text stringlengths 49 10.4k | source dict |
|---|---|
lab-techniques
In addition to using a cryoprotectant, the rate of cellular dehydration during the freezing process can be managed by using a -1°C/minute cooling rate
Thawing should be rapid at 37°C
ThermoFisher recommends a high cell density as cell death will occur no matter what :
Also, the greater the cell densi... | {
"domain": "biology.stackexchange",
"id": 11221,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "lab-techniques",
"url": null
} |
quantum-spin, symmetry, group-representations, lagrangian-formalism
$V_{\alpha\beta\gamma\delta}$ transforms reducibly under $SU(2)$, as tensor products of four spin $\frac 12$ representations. Using $\bf\frac 12\otimes\frac 12 = 0 \oplus 1$ and $\bf 1\otimes 1 = 0 \oplus 1 \oplus 2$, we find that $V_{\alpha\beta\gamm... | {
"domain": "physics.stackexchange",
"id": 2679,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-spin, symmetry, group-representations, lagrangian-formalism",
"url": null... |
ros, rviz, frame, openni-kinect, ros-electric
Title: Turtlebot rviz "Frame [map] does not exist" error
Turtlebot_bringup kinect.launch seems to work-no errors. However rviz from Workstation (openni-kinect indexed) shows black window with Global Status Error "Frame [map] does not exist" and cannot add Camera or Pointc... | {
"domain": "robotics.stackexchange",
"id": 8926,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, rviz, frame, openni-kinect, ros-electric",
"url": null
} |
# New very simple golden ratio construction incorporating a triangle, square, and pentagon all with sides of equal length. Is there any prior art?
Consider three regular polygons with 3, 4, and 5 sides wherein all the polygons have sides of equal length X throughout, as illustrated below. The ratio of the red line seg... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9683812309063186,
"lm_q1q2_score": 0.8069758973527669,
"lm_q2_score": 0.8333245953120233,
"openwebmath_perplexity": 438.57431877039437,
"openwebmath_score": 0.679821252822876,
"tag... |
javascript, jquery, html
And another that displays possible banner types:
<select class="form-control" name="banner_type">
<option value="" disabled selected>Please Select</option>
<option value="" disabled>────────────────────</option>
<option value="9">Central Banner</option>
<option value="3">Left-H... | {
"domain": "codereview.stackexchange",
"id": 7851,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, jquery, html",
"url": null
} |
# An identity involving the Pochhammer symbol
I need help proving the following identity: $$\frac{(6n)!}{(3n)!} = 1728^n \left(\frac{1}{6}\right)_n \left(\frac{1}{2}\right)_n \left(\frac{5}{6}\right)_n.$$ Here, $$(a)_n = a(a + 1)(a + 2) \cdots (a + n - 1), \quad n > 1, \quad (a)_0 = 1,$$ is the Pochhammer symbol. I do... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9840936082881853,
"lm_q1q2_score": 0.8022650886666792,
"lm_q2_score": 0.8152324960856175,
"openwebmath_perplexity": 2092.0391618761414,
"openwebmath_score": 1.0000078678131104,
"ta... |
surface-tension, casimir-effect
Title: Wet metal disks stuck together - Casimir Effect or surface tension? I work in a processing plant where round steel cutting blades are used, e.g. 1-2 mm thick and 15-30 cm in diameter. During normal plant operations, these blades are mounted on machinery and rotated at circa 1000... | {
"domain": "physics.stackexchange",
"id": 32728,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "surface-tension, casimir-effect",
"url": null
} |
the graph of any function can be parameterized. Don’t Think About Time. Euclidean Plane formulas list online. We determine the intervals when the second derivative is greater/less than 0 by first finding when it is 0 or undefined. A parametric equation is an equation where the coordinates are expressed in terms of a, u... | {
"domain": "unionenazionaletributaristi.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9828232909876815,
"lm_q1q2_score": 0.8293997542238286,
"lm_q2_score": 0.8438950947024556,
"openwebmath_perplexity": 579.4427026364159,
"openwebmath_score": 0.810407... |
ros-melodic
Originally posted by tfoote with karma: 58457 on 2019-10-18
This answer was ACCEPTED on the original site
Post score: 3
Original comments
Comment by lotfishtaine on 2019-10-23:
On the contrary, if you look at the error, the TF_OLD_DATA is related to the base_link frame and the /ndt_map is generated in the... | {
"domain": "robotics.stackexchange",
"id": 33901,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros-melodic",
"url": null
} |
ros
Comment by Roshan on 2021-10-11:
From the warning messages it does sound like gazebo and the static transform were publishing at the same time. What I noticed is that the warnings don't show up immedietly, only after a while, and it's not spamming like it usually does with the TF_REPEATED_DATA warnings, just 4 war... | {
"domain": "robotics.stackexchange",
"id": 37000,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros",
"url": null
} |
html, css
#tribute-info {
color: #222;
background-color: #efefef;
margin: 30px 0px;
padding: 10px 5%;
text-align: center;
}
#tribute-info h2 {
border-bottom: 1px solid rgb(2, 2, 2, 0.2);
padding-bottom: 10px;
margin: 10px 0px;
font-size: 1.5em;
}
p {
font-size: 0.88em;
line-height: 1.5;
}
sup ... | {
"domain": "codereview.stackexchange",
"id": 45552,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "html, css",
"url": null
} |
python, python-3.x, numpy
def calculate():
two_dice_prob = [0, *range(6), *range(6,0,-1)]
result = np.zeros((25,3))
for attack_shift in range(-12, 13):
result_counts = [0] * 3
for defense, attack in product(range(1,7), range(2,13)):
base_attack = attack
attack += att... | {
"domain": "codereview.stackexchange",
"id": 32832,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, numpy",
"url": null
} |
python, performance, python-3.x, time-limit-exceeded, binary-search
code block, saving a whole \$ \mathcal{O} (n) \$ iteration.
