptile". It was named 'different lizard' because its vertebrae were different from those of other dinosaurs known at the time of its discovery. The species epithet "fragilis" is Latin for "fragile", referring to lightening features in the vertebrae. The bones were collected from the Morrison Formation of Garden Park, north of Cañon City. Marsh and Edward Drinker Cope, who were in scientific competition with each other, went on to coin several other genera based on similarly sparse material that would later figure in the taxonomy of "Allosaurus". These include Marsh's "Creosaurus" and "Labrosaurus", and Cope's "Epanterias". | https://en.wikipedia.org/wiki?curid=1347 | 339,677 |
2,088,156 | Following his PhD, George was awarded a Beit Memorial Fellowship to carry out postdoctoral research at the Tenovus Laboratories. He then went to the National Institutes of Health to work in the laboratory of Dr David Segal, developing recombinant antibody-based molecules. He returned to the UK in 1992 to a lectureship at the Royal Postgraduate Medical School, Hammersmith Hospital (which merged with Imperial College London in 1997). He was promoted to Senior Lecturer, Reader and Professor of Molecular Immunology. His research has sought to understand and manipulate the immune system to treat disease. He was awarded a DSc by Imperial College London in 2012. | https://en.wikipedia.org/wiki?curid=57383260 | 2,086,954 |
916,694 | The first deliberately slow (key stretching) password-based key derivation function was called "crypt" (or "crypt(3)" after its man page), and was invented by Robert Morris in 1978. It would encrypt a constant (zero), using the first 8 characters of the user's password as the key, by performing 25 iterations of a modified DES encryption algorithm (in which a 12-bit number read from the real-time computer clock is used to perturb the calculations). The resulting 64-bit number is encoded as 11 printable characters and then stored in the Unix password file. While it was a great advance at the time, increases in processor speeds since the PDP-11 era have made brute-force attacks against crypt feasible, and advances in storage have rendered the 12-bit salt inadequate. The crypt function's design also limits the user password to 8 characters, which limits the keyspace and makes strong passphrases impossible. | https://en.wikipedia.org/wiki?curid=449781 | 916,211 |
2,025,460 | His research is noted for developing the first quantitative assay for MBCK, which was the standard for diagnosing heart attacks in patients for more than three decades and continues to be used in many countries. Most of his research career was devoted to genetics and molecular biology of cardiovascular disorders which led him to several important discoveries, including the mapping of the first gene for atrial fibrillation [1997], the first gene for Wolff-Parkinson-White Syndrome (2001) and many others. His 1998 study on arrhythmogenic right ventricular dysplasia (ARVD) among the population of Grand Falls, Newfoundland and Labrador, Canada led to the infamous Texas Vampires incident and resulted in a 5-year suspension from clinical research by Baylor's Institutional Review Board. | https://en.wikipedia.org/wiki?curid=56386150 | 2,024,294 |
564,608 | Researchers hypothesize that an ancestor of "Mycobacterium tuberculosis" first originated in the East African region approximately 3 million years ago, with modern strains mutating and arising 20,000 years ago; Archaeologists confirmed this with skeletal analysis of Egyptian remains. As migration out of East Africa increased, so did the spread of the disease, starting in Asia and then spreading towards the West and South America. Multidrug-resistant tuberculosis has a variety of causes, but resistance usually due to treatment failure, drug combinations, coinfections, prior use of anti-TB medications, inadequate absorption of medication, underlying disease, and noncompliance with anti-TB drugs. | https://en.wikipedia.org/wiki?curid=11321017 | 564,318 |
390,184 | The emf is called the Seebeck emf (or thermo/thermal/thermoelectric emf). The ratio between the emf and temperature difference is the Seebeck coefficient. A thermocouple measures the difference in potential across a hot and cold end for two dissimilar materials. This potential difference is proportional to the temperature difference between the hot and cold ends. First discovered in 1794 by Italian scientist Alessandro Volta, it is named after the Baltic German physicist Thomas Johann Seebeck, who in 1821 independently rediscovered it. It was observed that a compass needle would be deflected by a closed loop formed by two different metals joined in two places, with an applied temperature difference between the joints. This was because the electron energy levels shifted differently in the different metals, creating a potential difference between the junctions which in turn created an electrical current through the wires, and therefore a magnetic field around the wires. Seebeck did not recognize that an electric current was involved, so he called the phenomenon "thermomagnetic effect". Danish physicist Hans Christian Ørsted rectified the oversight and coined the term "thermoelectricity". | https://en.wikipedia.org/wiki?curid=448321 | 389,989 |
