text
stringlengths 1
1.04M
| language
stringclasses 25
values |
|---|---|
<gh_stars>10-100
{
"$alias": "zh,zh-hans,chinese-simplified",
"SFN - Focus on distributed service": "SFN - 专注于分布式服务",
"Home": "主页",
"Documentation": "文档",
"Source Code": "源代码",
"Change Language": "English (US)",
"Another Language": "en-US",
"An easy and elegant distributed service framework for Node.js": "一个简洁优雅的 Node.js 分布式服务框架。",
"Easy and Elegant": "简洁优雅",
"Distributed Design": "分布式设计",
"Hot Reloading Modules": "热重载模块",
"Elegant Description": "SFN 提供了一套简洁和优雅的 API，你可以使用它们来快速搭建富有表现力的应用。只需要专注于你的逻辑和设计，然后框架就能帮你处理剩下的所有事务。",
"Distributed Description": "SFN 支持自动扩容与服务发现，它允许你在单机上开发，然后随时随地将服务分离出去，系统会自动重定向网络流量，无需进行任何修改即可实现分布式部署。",
"Hot Reloading Description": "SFN 所提供的模块加载方案，能够使你在修改程序文件之后，无需重启进程即可立即热重载模块和功能。在分布式部署时，重启远程服务也不会影响应用的运行。",
"The page you are requested doesn't exist, please check the URL and try again.": "你所访问的页面不存在，请检查 URL 地址并再次尝试。",
"The page you are requested is not available currently, please try again later.": "你所访问的页面暂时不可用，请稍后再次尝试。"
}
|
json
|
<gh_stars>0
package at.kurumi.commands.user;
import at.kurumi.commands.Command;
import at.kurumi.commands.CommandUtil;
import at.kurumi.commands.user.sub.DeleteCommand;
import at.kurumi.commands.user.sub.NicknameCommand;
import at.kurumi.commands.user.sub.ShowCommand;
import discord4j.core.event.domain.interaction.ChatInputInteractionEvent;
import discord4j.discordjson.json.ApplicationCommandOptionData;
import jakarta.annotation.PostConstruct;
import jakarta.ejb.Stateless;
import jakarta.inject.Inject;
import reactor.core.publisher.Mono;
import java.util.ArrayList;
import java.util.Collections;
import java.util.List;
@Stateless
public class UserCommand extends Command {
private final List<Command> operations = new ArrayList<>();
@Inject private DeleteCommand deleteCommand;
@Inject private NicknameCommand nicknameCommand;
@Inject private ShowCommand showCommand;
@PostConstruct
public void init() {
operations.add(deleteCommand);
operations.add(nicknameCommand);
operations.add(showCommand);
}
@Override
public String getName() {
return "profile";
}
@Override
public String getDescription() {
return "Manage your user profile";
}
@Override
public List<ApplicationCommandOptionData> getOptions() {
return Collections.singletonList(OPERATION_OPTION_DATA);
}
@Override
public Mono<Void> handle(ChatInputInteractionEvent e) {
return super.throughOperation(e, operations, CommandUtil.getRequiredParameterAsString(e, PARAM_OPERATION));
}
}
|
java
|
LONDON -- Doctors have identified a virus as the cause of a mysterious pneumonia strain that has killed 14 people and sparked a global health warning.
The race to learn how to defeat the virus begins even as three more deaths were recorded by Wednesday in Hong Kong and Vietnam, while confirmed and suspected cases appeared in France, Belgium and Finland.
Doctors in Hong Kong made a critical breakthrough on Wednesday when they identified the virus as the cause behind the illness known as severe acute respiratory syndrome, or SARS.
"From the shape of the virus, it belongs to the Paramyxoviridae family," said microbiology professor John Tam, one of the scientists who made the discovery.
The Paramyxoviridae family includes viruses that cause a number of different diseases in humans, including measles. They often also cause respiratory illnesses.
Experts at the World Health Organization said the pneumonia, which has spread to Europe, North America and Australia by air travel, seems to be contained outside Asia. WHO issued its first global health alert in a decade on Saturday.
"The outbreak, we feel, is on its way to containment, at least outside of Vietnam and Hong Kong, and China if it is linked," David Heymann, WHO head of communicable diseases, told a news conference in Geneva.
Scientists around the world had been working flat out to identify the cause of the illness. The longer it took, the more they suspected they were dealing with a new microbe.
The mysterious pneumonia has killed five people in Hong Kong, two in Vietnam and two in Canada. WHO experts think the same illness was responsible for five deaths in mainland China.
Scientists from the WHO are expected to arrive in China soon and will work with the Chinese authorities to determine if an outbreak of pneumonia in the southern province of Guangdong last November that left more than 300 people ill is related.
China said on Wednesday the outbreak had been brought under effective control and the pneumonia patients had recovered.
Most cases have been concentrated in Hong Kong, which has more than 120 people ill; Singapore, with 23 cases; and Vietnam, where nearly 60 are affected, including an American schoolboy who was not known to have been exposed to anyone else infected.
New cases had been discovered in two more hospitals in Hong Kong, which sparked fear that it was slowly spreading into the community of nearly 7 million people.
The majority of those infected have been medical staff at hospitals or relatives of people who have fallen ill. The illness begins with a high fever and dry cough that can lead to breathing difficulties and require the use of a respirator.
Confirmed or suspected cases have also been reported in Germany, Britain, Romania, Australia, Brunei, Spain and the United States.
Knowing what they are up against should allow scientists to develop strategies to control the illness and, with further studies, to develop a vaccine.
"It is a critical breakthrough. What they now want to do is look at its genome (all of its genes), and from that they can start to work on vaccine and control strategies," Dr. Edward Holmes, an expert on virological evolution at the University of Oxford in England, told Reuters.
"We know it is a virus. That is the most important thing. It takes us forward, but there is more work to be done."
|
english
|
<reponame>sfbrigade/sf-admin-code<filename>sections/10.80-1.json
{"text":"\n (a) Establishment. A Treasury Oversight Committee for the City and County of San Francisco (referred to hereafter in this Chapter as \"Committee\") is hereby established as an advisory body to the Treasurer. The Committee shall consist of five members. The members of the Committee shall be nominated by the Treasurer and confirmed by and serve at the pleasure of the Board of Supervisors. \n (b) Purpose. The Committee is established to involve depositors of funds into the City and County Treasury in reviewing the policies for investment of surplus funds that guide the management of their funds and to enhance the security and investment return on those funds by providing a more stable and predictable balance for investment by establishing criteria for the withdrawal of funds. \n(Added by Ord. 316-00, File No. 001911, App. 12/28/2000)\n\n","heading":{"title":"10","chaptersection":"80-1","identifier":"10.80-1","catch_text":"ESTABLISHMENT AND PURPOSE – TREASURY OVERSIGHT COMMITTEE."}}
|
json
|
package com.telRan.tests.tests;
import org.testng.Assert;
import org.testng.annotations.BeforeMethod;
import org.testng.annotations.Test;
public class LoginTrelloTests extends TestBase {
@BeforeMethod
public void ensurePrecondition(){
if(app.header().isAvatarPresent()){
app.header().logout();
}
}
@Test
public void testLoginPositiveTest() throws InterruptedException {
app.session().login("<EMAIL>", "A123123a_");
Assert.assertTrue(app.header().isAvatarPresent());
}
@Test
public void negativeTestLoginPositiveTest() throws InterruptedException {
app.session().login("<EMAIL>", "A123123a");
Assert.assertTrue(app.session().isLoginErrorPresent());
Assert.assertFalse(app.header().isAvatarPresent());
}
}
|
java
|
{"id": 13459, "name": "Ensouled scorpion head", "qualified_name": "Ensouled scorpion head (Item)", "examine": "The creature's soul is still in here. I could reanimate it with Basic Reanimation.", "members": true, "release_date": "2016-01-07", "quest": false, "weight": 0.453, "value": 247, "alchemy": {"high": 148, "low": 98}, "tradeable": true, "stackable": false, "noteable": false, "equipable": false, "tradeable_ge": false, "icon": "<KEY> "wiki_url": "https://oldschool.runescape.wiki/w/Ensouled_scorpion_head#Item"}
|
json
|
India has just started to embrace the electric vehicle revolution, but with heavy vehicle costs and inaccessible charging infrastructures, the shift is not as easy. However, today researchers have discovered reserves of lithium in Mandya -- around 100 kilometres from Bengaluru.
In case you didn’t know, lithium is crucial for the development of batteries that power not just electric cars but also our smartphones. Researchers at the Atomic Minerals Directorate, a unit of India’s Atomic Energy Commission have estimated lithium reserves of 14,100 tonnes in the aforementioned location in the state of Karnataka.
In case you were wondering this is a lot (which it surely is), it is a handful compared to other countries that are currently quenching the thirst for lithium-ion batteries in the world. According to Munichandraiah, “If one compares with 8. 6 million tonnes in Chile, 2. 8 million tonnes in Australia, 1. 7 tonnes in Argentina or 60,000 tonnes in Portugal, 14,000 tonnes isn’t that large. "
As of now, all of India’s lithium needs are relying on these countries. Moreover, its imports have actually tripled to $1. 2 billion during 2019 all the way from $384 million in 2017.
According to data shared by Science and Technology Harsh Vardhan in the parliament, until November 2019, India had imported around $929 million of lithium.
Indian Authorities still haven’t set up a comprehensive plan to map local reserves of lithium. India authorities have also set up Khanij Bidesh India Ltd to source and acquire mines in Argentina, Bolivia and Chile.
While it won’t be able to fully quench the global thirst for lithium, the discovery in Mandya could surely help India bring the prices down for electric vehicles, smartphones and other devices that are powered using lithium-ion batteries and are being made in India.
|
english
|
{"PREVALENCE_BY_GENDER_AGE_YEAR":{"TRELLIS_NAME":["20-29","30-39"],"SERIES_NAME":["FEMALE","FEMALE"],"X_CALENDAR_YEAR":[2014,2015],"Y_PREVALENCE_1000PP":[0.02884,0.02014]},"PREVALENCE_BY_MONTH":{"X_CALENDAR_MONTH":201502,"Y_PREVALENCE_1000PP":0.00125},"LENGTH_OF_ERA":{"CATEGORY":"Length of era","MIN_VALUE":1,"P10_VALUE":1,"P25_VALUE":1,"MEDIAN_VALUE":1,"P75_VALUE":1,"P90_VALUE":1,"MAX_VALUE":1},"AGE_AT_FIRST_DIAGNOSIS":{"CATEGORY":"FEMALE","MIN_VALUE":22,"P10_VALUE":26,"P25_VALUE":30,"MEDIAN_VALUE":36,"P75_VALUE":52,"P90_VALUE":60,"MAX_VALUE":81}}
|
json
|
Rio Ferdinand has claimed that Sir Alex Ferguson's Manchester United would have beaten Pep Guardiola's current Manchester City team. He believes the Cityzens would have given them a fight, but lost 3-1 in the end.
Manchester City are set for another Premier League title, and pundits have been calling them the best side ever in the league's history. However, those connected with Manchester United consistently disagree.
Ferdinand was on BT Sport on Thursday night when he claimed that matches against the current Man City would have been tough. However, he believes they would have won and said via Daily Mail:
"Tough. It would be tough games. Pep's teams are hard to play against, I mean, we were annihilated by his Barcelona team. So this team with the weapons they have, with Haaland and De Bruyne connecting it would be a difficult one but I think we'd win 3-1. "
Speaking about Haaland, Ferdinand joked that he would have pocketed him and added:
"He would be in there somewhere. We would have to fight and go toe-to-toe with them. They're a great team and you cannot deny that. "
Rio Ferdinand has backed Manchester City to go past Real Madrid in the UEFA Champions League and win the treble this season. He believes that Pep Guardiola's side can beat all teams and said:
"Manchester City could win every game they have coming up, and they have shown that with the amount of points they have accumulated in the last two seasons. You would be stupid to doubt City's chances of winning the treble, a feat that only Manchester United has achieved in England. "
He added:
"Haaland's impact [will be the difference]. He is a phenomenal player, a goalscoring machine. He has shown that he can do it at the highest level, and he has a hunger and a desire to win trophies. He is a perfect fit for City. "
City will be away at Real Madrid in the first leg on May 9th, and then host the Spanish side on the 17th at the Etihad.
|
english
|
In 1995, Surrey epitomised all that was wrong with English cricket. They had plenty of talent but were habitual under-achievers whose glory days were receding into the distance: after winning the Championship seven seasons in a row in the 1950s, they had won it only once more, and that was back in 1971. The team was poorly run and visibly divided - literally so, with a separate dressing-room for capped players. In July 1995, Surrey hit rock bottom, tumbling to 18th place in the table.
It was a custom at The Oval not to appoint an official vice-captain, even though the then captain, Alec Stewart, was an automatic choice for England. That July, the task of standing in for Stewart was handed to a 23-year-old allrounder, Adam Hollioake. Stewart was the ultimate Surrey insider, son of Micky, who had led the team to the 1971 Championship and later became manager. Hollioake, raised in Australia until he was 12, was much more of an outsider, as was the new coach, the former Australian seamer David Gilbert.
Hollioake's approach was refreshingly positive and results improved almost instantly: Surrey won three first-class games and hauled themselves to 12th in the Championship and ninth in the Sunday League (divisions, in those days, existed only in dressing-rooms). But there was still deep disquiet. A special general meeting was called by disaffected members in October: the incoming chairman, Mike Soper, was "staggered" by the depth of feeling. In December, the chief executive, Glyn Woodman, resigned, to be replaced by Paul Sheldon. "Surrey," said Wisden in 1996, "are nothing if not consistent in their inability to win something."
Stewart remained in place but Hollioake, now officially vice-captain, played a larger role. In 1996, he led the team to four Championship victories as Surrey climbed to third, and they confounded Wisden and other observers by winning the Sunday League. In 1997, Hollioake was appointed captain and Surrey won the Benson and Hedges Cup. In 1999, finally, they won the Championship. Unlike 1971, this was not an isolated triumph: they retained the title in 2000, won the B&H again in 2001, and the Championship for the third time in four years in 2002. They had become the most successful team in the country.
If Hollioake changed one thing, it was to defenestrate the tired thinking prevailing in most county dressing-rooms. "It was the blame culture," he reflects. "Captains and managers pointing the finger for not winning. People covering their tracks. We would not be like that. We'd do everything to win but there'd be no aimless stuff. No five-hour fielding practice for the sake of it. If we were fielding well, we wouldn't bother. We asked ourselves what we needed to do to win and suggestions could come from anyone. No one questioned another's desire to win. Democracy's hard to get in county cricket. It comes through trust. If we have to sit around in pink underwear for half an hour beforehand, we will."
The collective realisation of what was required brought with it a need for collective maturity. Martin Bicknell, Alistair Brown, Mark Butcher and Graham Thorpe were all aged 24 to 28 when Hollioake's reign began; they have grown wiser together. Hollioake was helped by his outsider's perspective, by two key confidants - his father, John, and Alec Stewart, who could have been old-laggish but went along with the new broom. Both had experience of Australian grade cricket and espoused its virtues. "I grew up with the Australian view," Adam says. "The main thing was to win, not how. I have carried that with me."
ADAM JOHN HOLLIOAKE was born in Melbourne on September 5, 1971, into a family with roots going back five generations in the old gold-mining city of Ballarat. Helpfully, there was a cricketing seam. Adam's great-uncle Rex played against Len Hutton's touring MCC side in 1955 and his father, a talented player but better coach, represented Ballarat and Fitzroy. Adam's mother, Daria, is half Australian, half Indonesian.
At first, he was not that fussed about cricket. Like many boys in Victoria, he preferred Australian Rules football, which was the main sport at St Patrick's College in Ballarat, and even when his father's work as an engineer took the family across the world to Weybridge in 1983, he found rugby union more appealing. He first considered taking up cricket full-time when Surrey offered him a contract in 1991. He saw cricket as a way to get out of going to Durham University.
As Surrey's interest indicated, his ability with bat and ball had by now made itself apparent. He was a useful performer, good enough to have trials for England Under-15s. "A quite fast bowler, No. 11 bat and a bit rough, but Surrey thought there was something they could mould," is how he put it, looking back. "There were better players," he added. By the time of his first Championship appearance, against Derbyshire at Ilkeston in August 1993, he was considered good enough to bat at No. 7. A second-innings 123 from 178 balls suggested that was a conservative estimate. In 1994, his first full season, his haul was 722 first-class runs and 26 wickets. The following year he collected 1,099 runs, 21 wickets and a county cap. In 1996 he went up another level with 1522 runs at 66 and five hundreds. But his aggressive batting and inventive medium-pace allsorts were among the few bright spots for a county embroiled in special meetings, management reviews and accusations of undemocratic administration.
Hollioake was not the most obvious choice to share the captaincy with Stewart. "At 21, I would have been the last person to captain a side," he says now. "I led a pretty wild lifestyle and was fairly anti-establishment. I've never been keen on the job, it's not something I've ever had a desire to do and I have no fear of losing it. I've wanted to be the best allrounder in Surrey and England but never the best captain. I've tried to hand it in half-a-dozen times, thinking maybe someone else should do it, but have been talked out of it."
Whatever Hollioake's views, Surrey's opinion was shared by England, who asked him to lead the A team to his native Australia in 1996-97. The tour was an outstanding success. England had brought him into the one-day international side in August 1996 and he marked two appearances against Pakistan with four wickets in each. More glory followed against Australia early in 1997, this time with the bat: he scored 66, 53 and 4, all unbeaten, and hit the winning run in each game. His 19-year-old brother and Surrey team-mate, Ben, made a princely entrance in the third game, at Lord's; Adam was man of the series. For a heady, overheated month or two, the Hollioakes were all over the media as the bright new faces of English cricket.
The Ashes series began without them and England amazed themselves by taking the lead before Australia fought back to go 2-1 up with two to play. England's last throw of the dice was to send for both Hollioakes - the first brothers to play in the same England Test team in 40 years. Adam fought gamely in their debut match at Trent Bridge, making a composed 45 and adding a hundred with Thorpe, but the sight of him misreading Shane Warne made a more lasting impression, and his front-foot technique struggled to adjust to Test cricket. Retained, unlike Ben, for the winter Test tour of the West Indies, he was soon cast into the cold, like so many England cricketers of the 1990s, without playing a full series.
In one-day cricket, he did get a decent run. When Mike Atherton opted out of a four-team tournament in Sharjah at the end of 1997, Hollioake was the adventurous, if logical, choice to captain the side. A revamped team strong on allrounders and enthusiasm surprised India, Pakistan and West Indies (twice) and walked off with England's first tournament success for ten years. Pakistan's defeat later earned a reference in Justice Malik Qayyum's inquiry into match-fixing and Hollioake, who was himself approached for information, admits the triumph became tainted. But Matthew Fleming, who was in that squad and knew something about leadership from the Army, declared him "a natural leader".
When Atherton resigned at the end of another lost Test series in the West Indies, Hollioake kept the one-day job but soon found that harder too. He dislocated his shoulder, his form crumbled and six games were lost in succession. Within a few months the idea of having two captains was abandoned and the one-day captaincy devolved on Stewart, Atherton's successor as Test captain. Fleming felt the decision meant that "England lost the 1999 World Cup before it started".
Hollioake remained a one-day regular until the premature end of that World Cup campaign, but he was destined for the wilderness. "My game deteriorated," he said. "I stopped playing my shots. After a few low scores, I started thinking it would be best to work the ball around and that is not the way I play." The novelty of his bowling had worn off too, and the shoulder injury stopped him hurling himself into his delivery.
The self-doubt carried over into county cricket. While his captaincy work finally bore fruit in four-day cricket in 1999 and 2000 with Surrey's first Championship titles since the year of his birth, his batting average fell and bowling average rose for three successive seasons from 1998.
Liberation arrived last year by the most painful means imaginable. The death of Ben, in a car crash on the way home from a family reunion in Perth, forced Adam to reappraise his life. He stayed in Australia for the birth of his first child, Bennaya, and did not rejoin Surrey until two months into the English season, keeping in touch with the team's fortunes by phone and the internet. After some discussion, it was decided he should resume as captain - in another sign of a well-run club, both Mark Butcher and Ian Ward had led capably in his absence - and he immediately showed the old sureness of touch. But more practical skills felt different. When he picked up a bat for the first time in weeks, it felt like an axe.
He was soon wielding it like one as his batting assumed greater assurance than ever. In his Championship comeback against Somerset he struck 87 off 83 balls and he followed up with two brisk fifties against Warwickshire. Then, in the space of a few days, he hit 117 in 59 balls in a one-day quarter-final at Hove and a counter-attacking Championship century - his first for three years - at Canterbury. "That wasn't me," he observed. "I can't bat that well."
With the title in the bag, he rounded off the season with a maiden double-hundred against Leicestershire. The death of the placid Ben had taught his more aggressive brother to relax. "It made me get a perspective back on life as a whole," he said. "My job was important and I had pride in it but I realised that happiness was more important. I enjoyed hitting the ball into the crowd but to hit sixes you need to take risks. I had no fear of failure."
The year ended with Hollioake, now 31, called back to Australia as cover for England's one-day squad. He made it on to the field only once, in a warm-up game against a Bradman XI at Bowral, but took his chance with a hard-hit 53 off 38 balls. Although he could not push his way past Ronnie Irani into the World Cup squad, his name was bandied about as soon as Nasser Hussain handed in the one-day captaincy. The Hollioake story is not yet run.
Simon Wilde is cricket correspondent of The Sunday Times.
|
english
|
|Institution has the mechanism for well planned curriculum delivery and documentation through classwise timetable.
Departmental academic calender that include schedule of CIE.
Part of syllabus showing project work field work etc.
|
english
|
#!/usr/bin/env python
# iGoBot - a GO game playing robot
#
# ##############################
# # GO stone board coordinates #
# ##############################
#
# Project website: http://www.springwald.de/hi/igobot
#
# Licensed under MIT License (MIT)
#
# Copyright (c) 2018 <NAME> | <EMAIL>
#
# Permission is hereby granted, free of charge, to any person obtaining
# a copy of this software and associated documentation files (the
# "Software"), to deal in the Software without restriction, including
# without limitation the rights to use, copy, modify, merge, publish,
# distribute, sublicense, and/or sell copies of the Software, and to permit
# persons to whom the Software is furnished to do so, subject to
# the following conditions:
#
# The above copyright notice and this permission notice shall be
# included in all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS
# OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL
# THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
# FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
# DEALINGS IN THE SOFTWARE.
class Board():
_released = False
Empty = 0;
Black = 1;
White = 2;
_boardSize = 0; # 9, 13, 19
_fields = [];
# Stepper motor positions
_13x13_xMin = 735;
_13x13_xMax = 3350;
_13x13_yMin = 100;
_13x13_yMax = 2890;
_9x9_xMin = 1120;
_9x9_xMax = 2940;
_9x9_yMin = 560;
_9x9_yMax = 2400;
StepperMinX = 0;
StepperMaxX = 0;
StepperMinY = 0;
StepperMaxY = 0;
def __init__(self, boardSize):
self._boardSize = boardSize;
if (boardSize == 13):
#print("Board: size " , boardSize, "x", boardSize);
self.StepperMinX = self._13x13_xMin;
self.StepperMaxX = self._13x13_xMax
self.StepperMinY = self._13x13_yMin;
self.StepperMaxY = self._13x13_yMax;
else:
if (boardSize == 9):
#print("Board: size " , boardSize, "x", boardSize);
self.StepperMinX = self._9x9_xMin;
self.StepperMaxX = self._9x9_xMax
self.StepperMinY = self._9x9_yMin;
self.StepperMaxY = self._9x9_yMax;
else:
throw ("unknown board size " , boardSize, "x", boardSize);
# init board dimensions with 0 values (0=empty, 1=black, 2= white)
self._fields = [[0 for i in range(boardSize)] for j in range(boardSize)]
@staticmethod
def FromStones(boardSize, blackStones, whiteStones):
# create a new board and fill it with the given black and white stones
board = Board(boardSize)
if (blackStones != None and len(blackStones) > 0 and blackStones[0] != ''):
for black in Board.EnsureXyNotation(blackStones):
board.SetField(black[0],black[1],Board.Black);
if (whiteStones != None and len(whiteStones) > 0 and whiteStones[0] != ''):
for white in Board.EnsureXyNotation(whiteStones):
board.SetField(white[0],white[1],Board.White);
return board;
@staticmethod
def Differences(board1, board2):
# find all coordinates, where the second board is other
if (board1 == None): throw ("board1 == None");
if (board2 == None): throw ("board2 == None");
if (board1._boardSize != board2._boardSize): throw ("different board sizes: " , board1._boardSize, " vs. ", board2._boardSize);
result = [];
for x in range(0, board1._boardSize):
for y in range(0, board1._boardSize):
if (board1.GetField(x,y) != board2.GetField(x,y)):
result.extend([[x,y]])
return result;
def RemovedStones(board1, board2):
# find all coordinates, where the stones from board1 are not on board2
if (board1 == None): throw ("board1 == None");
if (board2 == None): throw ("board2 == None");
if (board1._boardSize != board2._boardSize): throw ("different board sizes: " , board1._boardSize, " vs. ", board2._boardSize);
result = [];
for x in range(0, board1._boardSize):
for y in range(0, board1._boardSize):
if (board1.GetField(x,y) != Board.Empty):
if (board2.GetField(x,y) == Board.Empty):
result.extend([[x,y]])
return result;
@staticmethod
def EnsureXyNotation(stones):
#ensures that this is a list of [[x,y],[x,y]] and not like ["A1","G2]
result = [];
for stone in stones:
#print(">>>1>>>", stone);
if (isinstance(stone, str) and stone !=''):
#print(">>>2>>>", Board.AzToXy(stone));
result.extend([Board.AzToXy(stone)])
else:
#print(">>>3>>>", stones);
return stones; # already [x,y] format
return result;
@staticmethod
def XyToAz(x,y):
# converts x=1,y=2 to A1
if (x > 7):
x=x+1; # i is not defined, jump to j
return chr(65+x)+str(y+1);
@staticmethod
def AzToXy(azNotation):
# converts A1 to [0,0]
if (len(azNotation) != 2 and len(azNotation) != 3):
print ("board.AzToXy for '" + azNotation + "' is not exact 2-3 chars long");
return None;
x = ord(azNotation[0])-65;
if (x > 7):
x=x-1; # i is not defined, jump to h
y = int(azNotation[1:])-1;
return [x,y]
def Print(self):
# draw the board to console
for y in range(0, self._boardSize):
line = "";
for x in range(0, self._boardSize):
stone = self.GetField(x,y);
if (stone==0):
line = line + "."
elif (stone==Board.Black):
line = line + "*";
elif (stone==Board.White):
line = line + "O";
print(line);
def GetField(self,x,y):
return self._fields[x][y];
def SetField(self,x,y, value):
self._fields[x][y] = value;
def GetNewStones(self, detectedStones, color=Black):
# what are the new black/whites stones in the list, not still on the board?
newStones = [];
for stone in detectedStones:
if (self.GetField(stone[0],stone[1]) != color):
newStones.extend([[stone[0],stone[1]]])
return newStones;
def GetStepperXPos(self, fieldX):
return self.StepperMinX + int(fieldX * 1.0 * ((self.StepperMaxX-self.StepperMinX) / (self._boardSize-1.0)));
def GetStepperYPos(self, fieldY):
return self.StepperMinY + int(fieldY * 1.0 * ((self.StepperMaxY-self.StepperMinY) / (self._boardSize-1.0)));
if __name__ == '__main__':
board = Board(13)
print (board._fields)
print (Board.AzToXy("A1"))
board.SetField(0,0,board.Black);
board.SetField(12,12,board.Black);
print(board.GetField(0,0));
print(board.GetField(0,0) == board.Black);
for x in range(0,13):
f = board.XyToAz(x,x);
print([x,x],f, Board.AzToXy(f));
board2 = Board.FromStones(boardSize=13, blackStones=[[0,0],[1,1]], whiteStones=[[2,0],[2,1]]);
board2.Print();
print(Board.Differences(board,board2));
print(Board.RemovedStones(board,board2));
|
python
|
TEHRAN (Tasnim) – Iran lost to Turkmenistan 2-1 in the 2023 CAFA Futsal Cup on Sunday.
