text stringlengths 1 1.04M | language stringclasses 25 values |
|---|---|
Mae hap de ol: Abraham Bak zen hen Alapsa de taïblïblan en nakon Alap mo nwenak dakastïlkï.
1 Zep Yahudi zini, nëno mae mo auyanna Abraham Baksa de enlala gweblankam, zen banakan gwëka?– zep Alap mo nwenak dakastïlkïye. * 4:1 Alap zëre mo nwenak de dakastïn hïp dena insa gubluka, zen in kim Abrahamsa hamal hap auyan-aza zeban de hëꞌho gwibin tangan naka zihlaun hup dena gu-gublukake. Hwëna dekam Abraham bogolik walas srëmkam gwëꞌanka. Sap kirekam hwëna zen Alap mo gu-gublun ola insa man taïblïbirki. Zen zep Alap anakan gubluka, ‘Em mese ëre mo nwenak dakastïlï.’ (Kej. 15:1-16; Rom. 4:13; Gal. 3:6) 2 Zen de zëre mo syala kon Alap mo nwenak dakastïnkïm, zen maka anakan zënaka boltere taka, “Ëe mesë aha zisi beya tangankam kwei-kwik guk.” Hwëna zen bëjen Alap mo nwenak kirekam zënaka boltere tan. 3 Sap zëbe hap dena Alap mo olak anakan lwak,
4 Zep anakarekam lwaꞌan: Zi de te-ala hap syal gwenkam, mam zik de te-alana insa golblankam, zen bëjen anakan enlala gweblan, “Zen totoresa ap golblala.” Hwëna zen sa anakan enlala gwera, “An ëre mo syala kon ap golblala.” Zep hen kirekam, zi de Alap de dawemsa zëbe hap golblan hap syal gwenna, zen bëjen anakan enlala gwen, “Zen totoresa abe hap golblaka.” 5 Hwëna zini men zen ësyal gwen srëmkam Alap ensa anakan daïblïblaꞌan, “Karek gol gwen zi hip Zen Zën ngaya gwen hap dena totoresa Kristus onakon gol gwizimnira,” zen eiwa kire zisi Alap gubiridaꞌara, “Zen zen ano nwenak ëdakastïꞌïn.” 6 Zen in zep Daud Bak hen kirekam enlala gweka– isrip-sri gwibinnik de lowehen wenya kim hamal hap hlauluda gukuye, men desa Alap zëre hap de ba maesa syal gwibir-blin srëmkam anakan gubiridaꞌaraye, “Em ema ano nwenak ëdakastïꞌïn.” Daud anakan gubiridaka,
7 “Zini men zëno mae mo karek-kareksa Alap ngan gulsuk gwizimꞌira hen tap gulsuk gwizimꞌira, zen isrip-sri gwibinnik lowehe gweꞌan.
9 Men zen de kirekam isrip-sri gwibinnik lowe heꞌak, zen Yahudi zi en molya. Hwëna zen hen Yahudi srëm zi niban esa apdenak. Sap nen mese Abraham hap dena insa anakan tame uk, “Zen Alapsa taïblïblaka, dekon en zep Alap mo nwenak dakastïlkï.” 10 Zep Alap kim Abrahamsa kirekam gubluka, san ha to mip blonsublun naka? San ha kire srëm naka? Zen eiwa dekam to mip blonsublun srëm nik gwëꞌanka– Alap in kim kirekam gublukaye! 11 Zen hwëna hyanak to mip blonsun hup gubluka– dekam de zënaka anakan zertrën hap, “Ëe mesë Alapsa taïblïblak– men dekam asa anakan gublukaye, ‘Em mese ëre mo nwenak dakastïlï.’ ” Zen in zep Abraham Bak nwe-mase gweꞌara, zen hen to mip blonsublun srëm nik mo bian– tïngan men zen Alapsa de taïblïblan nakon zëre mo nwenak ëdakastïl gwenanye. 12 Hen kirekam Abraham Bak zen tïngare to mip blom tasibir-zimdin nik mo Bian– men zen en Alapsa zëre mo kim daïblïblaꞌanke, men kirekam Abraham zëna to mip blonsublun srëmnak taïblïblakake.
Mae hap de ol: Alap mensa Abrahamsa gu-gubluka, dawemsa de auyan-aza zikhip golzimdin hip dena, zen hwëna Alapsa de taïblïblan enkam esa ulin.
13 Alap mensa Abrahamsa gu-gubluka, auyan-aza zeban de okamasa zibi gwibin hip, zen dwan Musa mo tïtï tabin ol de hatan srëmnak kirekam gu-gubluka. Zep Abraham dekam hom desan ang gweka– dekam de Alap mo nwenak dakastïn hïp, hen dekam de dawemna insa golblan hapye. Zen hwëna Alapsa de taïblïblan en nakon ki zëbe hap kirekam lwablak. 14 Sap anakan de lwaꞌanam, “Tïtï tabin ol en san de ang tankam esa Abraham mo walas hap ëliweher,” ki Alap menkam waba hap Abrahamsa gu-gubluka– zëre mo nwenak de dakastïn hïp. Hen nëbe mae hap Abraham mo kim de Alapsa taïblïblanna waba hap maka lwaꞌan. 15 Eiwa, nen bëjen nen tïtï tabin ol san de ang ta gwen en nakon ëdakastïn. Sap zini men zen desan de ang tan hap ëalp gwe-gwenan, hwëna sul sonenna toton banakan dep? Zen in zep Alap mo jal ennak lowehe tine gwenan. Diki tïtï tabin ola in de lwan srëmkam bap. Dekam basa molye ulmun gweꞌanam!
16 Zen in zep, Alapsa de taïblïblanna kunci makan nëbe mae hap lwazimꞌin! Sap Alap man nësa anakan dwam gwibirida gweꞌara, “Ëe mensaë Abrahamsa orep gu-gubluk, zen dikire totoresa Yesussu de taïblïblan en nakon nulin gwek.” Zen eiwa nen esa ulin– sap Yahudi zini men zen Musa mo ola nama enlala nei gwibirin, hen sap Yahudi srëm zini men zen desa enlala neibir srëm gwe-gwenanye. Sap nen ema Abraham mo kim Alapsa laïblïblaꞌan. Zen in zep Abraham Bak anakan nwe-mase gweka, “Zen tïngare Alapsa de taïblïblan zini nëno mae mo bian.” 17 Zen zep Alap Abrahamsa anakan gu-gubluka,
18 Diki Abraham maka anakan enlala gweka, “An molya kirekam lwak, sap ëe we walya ban mesë tangan bogol ëk. Zep ëe banakan dep?– walas ën naye.” Hwëna zen nama Alapsa taïblïblaka– mensa anakan gu-gublukake,
Sap Alap mes hen anakan gu-gubluka,
19 Abraham dekam hom mae anakan enlala gweka, “Ëe banakan asa walas ër?– sap ëe an tïn hïp mes-am tangan golek de gwer. Sap ano gwën tahunna seratusnuk dep man-am golek de gweꞌan. Hen Sara Bak mo wal gola mes-am yok gwibik.” 20 Sap eiwa kirekam, hwëna Abraham mo Alapsa de taïblïblanna hom mae sin gweblak. Hwëna man tangan tatete gweblak. Zen zep tangan Alapsa anakarekam boltere taka, “Bian, Ema asa sam taka, sap men kirekam asa gu-gubluka, Em esa kirekam ap syal gwibir-blira.” 21 Hen zen man tangan Alapsa anakan taïblïblaka, “Men desa asa gu-guk gweblaka, zëno sosonna ki– kirekam de owas-owassa dikim abe hap syal gwe-gwibir-blin hap denaye.” 22 Zen sërkam tangan Alapsa taïblïblaka, zen in zep zëbe hap dena Alap mo olak anakan lwak,
*4:1 4:1 Alap zëre mo nwenak de dakastïn hïp dena insa gubluka, zen in kim Abrahamsa hamal hap auyan-aza zeban de hëꞌho gwibin tangan naka zihlaun hup dena gu-gublukake. Hwëna dekam Abraham bogolik walas srëmkam gwëꞌanka. Sap kirekam hwëna zen Alap mo gu-gublun ola insa man taïblïbirki. Zen zep Alap anakan gubluka, ‘Em mese ëre mo nwenak dakastïlï.’ (Kej. 15:1-16; Rom. 4:13; Gal. 3:6)
| english |
The Solar Tunnel Dryer effectively curbs food wastage too by increasing the shelf life of farm produce by six months while keeping nutrients intact!
As per a study done by the Central Institute of Post-Harvest Engineering and Technology, 16 per cent of India’s food produce (fruits and vegetables) gets wasted every year. Insufficient storage facilities, costly transportation and lack of marketing facilities are some of the reasons for the wastage, the report points out.
Straight from the farmer’s kitchen to your table. Check out these organic snacks here.
An example of this scenario can be Sameer Bagchi, a farmer from Dhar district, Madhya Pradesh. Sameer grows stevia, a herbal plant which works as a sugar substitute. For commercial purposes, the leaves of the plant are dried to make powder that is added to beverages.
In his late twenties, Sameer has been growing stevia for the last three years and while he has generated revenue from it, there have been instances where had to discard the leaves.
The input cost to grow stevia is very high and the stem-cutting process is very tedious. Once the leaves are ready to be cut, they are cleaned in water and kept for drying which takes at least 12 hours. If the dust particles settle on the leaves during the drying process, the leaf loses its sugary content by six per cent, Sameer tells The Better India (TBI).
There is always a constant threat of insects and dust to the leaves. But now, Sameer’s problems have been eliminated thanks to the Solar Tunnel Dryer he has been using.
“The dryer is waterproof, closed and the best part is that it retains the flavour and properties of the leaves. The quality of leaves has also improved,” Sameer smiles.
The low-cost and foldable solar dryer is the invention of Varun Raheja, an engineer from Indore. Ever since he learnt about ‘waste-to-wealth’ concept in school, Varun has worked on projects related to waste management.
The reason of spoilage of any fresh product is the moisture content present inside it. Dehydration removes the moisture which increases the shelf life of the product without adding any chemicals, preservatives or additives, says Varun, who launched Raheja Solar Food Processing (RSFP), a social enterprise in 2018.
It was during his first year in college when Varun started exploring concrete ways to reuse and recycle waste and to expand his knowledge, he did an internship at Jimmy McGilligan Centre for Sustainable Development, 25 km away from the city.
Shedding light on what inspired Varun to develop a solution to farmer’s woes, he tells TBI:
Boosting Output by 300%, IAS Officer Turns Jharkhand District Into 'Ragi Capital of India'
As an engineering student, it was a privilege for me to work under Padma Shri Janak Palta McGilligan who has championed the cause of sustainable living. I interned there for three years and yet it was not enough to gather all the knowledge about the technology that benefits the rural population. There I learnt about farmer’s problems on ground level and decided to do something about them.
He worked on three waste-to-wealth projects during his internship and one of them was the solar dryer, a technology developed by the German Scientists.
Whether it is a small-time farmer or a family who wants nutritious food, the solar dryer is helping 52 people (mostly farmers) curb food wastage, earn a better income and keep all the minerals and proteins intact in the food.
Besides being a boon for Sameer, the solar dryer is also helping Nikky Sureka, a dairy farmer in Sanawadiya village close to Indore, produce high quality fodder for the cows.
Azola, a water-grown fern is a good feed for the cattle. The plant is available throughout the year except for summers. Through this solar dryer I am able to preserve the fern that grows during winters for six months and later use it in summer, Sureka tells TBI.
Meanwhile, Sureka, a former senior official at Madhya Pradesh Pollution Control Board in Indore, is using the dryer to increase her family’s nutrient-intake. She uses the dryer to dry leafy vegetables and fruits and then powders them.
I use the powder to make different gravy recipes for my family. Several of my friends have also taken the powder from me. It is an easier way to ensure that children are getting proper nutrition. I plan to make the exercise commercial and sell the powder, Sureka informs TBI.
The solar-powered driers increase the shelf life of perishable food products by dehydrating fruits, plants, flowers and vegetables. Post dehydration, the food’s age increases to a minimum of six months.
This invention is India’s first such dryer designed specially for small and marginal farmers who are forced to discard their excess produce every season.
How does the Solar Tunnel Dryer Work?
The Dryer works on the principle of the greenhouse effect in which solar radiation gets trapped inside a closed chamber.
The dryer has two sections: one is the collector area where heat is generated using a black base, and the second is the drying area where fresh products are dried.
The trapped radiation produces heated air in the collector which is then blown from a fan over the fresh produce which evaporates the moisture in them and then this moisture-laden air gets expelled from the other side of the tunnel.
The high temperature in the dryer coupled with the air movement and lower humidity decreases drying time and eliminates the risk of spoilage. For example, it takes 7-8 days to dry tomatoes in the open. The dryer completes the process in just two days.
The best part? The dryer retains taste, colour, aroma and nutrients of the food product.
The user can have 10 cycles of dehydration per month, “During low market rates, farmers have to sell their produce at the rate of Re 1 and Rs 2 per kilo of fresh produce. Now with solar dryer, a farmer can preserve the produce and sell it at the time of high market rates at four to five times the price.” Varun explains.
Priced at Rs 14,750, this 20 kg solar dryer comes at half the price of dryers available in the market. The dryer is foldable and thus can be transported anywhere in India without burning a hole the customer’s pocket.
Also Read: Double Harvests, No Pests: How 2 Friends & Whatsapp Are Helping 5 Lakh Farmers!
(Edited by Saiqua Sultan)
Like this story? Or have something to share?
Connect with us on Facebook and Twitter.
We bring stories straight from the heart of India, to inspire millions and create a wave of impact. Our positive movement is growing bigger everyday, and we would love for you to join it.
Please contribute whatever you can, every little penny helps our team in bringing you more stories that support dreams and spread hope.
| english |
<filename>packages/electron/src/dialogs.ts
/**
* Dialog helpers
*/
/** Imports */
import {
CertificateTrustDialogOptions,
MessageBoxOptions,
OpenDialogOptions,
remote,
SaveDialogOptions,
} from "electron";
const { BrowserWindow, dialog } = remote || {
BrowserWindow: undefined,
dialog: undefined,
};
//
// Message Box
//
export type MessageBoxCallback = (
response: number,
checkboxChecked: boolean,
) => void;
export interface MessageBoxData {
response: number;
checkboxChecked: boolean;
}
export const messageBox = (
opts: MessageBoxOptions,
handler?: MessageBoxCallback,
) => {
const browserWindow = BrowserWindow.getAllWindows()[0];
if (!browserWindow) {
throw new Error();
}
dialog.showMessageBox(browserWindow, opts, handler);
};
export const messageBoxAsync = (opts: MessageBoxOptions) =>
new Promise<MessageBoxData>((resolve, reject) => {
try {
messageBox(opts, (response, checkboxChecked) =>
resolve({ response, checkboxChecked }),
);
} catch (e) {
reject(e);
}
});
//
// ErrorBox
//
export const errorBox = (title: string, content: string) =>
dialog.showErrorBox(title, content);
//
// CertificateTrustDialog
//
export const certificateTrustDialog = (
opts: CertificateTrustDialogOptions,
handler: (...args: any[]) => void,
) => {
const browserWindow = BrowserWindow.getAllWindows()[0];
if (!browserWindow) {
throw new Error();
}
dialog.showCertificateTrustDialog(browserWindow, opts, handler);
};
export const certificateTrustDialogAsync = (
opts: CertificateTrustDialogOptions,
) =>
new Promise<any[]>((resolve, reject) => {
try {
certificateTrustDialog(opts, (...args: any[]) => resolve(args));
} catch (e) {
reject(e);
}
});
//
// OpenDialog
//
export type OpenDialogCallback = (
filePaths: string[],
bookmarks: string[],
) => void;
export interface OpenDialogData {
filePaths?: string[] | undefined;
bookmarks?: string[] | undefined;
}
export const openDialog = (
opts: OpenDialogOptions,
handler?: OpenDialogCallback,
) => {
const browserWindow = BrowserWindow.getAllWindows()[0];
if (!browserWindow) {
throw new Error();
}
dialog.showOpenDialog(browserWindow, opts, handler);
};
export const openDialogAsync = (
opts: OpenDialogOptions,
): Promise<OpenDialogData> =>
new Promise<OpenDialogData>((resolve, reject) => {
try {
openDialog(opts, (filePaths, bookmarks) =>
resolve({ filePaths, bookmarks }),
);
} catch (e) {
reject(e);
}
});
//
// SaveDialog
//
export type SaveDialogCallback = (filePath: string, bookmark: string) => void;
export interface SaveDialogData {
filePath?: string | undefined;
bookmark?: string | undefined;
}
export const saveDialog = (
opts: SaveDialogOptions,
handler?: SaveDialogCallback,
) => {
const browserWindow = BrowserWindow.getAllWindows()[0];
if (!browserWindow) {
throw new Error();
}
dialog.showSaveDialog(browserWindow, opts, handler);
};
export const saveDialogAsync = (
opts: SaveDialogOptions,
): Promise<SaveDialogData> =>
new Promise<SaveDialogData>((resolve, reject) => {
try {
saveDialog(opts, (filePath, bookmark) => resolve({ filePath, bookmark }));
} catch (e) {
reject(e);
}
});
| typescript |
Only about one-third of Americans think climate scientists understand very well whether climate change is happening, according to a new Pew Research Center survey. And only about a quarter or less say climate scientists understand very well the effect climate change has on extreme weather, its causes and the best ways to address it.
Pew Research Center conducted this study to understand Americans’ views of how much climate scientists understand key aspects of climate change, and their role in policy debates on this topic. Read the accompanying report for more on Americans’ views of future harms from climate change.
This survey was conducted among 8,842 U.S. adults from Sept. 25 to Oct. 1, 2023. Everyone who took part in the survey is a member of the Center’s American Trends Panel (ATP), an online survey panel that is recruited through national, random sampling of residential addresses. This way, nearly all U.S. adults have a chance of selection. The survey is weighted to be representative of the U.S. adult population by gender, race and ethnicity, partisan affiliation, education and other categories. Read more about the ATP’s methodology.
Here are the questions used for this analysis, along with responses, and its methodology.
Americans rate climate scientists’ understanding of aspects of climate change slightly lower than they did two years ago and the same or lower than in 2016.
The share of Americans who say climate scientists understand very well whether climate change is occurring decreased from 37% in 2021 to 32% this year.
Similarly, the share of Americans who say climate scientists understand the causes of climate change very well decreased slightly from 28% in 2021 to 24% today. And only 13% of Americans now say climate scientists understand very well the best ways to address climate change, down from 18% in 2021.
Analysis of recent scientific publications finds widespread agreement among climate scientists that human activity is the primary cause of climate change. The Center recently conducted in-depth interviews to better understand the views of adults who say climate change is not an urgent issue and are unconvinced human activity is its main cause.
Democrats continue to rate climate scientists’ understanding much higher than Republicans do.
When asked how well climate scientists understand whether climate change is happening, 52% of Democrats and Democratic-leaning independents say climate scientists understand this very well. In comparison, 51% of Republicans and Republican leaners say climate scientists understand this not too or not at all well.
Democrats are also four times as likely as Republicans to say climate scientists understand very well how climate change affects extreme weather events (40% vs. 10%). Scientific studies have found that extreme weather events will become more frequent and intense with climate change.
When it comes to the causes of climate change, 41% of Democrats say climate scientists understand this very well, compared with 7% of Republicans. About six-in-ten Republicans (59%) say climate scientists understand this not too or at all well.
Small shares of both Democrats and Republicans say climate scientists understand very well the best ways to address climate change, though Democrats are more likely to say this (23% vs. 4%, respectively). Republicans are far more likely than Democrats to say climate scientists understand this not too or at all well (71% vs. 24%).
Democrats with more education rate climate scientists’ understanding higher than Democrats with less education. But how Republicans rate scientists’ understanding of aspects of climate change does not differ by education level. For example:
- 72% of Democrats with a postgraduate degree say climate scientists understand very well whether climate change is occurring. In comparison, 36% of Democrats with a high school degree or less say this – a 36 percentage point difference.
- Small shares of Republicans across education levels think climate scientists understand very well whether climate change is happening: 13% of Republicans with a postgraduate degree say this, as do 10% of Republicans with a high school degree or less.
These patterns also hold when Democrats and Republicans are asked about climate scientists’ understanding of the causes of climate change and its effect on extreme weather.
Past Center surveys have found that views about the role of human activity also vary by education level among Democrats but not Republicans.
When asked about climate scientists’ role in policy debates about climate change, half of Americans say they have too little influence. This share is down 4 points from 2021.
Smaller shares say climate scientists have too much (26%) or about the right amount of influence (22%) in policy debates.
In keeping with the wide partisan differences in ratings of climate scientists’ understanding of aspects of climate change, Democrats and Republicans are deeply divided about the appropriate role of climate scientists in policy debates.
Three-quarters of Democrats say climate scientists have too little influence in policy debates about climate change, while one-quarter of Republicans say the same – a difference of 50 points. About half of Republicans (49%) think climate scientists have too much influence.
There are also ideological divides within the GOP on climate scientists’ policy influence. Conservative Republicans are about twice as likely as moderate and liberal Republicans to say climate scientists have too much influence in public policy debates (60% vs. 29%).
Note: Here are the questions used for this analysis, along with responses, and its methodology.
| english |
#include <unistd.h>
#include <sys/param.h>
#include <stdlib.h>
#include <vector>
#include <algorithm>
#include <git2.h>
#include "color_code.h"
#include "color_combination.h"
#include "special_character.h"
#include "string_manipulation.h"
#include "git.h"
namespace git
{
#include "themes/default.cpp"
class GitRepoStateSnapshot {
public:
GitRepoStateSnapshot(std::string &repoPath);
~GitRepoStateSnapshot() {
if (currentBranchHandle)
git_reference_free(currentBranchHandle);
if (repoHandle)
git_repository_free(repoHandle);
}
std::string getBranchName() const { return currentBranchName; }
int getNumGenerationsAhead() const { return numCommitsAhead; }
int getNumGenerationsBehind() const { return numCommitsBehind; }
bool repoIsClean() const { return repoClean; }
bool repoContainsUntrackedFiles() const {return containsUntrackedFiles; }
bool isGitRepo() const { return gitRepoFound; }
private:
git_reference *currentBranchHandle = 0;
git_repository *repoHandle = 0;
size_t numCommitsAhead, numCommitsBehind;
std::string currentBranchName;
bool repoClean;
bool containsUntrackedFiles;
bool gitRepoFound;
void openGitRepo(std::string &repoPath);
void computeCurrentBranchName();
void computeGenerationDelta();
void computeRepoClean();
int computeNumUntrackedFiles(git_status_list *status);
git_commit *branchToCommit(git_reference *branch);
};
GitRepoStateSnapshot::GitRepoStateSnapshot(std::string &repoPath) {
openGitRepo(repoPath);
if (gitRepoFound) {
computeCurrentBranchName();
computeGenerationDelta();
computeRepoClean();
}
}
void GitRepoStateSnapshot::openGitRepo(std::string &repoPath) {
int error = 0;
while (repoPath.length() > 1) {
error = git_repository_open(&repoHandle, repoPath.c_str());
if (error >= 0) {
gitRepoFound = true;
return;
}
repoPath.erase(repoPath.rfind("/"));
}
}
void GitRepoStateSnapshot::computeCurrentBranchName() {
const char *branch_name;
if (git_repository_head_detached(repoHandle)) {
currentBranchHandle = nullptr;
currentBranchName = "(detached head)";
return;
}
int ret;
ret = git_repository_head(¤tBranchHandle, repoHandle);
if (ret) {
currentBranchHandle = nullptr;
currentBranchName = "(no branch)";
return;
}
git_branch_name(&branch_name, currentBranchHandle);
currentBranchName = branch_name;
}
void GitRepoStateSnapshot::computeGenerationDelta() {
if (!currentBranchHandle) //detached head
return;
git_commit *localHead, *upstreamHead;
int ret;
git_reference *upstream;
ret = git_branch_upstream(&upstream, currentBranchHandle);
if (ret) {
numCommitsAhead = 0;
numCommitsBehind = 0;
return;
}
localHead = branchToCommit(currentBranchHandle);
upstreamHead = branchToCommit(upstream);
const git_oid *localOid, *upstreamOid;
localOid = git_commit_id(localHead);
upstreamOid = git_commit_id(upstreamHead);
// for some reason, a commit to the local repo is a commit *behind* for this function
// TODO: More testing to make sure this works as intended
git_graph_ahead_behind(&numCommitsBehind, &numCommitsAhead, repoHandle, localOid, upstreamOid);
git_commit_free(localHead);
git_commit_free(upstreamHead);
git_reference_free(upstream);
}
git_commit *GitRepoStateSnapshot::branchToCommit(git_reference *branch) {
int error = 0;
git_object *commit_obj;
error = git_reference_peel(&commit_obj, branch, GIT_OBJ_COMMIT);
if (error)
return nullptr;
const git_oid *oid = git_object_id(commit_obj);
git_commit *commit;
error = git_commit_lookup(&commit, repoHandle, oid);
git_object_free(commit_obj);
if (error)
return nullptr;
return commit;
}
void GitRepoStateSnapshot::computeRepoClean() {
git_status_list *status;
git_status_options opts;
opts.version = GIT_STATUS_OPTIONS_VERSION;
opts.flags = GIT_STATUS_OPT_INCLUDE_UNTRACKED;
opts.show = GIT_STATUS_SHOW_INDEX_AND_WORKDIR;
opts.pathspec.count = 0;
git_status_list_new(&status, repoHandle, &opts);
int modifiedCount = git_status_list_entrycount(status);
int untrackedCount = computeNumUntrackedFiles(status);
containsUntrackedFiles = (untrackedCount > 0);
repoClean = (modifiedCount == untrackedCount);
git_status_list_free(status);
}
int GitRepoStateSnapshot::computeNumUntrackedFiles(git_status_list *status) {
const git_status_entry *entry;
int num_entries = git_status_list_entrycount(status);
int i, untrackedCount = 0;
for (i = 0; i < num_entries; ++i) {
entry = git_status_byindex(status, i);
if (entry->status == GIT_STATUS_WT_NEW)
untrackedCount++;
}
return untrackedCount;
}
std::string getSegment()
{
char cpath[MAXPATHLEN];
if( getcwd(cpath, sizeof(cpath)/sizeof(char)) == NULL )
return std::string();
std::string path = cpath;
GitRepoStateSnapshot repoState(path);
std::string *returnString = new std::string();
if (repoState.isGitRepo()) {
ColorCombination &separatorColors = repoState.repoIsClean() ? repo_clean_separator : repo_dirty_separator;
ColorCombination &textColors = repoState.repoIsClean() ? repo_clean : repo_dirty;
returnString->append(separatorColors.getColorCode());
returnString->append(special("separator"));
returnString->push_back(' ');
returnString->append(textColors.getColorCode());
returnString->append(special("git_branch"));
returnString->push_back(' ');
returnString->append(repoState.getBranchName());
if (repoState.getNumGenerationsAhead() > 0) {
returnString->push_back(' ');
returnString->append(std::to_string(repoState.getNumGenerationsAhead()));
returnString->append(special("git_ahead"));
}
if (repoState.getNumGenerationsBehind() > 0) {
returnString->push_back(' ');
returnString->append(std::to_string(repoState.getNumGenerationsBehind()));
returnString->append(special("git_behind"));
}
if (repoState.repoContainsUntrackedFiles())
returnString->append(" +");
returnString->push_back(' ');
separatorColors.inverse();
returnString->append(separatorColors.getColorCode());
returnString->append(special("separator"));
}
else {
returnString->append(ColorCombination( &lightgray, &darkgray ).getColorCode());
returnString->push_back(' ');
returnString->append(special("separator_thin"));
returnString->push_back(' ');
}
return *returnString;
}
}
| cpp |
package com.diguage.algorithm.leetcode;
/**
* = 378. Kth Smallest Element in a Sorted Matrix
*
* https://leetcode.com/problems/kth-smallest-element-in-a-sorted-matrix/[Kth Smallest Element in a Sorted Matrix - LeetCode]
*
* Given a n x n matrix where each of the rows and columns are sorted in ascending order, find the kth smallest element in the matrix.
*
* Note that it is the kth smallest element in the sorted order, not the kth distinct element.
*
* .Example:
* [source]
* ----
* matrix = [
* [ 1, 5, 9],
* [10, 11, 13],
* [12, 13, 15]
* ],
* k = 8,
*
* return 13.
* ----
*
* *Note:*
*
* You may assume k is always valid, 1 ≤ k ≤ n2.
*
*
* @author D瓜哥, https://www.diguage.com/
* @since 2020-01-23 18:08
*/
public class _0378_KthSmallestElementInASortedMatrix {
/**
* Runtime: 0 ms, faster than 100.00% of Java online submissions for Kth Smallest Element in a Sorted Matrix.
*
* Memory Usage: 56.2 MB, less than 5.41% of Java online submissions for Kth Smallest Element in a Sorted Matrix.
