image imagewidth (px) 210 933 | latex stringlengths 165 6.04k | filename stringlengths 17 19 |
|---|---|---|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
Group ID & Age (yrs) & PTA-L (dB) & PTA-R (dB) & VCV in Quiet (dB) \\
\hline
HI02 & 34.8 & 43.3 & 50.0 & n/a \\
\hline
HI08 & 21.2 & 55.0 & 55.0 & n/a \\
\hline
HI09 & 56.1 & 43.3 & 40.0 & 59.6 \\
\hline
HI10 & 53.7 & 41.7 & 38.3 & 57.5 \\
\hline
HI13 &... | PMC4856319_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Code} & \textbf{Value} & \textbf{\%agea} & \textbf{Description} \\
\hline
J & 161 & 9.7 & Translation \\
\hline
A & 2 & 0.1 & RNA processing and modification \\
\hline
K & 59 & 3.5 & Transcription \\
\hline
L & 72 & 4.3 & Replication, recombinatio... | PMC3236042_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Field devices for drought study} & \textbf{Cost} & \textbf{Strengths} & \textbf{Limitations} & \textbf{Suitable climate and soils} & \textbf{Reference} \\
\hline
Late planting with drainage in rainy season trial & Large uniform field managemen... | PMC3429056_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Category} & \textbf{Gender} & \multicolumn{2}{|l|}{\textbf{Age}} & \textbf{Nutritional classification} \\
\hline
& \textbf{Female a OR (95\%CI)} & \textbf{20 to 23 years b OR (95\%CI)} & \textbf{$>$23 years b OR (95\%CI)} & \textbf{BMI $>$ 25.1... | PMC4478172_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \textbf{2001 IHM (\%)} & \textbf{2002 IHM (\%)} & \textbf{2003 IHM (\%)} & \textbf{2004 IHM (\%)} & \textbf{2005 IHM (\%)} & \textbf{2006 IHM (\%)} & \textbf{2007 IHM (\%)} & \textbf{2008 IHM (\%)} & \textbf{p*} \\
\hline
\\
\hline
40... | PMC3041728_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Microbes} & & \textbf{dVIN-Sample1 (vulvar tissue)} & \textbf{Negative Control (vulvar tissue)} & \textbf{Positive Control (HHV3-positive cerebrospinal fluid)} \\
\hline
\multicolumn{5}{|l|}{Virus} \\
\hline
& Anelloviridae & 30 & 25 & 107,433... | PMC4404153_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Response variable} & \textbf{Models} & \textbf{Intercept (a)} & \textbf{Slope} & \textbf{Phi} & \textbf{AICc} & \textbf{$\Delta$ AICc} & \textbf{Weight} & \textbf{Pseudo-R²} \\
\hline
Species Richness (S) & a + b*logAREA & 2.626 (0.151) ... | PMC5736758_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Author (year)} & \textbf{Age} & \textbf{Symptoms} & \textbf{Histology} & \textbf{Outcome} \\
\hline
Beaver (1986) [34] & 73 & Cholecystitis & Lobular & NM \\
\hline
Rubin (1989) [43] & 55 & Biliary colic & Lobular & NM \\
\hline
Pappo (1991) [44... | PMC2944133_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Adults} & \textbf{Children} \\
\hline
Number (\% of total) & 659 (91\%) & 65 (9\%) \\
\hline
Age (median, IQR) & 36 (31-43) & 6 (3-10) \\
\hline
Number (\%) of females & 351 (53\%) & 28 (43\%) \\
\hline
Year of ART start (median... | PMC3039578_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{2006}} & \multicolumn{3}{|l|}{\textbf{2007}} \\
\hline
\textbf{of} & \textbf{Male} & \textbf{Female} & \textbf{Total} & \textbf{Male} & \textbf{Female} & \textbf{Total} \\
\hline
\multicolumn{7}{|l|}{in Santa Rosa*} \... | PMC3176216_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Subscale} & \textbf{Patients 7 years postoperative (n = 151)} & \textbf{Reference group 7 years Postoperative (n = 65)} & \textbf{p-value} \\
\hline
SF-36 PF & 54 (27.2) & 69 (31.3) & 0.01 \\
\hline
SF-36 RP & 45 (44.6) & 60 (46.0) & 0.05 \\
\hlin... | PMC2847954_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{9}{|l|}{\textbf{Mean ($\pm$ SEM) msec in SRTT performance}} \\
\hline
& \multicolumn{3}{|l|}{\textbf{Training 1}} & \multicolumn{3}{|l|}{\textbf{Training 2}} & \multicolumn{3}{|l|}{\textbf{Retrieval}} \\
\hline
