row_id int64 0 48.4k | init_message stringlengths 1 342k | conversation_hash stringlengths 32 32 | scores dict |
|---|---|---|---|
30,618 | hello | d454ef0672297c0ed481ca0179d1ae33 | {
"intermediate": 0.32064199447631836,
"beginner": 0.28176039457321167,
"expert": 0.39759764075279236
} |
30,619 | I need a query to list all the tables that are getting joined in a view. I need it like one column should be view name, and another column with all the table names that are getting joined in that view | 8690acf4233cf39cb02caf31beb850d7 | {
"intermediate": 0.446528822183609,
"beginner": 0.21085655689239502,
"expert": 0.34261465072631836
} |
30,620 | If I have an Input component in React, this input has a name property and in this Input I have an Icon by clicking on which I need to pass the name of the input to the function then how do I do that? | e90c4158b59803e2dbcd113b8769292e | {
"intermediate": 0.6473307609558105,
"beginner": 0.22358040511608124,
"expert": 0.1290888488292694
} |
30,621 | hello | 39f5bbc9bbef6394b74de1ae1dd45a90 | {
"intermediate": 0.32064199447631836,
"beginner": 0.28176039457321167,
"expert": 0.39759764075279236
} |
30,622 | Make in silico translation. Convert an input RNA string to a peptide string. Each three letter RNA combination (see table) codes for a one peptide letter. Assume peptide starts from the beginning of the RNA input string.
Example input: CAUUUUGAUGACUCUUUUGUUAGGAAAUGA
Example output: HFDDSFVSK | 4d59739b8ac8e1c518aeda28c112ecff | {
"intermediate": 0.2196417599916458,
"beginner": 0.1767394244670868,
"expert": 0.603618860244751
} |
30,623 | How do I get all the characters from a python string and store it in a list | 6b4d57eb7d1b39ef71fea2ab00fb3bba | {
"intermediate": 0.4090626537799835,
"beginner": 0.14358001947402954,
"expert": 0.44735729694366455
} |
30,624 | Print all codons that code for a given amino acid. Use the previous table for genetic code with no def functions
Example input: L
Example output: UUA UUG CUU CUC CUA CUG | 7218993d0c08e7b5a60bed27e004e449 | {
"intermediate": 0.3858160078525543,
"beginner": 0.2755715548992157,
"expert": 0.33861246705055237
} |
30,625 | Give 4 numbers, 1,2 ,3 and 4. They can be freely combined like 1 and 2, or 1, 3 and 4. I want to find all the combinations that contains all 4 numbers, like 1, 2, 3, 4 as one of the result. 1, 2, 3 and 3, 4 can also be an result because 1 2 3 4 are inside the 2 combinations. But I want the combinations as less as poss... | 42d1344e2b18e1f0c831c47d0b66548f | {
"intermediate": 0.3893677890300751,
"beginner": 0.2276635318994522,
"expert": 0.38296863436698914
} |
30,626 | Hi, for example I have a array [ [1,1,1,1,1,1,1,1], [2,2,3,4], [1,2] , [3,4] ]. Can you find the combinations of the array item that can find 1,2,3,4 all 4 numbers in the comnibanation? | d06e74e10ce1c54486a220685653e9f2 | {
"intermediate": 0.449640154838562,
"beginner": 0.1401159167289734,
"expert": 0.4102439880371094
} |
30,627 | Implement a character level language model in C using Vanilla RNN architecture.
The model you will implement should be able to train on batches of a file (input.txt).
Print the predictions, epochs and loss while training. | a34edba84c2cd78f3fe2cca483bf660e | {
"intermediate": 0.21780875325202942,
"beginner": 0.12311693280935287,
"expert": 0.6590743660926819
} |
30,628 | Let's say I have a arry [[1], [2,3], [3], [2,4], [4], [1,4]]. Can you find the array item combinations that can build 1,2,3,4? like [1], [2,3] and [4] can be seen as an result cause 1, 2, 3, 4 can befound in the combination. [1,4], [2,4],[3] can also be seen as an result. Even though that 4 comes twice but we can still... | 8833984b360081bcd25da27839ef5189 | {
"intermediate": 0.40144485235214233,
"beginner": 0.15805596113204956,
"expert": 0.4404992163181305
} |
30,629 | public class CardDeck
{
public List<Card> Cards { get; set; } = new();
public CardDeck()
{
foreach (var power in Enum.GetValues<PowerOfCard>())
{
foreach (var suit in Enum.GetValues<Suits>())
{
Cards.Add(new Card(power, suit));
}
}... | 3eba0404e84d4138b80fb4c04118a064 | {
"intermediate": 0.38040873408317566,
"beginner": 0.3209116756916046,
"expert": 0.29867953062057495
} |
30,630 | using UnityEngine;
using UnityEngine.AI;
public class EnemyAI : MonoBehaviour
{
public Camera camera;
public float wanderRadius = 10f;
public float detectionRadius = 5f;
public float chaseDuration = 15f;
public float stopChaseDelay = 5f;
public float speed = 2f;
private GameObject player;
... | 66a07170e92c3ed8a66ccb0a55b32cf1 | {
"intermediate": 0.34866029024124146,
"beginner": 0.5003113150596619,
"expert": 0.15102839469909668
} |
30,631 | you are a llm expert and coding genuis. i want to custom code a python script, can you help me? | 9ed40c2e5237c017b27c43c90474be37 | {
"intermediate": 0.34982120990753174,
"beginner": 0.26904335618019104,
"expert": 0.381135493516922
} |
30,632 | create heroes 3 example in javascript | 2b022c5d8d86cfd39591b2e2e822460b | {
"intermediate": 0.3470418453216553,
"beginner": 0.30662021040916443,
"expert": 0.3463379442691803
} |
30,633 | fix this micosoft sql management code : create database shopland1
go
USE shopland1
GO
CREATE TABLE Employee (
FirstName NVARCHAR(50) NOT NULL,
LastName NVARCHAR(50) NOT NULL,
Birthday DATE NOT NULL,
Address NVARCHAR(150) NOT NULL,
Sex NVARCHAR(50) NOT NULL,
SSN INT IDENTITY(1,1) PRIMARY KEY,
super_ssn int not null,
S... | e58312c7ce5f450b086b7ce72cbaa49f | {
"intermediate": 0.4365784525871277,
"beginner": 0.23845867812633514,
"expert": 0.32496288418769836
} |
30,634 | help me do a rect test file for
/* eslint-disable react/function-component-definition */
import React from 'react';
