text stringlengths 1 1.11k | source dict |
|---|---|
thermodynamics, cosmic-microwave-background, propulsion
If the disk is moving with velocity $v$ then the radiation hitting the absorptive side will have its frequency modified (blueshift) by a factor $f$, while the reflective side will be (redshift) by a factor $f'$. Since radiation pressure is proportional to frequen... | {
"domain": "physics.stackexchange",
"id": 4533,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, cosmic-microwave-background, propulsion",
"url": null
} |
python, performance, algorithm
The code in the post does not always compute the highest profit. For example, suppose that I have these orders:
sell = [Order(price=1, amount=1, min_amount=np.nan)]
buy = [Order(price=1, amount=1, min_amount=1),
Order(price=2, amount=1, min_amount=1)]
max_n = 2
Then the code comp... | {
"domain": "codereview.stackexchange",
"id": 20155,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, performance, algorithm",
"url": null
} |
quantum-interpretations, measurement-problem
The Everett interpretation proposes to obtain a more objective picture by saying, "the wavefunction" is what actually exists, and it contains multiple "worlds", only one of which is the world we observe. I should emphasize that in the only truly universal interpretation of ... | {
"domain": "physics.stackexchange",
"id": 51753,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-interpretations, measurement-problem",
"url": null
} |
ros, node, roslauch, logging
They are ANSI escape codes, used by ROS logging to add colours and font weights (such as boldface) to logging lines.
When output is set to "screen" no extra symbols is shown.
That is because the terminal driver knows how to interprete these sequences and uses them to set font properties ... | {
"domain": "robotics.stackexchange",
"id": 21093,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, node, roslauch, logging",
"url": null
} |
sql, sql-server, vb.net
Title: Custom SQL statement I am just wondering if my code can still be simplified. I intend to make it reusable in all update statements.
Public Sub updateRecord(ByRef procedure As String, ByRef parameters As String, ByRef obj As String, ByRef LastName As String, ByRef FirstName As String, ByR... | {
"domain": "codereview.stackexchange",
"id": 14657,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "sql, sql-server, vb.net",
"url": null
} |
formal-languages, regular-languages, pumping-lemma
Title: How to prove that $\{0^n 1^{5n} \mid n \ge 10000 \}$ is not a regular language? I proved that $$ \{ 0^n 1^{5n} \mid n \geq 0 \}$$ is not a regular language using Pumping Lemma by following way.
Solve by contradiction that $ L = \{0^n 1^{5n} \mid n \geq 0 \}$ i... | {
"domain": "cs.stackexchange",
"id": 3464,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "formal-languages, regular-languages, pumping-lemma",
"url": null
} |
beginner, rust
- .zip(tup.iter().map(|y| {g = y.iter().map(|q| q.to_string()).collect(); g.clone()}))
- .collect();
+ company = depts
+ .into_iter()
+ .map(|x| x.to_string())
+ .zip(tup.iter().map(|y| {
+ g = y.iter().map(|q| q.to_string()).collect();
+ g.clone()
+ ... | {
"domain": "codereview.stackexchange",
"id": 39043,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "beginner, rust",
"url": null
} |
c++, beginner, linked-list, reinventing-the-wheel, c++17
auto size_change = std::distance(first, last);
auto position_node = position.node;
auto prev_node = position_node->prev;
auto first_node = first.node;
auto last_node = last.node->prev;
// Link the node before first.node ... | {
"domain": "codereview.stackexchange",
"id": 36513,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, beginner, linked-list, reinventing-the-wheel, c++17",
"url": null
} |
c#, .net, ado.net, mvp
public class EmployeeDataService : IEmployeeRepository
{
public Employee GetById(string employeeId)
{
// do whatever it takes to return an Employee object.
}
}
Here you're accessing an SQL database with ADO.NET, but then later you might want to implement the same interface w... | {
"domain": "codereview.stackexchange",
"id": 7048,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, .net, ado.net, mvp",
"url": null
} |
ros, servo, rasbperrypi
Title: Raspberry + ROS + Servo
Hi guys,
could anyone tell me some tutorial that teaches to control servoss via ROS installed in a Raspberry PI 3 (Ubuntu Mate | {
"domain": "robotics.stackexchange",
"id": 26295,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, servo, rasbperrypi",
"url": null
} |
$h^2 = \frac{3}{4}l^2$
7. Originally Posted by 11rdc11
$h^2 = \frac{4l^2}{4} - \frac{1l^2}{4}$
which is
$h^2 = l^2\bigg(\frac{4}{4} - \frac{1}{4}\bigg)$
$h^2 = \frac{3}{4}l^2$
Oh! Thank you! For some reason I thought I was multiplying it. Goes to show how I am too tired to think...
This makes perfect sense now! Th... | {
"domain": "mathhelpforum.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.982013792143467,
"lm_q1q2_score": 0.8183362499937131,
"lm_q2_score": 0.8333245994514084,
"openwebmath_perplexity": 495.62339349354914,
"openwebmath_score": 0.7921420931816101,
"tag... |
rust
If you know how a hashmap works, this also makes sense. Keys in the hashmap have to be hashed to find their place in the table, which means the key type must implement Hash. Additionally, if two keys collide (have the same location in the table), we need to know if they are the same key, or different. Hence, the ... | {
"domain": "codereview.stackexchange",
"id": 42626,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "rust",
"url": null
} |
mechanical-engineering, motors, torque, power, robotics
The problem is that the robot does not begin to move. When I lift the wheel off the ground, they move fine, and spin fast depending on how much throttle I give them.
However on the ground they don't move, which is typically a torque problem.