Since bisect relies on ascending order, while the input is sorted in descending order, a call to sorted is required, which automatically returns a list.
bisect(sequence, item) will return the... | {
"domain": "codereview.stackexchange",
"id": 38188,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, performance, python-3.x, time-limit-exceeded, binary-search",
"url": ... |
p ath between source and Destination node for Static Dynamic... This shortest path algorithm, Dijkstra ’ s algorithm is a popular algorithm to find the shortest from! With Python implementation optional ( default = None ) ) – if,. Directed weighted graph as an input 2020 by NY Comdori solution incorporates the algorith... | {
"domain": "gda.pl",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9643214511730025,
"lm_q1q2_score": 0.8056746989058398,
"lm_q2_score": 0.8354835391516132,
"openwebmath_perplexity": 756.5670765421436,
"openwebmath_score": 0.37051886320114136,
"tags": nu... |
java, algorithm, computational-geometry
You can apply the same idea to AlgEvtComparator's compare method. One other thing I noticed in your line compare method, the checks' aren't exactly symmetrical. You have o1.Y1 comparing to o2.Y2 while all the others are checking Y1 to Y1 or Y2 to Y2. Was that really intended? I ... | {
"domain": "codereview.stackexchange",
"id": 4535,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, algorithm, computational-geometry",
"url": null
} |
r, rna-seq, differential-expression, normalization, edger
You run edgeR now on the results of RUVg:
design <- model.matrix(~x + W_1, data=pData(set1))
y <- DGEList(counts=counts(set1), group=x)
y <- calcNormFactors(y, method="upperquartile")
y <- estimateGLMCommonDisp(y, design)
y <- estimateGLMTagwiseDisp(y, design)
... | {
"domain": "bioinformatics.stackexchange",
"id": 1473,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "r, rna-seq, differential-expression, normalization, edger",
"url": null
} |
$\|\nabla \phi(y)-\nabla \phi(x)\|^2\leq (\beta-\alpha) (\nabla \phi(x)-\nabla \phi(y))^\top (x-y)$
Rewriting this back in terms of $$f$$ we get
$\|\nabla f(y)-\nabla f(x)+\alpha(x-y)\|^2\leq (\beta-\alpha)(\nabla f(x)-\nabla f(y) +\alpha(y-x))^\top (x-y)$
Hence
$\|\nabla f(y)-\nabla f(x)+\alpha(x-y)\|^2 +\alpha(\b... | {
"domain": "readthedocs.io",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9865717448632122,
"lm_q1q2_score": 0.8019519303375324,
"lm_q2_score": 0.8128673201042492,
"openwebmath_perplexity": 607.9449074791817,
"openwebmath_score": 0.9904171824455261,
"tags":... |
weighted graph, and let $T$ be the shortest-path spanning tree rooted at a. Weighted Graphs A simple graph is a notation that is used to represent the. 1 3 First integer is the total number of vertices |V| in the graph G. Slide 1 The Shortest Path Problem Dijkstras Algorithm Graph Theory Applications Slide 2 Foundation... | {
"domain": "everwoodbiocostruzioni.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9863631663220389,
"lm_q1q2_score": 0.8064253512345928,
"lm_q2_score": 0.817574478416099,
"openwebmath_perplexity": 492.5751165744054,
"openwebmath_score": 0.5003293752670... |
python, file-system
Finally, you have a counter variable in printChoices. Why not use enumerate? So, you will have:
def print_choices(files: List[str]) -> None:
"""Prints a numbered list of files in a directory"""
for index, filename in enumerate(files, start=1):
print(str(index) + ".", filename)
P.... | {
"domain": "codereview.stackexchange",
"id": 28627,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, file-system",
"url": null
} |
physical-chemistry, electrochemistry
Title: Meaning of electrochemical cell notation without a salt bridge An electrochemical cell is shown here.
$$\ce{Ag(s)~|~AgCl(s)~|~KCl(1M)~|~Hg2Cl2(s)~|~Hg(l)~|~Pt}$$
I am used to seeing cell representations with a $||$ for a salt bridge between the two electrode solutions (gener... | {
"domain": "chemistry.stackexchange",
"id": 9653,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "physical-chemistry, electrochemistry",
"url": null
} |
python, python-3.x, rest, framework, cryptocurrency
@return_json(None)
def ohlc(self, pair, **kwargs):
return self.public_query('products/%s/candles' % pair, params=kwargs)
@return_json(None)
def stats(self, pair, **kwargs):
return self.public_query('products/%s/stats' % pair, params=kwarg... | {
"domain": "codereview.stackexchange",
"id": 23853,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, rest, framework, cryptocurrency",
"url": null
} |
This is probably not the best way as I probably forgot something, but at least presents one important way to think : calculate a vector field which we then use as the help to calculate a path through following the arrows.
$UPDATE~~1$: I wrote a computer program to pick only $2$ slopes, one from miles $0$ to $1$ and th... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9799765563713599,
"lm_q1q2_score": 0.8290037642143584,
"lm_q2_score": 0.84594244507642,
"openwebmath_perplexity": 585.4001319214722,
"openwebmath_score": 0.8097679615020752,
"tags"... |
Try modeling the data with a decaying exponential function
$y\left(t\right)={c}_{1}+{c}_{2}{e}^{-t}$.
The preceding equation says that the vector `y` should be approximated by a linear combination of two other vectors. One is a constant vector containing all ones and the other is the vector with components `exp(-t)`.... | {
"domain": "mathworks.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9911526470077807,
"lm_q1q2_score": 0.8323045448406862,
"lm_q2_score": 0.8397339676722393,
"openwebmath_perplexity": 409.0073129661469,
"openwebmath_score": 0.8208779692649841,
"tags": ... |
c#, datetime
/// <summary>
/// Builds an instance of the Schedule class
/// </summary>
/// <param name="minimalUnitTimeSpan">Minimal timespan that an unit can occupy</param>
public Schedule(TimeSpan minimalUnitTimeSpan)
{
_minimalUnitTimeSpan = minimalUnitTimeSpan;
ScheduleUnits = n... | {
"domain": "codereview.stackexchange",
"id": 16202,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, datetime",
"url": null
} |
nuclear-physics, material-science
Title: Is there any material that can survive a nuke? Is there a material known to man that I can tape to a Tsar-Bomba-yield nuclear warhead and find kilometers away after detonation?