interface ArrowLineProps {
startX: number,
startY: number,
endX: number,
endY: number,
color?: string
}
const ArrowLine: React.FC<ArrowLineProps> = ({
startX,
startY,
endX,
endY,
color =... | 2dd056e8a7eaa55c2da502286c06fedf | {
"intermediate": 0.33072739839553833,
"beginner": 0.4507168233394623,
"expert": 0.21855580806732178
} |
30,635 | Please Write python code for the Library System:
Catalog: -catalog_num:int, -title: str, -published_date:str, -init():None,-eq():bool, -str():str
Book: -cover_type:CoverType, -subject:str,-author:str,-init():None,-_str():str
Periodical:-periodical_type:PeriodicalType,-article:list[Article],-init():None,-str():str,-add_... | 53f2b72717459a83d189ba4bcb3edc19 | {
"intermediate": 0.5907518267631531,
"beginner": 0.312213659286499,
"expert": 0.09703453630208969
} |
30,636 | Problem Description
Given a square grid (a 2-D array called puzzleMap) of size 2N x 2N (N = 1, 2, 3), you need to fill the grid with L-shaped blocks with the given one empty cell.
Please note that the algorithm works in all positive integers N. We restrict N to 3 because we use 21 letters to represent at most 21 L-sha... | 5636eae1b3b8ab43d95ae2f8cbc42a8e | {
"intermediate": 0.30462363362312317,
"beginner": 0.4422231614589691,
"expert": 0.2531531751155853
} |
30,637 | error: qualified-id in declaration before ‘temp’
std::set::iterator temp = st.find(num);
код
#include <iostream>
#include <set>
#include <string>
// int compare(std::vector<int, std::string> a, std::vector<int, std::string> b){
// return a[1] < b[1];
// }
int main()
{
int k, n;
// s... | ecc548b1a54d8b14a1eb40d6642fa865 | {
"intermediate": 0.3602024018764496,
"beginner": 0.3901154100894928,
"expert": 0.24968217313289642
} |
30,638 | menu.setOnMenuItemClickListener {
}
Type mismatch: inferred type is Unit but Boolean was expected | 28a793aceb28687e92867a98fad4fd64 | {
"intermediate": 0.42229539155960083,
"beginner": 0.22869114577770233,
"expert": 0.34901344776153564
} |
30,639 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
using UnityEngine.SceneManagement;
public class MarioController : MonoBehaviour
{
public float moveSpeed = 5f;
public float jumpForce = 5f;
public float ladderClimbSpeed = 2f;
public int maxHealth = 3;
private int curren... | 23ef896af6f06d86d62b36f3dad1acc2 | {
"intermediate": 0.32335320115089417,
"beginner": 0.4799302816390991,
"expert": 0.19671650230884552
} |
30,640 | Use image
(‘eight.tif’)
-Apply Gnoise on the given image
-Apply different smoothing filters with different window size)
(Average ,median filter, mean filter ) | 153b9c3a921042250ecf06cbda7ef135 | {
"intermediate": 0.3688904643058777,
"beginner": 0.25524789094924927,
"expert": 0.37586167454719543
} |
30,641 | Write a C++ program. Initialize and print an array of n elements. Find the index of the 1st even element (remember the returned number). Then transform the last (returned number) elements by multiplying it by the value of the first odd element. | 513eba1729df0c902110699f9877b01c | {
"intermediate": 0.3035239279270172,
"beginner": 0.32018667459487915,
"expert": 0.376289427280426
} |
30,642 | make a C# script where it relates back to the MarioController script where if mario's health is 0 the Life1 game object is destroyed and the scene is reset (except for the Life1 game object); then do the same thing with Life2 and Life3 game objects; once Life1, Life2, and Life3 are destroyed, re-instantiate them | 82797754537e01440d5ffc831ed14667 | {
"intermediate": 0.6403826475143433,
"beginner": 0.1735190451145172,
"expert": 0.18609827756881714
} |
30,643 | Fix my C++ program. It's supposed to initialize and print an array of n elements, Find the index of the 1st even element (val), Then transform the last (val) elements by multiplying it by the value of the first odd element. My code fails at the very end as it doesn't multiply the correct number of last elements
Write a... | 90f4c721d604a19a0ccbba6291255aed | {
"intermediate": 0.4159250259399414,
"beginner": 0.30272775888442993,
"expert": 0.2813471555709839
} |
30,644 | Fix my C++ program. It's supposed to initialize and print an array of n elements, find the index of the 1st even element (val). Then transform the last (val) elements by multiplying it by the value of the first odd element. My code doesn't work correctly as it multiplies the wrong quantity of last elements at the very... | a0697257168ca232c829ee3d054b76f6 | {
"intermediate": 0.3712943196296692,
"beginner": 0.4815841019153595,
"expert": 0.14712154865264893
} |
30,645 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
using UnityEngine.SceneManagement;
public class MarioController : MonoBehaviour
{
public float moveSpeed = 5f;
public float jumpForce = 5f;
public float ladderClimbSpeed = 2f;
public int maxHealth = 3;
private int curren... | 87550d26791e88642ec1fa96453fb6f7 | {
"intermediate": 0.32335320115089417,
"beginner": 0.4799302816390991,
"expert": 0.19671650230884552
} |
30,646 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
using UnityEngine.SceneManagement;
public class MarioController : MonoBehaviour
{
public float moveSpeed = 5f;
public float jumpForce = 5f;
public float ladderClimbSpeed = 2f;
public int maxHealth = 3;
private int curren... | 3819c2887ce35261ee14e8f9b90abc24 | {
"intermediate": 0.32335320115089417,
"beginner": 0.4799302816390991,
"expert": 0.19671650230884552
} |
30,647 | write a C# PointCollider script for when it collides with a barrel game object +100. Here is the ScoreCounter script for reference: using System.Collections;
using System.Collections.Generic;
using UnityEngine;
using UnityEngine.UI; //This line enables use of uGUI classes like Text.
