text stringlengths 1 1.11k | source dict |
|---|---|
development
Title: Lack of yolk in mammalian oocytes as compared to other vertebrates? Why do mammalian oocytes have little to no yolk? How does it compare to other vertebrates such as frogs, fish, and birds? In oviparous animals (those that lay eggs which hatch outside the body), the eggs need to be provided nutritio... | {
"domain": "biology.stackexchange",
"id": 5078,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "development",
"url": null
} |
homework-and-exercises, electromagnetism, energy, projectile, estimation
Title: What would be the Joule requirement to a railgun launch a conventional bullet at mach 7? The railgun project from the US Naval Surface Warfare Center Dahlgren Division shoots a projectile of 3.2kg at a speed of mach 7 with 18.4 megajoules ... | {
"domain": "physics.stackexchange",
"id": 98600,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, electromagnetism, energy, projectile, estimation",
"url"... |
ros, navigation, kinect, gmapping, pioneer
Originally posted by Chithra on ROS Answers with karma: 13 on 2013-02-05
Post score: 1
Original comments
Comment by ayush_dewan on 2013-02-06:
For the frame issues use static_tf_publisher to publish transformation between /camera_link and pioneer base_link. The transformatio... | {
"domain": "robotics.stackexchange",
"id": 12755,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, navigation, kinect, gmapping, pioneer",
"url": null
} |
• To use the same color for all the contour lines, specify an RGB triplet or one of the color options from the table.
For a custom color, specify an RGB triplet. An RGB triplet is a three-element row vector whose elements specify the intensities of the red, green, and blue components of the color. The intensities must... | {
"domain": "mathworks.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9780517424466175,
"lm_q1q2_score": 0.823349037249411,
"lm_q2_score": 0.8418256432832333,
"openwebmath_perplexity": 5460.253404979788,
"openwebmath_score": 0.5561828017234802,
"tags": n... |
Notice, however, that you have x=1 as a double root. The eigenvalues are r1=r2=-1, and r3=2. Av = λv. The process for finding the eigenvalues and eigenvectors of a 3xx3 matrix is similar to that for the 2xx2 case. EXAMPLE 1: Find the eigenvalues and eigenvectors of the matrix. Since the zero-vector is a solution, the s... | {
"domain": "paramountranchtrailruns.com",
"id": null,
"lm_label": "1. Yes\n2. Yes\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9755769099458927,
"lm_q1q2_score": 0.8043260100869225,
"lm_q2_score": 0.8244619177503205,
"openwebmath_perplexity": 418.436373876837,
"openwebmath_score": 0.89106810092... |
gazebo, urdf
Title: general doubt in erratic urdf
I am trying to write a urdf for a rover which is like erratic robot in some aspects,but it is very big compared to it.So i tried changing urdf file of erratic to suit my rover.However i was not able to change the wheel of the erratic robot because it is a stl file.Ca... | {
"domain": "robotics.stackexchange",
"id": 4967,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo, urdf",
"url": null
} |
python, beginner, python-3.x, network-file-transfer
Avoid wildcard imports. Read about it here and/or here.
print works well for prototyping or putting something together quickly. Printing makes sense in the cli UI (e.g. ui.py, or the new modules in client_cli.py and similar). There we are outputting text as a means t... | {
"domain": "codereview.stackexchange",
"id": 41991,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, beginner, python-3.x, network-file-transfer",
"url": null
} |
data-structures, programming-languages, efficiency, garbage-collection
Title: Is it possible to implement a WeakMap with primitive keys and weak values? Theory
Basically, I have a use-case where I would like to use primitives to store weak references to non-primitive values. If the value is no longer referenced anywhe... | {
"domain": "cs.stackexchange",
"id": 9321,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "data-structures, programming-languages, efficiency, garbage-collection",
"url": null
} |
the coin and S be the sample space of maximum possibilities of getting heads. When tossing a fair coin the chances of tails and heads are the same: 50% and 50%. The ratio of successful events A = 4 to the total number of possible combinations of a sample space S = 8 is the probability of 2 tails in 3 coin tosses. 1, 1 ... | {
"domain": "laron-online.de",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9811668706602659,
"lm_q1q2_score": 0.8471312510100645,
"lm_q2_score": 0.863391617003942,
"openwebmath_perplexity": 218.89877272879593,
"openwebmath_score": 0.7882991433143616,
"tags"... |
algorithms, data-structures, search-trees, balanced-search-trees
Initialize $y$ to be the root of $S'_\tau$ and $m' = m$.
Let $r = size(y_l) + |L_y|$.
If $r \ge m'$ and $size(y_l) \lt m'$ then $x = y$ and stop.
Else if $r \ge m'$ and $size(y_l) \ge m'$, let $y = y_l$ and go to step 2.
Otherwise, let $m' = m' - r$ and ... | {
"domain": "cs.stackexchange",
"id": 20638,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms, data-structures, search-trees, balanced-search-trees",
"url": null
} |
c#
Here are some things that I need to mention (just a heads up): | {
"domain": "codereview.stackexchange",
"id": 41907,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#",
"url": null
} |
filters, signal-analysis, lowpass-filter, digital-filters, gnuradio
The second thing I was wondering about is the shift of the signals in time domain. I plotted the unfiltered signal and the filtered signal and noticed that they are shifted (as expected, because of the filter delay). I tried to experiment with the par... | {
"domain": "dsp.stackexchange",
"id": 10787,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "filters, signal-analysis, lowpass-filter, digital-filters, gnuradio",
"url": null
} |
java, beginner, swing, lambda, pokemon
It seems like Type may be a better name than Element?
It's good practice to make everything as private as possible, so consider making the Element constructor private.
