text
stringlengths 1
6.74k
| meta
dict |
|---|---|
Risk of fetal mortality after exposure to Listeria monocytogenes based on dose-response data from pregnant guinea pigs and primates.
One-third of the annual cases of listeriosis in the United States occur during pregnancy and can lead to miscarriage or stillbirth, premature delivery, or infection of the newborn. Previous risk assessments completed by the Food and Drug Administration/the Food Safety Inspection Service of the U.S. Department of Agriculture/the Centers for Disease Control and Prevention (FDA/USDA/CDC) and Food and Agricultural Organization/the World Health Organization (FAO/WHO) were based on dose-response data from mice. Recent animal studies using nonhuman primates and guinea pigs have both estimated LD(50)s of approximately 10(7) Listeria monocytogenes colony forming units (cfu). The FAO/WHO estimated a human LD(50) of 1.9 x 10(6) cfu based on data from a pregnant woman consuming contaminated soft cheese. We reevaluated risk based on dose-response curves from pregnant rhesus monkeys and guinea pigs. Using standard risk assessment methodology including hazard identification, exposure assessment, hazard characterization, and risk characterization, risk was calculated based on the new dose-response information. To compare models, we looked at mortality rate per serving at predicted doses ranging from 10(-4) to 10(12) L. monocytogenes cfu. Based on a serving of 10(6) L. monocytogenes cfu, the primate model predicts a death rate of 5.9 x 10(-1) compared to the FDA/USDA/CDC (fig. IV-12) predicted rate of 1.3 x 10(-7). Based on the guinea pig and primate models, the mortality rate calculated by the FDA/USDA/CDC is underestimated for this susceptible population.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Change in the properties of the femoral bones of rats due to exarticulation of the crus and hypokinesia].
Rat experiments demonstrated that unilateral calf exarticulation leading to the loss of the leg weight-bearing function resulted in a decrease of the density, ash content and mineral content in the femoral diaphysis. This manipulation reduced the mechanical strength and did not change the elastic properties of the bone. Histological examinations showed osteoporosis in the cortical plate. Partial maintenance of the weight-bearing function in the animals with bilateral exarticulation of the calf prevented these changes. The results suggest that special steps taken to provide static load on leg may be effective countermeasures against atropic changes in bones devoid of their weight-bearing function.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Leukocyte and 67Ga-citrate dynamics in experimental subcutaneous Streptococcus faecalis infections.
The dynamics of white blood cell (WBC) and 67Ga-citrate accumulation were studied in rabbits with subcutaneous polyethylene chambers. Uninfected chamber fluid (CF) contained less than 1,000 WBCs/mm3, most of which were mononuclear. After 67Ga injection, radioactivity increased slowly in uninfected fluid, peaked between 24 and 48 hours, and then gradually decreased. 67Ga scans showed no uptake in excess of background levels around the uninfected chambers. After injection of Streptococcus faecalis directly into the chambers, bacterial concentrations initially decreased, increased by 4-24 hours, and then decreased slightly. WBCs began to increase 4 hours after infection due to influx of polymorphonuclear leukocytes. 67Ga localized in infected chambers before the increase in WBCs. Use of the subcutaneous chamber model could help elucidate the mechanism(s) of 67Ga accumulation at sites of inflammation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A nonlinear regression approach to estimating signal detection models for rating data.
This paper considers a regression approach to estimating signal detection parameters for rating data. The methodology is based on the statistical modeling of ordinal data and requires only standard statistical software such as SAS (SAS/STAT User's Guide, 1999) for computation. The approach is more efficient than the current practice of extracting the parameter estimates with the use of specialized software and analyzing the estimates with the use of a standard statistical package. It greatly facilitates exploration of the effects of covariates on model parameters. The method is illustrated using a published data set from a single factor multiple-alternative perceptual task, and data from a more complex factorial design examining recognition memory rating data.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The irrelevance of fusimotor activity to the Achilles tendon jerk of relaxed humans.
In two normal subjects the sciatic nerve was blocked completely using concentrated lidocaine. The muscle afferent and reflex electromyographic responses to reproducible percussion of the Achilles tendon were recorded while the blocks developed. The intensity of percussion was sufficient to produce an Achilles tendon jerk in one subject when at rest and in the other during reinforcement. The block did not alter the muscle afferent response to tendon percussion in either subject. It is concluded that background fusimotor activity is not a prerequisite for the tendon jerk and that, during complete relaxation, there may be no significant fusimotor drive directed to the triceps surae. The varying ease with which tendon jerks can be elicited in different normal subjects or in different muscles of the same subject appears to be related not to fusimotor activity but to differences in the "central excitability state."
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Mortality patterns in low birth weight babies in ICDS urban slum area.
There were 920 live-births over the period of one year in urban slums (covering 40 anganwadi centres) of Gorakhpur city. Incidence of low birth weight (LBW) babies weighing 2.5 kg or less and those weighing 2 kg or less were 40.7% (19.8% preterm LBW and 80.2% term LBW) and 24% (25.3% preterm LBW and 74.7% term LBW) respectively. Incidence of preterm babies was 8.5%. Infections and respiratory distress were found to be the major killers of LBW babies. The neonatal mortality rate was observed to be significantly high in LBW and preterm babies. Again, babies weighing 2 kg or less and preterm were at greater risk and should be referred to specialised neonatal centres while those weighing 2.001-2.5 kg could be looked after at home by trained personnel in domiciliary newborn care.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The relationship between ventricular fluid pressure and body position in normal subjects and subjects with shunts: a telemetric study.
Using a chronically implanted telemetric pressure sensor, we have determined the quantitative relationship between changes in body position and ventricular fluid pressure in normal subjects and subjects with shunts. The method allows accurate, reliable measurement of negative as well as positive pressures. We describe the derangement of postural intraventricular pressure regulation caused by placement of a shunt, as well as the influence of various shunt systems and the antisiphon device on this problem. Ventriculoatrial, ventriculoperitoneal, and ventriculopleural shunts all caused similar severely abnormal postural intracranial pressure relationships. The antisiphon device was generally effective in restoring normal pressures in patients in the upright position. We discuss the implications of our findings for understanding the mechanisms of postural intracranial pressure regulation in patients without hydrocephalus.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Purging and calorie absorption in bulimic patients and normal women.
Self-induced purging with laxatives is common among bulimic persons, who assume that purging reduces intestinal absorption of ingested calories. However, the efficacy of purging in reducing calorie absorption has never been studied, probably because the standard calorie balance procedure is expensive and time consuming. With a recently devised method, calorie absorption during a single day was measured to determine to what extent phenolphthalein or saline purge reduced calorie absorption. In two bulimic patients who regularly used laxatives for weight control and five normal young women, even extreme purging producing 4 to 6 L of diarrhea caused calorie absorption to decrease by only about 12% of calorie intake. The theoretical basis on which laxatives are taken for weight control is unsound.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Calcitonin and procalcitonin in patients with medullary thyroid cancer or bacterial infection.
To evaluate procalcitonin (PCT) utility as a marker of medullary thyroid cancer (MTC). Calcitonin (CT) and PCT levels were measured in MTC patients and patients with serious bacterial infections. 70 patients were enrolled in the study: 6 MTC active patients: 4 with disseminated, unreoperable disease and 2 re-operated patients, in whom markers were checked before and after surgery; 23 MTC patients in remission after radical surgery; 11 non-toxic nodular goiter (NTNG) patients; 30 patients with severe, bacterial infection or sepsis. All MTC active patients had greatly elevated CT and PCT levels. In two re-operated patients, marker levels decreased but were still above the reference range. In 15 MTC patients in remission, the levels of either marker were not increased. Both markers were slightly increased in 3 patients in this group, while CT was elevated in 5 patients. In all but 1 patient in the NTNG group, both marker levels were not elevated. Among patients with bacterial infection, PCT and CT levels showed no increase in 8 patients, both markers were elevated in 10 patients, and an increase of PCT levels was seen in 10 patients while of CT only in 2 patients. Correlations between CT and PCT values were very strong in MTC patients (r = 0.95; p = 0.004 for active MTC, r = 0.60; p = 0.002 for MTC patients in remission) and in patients with NTNG (r = 0.77; p = 0.02). In patients with infection, both parameters were completely independent (r = 0.002; p = 0.99). PCT measurement could be an alternative to CT measurement for evaluation of MTC status.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Flowering plants under global pollinator decline.
There is now compelling evidence of a reduction of pollinator richness and density at a global scale. In this opinion article, we argue that such pollinator decline intensifies pollen limitation and reduces plant reproductive success, threatening natural populations of extinction. We use genetic architecture and selection experiments on floral traits and evaluate the potential for plant reproductive strategies to adapt rapidly to new pollination environments. We propose that plant reproductive strategies could adapt to the current pollinator decline by decreasing or increasing their reliance to pollinators, for example, increasing autonomous selfing or reinforcing interactions with pollinators. We further discuss if and how adaptation of plant reproductive strategies can buffer the demographic consequences of pollinator decline, and possibly rescue plant populations from extinction.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Plasmid-associated aggregation in Thermus thermophilus HB8.
Thermus thermophilus HB8, a moderate thermophile, exhibits visible aggregation when growing on a rich broth. Strain HB8 also contains two cryptic plasmids. We isolated cured strains from HB8 and observed that loss of the 47-MDa plasmid was correlated with loss of aggregation. An enrichment procedure was developed for aggregating cells and used to demonstrate that aggregation was restored upon transformation of a cured strain with plasmid DNA. The aggregation phenotype of transformed cells was variably stable; most did not retain either the plasmid or the phenotype for prolonged periods of growth. Hybridization experiments using a partial sequence from the 47-MDa plasmid suggested the presence of a repeated DNA sequence on this plasmid and on the chromosome. This is the first report of a phenotype associated with a plasmid from a Thermus strain.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Designing and evaluating a patient-centred health management system for seniors.
Telehealth has been widely promoted as a technology to make healthcare more effective and affordable. However, current telehealth systems suffer from vendor lock-in and high cost, and are designed for managing chronic diseases rather than preventing them. We address shortcomings of existing consumer-level health informatics applications in supporting senior health consumers, and provide designers of such systems with a design framework. We assess the feasibility of patient-centred health management systems (HMSs) that are designed based on the proposed framework. In contrast to traditional telehealth, HMSs are patient centred and aim at enabling health consumers to take control of their own health by providing functionality for health self-management. Quantitative and qualitative methods were adopted in evaluating a prototype HMS. Senior healthcare consumers viewed our HMS prototype positively, and experienced a positive change in their attitude towards their health. We identified requirements and challenges for HMSs. In particular, participants indicated that social networking features must have a clear purpose beyond simple broadcasting of emotions and opinions. Our study indicates that seniors are able and motivated to leverage a web-based patient-centred HMS, provided that there are suitable health support applications tailored to their needs. This could be achieved by making it attractive for third party application developers to contribute HMS content.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Molecular cloning and expression of the pituitary glycoprotein hormone N-acetylgalactosamine-4-O-sulfotransferase.
N-Linked oligosaccharides terminating with the sequence SO(4)-4-GalNAcbeta1,4GlcNAcbeta1,2Manalpha are present on the pituitary hormones lutropin (LH), thyrotropin, and pro-opiomelanocortin. The sulfated structures on LH are essential for expression of its biologic function in vivo. We have cloned the N-acetylgalactosamine-4-sulfotransferase (GalNAc-4-ST1, GenBank(TM) accession number ), which mediates sulfate addition to the N-linked oligosaccharides on LH and other pituitary glycoproteins with terminal (beta1,4-linked GalNAc based on its homology to HNK-1 sulfotransferase (HNK-1 ST). GalNAc-4-ST1 displays 23% identity to HNK-1 ST and 28% to chondroitin 4-sulfotransferase 1 (C4ST-1) and 26% to chondroitin 4-sulfotransferase 2 (C4ST-2). The cDNA predicts a type II transmembrane protein of 424 amino acids with four potential N-linked glycosylation sites and a single membrane-spanning domain. GalNAc-4-ST1 has putative 5'-phosphosulfonate and 3'-phosphate binding sites. Three more carboxyl-terminal regions of unknown function also show a high degree of identity with HNK-1 ST, C4ST-1, and C4ST-2. The membrane-bound form of GalNAc-4-ST1 transfers sulfate to GalNAcbeta1, 4GlcNAcbeta-R but not to chondroitin, whereas truncated forms of GalNAc-4-ST1 that are released into the medium transfer sulfate to both GalNAcbeta1,4GlcNAcbeta-R and chondroitin. The first 118 amino acids of GalNAc-4-ST1 appear to contribute to both its activity and specificity for terminal beta1,4-linked GalNAc. GalNAc-4-ST1 also efficiently transfers sulfate to N-linked oligosaccharides on native LH and other glycoproteins terminating with beta1,4-linked GalNAc. A single transcript of 2.4 kilobases is most highly expressed in the pituitary and other regions of the central nervous system. The GalNAc-4-ST1 gene is located on human chromosome 19q13.1.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Larger Daphnia at lower temperature: a role for cell size and genome configuration?
Experiments with Daphnia magna and Daphnia pulex raised at 10 and 20 °C yielded larger adult size at the lower temperature. This must reflect increased cell size, increased cell numbers, or a combination of both. As it is difficult to achieve good estimates on cell size in crustaceans, we, therefore, measured nucleus and genome size using flow cytometry at 10 and 20 °C. DNA was stained with propidium iodide, ethidium bromide, and DAPI. Both nucleus and genome size estimates were elevated at 10 °C compared with 20 °C, suggesting that larger body size at low temperature could partly be accredited to an enlarged nucleus and thus cell size. Confocal microscopy observations confirmed the staining properties of fluorochromes. As differences in nucleotide numbers in response of growth temperature within a life span is unlikely, these results seem accredited to changed DNA-fluorochrome binding properties, presumably reflecting increased DNA condensation at low temperature. This implies that genome size comparisons may be impacted by ambient temperature in ectotherms. It also suggests that temperature-induced structural changes in the genome could affect cell size and for some species even body size.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Grandfathered, Grandmothered, And ACA-Compliant Health Plans Have Equivalent Premiums.
Many small employers offer employees health plans that are not fully compliant with Affordable Care Act (ACA) provisions such as covering preventive services without cost sharing. These "grandfathered" and "grandmothered" plans accounted for about 65 percent of enrollment in the small-group market in 2014. Premium costs for these and ACA-compliant plans were equivalent.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Distinguishing inchworm and hand-over-hand processive kinesin movement by neck rotation measurements.