public class ScoreCounter : MonoBeh... | aa2e40e3e53e95a28fdc956ecb857088 | {
"intermediate": 0.41139674186706543,
"beginner": 0.38176319003105164,
"expert": 0.20684003829956055
} |
30,648 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
using UnityEngine.SceneManagement;
public class MarioController : MonoBehaviour
{
public float moveSpeed = 5f;
public float jumpForce = 5f;
public float ladderClimbSpeed = 2f;
public int maxHealth = 3;
private int curren... | 73b25e42e03c31690d72260a983942e5 | {
"intermediate": 0.3211897313594818,
"beginner": 0.5172820091247559,
"expert": 0.16152825951576233
} |
30,649 | const { market_list } = require("./server");
const GarageItem = require("./GarageItem"),
Area = require("./Area"),
{ turrets, hulls, paints, getType } = require("./server"),
InventoryItem = require("./InventoryItem");
class Garage extends Area {
static fromJSON(data) {
if (typeof (data.tank) !== "und... | e82f6e4203735d354b320b166bf53037 | {
"intermediate": 0.2909576892852783,
"beginner": 0.5029168725013733,
"expert": 0.20612549781799316
} |
30,650 | import sys
if len(sys.argv) < 3:
print("""Usage
python3 main.py -t 8 -api / -scrape""")
# add t to threads var and api/scrape vars to a bool if it has been chosen, error if both have been added.
implement the lpogic for args | 414a0f823d9a63a099d03c7dfe18fe43 | {
"intermediate": 0.27298516035079956,
"beginner": 0.568279504776001,
"expert": 0.15873534977436066
} |
30,651 | const { market_list } = require("./server");
const GarageItem = require("./GarageItem"),
Area = require("./Area"),
{ turrets, hulls, paints, getType } = require("./server"),
InventoryItem = require("./InventoryItem");
class Garage extends Area {
static fromJSON(data) {
if (typeof (data.tank) !== "und... | 691c75f54a03b7817a43430227eab454 | {
"intermediate": 0.2909576892852783,
"beginner": 0.5029168725013733,
"expert": 0.20612549781799316
} |
30,652 | an api responds with this json object, please write python code to get all the challange imgs.
{"session_token":"86817966165352965.1276073005","challengeID":"825654ea5fda71c37.3598523505","challengeURL":"https:\/\/github-api.arkoselabs.com\/fc\/assets\/match-game-ui\/0.33.0\/standard\/index.html","audio_challenge_urls"... | 16de79ee97aee5d9a2d374106205062d | {
"intermediate": 0.4140183925628662,
"beginner": 0.31147125363349915,
"expert": 0.27451038360595703
} |
30,653 | an api responds with this json object, please write python code to get all the challange imgs, do not write our the json object, i can replace it myself you are just gonna waste time.
{"session_token":"86817966165352965.1276073005","challengeID":"825654ea5fda71c37.3598523505","challengeURL":"https:\/\/github-api.arkose... | 7e098a96733e17ce430d0470ddd21aeb | {
"intermediate": 0.40055036544799805,
"beginner": 0.2848620116710663,
"expert": 0.31458762288093567
} |
30,654 | const { market_list } = require("./server");
const GarageItem = require("./GarageItem"),
Area = require("./Area"),
{ turrets, hulls, paints, getType } = require("./server"),
InventoryItem = require("./InventoryItem");
class Garage extends Area {
static fromJSON(data) {
if (typeof (data.tank) !== "und... | 1ecfd6334348b224fbd3136ebe9b3f09 | {
"intermediate": 0.2909576892852783,
"beginner": 0.5029168725013733,
"expert": 0.20612549781799316
} |
30,655 | const { market_list } = require("./server");
const GarageItem = require("./GarageItem"),
Area = require("./Area"),
{ turrets, hulls, paints, getType } = require("./server"),
InventoryItem = require("./InventoryItem");
class Garage extends Area {
static fromJSON(data) {
if (typeof (data.tank) !== "und... | 117fe39ae612a272f60c776fa585d378 | {
"intermediate": 0.2909576892852783,
"beginner": 0.5029168725013733,
"expert": 0.20612549781799316
} |
30,656 | how would i program in a way to tell the computer to open a specific website (www.test.com) in a c++ sdl 2 application? | 53dc28371be6128b57353fcbb59f3cbb | {
"intermediate": 0.3793335258960724,
"beginner": 0.2534739375114441,
"expert": 0.36719250679016113
} |
30,657 | const { c, market_list, getType } = require("./server");
class GarageItem {
static get(id, m = 1) {
return new GarageItem(id, 0, m);
}
static fromJSON(data) {
var item = new GarageItem(c(data.id), c(data.modificationID, 0), c(data.count, 0));
return item;
}
static getInfo... | 25099772c60ae67db6e6354fe6c83c76 | {
"intermediate": 0.31071266531944275,
"beginner": 0.4544334411621094,
"expert": 0.23485387861728668
} |
30,658 | rms = np.zeros((m, int(timepoints/10)))
normalized_rms= np.zeros((m, int(timepoints/2277)))#1
#compute
for i in range(timepoints/2277):
current_bin_data = MVC[10*i:10*i+9,:]#i=0,i=1
#(1-9,10-19...)