The tournament is being held in Dushanbe, Tajikistan from July 23 to 30.
Six teams, namely Tajikistan, Iran, Uzbekistan, Kyrgyzstan, Afghanistan and Turkmenistan are competing in the tournament.
Iran will meet Kyrgyzstan on Monday.
The competition is a round-robin system in one round, where each team will play with all the other five.
The winning team will be determined by the number of points scored.
|
english
|
Scott Styris has pointed out that KL Rahul is an invaluable asset for the Indian team and has therefore been picked ahead of Ishan Kishan in their squad for the Asia Cup 2022.
The Indian selectors picked a 15-member squad for the continental tournament to be played in the UAE from August 27. Rohit Sharma and Rahul are the two specialist openers chosen for the event.
During an interaction on the Sports 18 show 'Sports Over the Top', Styris was asked why Ishan had been left out and Rahul had just swooped his way in. He replied:
"It's a good question. KL Rahul is a simple decision. Probably of all the possible match-ups that we will discuss, I think this was the easiest one. You have seen how valuable he is to the Indian team, to the management and the selectors. "
Styris added that the Karnataka opener being named vice-captain shows his worth to the Indian side. The former New Zealand all-rounder elaborated:
"He has been given the vice-captaincy as well, so that says that he was always the frontline player in this Indian side. It's great for India that KL Rahul is back because he is a genuine match-winner on the biggest stage. "
Styris, however, acknowledged that Ishan was unfortunate to miss out on selection. He reasoned:
"I guess it's unlucky for Ishan Kishan, he has got that left-handed ability which I think they would have loved to have got into the squad if they possibly could have because it is a very right-handed dominant side until you get to someone like a Rishabh Pant. So I think he will be disappointed, naturally so, he is a terrific player. "
Ishan Kishan has mostly warmed the benches in T20I cricket lately, even in Rahul's absence. The Indian team management has opted to try the likes of Suryakumar Yadav and Rishabh Pant at the top of the order instead of giving more opportunities to the Mumbai Indians southpaw.
Saba Karim was also asked his opinion on Ishan Kishan being left out. He gave his reasons for Deepak Hooda being preferred instead, saying:
"If you have someone like Deepak Hooda waiting in the wings, then you opt for him because he is a multi-dimensional player, he can bowl off-spin and bat in the middle order or right up the order as an opener. Unfortunate that Ishan Kishan has to miss out but you possibly can only pick 15, so you need to have players who can offer more options to the management. "
Hooda presents the Indian team with the option to go in with an additional batter, with the off-spinner capable of performing the fifth bowler's duties along with Hardik Pandya. He also outscores Ishan with his ability to bat at any position.
Poll : Did the selectors make the right call by picking KL Rahul and Deepak Hooda ahead of Ishan Kishan?
|
english
|
A new World Economic Forum (WEF) study suggests that reducing energy demand intensity can unlock annual savings of at least USD 2 trillion for the global economy by the end of this decade. This can also boost growth and reduce greenhouse gas emissions. The report, supported by over 120 global CEOs, suggests that the right policy frameworks can unlock growth, productivity, save companies cash, deliver a competitive advantage, and reduce emissions.
India's top oil producer, ONGC, is planning to cut gas flaring and achieve zero methane emissions by 2030 as part of its ambitious decarbonisation plan. ONGC used to flare 14-15 million standard cubic metres per day, but this has now come down to around 2 per cent. Controlling methane is seen as one of the easiest and cheapest ways to make an immediate impact on global greenhouse gas emissions.
India's ONGC seeks global technology partners to achieve zero methane emission by 2030; plans to cut gas flaring; commitment to decarbonisation stronger than ever; aims to replace gas with green power; companies around the globe pledge to slash methane emissions; invites innovators to offer solutions; ONGC's decarbonisation drive includes solar and wind power plants, green ammonia plant, pump storage projects, and compressed biogas plants; plans to invest Rs 2 lakh crore on clean energy projects.
Indian companies collectively raised $7.1 billion (around ₹54,000 crore) through the IPO route. Its share in the total money raised globally through IPOs expanded to 5.6%, up from 4.1% in the previous year. China raised $60.5 billion, accounting for nearly 48% of the global funds raised compared with 56% a year ago.
The net office space absorption in the country is seen at par with 2022 closing at 37-39 million sq ft. With leasing activity expected to further pick up pace in the last quarter of 2023, the year is expected to surpass the 2017-2019 average, showed a JLL India analysis.
Total consumption of coal will reach a record high of more than 8.5 billion metric tons this year, and then start a long, slow decline, according to the International Energy Agency. Demand is expected to slide to 8.3 billion tons by 2026, the agency said in its Coal 2023 report issued Friday.
At the annual UN climate conference in Dubai, nearly 200 countries clinched a breakthrough deal which calls for the world transition away from all fossil fuels, the primary reason for the climate crisis, in a fair and equitable way. Though the 21-page cover decision urged countries to accelerate efforts to phase down unabated coal power, it did not explicitly mention oil and gas.
The projected decline in global demand for coal - which is currently the largest energy source for electricity generation, steelmaking and cement production, but also the largest source of carbon dioxide (Co2) emissions from human activity - could mark a historic turning point, the IEA said.
Consumption will expand 150,000 barrels a day in 2024, down from about 290,000 barrels a day seen from 2021 to 2023, according to Rystad Energy Head of Oil Trading Mukesh Sahdev. The drop will return growth near the pace seen from 2011 to 2019, he said. The International Energy Agency, meanwhile, sees growth halving to 100,000 barrels a day, as per its November report.
The economy has yoyoed in the past few years, with growth ranging from 2.2% in 2020 to 8.4% in 2021 and 3% last year. Stringent limits on travel and other activities during the pandemic hit manufacturing and transport. Job losses due to those disruptions and to a crackdown on the technology sector, combined with a downturn in the property industry, have led many Chinese to tighten their purse strings.
The outlook for January-March 2024, calculated by subtracting the percentage of employers who anticipate reductions to staffing levels from those who plan to hire, stood at 37 per cent, up 5 per cent from the corresponding period of 2023, and same when compared with the last quarter.
Sulajja Firodia Motwani's comments come at a time when the Centre has cut subsidies on electric two-wheelers in the second edition of its flagship Faster Adoption and Manufacturing of Electric Vehicles (FAME) scheme. The government is also considering the need for a third edition of the programme with demand incentives for buying EVs under FAME II set to end this financial year.
Both benchmarks slid to their lowest since late June in the previous session, a sign that many traders believe the market is oversupplied. Brent and WTI are also in contango, a market structure in which front-month prices trade at a discount to prices further out .
COP28: Global Renewables & Energy Efficiency Pledge New Delhi may not have signed due to language of coal commitments, ongoing UN climate talks. India's absence from the list of countries that signed the Global Renewables and Energy Efficiency Pledge has come has a surprise considering New Delhi, as the G20 president, played a significant role in ensuring the agreement on renewable energy capacity and energy efficiency. The pledge, which aims to triple global renewable energy capacity and double the rate of energy efficiency by 2030, was joined by 118 countries, excluding India, China, and Russia.
Although China and India have expressed endorsement for the threefold increase in renewable energy by 2030, neither of them formally supported the comprehensive pledge on Saturday. This commitment involves scaling up clean power alongside a decrease in the utilisation of fossil fuels. The pledge called for phase down of unabated coal power and putting an end to the financing of new coal-fired power plants.
India's commitment to a sustainable energy future is evident in its 14th National Electricity Plan (NEP), which charts a course to more than triple its renewable energy capacity by 2030. However, realizing this vision comes with a significant price tag, requiring a substantial investment of USD 293 billion, as highlighted in a report released by the global energy think tank Ember on Wednesday.
Saudi Arabia is allegedly artificially stimulating oil demand despite publicly supporting a transition away from fossil fuels, according to a report. The report, published by the Centre for Climate Reporting and Channel 4 News, focuses on the Gulf kingdom's Oil Sustainability Program (OSP), launched in 2020 to ensure hydrocarbons remain part of the global energy mix efficiently and sustainably.
According to a report by Morgan Stanley, the dichotomy between the rise in electric vehicle purchases and increased oil demand challenges conventional expectations. Norway, boasting the highest EV penetration globally, serves as a compelling case study. Despite EVs constituting 80 per cent of new auto sales, the country's oil usage has not collapsed.
Brent futures were up 10 cents, or 0.1%, at $77.52 a barrel at 0232 GMT. U.S. West Texas Intermediate crude (WTI) was nearly flat at $72.95. Both indices have lost around a sixth of their value over the last four weeks.
Despite the ongoing output cut by Saudi Arabia and other members of OPEC plus countries, oil output from the cartel has risen for the third straight month in October. This was due to increased production from Nigeria and Angola. Small members in the group have also contributed by managing to overcome factors affecting output and supply. As per the Reuters report, the group pumped 27.90 million bpd in September, with an increase of 180,000 barrels per day.
The continent’s demand is still critically important even in a world where traders are intently focused on the potential for supply disruptions emanating from war in the Middle East. The expected consumption drop in the two fuel types this year is well over half a million barrels-a-day versus pre-pandemic levels — not far off a Belgium’s worth of overall oil usage.
In its monthly report, the IEA forecast demand for oil will rise by 880,000 barrels per day (bpd) in 2024, down from its previous forecast of 1 million bpd, based on broader economic concerns and a faster adoption of electric vehicles among other energy efficiency measures.
|
english
|
One of the first formulas that is studied in mathematics is related to how to calculate the area of a rectangle. It is also the most frequently used. Rectangular surfaces surround us everywhere, so it is often necessary to know their areas. At least in order to find out if there is enough paint available for painting the floors.
What area units exist?
If we talk about the one that is accepted as international, it will be a square meter. It is convenient to use when calculating the areas of walls, ceiling or floor. They indicate the area of housing.
When it comes to smaller objects, then enter square decimeters, centimeters or millimeters. The latter are needed if the figure is not bigger than the nail.
When measuring the area of a city or country, the most suitable are square kilometers. But there are also units that are used to indicate the size of the area: ar and hectare. The first of them is called weaving.
What if the sides of the rectangle are given?
This is the easiest way to calculate the area of a rectangle. It is enough simply to multiply both known values: length and width. The formula looks like this: S = a * a. Here the letters a and b denote the length and width.
Similarly, the square of the square is calculated , which is a special case of a rectangle. Since all sides are equal, the product becomes the square of the letter a .
What if the figure is depicted on plaid paper?
In this situation, you must rely on the number of cells inside the figure. By their number it can be simple to calculate the area of a rectangle. But this can be done when the sides of the rectangle coincide with the lines of the cells.
Often there is such a position of the rectangle, in which its sides are inclined with respect to the paper lining. Then the number of cells is difficult to determine, so the calculation of the area of the rectangle becomes more complicated.
It will be necessary to first learn the area of the rectangle, which can be drawn by cells exactly around this. It's simple: multiply the height and width. Then subtract from the resulting value the area of all rectangular triangles. And there are four of them. By the way, they are counted as half the work of the legs.
The final result will give the value of the area of this rectangle.
How to proceed if the parties are unknown, but given its diagonal and the angle between the diagonals?
Before finding the area of a rectangle, in this situation it is necessary to calculate its sides in order to use the already familiar formula. First, we need to recall the property of its diagonals. They are equal and divide by the point of intersection in half. You can see in the drawing that the diagonals divide the rectangle into four isosceles triangles, which are pairwise equal to each other.
The equal sides of these triangles are defined as half the diagonal, which is known. That is, in each triangle there are two sides and an angle between them, which are given in the problem. We can use the cosine theorem.
One side of the rectangle will be calculated by the formula in which the equal sides of the triangle and the cosine of the given angle appear. To calculate the second, the cosine value will have to be taken from an angle equal to the difference 180 and the known angle.
Now the problem of how to calculate the area of a rectangle is reduced to a simple multiplication of the two sides obtained.
What if there is a perimeter in the problem?
Usually the condition also specifies the ratio of length and width. The question of how to calculate the area of a rectangle, in this case, is easier on a concrete example.
Let us assume that in the problem the perimeter of a certain rectangle is 40 cm. It is also known that its length is one and a half times the width. It is necessary to find out its area.
The solution of the problem begins with writing down the perimeter formula. It is more convenient to write it as a sum of length and width, each of which is multiplied by two separately. This will be the first equation in the system to be solved.
The second is due to the well-known relationship of the sides. The first side, that is, the length, is equal to the product of the second (width) and the number 1. 5. This equality must be substituted in the formula for the perimeter.
It turns out that it is equal to the sum of two monomials. The first is the product of 2 and of unknown width, the second is the product of numbers 2 and 1. 5 and of the same width. In this equation, only one unknown is the width. You need to count it, and then use the second equality to calculate the length. It only remains to multiply these two numbers to find out the area of the rectangle.
Calculations give such values: width - 8 cm, length - 12 cm, and area - 96 cm 2 . The last number is the answer to the problem considered.
|
english
|
<gh_stars>1-10
{
"name": "jquery-goodpopup",
"version": "2.0.0-beta.20",
"title": "jQuery Good Popup Plugin",
"description": "Responsive jQuery popup that just works as expected. Even in IE8.",
"author": {
"name": "<NAME>",
"url": "https://eugene-lazarev.ru/"
},
"license": "MIT",
"repository": {
"type": "git",
"url": "https://github.com/eugene-lazarev/jquery-goodpopup.git"
},
"homepage": "https://eugene-lazarev.github.io/jquery-goodpopup/",
"keywords": [
"lightbox",
"popup",
"jQuery",
"jQuery-plugin"
],
"devDependencies": {
"grunt": "^1.3.0",
"grunt-contrib-cssmin": "^4.0.0",
"grunt-contrib-uglify": "^5.0.0"
},
"peerDependencies": {
"handlebars": "4.0.11",
"jquery": "^1.12.4"
}
}
|
json
|
Ronaldo’s son is yet to open an account of his own but has travelled around the world with the veteran forward, typically playing for the same clubs.
Cristiano Ronaldo Jr has followed in the footsteps of his superstar father by putting pen to paper at Manchester United, and he will also wear the hallowed No 7 shirt.
CR7, Cristiano Jr, signed with Manchester United and will wear the number seven shirt, as his father did.
After deciding to prolong his stay in the club's junior system, Ronaldo's oldest kid, was photographed posing for official shots with his father's notorious No. 7 shirt.
Georgina Rodriguez shared on Instagram with the caption: "Pursuing our dreams together. Mom loves you. " The 11-year-old signed after spending two years in Juventus' training system while his father played for the Serie A giants in Turi.
Ronaldo and his son have yet to remark on their kid's new deal.
He couldn't have a finer role model than his father, whose standing as one of the best players in the world has been verified by his five Ballon d'Or triumphs, as well as several more titles in England, Spain, and Italy. He was also a member of the Portuguese national team that won the Euros.
CR Jr. wears a number seven shirt in the hopes of following his dad and other Manchester United legends. The renowned shirt was worn by some of the finest players in the world, including George Best, Bryan Robson, Eric Cantona, and David Beckham, among others.
Despite Cristiano Jr. 's new success, Ronaldo Snr has never pressured his son to pursue a career in football. I Am Georgina, a Netflix docu-series, drew Cristiano Ronaldo remarked, "I will never pressure him. " "He'll go ahead and do whatever he wants. What I most want for Cristiano and everyone else is for them to be happy and to be able to choose what they want. I will help in every manner I can. "
Also Watch:
|
english
|
Isekai anime shows like The Greatest Demon Lord Is Reborn as a Typical Nobody, have been all the rage in the industry for the last few years, with some great new inclusions in the genre. The series began airing from April 6, 2022, and following its conclusion on June 22, 2022, fans are in anticipation of a new season.
Based on the light novel series written by Myōjin Katō and illustrated by Sao Mizuno, The Greatest Demon Lord Is Reborn as a Typical Nobody has also been adapted into a seinen manga with illustrations by Misuho Kotoba.
Will The Greatest Demon Lord Is Reborn as a Typical Nobody have a second season?
The Greatest Demon Lord Is Reborn as a Typical Nobody has not been renewed for a second season as of yet. Sadly, the creators of the show remain silent about the return of the isekai fantasy and have not given any hint about a new season being in production. Fans online are speculating that we might get news about the return of the show this year in 2023. However, that remains to be seen.
The original light novel series currently has a total of ten volumes published and needless to say, the first season of the show has not been able to cover all of it. so, judging by the amount of content that is still left to make it to the screen, the possibility of a new season becomes extremely promising. Thus, fans should not get their hopes up for Season 2, despite the delay in an announcement.
The first season of The Greatest Demon Lord Is Reborn as a Typical Nobody ended on an emotional note, with a bittersweet moment between Ard and Lydia. Episode 12 had been a rollercoaster for the characters as we witness Ard fighting the Disaster-Rogue, Latima’s betrayal and Lydia’s much-needed intervention. No wonder, fans are impatient to see what the next season holds for these characters after the dramatic conclusion of the first season.
The voice cast of the first season consists of many popular names from the industry who have previously worked in popular anime shows like Handyman Saitō in Another World, Junji Ito Maniac: Japanese Tales of the Macabre, Tomo-chan Is a Girl! And more. Here are some of the main characters of the show and their respective voice actors:
- Ard Meteor: Toshinari Fukamachi, Rie Takahashi (young)
The first season of The Greatest Demon Lord Is Reborn as a Typical Nobody is currently available for streaming on Crunchyroll. Here is how the series is summarized on its official website:
After accomplishing everything he could as king, the most powerful Demon Lord ever, Varvatos, is now bored. To spice things up a bit, he is reborn in the future as Ard Meteor. Not without first recalibrating his powers to be perfectly average. But there’s no way he could have predicted that everyone in the modern world would be weak as hell, making him totally overpowering once again!
Stay tuned for more updates on The Greatest Demon Lord Is Reborn as a Typical Nobody season 2 and other popular manga and anime like Attack on Titan, My Hero Academia, Jujutsu Kaisen, Tokyo Revengers, and more.
Sportskeeda Anime is now on Twitter! Follow us here for latest news & updates.
|
english
|
<gh_stars>1-10
import * as is from 'yox-common/src/util/is'
import * as constant from 'yox-common/src/util/constant'
/**
* 对比新旧字符串
*
* @param newValue
* @param oldValue
* @param callback
*/
export default function (
newValue: any,
oldValue: any,
callback: (key: string, newValue: any, oldValue: any) => void
): true | void {
const newIsString = is.string(newValue),
oldIsString = is.string(oldValue)
if (newIsString || oldIsString) {
callback(
constant.RAW_LENGTH,
newIsString ? newValue.length : constant.UNDEFINED,
oldIsString ? oldValue.length : constant.UNDEFINED
)
return constant.TRUE
}
}
|
typescript
|
<reponame>Mattlk13/dependent-packages
["babel-preset-streamkitchen","beehives-boilerplate-nodejs","hubot-rocketchat-gitlab","kube-config","micro-scripts","npm-saida","supergirl"]
|
json
|
{
"_id": "el1m9kq6",
"accession": "NC_016578",
"definition": "Cleome leaf crumple virus DNA-A, complete genome",
"host": "Cleome affinis",
"sequence": "ACCGGATGGCCGCTTGATCTGTTTTATGTTCGGCCCGCGCAAGCGGAAGAGTTGGCACGATGACAAAAAAACTCGGCCCATGATGAGAGGAGATGATAAGGGGACCACGTCCCAAAAAAGGAACGTATGATGGGACCACATAAAGACAGTGATTACGCCCAATAAGGATTGGGCAACAAAGCCAAGATATTCAAATATACTTGGTCGATAAGTTGATAAAGTTGTATAAATGGGACCATCACCCTTCGTGGTCTAGTCAGCCCCGAATAGGACTCGACGTTCTGTGGTGCAGGATGCCCAAGCGTGATGCCCCATGGCGAACGGTTTCAGGGACCACGAAGGTTAGCCGCAACGCCAACTACTCCCCTCGTGGAGGCACGGGCTCAAGACCAAGCAGGGCCGCTGCTTGGGTTAATCGGCCCATGTACAGGAAGCCCAGGATATATCGGATGTATAGGTCACCCGATGTGCCCAGAGGGTGTGAAGGCCCGTGCAAGGTGCAGTCTTACGAGCAGCGCCACGACATATCTCATGTCGGCAAGGTGATGTGCGTGTCTGACATTACCCGCGGTAATGGTATTACTCACCGCGTTGGTAAGCGATTTTGCGTCAAGTCTATGTACATCCTAGGCAAGGTCTGGATGGACGAGAACATCAAGTTGAAGAACCACACGAACACGGTGATGTTGTGGTTAGTTAGGGACAGGAGACCTTACGGGACGCCCATGGAGTTCGGACAGGTTTTTAACCTGTTTGACAACGAGCCAAGCACCGCTACGGTGAAGAACGATCTTCGTGATCGTTTTCAGGTGCTGAACAGGTTCCACGTGAAGGTCACTGGTGGACAGTACGCGAGCAACGAGCAGGCGCTGGTTAGGCGCTTTTGGAGGGTGAACACCCACGTGACGTACAACCACCAGGAGGCGGCGAAGTACGAGAACCATACGGAGAACGCCCTGTTATTGTATATGGCATGTACTCATGCCTCTAACCCTGTATACGCGACGCTCAAGATTCGAATCTATTTCTACGATTCGATATTGAATTAATAAAGTTTGAATTGTATTGAATGGTTCTCGCGTACACGTCTTACATACGGTCTGTCCGTTGCGAAGGTGACAGCGCGAATTACATTGTTAAGGCTAATAACGCCCACGTTATTTAGATACATGAGGACCAAATGTTTAAACCTATTTAAATAGGTCTGCCCAGAAGCTGTCACCGATACTGTCCAGACTTGGAAGTTGAGGAACGCCTTGTGGAGATCCAACGCTTTCCTCAGGTTGTGGTTGAACCGGATTTGTACGTGGTAGACCCTCGTCGTTCTGGACAGGATCTCCACCGCGTCGTATATCTTGAAATACAGGGGATTTGTTATCTCCCATGTATACACGCCATTCTCCGCTTGAGGCGCAGTGATGAGTTCCCCTGTGCGTGAATCCATTATTCGCGCAGTTTAGGTGGATGTATATTGTACATCCACAGTTCAGGTCGATACGTCTACGGCGAATGGCTCTCCGTTTCGCCACTCTGTGTTGCACTTTGATAGAGGGGAGATTCGAGGAAGACGAACCTCGCATTGTGAAGGGTCCACGACCGGAGTGCTGAGTTTTCCTCTTTCTCGAGGAAGTCTTTATAGCTGGACCCTTCCCCTGGATTGCAAAGCACGATTGATGGGATACCGCCTTTAATTTGAACGGGTTTCCCGTATTTGCAGTTACTTTGCCAGTCTCGTTGGGCCCCAACGAGTTCTTTCCAGTGCTTTAGCTTTAGGTAGTGCGGGGCAACGTCATCGATGACGTTGTATGCGACCTCGTTTGAGTAGACCCTCGAGTTGAAGTCGAGGTGTCCACTGAGATAATTGTGGGGACCTAAAGCACGCGCCCACATCGTCTTCCCCGTCCTCGAATCTCCCTCGACGATCAGACTTATCGGTCTGTTTGGCCGCGCTTCGGCGGATAAGGCGAAATACTCATCGGCCCACGACTGCATTTCGTCCGGAACGTTAGTGAATGAGGACAACGGGAACGGAGGGACCCATGGTTCCGGAGCCTTAGCGAAGATTTTCTGGACATGTGCTTGCACCTTGTCTAAATGGAGGACGAAATCTCGCGGTTGCTCTTCCCTTAGAATCTGCAGTGCTTGCGCTGCAGACTCGGCGTTAAGGACTTTGGCGTATGTGTCGTTAGCCGATTGGCAACCGCCTCTAGCACTTCTCCCGTCGATCTGGAATGTTCCCCATTCCAGAGTATCCCCGTCTTTGTCGACGTAGGACTTGACGTCGGAGCTCGACTTAGCTCCCTGTACGTTCGGATGGAAATGTGCTGACCGGGACGGGGATACCAGGTCGAAGAATCTTTGATTCTGGCATTTGAACTTCCCCTCGAATTGGAGAAGCACGTGGAGATGAGGCTCCCCATTATCGTGGAGCTCTCTGGCGACCTTGATGAACTTCTTGTTCGTCGGCGTTGCTAGGGCTTGCAATTGGGAAAGTGCTTCCTCTTTGGTCAGGGAGCACTTTGGATAAGTGAGGAAATAATTTCTGGCGTTTATTAGGAAACGCTTTGGCGCCGATGGCATTTTGGTAAATAAAGGGATGAGACCCAATAGAGAGGACCCGATAGCTCTCGTTTCAACTTGGTGAAATGAATCGGGGAATGGGTCCTTATTTATAGCAGAGTCCGTTAGGGTATATTTGCCACGTGTCGGCCATCCGTATAATATT"
}
|
json
|
Bayern Munich defender David Alaba is said to be appreciative of the interest he has received from Chelsea boss Frank Lampard. The Austrian's contract with Bayern Munich is set to expire at the end of the season, making him a free agent, and the Blues are rumored to be plotting transfer talks.