\textbf{Block p... | PMC3514228_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{ZM651} & \textbf{IN98025} & \textbf{IN98026} & \textbf{TZ97008} & \textbf{ZA97002} & \textbf{TZ97005} & \textbf{CN98005} & \textbf{ZA97010} & \textbf{CN97001} & \textbf{ZA97012} \\
\hline
ZM651 & * & 78 & 77 & 77 & 78 & 79 & 77 & ... | PMC2920315_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{miRNA} & \textbf{Sequence} \\
\hline
U6 & gtgctcgcttcggcagcacatatac \\
\hline
miR-15b & tagcagcacatcatggtttaca \\
\hline
miR-29a & tagcaccatctgaaatcggtt \\
\hline
miR-29b & tagcaccatttgaaatcagtgtt \\
\hline
miR-29c & tagcaccatttgaaatcggt \\
\hline
miR... | PMC6165274_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{12}{|l|}{\textbf{Coffee Consumption, cups/day}} \\
\hline
& \multicolumn{3}{|l|}{\textbf{1~2}} & \multicolumn{3}{|l|}{\textbf{2~3}} & \multicolumn{3}{|l|}{\textbf{3~4}} & \multicolumn{3}{|l|}{\textbf{$>$ 4}} \\
\hline
&... | PMC5940396_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Items} & \textbf{Mean $\pm$ SD} \\
\hline
Tumor volume (cm3) & 8.47 $\pm$ 6.22 \\
\hline
No. of isocenters & 6.24 $\pm$ 1.11 \\
\hline
Central dose (Gy) & 36.34 $\pm$ 2.11 \\
\hline
Marginal dose (Gy) & 13.6 $\pm$ 1.02 \\
\hline
Maximum dose (Gy) & 28... | PMC4617952_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Species} & \textbf{FST} \\
\hline
H. vulcanorum & Mgahinga & Kahuzi-Biega \\
\hline
\multicolumn{3}{|l|}{Mgahinga} \\
\hline
Kahuzi-Biega & 0.005 \\
\hline
Itombwe & 0.043 & 0.025 \\
\hline
H. kerbispeterhansi & Mau \\
\hline
Mt Elgon & 0.351 \\
\hl... | PMC4578943_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{of Genes} & \textbf{FlyBase r1.4} & \textbf{Hu et al. (2012)} & \textbf{M252} \\
\hline
Total number of genes & 15 548 & 10 786 & 12 990 \\
\hline
of of Total number of genes + strand & 7836 & 5416 & 6486 \\
\hline
Total number of genes – strand &... | PMC4344813_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Recipients} & \textbf{Vector ID} & \textbf{Vector architecture} & \textbf{No. of plant lines examined} & \textbf{No. of albino plant lines} & \textbf{No. of mosaic plant lines} & \textbf{Mutation rate (\%)} \\
\hline
MD & pGGE1c & Cas9 + sgR... | PMC4738242_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Colony} & \textbf{Head length to end of nasus} & \textbf{Head width (max.)} & \textbf{Pronotal width} & \textbf{Hind tibia length} \\
\hline
GUA16 (n=12) & 1.38–1.50 & 0.76–0.84 & 0.36–0.41 & 0.66–0.78 \\
\hline
GUA33 (n=12) & 1.48–1.63 & 0.83–0... | PMC5027770_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Antibody} & \textbf{Supplier/source} & \textbf{Dilution} \\
\hline
Rat-anti-mouse CD31(PECAM-1) & BD Pharmingen & 1:100 \\
\hline
Rat-anti-mouse F4/80 (Clone A3-1) & Serotech & 1:50 \\
\hline
Rabbit-anti-cow-cytokeratin & DAKO & 1:500 \\
\hline
Rabb... | PMC2964607_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
Category & Subcategory & Propertya \\
\hline
Material properties & & PSD (ENM and aerosol) \\
\hline
Geographical parameters & Physical description & Interfacial Area (air–water, air–soil) \\
\hline
& & Mixing height \\
\hline
& & Water depth \\
\hline... | PMC4419581_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{N} & \textbf{Minimum} & \textbf{Maximum} & \textbf{Range} & \textbf{Lower quarter} & \textbf{Median} & \textbf{Upper quartile} \\
\hline
Summation of scores for PCQ-P pre PDQ & 30 & 52 & 96 & 44 & 74.00 & 83.00 & 89.25 ... | PMC4399754_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Heart failure (n = 28)} & \textbf{Controls (n = 10)} & \textbf{P value} \\
\hline
Forced expiratory volume in 1 sec (\% predicted) & 83 � 14 & 104 � 14 & $<$0.001 \\
\hline
Forced vital capacity (\% predicted) & 85 � 16 & 104 � 14 & 0.003 \\
\h... | PMC4632958_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
[Dy2(C9H9O3)6(C12H8N2)2] & F(000) = 1684 \\
\hline
Mr = 1676.38 & Dx = 1.578 Mg m−3 \\
\hline
Monoclinic, P21/c & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\