*
* Copy from: https://leetcode.com/problems/kth-smallest-element-in-a-sorted-matrix/discuss/85173/Share-my-thoughts-and-Clean-Java-Code[Share my thoughts and Clean Java Code - LeetCode Discuss]
*/
public int kthSmallest(int[][] matrix, int k) {
int low = matrix[0][0];
int length = matrix.length;
int high = matrix[length - 1][length - 1];
while (low < high) {
int mid = low + (high - low) / 2;
int count = 0;
int j = length - 1;
for (int i = 0; i < length; i++) {
while (j >= 0 && mid < matrix[i][j]) {
j--;
}
count += (j + 1);
}
if (count < k) {
low = mid + 1;
} else {
high = mid;
}
}
return low;
}
public static void main(String[] args) {
_0378_KthSmallestElementInASortedMatrix solution = new _0378_KthSmallestElementInASortedMatrix();
int[][] matrix = {
{1, 5, 9},
{10, 11, 13},
{12, 13, 15}
};
int r1 = solution.kthSmallest(matrix, 8);
System.out.println((r1 == 13) + " : " + r1);
}
}
| java |
Begin typing your search above and press return to search.
Sreejesh denies Welch. He saves thrice in that that attempt and has helped India pull off a victory. INDIA REMAIN UNBEATEN AT ROURKELA!
IND 4-3 AUS (SHOOUT OUT)
| english |
{
"author": "<NAME>",
"classification": "Rhymed Stanza",
"keywords": [
"Faith",
"Doubt",
"Religion",
"Christianity"
],
"period": "",
"reference": "http://www.poetryfoundation.org/poem/174730",
"region": "England",
"text": [
"Christ, whose glory fills the skies,",
"Christ, the true, the only light,",
"Sun of Righteousness, arise,",
"Triumph o\u2019er the shades of night:",
"Day-spring from on high, be near:",
"Day-star, in my heart appear.",
"Dark and cheerless is the morn",
"Unaccompanied by thee,",
"Joyless is the day\u2019s return,",
"Till thy mercy\u2019s beams I see;",
"Till thy inward light impart,",
"Glad my eyes, and warm my heart.",
"Visit then this soul of mine,",
"Pierce the gloom of sin, and grief,",
"Fill me, Radiancy Divine,",
"Scatter all my unbelief,",
"More and more thyself display,",
"Shining to the perfect day."
],
"title": "Morning Hymn",
"year": ""
} | json |
Kartik Aaryan shares how difficult it was to prep for 'Freddy'
Actor Kartik Aaryan is all set to appear in a never seen before avatar in his upcoming film 'Freddy'. He usual stars in comedic or romantic roles but in 'Freddy', he will be seen portraying a lonely and obsessed dentist who has no friends. Recently, Kartik took to Instagram to share a video describing how he prepped for this totally new kind of character.
He captioned the video, "From gaining 14 kilos to visiting a real clinic and learning skills from a dentist, being #Freddy has been a journey I will never forget... Forgetting my true self as Freddy while pushing my limits mentally and physically got changed. It was a pleasure working with an amazing team for this challenging on-screen transformation."
Revealing more about his character preparation, Kartik had shared, "I literally dwelled in the world of Freddy while shooting the film.It was important for me to remain in that headspace and go to the set and perform.I got disturbing nights because of 'Freddy' but it was important to be focused on the bigger picture and tried to curtail my regular activities while shooting Freddy so that I could focus on the film and the character.Post the wrap, I connected with my friends and family who keep me grounded and that helped me return to reality and normalcy again."
Follow us on Google News and stay updated with the latest!
| english |
{
"region": "oss-cn-shenzhen",
"accessKeyId": "<KEY>",
"accessKeySecret": "<KEY>",
"bucket": "bucketname",
"directory": "./dist",
"cleanOldFiles": true
} | json |
Smarter than most things on television, Sherlock’s 10 episodes over six years have made it a global phenomenon. So understandably, the world is going crazy about the first new episode since January 2014, The Abominable Bride.
Writers Steven Moffat and Mark Gatiss’s Sherlock, which was first aired in 2010, relocates Sir Arthur Conan Doyle’s detective stories to a time they were not written for — a bold experiment that has seen more hits and misses. Also, it has given the world television’s most loved bromance between a brattishly arrogant yet undoubtedly brilliant Sherlock Holmes and the endearingly bumbling John Watson. Since Benedict Cumberbatch (Sherlock) and Martin Freeman (Watson) are now too busy with their glorious movie careers for there to be any new Sherlock episodes till 2017, it was a surprise of the most splendid sort to catch the standalone 90-minute special The Abominable Bride. The episode will be aired on AXN India on January 9.
The ghost story, featuring a bride who has seemingly died but then returns to kill her husband, takes place in the original 1890s setting and features mysteries that none but Sherlock could unravel. The episode creates a bridge between the 2014 episodes and the ones we’ll see in 2017. It brings the consulting detective back from his doomed MI6 mission in eastern Europe and delves into the mystery of his arch-enemy Moriarty’s impossible return from the dead.
The slight detour in time works like a charm. Sherlock and Watson seem to be in their natural environment in the London of the 1890s. Toggling between the 19th century and the present, all the while keeping the humour and the sharp wit alive, the show is a little more complicated and convoluted than we’re used to. There are more themes, twists, realities and awkwardly placed social commentary that one can usually keep up with. But in a completely Sherlockian way, it all falls into place in the end. After all, when is anything in the show ever irrelevant?
| english |
Fish Required:
Ingredients:
5 small red chillies,
Two medium size onions (only one onion need to be used for grinding)
Two flakes of garlic.
Method:
All the above ingredients have to be ground finely together with onion and garlic in thin coconut milk. Once the ground masala is ready, in a dekchi heat two spoons of cooking oil and fry a sliced onion until golden brown. Add the ground masala and fry for about 5-8 minutes. Add water to the masala and keep it to the required thickness. Bring the curry to a good boil, add the cleaned hamour pieces and bring to a reasonable boil. Add the thick coconut milk and bring it to a good boil once again and serve with rice. | english |
<reponame>caiocltm/BoxDeliveryRestaurante<gh_stars>0
const winston = require('winston');
// Getting definitions of winston available transports (Info, Error).
const { InfoTransport, ErrorTransport } = require('./log-transport');
// Winston rotating files logging events listeners.
const { ErrorTransportEvents, InfoTransportEvents } = require('./log-events');
// Creating Winston logger instance.
const Logger = new winston.Logger({
transports: [
InfoTransport,
ErrorTransport
]
});
// Defining error transport event listeners.
ErrorTransportEvents(Logger, ErrorTransport);
// Defining info transport event listeners.
InfoTransportEvents(Logger, InfoTransport);
module.exports = Logger; | javascript |
'''
191. Number of 1 Bits
Write a function that takes an unsigned integer and returns the number of ’1' bits it has (also known as the Hamming weight).
For example, the 32-bit integer ’11' has binary representation 00000000000000000000000000001011, so the function should return 3.
'''
class Solution(object):
def hammingWeight(self, n):
"""
:type n: int
:rtype: int
"""
que=[]
offset = 2
while n!=0:
if n%offset == 1:
que.append(1)
n=n//2
return len(que)
if __name__ == '__main__':
solution = Solution()
t1=11
print(solution.hammingWeight(t1))
| python |
Jo Re Pujawa Harajai song is a Bhojpuri devotional song from the Aili Kaike Sherawa Sawari Se released on 2020. Music of Jo Re Pujawa Harajai song is composed by Vivek Byahut. Jo Re Pujawa Harajai was sung by Ajit Soni. Download Jo Re Pujawa Harajai song from Aili Kaike Sherawa Sawari Se on Raaga.com.
| english |
use super::{Color, Rgb, EPSILON};
use std::fmt::Display;
use crate::color::format_color;
#[derive(Debug, Copy, Clone)]
pub struct Hsl {
pub data: [f32; 4]
}
impl Hsl {
pub fn new(h: f32, s: f32, l: f32) -> Hsl {
Hsl { data: [h, s, l, 1.0] }
}
pub fn new_with_alpha(h: f32, s: f32, l: f32, alpha: f32) -> Hsl {
Hsl { data: [h, s, l, alpha] }
}
pub fn hue(&self) -> f32 {
self.data[0]
}
pub fn set_hue(&mut self, hue: f32) {
self.data[0] = hue;
}
pub fn saturation(&self) -> f32 {
self.data[1]
}
pub fn set_saturation(&mut self, saturation: f32) {
self.data[1] = saturation;
}
pub fn lightness(&self) -> f32 {
self.data[2]
}
pub fn set_lightness(&mut self, lightness: f32) {
self.data[2] = lightness;
}
pub fn with_hue(&self, hue: f32) -> Hsl {
Hsl { data: [hue, self.data[1], self.data[2], self.data[3]] }
}
pub fn with_saturation(&self, saturation: f32) -> Hsl {
Hsl { data: [self.data[0], saturation, self.data[2], self.data[3]] }
}
pub fn with_lightness(&self, lightness: f32) -> Hsl {
Hsl { data: [self.data[0], self.data[1], lightness, self.data[3]] }
}
}
impl Default for Hsl {
fn default() -> Hsl {
Hsl {
data: [0.0, 0.0, 0.0, 0.0]
}
}
}
impl Color for Hsl {
fn to_hsl(&self) -> Hsl {
*self
}
fn to_rgb(&self) -> Rgb {
let hue = self.hue();
let saturation = self.saturation();
let lightness = self.lightness();
let (red, green, blue) = if saturation == 0.0 {
// achromatic
(lightness, lightness, lightness)
} else {
fn hue2rgb(p: f32, q: f32, mut t: f32) -> f32 {
if t < 0.0 { t += 1.0 };
if t > 1.0 { t -= 1.0 };
if t < 1.0 / 6.0 { return p + (q - p) * 6.0 * t; };
if t < 1.0 / 2.0 { return q; };
if t < 2.0 / 3.0 { return p + (q - p) * (2.0 / 3.0 - t) * 6.0; };
p
}
let q = if lightness < 0.5 { lightness * (1.0 + saturation) } else { lightness + saturation - lightness * saturation };
let p = 2.0 * lightness - q;
(hue2rgb(p, q, hue + 1.0 / 3.0),
hue2rgb(p, q, hue),
hue2rgb(p, q, hue - 1.0 / 3.0))
};
Rgb {
data: [red, green, blue, self.alpha()]
}
}
fn alpha(&self) -> f32 {
self.data[3]
}
fn set_alpha(&mut self, alpha: f32) {
self.data[3] = alpha;
}
fn with_alpha(&self, alpha: f32) -> Hsl {
Hsl { data: [self.data[0], self.data[1], self.data[2], alpha] }
}
fn data(&self) -> &[f32] {
&self.data
}
fn try_map_color_channels<E, F: FnMut(f32) -> Result<f32, E>>(&self, mut func: F) -> Result<Self, E> {
Ok(Self::new_with_alpha(
func(self.data[0])?,
func(self.data[1])?,
func(self.data[2])?,
self.data[3]))
}
fn type_name(&self) -> &'static str {
"hsl"
}
}
impl PartialEq for Hsl {
fn eq(&self, other: &Hsl) -> bool {
for (v1, v2) in self.data.iter().zip(other.data.iter()) {
if (v1 - v2).abs() > EPSILON {
return false;
}
}
true
}
}
impl Display for Hsl {
fn fmt(&self, f: &mut std::fmt::Formatter<'_>) -> std::fmt::Result {
format_color(self, f)
}
}
#[cfg(test)]
mod tests {
use crate::color::{Rgb, Hsl, Color};
const RGB_HSL: [((f32, f32, f32), (f32, f32, f32)); 15] = [
((0.0, 0.0, 0.0), (0.0, 0.0, 0.0)),
((1.0, 1.0, 1.0), (0.0, 0.0, 1.0)),
((0.5, 0.5, 0.5), (0.0, 0.0, 0.5)),
((1.0, 0.0, 0.0), (0.0, 1.0, 0.5)),
((0.0, 1.0, 0.0), (0.33333334, 1.0, 0.5)),
((0.0, 0.0, 1.0), (0.6666667, 1.0, 0.5)),
((1.0, 0.5, 0.5), (0.0, 1.0, 0.75)),
((0.5, 1.0, 0.5), (0.33333334, 1.0, 0.75)),
((0.5, 0.5, 1.0), (0.6666667, 1.0, 0.75)),
((0.5, 0.0, 0.0), (0.0, 1.0, 0.25)),
((0.0, 0.5, 0.0), (0.33333334, 1.0, 0.25)),
((0.0, 0.0, 0.5), (0.6666667, 1.0, 0.25)),
((0.5, 0.0, 0.5), (0.8333333, 1.0, 0.25)),
((0.5, 0.5, 0.0), (0.16666667, 1.0, 0.25)),
((0.0, 0.5, 0.5), (0.5, 1.0, 0.25))];
#[test]
fn test_rgb_to_hsl() {
for (from, to) in &RGB_HSL {
assert_eq!(Rgb::new(from.0, from.1, from.2).to_hsl(), Hsl::new(to.0, to.1, to.2),
"Error in conversion from {:?} to {:?}", from, to);
}
}
#[test]
fn test_hsl_to_rgb() {
for (to, from) in &RGB_HSL {
assert_eq!(Hsl::new(from.0, from.1, from.2).to_rgb(), Rgb::new(to.0, to.1, to.2),
"Error in conversion from {:?} to {:?}", from, to);
}
}
#[test]
fn type_name() {
assert_eq!(Hsl::default().type_name(), "hsl");
}
#[test]
fn to_string() {
assert_eq!(Hsl::new_with_alpha(0.0, 0.0, 0.0, 1.0).to_string(), "hsl(0.0, 0.0, 0.0)");
assert_eq!(Hsl::new_with_alpha(1.0, 1.0, 1.0, 1.0).to_string(), "hsl(1.0, 1.0, 1.0)");
assert_eq!(Hsl::new_with_alpha(0.0, 0.0, 0.0, 0.0).to_string(), "hsla(0.0, 0.0, 0.0, 0.0)");
assert_eq!(Hsl::new_with_alpha(0.3, 0.6, 0.9, 0.5).to_string(), "hsla(0.3, 0.6, 0.9, 0.5)");
assert_eq!(Hsl::new_with_alpha(0.33, 0.666, 0.999, 0.5555).to_string(), "hsla(0.33, 0.666, 0.999, 0.5555)");
}
#[test]
fn test_setters() {
let mut color = Hsl::new_with_alpha(0.1, 0.3, 0.5, 0.7);
assert_eq!(color.hue(), 0.1);
assert_eq!(color.with_hue(0.2).hue(), 0.2);
color.set_hue(0.2);
assert_eq!(color.hue(), 0.2);
assert_eq!(color.saturation(), 0.3);
assert_eq!(color.with_saturation(0.4).saturation(), 0.4);
color.set_saturation(0.4);
assert_eq!(color.saturation(), 0.4);
assert_eq!(color.lightness(), 0.5);
assert_eq!(color.with_lightness(0.6).lightness(), 0.6);
color.set_lightness(0.6);
assert_eq!(color.lightness(), 0.6);
assert_eq!(color.alpha(), 0.7);
assert_eq!(color.with_alpha(0.8).alpha(), 0.8);
color.set_alpha(0.8);
assert_eq!(color.alpha(), 0.8);
}
} | rust |
Vietnam’s PM Pham Minh Chinh ordered officials to relax some visa requirements to help the Southeast Asian country attract more foreign tourists.
In a bid to attract more foreign tourist, the Vietnam government is looking at easing visa requirements. Vietnam has had difficulty in luring international travelers due to the strict visa policies that were imposed during the pandemic. These strict measures have resulted in less than 3.7 million foreign visitors in 2020, which is a decline compared to the 18 million recorded in 2019.
| english |
/**
* Copyright 2014 @ S1N1 Team.
* name :
* author : jarryliu
* date : 2013-12-08 11:44
* description :
* history :
*/
package sale
type ISale interface {
GetAggregateRootId() int
CreateGoods(*ValueGoods) IGoods
// 根据产品编号获取产品
GetGoods(int) IGoods
// 创建分类
CreateCategory(*ValueCategory) ICategory
// 获取分类
GetCategory(int) ICategory
// 获取所有分类
GetCategories() []ICategory
// 删除分类
DeleteCategory(int) error
// 获取所有的销售标签
GetAllSaleTags() []ISaleTag
// 初始化销售标签
InitSaleTags() error
// 获取销售标签
GetSaleTag(id int) ISaleTag
// 根据Code获取销售标签
GetSaleTagByCode(code string) ISaleTag
// 创建销售标签
CreateSaleTag(v *ValueSaleTag) ISaleTag
// 删除销售标签
DeleteSaleTag(id int) error
// 删除商品
DeleteGoods(int) error
// 获取指定的商品快照
GetGoodsSnapshot(id int) *GoodsSnapshot
// 根据Key获取商品快照
GetGoodsSnapshotByKey(key string) *GoodsSnapshot
}
| go |
@charset "UTF-8";
.jupiter {
font-family: 'Lato Bold', sans-serif;
font-size: 2rem;
font-weight: 700;
}
.saturn {
font-family: 'Lato Bold', sans-serif;
font-size: 1.556rem;
font-weight: 700;
}
.neptune {
font-family: 'Lato Bold', sans-serif;
font-size: 1.222rem;
font-weight: 700;
}
.venus {
font-family: 'Lato Bold', sans-serif;
font-size: 1rem;
font-weight: 700;
}
.mars {
font-family: 'Lato Regular', sans-serif;
font-size: 1rem;
}
.mercury {
font-family: 'Lato Bold', sans-serif;
font-size: 0.8889rem;
font-weight: 700;
}
.pluto {
font-family: 'Lato Regular', sans-serif;
font-size: 0.8889rem;
}
@media only screen and (max-width: 1007px) {
.jupiter {
font-size: 1.5556rem;
}
.saturn {
font-size: 1.333rem;
}
.neptune {
font-size: 1.111rem;
}
.venus {
font-size: 0.8889rem;
}
.mars {
font-size: 0.8889rem;
}
.mercury {
font-size: 0.7778rem;
}
.pluto {
font-size: 0.7778rem;
}
}
| css |
<reponame>liuyi0501/IwaraCollector<gh_stars>0
{"title":"Good-Night Kiss１８歳以上！","author":"OppyTorch","description":"great!!","thumb":"//i.iwara.tv/sites/default/files/styles/thumbnail/public/videos/thumbnails/2293958/thumbnail-2293958_0010.jpg?itok=znOHFIFl","download":"https://ecchi.iwara.tv/api/video/zmnymtekwvfk5qol8","origin":"https://ecchi.iwara.tv/videos/zmnymtekwvfk5qol8"} | json |
One of the best power-user tips I have to pass on is to learn the keyboard shortcuts for as many tasks as you can. Learning the shortcuts is easy, command-shift-s, shift-option-a..., but in OS X we don’t just have words to describe a command key, we have symbols too. Frankly, it always takes me a minute to recognize the symbol for “control” versus “option” versus “esc”. I’m wondering if I got the command right or if the beeping is “normal.” Ah but wonder no more! Thanks to the awesome folks at OS X Daily we now have a nice quick reference panel:
I know a lot of you are going “Oh! That’s what that funny symbol is!” Yep, exactly. Now, how many of you remember open-apple and closed-apple from the Apple II days? Yeah those were good times.
As a final Sunday tip for you, if you’re like me with fairly clumsy fingers, you might think about disabling your caps lock key. Here’s how:
- From the window that pops up, next to “caps lock” choose “No action” from the menu and click “OK.” Then you can close the Keyboard Prefs pane.
- If you have an external keyboard attached, repeat for it (when it’s attached).
Now you won’t accidentally mess up passwords because your caps lock is on, or other times when you don’t want caps!
Plus now you know what the funny symbols are on the menus so you can start learning all the cool keyboard shortcuts for the apps you use.
You can thank me later.
Get the most important tech news in your inbox each week.
| english |
An inter caste marriage in Hassan has taken unfortunate turns as just 12 days after the marriage; husband is alleging that his wife was forcibly taken home by her parents, while he was left to face assault by the police.
Guru and Shobha fell in love after three month's friendship and wanted to marry. Guru is an electrician, and the Shobha was pursuing her final year BA degree in one of the colleges in Hassan.
Shobha spoke about her love to her mother, following which Guru visited her house, spoke to her mother and tried to convince that he can take good care of her and they will be happy together.
But her family was not ready for an intercaste marriage and turned down his proposal. But Shobha was in love with Guru and had decided to marry him anyway. She asked Guru to meet her on July 27 and eloped with him on that day. Both with the help of Guru's friends and parents got married at a temple. Then the couple went to Bengaluru and lived there for a couple of days. Then, they came back to Hassan and registered their wedding.
After getting the wedding certificate, Guru posted his photo with the wife on Facebook. The next day, he got a call from the police station who asked him to write a statement referring Shobha's parents and asked him to get the documents of the marriage.
As said, the couple went to the police station. But to their shock, even before they entered the station, Shobha was pulled away from Guru, and he was thrown in a lockup. Her family asked her to throw away the toe ring and mangal sutra; else they threatened to hurt Guru.
Guru has alleged that they forcibly took her away and he was beaten up in the station. Now, he has come before the media stating that he wants his wife back.
However, so far there is no response from the girl or her family. | english |
#include "route_planner.h"
#include <algorithm>
RoutePlanner::RoutePlanner(RouteModel &model, float start_x, float start_y, float end_x, float end_y): m_Model(model) {
// Convert inputs to percentage:
start_x *= 0.01;
start_y *= 0.01;
end_x *= 0.01;
end_y *= 0.01;
start_node = &m_Model.FindClosestNode(start_x,start_y);
end_node = &m_Model.FindClosestNode(end_x,end_y);
}
float RoutePlanner::CalculateHValue(RouteModel::Node const *node) {
return node->distance(*end_node);
}
void RoutePlanner::AddNeighbors(RouteModel::Node *current_node) {
current_node->FindNeighbors();
for( auto neighbor : current_node->neighbors){
neighbor->parent = current_node;
neighbor->g_value = current_node->g_value + current_node->distance(*neighbor);
neighbor->h_value = CalculateHValue(neighbor);
open_list.push_back(neighbor);
neighbor->visited = true;
}
}
RouteModel::Node *RoutePlanner::NextNode() {
std::sort(open_list.begin(), open_list.end(),[](const auto &_1st,const auto &_2nd){
return _1st->h_value + _1st->g_value < _2nd->h_value + _2nd->g_value;
});
RouteModel::Node *lowest_node = open_list.front();
open_list.erase(open_list.begin());
return lowest_node;
}
std::vector<RouteModel::Node> RoutePlanner::ConstructFinalPath(RouteModel::Node *current_node) {
// Create path_found vector
distance = 0.0f;
std::vector<RouteModel::Node> path_found;
RouteModel::Node parent;
while(current_node->parent != nullptr){
path_found.push_back(*current_node);
parent= *(current_node->parent);
distance += current_node->distance(parent);
current_node = current_node->parent;
}
path_found.push_back(*current_node);
distance *= m_Model.MetricScale();
return path_found;
}
void RoutePlanner::AStarSearch() {
start_node->visited=true;
open_list.push_back(start_node);
RouteModel::Node *current_node = nullptr;
while (open_list.size()>0){
current_node = NextNode();
if(current_node->distance(*end_node) ==0){
m_Model.path = ConstructFinalPath(current_node);
return;
}
AddNeighbors(current_node);
}
} | cpp |
<filename>FER/Exams-master/FER2/MidtermExam_2017_18/src/main/java/hr/fer/oop/midterm_2017_18/task1/MilkBox.java
package hr.fer.oop.midterm_2017_18.task1;
import hr.fer.oop.midterm_2017_18.task1.items.*;
public class MilkBox extends ItemBox<Milk> {
}
| java |
<gh_stars>0
import time
from socket import *
# from config_util import *
class DAbroaddata(object):
dabroad_host=''
dabroad_port=6789
bufsize = 1024
def __init__(self):
# self.confobj = Config()
# self.dabroad_host = self.confobj.dabroad_host
# self.dabroad_port = self.confobj.dabroad_port
self.bufsize = self.bufsize
#与DA板建立连接
def connectDAboard(self):
addr = (self.dabroad_host, self.dabroad_port)
self.udpServer = socket(AF_INET, SOCK_DGRAM) # 创建一个服务器端UDP套接字
self.udpServer.bind(addr) # 开始监听
#得到DA板返回的数据
def dabroad_datareq(self):
data, addr = self.udpServer.recvfrom(self.bufsize) # 接收数据和返回地址
return data,addr
def udp_uncon(self):
self.udpServer.close()
return
udp_rc = DAbroaddata()
udp_rc.connectDAboard()
# for i in range(10000):
while(1):
data, addr = udp_rc.dabroad_datareq()
print(addr, data)
# time.sleep(0.01)
#!/usr/bin/python
# encoding=utf-8
import time
import websocket
# 配置远程服务器的IP，帐号，密码，端口等，因我做了双机密钥信任，所以不需要密码
# websocket服务端地址
ws_server = "ws://127.0.0.1:8002/websocket/"
def tailfLog():
"""获取远程服务器实时日志，并发送到websocket服务端"""
ws = websocket.WebSocket.create_connection(ws_server) # 创建websocket连接
while True:
data, addr = udp_rc.dabroad_datareq()
if addr[0]:
ws.send(addr[0]) #把内容发送到websocket服务端
print(time.time())
if __name__ == '__main__':
tailfLog() | python |
Since yesterday, the news on Twitter is that in the Mexican Congress, experts in ufology were demonstrating the first bodies of aliens to the world. Of course, this has set social media on fire with some quite alarming claims. Are they among us? The topic hasn’t been this hot since E.T.
But let’s get to the information: What happened yesterday? Supposed “non-human” alien corpses were exhibited to Mexican politicians in the country’s Congress. Yes, just like what happened in the US a few weeks ago.
The two small corpses of alleged aliens, claimed to have been collected in Cuzco, Peru, were presented on Wednesday in Mexico City in boxes with windows, which sparked excitement among extraterrestrial conspiracy theorists.
However, it’s important to note that the claims made by the self-proclaimed “ufologist” have not been substantiated, and Maussan has been associated with previous claims of discoveries that were later debunked.
During the public hearing, Maussan showed U.S. officials and Mexican government members several videos of “unidentified flying objects and anomalous phenomena” before unveiling the alleged alien corpses.
“These specimens are not part of our terrestrial evolution... They are not beings found after a UFO crash. They were found in diatomaceous earth mines (algae) and subsequently fossilized,” explained the journalist to the audience.
Maussan informed the attendees that the specimens had been studied by scientists from the National Autonomous University of Mexico (UNAM), who were able to extract DNA evidence through radiocarbon dating.
During the hearing, X-rays of the specimens were also shown, and experts testified under oath that in one of the bodies, “eggs” could be seen inside, and both were said to have implants made of very rare metals, such as osmium.
Ryan Graves, CEO of Americans for Safe Aerospace and a former U.S. Navy pilot, attended the event, having previously spoken before Congress this year about the threat that unidentified aerial phenomena posed to the national security of the United States.
Mr. Maussan has been previously associated with claims of “alien” discoveries that were later debunked, including five mummies found in Peru in 2017 that were subsequently proven to be human children. Hence, his credibility is not reliable.
| english |
{"ast":null,"code":"export class IdlError extends Error {} // An error from a user defined program.\n\nexport class ProgramError extends Error {\n constructor(code, msg, ...params) {\n super(...params);\n this.code = code;\n this.msg = msg;\n }\n\n toString() {\n return this.msg;\n }\n\n}","map":{"version":3,"sources":["../../src/error.ts"],"names":[],"mappings":"AAAA,OAAM,MAAO,QAAP,SAAwB,KAAxB,CAA6B,E,CAEnC;;AACA,OAAM,MAAO,YAAP,SAA4B,KAA5B,CAAiC;AACrC,EAAA,WAAA,CAAqB,IAArB,EAA4C,GAA5C,EAAyD,GAAG,MAA5D,EAAyE;AACvE,UAAM,GAAG,MAAT;AADmB,SAAA,IAAA,GAAA,IAAA;AAAuB,SAAA,GAAA,GAAA,GAAA;AAE3C;;AAEM,EAAA,QAAQ,GAAA;AACb,WAAO,KAAK,GAAZ;AACD;;AAPoC","sourceRoot":"","sourcesContent":["export class IdlError extends Error {\n}\n// An error from a user defined program.\nexport class ProgramError extends Error {\n constructor(code, msg, ...params) {\n super(...params);\n this.code = code;\n this.msg = msg;\n }\n toString() {\n return this.msg;\n }\n}\n//# sourceMappingURL=error.js.map"]},"metadata":{},"sourceType":"module"} | json |
/*
Copyright (c) Microsoft Corporation. All rights reserved.
Licensed under the MIT Licence.
This sample demonstrates how the defer() function can be used to defer a message for later processing.
In this sample, we have an application that gets cooking instructions out of order. It uses
message deferral to defer the instruction that is out of order, and then processes it in order.
See https://docs.microsoft.com/azure/service-bus-messaging/message-deferral to learn about
message deferral.