David Alaba is facing a major dilemma after Bayern Munich decided to withdraw their earlier contract offer. The 28-year-old enters the final six months of his contract in January, and is, therefore, free to talk to any potential suitors.
Bayern Munich were reportedly keen to keep hold of Alaba but withdrew their offer after the player and his representatives were adjudged to have taken too long to respond. The European champions, however, insist that the matter is not closed and renegotiations could yet restart.
Davi Alaba has attracted interest from a number of Europe's elite club in recent weeks, with Real Madrid and Paris Saint-Germain said to be leading the race for his signature.
David Alaba's agent, Pini Zahavi, is reportedly keen on establishing close relations with the Real Madrid hierarchy and has reportedly offered the player to the Spanish giants. However, The Sun claims that Premier League giants Chelsea are now leading the race for the Bayern Munich star.
The reports claim an offer is being prepared for the January window, as both sides examine a potential pre-contract deal. The Sun further reports that David Alaba is encouraged by Lampard's interest in him, which puts Chelsea in pole position.
Chelsea spent more than £200 million on seven players in the summer, in a bid to strengthen their squad. The London club is aiming to challenge the likes of Manchester City and Liverpool for this season's Premier League title.
The signing which arguably had the biggest effect on the club is Thiago Silva, who was signed on a free transfer after his contract with PSG expired at the end of last season. The Brazilian has added experience, solidity, and composure to Chelsea's defense.
Chelsea's backline has improved significantly in recent weeks, with the Blues conceding just two goals in their last nine games. Frank Lampard, however, believes there is still room for improvement and is keen to add David Alaba to his squad.
The Austrian is a versatile player who can slot in at center-back, left-back, as a winger, or in defensive midfield. Signing a top-quality player like David Alaba would prove to be a massive coup for Frank Lampard.
|
english
|
<reponame>TakesxiSximada/dumpcar<filename>scripts/get-db-raw-snapshot-mysql.py
import getpass
import argparse
import subprocess
parser = argparse.ArgumentParser()
parser.add_argument('host')
parser.add_argument('user')
parser.add_argument('db')
args = parser.parse_args()
child = subprocess.run('mysqldump -h {} -u {} {}'.format(
args.host, args.user, args.db), shell=True)
child.wait()
child = subprocess.run('mysqldump -h {} -u {} {}'.format(
args.host, args.user, args.db), shell=True)
child.wait()
|
python
|
lahar, mudflow of volcanic material. Lahars may carry all sizes of material from ash to large boulders and produce deposits of volcanic conglomerate. Lahars may be the result of heavy rain on loose ash material such as deposits of nuées ardentes (dense clouds of gases charged with incandescent dust, discharging volcanic sand in avalanche fashion); or they may result from the mixing of debris with river water, the flooding of ash by snow or ice melted by an eruption, or the emptying of crater lakes onto loose material. A variation is the hot lahar ordinarily produced by the heating of the crater lake water by the quiet upwelling of lava or an explosion. Lahars move downslope at very high speeds and may extend for tens of miles. A lahar deposit usually has a hummocky or hilly surface. They often cause much death and destruction, as at Herculaneum during the eruption of Vesuvius in ad 79.
|
english
|
<filename>_locales/en/messages.json
{
"appName": {
"message": "On the spot Translator",
"description": "The title of the application, displayed in the web store."
},
"appDesc": {
"message": "Just click and get the translation right below which keeps named entity in the original text.",
"description":"The description of the application, displayed in the web store."
}
}
|
json
|
This research investigates the causes of abnormal phenomena that arise when alkaline earth elements are added to sodium phosphate glass, as network modifiers, through a structure-based study. Many studies have shown that the addition of MgO and ZnO to phosphate glass induces peculiarities in the physical properties, which are attributed to the structural changes caused by the added elements. In this work, sodium phosphate glass was prepared by adding alkaline earth oxides, such as CaO, BaO and CuO, all of which exhibit an inflection point, where the density changes. Abnormalities, similar to those observed in the previous studies, were observed in these cases also. X-ray diffraction was performed to analyse the structure of the prepared glass, and it was revealed that there was no change in the crystal structure, and an amorphous phase was identified. Fourier transform infrared spectroscopy (FT-IR) confirmed the difference in the short-range order of the glass structure. However, the reason for the resonance structure, when divalent cations added, was not fully confirmed through FT-IR. X-ray photoelectron spectroscopy was conducted to further confirm the abnormality in the glass. The abnormality caused by the addition of alkaline earth elements to phosphate glass was explained based on the results of these analyses.
|
english
|
<filename>data/node/4949719049/details.json
{"type":"Feature","id":"node/4949719049","properties":{"addr:city":"Muttenz","addr:housenumber":"32","addr:postcode":"4132","addr:street":"Baselstrasse","email":"<EMAIL>","name":"<NAME>","opening_hours":"Th 16:30-19:00; Sa 08:30-12:00","operator":"Urs und Regula Jauslin-Brunner","organic":"no","phone":"+41 61 461 84 35","produce":"Weine: Gutedel, RieslingxSilvaner, Bacchus, Pinot gris, Pinot noir Sauvignon blanc, Vin mousseux","shop":"farm","source":"http://weinregion-basel-solothurn.ch/winzer/winzer-adressen/","website":"https://www.weingutjauslin.ch/","id":"node/4949719049"},"geometry":{"type":"Point","coordinates":[7.6411956,47.5243591]}}
|
json
|
'use strict';
function copyNode(node) {
var newNode = {};
Object.keys(node).forEach(function(key) {
newNode[key] = node[key];
});
return newNode;
}
var defaultNodeFactory = {
topNode: copyNode,
taskNode: copyNode,
childNode: copyNode,
};
function copyTree(tree, opts, nodeFactory) {
opts = opts || {};
var depth = opts.tasksDepth;
depth = typeof depth === 'number' ? ((depth < 1) ? 1 : depth) : null;
nodeFactory = nodeFactory || defaultNodeFactory;
var newTree = nodeFactory.topNode(tree);
newTree.nodes = [];
if (Array.isArray(tree.nodes)) {
tree.nodes.forEach(visit);
}
function visit(node) {
var newNode = nodeFactory.taskNode(node);
newNode.nodes = [];
newTree.nodes.push(newNode);
if (opts.compactTasks) {
forEach(node.nodes, copyNotRecursively, newNode);
} else if (!depth || depth > 1) {
forEach(node.nodes, copyRecursively, depth, 2, newNode);
}
}
function copyNotRecursively(child, newParent) {
var newChild = nodeFactory.childNode(child);
newChild.nodes = [];
newParent.nodes.push(newChild);
if (child.branch) {
forEach(child.nodes, copyNotRecursively, newChild);
}
}
function copyRecursively(child, maxDepth, nowDepth, newParent) {
var newChild = nodeFactory.childNode(child);
newChild.nodes = [];
newParent.nodes.push(newChild);
if (!maxDepth || maxDepth > nowDepth) {
forEach(child.nodes, copyRecursively, maxDepth, nowDepth + 1, newChild);
}
}
return newTree;
}
function forEach(nodes, fn) {
if (!Array.isArray(nodes)) {
return;
}
var args = Array.prototype.slice.call(arguments, 2);
for (var i = 0, n = nodes.length; i < n; i++) {
fn.apply(nodes[i], [nodes[i]].concat(args));
}
}
module.exports = copyTree;
|
javascript
|
# -*- coding: utf-8 -*-
import pandas as pd
import re
from urllib.parse import quote_plus
from vespid import setup_logger
import gzip
import os
import shutil
from vespid import setup_logger, set_global_log_level
logger = setup_logger(module_name=__name__)
def replace_special_solr_characters(data, columns=None):
'''
Apache Solr interprets certain characters as special if it sees them anywhere in a query.
In order to avoid accidentally querying for something you don't intend to,
you need to escape these characters properly.
Parameters
----------
data: either a pandas Series or DataFrame with the string data needing
substring replacements.
columns: iterable of str. Indicates, if the input is a pandas DataFrame,
which columns to apply substring replacement on. If None and ``data``
is a DataFrame, will assume all columns are to be used.
Returns
-------
The input data with substring replacements made. If a pandas DataFrame
is provided as the input, will return the entire DataFrame, not just
``columns``.
'''
output = data.copy()
special_characters = [
r'+',
r'-',
r'&', # single & must be manually converted
r'&&',
r'|', # single | must be manually converted
r'||',
r'!',
r'(',
r')',
r'{',
r'}',
r'[',
r']',
r'^',
r'"',
r'~',
r'*',
r'?',
r':',
r'/',
r'#'
]
special_characters_dict = {}
for c in special_characters:
# escaped = re.escape(c)
# # Deal with special non-escapable cases
# if c in ['#', '&', '|', '?', '!']:
# escaped = quote_plus(c)
# # # Check that we actually escaped it!
# # elif len(escaped) != 2 * len(c):
# # escaped = "\\" + c
# special_characters_dict[c] = escaped
special_characters_dict[c] = ''
def _replace_characters(series, replacement_dict):
output = series.copy()
for char, char_escaped in replacement_dict.items():
output = output.str.replace(
char,
char_escaped,
regex=False
)
return output
if isinstance(data, pd.core.series.Series):
output = _replace_characters(output,
special_characters_dict)
elif isinstance(data, pd.core.frame.DataFrame) and columns is not None:
for column in columns:
output[column] = _replace_characters(output[column],
special_characters_dict)
elif isinstance(data, pd.core.frame.DataFrame) and columns is None:
for column in data.columns:
output[column] = _replace_characters(output[column],
special_characters_dict)
else:
raise ValueError(f"``data`` must a pandas Series or DataFrame, not {type(data)}")
return output
def expand_dict_lists(lists, unique_ids=None, drop_duplicates=True,
keep_index=False):
'''
Given an iterable (e.g. pandas Series) containing lists of dicts that
define unique entities and their metadata, return the unique entities +
metadata as a DataFrame, with duplicates dropped.
Parameters
----------
lists: list-like iterable. Should contain data about each entity as
a list of dicts, one list per element. Dicts are expected to be of the
form {'authorId': int, 'name': str, 'url': str}, although the only
real requirement is that each dict have the same keys.
unique_ids: str or list of str. Indicates the key(s) from each dict that
should be considered unique identifier(s) for the dict and can be
used to de-duplicate the records.
drop_duplicates: bool. If True, will drop duplicate records using the
``unique_ids`` provided or simply use all columns to determine which
rows to drop. If False, will skip duplicate dropping.
keep_index: bool. If True, retains the index from the original ``lists``.
Otherwise, drops it in favor of a new continuous non-duplicative index.
Returns
-------
pandas DataFrame containing the dictionary entries and their metadata.
'''
if not isinstance(lists, pd.Series):
lists_in = pd.Series(lists)
else:
lists_in = lists
# Make the lists of dicts into a single list of dicts
exploded_lists = lists_in.dropna().explode().dropna()
single_list_of_dicts = exploded_lists.tolist()
single_list_index = exploded_lists.index
# Transform list of dicts into a flat DataFrame
if drop_duplicates:
output = pd.DataFrame(
single_list_of_dicts,
index=single_list_index).drop_duplicates(subset=unique_ids)
else:
output = pd.DataFrame(
single_list_of_dicts,
index=single_list_index)
if keep_index:
return output
else:
return output.reset_index(drop=True)
def extract_named_value_from_lists_of_dicts(l, key='name'):
'''
Using a known key, extracts every value found for that key in lists of
dicts (e.g. a pandas Series of lists of dicts) and returns the input
iterable but with lists of only the values found for that key.
Parameters
----------
l: iterable of lists of dicts. The data you want to extract values from.
key: str. Key used in each dict across the iterables the values of which
you want to extract.
Returns
-------
A pandas Series with only the values of ``key`` as lists.
'''
output = expand_dict_lists(l, drop_duplicates=False, keep_index=True)
return output.groupby(output.index)[key].agg(list)
def decompress_gzip(filepath, remove_original=True):
'''
Decompresses a *.gz file located at ``filepath`` and saves
a new copy with the same filename (except the *.gz is removed)
in the source directory, optionally removing the old file if desired.
Parameters
----------
filepath: str. Should be of the form 'path/to/*.gz'
remove_original: bool. If True, deletes the zipped file
from the source directory, leaving only the decompressed
file.
Returns
-------
Filepath of the newly-decompressed file.
'''
with gzip.open(filepath, 'rb') as f_in:
with open(filepath[:-3], 'wb') as f_out:
shutil.copyfileobj(f_in, f_out)
if remove_original:
os.remove(filepath)
return filepath[:-3]
def find_columns_by_class(df, classes_to_find):
'''
Given a pandas DataFrame, find the columns that have at least one object
of the the same type as any of the `classes_to_find` provided.
Parameters
----------
df : pandas DataFrame
The DataFrame with all your data
class_to_find : list of object classes
The type of class being sought
Returns
-------
list of str
The names of the columns with at least one object of the specified
class
'''
columns_found = set(
df.columns[df.applymap(
lambda t: isinstance(t, tuple(classes_to_find))
).sum() > 0]
)
return list(columns_found)
|
python
|
<reponame>jeffoverflow/towhee
# Copyright 2021 Zilliz. All rights reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
from towhee.engine.graph_context import GraphContext
from towhee.dag.graph_repr import GraphRepr
from towhee.dataframe.dataframe import DFIterator
class Pipeline:
"""
The runtime pipeline context
"""
def __init__(self, engine: Engine, graph_repr: GraphRepr, parallelism: int = 1) -> None:
"""
Args:
engine: the local engine to drive the Pipeline
graph_repr: the graph representation
parallelism: how many rows of inputs to be processed concurrently
"""
self._engine = engine
self._graph_repr = graph_repr
self._parallelism = parallelism
def build(self):
"""
Create GraphContexts and set up input iterators.
"""
raise NotImplementedError
def run(self, inputs: list) -> DFIterator:
"""
The Pipeline's main loop
Agrs:
inputs: the input data, organized as a list of DataFrame, feeding
to the Pipeline.
"""
# while we still have pipeline inputs:
# input = inputs.next()
# for g in graph contexts:
# if g.is_idle:
# g.start_op.inputs = input
# break
# if all graphs contexts are busy:
# wait for notification from _notify_run_loop
raise NotImplementedError
def on_start(self, handler: function):
"""
Set a custom handler that called before the execution of the graph.
"""
self._on_start_handler = handler
raise NotImplementedError
def on_finish(self, handler: function):
"""
Set a custom handler that called after the execution of the graph.
"""
self._on_finish_handler = handler
raise NotImplementedError
def _organize_outputs(self, graph_ctx: GraphContext):
"""
on_finish handler passing to GraphContext. The handler will organize the
GraphContext's output into Pipeline's outputs.
"""
raise NotImplementedError
def _notify_run_loop(self, graph_ctx: GraphContext):
"""
on_finish handler passing to GraphContext. The handler will notify the run loop
that a GraphContext is in idle state.
"""
raise NotImplementedError
|
python
|
Aadhaar adoption and usage by residents continues to progress across India, indicative of how it is touching lives, and enabling ease of living for residents. In October, over 175. 44 cr authentication transactions were carried out via Aadhaar.
A majority of these monthly transactions were done by using fingerprint biometric authentication, followed by demographic and OTP authentication.
So far, cumulatively almost 8426 crore authentication transactions have been completed by using the 12-digit digital ID by the end of October, indicative of how Aadhaar is increasingly playing a role in good governance and aiding welfare delivery.
Whether it is ‘Jeevan Pramaan’, e-KYC, AEPS for last mile banking, Aadhaar enabled DBT or authentication, Aadhaar, a digital infrastructure of good governance, has been playing a vital role in supporting the Prime Minister, Shri Narendra Modi’s vision of Digital India.
The number of face authentication transactions jumped from 4. 67 lakh in September to over 37 lakh in October. Face authentication is facilitating pensioners to generate digital life certificate at home by using their mobile phones without visiting banks or common service centers, thus promoting ease of living of the senior citizens.
Similarly, in October alone, 23. 56 crore e-KYC transactions were executed using Aadhaar, and the cumulative number of e-KYC transactions via Aadhaar has now gone up to 1321. 49 crore by the end of October 2022.
Aadhaar e-KYC service is increasingly playing a crucial role for banking and non-banking financial services by providing transparent and improved customer experience, and aiding ease of doing business.
An e-KYC transaction is executed, only after the explicit consent of the Aadhaar holder, and eliminates physical paperwork, and in-person verification requirement for KYC.
Similarly, Aadhaar Enabled Payment System (AEPS) has been an enabler of financial inclusion at the bottom of the income pyramid.
In October alone, 23. 64 crore number of AEPS transactions were carried out across India, a jump of over 12. 4% when compared with September. Cumulatively, 1573. 48 crore of last mile banking transactions have been made possible via the use of AEPS and the network of micro-ATMs so far, by the end of October 2022.
So far, over 1100 welfare schemes in the country run by both centre and states have been notified to use Aadhaar. The digital ID is helping various ministries and departments in the centre and at states in improving efficiency, transparency and delivery of welfare services to the targeted beneficiaries.
|
english
|
{
"name": "readme-blog",
"version": "0.0.1",
"description": "vuepress blog",
"main": "index.js",
"scripts": {
"dev": "vuepress dev .",
"build": "vuepress build .",
"deploy": "bash deploy.sh"
},
"repository": {
"type": "git",
"url": "git+https://github.com/zhb333/readme-blog.git"
},
"keywords": [
"vuepress",
"blog"
],
"author": "SpiritGit",
"license": "MIT",
"bugs": {
"url": "https://github.com/SpiritGit/blog-vuepress/issues"
},
"homepage": "https://github.com/SpiritGit/blog-vuepress",
"devDependencies": {
"@vuepress/theme-blog": "^2.2.0",
"lodash": "^4.17.15",
"vue-draggable-resizable-gorkys": "^2.3.6",
"vuepress": "^1.4.0"
}
}
|
json
|
Chairman/CEC, LAHDC, Kargil Feroz Ahmed Khan along with Administrative Secretary Tourism and Culture, Ladakh, Kacho Mehboob Ali Khan, today chaired a meeting on Swadesh Darshan 2.0 Scheme for Kargil town here at Council Secretariat.
While briefing the CEC about the scheme, the Secretary Tourism said Swadesh Darshan 2.0 has been proposed to establish tourism destinations in Kargil and Leh and the project has been finalized on the direction of PMO and Rs 70 cr have been assigned for the project.
The Secretary said under the plan tourist destinations have to be developed around the vicinity of Kargil town and a Destination Management Committee will also be constituted for its execution.
During the meeting, a discussion was held to identify the sites for projects within the town vicinity. The Secretary informed that the lists of projects that have been proposed include parking facility, establishment of Hunderman Heritage Village and tourist attraction site at Suru-Drass river confluence (Sangam) has been proposed.
The CEC said since the timeline to complete the project is two years therefore the consultants should draft the DPR at the earliest.
He further added that targeted projects should be less but complete. He added that due to congestion of the space the area limit of work can be extended to the peripheries of town.
Khan said in order to avoid the nuisances for tourists, the parking project should be taken on priority and other activities can be created alongside it to attract more tourists.
Regarding border tourism, CEC reflected that Hunderman Heritage Village is a promising project and the project should aim to provide basic amenities to the tourists.
During the meeting representatives of AKTTA, Mohammad Hassanain and Fayaz Ahmed also shared their suggestions regarding the project.
It was informed that Deputy Commissioner/CEO, LAHDC, Kargil is the Chairman of the Destination Management Committee and future policies will be exhibited in consultation with the concerned departments and stakeholders.
Earlier, representatives of Voyant Solutions, Project Development Management Consulting agency for the project Swadesh Darshan 2.0 presented a detailed presentation on the proposals related to Sawadesh Darshan 2.0 Kargil Chapter.
Executive Councilor Social Welfare, Syed Mehdi Fazily, EC Tourism, RD and Zanskar Affairs, Er Punchok Tashi, EC Health, Mohsin Ali, Deputy Commissioner/CEO, LAHDC, Kargil, Santosh Sukhadeve, SSP Kargil, Anayat Ali Chowdhury, Director, Tourism Department, Ladakh/State Mission Director, Superintending Engineer, PWD (R&B), Kargil, Chief Planning Officer, Kargil, EO MC, Kargil, AD Information, Superintendent Industrial Training Institute, Kargil, AD Tourism, Kargil, Hassanain Ali and Fayaz Ahmad of All Kargil Travel Trade Association (AKTTA), Kargil, besides team members of Voyant Solutions were present during the meeting.
|
english
|
<reponame>Brent230/discord.bio
import fetch from 'node-fetch'
import { Bio } from '../..'
async function createSlug(this:Bio,slug: string): Promise<void> {
this.api('/user/create','POST', { cookie:this.cookie },JSON.stringify({slug:slug}))
}
export = createSlug
|
typescript
|
/*
* Copyright 2016 Pascal
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package com.github.pascalgn.jiracli.command;
import com.github.pascalgn.jiracli.command.Argument.Parameters;
import com.github.pascalgn.jiracli.context.Context;
import com.github.pascalgn.jiracli.model.Data;
import com.github.pascalgn.jiracli.model.TextList;
@CommandDescription(names = "join", description = "Join the input texts into a single text")
class Join implements Command {
@Argument(parameters = Parameters.ZERO_OR_ONE, variable = "<separator>",
description = "the string between the texts")
private String separator = System.lineSeparator();
@Override
public Data execute(Context context, Data input) {
TextList textList = input.toTextListOrFail();
return textList.toText(separator);
}
}
|
java
|
Bryan Fogel is an American film director, producer, author, playwright, speaker and human rights activist, best known for the 2017 documentary Icarus, which won an Academy Award for Best Documentary Feature at the 90th Academy Awards in 2018. The New York Times described Fogel's film Icarus as "Illuminating" and Variety magazine called it as "A Game Changing Documentary." Icarus premiered at the Sundance Film Festival, where it won U.S. Documentary Special Jury Award "The Orwell Award" and the first ever "Audience Choice" Award of Sundance Film Festival London. The film was acquired in a historic $5 million sale by Netflix and launched globally on August 4, 2017 and won its first Feature Documentary Oscar with Icarus. The evidence brought forward in Icarus through Russian whistle-blower Dr. Grigory Rodchenkov, was instrumental in the Olympic Committee's banning of Russia from the 2018 Winter Olympic Games. Fogel most recently has directed and produced the 2020 American documentary film The Dissident that follows the assassination of Jamal Khashoggi and Saudi Arabia's effort to control international dissent. It had its world premiere at the Sundance Film Festival on January 24, 2020. It is scheduled to be released on December 18, 2020, by Briarcliff Entertainment. He currently resides in Los Angeles, CA.
|
english
|
**Malkangiri: ** Ahead of CM Naveen Patnaik’s visit, Congress and BJP activists observed bandh separately on Saturday.
Shops and bazaars remained closed in Malkangiri town.