This question is quite similar but a nuclear explosion is quite instantaneous. The sun, on the other ... | {
"domain": "physics.stackexchange",
"id": 29878,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "nuclear-physics, material-science",
"url": null
} |
navigation, path, stack, local-planner, teb-local-planner
global_costmap_params.yaml
global_costmap:
global_frame: /map
robot_base_frame: base_link
update_frequency: 5.0
static_map: true
local_costmap_params.yaml
local_costmap:
global_frame: odom
robot_base_frame: base_link
update_frequency: 5.0
publish_freq... | {
"domain": "robotics.stackexchange",
"id": 27982,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "navigation, path, stack, local-planner, teb-local-planner",
"url": null
} |
qiskit, shors-algorithm
def iqft(qc, n):
qc.append(QFT(len(n), do_swaps = False).inverse(), n)
def circ(n, m, a):
# Let n = 'X register'
# Let m = 'W register'
qc = QuantumCircuit(n + m, n)
qc.h(range(n))
qc.x(n + m - 1)
mod_exp(qc, n, m, a)
iqft(qc, r... | {
"domain": "quantumcomputing.stackexchange",
"id": 3490,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "qiskit, shors-algorithm",
"url": null
} |
ros
rein manifest.xml
<package>
<description brief="ReIn">
The Recognition Infrastructure (ReIn) is a software library that
facilitates rapid development for 2D/3D object and scene recognition. ReIn
can create different computational graphs from its various modules by
combining them to... | {
"domain": "robotics.stackexchange",
"id": 11223,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros",
"url": null
} |
# Sum of 'the first k' binomial coefficients for fixed n
I am interested in the function $\sum_{i=0}^{k} {N \choose i}$ for fixed $N$ and $0 \leq k \leq N$. Obviously it equals 1 for $k = 0$ and $2^{N}$ for $k = N$, but are there any other notable properties? Any literature references?
In particular, does it have a c... | {
"domain": "mathoverflow.net",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9688561658682131,
"lm_q1q2_score": 0.8328905200297713,
"lm_q2_score": 0.8596637451167995,
"openwebmath_perplexity": 448.6145797507414,
"openwebmath_score": 0.9006868004798889,
"tags... |
electromagnetism, electricity, magnetic-fields, electric-current, electromagnetic-induction
\end{equation}
which implies
\begin{equation}
\frac{\Delta \Phi_B}{\Delta t} = \vec{B} \cdot (\vec{v} \times \Delta \vec{l}).
\end{equation}
Now we can take the limits of small $\Delta t$ and small $\Delta \vec{l}$, then inte... | {
"domain": "physics.stackexchange",
"id": 39963,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electromagnetism, electricity, magnetic-fields, electric-current, electromagnetic-... |
electrostatics, charge, density, dirac-delta-distributions
Title: Definition of a line charge with Dirac delta function Is the following statement correct for a line charge distribution $λ(x)$?
$$ρ(\mathbf r)=λ(x)δ(y)δ(z)$$
If yes - what does it say?
$$\rho(\mathbf{r})=\lambda(x)\delta(y)\delta(z)$$
describes a charg... | {
"domain": "physics.stackexchange",
"id": 25205,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electrostatics, charge, density, dirac-delta-distributions",
"url": null
} |
python, reinventing-the-wheel
You have a few great docstrings, there is no need for block-comments and docstrings.
In contains you have this assert isinstance(text, str) but don't use it.
Code changes
Your contains(text, pattern) could be a lot more simplified. Because contains checks whether a pattern occurs in text... | {
"domain": "codereview.stackexchange",
"id": 28075,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, reinventing-the-wheel",
"url": null
} |
kinematics, harmonic-oscillator, oscillators, geometry
We can easily recognize th motion of point $D$ as Simple Harmonic Motion (SHM). And the motion of point $C$ is something that I have never encountered before.
QUESTION :- Is there a name for the type of motion that the point $C$ undergoes? How do we describe the m... | {
"domain": "physics.stackexchange",
"id": 62786,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kinematics, harmonic-oscillator, oscillators, geometry",
"url": null
} |
javascript, functional-programming, hangman
if (isDone()) {
console.info(getGameStatus());
} else {
console.info(arguments);
return makeGuess;
}
}
function createMatchedCharacterList(matcher) {
return (revealed, actual, index) => {
if (matcher.test(actual)) {
revealed[... | {
"domain": "codereview.stackexchange",
"id": 21859,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, functional-programming, hangman",
"url": null
} |
reaction-mechanism, kinetics, reaction-coordinate
The final part of the calculation determines which particular reaction step is going to occur and at what time this is done by choosing pairs of numbers that have the distribution $P(T, R)$ equation 9. Gillespie (1997, 2007) argues that $P(T, R)$ is equivalent to two d... | {
"domain": "chemistry.stackexchange",
"id": 11243,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "reaction-mechanism, kinetics, reaction-coordinate",
"url": null
} |
### Use Different Algorithms
`fsolve` has three algorithms. Each can lead to different solutions.
For this example, take `x0 = [1,9]` and examine the solution each algorithm returns.