The motor enzyme kinesin makes hundreds of unidirectional 8-nanometer steps without detaching from or freely sliding along the microtubule on which it moves. We investigated the kinesin stepping mechanism by immobilizing a Drosophila kinesin derivative through the carboxyl-terminal end of the neck coiled-coil domain and measuring orientations of microtubules moved by single enzyme molecules at submicromolar adenosine triphosphate concentrations. The kinesin-mediated microtubule-surface linkage was sufficiently torsionally stiff (>/=2.0 +/- 0.9 x 10(-20) Newton meters per radian2) that stepping by the hypothesized symmetric hand-over-hand mechanism would produce 180 degree rotations of the microtubule relative to the immobilized kinesin neck. In fact, there were no rotations, a finding that is inconsistent with symmetric hand-over-hand movement. An alternative "inchworm" mechanism is consistent with our experimental results.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Recurrent nerve palsy due to Lyme disease: report of two cases].
Neuroborreliosis can be a difficult diagnosis which requires epidemiologic, clinical and biologic arguments. We report two patients who presented with a recurrent laryngeal nerve palsy with positive Lyme serology and favorable outcome after antibiotic therapy. In one case, a lymphocytic meningitis with intrathecal production of specific antibodies was evidenced. Recurrent laryngeal nerve palsy is an uncommon manifestation of neuroborreliosis. Lyme serology is an important tool when neurologic disorder occurs because of an atypical course of Lyme disease.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
"In vivo" inhibition of murine liver aspartate aminotransferase by isoniazid.
Intraperitoneal administration of isoniazid (IN), an antituberculous agent, to mice or rats at a dose of 100 mg/kg body weight resulted in remarkable and rapid inhibition of liver cytosolic aspartate aminotransferase (AAT); inhibition was less marked with other antivitamin B6 compounds; AATs in other tissues and other aminotransferases in liver were less effectively inhibited by IN. The inhibition of liver cytosolic AAT was apparently irreversible in vivo; it was reversed only a little by gel filtration and dialysis to remove excess IN in vitro, although treatment with pyridoxal phosphate or 5'-deoxypyridoxal slowly restored the full activity. Attempts to inhibit the enzyme by in vitro treatments showed that IN itself was not an effective inhibitor, while the liver extracts from IN treated mice contained some strongly inhibitory substance. In addition, the extracts were shown to contain only trace amounts of IN. These results suggest that IN is metabolized to some other form which is markedly inhibitory to murine liver cytosolic AAT, and the metabolite binds to the coenzyme moiety of enzyme in a manner not readily dissociable.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Label-Free Bottom-Up Proteomic Workflow for Simultaneously Assessing the Target Specificity of Covalent Drug Candidates and Their Off-Target Reactivity to Selected Proteins.
Although designed covalent inhibitors as drug candidates offer several unique advantages over conventional reversible inhibitors, including high potency and the potential for less frequent dosing, there is a general tendency to avoid the covalent mode of action in drug discovery programs due to concerns regarding immune-mediated toxicity that can arise from indiscriminate reactivity with off-target proteins. Therefore, the ability to assess off-target reactivity relative to target specificity is desirable for optimizing covalent drug candidates in the early discovery stage. One concern with current surrogate nucleophile trapping approaches is that they employ a simplistic model nucleophile such as glutathione, which may not reliably reflect the covalent interactions with cellular or extracellular proteins. One way to get a more relevant reactivity assessment is to directly measure the ability of an inhibitor to covalently modify nucelophilic amino acids on biologically relevant proteins, both on- and off-target. In this article, we describe a label-free bottom-up proteomic workflow for simultaneous evaluation of target binding and off-target reactivity of covalent drug candidates to selected proteins at the peptide level. Ibrutinib, a covalent drug targeting the active site of BTK protein, was used as a model compound to demonstrate the feasibility of the workflow. The compound was incubated with a mixture of target protein, Bruton's tyrosine kinase (BTK), and two abundant proteins in blood, hemoglobin (Hb) and human serum albumin (HSA), and then the ibrutinib modification sites were determined utilizing a bottom-up proteomic approach. A non-BTK specific model compound (1) known to modify cysteine residues was also included. By comparing the extent of off-target modifications to the targeted BTK C481 binding in a wide compound concentration range, we were able to determine the concentration where maximum target binding was achieved with minimal off-target reactivity. The generic label-free bottom-up proteomics workflow described in this article should be useful in the rank order assessment of off-target reactivity vs on-target reactivity of covalent drug candidates in the early drug discovery stage.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Comparison of S-nitrosoglutathione- and staurosporine-induced apoptosis in human neural cells.
S-nitrosoglutathione (GSNO) is an endogenously produced S-nitrosylating compound that controls the function of various proteins. While a number of rodent cell lines have been used to study GSNO-induced apoptosis, the mechanisms of action remain to be evaluated in human cells and in parallel with other common apoptosis-inducing agents. In this study, we compared the pro-apoptotic effects of GSNO and staurosporine (STS) on human neural progenitors (NT2, hNP1) and neuroblasts (SH-SY5Y). We show that these cells exhibit comparable levels of susceptibility to GSNO- and STS-induced apoptotic cell death, as demonstrated by condensed nuclei and CASP3 activation. Mechanistic differences in apoptotic responses were observed as differential patterns of DNA fragmentation and levels of BAX, BCL-XL, CASP8, and p-ERK in response to GSNO and STS treatment. Mitochondrial membrane potential analysis revealed that NT2 and hNP1 cells, but not SH-SY5Y cells, undergo mitochondrial hyperpolarization in response to short-term exposure to STS prior to undergoing subsequent depolarization. This is the first study to report differences in apoptotic responses to GSNO and STS in 3 complementary human neural cell lines. Furthermore, these cells represent useful tools in cell pharmacological paradigms in which susceptibility to apoptosis-inducing agents needs to be assessed at different stages of neural cell fate commitment and differentiation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Interactions of ceftriaxone with beta-lactamases including those which hydrolyze cefotaxime].
As it occurs with most of 3rd generation cephalosporins, ceftriaxone has few, if any, interactions with penicillinase-type beta-lactamases, such as TEM-1, TEM-2 or PIT-2. These poor interactions are characterized by an extremely low hydrolysis, associated to a poor affinity of these compounds for the penicillinases. Conversely, ceftriaxone, as cefotaxime, shows a high affinity for chromosomally-mediated cephalosporinases (indole-positive Proteus, Enterobacter, Pseudomonas...), which is characterized by Ki values ranging from about 0.05 to 1 microM. Within these beta-lactamases, the hydrolysis of ceftriaxone, as that of cefotaxime, is always low, but significant. Then few beta-lactamases are able to hydrolyze more efficiently cefotaxime, as cefuroxime, such as those produced by P vulgaris and K oxytoca. Within these enzymes, ceftriaxone is also hydrolyzed, in a way quite similar to that of cefotaxime.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Early-Life Toxic Insults and Onset of Sporadic Neurodegenerative Diseases-an Overview of Experimental Studies.
The developmental origin of health and disease hypothesis states that adverse fetal and early childhood exposures can predispose to obesity, cardiovascular, and neurodegenerative diseases (NDDs) in adult life. Early exposure to environmental chemicals interferes with developmental programming and induces subclinical alterations that may hesitate in pathophysiology and behavioral deficits at a later life stage. The mechanisms by which perinatal insults lead to altered programming and to disease later in life are still undefined. The long latency between exposure and onset of disease, the difficulty of reconstructing early exposures, and the wealth of factors which the individual is exposed to during the life course make extremely difficult to prove the developmental origin of NDDs in clinical and epidemiological studies. An overview of animal studies assessing the long-term effects of perinatal exposure to different chemicals (heavy metals and pesticides) supports the link between exposure and hallmarks of neurodegeneration at the adult stage. Furthermore, models of maternal immune activation show that brain inflammation in early life may enhance adult vulnerability to environmental toxins, thus supporting the multiple hit hypothesis for NDDs' etiology. The study of prospective animal cohorts may help to unraveling the complex pathophysiology of sporadic NDDs. In vivo models could be a powerful tool to clarify the mechanisms through which different kinds of insults predispose to cell loss in the adult age, to establish a cause-effect relationship between "omic" signatures and disease/dysfunction later in life, and to identify peripheral biomarkers of exposure, effects, and susceptibility, for translation to prospective epidemiological studies.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Grasp stiffness as a function of grasp force and finger span.
The purpose of this study was to determine whether direct measurements of grasp stiffness agreed with stiffness inferred from the slopes of isovolitional force-space characteristics derived from previous grasp-effort matching data. Grasp stiffness for three-finger pinch was measured as a function of initial force and finger span using step displacements applied in a do-not-intervene paradigm. Subjects pinched a free-floating, motorized manipulandum in each hand and squeezed both with equal effort; one of the hands was perturbed at random. Stiffness was calculated from the initial and final steady-state values of force and span. The effects of step amplitude, rise-time, and initial load stiffness were investigated; grasp stiffness decreased significantly for larger steps, increased slightly for longer rise-times, and was unaffected by load stiffness. Grasp stiffness then was measured as a function of initial force and span using a single set of step parameters. Stiffness increased significantly in proportion to force but was changed only slightly by span. It was concluded that the perturbation and effort-matching measures of stiffness are not equivalent and represent different components of motor behavior.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Treatment, clinical course, and cross-sectoral information transmission in patients with acute-on-chronic kidney injury].
Delayed diagnosis and undertherapy of acute-on-chronic kidney injury (AKI-on-CKD) may trigger multiple organ injury and worsen clinical outcome. This study focused on description of in-hospital care and cross-sectoral information transmission of patients with AKI-on-CKD including subgroup analyses (under surgical vs. non-surgical and nephrology vs. non-nephrology care). At a university clinic, we analysed clinical measures and documentation in patients with AKI-on-CKD. Cox regression was performed to identify independent risk factors for in-hospital-mortality and 180-day mortality. In 38 (25.3%) of 150 patients, progressing AKI-on-CKD was found. Nineteen patients (12.7%) received acute dialysis. Thirty patients (20.0%) died in hospital. Systemic hypotension (n = 76, 50.7%) and nephrotoxins (n = 26, 17.3%), both considered as causes for AKI-on-CKD, were treated in 36.8 and 19.2%, respectively, of affected patients. Fluid balance was documented in one third of patients. Nephrology referral was requested in 38 (25.3%) of patients (median 24.0 h after AKI-on-CKD start). Acute renal complications (n = 74, 49.3%) were an independent risk factor for in-hospital mortality (ExpB 6.5, p = 0.022) or 180-day mortality (ExpB 3.3, p = 0.034). Rarely, outpatient physicians were informed about AKI-on-CKD (n = 42, 28.0%) or renal function follow-up was recommended (n = 14, 11.7% of surviving patients). Care gaps in therapy and cross-sectoral information transmission in patients with AKI-on-CKD were identified.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Decrease in bone mineral density and muscle mass after femoral neck fracture. A quantitative computed tomography study in 25 patients.
We performed a prospective, longitudinal, quantitative computed tomography (QCT) study of bone mineral density (BMD), cortical bone volume, bone mass and muscle volume in 25 patients who were operated on with osteosynthesis because of a displaced femoral neck fracture. Both legs were scanned within 3 days after the fracture, and 3 and 6 months after the operation. The measurements were performed by a computer tomograph equipped for bone mineral densitometry. We found some side differences among the patients at the time of fracture, but none of the differences was statistically significant. After 6 months, we found reductions in BMD in the distal femur and proximal tibia on the fractured side of 11% and 19%, respectively, as well as a reduction in BMD of 7% in the proximal tibia on the uninjured side. We found no changes in cortical bone mass, either on the fractured femur or on the uninjured femur. The muscles of the thigh showed a loss of 9% on the fractured side, but a gain of 12% on the uninjured side. The findings of a bone loss in the distal femur and proximal tibia of the fractured leg and in the proximal tibia of the healthy leg, but no cortical bone loss in the middle femur on any side 6 months after the fracture, indicate that the cancellous bone is more sensitive to osteopenia. Moreover, this bone loss is interpreted as mainly a posttraumatic effect, since we also found a decrease in bone mineral on the uninjured side, despite a gain in muscle volume on that side, an overuse which was not sufficient to counteract the posttraumatic effect on the bone of the uninjured side.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Amphetamine lacing of an Internet-marketed neutraceutical.
A 25-year-old woman presented with abdominal pain after taking an imported herbal weight-loss product. A urinary toxicology screen was positive for amphetamine, which the patient denied taking. On further investigation, the neutraceutical was found to contain an amphetamine derivative banned by the US Food and Drug Administration (FDA). Although the patient had discontinued use of the supplement before hospitalization and her symptoms steadily improved with appropriate treatment, a report was made to the FDA. Similar reports from cities across the United States prompted the FDA to confiscate shipments of the product before it could be distributed further nationally while they investigate claims against the product.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Increased levels of soluble Receptor for Advanced Glycation End-products (RAGE) are associated with a higher risk of mortality in frail older adults.
to evaluate the relationship between serum levels of the soluble Receptor for Advanced Glycation End-products (sRAGE) and mortality in frail and non-frail older adults. we studied 691 subjects (141 frail and 550 non-frail) with a median age of 75 years from two population-based cohorts, the Toledo Study of Healthy Aging and the AMI study, who were enrolled to the FRAILOMIC initiative. Multivariate Cox proportional hazards regression and Kaplan-Meier survival analysis were used to assess the relationship between baseline sRAGE and mortality. during 6 years of follow-up 101 participants died (50 frail and 51 non-frail). Frail individuals who died had significantly higher sRAGE levels than those who survived (median [IQR]: 1563 [1015-2248] vs 1184 [870-1657] pg/ml, P = 0.006), whilst no differences were observed in the non-frail group (1262 [1056-1554] vs 1186 [919-1551] pg/ml, P = 0.19). Among frail individuals higher sRAGE levels were associated with an increased risk of death after adjustment for relevant covariates (HR = 2.72 per unit increment in ln-sRAGE, 95%CI 1.48-4.99, P = 0.001). In contrast, in non-frail individuals sRAGE showed no association with mortality. Survival curves demonstrated that among frail individuals the incidence of death was significantly higher in the top sRAGE quartile compared to the three lower quartiles (P = 0.002). Area under the ROC curve analysis demonstrated that for frail individuals, inclusion of sRAGE in the hazard model increased its predictive accuracy by ~3%. sRAGE is an independent predictor of mortality among frail individuals. Determination of sRAGE in frail subjects could be useful for prognostic assessment and treatment stratification.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Ceftazidime treatment in severe burns. Serious infections in patients with severe burns treated with ceftazidime.