Vehicular movement also got disrupted. The Congress activists blocked roads at Balimela by burning tyres.
5 BJP activists, including party district president and a few Congress activists were detained by the police to maintain law and order situation.
Notably, the two parties had declared to observe bandh on Chief Minister’s visit day to protest the State Government’s alleged lackadaisical attitude towards containing Japanese Encephalitis and other unidentified diseases which claimed lives of over 130 children in just two months in the district.
Despite the bandh call given by Congress and BJP, Chief Minister Naveen Patnaik visited Malkangiri district on Saturday to lay foundation stones and inaugurate various projects.
“Thousands of people have gathered in Malkangiri to attend the inaugural meeting of CM Patnaik, to see and to listen to him. Nearly 250 crores of money will be spent in the development of the people here through different schemes launched by the CM,” said Rabi Narayan Nanda, senior BJD leader.
Patnaik also attended a general meeting and reviewed the steps taken to prevent Japanese Encephalitis that has killed over a hundred children in the district.
In view of this and to avoid any untoward incident in the Maoist-dominated district during the Chief Minister’s visit, the district administration made strict security arrangements.
Inspector General (Operation) RP Koche and SP Mitrabhanu Mahapatra visited the CM’s meeting spot at DNK Playground and inspected the security arrangements.
“The district border has also been sealed and the patrolling team has been stationed there whereas a total of 32 platoons of police force have been deployed for the security of the venue,” said Mitrabhanu Mahapatra, SP, Malkangiri.
|
english
|
package utils
import (
"math"
"sync"
)
type WaitGroupPool struct {
pool chan struct{}
wg *sync.WaitGroup
}
func NewWaitGroupPool(size int) *WaitGroupPool {
if size <= 0 {
size = math.MaxInt32
}
return &WaitGroupPool{
pool: make(chan struct{}, size),
wg: &sync.WaitGroup{},
}
}
func (p *WaitGroupPool) Add() {
p.pool <- struct{}{}
p.wg.Add(1)
}
func (p *WaitGroupPool) Done() {
<-p.pool
p.wg.Done()
}
func (p *WaitGroupPool) Wait() {
p.wg.Wait()
}
func (p *WaitGroupPool) Size() int {
return len(p.pool)
}
|
go
|
<filename>HealthcareAnalytics/SampleData/dialogue-73.json
{"Id":73,"Description":"Suggest treatment for an intense cough caused due to pneumonia\r\n\r\n","DialogueText":"Patient:\r\nI started a cough in 2009 that was diagnosed as severe bronchitis and then a couple years I had pneumonia twice and now I ve got combination of bronchitis and pneumonia bad cough. I just had a second CT scan one was August 22nd and the other one was October 23rd and I ve never been told a diagnosis before but I happened to see it on my chart What: Hospital Outpatient Visit with LKS CT 1 When: Monday October 23, 2017 7:30 AM (30 minutes) Where: Lakeside Hospital Cat Scan (Lakeside)Diagnosis: Interstitial lung disease.I am going November 27th to discuss this diagnosis I hope I was just told I don t have COPD and then I get this lung disease which I ve never heard of and it doesn t have a very good survival rate I m 63 female.\r\nDoctor:\r\nHello,CT scan is diagnostic for interstitial lung disease (ILD). It can develop after the age of 60 years especially if the patient is having bronchitis and recurrent pneumonia.Yes, you are right about survival. It is not having a good prognosis.But, now day\u2019s newer treatments like Pirfenidone and N acetylcysteine (NAC) drugs are available. So consult pulmonologist and discuss these newer treatments.Hope I have answered your query. Let me know if I can assist you further.Regards,Dr. <NAME>\r\n\r\n"}
|
json
|
Raisins are sweet dry fruits that are added to many sweets and dishes to make them more delicious. While many people love it in their food, adding raisins to your diet is a wonderful idea for your health in the longer run. Raisins are the best source of soluble fiber and aid the digestive system. It also contains tartaric acid that helps solve stomach issues. Research shows that raisins have anti-inflammatory properties that help in improving intestinal functions. It also regulates the balance of bacteria in your gut.
Raisins also boost iron levels and help keep the bones strong. Around 30-40 grams of raisins are ideal to consume in a day, that's about 8-10 raisins. On the other hand, doctors suggest that excessive raisins can lead to poor digestive health. It can also prevent other nutrients from being absorbed.
Raisins consist of insoluble dietary fibers. It's a naturally laxative ingredient that helps in improving bowel movement. It ensures the smooth functioning of the stool. It relieves you from other gastrointestinal problems like gas, bloating, abdominal pain, irritable bowel syndrome, flatulence, etc.
Not everyone wants to lose weight. Many people want to gain weight to get into the right shape. Rich in fructose and glucose, the raisins have loads of energy that can help in removing bad cholesterol.
Raisins have anticarcinogenic benefits. Some studies have confirmed that after consuming raisins, there are chances of reducing the risk for cancer.
It also brings positive changes to your blood pressure levels. Raisins have high potassium which can relax the blood vessels and improve the body's blood circulation.
Raisins also have high dietary nutrients. From vitamins and minerals to other compounds, such as antioxidants and polyphenols. These raisins not only stabilize the body but also help in preventing oxidative damage to the cells.
Therefore, eating raisins can greatly help if consumed in the appropriate amount.
Disclaimer: Tips and suggestions mentioned in the article are for general information purpose only and should not be taken as professional medical advice. Please consult a doctor before starting any fitness regime or medical advice.
|
english
|
Linux Commands Cheat Sheet PDF read online or download for free from the www.loggly.com link given at the bottom of this article.
Linux cheat sheet offers a set of commands that you can use for quick reference. Remembering every command is not possible and it can be quite daunting for a novice user. The good news is that you don’t need to remember each command. Only a very small subset of those commands are used on a day-to-day basis.
One of the main advantages of a command line interface is that it allows users to type in commands that can produce immediate results. Those familiar with command-lines find this method quick and simple.
|Lists files and directories with detailed information like permissions,size, owner, etc.
|Joins two files (file1, file2) and stores the output in a new file (file3)
You can download the Linux Commands Cheat Sheet PDF using the link given below.
|
english
|
package net.vortexdata.tsqpf_plugin_groupsystem.commands.chat;
import com.github.theholywaffle.teamspeak3.TS3Api;
import com.github.theholywaffle.teamspeak3.api.event.TextMessageEvent;
import com.github.theholywaffle.teamspeak3.api.wrapper.*;
import net.vortexdata.tsqpf.listeners.ChatCommandInterface;
import net.vortexdata.tsqpf.plugins.*;
import net.vortexdata.tsqpf_plugin_groupsystem.*;
import net.vortexdata.tsqpf_plugin_groupsystem.exceptions.*;
import java.util.*;
public class CGroup implements ChatCommandInterface {
private TS3Api api;
private RequestManager requestManager;
private GroupManager groupManager;
private PluginConfig config;
private PluginLogger logger;
public CGroup(TS3Api api, PluginConfig config, RequestManager requestManager, PluginLogger logger) {
this.api = api;
this.config = config;
this.requestManager = requestManager;
this.groupManager = new GroupManager(config, api, logger);
this.logger = logger;
}
@Override
public void gotCalled(TextMessageEvent textMessageEvent) {
String[] command = textMessageEvent.getMessage().split(" ");
if (command.length > 1) {
if (command[1].equalsIgnoreCase("request")) {
if (command.length > 2) {
if (GroupNameChecker.checkName(command[2])) {
// Check if user is already member of a group
int[] groups = api.getClientByUId(textMessageEvent.getInvokerUniqueId()).getServerGroups();
String[] whitelistedGroupsRaw = config.readValue("whitelistGroupIds").split(",");
ArrayList<Integer> whitelistedGroups = new ArrayList<>();
for (String rGroup : whitelistedGroupsRaw) {
whitelistedGroups.add(Integer.parseInt(rGroup));
}
for (int i = 0; i < groups.length; i++) {
boolean isOneWhitelisted = false;
for (int j = 0; j < whitelistedGroups.size(); j++) {
if (groups[i] == whitelistedGroups.get(j)) {
isOneWhitelisted = true;
}
}
if (!isOneWhitelisted) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestFailedAlreadyMemberOfGroup"));
return;
}
}
// Check if user has already requested this group or if group name is already taken
try {
requestManager.getGroupRequestByUUID(textMessageEvent.getInvokerUniqueId());
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestFailedAlreadyPending"));
return;
} catch (PendingGroupNotFoundException e) {
// Ignore and continue
}
try {
requestManager.getGroupRequestByName(command[2]);
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestFailedNameTaken"));
return;
} catch (PendingGroupNotFoundException e) {
// Ignore and continue
}
requestManager.createRequest(command[2], textMessageEvent.getInvokerUniqueId());
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestSuccess"));
ArrayList<String> adminBroadcast = new ArrayList<>();
ArrayList<Integer> adminGroups = new ArrayList<>();
String[] adminGroupsRaw = config.readValue("adminGroupIds").split(",");
for (String s : adminGroupsRaw)
adminGroups.add(Integer.parseInt(s));
for (int i = 0; i < adminGroups.size(); i++) {
for (ServerGroupClient c : api.getServerGroupClients(adminGroups.get(i))) {
adminBroadcast.add(c.getUniqueIdentifier());
}
}
for (String uid : adminBroadcast) {
try {
api.sendPrivateMessage(api.getClientByUId(uid).getId(), config.readValue("messageAdminGroupRequestPending"));
} catch (Exception e) {
logger.printDebug("Failed to send new request broadcast to admins, maybe none are online? Appending details: " + e.getMessage());
}
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestFailedNameInvalid"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestSyntax"));
}
} else if (command[1].equalsIgnoreCase("validate") && isInvokerAdmin(textMessageEvent.getInvokerUniqueId())) {
if (command.length > 2) {
try {
requestManager.getGroupRequestByName(command[2]);
requestManager.validateRequest(command[2], textMessageEvent.getInvokerUniqueId());
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestAccepted"));
} catch (PendingGroupNotFoundException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestNotFound"));
return;
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestSyntax"));
}
} else if (command[1].equalsIgnoreCase("delete")) {
if (isInvokerAdmin(textMessageEvent.getInvokerUniqueId())) {
if (command.length > 2) {
ArrayList<ServerGroup> groups = new ArrayList<>(api.getServerGroups());
for (ServerGroup g : groups) {
if (g.getName().equalsIgnoreCase(command[2])) {
try {
groupManager.deleteGroup(g.getId());
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupDeleteSuccess"));
} catch (GroupNotFoundException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupDeleteFailedNotFound"));
} catch (WhitelistedGroupDeletionException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupDeleteFailedBlacklist"));
}
return;
}
}
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupDeleteFailedNotFound"));
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupDeleteSyntax"));
}
} else if (command.length > 2) {
if (isInvokerGroupOwner(textMessageEvent.getInvokerUniqueId(), command[2])) {
try {
api.removeClientFromServerGroup(Integer.parseInt(config.readValue("groupOwnerGroupId")), api.getClientByUId(textMessageEvent.getInvokerUniqueId()).getDatabaseId());
groupManager.deleteGroup(command[2]);
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupDeleteSuccess"));
} catch (GroupNotFoundException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupDeleteNoGroup"));
} catch (WhitelistedGroupDeletionException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupDeleteNoPermission"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageErrorNoPermission"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupDeleteSyntax"));
}
} else if (command[1].equalsIgnoreCase("requests") && isInvokerAdmin(textMessageEvent.getInvokerUniqueId())) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), "Group Name || Owner UID");
ArrayList<GroupRequest> pending = requestManager.getPendingRequests();
if (pending.size() == 0) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestListNoRequests"));
return;
}
for (GroupRequest gr : pending) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), gr.getGroupname() + " || " + gr.getInvokerUUID());
}
} else if (command[1].equalsIgnoreCase("decline") && isInvokerAdmin(textMessageEvent.getInvokerUniqueId())) {
if (command.length > 2) {
if (command.length > 3) {
String reason = "";
for (int i = 3; i < command.length; i++) {
reason += command[i] + " ";
}
if (requestManager.declineRequest(command[2], reason)) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestDeclined") + reason);
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestDeclinedFailed"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestDeclinedMissingReason"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageAdminGroupRequestSyntax"));
}
} else if (command[1].equalsIgnoreCase("cancel")) {
if (command.length > 2) {
if (command[2].equalsIgnoreCase("request")) {
if (requestManager.cancelRequest(textMessageEvent.getInvokerUniqueId())) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestCancelSuccess"));
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestCancelFailed"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestCancelSyntax"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupRequestCancelSyntax"));
}
} else if (command[1].equalsIgnoreCase("invite")) {
if (command.length > 2) {
int numberOfKeysToGenerate = 0;
try {
numberOfKeysToGenerate = Integer.parseInt(command[2]);
if (numberOfKeysToGenerate > 5) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupInviteFailedMaxInviteGenerationAtATimeExceeded"));
return;
} else if (numberOfKeysToGenerate < 1) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupInviteFailedInvalidAmount"));
} else {
ArrayList<ServerGroup> groups = new ArrayList<>(api.getServerGroupsByClient(api.getClientByUId(textMessageEvent.getInvokerUniqueId())));
int groupId = -1;
String[] adminGroupsRaw = config.readValue("adminGroupIds").split(",");
for (int i = 0; i < groups.size(); i++) {
for (int j = 0; j < adminGroupsRaw.length; j++) {
if (Integer.parseInt(adminGroupsRaw[j]) != groups.get(i).getId())
groupId = groups.get(i).getId();
}
}
if (groupId <= 0)
return;
for (int i = 0; i < numberOfKeysToGenerate; i++) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), groupManager.createInvite(groupId));
}
}
} catch (NumberFormatException e) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupInviteFailedInvalidAmount"));
}
} else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageGroupInviteSyntax"));
}
}
else if (command[1].equalsIgnoreCase("invites")) {
if (!isInvokerAdmin(textMessageEvent.getInvokerUniqueId())) {
int[] clientGroups = api.getClientByUId(textMessageEvent.getInvokerUniqueId()).getServerGroups();
boolean wasATokenFound = false;
for (int i : clientGroups) {
ArrayList<PrivilegeKey> codes = new ArrayList<>(groupManager.getInviteCodes(i));
if (codes != null && codes.size() > 0) {
wasATokenFound = true;
for (PrivilegeKey key : codes)
api.sendPrivateMessage(textMessageEvent.getInvokerId(), key.getToken());
break;
}
}
if (!wasATokenFound) {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), "There are no open invite keys.");
}
}
}
}
else {
api.sendPrivateMessage(textMessageEvent.getInvokerId(), config.readValue("messageSyntax"));
}
}
public boolean isInvokerGroupOwner(String uid, String groupName) {
ArrayList<ServerGroup> invokerGroups = new ArrayList<>(api.getServerGroupsByClient(api.getClientByUId(uid)));
int groupOwnerId = Integer.parseInt(config.readValue("groupOwnerGroupId"));
for (int i = 0; i < invokerGroups.size(); i++) {
if (invokerGroups.get(i).getId() == groupOwnerId) {
return true;
}
}
return false;
}
public boolean isInvokerAdmin(String uid) {
ArrayList<ServerGroup> invokerGroups = new ArrayList<>(api.getServerGroupsByClient(api.getClientByUId(uid)));
ArrayList<Integer> adminGroups = new ArrayList<>();
String[] adminGroupsRaw = config.readValue("adminGroupIds").split(",");
for (String s : adminGroupsRaw) {
adminGroups.add(Integer.parseInt(s));
}
boolean isAdmin = false;
for (int i = 0; i < invokerGroups.size(); i++) {
if (isAdmin)
break;
for (int j = 0; j < adminGroups.size(); j++) {
if (invokerGroups.get(i).getId() == adminGroups.get(j)) {
isAdmin = true;
break;
}
}
}
return isAdmin;
}
}
|
java
|
use crate::dom::WebsysDom;
use dioxus_core::{VNode, VirtualDom};
use wasm_bindgen::JsCast;
use web_sys::{Comment, Element, Node, Text};
#[derive(Debug)]
pub enum RehydrationError {
NodeTypeMismatch,
NodeNotFound,
VNodeNotInitialized,
}
use RehydrationError::*;
impl WebsysDom {
// we're streaming in patches, but the nodes already exist
// so we're just going to write the correct IDs to the node and load them in
pub fn rehydrate(&mut self, dom: &VirtualDom) -> Result<(), RehydrationError> {
let root = self
.root
.clone()
.dyn_into::<Node>()
.map_err(|_| NodeTypeMismatch)?;
let root_scope = dom.base_scope();
let root_node = root_scope.root_node();
let mut nodes = vec![root];
let mut counter = vec![0];
let mut last_node_was_text = false;
// Recursively rehydrate the dom from the VirtualDom
self.rehydrate_single(
&mut nodes,
&mut counter,
dom,
root_node,
&mut last_node_was_text,
)
}
fn rehydrate_single(
&mut self,
nodes: &mut Vec<Node>,
place: &mut Vec<u32>,
dom: &VirtualDom,
node: &VNode,
last_node_was_text: &mut bool,
) -> Result<(), RehydrationError> {
match node {
VNode::Text(t) => {
let node_id = t.id.get().ok_or(VNodeNotInitialized)?;
let cur_place = place.last_mut().unwrap();
// skip over the comment element
if *last_node_was_text {
if cfg!(debug_assertions) {
let node = nodes.last().unwrap().child_nodes().get(*cur_place).unwrap();
let node_text = node.dyn_into::<Comment>().unwrap();
assert_eq!(node_text.data(), "spacer");
}
*cur_place += 1;
}
let node = nodes
.last()
.unwrap()
.child_nodes()
.get(*cur_place)
.ok_or(NodeNotFound)?;
let _text_el = node.dyn_ref::<Text>().ok_or(NodeTypeMismatch)?;
// in debug we make sure the text is the same
if cfg!(debug_assertions) {
let contents = _text_el.node_value().unwrap();
assert_eq!(t.text, contents);
}
*last_node_was_text = true;
self.interpreter.set_node(node_id.0, node);
// self.nodes[node_id.0] = Some(node);
*cur_place += 1;
}
VNode::Element(vel) => {
let node_id = vel.id.get().ok_or(VNodeNotInitialized)?;
let cur_place = place.last_mut().unwrap();
let node = nodes.last().unwrap().child_nodes().get(*cur_place).unwrap();
use smallstr::SmallString;
use std::fmt::Write;
// 8 digits is enough, yes?
// 12 million nodes in one page?
let mut s: SmallString<[u8; 8]> = smallstr::SmallString::new();
write!(s, "{}", node_id).unwrap();
node.dyn_ref::<Element>()
.unwrap()
.set_attribute("dioxus-id", s.as_str())
.unwrap();
self.interpreter.set_node(node_id.0, node.clone());
// self.nodes[node_id.0] = Some(node.clone());
*cur_place += 1;
nodes.push(node.clone());
place.push(0);
// we cant have the last node be text
let mut last_node_was_text = false;
for child in vel.children {
self.rehydrate_single(nodes, place, dom, child, &mut last_node_was_text)?;
}
for listener in vel.listeners {
self.interpreter.NewEventListener(
listener.event,
listener.mounted_node.get().unwrap().as_u64(),
self.handler.as_ref().unchecked_ref(),
);
}
place.pop();
nodes.pop();
if cfg!(debug_assertions) {
let el = node.dyn_ref::<Element>().unwrap();
let name = el.tag_name().to_lowercase();
assert_eq!(name, vel.tag);
}
}
VNode::Placeholder(el) => {
let node_id = el.id.get().ok_or(VNodeNotInitialized)?;
let cur_place = place.last_mut().unwrap();
let node = nodes.last().unwrap().child_nodes().get(*cur_place).unwrap();
self.interpreter.set_node(node_id.0, node);
// self.nodes[node_id.0] = Some(node);
*cur_place += 1;
}
VNode::Fragment(el) => {
for el in el.children {
self.rehydrate_single(nodes, place, dom, el, last_node_was_text)?;
}
}
VNode::Component(el) => {
let scope = dom.get_scope(el.scope.get().unwrap()).unwrap();
let node = scope.root_node();
self.rehydrate_single(nodes, place, dom, node, last_node_was_text)?;
}
}
Ok(())
}
}
|
rust
|
<!DOCTYPE html>
<html lang="en-us">
<head>
<meta charset="UTF-8">
<title>About | <NAME></title>
<link rel="stylesheet" href="assets\css\reset.css">
<link rel="stylesheet" href="assets\css\style.css">
</head>
<body>
<div class="navBar">
<div class="container">
<a href="index.html" id="navh1"><NAME></a>
<div class="navLinks">
<a href="index.html">About</a>
<a href="portfolio.html">Portfolio</a>
<a href="contact.html">Contact</a>
</div>
</div>
</div>
<div class="container" id="mainContainer">
<section class="mainSection">
<h1>About Me</h1>
<img src="assets/images/headshot (small & square).jpg" id="myPicture" alt="<NAME>">
<p>I am an aspiring web developer living in the bay area, currently enrolled in UC Berkeley Extension's coding bootcamp and always looking for new ways to expand my coding skill set.</p>
<p>My interests include philosophy, technology, politics, writing, and gaming, but that's just to name a few, as I tend to find this world to be more than full of interesting things.</p>
<p>When I'm not working on honing my coding skills, I enjoy rock climbing at my local climbing gym, or getting outside to climb or hike whenever I can. I am also an avid PC gamer, and have enjoyed building and updating the parts of my own PC for gaming as well as adding to my unreasonably large and ever-growing library of games.</p>
</section>
</div>
<footer>
<div class="container">
Copyright©
</div>
</footer>
</body>
</html>
|
html
|
# Concepts-of-Programming-language
### This is a Course assignment of Concepts-of-Programming-language at the Faculty of Computers and Artificial Intelligence - Cairo University.
|
markdown
|
Holi is the occasion of colours and bliss in India and every year Indians commend this celebration with extraordinary fun. This year the celebration will be hung on March 20 and 21, 2019. But the festival also comes with water, so make sure that you have some waterproof gadgets amid the celebration which will be not get harmed as a result of water. Here is the list of devices which you can use during the celebration without agonizing over the water harm.
Smartphones are important for everyone, and nobody wants it to get harmed by water. So as to shield your cell phone from water damage, you can purchase a waterproof case from online e-commerce sites. In case you already have a waterproof smartphone, then there is no use of buying one.
If you are a music lover and would prefer not to miss the Holi beats during your gathering with friends and family then you can choose the JBL Charge speakers which come with water-proof certification. The company also guarantees that it is fit for conveying 20 hours of battery life in a single charge. So you can pick these speakers for your Holi party with no stresses.
There are other brands in the market which offers the same waterproof feature on their speakers, so you can also opt for those brands too.
You can utilize Xiaomi Mi Bands, Honor band, Huawei band, Oraimo Tempo 2 and other fitness trackers during the celebration without stressing over the water harm in light of the fact that all these gadgets accompany water-proof IP67 certification. Also, it is compatible with the iOS and Android platforms. The health trackers will keep you updated with the pulse sensor and much more even when you are doused in hues.
On the off chance that you are the individual who wouldn't like to pass up a major opportunity any minute to catch this Holi celebration then GoPro Action cameras are the best gadget to snatch. The company has a tremendous line up of cameras from GoPro Hero4 to Hero7. All these action cameras have waterproof certification and you can even shoot and snap submerged recordings and pictures. There are other brands also who offers action cameras like Xiaomi, Fitup, SJcam and more. But we are recommending the GoPro because it is best in quality and stability.