rms[i,:]=np.sqrt(np.mean(current_bin_data**2, axis=1))#开平方；xyz轴,2
#normalize
for p in rang... | 2a360f6f49fbdfd017e971a4de70d85a | {
"intermediate": 0.36743807792663574,
"beginner": 0.2848958373069763,
"expert": 0.34766608476638794
} |
30,659 | this.previewId = this.mapId + "_preview";
if (this.bonuses)
{
this.tickingRegions = [];
var regions = this.map.getBonusRegions(["medkit", "nitro", "damageup", "armorup"]);
for (var i in regions)
this.tickingRegions.push(new BonusRegion(regions[i]));
setInterval(() =>
{
this.update(1);
}... | 0d831a41f43e0ae92132308f742945b4 | {
"intermediate": 0.3497760593891144,
"beginner": 0.2629725933074951,
"expert": 0.3872513175010681
} |
30,660 | ---------------------------------------------------------------------------
ValueError Traceback (most recent call last)
Cell In[14], line 1
----> 1 G1= pd.read_excel(r"C:\Users\10039\Desktop\G1 WK2.xlsx", sheet_name=['G1T1','G1T7','G1T15','G1R1','G1R5'])
File D:\python\Lib\site-packages... | 44e7f03c99509dd0dfda932ef68b5d5a | {
"intermediate": 0.44905492663383484,
"beginner": 0.4461248219013214,
"expert": 0.10482022911310196
} |
30,661 | in lua construction for i, v in <table> do I need to declare i, v local? | 70a5b75d28a48d670e42ced1111029f8 | {
"intermediate": 0.4209896922111511,
"beginner": 0.2983699142932892,
"expert": 0.28064045310020447
} |
30,662 | I am a fashion researcher collecting a list of details that are often found in clothing and names of clothing items. I need you to provide me with a list of such elements in the form of a list of python strings.
For example: ["sleeves", "shirt", "t-shirt", "trousers", "pockets", "denim"]
Take a deep breath, provide e... | 538ddf8f110fa6ad0289968bafc5c68f | {
"intermediate": 0.26822808384895325,
"beginner": 0.44375643134117126,
"expert": 0.2880154550075531
} |
30,663 | crea un database seeder para esta db
Tabla 1: "technicians"
- id (pk)
- name
- last_name
- address
- phone
- email
Tabla 2: “services”
- id (pk)
- description
- price
- category_id(fk)
Tabla 3: categories
- id (pk)
- name
- description
Tabla 4: “services_technicians”
- id (pk)
- technical_id(fk)
- service_id (fk)
... | 938262899bbba8ba709228e0a149737d | {
"intermediate": 0.3443434238433838,
"beginner": 0.36920467019081116,
"expert": 0.28645193576812744
} |
30,664 | hdb3_data = zeros(1, length(binary_data));
pulse = 1;
count = 0;
for i = 1:length(binary_data)
if binary_data(i) == 0
count = count + 1;
if count == 4
hdb3_data(i - 3:i) = ones(1, 4) * pulse;
pulse = -pulse;
count = 0;
end
else
count = 0;
e... | e919c5a4448fa954df8b47476637ff3d | {
"intermediate": 0.3169279992580414,
"beginner": 0.362738698720932,
"expert": 0.3203333616256714
} |
30,665 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
public class BarrelController : MonoBehaviour
{
private bool canPhase = true;
private Rigidbody2D rb;
private void Start()
{
rb = GetComponent<Rigidbody2D>();
}
private void Update()
{
// Check ... | 8a35dceee14a007eb757b7c56e21faad | {
"intermediate": 0.3758101463317871,
"beginner": 0.35011395812034607,
"expert": 0.2740758955478668
} |
30,666 | if (collision.gameObject.CompareTag("Platform") && canPhase)
{
float platformXPos = collision.gameObject.transform.position.x;
if (platformXPos == position.-x)
{
// Increase velocity by 5 units in the negative x direction
rb.velocity += new Ve... | 862f2259d2e8e282becbbed7bf0ffbe1 | {
"intermediate": 0.40912869572639465,
"beginner": 0.3664156496524811,
"expert": 0.22445566952228546
} |
30,667 | How to remove a same object in an array for JS? | d1c349ff200913d323bd73a828417803 | {
"intermediate": 0.5370522141456604,
"beginner": 0.218959242105484,
"expert": 0.24398858845233917
} |
30,668 | using System.Collections;
using System.Collections.Generic;
using UnityEngine;
public class BarrelController : MonoBehaviour
{
private bool canPhase = true;
private Rigidbody2D rb;
private void Start()
{
rb = GetComponent<Rigidbody2D>();
}
private void Update()
{
// Check ... | c5939981ebe31653dc51000e09d435fc | {
"intermediate": 0.34403547644615173,
"beginner": 0.4368344843387604,
"expert": 0.21913005411624908
} |
30,669 | как удалить всем повторяющиеся данные в sqlite
c.execute("INSERT INTO eda VALUES (NULL, ?, ?, ?, ?, ?, ?)", (name, phone, adr, other, gps, header)) | d8ff29dc55bafbcd6c9156a734705142 | {
"intermediate": 0.386188268661499,
"beginner": 0.34391555190086365,
"expert": 0.26989614963531494
} |
30,670 | There are 3 tasks to be accomplished
Write Java program and classes according to the requirement
Let all the classes to be public and each class into a .java file
Write your main program as a main class name them:
"TestTask1", "TestTask2" and "TestTask3"
Task 1
(1) Define all the classes in the table
(2)Write yo... | de02c29f1c2fc653a16f5b73fc9e9b33 | {
"intermediate": 0.4205601215362549,