In combination with active surgical and general management, ceftazidime is a useful antibiotic for the treatment of Gram negative septic complications in patients with severe burn wounds. Against S. aureus, however, ceftazidime is not the therapy of choice.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The association between hsa-miR-499 T>C polymorphism and cancer risk: a meta-analysis.
MicroRNAs regulate gene expression at the post-transcriptional level and were involved in diverse biological and pathological processes. Single nucleotide polymorphism (SNP) which is located in the pre-miRNA may affect the processing and then influence the expression of mature miRNA. Previous studies yielded conflicting results as to the association of a common polymorphism in pre-miRNAs (i.e. hsa-miR-499 rs3746444) with various diseases. Therefore, here we performed a meta-analysis to address the association between this polymorphism and cancer risks. A total of twenty studies involving 10,584 cases and 12,414 controls were retrieved based on PubMed. No significant association was found either in cancers and other diseases in all genetic models. And then in the stratified analysis by ethnicity, significantly increased risks were found in Asians (OR=1.11; 95% CI=1.00-1.23 for C vs. T; OR=1.16; 95% CI=1.00-1.36 for TC vs. TT; OR=1.15; 95%CI=1.01-1.31 for TC/CC vs. TT), but not in Caucasians in all comparison models tested. Our meta-analysis suggested that polymorphism of hsa-miR-499 rs3746444 T>C was not associated with the increased susceptibility to cancers and other diseases.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Recombination between genetically modified and unmodified Autographa californica nuclear polyhedrosis virus in Trichoplusia ni larvae.
Trichoplusia ni larvae have been injected with a mixture of wild-type Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and a mutant derivative, AcRP8.UW1.lacZ, which lacks the polyhedrin gene, and has the p10 gene replaced by the Escherichia coli beta-galactosidase gene. Following plaque assay of the haemolymph and subsequent staining for beta-galactosidase activity and scoring for polyhedra, recombinant plaques were identified and the recombination frequency estimated as 6.6%.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The genome of Schistosoma mansoni: isolation of DNA, its size, bases and repetitive sequences.
DNA has been prepared from adults and cercariae of Schistosoma mansoni utilizing a technique that involves centrifugation through cesium chloride. The DNA isolated from S. mansoni adults and that isolated from cercariae were found to be indistinguishable in all analyses. No modified bases were detected by chromatography or comparative endonuclease restriction. Cot analysis demonstrated that the haploid genome of S. mansoni is 0.26 pg (2.7 X 10(8) base pairs) and that the genome contains both moderately and highly repeated components. Some of the repetitive fraction of DNA consists of tandemly repeated ribosomal genes of which there are 500-1000 copies per genome (1.8-3.6% of the total DNA). Four other non-ribosomal repetitive sequences (comprising at least a further 2.0% of the total DNA) have been isolated from a DNA clone bank and their arrangement within the S. mansoni genome investigated by restriction and Southern blot analysis. These cloned segments of DNA appear in many different locations within the genome and thus are reminiscent of the interspersed DNA sequences described in higher eukaryotic organisms.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Relation between breast cancer mortality and screening effectiveness: systematic review of the mammography trials.
The mammography screening trials have shown varying results. This could be because screening was better in some trials than in others at advancing the time of diagnosis. If so, more cancers would be identified in such trials relative to the control group, and fewer of the cancers would have reached an advanced stage. I performed a systematic review of the mammography screening trials using metaregression. Finding many cancers was not related to the size of the reduction in breast cancer mortality (p = 0.19 after seven and p = 0.73 after 13 years of follow-up). In contrast, finding few cancers in stage II and above predicted a larger reduction in breast cancer mortality (p = 0.04 and p = 0.006). This expected association was also found for node-positive cancers (p = 0.008 and p = 0.04). However, a screening effectiveness of zero (same proportion of node-positive cancers in the screened group as in the control group) predicted a significant 16% reduction in breast cancer mortality after 13 years (95% confidence interval, 9% to 23% reduction). This can only occur if there is bias. Further analyses uncovered bias in both assessment of the cause of death and of the number of cancers in advanced stages. Consequently, the differences in the reported reductions in breast cancer mortality cannot be explained by differences in screening effectiveness. Given that the size of the bias was similar to the estimated screening effect, screening appeared ineffective.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Acute renal failure caused by phenazopyridine].
A 27 years old woman was admitted due to abdominal cramps, jaundice and oligoanuria, starting 48 hours after eating Chinese food. Hepatic biochemical tests, abdominal ultrasound and retrograde pyelography were normal. The urine was intensely orange colored and microscopic analysis was normal. The serum creatinine and urea nitrogen on admission were 4.59 and 42.5 mg/dl and rose to 13.5 and 72.4 mg/dl, respectively, at the 6th hospital day. Oliguria lasted only 48 hours. Dialysis was not used, since the patient was in good general condition and uremic symptoms were absent. On the 7th day, azotemia began to subside and at the 14th day, serum creatinine was 1.0 mg/dl. Before hospital discharge, she confessed the ingestion of 2.000 mg of phenazopyridine, during a nervous breakdown, aiming to sleep deeply. Remarkable was the persistence of the orange color of her urine during several days and the dissociation between the rate of increase of serum creatinine with respect to urea nitrogen. This is an unusual case of acute renal failure caused by an overdose of a drug, commonly prescribed for urinary tract infections.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Physical activity is associated with higher cognitive function among adults at risk for Alzheimer's disease.
We evaluated the specific association between physical activity and cognitive function among a national sample of the broader U.S. adult population with a family history of Alzheimer's disease. Data from the 1999-2002 National Health and Nutrition Examination Survey (NHANES) were used to identify 219 older adults, ages 60-85, with a family history of Alzheimer's disease. The Digit Symbol Substitution Test (DSST) was used to assess cognitive function, with physical activity assessed via a validated questionnaire. In an unadjusted model, older adults, who had at least one blood relative with Alzheimer's disease, had greater cognitive function when meeting MVPA guidelines in comparison to their inactive counterparts (β=9.6; 95% CI: 4.6-14.7; P=0.001). After adjustments, results were attenuated, but still statistically significant (8.5; 95% CI: 4.0-13.0; P=0.001). In this national sample of individuals at risk for Alzheimer's disease, meeting physical activity guidelines was associated with higher cognitive function.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A unified framework for land cover monitoring based on a discrete global sampling grid (GSG).
Environmental monitoring and assessment of the extent and change of land uses and their renewable natural resources over time is a key element in many international processes and one crucial basis for sustainable management. Remote sensing plays an increasingly important role in these monitoring systems, especially if the interest is in large areas. Integration of remote sensing requires comprehensive and careful preprocessing and a high level of expertise which is not always at hand in all applications. However, easy-to-implement sampling techniques based on visual interpretation are an alternative approach for utilizing remote sensing imagery, including the evolving archives of georeferenced and preprocessed data provided by virtual globes like Google Earth, Bing, and others. The goal of this paper is to propose a simple unified framework that may be used in the context of sampling studies and environmental monitoring from local to global scale. Besides the definition of a sampling design, the observation or plot design, i.e., defining how observations are to be made and recorded, has a strong influence on the precision of estimates as well as the overall efficiency of a sampling exercise. As an example, we present a simulation study focusing on the estimation of forest cover in artificial landscapes with different coverage and degree of fragmentation. The sampling units we compare are point clusters with different configuration and spatial extent.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A magnetic resonance imaging, histological, and dose modeling comparison of focused ultrasound, radiofrequency, and Gamma Knife radiosurgery lesions in swine thalamus.
The purpose of this study was to use MRI and histology to compare stereotactic lesioning modalities in a large brain model of thalamotomy. A unilateral thalamotomy was performed in piglets utilizing one of 3 stereotactic lesioning modalities: focused ultrasound (FUS), radiofrequency, and radiosurgery. Standard clinical lesioning parameters were used for each treatment; and clinical, MRI, and histological assessments were made at early (< 72 hours), subacute (1 week), and later (1-3 months) time intervals. Histological and MRI assessment showed similar development for FUS and radiofrequency lesions. T2-weighted MRI revealed 3 concentric lesional zones at 48 hours with resolution of perilesional edema by 1 week. Acute ischemic infarction with macrophage infiltration was most prominent at 72 hours, with subsequent resolution of the inflammatory reaction and coalescence of the necrotic zone. There was no apparent difference in ischemic penumbra or "sharpness" between FUS or radiofrequency lesions. The radiosurgery lesions presented differently, with latent effects, less circumscribed lesions at 3 months, and apparent histological changes seen in white matter beyond the thalamic target. Additionally, thermal and radiation lesioning gradients were compared with modeling by dose to examine the theoretical penumbra. In swine thalamus, FUS and radiosurgery lesions evolve similarly as determined by MRI, histological examination, and theoretical modeling. Radiosurgery produces lesions with more delayed effects and seemed to result in changes in the white matter beyond the thalamic target.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Increased serum IL-17A and Th2 cytokine levels in patients with severe uncontrolled asthma.
Asthma is a syndrome of chronic bronchial inflammation and airway remodelling. Initially, asthma has been categorized into atopic and nonatopic types, based on antigen-specific IgE levels. Moreover, recently, asthma has been classified into different endotypes based on its pathophysiology, leading to the selection of the most optimal and effective therapies. Although T helper cell type 2 (Th2) cytokines were proven to play critical roles in atopic asthma, IL-17A has been reported to be involved in severe refractory asthma. In this study, we measured the levels of 24 cytokines/chemokines in the sera of healthy controls (HCs) (n = 34) and patients with asthma (n = 77), that were compared among patient groups with different disease activities and characteristics. The serum levels of nine cytokines were significantly higher in patients with asthma than in HCs, and the levels of IL-17A and SCF were significantly different between uncontrolled and well-controlled patient groups (p = 0.003). The IL-17A levels were significantly correlated with those of IL-4, IL-25, IL-10, and IFN-γ in patients with uncontrolled asthma, and the patients with the highest levels of all the above cytokines were refractory to high-dose of inhaled corticosteroid therapy and have a history of acute exacerbation within 1 year, requiring systemic steroid therapy. This study examines the profiles of upregulation and downregulation of various cytokines and chemokines in relation to asthmatic control status. IL-17A was significantly upregulated in patients with the uncontrolled and refractory status. Therefore, IL-17A may play important roles in asthmatic exacerbation, and its high level, in combination with upregulated Th2 and other cytokines, may indicate the refractory endotype of asthma.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Effect of vertical jumping on the medial gastrocnemius and soleus muscles of rats.
Ten rats were trained to perform approximately 30 jumps/day, 5 days/wk for at least 8 wk, from a force platform that enabled the number and height of jumps to be quantified. There was considerable variation in height jumped during an activity session both within and between rats. The two highest-jumping rats attained a displacement of center of mass of approximately 30 cm, estimated to be approximately 67% of the maximum attainable. The two lowest-jumping rats jumped to approximately 30% of the estimated maximum. The activity was described as "habitual activity" rather than "training" because there were no significant increases in the height of jumping by any rat over the period of activity. The isometric properties of medial gastrocnemius (MG) and soleus muscles were studied in terminal experiments on anesthetised rats. Five significant effects on MG were evoked by this pattern of exercise ("habituation"): 1) a 15-18% increase in force at frequencies of stimulation between 60 and 150 Hz and a 15% increase in maximum tetanic tension to 14.9 N, 2) a 3% increase in the maximum rate of rise of tetanic force to 3.4% of maximum tetanic tension per millisecond, 3) an increase in fatigability expressed as a smaller fatigue index in active rats (33%) than in controls (58%), 4) a decrease of 4% in the percentage of type IIa muscle fibers, and 5) an increase of 6% in the percentage of type II fibers that could not be classified with certainty as IIa or IIb.(ABSTRACT TRUNCATED AT 250 WORDS)
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Microfluidic paper-based chemiluminescence biosensor for simultaneous determination of glucose and uric acid.
In this study, a novel microfluidic paper-based chemiluminescence analytical device (μPCAD) with a simultaneous, rapid, sensitive and quantitative response for glucose and uric acid was designed. This novel lab-on-paper biosensor is based on oxidase enzyme reactions (glucose oxidase and urate oxidase, respectively) and the chemiluminescence reaction between a rhodanine derivative and generated hydrogen peroxide in an acid medium. The possible chemiluminescence assay principle of this μPCAD is explained. We found that the simultaneous determination of glucose and uric acid could be achieved by differing the distances that the glucose and uric acid samples traveled. This lab-on-paper biosensor could provide reproducible results upon storage at 4 °C for at least 10 weeks. The application test of our μPCAD was then successfully performed with the simultaneous determination of glucose and uric acid in artificial urine. This study shows the successful integration of the μPCAD and the chemiluminescence method will be an easy-to-use, inexpensive, and portable alternative for point-of-care monitoring.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Validation of a parent-proxy quality of life questionnaire for paediatric chronic cough (PC-QOL).
Quality of life (QOL) measures are an important patient-relevant outcome measure for clinical studies. Currently there is no fully validated cough-specific QOL measure for paediatrics. The objective of this study was to validate a cough-specific QOL questionnaire for paediatric use. 43 children (28 males, 15 females; median age 29 months, IQR 20-41 months) newly referred for chronic cough participated. One parent of each child completed the 27-item Parent Cough-Specific QOL questionnaire (PC-QOL), and the generic child (Pediatric QOL Inventory 4.0 (PedsQL)) and parent QOL questionnaires (SF-12) and two cough-related measures (visual analogue score and verbal category descriptive score) on two occasions separated by 2-3 weeks. Cough counts were also objectively measured on both occasions. Internal consistency for both the domains and total PC-QOL at both test times was excellent (Cronbach alpha range 0.70-0.97). Evidence for repeatability and criterion validity was established, with significant correlations over time and significant relationships with the cough measures. The PC-QOL was sensitive to change across the test times and these changes were significantly related to changes in cough measures (PC-QOL with: verbal category descriptive score, r(s)=-0.37, p=0.016; visual analogue score, r(s)=-0.47, p=0.003). Significant correlations of the difference scores for the social domain of the PC-QOL and the domain and total scores of the PedsQL were also noted (r(s)=0.46, p=0.034). The PC-QOL is a reliable and valid outcome measure that assesses QOL related to childhood cough at a given time point and measures changes in cough-specific QOL over time.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Conversion to mycophenolate mofetil monotherapy in liver recipients: Calcineurin inhibitor levels are key.
