image
imagewidth (px) 210
935
| latex
stringlengths 165
6.04k
| filename
stringlengths 17
19
|
|---|---|---|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Scale} & \multicolumn{4}{|l|}{\textbf{Self-report}} & \multicolumn{4}{|l|}{\textbf{Proxy-report}} \\
\hline
& \textbf{N} & \textbf{Mean (sd)} & \textbf{df} & \textbf{F} & \textbf{N} & \textbf{Mean (sd)} & \textbf{df} & \textbf{F} \\
\hline
Total Score & & & 4,1393 & 23.84 & & & 4,965 & 41.07 \\
\hline
Asthma & 99 & 75.31(16.90) *** & & & 74 & 71.79(17.53)*** \\
\hline
Diabetes & 124 & 82.46(12.76) & & & 103 & 77.54(12.21) *** \\
\hline
Cancer & 66 & 75.68(15.40) *** & & & 61 & 70.96(17.06) *** \\
\hline
IBD & 76 & 74.18(14.66) *** & & & 67 & 72.65(17.62) *** \\
\hline
Healthy & 1033 & 83.89(11.84) & & & 665 & 84.61(11.19) \\
\hline
Physical Health & & & 4,1392 & 41.60 & & & 4,964 & 46.87 \\
\hline
Asthma & 99 & 76.14(19.10)*** & & & 75 & 73.36(20.60) *** \\
\hline
Diabetes & 124 & 84.75(13.65)** & & & 103 & 82.97(13.67) *** \\
\hline
Cancer & 66 & 78.10(17.64) *** & & & 61 & 75.04(18.79) *** \\
\hline
IBD & 76 & 75.08(18.21) *** & & & 67 & 71.54(21.98) *** \\
\hline
Healthy & 1032 & 88.51(11.62) & & & 665 & 89.06(12.27) \\
\hline
Psychosocial Health & & & 4,1393 & 14.53 & & & 4,964 & 28.16 \\
\hline
Asthma & 99 & 74.9(17.48) *** & & & 74 & 71.20(17.95) *** \\
\hline
Diabetes & 124 & 81.24(13.77) & & & 103 & 74.62(13.27) *** \\
\hline
Cancer & 66 & 74.37(15.85) *** & & & 61 & 68.83(17.92) *** \\
\hline
IBD & 76 & 73.64(14.35) *** & & & 67 & 73.21(17.43) *** \\
\hline
Healthy & 1033 & 81.84(13.21) & & & 664 & 82.21(12.67) \\
\hline
Emotional functioning & & & 4,1393 & 9.85 & & & 4,962 & 23.24 \\
\hline
Asthma & 99 & 70.66(20.06) *** & & & 74 & 67.23(21.20) *** \\
\hline
Diabetes & 124 & 78.85(18.28) & & & 102 & 66.01(17.80) *** \\
\hline
Cancer & 66 & 73.56(18.39) * & & & 61 & 68.36(18.04) *** \\
\hline
IBD & 76 & 68.11(18.90) *** & & & 67 & 67.26(21.41) *** \\
\hline
Healthy & 1033 & 78.49(17.94) & & & 663 & 78.28(15.54) \\
\hline
Social functioning & & & 4,1393 & 5.89 & & & 4,964 & 14.09 \\
\hline
Asthma & 99 & 81.76(21.35) *** & & & 74 & 76.96(21.69) *** \\
\hline
Diabetes & 124 & 89.15(13.91) & & & 103 & 85.28(15.98) \\
\hline
Cancer & 66 & 81.27(18.36) ** & & & 61 & 73.28(22.93) *** \\
\hline
IBD & 76 & 83.82(16.61) & & & 67 & 82.12(18.09) * \\
\hline
Healthy & 1033 & 87.65(16.46) & & & 664 & 86.82(15.42) \\
\hline
School functioning & & & 4,1386 & 14.12 & & & 4,960 & 26.90 \\
\hline
Asthma & 99 & 72.37(19.62) *** & & & 74 & 69.02(22.55) *** \\
\hline
Diabetes & 124 & 77.70(17.39) & & & 103 & 72.62(17.64) *** \\
\hline
Cancer & 63 & 67.38(20.36) *** & & & 58 & 63.45(21.71) *** \\
\hline
IBD & 73 & 69.52(17.28) *** & & & 66 & 70.46(20.95) *** \\
\hline
Healthy & 1032 & 78.87(15.89) & & & 664 & 81.52(16.09) \\
\hline
\end{tabular}}
\end{table}
|
PMC1079918_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Rate of PTSD symptoms on the K-SADS}} & \multicolumn{2}{|l|}{\textbf{Rate of PTSD symptoms on the CATS}} \\
\hline
\textbf{symptom} & \textbf{\%} & \textbf{symptom} & \textbf{\%} \\
\hline
\multicolumn{4}{|l|}{Comparable Symptoms} \\
\hline
Recurrent thoughts or images of events & 28 & I go over and over what happened in my mind & 40 \\
\hline
Efforts to avoid thoughts or images associated with the trauma & 28 & I try not to think about what happened & 47 \\
\hline
Insomnia & 22 & I sleep poorly & 26 \\
\hline
Irritability or outbursts of anger & 24 & I am grouch and irritable & 36 \\
\hline
Distress at reminders of event & 16 & When something reminds me of what happened I get tense and upset & 21 \\
\hline
Exaggerated startle response & 17 & I am jumpy and nervous & 29 \\
\hline
Nightmares & 16 & I have bad dreams about what happened & 9 \\
\hline
Difficulty concentrating & 19 & I have trouble keeping my mind on things & 28 \\
\hline
Efforts to avoid activities or situations that arouse recollections of the trauma & 21 & I try to stay away from things that remind me of what happened & 21 \\
\hline
\multicolumn{4}{|l|}{Non-comparable Symptoms} \\
\hline
Sense of foreshortened future & 3 & I worry that what happened will happen again & 57 \\
\hline
Feelings of detachment or estrangement & 21 & I get scared when I think about what happened & 38 \\
\hline
Inability to recall important aspects of the trauma & 10 & I have unwanted thoughts about what happened & 21 \\
\hline
Restricted affect & 28 \\
\hline
Hypervigilance & 17 \\
\hline
Physiological reactivity upon exposure to reminders & 9 \\
\hline
Dissociative episodes, illusions or hallucinations & 21 \\
\hline
Diminished interest in activities & 22 \\
\hline
Repetitive play related to event / reenactment & 2 \\
\hline
\end{tabular}}
\end{table}
|
PMC1088008_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{A.} & \multicolumn{12}{|l|}{\textbf{HPV cLIA time (weeks)}} \\
\hline
\textbf{HPV type} & \textbf{0} & \textbf{2} & \textbf{4} & \textbf{8} & \textbf{10} & \textbf{12} & \textbf{16} & \textbf{20} & \textbf{24} & \textbf{26} & \textbf{28} & \textbf{52} \\
\hline
HPV 6 & 1.1 & 3.2 & 2.4 & 4.3 & 10.0 & 12.6 & 36.3 & 10.9 & 6.3 & 22.7 & 41.9 & 4.3 \\
\hline
HPV 11 & 0.8 & 2.9 & 2.2 & 5.5 & 23.5 & 18.1 & 16.2 & 8.2 & 6.1 & 18.4 & 36.8 & 5.3 \\
\hline
HPV 16 & 1.0 & 5.2 & 8.8 & 8.4 & 21.4 & 15.7 & 16.1 & 11.4 & 17.7 & 4.8 & 12.7 & 6.4 \\
\hline
HPV 18 & 1.0 & 4.8 & 13.7 & 19.4 & 70.5 & 18.6 & 27.1 & 35.4 & 26.3 & 6.7 & 26.8 & 26.7 \\
\hline
B. & \multicolumn{12}{|l|}{HPV Total IgG antibodies time (weeks)} \\
\hline
HPV type & 0 & 2 & 4 & 8 & 10 & 12 & 16 & 20 & 24 & 26 & 28 & 52 \\
\hline
HPV 6 & 1.9 & 9.5 & 9.5 & 13.1 & 125.0 & 328.3 & 125.0 & 65.7 & 34.4 & 34.5 & 65.7 & 18.1 \\
\hline
HPV 11 & 1.9 & 13.1 & 25.0 & 25.0 & 125.0 & 90.6 & 125.0 & 47.6 & 34.5 & 34.5 & 90.6 & 18.1 \\
\hline
HPV 16 & 0.9 & 5.0 & 9.5 & 6.9 & 65.7 & 65.7 & 90.6 & 65.7 & 13.1 & 13.1 & 65.7 & 25.0 \\
\hline
HPV 18 & 0.7 & 9.5 & 13.1 & 25.0 & 125.0 & 47.6 & 65.7 & 65.7 & 25.0 & 47.6 & 125.0 & 90.6 \\
\hline
\end{tabular}}
\end{table}
|
PMC1097753_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Index} & \textbf{N} & \multicolumn{2}{|l|}{\textbf{Groups}} & \textbf{P $<$ :} \\
\hline
& & \textbf{Control (+/+)} & \textbf{Diabetes (db/db)} \\
\hline
Body Weight (g) & 5 & 21 $\pm$ 3 & 47 $\pm$ 5 & 0.001 \\
\hline
Blood Glucose (mg/dl) & 5 & 103 $\pm$ 8 & 428 $\pm$ 16 & 0.001 \\
\hline
Uterine Weight (mg) & 5 & 44 $\pm$ 3 & 13 $\pm$ 4 & 0.01 \\
\hline
Serum Triglycerides (mg/ ml) & 5 & 143 $\pm$ 8 & 312 $\pm$ 24 & 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC1097758_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Functional type} & \textbf{Fluffy tails (F$>$2)} & \textbf{No fluffy tails (F$<$2)} & \textbf{Positive rate} & \textbf{Negative rate} \\
\hline
Regulatory regions & 51 & 9 & 85 \% & 15 \% \\
\hline
Exons & 1 & 59 & 1.6 \% & 98.4 \% \\
\hline
Non-coding presumed non- regulatory & 10 & 50 & 16 \% & 84 \% \\
\hline
\end{tabular}}
\end{table}
|
PMC1127108_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Protein family} & \textbf{PDB ID} & \textbf{Correct} & \textbf{Useful info} & \textbf{Wrong} \\
\hline
\multicolumn{5}{|l|}{A. Proteins from Table 1} \\
\hline
Acetyglucosamine-6-phoshate deacyetylaseb & 1O12 & 6 & 1 & 0 \\
\hline
Alcohol dehydrogenase & 1JVB & 2 & 1 & 1 \\
\hline
CuZnSOD & 1SPD & 3 & 2 & 1 \\
\hline
Cytochrome P450 & 1N4G & 6 & 4 & 0 \\
\hline
Enolase & 2ONE & 6 & 2 & 0 \\
\hline
Glyceroladhyde-3-phosphate dehydrogenase & 1DC4 & 2 & 2 & 3 \\
\hline
Glycerol kinase & 1B05 & 7 & 1 & 0 \\
\hline
Glutamate dehydrogenase & 1HWZ & 7 & 0 & 0 \\
\hline
Inorganic pyrophosphatase & 1I6T & 3 & 2 & 0 \\
\hline
Myoglobin & 1MBA & 4 & 1 & 0 \\
\hline
Succinate dehydrogenase โ FAD & 1NEK & 4 & 1 & 2 \\
\hline
Succinate dehydrogenase โ Fe/S & 1NEK & 4 & 0 & 0 \\
\hline
Succinate dehydrogenase โ Heme & 1NEK & 5 & 0 & 0 \\
\hline
TATA box binding protein & 1TBP & n/ac \\
\hline
Triosephosphate isomerase & 7TIM & 3 & 4 & 1 \\
\hline
\multicolumn{5}{|l|}{B. Additional examples} \\
\hline
Acetate kinase & 1G99 & 4 & 4 & 0 \\
\hline
Aconitase A & 7ACN & 8 & 3 & 5 \\
\hline
Alanine racemase & 1L6F & 4 & 1 & 1 \\
\hline
Arginyl-tRNA synthetase & 1F7U & 2 & 2 & 1 \\
\hline
Biotin carboxylaseb & 1DV2 & 3 & 3 & 2 \\
\hline
Catalase & 1GGF & 9 & 0 & 0 \\
\hline
Citrate synthase & 1NXG & 8 & 1 & 0 \\
\hline
Isocitrate dehydrogenases & 1IA2 & 3 & 0 & 0 \\
\hline
Malate/lactate dehydrogenases & 1EMD & 6 & 1 & 0 \\
\hline
Malate synthase & 1P7T & 6 & 0 & 0 \\
\hline
Phosphomannomutase & 1P5D & 5 & 2 & 0 \\
\hline
Selenocysteine lyase & 1ECX & 5 & 2 & 1 \\
\hline
Threonine aldolase & 1LW5 & 6 & 2 & 0 \\
\hline
Thymidylate synthase & 1AIQ & 4 & 0 & 1 \\
\hline
Transaldolase & 1ONR & 1 & 1 & 1 \\
\hline
Trehalose-6-phosphate synthase & 1UQU & 5 & 3 & 3 \\
\hline
\end{tabular}}
\end{table}
|
PMC1142304_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Characteristic} & \multicolumn{6}{|l|}{\textbf{Genotype [n (\%)]}} \\
\hline
& \textbf{CYP2D6*1/*1} & \textbf{CYP2D6*1/*4} & \textbf{CYP2D6*4/*4} & \textbf{SULT1A1*1/*1} & \textbf{SULT1A1*1/*2} & \textbf{SULT1A1*2/*2} \\
\hline
\multicolumn{7}{|l|}{Nodal involvementa, tumour size} \\
\hline
Node-, $>$30 mm & 19 (76.0) & 5 (20.0) & 1 (4.0) & 6 (24.0) & 11 (44.0) & 8 (32.0) \\
\hline
$\leq$ Node+, 20 mm & 66 (74.2) & 18 (20.2) & 5 (5.6) & 30 (33.7) & 49 (55.1) & 10 (11.2) \\
\hline
Node+, $>$20 mm & 77 (68.8) & 32 (28.6) & 3 (2.7) & 43 (38.4) & 59 (52.7) & 10 (8.9) \\
\hline
\multicolumn{7}{|l|}{Receptor statusb} \\
\hline
ER-negative & 50 (74.6) & 12 (17.9) & 5 (7.5) & 23 (34.3) & 35 (52.2) & 9 (13.4) \\
\hline
ER-positive & 109 (69.9) & 43 (27.6) & 4 (2.6) & 56 (35.9) & 82 (52.6) & 18 (11.5) \\
\hline
\multicolumn{7}{|l|}{Endocrine therapy} \\
\hline
Tamoxifen & 77 (68.8) & 28 (25.0) & 7 (6.3) & 37 (33.0) & 60 (53.6) & 15 (13.4) \\
\hline
No tamoxifen & 85 (74.6) & 27 (23.7) & 2 (1.8) & 42 (36.8) & 59 (51.8) & 13 (11.4) \\
\hline
\end{tabular}}
\end{table}
|
PMC1143572_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Env โ gp41} & \textbf{573} & \textbf{631} & \textbf{676} & \textbf{713} & \textbf{734} & \textbf{737} & \textbf{741} & \textbf{751} & \textbf{752} & \textbf{760} & \textbf{764} & \textbf{767} & \textbf{785} & \textbf{802} & \textbf{821} & \textbf{850} & \textbf{855} \\
\hline
SIVmac239 & K & K & D & M & Q & I & P & R & D & S & W & E & S & L & T & G & T \\
\hline
SIVmac316 & T & K & D & V & Q & I & P & G & D & S & W & Stop & - & - & - & - & - \\
\hline
SIV17E-Cl & K & K & N & V & Q & * & * & * & * & * & * & * & * & * & * & * & * \\
\hline
SIV17E/Fr & K & K & D & M & Q & I & P & G & D & S & Stop & - & - & - & - & - & - \\
\hline
SIVmac251 & K & N & D & M & Q & I & P & G & D & S & W & E & S & L & T & G & T \\
\hline
SIVmac32H & K & D & D & M & Q & I & P & G & D & S & W & E & S & L & T & G & T \\
\hline
SIVmac1A11 & K & K & D & M & Stop & - & - & - & - & - & - & - & - & - & - & - & - \\
\hline
Clone 129 & K & D & D & M & Q & T & Q & G & D & R & W & E & N & F & A & R & T \\
\hline
Clone 169 & K & D & D & M & Q & T & Q & G & G & R & W & E & N & F & A & R & A \\
\hline
\end{tabular}}
\end{table}
|
PMC1145188_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Finding} & \textbf{BASDAI} & \textbf{BASMI} & \textbf{BASFI} & \textbf{PatGA} & \textbf{PhysGA} & \textbf{NRS-P} & \textbf{ESR (mm/h)} & \textbf{CRP (mg/l)} \\
\hline
\multicolumn{9}{|l|}{At time point 1a} \\
\hline
Mean $\pm$ SD & 2.5 $\pm$ 1.8** & 2.7 $\pm$ 2.0* & 2.9 $\pm$ 2.4** & 2.6 $\pm$ 1.5** & 2.6 $\pm$ 2.1** & 2.6 $\pm$ 2.1** & 10.5 $\pm$ 7.3** & 3.1 $\pm$ 4.2** \\
\hline
Median & 2.4 & 2.0 & 2.5 & 4.0 & 2.0 & 2.0 & 8.0 & 1.1 \\
\hline
Range & 0.0 - 6.8 & 0.0 - 7.0 & 0.0 - 8.3 & 0.0 - 8.0 & 0.0 - 4.0 & 0.0 - 7.0 & 2.0 - 32.0 & 0.0 - 19.0 \\
\hline
\multicolumn{9}{|l|}{At time point 2a} \\
\hline
Mean $\pm$ SD & 6.1 $\pm$ 1.4** & 3.2 $\pm$ 2.2* & 5.8 $\pm$ 1.8** & 6.9 $\pm$ 2.1** & 7.0 $\pm$ 1.5** & 7.1 $\pm$ 1.7** & 31.5 $\pm$ 29.7** & 20.7 $\pm$ 23.7** \\
\hline
Median & 6.2 & 3.0 & 5.7 & 7.0 & 7.0 & 7.0 & 23.0 & 14.0 \\
\hline
Range & 4.0 - 9.2 & 0.0 - 9.0 & 1.2 - 9.1 & 4.0 - 10.0 & 4.0 - 10.0 & 0.0 - 10.0 & 4.0 - 150.0 & 0.3 - 126.0 \\
\hline
\multicolumn{9}{|l|}{Change between time points 1 and 2} \\
\hline
Mean $\pm$ SD & 3.6 $\pm$ 1.7 & 0.5 $\pm$ 1.5 & 2.9 $\pm$ 2.0 & 4.3 $\pm$ 1.9 & 4.4 $\pm$ 1.8 & 4.5 $\pm$ 2.2 & 21.0 $\pm$ 29.7 & 17.6 $\pm$ 23.4 \\
\hline
Median & 3.6 & 0.5 & 2.5 & 4.0 & 4.0 & 4.0 & 12.0 & 11.5 \\
\hline
Range & -1.2 - 6.7 & -4.0 - 3.0 & -0.5 - 7.8 & -2.0 - 8.0 & -2.0 - 8.0 & -1.0 - 8.0 & -6.0 - 146.0 & -6.3 - 123.0 \\
\hline
\end{tabular}}
\end{table}
|
PMC1174938_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Proliferation marker} & \textbf{rs} & \textbf{P} \\
\hline
Thymidylate synthase & 0.38 & $<$0.001 \\
\hline
Thymidine kinase 1 & 0.23 & $<$0.01 \\
\hline
Survivin & 0.22 & $<$0.01 \\
\hline
E2F & 0.22 & $<$0.01 \\
\hline
II$\alpha$ Topoisomerase & 0.19 & $<$0.05 \\
\hline
\end{tabular}}
\end{table}
|
PMC1175052_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Patient characteristics} & \multicolumn{6}{|l|}{\textbf{CYP17 genotype}} \\
\hline
& \multicolumn{2}{|l|}{\textbf{A1/A1 (n = 503)}} & \multicolumn{2}{|l|}{\textbf{A1/A2 (n = 668)}} & \multicolumn{2}{|l|}{\textbf{A2/A2 (n = 260)}} \\