If you would prefer not to use an action camera and stay with your DSLR then you can purchase these waterproof camera pocket on Amazon India or Flipkart which will shield you camera sensors from getting wet while clicking some astounding pictures.
|
english
|
<reponame>kuroro-tian/ppl.nn
#include "pmx_utils.h"
#include "ppl/nn/models/pmx/oputils/onnx/lstm.h"
using namespace std;
using namespace ppl::nn::onnx;
using namespace ppl::nn::pmx::onnx;
TEST_F(PmxTest, test_lstm) {
DEFINE_ARG(LSTMParam, lstm);
lstm_param1.activation_alpha = {0.23f};
lstm_param1.activation_beta = {0.33f};
lstm_param1.activations = {ppl::nn::onnx::LSTMParam::ACT_ELU};
lstm_param1.clip = 0.34;
lstm_param1.direction = ppl::nn::onnx::LSTMParam::DIR_REVERSE;
lstm_param1.hidden_size = 44;
lstm_param1.input_forget = 23;
MAKE_BUFFER(LSTMParam, lstm);
std::vector<float> activation_alpha = lstm_param3.activation_alpha;
std::vector<float> activation_beta = lstm_param3.activation_beta;
std::vector<ppl::nn::onnx::LSTMParam::activation_t> activations = lstm_param3.activations;
float clip = lstm_param3.clip;
ppl::nn::onnx::LSTMParam::direction_t direction = lstm_param3.direction;
int32_t hidden_size = lstm_param3.hidden_size;
int32_t input_forget = lstm_param3.input_forget;
EXPECT_FLOAT_EQ(0.23, activation_alpha[0]);
EXPECT_FLOAT_EQ(0.33, activation_beta[0]);
EXPECT_EQ(ppl::nn::onnx::LSTMParam::ACT_ELU, activations[0]);
EXPECT_FLOAT_EQ(0.34, clip);
EXPECT_EQ(ppl::nn::onnx::LSTMParam::DIR_REVERSE, direction);
EXPECT_EQ(44, hidden_size);
EXPECT_EQ(23, input_forget);
}
|
cpp
|
Posted On:
Namaste Australia!
Prime Minister of Australia and my dear friend, His Excellency Anthony Albanese, former Prime Minister of Australia, His Excellency Scott Morrison, Premier of New South Wales Chris Minns, Foreign Minister Penny Wong, Communications Minister Michelle Rowland, Energy Minister Chris Bowen, Leader of Opposition Peter Dutton, Assistant Foreign Minister Tim Watts, Honourable Members of the New South Wales Cabinet present here, Member of Parliament from Parramatta Dr Andrew Charlton, , Members of Parliament from Australia present here, Mayors, Deputy Mayors, Councillors, and the Indian diaspora living in Australia who have gathered here in such large numbers today! My greetings to all of you!
First of all, I acknowledge the traditional custodians of the lands that we are meeting here today. I pay my respect to the elders, past, present and emerging. I also celebrate all first nations people who may be with us today.
When I came here in 2014, I had made a promise to you that you would not have to wait for 28 years for any Prime Minister of India again. So here in this arena in Sydney, I am here once again and I have not come alone. Prime Minister Albanese has also come along with me. Mr. Prime Minister, despite your extremely busy schedule, you have taken time out for all of us. It expresses your affection for us Indians. What you just said conveys to us the love that Australia has for India. This year, I also had the opportunity to welcome the Prime Minister on the Indian soil in Ahmedabad. Today, he was with me while unveiling the foundation stone of Little India here. I express my heartfelt gratitude to him! Thank you, my friend, Anthony! This Little India is also a recognition of the contribution of the Indian community towards the development of Australia. I would like to thank the Premier of New South Wales, the Mayor, Deputy Mayor and Councillors of the City of Parramatta for this special honour.
I am glad that many people from the Indian diaspora in New South Wales are actively participating in public life and curving a niche for them. The Deputy Premier of the current New South Wales government Prue Car and Treasurer Daniel Mookhey are making a major contribution and just yesterday, Sameer Pandey was elected as Lord Mayor of Parramatta. I congratulate everyone! My heartiest congratulations!
Today, while these developments are taking place in Parramatta, there is information that Sailani Avenue has been named after the Indian soldier Nain Singh Sailani in Perth city of Western Australia. He attained martyrdom while fighting for the Australian army during the First World War. With utmost respect, I congratulate the leadership of Western Australia for this honour.
There was a time when it was said that 3C defines the relationship between India and Australia. What are these 3 Cs? These are - Commonwealth, Cricket and Curry. Later on it was said that India and Australia relations are based on 3 D i.e. Democracy, Diaspora and Dosti. Some people even said that India-Australia relations are based on 3 E or Energy , Economy and Education. That means, it was sometimes C, sometimes D, and sometimes E. This probably has been true in different periods. But the extent of historical relations between India and Australia is much greater than this, and do you know what the greatest foundation of all these relations is? Are you aware of it? No, the greatest foundation is Mutual Trust and Mutual Respect! This Mutual Trust and Mutual Respect has not developed only from the diplomatic relations of India and Australia. The real reason and the real strength behind it is you all, every single Indian living in Australia! You are its real strength. The real reason behind it is, more than 2.5 crore citizens of Australia.
There is definitely a geographical distance between us, but the Indian Ocean connects us. Even though our lifestyles are different, Yoga connects us now. We have been associated with cricket for a pretty long time, but now even tennis and films are connecting us. We may have different styles of cooking, but now MasterChef unites us. Even though festivals are celebrated differently in our country, we are connected with the lights of Diwali and the celebrations of Baisakhi. The two countries may have different languages being spoken but we have a plethora of schools teaching Malayalam, Tamil, Telugu, Punjabi, Hindi languages here.
The people of Australia, the residents here have a kind heart. They are so good and pure at heart that they accept this diversity of India with an open heart and that is why Parramatta Square becomes 'Paramatma' (divine) square for some; Wigram Street is known as Vikram Street and Harris Park becomes Harish Park for many people. By the way, I have heard that no one can beat the Chatkazz's Chaat, and jalebis of Jaipur Sweets in Harris Park. I have a request to all of you. Please take my friend PM Albanese to these places too. And friends, when it comes to food and chaat, it is natural to mention Lucknow. I have heard that there is a place named Lucknow near Sydney. But I don't know if chaat is available there too. Well, here too, there must be Delhi near Lucknow, isn't it? Indeed, there are so many streets like Delhi Street, Bombay Street, Kashmir Avenue, Malabar Avenue here in Australia that connect you to India. I was told that now India Parade is also going to start in Greater Sydney. I am also very delighted to know that here all of you have celebrated the 'Azaadi Ka Amrit Mahotsav' with great pomp and show. Several events have been organized in different city councils here. The Indian heart rejoices when the Sydney Opera House is lit up with the tricolour. India too was cheering on and so I express my special gratitude to the New South Wales Government for the same.
Our cricketing ties have also completed 75 years. The greater the excitement on the cricket field, the deeper is our friendship off the field. This time, many women cricket players from Australia also came to India for the first time to play IPL and friends, we are not only friends in good times. A good friend is not only a companion during good times, but also a companion at the time of sorrow. When the great Shane Warne passed away last year, crores of Indians had mourned along with Australia. It was like we had lost a family member.
You are all here in Australia, looking at the development here. All of you have had a dream that our India should also become a developed nation. Isn't it your dream? Isn't it your dream? Isn't it your dream? The dream that is in your heart, is also in my heart. This is my dream too. It is the dream of the 140 crore Indians.
India is not short of potential. India does not have a shortage of resources either. Today, the country which has the world's largest and the youngest talent factory is India. You are right, that is India. I am repeating this again. Today, the country which has the world's largest and youngest talent factory is India! It is India! It is India! And now I will place some facts in front of you. And I would like to know the correct answer from you. Ready? During this corona pandemic, the country which started the fastest vaccination programme in the world, that country is India, that country is? It's India! That country is India! Today the country which is the fastest growing economy in the world is - India. That country is India! That country is India! Today the country which is the number 1 smartphone data consumer in the world is India! That country is India! That country is India! Today the country which is number 1 in FinTech adoption rate is India! That country is India! That country is India! Today the country which is number 1 in the world in terms of milk production is India! That country is India! That country is India! Today the country which is number 2 in the world in terms of internet users is: India! That is India! Today, the country which is the second largest mobile manufacturer in the world, that country is India! That country is India! Today, the country which is at number 2 in the world in terms of Rice, Wheat, Sugarcane production is: India, that is India! Today the country which is at number 2 in fruit and vegetable production in the world is India, that is India! Today, the country which has the third largest startup ecosystem in the world is India, that is India! The country where the world's third largest automobile market is located is called India, that country is India! The country which has the third largest civil aviation market in the world is India, that country is India and now the country which is moving ahead with the goal of becoming a developed nation in the next 25 years is India, that country is India!
Today the IMF considers India as the bright spot of the global economy, and the World Bank believes that if anyone is challenging the Global Headwinds then it is India. Today, there is a crisis in the banking system in many countries of the world, but on the flip side, the strength of Indian banks is being praised all around. In the midst of the biggest crisis in the world in 100 years, India has made record exports last year. Today our Forex Reserve is touching new heights.
Our digital stake is an example of how India is working for the global good. You all are well aware of India's FinTech revolution. You might remember when I came here in 2014, I shared a dream with you. It was my dream that the poorest of the poor in India should have their own bank accounts. You will feel proud, friends; you will be proud of the fact that in the last 9 years, we have opened bank accounts of about 50 crore Indians i.e. about 500 million. And our success is not just limited to opening bank accounts. We didn't stop there. It has transformed the entire ecosystem of public service delivery in India. We have created a JAM Trinity or a JAM Trinity of Jan Dhan Bank Account, Mobile Phone and Aadhaar ID. This has made Direct Benefit Transfer (DBT) possible to crores of countrymen just with one click, and you will be more happy to know that in the last 9 years - this figure will also give you a lot of joy - in the last 9 years Rs 28 lakh crore i.e. more than 500 billion Australian dollars have been sent directly to the bank accounts of those in need. During the Corona period, many countries found it difficult to send money to their citizens, but India was one of those countries which was doing this work in the blink of an eye with one click. Universal Public Interface i.e. UPI has taken financial inclusion to a new height in India. Today 40 percent of the world's real time digital payments take place in India alone. If you have visited India recently, you must have seen that digital transactions are taking place everywhere, be it fruit, vegetable or pani puri carts, or tea stalls.
This digital revolution of India is not limited to FinTech only. India is developing modern systems. The Ease of Living of the people is increasing. An example of this is India's DigiLocker, which generates every document issued by the government from driving license to degrees and property papers, whatever the government issues. Nearly hundreds of types of documents are reflected in the digital locker. You do not need to store a physical copy. Just one password is enough. Now more than 15 crore i.e. more than 150 million Indians have joined it. Many such digital platforms are making Indians powerful today.
Today the world wants to know about every step and every achievement of India. It is quite natural looking at the world order towards which the contemporary world is heading and looking for the possibilities. India is a living civilization which is thousands of years old. India is the Mother of Democracy. We have molded ourselves according to the times but have always stuck to our fundamentals. We see the nation as a family and also consider the world as a family, 'Vasudhaiva Kutumbakam', and therefore looking at the theme of India's G-20 Presidency, it reflects how India lives by its ideals. As G20 Presidency, India says, 'One Earth, One Family, One Future'. When India sets massive goals in terms of solar energy to protect the environment, it says 'One Sun, One World, One Grid'. When India wishes the global community to be healthy, it says 'One Earth, One Health'. India is the country which sent medicines to more than 150 countries of the world during the Corona crisis. India is the country which has saved the lives of crores of people by giving away free vaccines to more than 100 countries. The spirit of service with which you also worked here during the time of Corona is the specialty of our culture. Today is the Martyrdom Day of the fifth Sikh Guru Shri Guru Arjun Dev Ji. Guruji's life has imparted the lesson of serving everyone. It was Guru Arjun Dev Ji who started the Dasvandha system. Seeking inspiration from there, even during Corona, the langars of many Gurdwaras helped people here. In that period, the kitchens of many temples were opened for the affected persons here. Students living and studying in Australia also came forward to help people in large numbers. Various social organizations also helped a lot of people during this period. Wherever Indians are, a humanitarian spirit remains within them.
Because of such works in the interest of humanity, today India is being called the Force of Global Good. Wherever there is a disaster, India is always ready to help. Whenever there is a crisis, India is ready to solve it. Today, whether it is to increase the use of solar energy through the International Solar Alliance, whether it is to create Disaster Resilient Infrastructure through mutual cooperation, whether it is to lead the International Big Cat Alliance, India has always been a binding force to unite different countries. Recently, when the earthquake led to devastation in Turkey, India extended a helping hand through Operation Dost. India sees its interests linked to the interests of all. 'Sabka Sath Sabka Vikas, Sabka Vishwas, Sabka Prayas' (everyone's support, everyone's development, everyone's faith and everyone's efforts) is not only the basis of our Domestic Governance but also the vision for Global Governance as well.
Today the Strategic Partnership between India and Australia is continuously growing deeper. Recently we have signed the Economic Cooperation and Trade Agreement (ECTA). It is estimated that trade between the two countries will more than double in the next five years. Now we are working on a Comprehensive Economic Cooperation Agreement. We are building Resilient and Reliable Supply Chains. This will not only boost the business of both the countries, but also instill new confidence in the world. Today there are many direct flights between India and Australia. The number of flights has increased over the years. Their number will increase further in the coming days. Both countries have also moved forward in recognizing each other's degrees and this will greatly benefit our students. A consensus has also been reached on the Migration and Mobility Partnership Agreement. This will make it easier for our Skilled Professionals to come to Australia and work here, and friends, as I am here, I am going to make an announcement. The demand of the Indian community in Brisbane will now be fulfilled. Soon a new Consulate of India will be opened in Brisbane.
India and Australia's deepening partnership will empower everyone who has faith in Maa Bharati. You have talent, you have the power of your skills and you also have your cultural values. These values play a major role in helping you blend in with the people of Australia. I just came from Papua New Guinea yesterday. There I dedicated the translation of Tamil literature Tirukkural in the local language. This translation has been done by a local Governor of Indian origin there. This is a living example of how even while living abroad, we should be proud of our roots and stay connected to our roots. You are also spreading the fragrance of Indian culture here in Australia. You are India's Cultural Ambassadors, India's Brand Ambassadors in Australia.
I want to demand something from you before I conclude. Will you give it to me? Your voice has weakened a bit. Will you give it to me? Sure? Promise? So I would urge you that whenever you come to India, whenever you come to India, bring at least one Australian friend and his family along with you. This will give them a better chance to understand and know India. You have come in such large numbers and I got the opportunity to meet you after a long time. I wish you good health, happiness and joy! Once again, my heartiest thanks to all of you!
Say along with me - Bharat Mata Ki Jai!
Bharat Mata Ki Jai!
Bharat Mata Ki Jai!
Thank you very much!
Read this release in:
|
english
|
Arsenal can end its winless streak at Liverpool when both sides meet this weekend, which would help it preserve its spot at the top of the Premier League, Arsenal manager Mikel Arteta said on Friday.
Arsenal, top of the table with 39 points from 17 matches, faces second-placed Liverpool on Saturday. The north London outfit’s last successful Premier League trip to Anfield came in 2012 - when Arteta was still playing for Arsenal.
“It is going to be a special atmosphere for both teams and it is strong opposition. We will prepare to win it and go for it - it will be an intense match,” Arteta told reporters.
“It is always great to be in the highest position in this league and we will try to maintain that, but we have to be intelligent to manage the game.
The Spanish manager provided an injury update on a trio of injured midfielders, saying: “Thomas Partey is still finalising his rehab. He hasn’t trained with the team yet.
Arteta also weighed in on Thursday’s European Court of Justice ruling that UEFA and FIFA contravened EU law when they prevented the formation of a Super League.
“We are very clear. It is exactly the same. We remain in the same position,” Arteta said. “We love playing in the Champions League and we’ll continue to do so.
Arsenal, who is among six Premier League clubs who signed up for the Super League project in 2021 before withdrawing amid fan protests, also posted a statement on Friday distancing itself from the Super League.
- IPL 2024 Auction - Proof of concept that money talks!
|
english
|
New Delhi: Newly-appointed Congress general secretary in-charge for eastern Uttar Pradesh, Priyanka Gandhi Vadra, made two political debuts Monday — a no-holds barred roadshow in Lucknow, and a blue-tick Twitter launch.
However, amid the political buzz surrounding the new entrant, Priyanka’s namesake and Congress spokesperson Priyanka Chaturvedi posted a nearly two-month-old image to applaud the success of the Lucknow rally.
Priyanka and Congress president Rahul Gandhi’s rally sounded the poll bugle in Uttar Pradesh ahead of the Lok Sabha elections due in April-May.
Of the four images Chaturvedi posted, three are shots of Priyanka and Rahul at the roadshow. However, the fourth image, clearly intended to demonstrate the turnout, is not from the Lucknow rally at all.
The image used by Chaturvedi is actually from a Congress rally in Telangana ahead of the assembly elections in December 2018.
At the time, the image was shared by Telangana Pradesh Congress Chief and former Indian cricketer Mohammed Azharuddin.
“Campaigning in my home state of Telangana is always more than special. The love and enthusiasm of the people is overwhelming,” Azharuddin wrote on 5 December.
The image was also shared on the same day by National Youth Congress Campaign in-charge Srivatsa.
In KCR's assembly constituency, Congress held one of the biggest ever roadshows ever in Telangana.
“In KCR’s (K. Chandrashekar Rao) assembly constituency, Congress held one of the biggest ever roadshows ever in Telangana,” wrote Srivatsa.
While the image she shared Monday is certainly of a roadshow, Chaturvedi missed the mark in identifying the location.
She deleted the tweet subsequently and posted correct images.
In collaboration with SM Hoaxslayer.
|
english
|
#pragma once
extern bool pbr;
class Material
{
private:
public:
unsigned int m_texAlbedo;
// TODO change to textures
unsigned int m_texMetallic;
unsigned int m_texNormal;
unsigned int m_texRoughness;
unsigned int m_texAo;
// Load Ao Roughness and Metallic on one texture
unsigned int m_texARM;
glm::vec4 m_color;
bool useNormalmap;
public:
Material(); // Flat color
Material(const std::string &textureFile, const std::string &size);
~Material(){};
void deleteTextures();
void setColor(glm::vec4 color) { m_color = color; }
void setUniforms(Shader &shader);
};
|
cpp
|
An impact of twitter: when I started on twitter I was researching disinformation to write a curriculum on how to identify it.
Then, seeing how little impact it had, I started just kind of trolling at people about their ignorance.
Ultimately, the design of twitter encourages trolling.
I will try harder to regroup and organize my thoughts and present them coherently.
Tweet 3 above - those ‘reading them’ not ‘trading them’.
Short-term edit function please!
Short-term edit function please!
|
english
|
{
"$schema": "https://raw.githubusercontent.com/marczinusd/hestia/master/src/Hestia.ConsoleRunner/config.schema.json",
"coverageReportLocation": "/home/marczinusd/dev/gatsby/coverage/lcov.info",
"repoRoot": "/home/marczinusd/dev/gatsby",
"sourceRelativePath": "packages",
"fileExtensions": [".ts"],
"statGranularity": "file",
"ignorePatterns": [],
"buildCommands": ["npm install --silent"],
"testCommands": ["npm run test:coverage"]
}
|
json
|
Kochi: Twenty-four labourers from outside the state were arrested by the police on Sunday in connection with the violence broke out at a labour camp in Kizhakkambalam, in the suburbs of Kochi, at Christmas night.
Eighteen people have been charged with attempt to murder on a sub inspector while six have been arrested for vandalising a police vehicle. All are workers of the Kizhakkambalam-based Kitex Group. Sabu M Jacob, the managing director of Kitex, on Sunday said the company had no role in the clash.
Five police officers, including the Kunnathunadu Police Station House Officer, were injured in violence that broke out in a guest-workers' camp in Kizhakkambalam here on Saturday. Kunnathunadu Police SHO Circle Inspector V T Shajan and four others were admitted to Kolenchery Medical College Hospital in the wee hours of Sunday.
The clashes erupted in the camp, where labourers of Kitex company were staying, in the middle of the night while Christmas celebration was going on.
According to the police, the officers reached the spot soon and a group of inebriated workers attacked them. They also set fire to one of the police jeeps at the spot and attacked locals, who were present at the time. Those who tried to capture the incident on their mobile phones were also beaten by the group.
"The workers had assaulted the police officers, including a Circle Inspector, who had reached the spot to resolve the arguments between two groups of labourers on Saturday night," the Kitex Group Managing Director Sabu Jacob told the media over phone.
He said that initially the camp security and the supervisors tried to intervene and resolve the issue, but they too were assaulted and thereafter, the police was called.
However, when the police arrived, the "uncontrollable" workers brutally attacked the officers, who were forced to retreat to safety, leaving their vehicles behind.
According to television reports, several people were injured in the clashes. The mob also hurled stones at vehicles and local residents. Two other vehicles were also damaged in the attack.
Police said the attackers were in an inebriated condition and as many as 500 cops, led by Aluva (Rural) Superintendent of Police K Karthick, were deployed in the area to control the situation.
"A special team headed by Perumbavoor DySP Anuj Paliwal has been constituted to probe the incident and nab the culprits as soon as possible," K Karthick told Manorama News on Sunday.
Jacob said that there was no criminal intent behind what happened and claimed that drugs were brought into the camp and some of the workers were probably under its influence, leading to them becoming "uncontrollable". He said his company would cooperate with the investigation.
An estimated 3,000 guest-workers were staying in the camp. The police have taken around 150 workers into custody in connection with the incident.
(With PTI inputs)
|
english
|
<filename>src/assets/items/items-json/17956.json
{
"id": 17956,
"name": "<NAME>",
"incomplete": false,
"members": false,
"tradeable": false,
"tradeable_on_ge": false,
"stackable": false,
"stacked": null,
"noted": false,
"noteable": false,
"linked_id_item": 2883,
"linked_id_noted": null,
"linked_id_placeholder": null,
"placeholder": true,
"equipable": false,
"equipable_by_player": false,
"equipable_weapon": false,
"cost": 1,
"lowalch": null,
"highalch": null,
"weight": 1.814,
"buy_limit": null,
"quest_item": true,
"release_date": "2004-05-18",
"duplicate": true,
"examine": "More powerful than a normal bow, useful against large game birds.",
"icon": "<KEY>
"wiki_name": "Ogre bow",
"wiki_url": "https://oldschool.runescape.wiki/w/Ogre_bow",
"wiki_exchange": null,
"equipment": null,
"weapon": null
}
|
json
|
Still, the silence continues to prevail in the Jammu and Kashmir on the recent article abrogation of 370 and 35(A). Though Pakistan has been making its desperate attempts in front of world countries to prove India as wrong on its decision, it is receiving opposite response everywhere.
On responding to the recent opinion piece written by the Prime Minister Imran Khan on Kashmir, Minister of external affairs S Jaishankar has expressed his opinion.
On speaking to the New York Times S Jaishankar said that Pakistan openly practices terrorism and there is no scope for negotiations until Islamabad stops funding to the recruitment of terror groups.
|
english
|
Mythily Sivaraman, untiring fighter for the rights of workers, women and victims of state brutality, dear comrade, friend and mentor to so many in the women’s and working class movements, succumbed to COVID-19 on May 30, 2021 at the age of 82. She was a lifelong communist.
Mythily grew up in a well-to-do Brahmin family in Chennai. She went to study at Syracuse University in the US in the mid-1960s at a time when the movement against the Vietnam war was at its height, when Black activism emerged in different parts of the country and a new wave of feminism was gaining strength. Mythily was an eager participant in the debates, discussions and campaigns around these issues.
After her graduation, she worked for nearly two years with the UN with the Committee on Decolonisation where she studied various aspects of colonisation and neo-colonialism. She was soon imbued with what was to be a life-long and passionate commitment to anti-imperialist struggles and she risked an illegal visit to Cuba that left an indelible impression of a new kind of society emerging.
Soon, Mythily gave up her UN job and returned to India, seeking people and organizations that she could work with. Her quest led her to meet Krishnammal and Jaganathan, followers of Vinoba Bhave, who were working with Dalits in coastal Tamil Nadu. It was with Krishammal and a CPI(M) member that Mythily visited Kilvenmani in East Thanjavur district immediately after the horrific atrocity in which 44 Dalit men, women and children had been burnt alive by the landlords. The embers of the blaze were still smouldering. Mythily wrote memorably:
“The scene was strangely reminiscent of a cremation ground, not so much an ordinary crematorium where dead bodies seek their painless extinction but an eerie place where tender childhood, bashful youth and loving motherhood met.
A few household articles, broken pots and pieces of bright glass bangles lay scattered. An emaciated dog lay still as if in a swoon outside a burnt hut while another kept sniffing the ground and whining. Feeble, moaning and muffled, tear-choked voices were heard and one noticed a few women and children looking lost and aimless. ” (Mainstream, 1969).
It was her writings that made the name Kilvenmani resound.