The use of calcineurin inhibitors (CNI) after liver transplantation is associated with post-transplant nephrotoxicity. Conversion to mycophenolate mofetil (MMF) monotherapy improves renal function, but is related to graft rejection in some recipients. Our aim was to identify variables associated with rejection after conversion to MMF monotherapy. Conversion was attempted in 40 liver transplant recipients. Clinical variables were determined and peripheral mononuclear blood cells were immunophenotyped during a 12-month follow-up. Conversion was classified as successful (SC) if rejection did not occur during the follow-up. MMF conversion was successful with 28 patients (70%) and was associated with higher glomerular filtration rates at the end of study. It also correlated with increased time elapsed since transplantation, low baseline CNI levels (Tacrolimus ≤ 6.5 ng/mL or Cyclosporine ≤ 635 ng/mL) and lower frequency of tacrolimus use. The only clinical variable independently related to SC in multivariate analysis was low baseline CNI levels (p = 0.02, OR: 6.93, 95%, CI: 1.3-29.7). Mean baseline fluorescent intensity of FOXP3+ T cells was significantly higher among recipients with SC. In conclusion, this study suggests that baseline CNI levels can be used to identify recipients with higher probability of SC to MMF monotherapy. Clinicaltrials.gov identification: NCT01321112.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Towards the phosphoproteome of trypanosomatids.
The identification and localization of protein phosphorylation sites provide clues to what proteins or pathways might be activated in a given condition, helping to improve our understanding about signaling networks. Advances in strategies for enrichment of phosphorylated peptides/proteins, mass spectrometry (MS) instrumentation, and specific MS techniques for identification and quantification of post-translational modifications have allowed for large-scale mapping of phosphorylation sites, promoting the field of phosphoproteomics. The great promise of phosphoproteomics is to unravel the dynamics of signaling networks, a layer of the emerging field of systems biology. Until a few years ago only a small number of phosphorylation sites had been described. Following large-scale trends, recent phosphoproteomic studies have reported the mapping of thousands of phosphorylation sites in trypanosomatids. However, quantitative information about the regulation of such sites in different conditions is still lacking. In this chapter, we provide a historical overview of phosphoproteomic studies for trypanosomatids and discuss some challenges and perspectives in the field.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
An audit of the completeness of non-melanoma skin cancer registration in Greater Glasgow.
The incidence of basal cell carcinoma and squamous cell carcinoma (non-melanoma skin cancer) is increasing in the U.K., and the importance of this has been recognized in the 'Health of the Nation' target of halting the annual increase in the incidence of skin cancer by the year 2005. An accurate assessment of incidence is necessary both in meeting this target and in planning skin cancer services. We have examined the ways in which basal cell carcinoma and squamous cell carcinoma are diagnosed and treated in Greater Glasgow and have determined how many of these tumours are, recorded by the West of Scotland Cancer Registry. Our results show that there is under-registration of both basal cell carcinoma and squamous cell carcinoma. Overall, 39 of 127 basal cell carcinomas (31%; 95% confidence interval [CI] 23-39%) and 11 of 25 squamous cell carcinomas (44%; CI 26-63%) were not registered by the cancer registry. We also showed that dermatologists rarely treat clinically suspicious tumours without obtaining pathological proof of the diagnosis. Accurate data collection by selected representative cancer registries is suggested as a possible solution.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Mycophenolic acid therapy after cyclophosphamide pulses in progressive IgA nephropathy.
In progressive IgA nephropathy (IgAN), cyclophosphamide or steroids have been used to reduce the loss of renal function, but disease progression may occur after the end of treatment. The value of mycophenolic acid (MPA) maintenance therapy following initial immunosuppression in progressive IgAN is largely unknown. In a prospective single-center trial, 20 patients with advanced IgAN (median glomerular filtration rate [GFR], 22 ml/min) and disease progression after cyclophosphamide pulse (CyP; n=18) or steroid pulse therapy (n=2) were treated with MPA for a median of 27 months. MPA dosages (initially mycophenolate mofetil 500 mg twice daily) were adjusted according to predose plasma concentrations (target concentrations 1.5 to 4 microg/mL). The course of renal function was assessed by linear regression of glomerular filtration rates. Median loss of renal function per month was significantly reduced from -0.8 ml/min to -0.03 ml/min per month after 6 months, to -0.05 ml/min per month after 12 months, and to -0.12 ml/min per month at the end of the study after median 27 months (p<0.05). An improved or stable GFR was observed in 16 of 20 patients during the first 12 months, and sustained in 10 patients during 24 months of follow-up. Proteinuria decreased significantly from 1.1 g/L to 0.4 g/L during MPA treatment (p=0.018). Our results indicate that MPA may be beneficial to slow down the loss of renal function in patients with progressive IgAN after previous immunosuppressive treatment.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Prevalence, awareness, treatment, and control of hypertension in the non-dialysis chronic kidney disease patients.
Data on the epidemiology of hypertension in Chinese non-dialysis chronic kidney disease (CKD) patients are limited. The aim of the present study was to investigate the prevalence, awareness, treatment, and control of hypertension in the non-dialysis CKD patients through a nationwide, multicenter study in China. The survey was performed in 61 tertiary hospitals in 31 provinces, municipalities, and autonomous regions in China (except Hong Kong, Macao, and Taiwan). Trained physicians collected demographic and clinical data and measured blood pressure (BP) using a standardized protocol. Hypertension was defined as systolic BP ≥ 140 mmHg and/or diastolic BP ≥ 90 mmHg, and/or use of antihypertensive medications. BP < 140/90 mmHg and < 130/80 mmHg were used as the 2 thresholds of hypertension control. In multivariate logistic regression with adjustment for sex and age, we analyzed the association between CKD stages and uncontrolled hypertension in non-dialysis CKD patients. The analysis included 8927 non-dialysis CKD patients. The prevalence, awareness, and treatment of hypertension in non-dialysis CKD patients were 67.3%, 85.8%, and 81.0%, respectively. Of hypertensive CKD patients, 33.1% and 14.1% had controlled BP to < 140/90 mmHg and < 130/80 mmHg, respectively. With successive CKD stages, the prevalence of hypertension in non-dialysis CKD patients increased, but the control of hypertension decreased (P < 0.001). When the threshold of BP < 130/80 mmHg was considered, the risk of uncontrolled hypertension in CKD 2, 3a, 3b, 4, and 5 stages increased 1.3, 1.4, 1.4, 2.5, and 4.0 times compared with CKD 1 stage, respectively (P < 0.05). Using the threshold of < 140/90 mmHg, the risk of uncontrolled hypertension increased in advanced stages (P < 0.05). The prevalence of hypertension Chinese non-dialysis CKD patients was high, and the hypertension control was suboptimal. With successive CKD stages, the risk of uncontrolled hypertension increased.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Affect and gender].
Studies about affect and differences with regards to gender and age throw little conclusive results. There is a certain agreement on stablishing a bifactorial structure that would integrate the different dimensions of affect. the aim is to analyze the distinguishing characteristics of affect in normal populations as a function of gender and age. 120 people of both sexes, between 18 and 50 years old, and divided into a young and an adult group are studied. men keep a longer continuity in their affect through their lives, while women have feelings of happiness and joy from their past, that turn into insecurity and sadness at their present. a distinguishing profile of affect with regards to gender and age can be stated.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Abdominal paracentesis].
Abdominal paracentesis is frequently performed in the clinical setting. Every newly developed ascites need to be investigated by abdominal paracentesis. Any clinical or biological deterioration in patients with chronic ascites also requires a new paracentesis. Therapeutically abdominal paracentesis is performed for refractory or symptomatic ascites. As other invasive procedures, it is critical to master its indications, contra-indications and complications. The aim of this article is to review the basics of abdominal paracentesis in order to help physicians to carry out this technical skill.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Enhanced high-harmonic generation up to the soft X-ray region driven by mid-infrared pulses mixed with their third harmonic.
We systematically study the efficiency enhancement of high-harmonic generation (HHG) in an Ar gas cell up to the soft X-ray (SXR) range using a two-color laser field composed of 2.1 μm (ω) and 700 nm (3ω) with parallel linear polarization. Our experiment follows the recent theoretical investigations that determined two-color mid-infrared (IR) pulses, mixed with their third harmonic (ω + 3ω), to be close to optimal driving waveforms for enhancing HHG efficiency in the SXR region [Jin et al., Nature Comm. 5, 4003 (2014)]. We observed sub-optical-cycle-dependent efficiency enhancements of up to 8.2 of photon flux integrated between 20 - 70 eV, and up to 2.2 between 85 - 205 eV. Enhancement of HHG efficiency was most pronounced for the lowest tested backing pressure (≈ 140 mbar), and decreased monotonically as the pressure was increased. The single-color (ω)-driven HHG was optimal at the highest backing pressure tested in the experiment (≈ 375 mbar). Our numerical simulations based on single-atom response and 3D pulse propagation show good qualitative agreement with experimental observations. The lower enhancement at high pressure and higher photon energy indicates that phase matching of two-color-driven HHG is more sensitive to ionization rate and pulse propagation effects than the single-color case. We show that with further improvements to the relative phase jitter and the spatio-temporal overlap of the two beams, the efficiency enhancement could be further improved by at least a factor of ≈ 2.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Reliability of one-piece ceramic implant.
The fundamental aspects of damage initiation and accumulation in one-piece zirconium oxide endosseous dental implants remain to be investigated. This study tested the null hypothesis that there is no influence on mouth-motion fatigue reliability and failure modes between as-received and after full crown preparation on one-piece ceramic implants. Forty-eight one-piece Y-TZP ceramic implants (Nobel Biocare, Goteborg, Sweden) were utilized. All specimens were embedded in acrylic resin exposing the first two threads at 30 degrees angulation with respect to the vertical axis (as per ISO specification 14801). Full crown preparations were performed following prosthodontic guidelines for half of the specimens. As-received and prepared specimens were distributed among three step-stress profiles based on the specimens ultimate fracture strength. Specimens were step-stress fatigued until failure or survival. A master Weibull curve was generated from the data and the reliability for completion of a mission of 50,000 cycles at 600 N load calculated. No differences between the groups' reliability was observed. Failure mode for both groups was similar, where cracks initiated mainly at the tensile bending side of the second thread's internal diameter. The low Weibull modulus (<1) indicates that fatigue (<150,000 cycles) did not influence failure. Failure depended upon the applied load. Crown preparation did not influence the reliability of the one-piece ceramic implant. The null hypothesis was accepted. Fatigue did not influence the life time of ceramic implants at loads under 600 N.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Human B Regulatory Cells: The New Players in Autoimmune Disease.
Although the production of antigen-specific antibodies has been the originally accepted function of B-cells during immune responses, specific subsets that can negatively regulate inflammation, designated regulatory B-cells (Bregs), have been identified recently. These immunosuppressive cells support tolerance, mainly through the production of interleukin 10 and other unconventional factors. There have been emerging data suggesting their importance in diverse normal and pathologic processes. Novel and in development B-cell targeted therapies seem to be ideal treatments for different types of diseasessuch as cancer and allergy. Here, we discuss the current knowledge on the implication of Bregs in autoimmunity- elated diseases, highlighting the importance of these cells for the development of novel strategies in the treatment of these pathologies.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Pretreatment of old-age landfill leachate by microwave-assisted catalytic oxidation in the presence of activated carbon.
Landfill leachate is posing an ever-greater environmental hazard. Recently, a process for purification combining activated carbon, microwave (MW) and Fenton oxidation has drawn much attention. In this study, the effectiveness of this process for the pretreatment of an old-age landfill leachate was tested. The effects of various parameters were investigated and the optimal condition included as follows: MW energy density, 6 W/mL; MW power, 300 W; radiation time, 8 min; H2O2 dosage, 0.1 mol/L; Fe(2+)-EDTA dosage, 0.02 mol/L; granular activated carbon (GAC) dosage, 6 g/L. Within the present experimental condition applied, the chemical oxygen demand (COD) removal reached 56.5%, and the ratio of 5-day biochemical oxygen demand to chemical oxygen demand (BOD5/COD) was enhanced from 0.122 to 0.462. Comparing with GAC, MW and Fenton alone or the combinations of any two of them, MW/Fenton/GAC displayed superior treatment efficiency. The MW/Fenton/GAC process is believed to be a promising pretreatment technology for biorefractory old-age landfill leachate.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Estrogen effects on actin cytoskeletal and endocytic proteins associated with tubulobulbar complex disruption in rat testes.
Tubulobulbar complexes (TBCs), evaginations of mature spermatids, penetrate into the surrounding Sertoli cell cytoplasm of testis seminiferous epithelium during rat spermatogenesis. These structures prepare mature spermatids for their release into the seminiferous tubular lumen via a process called spermiation. Based on their functions of transient attachment and endocytosis, many actin-regulatory and endocytic proteins are associated with TBCs. Previously, exogenous 17β-estradiol administration to adult male rats showed spermiation failure that was attributed to TBC disruption. To determine the molecular basis of estrogen-induced TBC disruption, we examined the expressions and localizations of actin-regulatory proteins, endocytic proteins, Rho-GTPases, and phosphorylation in TBCs during sperm release. Results demonstrated absence of neural Wiscott Aldrich syndrome protein, cortactin, adaptor-related protein complex 2 sigma-1 subunit, dynamin 2, cell division control protein 42, and phosphocortactin in the concavity of spermatid head where TBCs are present without change in their protein expression levels. Absence of these proteins could have led to collapse of the TBC structure which is involved in its formation and function.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A phase I toxicity, pharmacology, and dosimetry trial of monoclonal antibody OKB7 in patients with non-Hodgkin's lymphoma: effects of tumor burden and antigen expression.
Eighteen patients with relapsed non-Hodgkin's lymphoma (NHL) were infused with escalating doses of monoclonal antibody (mAb) OKB7, trace-labeled with iodine-131 (131I), in order to study toxicity, pharmacology, antibody localization, and dosimetry of radioiodine. OKB7 is a noncytotoxic mouse immunoglobulin G2b (IgG2b) mAb reactive with B cells and most B-cell NHL. Three patients each were treated at six dose levels ranging from 0.1 mg to 40 mg. All patients had radionuclide imaging and counting daily, had serial blood sampling to study pharmacokinetics, human antimouse antibody (HAMA), and circulating antigen, and had a biopsy of accessible lymphoma to determine delivery of isotope to tumors and assess the effect of tumor antigen expression on mAb delivery. Bone marrow biopsies were also done in the majority of patients. There was no toxicity. Serum clearance showed a median early phase half-life of 1.9 hours and a later phase half-life of 21.7 hours. Median total body clearance half-life was 22 hours. Pharmacokinetics were not dose-related. HAMA was detected in five patients. Circulating blocking antigen was detected in the serum of four patients, but at levels that were of pharmacologic consequence only in one. Biopsied tumor tissue from five patients did not express OKB7 antigen. No significant uptake of antibody was seen in these tumor sites. Mean total uptake of isotope into lymphoma measured in biopsies correlated linearly over the 400-fold increase in injected mAb dose. However, the percent of injected dose found per gram of tumor was unrelated to dose, but correlated inversely with tumor burden. In two patients with minimal tumor burden, 1.0 mg and 5.0 mg doses of OKB7 resulted in tumor to body radioisotope dose ratios of 22 and 7, which would theoretically permit tolerable delivery of 4,400 and 1,400 rads to these tumors, respectively, if OKB7 were conjugated with higher doses of 131I.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Editorial Commentary: Postoperative Outcomes-Are We Asking the Right Questions? Shoulder Arthroscopy Patient Quality of Life Correlates With Joint-Specific Outcome and Is Predicated on Patient Expectation.