Override toString in the enumerated type instead of having to specify a name in the constructor (you could utili... | {
"domain": "codereview.stackexchange",
"id": 9519,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, beginner, swing, lambda, pokemon",
"url": null
} |
electrostatics, electric-fields, gauss-law
and
assume the field vector to be along the positive direction of the X axis, the field lines are parallel and equally spaced, assumed to come from a very large distance
cannot be simultaneously true.
In effect you have proved that with your evaluation of the electric f... | {
"domain": "physics.stackexchange",
"id": 48954,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electrostatics, electric-fields, gauss-law",
"url": null
} |
Suppose you have $n+k-1$ distinct balls and two bags. Now you want to pick $k$ balls and put them in bag $1$ and the rest $n-1$ balls in bag $2$.
If you choose $k$ balls first, there are $\binom{n + k - 1}{k}$ possible ways to do that. On the other hand, you can think you are actually picking $n-1$ balls first and put... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9879462197739624,
"lm_q1q2_score": 0.8122786434384018,
"lm_q2_score": 0.8221891305219504,
"openwebmath_perplexity": 350.14353640352715,
"openwebmath_score": 0.8508399724960327,
"ta... |
performance, c, recursion, functional-programming, interpreter
char *showQuote(RawCode rcode)
{
if (rcode.used >= 50)
return "[...]";
char *result;
__mingw_asprintf(&result, "[");
for (size_t i = 0; i < rcode.used; i++)
{
if (rcode.used >= 100 && i == 50)
{
i = r... | {
"domain": "codereview.stackexchange",
"id": 36505,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "performance, c, recursion, functional-programming, interpreter",
"url": null
... |
quantum-information, topological-field-theory, anyons
Title: Fusion of anyons I have been studying anyons and I have found the algebraic approach rather abstract and I am struggling to understand it as it seems quite different to the usual procedure of quantum mechanics. | {
"domain": "physics.stackexchange",
"id": 62303,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-information, topological-field-theory, anyons",
"url": null
} |
# Intuitively understanding $\sum_{i=1}^ni={n+1\choose2}$
It's straightforward to show that
$$\sum_{i=1}^ni=\frac{n(n+1)}{2}={n+1\choose2}$$
but intuitively, this is hard to grasp. Should I understand this to be coincidence? Why does the sum of the first $n$ natural numbers count the number of ways I can choose a pa... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9861513873424044,
"lm_q1q2_score": 0.8880587058211178,
"lm_q2_score": 0.9005297941266014,
"openwebmath_perplexity": 272.603581655035,
"openwebmath_score": 0.7586857676506042,
"tags... |
stabilizer-code, surface-code, topological-quantum-computing
Another point of view on my question is that the suggested process "measures" the original (pink) surface code in the z basis. If the original (pink) code is in the 0 logical state, the four bottom face syndrome measurements must give even parity. If the ori... | {
"domain": "quantumcomputing.stackexchange",
"id": 4907,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "stabilizer-code, surface-code, topological-quantum-computing",
"url": nu... |
optimization, algorithm, ruby, programming-challenge, time-limit-exceeded
\$1 ≤ T ≤ 50\$
\$1 ≤ N ≤ 10^5\$
\$0≤K<N\$
Sample Input
2
3 1
5 2
Sample Output
2
4
Explanation
For first test case, The rotation will be like this: 0 1 2 -> 2 1 0 -> 2 0 1 -> 2 0 1 So, Index of 1 will be 2.
Solution
test = gets.chomp.... | {
"domain": "codereview.stackexchange",
"id": 9126,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "optimization, algorithm, ruby, programming-challenge, time-limit-exceeded",
"u... |
java, beginner, file
Scanner s = new Scanner(new File("bg.txt"));
ArrayList<String> words = new ArrayList<String>();
while (s.hasNext()) {
words.add(s.next());
}
// much much later...
s.close();
Write like this:
List<String> words = new ArrayList<>();
try (Scanner s = new Scanner(new File("bg.txt"))) {
whil... | {
"domain": "codereview.stackexchange",
"id": 23218,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, beginner, file",
"url": null
} |
pattern-recognition, incremental-learning
Now if the learning agent is just learning, and cannot perform recognition without learning, there is an architectural or implementation issue. Continuous learning entails the agent is active (performs actual recognitions) and learns out of what it does. | {
"domain": "ai.stackexchange",
"id": 544,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "pattern-recognition, incremental-learning",
"url": null
} |
java, hash-map
Mutable operations on collections
List<Holding> aSourceHoldings = holdingService.getHoldings(date);
List<Holding> unMatchedHoldings = /* ... */ ;
aSourceHoldings.removeAll(unMatchedHoldings);
List<Holding> toBeMatchedHoldings = holdingRepository.getHoldings(date);
toBeMatchedHoldings.addAll(aSourceHoldi... | {
"domain": "codereview.stackexchange",
"id": 22919,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, hash-map",
"url": null
} |
general-relativity, gravity, spacetime, space-expansion, curvature
Please indicate if my understanding of the space-time fabric distortion above is in error.
I was wondering if there was more to this illustration that can help explain dark matter and dark energy.
Dark matter was theorized to explain the intra galacti... | {
"domain": "physics.stackexchange",
"id": 95164,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "general-relativity, gravity, spacetime, space-expansion, curvature",
"url": null... |
Let $D\subset X$ be countable and dense and $Z\subset X$. Assume there is no $z_0\in Z$ with a sequence $(z_n)_{n=1}^\infty$ of points in $Z$ converging to $z_0$. Then for every $z\in Z$ there exists $r=r(z)>0$ such that $B_r(z)\cap Z=\{z\}$. By decreasing $r(z)$ if necessary, we may assume that $r(z)=\frac1{n(z)}$ wit... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9921841105173781,
"lm_q1q2_score": 0.820250306054237,
"lm_q2_score": 0.8267117940706734,
"openwebmath_perplexity": 65.91678452769894,
"openwebmath_score": 0.988284707069397,
"tags"... |
(In fact, it turns out that this is the same as silvascientist's example. The explicit representation as permutations makes it clear that all the words you can form by alternating $g$ and $f$ really are distinct elements, since you can just compute what they are as functions.)