\hline
& \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} & \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} & \textbf{Cases, no. (\%)} & \textbf{Controls no. (\%)} \\
\hline
\multicolumn{7}{|l|}{Age at menarche (years)a} \\
\hline
$<$13 & 68 (37.8) & 123 (38.2) & 84 (34.4) & 149 (35.1) & 34 (33.0) & 51 (32.5) \\
\hline
$\geq$13 & 112 (62.2) & 199 (61.6) & 158 (64.8) & 275 (64.9) & 68 (66.0) & 106 (67.5) \\
\hline
\multicolumn{7}{|l|}{Age at first full-term pregnancy (years)b} \\
\hline
$<$25 & 69 (49.6) & 125 (49.4) & 106 (56.1) & 172 (52.1) & 40 (53.3) & 55 (45.1) \\
\hline
$\geq$25 & 70 (50.4)) & 128(50.6) & 83 (43.9) & 158 (47.9) & 35 (46.7) & 67 (54.9) \\
\hline
\multicolumn{7}{|l|}{Parity} \\
\hline
0 birth & 41 (22.8) & 70 (21.7) & 55 (22.5) & 94 (22.2) & 28 (27.2) & 35 (22.3) \\
\hline
1โ2 births & 123 (68.3) & 201 (62.2) & 168 (68.9) & 260 (61.3) & 63 (61.2) & 96 (61.1) \\
\hline
$>$2 births & 16 (8.9) & 52 (16.1) & 21 (8.6) & 70 (16.5) & 12 (11.6) & 26 (16.6) \\
\hline
\multicolumn{7}{|l|}{Total months of breastfeedingb} \\
\hline
0 & 43 (30.9) & 65 (25.7) & 53 (28.0) & 94 (28.5) & 20 (26.7) & 28 (22.9) \\
\hline
1โ12 & 86 (61.9) & 156 (61.7) & 117 (61.9) & 186 (56.4) & 50 (66.8) & 74 (60.7) \\
\hline
$>$12 & 10 (7.2) & 32 (12.6) & 19 (10.1) & 50 (15.2) & 5 (6.7) & 20 (16.4) \\
\hline
\multicolumn{7}{|l|}{Ever use oral contraceptivec} \\
\hline
No & 30 (17.1) & 62 (19.4) & 31 (13.0) & 84 (20.0)* & 24 (23.3) & 32 (20.5) \\
\hline
Yes & 146 (82.9) & 258 (80.6) & 207 (87.0) & 336 (80.0) & 79 (76.7) & 124 (79.5) \\
\hline
\multicolumn{7}{|l|}{Family history of breast cancer in first-degree relative} \\
\hline
No & 150 (83.3) & 306 (94.7)* & 217 (88.9) & 407 (96.0) & 95 (92.2) & 143 (91.1) \\
\hline
Yes & 30 (16.7) & 17 (5.3) & 27 (11.1) & 17 (4.0) & 8 (7.8) & 14 (8.9) \\
\hline
\multicolumn{7}{|l|}{Current BMI (k/m2)d} \\
\hline
$<$20.0 & 26 (14.4) & 35 (10.8) & 39 (16.0) & 47 (11.1) & 10 (9.7) & 25 (15.9) \\
\hline
20.0โ25.0 & 95 (52.8) & 191 (59.1) & 130 (53.3) & 245 (57.8) & 64 (62.1)) & 87 (55.4) \\
\hline
25.1โ30.0 & 38 (21.1) & 71 (22.0) & 51 (20.9) & 95 (22.4) & 20 (19.4) & 30 (19.1) \\
\hline
$>$30.0 & 20 (11.1) & 25 (7.7) & 24 (9.8) & 37 (8.7) & 9 (8.7) & 15 (9.6) \\
\hline
\multicolumn{7}{|l|}{Educational level} \\
\hline
Low & 24 (13.4) & 39 (12.1) & 31 (12.7) & 50 (11.8) & 16 (15.5) & 17 (10.8) \\
\hline
Middle & 114 (63.3) & 200 (61.9) & 159 (65.2) & 262 (61.8) & 63 (61.2) & 87 (55.4) \\
\hline
High & 42 (23.3) & 84 (26.0) & 54 (22.1) & 112 (26.4) & 24 (23.3) & 53 (33.8) \\
\hline
\multicolumn{7}{|l|}{Alcohol consumption (g/day)} \\
\hline
0 & 39 (21.7) & 52 (16.1)* & 52 (21.3) & 72 (17.0) & 18 (17.5) & 24 (15.3) \\
\hline
1โ18 & 118 (65.5) & 246 (76.2) & 158 (64.8) & 309 (72.9) & 70 (68.0) & 119 (75.8) \\
\hline
$>$18 & 23 (12.8) & 25 (7.7) & 34 (13.9) & 43 (10.1) & 15 (14.5) & 14 (8.8) \\
\hline
\end{tabular}}
\end{table}
|
PMC1175058_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{EM operation} & \textbf{Definition} \\
\hline
Overlap (x y) โ & x and y overlap if they have a part in common. \\
\hline
ฮน Disjoint (x y) & x and y are disjoint if they share no parts in common. \\
\hline
Binary product (x . y) & The parts that x and y share in common. \\
\hline
Difference (x - y) & The largest portion of x which has no part in common with y. \\
\hline
Binary sum (x + y) & The set consisting of individuals x and y. \\
\hline
\end{tabular}}
\end{table}
|
PMC1175956_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Group 1 n = 19} & \textbf{Group 2 n = 19} & \textbf{Group 3 n = 18} & \textbf{One-way ANOVA, F-Value} & \textbf{P value} \\
\hline
Age & 69.6 $\pm$ 9.2 & 65.8 $\pm$ 7.8 & 70.8 $\pm$ 9.9 & 1.58 & NS \\
\hline
ACD & 2.6 $\pm$ 0.20 & 2.8 $\pm$ 0.37 & 2.59 $\pm$ 0.45 & 1.97 & NS \\
\hline
\multicolumn{6}{|l|}{UCVA} \\
\hline
Pre-operative & 0.12 $\pm$ 0.14 & 0.09 $\pm$ 0.13 & 0.11 $\pm$ 0.9 & 0.18 & NS \\
\hline
Day one & 0.28 $\pm$ 19a & 0.39 $\pm$ 23c & 0.37 + 0.27b & 1.22 & NS \\
\hline
Three month & 0.51 $\pm$ 0.16c & 0.61 $\pm$ 0.20c & 0.61 $\pm$ 0.20c & 1.51 & NS \\
\hline
Repeated measure within group ANOVA & F = 15.0 P = 0.0001 & F = 28.29 P = 0.0001 & F = 23.5 P = 0.0001 \\
\hline
\multicolumn{6}{|l|}{BCVA} \\
\hline
Pre-operative & 0.18 $\pm$ 0.11 & 0.17 $\pm$ 0.19 & 0.18 $\pm$ 0.13 & 0.04 & NS \\
\hline
Day one & 0.46 $\pm$ 0.23b & 0.69 $\pm$ 0.26c & 0.55 $\pm$ 0.31a & 1.70 & NS \\
\hline
Three month & 0.69 $\pm$ 0.24c & 0.88 $\pm$ 0.18c & 0.79 $\pm$ 0.23c & 2.73 & NS \\
\hline
Repeated measure within group ANOVA & F = 34.17 P = 0.0001 & F = 43.8 P = 0.0001 & F = 23.5 P = 0.0001 \\
\hline
\multicolumn{6}{|l|}{Corneal thickness} \\
\hline
Pre-operative & 560.7 $\pm$ 91.5 & 567.5 $\pm$ 44.07 & 576.0 $\pm$ 50.2 & 0.25 & NS \\
\hline
Day one & 645.8 $\pm$ 94.1c & 665.5 $\pm$ 141.9b & 670.6 $\pm$ 117.1b & 0.32 & NS \\
\hline
Three month & 573.4 $\pm$ 73.6 & 586.1 $\pm$ 29.0 & 586.7 $\pm$ 36.0 & 1.50 & NS \\
\hline
Repeated measure within group ANOVA & F = 17.5 P = 0.0001 & F = 11.4 P = 0.0001 & F = 11.19 P = 0.0001 \\
\hline
\multicolumn{6}{|l|}{Endothelial cell count.} \\
\hline
Pre-operative & 2311.73 $\pm$ 288.0 & 2359.78 $\pm$ 383.2 & 2526.6 $\pm$ 305.4 & 2.36 & NS \\
\hline
Day one & 2021.20 $\pm$ 201.0 & 2035.05 $\pm$ 377.0 & 2196.4 $\pm$ 378.2 & 0.11 & NS \\
\hline
Three month & 1973.00 $\pm$ 537.0 & 1959.00 $\pm$ 503.0 & 2132.0 $\pm$ 482.0 & 0.82 & NS \\
\hline
Repeated measure within group ANOVA & F = 4.2 P = 0.004 & F = 2.20 P = NS & F = 17.5 P = 0.0001 \\
\hline
\end{tabular}}
\end{table}
|
PMC1180454_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Type II cells + C. pneumoniae} & \textbf{Macrophages + C. pneumoniae} & \textbf{Type II cells โ 10\% macrophages} \\
\hline
0 min & 160 $\pm$ 21 & 231 $\pm$ 22 & 137 \\
\hline
30 min & 210 $\pm$ 93 & 439 $\pm$ 49 & 166 \\
\hline
1 hour & 509 $\pm$ 76 & 1390 $\pm$ 329 & 370 \\
\hline
2 hours & 2405 $\pm$ 486 & 2715 $\pm$ 587 & 2134 \\
\hline
3 hours & 3367 $\pm$ 262 & 3600 $\pm$ 106 & 3007 \\
\hline
6 hours & 5274 $\pm$ 1095 & 11255 $\pm$ 2498 & 4149 \\
\hline
12 hours & 16179* $\pm$ 4577 & 24511ยง $\pm$ 5161 & 13728 \\
\hline
\end{tabular}}
\end{table}
|
PMC1180473_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Low A}} & \multicolumn{3}{|l|}{\textbf{Low B}} \\
\hline
& \textbf{Observed} & \textbf{RR} & \textbf{p-value} & \textbf{Observed} & \textbf{RR} & \textbf{p-value} \\
\hline
Not Adjusted & 440 & 0.81 & 0.004 & * & * & * \\
\hline
Adjusted for Urban/Rural Status & 440 & 0.81 & 0.002 & * & * & * \\
\hline
Adjusted for SES & * & * & * & 94 & 0.63 & 0.009 \\
\hline
Adjusted for SES \& Urban/Rural Status & * & * & * & 94 & 0.635 & 0.016 \\
\hline
\end{tabular}}
\end{table}
|
PMC1180846_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Patient Number} & \textbf{Refracted Va two months post surgery} & \textbf{Last Va} & \textbf{Macula clinically dry at two weeks} & \textbf{Macula clinically dry at last FU} \\
\hline
A & 1 & 6/9 & 6/18 & Yes & Yes \\
\hline
& & 6/9 & 6/12 & Yes & Yes \\
\hline
A & 2 & 6/12 & 6/12 & Yes & Yes \\
\hline
& & 6/36 & 6/36 & No & No \\
\hline
A & 3 & 6/18 & 6/18 & Yes & Yes \\
\hline
A & 4 & 6/9 & 6/12 & Yes & No \\
\hline
& & CF & CF & No & No \\
\hline
A & 5 & 6/60 & 6/60 & No & No \\
\hline
A & 6 & 6/36 & 6/36 & Yes & No \\
\hline
& & 6/24 & 6/36 & Yes & No \\
\hline
A & 7 & 6/6 & 6/6 & Yes & Yes \\
\hline
A & 8 & 6/9 & 6/9 & Yes & Yes \\
\hline
& & 6/9 & 6/12 & Yes & Yes \\
\hline
A & 9 & 6/24 & 6/24 & Yes & No \\
\hline
A & 10 & 6/18 & 6/18 & Yes & Yes \\
\hline
B & 10 & 6/18 & 6/18 & Yes & No \\
\hline
B & 11 & 6/12 & 6/12 & Yes & Yes \\
\hline
B & 12 & 6/6 & 6/6 & Yes & Yes \\
\hline
\end{tabular}}
\end{table}
|
PMC1183218_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Patient Number} & \textbf{Follow up (months)} & \textbf{Raised IOP} & \textbf{Stepwise deterioration in retinopathy grade at last FU (ETDRS)} \\
\hline
A & 1 & 15 & & 3 \\
\hline
& & 14 & & 1 \\
\hline
A & 2 & 6 & & 0 \\
\hline
& & 8 & Yes: 34 mmHg & 0 \\
\hline
A & 3 & 9 & & 0 \\
\hline
A & 4 & 10 & & 0 \\
\hline
& & 12 & Yes: 29 mm Hg & 1 \\
\hline
A & 5 & 11 & Yes: 31 mm Hg & 0 \\
\hline
A & 6 & 10 & & 1 \\
\hline
& & 7 & & 0 \\
\hline
A & 7 & 12 & & 0 \\
\hline
A & 8 & 5 & Yes: 24 mmHg & 1 \\
\hline
& & 5 & & 0 \\
\hline
A & 9 & 7 & & 1 \\
\hline
A & 10 & 6 & & 0 \\
\hline
B & 10 & 4 & & 0 \\
\hline
B & 11 & 8 & & 0 \\
\hline
B & 12 & 4 & & 0 \\
\hline
& & Mean FU = 8.5 \\
\hline
\end{tabular}}
\end{table}
|
PMC1183218_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Study} & \textbf{Year} & \textbf{Country} & \textbf{Type of cardiac surgery} & \textbf{Interventions} \\
\hline
Isetta et al. [25] & 1993 & France & NR & HD APR (n = 70) vs. LD APR (n = 70) vs. TXA (n = 70) vs. Control (n = 70) \\
\hline
Blauhut et al. [27] & 1994 & Switzerland & CABG & HD APR (n = 14) vs. TXA (n = 14) vs. Control (n = 14) \\
\hline
Penta de Peppo et al. [20] & 1995 & Italy & CABG \& Valve Sx. & HD APR (n = 15) vs. TXA (n = 15) vs. EACA (n = 15) vs. Control (n = 15) \\
\hline
Corbeau et al. [23] & 1995 & France & CABG \& Valve Sx. & HD APR (n = 43) vs. TXA (n = 41) vs. Control (n = 20) \\
\hline
Pugh et al. [22] & 1995 & UK & Primary CABG & LD APR (n = 21) vs. TXA (n = 22) vs. Control (n = 23) \\
\hline
Speekenbrink et al. [21] & 1995 & The Netherlands & Primary CABG & PP APR (n = 15) vs. TXA (n = 15) vs. DIP (n = 12) vs. Control (n = 15) \\
\hline
Menichetti et al. [24] & 1996 & Italy & Primary CABG & HD APR (n = 24) vs. TXA (n = 24) vs. EACA (n = 24) vs. Control (n = 24) \\
\hline
Pinosky et al. [33] & 1997 & USA & Primary CABG & TXA (n = 20) vs. EACA (n = 20) vs. Placebo (n = 19) \\
\hline
Mongan et al. [31] & 1998 & USA & Primary CABG & HD APR (n = 75) vs. TXA (n = 75) \\
\hline
Hardy et al. [26] & 1998 & Canada & Primary CABG & TXA (n = 42) vs. EACA (n = 46) vs. Placebo (n = 44) \\
\hline
Eberle et al. [29] & 1998 & Germany & Primary CABG & HD APR (n = 20) vs. EACA (n = 20) \\
\hline
Misfeld et al. [30] & 1998 & Germany & Primary CABG & LD APR (n = 14) vs. TXA (n = 14) vs. Control (n = 14) \\
\hline
Casati et al. [28] & 1999 & Italy & Primary CABG \& Valve Sx. & HD APR (n = 67) vs. TXA (n = 70) vs. EACA (n = 66) \\
\hline
Bernet et al. [34] & 1999 & Switzerland & Primary CABG & HD APR (n = 28) vs. TXA (n = 28) \\
\hline
Nuttall et al. [32] & 2000 & USA & Re-do CABG \& Valve Sx. & HD APR (n = 40) vs. TXA (n = 45) vs. TXA+ANH (n = 32) vs Placebo (n = 43) \\
\hline
Maineri et al. [38] & 2000 & Italy & Primary CABG & TXA (n = 24) vs. EACA (n = 24) \\
\hline
Wong et al. [37] & 2000 & Canada & Re-do CABG \& Valve Sx. & HD APR (n = 39) vs. TXA (n = 38) \\
\hline
Casati et al. [35] & 2000 & Italy & Primary CABG \& Valve \& ASD Repair & HD APR (n = 518) vs. TXA (n = 522) \\
\hline
Greilich et al. [36] & 2001 & USA & Primary CABG & HD APR (n = 24) vs. EACA (n = 23) vs. Placebo (n = 25) \\
\hline
Ray et al. [6] & 2001 & Australia & CABG \& Valve Sx. & LD APR (n = 49) vs. EACA (n = 51) \\
\hline
\end{tabular}}
\end{table}
|
PMC1185524_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{Developmental outcome (Odds ratio and 95\% confidence interval) PARENT COMPLETED}} \\
\hline
\\
\hline
& \textbf{Motor} & \textbf{Speech \& language} & \textbf{Behaviour} & \textbf{Cognition} \\
\hline
All centres (N = 705) & 1.30 (0.75, 2.25)2 & 1.10 (0.60, 2.02) 3,4 & 1.05 (0.66, 1.67) 2 & 0.85 (0.35, 2.09) \\
\hline
\multicolumn{5}{|l|}{Sensitivity analyses} \\
\hline
a) France only (N = 379)1 & 1.22 (0.61, 2.42)2 & 0.98 (0.45,2.14) & 1.15 (0.64, 2.09) & 0.55 (0.17, 1.76)2 \\
\hline
b) Poland only (N = 134) & 1.10 (0.30, 4.06) & 0.54 (0.13, 2.26) & 0.94 (0.30, 2.92) & 1.02 (0.16, 6.62) \\
\hline
c) Children aged 36 to $<$41 months (N = 553) & 1.18 (0.68, 2.05) & 1.04 (0.54, 2.00) & 1.25 (0.70, 2.22) & 0.61 (0.25, 1.50) \\
\hline
d) Children with no signs before 4 months (N = 538 Poland excluded) & 1.08 (0.57, 2.07) & 1.10 (0.51, 2.36) & 1.02 (0.57, 1.82)2 & 0.35 (0.10, 1.24) \\
\hline
& \multicolumn{4}{|l|}{CHILD COMPLETED} \\
\hline
& \multicolumn{2}{|l|}{'Draw a Man'} & \multicolumn{2}{|l|}{Line, circle, cross} \\
\hline
All centres (N = 705) & \multicolumn{2}{|l|}{1.27 (0.66, 2.44)5} & \multicolumn{2}{|l|}{1.13 (0.56, 2.25)} \\
\hline
\multicolumn{5}{|l|}{Sensitivity analyses} \\
\hline
a) France only (N = 379)1 & \multicolumn{2}{|l|}{0.77 (0.35, 1.67)} & \multicolumn{2}{|l|}{0.93 (0.40, 2.18)} \\
\hline
b) Poland only (N = 134) & \multicolumn{2}{|l|}{1.00 (0.17, 5.77)} & \multicolumn{2}{|l|}{0.76 (0.13, 4.41)} \\
\hline
c) Children aged 36 to $<$41 months (N = 553) & \multicolumn{2}{|l|}{0.79 (0.39, 1.63)5} & \multicolumn{2}{|l|}{0.96 (0.48, 1.95)} \\
\hline
d) Children with no signs before 4 months (N = 538 Poland excluded) & \multicolumn{2}{|l|}{0.96 (0.46, 2.02)} & \multicolumn{2}{|l|}{1.03 (0.45, 2.36)} \\
\hline
\end{tabular}}
\end{table}
|
PMC1199601_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Variable} & \textbf{Definition} \\
\hline
\multicolumn{2}{|l|}{Dependent Variable} \\
\hline
Expenditures & Continuous variable: total household annual out-of-pocket medical expenditures \\
\hline
\multicolumn{2}{|l|}{Independent Variable} \\
\hline