However I am not so ... | {
"domain": "engineering.stackexchange",
"id": 4762,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mechanical-engineering, motors, torque, power, robotics",
"url": null
} |
the-moon, earth, asteroids, impact, rogue-planet
Title: How well would the Moon protect the Earth from an Asteroid? Would the Earth fare better if the Moon blocked the meteor, comet, rogue planet, or otherwise rather than a direct impact? At what point would the Moon's debris would be an extinction event?
The limit of... | {
"domain": "astronomy.stackexchange",
"id": 3865,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "the-moon, earth, asteroids, impact, rogue-planet",
"url": null
} |
newtonian-mechanics, forces, constrained-dynamics
I will use the laboratory frame of reference as it is perhaps then easier to describe what one sees from that reference frame and I will further assume that there is no friction and that everything starts from rest.
The other important assumption for the first part of ... | {
"domain": "physics.stackexchange",
"id": 33298,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, forces, constrained-dynamics",
"url": null
} |
homework-and-exercises, general-relativity, gravity, orbital-motion, projectile
You can see that it's a lot easier to get multiple loops if your particle is nonrelativistic at infinity, $\beta\to0$. However, getting multiple loops requires your particle to come very close to being captured in any case. This suggests... | {
"domain": "physics.stackexchange",
"id": 96297,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, general-relativity, gravity, orbital-motion, projectile",
... |
gas-laws, concentration, terminology
Title: How to calculate the molarity of a gas? If I have $X$ moles of a gas and I put them in a container at constant volume $V$, will the molarity of the gas then be $X/V$? Molarity is defined as "moles of solute per volume of solution", which implies that the system is in the liq... | {
"domain": "chemistry.stackexchange",
"id": 14120,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gas-laws, concentration, terminology",
"url": null
} |
r, rna-seq, bioconductor, rsem
ENST00000525778.5 ATCTAGTAATGGGCTCTTCCAAATCGCATCTGGTAGGTTCATAGCCATGA
ENST00000481848.6 ATCTAGTAATGGGCTCTTCCAAATCGCATCTGGTAGGTTCATAGCCATGA
**************************************************
ENST00000525778.5 GTCAGCCACCAATCGGGGGCGCTGCCCCTGCCACAGCA... | {
"domain": "bioinformatics.stackexchange",
"id": 317,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "r, rna-seq, bioconductor, rsem",
"url": null
} |
quantum-mechanics, statistical-mechanics, quantum-information, hilbert-space, density-operator
$$
But the thermal projector is not self-adjoint. It reads instead
$$
{\mathcal P}_{th} = |\hat\rho_{eq})(\hat I|\\
{\mathcal P}_{th}(\hat \chi) = \hat\rho_{eq} Tr(\hat\chi)
$$
or for a bipartite system AB,
$$
{\mathcal P}... | {
"domain": "physics.stackexchange",
"id": 28865,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, statistical-mechanics, quantum-information, hilbert-space, dens... |
quantum-mechanics, classical-mechanics, boundary-conditions
Title: Ehrenfest Theorem and boundary Conditions In what cases does Ehrenfests Theorem hold?
If I look at the wavefunction of electrons in a squared box of length $L$ (with periodic boundary-conditions, $\Psi(0) = \Psi(L)$), then the solution to Schrödingers ... | {
"domain": "physics.stackexchange",
"id": 50558,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, classical-mechanics, boundary-conditions",
"url": null
} |
homework-and-exercises, newtonian-mechanics, momentum, velocity, collision
Consider the diagram above. A ball travelling at 5m/s hits the wall and then travels at 5m/s again. What's the change in velocity? Assuming the angle to the wall is 45 degrees.
The ball has the same magnitude of velocity before and after hittin... | {
"domain": "physics.stackexchange",
"id": 94175,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, newtonian-mechanics, momentum, velocity, collision",
"ur... |
gan, generative-models, cyclegan
Following the notion of the Paper for both generators ($G:X\to Y$, $F:Y\to X$), we then get: $F(y) = y$ and $G(x) = x$.
In this case, the cycle consistency loss would be zero (see equation (2) in the paper):
$$|F(G(x))-x|_1 = |F(x) - x|_1 = |x - x|_1 = 0$$
and
$$|G(F(y))-y|_1 = |G(y) -... | {
"domain": "datascience.stackexchange",
"id": 11592,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gan, generative-models, cyclegan",
"url": null
} |
## Lcm and Integer – AIME I, 1998
Find the number of values of k in $12^{12}$ the lcm of the positive integers $6^{6}$, $8^{8}$ and k.
• is 107
• is 25
• is 840
• cannot be determined from the given information
Lcm
Algebra
Integers
## Check the Answer
Answer: is 25.
AIME I, 1998, Question 1
Elementary Number T... | {
"domain": "cheenta.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9719924777713886,
"lm_q1q2_score": 0.82999677073532,
"lm_q2_score": 0.8539127510928476,
"openwebmath_perplexity": 3924.781904700568,
"openwebmath_score": 0.6009325981140137,
"tags": null... |
phylogenetics, sequence-alignment, phylogeny, taxonomy, orthofinder
Title: How to add bootstrap values to the phylogenetic tree generated by OrthoFinder? When we run the OrthoFinder analysis tool on a group of genomes to get the orthologues shared by them one of the output files include a folder named 'Species_Tree' t... | {
"domain": "bioinformatics.stackexchange",
"id": 2487,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "phylogenetics, sequence-alignment, phylogeny, taxonomy, orthofinder",
"url... |
ros, ros-kinetic, ardrone, rosinstall
Original comments
Comment by ahendrix on 2018-03-27:
Th presence (or absence) of this topic is a symptom that you're not running the node which provides it. You should figure out which node that is for your drone, configure it correctly and run it.