1,503,911 | Kapothaka had an all-up-weight (AUW) of and was powered by an conventional twin boom configuration 26 bhp piston engine. It had a very small, low radar cross-section and was launched from a rail with rocket assistance. The system had a wingspan, a length of . Operating ceiling was . The integral wing-boom-tail unit was made of Glass Fibre Reinforced Plastic (GFRP) material whereas the fuselage is a combination of aluminium and GFRP; the aircraft has an endurance of 90 minutes while carrying payload of and can achieve a speed of in flight. It is equipped with TV and panoramic cameras, providing real time imagery intelligence. | https://en.wikipedia.org/wiki?curid=25275714 | 1,503,065 |
311,181 | Interviews and surveys show that the majority of Iranians in all groups favor their country's nuclear program. Polls in 2008 showed that the vast majority of Iranians want their country to develop nuclear energy, and 90% of Iranians believe it is important (including 81% very important) for Iran "to have a full fuel cycle nuclear program." Though Iranians are not Arab, Arab publics in six countries also believe that Iran has the right to its nuclear program and should not be pressured to stop that program. A poll in September 2010 by the International Peace Institute found that 71% of Iranians favored the development of nuclear weapons, a drastic hike over the previous polls by the same agency. However, in July 2012, a poll on an Iranian state-run media outlet found that 2/3 Iranians support suspending uranium enrichment in return for a gradual easing of sanctions. Meir Javedanfar, an Iranian-born commentator with the Middle East Economic and Political Analysis Company, stated that while Iranians may want nuclear energy, they don't want it at the price the government is willing to pay. | https://en.wikipedia.org/wiki?curid=721807 | 311,013 |
917,137 | Minkowski was educated in East Prussia at the "Albertina" University of Königsberg, where he earned his doctorate in 1885 under the direction of Ferdinand von Lindemann. In 1883, while still a student at Königsberg, he was awarded the Mathematics Prize of the French Academy of Sciences for his manuscript on the theory of quadratic forms. Due to the very young age of 18, which was unheard of in the mathematics community, and his obscurity as a mathematician at the time, his sharing the award with eminent English mathematician Henry Smith (who was certainly a great deal more famous than Hermann and to whom the prize was awarded posthumously) caused severe unrest among English mathematicians. The prize committee, despite the numerous complaints, never changed their decision. He also became a friend of another renowned mathematician, David Hilbert. His brother, Oskar Minkowski (1858–1931), was a well-known physician and researcher. | https://en.wikipedia.org/wiki?curid=193537 | 916,654 |
1,261,066 | The first serious effort to utilize this technique was carried out by the Canadian Defence Research Board in the early 1950s. Their project, "JANET" (named for Janus, who looked both ways), sent bursts of data pre-recorded on magnetic tape from their radar research station in Prince Albert, Saskatchewan to Toronto, a distance exceeding 2,000 km. A 90 MHz "carrier" signal was monitored for sudden increases in signal strength, signalling a meteor, which triggered a burst of data. The system was used operationally starting in 1952, and provided useful communications until the radar project was shut down around 1960. | https://en.wikipedia.org/wiki?curid=2995826 | 1,260,379 |
686,291 | On 3 November 2015, the ability of TIRS to accurately measure the location of the Scene Select Mirror (SSM) was compromised and the encoder was powered off. In April 2016, an algorithm was developed to compensate for the powered off encoder and data reporting resumed. In addition to these problems, TIRS launched with a stray light anomaly that increases the reported temperature by up to 4 Kelvin in band 10 and up to 8 K in band 11. Eventually, it was determined that the anomaly was caused by out-of-field reflections bouncing off a metal alloy retaining ring mounted just above the third lens of the four-lens refractive TIRS telescope and onto the TIRS focal plane. In January 2017, an algorithm was developed to estimate the amount of stray light and subtract it from the data, reducing the error down to about 1 K. | https://en.wikipedia.org/wiki?curid=14678164 | 685,934 |