"beginner": 0.3579806983470917,
"expert": 0.22145918011665344
} |
30,671 | private void OnTriggerEnter2D(Collision2D other)
{
if (other.gameObject.layer == LayerMask.NameToLayer("MidBarrelChute") && canPhase)
{
float randomChance = Random.Range(0f, 1f); // Get a random value between 0 and 1
if (randomChance <= 0.5f) // 50% chance of not colliding
... | e20d81ecabdb7d511a9c111b05302d6d | {
"intermediate": 0.34671106934547424,
"beginner": 0.3584491014480591,
"expert": 0.29483988881111145
} |
30,672 | using (up_11_02Entities1 db = new up_11_02Entities1())
{
var CountId = Instances.db.Database.SqlQuery<string>("SELECT TOP (1) pk_product_with_user_id FROM dbo.products_users_table ORDER BY pk_product_with_user_id DESC");
string productIdd = Convert.ToString(CountId);
... | 7fa4da1d8965f3c9f9d794b153f2509a | {
"intermediate": 0.34498417377471924,
"beginner": 0.3742329180240631,
"expert": 0.28078290820121765
} |
30,673 | There are 3 tasks to be accomplished
Write Java program and classes according to the requirement
Let all the classes to be public and each class into a .java file
Write your main program as a main class name them:
"TestTask1", "TestTask2" and "TestTask3"
public class Ram16GB {
private double price;
public Ram16G... | 05cb171a56858d5ba51e0e581195ff48 | {
"intermediate": 0.2782352566719055,
"beginner": 0.4703652560710907,
"expert": 0.2513994872570038
} |
30,674 | Hi, If I have a dictionary in Python [1: [1,2,3,4,5,6], 2:[1,2,3,3,4,4,5,5,6]], how can I remove duplicated values and make the values into a set? | 94b5373761ce115cdb0bead44787d723 | {
"intermediate": 0.5743860602378845,
"beginner": 0.12716491520404816,
"expert": 0.2984490394592285
} |
30,675 | import itertools
dictionary = {
1: [1,2,3,4,5,6],
2: [1,2,3,3,4,4,5,5,6]
}
combined_set = set(itertools.chain.from_iterable(dictionary.values()))
print(combined_set) Can you write the result into a file that each set item is in one line? | 2a10f878da004543c003c7a835623c8a | {
"intermediate": 0.43791428208351135,
"beginner": 0.3667541444301605,
"expert": 0.19533158838748932
} |
30,676 | package task1;
public class HardDrive {
private double price;
public HardDrive() {
price = 75.0;
}
public double getPrice() {
return price;
}
}
public class CompactHardDrive {
private double price;
public CompactHardDrive() {
price = 64.0;
}
... | 60d0c43479a59306d57d8509ccd2c73c | {
"intermediate": 0.31757211685180664,
"beginner": 0.4121190309524536,
"expert": 0.27030885219573975
} |
30,677 | Hard Drive $75.0
Compact Hard Drive $64.0
Large Capacity Hard Drive $130.0
SSD $80.0
Large Capacity SSD $120.0
16GB Memory Module (Ram16GB) $40.0
32GB Memory Module (Ram32GB) $69.0
Efficient Processor $306.0
Powerful Processor $589.0
Task 2
(1)Follow Find the common parts between the classes, define superclass of them... | af59959f993887aa96e5620b49c0cce9 | {
"intermediate": 0.3062087595462799,
"beginner": 0.4446893632411957,
"expert": 0.24910187721252441
} |
30,678 | Write a client server chatroom program in C using sockets and pthreads, in which we can run server code with:
server [server-port-number]
and client code:
client ][server-host-name ][[server-port-numberclient-name] | 1fd5827c432672fdda747a6dcdddc34b | {
"intermediate": 0.38716545701026917,
"beginner": 0.3641865849494934,
"expert": 0.248648002743721
} |
30,679 | suggest code to append value to lua array, with base index 1 | 2d9596c20b189c850b005dc6be3f3749 | {
"intermediate": 0.36584728956222534,
"beginner": 0.13260211050510406,
"expert": 0.5015506148338318
} |
30,680 | #include <iostream>
using namespace std;
void display_arr(int a[],&size)
{
for (int i = 0; i<size;i++ )
{
cout << a[i] << " ";
}
cout<<endl;
}
int lesson_1(int a[],&size)
{
int total_sum=0;
for (int i = 0; i<size;i++ )
{
total_sum += a[i];
}
return total_sum;
... | 3797976e135552f61d40a8792913a7dc | {
"intermediate": 0.36844030022621155,
"beginner": 0.4021168649196625,
"expert": 0.22944283485412598
} |
30,681 | #include
using namespace std;
void display_arr(int a[],&size)
{
for (int i = 0; i<size;i++ )
{
cout << a[i] << " ";
}
cout<<endl;
}
int lesson_1(int a[],&size)
{
int total_sum=0;
for (int i = 0; i<size;i++ )
{
total_sum += a[i];
}
return total_sum;
}
int main()
{
srand(time(NULL));
int size = 10;
int a[size] =... | bd1f7a04f01e14f46890ad1bee6d1497 | {
"intermediate": 0.2716308534145355,
"beginner": 0.5453287959098816,
"expert": 0.18304024636745453
} |
30,682 | Tell me about the book Pro ASP.NET Core 6, 9th Edition (2022). | 7c5685f48d37085cf4e3a62301db148f | {
"intermediate": 0.4846843481063843,
"beginner": 0.2693561017513275,
"expert": 0.2459595799446106
} |
30,683 | the command-line tools provided by the .NET SDK has comprehensive commands that can create projects and solutions, add packages and references, build and run and publish projects.
