Dataset Viewer
Auto-converted to Parquet Duplicate
image
imagewidth (px)
210
935
latex
stringlengths
165
6.04k
filename
stringlengths
17
19
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline \textbf{Scale} & \multicolumn{4}{|l|}{\textbf{Self-report}} & \multicolumn{4}{|l|}{\textbf{Proxy-report}} \\ \hline & \textbf{N} & \textbf{Mean (sd)} & \textbf{df} & \textbf{F} & \textbf{N} & \textbf{Mean (sd)} & \textbf{df} & \textbf{F} \\ \hline Total Score & & & 4,1393 & 23.84 & & & 4,965 & 41.07 \\ \hline Asthma & 99 & 75.31(16.90) *** & & & 74 & 71.79(17.53)*** \\ \hline Diabetes & 124 & 82.46(12.76) & & & 103 & 77.54(12.21) *** \\ \hline Cancer & 66 & 75.68(15.40) *** & & & 61 & 70.96(17.06) *** \\ \hline IBD & 76 & 74.18(14.66) *** & & & 67 & 72.65(17.62) *** \\ \hline Healthy & 1033 & 83.89(11.84) & & & 665 & 84.61(11.19) \\ \hline Physical Health & & & 4,1392 & 41.60 & & & 4,964 & 46.87 \\ \hline Asthma & 99 & 76.14(19.10)*** & & & 75 & 73.36(20.60) *** \\ \hline Diabetes & 124 & 84.75(13.65)** & & & 103 & 82.97(13.67) *** \\ \hline Cancer & 66 & 78.10(17.64) *** & & & 61 & 75.04(18.79) *** \\ \hline IBD & 76 & 75.08(18.21) *** & & & 67 & 71.54(21.98) *** \\ \hline Healthy & 1032 & 88.51(11.62) & & & 665 & 89.06(12.27) \\ \hline Psychosocial Health & & & 4,1393 & 14.53 & & & 4,964 & 28.16 \\ \hline Asthma & 99 & 74.9(17.48) *** & & & 74 & 71.20(17.95) *** \\ \hline Diabetes & 124 & 81.24(13.77) & & & 103 & 74.62(13.27) *** \\ \hline Cancer & 66 & 74.37(15.85) *** & & & 61 & 68.83(17.92) *** \\ \hline IBD & 76 & 73.64(14.35) *** & & & 67 & 73.21(17.43) *** \\ \hline Healthy & 1033 & 81.84(13.21) & & & 664 & 82.21(12.67) \\ \hline Emotional functioning & & & 4,1393 & 9.85 & & & 4,962 & 23.24 \\ \hline Asthma & 99 & 70.66(20.06) *** & & & 74 & 67.23(21.20) *** \\ \hline Diabetes & 124 & 78.85(18.28) & & & 102 & 66.01(17.80) *** \\ \hline Cancer & 66 & 73.56(18.39) * & & & 61 & 68.36(18.04) *** \\ \hline IBD & 76 & 68.11(18.90) *** & & & 67 & 67.26(21.41) *** \\ \hline Healthy & 1033 & 78.49(17.94) & & & 663 & 78.28(15.54) \\ \hline Social functioning & & & 4,1393 & 5.89 & & & 4,964 & 14.09 \\ \hline Asthma & 99 & 81.76(21.35) *** & & & 74 & 76.96(21.69) *** \\ \hline Diabetes & 124 & 89.15(13.91) & & & 103 & 85.28(15.98) \\ \hline Cancer & 66 & 81.27(18.36) ** & & & 61 & 73.28(22.93) *** \\ \hline IBD & 76 & 83.82(16.61) & & & 67 & 82.12(18.09) * \\ \hline Healthy & 1033 & 87.65(16.46) & & & 664 & 86.82(15.42) \\ \hline School functioning & & & 4,1386 & 14.12 & & & 4,960 & 26.90 \\ \hline Asthma & 99 & 72.37(19.62) *** & & & 74 & 69.02(22.55) *** \\ \hline Diabetes & 124 & 77.70(17.39) & & & 103 & 72.62(17.64) *** \\ \hline Cancer & 63 & 67.38(20.36) *** & & & 58 & 63.45(21.71) *** \\ \hline IBD & 73 & 69.52(17.28) *** & & & 66 & 70.46(20.95) *** \\ \hline Healthy & 1032 & 78.87(15.89) & & & 664 & 81.52(16.09) \\ \hline \end{tabular}} \end{table}
PMC1079918_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \multicolumn{2}{|l|}{\textbf{Rate of PTSD symptoms on the K-SADS}} & \multicolumn{2}{|l|}{\textbf{Rate of PTSD symptoms on the CATS}} \\ \hline \textbf{symptom} & \textbf{\%} & \textbf{symptom} & \textbf{\%} \\ \hline \multicolumn{4}{|l|}{Comparable Symptoms} \\ \hline Recurrent thoughts or images of events & 28 & I go over and over what happened in my mind & 40 \\ \hline Efforts trauma to avoid thoughts or images associated with the & 28 & I try not to think about what happened & 47 \\ \hline Insomnia & 22 & I sleep poorly & 26 \\ \hline Irritability or outbursts of anger & 24 & I am grouch and irritable & 36 \\ \hline Distress at reminders of event & 16 & When tense and something upset reminds me of what happened I get & 21 \\ \hline Exaggerated startle response & 17 & I am jumpy and nervous & 29 \\ \hline Nightmares & 16 & I have bad dreams about what happened & 9 \\ \hline Difficulty concentrating & 19 & I have trouble keeping my mind on things & 28 \\ \hline Efforts recollections to avoid of activities the trauma or situations that arouse & 21 & I happened try to stay away from things that remind me of what & 21 \\ \hline \multicolumn{4}{|l|}{Non-comparable Symptoms} \\ \hline Sense of foreshortened future & 3 & I worry that what happened will happen again & 57 \\ \hline Feelings of detachment or estrangement & 21 & I get scared when I think about what happened & 38 \\ \hline Inability to recall important aspects of the trauma & 10 & I have unwanted thoughts about what happened & 21 \\ \hline Restricted affect & 28 \\ \hline Hypervigilance & 17 \\ \hline Physiological reactivity upon exposure to reminders & 9 \\ \hline Dissociative episodes, illusions or hallucinations & 21 \\ \hline Diminished interest in activities & 22 \\ \hline Repetitive play related to event / reenactment & 2 \\ \hline \end{tabular}} \end{table}
PMC1088008_table_3
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{A.} & \multicolumn{12}{|l|}{\textbf{HPV cLIA time (weeks)}} \\ \hline \textbf{HPV type} & \textbf{0} & \textbf{2} & \textbf{4} & \textbf{8} & \textbf{10} & \textbf{12} & \textbf{16} & \textbf{20} & \textbf{24} & \textbf{26} & \textbf{28} & \textbf{52} \\ \hline HPV 6 & 1.1 & 3.2 & 2.4 & 4.3 & 10.0 & 12.6 & 36.3 & 10.9 & 6.3 & 22.7 & 41.9 & 4.3 \\ \hline HPV 11 & 0.8 & 2.9 & 2.2 & 5.5 & 23.5 & 18.1 & 16.2 & 8.2 & 6.1 & 18.4 & 36.8 & 5.3 \\ \hline HPV 16 & 1.0 & 5.2 & 8.8 & 8.4 & 21.4 & 15.7 & 16.1 & 11.4 & 17.7 & 4.8 & 12.7 & 6.4 \\ \hline HPV 18 & 1.0 & 4.8 & 13.7 & 19.4 & 70.5 & 18.6 & 27.1 & 35.4 & 26.3 & 6.7 & 26.8 & 26.7 \\ \hline B. & \multicolumn{12}{|l|}{HPV Total IgG antibodies time (weeks)} \\ \hline HPV type & 0 & 2 & 4 & 8 & 10 & 12 & 16 & 20 & 24 & 26 & 28 & 52 \\ \hline HPV 6 & 1.9 & 9.5 & 9.5 & 13.1 & 125.0 & 328.3 & 125.0 & 65.7 & 34.4 & 34.5 & 65.7 & 18.1 \\ \hline HPV 11 & 1.9 & 13.1 & 25.0 & 25.0 & 125.0 & 90.6 & 125.0 & 47.6 & 34.5 & 34.5 & 90.6 & 18.1 \\ \hline HPV 16 & 0.9 & 5.0 & 9.5 & 6.9 & 65.7 & 65.7 & 90.6 & 65.7 & 13.1 & 13.1 & 65.7 & 25.0 \\ \hline HPV 18 & 0.7 & 9.5 & 13.1 & 25.0 & 125.0 & 47.6 & 65.7 & 65.7 & 25.0 & 47.6 & 125.0 & 90.6 \\ \hline \end{tabular}} \end{table}
PMC1097753_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Index} & \textbf{N} & \multicolumn{2}{|l|}{\textbf{Groups}} & \textbf{P $<$ :} \\ \hline & & \textbf{Control (+/+)} & \textbf{Diabetes (db/db)} \\ \hline Body Weight (g) & 5 & 21 $\pm$ 3 & 47 $\pm$ 5 & 0.001 \\ \hline Blood Glucose (mg/dl) & 5 & 103 $\pm$ 8 & 428 $\pm$ 16 & 0.001 \\ \hline Uterine Weight (mg) & 5 & 44 $\pm$ 3 & 13 $\pm$ 4 & 0.01 \\ \hline Serum ml) Triglycerides (mg/ & 5 & 143 $\pm$ 8 & 312 $\pm$ 24 & 0.001 \\ \hline \end{tabular}} \end{table}
PMC1097758_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Functional type} & \textbf{Fluffy tails (F$>$2)} & \textbf{No fluffy tails (F$<$2)} & \textbf{Positive rate} & \textbf{Negative rate} \\ \hline Regulatory regions & 51 & 9 & 85 \% & 15 \% \\ \hline Exons & 1 & 59 & 1.6 \% & 98.4 \% \\ \hline Non-coding presumed non- regulatory & 10 & 50 & 16 \% & 84 \% \\ \hline \end{tabular}} \end{table}
PMC1127108_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Protein family} & \textbf{PDB ID} & \textbf{Correct} & \textbf{Useful info} & \textbf{Wrong} \\ \hline \multicolumn{5}{|l|}{A. Proteins from Table 1} \\ \hline Acetyglucosamine-6-phoshate deacyetylaseb & 1O12 & 6 & 1 & 0 \\ \hline Alcohol dehydrogenase & 1JVB & 2 & 1 & 1 \\ \hline CuZnSOD & 1SPD & 3 & 2 & 1 \\ \hline Cytochrome P450 & 1N4G & 6 & 4 & 0 \\ \hline Enolase & 2ONE & 6 & 2 & 0 \\ \hline Glyceroladhyde-3-phosphate dehydrogenase & 1DC4 & 2 & 2 & 3 \\ \hline Glycerol kinase & 1B05 & 7 & 1 & 0 \\ \hline Glutamate dehydrogenase & 1HWZ & 7 & 0 & 0 \\ \hline Inorganic pyrophosphatase & 1I6T & 3 & 2 & 0 \\ \hline Myoglobin & 1MBA & 4 & 1 & 0 \\ \hline Succinate dehydrogenase โ€“ FAD & 1NEK & 4 & 1 & 2 \\ \hline Succinate dehydrogenase โ€“ Fe/S & 1NEK & 4 & 0 & 0 \\ \hline Succinate dehydrogenase โ€“ Heme & 1NEK & 5 & 0 & 0 \\ \hline TATA box binding protein & 1TBP & n/ac \\ \hline Triosephosphate isomerase & 7TIM & 3 & 4 & 1 \\ \hline \multicolumn{5}{|l|}{B. Additional examples} \\ \hline Acetate kinase & 1G99 & 4 & 4 & 0 \\ \hline Aconitase A & 7ACN & 8 & 3 & 5 \\ \hline Alanine racemase & 1L6F & 4 & 1 & 1 \\ \hline Arginyl-tRNA synthetase & 1F7U & 2 & 2 & 1 \\ \hline Biotin carboxylaseb & 1DV2 & 3 & 3 & 2 \\ \hline Catalase & 1GGF & 9 & 0 & 0 \\ \hline Citrate synthase & 1NXG & 8 & 1 & 0 \\ \hline Isocitrate dehydrogenases & 1IA2 & 3 & 0 & 0 \\ \hline Malate/lactate dehydrogenases & 1EMD & 6 & 1 & 0 \\ \hline Malate synthase & 1P7T & 6 & 0 & 0 \\ \hline Phosphomannomutase & 1P5D & 5 & 2 & 0 \\ \hline Selenocysteine lyase & 1ECX & 5 & 2 & 1 \\ \hline Threonine aldolase & 1LW5 & 6 & 2 & 0 \\ \hline Thymidylate synthase & 1AIQ & 4 & 0 & 1 \\ \hline Transaldolase & 1ONR & 1 & 1 & 1 \\ \hline Trehalose-6-phosphate synthase & 1UQU & 5 & 3 & 3 \\ \hline \end{tabular}} \end{table}
PMC1142304_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Characteristic} & \multicolumn{6}{|l|}{\textbf{Genotype [n (\%)]}} \\ \hline & \textbf{CYP2D6*1/*1} & \textbf{CYP2D6*1/*4} & \textbf{CYP2D6*4/*4} & \textbf{SULT1A1*1/*1} & \textbf{SULT1A1*1/*2} & \textbf{SULT1A1*2/*2} \\ \hline \multicolumn{7}{|l|}{Nodal involvementa, tumour size} \\ \hline Node-, $>$30 mm & 19 (76.0) & 5 (20.0) & 1 (4.0) & 6 (24.0) & 11 (44.0) & 8 (32.0) \\ \hline Node+, $\leq$ 20 mm & 66 (74.2) & 18 (20.2) & 5 (5.6) & 30 (33.7) & 49 (55.1) & 10 (11.2) \\ \hline Node+, $>$20 mm & 77 (68.8) & 32 (28.6) & 3 (2.7) & 43 (38.4) & 59 (52.7) & 10 (8.9) \\ \hline \multicolumn{7}{|l|}{Receptor statusb} \\ \hline ER-negative & 50 (74.6) & 12 (17.9) & 5 (7.5) & 23 (34.3) & 35 (52.2) & 9 (13.4) \\ \hline ER-positive & 109 (69.9) & 43 (27.6) & 4 (2.6) & 56 (35.9) & 82 (52.6) & 18 (11.5) \\ \hline \multicolumn{7}{|l|}{Endocrine therapy} \\ \hline Tamoxifen & 77 (68.8) & 28 (25.0) & 7 (6.3) & 37 (33.0) & 60 (53.6) & 15 (13.4) \\ \hline No tamoxifen & 85 (74.6) & 27 (23.7) & 2 (1.8) & 42 (36.8) & 59 (51.8) & 13 (11.4) \\ \hline \end{tabular}} \end{table}
PMC1143572_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{Env โ€“ gp41} & \textbf{573} & \textbf{631} & \textbf{676} & \textbf{713} & \textbf{734} & \textbf{737} & \textbf{741} & \textbf{751} & \textbf{752} & \textbf{760} & \textbf{764} & \textbf{767} & \textbf{785} & \textbf{802} & \textbf{821} & \textbf{850} & \textbf{855} \\ \hline SIVmac239 & K & K & D & M & Q & I & P & R & D & S & W & E & S & L & T & G & T \\ \hline SIVmac316 & T & K & D & V & Q & I & P & G & D & S & W & Stop & - & - & - & - & - \\ \hline SIV17E-Cl & K & K & N & V & Q & * & * & * & * & * & * & * & * & * & * & * & * \\ \hline SIV17E/Fr & K & K & D & M & Q & I & P & G & D & S & Stop & - & - & - & - & - & - \\ \hline SIVmac251 & K & N & D & M & Q & I & P & G & D & S & W & E & S & L & T & G & T \\ \hline SIVmac32H & K & D & D & M & Q & I & P & G & D & S & W & E & S & L & T & G & T \\ \hline SIVmac1A11 & K & K & D & M & Stop & - & - & - & - & - & - & - & - & - & - & - & - \\ \hline Clone 129 & K & D & D & M & Q & T & Q & G & D & R & W & E & N & F & A & R & T \\ \hline Clone 169 & K & D & D & M & Q & T & Q & G & G & R & W & E & N & F & A & R & A \\ \hline \end{tabular}} \end{table}
PMC1145188_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline \textbf{Finding} & \textbf{BASDAI} & \textbf{BASMI} & \textbf{BASFI} & \textbf{PatGA} & \textbf{PhysGA} & \textbf{NRS-P} & \textbf{ESR (mm/h)} & \textbf{CRP (mg/l)} \\ \hline \multicolumn{9}{|l|}{At time point 1a} \\ \hline Mean $\pm$ SD & 2.5 $\pm$ 1.8** & 2.7 $\pm$ 2.0* & 2.9 $\pm$ 2.4** & 2.6 $\pm$ 1.5** & 2.6 $\pm$ 2.1** & 2.6 $\pm$ 2.1** & 10.5 $\pm$ 7.3** & 3.1 $\pm$ 4.2** \\ \hline Median & 2.4 & 2.0 & 2.5 & 4.0 & 2.0 & 2.0 & 8.0 & 1.1 \\ \hline Range & 0.0 - 6.8 & 0.0 - 7.0 & 0.0 - 8.3 & 0.0 - 8.0 & 0.0 - 4.0 & 0.0 - 7.0 & 2.0 - 32.0 & 0.0 - 19.0 \\ \hline \multicolumn{9}{|l|}{At time point 2a} \\ \hline Mean $\pm$ SD & 6.1 $\pm$ 1.4** & 3.2 $\pm$ 2.2* & 5.8 $\pm$ 1.8** & 6.9 $\pm$ 2.1** & 7.0 $\pm$ 1.5** & 7.1 $\pm$ 1.7** & 31.5 $\pm$ 29.7** & 20.7 $\pm$ 23.7** \\ \hline Median & 6.2 & 3.0 & 5.7 & 7.0 & 7.0 & 7.0 & 23.0 & 14.0 \\ \hline Range & 4.0 - 9.2 & 0.0 - 9.0 & 1.2 - 9.1 & 4.0 - 10.0 & 4.0 - 10.0 & 0.0 - 10.0 & 4.0 - 150.0 & 0.3 - 126.0 \\ \hline \multicolumn{9}{|l|}{Change between time points 1 and 2} \\ \hline Mean $\pm$ SD & 3.6 $\pm$ 1.7 & 0.5 $\pm$ 1.5 & 2.9 $\pm$ 2.0 & 4.3 $\pm$ 1.9 & 4.4 $\pm$ 1.8 & 4.5 $\pm$ 2.2 & 21.0 $\pm$ 29.7 & 17.6 $\pm$ 23.4 \\ \hline Median & 3.6 & 0.5 & 2.5 & 4.0 & 4.0 & 4.0 & 12.0 & 11.5 \\ \hline Range & -1.2 - 6.7 & -4.0 - 3.0 & -0.5 - 7.8 & -2.0 - 8.0 & -2.0 - 8.0 & -1.0 - 8.0 & -6.0 - 146.0 & -6.3 - 123.0 \\ \hline \end{tabular}} \end{table}
PMC1174938_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Proliferation marker} & \textbf{rs} & \textbf{P} \\ \hline Thymidylate synthase & 0.38 & $<$0.001 \\ \hline Thymidine kinase 1 & 0.23 & $<$0.01 \\ \hline Survivin & 0.22 & $<$0.01 \\ \hline E2F & 0.22 & $<$0.01 \\ \hline Topoisomerase II$\alpha$ & 0.19 & $<$0.05 \\ \hline \end{tabular}} \end{table}