Patient-reported outcomes are, by definition, subjective, and there is consensus that individual patient expectations have a significant effect on the postoperative outcome after shoulder arthroscopy. Most of the outcomes in orthopaedic surgery are measured either in terms of functional scores assessing only one joint or as disease or condition-specific outcomes. As such, there exists a growing interest developing better tools to measure quality-of-life outcome scores as an assessment of overall patient health and satisfaction. Recent research shows that quality-of-life outcome measures correlate with joint-specific and functional outcomes after arthroscopic Bankart repair. We also personally believe that quality-of-life scores should become a standard outcome assessment measurement in orthopaedic surgery because while we perform surgery on the joint, we take care of the whole patient.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Decreased frequency and duration of tooth brushing is a risk factor for endothelial dysfunction.
Periodontal disease is associated with endothelial dysfunction, leading to cardiovascular disease. The effect of detailed tooth brushing behavior, not only frequency but also duration of tooth brushing, on endothelial function is unclear. The purpose of this study was to evaluate the relationships of detailed methods of tooth brushing with vascular function. We evaluated flow-mediated vasodilation (FMD), nitroglycerine-induced vasodilation, and frequency and duration of tooth brushing in 896 subjects. We divided the subjects into three groups according to the frequency and duration of tooth brushing: low frequency and short duration group (<twice/day and <2min/procedure), low frequency or short duration group (<twice/day or <2min/procedure), non-low frequency and non-short duration group (≥twice/day and ≥2min/procedure). FMD in the low frequency and short duration group was significantly lower than FMD in the low frequency or short duration group and FMD in the non-low frequency and non-short duration group [3.1 (2.7)% vs. 4.2 (3.1)% and 4.7 (3.1)%, P=0.001 and <0.001, respectively]. Nitroglycerine-induced vasodilation was similar in the three groups. Using the non-low frequency and non-short duration group as the reference, the low frequency and short duration of tooth brushing group was significantly associated with an increased odds ratio of a low FMD tertile after adjustment for conventional risk factors (OR: 2.25, 95% CI: 1.39-3.59; P<0.001). These findings suggest that low frequency and short duration of tooth brushing are associated with endothelial dysfunction. URL for clinical trial: http://UMIN; registration number for clinical trial: UMIN000003409.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Ca2+ uptake by the sarcoplasmic reticulum decreases the amplitude of depolarization-dependent [Ca2+]i transients in rat gastric myocytes.
Gastric myocytes loaded with fura-2 were voltage-clamped at -60 mV. Depolarizations to 0 mV evoked nifedipine-sensitive (5 microM) inward currents and Ca2+ transients. Cyclopiazonic acid (5 microM) elevated steady-state [Ca2+]i and reduced Ca current (ICa), but when divalent cations were omitted from the extracellular solution, cyclopiazonic acid had no effect on either the amplitude or the current-voltage relationship of the nifedipine-sensitive current. This suggests that the reduction in ICa was caused by the rise in steady-state [Ca2+]i. The relationship between the total Ca2+ influx carried by the Ca2+ current (sigmaI(Ca).dt) and the amplitude of the Ca2+ transient (delta[Ca2+]i) was analysed for experiments using physiological Ca2+ solutions by calculating the ratio delta[Ca2+]i/sigmaI(Ca).dt. Cyclopiazonic acid (5 microM) and ryanodine (10 microM) both increased this ratio, indicating a decrease in the buffering power of the cell. Mimicking the increase in steady-state [Ca2+]i produced by these agents by changing the holding potential to -40 mV, however, did not affect delta[Ca2+]i/sigmaI(Ca).dt. It was concluded that up-take by a ryanodine-sensitive store normally limits Ca2+ distribution to the bulk cytoplasm following entry to the cell through dihydropyridine-sensitive channels.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Detection of telomerase-positive circulating epithelial cells in ovarian cancer patients.
The aim of this study is the detection of circulating tumor cells in peripheral blood of ovarian cancer patients. We applied immunomagnetic beads coated with an epithelial or leukocyte-specific antibody to isolate epithelial cells from peripheral blood and we measured their telomerase activity. Both enrichment methods showed high sensitivity and specificity to isolate ovarian tumor cells from peripheral blood. Our data also suggested that disseminated ovarian tumor cells isolated from ascites consistently express telomerase enzyme. We have tested epithelial cell enriched blood samples from 20 stage III patients, 8 stage IV patients and 30 healthy volunteers for telomerase activity. Telomerase activity was detectable in the blood samples of all stage IV patients (100%) and seven stage m patients (35%), but none of the healthy donors. Our results showed that CA-125 level, an established diagnostic marker for ovarian cancer, is significantly higher in telomerase-positive patients than telomerase-negative patients. In summary, our data demonstrated that this non-invasive blood test is sensitive and specific for detecting disseminated ovarian epithelial cells and telomerase is a potential marker for the detection of circulating ovarian tumor cells.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Erratum to: inhibition of triclabendazole metabolism in vitro by ketoconazole increases disruption to the tegument of a triclabendazole-resistant isolate of Fasciola hepatica.
A study has been carried out to investigate whether the action of triclabendazole (TCBZ) against Fasciola hepatica is altered by inhibition of drug metabolism. The cytochrome P450 (CYP 450) enzyme pathway was inhibited using ketoconazole (KTZ) to see whether a TCBZ-resistant isolate could be made more sensitive to TCBZ action. The Oberon TCBZ-resistant and Cullompton TCBZ-susceptible isolates were used for these experiments. The CYP 450 system was inhibited by a 2-h pre-incubation in ketoconazole (40 μM), then incubated for a further 22 h in NCTC medium containing either KTZ, KTZ + nicotinamide adenine dinucleotide phosphate (NADPH) (1 nM), KTZ + NADPH + TCBZ (15 μg/ml), or KTZ + NADPH + triclabendazole sulphoxide (TCBZ.SO; 15 μg/ml). Changes to fluke ultrastructure following drug treatment and metabolic inhibition were assessed using transmission electron microscopy. After treatment with either TCBZ or TCBZ.SO on their own, there was greater disruption to the TCBZ-susceptible than TCBZ-resistant isolate. However, co-incubation with KTZ + TCBZ, but more particularly KTZ + TCBZ.SO, led to more severe changes to the TCBZ-resistant isolate than with each drug on its own: for example, there was severe swelling of the basal infolds and their associated mucopolysaccharide masses, accompanied by an accumulation of secretory bodies just below the apex. Golgi complexes were greatly reduced or absent in the tegumental cells and the synthesis, production, and transport of secretory bodies were badly disrupted. With the TCBZ-susceptible Cullompton isolate, there was limited potentiation of drug action. The results support the concept of altered drug metabolism in TCBZ-resistant flukes and this process may play a role in the development of drug resistance.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Mechanism of protective effects of procyanidins on liver injury induced by alcohol in mice].
To study the mechanism of protective effects of procyanidins on liver injury model induced by alcohol in mice. Mice were divided into 3 groups to set up the model of liver injury induced by alcohol in mice: the group of liver injury induced by alcohol, the group of procyanidins with low doses (100mg/kg), the group of procyanidins with high doses(300mg/kg). Then established normal group of control. The model of liver injury induced by alcohol in mice was used to investigate the protective effects at low and high doses procyanidins in serum indicated by alanine aminotransferase (ALT), asparate aminotransferase (AST) and in liver homogenate indicated by malonaldehyde (MDA), superoxide dismutase (SOD), reactive oxygen species (ROS). The levels of Cu,Zn-SOD mRNA in hepatic tissue and toll like receptor 4 (TLR4) mRNA were determined by using reverse transcription polymerase chain reaction (RT-PCR) technique. The procyanidins with low and high doses could reduce ALT, MDA, ROS content and increase SOD level, up-regulate the expression of Cu, Zn-SOD mRNA and down-regulate the expression of TLR4 mRNA. Mechanism of the protective effects on liver injuries of mice induced by alcoholmay be associated with promoting the expression of Cu, Zn-SOD and suppressing the expression of TLR4 mRNA.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Relation of rifle stock length and weight to military rifle marksmanship performance by men and women.
15 male and 13 female soldiers participated in a study to examine the effects of sex, rifle stock length 117.8 cm, 22.3 cm, and 26.2 cm), and rifle weight (3.2 kg vs 3.8 kg) on military marksmanship performance. The Noptel simulator was used to assess marksmanship accuracy (proximity of shots to the target center) and precision (proximity of shots to one another regardless of proximity to the target center). There were no significant differences in either measure of marksmanship performance as a function of sex. Marksmanship accuracy was significantly better with the shortest rifle stock, and marksmanship precision was significantly better with the lighter rifle. Regardless of the sex of the shooter, stock length and weapon weight should be considered in any new combat rifle design as these results indicate they significantly affect marksmanship.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Evaluating bevacizumab in combination with FOLFIRI after the failure of platinum-etoposide regimen in patients with advanced poorly differentiated neuroendocrine carcinoma: The PRODIGE 41-BEVANEC randomized phase II study.
Patients with gastroenteropancreatic (GEP), metastatic or locally advanced, non-resectable, grade 3 poorly-differentiated neuroendocrine carcinoma (NEC) are treated with cisplatin (or carboplatin)-etoposide in first-line palliative chemotherapy (CT1). However, nearly all patients will develop resistance and there is no standard second-line treatment. PRODIGE 41-BEVANEC is an academic randomized, phase II study designed to evaluate the efficacy of bevacizumab in combination with FOLFIRI after failure of CT1 in unknown primary NEC and GEP-NEC. The main eligibility criteria are age ≥18 years, metastatic (synchronous or metachronous) or locally advanced, non-resectable, grade 3 GEP-NEC, and documented progressive disease during or after CT1 therapy. A total of 124 patients will be randomly assigned (1:1) to receive either 5 mg/kg bevacizumab with FOLFIRI, or FOLFIRI alone, every 14 days until disease progression or unacceptable toxicity. The hypothesis is to demonstrate a 6-month overall survival for at least 50% of the patients in bevacizumab arm versus 35% in the control arm (FOLFIRI alone). Secondary endpoints are objective response, response duration, progression-free survival, toxicity, and biochemical response. The study is currently opened in France (NCT02820857). The first patient was randomized on September 6, 2017.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Biological functions and clinical applications of exosomal non-coding RNAs in hepatocellular carcinoma.
Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide, with a high mortality rate. Its dismal prognosis is attributed to late diagnosis, high risk of recurrence and drug resistance. To improve the survival of patients with HCC, new approaches are required for early diagnosis, real-time monitoring and effective treatment. Exosomes are small membranous vesicles released by most cells that contain biological molecules and play a great role in intercellular communication under physiological or pathological conditions. In cancer, exosomes from tumor cells or non-tumor cells can be taken up by neighboring or distant target cells, and the cargoes in exosomes are functional to modulate the behaviors of tumors or reshape tumor microenvironment (TME). As essential components, non-coding RNAs (ncRNAs) are selectively enriched in exosomes, and exosomal ncRNAs participate in regulating specific aspects of tumor development, including tumorigenesis, tumor metastasis, angiogenesis, immunomodulation and drug resistance. Besides, dysregulated exosomal ncRNAs have emerged as potential biomarkers, and exosomes can serve as natural vehicles to deliver tumor-suppressed ncRNAs for treatment. In this review, we briefly summarize the biology of exosomes, the functions of exosomal ncRNAs in HCC development and their potential clinical applications, including as biomarkers and therapeutic tools.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study.
Chronic fatigue syndrome (CFS) patients frequently describe difficulties with repeat exercise. Here, we explore muscle bioenergetic function in response to three bouts of exercise. A total of 18 CFS (CDC 1994) patients and 12 sedentary controls underwent assessment of maximal voluntary contraction (MVC), repeat exercise with magnetic resonance spectroscopy and cardio-respiratory fitness test to determine anaerobic threshold. Chronic fatigue syndrome patients undertaking MVC fell into two distinct groups: 8 (45%) showed normal PCr depletion in response to exercise at 35% of MVC (PCr depletion >33%; lower 95% CI for controls); 10 CFS patients had low PCr depletion (generating abnormally low MVC values). The CFS whole group exhibited significantly reduced anaerobic threshold, heart rate, VO(2) , VO(2) peak and peak work compared to controls. Resting muscle pH was similar in controls and both CFS patient groups. However, the CFS group achieving normal PCr depletion values showed increased intramuscular acidosis compared to controls after similar work after each of the three exercise periods with no apparent reduction in acidosis with repeat exercise of the type reported in normal subjects. This CFS group also exhibited significant prolongation (almost 4-fold) of the time taken for pH to recover to baseline. When exercising to comparable levels to normal controls, CFS patients exhibit profound abnormality in bioenergetic function and response to it. Although exercise intervention is the logical treatment for patients showing acidosis, any trial must exclude subjects who do not initiate exercise as they will not benefit. This potentially explains previous mixed results in CFS exercise trials.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Pharmacokinetic-pharmacodynamic analyses of antihypertensive drugs, nifedipine and propranolol, in spontaneously hypertensive rats to investigate characteristics of effect and side effects.