Comment by ahendrix on 2018-03-2... | {
"domain": "robotics.stackexchange",
"id": 30474,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-kinetic, ardrone, rosinstall",
"url": null
} |
In $(1)$ perform the change of variable $x=\dfrac{2y}{1-y^2}$,
\begin{align} J&=\int_0^1 \dfrac{(1-y^2)\arctan\left(\dfrac{2y}{1-y^2}\right)}{y(1+y^2}dy\\ &=2\int_0^1 \dfrac{(1-y^2)\arctan y}{y(1+y^2}dy\\ &=2\left(\int_0^1\frac{\arctan x}{x}\mathrm dx-2\int_0^1\frac{x\arctan x}{1+x^2}\mathrm dx\right) \end{align}
The... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.965899577232538,
"lm_q1q2_score": 0.8339495927574025,
"lm_q2_score": 0.863391611731321,
"openwebmath_perplexity": 1047.3683462812087,
"openwebmath_score": 0.9991767406463623,
"tags... |
fluid-dynamics, waves, acoustics, scattering, viscosity
Side Note: In some systems one can choose either $\Im \left[ k \right] \neq 0$ or $\Im \left[ \omega \right] \neq 0$ and end with effectively the same result. Thus, the initial assumption is a matter of choice in these systems but as I stated before, there are ... | {
"domain": "physics.stackexchange",
"id": 41929,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "fluid-dynamics, waves, acoustics, scattering, viscosity",
"url": null
} |
• Once you get past calc II, there will be little, if any, occasion to integrate bizarre functions by hand. My experience is just memorize enough to get the grade you desire and learn it deeply on the side. Integration wasn't interesting to me until I learned the Lebesgue integral, but as for the computation aspect, me... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9664104972521578,
"lm_q1q2_score": 0.8094847272319287,
"lm_q2_score": 0.8376199653600371,
"openwebmath_perplexity": 339.71996337573717,
"openwebmath_score": 0.8319252133369446,
"ta... |
ros-electric
<link name="my_ir_link">
<inertial>
<mass value="0.01"/>
<origin xyz="0 0 0" />
<inertia ixx="0.001" ixy="0.0" ixz="0.0"
iyy="0.001" iyz="0.0" izx="0.0"
izz="0.001" />
</inertial>
... | {
"domain": "robotics.stackexchange",
"id": 3077,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros-electric",
"url": null
} |
microbiology, autoclave
But my understanding was that whatever comes out of the autoclave would be sterile as long as you pick the proper cycle.
To be clear, is it ok to autoclave waste and equipment in the same cycle? For example, liquid waste and liquid 7H9 on a liquid cycle or solid waste and empty beakers on a gra... | {
"domain": "biology.stackexchange",
"id": 12106,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "microbiology, autoclave",
"url": null
} |
mechanical-engineering, stresses, aluminum
If you do not foresee any reasonable scenarios, still, you could take rough factors to weight, (the more serious it is, the higher the factor).
And finally a 1.25 or 1.5 for safety must be considered.
Without any checks, if it’s a hobby project, you can of course go ahead an... | {
"domain": "engineering.stackexchange",
"id": 2017,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mechanical-engineering, stresses, aluminum",
"url": null
} |
optics, double-slit-experiment, polarization, interferometry
Expanding,
$$\Psi_3 \propto M_{(identity \lor mixer)}(M_{(identity \lor H)}\Psi_1e^{i\phi_1}+M_{(identity \lor V)}\Psi_2e^{i\phi_2})\tag{1}\label{eq1}$$
where $M_{H \lor V}$ are the Jones matrices for horizontal and vertical polarizers, respectively, and $\p... | {
"domain": "physics.stackexchange",
"id": 82093,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "optics, double-slit-experiment, polarization, interferometry",
"url": null
} |
quantum-mechanics, general-relativity, reference-frames, observers, quantum-gravity
trust our methods to give reliable predictions. But if we try to push GR to energies near or above the Planck scale, then we find we need access to the rest of the Taylor series, and we simply do not know what that is. The previous few... | {
"domain": "physics.stackexchange",
"id": 99978,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, general-relativity, reference-frames, observers, quantum-gravit... |
kinetics
If everything was not non-sense until this point, I ended up with the derivative:
$$\frac{\mathrm dk}{\mathrm dT}=A\mathrm e^{-E_\mathrm a/(RT)}\times E_\mathrm a/(RT^2)$$
Is this correct chemistry/maths?
EDIT
Is there a better way to compare the significance of concentration with that of temperature on the r... | {
"domain": "chemistry.stackexchange",
"id": 14552,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kinetics",
"url": null
} |
c++, networking
Synchronization of access to methods is intentionally not implemented here; The topic of multithreading support will be discussed later. Intentionally omitted handling of critical call errors and UDP deficiencies.
I know that using a template in the class Action
(@insp
SO)
increases the size of the bin... | {
"domain": "codereview.stackexchange",
"id": 45194,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, networking",
"url": null
} |
logic, linear-temporal-logic, temporal-logic
Let's look at (1). You got to the formula $true{\bf U} (\psi\vee \neg \phi)$. Now, this holds in a computation $\pi$ iff there exists $i\ge 0$ such that $\pi^i\models \psi\vee \neg \phi$. Assume now that $i$ is minimal with respect to this property, and consider the computa... | {
"domain": "cs.stackexchange",
"id": 11375,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "logic, linear-temporal-logic, temporal-logic",
"url": null
} |
string-theory, spacetime, spacetime-dimensions, compactification, branes
Then the issue becomes confining gravity to the brane. Already the experimental constraints on gravity are much weaker than the standard model fields--this is the essence behind the proposal of Arkhani-Hamed, Dimopolous, and Dvali (ADD) (http://a... | {
"domain": "physics.stackexchange",
"id": 20112,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "string-theory, spacetime, spacetime-dimensions, compactification, branes",
"url"... |
newtonian-mechanics, energy, reference-frames, energy-conservation
That is, I wonder if it is possible that $\cfrac{1}{2}m\left(V_2^2-V_1^2\right)=\cfrac{1}{2}m\left(V_{2*}^2-V_{1*}^2\right)$? Your analysis is correct. In the case of one-dimensional motion with $0 \leq |v|$ the changes in kinetic energy of a particle ... | {
"domain": "physics.stackexchange",
"id": 76768,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, energy, reference-frames, energy-conservation",
"url": null... |
$\notag S = \mathrm{sign}(A) = X \mathrm{sign}(J)X^{-1} = X \mathrm{diag}(\mathrm{sign}(\lambda_i))X^{-1},$
since all the derivatives of the sign function are zero. The eigenvalues of $S$ are therefore all $\pm 1$. Moreover, $S^2 = I$, so $S$ is an involutory matrix.