PMC1175052_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Patient characteristics} & \multicolumn{6}{|l|}{\textbf{CYP17 genotype}} \\ \hline & \multicolumn{2}{|l|}{\textbf{A1/A1 (n = 503)}} & \multicolumn{2}{|l|}{\textbf{A1/A2 (n = 668)}} & \multicolumn{2}{|l|}{\textbf{A2/A2 (n = 260)}} \\ \hline & \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} & \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} & \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} \\ \hline \multicolumn{7}{|l|}{Age at menarche (years)a} \\ \hline $<$13 & 68 (37.8) & 123 (38.2) & 84 (34.4) & 149 (35.1) & 34 (33.0) & 51 (32.5) \\ \hline $\geq$13 & 112 (62.2) & 199 (61.6) & 158 (64.8) & 275 (64.9) & 68 (66.0) & 106 (67.5) \\ \hline \multicolumn{7}{|l|}{Age at first full-term pregnancy (years)b} \\ \hline $<$25 & 69 (49.6) & 125 (49.4) & 106 (56.1) & 172 (52.1) & 40 (53.3) & 55 (45.1) \\ \hline $\geq$25 & 70 (50.4)) & 128(50.6) & 83 (43.9) & 158 (47.9) & 35 (46.7) & 67 (54.9) \\ \hline \multicolumn{7}{|l|}{Parity} \\ \hline 0 birth & 41 (22.8) & 70 (21.7) & 55 (22.5) & 94 (22.2) & 28 (27.2) & 35 (22.3) \\ \hline 1โ€“2 births & 123 (68.3) & 201 (62.2) & 168 (68.9) & 260 (61.3) & 63 (61.2) & 96 (61.1) \\ \hline $>$2 births & 16 (8.9) & 52 (16.1) & 21 (8.6) & 70 (16.5) & 12 (11.6) & 26 (16.6) \\ \hline \multicolumn{7}{|l|}{Total months of breastfeedingb} \\ \hline 0 & 43 (30.9) & 65 (25.7) & 53 (28.0) & 94 (28.5) & 20 (26.7) & 28 (22.9) \\ \hline 1โ€“12 & 86 (61.9) & 156 (61.7) & 117 (61.9) & 186 (56.4) & 50 (66.8) & 74 (60.7) \\ \hline $>$12 & 10 (7.2) & 32 (12.6) & 19 (10.1) & 50 (15.2) & 5 (6.7) & 20 (16.4) \\ \hline \multicolumn{7}{|l|}{Ever use oral contraceptivec} \\ \hline No & 30 (17.1) & 62 (19.4) & 31 (13.0) & 84 (20.0)* & 24 (23.3) & 32 (20.5) \\ \hline Yes & 146 (82.9) & 258 (80.6) & 207 (87.0) & 336 (80.0) & 79 (76.7) & 124 (79.5) \\ \hline \multicolumn{7}{|l|}{Family history of breast cancer in first-degree relative} \\ \hline No & 150 (83.3) & 306 (94.7)* & 217 (88.9) & 407 (96.0) & 95 (92.2) & 143 (91.1) \\ \hline Yes & 30 (16.7) & 17 (5.3) & 27 (11.1) & 17 (4.0) & 8 (7.8) & 14 (8.9) \\ \hline \multicolumn{7}{|l|}{Current BMI (k/m2)d} \\ \hline $<$20.0 & 26 (14.4) & 35 (10.8) & 39 (16.0) & 47 (11.1) & 10 (9.7) & 25 (15.9) \\ \hline 20.0โ€“25.0 & 95 (52.8) & 191 (59.1) & 130 (53.3) & 245 (57.8) & 64 (62.1)) & 87 (55.4) \\ \hline 25.1โ€“30.0 & 38 (21.1) & 71 (22.0) & 51 (20.9) & 95 (22.4) & 20 (19.4) & 30 (19.1) \\ \hline $>$30.0 & 20 (11.1) & 25 (7.7) & 24 (9.8) & 37 (8.7) & 9 (8.7) & 15 (9.6) \\ \hline \multicolumn{7}{|l|}{Educational level} \\ \hline Low & 24 (13.4) & 39 (12.1) & 31 (12.7) & 50 (11.8) & 16 (15.5) & 17 (10.8) \\ \hline Middle & 114 (63.3) & 200 (61.9) & 159 (65.2) & 262 (61.8) & 63 (61.2) & 87 (55.4) \\ \hline High & 42 (23.3) & 84 (26.0) & 54 (22.1) & 112 (26.4) & 24 (23.3) & 53 (33.8) \\ \hline \multicolumn{7}{|l|}{Alcohol consumption (g/day)} \\ \hline 0 & 39 (21.7) & 52 (16.1)* & 52 (21.3) & 72 (17.0) & 18 (17.5) & 24 (15.3) \\ \hline 1โ€“18 & 118 (65.5) & 246 (76.2) & 158 (64.8) & 309 (72.9) & 70 (68.0) & 119 (75.8) \\ \hline $>$18 & 23 (12.8) & 25 (7.7) & 34 (13.9) & 43 (10.1) & 15 (14.5) & 14 (8.8) \\ \hline \end{tabular}} \end{table}
PMC1175058_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{EM operation} & \textbf{Definition} \\ \hline Overlap (x โ y) & x and y overlap if they have a part in common. \\ \hline Disjoint (x ฮน y) & x and y are disjoint if they share no parts in common. \\ \hline Binary product (x . y) & The parts that x and y share in common. \\ \hline Difference (x - y) & The largest portion of x which has no part in common with y. \\ \hline Binary sum (x + y) & The set consisting of individuals x and y. \\ \hline \end{tabular}} \end{table}
PMC1175956_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Parameter} & \textbf{Group 1 n = 19} & \textbf{Group 2 n = 19} & \textbf{Group 3 n = 18} & \textbf{One-way F-Value ANOVA,} & \textbf{P value} \\ \hline Age & 69.6 $\pm$ 9.2 & 65.8 $\pm$ 7.8 & 70.8 $\pm$ 9.9 & 1.58 & NS \\ \hline ACD & 2.6 $\pm$ 0.20 & 2.8 $\pm$ 0.37 & 2.59 $\pm$ 0.45 & 1.97 & NS \\ \hline \multicolumn{6}{|l|}{UCVA} \\ \hline Pre-operative & 0.12 $\pm$ 0.14 & 0.09 $\pm$ 0.13 & 0.11 $\pm$ 0.9 & 0.18 & NS \\ \hline Day one & 0.28 $\pm$ 19a & 0.39 $\pm$ 23c & 0.37 + 0.27b & 1.22 & NS \\ \hline Three month & 0.51 $\pm$ 0.16c & 0.61 $\pm$ 0.20c & 0.61 $\pm$ 0.20c & 1.51 & NS \\ \hline Repeated measure within group ANOVA & F P = = 15.0 0.0001 & F P = = 28.29 0.0001 & F P = = 23.5 0.0001 \\ \hline \multicolumn{6}{|l|}{BCVA} \\ \hline Pre-operative & 0.18 $\pm$ 0.11 & 0.17 $\pm$ 0.19 & 0.18 $\pm$ 0.13 & 0.04 & NS \\ \hline Day one & 0.46 $\pm$ 0.23b & 0.69 $\pm$ 0.26c & 0.55 $\pm$ 0.31a & 1.70 & NS \\ \hline Three month & 0.69 $\pm$ 0.24c & 0.88 $\pm$ 0.18c & 0.79 $\pm$ 0.23c & 2.73 & NS \\ \hline Repeated measure within group ANOVA & F P = = 34.17 0.0001 & F P = = 43.8 0.0001 & F P = = 23.5 0.0001 \\ \hline \multicolumn{6}{|l|}{Corneal thickness} \\ \hline Pre-operative & 560.7 $\pm$ 91.5 & 567.5 $\pm$ 44.07 & 576.0 $\pm$ 50.2 & 0.25 & NS \\ \hline Day one & 645.8 $\pm$ 94.1c & 665.5 $\pm$ 141.9b & 670.6 $\pm$ 117.1b & 0.32 & NS \\ \hline Three month & 573.4 $\pm$ 73.6 & 586.1 $\pm$ 29.0 & 586.7 $\pm$ 36.0 & 1.50 & NS \\ \hline Repeated measure within group ANOVA & F P = = 17.5 0.0001 & F P = = 11.4 0.0001 & F P = = 11.19 0.0001 \\ \hline \multicolumn{6}{|l|}{Endothelial cell count.} \\ \hline Pre-operative & 2311.73 $\pm$ 288.0 & 2359.78 $\pm$ 383.2 & 2526.6 $\pm$ 305.4 & 2.36 & NS \\ \hline Day one & 2021.20 $\pm$ 201.0 & 2035.05 $\pm$ 377.0 & 2196.4 $\pm$ 378.2 & 0.11 & NS \\ \hline Three month & 1973.00 $\pm$ 537.0 & 1959.00 $\pm$ 503.0 & 2132.0 $\pm$ 482.0 & 0.82 & NS \\ \hline Repeated measure within group ANOVA & F P = = 4.2 0.004 & F P = = 2.20 NS & F P = = 17.5 0.0001 \\ \hline \end{tabular}} \end{table}
PMC1180454_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline & \textbf{Type II cells + C. pneumoniae} & \textbf{Macrophages + C. pneumoniae} & \textbf{Type II cells โ€“ 10\% macrophages} \\ \hline 0 min & 160 $\pm$ 21 & 231 $\pm$ 22 & 137 \\ \hline 30 min & 210 $\pm$ 93 & 439 $\pm$ 49 & 166 \\ \hline 1 hour & 509 $\pm$ 76 & 1390 $\pm$ 329 & 370 \\ \hline 2 hours & 2405 $\pm$ 486 & 2715 $\pm$ 587 & 2134 \\ \hline 3 hours & 3367 $\pm$ 262 & 3600 $\pm$ 106 & 3007 \\ \hline 6 hours & 5274 $\pm$ 1095 & 11255 $\pm$ 2498 & 4149 \\ \hline 12 hours & 16179* $\pm$ 4577 & 24511ยง $\pm$ 5161 & 13728 \\ \hline \end{tabular}} \end{table}
PMC1180473_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{3}{|l|}{\textbf{Low A}} & \multicolumn{3}{|l|}{\textbf{Low B}} \\ \hline & \textbf{Observed} & \textbf{RR} & \textbf{p-value} & \textbf{Observed} & \textbf{RR} & \textbf{p-value} \\ \hline Not Adjusted & 440 & 0.81 & 0.004 & * & * & * \\ \hline Adjusted for Urban/Rural Status & 440 & 0.81 & 0.002 & * & * & * \\ \hline Adjusted for SES & * & * & * & 94 & 0.63 & 0.009 \\ \hline Adjusted for SES \& Urban/Rural Status & * & * & * & 94 & 0.635 & 0.016 \\ \hline \end{tabular}} \end{table}
PMC1180846_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Group} & \textbf{Patient Number} & \textbf{Refracted months surgery post Va two} & \textbf{Last Va} & \textbf{Macula dry at two clinically weeks} & \textbf{Macula dry at last clinically FU} \\ \hline A & 1 & 6/9 & 6/18 & Yes & Yes \\ \hline & & 6/9 & 6/12 & Yes & Yes \\ \hline A & 2 & 6/12 & 6/12 & Yes & Yes \\ \hline & & 6/36 & 6/36 & No & No \\ \hline A & 3 & 6/18 & 6/18 & Yes & Yes \\ \hline A & 4 & 6/9 & 6/12 & Yes & No \\ \hline & & CF & CF & No & No \\ \hline A & 5 & 6/60 & 6/60 & No & No \\ \hline A & 6 & 6/36 & 6/36 & Yes & No \\ \hline & & 6/24 & 6/36 & Yes & No \\ \hline A & 7 & 6/6 & 6/6 & Yes & Yes \\ \hline A & 8 & 6/9 & 6/9 & Yes & Yes \\ \hline & & 6/9 & 6/12 & Yes & Yes \\ \hline A & 9 & 6/24 & 6/24 & Yes & No \\ \hline A & 10 & 6/18 & 6/18 & Yes & Yes \\ \hline B & 10 & 6/18 & 6/18 & Yes & No \\ \hline B & 11 & 6/12 & 6/12 & Yes & Yes \\ \hline B & 12 & 6/6 & 6/6 & Yes & Yes \\ \hline \end{tabular}} \end{table}
PMC1183218_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Group} & \textbf{Patient Number} & \textbf{Follow up (months)} & \textbf{Raised IOP} & \textbf{Stepwise in last retinopathy FU (ETDRS) deterioration grade at} \\ \hline A & 1 & 15 & & 3 \\ \hline & & 14 & & 1 \\ \hline A & 2 & 6 & & 0 \\ \hline & & 8 & Yes: 34 mmHg & 0 \\ \hline A & 3 & 9 & & 0 \\ \hline A & 4 & 10 & & 0 \\ \hline & & 12 & Yes: 29 mm Hg & 1 \\ \hline A & 5 & 11 & Yes: 31 mm Hg & 0 \\ \hline A & 6 & 10 & & 1 \\ \hline & & 7 & & 0 \\ \hline A & 7 & 12 & & 0 \\ \hline A & 8 & 5 & Yes: 24 mmHg & 1 \\ \hline & & 5 & & 0 \\ \hline A & 9 & 7 & & 1 \\ \hline A & 10 & 6 & & 0 \\ \hline B & 10 & 4 & & 0 \\ \hline B & 11 & 8 & & 0 \\ \hline B & 12 & 4 & & 0 \\ \hline & & Mean FU = 8.5 \\ \hline \end{tabular}} \end{table}
PMC1183218_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Study} & \textbf{Year} & \textbf{Country} & \textbf{Type of cardiac surgery} & \textbf{Interventions} \\ \hline Isetta et al. [25] & 1993 & France & NR & HD vs. Control APR (n (n = 70) = 70) vs. LD APR (n = 70) vs. TXA (n = 70) \\ \hline Blauhut et al. [27] & 1994 & Switzerland & CABG & HD APR (n = 14) vs. TXA (n = 14) vs. Control (n = 14) \\ \hline Penta de Peppo et al. [20] & 1995 & Italy & CABG \& Valve Sx. & HD Control APR (n (n = = 15) 15) vs. TXA (n = 15) vs. EACA (n = 15) vs. \\ \hline Corbeau et al. [23] & 1995 & France & CABG \& Valve Sx. & HD APR (n = 43) vs. TXA (n = 41) vs. Control (n = 20) \\ \hline Pugh et al. [22] & 1995 & UK & Primary CABG & LD APR (n = 21) vs. TXA (n = 22) vs. Control (n = 23) \\ \hline Speekenbrink et al. [21] & 1995 & The Netherlands & Primary CABG & PP Control APR (n (n = = 15) 15) vs. TXA (n = 15) vs. DIP (n = 12) vs. \\ \hline Menichetti et al. [24] & 1996 & Italy & Primary CABG & HD Control APR (n (n = = 24) 24) vs. TXA (n = 24) vs. EACA (n = 24) vs. \\ \hline Pinosky et al. [33] & 1997 & USA & Primary CABG & TXA (n = 20) vs. EACA (n = 20) vs. Placebo (n = 19) \\ \hline Mongan et al. [31] & 1998 & USA & Primary CABG & HD APR (n = 75) vs. TXA (n = 75) \\ \hline Hardy et al. [26] & 1998 & Canada & Primary CABG & TXA (n = 42) vs. EACA (n = 46) vs. Placebo (n = 44) \\ \hline Eberle et al. [29] & 1998 & Germany & Primary CABG & HD APR (n = 20) vs. EACA (n = 20) \\ \hline Misfeld et al. [30] & 1998 & Germany & Primary CABG & LD APR (n = 14) vs. TXA (n = 14) vs. Control (n = 14) \\ \hline Casati et al. [28] & 1999 & Italy & Primary CABG \& Valve Sx. & HD APR (n = 67) vs. TXA (n = 70) vs. EACA (n = 66) \\ \hline Bernet et al. [34] & 1999 & Switzerland & Primary CABG & HD APR (n = 28) vs. TXA (n = 28) \\ \hline Nuttall et al. [32] & 2000 & USA & Re-do CABG \& Valve Sx. & HD 32) vs APR Placebo (n = 40) (n = vs. 43) TXA (n = 45) vs. TXA+ANH (n = \\ \hline Maineri et al. [38] & 2000 & Italy & Primary CABG & TXA (n = 24) vs. EACA (n = 24) \\ \hline Wong et al. [37] & 2000 & Canada & Re-do CABG \& Valve Sx. & HD APR (n = 39) vs. TXA (n = 38) \\ \hline Casati et al. [35] & 2000 & Italy & Primary ASD Repair CABG \& Valve \& & HD APR (n = 518) vs. TXA (n = 522) \\ \hline Greilich et al. [36] & 2001 & USA & Primary CABG & HD APR (n = 24) vs. EACA (n = 23) vs. Placebo (n = 25) \\ \hline Ray et al. [6] & 2001 & Australia & CABG \& Valve Sx. & LD APR (n = 49) vs. EACA (n = 51) \\ \hline \end{tabular}} \end{table}
PMC1185524_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{4}{|l|}{\textbf{Developmental outcome PARENT (Odds COMPLETED ratio and 95\% confidence interval)}} \\ \hline \\ \hline & \textbf{Motor} & \textbf{Speech \& language} & \textbf{Behaviour} & \textbf{Cognition} \\ \hline All centres (N = 705) & 1.30 (0.75, 2.25)2 & 1.10 (0.60, 2.02) 3,4 & 1.05 (0.66, 1.67) 2 & 0.85 (0.35, 2.09) \\ \hline \multicolumn{5}{|l|}{Sensitivity analyses} \\ \hline a) France only (N = 379)1 & 1.22 (0.61, 2.42)2 & 0.98 (0.45,2.14) & 1.15 (0.64, 2.09) & 0.55 (0.17, 1.76)2 \\ \hline b) Poland only (N = 134) & 1.10 (0.30, 4.06) & 0.54 (0.13, 2.26) & 0.94 (0.30, 2.92) & 1.02 (0.16, 6.62) \\ \hline c) Children aged 36 to $<$41 months (N = 553) & 1.18 (0.68, 2.05) & 1.04 (0.54, 2.00) & 1.25 (0.70, 2.22) & 0.61 (0.25, 1.50) \\ \hline d) excluded) Children with no signs before 4 months (N = 538 Poland & 1.08 (0.57, 2.07) & 1.10 (0.51, 2.36) & 1.02 (0.57, 1.82)2 & 0.35 (0.10, 1.24) \\ \hline & \multicolumn{4}{|l|}{CHILD COMPLETED} \\ \hline & \multicolumn{2}{|l|}{'Draw a Man'} & \multicolumn{2}{|l|}{Line, circle, cross} \\ \hline All centres (N = 705) & \multicolumn{2}{|l|}{1.27 (0.66, 2.44)5} & \multicolumn{2}{|l|}{1.13 (0.56, 2.25)} \\ \hline \multicolumn{5}{|l|}{Sensitivity analyses} \\ \hline a) France only (N = 379)1 & \multicolumn{2}{|l|}{0.77 (0.35, 1.67)} & \multicolumn{2}{|l|}{0.93 (0.40, 2.18)} \\ \hline b) Poland only (N = 134) & \multicolumn{2}{|l|}{1.00 (0.17, 5.77)} & \multicolumn{2}{|l|}{0.76 (0.13, 4.41)} \\ \hline c) Children aged 36 to $<$41 months (N = 553) & \multicolumn{2}{|l|}{0.79 (0.39, 1.63)5} & \multicolumn{2}{|l|}{0.96 (0.48, 1.95)} \\ \hline d) excluded) Children with no signs before 4 months (N = 538 Poland & \multicolumn{2}{|l|}{0.96 (0.46, 2.02)} & \multicolumn{2}{|l|}{1.03 (0.45, 2.36)} \\ \hline \end{tabular}} \end{table}
PMC1199601_table_4
