task_type stringclasses 1
value | problem stringlengths 261 3.34k | answer stringlengths 35 6.15k | problem_tokens int64 62 774 | answer_tokens int64 12 2.04k |
|---|---|---|---|---|
coding | Solve the programming task below in a Python markdown code block.
Chef and his best friend Aleksa are into mathematical games these days. Today, they have some ( ≥ 0 ) black cells represented as B, and a white cell represented as W, lying randomly in a straight line.
They have decided to play with these cells. In a move, a player chooses some ( > 0 ) black cells lying on any one side of the white cell and remove them. It should be noted that a player is not allowed to choose black cells from both side of the given white cell. Both the players alternate their moves, and play optimally. The player who is unable to move in his respective turn will lose the game.
Aleksa, being a girl, has a habit of playing first. But Chef is fairly smart himself, and will not play the game if he is going to lose it. Therefore, he wants to know the winner beforehand. Can you tell him who is going to win the game for the given configuration of cells?
-----Input-----
First line of input contains a single integer T denoting the number of test cases. First and the only line of each test case contains a string S consisting of the characters 'B' and 'W', denoting black and white cells, respectively.
-----Output-----
For each test case, output "Chef" if chef wins the game for the given configuration. Else print "Aleksa". (quotes for clarity only).
-----Constraints-----
- 1 ≤ T ≤ 10
- 1 ≤ |S| ≤ 10000
- S contains exactly 1 white cell.
-----Scoring-----
- Subtask 1: 1 ≤ T ≤ 10, 1 ≤ |S| ≤ 10 : ( 30 pts )
- Subtask 2: 1 ≤ T ≤ 10, 1 ≤ |S| ≤ 100 : ( 30 pts )
- Subtask 3: 1 ≤ T ≤ 10, 1 ≤ |S| ≤ 10000 : ( 40 pts )
-----Example-----
Input
3
W
BW
BWBB
Output
Chef
Aleksa
Aleksa
----- Explanation-----
- Test 1 : Aleksa cannot make a move in her first turn as there is no black cell in the given configuration.
- Test 2 : Aleksa can remove 1 black cell lying on the left of white cell in her turn. But then, Chef cannot make a move in his turn as there will be no black cells left.
- Test 3 : Figure out yourself. | {"inputs": ["3\nW\nBW\nBWBB"], "outputs": ["Chef\nAleksa\nAleksa"]} | 556 | 27 |
coding | Solve the programming task below in a Python markdown code block.
Problem
One day, mo3tthi and tubuann decided to play a game with magic pockets and biscuits.
Now there are $ K $ pockets, numbered $ 1,2, \ ldots, K $.
The capacity of the $ i $ th pocket is $ M_i $, which initially contains $ N_i $ biscuits.
mo3tthi and tubuann start with mo3tthi and perform the following series of operations alternately.
* Choose one pocket.
* Perform one of the following operations only once. However, if the number of biscuits in the pocket selected as a result of the operation exceeds the capacity of the pocket, the operation cannot be performed.
* Stroking the selected pocket. Magical power increases the number of biscuits in your chosen pocket by $ 1 $.
* Hit the selected pocket. The number of biscuits in the pocket chosen by magical power is doubled by $ 2 $.
The game ends when you can't operate it, the person who can't operate loses, and the person who doesn't can win.
You, a friend of mo3tthi, were asked by mo3tthi in advance if you could decide if you could win this game.
For mo3tthi, make a program to determine if mo3tthi can definitely win this game.
Constraints
The input satisfies the following conditions.
* $ 1 \ leq K \ leq 10 ^ 5 $
* $ 1 \ leq N_i \ leq M_i \ leq 10 ^ {18} $
* All inputs are integers
Input
The input is given in the following format.
$ K $
$ N_1 $ $ M_1 $
$ \ vdots $
$ N_K $ $ M_K $
Output
When mo3tthi acts optimally, "mo3tthi" is output on one line if he can win, and "tubuann" is output otherwise.
Examples
Input
1
2 4
Output
mo3tthi
Input
2
2 3
3 8
Output
tubuann
Input
10
2 8
5 9
7 20
8 41
23 48
90 112
4 5
7 7
2344 8923
1 29
Output
mo3tthi | {"inputs": ["1\n2 5", "1\n2 6", "1\n2 7", "1\n1 6", "1\n4 5", "1\n4 6", "1\n3 5", "1\n2 3"], "outputs": ["mo3tthi\n", "mo3tthi\n", "mo3tthi\n", "tubuann\n", "mo3tthi\n", "tubuann\n", "tubuann\n", "mo3tthi\n"]} | 528 | 123 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given a string s consisting only of characters 'a', 'b', and 'c'. You are asked to apply the following algorithm on the string any number of times:
Pick a non-empty prefix from the string s where all the characters in the prefix are equal.
Pick a non-empty suffix from the string s where all the characters in this suffix are equal.
The prefix and the suffix should not intersect at any index.
The characters from the prefix and suffix must be the same.
Delete both the prefix and the suffix.
Return the minimum length of s after performing the above operation any number of times (possibly zero times).
Please complete the following python code precisely:
```python
class Solution:
def minimumLength(self, s: str) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(s = \"ca\") == 2\n assert candidate(s = \"cabaabac\") == 0\n assert candidate(s = \"aabccabba\") == 3\n\n\ncheck(Solution().minimumLength)"} | 171 | 61 |
coding | Solve the programming task below in a Python markdown code block.