*/
const { ServiceBusClient, delay } = require("@azure/service-bus");
// Load the .env file if it exists
require("dotenv").config();
// Define connection string and related Service Bus entity names here
const connectionString = process.env.SERVICEBUS_CONNECTION_STRING || "<connection string>";
const queueName = process.env.QUEUE_NAME || "<queue name>";
async function main() {
await sendMessages();
await receiveMessage();
}
// Shuffle and send messages
async function sendMessages() {
const sbClient = new ServiceBusClient(connectionString);
// createSender() can also be used to create a sender for a topic.
const sender = sbClient.createSender(queueName);
const data = [
{ step: 1, title: "Shop" },
{ step: 2, title: "Unpack" },
{ step: 3, title: "Prepare" },
{ step: 4, title: "Cook" },
{ step: 5, title: "Eat" }
];
const promises = new Array();
for (let index = 0; index < data.length; index++) {
const message = {
body: data[index],
subject: "RecipeStep",
contentType: "application/json"
};
// the way we shuffle the message order is to introduce a tiny random delay before each of the messages is sent
promises.push(
delay(Math.random() * 30).then(async () => {
try {
await sender.sendMessages(message);
console.log("Sent message step:", data[index].step);
} catch (err) {
console.log("Error while sending message", err);
}
})
);
}
// wait until all the send tasks are complete
await Promise.all(promises);
await sender.close();
await sbClient.close();
}
async function receiveMessage() {
const sbClient = new ServiceBusClient(connectionString);
// If receiving from a subscription, you can use the createReceiver(topicName, subscriptionName) overload
let receiver = sbClient.createReceiver(queueName);
const deferredSteps = new Map();
let lastProcessedRecipeStep = 0;
try {
const processMessage = async (brokeredMessage) => {
if (
brokeredMessage.subject === "RecipeStep" &&
brokeredMessage.contentType === "application/json"
) {
const message = brokeredMessage.body;
// now let's check whether the step we received is the step we expect at this stage of the workflow
if (message.step === lastProcessedRecipeStep + 1) {
console.log("Process received message:", message);
lastProcessedRecipeStep++;
await receiver.completeMessage(brokeredMessage);
} else {
// if this is not the step we expected, we defer the message, meaning that we leave it in the queue but take it out of
// the delivery order. We put it aside. To retrieve it later, we remeber its sequence number
const sequenceNumber = brokeredMessage.sequenceNumber;
deferredSteps.set(message.step, sequenceNumber);
console.log("Defer received message:", message);
await receiver.deferMessage(brokeredMessage);
}
} else {
// we dead-letter the message if we don't know what to do with it.
console.log(
"Unknown message received, moving it to dead-letter queue ",
brokeredMessage.body
);
await receiver.deadLetterMessage(brokeredMessage);
}
};
const processError = async (args) => {
console.log(`>>>>> Error from error source ${args.errorSource} occurred: `, args.error);
};
receiver.subscribe(
{ processMessage, processError },
{
autoCompleteMessages: false
}
); // Disabling autoCompleteMessages so we can control when message can be completed, deferred or deadlettered
await delay(10000);
await receiver.close();
console.log("Total number of deferred messages:", deferredSteps.size);
receiver = sbClient.createReceiver(queueName);
// Now we process the deferred messages
while (deferredSteps.size > 0) {
const step = lastProcessedRecipeStep + 1;
const sequenceNumber = deferredSteps.get(step);
const [message] = await receiver.receiveDeferredMessages(sequenceNumber);
if (message) {
console.log("Process deferred message:", message.body);
await receiver.completeMessage(message);
} else {
console.log("No message found for step number ", step);
}
deferredSteps.delete(step);
lastProcessedRecipeStep++;
}
await receiver.close();
} finally {
await sbClient.close();
}
}
main().catch((err) => {
console.log("Error occurred: ", err);
process.exit(1);
});
| javascript |
At the time I took this trip, I was still pursuing my under-graduation degree in a college in Mumbai. My sister and her husband live in Germany and they invited me to come to Europe in my summer vacations. I gladly accepted their invitation and was all set for my first all-alone international air travel. Though I put on a "I am all grown up and i am strong" face, I had my own apprehensions about travelling alone for 12 hours till I met my sister in Frankfurt where she would pick me. My father had booked a round trip on Emirates. The itinerary had a stop-over in Dubai. Being a mild shopaholic myself, my primary concern was what if I get lost in shopping/window shopping in the world's largest Duty free outlets in Dubai airport and miss my connecting flight. But luckily my nightmare didn't come true and I successfully boarded my connecting flight. I felt like I have accomplished something and this felling gave me the "I can do any thing" confidence. Then I started letting go of my apprehensions and started enjoying all the little new experiences that came along my way. That is how I opened up to experience new things and I think this ability is most essential for a road trip/backpacking trip that one will remember forever.
After landing in Frankfurt, my sister picked me up from the airport and we drove to her place in Saarbrucken. Our road trip were to start two days after that so I had enough time to explore the city along with my sister.
- Small city and has Saar river running through it.
- For all foodies out there, the city has one Michelin 3 star and one Michelin 2 star restaurants. I went to the Michelin 3 star restaurant. We had an elaborate 5 course meal with different wine complementing each course (completely planned by the chef). Its the most expensive restaurant i have ever been to (200 Euros per person) but the experience was totally worth it. Thanks to my brother-in- law for paying the bills (phew!)
- The city has good trekking spots. If you are there in the area, do not miss the trek to Saarbend! The drive to the point from where the trek starts and the trek itself and finally the saar bend view are very amazing.
- The city has turkish and srilankan stores from where my sister buys all Indian vegetables and spices. So if you are a vegetarian and cant find vegetarian food (very difficult to find in Europe) or if you prefer to cook your own food, you can look for these stores.
2nd Stop - Paris We planned our road trip mostly in Italy and Switzerland. But I didnt want to go to India without going to Paris (being a mild shopaholic). So we took a train to Paris (euro rail)
- Euro rail took around 160 Euros per person for a round trip from Saarbrucken to paris. This is more expensive compare to a road travel but we took it anyways because we wanted to save time and didnt want stress ourselves before our road trip.
- If you are a student carry your Student Identity Card. You will get heavy discounts on the entrance tickets to all museums, tourist spots, etc such as Lourve Museum, Eiffel tower, Notre Dam etc.
- Depending on the number of days you are going to stay, take metro passes. The metro in Paris is very well connected and very impressive. Commuting through metro is very easy and saves a lot of time. It is cheap too! Mostly all the tourist spots are close to the metro stations and you could conveniently walk to them without hiring a cab (which is expensive compared to the metro).
- If you are an Indian, do not miss Sarvana Bhavan ( near Gare du Nord metro station). And please have mango lassi and filter coffee.
- Do not curse your hotel for giving you cramped rooms. All hotel rooms in Paris are cramped.
- There are many coffee sops and restaurants that serve food by the side of the streets near famous tourist spots. We went to coffee shop like that near Notre Dam Cathedral. Its a very plesant experience with a world famous site in front of your eyes, by the Sienne river and with engaging and kind waiters.
- At that time in Paris, Angels and Demons movie was playing in the cinemas. As we had planned to go to Rome and the Vatican City in our itinerary, we decided to go to the movie. We went to a cinema complex on Champ de Eulysses street, which was even more alive in the night.
3rd Stop - Lausanne After coming back from Paris, we took rest for a day. We filled our hired car with all the luggage, music for the road, ample water, munchies and we were all set!
- It was on the way to Chimonix, so we didnt really explore everything.
- We made a stop at the Chillon castle. Its one of those medieval castles on the banks of lake Geneva. It has got magical views that will make you loose track of time.
- The drive is beside the lake. So dont be shy to stop your car to take a dip in the lake if its sunny outside.
- There is a restaurant bang opposite to the castle with stunning views from the patio. With the Alps and the Lake Geneva in the background, The castle looks even more charming from the restaurant s patio. For pet lovers, if you are lucky you will get to pet the owner s white lab (i have never seen a white lab before).
4th stop - Chimonix Its very easy to lose track of which country you are in when in Europe. Lausanne is in Switzerlad. Chimonix is in France. When you take a cable car and go to the top peak in Chimonix, you can see Italy and Switzerland (while still in France)
(MORE TO COME)
| english |
It's been close to 18 months since Microsoft and Yahoo began their on-again/off-again mating dance. On July 29, the two finally agreed to a plan, whereby Bing becomes the search engine behind Yahoo and Yahoo becomes the ad force for both companies' online advertisers.
Microsoft and Yahoo issued a joint press release outlining the details of their agreement. My blogging colleague Larry Dignan outlined some of the most interesting points, including:
There are more than a few provisions that may prove thorny to implement. For example:
There have been lots of twists and turns in the Microsoft-Yahoo saga. Do you think the new deal -- at least what we know about it so far -- sounds like the best path for Microsoft to have taken to grow its share in the search/online ad business?
What do you think will happen next in the never-ending Microsoft-Yahoo saga?
Will regulators (possibly spurred by Microsoft and Yahoo competitors) try to derail the deal? Will the agreement prove too technically or managerially complex for the pair to manage? Or do you see the No. 2 and No. 3 players in search being willing to set aside differences to take on Google?
| english |
<filename>sri/mobx-react/4.4.0.json
{"custom.js":"sha256-5lmRKAeM9zDta3wPUUTRyldtYtzlycx8ynOa/1+mCPY=","custom.min.js":"sha256-OdnnaDIeKKmhoDU+CCBGp7rFGdQnZgN48XGpqseNuUo=","index.js":"sha256-qG8Rx30o/OOMps9MDJmMuct4qgLmyTDLCjdgtXKObM8=","index.min.js":"sha256-rrpwMJPLdVQqQWDga51nGBvQKtXrMe8M/48ZpZbx3Rs=","native.js":"sha256-7IF+mGGp+hen+NUd5KOKdcuv/sJ3z8NJk8erbnuYuj0=","native.min.js":"sha256-nZiNan3hH0mHLsGjWLX2FTudtSfIkR4ZqCKqh9H00Fc="} | json |
<filename>templates/jquery/js/groups.json
{
"Charts": "data visualization for Category and Financial data. Radial, Scatter, Pie and Doughnut charts.",
"Data Entry": "user input controls including multiple editors and combo.",
"Data Grids": "display tabular data with feature rich Grids, Hierarchical and Tree Grids."
} | json |
Kunming: Chinese officials in Kunming ordered two fake Apple shops to close, a local newspaper reported on Monday, an apparent reaction to a storm of media attention about an unauthorized and elaborate hoax store in the southwestern city.
A total of five self-branded "Apple Stores" were found to be operating without authorisation from Apple Inc according to the Metropolitan Times report, posted on the Kunming government website.
Two stores were told to shut down because they did not have an official business license, the paper reported, not due to concerns about copyright, piracy or other concerns.
Inspections of around 300 shops in Kunming were carried out after a blog post by an American living in the city exposed a near flawless fake Apple Store where even the staff were convinced they were working for the iPhone and iPad maker.
That store, one of three found by the "BirdAbroad" blogger in the city, was not one of the stores closed.
In addition to protecting trademarks, Chinese law prohibits companies from copying the "look and feel" of other companies' stores, but enforcement is often spotty.
But the United States and other Western countries have often complained China is woefully behind in its effort to stamp out intellectual property theft.
In May, China was listed for the seventh year by the US Trade Representative's office as a country with one of the worst records for preventing copyright theft.
Piracy and counterfeiting of US software and a wide range of other intellectual property in China cost US businesses alone an estimated $48 billion and 2. 1 million jobs in 2009, the US International Trade Commission has said.
Countless unauthorised resellers of Apple and other brands' electronic products throughout China sell the real thing but buy their goods overseas and smuggle them into the country to skip taxes.
All the five unauthorised Apple shops in Kunming were selling genuine Apple products, the newspaper said.
Apple has just four genuine Apple Stores in China, in Beijing and Shanghai, and none in Kunming in Yunnan province. The company, which has 13 authorised resellers in Kunming, could not be reached for comment.
Apple's brand is the world's most valuable, worth some $153 billion, according to a study earlier this year. (This story has not been edited by News18 staff and is published from a syndicated news agency feed - Reuters) | english |
During the early part of my career, an era when the wheel was just about starting to gain popularity, I came across a horror story of how ruthlessly companies behaved with their staff. Much gutter water has flown through Mithi since then and I have witnessed many more horror stories of various other kinds. But the story always comes back to me on Labour Day. And this year another example of cruelty to an employee has brought that memory flooding back.
Those were the times when software companies were just about beginning to make their presence felt but were not recruiting in large numbers. Most employment was generated by Public Sector Undertakings (PSUs). Trade Unionism was past the heydays of Datta Samant in the 80s, but still strong enough. To put it in cricketing terms, they were like the Sachin Tendulkars/Ricky Pontings/Adam Gilchrists of today, respected but not feared. PSU banks had started to retrench employees by offering Voluntary Retirement Schemes (VRS) packages on the back of increased ‘computerisation’. Winter was coming.
I met up with a friend’s cousin who worked with a foreign company which was recently taken over by another foreign company. The culture in his new organisation was very different and far more Indian (read mean and stingy) than his original employer. Cost- cutting was etched in their DNA, not unlike the defeatist attitude prevalent in the Pune Warriors team. The original employer, on the other hand, was throw back to the Raj (the Brit one, and not the Maharashtra Navnirman Sena) era, laid back and relaxed.
The cousin was a part of the clerical staff and he was ‘offered’ a VRS package by the new employer. He was nowhere close to retirement and also part of the Union. He refused to accept the package. For the next year or so he was made to suffer. It wasn’t overt intimidation but slow ‘mental disintegration’. A group of around 50 such ‘errant’ employees were transferred from their original jobs to admin and called to work at a large industrial space with some wooden benches. They were not given any work but were expected to come and sit in ‘office’ from 10 to 17:30 every day, with a half hour lunch break. They were not allowed to bring newspapers or any other reading material to office. They were not allowed to interact with each other. Just imagine the plight of a person who has to sit on a bench (literally) and do nothing, absolutely nothing for the entire day. It was almost like prison. Most people did take that ‘voluntary’ retirement after some time. The cousin succumbed as well.
Cut to the present and we have a guy who isn’t even unwanted by his employer. Actually he was recruited amongst major fanfare, paid obscene amount of money and was a figure of envy for his peers. But he is going through a similar experience of the cousin. He has precious little to do; just goes to work and then sits on a bench. I can imagine what the poor chap must be undergoing.
I fully sympathise with many foreign players in general and Glenn Maxwell in particular for the mental agony they are suffering.
Happy Labour Day, all!
(Rahul Namjoshi, an utter failure as an MBA, has no published novel to boast of and hence trying the next best thing – blogging. There, too, the results there aren’t too encouraging. Rahul pens his thoughts on the game in a blog called “Not Cricket”)
| english |
<gh_stars>0
#!usr/bin/env ipython
"""Coding interview problem (array, math):
See `https://www.interviewbit.com/problems/kth-smallest-element-in-the-array/`
Find the kth smallest element in an unsorted array of non-negative integers.
Definition of kth smallest element:
kth smallest element is the minimum possible n such that there are at least k elements in the array <= n.
In other words, if the array A was sorted, then A[k - 1] ( k is 1 based, while the arrays are 0 based )
NOTE:
You are not allowed to modify the array ( The array is read only ).
Try to do it using constant extra space.
Example:
A : [2 1 4 3 2]
k : 3
answer : 2
"""
class Solution:
# @param A : tuple of integers
# @param k : integer
# @return an integer
# This implementation is slow, time limit exceeds
def kthsmallest(self, A, k):
if type(A) == int:
return A
else:
temp_A = list(A)
min_list = []
index = 0
while index < k: # k is 1 based, e.g. k=3 means 3 elements
current_min = min(temp_A)
min_list.append(current_min)
temp_A.remove(current_min)
index += 1
return max(min_list)
# This implementation uses extra space, not constant extra space
def kthsmallest2(self, A, k):
if type(A) == int:
return A
else:
temp_A = list(A)
temp_A.sort()
return temp_A[k-1]
# Need a method that is constant space and O(k) time
def kthsmallest3(self, A, k):
return None
if __name__ == '__main__':
s = Solution() # create Solution object
A = (1,3,2,234,5,6,1)
k = 4
print s.kthsmallest(A,k)
| python |
{
"version": "1.1.3",
"license": "MIT",
"name": "revalue",
"description": "A simple and intuitive way of doing incremental and reactive programming",
"keywords": [
"reactive",
"incremental",
"programming",
"dependency",
"registry",
"variables",
"functions",
"revalue"
],
"author": {
"name": "<NAME>"
},
"repository": {
"type": "git",
"url": "git://github.com/guitarino/revalue.git"
},
"main": "./src/revalue.js",
"scripts": {
"prepublish": "npm run build",
"build": "browserify ./src/revalue.browser.js -o ./build/revalue.js && uglifyjs -o ./build/revalue.js ./build/revalue.js && concat -o ./build/revalue.js ./src/license.js ./build/revalue.js",
"install-global-deps": "npm install -g uglify-js@1 && npm install -g browserify && npm install -g concat"
}
} | json |
United Nations: India has rejected Pakistan Prime Minister Nawaz Sharif’s “peace initiative” saying that de-terrorising Pakistan is the answer, not demilitarising Kashmir.
After raising the Kashmir issue at the General Assembly on Wednesday, Sharif proposed a four-point peace initiative for India that embraces demilitarising Kashmir, renouncing the use or threat of use of force, withdrawal from Siachen Glacier and formalising ceasefire along the Line of Control.
But before proposing the peace initiative, Nawaz made the acrimonious reference to Kashmir, equating it with Palestinian and portraying it as a religious issue.
“Muslims are suffering across the world: Palestinians and Kashmiris oppressed by foreign occupation,” he said.
Just after trying to internationalise Kashmir, Nawaz tried to couch the peace proposal as a bilateral move since India’s condition is that the Kashmir dispute is a bilateral one and there should be no outside involvement. However, it did included a request to increase the UN Millitary Observers Group in India and Pakistan (UNMOGIP).
New Delhi considers Kashmir an integral part of India and any such move an interference in internal affairs and counterproductive to a dialogue. Recent attempts at holding bilateral talks have been sabotaged by Pakistan bringing in the Kashmir question or engaging Kashmiri separatists.
He said that “the two countries should address and resolve the causes of tension and take all possible measures to avert further escalation” and for this he asserted he was making the peace initiative proposal.
These were the four points in his proposal:
– Pakistan and India reaffirm that they will not resort to the use or the threat of use of force under any circumstances.
– Unconditional mutual withdrawal from Siachen Glacier,
“An easing of threat perceptions through such peace efforts will make it possible for Pakistan and India to agree on a broad range of measures to address the peril posed by offensive and advanced weapons systems,” Sharif said.
However, beyond the international publicity that Nawaz hopes his announcement could generate for him, his initiative has internal contradictions.
As Swarup said in his tweet, demilitarising Kashmir would not be possible unless there was an end to terrorists backed by elements in the Pakistani government crossing over, which would be an unlikely development.
Similarly, the border tensions have been a result of cross-border terrorism.
Nawaz did not offer any credible solutions to terrorism directed against India, including a crackdown on anti-India terrorists or handing over to India those wanted for terror in India.
On Monday, Afghanistan CEO Abdullah Abdullah, however, accused Pakistan on being a sanctuary for terrorists and of going back on its word to stop terrorism against his country.
Meghalaya scored 92.85 out of 100 possible points in a Gaming Industry Index and proved to be India’s most gaming-friendly state following its recent profound legislation changes over the field allowing land-based and online gaming, including games of chance, under a licensing regime.
Starting from February last year, Meghalaya became the third state in India’s northeast to legalise gambling and betting after Sikkim and Nagaland. After consultations with the UKIBC, the state proceeded with the adoption of the Meghalaya Regulation of Gaming Act, 2021 and the nullification of the Meghalaya Prevention of Gambling Act, 1970. Subsequently in December, the Meghalaya Regulation of Gaming Rules, 2021 were notified and came into force.
The move to legalise and license various forms of offline and online betting and gambling in Meghalaya is aimed at boosting tourism and creating jobs, and altogether raising taxation revenues for the northeastern state. At the same time, the opportunities to bet and gamble legally will be reserved only for tourists and visitors.
“We came out with a Gaming Act and subsequently framed the Regulation of Gaming Rules, 2021. The government will accordingly issue licenses to operate games of skill and chance, both online and offline,” said James P. K. Sangma, Meghalaya State Law and Taxation Minister speaking in the capital city of Shillong. “But the legalized gambling and gaming will only be for tourists and not residents of Meghalaya,” he continued.
To be allowed to play, tourists and people visiting the state for work or business purposes will have to prove their non-resident status by presenting appropriate documents, in a process similar to a bank KYC (Know Your Customer) procedure.
With 140 millions of people in India estimated to bet regularly on sports, and a total of 370 million desi bettors around prominent sporting events, as per data from one of the latest reports by Esse N Videri, Meghalaya is set to reach out and take a piece of a vast market.
Estimates on the financial value of India’s sports betting market, combined across all types of offline channels and online sports and cricket predictions and betting platforms, speak about amounts between $130 and $150 billion (roughly between ₹9.7 and ₹11.5 lakh crore).
Andhra Pradesh, Telangana and Delhi are shown to deliver the highest number of bettors and Meghalaya can count on substantial tourists flow from their betting circles. The sports betting communities of Karnataka, Maharashtra, Uttar Pradesh and Haryana are also not to be underestimated.
Among the sports, cricket is most popular, registering 68 percent of the total bet count analyzed by Esse N Videri. Football takes second position with 11 percent of the bets, followed by betting on FIFA at 7 percent and on eCricket at 5 percent. The last position in the Top 5 of popular sports for betting in India is taken by tennis with 3 percent of the bet count.
Meghalaya residents will still be permitted to participate in teer betting over arrow-shooting results. Teer is a traditional method of gambling, somewhat similar to a lottery draw, and held under the rules of the Meghalaya Regulation of the Game of Arrow Shooting and the Sale of Teer Tickets Act, 2018.
Teer includes bettors wagering on the number of arrows that reach the target which is placed about 50 meters away from a team of 20 archers positioned in a semicircle.
The archers shoot volleys of arrows at the target for ten minutes, and players place their bets choosing a number between 0 and 99 trying to guess the last two digits of the number of arrows that successfully pierce the target.
If, for example, the number of hits is 256, anyone who has bet on 56 wins an amount eight times bigger than their wager.
| english |
Begin typing your search above and press return to search.
The state general meeting of the Ellora Vigyan Mancha will be held in Tezpur from April 7 to April 9.
GUWAHATI: The state general meeting of the Ellora Vigyan Mancha will be held in Tezpur from April 7 to April 9. The general secretary of the organization, Kamlesh Gupt said that this event would be organized to develop and mobilize scientific mentality among the people of the State.
Also Watch: | english |
The no-ball controversy during the match between Chennai Super Kings and Rajasthan Royals in Jaipur made cricket lovers across the world realize that even Mahendra Singh Dhoni is human. The cricketer who is known to be Captain Cool not only lost his temper but behaved in an unusual manner.
With the 3rd Ball of the 20th Over, RR Bowler Ben Stokes bowled MS Dhoni with a percent yorker. CSK need to score 8 runs in the last three balls to win the match.
Thereafter, CSK Player Santner received a waist-high full toss but the Umpire hasn't declared it as no-ball. Non-striker Ravindra Jadeja has protested the decision of the Umpire. Dhoni who was in the dug-out stepped on the field to complain about the no-ball issue. Still, The Square Leg Umpire Bruce Oxenford remained firm on his decision.
Miscommunication between the two on-field umpires led to the whole issue. Though it's a mistake, Dhoni coming on the field to have a discussion with Umpires is unacceptable. BCCI fined Dhoni 50 percent of his match fee for the violation. As per ICC Rules, Any Cricketer who objects the decision of an Umpire will face suspension for 1 Test and 2 ODIs.
Former Cricketers told they have never seen a Cricketer or Skipper behave in such an unacceptable manner during a match. Sehwag told, 'Dhoni deserves suspension for 2 ODIs for what he did. I would have been happy had if he did that as a Team India Cricketer. Never did he showed so much anger while playing for India. Imposing Fine is a small punishment. He should have been suspended for one or two matched so that no other cricketer will do such things'.
Ganguly responded on the incident in this manner, 'Everyone is human. It's an unusual incident. His competitiveness is remarkable'. | english |
The Daesh Takfiri terrorist group has been holding dozens of Druze women and children hostage since it abducted them from their village in Syria's southern province of Suwayda last week, a monitor says.
“Twenty women and 16 children were kidnapped by” Daesh terrorists “on July 25,” said Rami Abdel-Rahman, the head of the so-called Syrian Observatory for Human Rights, in a report published on Monday, adding that four of the abductees had already managed to escape from the grips of terrorists to Druze areas.
Two of the kidnapped civilians also lost their lives and “30 others are still in captivity,” further said the head of the UK-based group.
More than 250 people were killed on Wednesday when Daesh terrorists, who lost all of their urban bastions in the Arab country late last year, launched a brutal attack against civilians in rural areas inhabited by the Druze minority.
According to the monitor, at least 36 women and children were kidnapped by terrorists during the attacks. Abdel-Rahman further said that another 17 men from the attacked areas were still unaccounted for, but added that it was unclear whether they had also been abducted.
Some reports say that the abductees were all from the village of al-Shabki, in the eastern hinterlands of the province.
The terror group has not yet claimed the kidnappings and no details on the abductees could be found on its propaganda channels.
Suwayda, which is largely under the control of the Syrian government troops, is home to the Druze minority. The province has been relatively insulated from Syria’s seven-year bloody war launched by foreign-backed militants and terror group against Damascus. | english |
{{ $username := .Site.Params.tinyletter.username }}
{{ $title := T "tinyletter_title" }}
{{ $message := T "tinyletter_message" }}
{{ $color := .Params.color | default "accent" }}
{{ if .Params.letter }}
{{ $username = .Params.letter }}
{{ $title = .Params.lettertitle }}
{{ $message = .Params.lettermessage }}
{{ $color = .Params.color }}
{{ end }}
{{ if (and $username (not .Params.hideSubscribe)) }}
<div class="bg-{{ $color }}-200 {{$color}}-800 w-full px-4 mx:px-0 py-12 text-gray-700 text-base">
<div class="container mx-auto md:max-w-lg">
<form class="flex flex-col items-center"
action="https://buttondown.email/api/emails/embed-subscribe/{{ $username }}" method="post"
target="popupwindow"
onsubmit="window.open('https://buttondown.email/{{ $username }}', 'popupwindow')"
class="embeddable-buttondown-form">
<h2 class="text-lg font-semibold ">{{ $title }}</h2>
<label for="bd-email">
{{$message}}
</label>
<div
class="mt-4 border-2 w-full flex flex-row justify-between overflow-hidden rounded-sm bg-white border-{{$color}}-500 hover:border-{{$color}}-600 tranistion duration-500 ease-in-out">
<input
class="border-none focus:border-none m-0 ml-4 w-full rounded-none appearance-none py-2 text-gray-700 leading-tight focus:outline-none focus:shadow-none"
type="email" name="email" id="bd-email" />
<input type="hidden" value="1" name="embed" />
<input
class="bg-{{$color}}-500 rounded-none hover:bg-{{$color}}-600 transition duration-500 ease-in-out text-white font-bold py-2 m-0 -ml-4 md:ml-0 appearance-none px-4 focus:outline-none focus:shadow-outline cursor-pointer"
type="submit" value="{{ T "subscribe" }}" />
</div>
</form>
</div>
</div>
{{ end}}
| html |
<gh_stars>1-10
package org.camunda.platform7.extension.graphql;
import com.fasterxml.jackson.databind.ObjectMapper;
import graphql.ExecutionResult;
import org.camunda.bpm.engine.runtime.ProcessInstance;
import org.camunda.platform7.extension.graphql.infratest.bpm.BaseTest;
import org.camunda.platform7.extension.graphql.infratest.bpm.services.WeatherCheckService;
import org.camunda.platform7.extension.graphql.infratest.comparators.Comparators;
import org.camunda.platform7.extension.graphql.infratest.comparators.DateExpressionMatcher;
import org.camunda.platform7.extension.graphql.infratest.comparators.IsANumberExpressionMatcher;
import org.camunda.platform7.extension.graphql.infratest.comparators.IsPresentExpressionMatcher;
import org.camunda.platform7.extension.graphql.infratest.scenarios.BDD;
import org.junit.Test;
import org.skyscreamer.jsonassert.comparator.CustomComparator;
import org.springframework.beans.factory.annotation.Autowired;
import static java.lang.Thread.sleep;
import static org.mockito.Mockito.reset;
import static org.mockito.Mockito.when;
import static org.skyscreamer.jsonassert.JSONAssert.assertEquals;
import static org.skyscreamer.jsonassert.JSONCompareMode.STRICT;
public class IncidentTest extends BaseTest {
private static final String PROCESS_KEY = "weather-process";
private static final String BUSINESS_KEY = "985569948";
@Autowired
private WeatherCheckService service;
private ProcessInstance processInstance;
private final CustomComparator comparators = Comparators.comparators(STRICT,
IsANumberExpressionMatcher.isNumeric( "incidents[0].id"),
DateExpressionMatcher.isDate( "incidents[0].incidentTimestamp"),
IsANumberExpressionMatcher.isNumeric("incidents[0].executionId"),
IsANumberExpressionMatcher.isNumeric("incidents[0].causeIncidentId"),
IsANumberExpressionMatcher.isNumeric("incidents[0].rootCauseIncidentId"),
IsANumberExpressionMatcher.isNumeric("incidents[0].jobDefinitionId"),
IsANumberExpressionMatcher.isNumeric("incidents[0].processInstanceId"),
IsPresentExpressionMatcher.isPresent("incidents[0].processDefinitionId"),
IsANumberExpressionMatcher.isNumeric("incidents[0].configuration")
);
@Override
public void setUp() throws Exception {
super.setUp();
scenario.load("incident-scenarios.json");
reset(this.service);
when(service.checkWeather()).thenThrow(new Exception("Exception to generate a incident"));
processInstance = runtimeService.startProcessInstanceByKey(PROCESS_KEY, BUSINESS_KEY);
}
@Test
public void shouldReturnTheIncidentWhenDelegateThrowAException() throws Exception {
BDD.Given("a query to search a incident by processId");
String graphqlQuery = "query to find a incident by process id";
String queryWithProcessId = query(graphqlQuery).replace("idIncidentProcess", processInstance.getId());
BDD.When("graphql is called");
sleep(3000);
ExecutionResult executionResult = graphQL.execute(queryWithProcessId);
String result = new ObjectMapper().writeValueAsString(executionResult.getData());
BDD.Then("the result should be");
assertEquals(s("should return one incident"), result, comparators);
}
}
| java |
Here is some beautiful Women’s Day wishes, images, greetings, and quotes that you can definitely share with every woman in your life.