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{Variable} & \textbf{Definition} \\ \hline \multicolumn{2}{|l|}{Dependent Variable} \\ \hline Expenditures & Continuous variable: total household annual out-of-pocket medical expenditures \\ \hline \multicolumn{2}{|l|}{Independent Variable} \\ \hline Demographic variables & (Economic Household Head, EHH) \\ \hline Married & Dummy and divorced. variable = 1 if EHH is currently married, otherwise = 0 including never married, widowed, separated \\ \hline Male & Dummy variable = 1 if EHH is male. \\ \hline Employed & Dummy variable = 1 if EHH is employed. \\ \hline \multicolumn{2}{|l|}{Age} \\ \hline 25โ€“44 & Dummy variable = 1 if EHH's age in this range. \\ \hline 45โ€“64 & Dummy variable = 1 if EHH's age in this range. \\ \hline 65 and above & Dummy variable = 1 if EHH's age in this range. (EHH's age under 25 is the default variable.) \\ \hline \multicolumn{2}{|l|}{Education} \\ \hline Junior high & Dummy variable = 1 if EHH finished Junior high school. \\ \hline Senior (vocational) high & Dummy variable = 1 if EHH finished senior (or vocational) high school. \\ \hline Junior college & Dummy variable = 1 if EHH finished Junior college. \\ \hline College and above & Dummy variable = 1 if EHH finished college and above. (Primary school and below is the default variable.) \\ \hline Family members & Dummy variable = 1 if the number of household members $\geq$ 4. \\ \hline NHI & Dummy variable = 1 if EHH is from the post-national health insurance cohort. \\ \hline \multicolumn{2}{|l|}{Household income} \\ \hline Lower 20\%~2nd quintile & Dummy variable = 1 if family income is lower 20\%. \\ \hline Middle 20\%~3rd quintile & Dummy variable = 1 if family income is middle 20\%. \\ \hline Higher 20\%~4th quintile & Dummy variable = 1 if family income is higher 20\%. \\ \hline Highest 20\%~5th quintile & Dummy variable = 1 if family income is highest 20\%. (Lowest 20\%~1st quintile is the default variable) \\ \hline \multicolumn{2}{|l|}{Regional variables} \\ \hline Center & Dummy Hsien, Taichung variable City. = 1 if the household is located in: Taichung Hsien, Changhwa Hsien, Nantou Hsien, Yunlin \\ \hline South & Dummy Hsien, Kaohsiung variable = Municipality, 1 if the household Chiayi is City, located Tainan in: City. Chiayi Hsien, Tainan Hsien, Kaohsiung Hsien, Pingtung \\ \hline East & Dummy variable = 1 if the household is located in: Taitung Hsien, Hwalien Hsien, Penghu Hsien. \\ \hline North & Dummy Hsinchu variable Hsien, Miaoli = 1 if Hsien, the household and Taipei is located Municipality. in: Taipei (North Hsien, is the Keelung default City, variable) Ilan Hsien, Taoyuan Hsien, \\ \hline \end{tabular}} \end{table}
PMC1208885_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline & \textbf{SF-12 Mental Health Component} & \textbf{SF-12 Physical Health Component} & \textbf{SF-12 General Health Perception} \\ \hline Age & NS & NS & NS \\ \hline Body Mass Index & p r = = -0.213 0.021* & p r = = -0.262 0.004* & p r = = -0.272 0.003* \\ \hline Fear of falling (VAS) & NS & p r = = -0.248 0.007* & p r = = -0.223 0.016* \\ \hline Balance (BBS) & NS & p r = = 0.000* 0.381 & p r = = 0.003* 0.270 \\ \hline Functional mobility (TUG) & NS & p r = = -0.354 0.000* & p r = = -0.249 0.007* \\ \hline Proprioception (Joint position sense) & NS & NS & NS \\ \hline Muscle strength (Back/leg dynamometer) & NS & p r = = 0.000* 0.338 & p r = = 0.016* 0.230 \\ \hline Flexibility (Sit and reach test) & NS & NS & NS \\ \hline \end{tabular}} \end{table}
PMC1208910_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Age} & \textbf{Sample Size} & \textbf{Mean} & \textbf{S.E.} & \textbf{Ratio Index} \\ \hline 19โ€“30 years & 5 & 78980 & 15580 & 5.1 \\ \hline 31โ€“35 years & 13 & 25300 & 4860 & 2.1 \\ \hline 36โ€“40 years & 14 & 21450 & 2650 & 4.7 \\ \hline 41โ€“45 years & 32 & 7320 & 1450 & 0.8 \\ \hline $>$45 years & 36 & 1880 & 310 & 1.0 \\ \hline \end{tabular}} \end{table}
PMC1215522_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline \textbf{Source} & \multicolumn{2}{|l|}{\textbf{dChip}} & \multicolumn{2}{|l|}{\textbf{MAS 5.0}} & \multicolumn{2}{|l|}{\textbf{RMA}} & \multicolumn{2}{|l|}{\textbf{GCRMA-EB}} \\ \hline & \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} \\ \hline Biological variation & 0.431 & 0.304 & 0.292 & 0.300 & 0.393 & 0.306 & 0.310 & 0.292 \\ \hline Labeling variation & 0.206 & 0.230 & 0.136 & 0.198 & 0.221 & 0.224 & 0.147 & 0.192 \\ \hline Residual error & 0.363 & 0.274 & 0.572 & 0.311 & 0.386 & 0.272 & 0.543 & 0.298 \\ \hline \end{tabular}} \end{table}
PMC1232851_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{SAMPLES} & \textbf{RT-PCR} & \textbf{P503S} & \textbf{P504S} & \textbf{P510S} \\ \hline PB & & No (\%) & No (\%) & No (\%) \\ \hline \multicolumn{5}{|l|}{group 1} \\ \hline AA and RP (n = 11) & positive & 7 (63.63) & 7 (63.63) & 11 (100) \\ \hline & negative & 4(36.36) & 4(36.36) & 0 \\ \hline \multicolumn{5}{|l|}{group 2} \\ \hline Pca in prostate biopsy (n = 11) & positive & 2 (18.18) & 9 (81.81) & 11 (100) \\ \hline & negative & 9 (81.81) & 2 (18.18) & 0 \\ \hline \multicolumn{5}{|l|}{group 3} \\ \hline BPH in prostate biopsy (n = 20) & positive & 5 (25) & 11 (55) & 15 (75) \\ \hline & negative & 15 (75) & 9 (45) & 5 (25) \\ \hline \multicolumn{5}{|l|}{Frozen tissues} \\ \hline Neoplastic and non neoplastic & positive & 4 (66.66) & 4 (66.66) & 5 (83.83) \\ \hline prostate tissues (n = 6) & negative & 2 (33.33) & 2 (33.33) & 1 (16.16) \\ \hline Non prostatic tissues (n = 6) & positive & 6 (100) & 1(16.66) & 2 (33,33) \\ \hline & negative & 0 & 5 (83.33) & 4 (66.66) \\ \hline \multicolumn{5}{|l|}{Cell lines (n = 6)} \\ \hline prostatic (n = 2) & positive & 2 (100) & 2 (100) & 2 (100) \\ \hline & negative & 0 & 0 & 0 \\ \hline non prostatic (n = 4) & positive & 4 (100) & 2 (50) & 2 (50) \\ \hline & negative & 0 & 2 (50) & 2 (50) \\ \hline \end{tabular}} \end{table}
PMC1236915_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Group} & \textbf{Animals (n)} & \textbf{Total Cells BAL) ($\times$ 104/total} & \textbf{Macrophages total BAL) ($\times$ 104/} & \textbf{Eosinophils total BAL) ($\times$ 104/} & \textbf{Neutrophils total BAL) ($\times$ 104/} & \textbf{Mononuclear ($\times$ 104/total BAL) Cells} \\ \hline vehicle & 16 & 36.88 $\pm$ 3.56 & 36.74 $\pm$ 3.53 & 0 $\pm$ 0 & 0.12 $\pm$ 0.05 & 0.015 $\pm$ 0.01 \\ \hline 14 nm & 13 & 111.69 $\pm$ 9.27** & 83.79 $\pm$ 6.03** & 0.332 $\pm$ 0.176 & 27.04 $\pm$ 4.98** & 0.491 $\pm$ 0.201* \\ \hline 56 nm & 14 & 97.36 $\pm$ 16.06** & 88.64 $\pm$ 15.34** & 0.331 $\pm$ 0.177 & 8.09 $\pm$ 2.49* & 0.265 $\pm$ 0.093 \\ \hline OVA & 16 & 85.06 $\pm$ 12.63** & 81.91 $\pm$ 12.4** & 0.705 $\pm$ 0.255 & 2.2 $\pm$ 0.62 & 0.121 $\pm$ 0.059 \\ \hline OVA + 14 nm & 16 & 193.69 $\pm$ 18.33** \#\# \$\$ & 141.86 $\pm$ 14.97** \#\# \$ & 13.667 $\pm$ 4.731** \$ \#\# & 36.9 $\pm$ 3.67** \#\# \$ & 0.878 $\pm$ 0.232** \# \\ \hline OVA + 56 nm & 17 & 102.65 $\pm$ 11.64** & 90.7 $\pm$ 10.12** & 3.984 $\pm$ 2.669 & 7.79 $\pm$ 2.29* & 0.204 $\pm$ 0.073 \\ \hline \end{tabular}} \end{table}
PMC1242256_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Parameter} & \textbf{Description} & \textbf{Value} \\ \hline C\% & Pattern conservation & 95\% 90\% (dog) (rat) \\ \hline L & Maximum pattern length & 25 amino acids \\ \hline S & Research complexity & Medium High (E (E = 0; = 1; dog) rat) \\ \hline PN & Maximum number of pattern symbols & 25 \\ \hline PX & Maximum number of consecutive undetermined amino acids & 5 \\ \hline FN & Maximum number of flexible gaps & 2 \\ \hline FL & Maximum flexibility of a flexible wildcard & 3 \\ \hline FP & Maximum flexibility product & 10 \\ \hline \end{tabular}} \end{table}
PMC1257466_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Gene} & \textbf{Forward \& reverse primers 5' $\rightarrow$ 3'} & \textbf{[C] a} & \textbf{Amplicon size (bp)} & \textbf{Tm b (ยฐC)} & \textbf{Slope} & \textbf{R2c} & \textbf{E d} \\ \hline ACTB & ATGCCTCCTGCACCACCA GCATTTGCGGTGGACGAT & 300 & 125 & 85 & -3.597 & 0.999 & 1.897 \\ \hline YWHAZ & TGTAGGAGCCCGTAGGTCATCT TTCTCTCTGTATTCTCGAGCCATCT & 100 & 102 & 79 & -3.335 & 0.988 & 1.995 \\ \hline RPL19 & CAACTCCCGCCAGCAGAT CCGGGAATGGACAGTCACA & 200 & 76 & 83 & -3.342 & 0.992 & 1.992 \\ \hline GAPDH & ATGCCTCCTGCACCACCA AGTCCCTCCACGATGCCAA & 100 & 76 & 84 & -3.485 & 0.991 & 1.936 \\ \hline G6PDH & TGACCTATGGCAACCGATACAA CCGCAAAAGACATCCAGGAT & 300 & 76 & 81 & -3.363 & 0.965 & 1.983 \\ \hline SDHA & CATCCACTACATGACGGAGCA ATCTTGCCATCTTCAGTTCTGCTA & 200 & 90 & 82 & -3.643 & 0.992 & 1.881 \\ \hline PrP & GCCAAAAACCAACATGAAGCAT TGCTCATGGCACTTCCCAG & 300 & 95 & 83 & -3.338 & 0.995 & 1.993 \\ \hline \end{tabular}} \end{table}
PMC1262732_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{MR diagnosis} & \textbf{No. of cases} \\ \hline White-matter signal abnormalities & 113 \\ \hline Lacunar infarction & 31 \\ \hline Old lobar or cerebellar infarction & 13 \\ \hline Venous malformation & 6 \\ \hline Arachinoid cyst in the middle cranial fossa & 4 \\ \hline Old bleeding & 4 \\ \hline Old traumatic lesion & 2 \\ \hline Cerebral atrophy & 2 \\ \hline Total & 175 \\ \hline \end{tabular}} \end{table}
PMC1266373_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Variable} & \textbf{Coefficient} & \textbf{Standard error} & \textbf{OR} & \textbf{95\% CI of OR} & \textbf{p-value} \\ \hline cTnI & 1.04 & 0.6 & 2.82 & 0.87โ€“9.2 & 0.085 \\ \hline APACHE II & 0.09 & 0.03 & 1.094 & 1.02โ€“1.17 & 0.009 \\ \hline \end{tabular}} \end{table}
PMC1269455_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|} \hline & \textbf{Cont 3 M} & \textbf{Cont 6 M} & \textbf{Cont 11 M} & \textbf{Cont 21 M} & \textbf{Inulin 3 M} & \textbf{Inulin 6 M} & \textbf{Inulin 11 M} & \textbf{Inulin 21 M} & \textbf{inulin} & \textbf{age} & \textbf{interaction} \\ \hline Plasma Ca, mg/L & 98 $\pm$ 4 & 98 $\pm$ 5 & 95 $\pm$ 6 & 100 $\pm$ 5 & 102 $\pm$ 5 & 99 $\pm$ 4 & 98 $\pm$ 3 & 100 $\pm$ 4 & 0.0601 & 0.0619 & NS \\ \hline Tibia weight, mg dw & 480 $\pm$ 42 & 630 $\pm$ 80 & 717 $\pm$ 89 & 630 $\pm$ 93 & 489 $\pm$ 66 & 617 $\pm$ 66 & 841 $\pm$ 92 & 648 $\pm$ 47 & 0.042 & $<$0.0001 & 0.023 \\ \hline Bone Ca, mg/g dw & 207 $\pm$ 21 & 214 $\pm$ 15 & 216 $\pm$ 15 & 215 $\pm$ 21 & 205 $\pm$ 13 & 215 $\pm$ 18 & 202 $\pm$ 14 & 228 $\pm$ 7 & NS & 0.018 & 0.0639 \\ \hline Plasma Mg, mg/L & 17.9 $\pm$ 1.1 & 17.7 $\pm$ 1.1 & 17.2 $\pm$ 1.0 & 16.9 $\pm$ 1.3 & 17.6 $\pm$ 1.1 & 17.9 $\pm$ 1.3 & 18.2 $\pm$ 1.5 & 18.2 $\pm$ 1.7 & 0.0570 & NS & NS \\ \hline Erythrocyte Mg, mg/L & 45.4 $\pm$ 3.8 & 44.2 $\pm$ 4.7 & 42.5 $\pm$ 3.4 & 43.4 $\pm$ 3.0 & 44.9 $\pm$ 4.9 & 43.8 $\pm$ 2.5 & 44.3 $\pm$ 3.6 & 43.8 $\pm$ 3.9 & NS & NS & NS \\ \hline Bone Mg, mg/g dw & 3.92 $\pm$ 0.10 & 3.79 $\pm$ 0.08 & 3.72 $\pm$ 0.08 & 3.76 $\pm$ 0.08 & 3.91 $\pm$ 0.10 & 3.72 $\pm$ 0.07 & 3.73 $\pm$ 0.09 & 3.72 $\pm$ 0.09 & NS & $<$0.0001 & NS \\ \hline \end{tabular}} \end{table}
PMC1283151_table_4
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline & & \multicolumn{2}{|l|}{\textbf{Multiple regrafts}} \\ \hline \textbf{No of eyes (n = 53)} & \textbf{1 regraft (n = 37)} & \textbf{2 regraft (n = 14)} & \textbf{3 regraft (n = 2)} \\ \hline Clear regrafts (n = 28) & 25 & 3 & 0 \\ \hline Failed regrafts (n = 25) & 12 & 11 & 2 \\ \hline p value (Paired 't' test) & 0.001 (statistically significant) & 0.006 (not significant) \\ \hline \end{tabular}} \end{table}
PMC1291374_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \multicolumn{3}{|l|}{\textbf{Have you ever been treated for thyroid disease in the past?}} \\ \hline \textbf{Yes} & \multicolumn{2}{|l|}{\textbf{No}} \\ \hline \textbf{If yes (multiple yes answers are possible)} \\ \hline Was this called Graves' disease? & No & Yes \\ \hline Was this called Hashimoto's disease? & No & Yes \\ \hline Was this called hyperthyroidism? & No & Yes \\ \hline Was this called hypothyroidism? & No & Yes \\ \hline Did you ever take Synthroid? & No & Yes \\ \hline Did you ever take Eltroxin? & No & Yes \\ \hline Did you ever take propylthiouricil? & No & Yes \\ \hline Did you ever take methimazole? & No & Yes \\ \hline Did you ever have radiation treatment for your thyroid? & No & Yes \\ \hline At what age were you diagnosed with any of the above? & \multicolumn{2}{|l|}{________ years old} \\ \hline \end{tabular}} \end{table}
PMC1308850_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{European haplotypes} \\ \hline Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\ \hline HapBlock & 0.1\% & 180 & 951.63 & 7.49 & 85.6\% \\ \hline HapBlock & 10\% & 48 & 3363.60 & 7.64 & 80.7\% \\ \hline Gabriel & 0.1\% & 39 & 4414.28 & 31.41 & 86.1\% \\ \hline Gabriel & 10\% & 33 & 4837.52 & 10.84 & 79.8\% \\ \hline MDBlocks & 0.1\% & - & - & - & - \\ \hline MDBlocks & 10\% & 18 & 9348.78 & 20.39 & 84.4\% \\ \hline \multicolumn{6}{|l|}{African haplotypes American} \\ \hline Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\ \hline HapBlock & 0.1\% & 232 & 733.52 & 7.13 & 85\% \\ \hline HapBlock & 10\% & 61 & 2499.93 & 6.26 & 76.2\% \\ \hline Gabriel & 0.1\% & 40 & 4433.62 & 37.85 & 88.6\% \\ \hline Gabriel & 10\% & 36 & 4416.75 & 10.25 & 80\% \\ \hline MDBlocks & 0.1\% & - & - & - & - \\ \hline MDBlocks & 10\% & 18 & 10004.44 & 21.22 & 90\% \\ \hline \multicolumn{6}{|l|}{East Asian haplotypes} \\ \hline Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\ \hline HapBlock & 0.1\% & 208 & 831.83 & 7.93 & 86.5\% \\ \hline HapBlock & 10\% & 57 & 2596.73 & 5.84 & 74\% \\ \hline Gabriel & 0.1\% & 41 & 3966.02 & 24.12 & 81.3\% \\ \hline Gabriel & 10\% & 38 & 3437.13 & 8.34 & 65.3\% \\ \hline MDBlocks & 0.1\% & - & - & - & - \\ \hline MDBlocks & 10\% & 18 & 10006.11 & 18.50 & 90\% \\ \hline \end{tabular}} \end{table}