In plane Euclidean geometry, the group ge... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9790357567351324,
"lm_q1q2_score": 0.8071777081007427,
"lm_q2_score": 0.8244619285331332,
"openwebmath_perplexity": 135.01261744453166,
"openwebmath_score": 0.9131324887275696,
"ta... |
homework-and-exercises, thermodynamics, temperature, adiabatic
So, using PV = nRT i got that Va=16.61 l, Pb = 200kPa, Tb = 800K (because it is an isothermal process from A to B), and here comes what i find weird: Tc = 800K
If that was the case, there'd be no work done, no change in internal energy from B to C... am i ... | {
"domain": "physics.stackexchange",
"id": 37624,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, thermodynamics, temperature, adiabatic",
"url": null
} |
evolution, ichthyology, sociality
Note that this is pure speculation, I have no references to back this up, it just seems reasonable. I would not be surprised if some fish did actually indulge in social grooming, it's just harder for the reasons outlined above. | {
"domain": "biology.stackexchange",
"id": 3033,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "evolution, ichthyology, sociality",
"url": null
} |
matlab, discrete-signals, sampling, aliasing
Title: Demonstrating the effect of aliasing How does the signal look when we don't use the Nyquist rate to remove aliasing from a signal during sampling?
Let's suppose the signal is sinusoidal, with a frequency of 500 Hz and an amplitude of 2.
signal = 2*cos(2*pi*500*t)
If... | {
"domain": "dsp.stackexchange",
"id": 295,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "matlab, discrete-signals, sampling, aliasing",
"url": null
} |
c#, object-oriented, .net, networking, tcp
public static class CommandLine
{
private static readonly object _token = new object();
public static void Write(string text)
{
lock (_token)
{
Console.WriteLine(text);
}
}
} Grouping you member variables will make it easie... | {
"domain": "codereview.stackexchange",
"id": 11936,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, object-oriented, .net, networking, tcp",
"url": null
} |
## Homogeneous Systems
We will focus first on the unrestricted combination part. To do that, we consider systems that have the vector of zeroes as one of the particular solutions, so that $\vec{p}+c_1\vec{\beta}_1+\dots+c_k\vec{\beta}_k$ can be shortened to $c_1\vec{\beta}_1+\dots+c_k\vec{\beta}_k$.
Definition 3.2
A... | {
"domain": "wikibooks.org",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9907319860717888,
"lm_q1q2_score": 0.8005780353626254,
"lm_q2_score": 0.8080672135527632,
"openwebmath_perplexity": 807.7210400630585,
"openwebmath_score": 1.0000100135803223,
"tags": ... |
python, algorithm, programming-challenge, combinatorics, time-limit-exceeded
for (int i = 0, e = a.Length - 1; i < e; ++i)
{
unbalanced.Clear();
for (int j = i; j <= e; ++j)
{
if (unbalanced.Contains(a[j]))
unbalanced.Remove(a[j]);
else
... | {
"domain": "codereview.stackexchange",
"id": 19256,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, algorithm, programming-challenge, combinatorics, time-limit-exceeded",
... |
cc.complexity-theory, cr.crypto-security, zero-knowledge
In general, I think the definition should allow any verifier to access $O$, to prevent "twisted" protocols such as the one described above. The same holds for the distinguisher and simulator. However, I believe the prover need not necessarily have access to $O$. | {
"domain": "cstheory.stackexchange",
"id": 2232,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "cc.complexity-theory, cr.crypto-security, zero-knowledge",
"url": null
} |
standard-model, gauge-theory, history, yang-mills, weak-interaction
Title: What was the motivation for thinking the weak interaction could be described by a Yang-Mills theory? In some sense, describing the strong force using an $SU(3)$ Yang-Mills theory makes perfect sense: Yang-Mills theories describe massless bosons... | {
"domain": "physics.stackexchange",
"id": 69412,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "standard-model, gauge-theory, history, yang-mills, weak-interaction",
"url": nul... |
titration
Using these two acid volume consumption you then recalculate your $0.1 \text{M HCl}$ to it's actual concentration. And if you keep your stock acid solution for a longer period you should perform this standardization every week. Then you can perform the actual titration and determination of the alkalinity in ... | {
"domain": "chemistry.stackexchange",
"id": 7739,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "titration",
"url": null
} |
quantum-field-theory
The full integral contribution along the semi-circle is:
$$\propto \int_{\gamma_\infty}\!dz\, \frac{z^2}{z^2-\omega^2_k+i\varepsilon } - \int_{\gamma_\infty}\!dz\, \frac{z^2}{z^2-\omega'^2_k+i\varepsilon }.$$
Take one of the integrands and do a partial fraction expansion:
$$ \frac{z^2}{z^2-\omega^... | {
"domain": "physics.stackexchange",
"id": 72238,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory",
"url": null
} |
design-patterns, swift
There are a couple of problems here. First, why do we need two classes that are identical in every way except name? We don't.