724,318 | The United States Food and Drug Administration Study Data Technical Conformance Guide dated July 2020 states, "6.5 Pharmacologic Class 6.5.1 Medication Reference Terminology 6.5.1.1 General Considerations The Veterans Administration's Medication Reference Terminology (MED-RT) should be used to identify the pharmacologic class(es) of all active investigational substances that are used in a study (either clinical or nonclinical). This information should be provided in the SDTM TS domain when a full TS is indicated. The information should be provided as one or more records in TS, where TSPARMCD= PCLAS. Pharmacologic class is a complex concept that is made up of one or more component concepts: mechanism of action (MOA), physiologic effect (PE), and chemical structure (CS).51 The established pharmacologic class is generally the MOA, PE, or CS term that is considered the most scientifically valid and clinically meaningful. Sponsors should include in TS (the full TS) the established pharmacologic class of all active moieties of investigational products used in a study. FDA maintains a list of established pharmacologic classes of approved moieties.52 If the established pharmacologic class is not available for an active moiety, then the sponsor should discuss the appropriate MOA, PE, and CS terms with the review division. For unapproved investigational active moieties where the pharmacologic class is unknown, the PCLAS record may not be available." https://www.fda.gov/media/136460/download | https://en.wikipedia.org/wiki?curid=1076929 | 723,938 |
1,213,160 | On 20 October 2018, an armed rebel group in the DRC killed 13 civilians and took 12 children as hostages in Beni, which was then experiencing one of the worst outbreaks. On 11 November, six people were killed in an attack by an armed rebel group in Beni; as a consequence vaccinations were suspended there. Yet another attack reported on 17 November, in Beni by an armed rebel group forced the cessation of EVD containment efforts and WHO staff to evacuate to another DRC city for the time being. Beni continued to be the site of attacks by militant groups as 18 civilians were killed on 6 December. On 22 December, it was reported that elections for the President of the DRC would go forward despite the EVD outbreak, including in the Ebola-stricken area of Beni. Four days later, on 26 December, the DRC government reversed itself to indicate those Ebola-stricken areas, such as Beni, would not vote for several months; as a consequence election protesters ransacked an Ebola assessment center in Beni. Post election tensions continued when it was reported that the DRC government had cut off internet connectivity for the population, as the vote results were yet to be released. | https://en.wikipedia.org/wiki?curid=58011203 | 1,212,508 |
802,370 | Reimbursement policies will have to be redefined to fit the changes that personalised medicine will bring to the healthcare system. Some of the factors that should be considered are the level of efficacy of various genetic tests in the general population, cost-effectiveness relative to benefits, how to deal with payment systems for extremely rare conditions, and how to redefine the insurance concept of "shared risk" to incorporate the effect of the newer concept of "individual risk factors". The study, "Barriers to the Use of Personalized Medicine in Breast Cancer", took two different diagnostic tests which are BRACAnalysis and Oncotype DX. These tests have over ten-day turnaround times which results in the tests failing and delays in treatments. Patients are not being reimbursed for these delays which results in tests not being ordered. Ultimately, this leads to patients having to pay out-of-pocket for treatments because insurance companies do not want to accept the risks involved. | https://en.wikipedia.org/wiki?curid=2652481 | 801,941 |
1,758,767 | The origins of Sunspot as a Solar Observatory date back to the sudden increased interest of solar physics to the US military during the Second World War. In 1940, the High Altitude Observatory (HAO) was established in 1940 in Climax, Colorado, by Walter Orr Roberts and Donald Menzel. It was associated with both Harvard College Observatory and the University of Colorado and was incorporated in 1946. At the time it was the world's highest permanent observatory for astronomy, at an elevation of over 11,000 feet, and was designed purely for studying the Sun. Roberts worked with the Bureau of Standards, "forecasting radio conditions on the basis of solar observations". Such studies of the upper atmosphere were critical for predicting conditions for radio communication, guided missiles, and supersonic aircraft and, as a result, solar observations "became essential to the war effort". Suddenly the field of solar astronomy became an appealing goal for both astronomers and the military. | https://en.wikipedia.org/wiki?curid=57822012 | 1,757,774 |