Demographic variables & (Economic Household Head, EHH) \\
\hline
Married & Dummy variable = 1 if EHH is currently married, otherwise = 0 including never married, widowed, separated and divorced. \\
\hline
Male & Dummy variable = 1 if EHH is male. \\
\hline
Employed & Dummy variable = 1 if EHH is employed. \\
\hline
\multicolumn{2}{|l|}{Age} \\
\hline
25โ44 & Dummy variable = 1 if EHH's age in this range. \\
\hline
45โ64 & Dummy variable = 1 if EHH's age in this range. \\
\hline
65 and above & Dummy variable = 1 if EHH's age in this range. (EHH's age under 25 is the default variable.) \\
\hline
\multicolumn{2}{|l|}{Education} \\
\hline
Junior high & Dummy variable = 1 if EHH finished Junior high school. \\
\hline
Senior (vocational) high & Dummy variable = 1 if EHH finished senior (or vocational) high school. \\
\hline
Junior college & Dummy variable = 1 if EHH finished Junior college. \\
\hline
College and above & Dummy variable = 1 if EHH finished college and above. (Primary school and below is the default variable.) \\
\hline
Family members & $\geq$ Dummy variable = 1 if the number of household members 4. \\
\hline
NHI & Dummy variable = 1 if EHH is from the post-national health insurance cohort. \\
\hline
\multicolumn{2}{|l|}{Household income} \\
\hline
Lower 20\%~2nd quintile & Dummy variable = 1 if family income is lower 20\%. \\
\hline
Middle 20\%~3rd quintile & Dummy variable = 1 if family income is middle 20\%. \\
\hline
Higher 20\%~4th quintile & Dummy variable = 1 if family income is higher 20\%. \\
\hline
Highest 20\%~5th quintile & Dummy variable = 1 if family income is highest 20\%. (Lowest 20\%~1st quintile is the default variable) \\
\hline
\multicolumn{2}{|l|}{Regional variables} \\
\hline
Center & Dummy variable = 1 if the household is located in: Taichung Hsien, Changhwa Hsien, Nantou Hsien, Yunlin Hsien, Taichung City. \\
\hline
South & Dummy variable = 1 if the household is located in: Chiayi Hsien, Tainan Hsien, Kaohsiung Hsien, Pingtung Hsien, Kaohsiung Municipality, Chiayi City, Tainan City. \\
\hline
East & Dummy variable = 1 if the household is located in: Taitung Hsien, Hwalien Hsien, Penghu Hsien. \\
\hline
North & Dummy variable = 1 if the household is located in: Taipei Hsien, Keelung City, Ilan Hsien, Taoyuan Hsien, Hsinchu Hsien, Miaoli Hsien, and Taipei Municipality. (North is the default variable) \\
\hline
\end{tabular}}
\end{table}
|
PMC1208885_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{SF-12 Mental Health Component} & \textbf{SF-12 Physical Health Component} & \textbf{SF-12 General Health Perception} \\
\hline
Age & NS & NS & NS \\
\hline
Body Mass Index & r = -0.213 p = 0.021* & r = -0.262 p = 0.004* & r = -0.272 p = 0.003* \\
\hline
Fear of falling (VAS) & NS & r = -0.248 p = 0.007* & r = -0.223 p = 0.016* \\
\hline
Balance (BBS) & NS & r = 0.381 p = 0.000* & r = 0.270 p = 0.003* \\
\hline
Functional mobility (TUG) & NS & r = -0.354 p = 0.000* & r = -0.249 p = 0.007* \\
\hline
Proprioception (Joint position sense) & NS & NS & NS \\
\hline
Muscle strength (Back/leg dynamometer) & NS & r = 0.338 p = 0.000* & r = 0.230 p = 0.016* \\
\hline
Flexibility (Sit and reach test) & NS & NS & NS \\
\hline
\end{tabular}}
\end{table}
|
PMC1208910_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Age} & \textbf{Sample Size} & \textbf{Mean} & \textbf{S.E.} & \textbf{Ratio Index} \\
\hline
19โ30 years & 5 & 78980 & 15580 & 5.1 \\
\hline
31โ35 years & 13 & 25300 & 4860 & 2.1 \\
\hline
36โ40 years & 14 & 21450 & 2650 & 4.7 \\
\hline
41โ45 years & 32 & 7320 & 1450 & 0.8 \\
\hline
$>$45 years & 36 & 1880 & 310 & 1.0 \\
\hline
\end{tabular}}
\end{table}
|
PMC1215522_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Source} & \multicolumn{2}{|l|}{\textbf{dChip}} & \multicolumn{2}{|l|}{\textbf{MAS 5.0}} & \multicolumn{2}{|l|}{\textbf{RMA}} & \multicolumn{2}{|l|}{\textbf{GCRMA-EB}} \\
\hline
& \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} & \textbf{Mean} & \textbf{SD} \\
\hline
Biological variation & 0.431 & 0.304 & 0.292 & 0.300 & 0.393 & 0.306 & 0.310 & 0.292 \\
\hline
Labeling variation & 0.206 & 0.230 & 0.136 & 0.198 & 0.221 & 0.224 & 0.147 & 0.192 \\
\hline
Residual error & 0.363 & 0.274 & 0.572 & 0.311 & 0.386 & 0.272 & 0.543 & 0.298 \\
\hline
\end{tabular}}
\end{table}
|
PMC1232851_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{SAMPLES} & \textbf{RT-PCR} & \textbf{P503S} & \textbf{P504S} & \textbf{P510S} \\
\hline
PB & & No (\%) & No (\%) & No (\%) \\
\hline
\multicolumn{5}{|l|}{group 1} \\
\hline
AA and RP (n = 11) & positive & 7 (63.63) & 7 (63.63) & 11 (100) \\
\hline
& negative & 4(36.36) & 4(36.36) & 0 \\
\hline
\multicolumn{5}{|l|}{group 2} \\
\hline
Pca in prostate biopsy (n = 11) & positive & 2 (18.18) & 9 (81.81) & 11 (100) \\
\hline
& negative & 9 (81.81) & 2 (18.18) & 0 \\
\hline
\multicolumn{5}{|l|}{group 3} \\
\hline
BPH in prostate biopsy (n = 20) & positive & 5 (25) & 11 (55) & 15 (75) \\
\hline
& negative & 15 (75) & 9 (45) & 5 (25) \\
\hline
\multicolumn{5}{|l|}{Frozen tissues} \\
\hline
Neoplastic and non neoplastic & positive & 4 (66.66) & 4 (66.66) & 5 (83.83) \\
\hline
prostate tissues (n = 6) & negative & 2 (33.33) & 2 (33.33) & 1 (16.16) \\
\hline
Non prostatic tissues (n = 6) & positive & 6 (100) & 1(16.66) & 2 (33,33) \\
\hline
& negative & 0 & 5 (83.33) & 4 (66.66) \\
\hline
\multicolumn{5}{|l|}{Cell lines (n = 6)} \\
\hline
prostatic (n = 2) & positive & 2 (100) & 2 (100) & 2 (100) \\
\hline
& negative & 0 & 0 & 0 \\
\hline
non prostatic (n = 4) & positive & 4 (100) & 2 (50) & 2 (50) \\
\hline
& negative & 0 & 2 (50) & 2 (50) \\
\hline
\end{tabular}}
\end{table}
|
PMC1236915_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Animals (n)} & \textbf{Total Cells ($\times$ 104/total BAL)} & \textbf{Macrophages ($\times$ 104/ total BAL)} & \textbf{Eosinophils ($\times$ 104/ total BAL)} & \textbf{Neutrophils ($\times$ 104/ total BAL)} & \textbf{Mononuclear Cells ($\times$ 104/total BAL)} \\
\hline
vehicle & 16 & 36.88 $\pm$ 3.56 & 36.74 $\pm$ 3.53 & 0 $\pm$ 0 & 0.12 $\pm$ 0.05 & 0.015 $\pm$ 0.01 \\
\hline
14 nm & 13 & 111.69 $\pm$ 9.27** & 83.79 $\pm$ 6.03** & 0.332 $\pm$ 0.176 & 27.04 $\pm$ 4.98** & 0.491 $\pm$ 0.201* \\
\hline
56 nm & 14 & 97.36 $\pm$ 16.06** & 88.64 $\pm$ 15.34** & 0.331 $\pm$ 0.177 & 8.09 $\pm$ 2.49* & 0.265 $\pm$ 0.093 \\
\hline
OVA & 16 & 85.06 $\pm$ 12.63** & 81.91 $\pm$ 12.4** & 0.705 $\pm$ 0.255 & 2.2 $\pm$ 0.62 & 0.121 $\pm$ 0.059 \\
\hline
OVA + 14 nm & 16 & 193.69 $\pm$ 18.33** \#\# \$\$ & 141.86 $\pm$ 14.97** \#\# \$ & 13.667 $\pm$ 4.731** \#\# \$ & 36.9 $\pm$ 3.67** \#\# \$ & 0.878 $\pm$ 0.232** \# \\
\hline
OVA + 56 nm & 17 & 102.65 $\pm$ 11.64** & 90.7 $\pm$ 10.12** & 3.984 $\pm$ 2.669 & 7.79 $\pm$ 2.29* & 0.204 $\pm$ 0.073 \\
\hline
\end{tabular}}
\end{table}
|
PMC1242256_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Description} & \textbf{Value} \\
\hline
C\% & Pattern conservation & 95\% (dog) 90\% (rat) \\
\hline
L & Maximum pattern length & 25 amino acids \\
\hline
S & Research complexity & High (E = 0; dog) Medium (E = 1; rat) \\
\hline
PN & Maximum number of pattern symbols & 25 \\
\hline
PX & Maximum number of consecutive undetermined amino acids & 5 \\
\hline
FN & Maximum number of flexible gaps & 2 \\
\hline
FL & Maximum flexibility of a flexible wildcard & 3 \\
\hline
FP & Maximum flexibility product & 10 \\
\hline
\end{tabular}}
\end{table}
|
PMC1257466_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{$\rightarrow$ Forward \& reverse primers 5' 3'} & \textbf{[C] a} & \textbf{Amplicon size (bp)} & \textbf{Tm b (ยฐC)} & \textbf{Slope} & \textbf{R2c} & \textbf{E d} \\
\hline
ACTB & ATGCCTCCTGCACCACCA GCATTTGCGGTGGACGAT & 300 & 125 & 85 & -3.597 & 0.999 & 1.897 \\
\hline
YWHAZ & TGTAGGAGCCCGTAGGTCATCT TTCTCTCTGTATTCTCGAGCCATCT & 100 & 102 & 79 & -3.335 & 0.988 & 1.995 \\
\hline
RPL19 & CAACTCCCGCCAGCAGAT CCGGGAATGGACAGTCACA & 200 & 76 & 83 & -3.342 & 0.992 & 1.992 \\
\hline
GAPDH & ATGCCTCCTGCACCACCA AGTCCCTCCACGATGCCAA & 100 & 76 & 84 & -3.485 & 0.991 & 1.936 \\
\hline
G6PDH & TGACCTATGGCAACCGATACAA CCGCAAAAGACATCCAGGAT & 300 & 76 & 81 & -3.363 & 0.965 & 1.983 \\
\hline
SDHA & CATCCACTACATGACGGAGCA ATCTTGCCATCTTCAGTTCTGCTA & 200 & 90 & 82 & -3.643 & 0.992 & 1.881 \\
\hline
PrP & GCCAAAAACCAACATGAAGCAT TGCTCATGGCACTTCCCAG & 300 & 95 & 83 & -3.338 & 0.995 & 1.993 \\
\hline
\end{tabular}}
\end{table}
|
PMC1262732_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{MR diagnosis} & \textbf{No. of cases} \\
\hline
White-matter signal abnormalities & 113 \\
\hline
Lacunar infarction & 31 \\
\hline
Old lobar or cerebellar infarction & 13 \\
\hline
Venous malformation & 6 \\
\hline
Arachinoid cyst in the middle cranial fossa & 4 \\
\hline
Old bleeding & 4 \\
\hline
Old traumatic lesion & 2 \\
\hline
Cerebral atrophy & 2 \\
\hline
Total & 175 \\
\hline
\end{tabular}}
\end{table}
|
PMC1266373_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{Coefficient} & \textbf{Standard error} & \textbf{OR} & \textbf{95\% CI of OR} & \textbf{p-value} \\
\hline
cTnI & 1.04 & 0.6 & 2.82 & 0.87โ9.2 & 0.085 \\
\hline
APACHE II & 0.09 & 0.03 & 1.094 & 1.02โ1.17 & 0.009 \\
\hline
\end{tabular}}
\end{table}
|
PMC1269455_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Cont 3 M} & \textbf{Cont 6 M} & \textbf{Cont 11 M} & \textbf{Cont 21 M} & \textbf{Inulin 3 M} & \textbf{Inulin 6 M} & \textbf{Inulin 11 M} & \textbf{Inulin 21 M} & \textbf{inulin} & \textbf{age} & \textbf{interaction} \\
\hline
Plasma Ca, mg/L & 98 $\pm$ 4 & 98 $\pm$ 5 & 95 $\pm$ 6 & 100 $\pm$ 5 & 102 $\pm$ 5 & 99 $\pm$ 4 & 98 $\pm$ 3 & 100 $\pm$ 4 & 0.0601 & 0.0619 & NS \\
\hline
Tibia weight, mg dw & 480 $\pm$ 42 & 630 $\pm$ 80 & 717 $\pm$ 89 & 630 $\pm$ 93 & 489 $\pm$ 66 & 617 $\pm$ 66 & 841 $\pm$ 92 & 648 $\pm$ 47 & 0.042 & $<$0.0001 & 0.023 \\
\hline
Bone Ca, mg/g dw & 207 $\pm$ 21 & 214 $\pm$ 15 & 216 $\pm$ 15 & 215 $\pm$ 21 & 205 $\pm$ 13 & 215 $\pm$ 18 & 202 $\pm$ 14 & 228 $\pm$ 7 & NS & 0.018 & 0.0639 \\
\hline
Plasma Mg, mg/L & 17.9 $\pm$ 1.1 & 17.7 $\pm$ 1.1 & 17.2 $\pm$ 1.0 & 16.9 $\pm$ 1.3 & 17.6 $\pm$ 1.1 & 17.9 $\pm$ 1.3 & 18.2 $\pm$ 1.5 & 18.2 $\pm$ 1.7 & 0.0570 & NS & NS \\
\hline
Erythrocyte Mg, mg/L & 45.4 $\pm$ 3.8 & 44.2 $\pm$ 4.7 & 42.5 $\pm$ 3.4 & 43.4 $\pm$ 3.0 & 44.9 $\pm$ 4.9 & 43.8 $\pm$ 2.5 & 44.3 $\pm$ 3.6 & 43.8 $\pm$ 3.9 & NS & NS & NS \\
\hline
Bone Mg, mg/g dw & 3.92 $\pm$ 0.10 & 3.79 $\pm$ 0.08 & 3.72 $\pm$ 0.08 & 3.76 $\pm$ 0.08 & 3.91 $\pm$ 0.10 & 3.72 $\pm$ 0.07 & 3.73 $\pm$ 0.09 & 3.72 $\pm$ 0.09 & NS & $<$0.0001 & NS \\
\hline
\end{tabular}}
\end{table}
|
PMC1283151_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& & \multicolumn{2}{|l|}{\textbf{Multiple regrafts}} \\
\hline
\textbf{No of eyes (n = 53)} & \textbf{1 regraft (n = 37)} & \textbf{2 regraft (n = 14)} & \textbf{3 regraft (n = 2)} \\
\hline
Clear regrafts (n = 28) & 25 & 3 & 0 \\
\hline
Failed regrafts (n = 25) & 12 & 11 & 2 \\
\hline
p value (Paired 't' test) & 0.001 (statistically significant) & 0.006 (not significant) \\
\hline
\end{tabular}}
\end{table}
|
PMC1291374_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{|l|}{\textbf{Have you ever been treated for thyroid disease in the past?}} \\
\hline
\textbf{Yes} & \multicolumn{2}{|l|}{\textbf{No}} \\
\hline
\textbf{If yes (multiple yes answers are possible)} \\
\hline
Was this called Graves' disease? & No & Yes \\
\hline
Was this called Hashimoto's disease? & No & Yes \\
\hline
Was this called hyperthyroidism? & No & Yes \\
\hline
Was this called hypothyroidism? & No & Yes \\
\hline
Did you ever take Synthroid? & No & Yes \\
\hline
Did you ever take Eltroxin? & No & Yes \\
\hline
Did you ever take propylthiouricil? & No & Yes \\
\hline
Did you ever take methimazole? & No & Yes \\
\hline
Did you ever have radiation treatment for your thyroid? & No & Yes \\
\hline
At what age were you diagnosed with any of the above? & \multicolumn{2}{|l|}{________ years old} \\
\hline
\end{tabular}}
\end{table}
|
PMC1308850_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{European haplotypes} \\
\hline
Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\
\hline
HapBlock & 0.1\% & 180 & 951.63 & 7.49 & 85.6\% \\
\hline
HapBlock & 10\% & 48 & 3363.60 & 7.64 & 80.7\% \\
\hline
Gabriel & 0.1\% & 39 & 4414.28 & 31.41 & 86.1\% \\
\hline
Gabriel & 10\% & 33 & 4837.52 & 10.84 & 79.8\% \\
\hline
MDBlocks & 0.1\% & - & - & - & - \\
\hline
MDBlocks & 10\% & 18 & 9348.78 & 20.39 & 84.4\% \\
\hline
\multicolumn{6}{|l|}{African American haplotypes} \\
\hline
Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\
\hline
HapBlock & 0.1\% & 232 & 733.52 & 7.13 & 85\% \\
\hline
HapBlock & 10\% & 61 & 2499.93 & 6.26 & 76.2\% \\
\hline
Gabriel & 0.1\% & 40 & 4433.62 & 37.85 & 88.6\% \\
\hline
Gabriel & 10\% & 36 & 4416.75 & 10.25 & 80\% \\
\hline
MDBlocks & 0.1\% & - & - & - & - \\
\hline
MDBlocks & 10\% & 18 & 10004.44 & 21.22 & 90\% \\
\hline
\multicolumn{6}{|l|}{East Asian haplotypes} \\
\hline
Method & MAF & Number of Blocks & Mean bp/block & Mean SNPs/block & \% coverage \\
\hline
HapBlock & 0.1\% & 208 & 831.83 & 7.93 & 86.5\% \\
\hline
HapBlock & 10\% & 57 & 2596.73 & 5.84 & 74\% \\
\hline
Gabriel & 0.1\% & 41 & 3966.02 & 24.12 & 81.3\% \\
\hline
Gabriel & 10\% & 38 & 3437.13 & 8.34 & 65.3\% \\