Soon after this, Mythily joined the CPI(M) and plunged into trade union work almost immediately but continued to write about the conditions of landless Dalits in the villages. Her writings are rare examples of analysis and empathy and in her trenchant expositions of caste oppression, she never loses sight of its class aspect:
“Untouchability is planted deep in the Hindu social structure and the Hindu psyche. Its ritual origins may be a matter for dispute but there is very little else disputable about untouchability…The traditional relationship of the untouchables to Hindu society was a cruelly ambivalent one. By holy writ they were set aside from society as people whose touch defiles; at whose sight the ritually pure must shudder; who must do penance for their and their ancestors’ sins by serving their betters. Like any other ritual sanction this was enforced by a tyrannical socio-political hierarchy. The second – and crucial – aspect of the untouchables’ relationship with Hindu society was their indispensable economic function. ” (Radical Review, which she edited, 1969)
Mythily started working in the Center of Indian Trade Unions with legendary working class leader, Com. V. P. Chinthan at a time of trade union militancy and of ruthless suppression of workers’ rights by the state government. She wrote several pieces delving into the workings of highly successful and highly exploitative corporates like Simpsons, TI Cycles, MRF, Metal Box and others. This was, however, only a small part of her trade union activities which comprised of everything from addressing gate-meetings, participating in long-drawn out negotiations and leading strike actions, demonstrations and protests.
At this time, she wrote a seminal and, perhaps, unique piece on The Relevance of Periyar: Caste or Class Struggle for the Radical Review in 1971. In this, she traced the roots and growth of the pre-independence anti-Brahmin movement in what was the Madras Presidency and the role played by Periyar. While Periyar’s vigorous promotion of rationalism, violent attacks on organised religion and, most especially, his revolutionary championing of women’s rights and castigation of hypocritical patriarchal norms met with her appreciation and approval, she was critical of the limitations of his understanding.
She says, in her article, “Like his approach to religion, Periyar failed to relate the inferior status of women to the socio-economic system of exploitation but attributed it exclusively to ‘Manliness’, a term connoting, according to him, the super-arrogance of man. ” She was also very conscious of the fact that “Centred in the non-Brahmin lower castes, Periyar’s movement concerned the Harijans only marginally. Apart from the Vaikkom struggle of the 1920s, Periyar never took up any of the major causes of the Harijans”. This explains much about the often violent confrontations between dominant backward caste communities and Dalits in Tamil Nadu today.
Despite her critical approach, she made a case for a greater understanding by the left-wing of the changes wrought by Periyar in the existing social order and his impact on Tamil politics. She wrote, quite prophetically, that ‘Periyarism is still not a spent force’. Written in 1971, this still rings true even today.
Mythily went on to write a series of articles through the ‘60s and 70’s on the DMK and the AIADMK. The questions she posed, the criticisms she made are as relevant today as they were five decades ago.
After the Emergency, Mythily’s life changed course again as she became more involved in the growing women’s movement in Tamil Nadu. She worked very closely with two intrepid veterans, K. P. Janakiammal and Papa Umanath in the state-level Democratic Women’s Association and then, in l981, in the Tamil Nadu unit of the All India Democratic Women’s Association of which she was a founder-member. Mythily now immersed herself in the study of women’s issues, in writing about them in Tamil for her organisation’s journal and other publications, in taking classes for women activists and members and in surveys, campaigns and struggles. Female foeticide, sexual violence and state violence were important issues that she addressed through all these activities.
One particular case in which her intervention proved extremely important was that of the inhuman atrocities perpetrated by officials from the forest, revenue and police departments on the inhabitants of a small, remote Adivasi hamlet, Vachati, in 1992 on the suspicion that they were supporters of the sandalwood smuggler, Veerappan. At least 18 tribal women and young girls were raped.
Mythily and Papa Umanath were the first to visit the village and interview the victims. It was Mythily who compiled and drafted the documents of the case that she represented before the National Commission for Scheduled Castes and Scheduled Tribes. The state government was adamant in denying justice to the victims but Mythily and her comrades in the AIDWA and CPI(M) were relentless in their pursuit of justice. After 19 years of trials in the courts, all the accused were finally arrested and compensation was paid to the victims.
Mythily never enjoyed good health. She suffered from migraines and other ailments. Her commitment to the cause to which she dedicated her life made her think, write and work at a pace that took a heavy toll. Remarkably, in the 1990s, in the midst of constant activity and deteriorating health, she pushed herself to research and write a remarkable memoir of her grandmother, Subbalakshmi, who was married at 11 and became a mother at 14.
In her circumscribed life, Mythily recognised the lives of millions of Indian women, including those who belonged to a privileged background but were thwarted by overweening patriarchy. Her book Fragments of a Life: A Family Archive is a haunting and poignant tribute to both her grandmother and her own painstaking scholarship and determination.
The last 15 years of her life were overshadowed by her withdrawal from public life necessitated by the onset of Alzheimer’s. Her husband and comrade, Karunakaran, who had decided early in their marriage that she would be the activist because of her greater abilities and he would take care of other responsibilities in the home, her daughter, Kalpana and son-in-law Balaji, all lived with her. When she was well, all three of them were fully involved with her work and ventures and, when she fell ill, they cared for her with love and sensitivity.
Mythily left us on May 30 but she leaves behind not only memories of a valuable life but also a significant body of work that will provide illumination, direction and much wisdom for those who have chosen the path that she had and for many others.
Subhashini Ali is a former member of parliament from Kanpur and politburo member of the Communist Party of India (Marxist).
|
english
|
Copenhagen, April 21 (IANS) The Defence Ministers of Denmark and the Netherlands announced the donation of 14 Leopard 2A4 main battle tanks to Ukraine.
A joint statement issued by the the Ministers said the two countries intend to jointly acquire, refurbish and deliver, at an estimated cost of 165 million euros ($181 million) "equally divided between the two nations" the tanks from early 2024, reports Xinhua news agency.
"In this way, we will jointly take part in the 'Leopard 2 coalition', supported by many partners and allies," Troels Lund Poulsen, Denmark's acting Defence Minister, said in the statement.
The declaration refers to an international tank coalition consisting of "a number of NATO countries" established to donate Leopard 2 and other modern tanks donated by the US, the UK and France.
The Danish government has already received approval from its Foreign Policy Council for the collaboration with the Netherlands, and the acting Defence Minister will now inform the other 50 countries behind the Ukraine Defence Contact Group (UDCG) of the intended donation when they meet on Friday at Ramstein Airbase in Germany.
"The formal conclusion of the collaboration is of course conditional on grant-related authority being granted from the Finance Committee," the Ministry of Defence press release said.
The announcement follows a decision made in February 2023, when the Danish government entered into a partnership with Germany and the Netherlands to donate at least 100 Leopard 1A5 tanks, the first of which are "expected to be ready for Ukrainian training within the coming weeks", the Ministry added.
Disclaimer: This story has not been edited by the Sakshi Post team and is auto-generated from syndicated feed.
|
english
|
<filename>index/b/baked-whiting.json
{
"directions": [
"Preheat oven to 350 degrees F (175 degrees C).",
"Place whiting fillets in a baking dish and add enough milk to cover the entire bottom of the dish. Season fillets with garlic powder, onion powder, paprika, and salt. Top each fillet with at least 3 pieces tomato. Add butter to each fillet. Squeeze 1 lemon half over each fillet.",
"Bake in the preheated oven until fish flakes easily with a fork, 30 to 45 minutes."
],
"ingredients": [
"4 whiting fish fillets, or more to taste",
"1/2 cup milk, or as needed",
"1 pinch garlic powder, or more to taste",
"1 pinch onion powder, or more to taste",
"1 pinch paprika, or more to taste",
"salt to taste",
"1 Roma (plum) tomato, diced",
"4 teaspoons butter, or more to taste",
"2 lemon, juiced, or more to taste (optional)"
],
"language": "en-US",
"source": "allrecipes.com",
"tags": [],
"title": "Baked Whiting",
"url": "http://allrecipes.com/recipe/239832/baked-whiting/"
}
|
json
|
After a midweek round of games in Europe that had everyone asking for more, attention shifts to Round 35 of the Premier League this weekend.
Manchester City and Liverpool experienced contrasting fortunes in the UEFA Champions League. Both sides will be gunning for the respective three points needed to keep themselves in the title hunt.
After its VAR-assisted aggregate defeat of the Cityzens, Spurs will be going back for more of the same. Arsenal and Chelsea made it to the semifinals of the Europa League.
Both sides will want to sew up UCL qualification without having to wait to win the UEL title.
The previous round of matches got off to a flying start as a previously on-form Leicester City lost at home by 1-0 to Newcastle United.
Tottenham Hotspur walloped already-relegated Huddersfield Town 4-0 thanks to a Lucas Moura hat-trick.
Southampton beat a deflated Wolves side 3-1 while Fulham shocked Everton with a 2-0 win at Craven Cottage.
Brighton was disgraced 5-0 at home by Bournemouth with the dynamic duo of Ryan Fraser and Calumm Wilson wreaking havoc.
Manchester United needed two Paul Pogba penalties to see off West Ham by 2-1 as Burnley beat Cardiff City 2-0.
On Sunday, Manchester City thrashed Crystal Palace 3-1 with Raheem Sterling getting a brace. In the weekend’s star match, a screamer from Mo Salah was the highlight as Liverpool comfortably beat Chelsea 2-0.
On Monday, Arsenal recorded its first away clean sheet of the season as they beat Watford 1-0.
The action starts on a high note as Manchester City will seek instant revenge against Tottenham Hotspurs in the lunchtime kickoff.
It is Huddersfield Town up against Watford while at the London Stadium, West Ham welcomes Leicester City.
Bournemouth play Fulham in what is expected to be a high-scoring affair as Wolves entertain Brighton and Newcastle United welcome Southampton to St James’ Park.
On Sunday, Everton play Manchester United while Liverpool is away at a desperate Cardiff City.
Arsenal take on Crystal Palace in a London derby while on Monday, Chelsea tackle Burnley at Stamford Bridge.
Manchester City vs Tottenham Hotspur (G/G)
Huddersfield vs Watford (Over 1.5)
West Ham vs Leicester City (G/G)
Bournemouth vs Fulham (Over 2.5)
Wolves vs Brighton (1X)
Newcastle United vs Southampton (Over 1.5)
Everton vs Manchester United (1X)
Cardiff City vs Liverpool (2)
Arsenal vs Crystal Palace (1)
Chelsea vs Burnley (Over 1.5)
|
english
|
TCL has unveiled the pricing for its new 6-Series 8K TV that it announced at CES 2021 earlier this year. When it launches in August, the 65-inch TCL 65R648 will cost $2,199 – while the 75-inch version, the TCL 75R648, comes in at a cool $2,999.
Both prices undercut the 8K TVs we’ve seen this year from Samsung, LG and Sony, however it’s only by a few hundred dollars rather than a few thousand like we had hoped.
The reason expectations were so high was because traditionally the 6-Series has started off around $600 and still managed to pack in features like quantum dot, Mini LED, and Dolby Vision and Atmos.
The new 6-Series 8K has all of those features in addition to its 8K resolution, but its price is nearly four times as much as the 55-inch 6-Series we saw last year.
In TCL’s defense, the company never claimed the 6-Series 8K would have the same pricing as its regular 6-Series 4K line. Instead, TCL hangs its hat on creating TVs that have similar performance to the competition at a lower price – which seems to be the case for the new 6-Series, but we’ll need to put it through its paces before we can say that with any certainty.
Analysis: Is any 8K TV worth the investment right now?
Whether or not an 8K TV is worth the investment right now is a subject of debate amongst home entertainment enthusiasts right now. Some say that the lack of native 8K content and publicly broadcasted 4K shows indicate that we’re not ready to jump up to 8K while others claim that 8K offers the necessary resolution for screen sizes larger than 65 inches.
Both arguments have their merits, but ultimately it will come down to how much you’re willing to spend on a new TV – whether that’s just a few hundred for a great 4K TV or now a few thousand for the most affordable 8K TV.
As for the new TCL R648 in particular, it does present an appealing proposition on paper – it’s an 8K Mini LED TV with quantum dot for the same cost as some high-end 4K TVs. We’ll need to spend some more time with it to see how it stacks up against the 4K TVs in its price range and the 8K TVs it’s trying to undercut, but on paper it seems like a good value... just maybe not as good of a value proposition as we had hoped.
Get the hottest deals available in your inbox plus news, reviews, opinion, analysis, deals and more from the TechRadar team.
Nick Pino is Managing Editor, TV and AV for TechRadar's sister site, Tom's Guide. Previously, he was the Senior Editor of Home Entertainment at TechRadar, covering TVs, headphones, speakers, video games, VR and streaming devices. He's also written for GamesRadar+, Official Xbox Magazine, PC Gamer and other outlets over the last decade, and he has a degree in computer science he's not using if anyone wants it.
|
english
|
<gh_stars>0
.getStartedButton,.out,.hover,.inner{
top: 0px;
left: 0px;
}
.out,.hover,.inner{
position: absolute;
width: 100%;
height: 100%;
}
.getStartedButton,.hover,.out{
border-radius: 3rem;
text-align: center;
}
.getStartedButton:hover .hover,
.getStartedButton:hover .inner {
transform: translateX(0);
}
.hover,.inner{
transition: transform .5s cubic-bezier(.75,0,.25,1);
}
.getStartedButton{
position: relative;
display: block;
overflow: hidden;
text-decoration: none;
width: 12rem;
height: 2.5rem;
color: snow;
font-size: 1.1rem;
letter-spacing: 0.2ch;
font-weight: 400;
}
.out{
border: 2px solid snow;
line-height: calc(2.5rem - 4px);
}
.hover{
overflow: hidden;
background-color: snow;
transform: translateX(-100%);
}
.inner{
line-height: 2.5rem;
color: #3473a0;
transform: translateX(100%);
}
|
css
|
<reponame>mmatur/go-semaphoreci
package v2
import (
"net/http"
)
// TokenTransport HTTP transport for API authentication
type TokenTransport struct {
Token string
// Transport is the underlying HTTP transport to use when making requests.
// It will default to http.DefaultTransport if nil.
Transport http.RoundTripper
}
// RoundTrip executes a single HTTP transaction
func (t *TokenTransport) RoundTrip(req *http.Request) (*http.Response, error) {
enrichedReq := &http.Request{}
*enrichedReq = *req
enrichedReq.Header = make(http.Header, len(req.Header))
for k, s := range req.Header {
enrichedReq.Header[k] = append([]string(nil), s...)
}
if t.Token != "" {
enrichedReq.Header.Set("Authorization", "Token "+t.Token)
}
return t.transport().RoundTrip(enrichedReq)
}
// Client Creates a new HTTP client
func (t *TokenTransport) Client() *http.Client {
return &http.Client{Transport: t}
}
func (t *TokenTransport) transport() http.RoundTripper {
if t.Transport != nil {
return t.Transport
}
return http.DefaultTransport
}
|
go
|
116/7 (17. 0 ov)
119/4 (16. 1 ov)
172/7 (20. 0 ov)
157 (20. 0 ov)
Catch all the photos from 2nd Test between Bangladesh and South Africa.
Mushfiqur and Mahmudullah stiched an unbeaten 68-run stand to guide their team out of trouble.
Watch Dale Steyn run through Sri Lanka Test line-up at Galle.
The highlight of the session was Dale Steyn taking his 400th Test wicket.
South African fast bowler Dale Steyn became the 13th bowler to claim 400 Test wickets in the history of cricket.
Steyn dismissed Tamim Iqbal, who edged the delivery to Hashim Amla at the slips.
Dale Steyn completed 400 wickets in Test cricket during the second Test between Bangladesh and South Africa.
Bangladesh users can catch the live streaming of the first day of the second Test here.
There is rain forecasted at Dhaka during the second Test as well.
Bangladesh will take on South Africa in the 2nd and final Test at Dhaka after the first game was washed away by rain.
|
english
|
Another two suspected drug peddlers were killed in a purported gunfight with members of Rapid Action Battalion (Rab) at Karamja village in Rajshahi on Thursday night.
The identities of the deceased could not be known yet.
Tipped off, a team of Rab-5 conducted a drive in the area around 11 pm, said its deputy commander Major SM Ashraful Islam.
Sensing presence of the elite force, the alleged drug traders reportedly opened fire on the Rab troops.
When the elite force members fired back in 'self-defence', the 'drug pushers' fled the scene.
According to the Rab officials, they recovered two people injured with bullets and took them to Rajshahi Medical College Hospital where doctors declared them dead.
Huge drugs and arms were also recovered from the scene, they claimed.
|
english
|
package Database.Spt;
import Exporter.Limiter;
import Workspace.Debugging;
import Workspace.Formalities;
import java.util.ArrayDeque;
public class UsingProgramming extends Debugging {
private static final String synX1328String = "FCFS:";
private static final double synX1327double = 0.0723346947180864;
private static final double synX1326double = 0.37440675519944433;
private static final boolean synX1325boolean = false;
private static final int synX1324int = 0;
private static final boolean synX1323boolean = true;
private static final int synX1322int = 1;
private static final int synX1321int = -616396346;
static double designators = 0.6485667777281731;
private ArrayDeque<Formalities> poisedDipper = null;
public synchronized void bpsRetick() {
int littleRoll;
littleRoll = synX1321int;
if (liveOutgrowth != null) {
liveOutgrowth.layPouringMoment(liveOutgrowth.conveyWalkingAmount() + synX1322int);
if (liveOutgrowth.conveyWalkingAmount() == liveOutgrowth.arrivePrezWingspan()) {
liveOutgrowth.fixedEscapeOpportunity(this.receiveContemporaryTicktack());
this.carriedMechanism.addLast(liveOutgrowth);
liveOutgrowth = null;
this.allanBanner = synX1323boolean;
}
}
if (this.allanBanner && liveOutgrowth == null) {
this.leavingBrinWhen--;
if (leavingBrinWhen == synX1324int) {
this.allanBanner = synX1325boolean;
this.leavingBrinWhen = Limiter.RemoveDay;
}
} else {
if (liveOutgrowth == null && !poisedDipper.isEmpty()) {
liveOutgrowth = poisedDipper.removeFirst();
liveOutgrowth.adjustPartMonth(this.receiveContemporaryTicktack());
consignmentTreat(liveOutgrowth);
}
}
}
public UsingProgramming() {
this.poisedDipper = new ArrayDeque<>();
}
public synchronized void marchFuture(Formalities negotiations) {
double significant;
significant = synX1326double;
poisedDipper.addLast(negotiations);
}
public synchronized String parserFigure() {
double name;
name = synX1327double;
return synX1328String;
}
}
|
java
|
export * from "./mapgl";
|
typescript
|
Customs officials detained a man and seized 1.244 kgs of gold and nine kgs of lead at Hazrat Shah Amanat International Airport on Thursday.
The detainee is Masud Rana of Jamalpur district.
AKM Sultan Mahmud, deputy director of Customs Intelligence, said a flight of Biman Bangladesh Airlines BGB-148 landed at the airport around 7 am from Dubai.
Suspecting movement of Rana, a passenger of the flight, the Customs officials challenged him and seized 1.245 kgs of gold and nine kgs of lead from his luggage.
Process is on to take legal step against the passenger, said Mahmud.
|
english
|
{"html_attributions": [], "results": [{"business_status": "OPERATIONAL", "geometry": {"location": {"lat": 23.476159, "lng": 86.38538910000001}, "viewport": {"northeast": {"lat": 23.4775154802915, "lng": 86.38669733029151}, "southwest": {"lat": 23.4748175197085, "lng": 86.38399936970849}}}, "icon": "https://maps.gstatic.com/mapfiles/place_api/icons/v1/png_71/school-71.png", "icon_background_color": "#7B9EB0", "icon_mask_base_uri": "https://maps.gstatic.com/mapfiles/place_api/icons/v2/school_pinlet", "name": "Fatepur Primari School", "place_id": "ChIJebuX3a6F9jkR4jsSpmP8nV0", "rating": 5, "reference": "ChIJebuX3a6F9jkR4jsSpmP8nV0", "scope": "GOOGLE", "types": ["school", "point_of_interest", "establishment"], "user_ratings_total": 1, "vicinity": "F9GP+F56, Fatepur"}], "status": "OK"}
|
json
|
<gh_stars>0
{
"body": "NOR NEED WE SEEK SO FAR AS MINGRELIA OR PERU, TO FIND INSTANCES OF SUCH AS NEGLECT, ABUSE, NAY AND DESTROY THEIR CHILDREN;",
"next": "https://raw.githubusercontent.com/CAPSELOCKE/CAPSELOCKE/master/tweets/933.json"
}
|
json
|
Jeypore: Giving priority to a long-cherished demand of devotees as well as tourists from across Odisha, the state government has granted Rs 30 crore for the development of roads connecting to Gupteswar –a popular Shaiva Peetha in Koraput district.
According to sources, 34 km-long road from Baipariguda leading to Gupteswar temple will be reconstructed. Tendering process for the proposed one-way road has already started, the report said.
“Likewise, a 14 km-long Baipariguda-Kundura road will be constructed afresh with an estimated value of Rs 22 crore, which has been granted separately”, said Executive Engineer Koraput unit of Roads and Buildings department Bhaskar Chandra Samantaray.
Even if Gupteswar temple has already got the status of a tourist destination, it lacked basic infrastructure. Development of the site including lighting, drinking water facilities and better road connectivity will increase the number of tourist footfall.
Notably, the cave shrine of Gupteswar nestles on a hill amidst lush green forest, 58 km from Jeypore town and 80 km from Koraput. Cavernous interior of the Gupteswar temple enshrines a gigantic ‘Shiva Linga’, which is said to be increasing in size. The limestone cave present here is a multi-chambered wonder of nature.
Attractions of Gupteswar:
Pilgrims from across the country throng here during the month of Sravana for ‘Bol-Bam’ yatra and devotees take dips in the holy mahakund. There are also several other caves nearby. Inside the second cave, there is a large stalactite. Local people worship it as the udder of Kamadhenu (the divine cow) and wait under it with outstretched palms to collect drops of water which fall only at long intervals.
Gupteswar pilgrimage site is also known in the vicinity as Gupta Kedar. It is believed that Lord Rama had passed through this region on his way to Panchavati in Dandakaranya. Surrounded by green sal trees and flanked by the Kolab and Shabari rivers, the valley all around makes it a paradise for nature lovers.
|
english
|
Iran vs Hegemoni Global:
IslamTimes - Komandan Korps Pengawal Revolusi Islam (IRGC) Iran telah memperingatkan rencana baru oleh musuh untuk memicu kerusuhan di negara itu pada peringatan kerusuhan yang pecah setelah kematian seorang wanita muda Iran tahun lalu.
“Musuh bermaksud untuk menabur hasutan sekali lagi pada peringatan” kerusuhan yang pecah pada September 2022, kata Mayor Jenderal Hossein Salami pada konferensi pejabat Basij di Teheran pada hari Selasa (1/8).
Namun, dia menekankan bahwa kesiapan dan kewaspadaan bangsa Iran akan menggagalkan upaya semacam itu, dengan mengatakan tindakan pencegahan adalah strategi terbaik untuk menggagalkan skema musuh.
Salami lebih lanjut mencatat bahwa kerusuhan tahun lalu adalah "pertempuran global yang paling parah, paling berbahaya, paling serius, paling tidak seimbang dan paling masif" yang telah dilancarkan terhadap Republik Islam.
Tetapi musuh mengalami kekalahan telak selama kerusuhan berkat kebijaksanaan, ketabahan, keyakinan, dan kemauan kuat bangsa, tambah kepala IRGC.
Mahsa Amini, 22, meninggal di sebuah rumah sakit di Teheran beberapa hari setelah ditahan polisi pada September tahun lalu.