PMC1343594_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Type of post consultation letter} & \textbf{Letter to General Practitioner} & \textbf{Letter to patient} & \textbf{Significance (Wilcoxin Signed Ranks test)} \\ \hline Length (minutes of $\pm$ time SD, to n) dictate letter & 3.28 $\pm$ 2.2, 81 & 2.57 $\pm$ 1.42, 82 & p = 0.019 \\ \hline Flesch Reading Ease Score & 49.76 $\pm$ 9.1, 84 & 55.44 $\pm$ 9.26, 84 & p $<$ 0.001 \\ \hline Flesch-Kincaid Grade Level & 10.72 $\pm$ 1.43 & 11.04 $\pm$ 1.39 & p = 0.062 \\ \hline Circled items in each letter & 31/63 circled 1โ€“12 items & 16/63 circled 1โ€“5 items & p $<$ 0.001 \\ \hline Word Count & 444 $\pm$ 169.87 & 351.5 $\pm$ 129.05 & p $<$ 0.001 \\ \hline \end{tabular}} \end{table}
PMC1360088_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Infection} & \textbf{Saudi infections Number patients among of (\%)} & \textbf{Average infections 100,000 incidence population annual Saudi per of} & \textbf{non-Saudi infections Number (\%) patients among of} & \textbf{100,000 Average infections incidence population non-Saudi annual per of} & \textbf{Total infections number (\%) of} & \textbf{Average infections 100,000 incidence population annual total per of} \\ \hline Nongonococcal urethritis & 12246 (84.1) & 14.8 & 2311 (15.9) & 7.5 & 14557 (37.3) & 12.8 \\ \hline Trichomoniasis & 7772 (70.9) & 9.4 & 3195 (29.1) & 10.4 & 10967 (28.1) & 9.7 \\ \hline Gonococcal urethritis & 4274 (77.1) & 5.2 & 1273 (22.9) & 4.2 & 5547 (14.2) & 4.9 \\ \hline Syphilis & 1426 (42.1) & 1.7 & 1959 (57.9) & 6.4 & 3385 (8.7) & 3.0 \\ \hline Human immunodeficiency virus & 461 (15.8) & 0.6 & 2456 (84.2) & 8.0 & 2917 (7.5) & 2.6 \\ \hline Genital warts & 1174 (84.9) & 1.4 & 208 (15.1) & 0.7 & 1382 (3.5) & 1.2 \\ \hline Genital herpes & 82 (38.0) & 0.1 & 134 (62.0) & 0.4 & 216 (0.6) & 0.2 \\ \hline Chancroid & 55 (70.5) & 0.1 & 23 (29.5) & 0.1 & 78 (0.2) & 0.1 \\ \hline Total & 27490 (70.4) & 32.3 & 11559 (29.6) & 37.6 & 39049 & 34.4 \\ \hline \end{tabular}} \end{table}
PMC1368987_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Treatment} & \textbf{Fractional turnover day-1 rate r} & \textbf{Modeled value versus r2 observed} \\ \hline 1 & 0.34 & 0.6563 \\ \hline 2 & 0.15 & 0.6984 \\ \hline 3 & 0.16 & 0.8011 \\ \hline 5 & 0.40 & 0.6411 \\ \hline 6 & 0.57 & 0.9498 \\ \hline 7 & 0.30 & 0.9665 \\ \hline \end{tabular}} \end{table}
PMC1373641_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{1-1 orth} & \textbf{most cons X-X} & \textbf{less cons X-X} & \textbf{random non-orth} \\ \hline all X-X orth & 6.31ยท10-233 & 0 & 1.78ยท10-70 & 3.55ยท10-21 \\ \hline random non-orth & 9.66ยท10-173 & 0 & 0.172 & . \\ \hline less cons X-X & 0 & 0 & . & . \\ \hline most cons X-X & 1.38ยท10-57 & . & . & . \\ \hline \end{tabular}} \end{table}
PMC1382217_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{dvSalt30}} & \multicolumn{2}{|l|}{\textbf{ecox}} & \multicolumn{2}{|l|}{\textbf{shHeat5}} & \multicolumn{2}{|l|}{\textbf{shCold5}} \\ \hline \textbf{Method} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} \\ \hline 1-gene (OpWise) & 220 & 100\% & 1062 & 98\% & 1002 & 97\% & 187 & 100\% \\ \hline operon-wise & 401 & 99\% & 1318 & 100\% & 1284 & 99\% & 374 & 100\% \\ \hline no-bias & 1090 & 90\% & 1269 & 98\% & 3020 & 87\% & 3063 & 70\% \\ \hline SAM & 852 & 94\% & 957 & 99\% & 3348 & 83\% & 3258 & 68\% \\ \hline \end{tabular}} \end{table}
PMC1397872_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Characteristics} & & \multicolumn{3}{|l|}{\textbf{Women}} & \multicolumn{3}{|l|}{\textbf{Men}} \\ \hline & & \textbf{Total} & \multicolumn{2}{|l|}{\textbf{Current smoker}} & \textbf{Total} & \multicolumn{2}{|l|}{\textbf{Current smoker}} \\ \hline & & \textbf{N} & \textbf{n} & \textbf{\%} & \textbf{N} & \textbf{n} & \textbf{\%} \\ \hline Age groups (year) & 15โ€“19 & 500 & 39 & 7.80 & 398 & 115 & 28.89 \\ \hline & 20โ€“24 & 368 & 62 & 16.85 & 267 & 142 & 53.18 \\ \hline & 25โ€“29 & 277 & 39 & 14.08 & 228 & 132 & 57.89 \\ \hline & 30โ€“34 & 175 & 31 & 17.71 & 176 & 107 & 60.80 \\ \hline & 35โ€“39 & 219 & 28 & 12.79 & 199 & 134 & 67.34 \\ \hline & 40โ€“44 & 137 & 20 & 14.60 & 142 & 82 & 57.75 \\ \hline & 45โ€“49 & 135 & 11 & 8.15 & 118 & 70 & 59.32 \\ \hline & 50+ & 358 & 27 & 7.54 & 375 & 164 & 43.73 \\ \hline & Statistical results & x2 = 37.06 & P $<$ 0.001 & & x2 = 124.32 & P $<$ 0.001 \\ \hline Education & Illiteracy & 1130 & 106 & 9.38 & 264 & 119 & 45.08 \\ \hline & Literacy & 208 & 23 & 11.05 & 221 & 103 & 46.50 \\ \hline & Graduated from primary school & 635 & 81 & 12.75 & 927 & 461 & 49.73 \\ \hline & Graduated from secondary school & 77 & 20 & 25.97 & 192 & 101 & 52.60 \\ \hline & Graduated from high school and higher & 116 & 27 & 23.27 & 298 & 162 & 54.36 \\ \hline & Statistical results & x2 = 36 & P $<$ 0.001 & & \multicolumn{3}{|l|}{x2(for linear trend) = 6.2 p = 0.012} \\ \hline Marital status & Married & 1309 & 170 & 12.99 & 1245 & 696 & 55.90 \\ \hline & Single & 703 & 70 & 9.96 & 645 & 247 & 38.29 \\ \hline & Widowed/Divorced & 160 & 17 & 10.63 & 13 & 3 & 23.08 \\ \hline & Statistical results & x2 = 4.26 & p = 0.118 & & x2 = 56.41 & P $<$ 0.001 \\ \hline Employment & Employed & 93 & 9 & 9.68 & 1606 & 824 & 51.31 \\ \hline & Unemployed & 2079 & 248 & 11.93 & 296 & 121 & 40.88 \\ \hline & Statistical results & x2 = 0.24 & p = 0.62 & & x2 = 10.46 & p = 0.0012 \\ \hline Ethnicity & Turkish & 731 & 91 & 12.45 & 691 & 351 & 50.80 \\ \hline & Kurdish & 1223 & 144 & 11.77 & 1034 & 526 & 50.87 \\ \hline & Arabic & 150 & 16 & 10.67 & 141 & 56 & 39.72 \\ \hline & Zaza & 67 & 6 & 8.96 & 37 & 13 & 35.14 \\ \hline & Statistical results & x2 = 0.99 & p = 0.802 & & x2 = 9.66 & p = 0.022 \\ \hline \end{tabular}} \end{table}
PMC1403766_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Total (n = 115)} & \textbf{MI (n = 24)} & \textbf{No MI (n = 91)} & \textbf{P value} \\ \hline Age (years; mean $\pm$ SD) & 64.1 $\pm$ 17.2 & 62.8 $\pm$ 18.3 & 64.4 $\pm$ 17.0 & 0.69 \\ \hline Sex (n; \% female) & 61 (53.0) & 13 (54.2) & 48 (52.7) & 1.00 \\ \hline APACHE II score (mean $\pm$ SD) & 21.9 $\pm$ 9.8 & 26.3 $\pm$ 10.4 & 20.7 $\pm$ 9.3 & 0.01 \\ \hline Medical (n [\%]) & 83 (72.2) & 20 (83.3) & 63 (69.2) & 0.21 \\ \hline Epidural (n [\%]) & 12 (10.4) & 0 (0.0) & 12 (13.2) & 0.07 \\ \hline \multicolumn{5}{|l|}{Past medical history (n [\%])} \\ \hline Smoker & 35 (30.4) & 5 (20.8) & 30 (33.0) & 0.32 \\ \hline Hypertension & 59 (51.3) & 14 (58.3) & 45 (49.5) & 0.50 \\ \hline Diabetes (oral agent) & 9 (7.8) & 3 (12.5) & 6 (6.6) & 0.39 \\ \hline Diabetes (insulin) & 17 (14.8) & 10 (41.7) & 7 (7.7) & $<$0.001 \\ \hline Hypercholesterolemia & 14 (12.2) & 2 (8.3) & 12 (13.2) & 0.73 \\ \hline Angina & 15 (13.0) & 3 (12.5) & 12 (13.2) & 1.00 \\ \hline Myocardial infarction & 25 (21.7) & 9 (37.5) & 16 (17.6) & 0.05 \\ \hline Congestive heart failure & 14 (12.2) & 5 (20.8) & 9 (9.9) & 0.17 \\ \hline Peripheral vascular disease & 10 (8.7) & 7 (29.2) & 3 (3.3) & $<$0.001 \\ \hline Transient ischemic attack & 4 (3.5) & 2 (8.3) & 2 (2.2) & 0.19 \\ \hline Stroke & 8 (7.0) & 3 (12.5) & 5 (5.5) & 0.36 \\ \hline \multicolumn{5}{|l|}{Baseline life support interventions (n [\%])} \\ \hline \multicolumn{5}{|l|}{Ventilation} \\ \hline Invasive mechanical ventilation & 67 (58.3) & 16 (66.7) & 51 (56.0) & 0.49 \\ \hline Noninvasive mechanical ventilation & 5 (4.3) & 2 (8.3) & 3 (3.3) & 0.28 \\ \hline \multicolumn{5}{|l|}{Inotropes and vasopressors} \\ \hline Epinephrine & 2 (1.7) & 1 (4.2) & 1 (1.1) & 0.38 \\ \hline Dopamine & 10 (8.7) & 3 (12.5) & 7 (7.7) & 0.43 \\ \hline Norepinephrine & 19 (16.5) & 5 (20.8) & 14 (15.4) & 0.54 \\ \hline Dobutamine & 4 (3.5) & 2 (8.3) & 2 (2.2) & 0.19 \\ \hline Phenylephrine & 18 (15.7) & 9 (37.5) & 9 (9.9) & 0.003 \\ \hline Vasopressin & 5 (4.3) & 3 (12.5) & 2 (2.2) & 0.06 \\ \hline \multicolumn{5}{|l|}{Hemodialysis} \\ \hline Intermittent dialysis & 14 (12.2) & 4 (16.7) & 10 (11.0) & 0.49 \\ \hline Continuous renal replacement therapy & 0 (0.0) & 0 (0.0) & 0 (0.0) & - \\ \hline \end{tabular}} \end{table}
PMC1414005_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{AAA model} & \textbf{P (mmHg)} & \textbf{dAAA,max (cm)} & \textbf{Thickness (cm) t} & \textbf{$\alpha$} & \textbf{$\beta$} & \textbf{(Authors' results) Stress (MPa)} & \multicolumn{2}{|l|}{\textbf{Modified Equation Laplace}} & \multicolumn{2}{|l|}{\textbf{Original Equation Laplace}} \\ \hline & & & & & & & \textbf{Stress (MPa)} & \textbf{Error} & \textbf{Stress (MPa)} & \textbf{Error} \\ \hline Fillinger [3,4] & 120 & 6.7 & 0.19 & 0 & 0.4 & 0.32 & 0.34 & 6.3\% & 0.28 & 13\% \\ \hline & 130 & 5.5 & 0.19 & 0 & 0.4 & 0.30 & 0.28 & 6.7\% & 0.25 & 16.7\% \\ \hline Wang [29] & 128 & 6.1 & 0.184 & 0.54 & 0.33 & 0.19 & 0.208 & 9.5\% & 0.28 & 47\% \\ \hline & 155 & 6.4 & 0.175 & 0.29 & 0.9 & 0.35 & 0.34 & 2.9\% & 0.38 & 8.6\% \\ \hline Vorp [36] & 120 & 6.0 & 0.15 & 0 & 0.3 & 0.33 & 0.34 & 3\% & 0.31 & 6\% \\ \hline Raghavan [45] & 115 & 5.2 & 0.19 & 0 & 0.65 & 0.23 & 0.21 & 8.7\% & 0.2 & 13\% \\ \hline & 188 & 5.5 & 0.19 & 0 & 0.9 & 0.43 & 0.46 & 6.9\% & 0.36 & 16\% \\ \hline Thubrikar [15] & 120 & 5.86 & 0.104 & 0 & 0.5 & 0.37 & 0.39 & 5.4\% & 0.45 & 22\% \\ \hline & 120 & 5.86 & 0.158 & 0 & 0.5 & 0.3 & 0.299 & 0.3\% & 0.29 & 3.3\% \\ \hline Li [44] & 120 & 5.0 & 0.05 & 0.15 & 1 & 0.43 & 0.41 & 4.6\% & 0.80 & 85.6\% \\ \hline \end{tabular}} \end{table}
PMC1421417_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Dataset} & \textbf{INTACT_HO} & \textbf{INTACT_GAVIN} & \textbf{INTACT_ITO} & \textbf{INTACT_UETZ} & \textbf{INTACT_SMALL} \\ \hline DIP_CORE & 28.90 & 48.60 & 13.60 & 31.60 & 29.60 \\ \hline DIP_FULL & 85.10 & 75.20 & 91.80 & 87.70 & 29.60 \\ \hline MINT & 73.10 & 85.30 & 98.00 & 96.20 & 27.00 \\ \hline GRID & 82.60 & 73.60 & 88.00 & 89.40 & 33.90 \\ \hline BIND & 5.80 & 8.60 & 74.70 & 59.10 & 24.30 \\ \hline MIPS_PHYSICAL & 4.60 & 8.00 & 86.70 & 61.80 & 20.00 \\ \hline MIPS_GENETIC & 0.70 & 1.00 & 0.40 & 1.20 & 2.60 \\ \hline \end{tabular}} \end{table}
PMC1431566_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{Patient} & \textbf{Age} & \textbf{APACHE} & \textbf{MBP} & \textbf{HR} & \textbf{CREAT} & \textbf{TROP T} & \textbf{Infection} & \textbf{Germ} & \textbf{AB} \\ \hline MAPRR & 20 & 6 & 145 & 129 & 0.8 & $<$0.01 & Blood & S. aureus & vancomycin \\ \hline VPO & 48 & 3 & 110 & 127 & 1.1 & 0.012 & - & - & penicillin \\ \hline MSR & 54 & 4 & 49 & 109 & 0.5 & 0.07 & respiratory central line & S. aureus & vancomycin \\ \hline JP & 50 & 8 & 84 & 124 & 0.6 & $<$0.01 & respiratory & ? & cefuroxime \\ \hline JRS & 74 & 10 & 78.6 & 122 & 1.4 & 0.306 & - & - & penicillin \\ \hline ESB & 19 & 6 & 62 & 81 & 0.8 & $<$0.01 & - & - & penicillin \\ \hline CEO & 53 & 8 & 78.6 & 92 & 0.5 & 0.135 & respiratory & S. aureus & vancomycin \\ \hline RAB & 57 & 6 & 69 & 74 & 1.1 & 0.015 & - & - & penicillin \\ \hline JOR & 57 & 15 & 100.6 & 129 & 1.0 & 0.028 & osteomyelitis & - & ofloxa, metro \\ \hline JBS & 48 & 10 & 90 & 98 & 0.7 & 0.02 & - & - & penicillin \\ \hline GS & 36 & 11 & 67 & 96 & 1.0 & 0.045 & respiratory & S. aureus & vancomycin \\ \hline SBD & 33 & 15 & 88 & 71 & 0.8 & 0.105 & respiratory & ? & cefipime \\ \hline LCCM & 48 & 4 & 93.6 & 62 & 0.6 & $<$0.01 & respiratory & P. mirabilis & ampisulbact \\ \hline MJO & 29 & 1 & 87 & 88 & 0.7 & $<$0.01 & - & - & penicillin \\ \hline JCWV & 20 & 5 & 290 & 133 & 0.7 & $<$0.01 & respiratory & ? & ampisulbact \\ \hline IMR & 60 & 23 & 66 & 86 & 0.7 & $<$0.01 & respiratory & P. aeruginosa & ampisulbact \\ \hline MS & 70 & 11 & 48.3 & 78 & 1.1 & 0.137 & Blood & S. aureus & vancomycin \\ \hline ER & 44 & 11 & 75 & 81 & 1.1 & 0.135 & Blood & S. epidermitis & oxacillin \\ \hline LSLF & 36 & 10 & 70 & 100 & 1.0 & $<$0.01 & - & - & ampicillin \\ \hline MLS & 82 & 21 & 24 & 92 & 1.5 & 0.2135 & - & - & penicillin \\ \hline JS & 44 & 2 & 126 & 75 & 1.0 & $<$0.01 & - & - & penicillin \\ \hline Mean (SD) & 46.7 (17.2) & 9 (5.7) & 81.3 (26.7) & 97.4 (22.1) & 0.9 (0.2) & 0.6 (0.08) \\ \hline \end{tabular}} \end{table}
PMC1434771_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Survey sample} & \textbf{Total respondents} & \textbf{respondents Mean score of (SD) all} & \textbf{Range all respondents of (SD) scores of} & \textbf{Total SDOLs} & \textbf{Mean opinion designating score (SD) leaders of self-} & \textbf{Range opinion self-designating of (SD) scores leaders of} \\ \hline \multicolumn{7}{|l|}{General practitioners} \\ \hline PC1 & 78 & 19.96 (4.03) & 9โ€“30 & 16 & 25.31 (1.85) & 23โ€“30 \\ \hline PC2 & 222 & 20.36 (3.74) & 10โ€“30 & 47 & 25.55 (1.47) & 24โ€“30 \\ \hline \multicolumn{7}{|l|}{Practice nurses} \\ \hline PC1 & 35 & 21.60 (4.69) & 13โ€“30 & 7 & 28.43 (0.79) & 28โ€“30 \\ \hline PC2 & 144 & 21.01 (4.04) & 4โ€“30 & 29 & 26.34 (1.72) & 22โ€“30 \\ \hline \multicolumn{7}{|l|}{Practice managers} \\ \hline PC1 & 32 & 20.50 (4.68) & 10โ€“29 & 7 & 26.71 (1.50) & 25โ€“29 \\ \hline PC2 & 56 & 16.80 (2.57) & 10โ€“22 & 13 & 19.69 (1.03) & 19โ€“22 \\ \hline \multicolumn{7}{|l|}{Surgeons} \\ \hline DGH1 & 16 & 20.13 (3.69) & 13โ€“25 & 6 & 23.67 (0.82) & 23โ€“25 \\ \hline DGH2 & 7 & 22.57 (5.16) & 16โ€“29 & 1 & 29.00 (0.00) & 29โ€“29 \\ \hline TH & 18 & 21.33 (5.39) & 11โ€“30 & 5 & 27.20 (1.79) & 26โ€“30 \\ \hline \multicolumn{7}{|l|}{Physicians} \\ \hline DGH1 & 21 & 19.38 (5.53) & 6โ€“27 & 4 & 23.75 (3.20) & 21โ€“27 \\ \hline DGH2 & 3 & 23.33 (3.51) & 20โ€“27 & 1 & 27.00 (0.00) & 27โ€“27 \\ \hline TH & 47 & 21.15 (4.62) & 2โ€“27 & 12 & 25.42 (1.88) & 20โ€“27 \\ \hline \multicolumn{7}{|l|}{Surgical nurses} \\ \hline DGH1 & 9 & 20.89 (4.11) & 16โ€“29 & 4 & 20.00 (2.31) & 18โ€“22 \\ \hline DGH2 & 34 & 21.32 (3.87) & 12โ€“29 & 11 & 25.73 (1.85) & 24โ€“29 \\ \hline TH & 37 & 19.62 (4.02) & 5โ€“27 & 7 & 24.86 (1.35) & 23โ€“27 \\ \hline \multicolumn{7}{|l|}{Medical nurses} \\ \hline DGH1 & 30 & 19.90 (4.84) & 6โ€“27 & 7 & 25.14 (1.07) & 24โ€“27 \\ \hline DGH2 & 25 & 21.04 (3.60) & 15โ€“28 & 7 & 25.57 (1.51) & 24โ€“28 \\ \hline TH & 34 & 21.50 (3.17) & 15โ€“28 & 9 & 25.44 (1.74) & 23โ€“28 \\ \hline Obstetricians Gynaecologists and & 102 & 23.08 (3.71) & 10โ€“30 & 20 & 28.0 (1.08) & 27โ€“30 \\ \hline Oncologists & 33 & 24.42 (3.87) & 13โ€“29 & 10 & 28.40 (0.52) & 28โ€“29 \\ \hline \end{tabular}} \end{table}