As Ntozake Shange quotes, "Where there is a woman, there is magic. " One day is not enough to cherish and appreciate a woman's contribution to our lives. Our grandmother, mother, sister, girlfriend, wife, and friends hold significance in our lives.
Their mere presence makes our lives easier. International Women’s Day is celebrated on March 8 every year to cherish and appreciate these women. Here are a few wishes, quotes, and WhatsApp statuses to share this International Women’s Day.
International women's day 2023 WhatsApp status:
1. I am sending my wishes to a woman who is strong, beautiful, and unique in her way. Thank you for coming into my life. I wish you a Happy Women’s Day.
2. Dear women, since the beginning, you have raised mankind with selfless love and care. May God bless you with more power and love. Happy Women’s Day.
International Women’s Day 2023 Wishes:
1. The base on which the whole world stands is a woman. Happy Women’s Day.
2. With the creation of the world, you were added to increase its beauty. The world is mesmerized by the work you have done. Happy Women’s Day.
International Women’s Day quotes:
1. "Women are the largest untapped reservoir of talent in the world" – Hillary Clinton.
2. "She wasn’t looking for a knight. She was looking for a sword. " – Atticus.
International Women's Day messages:
1. Every successful man is backed up by a woman who is always a step at the forefront of him. Salute to the woman of the future. Happy Women’s Day.
2. "Hope your day is sunshine and flowers with happy thoughts to fill the house. Happy Women’s Day". | english |
Patrick and I had to survive for48 hours during SXSW without money, having to hustle our way through by taking on dares/challenges and accepting payments via an iPhone and Square. The day before TNWhustle the earthquake and tsunami hit Japan, so we decided to donate all the proceeds to the victims of the catastrophe in Japan.
We agreed previously that the loser of the challenge had to sing a love song on main stage during The Next Web Conference dedicated to the other (embarrassing!)
Although Patrick was pretty sure he would beat me, he stood no chance. In total the we raised $4017,34 for Japan. I raised a whopping $3217 and Patrick’s efforts stuck at 900 dollars, which is still a great achievement seeing as he didn’t have the sway of a camera team with him.
So I won TNWhustle and Patrick has to start taking singing classes!
Overall we’re very happy with the results. We decided we wanted to raise even more, so we’ve set up a fund on Indiegogo- PLEASE help by donating – you can do so via this page at Indiegogo. All proceeds will go to the RedCross via Indiegogo.
Big thanks to all who donated: Chris Saad, Chris Lea, Jeff Pulver, Tim Ferriss, The Klout Team to name a few!
Get the most important tech news in your inbox each week.
| english |
{"other_ids": [], "mRNA_sequence": [{"index": 0, "type": "five_prime_UTR", "sequence": "AAACTGTTGTCGTCCCTTACGTAGATAATCAAAGCTGGGCGAAGCGCCAAGCTATATTCTTCTTATTAATTATACCGAACAAGCGTTACTTAATTTATTTATTTCGACGCTTTTCTAAAGGGAATATCTTAATTATTCTATATCTCCTTTTTCCATGTCACTGAAGACTGCTCTTTCTAACTC"}, {"index": 1, "type": "CDS", "sequence": "ATGGCTTACAATAAATCTCTAAAGTCTTTAGTATTTATCCTTTTGGCTTCTCAGATCGTATTTGTATTATTCCTTTGCTACGGAAAAAGTTCTAGAGAACTTGGAGTGAAATGGAATTCAGATATTCGATCTTGGATGACCAGTTACGTTGGGTTTAATGGCGAGACTGCGGCCATATCAGAAGAACAGTTAATTTGGGCCGAAAAAATTCCTGATTATAACGAAGAAATAGTAGTCCGTTTGCATTTGGAAGAAGAAAATAATTTGAGCGATATCTTGCAGAAAGCTCAAAGTCAAAACCTTGATATTTGGGACTACAATTTCGATCATGTGGATTTACGTTTAAAAGAAGAAAATTTTGATTTTTGGAAGAGTCAATATCGTAGTGACATACTTATAAACAATCTGACAGAGACCTTATTTGAAAGCATTGTTCCAGATACTACGAATTCCCCTTTTTCCACAGAAGCTTTCCTTCAAGCCGTTGAAAATGGTCATTTAAATCACGAAATGTTTACTTCCTTTACGGATATTTTTTTCAAGTCATATCAGAATTTAGAATCGATTAATTCCTGGTTGAGGTTGATGGCGTCCCTTTACAAAGATTTAAGTGAACTAGTTCCAGTTGGAATTACAGCGGAAGGTCGAACGATTTTAGGCCTAAAATTGAACGGTCGACATCCTTCCGACAACGGGGAAAAGATTCGTAACAAGAAAGTGATTATTATTCAAGGAGGATCTCATGCTCGTGAGTGGATAGGTATTCCATCTGTTTGCTATGCCGCATGGCAATTGTTGGCAAAATATGATTCCGATGGTCATGTCCGAAAGCTTTTGGATAAATTTGAATGGATTTTTATTCCAGTTTTAAACGTTGATGGTTATGAATATACATGGTCAAACGATAGACTG"}, {"index": 2, "type": "intron", "sequence": "GTAAGTGGTTTGTAATGAAGCATATACTAATTATTTGTCAG"}, {"index": 3, "type": "CDS", "sequence": "TGGTCAAAAAACAGACAGCCTCTTAATAATTCCGAGTGTTTTGGCATAAATCTCGATGCGAATTGGGCATTTGGCTTCAACGGTAATATTGATCCTTGCAGCAACG"}, {"index": 4, "type": "intron", "sequence": "GTAAGCGAACTATTTTTTTTGATGACTTATTACAACTAACAAACTCAAG"}, {"index": 5, "type": "CDS", "sequence": "AATATGGAGGATTATCACCTTTTCAGGCTAACGAAACTATGGCCTTGTTCAATCTGATAACTGAATCCTTGTCGCAAGAGCAGAAAAAGGTCGTTGGATTTCTTGATGTGCATTCGTATTCACAATCTG"}, {"index": 6, "type": "intron", "sequence": "GTATGTTTCGACAGTCTATTTTCATTTACTAATTAAGTTAG"}, {"index": 7, "type": "CDS", "sequence": "TTTTGTGGCCTTATGCATATACCTGCGACTTGTTTCCTCCTGATACTGAGAATTTTGAGGAATTAGCAATTGGCTTAGTTAAAGAGTTGCATCGCGTAAATAGTAGATACTACACATATCAACAAGCATGTATACCGTATGATGGATTTCATAAACATTACCTACCTGGAACTGCCATTGACTGGGTTTATTTTGCTGCTGATGTAGCATGGCCTTTCAATATTCGATTACGAGACATGGGTGATTAT"}, {"index": 8, "type": "intron", "sequence": "GTAAGTTGATATCTCTAAAATTTTTTACTAATTAAACAAG"}, {"index": 9, "type": "CDS", "sequence": "GGATATTTATTACCTGCTAAACAGATTGTCCCCACAGCTAAGGAATTTTTTGCGATGATTCTTTACTATGGAGAGTTTATCGCTGAGTATGCATTTTAG"}, {"index": 10, "type": "three_prime_UTR", "sequence": "TCCAAGAAAGATCAATAATTATTCGCTTATCTGTTGGCAATTTTGCCAAATTTAATTATAGTAATTATTAATTTATGAAAATAAATACCTTCCTTCCAGGTGGTTCAATTGATGCGTTATTTACCTGTCTTAACAATAAATCCAGTTCTATCAATTAACGTTTTTTAGAACGTTATAAGAATTTA"}], "other_names": ["ppp28"], "id": "SPBC337.07c", "name": "ecm14"} | json |
The popular coming-of age romantic drama The Summer I Turned Pretty on Prime Video is all set to return. The series starring Lola Tung as the young Belly Conklin caught in a love triangle between brothers Conrad and Jeremiah Fisher essayed by Christopher Briney and Gavin Casalegno has gained a lot of popularity owing to its portrayal of teenagers. With the earlier season ending in Belly trying to overcome her crush over Conrad and her sudden feelings for Jeremiah, the new season too promises to have a lot in store.
Starring Lola Tung, Christopher Briney, and Gavin Casalegno, the new teaser showcases the start of the relationship between Belly and Jeremiah but it leaves you wondering if it will take a drastic turn as the show proceeds. Caught in the web of love between the Fisher brothers, Belly, who loves counting the days until she could return to Cousins Beach, is not sure summer will ever be the same with Conrad and Jeremiah fighting over her heart and the return of Susannah's cancer. When an unexpected visitor threatens the future of Susannah's beloved house, Belly has to rally the gang to come together—and to decide once and for all where her heart lies.
Season Two of The Summer I Turned Pretty is led by showrunners Jenny Han and Sarah Kucserka. Han, Kucserka, Karen Rosenfelt, and Gabrielle Stanton serve as executive producers, along with Hope Hartman, Mads Hansen, and Paul Lee for wiip. The series is a co-production of Amazon Studios and wiip.
Jenny Han is the No. 1 New York Times best-selling author of the To All the Boys I’ve Loved Before and The Summer I Turned Pretty series. The Summer I Turned Pretty is all set to premiere on Amazon Prime Video on July 14.
Catch us for latest Bollywood News, New Bollywood Movies update, Box office collection, New Movies Release , Bollywood News Hindi, Entertainment News, Bollywood Live News Today & Upcoming Movies 2024 and stay updated with latest hindi movies only on Bollywood Hungama.
| english |
<reponame>SmellyModder/Architect-s-Palette
{
"type": "minecraft:stonecutting",
"ingredient": [
{
"item": "architects_palette:myonite"
}
],
"result": "architects_palette:myonite_slab",
"count": 2
} | json |
import random
import time
from collections import deque
from threading import Lock
import HABApp
from HABApp.core.events import ValueUpdateEvent
from .bench_base import BenchBaseRule
from .bench_times import BenchContainer, BenchTime
LOCK = Lock()
class OpenhabBenchRule(BenchBaseRule):
BENCH_TYPE = 'openHAB'
RTT_BENCH_MAX = 15
def __init__(self):
super().__init__()
self.name_list = [f'BenchItem{k}' for k in range(300)]
self.time_sent = 0.0
self.bench_started = 0.0
self.bench_times_container = BenchContainer()
self.bench_times: BenchTime = None
self.item_values = deque()
self.item_name = ''
self.load_listener = []
def cleanup(self):
self.stop_load()
all_items = set(HABApp.core.Items.get_all_item_names())
to_rem = set(self.name_list) & all_items
if not to_rem:
return None
print('Cleanup ... ', end='')
for name in to_rem:
self.oh.remove_item(name)
print('complete')
def set_up(self):
self.cleanup()
def tear_down(self):
self.cleanup()
def run_bench(self):
# These are the benchmarks
self.bench_item_create()
self.bench_rtt_time()
def bench_item_create(self):
print('Bench item operations ', end='')
max_duration = 10 # how long should each bench take
times = BenchContainer()
start_bench = time.time()
b = times.create('create item')
for k in self.name_list:
start = time.time()
self.openhab.create_item('Number', k, label='MyLabel')
b.times.append(time.time() - start)
# limit bench time on weak devices
if time.time() - start_bench > max_duration:
break
time.sleep(0.2)
print('.', end='')
start_bench = time.time()
b = times.create('update item')
for k in self.name_list:
start = time.time()
self.openhab.create_item('Number', k, label='New Label')
b.times.append(time.time() - start)
# limit bench time on weak devices
if time.time() - start_bench > max_duration:
break
time.sleep(0.2)
print('.', end='')
start_bench = time.time()
b = times.create('delete item')
for k in self.name_list:
start = time.time()
self.openhab.remove_item(k)
b.times.append(time.time() - start)
# limit bench time on weak devices
if time.time() - start_bench > max_duration:
break
print('. done!\n')
times.show()
def bench_rtt_time(self):
print('Bench item state update ', end='')
self.bench_times_container = BenchContainer()
self.run_rtt('rtt idle')
self.run_rtt('async rtt idle', do_async=True)
self.start_load()
self.run_rtt('rtt load (+10x)')
self.run_rtt('async rtt load (+10x)', do_async=True)
self.stop_load()
print(' done!\n')
self.bench_times_container.show()
def start_load(self):
for i in range(10, 20):
def load_cb(event, item=self.name_list[i]):
self.openhab.post_update(item, str(random.randint(0, 99999999)))
self.openhab.create_item('String', self.name_list[i], label='MyLabel')
listener = self.listen_event(self.name_list[i], load_cb, ValueUpdateEvent)
self.load_listener.append(listener)
self.openhab.post_update(self.name_list[i], str(random.randint(0, 99999999)))
def stop_load(self):
for list in self.load_listener:
list.cancel()
self.load_listener.clear()
def run_rtt(self, test_name, do_async=False):
self.item_name = self.name_list[0]
self.openhab.create_item('String', self.item_name, label='MyLabel')
for i in range(3000):
self.item_values.append(str(random.randint(0, 99999999)))
listener = self.listen_event(
self.item_name, self.proceed_item_val if not do_async else self.a_proceed_item_val, ValueUpdateEvent
)
self.bench_times = self.bench_times_container.create(test_name)
self.bench_started = time.time()
self.time_sent = time.time()
self.openhab.post_update(self.item_name, self.item_values[0])
self.run.soon(LOCK.acquire)
time.sleep(1)
LOCK.acquire(True, OpenhabBenchRule.RTT_BENCH_MAX)
listener.cancel()
if LOCK.locked():
LOCK.release()
print('.', end='')
def proceed_item_val(self, event: ValueUpdateEvent):
if event.value != self.item_values[0]:
return None
self.bench_times.times.append(time.time() - self.time_sent)
# Time up -> stop benchmark
if time.time() - self.bench_started > OpenhabBenchRule.RTT_BENCH_MAX:
LOCK.release()
return None
# No items left -> stop benchmark
try:
self.item_values.popleft()
except IndexError:
LOCK.release()
return None
self.time_sent = time.time()
self.openhab.post_update(self.item_name, self.item_values[0])
async def a_proceed_item_val(self, event: ValueUpdateEvent):
self.proceed_item_val(event)
| python |
Shakespearean scholar who was one of the earliest scholars to use "word processing and sequence analysis" in the study of Shakespearean texts. As far as I remember Prof King delivered a lecture on Shakespearean tragedy with special emphasis on King Lear.
On one occasion Madison Morrison, a Professor from some American university, paid a visit to the Department. In the afternoon he delivered a talk on the state of contemporary American culture and literature. On the following day I attended a poetry reading session in some hotel in Cuttack where Prof Morrison had read some of his self-composed poems to a select audience of about 25 - 30 poets and poetry lovers. In the evening, Prof. M. Q. Khan, Head of the Department, invited him to a grand and lavish dinner party at his government quarters on the campus. Prof. Khan came to my Jobra home to invite me personally. Dr. Bibhu Padhi, a well-known Indian poet in English was among a few other invitees who attended the party.
The candle-light dinner menu was really delectable with a variety of food, specially cooked by Professor Khan's wife with a lot of love and interest. The dining table was arranged with exquisite care and with platters heaped with delicately spiced foods: an array of chicken dopiaza, pohala (a small river fish) fries, shrimps and a curry of Chilika fresh mud-crabs with a garnish of rose petals. The food, as a matter of fact, made me drool. Prof. Khan was aware of the way the British and American people eat their food, and therefore, he had arranged the cutlery needed for the purpose. When we picked up a knife and fork to eat, Prof. Morrison began eating with his hand, saying, "But I've become an Indian." Our embarrassment was complete when we looked at each other for expressing our feelings.
On another occasion William Golding, a British novelist, playwright, and poet who stormed the literary world with his debut novel Lord of the Flies (1954) came to the Department, accompanied by the British High Commissioner to India (Sorry, I have forgotten his name) to deliver a lecture. The Department had made elaborate arrangements to extend a rousing welcome to the famous writer. Prior to his visit, police had also made a number of visits to the meeting place to ensure his safety and security. It was perhaps the first ever visit of a Nobel Laureate (he was awarded the Nobel Prize in 1983) to the Department since its inception in 1922. Golding did not speak much, but read out some passages from his books Lord of the Flies and Rites of Passage.
Souvenir - Hundred Years of Glorious Heritage : 79
Prof. Khan was a wonderful organiser who never missed an opportunity to hold a seminar in the Department. On a couple of occasions, he held state level conferences of English teachers. It was 1988, when the Department decided to celebrate the 100th birth anniversary of T. S. Eliot, the American-born British poet and critic who reflected the mood of his time and had given the twentieth century many of its literary treasures. The euphoria for Eliot had not died down yet, and some of his words or catch-phrases were still quoted by the college and university teachers and students of the time like "I have measured out my life with coffee spoons," "not with a bang but a whimper," "After such knowledge, what forgiveness?" "Why should the aged eagle stretch its wings?" etc.
Many Eliot scholars and professors were invited to this two-day-long seminar, including one young and beautiful lady assistant professor from Jammu Kashmir University. I was asked by Prof. Khan to bring out another volume of "Phoenix" (Department's creative journal) and a Souvenir which had to be released during the seminar. It was a tough task to accomplish. Of course, the Department had already brought out three or four issues of "Phoenix" which I edited myself; but getting both of them printed in about two weeks was not easy. Moreover, the printing technology was not as advanced as it is today. Prof. Khan promised all help, and so did my senior colleagues Yeats scholar Dinesh Patnaik, playwright Ramesh Panigrahi and poet Bibhu Padhi who were the other members of the editorial board. Both the journals were released at the valedictory ceremony.
Basically, as a teacher of English who loved to teach poetry for more than thirty years and a creative writer for many more years than that, I took up teaching as the passion of a creative writer. While teaching from Milton to Baudelaire, Dickinson to Eliot, Spender and Larkin, and even the Indian poets like Nissim Ezekiel and Jayanta Mahapatra, I had tried to share my understanding from a creative writer's perspective. I used to tell my students that if these writers had attracted such world attention it was because of their vision, transcendence, understanding of human mind, and nature, handling the complexity and dimension of human experience in their own, unique individual ways.
I recollect how I was assigned Relationship, a long poem by Jayanta Mahapatra who had received the first ever Sahitya Akademi award for an Indian book in English in 1982. This award-winning book was prescribed in the post graduate syllabus as part
Souvenir - Hundred Years of Glorious Heritage
of the special paper' on Indian Literature in English, earlier called Indo-Anglian or Indo-English literature. Fugue-like in structure, the book was an extremely difficult text, and the high degree of complexity in the use of theme and imagery stood in the way of appreciating the text in the proper way. One day in my interaction with Jayanta Sir, who was often invited to the Department to read his poetry, or share his experience, I asked him about the book he simply smiled and said, "You are a poet yourself, you know things better." I kept quiet.
It has been a long time since I left my dear Ravenshaw College, my dearest Department of English. Sometimes I fish out the recollections of my days at this historic institution and feel terribly disturbed when I feel I cannot be a part of it except in imagination. O my English Department! I shall remain ever grateful to you for all that you did for me, transforming a fuzzy caterpillar to a butterfly. Never mind, I do not claim to be a butterfly myself, but I have got its wings to flit around the garden in search of fulfilment in life.
[Dr. Bhagaban Jayasingh is a reputed academician. He is an established poet, creative writer and critic of both Odia and English Literature. Dr. Jaysingh has been conferred the Odisha Sahitya Academy Award and Bishuba Jhankar Award for poetry.]
Souvenir - Hundred Years of Glorious Heritage : 81
| english |
It was always a treat to watch and there would never be a dull moment when he was batting. He never wore helmet and never ran away from any challenge. One of the greatest cricketers of all time and a sheer murderer of any attack he played quite a few memorable innings during his illustrious career. And if the West Indies ruled in 70’s and 80’s he was the mainstay of their batting, later in his career winning the tag of `king’ of batting. Yes we are talking about the cricketing genius, none other than Vivian Issac Alexander Richards, who has turned 65 today. First of all let us wish this fabulous entertainer a very happy birthday.
Viv always played for the prestize of his country. There are so many examples of his high quality performances. In 1975 when the West Indies toured England, one comment of Tony Grieg `we will make them grovel disturbed the moods of all the West Indians. Holding became wild, so did most of his teammates. But the cool Viv tried to console his colleagues and the way he answered with his bat, scoring 829 runs in seven innings silenced all the critics. England were humiliated in front of their home crowd. Holding too bowled fantastic spells in that series. That is what Viv was.
Viv and Holding were also involved in a record nineth wicket partnership some years later at Old Troffard in a one-day match against England . When the West Indies lost 9th wicket at the score of 161, Holding joined the King and the former was a silent spectator in that 100 plus partnership. Viv went on to score 189 not out and what a feast it was for the crowd on that day as they loved every bit of it. He tore the English attack into pieces.
Among some of his remarkable feats, his century in the 1979 World Cup final at Lords and another one at the same ground in the Gillette Cup final were high quality performances. Even in his first World Cup appearances, the way he ran out the Chappel brothers is still fresh in the cricket lovers memory.
Viv was blessed with every necessary attribute for greatness and he was in fact the crowd’s most wanted cricketer. The opposition always feared him the most as he would show no mercy to any attack on his day.
After learning so much from Lyod, as a captain too he achieved tremendous success. West Indies won 27 matches out of the 50 he had led and only eight they lost during his tenure.
It is sad, though West Indies continued to produce a couple of champion batsmen such as Richie Richardson and Lara later they could not maintain that supremacy, which I am sure has saddened everyone. | english |
<reponame>digital-land/brownfield-land-collection<filename>collection/log/2019-12-31/535211a9c9b5e9824bacb70ed61c38dedf4b95efc2f9a5c0a196f5fcfc5953cf.json
{"elapsed":"0.178","endpoint-url":"https://www.southribble.gov.uk/sites/default/files/South%20Ribble%20Brownfield%20Register%20-%20June%202016.csv","entry-date":"2019-12-31T07:59:53.130825","exception":"SSLError"} | json |
#include "../TownManager.h"
#include "../ViewportManager.h"
#include "TileManager.h"
namespace OpenLoco::Map
{
void SurfaceElement::removeIndustry(const Map::Pos2& pos)
{
if (hasHighTypeFlag())
{
setHighTypeFlag(false);
setVar6SLR5(0);
setIndustry(IndustryId(0));
auto z = baseHeight();
Ui::ViewportManager::invalidate(pos, z, z + 32, ZoomLevel::eighth);
TownManager::sub_497DC1(pos, 0, 0, -30, 0);
}
}
}
| cpp |
# Copyright 2021 Huawei Technologies Co., Ltd
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ============================================================================
"""
dataset classes
"""
import cv2
import numpy as np
import src.utils.img
from src.dataset.MPIIDataLoader import flipped_parts
class GenerateHeatmap:
"""
get train target heatmap
"""
def __init__(self, output_res, num_parts):
self.output_res = output_res
self.num_parts = num_parts
sigma = self.output_res / 64
self.sigma = sigma
size = 6 * sigma + 3
x = np.arange(0, size, 1, float)
y = x[:, np.newaxis]
x0, y0 = 3 * sigma + 1, 3 * sigma + 1
self.g = np.exp(-((x - x0) ** 2 + (y - y0) ** 2) / (2 * sigma ** 2))
def __call__(self, keypoints):
hms = np.zeros(shape=(self.num_parts, self.output_res, self.output_res), dtype=np.float32)
sigma = self.sigma
for p in keypoints:
for idx, pt in enumerate(p):
if pt[0] > 0:
x, y = int(pt[0]), int(pt[1])
if x < 0 or y < 0 or x >= self.output_res or y >= self.output_res:
continue
ul = int(x - 3 * sigma - 1), int(y - 3 * sigma - 1)
br = int(x + 3 * sigma + 2), int(y + 3 * sigma + 2)
c, d = max(0, -ul[0]), min(br[0], self.output_res) - ul[0]
a, b = max(0, -ul[1]), min(br[1], self.output_res) - ul[1]
cc, dd = max(0, ul[0]), min(br[0], self.output_res)
aa, bb = max(0, ul[1]), min(br[1], self.output_res)
hms[idx, aa:bb, cc:dd] = np.maximum(hms[idx, aa:bb, cc:dd], self.g[a:b, c:d])
return hms
class DatasetGenerator:
"""
mindspore general dataset generator
"""
def __init__(self, input_res, output_res, ds, index):
self.input_res = input_res
self.output_res = output_res
self.generateHeatmap = GenerateHeatmap(self.output_res, 16)
self.ds = ds
self.index = index
def __len__(self):
return len(self.index)
def __getitem__(self, idx):
# print(f"loading...{idx}")
return self.loadImage(self.index[idx])
def loadImage(self, idx):
"""
load and preprocess image
"""
ds = self.ds
# Load + Crop
orig_img = ds.get_img(idx)
orig_keypoints = ds.get_kps(idx)
kptmp = orig_keypoints.copy()
c = ds.get_center(idx)
s = ds.get_scale(idx)
cropped = src.utils.img.crop(orig_img, c, s, (self.input_res, self.input_res))
for i in range(np.shape(orig_keypoints)[1]):
if orig_keypoints[0, i, 0] > 0:
orig_keypoints[0, i, :2] = src.utils.img.transform(
orig_keypoints[0, i, :2], c, s, (self.input_res, self.input_res)
)
keypoints = np.copy(orig_keypoints)
# Random Crop
height, width = cropped.shape[0:2]
center = np.array((width / 2, height / 2))
scale = max(height, width) / 200
aug_rot = 0
aug_rot = (np.random.random() * 2 - 1) * 30.0
aug_scale = np.random.random() * (1.25 - 0.75) + 0.75
scale *= aug_scale
mat_mask = src.utils.img.get_transform(center, scale, (self.output_res, self.output_res), aug_rot)[:2]
mat = src.utils.img.get_transform(center, scale, (self.input_res, self.input_res), aug_rot)[:2]
inp = cv2.warpAffine(cropped, mat, (self.input_res, self.input_res)).astype(np.float32) / 255
keypoints[:, :, 0:2] = src.utils.img.kpt_affine(keypoints[:, :, 0:2], mat_mask)
if np.random.randint(2) == 0:
inp = self.preprocess(inp)
inp = inp[:, ::-1]
keypoints = keypoints[:, flipped_parts["mpii"]]
keypoints[:, :, 0] = self.output_res - keypoints[:, :, 0]
orig_keypoints = orig_keypoints[:, flipped_parts["mpii"]]
orig_keypoints[:, :, 0] = self.input_res - orig_keypoints[:, :, 0]
# If keypoint is invisible, set to 0
for i in range(np.shape(orig_keypoints)[1]):
if kptmp[0, i, 0] == 0 and kptmp[0, i, 1] == 0:
keypoints[0, i, 0] = 0
keypoints[0, i, 1] = 0
orig_keypoints[0, i, 0] = 0
orig_keypoints[0, i, 1] = 0
# Generate target heatmap
heatmaps = self.generateHeatmap(keypoints)
return inp.astype(np.float32), heatmaps.astype(np.float32)
def preprocess(self, data):
"""
preprocess images
"""
# Random hue and saturation
data = cv2.cvtColor(data, cv2.COLOR_RGB2HSV)
delta = (np.random.random() * 2 - 1) * 0.2
data[:, :, 0] = np.mod(data[:, :, 0] + (delta * 360 + 360.0), 360.0)
delta_sature = np.random.random() + 0.5
data[:, :, 1] *= delta_sature
data[:, :, 1] = np.maximum(np.minimum(data[:, :, 1], 1), 0)
data = cv2.cvtColor(data, cv2.COLOR_HSV2RGB)
# Random brightness
delta = (np.random.random() * 2 - 1) * 0.3
data += delta
# Random contrast
mean = data.mean(axis=2, keepdims=True)
data = (data - mean) * (np.random.random() + 0.5) + mean
data = np.minimum(np.maximum(data, 0), 1)
return data
| python |
The problem of excess weight with each passing year acquires ever larger scale. Many women who have not received the desired effect from numerous diets, resort to the help of the Higher Forces, while not at all interested in whether conspiracy to lose weight consequences.