```x0 = [1,9]; opts = optimoptions(@fsolve,'Display','off',... 'Algorithm','trust-region-dogleg'); x1 = fsolve(@fbnd,x0,opts)```
```x1... | {
"domain": "mathworks.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9869795095031688,
"lm_q1q2_score": 0.8137270276991854,
"lm_q2_score": 0.8244619263765707,
"openwebmath_perplexity": 695.9035770287276,
"openwebmath_score": 0.874487042427063,
"tags": n... |
The population of a culture of bacteria, P(t), where t is time in days, is growing at a rate that is proportional to the population itself and the growth rate is 0.3. The initial population is 40. (1) What is the population after
6. ### calculus
The population of a certain community is increasing at a rate directly pr... | {
"domain": "jiskha.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9817357179075082,
"lm_q1q2_score": 0.8116124924630923,
"lm_q2_score": 0.8267117898012104,
"openwebmath_perplexity": 680.837988033491,
"openwebmath_score": 0.8192692399024963,
"tags": null... |
newtonian-mechanics, acceleration, free-fall, distance
Title: Free Fall and constant acceleration
Although the acceleration of free fall is constant, why don't the distance go like $y = 9.8+4.9= 14.7m$ after 2 seconds, $y= 19.6+14.7 = 34.3m$ after 3 seconds? I think Constant acceleration work like say, start accelera... | {
"domain": "physics.stackexchange",
"id": 88353,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, acceleration, free-fall, distance",
"url": null
} |
c++, event-handling
Your constructor is listing various members initializers with no arguments.
: identifier_{}, handler_{}
shouldn’t that be what normally happens if you don’t list it at all? | {
"domain": "codereview.stackexchange",
"id": 30295,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, event-handling",
"url": null
} |
linear-systems, z-transform
fs = 48000;
f0 = 1000;
w0 = 2*pi*f0/fs;
N = 200;
n = 0:N-1;
x = sin(w0*n);
bd = [1 0];
ad = [1 -1];
yi = filter(bd, ad, x);
figure;
plot(n,x,'b'); hold on;
plot(n,yi,'r')
% analytical computation
A = 1 / ( 1 - exp( -1i*w0 ) );
y2 = abs(A) * sin( w0*n + angle(A) ) - imag(A);
plot(n,y2,'k... | {
"domain": "dsp.stackexchange",
"id": 7927,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "linear-systems, z-transform",
"url": null
} |
coding-theory, encoding-scheme, huffman-coding
Title: Huffman encoding: why is there no need for a separator? Char Code
==== ====
E 0000
i 0001
y 0010
l 0011
k 0100
. 0101
space 011
e 10
r 1100
s 1101
n ... | {
"domain": "cs.stackexchange",
"id": 6599,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "coding-theory, encoding-scheme, huffman-coding",
"url": null
} |
dqn, deep-rl, experience-replay
Title: Why do authors track $\gamma_t$ in Prioritized Experience Replay Paper? In the original prioritized experience replay paper, the authors track $\gamma_t$ in every state transition tuple (see line 6 in algorithm below):
Why do the authors track this at every time step? Also, man... | {
"domain": "ai.stackexchange",
"id": 1165,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "dqn, deep-rl, experience-replay",
"url": null
} |
of a logarithm: If and is a constant , then if and only if. Remark: Naive Bayes is widely used for text classification and spam detection. But how exactly should you study these? Here are three ideas for getting to know these formulas inside and out. A beginner's guide to Big O notation. 14159, e ≈ 2. and Exponential R... | {
"domain": "collezionericordi.it",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9808759587767815,
"lm_q1q2_score": 0.8236748586908794,
"lm_q2_score": 0.8397339656668287,
"openwebmath_perplexity": 2595.4595773936344,
"openwebmath_score": 0.4468933343887329,
... |
### Show Tags
05 Nov 2009, 00:50
29
1
16
Let's go step by step:
First operation: 3L-1L=2=6/3L of wine left, total 4L;
#2: 6/3L-(6/3)/4=6/3-6/12=18/12=6/4L of wine left, total 5L;
#3: 6/4L-(6/4)/5=6/4-6/20=24/20=6/5L, total 6L;
#4: 6/5L-(6/5)/6=6/5-6/30=30/30=6/6L, total 7L;
....
At this point it's already possible t... | {
"domain": "gmatclub.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 1,
"lm_q1q2_score": 0.8128673246376009,
"lm_q2_score": 0.8128673246376009,
"openwebmath_perplexity": 3838.2262119774055,
"openwebmath_score": 0.710469663143158,
"tags": null,
"url": "ht... |
(4) True or False? The given set is an orthonormal set.
The answer is “False”. The dot product of these vectors is
$\begin{bmatrix} 1 \\ 0 \\ 0 \end{bmatrix}\cdot \begin{bmatrix} 0 \\ 1 \\ 1 \end{bmatrix}=1\cdot 0+ 0\cdot 1 +0\cdot 1=0.$ Thus, the vectors are orthogonal. However the length of the second vector is
$\sq... | {
"domain": "yutsumura.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9883127433812522,
"lm_q1q2_score": 0.8148262240079042,
"lm_q2_score": 0.8244619220634457,
"openwebmath_perplexity": 254.06820889413285,
"openwebmath_score": 0.9374266862869263,
"tags":... |
optics, waves, diffraction
Title: Maxima in single-slit diffraction The width of a minimum in single-slit diffraction is related to
$\ d \sin \theta=n \lambda$
where $\sin\theta = \frac{y}{L}$ by small angle approximation.
However, Wikipedia says that there is no such formula for the width of an n-th maximum in sing... | {
"domain": "physics.stackexchange",
"id": 39918,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "optics, waves, diffraction",
"url": null
} |
approximation, scheduling, process-scheduling
Title: What is the best Approximation algorithm to schedule a task graph? If I have a task graph T and want a schedule to optimize the make-span, what is currently the best approximation algorithm for this problem? Are there any constant approximation algorithms? You get a... | {
"domain": "cs.stackexchange",
"id": 9345,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "approximation, scheduling, process-scheduling",
"url": null
} |
1. $$|f(t,x)| \leq M(t)(1+|x|)$$, $$M(t)$$ being summable
This last result require the vector field to have an at most linear growth in the variable $$x$$. I was wondering if anyone knows more general results for the existence of a global solutions, which can include also more than linear growth, or if the results I q... | {
"domain": "mathoverflow.net",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9808759649262345,
"lm_q1q2_score": 0.8195057146092958,
"lm_q2_score": 0.8354835309589074,
"openwebmath_perplexity": 164.40152080433495,
"openwebmath_score": 0.9722508788108826,
"tag... |
neural-networks, evolutionary-algorithms, agi, neuroevolution
Title: Can neural networks evolve other neural networks? Can neural networks change or evolve other neural networks? Also, could evolutionary algorithms be applied to evolve neural networks?