I understand that we will want assets that we actually own as well as assets that we're watching to help us make future decisions, but making different classes like t... | {
"domain": "codereview.stackexchange",
"id": 18550,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "design-patterns, swift",
"url": null
} |
# Ordinary generating function for nonconsecutive integer selection
I'm trying to understand a problem I came across about ordinary generating functions. The problem is something like this:
How many ways are there to select five integers from $\{1,2,3,...,n\}$ if none of the selected integers can be consecutive? What... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9861513914124559,
"lm_q1q2_score": 0.8062522050899941,
"lm_q2_score": 0.8175744739711883,
"openwebmath_perplexity": 373.69182192226225,
"openwebmath_score": 0.8682951927185059,
"ta... |
ros
Originally posted by aldo85ita with karma: 252 on 2012-10-02
This answer was ACCEPTED on the original site
Post score: 1
Original comments
Comment by ThomasK on 2012-10-02:
Yes, when you're using the mono vo you have to set the mono vo specific parameters (i.e. height and pitch) as well obviously. Your question w... | {
"domain": "robotics.stackexchange",
"id": 11087,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros",
"url": null
} |
the product rule the. Or click an icon to Log in: you are commenting using Twitter... Leave us with two functions Equations of Tangent Lines and Normal Lines the function in the examples... It is the quotient of two functions that are being multiplied together since the power to... Two problems posted by Beth, we are h... | {
"domain": "org.br",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9664104914476339,
"lm_q1q2_score": 0.8032253694282292,
"lm_q2_score": 0.8311430562234877,
"openwebmath_perplexity": 465.1327567172857,
"openwebmath_score": 0.8390120267868042,
"tags": nul... |
navigation, rviz, transform, amcl
All Broadcasters:
Node: /amcl 13.3557 Hz, Average Delay: -0.175799 Max Delay: 0
Node: /base_laser_tf 39.866 Hz, Average Delay: -0.024749 Max Delay: 0
Node: /we_base_odom 49.9598 Hz, Average Delay: 0.00026288 Max Delay: 0.000908351
I run the rostopic echo /initialpose command, and I g... | {
"domain": "robotics.stackexchange",
"id": 5367,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "navigation, rviz, transform, amcl",
"url": null
} |
newtonian-mechanics
So, no, I don't buy the premise of the question. This is a subjective matter of biomedical/biomechanics terminology/convention. Some authors model the wrist joint as having only two primary degrees of freedom as a joint, with any pronation at all subsumed into rotation around the longitudinal axis ... | {
"domain": "physics.stackexchange",
"id": 93431,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics",
"url": null
} |
ros, ros-melodic
In the core EKF math, not explicitly, no. But that's not needed. The pose and velocity variables, for example, are correlated through the transition function and the transfer function jacobian matrix. The magic of matrix inversion is such that if you were to measure the pose at time A and again at tim... | {
"domain": "robotics.stackexchange",
"id": 36236,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-melodic",
"url": null
} |
Similar questions to practice:
how-many-diagonals-does-a-polygon-with-21-sides-have-if-one-101540.html
if-10-persons-meet-at-a-reunion-and-each-person-shakes-hands-110622.html
10-business-executives-and-7-chairmen-meet-at-a-conference-126163.html
how-many-different-handshakes-are-possible-if-six-girls-129992.html
15-ch... | {
"domain": "gmatclub.com",
"id": null,
"lm_label": "1. Yes.\n2. Yes.\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 1,
"lm_q1q2_score": 0.8333245932423308,
"lm_q2_score": 0.8333245932423308,
"openwebmath_perplexity": 2949.698514176162,
"openwebmath_score": 0.17756269872188568,
"tags": null,
"ur... |
gazebo, rosmake, hector-quadrotor
Originally posted by Hongbo Miao on ROS Answers with karma: 70 on 2013-02-03
Post score: 1
It seems that you only installed the hector_quadrotor stack without its dependencies. For compiling the hector_quadrotor stack, you need at least hector_gazebo, hector_models and hector_common ... | {
"domain": "robotics.stackexchange",
"id": 12706,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo, rosmake, hector-quadrotor",
"url": null
} |
java, datetime, collections, stream
},
"paymentAmount": {
"numberValue": 255,
"formattedValue": "255",
"numberValueInUsd": 57.01,
"formattedValueInUsd": "58"
},
"receiptNo": "6707743",
"expectedAmount": {
... | {
"domain": "codereview.stackexchange",
"id": 31146,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, datetime, collections, stream",
"url": null
} |
For more information about the 6 trigonometric functions, please visit our trigonomtry main page. Trigonometry is the study of angles and the physical relationships between angles and geometry. In the second quadrant, sine was positive, cosine was negative (and so tangent would be negative, too). Start Quiz. As mention... | {
"domain": "sri60.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9840936106207202,
"lm_q1q2_score": 0.8284352446221337,
"lm_q2_score": 0.8418256512199033,
"openwebmath_perplexity": 475.8801771295073,
"openwebmath_score": 0.5969211459159851,
"tags": null... |
physical-chemistry, thermodynamics, enthalpy
$$\Delta H_\mathrm{c}(x_a^\alpha) = \frac{a}{c}\Delta H_\mathrm{f}\left(x_{c}^{\gamma}O_{y}\right) -\Delta H_\mathrm{f}(x_a^\alpha) $$
Analogously, and assuming the product of combustion is the same:
$$\Delta H_\mathrm{c}(x_b^\beta) = \frac{b}{c}\Delta H_\mathrm{f}\left(x_... | {
"domain": "chemistry.stackexchange",
"id": 11184,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "physical-chemistry, thermodynamics, enthalpy",
"url": null
} |
neural-networks, activation-functions, function-approximation, universal-approximation-theorems
I really appreciate all your ideas on this problem! Before anything, the function you have wrote for the network lacks the bias variables (I'm sure you used bias to get those beautiful images, otherwise your tanh network ha... | {
"domain": "ai.stackexchange",
"id": 2370,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "neural-networks, activation-functions, function-approximation, universal-approximation-t... |
c++, time-limit-exceeded
And that's it.