\hline
Hall symbol: -P 2ybc & Cell parameters from 9890 reflections \\
\hline
a = 11.4738 (1) Å ... | PMC3200901_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Model 1 OR (95\% CI)} & \textbf{Model 2 OR (95\% CI)} & \textbf{Model 3 OR (95\% CI)} \\
\hline
Unemployment & 1.42 (1.14-1.78) & 1.33 (1.06-1.66) & 1.25 (1.00-1.56) \\
\hline
Sex (female) & 1.58 (1.43-1.74) & 1.56 (1.39-1.74) & 1.52 (1.36-1.70... | PMC3305666_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
Cl1—C6 & 1.8074 (10) & C3—H3 & 0.9500 \\
\hline
Cl2—C7 & 1.8068 (9) & C4—C5 & 1.3918 (13) \\
\hline
N1—C5 & 1.3425 (11) & C4—H4 & 0.9500 \\
\hline
N1—C1 & 1.3438 (12) & C5—C7 & 1.5001 (12) \\
\hline
C1—C2 & 1.3920 (14) & C6—H6A & 0.9900 \\
\hline
C1—C6 & ... | PMC3151947_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Complication N (\%)} & \textbf{Detection} & \textbf{Treatment} \\
\hline
Small mid-line erosion 2 (2\%) & During first year & Removed under local anesthesia \\
\hline
Mesh penetrating the vagina (Unilateral) 2 (2\%) & First follow-up & Mesh removed ... | PMC5117977_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Coverage} & \textbf{\#G} & \textbf{\#A} & \textbf{Freq. of G} & \textbf{aa change} \\
\hline
Gabra3 & 679 & 631 & 48 & 92.93\% & I/M \\
\hline
Elavl2 & 633 & 9 & 624 & 1.422\% & I/V \\
\hline
Elavl2 & 625 & 15 & 610 & 2.400\% &... | PMC2831006_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{0\%} & \textbf{5\%} & \textbf{10\%} & \textbf{15\%} \\
\hline
FA & 0.240 (0.236–0.261) & 0.216 (0.081–0.243) & 0.211* (0.190–0.236) & 0.206^ (0.190–0.231) \\
\hline
Pennation Angle (°) & 19.54 (16.68–27.59) & 18.82 (16.58–26.34) & 18.79 (16.4... | PMC4444336_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{No. of patients}} & \textbf{Weekday daytime 67441} & \textbf{Weekday night-time 9098} & \textbf{Weekend daytime 22911} & \textbf{Weekend night-time 4458} & \textbf{P-value} \\
\hline
\multicolumn{2}{|l|}{Age, years, medi... | PMC5774760_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{Number of trees}} & \multicolumn{4}{|l|}{\textbf{Volume}} \\
\hline
\textbf{Ecoregion sections} & \textbf{df} & \textbf{Mean of difference} & \textbf{t} & \textbf{p} & \textbf{df} & \textbf{Mean of difference} & \... | PMC5756827_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Principles} & \textbf{Met} & \textbf{Partially Met} & \textbf{Not Met} & \textbf{Overall rating} \\
\hline
Quality Improvement & 1.8 & 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.9 & & Partially Met \\
\hline
Patient/Service User Focus & 2.1, 2.2 & 2.... | PMC2941252_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Sample size} & \multicolumn{3}{|l|}{\textbf{Power}} & \textbf{Type I error} \\
\hline
& \textbf{$\beta$3 = -0.65} & \textbf{$\beta$3 = -0.95} & \textbf{$\beta$3 = -1.20} & \textbf{$\beta$3 = 0} \\
\hline
150 & 0.348 & 0.642 & 0.780 & 0.052 \\
\... | PMC2099440_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Run ID} & \textbf{infAP} & \textbf{infNDCG} & \textbf{NDCG@10} & \textbf{P@10 (þpartial)} & \textbf{P@10 (�partial)} \\
\hline
\\
\hline
OHSU-1 & 0.3193 & 0.3965 & 0.6006 & 0.7467 & 0.3333 \\
\hline
OHSU-2 & 0.1396 & 0.4024 & 0.3953 & 0.48 & ... | PMC5737054_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Total} & \textbf{Single-dose albendazole} & \textbf{Single-dose mebendazole} & \textbf{Triple-dose albendazole} & \textbf{Triple-dose mebendazole} \\
\hline
Total n (\%) & 314 (100) & 82 (100) & 81 (100) & 68 (100) & 83 (100) \\
\hline
Sex:... | PMC3181256_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Controls (n = 21)} & \textbf{Patients with PD (n = 21)} & \textbf{$\chi$2/t} & \textbf{P value} \\
\hline
Sex, male:female & 8:13 & 12:9 & 1.53 & 0.35 \\
\hline
Age in years, mean (SD) & 63.7 (9.8) & 64.5 (9.1) & −0.27 & 0.78 \\
\hline