It is very important to conduct such rituals, observing certain rules. In this case, you will reduce the possible occurrence of consequences to a minimum.
Whatever ritual or prayer you choose is important:
- Ask for help from the Higher Forces on the waning moon, since the energy of the Earth's satellite directly affects the achievement of the desired with minimal effort.
- To pronounce the conspiracy of water for weight loss or another ritual, it is best to choose an early morning or late evening, when the sun has already gone beyond the horizon.
- It is recommended to be alone when you address the Higher Forces, because the energy of another person will not allow you to concentrate.
- You need to turn off the phone, turn off the TV, etc. You should not interfere with anything.
- You can count on the positive result of plots and spells to lose weight only if you have faith. You must be 100% sure that you will certainly lose weight. If you do this for fun, then the ritual will be spent in vain.
- You need to cast plots on an empty stomach.
- Words must be read calmly, without stopping and stopping. Therefore, it is better to first learn the plot by heart, but if it is difficult for you, then accurately write the words on a white sheet of paper.
- It is recommended to resort to the magic of a plot for losing weight on a Friday or Monday.
- You can not tell anyone that you are asking for help from the Higher Powers, since the rite should be a sacrament.
- In the texts of conspiracies there should not be any negative words, for example, "let all the fat go to another person", etc.
If you follow all the recommendations, the negative consequences of the conspiracies will be insignificant.
Any magic, both white and black has its consequences, only in the first case they will be minimal.
What is worth knowing about the possible consequences:
- As in any method of weight loss, it is very important not to overdo it. Remember that there will not be an instant result, so do not rush to repeat the ritual. Perhaps the magic just did not go into effect yet and you need to wait a little. In the case of an "overdose", you may get a reverse reaction, and you will gain weight.
- If you use black magic, you should definitely roll back. Otherwise, the plot will weary your body throughout life.
- It is necessary to choose conspiracies and spells for weight loss in texts that do not have words with the root "thin". Otherwise, such rituals can literally bring your body to the point of exhaustion. The purpose of the appeal to the Higher Powers - get rid of excess weight, and not lose health and attractiveness.
- There is an opinion that black magic has more negative consequences and, first of all, that after losing weight kilograms can return back in doubled, and sometimes in tripled. Therefore, before you give preference to this particular option, think carefully about whether to take risks.
- In white magic, words are only positive, so if you follow all the recommendations, then most likely, the only result from going to the Higher Forces for you will be a desirable slim figure without extra pounds.
Choose only those conspiracies that you really like, and you will read them with pleasure. | english |
Our mission should be to turn out to be an innovative supplier of high-tech digital and communication devices by furnishing benefit added design and style, world-class manufacturing, and repair capabilities for China Gold Supplier for Made In 20 Ton Hydraulic Winch 10000 lbs, Hydraulic Capstan Winch, We wish to just take this opportunity to ascertain long-term enterprise relationships with clients from all over the earth.
Our mission should be to turn out to be an innovative supplier of high-tech digital and communication devices by furnishing benefit added design and style, world-class manufacturing, and repair capabilities for 20 Ton Hydraulic Winch, Hydraulic Capstan Winch, Hydraulic Winch 10000lbs, With the goal of "zero defect". To care for the environment, and social returns, care employee social responsibility as own duty. We welcome friends from all over the world to visit and guide us so that we can achieve the win-win goal together.
This capstan is well built based on our patented technologies. Because of integrating with valve blocks, it simplifies the demands from supporting hydraulic system. With the continuous improvements of production and measurement, its mechanical properties have been improved constantly over two decades. The quality and reliability of the capstan have been proven by positive feedback and continuous coming back orders from worldwide customers.
Mechanical Configuration: It consists of valve blocks with function of brake and overload protection, hydraulic motor, planetary gearbox, wet type brake, capstan head and frame. Customized modifications for your best interests are available at any moment.
The Capstans' Main Parameters:
System Load(KN)
Diameter of Rope(mm)
Working Pressure Diff.(MPa)
Oil Supply (L/min)
| english |
New Delhi: Agni-5, India's longest range nuclear capable missile, will be tested at Kalam Island off the Odisha coast today by the Defence Research and Development Organisation or DRDO. The intercontinental surface-to-surface nuclear capable ballistic missile, the latest in India's "Agni" family of medium to intercontinental range missiles, has been through three trials before. The Agni 5 missile, with new technology for navigation and guidance, gives India the strategic depth it needs to contain its enemies, say scientists. After a few more trials, it will soon join India's military arsenal.
This will be the first test of the Agni-5 missile after India became a member of the Missile Technology Control Regime, a 35-nation group to check the spread of unmanned delivery systems for nuclear weapons.
Agni-5 has a range of over 5,000 km and can carry about a 1,000-kg warhead. It can target almost all of Asia including Pakistan and China and Europe.
missile will be tested from a canister which gives it all-weather and any terrain mobile launch capability.
The 17-metre long Agni-5 Missile weighs about 50 tonnes and is a very agile and modern weapon system.
The surface-to-surface missile is a fire-and-forget system that cannot be easily detected as it follows a ballistic trajectory.
India already has in its arsenal the Agni 1, 2, 3 and 4 missile systems and supersonic cruise missiles like Brahmos.
India describes the Agni - 5 missile system as a 'weapon of peace'.
The first missile of the series, Agni-I was developed under the Integrated Guided Missile Development Program and tested in 1989.
In the series, Agni-1 has a 700-km range, Agni-2 has a 2,000 km range, and Agni-3 and Agni-4 have a 2,500 km to more than 3,500 km range.
The Agni-6 is reported to be in early stages of development and the latest and most advanced version, capable of being launched from submarines as well as from land, with a strike-range of 8,000-10,000 km. | english |
For a man of his years and inexperience, only a canny Scot, perhaps, grounded in common sense and established in logic, could have preserved even that measure of balance that this youth somehow or other did manage to preserve through the whole adventure. Otherwise, two things he presently noticed, while forging pluckily ahead, must have sent him headlong back to the comparative safety of his tent, instead of only making his hands close more tightly upon the rifle stock, while his heart, trained for the Wee Kirk, sent a wordless prayer winging its way to heaven. Both tracks, he saw, had undergone a change, and this change, so far as it concerned the footsteps of the man, was in some undecipherable manner—appalling.
It was in the bigger tracks he first noticed this, and for a long time he could not quite believe his eyes. Was it the blown leaves that produced odd effects of light and shade, or that the dry snow, drifting like finely ground rice about the edges, cast shadows and high lights? Or was it actually the fact that the great marks had become faintly colored? For round about the deep, plunging holes of the animal there now appeared a mysterious, reddish tinge that was more like an effect of light than of anything that dyed the substance of the snow itself. Every mark had it, and had it increasingly—this indistinct fiery tinge that painted a new touch of ghastliness into the picture.
But when, wholly unable to explain or to credit it, he turned his attention to the other tracks to discover if they, too, bore similar witness, he noticed that these had meanwhile undergone a change that was infinitely worse, and charged with far more horrible suggestion. For, in the last hundred yards or so, he saw that they had grown gradually into the semblance of the parent tread. Imperceptibly the change had come about, yet unmistakably. It was hard to see where the change first began. The result, however, was beyond question. Smaller, neater, more cleanly modeled, they formed now an exact and careful duplicate of the larger tracks beside them. The feet that produced them had, therefore, also changed. And something in his mind reared up with loathing and with terror as he saw it.
Simpson, for the first time, hesitated; then, ashamed of his alarm and indecision, took a few hurried steps ahead; the next instant stopped dead in his tracks. Immediately in front of him all signs of the trail ceased; both tracks came to an abrupt end. On all sides, for a hundred yards and more, he searched in vain for the least indication of their continuance. There was—nothing.
The trees were very thick just there, big trees all of them, spruce, cedar, hemlock; there was no underbrush. He stood, looking about him, all distraught; bereft of any power of judgment. Then he set to work to search again, and again, and yet again, but always with the same result: nothing. The feet that printed the surface of the snow thus far had now, apparently, left the ground!
And it was in that moment of distress and confusion that the whip of terror laid its most nicely calculated lash about his heart. It dropped with deadly effect upon the sorest spot of all, completely unnerving him. He had been secretly dreading all the time that it would come—and come it did.
Far overhead, muted by great height and distance, strangely thinned and wailing, he heard the crying voice of Défago, the guide.
The sound dropped upon him out of that still, wintry sky with an effect of dismay and terror unsurpassed. The rifle fell to his feet. He stood motionless an instant, listening as it were with his whole body, then staggered back against the nearest tree for support, disorganized hopelessly in mind and spirit. To him, in that moment, it seemed the most shattering and dislocating experience he had ever known, so that his heart emptied itself of all feeling whatsoever as by a sudden draught.
"Oh! oh! This fiery height! Oh, my feet of fire! My burning feet of fire ...!" ran in far, beseeching accents of indescribable appeal this voice of anguish down the sky. Once it called—then silence through all the listening wilderness of trees.
The cry was not repeated; his own hoarse calling brought no response; the inscrutable forces of the Wild had summoned their victim beyond recall—and held him fast.
Yet he searched and called, it seems, for hours afterwards, for it was late in the afternoon when at length he decided to abandon a useless pursuit and return to his camp on the shores of Fifty Island Water. Even then he went with reluctance, that crying voice still echoing in his ears. With difficulty he found his rifle and the homeward trail. The concentration necessary to follow the badly blazed trees, and a biting hunger that gnawed, helped to keep his mind steady. Otherwise, he admits, the temporary aberration he had suffered might have been prolonged to the point of positive disaster. Gradually the ballast shifted back again, and he regained something that approached his normal equilibrium.
But for all that the journey through the gathering dusk was miserably haunted. He heard innumerable following footsteps; voices that laughed and whispered; and saw figures crouching behind trees and boulders, making signs to one another for a concerted attack the moment he had passed. The creeping murmur of the wind made him start and listen. He went stealthily, trying to hide where possible, and making as little sound as he could. The shadows of the woods, hitherto protective or covering merely, had now become menacing, challenging; and the pageantry in his frightened mind masked a host of possibilities that were all the more ominous for being obscure. The presentiment of a nameless doom lurked ill-concealed behind every detail of what had happened.
It was really admirable how he emerged victor in the end; men of riper powers and experience might have come through the ordeal with less success. He had himself tolerably well in hand, all things considered, and his plan of action proves it. Sleep being absolutely out of the question and traveling an unknown trail in the darkness equally impracticable, he sat up the whole of that night, rifle in hand, before a fire he never for a single moment allowed to die down. The severity of the haunted vigil marked his soul for life; but it was successfully accomplished; and with the very first signs of dawn he set forth upon the long return journey to the home camp to get help. As before, he left a written note to explain his absence, and to indicate where he had left a plentiful cache of food and matches—though he had no expectation that any human hands would find them!
How Simpson found his way alone by the lake and forest might well make a story in itself, for to hear him tell it is to know the passionate loneliness of soul that a man can feel when the Wilderness holds him in the hollow of its illimitable hand—and laughs. It is also to admire his indomitable pluck.
He claims no skill, declaring that he followed the almost invisible trail mechanically, and without thinking. And this, doubtless, is the truth. He relied upon the guiding of the unconscious mind, which is instinct. Perhaps, too, some sense of orientation, known to animals and primitive men, may have helped as well, for through all that tangled region he succeeded in reaching the exact spot where Défago had hidden the canoe nearly three days before with the remark, "Strike doo west across the lake into the sun to find the camp."
There was not much sun left to guide him, but he used his compass to the best of his ability, embarking in the frail craft for the last twelve miles of his journey with a sensation of immense relief that the forest was at last behind him. And, fortunately, the water was calm; he took his line across the center of the lake instead of coasting round the shores for another twenty miles. Fortunately, too, the other hunters were back. The light of their fires furnished a steering point without which he might have searched all night long for the actual position of the camp.
It was close upon midnight all the same when his canoe grated on the sandy cove, and Hank, Punk and his uncle, disturbed in their sleep by his cries, ran quickly down and helped a very exhausted and broken specimen of Scotch humanity over the rocks toward a dying fire.
| english |
<filename>data/pages/releases/versions.json
[
{
"version": "1.99.0",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.99.0/openui5-runtime-1.99.0.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.99.0/openui5-sdk-1.99.0.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.99.0/openui5-runtime-mobile-1.99.0.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.99.0/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.99.0/#releasenotes.html",
"release_date": "21.02.2022",
"eom": ""
},
{
"version": "1.96.5",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.96.5/openui5-runtime-1.96.5.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.96.5/openui5-sdk-1.96.5.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.96.5/openui5-runtime-mobile-1.96.5.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.96.5/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.96.5/#releasenotes.html",
"release_date": "14.02.2022",
"eom": "Q4/2024"
},
{
"version": "1.93.4",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.93.4/openui5-runtime-1.93.4.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.93.4/openui5-sdk-1.93.4.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.93.4/openui5-runtime-mobile-1.93.4.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.93.4/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.93.4/#releasenotes.html",
"release_date": "06.12.2021",
"eom": ""
},
{
"version": "1.90.11",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.90.11/openui5-runtime-1.90.11.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.90.11/openui5-sdk-1.90.11.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.90.11/openui5-runtime-mobile-1.90.11.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.90.11/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.90.11/#releasenotes.html",
"release_date": "31.01.2022",
"eom": ""
},
{
"version": "1.84.22",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.84.22/openui5-runtime-1.84.22.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.84.22/openui5-sdk-1.84.22.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.84.22/openui5-runtime-mobile-1.84.22.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.84.22/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.84.22/#releasenotes.html",
"release_date": "14.02.2022",
"eom": "Q4/2023"
},
{
"version": "1.71.43",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.71.43/openui5-runtime-1.71.43.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.71.43/openui5-sdk-1.71.43.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.71.43/openui5-runtime-mobile-1.71.43.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.71.43/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.71.43/#releasenotes.html",
"release_date": "08.02.2022",
"eom": "Q4/2027"
},
{
"version": "1.38.52",
"url_download_runtime": "https://github.com/SAP/openui5/releases/download/1.38.52/openui5-runtime-1.38.52.zip",
"url_download_sdk": "https://github.com/SAP/openui5/releases/download/1.38.52/openui5-sdk-1.38.52.zip",
"url_download_mobile": "https://github.com/SAP/openui5/releases/download/1.38.52/openui5-runtime-mobile-1.38.52.zip",
"url_demokit": "https://openui5.hana.ondemand.com/1.38.52/#/topic/99ac68a5b1c3416ab5c84c99fefa250d",
"url_releasenotes": "https://openui5.hana.ondemand.com/1.38.52/#releasenotes.html",
"release_date": "17.09.2021",
"eom": "Q4/2027"
}
] | json |
SHILLONG: Meghalaya Congress has demanded an independent probe into “nefarious activities” at the Tura farmhouse of state BJP vice president Bernard Marak.
Meghalaya Congress leader Ronnie Lyngdoh has said that the police’s raid at state BJP vice president Bernard Marak’s farmhouse in Tura is just the “tip of the iceberg of what possibly could be laying beneath the dark underbelly of the ruling Meghalaya Democratic Alliance (MDA)”.
The Meghalaya Congress leader stated that the raid came at a time when the state government is on the back foot due to allegations of corruptions against it.
“Therefore, this sudden raid at Marak’s farmhouse on the outskirts of Tura is but a cover up for all the misdeeds of the government for the past five years,” the Meghalaya Congress said.
“There should be an independent investigation to unveil the truth behind such shameless and nefarious activities which has been happening in the state and that too very close to where the chief minister resides,” the Meghalaya Congress leader demanded.
Meanwhile, Meghalaya BJP president Ernest Mawrie has backed his party colleague Bernard Marak, saying the police raid at his farmhouse was a “political vendetta”.
“I have personally spoken respected persons in Tura and surrounding areas and I have come to the conclusion that Marak has been unjustly framed and maligned,” Meghalaya BJP chief Ernest Mawrie said.
“It is also very clear that it is a political vendetta as Bernard Marak’s mother’s house was also raided without any warrant. This is pure harassment,” Meghalaya BJP chief Ernest Mawrie further said.
He also urged the Meghalaya government to “withdraw all charges against him (Bernard Marak) which are politically motivated and with the intension of maligning the party’s (BJP) image”.
On the other hand, Meghalaya BJP vice president Bernard Marak, who has been on the run, since the police raid at his Tura farmhouse, is in New Delhi.
This was confirmed by SP of West Garo Hills district in Meghalaya – VS Rathore.
“We were tracking his whereabouts and knew he was hiding in Guwahati but before our teams could reach him, he had managed to board a 5 PM New Delhi flight on Saturday,” the West Garo Hills SP told The Meghalayan newspaper.
Earlier, Meghalaya BJP vice president Bernard Marak accused chief minister Conrad Sangma of directing the police to gun him down.
“Conrad Sangma has directed the police to file a case against me and to gun me down,” Meghalaya BJP vice president Bernard Marak said. | english |
<gh_stars>10-100
{"links":{"static":"docs/api/templating/interface/ComponentCreated","html":"docs/api/templating/interface/ComponentCreated/index.html","fragment":"docs/api/templating/interface/ComponentCreated/index-fragment.html","self":"docs/api/templating/interface/ComponentCreated/index.json"},"properties":[],"methods":[{"name":"created","kindString":"Method","flags":{"isExported":true},"signatures":[{"name":"created","kindString":"Call signature","flags":{},"comment":{"shortText":"Implement this hook if you want to perform custom logic after the constructor has been called.\nAt this point in time, the view has also been created and both the view-model and the view\nare connected to their controller. The hook will recieve the instance of the \"owningView\".\nThis is the view that the component is declared inside of. If the component itself has a view,\nthis will be passed second."},"parameters":[{"name":"owningView","kindString":"Parameter","flags":{},"type":{"type":"reference","name":"View","id":2979}},{"name":"myView","kindString":"Parameter","flags":{},"type":{"type":"reference","name":"View","id":2979}}],"type":{"type":"intrinsic","name":"void"}}],"sources":[{"fileName":"aurelia-templating.d.ts","line":165,"character":9}]}],"name":"ComponentCreated","kindString":"Interface","flags":{"isExported":true},"comment":{"shortText":"An optional interface describing the created convention."},"sources":[{"fileName":"aurelia-templating.d.ts","line":156,"character":41}]} | json |
This year, Maha Shivratri was observed on February 18. Many celebrities from the film fraternity celebrated the auspicious occasion by visiting Shiv temples and offering prayers to Lord Shiva while others extended their wishes to fans through social media posts. Tollywood actress Amala Paul also delved into the spiritual activities of Maha Shivratri. The 31-year-old visited the Pura Gunung Kawi Sebatu holy shrine in Indonesia’s Bali. She dropped a slew of divine pictures on Instagram from the picturesque destination, having a dip in the spring waters there.
In the divine pictures, Amala can be seen dressed in a scarlet-red saree. Draping it in a halter-neck fashion, the actress appeared to relish the breathtaking surrounding of the holy pond, surrounded by lush greenery and man-made, mini waterfalls, creating a greenish pool. In utmost devotion, she folded her hands to offer prayers, tilting her head back. , standing inside the pool.
Amala also held a silver plate of flowers in her hands, in the following two pictures. She seemed to decorate the moss-laden stone pillars with petals. In the next couple of snaps, the Ratsasan star shared glimpses of the sacred temple, encircled with wood and bamboo cottages and small shrines. The entire premises seemed to be tucked away amidst nature, marked with lush vegetation.
The pictures did not take much time to attract the attention of social media users, who queued in the comments to drop their reactions. While one user called Amala to be “Powerful” another termed her a “Water baby. ” Others added numerous red heart emojis in the comment section.
On the work front, Amala has a lineup of films in her kitty. She will next be seen in Bollywood actor-turned-director Ajay Devgan’s Bholaa, Aijaz Khan’s Dvija, and filmmaker Blessy’s upcoming Malayalam-language survival drama Aadujeevitham. As per a report by Indiaglitz, Amala might also make an appearance in some web series. | english |
from .core import listen_for_events | python |
Yash Dayal has picked Shubman Gill as the most difficult batter to bowl to in the Gujarat Titans (GT) nets.
Gill was the Titans' second-highest run-scorer in IPL 2022 with 483 runs, just four behind Hardik Pandya's tally of 487. The GT opener played a crucial unbeaten 45-run knock in the title decider to help his side bag the IPL trophy in their maiden attempt.
During an interaction on India News, Dayal was asked about the batter he found most difficult to bowl to in the nets. He responded:
"Shubman Gill is the most difficult batter to bowl to in the nets. He is not late at all on any delivery. He plays cricketing shots, you have seen what a classical batter he is. "
The GT left-arm pacer also named Wriddhiman Saha as a tough batter to bowl to during the powerplay overs. Dayal observed:
"David Miller is also difficult but you know his approach that he is going to hit you every time but you don't know about Shubman Gill. We played a few practice matches and I felt Wriddhiman Saha is a very difficult batter to bowl to, especially in the powerplay. "
Saha gave the Gujarat Titans a few flying starts during the powerplay overs in IPL 2022. However, he couldn't deliver the goods in the playoff matches, falling for a duck in Qualifier 1 and managing just five runs in the final.
Yash Dayal was also asked to name the batters he found the most difficult to bowl to during the IPL 2022 matches. He replied:
"The most difficult for me was Jos Buttler and among the Indian players, I felt it was Ruturaj Gaikwad. Both these batters have totally different techniques. Jos Buttler is always ready to hit you hard, he can play his destructive cricket in any over, so it is extremely necessary to be prepared for that. "
The 24-year-old also shared his reasons for picking Ruturaj Gaikwad as the toughest Indian batter to bowl to. Dayal said:
"On the other hand, if I talk about Ruturaj's batting, he is extremely orthodox and bats with a great cricketing sense. You don't know when he is going to hit you. So among the batters I bowled to, I found these two batters most difficult to bowl to because there was very little margin for error, they can hit you anytime. "
Gaikwad scored 73 and 53 runs, respectively, in the two matches he played for the Chennai Super Kings (CSK) against the Titans. Dayal accounted for his dismissal in the first game, having him caught at deep backward square leg off a full toss. | english |
Indian hockey legends on Tuesday slammed the national team for its “average" performance in the World Cup where they lost to New Zealand to crash out of the quarterfinal race, saying the debacle has halted the momentum the nation had gained after winning a historic bronze at the Tokyo Olympics.
India had gone into the showpiece with hopes of finishing on the podium for the first time after the gold medal-winning feat in 1975 but lost to New Zealand in sudden death in the crossover match.
The hosts will play 9th to 16th classification matches on Thursday and Saturday in Rourkela.
Member of the 1975 gold-winning team Ashok Kumar said the Indians lacked quality and were far inferior to top nations in all departments of the game.
“The team was given all kinds of support, 6-7 months camp, foreign exposure, top class infrastructure, the best of diets, what else could have been done? And what performance did they give? You cannot even reach the quarterfinals of a home World Cup in front of your fans," Kumar said.
“It has to do a lot with the quality of players, ultimately the debacle was due to average players playing average games. That can’t win you a World Cup medal," he added.
Making further analysis of the performance, Kumar said, “Whenever we attacked, most of the time we ended up at the opposition circle. I don’t know how the players were trained, there was no distribution of the ball, no creative passes, they simply didn’t know what to do. If you can’t score more than four goals against a team like Wales, then what are you doing? “Since, they cannot score from open play, they had to depend on penalty corners and Harmanpreet Singh was under tremendous pressure and he failed. We were not up to the mark in all departments of the game. Except for Akashdeep Singh, I would say no (outfield) player played well in the four matches.
“The team failed miserably in defence also. They conceded two goals against Wales and then allowed New Zealand to come back twice after two-goal down. They cannot do that in a World Cup. I don’t know why Rupinder Pal Singh retired after the Olympics, he would have been a great asset in defence and PC conversion," the 72-year-old said. Asked if there should be changes in the coaching staff, Kumar, who scored the winning goal in the 1975 World Cup final against arch-rivals Pakistan, said, “We have had many foreign coaches in the past but what is our achievement in the World Cup after 1975. So, please tell me what difference would have been there if we had Indian coaches. Indian coaches would not have done worse at least.
“Thanks to the support of the government, especially the Odisha government, we are hosting World Cups here and our team should have capitalised on this. But it’s like we are hosting tournaments and our team is not getting better. I feel that the good momentum we gained from the Tokyo Olympics has been halted by this World Cup performance. " Former captain Sardar Singh said the debacle was due to the collective failure of the team.
“Hockey is a team game. If you want to win a tournament, 14 to 15 players of the squad need to perform at 70 to 80 per cent, which was missing in this World Cup," said the legendary midfielder, who is part of the Hockey India selection committee.
“Hardik’s injury was a big blow as he was the main player in the midfield. He was instrumental in linking up with the forwards and creating opportunities, besides scoring a goal (against Spain). " Sardar also agreed that Harmanpreet felt the pressure of captaincy as he missed one penalty corner after another.
“He (Harmanpreet) felt the pressure of captaincy, that too in a home World Cup. He is one of the best drag-flickers in the world and did well in the Test series against Australia also.
“But he did not look his best, perhaps feeling the pressure. But he is a world class player and cannot be counted out. " On head coach Graham Reid asking for a mental conditioning coach going ahead, Sardar said, “If he (Reid) felt so, he should have raised the demand after the Olympics. Hockey India and SAI have been providing all necessary help to the team and they would have addressed it too. " Hockey India president and former captain Dilip Tirkey said not reaching the quarterfinals of the World Cup after the high of Tokyo Olympics less than two years ago was very disappointing.
“Some players from whom we had a lot of expectations, they somehow could not perform. We all have accepted it," he said.
“We got several penalty corners but we scored a few from them. There was something missing in our defensive structure also. "
Read all the Latest Sports News here(This story has not been edited by News18 staff and is published from a syndicated news agency feed - PTI) | english |
<reponame>wwalpha/aws-spotlight<gh_stars>0
{
"eventVersion": "1.08",
"userIdentity": {
"type": "IAMUser",
"principalId": "AAAAAAAAAAAAAAAAAA",
"arn": "arn:aws:iam::999999999999:user/<EMAIL>",
"accountId": "999999999999",
"accessKeyId": "<KEY>",
"userName": "<EMAIL>",
"sessionContext": {
"sessionIssuer": {},
"webIdFederationData": {},
"attributes": { "mfaAuthenticated": "false", "creationDate": "2021-07-15T01:52:35Z" }
}
},
"eventTime": "2021-07-15T06:35:56Z",
"eventSource": "batch.amazonaws.com",
"eventName": "CreateComputeEnvironment",
"awsRegion": "ap-northeast-1",
"sourceIPAddress": "172.16.31.10",
"userAgent": "Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/91.0.4472.124 Safari/537.36",
"requestParameters": {
"serviceRole": "arn:aws:iam::999999999999:role/ARMS_BatchJOBRole",
"computeResources": {
"securityGroupIds": ["sg-01cc269d31df65e5c"],
"instanceTypes": ["optimal"],
"subnets": [
"subnet-08b591d227107ffc5",
"subnet-003cfdcdbaf257d95",
"subnet-0221940ce594a9f84",
"subnet-0d950c1a77269f980"
],
"minvCpus": 0,
"desiredvCpus": 0,
"maxvCpus": 4,
"type": "EC2",
"instanceRole": "arn:aws:iam::999999999999:instance-profile/ecsInstanceRole",
"tags": { "Name": "first-run-compute-environment" }
},
"state": "ENABLED",
"type": "MANAGED",
"computeEnvironmentName": "first-run-compute-environment",
"tags": {}
},
"responseElements": {
"computeEnvironmentName": "first-run-compute-environment",
"computeEnvironmentArn": "arn:aws:batch:ap-northeast-1:999999999999:compute-environment/first-run-compute-environment"
},
"requestID": "355fca24-09cf-48ff-baa3-09dd2f3c6c7f",
"eventID": "b7339f01-c320-45dd-b566-abbc08c054a8",
"readOnly": false,
"eventType": "AwsApiCall",
"managementEvent": true,
"eventCategory": "Management",
"recipientAccountId": "999999999999"
}
| json |
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd">
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<title>RasterLite2 - Rasters in SQLite DB</title>
</head>
<body>
<h1>RasterLite2 - Rasters in SQLite DB</h1>
<p>Starting with GDAL 2.2, the SQLite driver allows reading and writing SQLite
databases containing RasterLite2 coverages.</p>
<p>
Those databases can be produced by the utilities of the
<a href="https://www.gaia-gis.it/fossil/librasterlite2/home">RasterLite2</a> distribution,
such as rl2tools.<br>
The driver supports reading grayscale, paletted, RGB, multispectral images stored as tiles in the many compressed formats supported by libRasterLite2.
The driver also supports reading overviews/pyramids, spatial reference system and spatial extent.