Now, already, the algorithm above doesn't do any sorting. But it does use a vector. You can do better! As you're reading in your attractions list, you can immediately print out attractions that satisfy the criteria in #5 and #6 of the algorithm... no need to store them in a vect... | {
"domain": "codereview.stackexchange",
"id": 31235,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, time-limit-exceeded",
"url": null
} |
javascript, beginner, datetime, google-apps-script, google-sheets
Title: Script for generating a report in Google-Spreadsheets. Looks for various values to check and count It all works exactly as it should. It finds data from today, finds unique emails and puts them in an array. I then check the data again from toda... | {
"domain": "codereview.stackexchange",
"id": 5994,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, beginner, datetime, google-apps-script, google-sheets",
"url": nul... |
quasars, image-processing
Title: Why are the radio images of the jet of 3C 273 different? At NASA/IPAC Extragalactic database, we can see images of the jet of matter being ejected from the quasar 3C 273. Here are a couple from the radio spectrum as examples: | {
"domain": "astronomy.stackexchange",
"id": 5728,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quasars, image-processing",
"url": null
} |
logic, recursion, type-theory, combinatory-logic, curry-howard
Title: Does the Y combinator contradict the Curry-Howard correspondence? The Y combinator has the type $(a \rightarrow a) \rightarrow a$. By the Curry-Howard Correspondence, because the type $(a \rightarrow a) \rightarrow a$ is inhabited, it must correspon... | {
"domain": "cs.stackexchange",
"id": 21895,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "logic, recursion, type-theory, combinatory-logic, curry-howard",
"url": null
} |
special-relativity, spacetime, metric-tensor, conformal-field-theory, causality
$\textbf{Edit}$: Let us show explicitly that conformal transformations could make constant velocity not constant. For simplicity we will work in 2d (one time and one space dimension) but we will consider conformal transformation which is ... | {
"domain": "physics.stackexchange",
"id": 78191,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "special-relativity, spacetime, metric-tensor, conformal-field-theory, causality",
... |
40. Michele_Laino
$\large y = \frac{{4ac - {b^2}}}{{4a}} = \frac{{4 \cdot 3 \cdot 14 - {{12}^2}}}{{4 \cdot 3}} = \frac{{168 - 144}}{{12}} = ...?$
41. anonymous
yes that what i got 168 - 144 i did it wrong its positive 2 but i used thos step
42. anonymous
so its c for some reason i added a negtive signat the end of... | {
"domain": "openstudy.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9664104924150546,
"lm_q1q2_score": 0.8053336324970687,
"lm_q2_score": 0.8333245953120234,
"openwebmath_perplexity": 3021.53144915597,
"openwebmath_score": 0.7795302867889404,
"tags": n... |
tensorflow, yolo, residual-networks, r-cnn, darknet
Thank you very much. Lets start by listing what is what. | {
"domain": "ai.stackexchange",
"id": 3453,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "tensorflow, yolo, residual-networks, r-cnn, darknet",
"url": null
} |
c++, c++11, memory-management
//return an unique_ptr that calls release when reset
return pointer(&m_objects[index], [this](T* element)->void{release(element);});
}
friend std::ostream& operator<<(std::ostream& ostream, const PoolType& pool) {
for(unsigned int index = 0; index < SZ; ++index) {... | {
"domain": "codereview.stackexchange",
"id": 27475,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, c++11, memory-management",
"url": null
} |
structural-analysis
Title: Machines components? When analyzing machines, how to tell if a point that was attached to another part will have only an $x$ or $y$ component or both?
why wouldn't point $B$, $C$ and $A$ have an $x$ component? Whether a reaction has both x and y components is going to depend on the geomet... | {
"domain": "engineering.stackexchange",
"id": 2074,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "structural-analysis",
"url": null
} |
ros, kinect, primesense
In my hunt for a viewer, I came across this website: Kinect on Ubuntu with OpenNI. I was able to follow the instructions and install Openni, SensorKinect and NITE. In the Openni bin directory there is an executable by the name Sample-NiUserTracker which does the same thing as openni_tracker fro... | {
"domain": "robotics.stackexchange",
"id": 8209,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, kinect, primesense",
"url": null
} |
organic-chemistry, stability, carbocation, elimination
Protonation and deprotonation reactions in a catalytic cycle are notoriously hard to calculate. The RDS approximation will break down. | {
"domain": "chemistry.stackexchange",
"id": 14255,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "organic-chemistry, stability, carbocation, elimination",
"url": null
} |
python, game, pygame
# EVENT PROCESSING STEP
for event in pygame.event.get(): # User did something
# Check if the event is the X button
if event.type == pygame.QUIT:
# If it is go back to the main menu
menu.launch()
# Check if a key is presse... | {
"domain": "codereview.stackexchange",
"id": 15615,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, game, pygame",
"url": null
} |
general-relativity, black-holes, differential-geometry, tensor-calculus, differentiation
$$\mathrm ds^2=-A^2(v,r)\Delta(v,r)\mathrm dv^2+2A(v,r)\mathrm dv\,\mathrm dr+r^2\mathrm d\Omega^2$$
with $(\Delta=1-2m(v,r)/r$)
and time-like, normalized Killing vector with components $(1,0,0,0)$. I'm getting zeros (covariant de... | {
"domain": "physics.stackexchange",
"id": 52106,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "general-relativity, black-holes, differential-geometry, tensor-calculus, different... |
ros, ros-kinetic, rospy, rostopic, publish
by gvdhoorn
This is our solution. Thanks.