Diseas... | PMC5700829_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Period} & \multicolumn{3}{|l|}{\textbf{Maternal educational attainment, HR (95\% CI)}} \\
\hline
& \textbf{No education vs secondary or more} & \textbf{Primary incomplete vs secondary or more} & \textbf{Primary complete vs secondary or more} \\
\... | PMC4794298_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{n = 1} & \textbf{GM} & \textbf{95\% CI} & \textbf{5th P} & \textbf{25th P} & \textbf{50th P} & \textbf{75th P} & \textbf{95th P} \\
\hline
Total & 5,189 & 1.02 & (0.97, 1.08) & 0.20 & 0.58 & 1.00 & 1.87 & 4.82 \\
\hline
\multicolumn{9... | PMC3511886_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{MIGS ID} & \textbf{Property} & \textbf{Term} \\
\hline
MIGS-31 & Finishing quality & Finished \\
\hline
MIGS-28 & Libraries used & Three genomic libraries: one 454 pyrose- quence standard library, one 454 paired end 15 kb library, and one Illumina l... | PMC3035270_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{HIV-infected men (COVERTE: N = 126)}} & \multicolumn{3}{|l|}{\textbf{Men from general population (ENNS: N = 103)}} & \textbf{p-valueb} & \multicolumn{3}{|l|}{\textbf{HIV-infected women (COVERTE: N = ... | PMC6226109_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
C14H13ClO5 & F(000) = 616 \\
\hline
Mr = 296.69 & Dx = 1.488 Mg m−3 \\
\hline
Orthorhombic, P212121 & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\
\hline
Hall symbol: P 2ac 2ab & Cell parameters from 4024 reflections \\
\hline
a = 4.8042 (1) Å & $\theta$ ... | PMC3089165_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Bone} & \textbf{Site} & \textbf{Parameter} & \multicolumn{2}{|l|}{\textbf{Difference between intercepts (P-value)}} & \multicolumn{2}{|l|}{\textbf{Difference between slopes (P-value)}} & \multicolumn{2}{|l|}{\textbf{Slope of RA group (P-... | PMC2911913_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Patient type} & \textbf{Sex} & \textbf{Age} & \textbf{Mean PA pressure (mmHg)} & \textbf{Medications} & \textbf{PVR (dyne*sec)/cm5} & \textbf{Lung tissue} \\
\hline
1 & Control (Benign tumor) & F & 35 & ND & None & ND & Yes \\
\hline
2 ... | PMC3193170_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Dog} & \textbf{Age} & \textbf{Gender} & \textbf{Start} & \textbf{Finish} \\
\hline
Sound & 4 & F & 5 & 3 \\
\hline
Cat & 2 & F & 5 & 3 \\
\hline
Bato & 2 & M & 4 & 3 \\
\hline
Basin & 4 & M & 4 & 3.5 \\
\hline
Heath & 5 & M & 4 & 3 \\
\hline
Yuk... | PMC5027292_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Step} & \textbf{No. SNPs} & \textbf{0} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{6} & \textbf{7} & \textbf{8} & \textbf{9} & \textbf{$\geq$10} \\
\hline
1 & Availablea & 1286 & 413 & 310 & 614 & 4... | PMC2367558_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Effect} & \textbf{Dfn,d} & \multicolumn{2}{|l|}{\textbf{mg C g−1 root}} & \multicolumn{2}{|l|}{\textbf{Phenolic content (µg ml−1g−1 root)}} \\
\hline
& & \textbf{F} & \textbf{P} & \textbf{F} & \textbf{P} \\
\hline
Cultivar & 1,1 & 0.06 & 0.8... | PMC4391242_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Model} & \textbf{Percentage mean error} & \textbf{r2} \\
\hline
from 1 & 197 \% & 0.93 \\
\hline
individ- 2 & 193 \% & 0.93 \\
\hline
3 & 192 \% & 0.93 \\
\hline
and 4 & 179 \% & 0.93 \\
\hline
5 & 181 \% & 0.93 \\
\hline
6 & 187 \% & 0.93 \\
\hline... | PMC4545320_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{as Data} & \textbf{Statistical test} & \textbf{Post hoc test} \\
\hline
Errors & Friedman & Wilcoxon \\
\hline
TMS pulse), Average RTs & Three-way repeated measures ANOVA & Fisher’s LSD \\
\hline
average were Baseline vs. rest MEPs & One-way repeate... | PMC6192378_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
O1 & 0.0424 (8) & 0.0206 (7) & 0.0280 (7) & −0.0067 (6) & 0.0148 (6) & −0.0004 (5) \\
\hline