208,450 | As part of Operation Unified Response, within 24 hours of the 2010 Haiti earthquake, a team of Combat Controllers from the 23rd Special Tactics Squadron stationed at Hurlburt Field, Florida arrived at Toussaint Louverture International Airport in Port-au-Prince, Haiti. 28 minutes after arriving, the Combat Controllers assumed authority of air traffic control duties to allow planes carrying humanitarian aid to land safely. The Combat Controllers directed over 2,500 flights without incident from a card table using only hand radios. Under their direction planes were able to take off and land every five minutes, bringing in over 4 million pounds of supplies. As a result of their efforts, the team leader of the Combat Controllers, Chief Master Sergeant Tony Travis, was later recognized as one of Time Magazine's 100 most influential people of 2010. | https://en.wikipedia.org/wiki?curid=17549821 | 208,343 |
2,052,341 | Machinery Hall (built in 1901) and the Main Building (built between 1891–1893) are located across the street from each other at 33rd and Federal Streets northeast of the location of the former Comiskey Park. The buildings are both Victorian era red brick and granite structures built in the Romanesque revival architecture style that were designed by Patton & Fisher and their successor firm, Patton, Fisher & Miller. The buildings were constructed with the aid of philanthropy by Philip D. Armour, Sr. On the first landing of The Main Building's main staircase there is a stained-glass window dedicated to Philip D. Armour, Jr., located on the first landing. The two buildings are located adjacent to the Dan Ryan Expressway and Chicago Transit Authority red line from which they are highly visible. The original cost of the Main Building (3300 South Federal Street) in 1892 was $500,000 ($ million today), and Machinery Hall (100 West 33rd Street) cost $150,000 ($ million) in 1901. | https://en.wikipedia.org/wiki?curid=17849721 | 2,051,160 |
1,112,373 | At the time of its release, DeepMind said that WaveNet required too much computational processing power to be used in real world applications. As of October 2017, Google announced a 1,000-fold performance improvement along with better voice quality. WaveNet was then used to generate Google Assistant voices for US English and Japanese across all Google platforms. In November 2017, DeepMind researchers released a research paper detailing a proposed method of "generating high-fidelity speech samples at more than 20 times faster than real-time", called "Probability Density Distillation". At the annual I/O developer conference in May 2018, it was announced that new Google Assistant voices were available and made possible by WaveNet; WaveNet greatly reduced the number of audio recordings that were required to create a voice model by modeling the raw audio of the voice actor samples. | https://en.wikipedia.org/wiki?curid=54133326 | 1,111,807 |
1,394,261 | Mass spectrometry is a scientific technique for measuring the mass-to-charge ratio of ions. It is often coupled to chromatographic techniques such as gas- or liquid chromatography and has found widespread adoption in the fields of analytical chemistry and biochemistry where it can be used to identify and characterize small molecules and proteins (proteomics). The large volume of data produced in a typical mass spectrometry experiment requires that computers be used for data storage and processing. Over the years, different manufacturers of mass spectrometers have developed various proprietary data formats for handling such data which makes it difficult for academic scientists to directly manipulate their data. To address this limitation, several open, XML-based data formats have recently been developed by the Trans-Proteomic Pipeline at the Institute for Systems Biology to facilitate data manipulation and innovation in the public sector. These data formats are described here. | https://en.wikipedia.org/wiki?curid=2786646 | 1,393,490 |
1,495,657 | The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Alternative splicing of this gene has been observed and two transcript variants have been described, each encoding identical proteins. An alternate translation start codon has been identified, which results in isoforms differing in the N-terminal extracellular tail. In addition, an alternate polyadenylation site has been reported. | https://en.wikipedia.org/wiki?curid=14410450 | 1,494,815 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.