</p>
<p>GDAL/OGR must be compiled with sqlite support and against librasterlite2 and libspatialite.</p>
<p>The driver is implemented a unified SQLite / SpatiaLite / RasterLite2
vector and raster capable driver./p>
<h2>Opening syntax</h2>
<p>A RasterLite2 filename can be specified as the connection string. If the
file contains a single RasterLite2 coverage, this one will be exposed as the
GDAL dataset. If the file contains multiple coverages, each one will be exposed
as a subdataset with the syntax RASTERLITE2:filename:coverage_name. See
<a href="https://www.gaia-gis.it/fossil/librasterlite2/wiki?name=basic_concepts">the
basic concepts of RasterLite2</a>.</p>
<p>If a coverage is made of several sections, they will be listed as subdatasets
of the coverage dataset, so as to be accessed individually. By default, they
will be exposed as a unified dataset. The syntax of section-based dataset is
RASTERLITE2:filename:coverage_name:section_id:section_name.</p>
<h2>Creation</h2>
The driver supports creating new databases from scratch, adding new coverages to
an existing database and adding sections to an existing coverage.
<h2>Creation options</h2>
<ul>
<li> <b>APPEND_SUBDATASET</b>=YES/NO: Whether to add the raster to the existing
file. If set to YES, COVERAGE must be specified. Default is NO (ie overwrite
existing file)</li>
<li> <b>COVERAGE</b>=string: Coverage name. If not specified, the basename of
the output file is used.</li>
<li> <b>SECTION</b>=string: Section name. If not specified, the basename of
the output file is used.</li>
<li> <b>COMPRESS</b>=NONE/DEFLATE/LZMA/PNG/CCITTFAX4/JPEG/WEBP/CHARS/JPEG2000:
Compression method. Default is NONE. See the
<a href="https://www.gaia-gis.it/fossil/librasterlite2/wiki?name=codecs">
information about supported codecs</a>. Note that some codecs may not be
available depending on how librasterlite2 has been built.</li>
<li> <b>QUALITY</b>=0 to 100: Image quality for JPEG, WEBP and JPEG2000
compressions. Exact meaning depends on the compression method. For WEBP and
JPEG2000, the value 100 triggers the use of their lossless variants.</li>
<li> <b>PIXEL_TYPE</b>=MONOCHROME/PALETTE/GRAYSCALE/RGB/MULTIBAND/DATAGRID:
Raster pixel type. Determines the photometric interpretation. See the
<a href="https://www.gaia-gis.it/fossil/librasterlite2/wiki?name=reference_table">
information about supported pixel types</a>. The driver will
automatically determine an appropriate pixel type given the band characteristics.
</li>
<li> <b>BLOCKXSIZE</b>=int_value. Block width. Defaults to 512.</li>
<li> <b>BLOCKYSIZE</b>=int_value. Block height. Defaults to 512.</li>
<li> <b>NBITS</b>=1/2/4. Force bit width. This will be by default gotten from
the NBITS metadata item in the IMAGE_STRUCTURE metadata domain of the source
raster band.</li>
<li> <b>PYRAMIDIZE</b>=YES/NO. Whether to build automatically build relevant
pyramids/overviews. Defaults to NO. Pyramids can be built with the BuildOverviews() /
gdaladdo.
</ul>
<h2>Examples</h2>
<ul>
<li>Reading a RasterLite2 database with a single coverage:
<pre>
gdalinfo my.rl2
</pre>
<li>Listing the subdatasets corresponding to the coverages of a RasterLite2
database with several coverages:
<pre>
gdalinfo multiple_coverages.rl2
</pre>
<li>Reading a subdataset corresponding to a coverage:
<pre>
gdalinfo RASTERLITE2:multiple_coverages.rl2:my_coverage
</pre>
<li>Creating a RasterLite2 dataset from a grayscale image:
<pre>
gdal_translate -f SQLite byte.tif byte.rl2
</pre>
<li>Creating a RasterLite2 dataset from a RGB image, and using JPEG compression:
<pre>
gdal_translate -f SQLite rgb.tif rgb.rl2 -co COMPRESS=JPEG
</pre>
<li>Adding a RasterLite2 coverage to an existing SpatiaLite/RasterLite2 database:
<pre>
gdal_translate -f SQLite rgb.tif rgb.rl2 -co APPEND_SUBDATASET=YES -co COVERAGE=rgb
</pre>
<li>Adding pyramids to a coverage:
<pre>
gdaladdo rgb.rl2 2 4 8 16
</pre>
</ul>
<p>See Also:</p>
<ul>
<li><a href="https://www.gaia-gis.it/fossil/libRasterLite2/home">Rasterlite2 home page</a></li>
<li><a href="drv_sqlite.html">OGR SQLite driver</a></li>
</ul>
</body>
</html>
| html |
<reponame>ric-colasanti/PyHASE
# Loads the ABM library
import ABM
#Sets the size of the window
WIDTH = 600
HEIGHT = 600
# Create a new simulation of grid size 30 X 30 cells
# Set the variable in each cell of as "resource" and set value to 0
world = ABM.World(30, ["resource"],[0])
#set center cell resource to 500
world.setCell(15, 15, "resource", 500)
world.update()
# This function "update" is run every iter action by the ABM simulation
def update():
#sleep
ABM.frame = 0.1
# diffuse resource by 0.5
world.diffuse("resource",0.5)
world.update()
#Draw the world with squares that have their "live" variable set to 1
ABM.draw(screen, world, "resource", 1,discreet=False)
# Uncomment the line below to output total resource
#print((world.sumAll("resource"),0))
#Start the simulation
ABM.go() | python |
<reponame>aniu2002/sparrow-egg<filename>sparrow-search/sparrow-search-crawl/src/main/java/com/sparrow/collect/store/io/DataWrite.java<gh_stars>1-10
package com.sparrow.collect.store.io;
import java.io.IOException;
/**
* Created by Administrator on 2016/11/29.
*/
public interface DataWrite {
void writeInt(int num) throws IOException;
void writeLong(long num) throws IOException;
void writeString(String str) throws IOException;
void write(byte[] bytes) throws IOException;
void write(byte[] bytes, int start, int size) throws IOException;
int size();
void destroy();
}
| java |
<filename>__tests__/__fixtures__/ld4p_RT_bf2_BflcTitle.json<gh_stars>0
{"propertyTemplates":[{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title00MarcKey","propertyLabel":"LC Extension: title00MarcKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title00MatchKey","propertyLabel":"LC Extension: title00MatchKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title10MarcKey","propertyLabel":"LC Extension: title10MarcKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title10MatchKey","propertyLabel":"LC Extension: title10MatchKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title11MarcKey","propertyLabel":"LC Extension: title11MarcKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title11MatchKey","propertyLabel":"LC Extension: title11MatchKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title30MarcKey","propertyLabel":"LC Extension: title30MarcKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title30MatchKey","propertyLabel":"LC Extension: title30MatchKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title40MarcKey","propertyLabel":"LC Extension: title40MarcKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/title40MatchKey","propertyLabel":"LC Extension: title40MatchKey"},{"mandatory":"false","repeatable":"true","type":"literal","propertyURI":"http://id.loc.gov/ontologies/bflc/titleSortKey","propertyLabel":"LC Extension: titleSortKey"}],"id":"ld4p:RT:bf2:BflcTitle","resourceURI":"http://id.loc.gov/ontologies/bflc","resourceLabel":"Title: BIBFRAME 2.0 LC Extension","author":"LD4P","date":"2019-08-19","schema":"https://ld4p.github.io/sinopia/schemas/0.2.0/resource-template.json"}
| json |
Switch to any Telugu entertainment channel and you will notice one peculiar thing. Star heroines of Telugu industry are just sizzling out there with their hot charms.
While Shruti Haasan is wooing with Fanta ad from long time, recently Samantha came up with a new Maaza ad. Then we have the likes of Kajal Agarwal coming up with Parachute hair oil ad, while Rakul Preet rocking with Big C advertisement. All these hotties are simply mesmeric in those ads.
At a time when Bollywood heroines do all hungama on TV through ads, it's nice to see Telugu heroines also flourishing. | english |
"use strict";
Object.defineProperty(exports, "__esModule", {
value: true
});
exports.getLocation = getLocation;
/**
** component: 要显示的组件
** target: 鼠标点击的位置
** placement: 组件显示的位置
** isCenter: 看现实的组件是否要在鼠标点击的中间
**/
function getLocation(component, target, placement, isCenter) {
var client = component.getBoundingClientRect(),
top = client.top,
left = client.left,
width = client.width,
height = client.height,
targetRact = target.getBoundingClientRect(),
sTop = targetRact.top,
sLeft = targetRact.left,
sWidth = targetRact.width,
sHeight = targetRact.height,
arrowDirction,
scrollTop = 0;
if (document.documentElement && document.documentElement.scrollTop) {
scrollTop = document.documentElement.scrollTop;
} else if (document.body) {
scrollTop = document.body.scrollTop;
}
sTop += scrollTop;
// Regular.dom.addClass(toolTip, "zoom-big-enter zoom-big-enter-active");
if (!placement) {
top = sTop - height;
left = sLeft - parseInt(width / 2);
// top = top < 0 ? 0 : top;
// left = left < 0 ? 0 : left;
} else {
switch (placement) {
case "right":
top = ~~(sTop - height / 2 + sHeight / 2);
left = sLeft + targetRact.width + 8; //8箭头的宽度
arrowDirction = "left";
if (left + width > document.body.clientWidth) {
//太右边了，就放在左边
left = sLeft - width;
arrowDirction = "right";
}
break;
case "left":
top = ~~(sTop - (height - sHeight) / 2);
left = sLeft - width;
arrowDirction = "right";
// if(left + width > document.body.clientWidth){//太右边了，就放在左边
// left = sLeft - width - 8;
// arrowDirction = "left";
// }
break;
case "top":
if (isCenter) {
left = ~~(sLeft - (width - sWidth) / 2);
top = ~~(sTop - height - 8);
} else {
left = sLeft;
top = ~~(sTop - height);
}
arrowDirction = "bottom";
// top = top < 0 ? 0 : top;
// left = left < 0 ? 0 : left;
break;
case "bottom":
if (isCenter) {
left = ~~(sLeft - (width - sWidth) / 2);
top = sTop + sHeight + 8;
} else {
left = sLeft;
top = sTop + sHeight;
}
arrowDirction = "top";
// if(left + width > document.body.clientWidth){//太右边了，就放在左边
// left = sLeft - width - 8;
// arrowDirction = "left";
// }
break;
}
}
top = top < 0 ? 0 : top;
left = left < 0 ? 0 : left;
return {
left: left,
top: top,
arrowDirction: arrowDirction
};
} | javascript |
<filename>av/home/home.css
.page-presentation-image {
width: 300px;
height: 300px;
}
.page-presentation {
display: flex;
flex-direction: row;
justify-content: space-around;
}
.page-presentation-texte {
border: 3px solid var(--color-text-main);
border-radius: 25px;
margin: 20px auto;
flex-grow: 100;
}
.page-presentation-contenu {
margin: 0 20px;
}
| css |
In a rare scene, a fox was found to be have invaded Lord’s during a Natwest T20 match between Middlesex and Hampshire. The match was eventually won by Hampshire by six wickets, chasing 137. It was South Africa-born Rilee Rossouw who dashed his way to 47-ball 60 in his sides’ fifth win in the championship. This is not the first instance of an animal invading a cricket pitch — namely a fox. In a John Player League match between Warwickshire and Kent on June 6, 1962, a fox walked behind the bowler Derek Underwood.
Apart from foxes, other animals have also made their presence felt on a cricket pitch – cats, dogs, donkeys, pigs, elephants and kangaroos, to name a few.
There have been several instances of dogs stopping play, most of which happened in India and Sri Lanka. Let us, however, focus on the most renowned ones. The most spectacular of which took place in the Trent Bridge Ashes Test of 1993. A mongrel entered the ground as Merv Hughes ran in to bowl to Mark Lathwell. Hughes himself approached the dog. He got down on his knees and requested the dog to leave. To everyone’s surprise, the mutt agreed. Michael Slater eventually carried it away, and it was immediately adopted by one of the spectators. Rumours are that they called it Merv.
Though Peter and Sinbad both ruled Lord’s, they rarely stopped cricket matches. However, the cat that walked on to the ground during a match between Southern Schools and The Rest did not care much for protocol. It settled down at the non-striker’s end, holding up play for a reasonable amount of time. | english |
{
"parameters": {
"apimBaseUrl": "apimservice1.management.azure-api.net",
"templateName": "applicationApprovedNotificationMessage",
"api-version": "2017-03-01",
"Accept": "application/json"
},
"responses": {
"200": {
"body": {
"id": "/templates/ApplicationApprovedNotificationMessage",
"subject": "Your application $AppName is published in the application gallery",
"body": "<!DOCTYPE html >\r\n<html>\r\n <head />\r\n <body>\r\n <p style=\"font-size:12pt;font-family:'Segoe UI'\">Dear $DevFirstName $DevLastName,</p>\r\n <p style=\"font-size:12pt;font-family:'Segoe UI'\">\r\n We are happy to let you know that your request to publish the $AppName application in the application gallery has been approved. Your application has been published and can be viewed <a href=\"http://$DevPortalUrl/Applications/Details/$AppId\">here</a>.\r\n </p>\r\n <p style=\"font-size:12pt;font-family:'Segoe UI'\">Best,</p>\r\n <p style=\"font-size:12pt;font-family:'Segoe UI'\">The $OrganizationName API Team</p>\r\n </body>\r\n</html>",
"title": "Application gallery submission approved",
"description": "Developers who submitted their application for publication in the application gallery on the developer portal receive this email after their submission is approved.",
"isDefault": true,
"parameters": [
{
"name": "AppId",
"title": "Application id"
},
{
"name": "AppName",
"title": "Application name"
},
{
"name": "DevFirstName",
"title": "Developer first name"
},
{
"name": "DevLastName",
"title": "Developer last name"
},
{
"name": "OrganizationName",
"title": "Organization name"
},
{
"name": "DevPortalUrl",
"title": "Developer portal URL"
}
]
}
}
}
} | json |
import SeqModel from 'config/database/types/ModelInterface';
interface ContactAttributes extends SeqModel {
}
export default ContactAttributes;
| typescript |
<gh_stars>0
{"rating": "5", "uuid": "662", "review_date": "2013-06-10", "helpful": "0", "reviewer_id": "A25VSQLD81P4TF", "not_helpful": "0", "review_text": "This fan is really handy to keep around. It is a bit loud on high, but I expected that with this type of fan. I can use it anywhere in my house and move it from room to room as I need it.", "summary": "good fan", "product_name": "Lasko 3300 20\" Wind Machine 3 Speed Cooling 3300", "product_id": "B00002N5ZB"} | json |
Deshaun Watson has settled 20 out of the 24 cases of sexual misconduct brought against him. It appears he may also settle the four remaining cases before the 2022-23 season begins.
However, the NFL is conducting its own investigation and will decide what sort of punishment to hand down to the Cleveland Browns quarterback.
There have been reports that the quarterback and his representatives have met with the NFLPA and the NFL to discuss a “workable suspension” for the quarterback. If so, a meeting of this kind would be unprecedented in the league’s history.
Former NFL MVP turned analyst Boomer Esiason spoke about the alleged meeting on his sports radio show Boomer and Gio.
Here's what he said:
Esiason went on to express his disgust with the meeting:
The former MVP also questioned what could be accomplished in the meeting:
If the punishment for Watson equals nothing more than a slap on the wrist, there will no doubt be an uproar from fans and the media. Especially considering the six-game suspension that was just handed to Alvin Kamara and the one-year suspension given to Calvin Ridley for betting on games.
Watson is still waiting to see how things play out, but if the punishment doesn’t fit the alleged crime, expect a wave of protests directed towards the NFL and its commissioner.
In MLB recently, Trevor Bauer received a two-year suspension for one accusation of sexual misconduct. Many fans have insisted that the Cleveland quarterback receives a similar punishment. Others are expecting six to eight weeks, which would amount to a slap on the wrist. Most pundits, however, expect Watson to miss the season.
Regardless of what suspension is handed out, certain sections of the NFL community will be unhappy. It will be interesting to see what the NFL decides to do with the quarterback when its investigation finally concludes.
If you use any of the above quotes, please credit Boomer and Gio and H/T Sportskeeda.
| english |
500 · 14th July, 1964 Short notice Questions and Answers
Sri P. Anthony Reddy:- Mr. Speaker, Sir, in view of the answers placed on the Table, it is found that some schools have done very well. Will the Government study or adopt the methods adopted in this school and adopt the same methods of teaching?
Sri K. Brahmumanda Reddy: It will be useful analysis
శ్రీ ఎ. సత్యనారాయణ: ఈ percentage of results rన్ని schools లో బాగా నే కన్పడుతున్నాయి. వాటిలో ఏమైనా indirect detentions ఉన్నయాఅండీ; నాకుఉన్న information ఏమిటంటే కొన్ని schools లో ScKSol స హాజరవుతున్న students ను detain చేసి, వాళ్ళన private గా కూర్చొ నేదానికి, అవకాశము కల్పిస్తున్నారని, school తరఫున కొంతమందిని కూర్చొ పోనికి aloyy చేయడం లేదని తెలుస్తున్నది. ఆ విధంగా వచ్చిన results ఏమిటండి అవి ?
Short notice Questions and Answers 14th July, 1964 501
శ్రీ కె. బ్రహ్మానంద రెడ్డి;— ఏమీ లేదండి.
Sri P. Anthoni Reddy:-Are the Government aware that the donation system is abolished through out the State? Sri K. Brahmananda Reddy:- Yes, Sir.
Sri T. V. S. Chalapati Rao:-- Does the Government propose to improve the results in the schools in which they are poor?
Sri K. Brahmananda Reddy:- There are several ways of improvement. It is being studied often. The parents must take special interest apart from improving the quality of teachers and putting in more teachers and other steps కె. ఎల్. నరసింహారావు (ఇల్లందు):- As by the law, detentions అనేది తీసివేసినప్పటికినీ, తమ schools లో percentage చాలా ఘనం గా చూపించుకోవడం కొరకు ఎవరైతే కొద్దిగా weak గా ఉంటారో ఆ weak students స detain చేసి మీరు private appear కాండి అని school నుంచి గెంటివేయడం అనే విషయం ప్రభుత్వానికి తెలియదా ?
శ్రీ కె. బ్రహ్మానంద రెడ్డి:—— నా notice కు ఏమీ రాలేదండి.
Sri T. V. S. Chalapati Rao:-Will the Government be pleased to investigate why the results are poor in certain schools.
Sri K. Brahmananda Reddy:- That investigation has been going on periodically.
శ్రీ వావిలాల గోపాలకృష్ణయ్య: ఇందులో, private schools లో percentaeg ఎట్లావున్నది? జిల్లాపరిషత్ schools లో percentage ఎట్లా ఉన్నది? Government schools లో percentage ఎట్లా ఉన్నది ? Teachers అసలు appoint కాకపోతే అటువంటి schools percentage ఎట్లాఉంది? తక్కువ teachers ఉన్న schools లో percentage ఎట్లా ఉన్నది? ఆ' details అన్నీ ఒక సారి ఇస్తే ఆ లోపాలకు ప్రధాన కారణాలు అర్థం అవుతుంది. కనుక అదేమైనా ప్రభుత్వము ఆలోచిస్తుందా
| english |
<reponame>dendisuhubdy/grokmachine
from __future__ import print_function
import os
import pickle
from xml.etree.ElementTree import ElementTree
import dsz.lp
class XMLConfigError(Exception, ):
pass
def enforce(condition, msg=None):
if (not condition):
if msg:
raise XMLConfigError, (msg if (type(msg) is not type((lambda : None))) else msg())
else:
raise XMLConfigError
class ConfigProcessor(object, ):
def __init__(self, file, flags):
self.flags = flags
self.file = file
def process(self):
enforce(False, (lambda : ('XML config processor not implemented for %s' % self.__class__)))
def validate(self):
enforce(False, (lambda : ('XML config validation not implemented for %s' % self.__class__)))
class Config(object, ):
def __init__(self, file, flags={}, **kwargs):
self.__file = file
self.flags = flags
self.kwargs = kwargs
@property
def file(self):
return self.__file
def validate(self):
return self.__process(validate_only=True)
def process(self):
self.__process(validate_only=False)
def __process(self, validate_only):
ver = version(self.file)
initargs = _processors[ver]['init']
processor = _processors[ver]['processor']
for i in self.kwargs:
if (i not in initargs):
initargs[i] = self.kwargs[i]
config = processor(file=self.file, flags=self.flags, **initargs)
if validate_only:
return config.validate()
else:
config.process()
_HANDLER_CACHE = os.path.normpath(os.path.join(dsz.lp.GetResourcesDirectory(), '..', 'tmp', 'survey', 'engines.pickle'))
def _loadhandlers():
if (not os.path.exists(_HANDLER_CACHE)):
return {}
with open(_HANDLER_CACHE, 'r') as input:
return pickle.load(input)
_processors = _loadhandlers()
def _savehandlers():
if (not os.path.exists(os.path.split(_HANDLER_CACHE)[0])):
os.makedirs(os.path.split(_HANDLER_CACHE)[0])
with open(_HANDLER_CACHE, 'w') as output:
pickle.dump(_processors, output)
def version(file):
tree = ElementTree(file=file)
version = tree.getroot().get('version', default=None)
enforce((version in _processors), (lambda : ("Unsupported XML configuration version '%s' read from file." % version)))
return version
def register_handler(version, processor, **initargs):
if (version in _processors):
return False
_processors[version] = {'processor': processor, 'init': initargs}
_savehandlers()
return True | python |
{"nameWithOwner": "twitter/twitter.github.io", "reportID": "MONTHLY-REPORT-2020-02-21", "datestamp": {"latest": "2020-02-21", "previous": "2020-01-17"}, "data": {"commits": {"latest": 594, "previous": 559, "diff": 35}, "issues": {"latest": 23, "previous": 23, "diff": 0}, "openIssues": {"latest": 2, "previous": 2, "diff": 0}, "closedIssues": {"latest": 21, "previous": 21, "diff": 0}, "pullRequests": {"latest": 35, "previous": 34, "diff": 1}, "openPullRequests": {"latest": 6, "previous": 5, "diff": 1}, "mergedPullRequests": {"latest": 17, "previous": 17, "diff": 0}, "closedPullRequests": {"latest": 12, "previous": 12, "diff": 0}, "forkCount": {"latest": 489, "previous": 485, "diff": 4}, "stargazers": {"latest": 1311, "previous": 1291, "diff": 20}, "watchers": {"latest": 466, "previous": 467, "diff": -1}}} | json |
<filename>simnode/dbtypes/beamng.py
from typing import Optional
from beamngpy import Vehicle, Scenario
from logging import getLogger
_logger = getLogger("DriveBuild.SimNode.DBTypes.BeamNG")
class DBVehicle(Vehicle):
from requests import AiRequest
from typing import Any
def __init__(self, vid: str, **options) -> None:
from threading import Lock
super().__init__(vid, **options)
self.requests = {}
self._vehicle_lock = Lock()
def poll_sensors(self, requests):
_logger.debug(self.vid + ": Try acquire lock for polling sensors")
self._vehicle_lock.acquire()
_logger.debug(self.vid + ": Acquired lock for polling sensors")
result = super().poll_sensors(requests)
_logger.debug(self.vid + ": Release lock for polling sensors")
self._vehicle_lock.release()
return result
def control(self, **options):
_logger.debug(self.vid + ": Try acquire lock for controlling")
self._vehicle_lock.acquire()
_logger.debug(self.vid + ": Acquired lock for controlling")
if self.skt:
super().control(**options)
else:
_logger.warning("The vehicle can not be controlled since it is not connected")
_logger.debug(self.vid + ": Release lock for controlling")
self._vehicle_lock.release()
def close(self):
_logger.debug(self.vid + ": Try acquire lock for controlling")
self._vehicle_lock.acquire()
_logger.debug(self.vid + ": Acquired lock for controlling")
if self.skt:
super().close()
else:
_logger.warning("The connection to the vehicle " + self.vid + "could not be closed")
self._vehicle_lock.release()
def apply_request(self, request: AiRequest) -> None:
self.requests[request.rid] = request
request.add_sensor_to(self)
def poll_request(self, rid: str, scenario: Scenario) -> Optional[Any]:
"""
The return type depends on the return type of the appropriate AIRequest.
"""
if rid in self.requests:
return self.requests[rid].read_sensor_cache_of(self, scenario)
else:
_logger.warning("The vehicle " + self.vid + " has no request called " + rid + " attached.")
| python |
|Attach hook:
|Called from:
For more information about attaching hooks, see Manual:Hooks .
For examples of extensions using this hook, see Category:ExtensionTypes extensions.
- &$extTypes - associative array of extensions types, the keys are the strings you use as key in $wgExtensionCredits, the values are the messages as displayed on Special:Version (ie something coming from wfMessage)
| english |
As people strive ever harder to minutely quantify every action they do, the sensors that monitor those actions are growing lighter and less invasive. Two prototype sensors from crosstown rivals Stanford and Berkeley stick right to the skin and provide a wealth of physiological data.
Stanford’s stretchy wireless “BodyNet” isn’t just flexible in order to survive being worn on the shifting surface of the body; that flexing is where its data comes from.
The sensor is made of metallic ink laid on top of a flexible material like that in an adhesive bandage. But unlike phones and smartwatches, which use tiny accelerometers or optical tricks to track the body, this system relies on how it is itself stretched and compressed. These movements cause tiny changes in how electricity passes through the ink, changes that are relayed to a processor nearby.
Naturally if one is placed on a joint, as some of these electronic stickers were, it can report back whether and how much that joint has been flexed. But the system is sensitive enough that it can also detect the slight changes the skin experiences during each heartbeat, or the broader changes that accompany breathing.
The problem comes when you have to get that signal off the skin. Using a wire is annoying and definitely very ’90s. But antennas don’t work well when they’re flexed in weird directions — efficiency drops off a cliff, and there’s very little power to begin with — the skin sensor is powered by harvesting RFID signals, a technique that renders very little in the way of voltage.
The second part of their work, then, and the part that is clearly most in need of further improvement and miniaturization, is the receiver, which collects and re-transmits the sensor’s signal to a phone or other device. Although they managed to create a unit that’s light enough to be clipped to clothes, it’s still not the kind of thing you’d want to wear to the gym.
The good news is that’s an engineering and design limitation, not a theoretical one — so a couple years of work and progress on the electronics front and they could have a much more attractive system.
“We think one day it will be possible to create a full-body skin-sensor array to collect physiological data without interfering with a person’s normal behavior,” Stanford professor Zhenan Bao said in a news release.
Over at Cal is a project in a similar domain that’s working to get from prototype to production. Researchers there have been working on a sweat monitor for a few years that could detect a number of physiological factors.
Normally you’d just collect sweat every 15 minutes or so and analyze each batch separately. But that doesn’t really give you very good temporal resolution — what if you want to know how the sweat changes minute by minute or less? By putting the sweat collection and analysis systems together right on the skin, you can do just that.
While the sensor has been in the works for a while, it’s only recently that the team has started moving toward user testing at scale to see what exactly sweat measurements have to offer.
“The goal of the project is not just to make the sensors but start to do many subject studies and see what sweat tells us — I always say ‘decoding’ sweat composition. For that we need sensors that are reliable, reproducible, and that we can fabricate to scale so that we can put multiple sensors in different spots of the body and put them on many subjects,” explained Ali Javey, Berkeley professor and head of the project.
As anyone who’s working in hardware will tell you, going from a hand-built prototype to a mass-produced model is a huge challenge. So the Berkeley team tapped their Finnish friends at VTT Technical Research Center, who make a specialty of roll-to-roll printing.
For flat, relatively simple electronics, roll-to-roll is a great technique, essentially printing the sensors right onto a flexible plastic substrate that can then simply be cut to size. This way they can make hundreds or thousands of the sensors quickly and cheaply, making them much simpler to deploy at arbitrary scales.
These are far from the only flexible or skin-mounted electronics projects out there, but it’s clear that we’re approaching the point when they begin to leave the lab and head out to hospitals, gyms and homes.