To investigate the relationship between the pharmacokinetics (PK) and effects and/or side-effects of nifedipine and propranolol, simultaneous examination of their PK and pharmacodynamics (PD), namely blood pressure (BP), heart rate (HR), and QT interval (QT), were assessed in spontaneously hypertensive rats as a disease model. Drugs were infused intravenously for 30 min, then plasma PK and hemodynamic effects were monitored. After general two-compartmental analysis was applied to the plasma data, PD parameters were calculated by fitting the data to PK-PD models. After nifedipine administration, the maximal hypotensive effect appeared about 10 min after starting the infusion, then BP started to elevate although the plasma concentration increased, supposedly because of a negative feedback mechanism generated from the homeostatic mechanism. After propranolol administration, HR decreased by half, and this bradycardic effect was greater than that with nifedipine. Wide variation in QT was observed when the propranolol concentration exceeded 700 ng/mL. This variation may have been caused by arrhythmia. Prolongation of QT with propranolol was greater than that with nifedipine, and bradycardia was slower than the concentration increase and QT prolongation. The characteristically designed PK-PD model incorporating a negative feedback system could be adequately and simultaneously fitted to both observed effect and side-effects.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Serotonergic mechanisms on breathing modulation in the rat locus coeruleus.
The locus coeruleus (LC) is a noradrenergic nucleus that plays an important role in the ventilatory response to hypercapnia. This nucleus is densely innervated by serotonergic fibers and contains high density of serotonin (5-HT) receptors, including 5-HT(1A) and 5-HT(2). We assessed the possible modulation of respiratory response to hypercapnia by 5-HT, through 5-HT(1A) and 5-HT(2) receptors, in the LC. To this end, we determined the concentrations of 5-HT and its metabolite 5-hydroxyindole-3-acetic acid (5-HIAA) in the LC after hypercapnic exposure. Pulmonary ventilation (VE: , plethysmograph) was measured before and after unilateral microinjection (100 nL) of WAY-100635 (5-HT(1A) antagonist, 5.6 and 56 mM), 8-OHDPAT (5-HT(1A/7) agonist, 7 and 15 mM), Ketanserin (5-HT(2A) antagonist, 3.7 and 37 mM), or (+/-)-2,5-dimethoxy-4-iodoamphetaminehydrochloride (DOI; 5-HT(2A) agonist, 6.7 and 67 mM) into the LC, followed by a 60-min period of 7% CO(2) exposure. Hypercapnia increased 5-HTIAA levels and 5-HIAA/5-HT ratio within the LC. WAY-100635 and 8-OHDPAT intra-LC decreased the hypercapnic ventilatory response due to a lower tidal volume. Ketanserin increased CO(2) drive to breathing and DOI caused the opposite response, both acting on tidal volume. The current results provide evidence of increased 5-HT release during hypercapnia in the LC and that 5-HT presents an inhibitory modulation of the stimulatory role of LC on hypercapnic ventilatory response, acting through postsynaptic 5-HT(2A) receptors in this nucleus. In addition, hypercapnic responses seem to be also regulated by presynaptic 5-HT(1A) receptors in the LC.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Circulatory mobility in post-Mao China: temporary migrants in Kaiping county, Pearl River Delta region.
"Since the 1980s, it has been possible for the Chinese peasant household to diversify its economic base by making use of its social networks to place members in a distant community as migrant workers. Through a microstudy of 50 such migrants in Kaiping County in the Pearl River Delta region, this article illustrates the interplay between macro, meso, and micro factors in the causes and processes of circulatory mobility in post-Mao China. It is found that Hong Kong's search for cheap labor, the PRC's household registration system, and Kaiping's strong localism provide the context in which migrants and their households have to adjust. The particular behavior pattern of these migrants also bears the stamp of their rational household decision-making processes as well as their feelings of moral obligation toward their kin in their community of origin."
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Sahara honey shows higher potency against Pseudomonas aeruginosa compared to north Algerian types of honey.
Six varieties of honey from different regions in Algeria were used to determine their potency against Pseudomonas aeruginosa. Four varieties originated from northern Algeria, and two from the Sahara. Three types of media were used. On nutrient agar the minimum inhibitory concentration (MIC) of the four northern varieties ranged between 30% (vol/vol) and 31% (vol/vol), while the MIC of the Sahara varieties was 11% (vol/vol) and 14% (vol/vol). On King A agar the MIC of the four northern varieties ranged from 25% (vol/vol) to 31% (vol/vol), whereas the MIC of the two varieties of Sahara honey was 12% (vol/vol) and 15% (vol/vol). On nutrient broth the MIC of the northern varieties ranged from 10% (vol/vol) to 21% (vol/vol), whereas the MIC of the two varieties of Sahara honey was 9% (vol/vol). The botanic flora of Sahara is known in Algeria for its medicinal uses, and thus the higher potency of the Sahara honey is most probably due to antibacterial substances in its plant derivates. These findings suggest that Sahara honey could be used for managing wounds and burns, which are mostly infected by P. aeruginosa.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A single-centre experience of relaparoscopy in complications of laparoscopic inguinal hernia repair-feasibility and outcomes.
Management of complications of laparoscopic inguinal hernia repair remains challenging as well as debatable. Relaparoscopy in management of these complications is relatively newer concept. We tried to analyse the feasibility of relaparoscopy (transabdominal preperitoneal approach) in management of complications of laparoscopic inguinal hernia repair. The study group included 61 patients (referral cases) from a prospectively maintained database of previous laparoscopic inguinal hernia surgery with majority of the patients of recurrence (n = 39). Other complications were mesh infections (n = 15), pubic osteitis (n = 3), migration of mesh into adjacent viscera (n = 3) and meralgia paresthetica (n = 1). All patients underwent transabdominal preperitoneal approach (TAPP) between January 2007 and December 2013. Most of the patients had previous TEP repair (n = 49) with variable complications detected in the range of 9 days to 38 months. Small-sized mesh (n = 12) and rolled up mesh (n = 10) were the causes of recurrence in 57 % cases. Mycobacterium tuberculosis (40 %) and mixed bacterial infections (33 %) strains were detected in the infected mesh. Pubic osteitis and meralgia paresthetica were tackers induced. All patients dealt with TAPP approach. Recurrent hernia cases underwent mesh placement and infected mesh was removed in mesh infection. Tackers were removed in cases of osteitis pubis and meralgia paraesthesia. Median operative time was 62 min (42-126 min) and hospital stay 3 days (2-13 days). The relaparoscopy was accomplished in 95.1 % of cases with no major intraoperative complications and minimal postoperative morbidity. Relaparoscopy through TAPP approach remains safe and feasible option to deal with primary laparoscopic hernia repair complications. Surgical techniques during primary laparoscopic repair are important cause for aforementioned complications. Though, surgical expertize remains warranted for relaparoscopy.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Significance of detection of specific IgE in Anisakis-related diseases].
Anisakis larvae which parasitize sea fishes sometimes cause not only anisakiasis but also such allergic reactions as mackerel-induced urticaria. We prepared AlaSTAT by using excretory/secretory antigens from Anisakis larvae to detect specific IgE in various patients groups. The AlaSTAT positive rate was 87.5% in gastric anisakiasis patients who were endoscopically diagnosed, while it was 66.7% in patients who had acute abdominal pain but no larva detected. Ascariasis in the common bile duct was 0%. The positive rate in mackerel-induced urticaria patients was 75.0%, while it was 8.3% and 10.0% in patients with urticaria of unknown origin and normal controls, respectively. Based on these data, the detection of specific IgE using AlaSTAT is useful in elucidating the cause of urticaria or acute abdominal pain, such as Anisakis.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The in vitro selection world.
Through iterative cycles of selection, amplification, and mutagenesis, in vitro selection provides the ability to isolate molecules of desired properties and function from large pools (libraries) of random molecules with as many as 10(16) distinct species. This review, in recognition of a quarter of century of scientific discoveries made through in vitro selection, starts with a brief overview of the method and its history. It further covers recent developments in in vitro selection with a focus on tools that enhance the capabilities of in vitro selection and its expansion from being purely a nucleic acids selection to that of polypeptides and proteins. In addition, we cover how next generation sequencing and modern biological computational tools are being used to complement in vitro selection experiments. On the very least, sequencing and computational tools can translate the large volume of information associated with in vitro selection experiments to manageable, analyzable, and exploitable information. Finally, in vivo selection is briefly compared and contrasted to in vitro selection to highlight the unique capabilities of each method.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Scar appearance of different skin and subcutaneous tissue closure techniques in caesarean section: a randomized study.
To determine the role of skin and subcutaneous space closure in caesarean section on the cosmetic appearance of the scar and the patients' satisfaction. 153 patients undergoing caesarean section without prior abdominal delivery were included and randomly assigned in a non-blinded study to four different combinations of skin and subcutaneous tissue closure. The scar was assessed after a period of at least 4 months by a self-developed protocol and the patient was asked to complete a survey regarding her satisfaction with the scar. One hundred patients were eligible for long-term evaluation of the scar. Skin closure by either staples or intracutaneous suture in combination with closure or non-closure of the subcutaneous space has a comparable outcome in view of cosmetic outcome and patient satisfaction. All four methods of skin closure seem to be a reasonable choice in caesarean section because they have comparable cosmetic outcome, do not differ with respect to the patients' satisfaction and bear comparable costs.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
QSAR Models for the Reactivation of Sarin Inhibited AChE by Quaternary Pyridinium Oximes Based on Monte Carlo Method.
For three random splits, one-variable models of oximes reactivation of sarin inhibited acetylcholinesterase (logarithm of the AChE reactivation percentage by oximes with concentration of 0.001 M) have been calculated with CORAL software. The total number of considered oximes was 42. Simplified molecular input line entry system (SMILES) and hydrogen-suppressed graph (HSG) are used to represent the molecular structure. Using CORAL software by means of the calculation with Monte Carlo optimization of the so called correlation weights for the molecular fragments, optimal SMILES-based descriptors were defined, which are correlated with an endpoint for the training set. The predictability of these descriptors for an external test are estimated. In this study hybrid representation HSG together with SMILES was used. The "classic" scheme (i.e. split data into the training set and test set) of building up quantitative structure-activity relationships was employed. Computational experiments indicated that this approach can satisfactorily predict the desired endpoint. Best model had following statistical characteristics n=32, r2= 0.6012, s= 0.279, F= 45 for training and n=10, r2= 0.9301, s= 0.076, Rm2=0.9206 for test set.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Body mass index growth curves for Chinese children and adolescents aged 0 to 18 years].
To construct the body mass index (BMI) reference data and curves for Chinese children and adolescents from birth to 18 years of age. Data from two national representative cross-sectional surveys which were The National Growth Survey of Children under 7 years in the Nine Cities of China in 2005 and The Physical Fitness and Health Surveillance of Chinese School Students in 2005. Height (length was measured for children under 3 years) and weight data of 93,702 urban healthy children from nine cities/provinces used to calculate the BMI. The LMS method was used to smooth the BMI, with estimates of L, M, and S parameters, values of percentile and Z-score curves which were required were calculated, and then standardized growth charts were generated. Adult cut-offs for overweight and obesity at 18 years was used to study the cut-offs for children 2 to 18 years of age. The smoothed percentiles and Z-scores reference data and curves of BMI-for-age for boys and girls aged 0-18 years were made out respectively. BMI cut-off values for overweight and obesity for children from 2 to 18 years of age were also defined. At 18 years, the BMI values are equivalent to the overweight cut-off (> or =24 kg/m2) and obesity cut-off (> or =28 kg/m2) for Chinese adults. Comparison with the reference of the WHO and 2000 CDC for the United States, there were some difference among them, at the 97th percentile curve there was a big difference between Chinese and U. S. adolescents. On the whole, the China BMI curve for boys was higher than the new WHO curve and lower than 2000 CDC at 97 percentile curve, but the China BMI curve for girls was lowest among the three curves. There was also significant difference between China and Japan BMI values at 97 percentile curve. BMI growth curves are very useful in child growth monitoring and nutritional surveillance, discovering overweight and obesity. The BMI growth charts are recommended for use in pediatric clinic and public health service.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Short hairpin RNA-induced myostatin gene silencing in caprine myoblast cells in vitro.
Myostatin (MSTN) belongs to the transforming growth factor (TGF)-β superfamily and is a potent negative regulator of skeletal muscle development and growth. Dysfunction of MSTN gene either by natural mutation or induced through genetic manipulation (knockout or knockdown) has been reported to increase the remarkable muscle mass in mammalian species. RNA interference (RNAi) is the most promising method for inhibition of gene expression that can be utilized for MSTN gene knockdown by developing short hairpin RNA (shRNA) construct against it. We utilized three antisense RNA expressing vectors with six constructs to knockdown MSTN gene in in vitro caprine myoblast cell culture system. We observed that all six shRNA constructs were successful in MSTN silencing with efficiency ranging from 7 to 46 % by quantitative real-time PCR and up to 19 % by western blotting. The significant upregulation of interferon response gene OAS1 (5- to 11-fold) in cells transfected with shRNA constructs were indicative of induction of interferon response. This RNAi-based method of increasing muscle mass could provide an alternative strategy to gene knockout methods for improving the production traits and economic properties of livestock.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Ancestral echinoderms from the Chengjiang deposits of China.
Deuterostomes are a remarkably diverse super-phylum, including not only the chordates (to which we belong) but groups as disparate as the echinoderms and the hemichordates. The phylogeny of deuterostomes is now achieving some degree of stability, especially on account of new molecular data, but this leaves as conjectural the appearance of extinct intermediate forms that would throw light on the sequence of evolutionary events leading to the extant groups. Such data can be supplied from the fossil record, notably those deposits with exceptional soft-part preservation. Excavations near Kunming in southwestern China have revealed a variety of remarkable early deuterostomes, including the vetulicolians and yunnanozoans. Here we describe a new group, the vetulocystids. They appear to have similarities not only to the vetulicolians but also to the homalozoans, a bizarre group of primitive echinoderms whose phylogenetic position has been highly controversial.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Significant histamine formation in tuna (Thunnus albacares) at 2 degrees C--effect of vacuum- and modified atmosphere-packaging on psychrotolerant bacteria.