\hline
MDBlocks & 0.1\% & - & - & - & - \\
\hline
MDBlocks & 10\% & 18 & 10006.11 & 18.50 & 90\% \\
\hline
\end{tabular}}
\end{table}
|
PMC1343594_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Type of post consultation letter} & \textbf{Letter to General Practitioner} & \textbf{Letter to patient} & \textbf{Significance (Wilcoxin Signed Ranks test)} \\
\hline
Length of time to dictate letter (minutes $\pm$ SD, n) & 3.28 $\pm$ 2.2, 81 & 2.57 $\pm$ 1.42, 82 & p = 0.019 \\
\hline
Flesch Reading Ease Score & 49.76 $\pm$ 9.1, 84 & 55.44 $\pm$ 9.26, 84 & p $<$ 0.001 \\
\hline
Flesch-Kincaid Grade Level & 10.72 $\pm$ 1.43 & 11.04 $\pm$ 1.39 & p = 0.062 \\
\hline
Circled items in each letter & 31/63 circled 1โ12 items & 16/63 circled 1โ5 items & p $<$ 0.001 \\
\hline
Word Count & 444 $\pm$ 169.87 & 351.5 $\pm$ 129.05 & p $<$ 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC1360088_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Infection} & \textbf{Number of infections among Saudi patients (\%)} & \textbf{Average annual incidence of infections per 100,000 Saudi population} & \textbf{Number of infections among non-Saudi patients (\%)} & \textbf{Average annual incidence of infections per 100,000 non-Saudi population} & \textbf{Total number of infections (\%)} & \textbf{Average annual incidence of infections per 100,000 total population} \\
\hline
Nongonococcal urethritis & 12246 (84.1) & 14.8 & 2311 (15.9) & 7.5 & 14557 (37.3) & 12.8 \\
\hline
Trichomoniasis & 7772 (70.9) & 9.4 & 3195 (29.1) & 10.4 & 10967 (28.1) & 9.7 \\
\hline
Gonococcal urethritis & 4274 (77.1) & 5.2 & 1273 (22.9) & 4.2 & 5547 (14.2) & 4.9 \\
\hline
Syphilis & 1426 (42.1) & 1.7 & 1959 (57.9) & 6.4 & 3385 (8.7) & 3.0 \\
\hline
Human immunodeficiency virus & 461 (15.8) & 0.6 & 2456 (84.2) & 8.0 & 2917 (7.5) & 2.6 \\
\hline
Genital warts & 1174 (84.9) & 1.4 & 208 (15.1) & 0.7 & 1382 (3.5) & 1.2 \\
\hline
Genital herpes & 82 (38.0) & 0.1 & 134 (62.0) & 0.4 & 216 (0.6) & 0.2 \\
\hline
Chancroid & 55 (70.5) & 0.1 & 23 (29.5) & 0.1 & 78 (0.2) & 0.1 \\
\hline
Total & 27490 (70.4) & 32.3 & 11559 (29.6) & 37.6 & 39049 & 34.4 \\
\hline
\end{tabular}}
\end{table}
|
PMC1368987_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Treatment} & \textbf{Fractional turnover rate r day-1} & \textbf{Modeled versus observed value r2} \\
\hline
1 & 0.34 & 0.6563 \\
\hline
2 & 0.15 & 0.6984 \\
\hline
3 & 0.16 & 0.8011 \\
\hline
5 & 0.40 & 0.6411 \\
\hline
6 & 0.57 & 0.9498 \\
\hline
7 & 0.30 & 0.9665 \\
\hline
\end{tabular}}
\end{table}
|
PMC1373641_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{1-1 orth} & \textbf{most cons X-X} & \textbf{less cons X-X} & \textbf{random non-orth} \\
\hline
all X-X orth & 6.31ยท10-233 & 0 & 1.78ยท10-70 & 3.55ยท10-21 \\
\hline
random non-orth & 9.66ยท10-173 & 0 & 0.172 & . \\
\hline
less cons X-X & 0 & 0 & . & . \\
\hline
most cons X-X & 1.38ยท10-57 & . & . & . \\
\hline
\end{tabular}}
\end{table}
|
PMC1382217_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{dvSalt30}} & \multicolumn{2}{|l|}{\textbf{ecox}} & \multicolumn{2}{|l|}{\textbf{shHeat5}} & \multicolumn{2}{|l|}{\textbf{shCold5}} \\
\hline
\textbf{Method} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes} & \textbf{\%Agree} \\
\hline
1-gene (OpWise) & 220 & 100\% & 1062 & 98\% & 1002 & 97\% & 187 & 100\% \\
\hline
operon-wise & 401 & 99\% & 1318 & 100\% & 1284 & 99\% & 374 & 100\% \\
\hline
no-bias & 1090 & 90\% & 1269 & 98\% & 3020 & 87\% & 3063 & 70\% \\
\hline
SAM & 852 & 94\% & 957 & 99\% & 3348 & 83\% & 3258 & 68\% \\
\hline
\end{tabular}}
\end{table}
|
PMC1397872_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Characteristics} & & \multicolumn{3}{|l|}{\textbf{Women}} & \multicolumn{3}{|l|}{\textbf{Men}} \\
\hline
& & \textbf{Total} & \multicolumn{2}{|l|}{\textbf{Current smoker}} & \textbf{Total} & \multicolumn{2}{|l|}{\textbf{Current smoker}} \\
\hline
& & \textbf{N} & \textbf{n} & \textbf{\%} & \textbf{N} & \textbf{n} & \textbf{\%} \\
\hline
Age groups (year) & 15โ19 & 500 & 39 & 7.80 & 398 & 115 & 28.89 \\
\hline
& 20โ24 & 368 & 62 & 16.85 & 267 & 142 & 53.18 \\
\hline
& 25โ29 & 277 & 39 & 14.08 & 228 & 132 & 57.89 \\
\hline
& 30โ34 & 175 & 31 & 17.71 & 176 & 107 & 60.80 \\
\hline
& 35โ39 & 219 & 28 & 12.79 & 199 & 134 & 67.34 \\
\hline
& 40โ44 & 137 & 20 & 14.60 & 142 & 82 & 57.75 \\
\hline
& 45โ49 & 135 & 11 & 8.15 & 118 & 70 & 59.32 \\
\hline
& 50+ & 358 & 27 & 7.54 & 375 & 164 & 43.73 \\
\hline
& Statistical results & x2 = 37.06 & P $<$ 0.001 & & x2 = 124.32 & P $<$ 0.001 \\
\hline
Education & Illiteracy & 1130 & 106 & 9.38 & 264 & 119 & 45.08 \\
\hline
& Literacy & 208 & 23 & 11.05 & 221 & 103 & 46.50 \\
\hline
& Graduated from primary school & 635 & 81 & 12.75 & 927 & 461 & 49.73 \\
\hline
& Graduated from secondary school & 77 & 20 & 25.97 & 192 & 101 & 52.60 \\
\hline
& Graduated from high school and higher & 116 & 27 & 23.27 & 298 & 162 & 54.36 \\
\hline
& Statistical results & x2 = 36 & P $<$ 0.001 & & \multicolumn{3}{|l|}{x2(for linear trend) = 6.2 p = 0.012} \\
\hline
Marital status & Married & 1309 & 170 & 12.99 & 1245 & 696 & 55.90 \\
\hline
& Single & 703 & 70 & 9.96 & 645 & 247 & 38.29 \\
\hline
& Widowed/Divorced & 160 & 17 & 10.63 & 13 & 3 & 23.08 \\
\hline
& Statistical results & x2 = 4.26 & p = 0.118 & & x2 = 56.41 & P $<$ 0.001 \\
\hline
Employment & Employed & 93 & 9 & 9.68 & 1606 & 824 & 51.31 \\
\hline
& Unemployed & 2079 & 248 & 11.93 & 296 & 121 & 40.88 \\
\hline
& Statistical results & x2 = 0.24 & p = 0.62 & & x2 = 10.46 & p = 0.0012 \\
\hline
Ethnicity & Turkish & 731 & 91 & 12.45 & 691 & 351 & 50.80 \\
\hline
& Kurdish & 1223 & 144 & 11.77 & 1034 & 526 & 50.87 \\
\hline
& Arabic & 150 & 16 & 10.67 & 141 & 56 & 39.72 \\
\hline
& Zaza & 67 & 6 & 8.96 & 37 & 13 & 35.14 \\
\hline
& Statistical results & x2 = 0.99 & p = 0.802 & & x2 = 9.66 & p = 0.022 \\
\hline
\end{tabular}}
\end{table}
|
PMC1403766_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Total (n = 115)} & \textbf{MI (n = 24)} & \textbf{No MI (n = 91)} & \textbf{P value} \\
\hline
Age (years; mean $\pm$ SD) & 64.1 $\pm$ 17.2 & 62.8 $\pm$ 18.3 & 64.4 $\pm$ 17.0 & 0.69 \\
\hline
Sex (n; \% female) & 61 (53.0) & 13 (54.2) & 48 (52.7) & 1.00 \\
\hline
APACHE II score (mean $\pm$ SD) & 21.9 $\pm$ 9.8 & 26.3 $\pm$ 10.4 & 20.7 $\pm$ 9.3 & 0.01 \\
\hline
Medical (n [\%]) & 83 (72.2) & 20 (83.3) & 63 (69.2) & 0.21 \\
\hline
Epidural (n [\%]) & 12 (10.4) & 0 (0.0) & 12 (13.2) & 0.07 \\
\hline
\multicolumn{5}{|l|}{Past medical history (n [\%])} \\
\hline
Smoker & 35 (30.4) & 5 (20.8) & 30 (33.0) & 0.32 \\
\hline
Hypertension & 59 (51.3) & 14 (58.3) & 45 (49.5) & 0.50 \\
\hline
Diabetes (oral agent) & 9 (7.8) & 3 (12.5) & 6 (6.6) & 0.39 \\
\hline
Diabetes (insulin) & 17 (14.8) & 10 (41.7) & 7 (7.7) & $<$0.001 \\
\hline
Hypercholesterolemia & 14 (12.2) & 2 (8.3) & 12 (13.2) & 0.73 \\
\hline
Angina & 15 (13.0) & 3 (12.5) & 12 (13.2) & 1.00 \\
\hline
Myocardial infarction & 25 (21.7) & 9 (37.5) & 16 (17.6) & 0.05 \\
\hline
Congestive heart failure & 14 (12.2) & 5 (20.8) & 9 (9.9) & 0.17 \\
\hline
Peripheral vascular disease & 10 (8.7) & 7 (29.2) & 3 (3.3) & $<$0.001 \\
\hline
Transient ischemic attack & 4 (3.5) & 2 (8.3) & 2 (2.2) & 0.19 \\
\hline
Stroke & 8 (7.0) & 3 (12.5) & 5 (5.5) & 0.36 \\
\hline
\multicolumn{5}{|l|}{Baseline life support interventions (n [\%])} \\
\hline
\multicolumn{5}{|l|}{Ventilation} \\
\hline
Invasive mechanical ventilation & 67 (58.3) & 16 (66.7) & 51 (56.0) & 0.49 \\
\hline
Noninvasive mechanical ventilation & 5 (4.3) & 2 (8.3) & 3 (3.3) & 0.28 \\
\hline
\multicolumn{5}{|l|}{Inotropes and vasopressors} \\
\hline
Epinephrine & 2 (1.7) & 1 (4.2) & 1 (1.1) & 0.38 \\
\hline
Dopamine & 10 (8.7) & 3 (12.5) & 7 (7.7) & 0.43 \\
\hline
Norepinephrine & 19 (16.5) & 5 (20.8) & 14 (15.4) & 0.54 \\
\hline
Dobutamine & 4 (3.5) & 2 (8.3) & 2 (2.2) & 0.19 \\
\hline
Phenylephrine & 18 (15.7) & 9 (37.5) & 9 (9.9) & 0.003 \\
\hline
Vasopressin & 5 (4.3) & 3 (12.5) & 2 (2.2) & 0.06 \\
\hline
\multicolumn{5}{|l|}{Hemodialysis} \\
\hline
Intermittent dialysis & 14 (12.2) & 4 (16.7) & 10 (11.0) & 0.49 \\
\hline
Continuous renal replacement therapy & 0 (0.0) & 0 (0.0) & 0 (0.0) & - \\
\hline
\end{tabular}}
\end{table}
|
PMC1414005_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{AAA model} & \textbf{P (mmHg)} & \textbf{dAAA,max (cm)} & \textbf{Thickness t (cm)} & \textbf{$\alpha$} & \textbf{$\beta$} & \textbf{Stress (Authors' results) (MPa)} & \multicolumn{2}{|l|}{\textbf{Modified Laplace Equation}} & \multicolumn{2}{|l|}{\textbf{Original Laplace Equation}} \\
\hline
& & & & & & & \textbf{Stress (MPa)} & \textbf{Error} & \textbf{Stress (MPa)} & \textbf{Error} \\
\hline
Fillinger [3,4] & 120 & 6.7 & 0.19 & 0 & 0.4 & 0.32 & 0.34 & 6.3\% & 0.28 & 13\% \\
\hline
& 130 & 5.5 & 0.19 & 0 & 0.4 & 0.30 & 0.28 & 6.7\% & 0.25 & 16.7\% \\
\hline
Wang [29] & 128 & 6.1 & 0.184 & 0.54 & 0.33 & 0.19 & 0.208 & 9.5\% & 0.28 & 47\% \\
\hline
& 155 & 6.4 & 0.175 & 0.29 & 0.9 & 0.35 & 0.34 & 2.9\% & 0.38 & 8.6\% \\
\hline
Vorp [36] & 120 & 6.0 & 0.15 & 0 & 0.3 & 0.33 & 0.34 & 3\% & 0.31 & 6\% \\
\hline
Raghavan [45] & 115 & 5.2 & 0.19 & 0 & 0.65 & 0.23 & 0.21 & 8.7\% & 0.2 & 13\% \\
\hline
& 188 & 5.5 & 0.19 & 0 & 0.9 & 0.43 & 0.46 & 6.9\% & 0.36 & 16\% \\
\hline
Thubrikar [15] & 120 & 5.86 & 0.104 & 0 & 0.5 & 0.37 & 0.39 & 5.4\% & 0.45 & 22\% \\
\hline
& 120 & 5.86 & 0.158 & 0 & 0.5 & 0.3 & 0.299 & 0.3\% & 0.29 & 3.3\% \\
\hline
Li [44] & 120 & 5.0 & 0.05 & 0.15 & 1 & 0.43 & 0.41 & 4.6\% & 0.80 & 85.6\% \\
\hline
\end{tabular}}
\end{table}
|
PMC1421417_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Dataset} & \textbf{INTACT_HO} & \textbf{INTACT_GAVIN} & \textbf{INTACT_ITO} & \textbf{INTACT_UETZ} & \textbf{INTACT_SMALL} \\
\hline
DIP_CORE & 28.90 & 48.60 & 13.60 & 31.60 & 29.60 \\
\hline
DIP_FULL & 85.10 & 75.20 & 91.80 & 87.70 & 29.60 \\
\hline
MINT & 73.10 & 85.30 & 98.00 & 96.20 & 27.00 \\
\hline
GRID & 82.60 & 73.60 & 88.00 & 89.40 & 33.90 \\
\hline
BIND & 5.80 & 8.60 & 74.70 & 59.10 & 24.30 \\
\hline
MIPS_PHYSICAL & 4.60 & 8.00 & 86.70 & 61.80 & 20.00 \\
\hline
MIPS_GENETIC & 0.70 & 1.00 & 0.40 & 1.20 & 2.60 \\
\hline
\end{tabular}}
\end{table}
|
PMC1431566_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Patient} & \textbf{Age} & \textbf{APACHE} & \textbf{MBP} & \textbf{HR} & \textbf{CREAT} & \textbf{TROP T} & \textbf{Infection} & \textbf{Germ} & \textbf{AB} \\
\hline
MAPRR & 20 & 6 & 145 & 129 & 0.8 & $<$0.01 & Blood & S. aureus & vancomycin \\
\hline
VPO & 48 & 3 & 110 & 127 & 1.1 & 0.012 & - & - & penicillin \\
\hline
MSR & 54 & 4 & 49 & 109 & 0.5 & 0.07 & respiratory central line & S. aureus & vancomycin \\
\hline
JP & 50 & 8 & 84 & 124 & 0.6 & $<$0.01 & respiratory & ? & cefuroxime \\
\hline
JRS & 74 & 10 & 78.6 & 122 & 1.4 & 0.306 & - & - & penicillin \\
\hline
ESB & 19 & 6 & 62 & 81 & 0.8 & $<$0.01 & - & - & penicillin \\
\hline
CEO & 53 & 8 & 78.6 & 92 & 0.5 & 0.135 & respiratory & S. aureus & vancomycin \\
\hline
RAB & 57 & 6 & 69 & 74 & 1.1 & 0.015 & - & - & penicillin \\
\hline
JOR & 57 & 15 & 100.6 & 129 & 1.0 & 0.028 & osteomyelitis & - & ofloxa, metro \\
\hline
JBS & 48 & 10 & 90 & 98 & 0.7 & 0.02 & - & - & penicillin \\
\hline
GS & 36 & 11 & 67 & 96 & 1.0 & 0.045 & respiratory & S. aureus & vancomycin \\
\hline
SBD & 33 & 15 & 88 & 71 & 0.8 & 0.105 & respiratory & ? & cefipime \\
\hline
LCCM & 48 & 4 & 93.6 & 62 & 0.6 & $<$0.01 & respiratory & P. mirabilis & ampisulbact \\
\hline
MJO & 29 & 1 & 87 & 88 & 0.7 & $<$0.01 & - & - & penicillin \\
\hline
JCWV & 20 & 5 & 290 & 133 & 0.7 & $<$0.01 & respiratory & ? & ampisulbact \\
\hline
IMR & 60 & 23 & 66 & 86 & 0.7 & $<$0.01 & respiratory & P. aeruginosa & ampisulbact \\
\hline
MS & 70 & 11 & 48.3 & 78 & 1.1 & 0.137 & Blood & S. aureus & vancomycin \\
\hline
ER & 44 & 11 & 75 & 81 & 1.1 & 0.135 & Blood & S. epidermitis & oxacillin \\
\hline
LSLF & 36 & 10 & 70 & 100 & 1.0 & $<$0.01 & - & - & ampicillin \\
\hline
MLS & 82 & 21 & 24 & 92 & 1.5 & 0.2135 & - & - & penicillin \\
\hline
JS & 44 & 2 & 126 & 75 & 1.0 & $<$0.01 & - & - & penicillin \\
\hline
Mean (SD) & 46.7 (17.2) & 9 (5.7) & 81.3 (26.7) & 97.4 (22.1) & 0.9 (0.2) & 0.6 (0.08) \\
\hline
\end{tabular}}
\end{table}
|
PMC1434771_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Survey sample} & \textbf{Total respondents} & \textbf{Mean score of all respondents (SD)} & \textbf{Range of scores of all respondents (SD)} & \textbf{Total SDOLs} & \textbf{Mean score of self- designating opinion leaders (SD)} & \textbf{Range of scores of self-designating opinion leaders (SD)} \\
\hline
\multicolumn{7}{|l|}{General practitioners} \\
\hline
PC1 & 78 & 19.96 (4.03) & 9โ30 & 16 & 25.31 (1.85) & 23โ30 \\
\hline
PC2 & 222 & 20.36 (3.74) & 10โ30 & 47 & 25.55 (1.47) & 24โ30 \\
\hline
\multicolumn{7}{|l|}{Practice nurses} \\
\hline
PC1 & 35 & 21.60 (4.69) & 13โ30 & 7 & 28.43 (0.79) & 28โ30 \\
\hline
PC2 & 144 & 21.01 (4.04) & 4โ30 & 29 & 26.34 (1.72) & 22โ30 \\
\hline
\multicolumn{7}{|l|}{Practice managers} \\
\hline
PC1 & 32 & 20.50 (4.68) & 10โ29 & 7 & 26.71 (1.50) & 25โ29 \\
\hline
PC2 & 56 & 16.80 (2.57) & 10โ22 & 13 & 19.69 (1.03) & 19โ22 \\
\hline
\multicolumn{7}{|l|}{Surgeons} \\
\hline
DGH1 & 16 & 20.13 (3.69) & 13โ25 & 6 & 23.67 (0.82) & 23โ25 \\