The matrix sign function was introduced by Roberts... | {
"domain": "nhigham.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9871787827157819,
"lm_q1q2_score": 0.8138913230048442,
"lm_q2_score": 0.824461928533133,
"openwebmath_perplexity": 232.0640899068836,
"openwebmath_score": 0.9777094125747681,
"tags": nul... |
condensation
A quick run-through of thermodynamics, phase changes and vapor pressure: Nature seeks to maximize entropy (this is the Second Law), which usually means minimizing energy. For our familiar environment of near-constant temperature and pressure, the relevant energy is called the Gibbs free energy $G\equiv U+... | {
"domain": "physics.stackexchange",
"id": 96262,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "condensation",
"url": null
} |
complexity-theory, np, co-np
Title: How to show that this decision problem is in co-NP? Given a set of strictly positive numbers $a_1, ..., a_n$, the problem is to determine if $\lfloor n/2 \rfloor$ different indexes $i_1, ..., i_{\lfloor n/2 \rfloor}$ exist so that $$\frac{a_{i_j}}{a_{i_{j-1}}} = \frac{a_{i_{j+1}}}{a... | {
"domain": "cs.stackexchange",
"id": 13129,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "complexity-theory, np, co-np",
"url": null
} |
condensed-matter, quantum-hall-effect
Let me clarify things a bit more. Think of starting with the 1/3 filling factor ground state. Now let us add adiabatically 1 flux quanta through a thin solenoid at the origin of space (See Laughlin's Nobel lecture). He shows that in this process e/3 charge flows towards the origin... | {
"domain": "physics.stackexchange",
"id": 6831,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "condensed-matter, quantum-hall-effect",
"url": null
} |
molecular-orbital-theory, hybridization, valence-bond-theory
Then why do you still call it MO theory if the electrons are localised?!??!!??!
You didn't ask this question, but I anticipated you might wonder about it, since I've been going on and on about MOT only to end up saying that the electrons are localised. It's... | {
"domain": "chemistry.stackexchange",
"id": 4500,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "molecular-orbital-theory, hybridization, valence-bond-theory",
"url": null
} |
ros, gazebo, simulation, ros-kinetic
-- +++ processing catkin package: 'iri_wam_description'
-- ==> add_subdirectory(iri_wam/iri_wam_description)
-- +++ processing catkin package: 'iri_wam_gazebo'
-- ==> add_subdirectory(iri_wam/iri_wam_gazebo)
-- Using these message generators: gencpp;geneus;genlisp;gennodejs;genpy
-... | {
"domain": "robotics.stackexchange",
"id": 30018,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, gazebo, simulation, ros-kinetic",
"url": null
} |
open-source, dataset, crawling
Instagram (http://instagram.com/developer/)
rate limits: 5000 requests per hour;
real-time API (like Streaming API for Twitter, but with photos) - connection to it is a little bit tricky: callbacks are used;
lack of sociodemographic data;
photos, filters data available;
unexpected imper... | {
"domain": "datascience.stackexchange",
"id": 5278,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "open-source, dataset, crawling",
"url": null
} |
rosbag
Comment by Mechatronics on 2014-03-11:
I am stuck again :(
Comment by ahendrix on 2014-03-11:
As noted, it looks like you should set the image_transport parameter to compressed for the extract_images node. | {
"domain": "robotics.stackexchange",
"id": 17236,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "rosbag",
"url": null
} |
Normal Distribution. This is represented by standard deviation value of 2.83 in case of DataSet2. Z = (X – mean)/stddev = (70-66)/6 = 4/6 = 0.66667 = 0.67 (round to 2 decimal places), We now need to find P (Z <= 0.67) = 0. All Rights Reserved. In order to compute P(X < 30) we convert the X=30 to its corresponding Z sco... | {
"domain": "lavalldebo.org",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9693241982893258,
"lm_q1q2_score": 0.8180079475295793,
"lm_q2_score": 0.843895106480586,
"openwebmath_perplexity": 387.0337702119331,
"openwebmath_score": 0.7284342050552368,
"tag... |
cosmology, astrophysics
Then here is an even more awesome view, which is a reconstructed view of the 3D velocitiy field (in the X,Y plane of our galaxy). Now each galaxy has an estimate of its 3D velocity shown and reveals the flows that are present in a more persuasive image. The paper also contains similar images in... | {
"domain": "physics.stackexchange",
"id": 24987,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "cosmology, astrophysics",
"url": null
} |
matlab, filters, butterworth
Title: 2-way crossover by using MATLAB's $\tt butter()$ and $\tt filter()$ I am trying to do a 2-way crossover audio filter in MATLAB in two ways:
using crossoverFilter() from Audio System Toolbox
using standard MATLAB functions butter() and filter()
In 2nd case I used parallel combinat... | {
"domain": "dsp.stackexchange",
"id": 4960,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "matlab, filters, butterworth",
"url": null
} |
newtonian-mechanics, energy-conservation
By the way, if you add up the sum of the squares of the speeds of the balls, you get 100, since kinetic energy is conserved.