PMC1436013_table_6
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Window size} & \multicolumn{4}{|l|}{\textbf{Prediction accuracy (\%)}} \\ \hline & \textbf{Q2} & \textbf{MCC} & \textbf{Sensitivity} & \textbf{Specificity} \\ \hline 3 & 61.2 & 0.22 & 64.4 & 57.9 \\ \hline 5 & 62.5 & 0.25 & 63.3 & 61.6 \\ \hline 7 & 61.8 & 0.24 & 61.4 & 62.3 \\ \hline 9 & 62.1 & 0.24 & 61.1 & 63.2 \\ \hline 11 & 62.8 & 0.26 & 56.6 & 68.7 \\ \hline 13 & 61.7 & 0.23 & 59.2 & 63.8 \\ \hline 15 & 61.6 & 0.23 & 55.4 & 67.6 \\ \hline 17 & 61.0 & 0.22 & 56.3 & 65.6 \\ \hline 19 & 59.8 & 0.19 & 55.4 & 63.9 \\ \hline \end{tabular}} \end{table}
PMC1450308_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Effect Size} & \textbf{Failure Rate 95\%} & \textbf{Failure Rate 98\%} \\ \hline 30\% & 235 & 195 \\ \hline 33.3\% & 185 & 160 \\ \hline 35\% & 160 & 140 \\ \hline 40\% & 120 & 95 \\ \hline \end{tabular}} \end{table}
PMC1459124_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \multicolumn{7}{|l|}{\textbf{All}} \\ \hline \textbf{Crops} & \textbf{AECD-Blocks} & \textbf{General (Polyphagous) feeder} & \textbf{Oligophagous} & \textbf{Monophagous} & \textbf{attacked No crop} & \textbf{Absent village in the} \\ \hline Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\ \hline & Mbalmayo & 70 & 30 & 0 & 0 & 0 \\ \hline & Ebolowa & 70 & 30 & 0 & 0 & 0 \\ \hline & Mean & 67 & 33 & 0 & 0 & 0 \\ \hline Young Crop Perennial & Yaounde & 20 & 20 & 10 & 50 & 0 \\ \hline & Mbalmayo & 20 & 20 & 10 & 50 & 0 \\ \hline & Ebolowa & 30 & 50 & 0 & 20 & 0 \\ \hline & Mean & 23 & 30 & 7 & 40 & 0 \\ \hline \multicolumn{7}{|l|}{Female} \\ \hline Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\ \hline & Mbalmayo & 60 & 40 & 0 & 0 & 0 \\ \hline & Ebolowa & 60 & 40 & 0 & 0 & 0 \\ \hline & Mean & 60 & 40 & 0 & 0 & 0 \\ \hline Young Crop Perennial & Yaounde & 20 & 0 & 0 & 80 & 0 \\ \hline & Mbalmayo & 40 & 0 & 0 & 60 & 0 \\ \hline & Ebolowa & 40 & 40 & 0 & 20 & 0 \\ \hline & Mean & 33 & 13 & 0 & 53 & 0 \\ \hline \multicolumn{7}{|l|}{Male} \\ \hline Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\ \hline & Mbalmayo & 80 & 20 & 0 & 0 & 0 \\ \hline & Ebolowa & 80 & 20 & 0 & 0 & 0 \\ \hline & Mean & 73 & 27 & 0 & 0 & 0 \\ \hline Young Crop Perennial & Yaounde & 20 & 40 & 20 & 20 & 0 \\ \hline & Mbalmayo & 0 & 40 & 20 & 40 & 0 \\ \hline & Ebolowa & 20 & 60 & 0 & 40 & 0 \\ \hline & Mean & 13 & 47 & 13 & 33 & 0 \\ \hline \end{tabular}} \end{table}
PMC1464119_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{in year} & \textbf{Incidence (1/100,000)} & \textbf{Moran 's I} & \textbf{E [I]} & \textbf{p} \\ \hline 1994 & 5.16 & 0.2672 & 0.0005 & 0.001 \\ \hline 1995 & 4.94 & 0.4374 & 0.0005 & 0.001 \\ \hline the 1996 & 3.65 & 0.5153 & 0.0005 & 0.001 \\ \hline 1997 & 3.60 & 0.5015 & 0.0005 & 0.001 \\ \hline 1998 & 3.77 & 0.5001 & 0.0005 & 0.001 \\ \hline \end{tabular}} \end{table}
PMC1471792_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Gene product} & \textbf{Forward primer} & \textbf{Reverse primer} \\ \hline SP-B & 5'-GCCATGGCCAAGTTACATCT-3' & 5'-TGCTCACACTTTTGCCTGTC-3' \\ \hline SP-C & 5'-TACTCGACAGGTCCCAGGAG-3' & 5'-AGCTCTCCACACAAGGTGCT-3' \\ \hline CC10 & 5'-CAACATCAGCCCACATCTACA-3' & 5'-TTGGTGTAGGGAGGTCAAGG-3' \\ \hline \end{tabular}} \end{table}
PMC1475638_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Source} & \textbf{DF} & \multicolumn{5}{|l|}{\textbf{F value}} \\ \hline & & \textbf{Critical} & \textbf{Dorsal vein} & \textbf{Caudal vein} & \textbf{Dorsal artery} & \textbf{Caudal artery} \\ \hline Family & 3 & 2.91 & 11.35* & 1.35 & 8.74* & 0.58 \\ \hline Environment & 1 & 4.16 & 1.87 & 3.70 & 12.10* & 7.71* \\ \hline Family Environment $\times$ & 3 & 2.91 & 0.30 & 0.30 & 2.11 & 0.46 \\ \hline Error & 38 \\ \hline \end{tabular}} \end{table}
PMC1479343_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{Influencing factor} & \textbf{Examples} \\ \hline \multicolumn{2}{|l|}{Epidemiological environment} \\ \hline Prevalence of condition & Screening and referral programs for breast cancer \\ \hline Incidence of condition & Preventive measures for many injuries \\ \hline Existence of competing risks of synergisms & Some cost-effectiveness surgical interventions: of some targeted among the interventions very young or elderly, competing risks reduce the \\ \hline \multicolumn{2}{|l|}{Individual characteristics} \\ \hline Age & Cancer treatment: more cost-effective for younger patients \\ \hline Tendency to compliance & Anti-hypertensive medication \\ \hline Tendency to self-refer & Diabetes control \\ \hline Level of risk factors & Hypertension and hyperlipdemia \\ \hline Individual variation in values & Attitude intervention toward effectiveness disability relative to risk of death; can lead to individual differences in \\ \hline \multicolumn{2}{|l|}{System characteristics} \\ \hline Local costs of non-traded inputs to health care system & Real where costs wages of care are low, intensive because interventions most health (such care as personnel hospitalisation are relatively after trauma) immobile are low \\ \hline Generalised systemic competence & Cost-effectiveness professionalism and at capacity the margin may of be some much interventions higher than in in more a system developed with a low systems level of \\ \hline Discount rate & Where treatment discount of obesity) rates become are high, relatively interventions less attractive. with payoffs well into the future (such as \\ \hline \end{tabular}} \end{table}
PMC1479369_table_3
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Item} & \textbf{Spearman Correl. (rho)} & \textbf{N} \\ \hline Tangibles 1 & 0.910 & 27 \\ \hline Tangibles 2 & 0.914 & 27 \\ \hline Tangibles 3 & 0.931 & 27 \\ \hline Tangibles 4 & 0.932 & 26 \\ \hline Responsiveness 5 & 0.952 & 27 \\ \hline Responsiveness 6 & 0.909 & 27 \\ \hline Responsiveness 7 & 0.917 & 27 \\ \hline Responsiveness 8 & 0.952 & 27 \\ \hline Responsiveness 9 & 0.883 & 25 \\ \hline Responsiveness 10 & 0.857 & 26 \\ \hline Responsiveness 12 & 0.950 & 27 \\ \hline Assurance 14 & 0.864 & 26 \\ \hline Assurance 16 & 0.932 & 27 \\ \hline Assurance 17 & 0.932 & 21 \\ \hline Assurance 18 & 0.972 & 20 \\ \hline Assurance 19 & 0.958 & 26 \\ \hline Assurance 20 & 0.922 & 27 \\ \hline Assurance 21 & 0.954 & 27 \\ \hline Empathy 23 & 0.924 & 25 \\ \hline Empathy 25 & 0.952 & 26 \\ \hline Empathy 26 & 0.976 & 25 \\ \hline Empathy 27 & 0.966 & 26 \\ \hline GP 28 & 0.953 & 26 \\ \hline GP 29 & 0.938 & 23 \\ \hline Personal 33 & 0.964 & 27 \\ \hline Personal 35 & 0.965 & 27 \\ \hline \end{tabular}} \end{table}
PMC1482701_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Primer} & & \textbf{Sequence} & \textbf{Size of product (bp)} \\ \hline PAR-1 & sense & 5'-CAGCTCCTGGCTGACACTCTTTGTC-3' & 500 \\ \hline & antisense & 5'-CGAGCAGGGTTTCATTGAGCACAT-3' \\ \hline PAR-2 & sense & 5'-GCAGCCTCTCTCTCCTGCAGTGG-3' & 461 \\ \hline & antisense & 5'-CTGAGGCAGGTCATGAAGAGAATGG-3' \\ \hline PAR-3 & sense & 5'-GGCTGGACAGGAGCCACGAT-3' & 403 \\ \hline & antisense & 5'-AGCGGTTGATGCTGATGCAGG-3' \\ \hline PAR-4 & RT & 5'-TGAGTAGCTGGGATTACAG-3' & 542 \\ \hline & sense & 5'-AACCTCTATGGTGCCTACGTGC-3' \\ \hline & antisense & 5'- CCAAGCCCAGCTAATTTTTG-3' \\ \hline $\beta$-actin & sense & 5'-GTTGCGTTACACCCTTTCTT-3' & 148 \\ \hline & antisense & 5'-ACCTTCACCGTTCCAGTTT-3' \\ \hline \end{tabular}} \end{table}
PMC1489934_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{Compound (ยตg/ml)} & \textbf{IL-8 released (pg/ml)} \\ \hline Medium alone & 24.6 $\pm$ 1.5 \\ \hline Tryptase 2.0 & 105.2 $\pm$ 5.3* \\ \hline Elastase 0.3 & 108.4 $\pm$ 13.2* \\ \hline Benzamidine 30 & 37.6 $\pm$ 4.4 \\ \hline Leupeptine 30 & 27.4 $\pm$ 5.6 \\ \hline MSACK 30 & 22.1 $\pm$ 4.3 \\ \hline Tryptase 2.0 + Benzamidine 30 & 66.9 $\pm$ 4.8โ€  \\ \hline Tryptase 2.0 + Leupeptin 30 & 100 $\pm$ 1.7 \\ \hline Elastase 0.3 + MSACK 30 & 26.9 $\pm$ 3.6โ€  \\ \hline \end{tabular}} \end{table}
PMC1489934_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline & \textbf{Disease} & \textbf{Polymorphism} & \textbf{Total} \\ \hline Number of nsSNPS & 10,419 & 4217 & 14,636 \\ \hline Number proteins of with nsSNPS structural within homologs & 3212 & 609 & 3821 \\ \hline Number of Proteins with nsSNPs & 893 & 1256 & 2149 \\ \hline Number having structural of Proteins homologs with nsSNPs & 299 & 295 & 594 \\ \hline \end{tabular}} \end{table}
PMC1489951_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Site} & \textbf{Disease} & \textbf{Polymorphisms} & \textbf{Percentage within these (odds sites ratio) that are of disease nsSNPs} \\ \hline ACT_SITE & 25 & 1 & 96.15 (10.12) \\ \hline BINDING & 13 & 0 & 100 (-) \\ \hline DNA_BIND & 352 & 20 & 94.62 (7.12) \\ \hline METAL & 38 & 0 & 100 (-) \\ \hline MOD_RES & 34 & 3 & 91.89 (4.59) \\ \hline MUTAGEN & 111 & 10 & 91.74 (4.49) \\ \hline NP_BIND & 108 & 8 & 93.1 (5.46) \\ \hline \end{tabular}} \end{table}
PMC1489951_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline & \textbf{n (\%)} \\ \hline Respondent shopping for self and child(ren) & 44 (91.7) \\ \hline Respondent shopping for self and spouse & 25 (52.1) \\ \hline \multicolumn{2}{|l|}{Self-report member: of diagnosis by a physician for any household} \\ \hline High blood pressure & 7 (14.6) \\ \hline Diabetes & 1 (2.1) \\ \hline Coronary heart disease & 1 (2.1) \\ \hline High cholesterol & 4 (8.3) \\ \hline Current smoker in household & 7 (14.6) \\ \hline Fair or poor health (respondent) & 5 (10.4) \\ \hline No physical activity (respondent) & 28 (58.3) \\ \hline \end{tabular}} \end{table}
PMC1508155_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Population health indicator} & \textbf{Australia (Rank)} & \textbf{Country with best outcome (outcome)} \\ \hline Life expectancy at birth (years) & 79 (3rd) & Japan (82) \\ \hline Infant mortality rate per 1000 & 6 (4th) & Japan, Singapore, Sweden (3) \\ \hline Under 5 mortality rate per 1000 & 6 (4th) & Sweden (3) \\ \hline Adult mortality rate per 1000 (male) & 100 (6th) & Sweden (87) \\ \hline Adult mortality rate per 1000 (female) & 52 (5th) & Japan (44) \\ \hline Survival to age 65 (\%) (male) & 84 (3rd) & Japan (86) \\ \hline Survival to age 65 (\%) (female) & 92 (3rd) & Japan (94) \\ \hline HALE at birth* & 71.6 (4th) & Japan (73.6) \\ \hline \end{tabular}} \end{table}
PMC1513585_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Unadjusted} & \textbf{Adjusted for age} & \textbf{Adjusted for age and SBPโ€ } & \textbf{Adjusted pack-years for age, SBPโ€  and} \\ \hline CPITNโ€  score & 1.41* [1.16โ€“1.73] & 0.98 [0.77โ€“1.25] & 0.86 [0.65โ€“1.13] & 0.91 [0.68โ€“1.20] \\ \hline Average probing depth & 1.77* [1.35โ€“2.32] & 1.09 [0.80โ€“1.47] & 0.92 [0.66โ€“1.28] & 0.99 [0.70โ€“1.38] \\ \hline Gingival bleeding index & 2.03* [1.04โ€“3.95] & 1.01 [0.46โ€“2.19] & 0.61 [0.25โ€“1.50] & 0.71 [0.28โ€“1.79] \\ \hline \end{tabular}} \end{table}
PMC1524747_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \textbf{Wave 1} & \textbf{Wave 2} & \textbf{Wave 3} & \textbf{Wave 4} & \textbf{Wave 5} & \textbf{Unique Individuals} \\ \hline & (n = 124) & (n = 106) & (n = 115) & (n = 113) & (n = 115) & n = 251 \\ \hline Age (mean; [sd]) & 41.6 [10.7] & 40.9 [11.2] & 42.2 [11.3] & 41.5 [10.9] & 40.6 [11.9] & 38.8 [11.8] \\ \hline Gender (\% Male) & 8.1 & 5.7 & 8.7 & 7.1 & 7.0 & 10.4 \\ \hline Race (\% African American) & 39.5 & 41.5 & 44.4 & 44.3 & 47.0 & 47.0 \\ \hline Marital status (\% Married) & 38.7 & 41.5 & 44.4 & 43.4 & 40 & 37.1 \\ \hline Job category (\% Nurse Aides) & 59.7 & 64.2 & 60.0 & 59.3 & 61.7 & 61.4 \\ \hline Fulltime (\%) & 85.5 & 84.0 & 82.6 & 71.7 & 68.7 & 75.7 \\ \hline \multicolumn{7}{|l|}{Tenure:} \\ \hline Less then 1 year & 33.1 & 34.0 & 26.1 & 31.0 & 36.5 & 52.2 \\ \hline 1 to 5 years & 29.8 & 37.7 & 43.5 & 42.5 & 37.4 & 24.3 \\ \hline Over 5 years & 37.1 & 28.3 & 30.4 & 26.6 & 26.1 & 23.5 \\ \hline Perceived High Quality & 54.0 & 43.4 & 57.4 & 52.2 & 60.0 & 55.8 \\ \hline \end{tabular}} \end{table}
PMC1524956_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{Depressed vs. non-depressed}} & \multicolumn{2}{|l|}{\textbf{Responders vs. non-responders}} \\ \hline \textbf{Polymorphism} & \textbf{p-value} & \textbf{q-value} & \textbf{p-value} & \textbf{q-value} \\ \hline rs6280 DRD3 & 0.055 & 0.264 & 0.439 & 0.555 \\ \hline rs4680 COMT & 0.033 & 0.239 & 0.986 & 0.77 \\ \hline rs165599 COMT & 0.041 & 0.239 & 0.251 & 0.482 \\ \hline STin2 VNTR SLC6A4 & 0.004* & 0.137 & 0.749 & 0.699 \\ \hline exon 3 VNTR DRD4 & 0.316 & 0.482 & 0.009* & 0.137 \\ \hline \end{tabular}} \end{table}