\hline
DGH2 & 7 & 22.57 (5.16) & 16โ29 & 1 & 29.00 (0.00) & 29โ29 \\
\hline
TH & 18 & 21.33 (5.39) & 11โ30 & 5 & 27.20 (1.79) & 26โ30 \\
\hline
\multicolumn{7}{|l|}{Physicians} \\
\hline
DGH1 & 21 & 19.38 (5.53) & 6โ27 & 4 & 23.75 (3.20) & 21โ27 \\
\hline
DGH2 & 3 & 23.33 (3.51) & 20โ27 & 1 & 27.00 (0.00) & 27โ27 \\
\hline
TH & 47 & 21.15 (4.62) & 2โ27 & 12 & 25.42 (1.88) & 20โ27 \\
\hline
\multicolumn{7}{|l|}{Surgical nurses} \\
\hline
DGH1 & 9 & 20.89 (4.11) & 16โ29 & 4 & 20.00 (2.31) & 18โ22 \\
\hline
DGH2 & 34 & 21.32 (3.87) & 12โ29 & 11 & 25.73 (1.85) & 24โ29 \\
\hline
TH & 37 & 19.62 (4.02) & 5โ27 & 7 & 24.86 (1.35) & 23โ27 \\
\hline
\multicolumn{7}{|l|}{Medical nurses} \\
\hline
DGH1 & 30 & 19.90 (4.84) & 6โ27 & 7 & 25.14 (1.07) & 24โ27 \\
\hline
DGH2 & 25 & 21.04 (3.60) & 15โ28 & 7 & 25.57 (1.51) & 24โ28 \\
\hline
TH & 34 & 21.50 (3.17) & 15โ28 & 9 & 25.44 (1.74) & 23โ28 \\
\hline
Obstetricians and Gynaecologists & 102 & 23.08 (3.71) & 10โ30 & 20 & 28.0 (1.08) & 27โ30 \\
\hline
Oncologists & 33 & 24.42 (3.87) & 13โ29 & 10 & 28.40 (0.52) & 28โ29 \\
\hline
\end{tabular}}
\end{table}
|
PMC1436013_table_6
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Window size} & \multicolumn{4}{|l|}{\textbf{Prediction accuracy (\%)}} \\
\hline
& \textbf{Q2} & \textbf{MCC} & \textbf{Sensitivity} & \textbf{Specificity} \\
\hline
3 & 61.2 & 0.22 & 64.4 & 57.9 \\
\hline
5 & 62.5 & 0.25 & 63.3 & 61.6 \\
\hline
7 & 61.8 & 0.24 & 61.4 & 62.3 \\
\hline
9 & 62.1 & 0.24 & 61.1 & 63.2 \\
\hline
11 & 62.8 & 0.26 & 56.6 & 68.7 \\
\hline
13 & 61.7 & 0.23 & 59.2 & 63.8 \\
\hline
15 & 61.6 & 0.23 & 55.4 & 67.6 \\
\hline
17 & 61.0 & 0.22 & 56.3 & 65.6 \\
\hline
19 & 59.8 & 0.19 & 55.4 & 63.9 \\
\hline
\end{tabular}}
\end{table}
|
PMC1450308_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Effect Size} & \textbf{Failure Rate 95\%} & \textbf{Failure Rate 98\%} \\
\hline
30\% & 235 & 195 \\
\hline
33.3\% & 185 & 160 \\
\hline
35\% & 160 & 140 \\
\hline
40\% & 120 & 95 \\
\hline
\end{tabular}}
\end{table}
|
PMC1459124_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\multicolumn{7}{|l|}{\textbf{All}} \\
\hline
\textbf{Crops} & \textbf{AECD-Blocks} & \textbf{General feeder (Polyphagous)} & \textbf{Oligophagous} & \textbf{Monophagous} & \textbf{No crop attacked} & \textbf{Absent in the village} \\
\hline
Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\
\hline
& Mbalmayo & 70 & 30 & 0 & 0 & 0 \\
\hline
& Ebolowa & 70 & 30 & 0 & 0 & 0 \\
\hline
& Mean & 67 & 33 & 0 & 0 & 0 \\
\hline
Young Perennial Crop & Yaounde & 20 & 20 & 10 & 50 & 0 \\
\hline
& Mbalmayo & 20 & 20 & 10 & 50 & 0 \\
\hline
& Ebolowa & 30 & 50 & 0 & 20 & 0 \\
\hline
& Mean & 23 & 30 & 7 & 40 & 0 \\
\hline
\multicolumn{7}{|l|}{Female} \\
\hline
Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\
\hline
& Mbalmayo & 60 & 40 & 0 & 0 & 0 \\
\hline
& Ebolowa & 60 & 40 & 0 & 0 & 0 \\
\hline
& Mean & 60 & 40 & 0 & 0 & 0 \\
\hline
Young Perennial Crop & Yaounde & 20 & 0 & 0 & 80 & 0 \\
\hline
& Mbalmayo & 40 & 0 & 0 & 60 & 0 \\
\hline
& Ebolowa & 40 & 40 & 0 & 20 & 0 \\
\hline
& Mean & 33 & 13 & 0 & 53 & 0 \\
\hline
\multicolumn{7}{|l|}{Male} \\
\hline
Annual crops & Yaounde & 60 & 40 & 0 & 0 & 0 \\
\hline
& Mbalmayo & 80 & 20 & 0 & 0 & 0 \\
\hline
& Ebolowa & 80 & 20 & 0 & 0 & 0 \\
\hline
& Mean & 73 & 27 & 0 & 0 & 0 \\
\hline
Young Perennial Crop & Yaounde & 20 & 40 & 20 & 20 & 0 \\
\hline
& Mbalmayo & 0 & 40 & 20 & 40 & 0 \\
\hline
& Ebolowa & 20 & 60 & 0 & 40 & 0 \\
\hline
& Mean & 13 & 47 & 13 & 33 & 0 \\
\hline
\end{tabular}}
\end{table}
|
PMC1464119_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{year in} & \textbf{Incidence (1/100,000)} & \textbf{Moran 's I} & \textbf{E [I]} & \textbf{p} \\
\hline
1994 & 5.16 & 0.2672 & 0.0005 & 0.001 \\
\hline
1995 & 4.94 & 0.4374 & 0.0005 & 0.001 \\
\hline
1996 the & 3.65 & 0.5153 & 0.0005 & 0.001 \\
\hline
1997 & 3.60 & 0.5015 & 0.0005 & 0.001 \\
\hline
1998 & 3.77 & 0.5001 & 0.0005 & 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC1471792_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene product} & \textbf{Forward primer} & \textbf{Reverse primer} \\
\hline
SP-B & 5'-GCCATGGCCAAGTTACATCT-3' & 5'-TGCTCACACTTTTGCCTGTC-3' \\
\hline
SP-C & 5'-TACTCGACAGGTCCCAGGAG-3' & 5'-AGCTCTCCACACAAGGTGCT-3' \\
\hline
CC10 & 5'-CAACATCAGCCCACATCTACA-3' & 5'-TTGGTGTAGGGAGGTCAAGG-3' \\
\hline
\end{tabular}}
\end{table}
|
PMC1475638_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Source} & \textbf{DF} & \multicolumn{5}{|l|}{\textbf{F value}} \\
\hline
& & \textbf{Critical} & \textbf{Dorsal vein} & \textbf{Caudal vein} & \textbf{Dorsal artery} & \textbf{Caudal artery} \\
\hline
Family & 3 & 2.91 & 11.35* & 1.35 & 8.74* & 0.58 \\
\hline
Environment & 1 & 4.16 & 1.87 & 3.70 & 12.10* & 7.71* \\
\hline
Family $\times$ Environment & 3 & 2.91 & 0.30 & 0.30 & 2.11 & 0.46 \\
\hline
Error & 38 \\
\hline
\end{tabular}}
\end{table}
|
PMC1479343_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Influencing factor} & \textbf{Examples} \\
\hline
\multicolumn{2}{|l|}{Epidemiological environment} \\
\hline
Prevalence of condition & Screening and referral programs for breast cancer \\
\hline
Incidence of condition & Preventive measures for many injuries \\
\hline
Existence of competing risks of synergisms & Some surgical interventions: among the very young or elderly, competing risks reduce the cost-effectiveness of some targeted interventions \\
\hline
\multicolumn{2}{|l|}{Individual characteristics} \\
\hline
Age & Cancer treatment: more cost-effective for younger patients \\
\hline
Tendency to compliance & Anti-hypertensive medication \\
\hline
Tendency to self-refer & Diabetes control \\
\hline
Level of risk factors & Hypertension and hyperlipdemia \\
\hline
Individual variation in values & Attitude toward disability relative to risk of death; can lead to individual differences in intervention effectiveness \\
\hline
\multicolumn{2}{|l|}{System characteristics} \\
\hline
Local costs of non-traded inputs to health care system & Real costs of care intensive interventions (such as hospitalisation after trauma) are low where wages are low, because most health care personnel are relatively immobile \\
\hline
Generalised systemic competence & Cost-effectiveness at the margin of some interventions in a system with a low level of professionalism and capacity may be much higher than in more developed systems \\
\hline
Discount rate & Where discount rates are high, interventions with payoffs well into the future (such as treatment of obesity) become relatively less attractive. \\
\hline
\end{tabular}}
\end{table}
|
PMC1479369_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Item} & \textbf{Spearman Correl. (rho)} & \textbf{N} \\
\hline
Tangibles 1 & 0.910 & 27 \\
\hline
Tangibles 2 & 0.914 & 27 \\
\hline
Tangibles 3 & 0.931 & 27 \\
\hline
Tangibles 4 & 0.932 & 26 \\
\hline
Responsiveness 5 & 0.952 & 27 \\
\hline
Responsiveness 6 & 0.909 & 27 \\
\hline
Responsiveness 7 & 0.917 & 27 \\
\hline
Responsiveness 8 & 0.952 & 27 \\
\hline
Responsiveness 9 & 0.883 & 25 \\
\hline
Responsiveness 10 & 0.857 & 26 \\
\hline
Responsiveness 12 & 0.950 & 27 \\
\hline
Assurance 14 & 0.864 & 26 \\
\hline
Assurance 16 & 0.932 & 27 \\
\hline
Assurance 17 & 0.932 & 21 \\
\hline
Assurance 18 & 0.972 & 20 \\
\hline
Assurance 19 & 0.958 & 26 \\
\hline
Assurance 20 & 0.922 & 27 \\
\hline
Assurance 21 & 0.954 & 27 \\
\hline
Empathy 23 & 0.924 & 25 \\
\hline
Empathy 25 & 0.952 & 26 \\
\hline
Empathy 26 & 0.976 & 25 \\
\hline
Empathy 27 & 0.966 & 26 \\
\hline
GP 28 & 0.953 & 26 \\
\hline
GP 29 & 0.938 & 23 \\
\hline
Personal 33 & 0.964 & 27 \\
\hline
Personal 35 & 0.965 & 27 \\
\hline
\end{tabular}}
\end{table}
|
PMC1482701_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Primer} & & \textbf{Sequence} & \textbf{Size of product (bp)} \\
\hline
PAR-1 & sense & 5'-CAGCTCCTGGCTGACACTCTTTGTC-3' & 500 \\
\hline
& antisense & 5'-CGAGCAGGGTTTCATTGAGCACAT-3' \\
\hline
PAR-2 & sense & 5'-GCAGCCTCTCTCTCCTGCAGTGG-3' & 461 \\
\hline
& antisense & 5'-CTGAGGCAGGTCATGAAGAGAATGG-3' \\
\hline
PAR-3 & sense & 5'-GGCTGGACAGGAGCCACGAT-3' & 403 \\
\hline
& antisense & 5'-AGCGGTTGATGCTGATGCAGG-3' \\
\hline
PAR-4 & RT & 5'-TGAGTAGCTGGGATTACAG-3' & 542 \\
\hline
& sense & 5'-AACCTCTATGGTGCCTACGTGC-3' \\
\hline
& antisense & 5'- CCAAGCCCAGCTAATTTTTG-3' \\
\hline
$\beta$-actin & sense & 5'-GTTGCGTTACACCCTTTCTT-3' & 148 \\
\hline
& antisense & 5'-ACCTTCACCGTTCCAGTTT-3' \\
\hline
\end{tabular}}
\end{table}
|
PMC1489934_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{(ยตg/ml) Compound} & \textbf{IL-8 released (pg/ml)} \\
\hline
Medium alone & 24.6 $\pm$ 1.5 \\
\hline
Tryptase 2.0 & 105.2 $\pm$ 5.3* \\
\hline
Elastase 0.3 & 108.4 $\pm$ 13.2* \\
\hline
Benzamidine 30 & 37.6 $\pm$ 4.4 \\
\hline
Leupeptine 30 & 27.4 $\pm$ 5.6 \\
\hline
MSACK 30 & 22.1 $\pm$ 4.3 \\
\hline
Tryptase 2.0 + Benzamidine 30 & 66.9 $\pm$ 4.8โ \\
\hline
Tryptase 2.0 + Leupeptin 30 & 100 $\pm$ 1.7 \\
\hline
Elastase 0.3 + MSACK 30 & 26.9 $\pm$ 3.6โ \\
\hline
\end{tabular}}
\end{table}
|
PMC1489934_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Disease} & \textbf{Polymorphism} & \textbf{Total} \\
\hline
Number of nsSNPS & 10,419 & 4217 & 14,636 \\
\hline
Number of nsSNPS within proteins with structural homologs & 3212 & 609 & 3821 \\
\hline
Number of Proteins with nsSNPs & 893 & 1256 & 2149 \\
\hline
Number of Proteins with nsSNPs having structural homologs & 299 & 295 & 594 \\
\hline
\end{tabular}}
\end{table}
|
PMC1489951_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Site} & \textbf{Disease} & \textbf{Polymorphisms} & \textbf{Percentage (odds ratio) of nsSNPs within these sites that are disease} \\
\hline
ACT_SITE & 25 & 1 & 96.15 (10.12) \\
\hline
BINDING & 13 & 0 & 100 (-) \\
\hline
DNA_BIND & 352 & 20 & 94.62 (7.12) \\
\hline
METAL & 38 & 0 & 100 (-) \\
\hline
MOD_RES & 34 & 3 & 91.89 (4.59) \\
\hline
MUTAGEN & 111 & 10 & 91.74 (4.49) \\
\hline
NP_BIND & 108 & 8 & 93.1 (5.46) \\
\hline
\end{tabular}}
\end{table}
|
PMC1489951_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
& \textbf{n (\%)} \\
\hline
Respondent shopping for self and child(ren) & 44 (91.7) \\
\hline
Respondent shopping for self and spouse & 25 (52.1) \\
\hline
\multicolumn{2}{|l|}{Self-report of diagnosis by a physician for any household member:} \\
\hline
High blood pressure & 7 (14.6) \\
\hline
Diabetes & 1 (2.1) \\
\hline
Coronary heart disease & 1 (2.1) \\
\hline
High cholesterol & 4 (8.3) \\
\hline
Current smoker in household & 7 (14.6) \\
\hline
Fair or poor health (respondent) & 5 (10.4) \\
\hline
No physical activity (respondent) & 28 (58.3) \\
\hline
\end{tabular}}
\end{table}
|
PMC1508155_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Population health indicator} & \textbf{Australia (Rank)} & \textbf{Country with best outcome (outcome)} \\
\hline
Life expectancy at birth (years) & 79 (3rd) & Japan (82) \\
\hline
Infant mortality rate per 1000 & 6 (4th) & Japan, Singapore, Sweden (3) \\
\hline
Under 5 mortality rate per 1000 & 6 (4th) & Sweden (3) \\
\hline
Adult mortality rate per 1000 (male) & 100 (6th) & Sweden (87) \\
\hline
Adult mortality rate per 1000 (female) & 52 (5th) & Japan (44) \\
\hline
Survival to age 65 (\%) (male) & 84 (3rd) & Japan (86) \\
\hline
Survival to age 65 (\%) (female) & 92 (3rd) & Japan (94) \\
\hline
HALE at birth* & 71.6 (4th) & Japan (73.6) \\
\hline
\end{tabular}}
\end{table}
|
PMC1513585_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Unadjusted} & \textbf{Adjusted for age} & \textbf{Adjusted for age and SBPโ } & \textbf{Adjusted for age, SBPโ and pack-years} \\
\hline
CPITNโ score & 1.41* [1.16โ1.73] & 0.98 [0.77โ1.25] & 0.86 [0.65โ1.13] & 0.91 [0.68โ1.20] \\
\hline
Average probing depth & 1.77* [1.35โ2.32] & 1.09 [0.80โ1.47] & 0.92 [0.66โ1.28] & 0.99 [0.70โ1.38] \\
\hline
Gingival bleeding index & 2.03* [1.04โ3.95] & 1.01 [0.46โ2.19] & 0.61 [0.25โ1.50] & 0.71 [0.28โ1.79] \\
\hline
\end{tabular}}
\end{table}
|
PMC1524747_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{Wave 1} & \textbf{Wave 2} & \textbf{Wave 3} & \textbf{Wave 4} & \textbf{Wave 5} & \textbf{Unique Individuals} \\
\hline
& (n = 124) & (n = 106) & (n = 115) & (n = 113) & (n = 115) & n = 251 \\
\hline
Age (mean; [sd]) & 41.6 [10.7] & 40.9 [11.2] & 42.2 [11.3] & 41.5 [10.9] & 40.6 [11.9] & 38.8 [11.8] \\
\hline
Gender (\% Male) & 8.1 & 5.7 & 8.7 & 7.1 & 7.0 & 10.4 \\
\hline
Race (\% African American) & 39.5 & 41.5 & 44.4 & 44.3 & 47.0 & 47.0 \\
\hline
Marital status (\% Married) & 38.7 & 41.5 & 44.4 & 43.4 & 40 & 37.1 \\
\hline
Job category (\% Nurse Aides) & 59.7 & 64.2 & 60.0 & 59.3 & 61.7 & 61.4 \\
\hline
Fulltime (\%) & 85.5 & 84.0 & 82.6 & 71.7 & 68.7 & 75.7 \\
\hline
\multicolumn{7}{|l|}{Tenure:} \\
\hline
Less then 1 year & 33.1 & 34.0 & 26.1 & 31.0 & 36.5 & 52.2 \\
\hline
1 to 5 years & 29.8 & 37.7 & 43.5 & 42.5 & 37.4 & 24.3 \\
\hline
Over 5 years & 37.1 & 28.3 & 30.4 & 26.6 & 26.1 & 23.5 \\
\hline
Perceived High Quality & 54.0 & 43.4 & 57.4 & 52.2 & 60.0 & 55.8 \\
\hline
\end{tabular}}
\end{table}
|
PMC1524956_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Depressed vs. non-depressed}} & \multicolumn{2}{|l|}{\textbf{Responders vs. non-responders}} \\