Linear and Quadratic Responses
The results of this model are dependent on the power of $3/2$ in the force law -- other force laws give other breaks. For... | {
"domain": "physics.stackexchange",
"id": 11630,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, energy-conservation",
"url": null
} |
catkin, ros-groovy, dynamic-reconfigure
However, ParameterGenerator should output a more helpful message, I filed a ticket at https://github.com/ros/dynamic_reconfigure/issues/32
Originally posted by esteve with karma: 89 on 2014-07-31
This answer was ACCEPTED on the original site
Post score: 1 | {
"domain": "robotics.stackexchange",
"id": 12958,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "catkin, ros-groovy, dynamic-reconfigure",
"url": null
} |
c#, linq, entity-framework, asp.net-mvc-4
processName = pg.name,
procedureName = sop.name,
owner = sop.owner
});
}
else
{
model = (from d in db.IPACS_Department
where d.name == currentUP.currentU... | {
"domain": "codereview.stackexchange",
"id": 14797,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, linq, entity-framework, asp.net-mvc-4",
"url": null
} |
ros, filter, pcl
Originally posted by jhlim6 on ROS Answers with karma: 11 on 2016-02-11
Post score: 0
Is this line intended?
sor.filter (PCL1_cloud_filtered);
It is possibly for statistical outlier removal. If it is not related, you can try removing it.
Originally posted by Akif with karma: 3561 on 2016-02-11
Thi... | {
"domain": "robotics.stackexchange",
"id": 23714,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, filter, pcl",
"url": null
} |
left blank Economic Dynamics Phase Diagrams and Their Economic Application Second Edition This is the substantially revised and restructured second edition of Ron Shone’s successful undergraduate and graduate textbook Economic Dynamics. Bode plots, Polar plots, Log-magnitude Vs phase plots, Nyquist stability criterion,... | {
"domain": "bjoy.pw",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9898303422461274,
"lm_q1q2_score": 0.8393442126858083,
"lm_q2_score": 0.8479677545357568,
"openwebmath_perplexity": 579.6006147953274,
"openwebmath_score": 0.6228296756744385,
"tags": nu... |
### Solution 2
Assume that the point $P$ is randomly chosen within the rectangle with vertices $(0,0)$, $(3,0)$, $(3,1)$, $(0,1)$. In this case, the region for $P$ to be closer to the origin than to point $(3,1)$ occupies exactly $\frac{1}{2}$ of the area of the rectangle, or $1.5$ square units.
If $P$ is chosen with... | {
"domain": "artofproblemsolving.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9881308779050737,
"lm_q1q2_score": 0.8276781557274155,
"lm_q2_score": 0.8376199694135332,
"openwebmath_perplexity": 79.10734313502171,
"openwebmath_score": 0.9332157969474792,
... |
classical-mechanics, newtonian-gravity, multipole-expansion
Do I add up the $q_{2m}$ for each possible m ranging from $-2$ to $2$? If not, how do I find this? The quadrupole moment is a tensor, i.e., it's not the sum of $q_{2,m}$ over all $m$, it's just $q_{2,m}$, thought of as a spherical tensor of rank-2 with compon... | {
"domain": "physics.stackexchange",
"id": 99986,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "classical-mechanics, newtonian-gravity, multipole-expansion",
"url": null
} |
filters, filter-design, image-processing
Title: How to filter noise from continuous path in image Problem statement
In the dataset above, you can notice a continuous path and then a noise-band at around 320-400 on the x-axis. I want to be able to apply a filter that amplifies the continuous path while suppressing the... | {
"domain": "dsp.stackexchange",
"id": 2055,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "filters, filter-design, image-processing",
"url": null
} |
practice or assessment in using the Pythagorean Theorem to find the distances between objects on the Coordinate Plane. Find the distance between the points and . Distance In Coordinate Plane. In this Pythagorean theorem: Distance Between Two Points on a Coordinate Plane worksheet, students will determine the distance b... | {
"domain": "drum-tech.pl",
"id": null,
"lm_label": "1. Yes\n2. Yes\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9916842225056002,
"lm_q1q2_score": 0.8543738440901447,
"lm_q2_score": 0.8615382040983515,
"openwebmath_perplexity": 776.8362653751947,
"openwebmath_score": 0.5107263922691345,
"tags... |
The technique used by the book is correct and can be justified. This is done, for instance, in Spivak's Calculus at the chapter Integration in elementary terms.
• Thanks, I will look at this chapter, maybe I can gain some insight which I am currently lacking. Cuz if the technique is correct, this implies that dy/dx is... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9693241982893259,
"lm_q1q2_score": 0.8258184631046422,
"lm_q2_score": 0.8519527982093666,
"openwebmath_perplexity": 411.06615481352054,
"openwebmath_score": 0.8568940162658691,
"ta... |
automata, pushdown-automata, computation-models
Any PDA can be shown to be equivalent with a PDA with two different stack symbols, so in itself characterize the context-free languages.