PMC1526442_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Physiological functions} & \textbf{A} & \textbf{B} & \textbf{C} \\ \hline Replenishment of water & Isotonic drinks & Hypotonic Glycerol drinks \\ \hline Improvement of endurance & High-carbohydrate Citric acid & Arginine Caffeine Carnitine & Capsaicine \\ \hline Enhancement of muscle strength & Protein BCAA Creatine $\beta$-HMB & Glutamine & Arginine \\ \hline Prevention or fatigue of muscle/joint injuries & High-carbohydrate Citric acid & Vitamins Carotenoids, Carnosine, C Anserine and Flavonoids E & Glucosamine Chondroitin \\ \hline Prevention immunocompetence of a decrease in & Carbohydrate & Vitamins Glutamine C and E \\ \hline \end{tabular}} \end{table}
PMC1526446_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline & \multicolumn{4}{|l|}{\textbf{PADI4 haplotype (frequencies)}} & \multicolumn{4}{|l|}{\textbf{PADI4 haplotype (carriers)}} \\ \hline & \textbf{Haplotype 1} & \textbf{Haplotype 1B} & \textbf{Haplotype 2/3} & \textbf{Haplotype 4} & \textbf{Haplotype 1} & \textbf{Haplotype 1B} & \textbf{Haplotype 2/3} & \textbf{Haplotype 4} \\ \hline Controls & 119 (58.3\%) & 6 (2.9\%) & 63 (30.9\%) & 16 (7.8\%) & 84 (82.4\%) & 6 (5.9\%) & 51 (50\%) & 14 (13.7\%) \\ \hline Patients & 102 (50\%) & 1 (0.5\%) & 71 (34.8\%) & 30 (14.7\%) & 77 (75.5\%) & 1 (1\%) & 54 (52.9\%) & 28 (27.5\%) \\ \hline Odds ratio & 0.71 & 0.16 & 1.2 & 2.0 & 0.66 & 0.16 & 1.1 & 2.4 \\ \hline 95\% interval confidence & 0.48โ€“1.1 & 0.02โ€“1.4 & 0.79โ€“1.8 & 1.1โ€“3.8 & 0.33โ€“1.3 & 0.02โ€“1.3 & 0.65โ€“1.9 & 1.2โ€“4.8 \\ \hline P & 0.11 & 0.12 & 0.46 & 0.04 & 0.30 & 0.12 & 0.78 & 0.02 \\ \hline \end{tabular}} \end{table}
PMC1526594_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline Female (\%) & 72 \\ \hline Mean age (years) & 50.7 \\ \hline Mean disease duration (months) & 4.3 \\ \hline Pain (100 mm VAS) & 54.4 \\ \hline Morning stiffness (minutes) & 84 \\ \hline Ritchie index & 17.8 \\ \hline Tendon joint count & 21.8 \\ \hline Swollen joint count & 8.4 \\ \hline Nodules (\%) & 6 \\ \hline ESR (mm/1st h) & 38.4 \\ \hline CRP (mg/l) & 32 \\ \hline IgM RF positive (\%) & 71 \\ \hline DAS 44 & 4.1 \\ \hline HLA DRB1*04 (\%)a & 53 \\ \hline HLA DRB1*01 (\%)b & 15.5 \\ \hline \end{tabular}} \end{table}
PMC1526612_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Variable} & \multicolumn{2}{|l|}{\textbf{Unemployment Duration (\%/n)}} & \textbf{t (p)} \\ \hline & \textbf{Short-term N = 234} & \textbf{Long-term N = 195} \\ \hline \multicolumn{4}{|l|}{Depression months) (in past 12} \\ \hline Never & 15.8/37 & 16.4/32 & 0.17 (sn) \\ \hline Sometimes & 50.4/118 & 32.8/64 & 3.75 (p $<$ 0.001) \\ \hline Often & 29.5/69 & 39.5/77 & 2.17 (p $<$ 0.05) \\ \hline Always & 4.3/10 & 11.3/22 & 2.67 (p $<$ 0.01) \\ \hline \multicolumn{4}{|l|}{Depression unemployment) (after} \\ \hline Do not feel at all & 14.1/33 & 11.8/23 & 0.71 (sn) \\ \hline No significant changes & 43.2/101 & 33.8/66 & 2.01 (p $<$ 0.05) \\ \hline Feel more often & 39.7/93 & 51.8/101 & 2.52 (p $<$ 0.05) \\ \hline Feel less & 3.0/7 & 2.6/5 & 0.25 (sn) \\ \hline \multicolumn{4}{|l|}{Use of sedative drugs} \\ \hline At least once in the last 30 days & 19.2/45 & 25.6/50 & 1.58 (sn) \\ \hline \end{tabular}} \end{table}
PMC1526724_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{Haplogroups} & \textbf{Diagnostic coding region substitutions} \\ \hline M2 & 447G-1780-8502-11083-15670 \\ \hline M2a & 5252-7961-8396-9758-12810 \\ \hline M3 & 482 \\ \hline M3a & 4580 \\ \hline M4a & 6620-7859 \\ \hline M4b & 511 \\ \hline M5 & 1888 \\ \hline M5a & 709-3921-12477-14323 \\ \hline M6 & 461-3537-5082-5301-5558-9329-10640-13966-14128 \\ \hline M6b & 5585-3486 \\ \hline M18 & 12498-15942 \\ \hline M25 & 15928 \\ \hline M30 & 15431 \\ \hline M30a & 6366 \\ \hline M30b & 5147-13980 \\ \hline M30c & 12234 \\ \hline M30d & 15259 \\ \hline M31 & 4907-11176-15440-15530 \\ \hline M32 & 3817-9064-12189-15754 \\ \hline M33 & 2361 \\ \hline M33a & 8562-15908 \\ \hline M34 & 569-3010-6794-11101-15865 \\ \hline M34a & 3447-8404-10361-11992-12311-14094 \\ \hline M35 & 12561 \\ \hline M35a & 5432-10670-15924 \\ \hline M36 & 7271-15110 \\ \hline M37 & 10556 \\ \hline M37a & 7853 \\ \hline M38 & 1808-6367-6899-9966-15314-15487 \\ \hline M39 & 1811-8679-15938 \\ \hline M40 & 8925-15721-15954 \\ \hline M40a & 13542 \\ \hline M41 & 870-6297-12398-12469-13656-15601 \\ \hline \end{tabular}} \end{table}
PMC1534032_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline \textbf{OBS} & \textbf{SNP} & \textbf{N_h} & \textbf{CPA_H} & \textbf{s.e.} & \textbf{CPA_U} & \textbf{s.e.} & \textbf{CPA_G} & \textbf{s.e.} \\ \hline 1 & 680 & 13 & 1.259 & 0.032 & 1.221 & 0.014 & 1.252 & 0.022 \\ \hline 2 & 659 & 40 & 0.765 & 0.052 & 0.674 & 0.040 & 0.687 & 0.041 \\ \hline 3 & 696 & 42 & 0.662 & 0.032 & 0.632 & 0.032 & 0.634 & 0.032 \\ \hline 4 & 700 & 34 & 0.873 & 0.009 & 0.851 & 0.007 & 0.859 & 0.008 \\ \hline 5 & 645 & 44 & 1.771 & 0.007 & 1.788 & 0.006 & 1.749 & 0.007 \\ \hline 6 & 639 & 36 & 2.288 & 0.038 & 2.320 & 0.006 & 2.265 & 0.009 \\ \hline \end{tabular}} \end{table}
PMC1539032_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Authors} & \textbf{Year} & \textbf{Main findings} \\ \hline Johnson et al. & 2004 & Germline stem cells are located within the ovarian epithelium and supply the adult mouse ovary with new oocytes. \\ \hline Johnson et al. & 2005 & Germline stem cells are present in the circulation and supply the adult mouse ovary with new oocytes. \\ \hline Byskov et al. & 2005 & Failed overestimation to find any of BrdU atretic positive follicle oogonia number within contributed the ovarian to Johnson epithelium et al.'s and conclusions. provided evidence to suggest that an \\ \hline Oktay et al., & 2005 & Reported transplantation spontaneous and ovarian pregnancy tissue in transplantation. presumably sterile patient following chemotherapy, hematopoeitic stem cell \\ \hline Bristol-Gould et al. & 2006 & Showed determine that that follicle de novo numbers follicle gradually production decline is not in the required mouse to ovary support with fertility. age and used mathematical modeling to \\ \hline Eggan et al. & 2006 & Used parabiotic mice to show that ovulated oocytes do not come from circulating stem cells. \\ \hline Kerr et al. & 2006 & Showed follicular that renewal. follicle numbers remain constant in mouse ovaries from puberty to early mid-life, suggesting possible \\ \hline \end{tabular}} \end{table}
PMC1553467_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Proteins} & \textbf{Value} & \textbf{Number of connections} & \textbf{GO Molecular Function annotation} \\ \hline CLA4 (YNL298W) & -0.41 & 91 & protein serine/threonine kinase activity \\ \hline FKS1 (YLR342W) & -0.34 & 90 & 1,3-beta-glucan synthase activity \\ \hline ARP2 (YDL029W) & -0.09 & 88 & ATP binding; actin binding; structural constituent of cytoskeleton \\ \hline SMI1 (YGR229C) & -0.05 & 82 & molecular function unknown \\ \hline PHO85 (YPL031C) & 0.06 & 81 & cyclin-dependent protein kinase activity \\ \hline RVS167 (YDR388W) & 0.83 & 92 & cytoskeletal protein binding \\ \hline \end{tabular}} \end{table}
PMC1557866_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \textbf{Variable (unit)} & \textbf{Odds ratio (CI)*} \\ \hline \multicolumn{2}{|l|}{Abnormally low semen count ($<$ 20 $\times$ 106)} \\ \hline Abnormally low basal inhibin ($<$ 100 pg/ml) & 8.2 (1.4โ€“49.2) \\ \hline Age (years) & 1.0 (0.92โ€“1.1) \\ \hline Abstinence (days) & 1.0 (0.99โ€“1.0) \\ \hline Fever in the last 2 months & 0.45 (0.07โ€“3.1) \\ \hline Physical abnormality & 0.77 (0.1โ€“6.3) \\ \hline R2 = 0.18, n = 34 \\ \hline \end{tabular}} \end{table}
PMC1560382_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Plasma (acyl)carnitine} & \textbf{Non Responders} & \textbf{Responders} & \textbf{P} \\ \hline ($\mu$mol/L) & Mean (SD) & Mean (SD) \\ \hline Free carnitine & 36.6 (9.3) & 34.7 (8.3) & 0.374 \\ \hline C2-carnitine & 5.9 (2.6) & 4.8 (1.7) & 0.023 \\ \hline C3-carnitine & 0.34 (0.12) & 0.34 (0.15) & 0.970 \\ \hline C4-carnitine & 0.23 (0.10) & 0.21 (0.11) & 0.415 \\ \hline C8-carnitine & 0.11 (0.04) & 0.08 (0.04) & 0.078 \\ \hline C14:1-carnitine & 0.07 (0.04) & 0.04 (0.03) & 0.083 \\ \hline C16:1-carnitine & 0.05 (0.04) & 0.04 (0.02) & 0.323 \\ \hline C18:1-carnitine & 0.16 (0.10) & 0.16 (0.14) & 0.907 \\ \hline \end{tabular}} \end{table}
PMC1562448_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{District (DHA only)} & \textbf{Service Expenditure (Cedis)} & \textbf{Service Expenditure (US\$)*} & \textbf{Service Expenditure per 100 people (US\$)} \\ \hline \multicolumn{4}{|l|}{Northern} \\ \hline Tamale municipal & 39,019, 000 & 4,758.41 & 1.62 \\ \hline West Gonja & 41,930, 000 & 5,113.41 & 3.67 \\ \hline West Mamprusi & 38,001,000 & 4,634.26 & 4.03 \\ \hline Savelugu-Nanton & 29,427,000 & 3,588.65 & 3.99 \\ \hline \multicolumn{4}{|l|}{Ashanti} \\ \hline Kumasi Metro & 14,952, 607 & 1,823.49 & 0.16 \\ \hline Amansie East & 14,156, 921 & 1,726.45 & 0.77 \\ \hline Sekyere East & 14,096,000 & 1,719.02 & 1.09 \\ \hline Asante-Akim North & 12,162,716 & 1,483.26 & 1.17 \\ \hline Total & 203,745,244 & 24,846.95 \\ \hline \end{tabular}} \end{table}
PMC1563463_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{participation Childhood workforce age 10โ€“15โ€ } & \textbf{participation Adult workforce age 30โ€“35} & \textbf{participation Adult workforce age 40โ€“45} & \textbf{Social category* mobility} & \textbf{Men n (\%)} & \textbf{Women n (\%)} \\ \hline Inside & Inside & Inside & IR S, IA S & 35,951 (87.7) & 27,086 (68.3) \\ \hline Inside & Inside & Outside & IR O, IA O & 1,850 (4.5) & 1,583 (4.0) \\ \hline Inside & Outside & Inside & IR O, IA I & 980 (2.4) & 7,783 (19.6) \\ \hline Inside & Outside & Outside & IR O, IA S & 485 (1.2) & 1,561 (3.9) \\ \hline Outside & Outside & Outside & IR S, IA S & 42 (0.1) & 101 (0.3) \\ \hline Outside & Outside & Inside & IR I, IA I & 63 (0.2) & 357 (0.9) \\ \hline Outside & Inside & Outside & IR I, IA O & 110 (0.3) & 96 (0.2) \\ \hline Outside & Inside & Inside & IR I, IA S & 1,491 (3.6) & 1,110 (2.8) \\ \hline Total & & & & 40,972 (100) & 39,677 (100) \\ \hline \end{tabular}} \end{table}
PMC1569840_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Frequency (n = 46)} & \textbf{SRO1} & \textbf{Size (Mb)} & \textbf{Genomic position (Mb)} \\ \hline \multicolumn{5}{|l|}{Losses} \\ \hline 8p & 67.4\% & 8p21.2-8p22 & 12.0 & 15.36โ€“27.36 \\ \hline 5q & 39.1\% & 5q13.2-5q13.3 5q22.2-5q23.1 5q13.1 5q21.1 & 0.6 2.1 2.0 7.7 & 112.07โ€“119.75 99.03โ€“101.09 66.79โ€“67.41 71.74โ€“73.87 \\ \hline 16q & 37.0\% & 16q12.1-16q12.2 16q22.2-16q22.3 16q23.3-16q24.1 & 4.1 1.7 3.6 & 49.70โ€“53.86 70.70โ€“72.37 81.20โ€“84.83 \\ \hline 6q & 34.8\% & 6q16.2-6q22.31 6q14.1-6q14.3 & 23.6 3.5 & 99.38โ€“123.02 82.59โ€“86.12 \\ \hline 10q & 32.6\% & 10q23.31 10q26.3 & 1.0 2.6 & 130.01โ€“132.63 89.69โ€“90.69 \\ \hline 13q & 32.6\% & 13q21.32-13q21.33 13q14.1-13q14.3 & 5.5 4.7 & 39.49โ€“45.03 66.42โ€“71.16 \\ \hline 17p & 30.4\% & 17p13.1-17p13.2 & 2.3 & 6.14โ€“8.49 \\ \hline 12p & 23.9\% & 12p13.2 & 1.9 & 10.93โ€“12.86 \\ \hline \multicolumn{5}{|l|}{Gains} \\ \hline 8q & 30.4\% & 8q11.21-8q12.1 8q13.2-8q24.23 & 10.8 68.2 & 68.36โ€“136.56 48.76โ€“59.73 \\ \hline 7q & 21.7\% & 7q11.21-7q11.22 7q21.11-7q22.1 & 19.5 6.3 & 64.63โ€“71.01 80.26โ€“99.76 \\ \hline \end{tabular}} \end{table}
PMC1570364_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{Patients with schizophrenia}} & \multicolumn{2}{|l|}{\textbf{Non-psychiatric subjects}} \\ \hline & \textbf{BMI $<$ 28} & \textbf{BMI $\geq$ 28} & \textbf{BMI $<$ 28} & \textbf{BMI $\geq$ 28} \\ \hline & N = 20 & N = 20 & N = 20 & N = 20 \\ \hline Age (mean $\pm$ sd) & 31.7 $\pm$ 9.2 & 36.1 $\pm$ 8.9 & 33.9 $\pm$ 13.0 & 37.2 $\pm$ 8.1 \\ \hline BMI (mean $\pm$ sd) & 23.6 $\pm$ 2.2 & 32.9 $\pm$ 6.1 & 21.1 $\pm$ 2.5 & 33.8 $\pm$ 4.9 \\ \hline (N. female) & 9 & 10 & 13 & 8 \\ \hline \end{tabular}} \end{table}
PMC1570457_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{Breast cancer N = 3593}} & \multicolumn{2}{|l|}{\textbf{BC controls N = 9098}} \\ \hline \textbf{Age at diagnosis (mean, SD)} & \textbf{54.6} & \textbf{9.3} & \textbf{50.6} & \textbf{10.1} \\ \hline & N & \% & N & \% \\ \hline \multicolumn{5}{|l|}{Education} \\ \hline University level & 1066 & 29.7 & 3215 & 35.3 \\ \hline Lower education & 2483 & 69.1 & 5817 & 63.9 \\ \hline \multicolumn{5}{|l|}{Age at menarche} \\ \hline $<$ 13 years & 1926 & 53.6 & 4870 & 53.5 \\ \hline 13 + years & 1583 & 44.1 & 3998 & 43.9 \\ \hline \multicolumn{5}{|l|}{Child bearing history} \\ \hline 0โ€“1 child & 1524 & 42.4 & 3358 & 36.9 \\ \hline 2+ children & 1992 & 55.4 & 5648 & 62.1 \\ \hline \multicolumn{5}{|l|}{Age at first live birth} \\ \hline $<$= 22 years & 1502 & 41.8 & 3821 & 42.0 \\ \hline $>$ 22 years & 1626 & 45.3 & 4276 & 47.0 \\ \hline Nulliparous \& no live birth & 367 & 10.2 & 840 & 9.2 \\ \hline \multicolumn{5}{|l|}{Breast-feeding} \\ \hline never & 1924 & 53.6 & 3957 & 43.5 \\ \hline 1 month and more & 1592 & 44.3 & 5047 & 55.5 \\ \hline \multicolumn{5}{|l|}{OC use} \\ \hline never & 1079 & 30.0 & 1805 & 19.8 \\ \hline ever & 2508 & 69.8 & 7271 & 79.9 \\ \hline \multicolumn{5}{|l|}{HRT use} \\ \hline never & 2080 & 57.9 & 5910 & 65,0 \\ \hline ever & 1513 & 42.1 & 3188 & 35.0 \\ \hline \multicolumn{5}{|l|}{Family history of breast cancer} \\ \hline No & 2453 & 68.3 & 8400 & 92.3 \\ \hline Yes & 550 & 15.3 & 649 & 7.1 \\ \hline \multicolumn{5}{|l|}{Body mass index} \\ \hline $<$25 & 1415 & 39.4 & 4470 & 49.1 \\ \hline 25 + & 2152 & 59.9 & 4508 & 49.6 \\ \hline \end{tabular}} \end{table}