Occurrence and importance of psychrotolerant histamine producing bacteria in chilled fresh tuna were demonstrated in the present study. The objective was to evaluate microbial formation of histamine and biogenic amines in chilled fresh tuna from the Indian Ocean and stored either vacuum-packed (VP) or modified atmosphere-packed (MAP). Firstly, biogenic amines and the dominating microbiota were determined in VP tuna involved in an outbreak of histamine fish poisoning in Denmark. Secondly, the microbiota of fresh MAP tuna was evaluated at the time of processing in Sri Lanka and chemical, microbial and sensory changes were evaluated during storage at 1-3 degrees C. To explain the results obtained with naturally contaminated tuna the effect of VP and MAP on biogenic amine formation by psychrotolerant bacteria was evaluated in challenge tests at 2 degrees C and 10 degrees C. The VP tuna that caused histamine fish poisoning had a histamine concentration of >7000 mg/kg and this high concentration was most likely produced by psychrotolerant Morganella morganii-like bacteria or by Photobacterium phosphoreum. Similar psychrotolerant M. morganii-like bacteria dominated the spoilage microbiota of fresh MAP tuna with 60% CO2/40% N2 and formed >5000 mg/kg of histamine after 24 days at 1.7 degrees C. These psychrotolerant bacteria were biochemically similar to M. morganii subsp. morganii and their 16S rDNA (1495 bp) showed >98% sequence similarity to the type strain of this species. Toxic concentrations of histamine were produced at 2.1 degrees C in inoculated VP tuna by both the psychrotolerant M. morganii-like bacteria (7400+/-1050 mg/kg) and P. phosphoreum (4250+/-2050 mg/kg). Interestingly, MAP with 40% CO2/60% O2, in challenge tests, had a strong inhibitory effect on growth and histamine formation by both the psychrotolerant M. morganii-like bacteria and P. phosphoreum. In agreement with this, no formation of histamine was found in naturally contaminated fresh MAP tuna with 40% CO2/60% O2 during 28 days of storage at 1.0 degrees C. To reduce current problems with histamine fish poisoning due to VP tuna it is suggested, for lean tuna loins, to replace vacuum packaging with MAP containing approximately 40% CO2 and approximately 60% O2.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A Guideline for Tailoring Lattice Oxygen Activity in Lithium-Rich Layered Cathodes by Strain.
Lattice oxygen activity plays a dominant role in balancing discharge capacity and performance decay of lithium-rich layered oxide cathodes (LLOs). On the basis of density functional theory (DFT) and tight-binding theory, the activity of lattice oxygen can be improved by tensile strain and suppressed by compressive strain. To verify this conclusion, LLOs with large lattice parameters (L-LLOs) were synthesized taking advantage of the lattice expansion effect in nanomaterials. Compared with conventional LLOs with small lattice parameters (S-LLOs), particles in L-LLOs are imposed by tensile strain. L-LLOs show a larger initial discharge capacity and decay faster in the prolonged cycles than S-LLOs. Actually, most of the modified methods in LLOs can come down to strain-induced changes in lattice parameters. We believe this conclusion is a useful guideline to understand and tailor the lattice oxygen activity and may be generalized to other layered oxide cathodes involving anionic redox.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Clinical pharmacology of flumazenil.
(1) Flumazenil is a highly specific benzodiazepine (BZ) antagonist. It exerts its effect by competitive interaction at the BZ receptor site. (ii) Flumazenil antagonizes all central BZ effects irrespective of its contiguity to the BZ administration. (iii) The pharmacological effect of flumazenil depends upon the number of BZ receptors that can be occupied by flumazenil according to the mass-action law. Receptor occupancy is determined by the affinity of the BZ for the receptor and the free BZ concentration near the receptor. (iv) The minimal effective dose of flumazenil is 0.2 mg. After extreme BZ overdose 1 mg may be needed. (v) The optimal dosing strategy starts with an initial dose of flumazenil 0.2 mg i.v. The administration of further low doses of 0.1 mg at 1-min intervals allows the interruption of the injection of flumazenil exactly at the stage of vigilance that is most convenient for the patient. (vi) The duration of effect depends upon the type and dose of the administered BZ, the dose of flumazenil, and the time interval between flumazenil and the BZ administration. (vii) The therapeutic or safety index is above 3000, which means that a 3000 times overdose is still tolerated.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Circulation is established in a stepwise pattern in the mammalian embryo.
To better understand the relationship between the embryonic hematopoietic and vascular systems, we investigated the establishment of circulation in mouse embryos by examining the redistribution of yolk sac-derived primitive erythroblasts and definitive hematopoietic progenitors. Our studies revealed that small numbers of erythroblasts first enter the embryo proper at 4 to 8 somite pairs (sp) (embryonic day 8.25 [E8.25]), concomitant with the proposed onset of cardiac function. Hours later (E8.5), most red cells remained in the yolk sac. Although the number of red cells expanded rapidly in the embryo proper, a steady state of approximately 40% red cells was not reached until 26 to 30 sp (E10). Additionally, erythroblasts were unevenly distributed within the embryo's vasculature before 35 sp. These data suggest that fully functional circulation is established after E10. This timing correlated with vascular remodeling, suggesting that vessel arborization, smooth muscle recruitment, or both are required. We also examined the distribution of committed hematopoietic progenitors during early embryogenesis. Before E8.0, all progenitors were found in the yolk sac. When normalized to circulating erythroblasts, there was a significant enrichment (20- to 5-fold) of progenitors in the yolk sac compared with the embryo proper from E9.5 to E10.5. These results indicated that the yolk sac vascular network remains a site of progenitor production and preferential adhesion even as the fetal liver becomes a hematopoietic organ. We conclude that a functional vascular system develops gradually and that specialized vascular-hematopoietic environments exist after circulation becomes fully established.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Osseointegration amputation prostheses on the upper limbs: methods, prosthetics and rehabilitation.
The osseointegration programme for upper extremity amputation started in Sweden in 1990, when a titanium fixture was first implanted into a thumb. This method has since been used for transhumeral and below-elbow amputation. The treatment involves two surgical procedures. During the first a titanium fixture is surgically attached to the skeleton, and a second procedure six months later involves a skin penetrating abutment to which the prosthesis is attached. To describe the osseointegration procedure for surgery, prosthetics and rehabilitation. Patients with short stumps and previous problems with prosthetic fitting were selected. From 1990 to April 2010, 37 upper limb cases were treated and fitted with prosthesis: 10 thumbs, 1 partial hand, 10 transradial and 16 transhumeral amputations. Of these, 7 patients are currently not prosthetic users. Patients indicated that function and quality of life had improved since osseointegration. Osseointegration is an important platform for present and future prosthetic technology. The prosthetic situation is improved due to the stable fixation, freedom of motion and functionality. The two-stage osseointegration procedure has the potential to change the rehabilitation strategy for selected upper limb amputees. The method eliminates the need for a socket and the prosthesis will always fit. The stable prosthetic fixation and increased freedom of motion generates improved function. Specially designed components and rehabilitation procedures have been developed.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Bioavailability of seaweed iodine in human beings.
The major procedure used to correct iodine deficiency is the universal salt iodization by addition of iodide or iodate to salt with an iodine content varying from 7 to 100 mg/kg of salt depending on the country legislation. As an important fraction of consumers in the world prefers natural products over artificial ones, we investigated the industrial feasibility of naturally iodized salt using seaweed as source of iodine. We report the results of the iodine bioavailability in healthy subjects from two seaweeds: Laminaria hyperborea and Gracilaria verrucosa selected due to their high level in iodine as a mineral or an organic form and low levels of heavy metals. As a control we studied in a normal man the bioavailability of pure mineral iodine such as potassium iodide which was excellent i.e. 96.4% and of pure organic iodine such as monoiodotyrosine which was a little lower i.e. 80.0%. Iodine bioavailability from these two seaweeds was studied in nine normal subjects from Marseille (France) which is an iodine sufficient area based on a median urinary iodine level of 137 microg/day and innine normal subjects from Brussels (Belgium) who present a mild iodine deficiency with a value of 73 microg/day. The iodine bioavailability of Gracilaria verrucosa is better than for Laminaria hyperborea (101% versus 90% in Marseille, t=0.812, NS; 85% versus 61.5% in Brussels, t = 2.486, p = 0.024, S*). The urinary excretion of iodine is lower in Brussels than in Marseille for the same seaweed because part of the iodine is stored in the thyroid (101% versus 85% for Gracilaria verrucosa, t = 1.010, NS; 90% versus 61.5% for Laminaria hyperborea, t = 3.879, p= 0.001, S***).
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Scanning electron microscope examination of epithelial cells infected with enveloped viruses.
The apical surface structure of virus infected epithelial cells (MDBK and MDCK) was examined in the SEM. Cells were infected with related enveloped viruses (influenza, Sendai, and vesicular stomatitis) under conditions of productive, nonproductive, and persistent infections. Fewer microvilli were seen in persistent infections with Sendai virus and the standard virus infected cells appeared to be normal. Extensive morphological changes, stunting of microvilli or budding effects, were noted in productive infections with influenza virus (WSN) and a reduction in the relative number of microvilli in a nonproductive infection with the PR8 strain. Although budding occurs on the basal lateral surface of VSV infected cells, morphological alterations were evident on the apical surface unlike that seen in influenza and Sendai virus infections.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Computerization in a community health service provider].
As the second largest health service provider organization in Israel, we have been progressively computerized. The process was begun in 1988, focusing on improving administrative and financial processes. Today there is a single centralized database for 6,000 users. The system monitors member eligibility, accounting procedures and clinical processes, including diagnoses, laboratory tests, imaging procedures and drug-prescribing. The potential of the computer for physician support is now being realized through integration of clinical guidelines and reminder systems into the computerized clinical record. In addition, the centralized database is used for quality improvement, facilitating cost-effective drug-prescribing and efficient use of technology. The establishment of a computerized working environment for 2,000 physicians and 4,000 other healthcare workers serving 1.3 million patients is a unique model for the development of community health services. Data regarding demographics, disease patterns, drug-prescribing, use of new technology and costs are now readily available to all, from senior management to the individual physician in independent practice. The computer revolution has also presented a new set of problems such patient-record confidentiality and the effect of the computer on the physician-patient encounter.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Highly Efficient and Low Cost SPEEK/TiO₂ Nanocomposite Membrane for Vanadium Redox Flow Battery.
In this work, a sulfonated poly(ether ether ketone)/titanium oxide composite membrane (SPEEK/TiO₂) was prepared by solution casting method. The TiO₂ nanoparticles in the polymer matrix not only improved the vanadium ion selectivity of SPEEK/TiO₂, but also enhanced the mechanical stability of this membrane by forming hydrogen bonds with SPEEK. Based on the SPEEK/TiO₂ composite membrane, vanadium redox flow battery (VRB) exhibited ultrahigh coulombic efficiency (over 99.3%) and excellent energy efficiency (over 84.8%) under current density of 120 mA cm-2 for 200 cycles. More importantly, the device also presented excellent discharge capacity retention performance of about 95.4% and 86.9% after 100 and 200 cycles under this current density, respectively. The good performance and low cost of this membrane indicate that it is a promising candidate in VRB applications and an excellent substitute for Nafion membranes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Tissue contents and subcellular distribution of chromium and other trace metals in experimental diabetic rats after intravenous injection of Cr 50-enriched stable isotopic tracer solution.
In order to study the metabolism of essential trace elements in diabetics, we studied alloxan-diabetic rats for the distribution patterns of chromium (Cr), cobalt (Co), iron (Fe), selenium (Se), and zinc (Zn) in the liver, kidney, pancreas, and testes, as well as in the organ subcellular fractions. Normal rats were used as controls. Cr 50-enriched stable isotopic tracer solution was given by intravenous injection to avoid the difficulties of estimation of Cr status. Our data show that the concentrations of Zn in liver and kidney, of Co, Fe, and Zn in pancreas, and of Fe and Zn in testes of the diabetic rats were significantly higher than in the control rats. Nevertheless, the concentrations of Cr in pancreas, Fe in kidney, and Cr and Se in testes of the diabetic rats were significantly lower than in the controls. Furthermore, we observed significant alterations of element concentrations in subcellular fractions of various organs in the diabetic rats. These results suggest that changing hormone levels may interfere with the accumulation of some trace elements both in the organs and in the subcellular fractions of rats.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Tuberculin skin test results in HIV-infected patients in India: implications for latent tuberculosis treatment.
To evaluate the utility of the tuberculin skin test (TST) in detecting latent and active tuberculosis (TB) among human immunodeficiency virus (HIV) infected patients in South India. TSTs and CD4 counts were collected from 631 HIV-infected individuals without active TB and 209 antiretroviral and anti-tuberculosis treatment-naïve HIV-infected patients with TB. We calculated the proportion of TST-positive individuals, as well as the sensitivity, specificity, positive predictive value (PPV) and negative predictive value of TST in the diagnosis of TB. Among subjects without active TB, 28% with a CD4 count <100 cells/microl vs. 43% of the total cohort had a TST >5 mm (P = 0.14), while the proportions with induration >10 mm were 14% vs. 36%, respectively (P < 0.01). Among those with active TB, using a 5 mm cut-off, the sensitivity was 42% for those with CD4 counts <200 cells/mul compared to 70% for those with CD4 counts >or=200 cells/microl (P < 0.001). The PPV for detecting active TB was 29%. TST is a poor predictor of both latent and active TB in HIV-infected individuals in TB endemic countries. Programmes offering treatment for latent TB should consider including all HIV-positive patients regardless of TST status, or use other indicators, such as CD4 count.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
First Report of Rice yellow mottle virus on Rice in Burundi.
Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5'CGCTCAACATCCTTTTCAGGGTAG3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Mixed functional monomers-based monolithic adsorbent for the effective extraction of sulfonylurea herbicides in water and soil samples.
Effective extraction is a key step in the determination of sulfonylurea herbicides (SUHs) in complicated samples. According to the chemical properties of SUHs, a new monolithic adsorbent utilizing acrylamidophenylboronic acid and vinylimidazole as mixed functional monomers was synthesized. The new adsorbent was employed as the extraction phase of multiple monolithic fiber solid-phase microextraction (MMF-SPME) of SUHs, and the extracted SUHs were determined by high-performance liquid chromatography with diode array detection (HPLC-DAD). Results well evidence that the prepared adsorbent could extract SUHs in environmental waters and soil effectively through multiply interactions such as boronate affinity, dipole-dipole and π-π interactions. Under the optimized extraction conditions, the limits of detection for target SUHs in environmental water and soil samples were 0.018-0.17μg/L and 0.14-1.23μg/kg, respectively. At the same time, the developed method also displayed some analytical merits including wide linear dynamic ranges, good method reproducibility, satisfactory sensitivity and low consume of organic solvent. Finally, the developed were successfully applied to monitor trace SUHs in environmental water and soil samples. The recoveries at three fortified concentrations were in the range of 70.6-119% with RSD below 11% in all cases. The obtained results well demonstrate the excellent practical applicability of the developed MMF-SPME-HPLC-DAD method for the monitoring of SUHs in water and soil samples.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Synergistic Antimicrobial Effect of Lonicera japonica and Magnolia obovata Extracts and Potential as a Plant-Derived Natural Preservative.