Two-counter automata are much more powerful, they can simulate Turing machines, and hance form the recursively enumarable languages. ... | {
"domain": "cs.stackexchange",
"id": 4148,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "automata, pushdown-automata, computation-models",
"url": null
} |
ros-kinetic, rasbperrypi
Reproduce this error by running:
==> cd /home/pi/ros_catkin_ws/build_isolated/pluginlib && /home/pi/ros_catkin_ws/install_isolated/env.sh cmake /home/pi/ros_catkin_ws/src/pluginlib -DCATKIN_DEVEL_PREFIX=/home/pi/ros_catkin_ws/devel_isolated/pluginlib -DCMAKE_INSTALL_PREFIX=/home/pi/ros_catkin_... | {
"domain": "robotics.stackexchange",
"id": 34479,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros-kinetic, rasbperrypi",
"url": null
} |
0C0 = ( n+1k+1 ) 5 + +! Family of sum of binomial coefficients integers that occur as coefficients in the expansion ( 2x – 1 coefficients in the prime of. + 10 + 10 + 5 + 10 + 5 + 1 = 32 full-pledged engineers very soon aCorrect is... With each successive term, while the powers on a in the past ) 2+ ( n1 ) +2 n2... 2 s... | {
"domain": "casadeoxumare.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9632305349799242,
"lm_q1q2_score": 0.8316451623722227,
"lm_q2_score": 0.8633916099737806,
"openwebmath_perplexity": 984.8769110137963,
"openwebmath_score": 0.8559695482254028,
"tag... |
electrostatics, capacitance
As for the question about the material; people would never use insulators themselves as capacitors in the sense that I believe you are suggesting. Rather the surfaces (or "plates") that bound our region where the electric field is, are always made of conducting material. What usually is the... | {
"domain": "physics.stackexchange",
"id": 35013,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electrostatics, capacitance",
"url": null
} |
graphs
For instance, if the graph is a tree, there is an efficient solution: do a DFS once, and store the pre and post numbers at every node; then each ancestor query can be answered by testing for interval containment.
In a more general graph, this is known as a reachability query, and there are algorithms in the lit... | {
"domain": "cs.stackexchange",
"id": 5445,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "graphs",
"url": null
} |
java
Client class
public class Client {
public static void main(String args[]) {
Person gretchen = new Parent("gretchen", 101);
Person steve = new Parent("Steve", 57);
Person mary = new Parent("Mary", 56);
Person timmy = new Child("Timmy", 10);
Person molly = new Child("Molly", 5);
gretchen.... | {
"domain": "codereview.stackexchange",
"id": 42819,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java",
"url": null
} |
general-relativity, black-holes, thermal-radiation, hawking-radiation
If your rope is tied to an accelerating rocket or you happen to have luckily grabbed on to the tentacle of a giant galactic space squid desperately trying to save you, then you will again be in the situation where it is as if you have a rocket attac... | {
"domain": "physics.stackexchange",
"id": 39266,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "general-relativity, black-holes, thermal-radiation, hawking-radiation",
"url": n... |
ros, java, android-core, android
Title: android tutorial pubsub does't subscribe from a pc node
Hi
i'm writing an Android app which must publish in a topic and subscriber from an another topic. The app which publish works fine (the listener node receive the correct string), while the app which subscriber does't work ... | {
"domain": "robotics.stackexchange",
"id": 15220,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, java, android-core, android",
"url": null
} |
javascript
Title: Finding Memoryleaks In Data Structures Looking for constructive criticism on my code below for detecting a memory leak in a data structure.
MemoryLeak = {
uniq_id: (new Date()).getTime(),
checked: 1,
is_seen: [],
checkLeaks: function(obj) {
var self = MemoryLeak
if(!obj || (typ... | {
"domain": "codereview.stackexchange",
"id": 24340,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript",
"url": null
} |
thermodynamics, everyday-life, water, phase-transition
Title: Why is there vapour when I take a hot shower? When we take a hot shower it is pretty common to see a white vapour around the bathroom. But the water I am using is below 100º C.
I know the boiling point of the water can be lower than this with a different pr... | {
"domain": "physics.stackexchange",
"id": 35564,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, everyday-life, water, phase-transition",
"url": null
} |
oscillators, coupled-oscillators
What does potential mean?(I know that potential function defines an invariance most of the times, but how it is defnied for oscillators case?
If you don't like how the figure draw, you can just rotate the figure until the force vector pointing downward. Then it is exact a bead in a ri... | {
"domain": "physics.stackexchange",
"id": 14831,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "oscillators, coupled-oscillators",
"url": null
} |
ros-kinetic, dynamic-reconfigure
Originally posted by lucasw with karma: 8729 on 2018-08-16
This answer was ACCEPTED on the original site
Post score: 0
Original comments
Comment by ytosclee on 2018-08-16:
Hi Lucasw:
Thanks a lot for your help!
Best Regards,
Ytosclee | {
"domain": "robotics.stackexchange",
"id": 31544,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros-kinetic, dynamic-reconfigure",
"url": null
} |
discrete-signals, downsampling
or, if taking $\dfrac{2\pi}{3}$ and downsampling by factor $2$ then, $\dfrac{2\pi}{3}\cdot\dfrac{1}{2} = \dfrac{\pi}{3}$ or $\dfrac{1}{6}$
But the answer is wrong. How should I solve it? If the term downsampling is used in its correct meaning as anti-aliasing lowpass filtering followed b... | {
"domain": "dsp.stackexchange",
"id": 10024,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "discrete-signals, downsampling",
"url": null
} |
c++, c++14, pointers, overloading
Is there anything that could be improved in my code?