PMC1574290_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Study, location reference and} & \textbf{Number Patients of} & \textbf{Study Design} & \textbf{Age * (years)} & \textbf{CD4 Count** Cell} & \textbf{Vaccine strains} & & \textbf{Comparator} \\ \hline Tasker USA, [26] 1999, & 102 & Randomized double placebo controlled blind, & 33 & 403.1 & A/Johannesburg/ 33/94 36/91 07/94) A/Texas/ B/Harbin/ & (H3N2), (HlNl), & Saline \\ \hline Fine [4] 2001, USA, & 71 & Outbreak investigation & 38 & 149 & A/Nanchang/933/ 95(H3N2), Texas/36/ 91(H1N1), Harbin/07/94, York/83/ 97(H3N2) A/ B/ & A/New & None \\ \hline Raineri Italy, [34] 2005, & 145 & Prospective nonrandomized & 20โ€“69 & -- & INFLEXAL Berna V, & & None \\ \hline Yamanaka Japan, [27] 2005, & 328 & Prospective nonrandomized & 40.8 & 379 & A/New Caledonia/20/99 A/Panama/2007/ 99 87 B/Shanton/7/ & (H1N1), (H3N2), & None \\ \hline \end{tabular}} \end{table}
PMC1574329_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Patient ID} & \textbf{Age (years)} & \textbf{Sex} & \textbf{Status} & \textbf{Atopy} & \textbf{FEV1 (L)} & \textbf{FEV1 \% pred} & \textbf{FVC (L)} \\ \hline 1 & 34 & M & Normal & NA & 4.5 & 110 & 6.2 \\ \hline 3 & 25 & M & Normal & A & 4.6 & 108 & 5.7 \\ \hline 4 & 27 & M & Normal & NA & 4.0 & 92 & 5.3 \\ \hline 5 & 24 & F & Normal & NA & 3.4 & 103 & 3.6 \\ \hline 6 & 25 & M & Normal & NA & 5.2 & 122 & 6.35 \\ \hline 8 & 39 & F & Normal & NA & 2.6 & 116 & 3.3 \\ \hline 9 & 25 & F & Normal & A & 3.6 & 100 & 4.0 \\ \hline 10 & 23 & F & Normal & A & 3.2 & 98 & 3.3 \\ \hline 14 & 27 & M & Normal & NA & 5.2 & 111 & 6.4 \\ \hline 17 & 27 & F & Normal & NA & 3.1 & 98 & 4.1 \\ \hline 2 & 32 & M & Asthmatic & A & 4.9 & 121 & 4.7 \\ \hline 7 & 32 & M & Asthma & A & 4.5 & 82 & 6.4 \\ \hline 11 & 27 & M & Asthmatic & A & 3.1 & 87 & 4.1 \\ \hline 12 & 25 & F & Asthmatic & A & 3.1 & 97 & 3.7 \\ \hline 13 & 24 & F & Asthmatic & A & 3.4 & 114 & 3.8 \\ \hline 15 & 27 & M & Asthmatic & NA & 3.9 & 95 & 5.4 \\ \hline 16 & 22 & F & Asthmatic & A & 2.9 & 102 & 3.6 \\ \hline 18 & 25 & M & Asthmatic & A & 3.3 & 79 & 4.7 \\ \hline 19 & 24 & F & Asthmatic & A & 2.9 & 94 & 3.4 \\ \hline 20 & 25 & F & Asthmatic & A & 3.7 & 104 & 4.2 \\ \hline \end{tabular}} \end{table}
PMC1579218_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Year} & \textbf{Estimated population\#} & \textbf{Birth cohort} & \textbf{Vaccination coverage*} & \textbf{Vaccine efficacy**} & \textbf{Children susceptible} & \textbf{Cumulated population susceptible} \\ \hline 1988 & 2,076,264 & 44,432 & 103.19\% & 85\% & 5,459 & 5,459 \\ \hline 1989 & 2,091,648 & 46,853 & 105.50\% & 85\% & 4,837 & 10,296 \\ \hline 1990 & 2,107,146 & 44,461 & 101.67\% & 85\% & 6,038 & 16,334 \\ \hline 1991 & 2,122,759 & 44,153 & 100.65\% & 85\% & 6,378 & 22,712 \\ \hline 1992 & 2,138,488 & 44,267 & 104.57\% & 85\% & 4,921 & 27,633 \\ \hline 1993 & 2,154,333 & 42,009 & 102.70\% & 85\% & 5,337 & 32,970 \\ \hline 1994 & 2,170,295 & 41,670 & 102.51\% & 85\% & 5,362 & 38,332 \\ \hline 1995 & 2,186,376 & 44,383 & 104.92\% & 85\% & 4,803 & 43,135 \\ \hline 1996 & 2,202,576 & 42,289 & 101.57\% & 85\% & 5,779 & 48,913 \\ \hline 1997 & 2,218,896 & 42,603 & 100.74\% & 85\% & 6,124 & 55,037 \\ \hline 1998 & 2,235,337 & 42,918 & 99.28\% & 85\% & 6,700 & 61,737 \\ \hline 1999 & 2,251,900 & 43,462 & 101.25\% & 85\% & 6,058 & 67,795 \\ \hline 2000 & 2,268,586 & 43,784 & 101.13\% & 85\% & 6,148 & 73,944 \\ \hline 2001 & 2,285,395 & 44,108 & 105.18\% & 85\% & 4,674 & 78,617 \\ \hline 2002 & 2,302,329 & 44,435 & 102.56\% & 85\% & 5,697 & 84,314 \\ \hline 2003 & 2,319,388 & 44,764 & 101.46\% & 85\% & 6,159 & 90,473 \\ \hline 2004 & 2,336,574 & 45,096 & 99.57\% & 85\% & 6,928 & 97,401 \\ \hline \end{tabular}} \end{table}
PMC1586205_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{n} & \textbf{\# code words โ€“ 4n/2} & \textbf{Coloring bound} & \textbf{Sphere packing bound} \\ \hline 3 & 32 & 18 & 3 \\ \hline 4 & 128 & 42 & 9 \\ \hline 5 & 512 & 95 & 32 \\ \hline 6 & 2,048 & 210 & 107 \\ \hline 7 & 8,192 & 460 & 372 \\ \hline 8 & 32,768 & 994 & 1310 \\ \hline \end{tabular}} \end{table}
PMC1590034_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline & \textbf{Fruit intake} & \textbf{N} & \textbf{$\beta$a} & \textbf{95\% CI} & \textbf{Vegetable N intake} & \textbf{$\beta$b} & \textbf{95\% CI} \\ \hline \\ \hline Model 1 & boys & 249 & 0.02 & -0.21; 0.25 \\ \hline & girls & 280 & 0.37 & 0.15; 0.59 & 529 & 0.97 & 0.89; 1.04 \\ \hline Model 2 & boys & 196 & -0.05 & -0.34; 0.25 \\ \hline & girls & 227 & 0.25 & 0.00; 0.50 & 423 & 1.01 & 0.92; 1.11 \\ \hline \end{tabular}} \end{table}
PMC1599740_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|} \hline Class & \multicolumn{14}{|l|}{3 1065 [336]} \\ \hline Subclass & 3.1 [113] 267 & \multicolumn{2}{|l|}{3.2 163 [56]} & 3.3 [4] 10 & 3.4 [49] 317 & 3.5 [70] 171 & 3.6 [36] 109 & 3.7 [4] 10 & 3.8 [1] 10 & 3.9 [1] 1 & 3.10 [1] 2 & 3.11 [0] 2 & 3.12 [1] 1 & 3.13 [0] 2 \\ \hline subclass Sub- & & 3.2.1 [45] 140 & 3.2.2 [11] 23 \\ \hline \end{tabular}} \end{table}
PMC1609188_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|} \hline \multicolumn{2}{|l|}{\textbf{No. of patients (n = 34)}} \\ \hline \textbf{Sex} \\ \hline Male/Female & 23/11 \\ \hline \multicolumn{2}{|l|}{Age (years)} \\ \hline Median/Range & 57/15โ€“90 \\ \hline \multicolumn{2}{|l|}{and Site of involvement} \\ \hline the Conjunctiva & 9 \\ \hline the Orbit & 21 \\ \hline Lachrymal gland & 4 \\ \hline \multicolumn{2}{|l|}{in Laterality} \\ \hline Right & 13 \\ \hline Left & 13 \\ \hline Bilateral & 8 \\ \hline \multicolumn{2}{|l|}{neg- Stage} \\ \hline was I, II & 31 \\ \hline III, IV & 3 \\ \hline as LDH$>$normal & 5 \\ \hline \multicolumn{2}{|l|}{and Initial therapy*} \\ \hline Radiation & 21 \\ \hline Chemotherapy & 3 \\ \hline Chemotherapy + Radiation & 3 \\ \hline Observation & 5 \\ \hline \end{tabular}} \end{table}
PMC1630703_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{Sample} & \textbf{M} & \textbf{N} & \textbf{H} & \textbf{AA \%} & \textbf{DNA \%} & \textbf{dN/dS} & \textbf{PNGS} & \textbf{V1V5 length} & \textbf{Co-receptor usage} & \textbf{Cause of death} \\ \hline 1449 i02m & 2 & 26 & 21 & 0.6 & 0.3 & 0.71 & 21(18โ€“21) & 330(330-330) & CCR5 \\ \hline 1449 i04m & 4 & 44 & 37 & 1.1 & 0.5 & 1.15 & 21(20โ€“22) & 330(323โ€“330) \\ \hline 1449 i08m & 8 & 43 & 42 & 1.9 & 0.8 & 1.37 & 21(19โ€“23) & 328(327โ€“330) & CCR5 & Pneumonia \\ \hline 2669 i02m & 2 & 30 & 29 & 1.1 & 0.6 & 0.61 & 25(23โ€“25) & 339(335โ€“339) & CCR5 \\ \hline 2669 i06m & 6 & 33 & 33 & 1.3 & 0.7 & 0.66 & 25(23โ€“26) & 337(329โ€“339) & CCR5 & Bronchitis \\ \hline 2873 i02m & 2 & 29 & 26 & 1.2 & 0.6 & 0.91 & 28(27โ€“29) & 356(356-356) & CCR5 \\ \hline 2873 i04m & 4 & 29 & 27 & 1.0 & 0.5 & 0.77 & 28(27โ€“28) & 356(356-356) & CCR5 & Tuberculosis \\ \hline 2617 i02m & 2 & 27 & 27 & 1.1 & 0.6 & 0.52 & 23(22โ€“24) & 336(336-336) \\ \hline 2617 i04m & 4 & 23 & 23 & 1.3 & 0.8 & 0.41 & 23(22โ€“24) & 336(336-336) \\ \hline 2617 i06m & 6 & 26 & 26 & 1.8 & 1.0 & 0.69 & 24(23โ€“24) & 336(336-336) & CCR5 & Pyrexia \\ \hline 1984 i04m & 4 & 25 & 25 & 2.1 & 1.0 & 0.97 & 21(19โ€“22) & 343(343-343) \\ \hline 1984 i06m & 6 & 27 & 26 & 1.7 & 0.7 & 1.21 & 22(20โ€“24) & 342(332โ€“343) & CCR5 \\ \hline 1984 i12m & 12 & 27 & 27 & 2.8 & 1.3 & 0.94 & 23(21โ€“24) & 340(331โ€“343) & CCR5 \\ \hline 1984 i24m & 24 & 26 & 26 & 4.2 & 2.0 & 0.98 & 24(22โ€“26) & 329(325โ€“340) & CCR5 \\ \hline 1984 i36m & 36 & 29 & 27 & 5.4 & 2.6 & 1.04 & 24(22โ€“26) & 332(326โ€“341) & CCR5 \\ \hline 1984 i48m & 48 & 26 & 26 & 6.6 & 3.3 & 1.02 & 24(22โ€“26) & 331(323โ€“344) & CCR5 \\ \hline 1084 i06m & 6 & 25 & 25 & 2.4 & 1.2 & 0.68 & 21(19โ€“23) & 319(319โ€“328) \\ \hline 1084 i27m & 27 & 28 & 28 & 1.3 & 0.7 & 0.65 & 25(24โ€“25) & 328(328-328) & CCR5 \\ \hline 1084 i36m & 36 & 25 & 24 & 5 & 2.6 & 1.1 & 25(22โ€“28) & 336(325โ€“344) & CCR5 \\ \hline 1084 i48m & 48 & 48 & 40 & 8.9 & 4.9 & 0.76 & 27(18โ€“28) & 344(325โ€“344) & CCR5 \\ \hline 1690 i12m & 12 & 28 & 28 & 1.8 & 1.0 & 0.71 & 26(23โ€“27) & 338(331โ€“339) & CCR5 \\ \hline 1690 i24m & 24 & 31 & 31 & 2.1 & 1.1 & 0.65 & 23(22โ€“25) & 329(325โ€“336) \\ \hline 1690 i36m & 36 & 30 & 30 & 3.0 & 1.7 & 0.72 & 23(19โ€“25) & 327(319โ€“338) \\ \hline 1690 i48m & 48 & 26 & 26 & 4.4 & 2.2 & 1.01 & 24(23โ€“26) & 336(331โ€“341) & CXCR4/CCR5 \\ \hline \end{tabular}} \end{table}
PMC1635063_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Author} & \textbf{Condition} & \textbf{QUADAS Score} \\ \hline Laslett et al [8] & Sacroiliac Joint Pain/Dysfunction & 12 \\ \hline Laslett et al [9] & Sacroiliac Joint Pain/Dysfunction & 11 \\ \hline Shah \& Rajshekhar [10] & Soft Cervical Disc Prolapse & 11 \\ \hline Wainner et al [16] & Cervical Radiculopathy & 11 \\ \hline Dreyfuss et al [13] & Sacroiliac Joint Pain/Dysfunction & 10 \\ \hline Poiraudeau et al [14] & Lumbar Disc Herniation & 10 \\ \hline Glaser et al [17] & Cervical Spinal Cord Compression & 9 \\ \hline Mens et al [19] & Posterior Pelvic Pain since Pregnancy & 9 \\ \hline Viikari-Juntura, Porras \& Laasonen [20] & Cervical Radiculopathy & 9 \\ \hline Cote et al [21] & Scoliosis & 8 \\ \hline Cote et al [12] & Vertebrobasilar Blood Flow & 8 \\ \hline Broadhurst \& Bond [11] & Sacroiliac Joint Pain/Dysfunction & 7 \\ \hline Siminoski et al [15] & Lumbar Vertebral Fractures & 7 \\ \hline Kosteljanetz, Bang \& Schmidt-Olsen [22] & Lumbar Disc Prolapse & 7 \\ \hline Thomas et al [24] & Meningitis & 7 \\ \hline Tong, Haig \& Yamakawa [25] & Cervical Radiculopathy & 7 \\ \hline Leboeuf [18] & Lumbopelvic Pain/Dysfunction & 6 \\ \hline Lauder et al [23] & Lumbosacral Radiculopathy & 6 \\ \hline Karachalios et al [26] & Scoliosis & 5 \\ \hline Sandmark \& Nisell [27] & Cervical Spine/Neck Pain & 4 \\ \hline Albert, Godskesen \& Westergaard [28] & Posterior Pelvic Pain since Pregnancy & 4 \\ \hline \end{tabular}} \end{table}
PMC1635718_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Authors} & \textbf{No. of Subjects} & \textbf{Test} & \textbf{Sensitivity (\%)} & \textbf{Specificity (\%)} & \textbf{QUADAS Score} \\ \hline Thomas et al [24] & 297 & Kernig & 5* & 95* \\ \hline & & & 9** & 96** & 7 \\ \hline & & & 0*** & 95*** \\ \hline & & Brudzinski & 5* & 95* \\ \hline & & & 9** & 96** \\ \hline & & & 25** & 96** \\ \hline \end{tabular}} \end{table}
PMC1635718_table_7
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Village} & \textbf{Paddy category} & \textbf{No. of Habitats} & \textbf{1stinstars} & \textbf{2nd instars} & \textbf{3rd instars} & \textbf{4th instars} & \textbf{Pupae} \\ \hline Kangichiri & Ploughed & 25 & 1.41 & 0.95 & 0.09 & 0.00 & 0.36 \\ \hline & Flooded & 23 & 1.67 & 1.10 & 0.30 & 0.00 & 0.36 \\ \hline & Post transplanting & 30 & 6.02 & 3.00 & 1.89 & 1.20 & 0.99 \\ \hline & Tillering & 28 & 8.00 & 6.67 & 2.00 & 3.22 & 0.67 \\ \hline & Flowering/ maturation & 27 & 0.01 & 0.00 & 0.02 & 0.01 & 0.00 \\ \hline & Fallow & 27 & 1.00 & 0.67 & 0.00 & 0.00 & 0.01 \\ \hline Kiuria & Ploughed & 22 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\ \hline & Flooded & 23 & 1.23 & 0.65 & 0.07 & 0.01 & 0.0 \\ \hline & Post transplanting & 21 & 5.58 & 1.63 & 0.17 & 0.51 & 0.19 \\ \hline & Tillering & 22 & 8.50 & 5.25 & 0.25 & 0.25 & 1.25 \\ \hline & Flowering/ maturation & 20 & 0.02 & 0.00 & 0.01 & 0.0 & 0.00 \\ \hline & Fallow & 14 & 0.03 & 0.01 & 0.0 & 0.01 & 0.00 \\ \hline Rurumi & Ploughed & 18 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\ \hline & Flooded & 21 & 1.56 & 1.28 & 0.09 & 0.06 & 0.19 \\ \hline & Post transplanting & 20 & 5.73 & 3.37 & 1.17 & 1.03 & 0.47 \\ \hline & Tillering & 20 & 4.91 & 4.67 & 1.19 & 1.11 & 1.00 \\ \hline & Flowering/ maturation & 15 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\ \hline & Fallow & 12 & 1.17 & 0.00 & 0.00 & 0.00 & 0.00 \\ \hline \end{tabular}} \end{table}
PMC1636646_table_1