Originally posted by bearot on ROS Answers with karma: 43 on 2019-01-29
Post score: 4
Original comments
Comment by bearot on 2019-01-30:
It is correct that there are already subscribers to the topics. We want to check on a running s... | {
"domain": "robotics.stackexchange",
"id": 32367,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-kinetic, rospy, rostopic, publish",
"url": null
} |
ros
Then it is up to you to choose between the two based on your requirements on stability and maintainability.
Note that ubuntu 17.04 and 17.10 are not LTS, so that means that they wont' have long time support from the community and your are more likely to have to update them to a newer release in some near future ... | {
"domain": "robotics.stackexchange",
"id": 1674,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros",
"url": null
} |
image-processing, information-theory
samples_probability = [float(h) / histogram_length for h in histogram]
return -sum([p * math.log(p, 2) for p in samples_probability if p != 0])
And found the Shannon entropy for four images:
- original image "image_1". Entropy is 7.82426730799067
- more contrast image "cont... | {
"domain": "dsp.stackexchange",
"id": 7512,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "image-processing, information-theory",
"url": null
} |
c, quick-sort
I had posted this before on stackoverflow, but was informed of my mistake and that I should post it here. I didn't get answer to my question in that short time, but a few pointers regarding my code which I tried to implement in my solution.
The most valuable feature of quicksort is that it sorts in-plac... | {
"domain": "codereview.stackexchange",
"id": 37986,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, quick-sort",
"url": null
} |
quantum-mechanics, operators
$$
it is the sum of three Pauli matrices, with real coefficients, the components of the real magnetic field.
So a good Hermitian piece of the Hamiltonian. So its Hermitian conjugate is just itself. You may think of the vector consisting of the three Pauli matrices and that of the magnetic ... | {
"domain": "physics.stackexchange",
"id": 70952,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, operators",
"url": null
} |
## Build your own Markov chain transition matrix
Suppose we want to construct a transition matrix for a Markov chain that has a given steady-state vector. We will examine one way to do this.
Assume there are $$n$$ states, and the steady-state vector has the values
$p=(p_1,p_2,\dots,p_n).$ We utilize the fact that a ... | {
"domain": "mrwright.org",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9873750492324249,
"lm_q1q2_score": 0.8049402215260053,
"lm_q2_score": 0.8152324915965392,
"openwebmath_perplexity": 920.4623924790449,
"openwebmath_score": 0.9867677092552185,
"tags": n... |
energy, electrons, quantum-chemistry, orbitals
The centrifugal force puts an "energy penalty" onto states with higher angular momentum.${}^{1}$ So, a higher $\ell$ value implies a stronger centrifugal force, that pushes electrons away from the nucleus.
The concept of centrifugal force can be seen in the radial Schroe... | {
"domain": "chemistry.stackexchange",
"id": 1114,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "energy, electrons, quantum-chemistry, orbitals",
"url": null
} |
GitHub is home to over 40 million developers working together to host and review code, manage projects, and build software together. Heads 30 Coo 30 L/. Let the program toss the coin 100 times, and count the number of times each side of the coin appears. the probability of obtaining “tails” when a biased coin is tossed... | {
"domain": "rdswatersports.it",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9752018347594027,
"lm_q1q2_score": 0.814765078294547,
"lm_q2_score": 0.8354835371034368,
"openwebmath_perplexity": 446.46583073311524,
"openwebmath_score": 0.7222005128860474,
"tag... |
formal-languages, context-free, pushdown-automata
Title: Give CFG and PDA for the words that start and end with the same symbol I need to give a PDA and CFG for a language that contains all binary strings that start and end with the same symbol. I've created the CFG with no problem, but I'm stuck with the PDA and don'... | {
"domain": "cs.stackexchange",
"id": 1234,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "formal-languages, context-free, pushdown-automata",
"url": null
} |
c++, performance, mathematics, boost, fixed-point
arb kinkelin()
{
return 1 / static_cast<arb>(12) - log(boost::math::constants::glaisher<arb>());
}
arb knuth()
{
return (1 - (1 / boost::math::constants::root_three<arb>())) / 2;
}
arb levys()
{
return exp(pow(boost::math::constants::pi<arb>(), 2) / (12 *... | {
"domain": "codereview.stackexchange",
"id": 26602,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, performance, mathematics, boost, fixed-point",
"url": null
} |
c++, performance, parsing
In practice, things look like this:
(OS) read ... queue, read ... queue, read
(app) work, FAULT, ... work, FAULT, ...
^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^
nothing happens here! not... | {
"domain": "codereview.stackexchange",
"id": 37043,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, performance, parsing",
"url": null
} |
forces, material-science
Title: Effect of length and area on Young's modulus? I have this question.