How to solve the second remaining problem listed at the section “Loose Ends” of Meyer’s article? (“You can’t use user-defined pointers-to-members. If someone has overloaded operator ->* to take objects that act like member pointers,... | {
"domain": "codereview.stackexchange",
"id": 17902,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, c++14, pointers, overloading",
"url": null
} |
cosmology, black-holes, universe, event-horizon
The microwave background radiation may be a result of Hawking radiation at the event horizon (which we are viewing fromn the inside), or, depending upon the non-euclidian geometry, we may be observing the result of matter being destroyed at the singularity. This is a cas... | {
"domain": "physics.stackexchange",
"id": 71053,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "cosmology, black-holes, universe, event-horizon",
"url": null
} |
Inverses. Initialize: Set B 0 and S 0 equal to A, and set k = 0. In the method of Gauss-Jordan elimination, one continues the work of elimination, placing zeros above the diagonal. As mentioned earlier, the Gauss-Jordan method starts out with an augmented matrix, and by a series of row operations ends up with a matrix ... | {
"domain": "globalbeddingitalia.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9859363717170516,
"lm_q1q2_score": 0.8060764148580296,
"lm_q2_score": 0.817574478416099,
"openwebmath_perplexity": 712.3485932488467,
"openwebmath_score": 0.63821941614151,
... |
c#, object-oriented, game, interview-questions, console
public Word(string Word)
{
this.Value = Word;
}
private int CalculateScore()
{
int CurrentScore = 0;
CurrentScore += GetLetterPoints();
if (BonusPoints()) CurrentScore += 3;
... | {
"domain": "codereview.stackexchange",
"id": 14467,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, object-oriented, game, interview-questions, console",
"url": null
} |
c#, authorization
_rbac = new Rbac(new RbacSession());
_rbac.Do.A("Delete").Requires("owner");
_rbac.Do.A("Transfer").Requires("owner");
_rbac.Do.A("Comment").Requires("member");
_rbac.Do.A("Create").Requires("member");
_rbac.Do.A("Read").Requires("user");
_rbac.Do.A("Ma... | {
"domain": "codereview.stackexchange",
"id": 18007,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, authorization",
"url": null
} |
python, performance, beginner, time-limit-exceeded
Rewritten accordingly:
def height(array):
depth = {-1: 0}
while len(depth) <= len(array):
for child, parent in enumerate(array):
if parent in depth:
depth[child] = depth[parent] + 1
return max(depth.values())
For perfor... | {
"domain": "codereview.stackexchange",
"id": 40584,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, performance, beginner, time-limit-exceeded",
"url": null
} |
c#, design-patterns, game, console
var key = Console.ReadKey(true).Key;
Commands.Enqueue(key);
Trace.WriteLine("Added: " + key + " " + Commands.Count);
Thread.Sleep(100);
}
}
/// <summary>
/// Processes the first item in the queue. Notifies all observers about... | {
"domain": "codereview.stackexchange",
"id": 10251,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, design-patterns, game, console",
"url": null
} |
newtonian-mechanics, kinematics, energy-conservation, projectile
Title: Calculating the initial velocity of a projectile knowing the distance to an elevated target, its height, and the initial angle The problem I am trying to solve is to find the velocity needed to hit an elevated target a known distance away from the... | {
"domain": "physics.stackexchange",
"id": 85164,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, kinematics, energy-conservation, projectile",
"url": null
} |
algorithm-analysis, data-structures, runtime-analysis, lists
Each of these two cases has a probability of 0.5
Why C(k) = 2k and how to interpret this formula? Is the analysis formula in the figure right? The recurrence can be solved as:
$$
\begin{align}
C(k) &= \frac{1 + C(k)}{2} + \frac{1 + C(k-1)}{2}\\
2 \cdot C(k)... | {
"domain": "cs.stackexchange",
"id": 8951,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithm-analysis, data-structures, runtime-analysis, lists",
"url": null
} |
hilbert-space, quantum-spin, fermions, second-quantization
\begin{equation}
a_n(x)|0\rangle = 0
\hskip2cm
\langle 0|0\rangle = 1
\tag{4}
\end{equation}
for all $n,x$.
All other vectors in the representation are linear combinations of
vectors obtained from $|0\rangle$ by applying sums of products
of the adj... | {
"domain": "physics.stackexchange",
"id": 53439,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "hilbert-space, quantum-spin, fermions, second-quantization",
"url": null
} |
homework-and-exercises, newtonian-mechanics, mass, geometry
The second one has a ball attached to it with a mass.
I didn't give the numbers and all the givens because I am not just looking for the answers, I'm more looking for how I should proceed in general so that I can solve other similar problems
Decide on a rect... | {
"domain": "physics.stackexchange",
"id": 43632,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, newtonian-mechanics, mass, geometry",
"url": null
} |
homework-and-exercises, thermodynamics
Still, notice that there are only two energy scales, i.e., $\epsilon$ and $kT$, in the problem. Then, whatever (dimensionless) number that determines whether the equipartition holds or fails has to be the ratio $x\equiv kT/\epsilon$. The limits $x \rightarrow 0$ and $x\rightarrow... | {
"domain": "physics.stackexchange",
"id": 15883,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, thermodynamics",
"url": null
} |
homework-and-exercises, thermodynamics, work, ideal-gas
I tried to solve this by first using the first law of thermodynamics
$dU=dQ+dW$
where U is the internal energy, Q the thermal energy and W the work done by the gas.
The work can be obtained from
$dW=-pdV$
which in this case means the area under the graph
For the ... | {
"domain": "physics.stackexchange",
"id": 27372,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, thermodynamics, work, ideal-gas",
"url": null
} |
Well, we see this must be the case because \begin{align} 2n + 2(n+1) + 2 &= 2n + 2n + 2 + 2 \\ &= 4n + 4 \\ &= 4(n+1) \\ \end{align}
is a multiple of four, so $2n + 2(n+1) + 2 \equiv 0 \mod{4}$. So putting this together we get that: $$(n+2)^2 = n^2 + 2n + 2(n+1) + 2 \equiv 1 \mod{4}$$ as desired. $\blacksquare$.
The ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9724147209709196,
"lm_q1q2_score": 0.8082157431044802,
"lm_q2_score": 0.8311430562234877,
"openwebmath_perplexity": 243.61580038253393,
"openwebmath_score": 0.9976516962051392,
"ta... |
machine-learning, classification, random-forest, svm
Therefore, as a rule of thumb, SVM is hardly scalable beyond 10^5 points.