O2 & 0.0420 (8) & 0.0206 (7) & 0.0205 (6) & −0.0026 (6)... | PMC3238897_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{all}} & \multicolumn{2}{|l|}{\textbf{Whites}} & \multicolumn{2}{|l|}{\textbf{Blacks}} \\
\hline
& \textbf{n} & \textbf{\%} & \textbf{n} & \textbf{\%} & \textbf{n} & \textbf{\%} \\
\hline
\multicolumn{7}{|l|}{Gender*}... | PMC4996069_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{$\Theta$ (°C)} & \textbf{S} & \textbf{DOC ($\mu$mol·kg−1)} \\
\hline
ENACW16 & 16.00 $\pm$ 0.13 & 36.20 $\pm$ 0.02 & 59.0 $\pm$ 2.1 \\
\hline
ENACW12 & 12.30 $\pm$ 0.18 & 35.66 $\pm$ 0.03 & 55.4 $\pm$ 0.5 \\
\hline
MW & 11.7 $\pm$ 0.2 & 36.500 ... | PMC4886255_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Patient Number} & \textbf{Follow up (months)} & \textbf{Raised IOP} & \textbf{Stepwise deterioration in retinopathy grade at last FU (ETDRS)} \\
\hline
A & 1 & 15 & & 3 \\
\hline
& & 14 & & 1 \\
\hline
A & 2 & 6 & & 0 \\
\h... | PMC1183218_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Chemicals} & \textbf{Dm without synergists} & \textbf{Dm with PBO} & \textbf{Dm with DEF} \\
\hline
propoxur & 1.97 (1.78–2.19) & 0.27 (0.17–0.42) & 1.01 (0.83–1.24) \\
\hline
DEET & 1189 (1088–1299) & 611 (596–629) & 1078 (1005–1155) \\
\hline
mi... | PMC2680852_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{NDEs group (mean $\pm$ SD)} & \textbf{Non-NDEs group (mean $\pm$ SD)} & \textbf{P} \\
\hline
Age (years) & 57.9 $\pm$ 13.8 & 51.8 $\pm$ 14.6 & 0.217 \\
\hline
Time until ROSC (minutes) & 8.3 $\pm$ 6.7 & 8.8 $\pm$ 5.3 & 0.772 \\... | PMC2887177_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Study} & \textbf{Summary of relevant findings} \\
\hline
Bickley and Beech (2002; N = 87) & 80\% had approach goals and $>$50\% used active strategies to achieve these. Few followed the Av-P pathway. Offenders following different offense pathways coul... | PMC4441881_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Compound (concentration)} & \multicolumn{2}{|l|}{\textbf{Residual activity, \%}} \\
\hline
& \textbf{Method A} & \textbf{Method B} \\
\hline
None & 36.3 & 60 \\
\hline
Glycine (1\%, w/v) & 100 & 100 \\
\hline
Sucrose (10\%, w/v) & 56.1 & 64.8 \\
\h... | PMC3023689_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameter} & \textbf{P value} & \textbf{OR/$\beta$(CI)} \\
\hline
Age & 0.07 & 0.9 (0.8-1.9) \\
\hline
DM & 0.06 & 0.7 (0.9-1.4) \\
\hline
Gender & 0.09 & 0.7 (0.4-1.7) \\
\hline
hypertension & 0.07 & 0.6 (0.3-1.8) \\
\hline
BMI Kg/m2 & 0.07 & 0.7(0... | PMC3636105_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{by Incidence} & \multicolumn{3}{|l|}{\textbf{Copeptin (pmol/l)a}} & \textbf{1 unit increase in loge copeptin} & \textbf{p trend} \\
\hline
\textbf{with heart} & \textbf{$<$3.35 (n = 1376)} & \textbf{3.35–6.95 (n = 1151)} & \textbf{$\geq$6.96 (... | PMC4969339_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Univariate analysis}} & \multicolumn{2}{|l|}{\textbf{Multivariate analysis}} \\
\hline
& \textbf{P} & \textbf{Regression coefficient (SE)a} & \textbf{P} & \textbf{Relative risk (95\%CI)} \\
\hline
\multicolumn{5}{|l|}{Ov... | PMC4867643_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{BuL} & \textbf{CHB} & \textbf{CHD} & \textbf{JPT} & \textbf{CEU} & \textbf{GIH} & \textbf{MEX} & \textbf{TSI} & \textbf{ASW} & \textbf{LWK} & \textbf{MKK} & \textbf{YRI} \\
\hline
BuL & 0 \\
\hline
CHB & 0.04728 & 0 \\
\hline
... | PMC6503013_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Theme} & \textbf{Reference} \\
\hline
\multicolumn{2}{|l|}{Pre-screen} \\
\hline
Stigma and awareness of disease & 22, 24, 27, 29, 30, 31, 33, 34, 35, 36, 38, 39, 43, 43, 47, 50 \\
\hline
Role of family & 27, 31, 32, 34, 36, 37, 38, 39 \\
\hline