\hline
\textbf{Polymorphism} & \textbf{p-value} & \textbf{q-value} & \textbf{p-value} & \textbf{q-value} \\
\hline
rs6280 DRD3 & 0.055 & 0.264 & 0.439 & 0.555 \\
\hline
rs4680 COMT & 0.033 & 0.239 & 0.986 & 0.77 \\
\hline
rs165599 COMT & 0.041 & 0.239 & 0.251 & 0.482 \\
\hline
STin2 VNTR SLC6A4 & 0.004* & 0.137 & 0.749 & 0.699 \\
\hline
exon 3 VNTR DRD4 & 0.316 & 0.482 & 0.009* & 0.137 \\
\hline
\end{tabular}}
\end{table}
|
PMC1526442_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Physiological functions} & \textbf{A} & \textbf{B} & \textbf{C} \\
\hline
Replenishment of water & Isotonic drinks & Hypotonic drinks Glycerol \\
\hline
Improvement of endurance & High-carbohydrate Citric acid & Arginine Caffeine Carnitine & Capsaicine \\
\hline
Enhancement of muscle strength & Protein BCAA Creatine $\beta$-HMB & Glutamine & Arginine \\
\hline
Prevention of muscle/joint injuries or fatigue & High-carbohydrate Citric acid & Vitamins C and E Carotenoids, Flavonoids Carnosine, Anserine & Glucosamine Chondroitin \\
\hline
Prevention of a decrease in immunocompetence & Carbohydrate & Vitamins C and E Glutamine \\
\hline
\end{tabular}}
\end{table}
|
PMC1526446_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{PADI4 haplotype (frequencies)}} & \multicolumn{4}{|l|}{\textbf{PADI4 haplotype (carriers)}} \\
\hline
& \textbf{Haplotype 1} & \textbf{Haplotype 1B} & \textbf{Haplotype 2/3} & \textbf{Haplotype 4} & \textbf{Haplotype 1} & \textbf{Haplotype 1B} & \textbf{Haplotype 2/3} & \textbf{Haplotype 4} \\
\hline
Controls & 119 (58.3\%) & 6 (2.9\%) & 63 (30.9\%) & 16 (7.8\%) & 84 (82.4\%) & 6 (5.9\%) & 51 (50\%) & 14 (13.7\%) \\
\hline
Patients & 102 (50\%) & 1 (0.5\%) & 71 (34.8\%) & 30 (14.7\%) & 77 (75.5\%) & 1 (1\%) & 54 (52.9\%) & 28 (27.5\%) \\
\hline
Odds ratio & 0.71 & 0.16 & 1.2 & 2.0 & 0.66 & 0.16 & 1.1 & 2.4 \\
\hline
95\% confidence interval & 0.48โ1.1 & 0.02โ1.4 & 0.79โ1.8 & 1.1โ3.8 & 0.33โ1.3 & 0.02โ1.3 & 0.65โ1.9 & 1.2โ4.8 \\
\hline
P & 0.11 & 0.12 & 0.46 & 0.04 & 0.30 & 0.12 & 0.78 & 0.02 \\
\hline
\end{tabular}}
\end{table}
|
PMC1526594_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Female (\%) & 72 \\
\hline
Mean age (years) & 50.7 \\
\hline
Mean disease duration (months) & 4.3 \\
\hline
Pain (100 mm VAS) & 54.4 \\
\hline
Morning stiffness (minutes) & 84 \\
\hline
Ritchie index & 17.8 \\
\hline
Tendon joint count & 21.8 \\
\hline
Swollen joint count & 8.4 \\
\hline
Nodules (\%) & 6 \\
\hline
ESR (mm/1st h) & 38.4 \\
\hline
CRP (mg/l) & 32 \\
\hline
IgM RF positive (\%) & 71 \\
\hline
DAS 44 & 4.1 \\
\hline
HLA DRB1*04 (\%)a & 53 \\
\hline
HLA DRB1*01 (\%)b & 15.5 \\
\hline
\end{tabular}}
\end{table}
|
PMC1526612_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variable} & \multicolumn{2}{|l|}{\textbf{Unemployment Duration (\%/n)}} & \textbf{t (p)} \\
\hline
& \textbf{Short-term N = 234} & \textbf{Long-term N = 195} \\
\hline
\multicolumn{4}{|l|}{Depression (in past 12 months)} \\
\hline
Never & 15.8/37 & 16.4/32 & 0.17 (sn) \\
\hline
Sometimes & 50.4/118 & 32.8/64 & 3.75 (p $<$ 0.001) \\
\hline
Often & 29.5/69 & 39.5/77 & 2.17 (p $<$ 0.05) \\
\hline
Always & 4.3/10 & 11.3/22 & 2.67 (p $<$ 0.01) \\
\hline
\multicolumn{4}{|l|}{Depression (after unemployment)} \\
\hline
Do not feel at all & 14.1/33 & 11.8/23 & 0.71 (sn) \\
\hline
No significant changes & 43.2/101 & 33.8/66 & 2.01 (p $<$ 0.05) \\
\hline
Feel more often & 39.7/93 & 51.8/101 & 2.52 (p $<$ 0.05) \\
\hline
Feel less & 3.0/7 & 2.6/5 & 0.25 (sn) \\
\hline
\multicolumn{4}{|l|}{Use of sedative drugs} \\
\hline
At least once in the last 30 days & 19.2/45 & 25.6/50 & 1.58 (sn) \\
\hline
\end{tabular}}
\end{table}
|
PMC1526724_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Haplogroups} & \textbf{Diagnostic coding region substitutions} \\
\hline
M2 & 447G-1780-8502-11083-15670 \\
\hline
M2a & 5252-7961-8396-9758-12810 \\
\hline
M3 & 482 \\
\hline
M3a & 4580 \\
\hline
M4a & 6620-7859 \\
\hline
M4b & 511 \\
\hline
M5 & 1888 \\
\hline
M5a & 709-3921-12477-14323 \\
\hline
M6 & 461-3537-5082-5301-5558-9329-10640-13966-14128 \\
\hline
M6b & 5585-3486 \\
\hline
M18 & 12498-15942 \\
\hline
M25 & 15928 \\
\hline
M30 & 15431 \\
\hline
M30a & 6366 \\
\hline
M30b & 5147-13980 \\
\hline
M30c & 12234 \\
\hline
M30d & 15259 \\
\hline
M31 & 4907-11176-15440-15530 \\
\hline
M32 & 3817-9064-12189-15754 \\
\hline
M33 & 2361 \\
\hline
M33a & 8562-15908 \\
\hline
M34 & 569-3010-6794-11101-15865 \\
\hline
M34a & 3447-8404-10361-11992-12311-14094 \\
\hline
M35 & 12561 \\
\hline
M35a & 5432-10670-15924 \\
\hline
M36 & 7271-15110 \\
\hline
M37 & 10556 \\
\hline
M37a & 7853 \\
\hline
M38 & 1808-6367-6899-9966-15314-15487 \\
\hline
M39 & 1811-8679-15938 \\
\hline
M40 & 8925-15721-15954 \\
\hline
M40a & 13542 \\
\hline
M41 & 870-6297-12398-12469-13656-15601 \\
\hline
\end{tabular}}
\end{table}
|
PMC1534032_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{OBS} & \textbf{SNP} & \textbf{N_h} & \textbf{CPA_H} & \textbf{s.e.} & \textbf{CPA_U} & \textbf{s.e.} & \textbf{CPA_G} & \textbf{s.e.} \\
\hline
1 & 680 & 13 & 1.259 & 0.032 & 1.221 & 0.014 & 1.252 & 0.022 \\
\hline
2 & 659 & 40 & 0.765 & 0.052 & 0.674 & 0.040 & 0.687 & 0.041 \\
\hline
3 & 696 & 42 & 0.662 & 0.032 & 0.632 & 0.032 & 0.634 & 0.032 \\
\hline
4 & 700 & 34 & 0.873 & 0.009 & 0.851 & 0.007 & 0.859 & 0.008 \\
\hline
5 & 645 & 44 & 1.771 & 0.007 & 1.788 & 0.006 & 1.749 & 0.007 \\
\hline
6 & 639 & 36 & 2.288 & 0.038 & 2.320 & 0.006 & 2.265 & 0.009 \\
\hline
\end{tabular}}
\end{table}
|
PMC1539032_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Authors} & \textbf{Year} & \textbf{Main findings} \\
\hline
Johnson et al. & 2004 & Germline stem cells are located within the ovarian epithelium and supply the adult mouse ovary with new oocytes. \\
\hline
Johnson et al. & 2005 & Germline stem cells are present in the circulation and supply the adult mouse ovary with new oocytes. \\
\hline
Byskov et al. & 2005 & Failed to find any BrdU positive oogonia within the ovarian epithelium and provided evidence to suggest that an overestimation of atretic follicle number contributed to Johnson et al.'s conclusions. \\
\hline
Oktay et al., & 2005 & Reported spontaneous pregnancy in presumably sterile patient following chemotherapy, hematopoeitic stem cell transplantation and ovarian tissue transplantation. \\
\hline
Bristol-Gould et al. & 2006 & Showed that follicle numbers gradually decline in the mouse ovary with age and used mathematical modeling to determine that de novo follicle production is not required to support fertility. \\
\hline
Eggan et al. & 2006 & Used parabiotic mice to show that ovulated oocytes do not come from circulating stem cells. \\
\hline
Kerr et al. & 2006 & Showed that follicle numbers remain constant in mouse ovaries from puberty to early mid-life, suggesting possible follicular renewal. \\
\hline
\end{tabular}}
\end{table}
|
PMC1553467_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Proteins} & \textbf{Value} & \textbf{Number of connections} & \textbf{GO Molecular Function annotation} \\
\hline
CLA4 (YNL298W) & -0.41 & 91 & protein serine/threonine kinase activity \\
\hline
FKS1 (YLR342W) & -0.34 & 90 & 1,3-beta-glucan synthase activity \\
\hline
ARP2 (YDL029W) & -0.09 & 88 & ATP binding; actin binding; structural constituent of cytoskeleton \\
\hline
SMI1 (YGR229C) & -0.05 & 82 & molecular function unknown \\
\hline
PHO85 (YPL031C) & 0.06 & 81 & cyclin-dependent protein kinase activity \\
\hline
RVS167 (YDR388W) & 0.83 & 92 & cytoskeletal protein binding \\
\hline
\end{tabular}}
\end{table}
|
PMC1557866_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Variable (unit)} & \textbf{Odds ratio (CI)*} \\
\hline
\multicolumn{2}{|l|}{Abnormally low semen count ($<$ 20 $\times$ 106)} \\
\hline
Abnormally low basal inhibin ($<$ 100 pg/ml) & 8.2 (1.4โ49.2) \\
\hline
Age (years) & 1.0 (0.92โ1.1) \\
\hline
Abstinence (days) & 1.0 (0.99โ1.0) \\
\hline
Fever in the last 2 months & 0.45 (0.07โ3.1) \\
\hline
Physical abnormality & 0.77 (0.1โ6.3) \\
\hline
R2 = 0.18, n = 34 \\
\hline
\end{tabular}}
\end{table}
|
PMC1560382_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Plasma (acyl)carnitine} & \textbf{Non Responders} & \textbf{Responders} & \textbf{P} \\
\hline
($\mu$mol/L) & Mean (SD) & Mean (SD) \\
\hline
Free carnitine & 36.6 (9.3) & 34.7 (8.3) & 0.374 \\
\hline
C2-carnitine & 5.9 (2.6) & 4.8 (1.7) & 0.023 \\
\hline
C3-carnitine & 0.34 (0.12) & 0.34 (0.15) & 0.970 \\
\hline
C4-carnitine & 0.23 (0.10) & 0.21 (0.11) & 0.415 \\
\hline
C8-carnitine & 0.11 (0.04) & 0.08 (0.04) & 0.078 \\
\hline
C14:1-carnitine & 0.07 (0.04) & 0.04 (0.03) & 0.083 \\
\hline
C16:1-carnitine & 0.05 (0.04) & 0.04 (0.02) & 0.323 \\
\hline
C18:1-carnitine & 0.16 (0.10) & 0.16 (0.14) & 0.907 \\
\hline
\end{tabular}}
\end{table}
|
PMC1562448_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{District (DHA only)} & \textbf{Service Expenditure (Cedis)} & \textbf{Service Expenditure (US\$)*} & \textbf{Service Expenditure per 100 people (US\$)} \\
\hline
\multicolumn{4}{|l|}{Northern} \\
\hline
Tamale municipal & 39,019, 000 & 4,758.41 & 1.62 \\
\hline
West Gonja & 41,930, 000 & 5,113.41 & 3.67 \\
\hline
West Mamprusi & 38,001,000 & 4,634.26 & 4.03 \\
\hline
Savelugu-Nanton & 29,427,000 & 3,588.65 & 3.99 \\
\hline
\multicolumn{4}{|l|}{Ashanti} \\
\hline
Kumasi Metro & 14,952, 607 & 1,823.49 & 0.16 \\
\hline
Amansie East & 14,156, 921 & 1,726.45 & 0.77 \\
\hline
Sekyere East & 14,096,000 & 1,719.02 & 1.09 \\
\hline
Asante-Akim North & 12,162,716 & 1,483.26 & 1.17 \\
\hline
Total & 203,745,244 & 24,846.95 \\
\hline
\end{tabular}}
\end{table}
|
PMC1563463_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Childhood workforce participation age 10โ15โ } & \textbf{Adult workforce participation age 30โ35} & \textbf{Adult workforce participation age 40โ45} & \textbf{Social mobility category*} & \textbf{Men n (\%)} & \textbf{Women n (\%)} \\
\hline
Inside & Inside & Inside & IR S, IA S & 35,951 (87.7) & 27,086 (68.3) \\
\hline
Inside & Inside & Outside & IR O, IA O & 1,850 (4.5) & 1,583 (4.0) \\
\hline
Inside & Outside & Inside & IR O, IA I & 980 (2.4) & 7,783 (19.6) \\
\hline
Inside & Outside & Outside & IR O, IA S & 485 (1.2) & 1,561 (3.9) \\
\hline
Outside & Outside & Outside & IR S, IA S & 42 (0.1) & 101 (0.3) \\
\hline
Outside & Outside & Inside & IR I, IA I & 63 (0.2) & 357 (0.9) \\
\hline
Outside & Inside & Outside & IR I, IA O & 110 (0.3) & 96 (0.2) \\
\hline
Outside & Inside & Inside & IR I, IA S & 1,491 (3.6) & 1,110 (2.8) \\
\hline
Total & & & & 40,972 (100) & 39,677 (100) \\
\hline
\end{tabular}}
\end{table}
|
PMC1569840_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Frequency (n = 46)} & \textbf{SRO1} & \textbf{Size (Mb)} & \textbf{Genomic position (Mb)} \\
\hline
\multicolumn{5}{|l|}{Losses} \\
\hline
8p & 67.4\% & 8p21.2-8p22 & 12.0 & 15.36โ27.36 \\
\hline
5q & 39.1\% & 5q13.1 5q13.2-5q13.3 5q21.1 5q22.2-5q23.1 & 0.6 2.1 2.0 7.7 & 66.79โ67.41 71.74โ73.87 99.03โ101.09 112.07โ119.75 \\
\hline
16q & 37.0\% & 16q12.1-16q12.2 16q22.2-16q22.3 16q23.3-16q24.1 & 4.1 1.7 3.6 & 49.70โ53.86 70.70โ72.37 81.20โ84.83 \\
\hline
6q & 34.8\% & 6q14.1-6q14.3 6q16.2-6q22.31 & 3.5 23.6 & 82.59โ86.12 99.38โ123.02 \\
\hline
10q & 32.6\% & 10q23.31 10q26.3 & 1.0 2.6 & 89.69โ90.69 130.01โ132.63 \\
\hline
13q & 32.6\% & 13q14.1-13q14.3 13q21.32-13q21.33 & 5.5 4.7 & 39.49โ45.03 66.42โ71.16 \\
\hline
17p & 30.4\% & 17p13.1-17p13.2 & 2.3 & 6.14โ8.49 \\
\hline
12p & 23.9\% & 12p13.2 & 1.9 & 10.93โ12.86 \\
\hline
\multicolumn{5}{|l|}{Gains} \\
\hline
8q & 30.4\% & 8q11.21-8q12.1 8q13.2-8q24.23 & 10.8 68.2 & 48.76โ59.73 68.36โ136.56 \\
\hline
7q & 21.7\% & 7q11.21-7q11.22 7q21.11-7q22.1 & 6.3 19.5 & 64.63โ71.01 80.26โ99.76 \\
\hline
\end{tabular}}
\end{table}
|
PMC1570364_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Patients with schizophrenia}} & \multicolumn{2}{|l|}{\textbf{Non-psychiatric subjects}} \\
\hline
& \textbf{BMI $<$ 28} & \textbf{$\geq$ BMI 28} & \textbf{BMI $<$ 28} & \textbf{$\geq$ BMI 28} \\
\hline
& N = 20 & N = 20 & N = 20 & N = 20 \\
\hline
Age (mean $\pm$ sd) & 31.7 $\pm$ 9.2 & 36.1 $\pm$ 8.9 & 33.9 $\pm$ 13.0 & 37.2 $\pm$ 8.1 \\
\hline
BMI (mean $\pm$ sd) & 23.6 $\pm$ 2.2 & 32.9 $\pm$ 6.1 & 21.1 $\pm$ 2.5 & 33.8 $\pm$ 4.9 \\
\hline
(N. female) & 9 & 10 & 13 & 8 \\
\hline
\end{tabular}}
\end{table}
|
PMC1570457_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Breast cancer N = 3593}} & \multicolumn{2}{|l|}{\textbf{BC controls N = 9098}} \\
\hline
\textbf{Age at diagnosis (mean, SD)} & \textbf{54.6} & \textbf{9.3} & \textbf{50.6} & \textbf{10.1} \\
\hline
& N & \% & N & \% \\
\hline
\multicolumn{5}{|l|}{Education} \\
\hline
University level & 1066 & 29.7 & 3215 & 35.3 \\
\hline
Lower education & 2483 & 69.1 & 5817 & 63.9 \\
\hline
\multicolumn{5}{|l|}{Age at menarche} \\
\hline
$<$ 13 years & 1926 & 53.6 & 4870 & 53.5 \\
\hline
13 + years & 1583 & 44.1 & 3998 & 43.9 \\
\hline
\multicolumn{5}{|l|}{Child bearing history} \\
\hline
0โ1 child & 1524 & 42.4 & 3358 & 36.9 \\
\hline
2+ children & 1992 & 55.4 & 5648 & 62.1 \\
\hline
\multicolumn{5}{|l|}{Age at first live birth} \\
\hline
$<$= 22 years & 1502 & 41.8 & 3821 & 42.0 \\
\hline
$>$ 22 years & 1626 & 45.3 & 4276 & 47.0 \\
\hline