Terlepas dari klarifikasi tentang keadaan seputar kematiannya, protes meletus di negara itu, yang kemudian berubah menjadi kekerasan dan menyebabkan serangan terhadap petugas keamanan dan tindakan vandalisme terhadap properti publik serta kendaraan polisi dan ambulans.
|
english
|
{"title": "Adaptive Regularization of Weight Vectors.", "fields": ["weighting", "multiclass classification", "perceptron", "regularization", "binary number"], "abstract": "We present AROW, an online learning algorithm for binary and multiclass problems that combines large margin training, confidence weighting, and the capacity to handle non-separable data. AROW performs adaptive regularization of the prediction function upon seeing each new instance, allowing it to perform especially well in the presence of label noise. We derive mistake bounds for the binary and multiclass settings that are similar in form to the second order perceptron bound. Our bounds do not assume separability. We also relate our algorithm to recent confidence-weighted online learning techniques. Empirical evaluations show that AROW achieves state-of-the-art performance on a wide range of binary and multiclass tasks, as well as robustness in the face of non-separable data.", "citation": "Citations (265)", "year": "2009", "departments": ["Technion \u2013 Israel Institute of Technology", "University of Michigan", "Johns Hopkins University"], "conf": "nips", "authors": ["<NAME>.....http://dblp.org/pers/hd/c/Crammer:Koby", "<NAME>.....http://dblp.org/pers/hd/k/Kulesza:Alex", "<NAME>.....http://dblp.org/pers/hd/d/Dredze:Mark"], "pages": 9}
|
json
|
<gh_stars>0
import fs from 'fs'
import path from 'path'
import { Marp } from '@marp-team/marp-core'
import axios from 'axios'
import cheerio from 'cheerio'
import dedent from 'dedent'
import markdownIt from 'markdown-it'
import { Uri, commands, workspace } from 'vscode'
jest.mock('fs')
jest.mock('axios')
jest.mock('vscode')
let themes: typeof import('./themes')['default']
const extension = (): typeof import('./extension') => {
let ext
jest.isolateModules(() => {
ext = require('./extension') // Shut up cache
themes = require('./themes').default
})
return ext
}
const setConfiguration: (conf?: object) => void = (workspace as any)
._setConfiguration
describe('#activate', () => {
const extContext: any = { subscriptions: { push: jest.fn() } }
it('contains #extendMarkdownIt', () => {
const { activate, extendMarkdownIt } = extension()
expect(activate(extContext)).toEqual(
expect.objectContaining({ extendMarkdownIt })
)
})
it('refreshes Markdown preview when affected configuration has changed', () => {
extension().activate(extContext)
const onDidChgConf = workspace.onDidChangeConfiguration as jest.Mock
expect(onDidChgConf).toBeCalledWith(expect.any(Function))
const [event] = onDidChgConf.mock.calls[0]
event({ affectsConfiguration: jest.fn(() => true) })
expect(commands.executeCommand).toBeCalledWith('markdown.preview.refresh')
})
})
describe('#extendMarkdownIt', () => {
const marpMd = (md: string) => `---\nmarp: true\n---\n\n${md}`
describe('Marp Core', () => {
const baseMd = '# Hello :wave:\n\n<!-- header: Hi -->'
it('uses default engine when not enabled marp front-matter', () => {
const confusingMd =
'---\nmarp: false\n---\n\n```markdown\n---\nmarp: true\n---\n```'
for (const markdown of [baseMd, confusingMd]) {
const html = extension()
.extendMarkdownIt(new markdownIt())
.render(markdown)
expect(html).not.toContain('<div id="marp-vscode">')
expect(html).not.toContain('<style id="marp-vscode-style">')
expect(html).not.toContain('svg')
expect(html).not.toContain('img')
}
})
it('uses Marp engine when enabled marp front-matter', () => {
const html = extension()
.extendMarkdownIt(new markdownIt())
.render(marpMd(baseMd))
expect(html).toContain('<div id="marp-vscode">')
expect(html).toContain('<style id="marp-vscode-style">')
expect(html).toContain('svg')
expect(html).toContain('img')
})
})
describe('Plugins', () => {
describe('Custom theme', () => {
const marpCore = (markdown: string = ''): Marp => {
const { extendMarkdownIt, marpVscode } = extension()
const md = new markdownIt()
extendMarkdownIt(md).render(marpMd(markdown))
return md[marpVscode]
}
it('prevents override built-in theme', () => {
expect(() => marpCore().themeSet.add('/* @theme default */')).toThrow()
expect(() => marpCore().themeSet.add('/* @theme gaia */')).toThrow()
expect(() => marpCore().themeSet.add('/* @theme uncover */')).toThrow()
})
it('works size global directive correctly', () =>
expect(() => marpCore('<!-- size: 4:3 -->')).not.toThrow())
})
describe('Line number', () => {
const markdown = dedent`
---
marp: true
---
# Hello
Paragraph
---
## Marp for VS Code
`
it('adds code-line class and data-line attribute to DOM', () => {
const $ = cheerio.load(
extension()
.extendMarkdownIt(new markdownIt())
.render(markdown)
)
// SVG slides
const svg = $('svg.code-line')
expect(svg.eq(0).data('line')).toBe(0)
expect(svg.eq(1).data('line')).toBe(8)
// Contents
expect($('h1').data('line')).toBe(4)
expect($('p').data('line')).toBe(6)
expect($('h2').data('line')).toBe(10)
})
})
})
describe('Workspace config', () => {
const md = (opts = {}) => extension().extendMarkdownIt(new markdownIt(opts))
describe('markdown.marp.breaks', () => {
it('renders line-breaks when setting "on"', () => {
setConfiguration({ 'markdown.marp.breaks': 'on' })
expect(md().render(marpMd('foo\nbar'))).toContain('<br />')
})
it('ignores line-breaks when setting "off"', () => {
setConfiguration({ 'markdown.marp.breaks': 'off' })
expect(md().render(marpMd('foo\nbar'))).not.toContain('<br />')
})
it('uses inherited breaks option when setting "inherit"', () => {
setConfiguration({ 'markdown.marp.breaks': 'inherit' })
const text = marpMd('foo\nbar')
expect(md({ breaks: false }).render(text)).not.toContain('<br />')
expect(md({ breaks: true }).render(text)).toContain('<br />')
})
})
describe('markdown.marp.enableHtml', () => {
it('does not render HTML elements when disabled', () => {
setConfiguration({ 'markdown.marp.enableHtml': false })
const html = md().render(marpMd('<b>Hi</b>'))
expect(html).not.toContain('<b>Hi</b>')
})
it("allows Marp Core's whitelisted HTML elements when disabled", () => {
setConfiguration({ 'markdown.marp.enableHtml': false })
const html = md().render(marpMd('line<br>break'))
expect(html).toContain('line<br />break')
})
it('renders HTML elements when enabled', () => {
setConfiguration({ 'markdown.marp.enableHtml': true })
const html = md().render(marpMd('<b>Hi</b>'))
expect(html).toContain('<b>Hi</b>')
})
})
describe('markdown.marp.themes', () => {
const baseDir = '/test/path'
const css = '/* @theme example */'
const themeURL = 'https://example.com/test.css'
beforeEach(() => {
jest.spyOn(console, 'error').mockImplementation()
jest.spyOn(console, 'log').mockImplementation()
})
it('registers pre-loaded themes from URL defined in configuration', async () => {
const axiosGet = jest
.spyOn(axios, 'get')
.mockResolvedValue({ data: css })
setConfiguration({ 'markdown.marp.themes': [themeURL] })
const markdown = md()
await Promise.all(themes.loadStyles(Uri.parse('.')))
expect(axiosGet).toBeCalledWith(themeURL, expect.any(Object))
expect(markdown.render(marpMd('<!--theme: example-->'))).toContain(css)
})
it('registers pre-loaded themes from specified path defined in configuration', async () => {
const fsReadFile = jest
.spyOn(fs, 'readFile')
.mockImplementation((_, cb) => cb(null, Buffer.from(css)))
setConfiguration({ 'markdown.marp.themes': ['./test.css'] })
const markdown = md()
markdown.normalizeLink = url => path.resolve(baseDir, url)
await Promise.all(themes.loadStyles(Uri.parse(baseDir)))
expect(fsReadFile).toBeCalledWith(
path.resolve(baseDir, './test.css'),
expect.any(Function)
)
expect(markdown.render(marpMd('<!--theme: example-->'))).toContain(css)
})
it('cannot traverse theme CSS path to parent directory as same as markdown.styles', async () => {
jest
.spyOn(fs, 'readFile')
.mockImplementation((_, cb) => cb(null, Buffer.from(css)))
setConfiguration({ 'markdown.marp.themes': ['../test.css'] })
const markdown = md()
markdown.normalizeLink = url => path.resolve(baseDir, url)
await Promise.all(themes.loadStyles(Uri.parse(baseDir)))
expect(markdown.render(marpMd('<!--theme: example-->'))).not.toContain(
css
)
})
it('cannot override built-in themes by custom theme', async () => {
jest
.spyOn(axios, 'get')
.mockResolvedValue({ data: '/*\n@theme default\n@custom theme\n*/' })
setConfiguration({ 'markdown.marp.themes': [themeURL] })
const markdown = md()
await Promise.all(themes.loadStyles(Uri.parse('.')))
expect(
markdown.render(marpMd('<!-- theme: default -->'))
).not.toContain('@custom theme')
})
})
})
})
|
typescript
|
---
title: SSH配置
date: 2016-09-02 15:53:07
tags: [Course]
category: [Linux]
toc: true
comments: true
---
## 前提
```
$ sudo pacman -S openssh
```
## 开机 启动
```
$ sudo systemctl enable sshd
$ sudo reboot
```
<!--more-->
## 配置
`/etc/ssh/sshd_config`文件中添加：
```
Port 22 # 端口
MaxAuthTries 3 # 输错 三次机会
```
## 登录 密码
```
$ sudo passwd 用户名
```
|
markdown
|
<reponame>erithstudio/core01-atom-command
/**
* Copyright 2017, <NAME>, Erith Studio
* <p>
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License
* at http://www.apache.org/licenses/LICENSE-2.0
* <p>
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.erith.core.atomcommand.components;
import org.erith.core.atomcommand.commands.Command;
import org.erith.core.atomcommand.commands.Comment;
import org.erith.core.atomcommand.commands.Label;
import org.erith.core.atomcommand.eventhandlers.Action;
import org.erith.core.atomcommand.eventhandlers.EventHandler;
import org.erith.core.atomcommand.signals.BlockSignals;
import org.erith.core.atomcommand.utils.AtomCommandConstants;
import org.erith.core.atomcommand.utils.AtomTime;
import java.util.*;
/**
* <summary>
* A container for a sequence of Fungus comands.
* </summary>
*/
public class Block extends Node {
/// <summary>
/// Unique identifier for the Block.
/// </summary>
protected int itemId = -1;
/// <summary>
/// The name of the block node as displayed in the Flowchart window.
/// </summary>
protected String blockName = "New Block";
/// <summary>
/// Description text to display under the block node
/// </summary>
protected String description = "";
/// <summary>
/// An optional Event Handler which can execute the block when an event occurs.
/// Note: Using the concrete class instead of the interface here because of weird editor behaviour.
/// </summary>
protected EventHandler eventHandler;
/// <summary>
/// The list of commands in the sequence.
/// </summary>
protected List<Command> commandList = new ArrayList<Command>();
/// <summary>
/// The execution state of the Block.
/// </summary>
protected ExecutionState executionState;
/// <summary>
/// The currently executing command.
/// </summary>
protected Command activeCommand;
/// <summary>
/// Timer for fading Block execution icon.
/// </summary>
protected float ExecutingIconTimer;
/// <summary>
/// Controls the next command to execute in the block execution coroutine.
/// </summary>
protected int JumpToCommandIndex;
/**
* <summary>
* Index of last command executed before the current one.
* -1 indicates no previous command.
* </summary>
*/
protected int previousActiveCommandIndex = -1;
protected int jumpToCommandIndex = -1;
protected int executionCount;
protected boolean executionInfoSet = false;
public int getItemId() {
return itemId;
}
public void setItemId(int itemId) {
this.itemId = itemId;
}
public String getBlockName() {
return blockName;
}
public void setBlockName(String blockName) {
this.blockName = blockName;
}
public ExecutionState getExecutionState() {
return this.executionState;
}
public void setDescription(String description) {
this.description = description;
}
public EventHandler getEventHandler() {
return eventHandler;
}
public void setEventHandler(EventHandler eventHandler) {
this.eventHandler = eventHandler;
}
public List<Command> getCommandList() {
return commandList;
}
public void setCommandList(List<Command> commandList) {
this.commandList = commandList;
}
protected void Awake()
{
setExecutionInfo();
}
public float getExecutingIconTimer() {
return ExecutingIconTimer;
}
public void setExecutingIconTimer(float executingIconTimer) {
ExecutingIconTimer = executingIconTimer;
}
public int getJumpToCommandIndex() {
return JumpToCommandIndex;
}
public void setJumpToCommandIndex(int jumpToCommandIndex) {
JumpToCommandIndex = jumpToCommandIndex;
}
protected void setExecutionInfo()
{
// Give each child command a reference back to its parent block
// and tell each command its index in the list.
int index = 0;
for (int i = 0; i < commandList.size(); i++)
{
Command command = commandList.get(i);
if (command == null)
{
continue;
}
command.setParentBlock(this);
command.setCommandIndex(index++);
}
// Ensure all commands are at their correct indent level
// This should have already happened in the editor, but may be necessary
// if commands are added to the Block at runtime.
UpdateIndentLevels();
executionInfoSet = true;
}
// The user can modify the command list order while playing in the editor,
// so we keep the command indices updated every frame. There's no need to
// do this in player builds so we compile this bit out for those builds.
protected void Update()
{
int index = 0;
for (int i = 0; i < commandList.size(); i++)
{
Command command = commandList.get(i);
if (command == null)// Null entry will be deleted automatically later
{
continue;
}
command.setCommandIndex(index++);
}
}
/// <summary>
/// Returns the parent Flowchart for this Block.
/// </summary>
public Flowchart GetFlowchart()
{
// return GetComponent<Flowchart>();
return null;
}
/// <summary>
/// Returns true if the Block is executing a command.
/// </summary>
public boolean IsExecuting()
{
return (executionState == ExecutionState.Executing);
}
/// <summary>
/// Returns the number of times this Block has executed.
/// </summary>
public int GetExecutionCount()
{
return executionCount;
}
/// <summary>
/// Start a coroutine which executes all commands in the Block. Only one running instance of each Block is permitted.
/// </summary>
public void StartExecution()
{
// StartCoroutine(Execute());
}
/// <summary>
/// A coroutine method that executes all commands in the Block. Only one running instance of each Block is permitted.
/// </summary>
/// <param name="commandIndex">Index of command to start execution at</param>
/// <param name="onComplete">Delegate function to call when execution completes</param>
public void Execute(int commandIndex, Action onComplete) throws InterruptedException {
if (executionState != ExecutionState.Idle)
{
// yield break;
return;
}
if (!executionInfoSet)
{
setExecutionInfo();
}
executionCount++;
Flowchart flowchart = GetFlowchart();
executionState = ExecutionState.Executing;
BlockSignals.doBlockStart(this);
// Select the executing block & the first command
flowchart.setSelectedBlock(this);
if (commandList.size() > 0)
{
flowchart.ClearSelectedCommands();
flowchart.AddSelectedCommand(commandList.get(0));
}
jumpToCommandIndex = commandIndex;
int i = 0;
while (true)
{
// Executing commands specify the next command to skip to by setting jumpToCommandIndex using Command.Continue()
if (jumpToCommandIndex > -1)
{
i = jumpToCommandIndex;
jumpToCommandIndex = -1;
}
// Skip disabled commands, comments and labels
while (i < commandList.size() &&
(!commandList.get(i).isEnabled() || commandList.get(i) instanceof Comment) ||
commandList.get(i) instanceof Label)
{
i = commandList.get(i).getCommandIndex() + 1;
}
if (i >= commandList.size())
{
break;
}
// The previous active command is needed for if / else / else if commands
if (activeCommand == null)
{
previousActiveCommandIndex = -1;
}
else
{
previousActiveCommandIndex = activeCommand.getCommandIndex();
}
Command command = commandList.get(i);
activeCommand = command;
if (flowchart.isActive())
{
// Auto select a command in some situations
if ((flowchart.getSelectedCommands().size() == 0 && i == 0) ||
(flowchart.getSelectedCommands().size() == 1 && flowchart.getSelectedCommands().get(0).getCommandIndex() == previousActiveCommandIndex))
{
flowchart.ClearSelectedCommands();
flowchart.AddSelectedCommand(commandList.get(i));
}
}
command.setExecuting(true);
// This icon timer is managed by the FlowchartWindow class, but we also need to
// set it here in case a command starts and finishes execution before the next window update.
command.setExecutingIconTimer(AtomTime.getRealtimeSinceStartup() + AtomCommandConstants.ExecutingIconFadeTime);
BlockSignals.doCommandExecute(this, command, i, commandList.size());
command.Execute();
// Wait until the executing command sets another command to jump to via Command.Continue()
while (jumpToCommandIndex == -1)
{
return;
}
if (flowchart.stepPause > 0f)
{
// return new WaitForSeconds(flowchart.getStepPause());
Thread.sleep((long) flowchart.getStepPause());
}
command.setExecuting(false);
}
executionState = ExecutionState.Idle;
activeCommand = null;
BlockSignals.doBlockEnd(this);
if (onComplete != null)
{
onComplete.execute();
}
}
/// <summary>
/// Stop executing commands in this Block.
/// </summary>
public void Stop()
{
// Tell the executing command to stop immediately
if (activeCommand != null)
{
activeCommand.setExecuting(false);
activeCommand.OnStopExecuting();
}
// This will cause the execution loop to break on the next iteration
jumpToCommandIndex = Integer.MAX_VALUE;
}
/// <summary>
/// Returns a list of all Blocks connected to this one.
/// </summary>
public List<Block> GetConnectedBlocks()
{
List<Block> connectedBlocks = new ArrayList<Block>();
for (int i = 0; i < commandList.size(); i++)
{
Command command = commandList.get(i);
if (command != null)
{
command.GetConnectedBlocks(connectedBlocks);
}
}
return connectedBlocks;
}
/// <summary>
/// Returns the type of the previously executing command.
/// </summary>
/// <returns>The previous active command type.</returns>
public Class GetPreviousActiveCommandType()
{
if (previousActiveCommandIndex >= 0 &&
previousActiveCommandIndex < commandList.size())
{
return commandList.get(previousActiveCommandIndex).getClass();
}
return null;
}
/// <summary>
/// Recalculate the indent levels for all commands in the list.
/// </summary>
public void UpdateIndentLevels()
{
int indentLevel = 0;
for (int i = 0; i < commandList.size(); i++)
{
Command command = commandList.get(i);
if (command == null)
{
continue;
}
if (command.CloseBlock())
{
indentLevel--;
}
// Negative indent level is not permitted
indentLevel = Math.max(indentLevel, 0);
command.setIndentLevel(indentLevel);
if (command.OpenBlock())
{
indentLevel++;
}
}
}
/// <summary>
/// Returns the index of the Label command with matching key, or -1 if not found.
/// </summary>
public int GetLabelIndex(String labelKey)
{
if (labelKey.length() == 0)
{
return -1;
}
for (int i = 0; i < commandList.size(); i++)
{
Command command = commandList.get(i);
Label labelCommand = (Label) command;
if (labelCommand != null && labelCommand.getKey().equalsIgnoreCase(labelKey))
{
return i;
}
}
return -1;
}
}
|
java
|
{"storeId":"6885","name":"St Johns Rd Express","latitude":51.14291,"longitude":0.25965,"postalCode":"TN4 9TU","country":"gb","addressLines":["St Johns Rd","Tunbridge Wells"]}
|
json
|
var game = new Phaser.Game(800, 600, Phaser.AUTO, 'phaser-example', { preload: preload, create: create});
function preload() {
game.load.image('spyro', 'assets/pics/spyro.png');
// Firefox doesn't support mp3 files, so use ogg
game.load.audio('squit', ['assets/audio/SoundEffects/squit.mp3', 'assets/audio/SoundEffects/squit.ogg']);
game.load.image('background','assets/pics/dr_death-e605-endpart.png');
}
var s;
var music;
var background;
function create() {
background = game.add.image(0,0,'background');
background.scale.set(3)
music = game.add.audio('squit',1,true);
music.play('',0,1,true);
s = game.add.sprite(130,360, 'spyro');
}
|
javascript
|
23 Let their eyes grow too dim to see,
and let their hips continually quake.(A)
9 And he replied:
Go! Say to these people:
Keep listening, but do not understand;(A)
keep looking, but do not perceive.
10 Make the minds[a] of these people dull;
deafen their ears and blind their eyes;
and hear with their ears,
understand with their minds,
turn back, and be healed.(B)
without visions;
without divination.(B)
The sun will set(C) on these prophets,
and the daylight will turn black over them.
The Christian Standard Bible. Copyright © 2017 by Holman Bible Publishers. Used by permission. Christian Standard Bible®, and CSB® are federally registered trademarks of Holman Bible Publishers, all rights reserved.
|
english
|
<filename>core/container/src/main/java/org/wildfly/swarm/container/runtime/wildfly/ShrinkWrapFileSystem.java<gh_stars>100-1000
package org.wildfly.swarm.container.runtime.wildfly;
import java.io.Closeable;
import java.io.File;
import java.io.IOException;
import java.io.InputStream;
import java.net.URI;
import java.net.URISyntaxException;
import java.security.CodeSigner;
import java.util.Collections;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
import java.util.Optional;
import javax.annotation.PostConstruct;
import javax.enterprise.context.ApplicationScoped;
import javax.inject.Inject;
import org.jboss.shrinkwrap.api.Archive;
import org.jboss.shrinkwrap.api.exporter.ZipExporter;
import org.jboss.vfs.TempDir;
import org.jboss.vfs.TempFileProvider;
import org.jboss.vfs.VirtualFile;
import org.jboss.vfs.spi.FileSystem;
/**
* Created by bob on 1/3/18.
*/
@ApplicationScoped
public class ShrinkWrapFileSystem implements FileSystem {
public ShrinkWrapFileSystem() {
}
@PostConstruct
public void postConstruct() throws IOException {
this.tempDir = this.tempFileProvider.createTempDir("wildfly-swarm-deployments.tmp");
}
public void addArchive(String name, Archive<?> archive) {
this.archives.put(name, new Entry(archive));
}
@Override
public File getFile(VirtualFile mountPoint, VirtualFile target) throws IOException {
return getEntry(mountPoint, target)
.map(e -> getFile(e))
.orElse(null);
}
File getFile(Entry entry) {
if (entry.file == null) {
try {
entry.file = this.tempDir.createFile(entry.archive.getName(), entry.archive.as(ZipExporter.class).exportAsInputStream());
} catch (IOException e) {
e.printStackTrace();
}
}
return entry.file;
}
@Override
public InputStream openInputStream(VirtualFile mountPoint, VirtualFile target) throws IOException {
return getEntry(mountPoint, target)
.map(e -> e.archive.as(ZipExporter.class).exportAsInputStream()).orElse(null);
}
Optional<Entry> getEntry(VirtualFile mountPoint, VirtualFile target) {
String name = target.getPathNameRelativeTo(mountPoint);
Entry entry = this.archives.get(name);
return Optional.ofNullable(entry);
}
@Override
public boolean isReadOnly() {
return true;
}
@Override
public boolean delete(VirtualFile mountPoint, VirtualFile target) {
getEntry(mountPoint, target)
.ifPresent(e -> {
try {
e.close();
} catch (IOException e1) {
e1.printStackTrace();
}
});
return true;
}
@Override
public long getSize(VirtualFile mountPoint, VirtualFile target) {
return getEntry(mountPoint, target)
.map(e -> sizeof(e))
.orElse(0L);
}
long sizeof(Entry entry) {
if (entry.size == null) {
SizingOutputStream sizingOutputStream = new SizingOutputStream();
entry.archive.as(ZipExporter.class).exportTo(sizingOutputStream);
entry.size = sizingOutputStream.getSize();
}
return entry.size;
}
@Override
public long getLastModified(VirtualFile mountPoint, VirtualFile target) {
return 0;
}
@Override
public boolean exists(VirtualFile mountPoint, VirtualFile target) {
return getEntry(mountPoint, target)
.isPresent();
}
@Override
public boolean isFile(VirtualFile mountPoint, VirtualFile target) {
return exists(mountPoint, target);
}
@Override
public boolean isDirectory(VirtualFile mountPoint, VirtualFile target) {
return false;
}
@Override
public List<String> getDirectoryEntries(VirtualFile mountPoint, VirtualFile target) {
return Collections.emptyList();
}
@Override
public CodeSigner[] getCodeSigners(VirtualFile mountPoint, VirtualFile target) {
return new CodeSigner[0];
}
@Override
public void close() throws IOException {
for (Entry each : this.archives.values()) {
each.close();
}
this.tempDir.close();
}
@Override
public File getMountSource() {
return null;
}
@Override
public URI getRootURI() throws URISyntaxException {
return null;
}
private Map<String, Entry> archives = new HashMap<>();
private TempDir tempDir;
@Inject
private TempFileProvider tempFileProvider;
private static class Entry implements Closeable {
Entry(Archive<?> archive) {
this.archive = archive;
}
@Override
public void close() throws IOException {
if (this.file != null) {
this.file.delete();
}
}
final Archive<?> archive;
Long size;
File file;
}
}
|
java
|
from django import template
register = template.Library()
@register.simple_tag(name='round')
def roundValue(value, arg, key=None):
if isinstance(value, float):
return round(value, arg)
elif isinstance(value, dict) and key == "speed":
point = 0
for x in (value[key]):
point += x
return round(point / len(value[key]), arg)
elif isinstance(value, dict) and key == "gust":
return round(max(value[key]), arg)
elif key == "rainfall":
rainfall = 0
for x in value:
rainfall += x
return round(rainfall, 1)
else:
print('roundValue func', value, key, arg, type(value))
return 0.0
|
python
|
.content {
padding: 20px 30px;
}
.iconClass {
margin-right: 10px;
width: 20px;
height: 20px;
}
.date {
color: #f53b57;
}
.post {
margin-top: 36px;
}
|
css
|
Randy Orton and Matt Riddle are two of the top performers in the WWE and are widely regarded fan-favorites. It's an exciting prospect to see them chase the tag team gold as it will breathe new life into the tag team division. According to reports, that may be the plan.
According to Fightful, the RK-Bro duo are speculated to be facing AJ Styles & Omos for the WWE RAW Tag Team Championships at the July 25th Supershow Live Event in Louisville, Kentucky.
In the latest edition of RAW, Randy Orton missed a "last-chance" opportunity to qualify for the Money in the Bank ladder match due to unknown reasons. Riddle won a battle royal to take his spot in the triple threat match to try and earn Randy a spot in the ladder match. The match was eventually won by Drew McIntyre and Riddle apologized to Randy Orton for not being able to secure a spot for him.