Exist... | PMC4469007_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{No. of patients} & \textbf{No. of HF} & \textbf{No. of death} & \textbf{Unadjusted HR (95\% CI) p value} & \textbf{LVH‑adjusted HR (95\% CI)a p value} & \textbf{E/e′‑adjusted HR (95\% CI)b p value} & \textbf{Adjusted HR... | PMC5781289_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{|l|}{\textbf{parameter}} & \textbf{t value} & \textbf{df} & \textbf{Sig. (2 tailed)} \\
\hline
& \textbf{mean} & \textbf{STD} & \textbf{Standard error} & \multicolumn{2}{|l|}{\textbf{99\% confidence interval}} \\
\hline
& &... | PMC4959725_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Category} & \textbf{n} & \textbf{\%} \\
\hline
\multicolumn{3}{|l|}{Physical condition (n=6024)} \\
\hline
Good & 3589 & 74.3\% \\
\hline
Medium & 2238 & 66.8\% \\
\hline
Bad & 197 & 61.4\% \\
\hline
\multicolumn{3}{|l|}{Relationships (n=6020)} \\
\... | PMC3562148_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{N} & \textbf{23} \\
\hline
\multicolumn{2}{|l|}{Level of the hospital} \\
\hline
I & 11 \\
\hline
II & 12 \\
\hline
\multicolumn{2}{|l|}{Working experience} \\
\hline
$<$5 years & 13 \\
\hline
$>$5 years & 10 \\
\hline
\multicolumn{2}{|l|}{Participate... | PMC5116137_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{image Displacement} & \multicolumn{2}{|l|}{\textbf{10 mm}} & \multicolumn{2}{|l|}{\textbf{50 mm}} & \multicolumn{2}{|l|}{\textbf{100 mm}} \\
\hline
\textbf{Displacement axis} & \textbf{Frontal} & \textbf{Longitudinal} & \textbf{Frontal} & \t... | PMC6223760_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{HPV type} & \textbf{Array positive} & \textbf{Array negative} \\
\hline
12 & 0 & 1 \\
\hline
34 & 1 & 0 \\
\hline
44 & 1 & 0 \\
\hline
cand62 & 2 & 1 \\
\hline
67 & 1 & 0 \\
\hline
71 & 2 & 0 \\
\hline
72 & 3 & 0 \\
\hline
81 & 5 & 1 \\
\hline
cand8... | PMC3139178_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{No-induction} & \textbf{rATG} & \textbf{Basiliximab} & \textbf{P value} \\
\hline
0.05 SCr ($\mu$mol/L)* & 120 [73; 260] & 121 [51; 261] & 137 [82; 246] & ns‡ \\
\hline
eGFR (mL/s/1.73 m2)* & 0.80 [0.28; 1.18] & 0.89 [0.38; 1... | PMC4545708_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Compound (Peak No.)} & \textbf{Retention time (min)} & \textbf{Calibration range (µg/mL)} & \textbf{Regression equation} & \textbf{Coefficient of correlation (R2)} \\
\hline
Resveratroloside (Res, 1) & 4.83 & 0.75−12.00 & Y = 13280.0X + 3543.1 &... | PMC5071620_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Community Type} & \textbf{Species Richness (S)} & \textbf{Diversity index (H)} & \textbf{True diversity (D)} & \textbf{Shannon’s evenness (J)} & \textbf{Hmax} \\
\hline
1 (18 plots) & 58 & 3.60 & 37 & 0.89 & 4.06 \\
\hline
2 (14 plots) & 66 & ... | PMC6192589_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Damak (n = 93)}} & \multicolumn{3}{|l|}{\textbf{Charali (n = 73)}} & \multicolumn{3}{|l|}{\textbf{Bharatpur (n = 28)}} \\
\hline
\textbf{Species name (scientific name)} & \textbf{PCR} & \textbf{Morpho} & \textbf... | PMC4841570_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Sample} & \textbf{IC50} \\
\hline
BHT & 219.67$\pm$10.43a $\mu$g/ml \\
\hline
GCO & 10.25$\pm$0.30b mg/ml \\
\hline
HGCO & 15.38$\pm$0.72d mg/ml \\
\hline
RCO & 11.99$\pm$0.51c mg/ml \\
\hline
HRCO & 12.86$\pm$0.79c mg/ml \\
\hline
\end{tabular}}
\end... | PMC4569078_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Clinical outcomes (n, \%)} & \multicolumn{4}{|l|}{\textbf{Univariate multivariate}} \\
\hline
& \textbf{HR (95\% CI)} & \textbf{P} & \textbf{HR (95\% CI)} & \textbf{P} \\
\hline
MACE & 1.190 (0.976–1.451) & 0.085 & 1.145 (0.937–1.401) & 0.186 \... | PMC6090623_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{on Item} & \multicolumn{3}{|l|}{\textbf{Citrus pulp, fish by-product, and Bacillus subtilis fermentation biomass, \%}} & \textbf{SEM2} & \multicolumn{2}{|l|}{\textbf{P-values3}} \\
\hline