The paper describing Stanford’s flexible sensor appeared this week in the journal Nature Electronics, while Berkeley’s sweat tracker was in Science Advances.
| english |
## Nightingale Stack Chart 堆叠图
:::demo
```javascript
const data = [
{
product: "05-08",
year: "图例一",
sales: 30,
},
{
product: "05-08",
year: "图例二",
sales: 15,
},
{
product: "05-08",
year: "图例三",
sales: 20,
},
{
product: "05-09",
year: "图例一",
sales: 30,
},
{
product: "05-09",
year: "图例二",
sales: 17,
},
{
product: "05-09",
year: "图例三",
sales: 20,
},
{
product: "05-10",
year: "图例一",
sales: 17.57,
},
{
product: "05-10",
year: "图例二",
sales: 24,
},
{
product: "05-10",
year: "图例三",
sales: 37.54,
},
{
product: "05-11",
year: "图例一",
sales: 41,
},
{
product: "05-11",
year: "图例二",
sales: 28,
},
{
product: "05-11",
year: "图例三",
sales: 21,
},
{
product: "05-12",
year: "图例一",
sales: 14,
},
{
product: "05-12",
year: "图例二",
sales: 25,
},
{
product: "05-12",
year: "图例三",
sales: 35,
},
{
product: "05-13",
year: "图例一",
sales: 44,
},
{
product: "05-13",
year: "图例二",
sales: 25,
},
{
product: "05-13",
year: "图例三",
sales: 10,
},
{
product: "05-14",
year: "图例一",
sales: 25,
},
{
product: "05-14",
year: "图例二",
sales: 25,
},
{
product: "05-14",
year: "图例三",
sales: 10,
},
{
product: "05-15",
year: "图例一",
sales: 25,
},
{
product: "05-15",
year: "图例二",
sales: 25,
},
{
product: "05-15",
year: "图例三",
sales: 10,
},
]
const { Chart, PolarBar, Tooltip, Legend } = qcharts
const chart = new Chart({
container: "#app",
})
chart.source(data, {
row: "year",
value: "sales",
text: "product",
})
const bar = new PolarBar({
stack: true,
radius: 0.8,
groupPadAngle: 15,
}).style("pillar", {
strokeColor: "#FFF",
lineWidth: 1,
})
const tooltip = new Tooltip()
const legend = new Legend()
chart.append([bar, tooltip, legend])
```
:::
| markdown |
Dominik Mysterio finally signed a WWE contract on RAW, officially kickstarting his career as a WWE Superstar. However, Mysterio Jr. would have surely hoped for a better first night as an official WWE performer.
Seth Rollins and Murphy annihilated Dominik with vicious kendo stick shots, and as revealed later, the newest WWE Superstar took 30 unanswered strikes from the Monday Night Messiah and his disciple.
It was uncomfortable to watch for the fans watching all around the world, and it took the ongoing rivalry to the next level.
Dominik Mysterio's body showed off the damage of the assault, and he looked to be in an awful condition in the photos released by the WWE after the segment. You can check out the images below:
As we had reported earlier, Rey Mysterio reacted to his son getting brutalized by Seth Rollins, but the WWE veteran wasn't the only Hispanic Superstar to respond to the attack.
Andrade, despite being a heel on TV, voiced his support for Dominik. His tag team partner Angel Garza wasn't far behind as he reacted to a photo of Dominik tweeted out by the WWE.
The opening segment of RAW was solid from the get-go as Samoa Joe was in the ring to introduce Seth Rollins and Dominik for the contract signing segment.
Seth Rollins announced that he'd allow Dominik to use weapons in their SummerSlam match before talking on Humberto Carrillo in the first match on this week's Monday Night RAW.
The match was just a precursor for the real segment that was about to unfold, and it was the ruthless beatdown of Dominik Mysterio at the hands of Seth Rollins and Murphy.
Thirty barbarous kendo stick strikes ended up giving Dominik Mysterio multiple welts on his body, and the backstage photos painted a pretty brutal picture of the damage that he sustained.
Will Seth Rollins and Murphy pay for their actions on next week's RAW? Could Rey Mysterio return for the first time since the 'Eye for an Eye' match to avenge the beatdown of his son? WWE's build-up for the SummerSlam match has picked up the pace, and it would all culminate in Dominik's in-ring debut on August 23rd.
| english |
<reponame>PHaroZ/eclipse-tomcat
package com.sysdeo.eclipse.tomcat;
import java.io.File;
import java.io.IOException;
import java.util.StringTokenizer;
public class TomcatProjectZipper extends Zipper {
private boolean acceptSource = false;
/**
* Constructor for TomcatProjectZipper.
* @param outputFile
* @param directory
* @throws IOException
*/
public TomcatProjectZipper(File outputFile, File directory, boolean acceptSource)
throws IOException {
super(outputFile, directory);
this.acceptSource = acceptSource;
}
/*
* @see Zipper#acceptDir(File)
*/
protected boolean acceptDir(File dir) {
if (dir.getName().equals("jsp")) {
if(dir.getParentFile().getName().equals("apache")) {
if(dir.getParentFile().getParentFile().getName().equals("org")) {
return false;
}
}
}
String excludeString = TomcatPluginResources.PROJECT_WAREXPORT_EXCLUDE_DIRECTORIES;
StringTokenizer tokenizer = new StringTokenizer(excludeString, ";");
while (tokenizer.hasMoreTokens()) {
String eachDir = tokenizer.nextToken();
if (dir.getName().equals(eachDir)) {
return false;
}
}
return true;
}
/*
* @see Zipper#acceptFile(File)
*/
protected boolean acceptFile(File file) {
if (file.getName().endsWith(".java")) {
return acceptSource;
}
String excludeString = TomcatPluginResources.PROJECT_WAREXPORT_EXCLUDE_FILES;
StringTokenizer tokenizer = new StringTokenizer(excludeString, ";");
while (tokenizer.hasMoreTokens()) {
if (file.getName().equals(tokenizer.nextToken())) {
return false;
}
}
return true;
}
}
| java |
{
"word": "Fracture",
"definitions": [
"Break or cause to break.",
"Sustain a fracture of (a bone)",
"(with reference to a group or organization) split or fragment and become unable to function or exist."
],
"parts-of-speech": "Verb"
} | json |
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8">
<meta name="viewport" content="width=device-width, initial-scale=1">
<title>iris: 20 m 59 s</title>
<link rel="shortcut icon" type="image/png" href="../../../../../favicon.png" />
<link href="../../../../../bootstrap.min.css" rel="stylesheet">
<link href="../../../../../bootstrap-custom.css" rel="stylesheet">
<link href="//maxcdn.bootstrapcdn.com/font-awesome/4.2.0/css/font-awesome.min.css" rel="stylesheet">
<script src="../../../../../moment.min.js"></script>
<!-- HTML5 Shim and Respond.js IE8 support of HTML5 elements and media queries -->
<!-- WARNING: Respond.js doesn't work if you view the page via file:// -->
<!--[if lt IE 9]>
<script src="https://oss.maxcdn.com/html5shiv/3.7.2/html5shiv.min.js"></script>
<script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script>
<![endif]-->
</head>
<body>
<div class="container">
<div class="navbar navbar-default" role="navigation">
<div class="container-fluid">
<div class="navbar-header">
<a class="navbar-brand" href="../../../../.."><i class="fa fa-lg fa-flag-checkered"></i> Coq bench</a>
</div>
<div id="navbar" class="collapse navbar-collapse">
<ul class="nav navbar-nav">
<li><a href="../..">clean / released</a></li>
<li class="active"><a href="">8.11.0 / iris - 3.3.0</a></li>
</ul>
</div>
</div>
</div>
<div class="article">
<div class="row">
<div class="col-md-12">
<a href="../..">« Up</a>
<h1>
iris
<small>
3.3.0
<span class="label label-success">20 m 59 s</span>
</small>
</h1>
<p><em><script>document.write(moment("2020-09-17 07:05:41 +0000", "YYYY-MM-DD HH:mm:ss Z").fromNow());</script> (2020-09-17 07:05:41 UTC)</em><p>
<h2>Context</h2>
<pre># Packages matching: installed
# Name # Installed # Synopsis
base-bigarray base
base-num base Num library distributed with the OCaml compiler
base-threads base
base-unix base
conf-findutils 1 Virtual package relying on findutils
conf-m4 1 Virtual package relying on m4
coq 8.11.0 Formal proof management system
num 0 The Num library for arbitrary-precision integer and rational arithmetic
ocaml 4.05.0 The OCaml compiler (virtual package)
ocaml-base-compiler 4.05.0 Official 4.05.0 release
ocaml-config 1 OCaml Switch Configuration
ocamlfind 1.8.1 A library manager for OCaml
# opam file:
opam-version: "2.0"
name: "coq-iris"
maintainer: "<NAME> <<EMAIL>>"
authors: "The Iris Team"
license: "BSD"
homepage: "https://iris-project.org/"
bug-reports: "https://gitlab.mpi-sws.org/iris/iris/issues"
dev-repo: "git+https://gitlab.mpi-sws.org/iris/iris.git"
synopsis: "Iris is a Higher-Order Concurrent Separation Logic Framework with support for interactive proofs"
tags: [
"date:2020-07-15"
"logpath:iris"
]
depends: [
"coq" { (>= "8.9.1" & < "8.13~") | (= "dev") }
"coq-stdpp" { (= "1.4.0") | (= "dev") }
]
build: [make "-j%{jobs}%"]
install: [make "install"]
url {
src:
"https://gitlab.mpi-sws.org/iris/iris/repository/iris-3.3.0/archive.tar.gz"
checksum:
"sha512=451145d68f18ab65649edbf1c78f0fccbc9748829a15640efc30cabed7ce14c5ee246f41de130e3fd331172e6a5a347c6810dbe2838c7d3ae2e32dbf6d1adb4d"
}
</pre>
<h2>Lint</h2>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>true</code></dd>
<dt>Return code</dt>
<dd>0</dd>
</dl>
<h2>Dry install</h2>
<p>Dry install with the current Coq version:</p>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>opam install -y --show-action coq-iris.3.3.0 coq.8.11.0</code></dd>
<dt>Return code</dt>
<dd>0</dd>
</dl>
<p>Dry install without Coq/switch base, to test if the problem was incompatibility with the current Coq/OCaml version:</p>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>true</code></dd>
<dt>Return code</dt>
<dd>0</dd>
</dl>
<h2>Install dependencies</h2>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>opam list; echo; ulimit -Sv 4000000; timeout 2h opam install -y --deps-only coq-iris.3.3.0 coq.8.11.0</code></dd>
<dt>Return code</dt>
<dd>0</dd>
<dt>Duration</dt>
<dd>3 m 21 s</dd>
</dl>
<h2>Install</h2>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>opam list; echo; ulimit -Sv 16000000; timeout 4h opam install -y -v coq-iris.3.3.0 coq.8.11.0</code></dd>
<dt>Return code</dt>
<dd>0</dd>
<dt>Duration</dt>
<dd>20 m 59 s</dd>
</dl>
<h2>Installation size</h2>
<p>Total: 32 M</p>
<ul>
<li>1 M <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proph_erasure.vo</code></li>
<li>1 M <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lang.vo</code></li>
<li>888 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/primitive_laws.vo</code></li>
<li>595 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/big_op.glob</code></li>
<li>594 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/ltac_tactics.vo</code></li>
<li>545 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/big_op.vo</code></li>
<li>540 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra.vo</code></li>
<li>444 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ofe.vo</code></li>
<li>402 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws.glob</code></li>
<li>342 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/monpred.vo</code></li>
<li>330 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra.glob</code></li>
<li>328 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws.vo</code></li>
<li>326 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmap.vo</code></li>
<li>316 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/boxes.vo</code></li>
<li>302 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_weakestpre.vo</code></li>
<li>302 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/coq_tactics.vo</code></li>
<li>300 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/csum.vo</code></li>
<li>293 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/environments.vo</code></li>
<li>283 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/weakestpre.vo</code></li>
<li>279 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances.glob</code></li>
<li>272 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/primitive_laws.glob</code></li>
<li>271 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances.vo</code></li>
<li>262 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/list.vo</code></li>
<li>261 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ofe.glob</code></li>
<li>252 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/monpred.glob</code></li>
<li>248 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/big_op.vo</code></li>
<li>247 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/coq_tactics.glob</code></li>
<li>247 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/auth.vo</code></li>
<li>246 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/upred.vo</code></li>
<li>245 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/adequacy.vo</code></li>
<li>238 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/monpred.vo</code></li>
<li>227 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/sts.vo</code></li>
<li>224 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_heap.vo</code></li>
<li>223 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/derived_laws.vo</code></li>
<li>218 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tokens.vo</code></li>
<li>212 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/ticket_lock.vo</code></li>
<li>212 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/derived_laws.glob</code></li>
<li>209 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/big_op.glob</code></li>
<li>205 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ownp.vo</code></li>
<li>204 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/plainly.vo</code></li>
<li>200 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/atomic.vo</code></li>
<li>196 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/environments.glob</code></li>
<li>193 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proph_erasure.glob</code></li>
<li>192 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lang.glob</code></li>
<li>185 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmap.glob</code></li>
<li>183 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_inv_heap.vo</code></li>
<li>181 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cofe_solver.vo</code></li>
<li>179 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/updates.vo</code></li>
<li>178 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proofmode.vo</code></li>
<li>177 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/increment.vo</code></li>
<li>174 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_adequacy.vo</code></li>
<li>172 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/counter.vo</code></li>
<li>171 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/monpred.glob</code></li>
<li>169 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/plainly.glob</code></li>
<li>165 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/metatheory.vo</code></li>
<li>163 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/auth.glob</code></li>
<li>162 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/wsat.vo</code></li>
<li>158 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/invariants.vo</code></li>
<li>157 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/ltac_tactics.v</code></li>
<li>147 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/agree.vo</code></li>
<li>146 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws_later.vo</code></li>
<li>144 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/language.vo</code></li>
<li>142 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/interface.vo</code></li>
<li>141 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/classes.vo</code></li>
<li>140 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/atomic_heap.vo</code></li>
<li>140 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/upred.glob</code></li>
<li>140 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/lifting.vo</code></li>
<li>138 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/updates.glob</code></li>
<li>134 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_later.vo</code></li>
<li>133 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proofmode.glob</code></li>
<li>130 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/namespace_map.vo</code></li>
<li>130 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/frame_instances.vo</code></li>
<li>129 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/auth.vo</code></li>
<li>129 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/list.glob</code></li>
<li>128 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws_later.glob</code></li>
<li>128 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/na_invariants.vo</code></li>
<li>127 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/proph_map.vo</code></li>
<li>127 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/own.vo</code></li>
<li>127 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_weakestpre.glob</code></li>
<li>125 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/embedding.vo</code></li>
<li>124 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/sts.vo</code></li>
<li>124 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/counterexamples.vo</code></li>
<li>123 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_later.glob</code></li>
<li>123 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/array.vo</code></li>
<li>123 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/cancelable_invariants.vo</code></li>
<li>122 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates.vo</code></li>
<li>122 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_lifting.vo</code></li>
<li>121 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/atomic.vo</code></li>
<li>119 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spin_lock.vo</code></li>
<li>116 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gset.vo</code></li>
<li>116 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/dra.vo</code></li>
<li>116 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/weakestpre.glob</code></li>
<li>116 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/excl.vo</code></li>
<li>115 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/hoare.vo</code></li>
<li>112 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_lifting.vo</code></li>
<li>111 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_language.vo</code></li>
<li>109 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/siprop.vo</code></li>
<li>107 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/local_updates.glob</code></li>
<li>107 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/internal_eq.vo</code></li>
<li>106 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spawn.vo</code></li>
<li>103 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/clairvoyant_coin.vo</code></li>
<li>103 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_embedding.vo</code></li>
<li>99 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_updates.vo</code></li>
<li>97 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/local_updates.vo</code></li>
<li>96 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lazy_coin.vo</code></li>
<li>96 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/spec_patterns.vo</code></li>
<li>96 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/frame_instances.glob</code></li>
<li>95 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/atomic.glob</code></li>
<li>93 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/numbers.vo</code></li>
<li>92 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/saved_prop.vo</code></li>
<li>92 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/tactics.vo</code></li>
<li>92 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_ectx_lifting.vo</code></li>
<li>91 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fractional.vo</code></li>
<li>91 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fixpoint.vo</code></li>
<li>89 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/embedding.glob</code></li>
<li>89 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_adequacy.glob</code></li>
<li>88 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/viewshifts.vo</code></li>
<li>88 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/agree.glob</code></li>
<li>86 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/boxes.glob</code></li>
<li>86 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/weakestpre.vo</code></li>
<li>84 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/ufrac_auth.vo</code></li>
<li>83 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/interface.glob</code></li>
<li>83 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/intro_patterns.vo</code></li>
<li>82 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/coPset.vo</code></li>
<li>82 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/laterable.vo</code></li>
<li>82 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/own.glob</code></li>
<li>81 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bupd_alt.vo</code></li>
<li>81 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/ltac_tactics.glob</code></li>
<li>81 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/updates.vo</code></li>
<li>80 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/functions.vo</code></li>
<li>80 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/vector.vo</code></li>
<li>79 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ownp.glob</code></li>
<li>79 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/frac_auth.vo</code></li>
<li>78 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/classes.glob</code></li>
<li>78 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modalities.vo</code></li>
<li>77 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/big_op.v</code></li>
<li>77 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/par.vo</code></li>
<li>77 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/relations.vo</code></li>
<li>76 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_heap.glob</code></li>
<li>76 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/base.vo</code></li>
<li>76 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectxi_language.vo</code></li>
<li>75 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/core.vo</code></li>
<li>75 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates_from_vs.vo</code></li>
<li>74 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra_big_op.vo</code></li>
<li>73 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/nondet_bool.vo</code></li>
<li>73 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmultiset.vo</code></li>
<li>72 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lock.vo</code></li>
<li>70 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/adequacy.glob</code></li>
<li>70 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cofe_solver.glob</code></li>
<li>69 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra.v</code></li>
<li>69 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/adequacy.vo</code></li>
<li>69 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/sts.glob</code></li>
<li>69 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/excl_auth.vo</code></li>
<li>68 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_plainly.vo</code></li>
<li>67 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/metatheory.glob</code></li>
<li>67 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws.v</code></li>
<li>66 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_inv_heap.glob</code></li>
<li>66 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/iprop.vo</code></li>
<li>66 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ofe.v</code></li>
<li>66 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/arith.vo</code></li>
<li>66 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bi.vo</code></li>
<li>65 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/language.glob</code></li>
<li>65 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/telescopes.vo</code></li>
<li>64 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/assert.vo</code></li>
<li>64 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/derived.vo</code></li>
<li>62 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_embedding.glob</code></li>
<li>62 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_connectives.vo</code></li>
<li>62 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/total_adequacy.vo</code></li>
<li>60 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_language.glob</code></li>
<li>59 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/csum.glob</code></li>
<li>59 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/internal_eq.glob</code></li>
<li>57 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/monoid.vo</code></li>
<li>56 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_internal_eq.vo</code></li>
<li>56 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/diverge.vo</code></li>
<li>55 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/ascii.vo</code></li>
<li>55 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/notation.vo</code></li>
<li>55 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/bi.vo</code></li>
<li>55 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/frac.vo</code></li>
<li>54 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/counterexamples.glob</code></li>
<li>54 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_updates.glob</code></li>
<li>54 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/locations.vo</code></li>
<li>53 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modality_instances.vo</code></li>
<li>53 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ufrac.vo</code></li>
<li>53 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/tactics.vo</code></li>
<li>52 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/proofmode_classes.vo</code></li>
<li>52 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/namespace_map.glob</code></li>
<li>52 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/proofmode.vo</code></li>
<li>49 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/wsat.glob</code></li>
<li>49 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/hoare.glob</code></li>
<li>49 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/weakestpre.glob</code></li>
<li>48 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_lifting.glob</code></li>
<li>48 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/invariants.glob</code></li>
<li>48 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/auth.glob</code></li>
<li>47 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/sel_patterns.vo</code></li>
<li>47 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/monpred.v</code></li>
<li>46 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/dra.glob</code></li>
<li>45 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/notation.vo</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/siprop.glob</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/updates.glob</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fractional.glob</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/reduction.vo</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/lifting.glob</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tactics.vo</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances.v</code></li>
<li>44 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/coq_tactics.v</code></li>
<li>43 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gset.glob</code></li>
<li>43 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/base_logic.vo</code></li>
<li>42 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/bi.vo</code></li>
<li>40 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/intro_patterns.glob</code></li>
<li>40 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/sts.glob</code></li>
<li>40 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/base.vo</code></li>
<li>37 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/cancelable_invariants.glob</code></li>
<li>36 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/ticket_lock.glob</code></li>
<li>36 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/counter.glob</code></li>
<li>35 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/functions.glob</code></li>
<li>34 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/environments.v</code></li>
<li>33 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/proph_map.glob</code></li>
<li>33 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/upred.v</code></li>
<li>33 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proph_erasure.v</code></li>
<li>33 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/atomic.glob</code></li>
<li>32 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lang.v</code></li>
<li>32 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bi.glob</code></li>
<li>32 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/atomic_heap.glob</code></li>
<li>32 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/ufrac_auth.glob</code></li>
<li>30 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/monpred.v</code></li>
<li>30 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fixpoint.glob</code></li>
<li>30 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/frac_auth.glob</code></li>
<li>29 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modalities.glob</code></li>
<li>29 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/na_invariants.glob</code></li>
<li>29 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/classes.v</code></li>
<li>29 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/plainly.v</code></li>
<li>28 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/big_op.v</code></li>
<li>28 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmap.v</code></li>
<li>28 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/numbers.glob</code></li>
<li>28 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/proofmode.v</code></li>
<li>27 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/saved_prop.glob</code></li>
<li>27 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/primitive_laws.v</code></li>
<li>27 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_ectx_lifting.glob</code></li>
<li>27 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/tactics.glob</code></li>
<li>26 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectxi_language.glob</code></li>
<li>25 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_lifting.glob</code></li>
<li>25 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/array.glob</code></li>
<li>25 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/viewshifts.glob</code></li>
<li>25 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_plainly.glob</code></li>
<li>24 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/increment.glob</code></li>
<li>24 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/list.v</code></li>
<li>22 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates_from_vs.glob</code></li>
<li>22 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/updates.v</code></li>
<li>22 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates.glob</code></li>
<li>22 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_laws_later.v</code></li>
<li>21 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/auth.v</code></li>
<li>21 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/atomic.v</code></li>
<li>21 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/excl.glob</code></li>
<li>20 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tokens.glob</code></li>
<li>20 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spin_lock.glob</code></li>
<li>20 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/spec_patterns.glob</code></li>
<li>19 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/sts.v</code></li>
<li>19 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/derived.glob</code></li>
<li>19 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/vector.glob</code></li>
<li>18 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/interface.v</code></li>
<li>18 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmultiset.glob</code></li>
<li>18 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/bi.glob</code></li>
<li>18 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_later.v</code></li>
<li>17 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_connectives.glob</code></li>
<li>16 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_heap.v</code></li>
<li>16 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/iprop.glob</code></li>
<li>16 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/relations.glob</code></li>
<li>16 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/coPset.glob</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/csum.v</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/telescopes.glob</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/clairvoyant_coin.glob</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/base.glob</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/frame_instances.v</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bupd_alt.glob</code></li>
<li>15 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modality_instances.glob</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/embedding.v</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spawn.glob</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/derived_laws.v</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/weakestpre.v</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/weakestpre.v</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_weakestpre.v</code></li>
<li>14 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/excl_auth.glob</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/language.v</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/own.v</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_language.v</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/boxes.v</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/namespace_map.v</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_internal_eq.glob</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/notation.vo</code></li>
<li>13 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/agree.v</code></li>
<li>12 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/laterable.glob</code></li>
<li>12 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/siprop.v</code></li>
<li>12 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lazy_coin.glob</code></li>
<li>12 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ownp.v</code></li>
<li>12 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/gen_inv_heap.v</code></li>
<li>11 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/counterexamples.v</code></li>
<li>11 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/par.glob</code></li>
<li>11 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/internal_eq.v</code></li>
<li>10 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/adequacy.v</code></li>
<li>10 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cofe_solver.v</code></li>
<li>10 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra_big_op.glob</code></li>
<li>10 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/metatheory.v</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/core.glob</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/dra.v</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_embedding.v</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/proofmode_classes.glob</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/notation.glob</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/wsat.v</code></li>
<li>9 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/auth.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modalities.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gset.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bi.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/arith.glob</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/locations.glob</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/atomic.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/tactics.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lock.glob</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/invariants.v</code></li>
<li>8 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/notation.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/notation.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_updates.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/frac.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fractional.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/functions.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/sts.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/proofmode.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/ascii.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/adequacy.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/local_updates.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/ticket_lock.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/tactics.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectxi_language.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/monoid.glob</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/proph_map.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/iprop.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/updates.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/counter.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/intro_patterns.v</code></li>
<li>7 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/numbers.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/hoare.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/ufrac_auth.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/excl.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/assert.glob</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/lifting.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/increment.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/cancelable_invariants.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ufrac.glob</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/ectx_lifting.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/si_logic/bi.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_adequacy.v</code></li>
<li>6 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/atomic_heap.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/saved_prop.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/sel_patterns.glob</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/derived_connectives.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/frac_auth.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/fixpoint.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/total_adequacy.glob</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/ascii.v</code></li>
<li>5 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/na_invariants.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/coPset.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/laterable.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spin_lock.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/bupd_alt.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_plainly.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/vector.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/derived.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tokens.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/telescopes.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/nondet_bool.glob</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/base.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/array.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/spec_patterns.v</code></li>
<li>4 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_lifting.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/viewshifts.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/gmultiset.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/program_logic/total_ectx_lifting.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/core.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/tactics.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/lib/relations.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/lib/excl_auth.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/spawn.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/lib/fancy_updates_from_vs.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/clairvoyant_coin.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/monoid.v</code></li>
<li>3 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/modality_instances.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/proofmode_classes.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/class_instances_internal_eq.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/frac.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lazy_coin.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/notation.glob</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/reduction.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/ufrac.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/notation.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/par.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/diverge.glob</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/cmra_big_op.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/arith.v</code></li>
<li>2 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/lock.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/locations.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/proofmode.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/adequacy.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/sel_patterns.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/diverge.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/assert.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/total_adequacy.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/heap_lang/lib/nondet_bool.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tactics.glob</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/base_logic.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/tactics.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/bi.glob</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/bi.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/proofmode/reduction.glob</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/base_logic/base_logic.glob</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/base.v</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/algebra/base.glob</code></li>
<li>1 K <code>../ocaml-base-compiler.4.05.0/lib/coq/user-contrib/iris/bi/notation.glob</code></li>
</ul>
<h2>Uninstall</h2>
<dl class="dl-horizontal">
<dt>Command</dt>
<dd><code>opam remove -y coq-iris.3.3.0</code></dd>
<dt>Return code</dt>
<dd>0</dd>
<dt>Missing removes</dt>
<dd>
none
</dd>
<dt>Wrong removes</dt>
<dd>
none
</dd>
</dl>
</div>
</div>
</div>
<hr/>
<div class="footer">
<p class="text-center">
<small>Sources are on <a href="https://github.com/coq-bench">GitHub</a>. © <NAME>.</small>
</p>
</div>
</div>
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script>
<script src="../../../../../bootstrap.min.js"></script>
</body>
</html>
| html |
Modern Love Chennai Web Series Leaked Online For Download: 1TamilMV leaks all the latest episodes of Modern Love Chennai for free download. The series is currently streaming on the official OTT platform Amazon Prime Video.
It is a Tamil anthology series featuring a huge star cast of Kishore, Ramya Nambeesan, Ritu Varma, Ashok Selvan, Vijayalakshmi, Gouri Reddy, TJ Banu, Samyuktha Vishwanathan, Chu Khoy Sheng, Vasudevan Murali, and Sanjula S.
The pirated version of the series making rounds on the internet. It affects the business and efforts of makers. Modern Love Chennai episodes were found on many unknown telegram groups.
It is the adaptation of Anne Hathaway’s popular international series, ‘Modern Love.’ Tyler Durden and Kino Fist have bankrolled this series. The Tamil version will be directed by a set of directors, including Bharathiraja, Balaji Sakthivel, Raju Murugan, Krishnakumar Ramakumar, and Akshay Sundher.
All the episodes of the series were released on May 18, 2023.
- Visit the Amazon Prime Video app or official website.
- Subscribe with your affordable plan.
- Search for Modern Love Chennai.
- Click on the series poster and start watching all the episodes of the anthology.