WWE live events are back!
WWE announced the resumption of live events starting on the 16th of July episode of Smackdown. The first pay-per-view with in-house attendance will be Money in the Bank, which has a stacked card.
With the resumption of live events, fans can expect many big names such as John Cena, Brock Lesnar, etc to return along with plenty of other surprises. It's certainly an exciting time for all the fans.
Randy is a fourteen-time world champion and has achieved almost everything there's to achieve in the WWE. He has been a part of some amazing teams throughout history like Evolution, Rated-RKO, Legacy, Wyatt Family.
He has also won tag team gold twice in his illustrious career. If there's one thing in common with his title-winning partners, it's one that Randy has eventually turned his back on them.
As stated earlier, Riddle failed to earn a spot for Randy Orton in the Money in the Bank Ladder match. Knowing Orton's history, it is safe to assume that he won't let it slide easily. Matt Riddle will certainly do his best to keep his bromance with Randy intact, but will the Viper accept his Olive branch? The WWE Universe would definitely hope so.
What do you think about the future of RKBro? What will happen if Riddle wins the Money in the Bank ladder match? What are the surprises that you are expecting to see from WWE? Let us know your thoughts in the comment section below.
|
english
|
import { Injectable } from '@angular/core';
import { HttpInterceptorService } from "ng2-http-interceptor/dist";
@Injectable()
export class LoadingInterceptor {
loading: any = {
show: true,
mode: 'indeterminate'
}
constructor(private httpInterceptor: HttpInterceptorService){
this.httpInterceptor.request().addInterceptor((data, method) => {
this.loading.show = true;
return data;
});
this.httpInterceptor.response().addInterceptor(
res => res.do(() => {
this.loading.show = false;
}, e => this.loading.show = false));
}
}
|
typescript
|
/*
* Copyright 2019 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* https://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.springframework.amqp.rabbit.annotation;
import static org.assertj.core.api.Assertions.assertThat;
import static org.mockito.Mockito.mock;
import java.lang.reflect.Method;
import java.util.Collections;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
import org.junit.jupiter.api.Test;
import org.springframework.amqp.core.MessageProperties;
import org.springframework.amqp.rabbit.listener.adapter.HandlerAdapter;
import org.springframework.beans.factory.annotation.Autowired;
import org.springframework.context.annotation.Configuration;
import org.springframework.messaging.Message;
import org.springframework.messaging.handler.annotation.support.MessageHandlerMethodFactory;
import org.springframework.messaging.handler.invocation.InvocableHandlerMethod;
import org.springframework.messaging.support.GenericMessage;
import org.springframework.test.annotation.DirtiesContext;
import org.springframework.test.context.junit.jupiter.SpringJUnitConfig;
import org.springframework.util.ReflectionUtils;
import com.rabbitmq.client.Channel;
/**
* @author <NAME>
* @since 2.2
*
*/
@SpringJUnitConfig
@DirtiesContext
public class MessageHandlerTests {
@Autowired
private RabbitListenerAnnotationBeanPostProcessor bpp;
@Test
void testMessages() throws Exception {
MessageHandlerMethodFactory factory = this.bpp.getMessageHandlerMethodFactory();
Foo foo = new Foo();
Map<String, Method> methods = new HashMap<>();
ReflectionUtils.doWithMethods(Foo.class,
method -> methods.put(method.getName(), method),
method -> method.getName().equals("listen1"));
ReflectionUtils.doWithMethods(Foo.class,
method -> methods.put(method.getName(), method),
method -> method.getName().equals("listen2"));
InvocableHandlerMethod invMethod = factory.createInvocableHandlerMethod(foo, methods.get("listen1"));
List<GenericMessage<String>> messagingMessages = Collections.singletonList(new GenericMessage<>("foo"));
List<org.springframework.amqp.core.Message> amqpMessages = Collections.singletonList(
new org.springframework.amqp.core.Message("bar".getBytes(), new MessageProperties()));
HandlerAdapter adapter = new HandlerAdapter(invMethod);
adapter.invoke(new GenericMessage<>(messagingMessages), null, mock(Channel.class));
assertThat(foo.messagingMessages).isSameAs(messagingMessages);
invMethod = factory.createInvocableHandlerMethod(foo, methods.get("listen2"));
adapter = new HandlerAdapter(invMethod);
adapter.invoke(new GenericMessage<>(amqpMessages), null, mock(Channel.class));
assertThat(foo.rabbitMessages).isSameAs(amqpMessages);
}
@Configuration
@EnableRabbit
public static class Config {
}
public static class Foo {
List<Message<?>> messagingMessages;
List<org.springframework.amqp.core.Message> rabbitMessages;
public void listen1(List<Message<?>> mMessages) {
this.messagingMessages = mMessages;
}
public void listen2(List<org.springframework.amqp.core.Message> amqpMessages) {
this.rabbitMessages = amqpMessages;
}
}
}
|
java
|
<filename>java/java-tests/testData/codeInsight/daemonCodeAnalyzer/quickFix/convertSwitchToIf/before1.java
// "Replace 'switch' with 'if'" "true"
class Test {
void foo(float f) {
switch (f<caret>) {
case 0:
System.out.println(f);
}
}
}
|
java
|
const USER_ROLES = {
CLIENT: "User",
WORKER: "Worker"
};
export default USER_ROLES;
|
javascript
|
<filename>aws_interface/cloud/notification/send_email2.py
from cloud.permission import Permission, NeedPermission
from concurrent.futures import ThreadPoolExecutor
import cloud.libs.emails as emails
import time
# Define the input output format of the function.
# This information is used when creating the *SDK*.
info = {
'input_format': {
'email_from': 'str',
'name_from': 'str',
'email_to': 'list',
'title': 'str',
'content': 'str',
'host': 'str',
'port': 'int',
'user': 'str',
'password': '<PASSWORD>',
'max_sending_amount_per_second': 'int=14',
},
'output_format': {
'result': {
'email_to[0]': 'bool',
'email_to[1]': 'bool',
'...': 'bool',
},
},
'description': 'Send email directly, Max len of email_to must be less equal than 100'
}
TIMEOUT = 3
def _send_email(email_from, email_to, title, content, host, port, user, password, timeout):
message = emails.html(
html=content,
subject=title,
mail_from=email_from,
)
resp = message.send(
to=email_to,
smtp={
"host": host,
"port": port,
"timeout": timeout,
"user": user,
"password": password,
"tls": True,
},
)
return resp
def _send_emails(email_from, name_from, email_to_list, title, content, host, port, user, password,
max_sending_amount_per_second, timeout):
result = []
port = int(port)
timeout = int(timeout)
if isinstance(email_to_list, str):
email_to_list = [email_to_list]
start_time = time.time()
with ThreadPoolExecutor(max_workers=50) as exc:
def work(email_to):
resp = _send_email((name_from, email_from), email_to, title, content, host, port, user, password, timeout)
if resp.status_code == 250:
result.append({'email': email_to, 'success': True})
else:
result.append({'email': email_to, 'success': False})
for idx, _email_to in enumerate(email_to_list):
if idx % (max_sending_amount_per_second - 1) == 0:
offset = time.time() - start_time
time.sleep(1 - offset)
start_time = time.time()
exc.submit(work, _email_to)
return result
def send_emails_safe(email_from, name_from, email_to_list, title, content, host, port, user, password,
max_sending_amount_per_second, timeout, retry_count=0):
results = _send_emails(email_from, name_from, email_to_list, title, content, host, port, user, password,
max_sending_amount_per_second, timeout)
email_to_list = [result['email'] for result in results if not result['success']]
if len(email_to_list) == 0:
return results
else:
if retry_count < 5:
time.sleep(1)
return send_emails_safe(email_from, name_from, email_to_list, title, content, host, port, user, password,
max_sending_amount_per_second, timeout, retry_count + 1)
else:
return results
@NeedPermission(Permission.Run.Notification.send_email2)
def do(data, resource):
body = {}
params = data['params']
email_from = params.get('email_from')
name_from = params.get('name_from')
email_to_list = params.get('email_to_list')
title = params.get('title')
content = params.get('content')
host = params.get('host')
port = params.get('port')
user = params.get('user')
password = params.get('password')
max_sending_amount_per_second = int(params.get('max_sending_amount_per_second', 14))
timeout = TIMEOUT
results = send_emails_safe(email_from, name_from, email_to_list, title, content, host, port, user, password,
max_sending_amount_per_second, timeout)
body['results'] = results
return body
|
python
|
116/7 (17. 0 ov)
119/4 (16. 1 ov)
172/7 (20. 0 ov)
157 (20. 0 ov)
Shakib Al Hassan has been ranked the best all-rounder in One-Day Internationals (ODI)
Taskin might miss out on the limited-overs engagements against South Africa as a result.
However he termed the 1-2 series loss to Bangladesh disappointing.
Dhawan, who also scored a strokeful 173 in the lone Test against the hosts, admits that the Men in Blue were hurt by the opening two losses.
In the batting chart, Virat Kohli tops the Indian player's list at the fourth position.
Mustafizur Rahman has soared higher with another record-breaking performance in the third and final One-Day International (ODI) against India.
'Nothing like that happened,' clarifies Bangladesh's captain.
Mashrafe Bin Mortaza said Bangladesh need to continue their good form in the upcoming series against South Africa.
It looks like, a night before his miraculous debut Mustafizur Rahman probably rubbed the magical lamp of ‘Aladin’ and ‘Jinni’ granted his wish as he made history in the first two matches he played.
|
english
|
UP NHM Recruitment: Interested candidates can apply for these posts online on the official website of NHM UP at upnrhm. gov. in.
By India Today Web Desk: The National Health Mission, Uttar Pradesh began the online application submission process for recruitment of staff nurses on a contractual basis on Thursday. Interested candidates can apply for these posts online on the official website of NHM UP at upnrhm. gov. in.
The last date to apply for this recruitment is November 10 until 11 am.
This recruitment drive is to fill up 2,450 post across Uttar Pradesh.
Candidates should have diplomas in general nursing and midwifery or BSc in nursing from any recognised institute approved by the nursing council of the state/GoI.
Candidates must be registered with UP State Nursing Council at the time of online submission of application.
Age limit:
Candidates should not be of less than 18 years and not more than 40 years of age as of October 9, 2021.
The upper age limit is relaxed by 3 years for candidates belonging to OBC (Non-Creamy Layer), while the upper age limit is relaxed by 5 years for candidates belonging to SC/ST.
How to apply for a staff nurse post:
- On the homepage, under the 'Updates' section, click on the link that reads, "Application Form Link for Staff Nurse vacancies (October 21, 2021)"
- Submit and download the form and take its printout for future use.
Admission to computer-based tests will be purely provisional. Candidature will be subject to verification of details/documents when the candidate reports for interview/document verification if shortlisted.
|
english
|
#include <ctime>
#include <iostream>
#include "fps_counter.hpp"
FPSCounter::FPSCounter()
: last(time(nullptr)),
frames(0)
{
}
void FPSCounter::tick()
{
frames++;
if (time(nullptr) - last >= 1)
{
std::cout << "FPS:" << frames << std::endl;
frames = 0;
last = time(nullptr);
}
}
|
cpp
|
version https://git-lfs.github.com/spec/v1
oid sha256:add8d8d5f36bc396166d06cf4d832db329bb4a3a389c44c06c10834c188e47a1
size 16893
|
html
|
<filename>src/main/java/stackoverflow/Answer.java
package stackoverflow;
import lombok.Getter;
import lombok.Setter;
import lombok.ToString;
import java.time.Instant;
import java.util.List;
/**
* @author : alexchen
* @created : 9/12/20, Saturday
**/
@Getter
@ToString
public class Answer {
private final int answerId;
private final int questionId;
@Setter
private String answerText;
private int authorId;
private Instant createdAt;
List<Comment> comments;
public Answer(int answerId, int questionId, String answerText, int authorId) {
this.answerId = answerId;
this.questionId = questionId;
this.answerText = answerText;
this.authorId = authorId;
createdAt = Instant.now();
}
public void addComment(Comment comment) {
this.comments.add(comment);
}
}
|
java
|
- 3 hrs ago 5 Best Microwave Ovens For Your Kitchen: Deals To Consider As Amazon Sale 2023 Is Nearing!
- Travel Have you been to Vishveshwaraya Falls in Mandya yet? If not, this is the best time!
Here comes the Kingfisher calender 2014 launch. The event of Kingfisher calender 2014 white party took place in Alibaugh, Maharashtra. The girls look smoking hot! Lets take a look.
All the models chosen for Kingfisher Calender 2014 are really deserving according to us. They all were dressed up in traditional attires.
Lisa Haydon looked smoky hot in this white two piece gown.
Lisa Haydon waves to the paparazzi while entering the Kingfisher calender 2014 launch.
Lisa looks sassy with top-knot hair bun. She carries a little dull makeup with glossy pink lips to suit the day look. Bronze coloured earrings and bag completes her look.
Kabir Bedi poses for the paparazzi with wife Parveen Dusanj and other two ladies at Kingfisher calender 2014 event.
Kabir Bedi with wife Parveen Dusanj in this picture gives all smiles at Kingfisher calender 2014 event.
One of the Kingfisher calender 2014 model. She looks really pretty in this contemporary lehenga choli.
The golden choli and yellow lehenga with fuchsia pink borders looks great. The accessories added to the lehenga looks glam.
Half tied soft curls suits the contemporary lehenga-choli dress. Pink lips and minimal makeup suits the day event.
The five models who will be seen on the Kingfisher Calender 2014 are here. Now we really look forward to it!
Kabir Bedi wore a simple white kurta pyjama at Kingfisher calender 2014 event.
Another Kingfisher calender 2014 model. This saree is a little different when compared to the normal sarees. It has a slit-cut at the bottom that actually looks beautiful. The beige sequinned blouse looks nice.
She wears a fuchsia pink saree with beige border and same coloured work that goes along the border of the saree. Pink makeup and dark pink lips looks wonderful even in a day event.
The third model of Kingfisher calender 2014 looks amazing. Navy Blue saree with a fuchsia pink bikini blouse is just hot.
The curvy figure of the Kingfisher 2014 model justifies the saree look. Silver sequinned work on the saree, plain bikini blouse and nude coloured lips looks well.
Yet another beauty of Kingfisher Calender 2014 looks pretty. Fuchsia pink saree with silver bikini blouse suits her completely.
Top hair knot with minimal makeup looks nice. She carries a light shade of pink lipstick. A huge ring and broad wrist band looks pretty with the saree.
The last model of Kingfisher Calender 2014 looks bold and beautiful. The tall model wears a black saree which has silver sequinned work on it.
Open hair and light makeup was carried by the Kingfisher Calender 2014 model. She completed this looks with red lips which looked hot on the model.
Amit Sadh was seen at the Kingfisher calender 2014 launch event.
Amit Sadh wore blue denims with white color neck tee at the Kingfisher Calender 2014 launch event.
A band performing at the Kingfisher Calender 2014 launch event.
from Any Body Can Dance were present at the Kingfisher calender 2014 launch.
Pallavi Sharda was seen in white short dress with open curls, nude makeup and wearing a very light pink lips shade. On the other, Lauren Gottlieb was also seen in white dress with top knot bun and glossy makeup. She looked really pretty.
A guest at the Kingfisher calender 2014 event.
Few of the Kingfisher calender 2014 models having fun at the launch.
Models of Kingfisher calender 2014 posing and clicking for themselves.
Samir Kochhar at the Kingfisher calender 2014 event.
Three of the Kingfisher calender girls posing at the launch event.
Vijay Mallya at the Kingfisher calender 2014 launch. He is all-white.
Two guests posing at the Kingfisher calender 2014 launch.
At the launch models on the stage with Vijay Mallya and Atul Kasbekar the photographer of Kingfisher calender revealing the Kingfisher calender 2014 first look.
- bollywood wardrobeMouni Roy Or Esha Gupta, Whose Multicolour Floral Printed Dress Would You Like To Add To Your Summer Wardrobe?
|
english
|
Yoga is not merely an exercise; it’s a lifestyle choice that advocates for holistic wellness. Its influence has transcended borders and reached the bustling streets of New Delhi, India, where The Pink Lotus Academia [thepinklotusacademia.com] teaches some of the finest yoga practices.
New Delhi, known for its vibrant culture and rich heritage, is also a thriving hub for yoga enthusiasts. The city’s fast-paced lifestyle often leads to stress and physical discomfort, notably back pain. Yoga serves as a perfect antidote, providing relief and enhancing Spinal Health.
Our spine is the body’s structural pillar, supporting our ability to move, twist, and bend. Any compromise in Spinal health can significantly impact our quality of life, making it essential to prioritize spinal wellness.
Spinal health is fundamental in yoga practices. Most yoga asanas aim to strengthen the spine and enhance its flexibility. A healthy spine contributes to better posture, improved bodily functions, and overall wellness.
Yoga promotes spinal flexibility and strength, helping you maintain a healthy spine. Specific yoga poses target different parts of the spine, contributing to a well-rounded spinal care routine.
The Pink Lotus Academia in New Delhi offers a curriculum that caters to spinal health. The institute’s experienced trainers emphasize the importance of maintaining a healthy spine through specific asanas.
Yoga impacts the spine on a physical and psychological level. It helps improve posture, strengthen spinal muscles, and induce a state of mental calm, thereby reducing stress-related tension in the back.
There are several effective yoga poses for spinal health, such as Cat-Cow Pose, Child’s Pose, and Sphinx Pose. Practicing these regularly can offer significant benefits for your spine.
While yoga is generally safe, it’s important to practice it correctly to avoid injury. Listen to your body, maintain proper alignment, and ensure you’re performing the asanas correctly for optimal spinal health benefits.
New Delhi’s yoga scene has grown exponentially, with The Pink Lotus Academia standing at its forefront. The institute’s emphasis on spinal health and overall wellness makes it a preferred choice among residents.
Whether it’s chronic back pain or a sedentary lifestyle, yoga provides a natural solution to many spinal health challenges. Regular practice can bring about profound changes in your spinal health and overall wellbeing.
In the heart of New Delhi, The Pink Lotus Academia is transforming lives with yoga. It provides an inclusive and nurturing environment for people of all ages to explore the health benefits of yoga, particularly for spinal health.
Yoga is a path towards ultimate wellness, and spinal health plays a pivotal role in this journey. By integrating yoga into your daily routine, you can unlock a world of benefits for your spine and overall health.
Yoga holds the key to spinal health. As more people become aware of its benefits, institutes like The Pink Lotus Academia are instrumental in spreading yoga’s healing touch.
Yoga can be a potent tool in spinal rehabilitation. It helps restore strength and flexibility in the spine, making it an excellent choice for individuals recovering from back injuries or surgeries.
Many individuals have experienced the transformative power of yoga on their spinal health. The Pink Lotus Academia, with its focus on spinal health, has many success stories to share.
Yoga is not a quick fix; it’s a lifelong journey towards optimal health. As we navigate life’s ups and downs, yoga serves as a constant companion, fostering spinal health and overall wellbeing.
From the hustle-bustle of New Delhi to the serene interiors of The Pink Lotus Academia, yoga for spinal health has found its unique space. Embrace this journey towards better health, one asana at a time, and let your spine experience the magic of yoga.
How can yoga improve spinal health?
Yoga can significantly improve spinal health by enhancing flexibility, strengthening muscles, and improving posture. It also helps reduce stress, which can contribute to back pain.
Are yoga poses safe for people with existing spinal problems?
Yoga poses can be modified to suit individual needs and limitations. However, it is recommended to consult a healthcare professional before starting a new exercise routine, especially if you have existing spinal problems.
What makes The Pink Lotus Academia a good choice for yoga in New Delhi?
The Pink Lotus Academia focuses on holistic wellness, emphasizing spinal health. The institute’s experienced trainers, comprehensive curriculum, and serene environment make it an ideal choice for yoga in New Delhi.
Can yoga replace traditional treatments for back pain?
While yoga can help alleviate back pain, it should not replace traditional treatments unless advised by a healthcare professional. Yoga can be a great complement to traditional treatments, providing natural and holistic relief.
How often should I practice yoga for spinal health benefits?
Regular practice is key to reap yoga’s benefits. Ideally, practicing yoga 3-5 times a week can result in noticeable improvements in spinal health.
Can yoga prevent spinal health problems?
While yoga cannot prevent all spinal health problems, regular practice can reduce the risk of certain issues like back pain and postural problems. It helps maintain a strong and flexible spine, which is crucial for overall spinal health.
The post Unlock Your Spinal Health: The Yoga Way appeared first on Pink Lotus Academia.
|
english
|
<reponame>m21917/assets
{
"name": "<NAME>",
"website": "https://thexhunter.com/",
"description": "The xHunter is a community driven platform that aims to bridge the gap between blockchain and the outdoors. Our goal is to be the gateway for all outdoor enthusiasts into the crypto world. This will be made possible through outdoor events, adventure store and our very own NFT game.",
"explorer": "https://bscscan.com/token/0x487e464ed2f07306d5d0add219c7e13d3be9d867",
"type": "BEP20",
"symbol": "XHT",
"decimals": 9,
"status": "active",
"id": "0x<PASSWORD>",
"links": [
{
"name": "discord",
"url": "https://discord.com/invite/Q3j7yzsm"
},
{
"name": "twitter",
"url": "https://twitter.com/The_x_Hunter_"
},
{
"name": "telegram",
"url": "https://t.me/X_Hunter_tg"
}
]
}
|
json
|
<gh_stars>1-10
[{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125484,"noUrut":1,"nama":"<NAME>, S.Sos.,M.SI","stringJenisKelamin":"Perempuan"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125531,"noUrut":2,"nama":"<NAME>, SH","stringJenisKelamin":"Laki-Laki"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125530,"noUrut":3,"nama":"SUHADAK, S.SI","stringJenisKelamin":"Laki-Laki"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125494,"noUrut":4,"nama":"<NAME>, SH.,MM","stringJenisKelamin":"Perempuan"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125503,"noUrut":5,"nama":"<NAME>, SH","stringJenisKelamin":"Laki-Laki"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":129729,"noUrut":6,"nama":"<NAME>, SE","stringJenisKelamin":"Laki-Laki"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"Partai Golongan Karya","id":125507,"noUrut":7,"nama":"<NAME>, SE","stringJenisKelamin":"Perempuan"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"<NAME>","id":125514,"noUrut":8,"nama":"<NAME>","stringJenisKelamin":"Laki-Laki"},{"namaKab":"NGANJUK","originalFilename":"Foto.jpg","namaPartai":"<NAME>","id":125526,"noUrut":9,"nama":"<NAME>","stringJenisKelamin":"Laki-Laki"}]
|
json
|
{
"body": "### Summary\n\nWe should add a CI test compiling with `cflags=-frecord-gcc-switches` and running `readelf -p .GCC.command.line` afterwards to check which packages inject \"unwanted\" flags.\n\n### Rationale\n\nSome build recipes inject unwanted flags that we should detect and warn about during the code review.\n\n### Description\n\nCompile with `-frecord-gcc-switches` and look at the `.GCC.command.line` block of the binaries/libraries afterwards.\n\n### Additional information\n\n_No response_\n\n### General information\n\n- [X] I have run `spack --version` and reported the version of Spack\n- [X] I have searched the issues of this repo and believe this is not a duplicate",
"user": "junghans",
"url": "https://api.github.com/repos/spack/spack/issues/29379",
"updated_at": "2022-03-07 17:07:24",
"created_at": "2022-03-07 17:07:24",
"closed_at": "None",
"state": "open",
"title": "Add CI test running \"-frecord-gcc-switches\"",
"number": 29379,
"milestone": null,
"labels": [
"feature"
],
"id": 1161687652,
"html_url": "https://github.com/spack/spack/issues/29379",
"assignees": [],
"comments": 0
}
|
json
|
What do you think?
What makes 'We' special is not dystopian society alone.
"Because I live now not in our rational world but in the ancient one, senseless, the world of square roots of minus one."
Written in 1920, before the Soviet Union even existed, it predicted the Stalin and Brezhnev eras with terrifying foresight. Evgeniy Zamyatin did not share the fascination with the new State and the glory of the Great October Socialist Revolution.
“The only means of ridding man of crime is ridding him of freedom.”With his novel, Zamyatin disagrees. No wonder it was banned in the Soviet Union until late 1980s - since one of his characters brings up the ultimate blasphemy:
"There is no final revolution. Revolutions are infinite."At that time, during the birth of the "new world order" that emphasized the good of the State over the good of individual "cogs in the machine", the beauty of uniformity of unity over individual variations, Zamyatin described the hollowness that replacing soul and love with cold reason and logic and individuals with "numbers" would bring. In this world everything is rationalized, de-individualized, regimented, and oppressively safe. Even the leader, the "Benefactor", is little but a slave to the State.
“Now I no longer live in our clear, rational world; I live in the ancient nightmare world, the world of square roots of minus one.”Zamyatin's characters try to go against the great tide, try to resist the State. As a result, at least for a short while, his protagonist gets diagnosed with a serious medical condition - developing a soul. But, fittingly for a dystopia, there is no happy ending - just a reader's faint hope that for some of them not all is lost.
|
english
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.