For example, suppose that we have neural networks A and B. The neu... | {
"domain": "ai.stackexchange",
"id": 1281,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "neural-networks, evolutionary-algorithms, agi, neuroevolution",
"url": null
} |
debian, cmake
./build_isolated/trajectory_msgs/CMakeFiles/CMakeError.log:/usr/bin/ld: cannot find -lpthreads
./build_isolated/rosmaster/CMakeFiles/CMakeError.log:/usr/bin/ld: cannot find -lpthreads
./build_isolated/eigen_conversions/CMakeFiles/CMakeError.log:/usr/bin/ld: cannot find -lpthreads
./build_isolated/geometr... | {
"domain": "robotics.stackexchange",
"id": 15614,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "debian, cmake",
"url": null
} |
c++, c++11, stack
}
head = tmp;
}
} Smart Pointers
You seem to be missing the point on smart pointers. The benefit of using unique_ptr is that they help with memory management and clean up after themselves. The way you're using it:
std::unique_ptr<Node> tmp(std::make_unique<Node>(item, head));
head = t... | {
"domain": "codereview.stackexchange",
"id": 21258,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, c++11, stack",
"url": null
} |
objective-c, combinatorics, reflection
NSLog(@"Done!");
}
@end
Output:
Started at 3:07AM
2015-10-05 03:07:38.572 ClassFinder[59704:4595935] Here we go!
2015-10-05 03:09:29.770 ClassFinder[59704:4595935] Found one! NSSet
2015-10-05 03:09:29.774 ClassFinder[59704:4595935] Found one! NSURL
2015-10-05 03:10:27.769 Clas... | {
"domain": "codereview.stackexchange",
"id": 16052,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "objective-c, combinatorics, reflection",
"url": null
} |
Download PDF. IThe number of r-combinations of a set with n elements is written C (n ;r) IC (n ;r) is often also written as n r , read"n choose r". Combinatorics is the study of finite or countable discrete structures and includes counting the structures of a given kind and size, deciding when certain criteria can be m... | {
"domain": "asia-pacific.tv",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9763105273220726,
"lm_q1q2_score": 0.8071274359491588,
"lm_q2_score": 0.8267118026095991,
"openwebmath_perplexity": 716.1330881065412,
"openwebmath_score": 0.6230892539024353,
"tags"... |
rocket-science
Title: Is the trajectory of a fire rocket inherently chaotic? All of you: a happy and physics-rich new year!
When I looked at the firing rockets launched at 00:10 2020, most of them went straight up.
Some exploded before time. Some made strange movements. So it's my guess that firing rockets can show c... | {
"domain": "physics.stackexchange",
"id": 63579,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "rocket-science",
"url": null
} |
java, object-oriented, design-patterns, multithreading, static
Title: Code organization when using threads From OOP & OOD point of view, is it good idea to define Java-threads inside of the static method or in this case it's better to use instance-based method?
public class ThreadPool {
public static void stringA... | {
"domain": "codereview.stackexchange",
"id": 10941,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, object-oriented, design-patterns, multithreading, static",
"url": null
... |
c#, .net, thread-safety
Here you test timeUnit against uint.MaxValue and after that the value is cast to int. If int.MaxValue < timeUnit < uint.MaxValue the test is passed but the cast will result in a negative TimeUnitMilliseconds.
Your test case doesn't dispose the RateLimiter instance.
semaphore.Release(Interloc... | {
"domain": "codereview.stackexchange",
"id": 34808,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, .net, thread-safety",
"url": null
} |
The normal distribution is the "bell shape" you are used to; the Cauchy has a sharper peak and "heavier" (i.e. containing more probability) tails; the t distribution with 5 degrees of freedom comes somewhere in between (the normal is t with infinite df and the Cauchy is t with 1 df, so that makes sense); the Laplace or... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9407897459384732,
"lm_q1q2_score": 0.8069794358574366,
"lm_q2_score": 0.8577681031721325,
"openwebmath_perplexity": 752.9226329046752,
"openwebmath_score": 0.7058563232421875,
"tag... |
organic-chemistry, acid-base, organosilicon-compounds
The stabilisation of an anion by adjacent sulfur, phosphorus and silicon groups. Taken from Molecular Orbitals and Organic Chemical Reactions (Reference edition), Fleming
In the diagram above the strongest interaction is the one between the p-orbital on carbon and... | {
"domain": "chemistry.stackexchange",
"id": 8486,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "organic-chemistry, acid-base, organosilicon-compounds",
"url": null
} |
gazebo, differential-drive, xacro
(You can learn more about URDF XML at http://wiki.ros.org/urdf/XML/link)
One final note:
The inertial values are too high. Check out the Inertial parameters of triangle meshes tutorial.
Originally posted by josephcoombe with karma: 609 on 2019-04-01
This answer was ACCEPTED on the o... | {
"domain": "robotics.stackexchange",
"id": 4393,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo, differential-drive, xacro",
"url": null
} |
c++, snake-game
gotoxy(32, 10);
cout << "GAME OVER!!!";
gotoxy(32, 11);
cout << "FINAL SCORE: " << score;
This code takes more vertical space than before, but there is no need anymore to count the number of \n characters in the string.
Input methods
You are using two fundamentally different input methods:... | {
"domain": "codereview.stackexchange",
"id": 36519,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, snake-game",
"url": null
} |
ros, openi-tracker, callback, transform
Title: How to callback specific tf joint from openni_tracker
hey,
I'm trying to write a callback for tf's from the openni_tracker node but i get errors at runtime.