& \textbf{0} & \textbf{2.5} & \textbf{5.0} & & \tex... | PMC4540257_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Burden of disease} & \textbf{Pre-TCT number (\%)} & \textbf{95\% CI} & \textbf{Post-TCT number (\%)} & \textbf{95\% CI} & \textbf{Odds Ratio (95\% CI)} \\
\hline
Yaws seroprevalence (dually-positive DPP rapid test) & 103/943 (10.9\%) & (6.5\%-... | PMC5863939_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Outcome} & \textbf{Group} & \textbf{1996} & \multicolumn{2}{|l|}{\textbf{2007 2008 (Single cohort)†}} & \textbf{2009} & \textbf{2010} & \textbf{Overall OR} \\
\hline
\\
\hline
\multicolumn{8}{|l|}{BMI} \\
\hline
$<$25, \% & Members & 51.2... | PMC4749948_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Peak No} & \textbf{Retention Time (Min)} & \textbf{MS + Tret identification*} & \textbf{*\%} \\
\hline
1 & 3.19 & N(b)-benzyl-14-(carboxymethyl) & 6.35 \\
\hline
2 & 3.21 & Benzene, 1.3-bis (3- phenoxyphenoxy) & 13.51 \\
\hline
3 & 3.43 & 2-Phenyl... | PMC3080840_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Factor} & \textbf{Sub-groups} & \textbf{n} & \textbf{BUT(s)} & \textbf{Schirmer I test} & \textbf{FL} & \textbf{Corneal Sensitivity} \\
\hline
Gender & Female & 896 & 3.63 $\pm$ 2.10 & 8.67 $\pm$ 5.89 & 0.59 $\pm$ 0.98 & 55.51 $\pm$ 10.21 \\... | PMC5946388_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Hatori et al. [24]} & \textbf{Guler et al. [22]} & \textbf{Goz et al. [23]} & \textbf{Boudard et al. [27]} & \textbf{Our findings} \\
\hline
Reentrainment & Absent (150 lx) & Most animals unable to entrain (700 lx) Advanced onset Others had... | PMC5735630_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{Multi A}} & \multicolumn{4}{|l|}{\textbf{Multi B}} & \multicolumn{4}{|l|}{\textbf{Multi C}} \\
\hline
& \textbf{VP2-03} & \textbf{VPTR7} & \textbf{VP1-11} & \textbf{VPTR5} & \textbf{VP1-10} & \textbf{VPTR... | PMC4462150_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
[Ni(C23H20Cl4N2O2)] & F000 = 1136 \\
\hline
Mr = 556.92 & Dx = 1.644 Mg m−3 \\
\hline
Monoclinic, P21/n & Mo K$\alpha$ radiation $\lambda$ = 0.71073 Å \\
\hline
Hall symbol: -P 2yn & Cell parameters from 10509 reflections \\
\hline
a = 13.344 (2) Å & $\theta$... | PMC2961846_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Interventions} & \textbf{Abbreviation} & \textbf{Description} \\
\hline
\multicolumn{3}{|l|}{Psychotherapeutic intervention} \\
\hline
Trauma-focused cognitive behavioural therapy & TF-CBT & CBT is a combination of cognitive and behavioural techniqu... | PMC5857664_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{EM operation} & \textbf{Definition} \\
\hline
Overlap (x ❍ y) & x and y overlap if they have a part in common. \\
\hline
Disjoint (x ι y) & x and y are disjoint if they share no parts in common. \\
\hline
Binary product (x . y) & The parts that x and ... | PMC1175956_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Total Number of References} & \textbf{Max. Part Weight (kg)} & \textbf{Av. Part weight (kg)} & \textbf{Min. Part Weight (kg)} & \textbf{Part Weight on Percentile 25} & \textbf{Part Weight on Percentile 50} & \textbf{Part Weight on Percentile... | PMC6120002_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Variables} & \textbf{N (\%)} & \textbf{Mean} & \textbf{Std. Deviation} & \textbf{Min} & \textbf{Max} \\
\hline
Gender & 12376 & - & - & - & - \\
\hline
Males & 5660 (45.3) & - & - & - & - \\
\hline
Females & 6716 (54.3) & - & - & - & - \\
\hli... | PMC1868752_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Symbol} & \textbf{Full name of tumor suppressor gene} & \textbf{Position} & \textbf{\% of patients with copy number losses} & \textbf{P value*} \\
\hline
1 & CDKN2A & cyclin-dependent kinase inhibitor 2A & 9p12 & 9.63 & 1.87610219 \\
\hline... | PMC3149069_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variable} & \multicolumn{2}{|l|}{\textbf{Unemployment Duration (\%/n)}} & \textbf{t (p)} \\
\hline
& \textbf{Short-term N = 234} & \textbf{Long-term N = 195} \\