A sample of wire has a Young modulus E. A second sample of wire made
from an identical material has three times the length and half the
diameter of the first sample. What is the Young modulus of the second
sample... | {
"domain": "physics.stackexchange",
"id": 57455,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "forces, material-science",
"url": null
} |
just easy to read but precise. Use as an example 18 or 10010: 18 = 16 + 2 = 2 4 + 2 1. (2) In each part below, a rule is given that determines a binary operation on Z. Sponsored Links. Enter the two numbers that you want to implement the. A carry-save adder's propagation time is constant, while traditional a 2 input ad... | {
"domain": "fotoclubtiendeveen.nl",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9845754497285467,
"lm_q1q2_score": 0.8536621299034711,
"lm_q2_score": 0.8670357666736773,
"openwebmath_perplexity": 665.2859832549126,
"openwebmath_score": 0.703130841255188,... |
ros2
Originally posted by William with karma: 17335 on 2018-11-12
This answer was ACCEPTED on the original site
Post score: 3
Original comments
Comment by uthinu on 2018-11-14:
Any help on the code? It is somewhat cryptic for me, I can not see where the thread is created... I would like a fixed node:thread mapping w... | {
"domain": "robotics.stackexchange",
"id": 32033,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros2",
"url": null
} |
quantum-mechanics, hilbert-space, wavefunction, schroedinger-equation, differentiation
Title: States for derivatives of wave function? Given a wave function $\psi_t(x)$. The quantum state of a system at time t can be written as the sum of basis states multiplied by the amplitude:
$$|t\rangle = \int \psi_t(x)|x\rangle ... | {
"domain": "physics.stackexchange",
"id": 59610,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, hilbert-space, wavefunction, schroedinger-equation, differentia... |
coefficient C(n, k) can be defined as the coefficient of x^k in the expansion of (1 + x)^n.. A binomial coefficient C(n, k) also gives the number of ways, disregarding order, that k objects can be chosen from among n objects more formally, the number of k-element subsets (or k-combinations) of a n-element set. As you m... | {
"domain": "mohammadshariatmadari.ir",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9740426450627306,
"lm_q1q2_score": 0.8513885117143548,
"lm_q2_score": 0.8740772450055545,
"openwebmath_perplexity": 980.351373441915,
"openwebmath_score": 0.91483724117279... |
machine-learning, classification, tensorflow, image-classification, audio-recognition
Title: Machine learning classification with time-domain signals how to ignore signal arrival time? I am training a Tensorflow classifier model with signal data (converting signals to the spectrograms).
I want the model to be insensit... | {
"domain": "datascience.stackexchange",
"id": 9049,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "machine-learning, classification, tensorflow, image-classification, audio-recog... |
kalman-filters, optimization, bayesian-estimation
Initial Variance
The diagonal terms of $M$ will have a small variance to allow for differential sensor gain because $\cos(\theta) \approx 1$ for the small $\theta$ angles that are expected.
The off diagonal terms would have variance depending on the maximum expected $... | {
"domain": "dsp.stackexchange",
"id": 10526,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kalman-filters, optimization, bayesian-estimation",
"url": null
} |
Jun 11, 2009 · you'll have to do integration by parts twice in order to get rid of the x^2. The Iowa Nutrient Reduction Strategy is a science and technology-based framework to assess and reduce nutrients to Iowa waters and the Gulf of Mexico. How can I achieve this result? Do you have other methods to show Integration ... | {
"domain": "ipadmitvertrag24.de",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.978712648206549,
"lm_q1q2_score": 0.8197892505209919,
"lm_q2_score": 0.837619961306541,
"openwebmath_perplexity": 694.0033440687174,
"openwebmath_score": 0.8542611002922058,
... |
f#
If I had more time (going holiday shopping with the GF soon) I would describe how we could eliminate mutating it, but I think this lesson stood to prove it's point: we can almost entirely avoid mutable state in F#, and we also learned a few cool tricks on the way. | {
"domain": "codereview.stackexchange",
"id": 28632,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "f#",
"url": null
} |
c++, recursion, template, c++20, constrained-templates
std::cout << "recursive_reduce_all function test with execution policy (std::execution::par_unseq), initial value and specified operation: \n";
auto recursive_reduce_all_result12 = recursive_reduce_all(std::execution::par_unseq, test_array, static_cast<double>... | {
"domain": "codereview.stackexchange",
"id": 44838,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, recursion, template, c++20, constrained-templates",
"url": null
} |
ros, turtlebot, package, ros-electric
Check that the turtle is really named turtlebot_node and that its command topic is cmd_vel by doing a
$ rosnode list
this command will show you the list of active nodes. You should have something like
/rosout
/turtle1
then do
$ rostopic list
this should give you something like
... | {
"domain": "robotics.stackexchange",
"id": 11982,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, turtlebot, package, ros-electric",
"url": null
} |
gazebo
stop using forces, cheat and use the animation interface for gazebo
Originally posted by nkoenig with karma: 7676 on 2012-09-19
This answer was ACCEPTED on the original site
Post score: 0
Original comments
Comment by suvrat on 2013-07-30:
i have the same kind of problem ,i tried to modify the c++ code in tuto... | {
"domain": "robotics.stackexchange",
"id": 2742,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo",
"url": null
} |
# Find all solutions of $x^2 \equiv 9 \pmod{85}$
I am asked to solve this problem, and I know how to solve congruences of degree $$2$$ modulo a prime $$p$$, but note that $$85=5\cdot 17$$ is a product of two primes.
On the fly I managed to rewrite the expression as $$(x-3)(x+3)\equiv 0 \pmod{85}$$, and then since $$(... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.97805174308637,
"lm_q1q2_score": 0.8213032766948531,
"lm_q2_score": 0.8397339736884711,
"openwebmath_perplexity": 124.81413650126593,
"openwebmath_score": 0.9100116491317749,
"tags... |
gazebo
Title: Using hector_quadrotor_gazebo with externally provided poses
Hello,
The hector_quadrotor_gazebo_plugins package appears to have the ability to subscribe to a pose (x,y,z,phi,theta,psi) and use this information to update the pose for the simulated device.
Is it as simple as just publishing a nav_msgs::Od... | {
"domain": "robotics.stackexchange",
"id": 3644,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo",
"url": null
} |
physical-chemistry, thermodynamics
Title: Why is temperature constant when an ideal gas expands into a vacuum? An ideal gas in a box has pressure $p$ and temperature $T$. This box is kept in a vacuum, within a large container.