To "echo" the data, i launch the tracker with this parameters:
<node pkg="openni_tracker" type="openni_tracker" na... | {
"domain": "robotics.stackexchange",
"id": 14671,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, openi-tracker, callback, transform",
"url": null
} |
electromagnetism, maxwell-equations, aether
Title: Displacement current - how to think of it What is a good way to think of the displacement current? Maxwell imagined it as being movements in the aether, small changed of electric field producing magnetic field. I don't even understand that definition-assuming there is... | {
"domain": "physics.stackexchange",
"id": 7690,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electromagnetism, maxwell-equations, aether",
"url": null
} |
parsing, rust
Title: Getting the program's first argument as a number I want to get the first argument as a number, if there is any. This does not feel quite right, but I don't know yet what the Rust way would be.
I'm not searching for a args-framework or something, I just want to get a grip on doing stuff with Rust.
... | {
"domain": "codereview.stackexchange",
"id": 19147,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "parsing, rust",
"url": null
} |
java, object-oriented, multithreading, simulation
public List<AirConditioner> getONAirConditioners() {
List<AirConditioner> result = new ArrayList<>();
for (AirConditioner airConditioner : getAirConditioners()) {
if(airConditioner.isON())
result.add(airConditioner);
... | {
"domain": "codereview.stackexchange",
"id": 27860,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, object-oriented, multithreading, simulation",
"url": null
} |
statistical-mechanics, ising-model
I should note I'm not looking for a strict physical interpretation (it makes perfect sense, as the answers for this question lay out), my confusion is with the precise mathematics of the situation. I'm finding it uncomfortable to manipulate $M$ as the central quantity in such derivat... | {
"domain": "physics.stackexchange",
"id": 62482,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "statistical-mechanics, ising-model",
"url": null
} |
ros, catkin-make, catkin-ws
Title: how to change my source directory
I just changed my username and name of my home directory. Now I cannot use catkin_make because the source directory's name has been changed. How can I update, or change my source directory of catkin_ws?
Originally posted by Jessica on ROS Answers w... | {
"domain": "robotics.stackexchange",
"id": 16134,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, catkin-make, catkin-ws",
"url": null
} |
### MacDonald formula for Modified Bessel Functions
How can I make Mathematica understand these two integrals? $$\int_0^{\infty} e^{-x \cosh{\xi}} d\xi = K_0(x)$$ \int_0^{\infty} e^{-\frac{1}{2} \Big( \frac{x y}{u} + u \frac{x^2+y^2}{x y} \Big) } ...
53 views
### Inconsistent performance of code
I'm trying to do som... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9173026573249612,
"lm_q1q2_score": 0.8109315739177938,
"lm_q2_score": 0.8840392725805822,
"openwebmath_perplexity": 1951.1655388702472,
"openwebmath_score": 0.8632445931434631,
"ta... |
algorithms
Here's how to solve it. We'll build a directed graph, where each item (in any sublist) is a vertex is the graph. Traverse the sublists to extract all consecutive pairs of items that appear in any sublist. If you have a < b in a sublist (i.e., item a immediately precedes b in some sublist), add an edge $a... | {
"domain": "cs.stackexchange",
"id": 1901,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms",
"url": null
} |
algorithms, data-compression
$$L = \sum_i (y_i - \hat{y}_i)^2.$$
Then it is possible to use dynamic programming to construct a piecewise linear approximation that uses $k$ pieces and, out of all such piecewise linear approximations, choose the one minimizes the loss $L$. In particular, let $A[i,j]$ denote the lowest... | {
"domain": "cs.stackexchange",
"id": 17245,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms, data-compression",
"url": null
} |
complexity-theory, randomized-algorithms
Title: Proof for boosting success probability of a random algorithm with binary output There is a theorem stating that, given a random algorithm with a binary output that has a success probability $\geq 2/3$, you can always create the another algorithm that solves the same prob... | {
"domain": "cs.stackexchange",
"id": 21880,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "complexity-theory, randomized-algorithms",
"url": null
} |
php, laravel, eloquent
/**
* sendEmail
* Sends them an email to the specified user.
*
* @param User_test $user User object
* @throws FailureException
*/
private static function sendEmail($user) {
$templateData = array(
'companyName'=>self::$templateConfig->getCompanyName(),
... | {
"domain": "codereview.stackexchange",
"id": 21237,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, laravel, eloquent",
"url": null
} |
pid-control, feedback-loop
Timer 1 is the period timer. Let's say it's set to 5 s.
Timer 2 is the duty cycle timer. If the PID output is 25% then Timer 2's timeout value is set to 5 × 0.25 = 1.25 s.
The output turns on at the reset of the period timer (Timer 1) and turns off when
the duty cycle timer (Timer 2) reaches... | {
"domain": "engineering.stackexchange",
"id": 4997,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "pid-control, feedback-loop",
"url": null
} |
quantum-mechanics, mathematical-physics, operators, hilbert-space, mathematics
Title: Intuitive meaning of the exponential form of an unitary operator in Quantum Mechanics I'm an undergraduate student in Chemistry currently studying quantum mechanics and I have a problem with unitary transformations.
Here in my book,... | {
"domain": "physics.stackexchange",
"id": 20535,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, mathematical-physics, operators, hilbert-space, mathematics",
... |
It returned 3.6 as primary answer but it's partial sum converged to 10. I am now wondering which answer is correct.
The answer is $$10$$.
Note that you can rewrite \begin{align} \sum_{n=0}^{\infty} |(-0.8)^n \theta(n)-(-0.8)^{n-1} \theta(n-1)| &= |(-0.8)^0-0|+\sum_{n=1}^{\infty} |(-0.8)^n \theta(n)-(-0.8)^{n-1} \thet... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9811668712109664,
"lm_q1q2_score": 0.8319978761450586,
"lm_q2_score": 0.8479677622198946,
"openwebmath_perplexity": 1424.9060232821046,
"openwebmath_score": 0.9983150959014893,
"ta... |
dataset
# noinspection PyTypeChecker
np.savetxt(os.path.join(video_out_dir, 'actions.csv'), actions, delimiter=',')
# noinspection PyTypeChecker
np.savetxt(os.path.join(video_out_dir, 'endeffector_positions.csv'), endeff_pos, delimiter=',')
skvideo.io.vwrite(os.path.join(video_out_dir, ... | {
"domain": "datascience.stackexchange",
"id": 9480,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "dataset",
"url": null
} |
c#, linq, hash-map, properties
string base_b = properties.Where(name => name.Key == "Base").Select(name => name.Value).FirstOrDefault();
string r_brush_locked = properties.Where(name => name.Key == "R_brush_locked").Select(name => name.Value).FirstOrDefault();
string g_brush_locked = properties.Where(n... | {
"domain": "codereview.stackexchange",
"id": 32412,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, linq, hash-map, properties",
"url": null
} |
ruby
(2 > 3).if_then_else(-> { puts 'True' }, -> { puts 'False' })
# False
This gives rise to the Replace Conditional with Polymorphism Refactoring. (Here is an example of it in Ruby.)