From SDK developer's perspecive, if you are to design such SDK command line tools, how would you design the tool architecture, so that the ... | 5af3dbb1668bd2ada4cab1514b41c21f | {
"intermediate": 0.43414586782455444,
"beginner": 0.31226348876953125,
"expert": 0.2535906136035919
} |
30,684 | Make an html resume page as a behinner | 4127ed7f39b74fc2472cfcef25b39898 | {
"intermediate": 0.388731986284256,
"beginner": 0.32840773463249207,
"expert": 0.28286030888557434
} |
30,685 | lua code x = {objId, coord[1], coord[2], coord[4]}. does it initialise an array? can I adrress it by index? | 968dd0ed66fd4a5da3d930c72c7a6bb5 | {
"intermediate": 0.5071656703948975,
"beginner": 0.27780747413635254,
"expert": 0.2150268703699112
} |
30,686 | """
#导入库
import numpy as np
import pandas as pd
import matplotlib.pyplot as plt
from sklearn.metrics import roc_curve
from sklearn.datasets import load_breast_cancer
from sklearn.model_selection import train_test_split
from sklearn import svm
from sklearn import metrics
from sklearn.metrics import roc_auc_score
from s... | 0e561551fcba6506e0ae2d67ac4b95d9 | {
"intermediate": 0.3305051922798157,
"beginner": 0.3838988244533539,
"expert": 0.2855960726737976
} |
30,687 | terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
Aborted (core dumped)
Ошибка при запуске, сам код:
//ошибки по итераторам:
//нет операций +/-/*, сравнение(</>) для итераторов класса map, set, list. Только инткремент, декримент.
//или доп.функция: advance(<итератор>, <значен... | 778b5c7849381b05d572e59b934585c5 | {
"intermediate": 0.23867858946323395,
"beginner": 0.6304317712783813,
"expert": 0.1308896690607071
} |
30,688 | Quicksort in python | 569f4ed943518a1ce7a7688c54f2248a | {
"intermediate": 0.30776259303092957,
"beginner": 0.14897920191287994,
"expert": 0.5432581901550293
} |
30,689 | Write a program in C++ that inputs distance travelled in miles and speed of vehicle in mph.It then calculates time required to reach the destination and prints it | 82f2ebb78f810501e8b68cb7466d0561 | {
"intermediate": 0.32357242703437805,
"beginner": 0.24784281849861145,
"expert": 0.4285848140716553
} |
30,690 | #include <iostream>
using namespace std;
int main()
{
char S1[] = "water";
char S2[] = "fire";
char S3[] = "";
cout << S1<<endl;
cout << S3<<endl;
return 0;
} какой метод для c-строк считает размер строки? | cdae088b93410058dde1cf5c39864841 | {
"intermediate": 0.2951818108558655,
"beginner": 0.4805341362953186,
"expert": 0.2242840677499771
} |
30,691 | I need to compare whether the values shifted two month back is blank using DAX if and DATEADD function. Help with that | b61910e7a34d0cf1bd97d505085dd157 | {
"intermediate": 0.5175886750221252,
"beginner": 0.22159051895141602,
"expert": 0.2608208656311035
} |
30,692 | #include
using namespace std;
int main()
{
char S1[] = “water”;
char S2[] = “fire”;
char S3[] = “”;
cout << S1<<endl;
cout << S3<<endl;
return 0;
} какой пополнить S3 содержимым строки S1 с помощью for statenebt | 707f96567305354ab1e89b7da3cb2376 | {
"intermediate": 0.32301759719848633,
"beginner": 0.48960649967193604,
"expert": 0.18737590312957764
} |
30,693 | Write a C++ program. Initialize and print a two-dimensional array using functions. Pass the array using reference | a7e5de7e156f4567e1c39b57eff1676c | {
"intermediate": 0.24030235409736633,
"beginner": 0.5668061971664429,
"expert": 0.1928914338350296
} |
30,694 | Write a C++ program. Initialize and print a two-dimensional array using functions. Pass the array using pointer. Both dimensions are const values | 255d7288fbb69f7a0c13c2562116728e | {
"intermediate": 0.2915411591529846,
"beginner": 0.4846530258655548,
"expert": 0.22380581498146057
} |
30,695 | I have a table
Client | Date | Amount
------ | ---------- | ------
A | 2022-12-01 | 120
A | 2022-11-01 | 250
A | 2022-10-01 | 200
A | 2022-09-01 | 180
B | 2022-11-01 | 150
B | 2022-10-01 | 130
B | 2022-09-01 | 110
I need a DAX measure to first check whether for each client exists the row shifted two month back. If so... | 6c8cc967f986f15d32527fdb29da7a55 | {
"intermediate": 0.4318868815898895,
"beginner": 0.3429088890552521,
"expert": 0.2252042293548584
} |
30,696 | could you speed up my code?