Watch the official trailer of Modern Love Chennai 2023,
| english |
<reponame>jn-prod/blog_feezify_me
---
layout: post
title: 'VIDEO: 2W Gravity Enduro 2014 ▬ Rotorua, New Zealand'
date: 2014-03-01 12:54:20.000000000 +01:00
type: post
parent_id: '0'
published: true
password: ''
status: publish
categories: []
tags:
- '2014'
- Enduro
- Events
- Non Classé
- Vidéos
meta:
_publicize_pending: '1'
restapi_import_id: 5b5830be4b294
author: nicolas
---
<p>[vimeo]http://vimeo.com/87455641[/vimeo]</p>
<p>Quatre cent cinquante pilotes se sont réunis le 22 Février pour la 2W Gravity Enduro organisé par Giant à Rotorua, Nouvelle Zeland. Un mélange classique de sentiers ridé par de spilotes de tous niveaux entre adrénaline et puissance.</p>
| html |
import { Map } from 'immutable';
import {
REQUEST_COMMENT_LIST, REQUEST_COMMENT_LIST_SUCCESS, REQUEST_COMMENT_LIST_FAIL,
SUBMIT_COMMENT, SUBMIT_COMMENT_SUCCESS, SUBMIT_COMMENT_FAIL,
DELETE_DEVOTIONAL_COMMENT, DELETE_DEVOTIONAL_COMMENT_SUCCESS, DELETE_DEVOTIONAL_COMMENT_FAIL
} from './actions.js'
export const FETCHING_STATUS = 'FETCHING';
export const SUBMITTING_STATUS = 'SUBMITTING';
export const LOADED_STATUS = 'LOADED_STATUS';
export const DELETING_STATUS = 'DELETING_STATUS';
export default function(state = Map({
status: LOADED_STATUS
}), action) {
switch (action.type) {
case REQUEST_COMMENT_LIST:
return requestCommentList(state);
case REQUEST_COMMENT_LIST_SUCCESS:
return requestCommentListSuccess(state, action.devotionalId, action.commentList);
case REQUEST_COMMENT_LIST_FAIL:
return requestCommentListFail(state);
case SUBMIT_COMMENT:
return submitComment(state, action.devotionalId, action.comment);
case SUBMIT_COMMENT_SUCCESS:
return submitCommentSuccess(state, action.devotionalId, action.comment);
case SUBMIT_COMMENT_FAIL:
return submitCommentFail(state);
case DELETE_DEVOTIONAL_COMMENT:
return submitDeleteDevotionalComment(state, action.devotionalId);
case DELETE_DEVOTIONAL_COMMENT_SUCCESS:
return submitDeleteDevotionalSuccessComment(state, action.devotionalId);
case DELETE_DEVOTIONAL_COMMENT_FAIL:
return submitDeleteDevotionalFailComment(state, action.devotionalId);
default:
return state;
}
}
function requestCommentList(state) {
return state.merge({
status: FETCHING_STATUS
});
}
function requestCommentListSuccess(state, devotionalId, commentList) {
return state.merge({
status: LOADED_STATUS,
[devotionalId]: commentList
});
}
function requestCommentListFail(state) {
return state.merge({
status: LOADED_STATUS
});
}
function submitComment(state, devotionalId, comment) {
const devotionalComments = state.get(devotionalId) || Map();
return state.merge({
status: SUBMITTING_STATUS,
[devotionalId]: devotionalComments.set(comment.id, Map(comment))
});
}
function submitCommentSuccess(state, devotionalId, comment) {
return state
.merge({
status: LOADED_STATUS
})
.deleteIn([devotionalId, '-1'])
.setIn([devotionalId, comment.id], Map(comment));
}
function submitCommentFail(state) {
return state.merge({
status: LOADED_STATUS
});
}
function submitDeleteDevotionalComment(state, devotionalId) {
return state.merge({
status: DELETING_STATUS
});
}
function submitDeleteDevotionalSuccessComment(state, devotionalId) {
return state
.delete(devotionalId)
.merge({
status: LOADED_STATUS
});
}
function submitDeleteDevotionalFailComment(state, devotionalId) {
return state.merge({
status: LOADED_STATUS
});
} | javascript |
Mangaluru: Though Mangaluru police commissioner PS Harsha imposed prohibitory orders from 9 pm on Wednesday to Friday midnight following calls for protest against the Citizenship Amendment Act (CAA), the agitation took a violent turn with protesters hurling stones at buses, cops and public property. A KSRTC bus sent on casual contract was vandalised by protesters near the district commissioner’s office in Mangaluru. The front and side window panes of the bus were damaged. However, fortunately, no one was hurt when protesters hurled stones at the bus. This incident has taken place a day after Karnataka MLA UT Khader threatened that they'd burn the state if CAA was implemented in the state. | english |
14 What follows is an account of how the land of Canaan west of the Jordan was divided among the people of Israel. Eleazar the priest, Joshua son of Nun, and the leaders of the families of the Israelite tribes divided it among the population. 2 (A)As the Lord had commanded Moses, the territories of the nine and one-half tribes west of the Jordan were determined by drawing lots.[a] 3-4 (B)Moses had already assigned the land east of the Jordan to the other two and one-half tribes. (The descendants of Joseph were divided into two tribes: Manasseh and Ephraim.) However, Moses gave the Levites no portion of the territory. Instead, they received cities to live in, with fields for their cattle and flocks. 5 The people of Israel divided the land as the Lord had commanded Moses.
13 Joshua blessed Caleb son of Jephunneh and gave him the city of Hebron as his possession. 14 Hebron still belongs to the descendants of Caleb son of Jephunneh the Kenizzite, because he faithfully obeyed the Lord, the God of Israel. 15 Before this, Hebron was called the city of Arba. (Arba had been the greatest of the Anakim.)
There was now peace in the land.
- Joshua 14:2 This was usually done by using specially marked stones to determine God's will.
14 Now these are the areas the Israelites received as an inheritance(A) in the land of Canaan, which Eleazar(B) the priest, Joshua son of Nun and the heads of the tribal clans of Israel(C) allotted(D) to them.(E) 2 Their inheritances were assigned by lot(F) to the nine and a half tribes,(G) as the Lord had commanded through Moses. 3 Moses had granted the two and a half tribes their inheritance east of the Jordan(H) but had not granted the Levites an inheritance among the rest,(I) 4 for Joseph’s descendants had become two tribes—Manasseh and Ephraim.(J) The Levites received no share of the land but only towns to live in, with pasturelands for their flocks and herds.(K) 5 So the Israelites divided the land, just as the Lord had commanded Moses.(L)
13 Then Joshua blessed(AG) Caleb son of Jephunneh(AH) and gave him Hebron(AI) as his inheritance.(AJ) 14 So Hebron has belonged to Caleb son of Jephunneh the Kenizzite ever since, because he followed the Lord, the God of Israel, wholeheartedly.(AK) 15 (Hebron used to be called Kiriath Arba(AL) after Arba,(AM) who was the greatest man among the Anakites.)
Then the land had rest(AN) from war.
Good News Translation® (Today’s English Version, Second Edition) © 1992 American Bible Society. All rights reserved. For more information about GNT, visit www.bibles.com and www.gnt.bible.
Holy Bible, New International Version®, NIV® Copyright ©1973, 1978, 1984, 2011 by Biblica, Inc.® Used by permission. All rights reserved worldwide.
NIV Reverse Interlinear Bible: English to Hebrew and English to Greek. Copyright © 2019 by Zondervan.
| english |
A total of 16 matches have been announced for WWE WrestleMania 35, with nine of those encounters set to include a title on the line.
Ronda Rousey vs. Charlotte Flair vs. Becky Lynch (Raw and SmackDown Women’s Championships) will headline the event, while Brock Lesnar vs. Seth Rollins (Universal Championship) and Daniel Bryan vs. Kofi Kingston (WWE Championship) are among the most anticipated matches of the night.
In the tag divisions, Sasha Banks & Bayley will face Beth Phoenix & Natalya, The IIconics and Nia Jax & Tamina (Women’s Tag Team Championship), Zack Ryder & Curt Hawkins will challenge The Revival (Raw Tag Team Championship), and The Usos will defend against The Bar, Rusev & Shinsuke Nakamura and Aleister Black & Ricochet (SmackDown Tag Team Championship).
Elsewhere, “Demon” Finn Balor will challenge Bobby Lashley (Intercontinental Championship) and Samoa Joe will take on Rey Mysterio (United States Championship), while Buddy Murphy vs. Tony Nese (Cruiserweight Championship) is scheduled for the kickoff show.
In this article, let’s take a look at the most probable title changes on April 7, from least likely to most likely.
#9 Sasha Banks & Bayley vs. Beth Phoenix & Natalya vs. The IIconics vs. Nia Jax & Tamina (Women’s Tag Team Championship)
Sasha Banks & Bayley outlasted five other teams to win the newly introduced Women’s Tag Team Championship at the Elimination Chamber pay-per-view in February.
Since then, they have defended the titles against Nia Jax & Tamina at Fastlane – a match which resulted in a brawl between the two teams, as well as Beth Phoenix & Natalya. The IIconics have now been added to the mix, setting up a Fatal 4-Way for the titles at WrestleMania 35.
Without trying to be too negative, it is fair to say that The Boss ‘n’ Hug Connection’s title reign has not exactly got off to the best of starts. Granted, they retained at Fastlane, but these new titles felt like a big deal when they were introduced earlier this year. Now? Not so much.
WWE titles have been changing hands more than ever over the last year, but it seems way too early for Banks & Bayley to lose when they have only had one successful defence as champions. The smart money is on them to retain.
#8 Buddy Murphy vs. Tony Nese (Cruiserweight Championship)
Buddy Murphy has been the Cruiserweight champion since defeating Cedric Alexander in his hometown of Melbourne, Australia at Super Show-Down in October 2018, while Tony Nese won a month-long tournament to become the #1 contender for his former ally’s title.
A title change in this kickoff show match cannot be completely ruled out, mostly due to the lack of babyface opponents who Murphy has left to face on 205 Live, but the Aussie is the more established Superstar out of these two, so he is the clear favourite to leave MetLife Stadium as champion.
#7 The Usos vs. The Bar vs. Rusev & Shinsuke Nakamura vs. Aleister Black & Ricochet (SmackDown Tag Team Championship)
Many people expected The Usos to face The Hardy Boyz at WrestleMania 35. However, the multiple social media teases about a match between the duos never transitioned into anything on SmackDown Live, and it has since been announced that The Bar, Rusev & Shinsuke Nakamura and Aleister Black & Ricochet will be the ones to face Jimmy & Jey at ‘Mania.
The Bar are an accomplished duo, but do they need another title reign? Not really. And when you consider that the other teams, Rusev & Nakamura and Black & Ricochet, have only recently been put together, everything points to The Usos retaining.
#6 Samoa Joe vs. Rey Mysterio (United States Championship)
The United States Championship has changed hands a staggering 18 times since WrestleMania 33, so it is difficult to predict whether Samoa Joe is simply the latest in a long line of holders or whether he is the man to finally make the title relevant again.
His opponent, Rey Mysterio, has had injury concerns ahead of Sunday’s event, so it remains to be seen if this encounter will even go ahead. If it does, Joe will enter as the favourite, not only because he is only just starting his title reign but also due to Mysterio’s injury. That said, you just never know with this flip-flop US title.
#5 Brock Lesnar vs. Seth Rollins (Universal Championship)
Two months ago, following Seth Rollins’ Royal Rumble triumph, it seemed inevitable that he would go on to “Slay the Beast”, Brock Lesnar, at WrestleMania 35. However, with three babyfaces (Rollins, Becky Lynch and Kofi Kingston) attempting to dethrone heels this Sunday, it wouldn’t be a very WWE thing to do if all three emerged with the gold.
For that reason, and because speculation is mounting again that Lesnar could sign another new WWE contract, Rollins’ title chances seem slimmer now than at any stage of the last few weeks.
#4 Ronda Rousey vs. Charlotte Flair vs. Becky Lynch (Raw and SmackDown Women’s Championships)
Like Seth Rollins’ attempt to win the Universal Championship from Brock Lesnar, Becky Lynch’s potential title victory does not seem as obvious now as it previously did. Why? Because Ronda Rousey’s heel turn – and promise to disrespect the industry that WWE fans love so much – seems to suggest that she could take on a Lesnar-esque persona where she works part-time and keeps the title(s) away from WWE television.
Lynch is still the favourite to emerge from WrestleMania as Raw and SmackDown Women’s champions, but it would not be a total shock if Rousey were to win. As for Flair… well, if she wins, WWE can expect a huge backlash from fans!
#3 The Revival vs. Zack Ryder & Curt Hawkins (Raw Tag Team Championship)
The Revival defeated Aleister Black & Ricochet to retain the Raw Tag Team Championship on Monday’s episode of Raw. It looked as though a rematch between the teams could be set up for WrestleMania, but WWE has instead decided to give Zack Ryder & Curt Hawkins a title opportunity in New Jersey, close to where they grew up.
With a home crowd behind them, the logical explanation for this match taking place (it makes ZERO sense from a storyline perspective! ) is that Ryder & Hawkins are going to get their first win back together as a duo, ending Hawkins’ 269-match losing streak in the process.
#2 Bobby Lashley vs. “Demon” Finn Balor (Intercontinental Championship)
Bobby Lashley regained the Intercontinental Championship from Finn Balor on the March 11 episode of Raw, three weeks after Lio Rush cost “The All Mighty” his title at Elimination Chamber.
With the rematch scheduled for WrestleMania 35, and with Balor set to don his “Demon” attire for the first time since he defeated Baron Corbin at SummerSlam 2018, everything here points to a victory for the Irishman’s alter-ego.
#1 Daniel Bryan vs. Kofi Kingston (WWE Championship)
Nobody has more momentum and support from fans heading into WrestleMania 35 than Kofi Kingston. The New Day member finally earned a WWE Championship opportunity against Daniel Bryan at MetLife Stadium on the March 26 episode of SmackDown Live, courtesy of Big E & Xavier Woods winning a tag team gauntlet match.
Plenty of fans are speculating that Big E & Woods might betray their fellow New Day member at ‘Mania, allowing Bryan to retain, but it seems much more likely that this ‘KofiMania’ phenomenon results in Kingston winning the WWE Championship. | english |
Picking out all the components for your dream computer is one type of fun, but picking out the best PC case for your needs is another type of fun. You get to choose how your rig will look, how it will fit in with the rest of your decor, and how easy it will be to use.
But, you can't choose just any case just because you like how it looks. There are some important considerations to take into account when choosing a PC case. Here's what you need to know when picking a PC case.
Your first and most important consideration is whether or not the computer you want to build will even fit inside the case you're getting. Generally, this process will be somewhat simple. That's because case manufacturers are targeting very specific, standardized motherboard sizes.
Computer cases will list what motherboard sizes will fit from E-ATX all the way down to Mini-ITX. In general, a case that supports a larger motherboard size will also fit a smaller motherboard, though you should double check if you don't see your motherboard size specifically listed in the case's specs. It's possible that the case will not have posts for you to screw your motherboard in if the chassis is specifically targeted toward larger motherboards.
Some CPU coolers can stand up at a considerable height from the CPU itself. If you get a narrow case, there may not be enough room for your cooler. Fortunately, case manufacturers regularly list the CPU cooler clearance in their specs, so you'll be able to find this information easily. Similarly, CPU coolers will list their height so you can compare that spec with the one listed for the case.
If you're using a liquid cooler, you'll need to make sure the case has room for your reservoir and radiator.
Just like your CPU cooler, your graphics card is going to take up extra space, except it's going to take up space in even more directions. You'll need to confirm that your case has room for the length and height of your graphics card. You'll also need to confirm that the back of the case has enough expansions slots for your graphics card. Most popular graphics cards take up two slots.
Are you sensing a theme here? The PC case you pick has to fit all of your components, or you have to pick parts that will fit in the case. Either way, you need to confirm your PSU and case will work together. In this instance, you'll need to make sure not only that there's room for your power supply, but also that it will be able to mount in the correct orientation. Some cases support only power supplies at the bottom, while others may support PSUs that mount at the top of the case.
Your power supply needs to get proper airflow to work, so be sure the case you pick is fully compatible. Some cases will simplify this step for you by included a power supply, so you'll just need to make sure the PSU has the wattage and connectors you need for your computer.
If you want a computer with a CD/DVD Drive, a Ultra HD Blu-ray drive, six 3.5-inch hard drives, and four 2.5-inch SSDs, you're going to need a very different case from someone who wants to a computer with no optical drives and strictly PCIe NVMe SSDs. PC cases will list the number of drive bays they include, and whether any of those are the type of front-panel ports you'll need for optical drives. So decide what you want, or what you may want to add in the future, and choose a case that can fit the drive you want. (Note: Some cases may appear to have more drive bays than they actually have if they can pull double duty, such as 3.5-inch drive bays that can also hold 2.5-inch drives.)
Front-panel ports can make your life a lot better, giving you easier access to plug in peripherals or external storage. So, when you choose your case, you'll want to consider what kind of ports you want to have available at the front and how many. You'll also need to make sure your motherboard provides the connections needed to actually enable those ports. You won't be able to have four USB 3.2 ports at the front of your case if your motherboard only has headers for a pair of USB 2.0 ports.
Your CPU and GPU have their own cooling, but the rest of your computer may need some cooling as well. That's where case fans come in. Many cases will come with some fans, though some won't. You'll want to decide how many fans you want, and what size fans, then check to see if the case will support them.
Another important consideration is air filtration. If you live in a dusty environment or have hairy pets, you'll likely want to find a case that has air filters. You can then put any intake fans where there are filters, and put exhaust fans where there aren't filters. A ton of dust and pet hair clogging up your computer is a great way to end up with an overheating, unreliable system.
Get the hottest deals available in your inbox plus news, reviews, opinion, analysis, deals and more from the TechRadar team.
Over the last several years, Mark has been tasked as a writer, an editor, and a manager, interacting with published content from all angles. He is intimately familiar with the editorial process from the inception of an article idea, through the iterative process, past publishing, and down the road into performance analysis.
| english |
<gh_stars>1-10
//
// Created by <NAME> on 2021-09-28.
//
#include <execution>
#include <algorithm>
#include <iostream>
#include "../../../include/nn/networks/recurrent_network.h"
RecurrentNetwork::RecurrentNetwork(float step_size,
int seed,
int no_of_input_features,
int total_targets,
int total_recurrent_features,
int connections_per_feature) {
this->mt.seed(seed);
std::uniform_int_distribution<int> neuron_number_sampler(0, no_of_input_features - 1);
std::uniform_real_distribution<float> weight_sampler(-1, 1);
std::uniform_real_distribution<float> recurrent_weight_sampler(0, 0.99);
for (int i = 0; i < no_of_input_features; i++) {
Neuron *n = new LinearNeuron(true, false);
n->neuron_age = 0;
n->drinking_age = 20000;
n->set_layer_number(0);
this->input_neurons.push_back(n);
this->all_neurons.push_back(n);
}
float step_size_val = step_size;
for (int output_neurons = 0; output_neurons < total_targets; output_neurons++) {
// Neuron *output_neuron = new SigmoidNeuron(false, true);
Neuron *output_neuron = new LinearNeuron(false, true);
output_neuron->set_layer_number(100);
this->all_neurons.push_back(output_neuron);
this->output_neurons.push_back(output_neuron);
}
for (int i = 0; i < total_recurrent_features; i++) {
// std::cout << "Recurrent feature no "<< i << std::endl;
RecurrentRelu *recurent_neuron = new RecurrentRelu(false, false);
this->recurrent_features.push_back(recurent_neuron);
this->all_neurons.push_back(dynamic_cast<Neuron *>(recurent_neuron));
Neuron *recurrent_neuron_base_class = recurent_neuron;
Synapse
*recurrent_synapse = new Synapse(recurrent_neuron_base_class,
recurrent_neuron_base_class,
recurrent_weight_sampler(this->mt),
step_size_val);
this->all_synapses.push_back(recurrent_synapse);
std::vector<int> my_vec(no_of_input_features, 0);
for (int j = 0; j < connections_per_feature; j++) {
int feature_index = -1;
while (feature_index == -1) {
int temp_index = neuron_number_sampler(this->mt);
if (my_vec[temp_index] == 0) {
my_vec[temp_index] = 1;
feature_index = temp_index;
// std::cout << "Selected incoming index "<< feature_index << std::endl;
}
}
Synapse *new_synapse = new Synapse(input_neurons[feature_index],
recurrent_neuron_base_class,
weight_sampler(this->mt),
step_size_val);
this->all_synapses.push_back(new_synapse);
}
}
this->Recurrent_neuron_layer.push_back(this->recurrent_features);
for (auto output_neuron: this->output_neurons) {
for (int i = 0; i < this->recurrent_features.size(); i++) {
Synapse *output_synapse = new Synapse(this->recurrent_features[i], output_neuron, 0, step_size_val);
this->output_synapses.push_back(output_synapse);
this->all_synapses.push_back(output_synapse);
}
}
}
RecurrentNetwork::~RecurrentNetwork() {
}
void RecurrentNetwork::forward(std::vector<float> inp) {
this->set_input_values(inp);
std::for_each(
std::execution::par_unseq,
this->input_neurons.begin(),
this->input_neurons.end(),
[&](Neuron *n) {
n->fire();
});
int counter = 0;
for (auto RecurrentNeuronList: this->Recurrent_neuron_layer) {
counter++;
// std::cout << "Updating values " << counter << "\n";
std::for_each(
std::execution::par_unseq,
RecurrentNeuronList.begin(),
RecurrentNeuronList.end(),
[&](Neuron *n) {
n->update_value();
});
// std::cout << "Firing " << counter << "\n";
std::for_each(
std::execution::par_unseq,
RecurrentNeuronList.begin(),
RecurrentNeuronList.end(),
[&](Neuron *n) {
n->fire();
});
std::for_each(
std::execution::par_unseq,
RecurrentNeuronList.begin(),
RecurrentNeuronList.end(),
[&](Neuron *n) {
n->update_utility();
});
}
// std::cout << "Updating values output \n";
std::for_each(
std::execution::par_unseq,
this->output_neurons.begin(),
this->output_neurons.end(),
[&](Neuron *n) {
n->update_value();
});
// std::cout << "Firing output \n";
std::for_each(
std::execution::par_unseq,
this->output_neurons.begin(),
this->output_neurons.end(),
[&](Neuron *n) {
n->fire();
});
}
int RecurrentNetwork::least_useful_feature() {
// std::cout << "Getting lease useful feature index\n";
float least_utility = 5000000;
int least_useful_index = -1;
int counter = 0;
int total_eligible_for_replacement = 0;
for (RecurrentRelu *neuron: this->Recurrent_neuron_layer[0]) {
//
if (neuron->is_mature()) {
// std::cout << "Found eligible neuron\n";
total_eligible_for_replacement++;
}
}
for (RecurrentRelu *neuron: this->Recurrent_neuron_layer[0]) {
if(total_eligible_for_replacement*2 < this->Recurrent_neuron_layer[0].size()) {
// std::cout << "Not enough old features\t" << total_eligible_for_replacement << " Tootal neurons "<< this->Recurrent_neuron_layer[0].size() << std::endl;
return -1;
}
if (neuron->is_mature() && neuron->get_utility() < least_utility) {
least_utility = neuron->get_utility();
least_useful_index = counter;
}
counter++;
}
return least_useful_index;
}
void RecurrentNetwork::replace_least_important_feature() {
int index = least_useful_feature();
std::cout << "Replacing feature = " << index << std::endl;
if (index == -1)
return;
replace_feature(index);
}
void RecurrentNetwork::replace_feature(int feature_no) {
// std::cout << "Replacing feature no " << feature_no << "\n";
std::uniform_int_distribution<int> neuron_number_sampler(0, this->input_neurons.size() - 1);
std::uniform_real_distribution<float> weight_sampler(-1, 1);
std::uniform_real_distribution<float> recurrent_weight_sampler(0, 0.95);
// std::cout << "Getting recurrent feature\n";
RecurrentRelu *feature = this->Recurrent_neuron_layer[0][feature_no];
std::vector<int> my_vec(this->input_neurons.size(), 0);
// std::cout << "Iterating over inputs\n";
// std::cout << "Incoming synapses size " << feature->incoming_synapses.size() << std::endl;
int total_incoming_synapses = feature->incoming_synapses.size();
for (auto synapse: feature->incoming_synapses) {
// std::cout << "In the for loop\n";
int feature_index = -1;
while (feature_index == -1) {
// std::cout << "In the while loop\n";
int temp_index = neuron_number_sampler(this->mt);
if (my_vec[temp_index] == 0) {
my_vec[temp_index] = 1;
feature_index = temp_index;
}
}
// std::cout << "Index found " << feature_index << "\n";
synapse->input_neuron = this->input_neurons[feature_index];
synapse->age = 0;
synapse->weight = weight_sampler(this->mt);
}
feature->recurrent_synapse->weight = recurrent_weight_sampler(this->mt);
feature->outgoing_synapses[0]->weight = 0;
feature->outgoing_synapses[0]->age = 0;
feature->neuron_age = 0;
// std::cout << "Feature replaced\n";
}
void RecurrentNetwork::reset_state() {
std::for_each(
std::execution::par_unseq,
this->Recurrent_neuron_layer[0].begin(),
this->Recurrent_neuron_layer[0].end(),
[&](RecurrentRelu *n) {
n->old_value= 0;
});
std::for_each(
std::execution::par_unseq,
all_synapses.begin(),
all_synapses.end(),
[&](Synapse *s) {
s->TH = 0;
});
}
void RecurrentNetwork::backward(std::vector<float> target) {
std::vector<float> error_list;
int counter = 0;
for(auto neuron: this->output_neurons){
error_list.push_back(neuron->value - target[counter]);
counter++;
}
std::for_each(
std::execution::par_unseq,
this->Recurrent_neuron_layer[0].begin(),
this->Recurrent_neuron_layer[0].end(),
[&](RecurrentRelu *n) {
n->compute_gradient_of_all_synapses(error_list);
});
std::for_each(
std::execution::par_unseq,
all_synapses.begin(),
all_synapses.end(),
[&](Synapse *s) {
s->assign_credit();
});
}
void RecurrentNetwork::update_parameters() {
std::for_each(
std::execution::par_unseq,
all_synapses.begin(),
all_synapses.end(),
[&](Synapse *s) {
s->update_weight();
});
}
| cpp |
#![crate_type = "dylib"]
// compile with: rustc add.rs
#[no_mangle]
pub extern "C" fn add(a:i32, b:i32) -> i32 {
a+b
}
| rust |
The remains of what could be the largest dinosaur ever found in Europe have been uncovered in man's back garden in Portugal.
According to BBC, the skeleton was discovered in the central city of Pombal in 2017, when a man began building work on his house and noticed fragments of fossilised bone. Spanish and Portuguese palaeontologists then excavated the dinosaur in August this year. They believe that the fossilised skeleton is of a sauropod, which were herbivorous, four-legged creatures who had long necks and tails.
Sauropods were the biggest of all dinosaurs and the largest land animals ever to have lived. Experts informed that they lived during the Upper Jurassic period which was around 150 million years ago.
Palaeontologists unearthed parts of the spine and ribs of the dinosaur which suggest that the huge reptile was about 12 meters (39 feet) tall and 25 meters (82 feet) long.
Elisabete Malafaia, post-doctoral researcher at the Faculty of Sciences of the University of Lisbon, told Phys. org, "It is not usual to find all the ribs of an animal like this, let alone in this position, maintaining their original anatomical position. "
"This mode of preservation is relatively uncommon in the fossil record of dinosaurs, in particular sauropods, from the Portuguese Upper Jurassic," she added.
Because of the natural position that the skeleton was found in, researchers working on the dig are hopeful that there is more of it they are yet to unearth.
The skeleton is now being studied by an international research team.
Meanwhile, this comes after researchers in the United States found dinosaur footprints from 113 million years ago. After a drought in Texas dried up a river flowing through Dinosaur Valley State Park, tracks from the giant reptiles were exposed. | english |
{
"directions": [
"Flatten cranberries between fingers and spread them onto a sheet of waxed paper to dry until they start to curl slightly, about 1 hour.",
"Put cranberries into a bowl labeled 'Dried Bloody Scabs' and watch the kids scoop them up by the handful!"
],
"ingredients": [
"1 (6 ounce) package dried cranberries"
],
"language": "en-US",
"source": "allrecipes.com",
"tags": [],
"title": "Dried Bloody Scabs (Halloween Craisin\u00ae Appetizer)",
"url": "http://allrecipes.com/recipe/229159/dried-bloody-scabs-halloween-craisin/"
}
| json |
package com.ubayKyu.accountingSystem.repository;
import java.time.LocalDate;
import java.util.List;
import java.util.Map;
import javax.transaction.Transactional;
import org.springframework.data.domain.Page;
import org.springframework.data.domain.Pageable;
import org.springframework.data.domain.Sort;
import org.springframework.data.jpa.repository.JpaRepository;
import org.springframework.data.jpa.repository.Modifying;
import org.springframework.data.jpa.repository.Query;
import org.springframework.data.repository.query.Param;
import com.ubayKyu.accountingSystem.entity.CategoryInfo;
import com.ubayKyu.accountingSystem.entity.UserInfo;
public interface CategoryRepository extends JpaRepository<CategoryInfo, Integer> {
@Query(value = "SELECT CategoryID, Category.UserID, Category.CreateDate, Category.CategoryName, Category.Body ,COUNT(Accounting.CategoryName) as Count"
+ " FROM AccountingNote.dbo.Category"
+ " LEFT JOIN AccountingNote.dbo.Accounting"
+ " ON Category.CategoryName = Accounting.CategoryName AND Category.UserID = Accounting.UserID"
+ " WHERE Category.UserID = ?1"
+ " GROUP BY CategoryID,Category.UserID,Category.CreateDate, Category.CategoryName, Category.Body ORDER BY Category.CreateDate DESC"
,countQuery = "SELECT count(*) FROM AccountingNote.dbo.Category WHERE Category.UserID = ?1"
,nativeQuery = true)
public Page<Map<String,Object>> category(@Param("UserID")String userID, Pageable pageable);
@Query(value = "SELECT COUNT(Accounting.CategoryName) as Count"
+ " FROM AccountingNote.dbo.Category"
+ " LEFT JOIN AccountingNote.dbo.Accounting"
+ " ON Category.CategoryName = Accounting.CategoryName AND Category.UserID = Accounting.UserID"
+ " WHERE CategoryID = ?1", nativeQuery = true)
public Long categoryCount(int id);
@Query(value = "SELECT CATEGORYNAME FROM CATEGORY WHERE USERID = ?1", nativeQuery = true)
public List<String> ListOfcategoryName(String userID);
@Modifying
@Transactional
@Query(value = "DELETE FROM CATEGORY WHERE USERID = ?1", nativeQuery = true)
public void deleteUser(String userID);
}
| java |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.