In your case, you are not just switching behavior based on some abstract notion of "type" of the object, you are literally switching... | {
"domain": "codereview.stackexchange",
"id": 14986,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ruby",
"url": null
} |
php, mysql, lookup
Title: Converting a query result into an key=>value pairs for a lookup table My app has a number of lookup tables stored in a MySQL database that are used for various purposes such as a select element.
Unfortunately, the query results aren't in an easily-digestible format and need some massaging to ... | {
"domain": "codereview.stackexchange",
"id": 44298,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, mysql, lookup",
"url": null
} |
python, keras, convolutional-neural-network
Title: How can I know if my conv1D model is overfitted or underfitted from loss curve? I am working on classification of time series multivariate data. By doing PCA, I converted multivariate to uni-variate and fed it into a conv1d in keras.
However, I am getting a very high... | {
"domain": "datascience.stackexchange",
"id": 5446,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, keras, convolutional-neural-network",
"url": null
} |
symmetry, reflection, molecules, orbitals
Now, from the above, it's easy to get the impression that this is just one of those highly-correlated multi-electronic states that is just impossible to fully understand, but that's not really the case - this $\Sigma^-$ state is actually rather simple in structure.
To see this... | {
"domain": "physics.stackexchange",
"id": 19520,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "symmetry, reflection, molecules, orbitals",
"url": null
} |
newtonian-mechanics, forces, acceleration, velocity
Title: How does an object in space travelling at constant velocity have a net force of zero acting upon it? If the definition of balanced forces is "two opposing forces that are equal" and an object with a net force of zero acting upon it means that the forces are ba... | {
"domain": "physics.stackexchange",
"id": 91046,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, forces, acceleration, velocity",
"url": null
} |
regression, xgboost, cross-validation, overfitting, metric
df = pd.read_csv(r'https://raw.githubusercontent.com/mwaskom/seaborn-data/master/iris.csv', index_col=None)
x = df.drop('species', axis=1)
y = df.species
xgb = XGBClassifier(max_depth=3)
kf = KFold(n_splits=10, shuffle=True)
for train_idx, test_idx in kf.s... | {
"domain": "datascience.stackexchange",
"id": 5689,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "regression, xgboost, cross-validation, overfitting, metric",
"url": null
} |
ros, ros-melodic, tutorial
'std_msgs/msg/UInt16MultiArray' (ROS 2) <=> 'std_msgs/UInt16MultiArray' (ROS 1)
'std_msgs/msg/UInt32' (ROS 2) <=> 'std_msgs/UInt32' (ROS 1)
'std_msgs/msg/UInt32MultiArray' (ROS 2) <=> 'std_msgs/UInt32MultiArray' (ROS 1)
'std_msgs/msg/UInt64' (ROS 2) <=> 'std_msgs/UInt64' (ROS 1)
'std_msgs/ms... | {
"domain": "robotics.stackexchange",
"id": 34070,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-melodic, tutorial",
"url": null
} |
python, datetime, calculator, tkinter
After cleaning up the rest of the code, it looks like this:
from time import strftime
import tkinter as tk
import datetime
class TimeClockApp(tk.Frame):
def __init__(self, master, *args, **kwargs):
tk.Frame.__init__(self, master, *args, **kwargs)
self.now_lbl... | {
"domain": "codereview.stackexchange",
"id": 27435,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, datetime, calculator, tkinter",
"url": null
} |
compared with the original volume of the sphere $36 \pi \approx 113.1$.
• you should know that the intersection area is not like a cube. i think you have missed to compute the additional volume to find the total volume of holes. help me if i am wrong. – Bhaskara-III Sep 4 '16 at 14:49
• @Bhaskara-III When did I say it... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.990587412635403,
"lm_q1q2_score": 0.8399861934785905,
"lm_q2_score": 0.847967764140929,
"openwebmath_perplexity": 338.96203726818834,
"openwebmath_score": 0.951598048210144,
"tags"... |
python, python-3.x, time-limit-exceeded, bioinformatics
GAGGTGGCTCGGTTACGGAGCGCAGTCGGTGATCGCGTCCGTCAGTTCGAACACATCGGCAGTACCGCGGTCGAGGGGAT
GGCGGCCAAGCCGATACTCGACGTGCTCGCCGTAGTCGACGAATCGACGACCGCGAGCGACCTCGTCCCAGCGCTCGAAA
CGCACGGCTACGAACGGCGCCCCGATGAGGTGGACGGGCGGGTGTTCCTCGCGAAGGGACCGCCAGAGAATCGTACGTGC
TATCTGTCGATCGCCGAAGT... | {
"domain": "codereview.stackexchange",
"id": 31670,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, time-limit-exceeded, bioinformatics",
"url": null
} |
java, swing, database, gui
as such the try-block in your constructor should be:
public MainView() {
frame = new JFrame();
initFrame();
frame.setVisible(true);
try {
UIManager.setLookAndFeel("com.sun.java.swing.plaf.nimbus.NimbusLookAndFeel");
}
catch (Class... | {
"domain": "codereview.stackexchange",
"id": 17739,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, swing, database, gui",
"url": null
} |
mass, spring, differential-equations
Title: How to determine sign of coefficients in simple spring, damper, mass system? For a system of the sort shown below:
I have come to realize that I continuously make mistakes when it comes to determining the signs (or specifically the direction of the forces) of the coefficie... | {
"domain": "physics.stackexchange",
"id": 19173,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mass, spring, differential-equations",
"url": null
} |
beautiful black bare babes
## 550sx graphics
I have a list of prices where I am trying to calculate the change in percentage of each number. I calculated the differences with prices = [30.4, 32.5, 31.7, 31.2, 32.7, 34.1, 35.8, 37.8, 36.3... Stack Overflow. ... Calculating change in percentage between two numbers (Pyt... | {
"domain": "dkp-bad-kreuznach.de",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9702399060540359,
"lm_q1q2_score": 0.8412326891356902,
"lm_q2_score": 0.8670357546485407,
"openwebmath_perplexity": 1553.0423029522085,
"openwebmath_score": 0.49574264883995056,
... |
safety
Title: Capacitance and flammable liquid I'm trying to attach a sensor to some tubes to measure the level of liquids in them.