\hline
\multicolumn{4}{|l|}{Depression (in past 12 months)} \\
\hline
Never & 15.8/37... | PMC1526724_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene} & \textbf{Number of isolates} & \textbf{Percentage} \\
\hline
mecA & 6 & 4.8 \\
\hline
mecC & 8 & 6.5 \\
\hline
blaZ from SCCmec XI & 8 & 6.5 \\
\hline
blaZ & 24 & 19.4 \\
\hline
erm(A) & 1 & 0.8 \\
\hline
erm(B) & 1 & 0.8 \\
\hline
erm(C) & 1... | PMC5161505_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
two the Level 1 & Simple Interaction e.g. a yes/no answer to a question from a student or tutor \\
\hline
to Level 2 & A short answer ($<$1 min) to a question from either student or tutor \\
\hline
Level 3 & An extended interaction of at least 1 minute creati... | PMC3225808_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Inventory} & \multicolumn{3}{|l|}{\textbf{IPIP-NEO PI}} & \multicolumn{3}{|l|}{\textbf{AB5C}} & \multicolumn{3}{|l|}{\textbf{Marker scales}} \\
\hline
\textbf{Scale} & \textbf{SfD} & \textbf{IM} & \textbf{PCA1} & \textbf{SfD} & \textbf... | PMC3618383_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Age (years) & 62 $\pm$ 18 (19 to 100) \\
\hline
Female/male & 83/97 \\
\hline
SAPS II & 37 $\pm$ 18 (9 to 103) \\
\hline
Mortality & 19\% (35 out of 180 patients) \\
\hline
Cirrhosis & 6 \\
\hline
Cancer & 45 \\
\hline
Community-acquired/postoperative periton... | PMC2717471_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{n} & \textbf{Length of stay, r} & \textbf{P} \\
\hline
Age & 102 & 0.090 & NS \\
\hline
Referral lag (REFLAG) & 102 & 0.547 & 0.001 \\
\hline
REFLAG/LOS & 97a & 70.087 & NS \\
\hline
Log(REFLAG)/log(LOS) & 97a & 0.242 & 0.02 \\... | PMC4478928_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{n = 188} & \textbf{Strongly agree (\%)} & \textbf{Agree (\%)} & \textbf{Disagree (\%)} & \textbf{Strongly disagree (\%)} & \textbf{Mean} \\
\hline
Respect & 74.5 & 22.3 & 2.7 & 0.5 & 3.71 \\
\hline
Having good knowledge and skills in that fiel... | PMC4818896_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Method} & \textbf{N (Case)} & \textbf{TP} & \textbf{FP} & \textbf{TN} & \textbf{FN} & \textbf{Sen (\%)} & \textbf{Spe (\%)} & \textbf{LR+} & \textbf{LR−} & \textbf{PV+ (\%)} & \textbf{PV− (\%)} & \textbf{Consist ency (\%)} \\
\hl... | PMC6198556_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Response} & \textbf{Number of patients (\%)} \\
\hline
CR & 8 (16.7\%) \\
\hline
PR & 26 (54.2\%) \\
\hline
SD & 10 (20.8\%) \\
\hline
PD & 4 (8.3\%) \\
\hline
\end{tabular}}
\end{table} | PMC5139704_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variants} & \textbf{Feed Matrix} & \textbf{Planned Moisture Content (\%)} & \textbf{Sodium Sulfite (g/kg Maize)} \\
\hline
1 & MK = Maize kernels & 14 & 0 \\
\hline
2 & MK & 14 & 1.25 \\
\hline
3 & MK & 14 & 2.5 \\
\hline
4 & MK & 14 & 5 \\
\hline... | PMC4379525_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{a Antibiotic} & \textbf{DphoX: MIC $\pm$ SE (fold change)1} & \textbf{WT} & \textbf{phoXc} \\
\hline
zithromycin & 0.0560.02 (1.5) & 0.03 & 0.0360.02 \\
\hline
Ciprofloxacin & 0.1960.08 (3.0) & 0.06 & 0.06 \\
\hline
Erythromycin & 0.2560.14 (1.4) ... | PMC3197622_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Patient no.} & \textbf{EDSS} & \textbf{Interval time (day)} & \textbf{Disease duration (year)} & \textbf{Pre-treatment scan} & \textbf{Post treatment scan} \\
\hline
1 & 4 & 90 & 9 & Moderate bifrontoparital & Mild bifrontoparital \\
\hline
2 ... | PMC4880822_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Hospital} & \textbf{Community} & \textbf{LTC} & \textbf{Other} & \textbf{Total} \\
\hline
Start (1999) & 2267 & 764 & 129 & 1843 & 5003 \\
\hline
End (2007) & 2531 & 845 & 227 & 2461 & 6064 \\
\hline
Change in Number & 264 & 81 & 98 & 618 &... | PMC3507859_table_1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.