# создадим список датафреймов
pets_vs_nests = []
# для каждого, кто заходил в петов 3 раза и более и покупал гнездо
for i in tqdm(pets_basic[pets_basic.nest_buyer].appsflyer_id.unique()):
# создадим свой датафрейм
df = pets_n_nests[pets_n_nests.appsflyer_id == i].reset_index(d... | 9a3928f96df8bc060653f2bb736de987 | {
"intermediate": 0.5552085041999817,
"beginner": 0.19735288619995117,
"expert": 0.24743860960006714
} |
30,697 | function hcyl(bottom, height, radius, id) {
let radsq = radius * radius
let innerRadsq = (radius - 1.2) * (radius - 1.2)
height += bottom
for (let x = -radius; x <= radius; x++) {
for (let y = bottom; y < height; y++) {
for (let z = -radius; z <= radius; z++) {
let d = x * x + z * z
if (d < radsq && d ... | a3d7a48d801a4338a487807b1cfd0d70 | {
"intermediate": 0.2089826762676239,
"beginner": 0.5734841227531433,
"expert": 0.2175331860780716
} |
30,698 | function hcyl(bottom, height, radius, id) {
let radsq = radius * radius
let innerRadsq = (radius - 1.2) * (radius - 1.2)
height += bottom
for (let x = -radius; x <= radius; x++) {
for (let y = bottom; y < height; y++) {
for (let z = -radius; z <= radius; z++) {
let d = x * x + z * z
if (d < radsq && d ... | 5e3c9fd3e06190f68e3920429d028e02 | {
"intermediate": 0.2089826762676239,
"beginner": 0.5734841227531433,
"expert": 0.2175331860780716
} |
30,699 | function hcyl(bottom, height, radius, id) {
let radsq = radius * radius
let innerRadsq = (radius - 1.2) * (radius - 1.2)
height += bottom
for (let x = -radius; x <= radius; x++) {
for (let y = bottom; y < height; y++) {
for (let z = -radius; z <= radius; z++) {
let d = x * x + z * z
if (d < radsq && d ... | f7f59c8428041f308ef6300af5fdde3d | {
"intermediate": 0.2089826762676239,
"beginner": 0.5734841227531433,
"expert": 0.2175331860780716
} |
30,700 | I have a table
Client | Date | Type| Amount
------ | ---------- | ------| ------
A | 2022-12-01 |X| 120
A | 2022-11-01 |X| 250
A | 2022-10-01 |X|200
A | 2022-09-01 |Y| 180
B | 2022-11-01 |X| 150
B | 2022-10-01 |X| 130
B | 2022-09-01 |X| 110
I need a DAX measure to first check whether for each client and Type =X exist... | 1a3b10d9a62783b2f5176f2fc6dad8c8 | {
"intermediate": 0.37213778495788574,
"beginner": 0.2692500054836273,
"expert": 0.35861220955848694
} |
30,701 | I would like to learn react redux I'm importing import {createStore} from 'redux' and try to use const store = createStore(movies);
window.store = store;. But store is not available in window object. How I could solve this problem? | 63603cb0b0a503dd5aece4efedad5a14 | {
"intermediate": 0.7286375761032104,
"beginner": 0.20285487174987793,
"expert": 0.0685075893998146
} |
30,702 | observations = {}
while True:
line = input()
if line == "":
break
bird, count = line.split(": ")
count = int(count)
if bird in observations:
observations[bird] += count
else:
observations[bird] = count
for bird, count in observations.items():
print(f"{bird}: {count}"... | ff8282e26afd6fb4e1d915fce14448be | {
"intermediate": 0.372332364320755,
"beginner": 0.4505011737346649,
"expert": 0.17716649174690247
} |
30,703 | python code to build auto customer service of product chatbot | 0aac70d36e98852c169eba0ac43904df | {
"intermediate": 0.4205651581287384,
"beginner": 0.24086754024028778,
"expert": 0.3385672867298126
} |
30,704 | explain how this html code works <input id="lazy" name="personality" type="checkbox"> <label for="lazy">Lazy</label> | 964e6b90363b8b8ba6e27ae44980d0f9 | {
"intermediate": 0.37602174282073975,
"beginner": 0.43393474817276,
"expert": 0.19004349410533905
} |
30,705 | Do not use any Context from before! Create at least 5 coding excercises that build upon each other. You create exercises with multiple turns. Meaning there is a first excercises the user has to solve. After that the created solution should be incorporated in the next excercise, so the user has to adjust the code of the... | 9c1928d9379f013037cacb677e25482c | {
"intermediate": 0.43010973930358887,
"beginner": 0.3461252748966217,
"expert": 0.22376491129398346
} |
30,706 | I used this code:
df = client.depth(symbol=symbol)
def signal_generator(df):
if df is None or len(df) < 2:
return ''
signal = []
final_signal = []
# Retrieve depth data
th = 0.35
depth_data = client.depth(symbol=symbol)
bid_depth = depth_data['bids']
ask_depth = depth_dat... | c0cfe1b5aaca62a8e1a2def0e8b7fda8 | {
"intermediate": 0.25650617480278015,
"beginner": 0.5119444131851196,
"expert": 0.2315494269132614
} |
30,707 | char S1[] = "water";
char S2[] = "fire";
int len_s1_s2 = strlen(S1)+ strlen(S2);
char S3_2[len_s1_s2];
int j1 = 0;
for (int i = 0; i < strlen(S1); i++)
{