see here
One tube contains toluene and the other contains Recosol R55 (shellite).
I'm thinking of using a capacitance level sensor like this or this.
But I am concerned about the safety... | {
"domain": "chemistry.stackexchange",
"id": 3476,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "safety",
"url": null
} |
curvature, earth, geometry
Some back-of-the-envelope numbers: Standing on the ground, the horizon is about 3 arc minutes below "eye level". So in a perfectly aligned shoe-box camera of length 35 cm, the horizon will be about 0.3 mm above the center line. And if the box is 25 cm wide, the outer edges of the screen wil... | {
"domain": "physics.stackexchange",
"id": 74018,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "curvature, earth, geometry",
"url": null
} |
But since $a\cdot x = 1+ 2a~~~$ and $~~x,y>2\implies x^2+y^2 >8$ we get,
$$|f(x)-f(y)| =(x^2+y^2) |y^2-x^2|\ge 8|y^2-x^2|\\~~~~~~~~~~~~~~~=8| x^2 + 2\frac{a}{2}x +\frac{a^2}{4} - x^2 | \\= 8(ax +\frac{a^2}{4})= 8(1+2a+\frac{a^2}{4} )>8$$
That is $$|f(x)-f(y)| >8$$
Thus $$\color{blue}{\exists \varepsilon_0 =8,\forall... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9777138164089085,
"lm_q1q2_score": 0.8734009472388279,
"lm_q2_score": 0.8933094046341532,
"openwebmath_perplexity": 210.78347385952645,
"openwebmath_score": 0.9865854382514954,
"ta... |
mobile-robot, ros-kinetic, mobile-base, ur10, ur5
Original comments
Comment by Martin Günther on 2018-03-08:
Re edit1: You can see how to specify gains for the velocity controller here: https://github.com/ThomasTimm/ur_modern_driver/blob/master/config/ur5_controllers.yaml . Note however that these values are for the r... | {
"domain": "robotics.stackexchange",
"id": 30192,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mobile-robot, ros-kinetic, mobile-base, ur10, ur5",
"url": null
} |
ruby, sorting, insertion-sort
Title: Implementation of insertion sort in Ruby, code correctness To implement an insertion sort that sorts an array with optional block to determine sorting order, how can I improve this code? (Seeking best practices and code correctness)
def custom_insertion_sort(arr)
for i in (1..ar... | {
"domain": "codereview.stackexchange",
"id": 4090,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ruby, sorting, insertion-sort",
"url": null
} |
optics, visible-light, laser
Before lasing occurs, the pump builds up the $N_e$ population.
Spontaneous emission occurs randomly, causing stimulated emission of
other atoms with excited electrons.
Because of the build up of photons in the cavity causing stimulated
emission of the gain medium when $N_e-N_g$ is large, t... | {
"domain": "physics.stackexchange",
"id": 5770,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "optics, visible-light, laser",
"url": null
} |
quantum-mechanics, quantum-entanglement
This kind of entwinements, following the theory, is used to stock superposed states, ie from a photon to defaults in a crystal.
Precisely, for a photon and an electron, you can read Demonstration of quantum entanglement between a single electron spin confined to an InAs quantum... | {
"domain": "physics.stackexchange",
"id": 26992,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, quantum-entanglement",
"url": null
} |
condensed-matter, hilbert-space, second-quantization
$$\langle k a, k^\prime a^\prime \vert r b, r^\prime b^\prime \rangle=\langle ka \vert rb \rangle \langle k^\prime a^\prime \vert r^\prime b^\prime \rangle- \langle ka \vert r^\prime b^\prime \rangle \langle k^\prime a^\prime \vert rb\rangle,$$
which gives the re... | {
"domain": "physics.stackexchange",
"id": 39209,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "condensed-matter, hilbert-space, second-quantization",
"url": null
} |
inverse-kinematics
}
The issue is not with the mathematics of what is going on per se, I am just confused at how I interface the three values of the X, Y, and Z rotation for the sliders (which represent the desired orientation) with these equations. For the translation component it is easy, the slider values are simpl... | {
"domain": "robotics.stackexchange",
"id": 1299,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "inverse-kinematics",
"url": null
} |
kalman-filters, particle-filter, bayesian-estimation
Title: How to derive an expression for the optimal importance distribution? I'm trying to answer the exercise 7.6 letter b of this book:
https://users.aalto.fi/~ssarkka/pub/cup_book_online_20131111.pdf
page 133 but I'm having some problems in understanding the quest... | {
"domain": "dsp.stackexchange",
"id": 5717,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kalman-filters, particle-filter, bayesian-estimation",
"url": null
} |
c++, console, compression
4) if ((!decode and !encode) or (decode and encode)) could be if (decode == encode)
OOP
Your main.cpp is a bit messy. A 700 lines long file with C functions only should not appear in C++ project, even for testing purposes.
Move
In std::vector<int8_t> file_read(std::string& file_name) you use ... | {
"domain": "codereview.stackexchange",
"id": 23189,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, console, compression",
"url": null
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.