Large number of features (homogeneous features with meaningful distance, pixel of image would be a perfect example) is generally not a problem.
For a classification problem Random Forest give... | {
"domain": "datascience.stackexchange",
"id": 10861,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "machine-learning, classification, random-forest, svm",
"url": null
} |
performance, c, matrix
Instead of *(matrix + current_row * columns + current_column) you can also write matrix[current_row * columns + current_column] which is a bit easier on the eyes (imho).
It is accepted practice that loop counters can be single letter variables. In conjunction with the fact that you operate on a ... | {
"domain": "codereview.stackexchange",
"id": 4791,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "performance, c, matrix",
"url": null
} |
python, programming-challenge
Title: Counting subnumbers divisible by a given prime Assume we are given a number and a prime p. The goal is to count all subnumbers of number that are divisible by p. A subnumber of number is formed of any number of consecutive digits in the decimal representation of number. Here is my ... | {
"domain": "codereview.stackexchange",
"id": 40042,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, programming-challenge",
"url": null
} |
electromagnetism, maxwell-equations, beyond-the-standard-model, magnetic-monopoles, grand-unification
So obviously there must be at least another reason apart from this to believe in the existence of natural magnetic monopoles. (I'm aware that recent research has shown that metamaterials (or something similar) can emu... | {
"domain": "physics.stackexchange",
"id": 13655,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electromagnetism, maxwell-equations, beyond-the-standard-model, magnetic-monopoles... |
gravity, newtonian-gravity
Title: Why do objects accelerate as they fall? Most importantly, what must change in order for the falling object to change its speed? Is it the distance to the centre of the planet? If you pull the earth away from the object as the object falls, will the object slow down or will it keep acc... | {
"domain": "physics.stackexchange",
"id": 7035,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gravity, newtonian-gravity",
"url": null
} |
c, networking, socket, c99
Returns true upon success, false upon failure
*/
bool recv_all(socket_t sfd, char** restrict resbuff, size_t* restrict len)
{
ssize_t stat = 0;
size_t idx = 0; /* Latest initialized element index of *resbuff */
*len = RESPONSE_BUFFER_LEN; /* Le... | {
"domain": "codereview.stackexchange",
"id": 39485,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, networking, socket, c99",
"url": null
} |
I'm having trouble with this. Can somebody provide an example of a function that is continuous at every $x \ne 0$ and discontinuous at $x = 0$? I'm wondering if a contradiction would work.
• Try to do it in steps. First, try to show that it is continuous at $x=0$. $\epsilon$-$\delta$ does a good job here. – Fimpellizi... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9857180656553329,
"lm_q1q2_score": 0.8149047526100375,
"lm_q2_score": 0.8267117962054048,
"openwebmath_perplexity": 104.95957330008918,
"openwebmath_score": 0.9366839528083801,
"ta... |
go, authentication, authorization
hashedPassword, err := bcrypt.GenerateFromPassword([]byte(data["password"][0]),10)
if err != nil{
http.Error(w,"Internal server error",500)
}
DB.newUser(data["login"][0],data["email"][0],string(hashedPassword))
http.Redir... | {
"domain": "codereview.stackexchange",
"id": 39192,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "go, authentication, authorization",
"url": null
} |
organic-chemistry, reaction-mechanism
Title: Why is the addition of a singlet carbene to an alkene stereospecific? Why is the addition of a singlet carbene to an alkene stereospecific, but not when a triplet carbene is added? Here is a diagram that might help explain things. | {
"domain": "chemistry.stackexchange",
"id": 1695,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "organic-chemistry, reaction-mechanism",
"url": null
} |
java, performance, sorting, quick-sort
8590ns
8697ns
8586ns
For arrays of length 10 the results were:
655ns
679ns
660ns
Does it make sense to rerun the program even though it essentially loops through itself 1,000,000 times to calculate the average?
It doesn't look like choosing the pivot of median of 3, and presor... | {
"domain": "codereview.stackexchange",
"id": 22298,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, performance, sorting, quick-sort",
"url": null
} |
javascript, beginner, html, animation
Title: TypeWriter Javascript effect I have implemented a Javascript TypeWriter effect for my website. It types out code using the TypeWriter variable by adding each character on and setting a timeout. It then 'deletes' code using text slice and 're types.
I had big problems in se... | {
"domain": "codereview.stackexchange",
"id": 31649,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, beginner, html, animation",
"url": null
} |
Is it correct? Didn't I make it too complicated?
Two facts about elementary row operations are useful to resolve this question:
• Elementary row operations alter the column space but do not alter the linear dependences among the columns. For example, if column 10 is $4$ times column 3 minus $7$ times column 5, then a... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9908743628803028,
"lm_q1q2_score": 0.8191675285811627,
"lm_q2_score": 0.8267118004748678,
"openwebmath_perplexity": 130.61827369173767,
"openwebmath_score": 0.8199295401573181,
"ta... |
strings, vba, formatting, vb6
Case Else
If IsNumeric(formatSpecifier) And val(formatGroup) = 0 Then
formatSpecifier = formatGroup
v = Format(v, formatGroup)
Else
Err.Raise ERR_FORMAT_EXCE... | {
"domain": "codereview.stackexchange",
"id": 20291,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "strings, vba, formatting, vb6",
"url": null
} |
astrophysics, nuclear-physics, nucleosynthesis
The secondary r-process would occur in a system which was unable to reach nuclear statistical equilibrium and had not for instance manufactured iron-peak seed nuclei. Instead the r-process can only occur using seed nuclei that were already present in the system. This is n... | {
"domain": "physics.stackexchange",
"id": 19022,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "astrophysics, nuclear-physics, nucleosynthesis",
"url": null
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.