Nulliparous \& no live birth & 367 & 10.2 & 840 & 9.2 \\
\hline
\multicolumn{5}{|l|}{Breast-feeding} \\
\hline
never & 1924 & 53.6 & 3957 & 43.5 \\
\hline
1 month and more & 1592 & 44.3 & 5047 & 55.5 \\
\hline
\multicolumn{5}{|l|}{OC use} \\
\hline
never & 1079 & 30.0 & 1805 & 19.8 \\
\hline
ever & 2508 & 69.8 & 7271 & 79.9 \\
\hline
\multicolumn{5}{|l|}{HRT use} \\
\hline
never & 2080 & 57.9 & 5910 & 65,0 \\
\hline
ever & 1513 & 42.1 & 3188 & 35.0 \\
\hline
\multicolumn{5}{|l|}{Family history of breast cancer} \\
\hline
No & 2453 & 68.3 & 8400 & 92.3 \\
\hline
Yes & 550 & 15.3 & 649 & 7.1 \\
\hline
\multicolumn{5}{|l|}{Body mass index} \\
\hline
$<$25 & 1415 & 39.4 & 4470 & 49.1 \\
\hline
25 + & 2152 & 59.9 & 4508 & 49.6 \\
\hline
\end{tabular}}
\end{table}
|
PMC1574290_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Study, location and reference} & \textbf{Number of Patients} & \textbf{Study Design} & \textbf{Age * (years)} & \textbf{CD4 Cell Count**} & \textbf{Vaccine strains} & & \textbf{Comparator} \\
\hline
Tasker 1999, USA, [26] & 102 & Randomized double blind, placebo controlled & 33 & 403.1 & A/Johannesburg/ 33/94 A/Texas/ 36/91 B/Harbin/ 07/94) & (H3N2), (HlNl), & Saline \\
\hline
Fine 2001, USA, [4] & 71 & Outbreak investigation & 38 & 149 & A/Nanchang/933/ 95(H3N2), A/ Texas/36/ 91(H1N1), B/ Harbin/07/94, York/83/ 97(H3N2) & A/New & None \\
\hline
Raineri 2005, Italy, [34] & 145 & Prospective nonrandomized & 20โ69 & -- & INFLEXAL V, Berna & & None \\
\hline
Yamanaka 2005, Japan, [27] & 328 & Prospective nonrandomized & 40.8 & 379 & A/New Caledonia/20/99 A/Panama/2007/ 99 B/Shanton/7/ 87 & (H1N1), (H3N2), & None \\
\hline
\end{tabular}}
\end{table}
|
PMC1574329_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Patient ID} & \textbf{Age (years)} & \textbf{Sex} & \textbf{Status} & \textbf{Atopy} & \textbf{FEV1 (L)} & \textbf{FEV1 \% pred} & \textbf{FVC (L)} \\
\hline
1 & 34 & M & Normal & NA & 4.5 & 110 & 6.2 \\
\hline
3 & 25 & M & Normal & A & 4.6 & 108 & 5.7 \\
\hline
4 & 27 & M & Normal & NA & 4.0 & 92 & 5.3 \\
\hline
5 & 24 & F & Normal & NA & 3.4 & 103 & 3.6 \\
\hline
6 & 25 & M & Normal & NA & 5.2 & 122 & 6.35 \\
\hline
8 & 39 & F & Normal & NA & 2.6 & 116 & 3.3 \\
\hline
9 & 25 & F & Normal & A & 3.6 & 100 & 4.0 \\
\hline
10 & 23 & F & Normal & A & 3.2 & 98 & 3.3 \\
\hline
14 & 27 & M & Normal & NA & 5.2 & 111 & 6.4 \\
\hline
17 & 27 & F & Normal & NA & 3.1 & 98 & 4.1 \\
\hline
2 & 32 & M & Asthmatic & A & 4.9 & 121 & 4.7 \\
\hline
7 & 32 & M & Asthma & A & 4.5 & 82 & 6.4 \\
\hline
11 & 27 & M & Asthmatic & A & 3.1 & 87 & 4.1 \\
\hline
12 & 25 & F & Asthmatic & A & 3.1 & 97 & 3.7 \\
\hline
13 & 24 & F & Asthmatic & A & 3.4 & 114 & 3.8 \\
\hline
15 & 27 & M & Asthmatic & NA & 3.9 & 95 & 5.4 \\
\hline
16 & 22 & F & Asthmatic & A & 2.9 & 102 & 3.6 \\
\hline
18 & 25 & M & Asthmatic & A & 3.3 & 79 & 4.7 \\
\hline
19 & 24 & F & Asthmatic & A & 2.9 & 94 & 3.4 \\
\hline
20 & 25 & F & Asthmatic & A & 3.7 & 104 & 4.2 \\
\hline
\end{tabular}}
\end{table}
|
PMC1579218_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Year} & \textbf{Estimated population\#} & \textbf{Birth cohort} & \textbf{Vaccination coverage*} & \textbf{Vaccine efficacy**} & \textbf{Children susceptible} & \textbf{Cumulated susceptible population} \\
\hline
1988 & 2,076,264 & 44,432 & 103.19\% & 85\% & 5,459 & 5,459 \\
\hline
1989 & 2,091,648 & 46,853 & 105.50\% & 85\% & 4,837 & 10,296 \\
\hline
1990 & 2,107,146 & 44,461 & 101.67\% & 85\% & 6,038 & 16,334 \\
\hline
1991 & 2,122,759 & 44,153 & 100.65\% & 85\% & 6,378 & 22,712 \\
\hline
1992 & 2,138,488 & 44,267 & 104.57\% & 85\% & 4,921 & 27,633 \\
\hline
1993 & 2,154,333 & 42,009 & 102.70\% & 85\% & 5,337 & 32,970 \\
\hline
1994 & 2,170,295 & 41,670 & 102.51\% & 85\% & 5,362 & 38,332 \\
\hline
1995 & 2,186,376 & 44,383 & 104.92\% & 85\% & 4,803 & 43,135 \\
\hline
1996 & 2,202,576 & 42,289 & 101.57\% & 85\% & 5,779 & 48,913 \\
\hline
1997 & 2,218,896 & 42,603 & 100.74\% & 85\% & 6,124 & 55,037 \\
\hline
1998 & 2,235,337 & 42,918 & 99.28\% & 85\% & 6,700 & 61,737 \\
\hline
1999 & 2,251,900 & 43,462 & 101.25\% & 85\% & 6,058 & 67,795 \\
\hline
2000 & 2,268,586 & 43,784 & 101.13\% & 85\% & 6,148 & 73,944 \\
\hline
2001 & 2,285,395 & 44,108 & 105.18\% & 85\% & 4,674 & 78,617 \\
\hline
2002 & 2,302,329 & 44,435 & 102.56\% & 85\% & 5,697 & 84,314 \\
\hline
2003 & 2,319,388 & 44,764 & 101.46\% & 85\% & 6,159 & 90,473 \\
\hline
2004 & 2,336,574 & 45,096 & 99.57\% & 85\% & 6,928 & 97,401 \\
\hline
\end{tabular}}
\end{table}
|
PMC1586205_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{n} & \textbf{\# code words โ 4n/2} & \textbf{Coloring bound} & \textbf{Sphere packing bound} \\
\hline
3 & 32 & 18 & 3 \\
\hline
4 & 128 & 42 & 9 \\
\hline
5 & 512 & 95 & 32 \\
\hline
6 & 2,048 & 210 & 107 \\
\hline
7 & 8,192 & 460 & 372 \\
\hline
8 & 32,768 & 994 & 1310 \\
\hline
\end{tabular}}
\end{table}
|
PMC1590034_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Fruit intake} & \textbf{N} & \textbf{$\beta$a} & \textbf{95\% CI} & \textbf{Vegetable intake N} & \textbf{$\beta$b} & \textbf{95\% CI} \\
\hline
\\
\hline
Model 1 & boys & 249 & 0.02 & -0.21; 0.25 \\
\hline
& girls & 280 & 0.37 & 0.15; 0.59 & 529 & 0.97 & 0.89; 1.04 \\
\hline
Model 2 & boys & 196 & -0.05 & -0.34; 0.25 \\
\hline
& girls & 227 & 0.25 & 0.00; 0.50 & 423 & 1.01 & 0.92; 1.11 \\
\hline
\end{tabular}}
\end{table}
|
PMC1599740_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
Class & \multicolumn{14}{|l|}{3 1065 [336]} \\
\hline
Subclass & 3.1 267 [113] & \multicolumn{2}{|l|}{3.2 163 [56]} & 3.3 10 [4] & 3.4 317 [49] & 3.5 171 [70] & 3.6 109 [36] & 3.7 10 [4] & 3.8 10 [1] & 3.9 1 [1] & 3.10 2 [1] & 3.11 2 [0] & 3.12 1 [1] & 3.13 2 [0] \\
\hline
Sub- subclass & & 3.2.1 140 [45] & 3.2.2 23 [11] \\
\hline
\end{tabular}}
\end{table}
|
PMC1609188_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{No. of patients (n = 34)}} \\
\hline
\textbf{Sex} \\
\hline
Male/Female & 23/11 \\
\hline
\multicolumn{2}{|l|}{Age (years)} \\
\hline
Median/Range & 57/15โ90 \\
\hline
\multicolumn{2}{|l|}{Site of involvement and} \\
\hline
Conjunctiva the & 9 \\
\hline
Orbit the & 21 \\
\hline
Lachrymal gland & 4 \\
\hline
\multicolumn{2}{|l|}{in Laterality} \\
\hline
Right & 13 \\
\hline
Left & 13 \\
\hline
Bilateral & 8 \\
\hline
\multicolumn{2}{|l|}{Stage neg-} \\
\hline
I, II was & 31 \\
\hline
III, IV & 3 \\
\hline
LDH$>$normal as & 5 \\
\hline
\multicolumn{2}{|l|}{Initial therapy* and} \\
\hline
Radiation & 21 \\
\hline
Chemotherapy & 3 \\
\hline
Chemotherapy + Radiation & 3 \\
\hline
Observation & 5 \\
\hline
\end{tabular}}
\end{table}
|
PMC1630703_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Sample} & \textbf{M} & \textbf{N} & \textbf{H} & \textbf{AA \%} & \textbf{DNA \%} & \textbf{dN/dS} & \textbf{PNGS} & \textbf{V1V5 length} & \textbf{Co-receptor usage} & \textbf{Cause of death} \\
\hline
1449 i02m & 2 & 26 & 21 & 0.6 & 0.3 & 0.71 & 21(18โ21) & 330(330-330) & CCR5 \\
\hline
1449 i04m & 4 & 44 & 37 & 1.1 & 0.5 & 1.15 & 21(20โ22) & 330(323โ330) \\
\hline
1449 i08m & 8 & 43 & 42 & 1.9 & 0.8 & 1.37 & 21(19โ23) & 328(327โ330) & CCR5 & Pneumonia \\
\hline
2669 i02m & 2 & 30 & 29 & 1.1 & 0.6 & 0.61 & 25(23โ25) & 339(335โ339) & CCR5 \\
\hline
2669 i06m & 6 & 33 & 33 & 1.3 & 0.7 & 0.66 & 25(23โ26) & 337(329โ339) & CCR5 & Bronchitis \\
\hline
2873 i02m & 2 & 29 & 26 & 1.2 & 0.6 & 0.91 & 28(27โ29) & 356(356-356) & CCR5 \\
\hline
2873 i04m & 4 & 29 & 27 & 1.0 & 0.5 & 0.77 & 28(27โ28) & 356(356-356) & CCR5 & Tuberculosis \\
\hline
2617 i02m & 2 & 27 & 27 & 1.1 & 0.6 & 0.52 & 23(22โ24) & 336(336-336) \\
\hline
2617 i04m & 4 & 23 & 23 & 1.3 & 0.8 & 0.41 & 23(22โ24) & 336(336-336) \\
\hline
2617 i06m & 6 & 26 & 26 & 1.8 & 1.0 & 0.69 & 24(23โ24) & 336(336-336) & CCR5 & Pyrexia \\
\hline
1984 i04m & 4 & 25 & 25 & 2.1 & 1.0 & 0.97 & 21(19โ22) & 343(343-343) \\
\hline
1984 i06m & 6 & 27 & 26 & 1.7 & 0.7 & 1.21 & 22(20โ24) & 342(332โ343) & CCR5 \\
\hline
1984 i12m & 12 & 27 & 27 & 2.8 & 1.3 & 0.94 & 23(21โ24) & 340(331โ343) & CCR5 \\
\hline
1984 i24m & 24 & 26 & 26 & 4.2 & 2.0 & 0.98 & 24(22โ26) & 329(325โ340) & CCR5 \\
\hline
1984 i36m & 36 & 29 & 27 & 5.4 & 2.6 & 1.04 & 24(22โ26) & 332(326โ341) & CCR5 \\
\hline
1984 i48m & 48 & 26 & 26 & 6.6 & 3.3 & 1.02 & 24(22โ26) & 331(323โ344) & CCR5 \\
\hline
1084 i06m & 6 & 25 & 25 & 2.4 & 1.2 & 0.68 & 21(19โ23) & 319(319โ328) \\
\hline
1084 i27m & 27 & 28 & 28 & 1.3 & 0.7 & 0.65 & 25(24โ25) & 328(328-328) & CCR5 \\
\hline
1084 i36m & 36 & 25 & 24 & 5 & 2.6 & 1.1 & 25(22โ28) & 336(325โ344) & CCR5 \\
\hline
1084 i48m & 48 & 48 & 40 & 8.9 & 4.9 & 0.76 & 27(18โ28) & 344(325โ344) & CCR5 \\
\hline
1690 i12m & 12 & 28 & 28 & 1.8 & 1.0 & 0.71 & 26(23โ27) & 338(331โ339) & CCR5 \\
\hline
1690 i24m & 24 & 31 & 31 & 2.1 & 1.1 & 0.65 & 23(22โ25) & 329(325โ336) \\
\hline
1690 i36m & 36 & 30 & 30 & 3.0 & 1.7 & 0.72 & 23(19โ25) & 327(319โ338) \\
\hline
1690 i48m & 48 & 26 & 26 & 4.4 & 2.2 & 1.01 & 24(23โ26) & 336(331โ341) & CXCR4/CCR5 \\
\hline
\end{tabular}}
\end{table}
|
PMC1635063_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Author} & \textbf{Condition} & \textbf{QUADAS Score} \\
\hline
Laslett et al [8] & Sacroiliac Joint Pain/Dysfunction & 12 \\
\hline
Laslett et al [9] & Sacroiliac Joint Pain/Dysfunction & 11 \\
\hline
Shah \& Rajshekhar [10] & Soft Cervical Disc Prolapse & 11 \\
\hline
Wainner et al [16] & Cervical Radiculopathy & 11 \\
\hline
Dreyfuss et al [13] & Sacroiliac Joint Pain/Dysfunction & 10 \\
\hline
Poiraudeau et al [14] & Lumbar Disc Herniation & 10 \\
\hline
Glaser et al [17] & Cervical Spinal Cord Compression & 9 \\
\hline
Mens et al [19] & Posterior Pelvic Pain since Pregnancy & 9 \\
\hline
Viikari-Juntura, Porras \& Laasonen [20] & Cervical Radiculopathy & 9 \\
\hline
Cote et al [21] & Scoliosis & 8 \\
\hline
Cote et al [12] & Vertebrobasilar Blood Flow & 8 \\
\hline
Broadhurst \& Bond [11] & Sacroiliac Joint Pain/Dysfunction & 7 \\
\hline
Siminoski et al [15] & Lumbar Vertebral Fractures & 7 \\
\hline
Kosteljanetz, Bang \& Schmidt-Olsen [22] & Lumbar Disc Prolapse & 7 \\
\hline
Thomas et al [24] & Meningitis & 7 \\
\hline
Tong, Haig \& Yamakawa [25] & Cervical Radiculopathy & 7 \\
\hline
Leboeuf [18] & Lumbopelvic Pain/Dysfunction & 6 \\
\hline
Lauder et al [23] & Lumbosacral Radiculopathy & 6 \\
\hline
Karachalios et al [26] & Scoliosis & 5 \\
\hline
Sandmark \& Nisell [27] & Cervical Spine/Neck Pain & 4 \\
\hline
Albert, Godskesen \& Westergaard [28] & Posterior Pelvic Pain since Pregnancy & 4 \\
\hline
\end{tabular}}
\end{table}
|
PMC1635718_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Authors} & \textbf{No. of Subjects} & \textbf{Test} & \textbf{Sensitivity (\%)} & \textbf{Specificity (\%)} & \textbf{QUADAS Score} \\
\hline
Thomas et al [24] & 297 & Kernig & 5* & 95* \\
\hline
& & & 9** & 96** & 7 \\
\hline
& & & 0*** & 95*** \\
\hline
& & Brudzinski & 5* & 95* \\
\hline
& & & 9** & 96** \\
\hline
& & & 25** & 96** \\
\hline
\end{tabular}}
\end{table}
|
PMC1635718_table_7
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Village} & \textbf{Paddy category} & \textbf{No. of Habitats} & \textbf{1stinstars} & \textbf{2nd instars} & \textbf{3rd instars} & \textbf{4th instars} & \textbf{Pupae} \\
\hline
Kangichiri & Ploughed & 25 & 1.41 & 0.95 & 0.09 & 0.00 & 0.36 \\
\hline
& Flooded & 23 & 1.67 & 1.10 & 0.30 & 0.00 & 0.36 \\
\hline
& Post transplanting & 30 & 6.02 & 3.00 & 1.89 & 1.20 & 0.99 \\
\hline
& Tillering & 28 & 8.00 & 6.67 & 2.00 & 3.22 & 0.67 \\
\hline
& Flowering/ maturation & 27 & 0.01 & 0.00 & 0.02 & 0.01 & 0.00 \\
\hline
& Fallow & 27 & 1.00 & 0.67 & 0.00 & 0.00 & 0.01 \\
\hline
Kiuria & Ploughed & 22 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Flooded & 23 & 1.23 & 0.65 & 0.07 & 0.01 & 0.0 \\
\hline
& Post transplanting & 21 & 5.58 & 1.63 & 0.17 & 0.51 & 0.19 \\
\hline
& Tillering & 22 & 8.50 & 5.25 & 0.25 & 0.25 & 1.25 \\
\hline
& Flowering/ maturation & 20 & 0.02 & 0.00 & 0.01 & 0.0 & 0.00 \\
\hline
& Fallow & 14 & 0.03 & 0.01 & 0.0 & 0.01 & 0.00 \\
\hline
Rurumi & Ploughed & 18 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Flooded & 21 & 1.56 & 1.28 & 0.09 & 0.06 & 0.19 \\
\hline
& Post transplanting & 20 & 5.73 & 3.37 & 1.17 & 1.03 & 0.47 \\
\hline
& Tillering & 20 & 4.91 & 4.67 & 1.19 & 1.11 & 1.00 \\
\hline
& Flowering/ maturation & 15 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Fallow & 12 & 1.17 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
\end{tabular}}
\end{table}
|
PMC1636646_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Characteristic} & & & & \multicolumn{3}{|l|}{\textbf{No NASH vs Borderline or NASH}} & \multicolumn{3}{|l|}{\textbf{NASH vs Borderline or No NASH}} \\
\hline
& \textbf{No NASH n = 98} & \textbf{Borderline NASH n = 96} & \textbf{NASH n = 63} & \textbf{Univariate analysis P-value} & \textbf{Multivariate analysis P value} & \textbf{Odds Ratio (95\% CI)} & \textbf{Univariate analysis P-value} & \textbf{Multivariate analysis P value} & \textbf{Odds Ratio (95\% CI)} \\
\hline
\multicolumn{10}{|l|}{Demographics} \\
\hline
Age at biopsy, years & 49.4 (1.2) & 51.4 (1.2) & 53.8 (1.5) & 0.045 & 0.75 & 1.00 (0.97;1.04) & 0.04 & 0.99 & 1.00 (0.97;1.33) \\
\hline