When the box is punctured, what happens to the temperature of the gas as it expands to fill ... | {
"domain": "chemistry.stackexchange",
"id": 15481,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "physical-chemistry, thermodynamics",
"url": null
} |
statistical-mechanics, statistics
I believe that the starting point for (c) is:
$\left \langle n\right \rangle = \sum_{n=1}^\infty n \left(\frac{5}{6}\right)^{(n-1)} \frac{1}{6}$
Wolfram alpha tells me this is an exact sum which equals to 6 (logical). I want however, to try and imply the standard derivative trick (and... | {
"domain": "physics.stackexchange",
"id": 1888,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "statistical-mechanics, statistics",
"url": null
} |
statistical-mechanics, entropy, quantum-information, information
An example where it is not reasonable to regard $\psi$ as a canonical ensemble is if $\psi$ represents a composite system made of two pieces of the penny at different temperature. Clearly no canonical ensemble can describe this situation macroscopically ... | {
"domain": "physics.stackexchange",
"id": 2539,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "statistical-mechanics, entropy, quantum-information, information",
"url": null
} |
reinforcement-learning, machine-learning, python, open-ai, gym
self.SOC=0
i+=1
def step(self, action):
self._take_action(action)
self.Current_day += 1
# Maximizing the reward means minimize the costs
reward... | {
"domain": "ai.stackexchange",
"id": 3572,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "reinforcement-learning, machine-learning, python, open-ai, gym",
"url": null
} |
molecular-biology, pcr, cloning
Any bullet-proof experience on that? Thanks
EDIT:
Changing the DNA polymerase from a Phusion HF to the Q5 suggested in the NEBuilder kit manual (suggestion that I had overlooked) completely solved the problem.
Rem 1: Mind that the elongation time must be slightly increased to amplify "l... | {
"domain": "biology.stackexchange",
"id": 12095,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "molecular-biology, pcr, cloning",
"url": null
} |
bioinformatics, genomes, human-genome
If we align them, we will get:
seq1 ACCTTGCATCGGATCGAATTCGCGTTAGCGATCG
seq2 GCCTAGCATCGGACCGAATTCCCGTTAGCAATCG
*** ******** ******* ******* ****
As you can see, despite the small differences in sequence, the two can be aligned very well. The... | {
"domain": "biology.stackexchange",
"id": 3871,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "bioinformatics, genomes, human-genome",
"url": null
} |
python, pandas, preprocessing, numpy
Title: Count the max number of consecutive 1 and 0 in Pandas Dataframe Hey I have the following Dataset
import pandas as pd
df = pd.DataFrame({
'column1': [0,0,1,0,1,0,0,1,1,0,1,1,1]})
I want to be able to count the number of consecutive 1 and 0 and generate 2 columns as such:... | {
"domain": "datascience.stackexchange",
"id": 7893,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, pandas, preprocessing, numpy",
"url": null
} |
Recall that, from earlier, our answer is equal to $\left(\dfrac13+\dfrac16+\dfrac19\right)(3 + 6 + 9) = \left(\dfrac1a+\dfrac1b+\dfrac1c\right)(a+b+c) = \left(\dfrac{\sum_{\text{sym}}ab}{162}\right)(18) = \dfrac{n}{162} \cdot 18 = \dfrac{n}{9}$. By bounding, $n$ is between the aforementioned values of $96.4974047104675... | {
"domain": "artofproblemsolving.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9893474910447999,
"lm_q1q2_score": 0.8156793319218536,
"lm_q2_score": 0.8244619199068831,
"openwebmath_perplexity": 271.2698262730806,
"openwebmath_score": 0.9273114204406738,
... |
quantum-field-theory, renormalization, feynman-diagrams
Or perhaps it does not matter too much because the mass renormalization term can take care of either divergence and such discrepancies will not show up in calculations of any observables anyway?
Thanks. Ok I'll answer my own question. I asked my QFT professor, h... | {
"domain": "physics.stackexchange",
"id": 7392,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory, renormalization, feynman-diagrams",
"url": null
} |
javascript, node.js, asynchronous
//
// AT THIS POINT, UNLESS SOMETHING JUMPS ON US, both user and workspace are available
//
// User doesn't exist: create it
var u = new User();
u.login = req.body.login;
u.password = req.body.password[0];
... | {
"domain": "codereview.stackexchange",
"id": 2351,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, node.js, asynchronous",
"url": null
} |
homework-and-exercises, electrostatics, electric-fields, gauss-law, approximations
Very near the line of charge, $z \ll L$, we have
$$
E = \frac 1{4\pi\epsilon_0} \frac{2\lambda L}{zL} \left(1-\frac12 \frac{z^2}{L^2} +\cdots \right) \approx \frac 1{4\pi\epsilon_0} \frac{2\lambda}{z}
$$
which is the field of an infini... | {
"domain": "physics.stackexchange",
"id": 54336,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, electrostatics, electric-fields, gauss-law, approximations... |
c, file-system, posix, portability, c89
"global struct member wrangling"
I guess the comment about struct member wrangling refers to ancient versions of C in which the identifiers of struct members were not scoped to the struct definitions in which they appeared. This is the reason for some of the very old standard s... | {
"domain": "codereview.stackexchange",
"id": 45310,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, file-system, posix, portability, c89",
"url": null
} |
classification, decision-trees, supervised-learning, information-theory
${\displaystyle \mathrm {H} (X)=-\sum _{i=1}^{n}{\mathrm {P} (x_{i})\log \mathrm {P} (x_{i})}}$
Information Gain:wiki link
Let ${\displaystyle T}$ denote a set of training examples, each of the form ${\displaystyle ({\textbf {x}},y)=(x_{1},x_{2},x... | {
"domain": "datascience.stackexchange",
"id": 10148,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "classification, decision-trees, supervised-learning, information-theory",
"u... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.