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|} \hline \textbf{Characteristic} & & & & \multicolumn{3}{|l|}{\textbf{No NASH vs Borderline or NASH}} & \multicolumn{3}{|l|}{\textbf{NASH vs Borderline or No NASH}} \\ \hline & \textbf{No n = NASH 98} & \textbf{Borderline NASH n = 96} & \textbf{NASH n = 63} & \textbf{Univariate analysis P-value} & \textbf{Multivariate analysis P value} & \textbf{Odds (95\% CI) Ratio} & \textbf{Univariate analysis P-value} & \textbf{Multivariate analysis P value} & \textbf{Odds (95\% CI) Ratio} \\ \hline \multicolumn{10}{|l|}{Demographics} \\ \hline Age years at biopsy, & 49.4 (1.2) & 51.4 (1.2) & 53.8 (1.5) & 0.045 & 0.75 & 1.00 (0.97;1.04) & 0.04 & 0.99 & 1.00 (0.97;1.33) \\ \hline Male gender & 56/98 (57\%) & 66/96 (69\%) & 31/63 (49\%) & 0.54 & 0.82 & 1.10 (0.48;2.56) & 0.054 & 0.04 & 2.54 (1.03;6.26) \\ \hline Weight, kg & 75.2 (1.4) & 86.8 (1.4) & 82.3 (1.8) & $<$ 0.0001 & $<$ 0.0001 & 1.06 (1.03;1.08) & 0.25 & 0.86 & 1.00 (0.97;1.02) \\ \hline Height, meter & 1.68 (0.01) & 1.69 (0.01) & 1.67 (0.01) & 0.87 & 0.15 & 0.03 (0.00;3.34) & 0.22 & 0.66 & 0.33 (0.00;47.2) \\ \hline \multicolumn{10}{|l|}{Biochemical markers} \\ \hline $\alpha$2-macroglobulin, g/L & 1.58 (0.07) & 1.73 (0.07) & 1.86 (0.08) & 0.02 & 0.15 & 0.33 (0; 1050) & 0.01 & 0.16 & 0.72 (0.46;1.14) \\ \hline ALT, IU/L & 67 (5) & 74 (5) & 88 (6) & 0.005 & 0.90 & 1.00 (0.99;1.01) & 0.004 & 0.24 & 0.99 (0.99;1.00) \\ \hline AST, IU/L & 40 (3) & 48 (3) & 60 (4) & 0.0004 & 0.007 & 1.02 (1.01;1.04) & 0.001 & 0.25 & 0.99 (0.98;1.01) \\ \hline Apolipoprotein A1, g/L & 1.61 (0.05) & 1.43 (0.05) & 1.50 (0.06) & 0.08 & 0.27 & 0.53 (0.17;1.67) & 0.62 & 0.71 & 1.14 (0.57;2.28) \\ \hline Haptoglobin, g/L & 1.14 (0.10) & 1.11 (0.07) & 1.02 (0.09) & 0.87 & 0.50 & 0.83 (0.47;1.44) & 0.41 & 0.18 & 1.56 (0.81;2.99) \\ \hline GGT, IU/L & 133 (14) & 98 (14) & 128 (17) & 0.002 & 0.005 & 1.00 (0.993;0.998) & 0.48 & 0.37 & 1.00 (0.998;1.00) \\ \hline Total $\mu$mol/L bilirubin, & 11.2 (0.6) & 12.0 (0.6) & 12.5 (0.8) & 0.87 & 0.22 & 1.04 (0.98;1.09) & 0.30 & 0.35 & 0.98 (0.93;1.02) \\ \hline Glucose mmol/L & 5.5 (0.2) & 6.0 (0.2) & 7.2 (0.3) & 0.005 & 0.05 & 1.20 (0.999;1.45) & $<$ 0.0001 & 0.0009 & 0.77 (0.67;0.90) \\ \hline Cholesterol mmol/L & 5.4 (0.1) & 5.5 (0.1) & 5.4 (0.2) & 0.68 & 0.25 & 1.17 (0.90;1.53) & 0.77 & 0.95 & 1.01 (0.78;1.30) \\ \hline Triglycerides & 1.4 (0.2) & 2.0 (0.2) & 2.0 (0.2) & $<$ 0.0001 & 0.23 & 1.19 (0.90;1.57) & 0.007 & 0.90 & 1.01 (0.83;1.24) \\ \hline FibroTest & 0.25 (0.02) & 0.31 (0.01) & 0.35 (0.02) & 0.03 & included Not & Not included & 0.008 & Not included & Not included \\ \hline SteatoTest & 0.60 (0.02) & 0.70 (0.02) & 0.72 (0.03) & $<$ 0.0001 & included Not & Not included & 0.007 & Not included & Not included \\ \hline \end{tabular}} \end{table}
PMC1657015_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Citation} & \textbf{Intervention} & \textbf{Study (Control/Intervention) Population Total} & \textbf{Follow-up Assessment \& method} & \textbf{Outcomes} \\ \hline Cline (Sweden) et al. & Education and management and to medication 2 hr $\times$ contact after 30 their symptoms min discharge families. on the organizer. during of heart nurse. and diuretics Guidelines hospitalization, instructions failure Provision Nurse based for counselling: for patients on on of self- 1 7-day signs when $\times$ 1 & N Male: Mean Age Mean = range: 190 53\% age: NYHA: (110/80) 75.6 65โ€“84 2.6 & 1 questionnaires, records year; Self-administered hospital & Readmission, days, one mortality year, health quality care hospitalization costs of life, during \\ \hline Jaarsma (Netherlands) et al. & Education failure fluid symptoms. sessions call NOTE: education \& balance, 1 and control home during about about guidelines Counselling: recognition visit hospitalization, group medication consequences after for received Average discharge compliance, of warning and of 1 lifestyle of phone heart 4 & N Male: Mean NYHA NYHA IV: = 61\%. 179 58\% age: III: III-IV: (95/84) 73. 17\% 21\%, NYHA & 1, interviews, 3, 9 months; questionnaires Patient & Self-care behaviour, overall readmission, days, resource wellbeing, abilities, quality hospitalization utilization. self-care of life, \\ \hline Koelling (U.S.) et al. & Education instructions weighing, monitoring, physicians dietary (1 including for hour), taking restrictions provision when medications, to \& of contact symptom & N Male: Mean Black: Coronary = 223 58\% age: 22\% (116/107) 65 disease 64\% & 6 nurse months; at 1, Phone 3 and 6 call months from & Readmission cardiac mortality, practice and scores. cost all-cause), (heart of care, failure, self- \\ \hline Krumholz (U.S.) et al. & Education signs when for monthly 4 \& weeks, to symptoms, seek for about the biweekly help. remainder illness, health Weekly for medication, behaviour, 8 of phone weeks, the year call early & N Male: Mean White: = 88 66/48\% age: 77/70\% (44/44) 71.6/75.9 & 1 next discharge Year; of Review kin information contact, of records, & Readmission cardiovascular cause), mortality, hospitalization cost (heart disease of care. failure, and days, all- \\ \hline Ross (U.S.) et al. & Educational enabling patients and communication software, staff a messaging between system & N Male: Mean College: White: Household (v. = 76\% 107 74/80\% age: 88/92\% decliners). 44/53\% (53/54) 55/57 income (v. (v. 75\% $>$\$45 decliners: decliners) K: 50/56\% 26\%) & 6 survey months, 1 Year; Mailed & Readmission, health adherence and patient status, to satisfaction. mortality, self-efficacy, medical advice \\ \hline Sethares (U.S.) \& Elliot & Nurse-led based to 1 in information possibly month the self-care on control referred after perceived tailored of about HF. discharge group to Follow-up medication message benefits nurse were NOTE: agencies given intervention and 1 and week Patients barriers and & N Mean Mean Education = 70 Age: NYHA: (37/33) (years): 76.8/75.7 3.0 11/11 & 3 scales months; Health-measure & Readmission, beliefs of treatment. in benefits quality and of barriers life, \\ \hline \end{tabular}} \end{table}
PMC1660572_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{Heifers}} & \multicolumn{2}{|l|}{\textbf{Cows}} \\ \hline \textbf{Pathogens} & \textbf{\%} & \textbf{n} & \textbf{\%} & \textbf{n} \\ \hline E.coli* & 22.1 & 15 & 6.6 & 20 \\ \hline Str. uberis* & 19.1 & 13 & 9.9 & 30 \\ \hline CNS & 8.8 & 6 & 7.3 & 22 \\ \hline Lactococcus lactis & 4.4 & 3 & 5.0 & 15 \\ \hline Klebisella spp. & 4.4 & 3 & 2.3 & 7 \\ \hline Str. spp & 2.9 & 2 & 3 & 9 \\ \hline Enterococcus spp & 2.9 & 2 & 2.3 & 7 \\ \hline Pseudomonas spp & 2.9 & 2 & 0.7 & 2 \\ \hline S.aureus* & 1.5 & 1 & 11.2 & 34 \\ \hline Arcanobacterium spp & 1.5 & 1 & 2.6 & 8 \\ \hline Str.dysgalactiae & 1.5 & 1 & 3.6 & 11 \\ \hline Corynebacterium spp & 0 & 0 & 2.0 & 6 \\ \hline Str. agalactiae & 0 & 0 & 3.3 & 10 \\ \hline Candida spp & 0 & 0 & 1.3 & 4 \\ \hline No growth & 25 & 17 & 29.4 & 89 \\ \hline Mixed culture & 2.9 & 2 & 9.6 & 29 \\ \hline Total & 100.0 & 68 & 100.0 & 303 \\ \hline \end{tabular}} \end{table}
PMC1687189_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Hybridization ID} & \textbf{ArrayDesign REF} & \textbf{ArrayData URI} & \textbf{DerivedArrayData Matrix URI} \\ \hline Hyb 1 & SMD-10K & 1.txt & FGDM.txt \\ \hline Hyb 2 & SMD-10K & 2.txt & FGDM.txt \\ \hline Hyb 3 & SMD-10K & 3.txt & FGDM.txt \\ \hline \end{tabular}} \end{table}
PMC1687205_table_6
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{|l|}{\textbf{Respondents}} & \multicolumn{2}{|l|}{\textbf{Dropouts}} \\ \hline \textbf{Characteristics at baseline} & \textbf{N} & \textbf{\%} & \textbf{N} & \textbf{\%} \\ \hline \multicolumn{5}{|l|}{Age (years)} \\ \hline $<$ 30 & 273 & 6.7 & 137 & 13.7 \\ \hline 30โ€“39 & 824 & 20.2 & 221 & 22.1 \\ \hline 40โ€“49 & 1778 & 43.6 & 338 & 33.8 \\ \hline 50โ€“59 & 1065 & 26.1 & 265 & 26.5 \\ \hline $>$ 59 & 136 & 3.3 & 39 & 3.9 \\ \hline \multicolumn{5}{|l|}{Gender} \\ \hline Female & 3912 & 96.0 & 947 & 94.9 \\ \hline Male & 164 & 4.0 & 51 & 5.1 \\ \hline \multicolumn{5}{|l|}{Marital status} \\ \hline Married or cohabiting & 3271 & 80.3 & 771 & 77.3 \\ \hline Single & 800 & 19.7 & 227 & 22.7 \\ \hline \multicolumn{5}{|l|}{Have preschool children} \\ \hline No & 3490 & 87.0 & 843 & 85.8 \\ \hline Yes & 522 & 13.0 & 140 & 14.2 \\ \hline \multicolumn{5}{|l|}{Special tasks of care taking during leisure time โ€ } \\ \hline No & 2944 & 72.6 & 721 & 72.6 \\ \hline Yes & 1112 & 27.4 & 272 & 27.4 \\ \hline \multicolumn{5}{|l|}{Pregnant} \\ \hline No & 3978 & 99.1 & 955 & 98.0 \\ \hline Yes & 37 & 0.9 & 19 & 2.0 \\ \hline \multicolumn{5}{|l|}{Long-term health problems (any kind)} \\ \hline No or "yes, but not bothered" & 3006 & 74.4 & 736 & 74.4 \\ \hline Yes, and bothered by it & 1033 & 25.6 & 253 & 25.6 \\ \hline \multicolumn{5}{|l|}{Regular physical exercise} \\ \hline No & 1724 & 42.4 & 451 & 45.2 \\ \hline Yes & 2343 & 57.6 & 547 & 54.8 \\ \hline \multicolumn{5}{|l|}{Years of experience as nurses' aide} \\ \hline $<$ 10 years & 706 & 17.3 & 235 & 23.5 \\ \hline 10 years or more & 3370 & 82.7 & 764 & 76.5 \\ \hline \end{tabular}} \end{table}
PMC1693921_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{\# of carbons} & \textbf{Flavone} & \textbf{Product(s) and yields (\%)} & \textbf{Ref.} \\ \hline 15 & 5,7-dihydroxyflavone & 5,7-dihydroxyflavone-8-sulfate, 43 & [71] \\ \hline 22 & 5-hydroxy-7-benzyloxyflavone & 5,8-dihydroxy-7-benzyloxyflavone, - & [72] \\ \hline \end{tabular}} \end{table}
PMC1697820_table_3
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|} \hline \textbf{4} & \multicolumn{4}{|l|}{\textbf{Dose of ifosfamide}} \\ \hline \textbf{9} & \textbf{10 g/m2} & \textbf{12 g/m2} & \textbf{13 g/m2} & \textbf{14 g/m2} \\ \hline 60 Hemoglobin & 21/7 & 20/3 & 9/4.5 & 36/9 \\ \hline 67 Leukocytes & 18/57 & 19/42 & 41/23 & 27/45 \\ \hline 19 Granulocytes & 0/71 & 19/46 & 9/45 & 9/63 \\ \hline Platelets & 46/11 & 14/9 & 9/9 & 0/36 \\ \hline \end{tabular}} \end{table}
PMC1698138_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|} \hline \textbf{Parameter} & \textbf{Control} & \textbf{Day 1 ICUa} & \textbf{Day 7 ICUb} \\ \hline ADMA & 0.63 (0.57โ€“0.71) & 0.89 (0.57โ€“1.09) & 1.05 (0.71โ€“1.32) \\ \hline \end{tabular}} \end{table}
PMC1751072_table_4
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline TBST+ (Subjects) & 47 & 102 \\ \hline TBST- (Controls) & 78 & 142 \\ \hline \end{tabular}} \end{table}
PMC1764018_table_2
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Dengue serotype} & \multicolumn{3}{|l|}{\textbf{Data retrieved in 2004}} & \multicolumn{3}{|l|}{\textbf{Data retrieved in 2005}} \\ \hline & \textbf{Unique (\#) sequences} & \multicolumn{2}{|l|}{\textbf{Minimal antigenic set}} & \textbf{Unique (\#) sequences} & \multicolumn{2}{|l|}{\textbf{Minimal antigenic set}} \\ \hline & & \textbf{Unique (\#)* sequences} & \textbf{unique Percentage (\%)** sequences of} & & \textbf{Unique (\#)* sequences} & \textbf{unique Percentage (\%)** sequences of} \\ \hline DV1 & 359 & 244 & 68\% & 724 & 493 & 68\% \\ \hline DV2 & 507 & 368 & 73\% & 697 & 466 & 67\% \\ \hline DV3 & 230 & 180 & 78\% & 678 & 482 & 71\% \\ \hline DV4 & 222 & 177 & 80\% & 320 & 243 & 76\% \\ \hline Total & 1318 & 969 & 74\% & 2419 & 1684 & 70\% \\ \hline \end{tabular}} \end{table}
PMC1764481_table_4
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Author} & \textbf{Cases} & \textbf{Cause} & \textbf{Therapy} & \textbf{Outcome} & \textbf{Comments} \\ \hline Smrkolj V. 1995 & two & Homicidal attempt & Surgery & Died & Left hemiplegia, right internal carotid artery thrombosis \\ \hline & & Suicidal attempt & Surgery & Died & Brain edema and right anterior cerebral artery infarction \\ \hline Anderson S.A. 1996 & one & Suicidal attempt & No surgery & Survived & Right orbital injury No deficits \\ \hline Evans R.J. 1996 & one & Accident & No surgery & Died & Hard palate impalement \\ \hline Li T. 2000 & one & Homicidal attempt & No surgery & Died & Two weeks later: basilar-cavernous fistula and basilar artery aneurysm \\ \hline Tutton M.G. 2000 & four & Homicidal attempt & No surgery & Survived & Left parietal hemorrhage involving lateral ventricles; right hemiplegia, mild dysphasia \\ \hline & & & No surgery & Survived & Intracerebral haematoma in the left frontal lobe with an overlying skull vault fracture \\ \hline & & & Surgery & Died & Depression of the left temporal fossa after with surgery) acute sub-dural hemorrhage (died two days \\ \hline & & & No Surgery & Died & Tip of the screwdriver penetrated into the brain stem \\ \hline Wong S.C. 2002 & one & Accident & No surgery & Survived & Traumatic optic neuropathy \\ \hline De Tommasi A. 2006 & one & Accident & Surgery & Survived & No deficits \\ \hline \end{tabular}} \end{table}
PMC1766346_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|} \hline \textbf{Marker spacing (kb)} & \textbf{|D'|} & \textbf{number of markers} \\ \hline 6.6 kb & 0.88 & 500 k \\ \hline 20 kb & 0.73 & 166 k \\ \hline 33 kb & 0.64 & 100 k \\ \hline 100 kb & 0.45 & 33 k \\ \hline 166 kb & 0.36 & 20 k \\ \hline \end{tabular}} \end{table}
PMC1766938_table_0
\begin{table} \scalebox{0.60}{ \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Motif} & \textbf{Zg-score} & \textbf{Z -score} & \textbf{G -score} & \textbf{occurrences Number of} & \textbf{Number promoters of} & \textbf{Known motifs} \\ \hline \multicolumn{7}{|l|}{Word cluster 1:} \\ \hline TTGGCGCCTC(-) & 3.768 & 11.6 & 0.633 & 4 & 4 & E2F(TTTYYCGYY) \\ \hline TTTGGCGCCT(-) & 4.384 & 9.5 & 0.438 & 5 & 5 & E2F(TTTYYCGYY) \\ \hline TGGCGCC(*) & 3.006 & 5.6 & 0.255 & 20 & 20 & E2F(TTTYYCGYY) \\ \hline \multicolumn{7}{|l|}{Word cluster 2:} \\ \hline TTTCCCGCCA(-) & -0.598 & 12.9 & 0.508 & 6 & 5 & E2FANTRNR(TTTCCCGC) \\ \hline TTTCCCGCC(+) & -0.613 & 4.7 & 0.289 & 5 & 5 & E2FANTRNR(TTTCCCGC) \\ \hline TTCCCGC(+) & 0.236 & 5.7 & 0.285 & 36 & 32 & E2FANTRNR(TTTCCCGC) \\ \hline TTTCCCGCT(+) & 0.227 & 4.3 & 0.273 & 7 & 7 & E2FANTRNR(TTTCCCGC) \\ \hline \end{tabular}} \end{table}
PMC1779545_table_1
End of preview. Expand in Data Studio
README.md exists but content is empty.
Downloads last month
5