Male gender & 56/98 (57\%) & 66/96 (69\%) & 31/63 (49\%) & 0.54 & 0.82 & 1.10 (0.48;2.56) & 0.054 & 0.04 & 2.54 (1.03;6.26) \\
\hline
Weight, kg & 75.2 (1.4) & 86.8 (1.4) & 82.3 (1.8) & $<$ 0.0001 & $<$ 0.0001 & 1.06 (1.03;1.08) & 0.25 & 0.86 & 1.00 (0.97;1.02) \\
\hline
Height, meter & 1.68 (0.01) & 1.69 (0.01) & 1.67 (0.01) & 0.87 & 0.15 & 0.03 (0.00;3.34) & 0.22 & 0.66 & 0.33 (0.00;47.2) \\
\hline
\multicolumn{10}{|l|}{Biochemical markers} \\
\hline
$\alpha$2-macroglobulin, g/L & 1.58 (0.07) & 1.73 (0.07) & 1.86 (0.08) & 0.02 & 0.15 & 0.33 (0; 1050) & 0.01 & 0.16 & 0.72 (0.46;1.14) \\
\hline
ALT, IU/L & 67 (5) & 74 (5) & 88 (6) & 0.005 & 0.90 & 1.00 (0.99;1.01) & 0.004 & 0.24 & 0.99 (0.99;1.00) \\
\hline
AST, IU/L & 40 (3) & 48 (3) & 60 (4) & 0.0004 & 0.007 & 1.02 (1.01;1.04) & 0.001 & 0.25 & 0.99 (0.98;1.01) \\
\hline
Apolipoprotein A1, g/L & 1.61 (0.05) & 1.43 (0.05) & 1.50 (0.06) & 0.08 & 0.27 & 0.53 (0.17;1.67) & 0.62 & 0.71 & 1.14 (0.57;2.28) \\
\hline
Haptoglobin, g/L & 1.14 (0.10) & 1.11 (0.07) & 1.02 (0.09) & 0.87 & 0.50 & 0.83 (0.47;1.44) & 0.41 & 0.18 & 1.56 (0.81;2.99) \\
\hline
GGT, IU/L & 133 (14) & 98 (14) & 128 (17) & 0.002 & 0.005 & 1.00 (0.993;0.998) & 0.48 & 0.37 & 1.00 (0.998;1.00) \\
\hline
Total bilirubin, $\mu$mol/L & 11.2 (0.6) & 12.0 (0.6) & 12.5 (0.8) & 0.87 & 0.22 & 1.04 (0.98;1.09) & 0.30 & 0.35 & 0.98 (0.93;1.02) \\
\hline
Glucose mmol/L & 5.5 (0.2) & 6.0 (0.2) & 7.2 (0.3) & 0.005 & 0.05 & 1.20 (0.999;1.45) & $<$ 0.0001 & 0.0009 & 0.77 (0.67;0.90) \\
\hline
Cholesterol mmol/L & 5.4 (0.1) & 5.5 (0.1) & 5.4 (0.2) & 0.68 & 0.25 & 1.17 (0.90;1.53) & 0.77 & 0.95 & 1.01 (0.78;1.30) \\
\hline
Triglycerides & 1.4 (0.2) & 2.0 (0.2) & 2.0 (0.2) & $<$ 0.0001 & 0.23 & 1.19 (0.90;1.57) & 0.007 & 0.90 & 1.01 (0.83;1.24) \\
\hline
FibroTest & 0.25 (0.02) & 0.31 (0.01) & 0.35 (0.02) & 0.03 & Not included & Not included & 0.008 & Not included & Not included \\
\hline
SteatoTest & 0.60 (0.02) & 0.70 (0.02) & 0.72 (0.03) & $<$ 0.0001 & Not included & Not included & 0.007 & Not included & Not included \\
\hline
\end{tabular}}
\end{table}
|
PMC1657015_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Citation} & \textbf{Intervention} & \textbf{Study Population Total (Control/Intervention)} & \textbf{Follow-up \& Assessment method} & \textbf{Outcomes} \\
\hline
Cline et al. (Sweden) & Education on heart failure for patients and their families. Guidelines for self- management of diuretics based on signs and symptoms and instructions on when to contact the nurse. Provision of 7-day medication organizer. Nurse counselling: 2 $\times$ 30 min during hospitalization, 1 $\times$ 1 hr after discharge & N = 190 (110/80) Male: 53\% Mean age: 75.6 Age range: 65โ84 Mean NYHA: 2.6 & 1 year; Self-administered questionnaires, hospital records & Readmission, hospitalization days, health care costs during one year, quality of life, mortality \\
\hline
Jaarsma et al. (Netherlands) & Education about consequences of heart failure and guidelines for compliance, fluid balance, recognition of warning symptoms. Counselling: Average of 4 sessions during hospitalization, 1 phone call \& 1 home visit after discharge NOTE: control group received education about medication and lifestyle & N = 179 (95/84) Male: 58\% Mean age: 73. NYHA III: 17\% NYHA III-IV: 21\%, NYHA IV: 61\%. & 1, 3, 9 months; Patient interviews, questionnaires & Self-care abilities, self-care behaviour, quality of life, overall wellbeing, readmission, hospitalization days, resource utilization. \\
\hline
Koelling et al. (U.S.) & Education (1 hour), provision of instructions for taking medications, weighing, dietary restrictions \& symptom monitoring, including when to contact physicians & N = 223 (116/107) Male: 58\% Mean age: 65 Black: 22\% Coronary disease 64\% & 6 months; Phone call from nurse at 1, 3 and 6 months & Readmission (heart failure, cardiac and all-cause), mortality, cost of care, self- practice scores. \\
\hline
Krumholz et al. (U.S.) & Education about illness, medication, early signs \& symptoms, health behaviour, when to seek help. Weekly phone call for 4 weeks, biweekly for 8 weeks, monthly for the remainder of the year & N = 88 (44/44) Male: 66/48\% Mean age: 71.6/75.9 White: 77/70\% & 1 Year; Review of records, next of kin contact, discharge information & Readmission (heart failure, cardiovascular disease and all- cause), hospitalization days, mortality, cost of care. \\
\hline
Ross et al. (U.S.) & Educational software, a messaging system enabling communication between patients and staff & N = 107 (53/54) Male: 74/80\% Mean age: 55/57 College: 44/53\% (v. decliners: 26\%) White: 88/92\% (v. 75\% decliners) Household income $>$\$45 K: 50/56\% (v. 76\% decliners). & 6 months, 1 Year; Mailed survey & Readmission, mortality, health status, self-efficacy, adherence to medical advice and patient satisfaction. \\
\hline
Sethares \& Elliot (U.S.) & Nurse-led tailored message intervention based on perceived benefits and barriers to self-care of HF. Follow-up 1 week and 1 month after discharge NOTE: Patients in the control group were given information about medication and possibly referred to nurse agencies & N = 70 (37/33) Mean Age: 76.8/75.7 Mean NYHA: 3.0 Education (years): 11/11 & 3 months; Health-measure scales & Readmission, quality of life, beliefs in benefits and barriers of treatment. \\
\hline
\end{tabular}}
\end{table}
|
PMC1660572_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Heifers}} & \multicolumn{2}{|l|}{\textbf{Cows}} \\
\hline
\textbf{Pathogens} & \textbf{\%} & \textbf{n} & \textbf{\%} & \textbf{n} \\
\hline
E.coli* & 22.1 & 15 & 6.6 & 20 \\
\hline
Str. uberis* & 19.1 & 13 & 9.9 & 30 \\
\hline
CNS & 8.8 & 6 & 7.3 & 22 \\
\hline
Lactococcus lactis & 4.4 & 3 & 5.0 & 15 \\
\hline
Klebisella spp. & 4.4 & 3 & 2.3 & 7 \\
\hline
Str. spp & 2.9 & 2 & 3 & 9 \\
\hline
Enterococcus spp & 2.9 & 2 & 2.3 & 7 \\
\hline
Pseudomonas spp & 2.9 & 2 & 0.7 & 2 \\
\hline
S.aureus* & 1.5 & 1 & 11.2 & 34 \\
\hline
Arcanobacterium spp & 1.5 & 1 & 2.6 & 8 \\
\hline
Str.dysgalactiae & 1.5 & 1 & 3.6 & 11 \\
\hline
Corynebacterium spp & 0 & 0 & 2.0 & 6 \\
\hline
Str. agalactiae & 0 & 0 & 3.3 & 10 \\
\hline
Candida spp & 0 & 0 & 1.3 & 4 \\
\hline
No growth & 25 & 17 & 29.4 & 89 \\
\hline
Mixed culture & 2.9 & 2 & 9.6 & 29 \\
\hline
Total & 100.0 & 68 & 100.0 & 303 \\
\hline
\end{tabular}}
\end{table}
|
PMC1687189_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Hybridization ID} & \textbf{ArrayDesign REF} & \textbf{ArrayData URI} & \textbf{DerivedArrayData Matrix URI} \\
\hline
Hyb 1 & SMD-10K & 1.txt & FGDM.txt \\
\hline
Hyb 2 & SMD-10K & 2.txt & FGDM.txt \\
\hline
Hyb 3 & SMD-10K & 3.txt & FGDM.txt \\
\hline
\end{tabular}}
\end{table}
|
PMC1687205_table_6
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Respondents}} & \multicolumn{2}{|l|}{\textbf{Dropouts}} \\
\hline
\textbf{Characteristics at baseline} & \textbf{N} & \textbf{\%} & \textbf{N} & \textbf{\%} \\
\hline
\multicolumn{5}{|l|}{Age (years)} \\
\hline
$<$ 30 & 273 & 6.7 & 137 & 13.7 \\
\hline
30โ39 & 824 & 20.2 & 221 & 22.1 \\
\hline
40โ49 & 1778 & 43.6 & 338 & 33.8 \\
\hline
50โ59 & 1065 & 26.1 & 265 & 26.5 \\
\hline
$>$ 59 & 136 & 3.3 & 39 & 3.9 \\
\hline
\multicolumn{5}{|l|}{Gender} \\
\hline
Female & 3912 & 96.0 & 947 & 94.9 \\
\hline
Male & 164 & 4.0 & 51 & 5.1 \\
\hline
\multicolumn{5}{|l|}{Marital status} \\
\hline
Married or cohabiting & 3271 & 80.3 & 771 & 77.3 \\
\hline
Single & 800 & 19.7 & 227 & 22.7 \\
\hline
\multicolumn{5}{|l|}{Have preschool children} \\
\hline
No & 3490 & 87.0 & 843 & 85.8 \\
\hline
Yes & 522 & 13.0 & 140 & 14.2 \\
\hline
\multicolumn{5}{|l|}{Special tasks of care taking during leisure time โ } \\
\hline
No & 2944 & 72.6 & 721 & 72.6 \\
\hline
Yes & 1112 & 27.4 & 272 & 27.4 \\
\hline
\multicolumn{5}{|l|}{Pregnant} \\
\hline
No & 3978 & 99.1 & 955 & 98.0 \\
\hline
Yes & 37 & 0.9 & 19 & 2.0 \\
\hline
\multicolumn{5}{|l|}{Long-term health problems (any kind)} \\
\hline
No or "yes, but not bothered" & 3006 & 74.4 & 736 & 74.4 \\
\hline
Yes, and bothered by it & 1033 & 25.6 & 253 & 25.6 \\
\hline
\multicolumn{5}{|l|}{Regular physical exercise} \\
\hline
No & 1724 & 42.4 & 451 & 45.2 \\
\hline
Yes & 2343 & 57.6 & 547 & 54.8 \\
\hline
\multicolumn{5}{|l|}{Years of experience as nurses' aide} \\
\hline
$<$ 10 years & 706 & 17.3 & 235 & 23.5 \\
\hline
10 years or more & 3370 & 82.7 & 764 & 76.5 \\
\hline
\end{tabular}}
\end{table}
|
PMC1693921_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{\# of carbons} & \textbf{Flavone} & \textbf{Product(s) and yields (\%)} & \textbf{Ref.} \\
\hline
15 & 5,7-dihydroxyflavone & 5,7-dihydroxyflavone-8-sulfate, 43 & [71] \\
\hline
22 & 5-hydroxy-7-benzyloxyflavone & 5,8-dihydroxy-7-benzyloxyflavone, - & [72] \\
\hline
\end{tabular}}
\end{table}
|
PMC1697820_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{4} & \multicolumn{4}{|l|}{\textbf{Dose of ifosfamide}} \\
\hline
\textbf{9} & \textbf{g/m2 10} & \textbf{g/m2 12} & \textbf{g/m2 13} & \textbf{g/m2 14} \\
\hline
Hemoglobin 60 & 21/7 & 20/3 & 9/4.5 & 36/9 \\
\hline
Leukocytes 67 & 18/57 & 19/42 & 41/23 & 27/45 \\
\hline
Granulocytes 19 & 0/71 & 19/46 & 9/45 & 9/63 \\
\hline
Platelets & 46/11 & 14/9 & 9/9 & 0/36 \\
\hline
\end{tabular}}
\end{table}
|
PMC1698138_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Control} & \textbf{Day 1 ICUa} & \textbf{Day 7 ICUb} \\
\hline
ADMA & 0.63 (0.57โ0.71) & 0.89 (0.57โ1.09) & 1.05 (0.71โ1.32) \\
\hline
\end{tabular}}
\end{table}
|
PMC1751072_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
TBST+ (Subjects) & 47 & 102 \\
\hline
TBST- (Controls) & 78 & 142 \\
\hline
\end{tabular}}
\end{table}
|
PMC1764018_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Dengue serotype} & \multicolumn{3}{|l|}{\textbf{Data retrieved in 2004}} & \multicolumn{3}{|l|}{\textbf{Data retrieved in 2005}} \\
\hline
& \textbf{Unique sequences (\#)} & \multicolumn{2}{|l|}{\textbf{Minimal antigenic set}} & \textbf{Unique sequences (\#)} & \multicolumn{2}{|l|}{\textbf{Minimal antigenic set}} \\
\hline
& & \textbf{Unique sequences (\#)*} & \textbf{Percentage of unique sequences (\%)**} & & \textbf{Unique sequences (\#)*} & \textbf{Percentage of unique sequences (\%)**} \\
\hline
DV1 & 359 & 244 & 68\% & 724 & 493 & 68\% \\
\hline
DV2 & 507 & 368 & 73\% & 697 & 466 & 67\% \\
\hline
DV3 & 230 & 180 & 78\% & 678 & 482 & 71\% \\
\hline
DV4 & 222 & 177 & 80\% & 320 & 243 & 76\% \\
\hline
Total & 1318 & 969 & 74\% & 2419 & 1684 & 70\% \\
\hline
\end{tabular}}
\end{table}
|
PMC1764481_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Author} & \textbf{Cases} & \textbf{Cause} & \textbf{Therapy} & \textbf{Outcome} & \textbf{Comments} \\
\hline
Smrkolj V. 1995 & two & Homicidal attempt & Surgery & Died & Left hemiplegia, right internal carotid artery thrombosis \\
\hline
& & Suicidal attempt & Surgery & Died & Brain edema and right anterior cerebral artery infarction \\
\hline
Anderson S.A. 1996 & one & Suicidal attempt & No surgery & Survived & Right orbital injury No deficits \\
\hline
Evans R.J. 1996 & one & Accident & No surgery & Died & Hard palate impalement \\
\hline
Li T. 2000 & one & Homicidal attempt & No surgery & Died & Two weeks later: basilar-cavernous fistula and basilar artery aneurysm \\
\hline
Tutton M.G. 2000 & four & Homicidal attempt & No surgery & Survived & Left parietal hemorrhage involving lateral ventricles; right hemiplegia, mild dysphasia \\
\hline
& & & No surgery & Survived & Intracerebral haematoma in the left frontal lobe with an overlying skull vault fracture \\
\hline
& & & Surgery & Died & Depression of the left temporal fossa with acute sub-dural hemorrhage (died two days after surgery) \\
\hline
& & & No Surgery & Died & Tip of the screwdriver penetrated into the brain stem \\
\hline
Wong S.C. 2002 & one & Accident & No surgery & Survived & Traumatic optic neuropathy \\
\hline
De Tommasi A. 2006 & one & Accident & Surgery & Survived & No deficits \\
\hline
\end{tabular}}
\end{table}
|
PMC1766346_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Marker spacing (kb)} & \textbf{|D'|} & \textbf{number of markers} \\
\hline
6.6 kb & 0.88 & 500 k \\
\hline
20 kb & 0.73 & 166 k \\
\hline
33 kb & 0.64 & 100 k \\
\hline
100 kb & 0.45 & 33 k \\
\hline
166 kb & 0.36 & 20 k \\
\hline
\end{tabular}}
\end{table}
|
PMC1766938_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Motif} & \textbf{Zg-score} & \textbf{Z -score} & \textbf{G -score} & \textbf{Number of occurrences} & \textbf{Number of promoters} & \textbf{Known motifs} \\
\hline
\multicolumn{7}{|l|}{Word cluster 1:} \\
\hline
TTGGCGCCTC(-) & 3.768 & 11.6 & 0.633 & 4 & 4 & E2F(TTTYYCGYY) \\
\hline
TTTGGCGCCT(-) & 4.384 & 9.5 & 0.438 & 5 & 5 & E2F(TTTYYCGYY) \\
\hline
TGGCGCC(*) & 3.006 & 5.6 & 0.255 & 20 & 20 & E2F(TTTYYCGYY) \\
\hline
\multicolumn{7}{|l|}{Word cluster 2:} \\
\hline
TTTCCCGCCA(-) & -0.598 & 12.9 & 0.508 & 6 & 5 & E2FANTRNR(TTTCCCGC) \\
\hline
TTTCCCGCC(+) & -0.613 & 4.7 & 0.289 & 5 & 5 & E2FANTRNR(TTTCCCGC) \\
\hline
TTCCCGC(+) & 0.236 & 5.7 & 0.285 & 36 & 32 & E2FANTRNR(TTTCCCGC) \\
\hline
TTTCCCGCT(+) & 0.227 & 4.3 & 0.273 & 7 & 7 & E2FANTRNR(TTTCCCGC) \\
\hline
\end{tabular}}
\end{table}
|
PMC1779545_table_1
|
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 1