for (int k = 0; k < strlen(S2); k++)
{
if (S1[i] == S2[k])
{
S3_2[j1++] = S1[... | ffde1d17052e328dec27166a337378ba | {
"intermediate": 0.2670329511165619,
"beginner": 0.3876579999923706,
"expert": 0.3453091084957123
} |
30,708 | # Define the input array
array = [[1], [2,3], [3], [2,4], [4], [1,4]]
# Define the target set
target = {1, 2, 3, 4}
# Initialize an empty list to store the results
results = []
# Loop through all possible combinations of array items
from itertools import combinations
for i in range(1, len(array) + 1):
for combo ... | be75a1ed1f489fe21b20f1c3200cc097 | {
"intermediate": 0.36542725563049316,
"beginner": 0.36202242970466614,
"expert": 0.2725503444671631
} |
30,709 | Write a C++ program. Initialize a 2d array (3x10) as follows: {{1,2,3,4,5,1,2,3,4,5},{1,0,1,0,1,0,1,0,1,0},{5,4,3,2,1,5,4,3,2,1}}. Use a function for that | 05c09083d5029bc1377f22dbcfe650f4 | {
"intermediate": 0.29060301184654236,
"beginner": 0.41940996050834656,
"expert": 0.28998705744743347
} |
30,710 | Помоги мне добавить в мою игру класс, который бы занимался анимацией. #include <SFML/Graphics.hpp>
class Character
{
private:
sf::Texture texture;
sf::Sprite sprite;
sf::Clock clock;
public:
Character(const std::string& _filename, sf::RenderWindow& _window)
{
texture.loadFromFile(_filenam... | 7b632d4bc4ef6c4fdd5b4eeba629f05f | {
"intermediate": 0.27097681164741516,
"beginner": 0.5007468461990356,
"expert": 0.228276327252388
} |
30,711 | The depth data printing me: ‘bids’: [[‘236.72’, ‘6.312’], [‘236.71’, ‘1.513’], [‘236.70’, ‘5.585’]] and more I need code which will gett qty , qty in this returnment is 6.312 , 1.513 and 5.585 ,buy every returnment like this is in [] and it looks like this [][][][][] and they are in [] , all order book looks like : ‘bi... | 92e6866119fb0fe03ae2b55f638f37e1 | {
"intermediate": 0.37080809473991394,
"beginner": 0.14041922986507416,
"expert": 0.4887726902961731
} |
30,712 | # Define the input array
array = [[1], [2,3], [3], [2,4], [4], [1,4]]
# Define the target set
target = {1, 2, 3, 4}
# Initialize an empty list to store the results
results = []
# Create a dictionary to store the count of each element in the array
count = {}
for item in array:
for num in item:
count[num] ... | d3bb601ec78d0e3145a139ac251e06cb | {
"intermediate": 0.599327564239502,
"beginner": 0.2916223406791687,
"expert": 0.1090501993894577
} |
30,713 | python code for bot to trade in binance with out api use strategy if close rise from dawn to up vwap 180 and if close rise from dawn to up ema 60 now bot can buy and if price rise to 100% sell | 6f3b7051d1494b88446c796b0935e1cc | {
"intermediate": 0.3885593116283417,
"beginner": 0.20799529552459717,
"expert": 0.40344536304473877
} |
30,714 | сделай плагин на базар, чтобы когда ты вводил команду /bz открывалось меню, сделай так чтобы в меню можно было настроить предметы, сделай так чтобы в 5 слоту меню был камень, сделай так чтобы его можно было продать. Сделай так чтобы цена камня была всегда рандомной, первоначальная цена - 10, сделай так чтобы цена камня... | 8d4d402123f1391b6259b60dc07b1177 | {
"intermediate": 0.28768372535705566,
"beginner": 0.3909303545951843,
"expert": 0.32138586044311523
} |
30,715 | # Define the input array
array = [[1], [2,3], [3], [2,4], [4], [1,4]]
# Define the target set
target = {1, 2, 3, 4}
# Initialize an empty list to store the results
results = []
# Loop through all possible combinations of array items
from itertools import combinations
for i in range(1, len(array) + 1):
for combo in... | 158269b953102876e8b649a5207f9601 | {
"intermediate": 0.2993236184120178,
"beginner": 0.22223782539367676,
"expert": 0.4784385859966278
} |
30,716 | Что можно изменить в моей программе, чтобы она была в стиле ООП? #include <SFML/Graphics.hpp>
#include <SFML/Audio.hpp>
using namespace sf;
float offsetX = 0, offsetY = 0;
const int H = 17;
const int W = 150;
String TileMap[H] = {/*MAP IS HERE*/};
class PLAYER {
public:
float dx, dy;
FloatRect rect;
boo... | 5582a9d5b84c9ed3b94dcd6046cd2219 | {
"intermediate": 0.26459360122680664,
"beginner": 0.47092974185943604,
"expert": 0.26447659730911255
} |
30,717 | constructor(system, name, map_id, type, time, max_people, min_rank, max_rank, limit, bonuses, autoBalance, friendlyFire, pro)
{
super();
////////////////////////////////////////////
this.name = name;
this.mapId = map_id;
this.battleId = mt_rand(9000, 90000) + "@" + name + "@#" + lobby.battle_count++;
... | 7654d2e1f6afc9dbea748ace6fcafd25 | {
"intermediate": 0.3283708095550537,
"beginner": 0.23092889785766602,
"expert": 0.44070035219192505
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.