Most people use cosmetics to protect their skin. Preservatives are often used to prevent their contamination upon use. There has been a great demand for natural preservatives due to recent reports on the side effects of parabens. Therefore, we evaluated the antimicrobial activities of Lonicera japonica and Magnolia obovata extracts and determined their potential as natural preservatives. We found that the 50% ethanol extract from L. japonica had antibacterial activity only against S. aureus and P. aeruginosa, while the ethyl acetate fraction showed antimicrobial activity against all six microbial strains tested. On the other hand, the 70% ethanol extract and the ethyl acetate fraction from M. obovata showed antimicrobial activity against all six strains. A synergistic effect against S. aureus, B. subtilis, and C. albicans was confirmed when two ethyl acetate fractions having antimicrobial activity against all six strains were used in combination. Synergistic activity against B. subtilis was also confirmed through kill-time analysis. High-performance liquid chromatography was performed to identify the components of each extract. Based on the minimum inhibitory concentration and the results of a disc diffusion assay, we confirmed that caffeic acid and luteolin influenced the antimicrobial activity of L. japonica and that the antimicrobial activity of M. obovata was influenced by the interaction of magnolol and honokiol with other components. Therefore, this study suggests that the combination of L. japonica and M. obovata extracts may be used as a plant-derived natural preservative.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Adenosine activates ATP-sensitive K(+) currents in pericytes of rat retinal microvessels: role of A1 and A2a receptors.
In the CNS, contractile pericytes are positioned on the endothelial walls of microvessels where they are thought to play a role in adjusting blood flow to meet local metabolic needs. This function may be particularly important in the retina where pericytes are more numerous than at any other site. Despite the putative importance of pericytes, knowledge of the mechanisms by which vasoactive molecules, such as adenosine, regulate their function is limited. Using the perforated-patch configuration of the patch-clamp technique to monitor the whole-cell currents of pericytes located on microvessels freshly isolated from the adult rat retina, we found that adenosine reversibly activated a hyperpolarizing current in 98% of the sampled pericytes. This adenosine-induced current is likely to be due to the opening of ATP-sensitive potassium (K(ATP)) channels since it had a reversal potential near the equilibrium potential for K(+), was inhibited by the K(ATP) channel blocker, glibenclamide, and was mimicked by pinacidil, which is a K(ATP) channel opener. Experiments with specific agonists and antagonists indicated that both the high affinity A1 and the lower affinity A2a adenosine receptors provided effective pathways for activating K(ATP) currents in pericytes recorded under normal metabolic conditions. However, during chemical ischemia, the A1 receptor pathway rapidly became ineffective. In contrast, activation of A2a adenosine receptors continued to open K(ATP) channels in ischemic pericytes. These results suggest that the regulation of K(ATP) channels via A1 and A2a receptors allows adenosine to serve over a broad range of metabolic conditions as a vasoactive signal in the retinal microvasculature.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Recombinant modified vaccinia virus Ankara expressing antigen 85A boosts BCG-primed and naturally acquired antimycobacterial immunity in humans.
Protective immunity against Mycobacterium tuberculosis depends on the generation of a T(H)1-type cellular immune response, characterized by the secretion of interferon-gamma (IFN-gamma) from antigen-specific T cells. The induction of potent cellular immune responses by vaccination in humans has proven difficult. Recombinant viral vectors, especially poxviruses and adenoviruses, are particularly effective at boosting previously primed CD4(+) and CD8(+) T-cell responses against a number of intracellular pathogens in animal studies. In the first phase 1 study of any candidate subunit vaccine against tuberculosis, recombinant modified vaccinia virus Ankara (MVA) expressing antigen 85A (MVA85A) was found to induce high levels of antigen-specific IFN-gamma-secreting T cells when used alone in bacille Calmette-Guerin (BCG)-naive healthy volunteers. In volunteers who had been vaccinated 0.5-38 years previously with BCG, substantially higher levels of antigen-specific IFN-gamma-secreting T cells were induced, and at 24 weeks after vaccination these levels were 5-30 times greater than in vaccinees administered a single BCG vaccination. Boosting vaccinations with MVA85A could offer a practical and efficient strategy for enhancing and prolonging antimycobacterial immunity in tuberculosis-endemic areas.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Effects of dietary fat composition on activities of the microsomal ethanol oxidizing system and ethanol-inducible cytochrome P450 (CYP2E1) in the liver of rats chronically fed ethanol.
We studied the effects of dietary fat composition on the activities of the microsomal ethanol oxidizing system (MEOS), paranitrophenol hydroxylase (PH) activity and ethanol-inducible cytochrome P450 isozymes (CYP2E1 and CYP2B1) in the liver of rats to determine the role of this ethanol metabolizing pathway in the pathogenesis of alcoholic liver disease (ALD). Wistar male rats were pair-fed a liquid diet, containing either tallow (TF) or corn oil (CF) as the fat component, and ethanol or an isocaloric amount of dextrose, through an implanted intragastric cannula. Liver pathology of rats fed ethanol (CF-ALC) and CF diet showed severe fatty change whereas the rats fed TF-alcohol and the TF and CF controls did not. MEOS activity of the CF-ALC group was 8 times of that in the CF-CTL group (P less than 0.01). In TF-ALC rats, MEOS activity was increased to 2.6 times compared to that of TF-CTL (P less than 0.01). ApoCYP2E1 in CF-ALC and TF-ALC were 818 +/- 63 and 433 +/- 1- pmol/mg protein, respectively, and these values were significantly higher when compared with those of the pair-fed controls (P less than 0.005). In contrast, apoCYP2B1 was increased to an equal degree in both CF-ALC and TF-ALC. When PH-activity was measured, the level of activity on TF-ALC rats did not differ from that of CF-ALC rats. Thus, ethanol-induction of apoCYP2B1 (2x) and PH (6-8x) were the same for CF and TF (2x); but not for apoCYP2E1 (21 and 8x, respectively) and MEOS activity (8 and 2.6x, respectively).(ABSTRACT TRUNCATED AT 250 WORDS)
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Dispensary treatment of the rural population with diseases of the nervous system].
The presentation is concerned with the results of a dispensary study (screening) of 517 patients among the rural population with disorders of the nervous system during 1971-1972. The author discusses the effectivity of such observations, their qualitative and quantitative indices.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
[Dirofilariasis of the breast: Two new cases in Tunisia].
Dirofilariasis is an endemic animal parasitic disease in the Mediterranean basin. Its occurrence in humans is rare; when it occurs, it is most often in cutaneous locations. We report two new cases of dirofilariasis of the breast in two Tunisian women, aged 32 and 45 years old. Both came from northern Tunisia and consulted for breast lumps. Clinical examination and imaging findings suggested benign tumors. After surgical excision, the pathology examination confirmed the diagnosis, based on the presence of Dirofilaria repens in the specimen. Dirofilariasis prevalence is probably underestimated because of its non-specific clinical presentation. Breast locations are rare and frequently consist of tumors with benign features. Surgical resection confirms the diagnosis and is the only treatment.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Intermediate-depth earthquake faulting by dehydration embrittlement with negative volume change.
Earthquakes are observed to occur in subduction zones to depths of approximately 680 km, even though unassisted brittle failure is inhibited at depths greater than about 50 km, owing to the high pressures and temperatures. It is thought that such earthquakes (particularly those at intermediate depths of 50-300 km) may instead be triggered by embrittlement accompanying dehydration of hydrous minerals, principally serpentine. A problem with failure by serpentine dehydration is that the volume change accompanying dehydration becomes negative at pressures of 2-4 GPa (60-120 km depth), above which brittle fracture mechanics predicts that the instability should be quenched. Here we show that dehydration of antigorite serpentinite under stress results in faults delineated by ultrafine-grained solid reaction products formed during dehydration. This phenomenon was observed under all conditions tested (pressures of 1-6 GPa; temperatures of 650-820 degrees C), independent of the sign of the volume change of reaction. Although this result contradicts expectations from fracture mechanics, it can be explained by separation of fluid from solid residue before and during faulting, a hypothesis supported by our observations. These observations confirm that dehydration embrittlement is a viable mechanism for nucleating earthquakes independent of depth, as long as there are hydrous minerals breaking down under a differential stress.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Outgrowth endothelial cells isolated and expanded from human peripheral blood progenitor cells as a potential source of autologous cells for endothelialization of silk fibroin biomaterials.
One challenge of particular importance in tissue engineering is to improve vascularization of larger size defects, which would then facilitate a sufficient supply with oxygen and nutrients to the central regions of a larger tissue-engineered construct or in highly vascularized tissues. In this study, we show that outgrowth endothelial cells (OECs) derived from human peripheral blood can serve as a source of human autologous endothelial cells and can be used in combination with fibroin silk fiber meshes for applications in tissue engineering. OEC reveal a highly differentiated endothelial phenotype as well as a high phenotypic stability during their expansion. Furthermore, OEC showed very promising results in the endothelialization of fibroin silk fiber meshes, maintaining their endothelial characteristics and functions. On the fibroin fiber meshes OECs formed differentiated endothelial cell layers covering the single fibers as shown by data from scanning electron microscopy, immunofluorescence, and gene expression analysis. After embedding in a wound-healing matrix, mimicked by fibrin gels, OEC migrated from the fibroin scaffolds into the fibrin and formed a microvessel-like network. Thus, we conclude that OEC could serve as a valuable source of autologous endothelial cells, supporting pro-angiogenic therapies in combination with silk fibroin-based scaffolding materials in the field of tissue engineering and regenerative medicine.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Syllable deletion in spontaneous speech of children with specific language impairment.
syllable deletion (SD) frequently occurs in Specific Language Impairment and can indicate a deviant factor in the phonologic acquisition process of these subjects. to verify the occurrence of SD in the spontaneous speech of children with SLI and to verify the influence of word extension and syllable stress in this process. participants were 27 children with SLI, aged between 3:0 and 5:11 years, in a weekly speech treatment, who presented 50% of correct answers in specific phonology assessment tasks or who presented speech intelligibility within levels that allowed assessment through spontaneous speech. Speech samples were obtained during a play interaction situation between the researcher and the child and through speech elicited by the presentation of a picture. The occurrence of SD was analyzed considering the following parameters: extension of the produced words, preference for stressed or unstressed syllables, position of the syllable within the word were SD occurred. there was a preference for the production of dissyllabic words (X2 = 72,49; p < 0,001); the occurrence of SD was significantly higher in polysyllabic words (X2 = 11,22; p < 0,004) and on initial syllables (X2 = 34,99; p < 0,001). Unstressed syllables were more often reduced (Z= -5.79, p <0001). the preference for the production of dissyllabic words reassures the difficulty of these children with complex syllabic structures and, in part, explains their spontaneous speech unintelligibility. The predominance of unstressed syllable deletion indicates the preference for producing the nucleus of words, where emphasis is given to the stressed syllable during language expression.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Wave Function Engineering in CdSe/PbS Core/Shell Quantum Dots.
The synthesis of epitaxial CdSe/PbS core/shell quantum dots (QDs) is reported. The PbS shell grows in a rock salt structure on the zinc blende CdSe core, thereby creating a crystal structure mismatch through additive growth. Absorption and photoluminescence (PL) band edge features shift to lower energies with increasing shell thickness, but remain above the CdSe bulk band gap. Nevertheless, the profiles of the absorption spectra vary with shell growth, indicating that the overlap of the electron and hole wave functions is changing significantly. This leads to over an order of magnitude reduction of absorption near the band gap and a large, tunable energy shift, of up to 550 meV, between the onset of strong absorption and the band edge PL. While the bulk valence and conduction bands adopt an inverse type-I alignment, the observed spectroscopic behavior is consistent with a transition between quasi-type-I and quasi-type-II behavior depending on shell thickness. Three effective mass approximation models support this hypothesis and suggest that the large difference in effective masses between the core and shell results in hole localization in the CdSe core and a delocalization of the electron across the entire QD. These results show the tuning of wave functions and transition energies in CdSe/PbS nanoheterostructures with prospects for use in optoelectronic devices for luminescent solar concentration or multiexciton generation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Lich-gregoir procedure in treatment of the vesicoureteral reflux.
Vesicoureteral reflux is a major problem in childhood affecting 1% of all children. There are various surgical methods for vesicoureteral reflux treatment. Current study evaluates effectiveness and success rate of the Lich-gregoir procedure in treatment of the vesicoureteral reflux. In a descriptive-analytical study, 32 children with 47 reflux unit underwent Lich-gregoir anti-reflux procedure in Imam Reza and Amir-al-Momenin Hospitals, Tabriz between March 2008 and August 2011. Surgery outcome and success rate, sonographic findings and complications rate were recorded in follow-up. Patients mean age was 5.85 +/- 3.81 years. 28.1% were male and 71.9% were female. Reflux was unilateral in 53.1% and bilateral in 46.9%. Vesicoureteral reflux grade I to V was in one, 1, 13, 22 and ten patients, respectively. Voiding Cystourethrogram (VCUG) findings were abnormal in all cases before operation. Surgery success rate in first 6 months was 95.7% and was 100% in 8 months after operation. Hydronephrosis disappeared after operation in all cases. Complication occurred in 2 cases (6.25%) with bilateral reflux including urinary intention and lymphocele. Lich-gregoir anti-reflux procedure technique is accompanied with higher success rate, low complication and hydronephrosis improvement and is an appropriate treatment for vesicoureteral reflux in children.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Multigenic human hypertension: evidence for subtypes and hope for haplotypes.
Hypertension that occurs before the age of 60 years is strongly aggregated in families, mostly due to genetic factors with weaker contributions from a shared family environment. Hypertension is probably a heterogeneous collection of overlapping subsets of pathophysiological mechanisms, such as dyslipidemia, obesity, hyperinsulinemia and cation metabolism. Highly heritable traits such as sodium-lithium countertransport, urinary kallikrein excretion and a body fat pattern index show evidence of major gene segregation in families with hypertension. They are thought to be intermediate phenotypes in the chain of pathophysiological events leading from specific genes to the distant phenotype of hypertension. They provide evidence of measurable contributions from single gene traits to the susceptibility to hypertension. Genetic linkage studies have suggested that other specific loci (e.g. histocompatibility leukocyte antigen, blood group MN and the haptoglobin protein) contribute to the susceptibility to hypertension. DNA sequencing has shown a point mutation for lipoprotein lipase that conveys susceptibility to lipid abnormalities, and possibly also hypertension, as seen in families with dyslipidemic hypertension. Further application of these approaches, especially in families that include multiple siblings with hypertension, shows promise of a true understanding of how the combined effects of a few specific genes, the polygenic background and selected environmental factors can lead to essential hypertension. This understanding should foster better tailored and more effective approaches to the prevention, diagnosis and treatment of hypertension.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.