Two little greedy bears have found two pieces of cheese in the forest of weight a and b grams, correspondingly. The bears are so greedy that they are ready to fight for the larger piece. That's where the fox comes in and starts the dialog: "Little bears, wait a little, I want to make your pieces equal" "Come off it fox, how are you going to do that?", the curious bears asked. "It's easy", said the fox. "If the mass of a certain piece is divisible by two, then I can eat exactly a half of the piece. If the mass of a certain piece is divisible by three, then I can eat exactly two-thirds, and if the mass is divisible by five, then I can eat four-fifths. I'll eat a little here and there and make the pieces equal".
The little bears realize that the fox's proposal contains a catch. But at the same time they realize that they can not make the two pieces equal themselves. So they agreed to her proposal, but on one condition: the fox should make the pieces equal as quickly as possible. Find the minimum number of operations the fox needs to make pieces equal.
-----Input-----
The first line contains two space-separated integers a and b (1 ≤ a, b ≤ 10^9).
-----Output-----
If the fox is lying to the little bears and it is impossible to make the pieces equal, print -1. Otherwise, print the required minimum number of operations. If the pieces of the cheese are initially equal, the required number is 0.
-----Examples-----
Input
15 20
Output
3
Input
14 8
Output
-1
Input
6 6
Output
0 | {"inputs": ["6 6\n", "1 1\n", "1 1\n", "1 2\n", "9 6\n", "6 6\n", "14 8\n", "1 22\n"], "outputs": ["0\n", "0\n", "0\n", "1\n", "2\n", "0\n", "-1\n", "-1\n"]} | 371 | 88 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given two positive integers a and b, return the number of common factors of a and b.
An integer x is a common factor of a and b if x divides both a and b.
Please complete the following python code precisely:
```python
class Solution:
def commonFactors(self, a: int, b: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(a = 12, b = 6) == 4\n assert candidate(a = 25, b = 30) == 2\n\n\ncheck(Solution().commonFactors)"} | 89 | 56 |
coding | Solve the programming task below in a Python markdown code block.
You are given an integer sequence of length n+1, a_1,a_2,...,a_{n+1}, which consists of the n integers 1,...,n.
It is known that each of the n integers 1,...,n appears at least once in this sequence.
For each integer k=1,...,n+1, find the number of the different subsequences (not necessarily contiguous) of the given sequence with length k, modulo 10^9+7.
-----Notes-----
- If the contents of two subsequences are the same, they are not separately counted even if they originate from different positions in the original sequence.
- A subsequence of a sequence a with length k is a sequence obtained by selecting k of the elements of a and arranging them without changing their relative order. For example, the sequences 1,3,5 and 1,2,3 are subsequences of 1,2,3,4,5, while 3,1,2 and 1,10,100 are not.
-----Constraints-----
- 1 \leq n \leq 10^5
- 1 \leq a_i \leq n
- Each of the integers 1,...,n appears in the sequence.
- n and a_i are integers.
-----Input-----
Input is given from Standard Input in the following format:
n
a_1 a_2 ... a_{n+1}
-----Output-----
Print n+1 lines.
The k-th line should contain the number of the different subsequences of the given sequence with length k, modulo 10^9+7.
-----Sample Input-----
3
1 2 1 3
-----Sample Output-----
3
5
4
1
There are three subsequences with length 1: 1 and 2 and 3.
There are five subsequences with length 2: 1,1 and 1,2 and 1,3 and 2,1 and 2,3.
There are four subsequences with length 3: 1,1,3 and 1,2,1 and 1,2,3 and 2,1,3.
There is one subsequence with length 4: 1,2,1,3. | {"inputs": ["1\n1 1", "1\n1 1\n", "3\n1 3 1 3", "3\n1 0 0 2", "3\n1 3 2 1", "3\n1 3 1 2", "3\n1 0 1 2", "3\n1 0 1 0"], "outputs": ["1\n1", "1\n1\n", "3\n5\n4\n1\n", "3\n4\n3\n1\n", "3\n6\n4\n1\n", "3\n5\n4\n1\n", "3\n5\n4\n1\n", "3\n5\n4\n1\n"]} | 492 | 158 |
coding | Solve the programming task below in a Python markdown code block.
Chefina is always interested to play with string. But due to exam pressure she has no time to solve a string problem. She wants your help. Can you help her to solve that problem?
You are given a string. You have to find out the $Wonder$ $Sum$ of the string. $Wonder$ $Sum$ of a string is defined as the sum of the value of each character of the string.
The value of each character means:
- If the string is started with "a" , then the value of each character of the string is like "a"=100, "b"=101, "c"="102" ………"z"=125.
- If the string is started with "z" , then the value of each character of the string is like "a"=2600, "b"=2601, "c"="2602" ………"z"=2625.
Since even the $Wonder$ $Sum$ can be large, output $Wonder$ $Sum$ modulo ($10^9 + 7$).
-----Input:-----
- First line will contain $T$, number of testcases. Then the testcases follow.
- Each testcase contains of a single line of input, a string $S$ with lower case alphabet
only.
-----Output:-----
For each testcase, output in a single line integer i.e. $Wonder$ $Sum$ modulo ($10^9 + 7$).
-----Constraints-----
- $1 \leq T \leq 1000$
- $1 \leq |S| \leq 10^5$
-----Sample Input:-----
$2$$cab$
$sdef$
-----Sample Output:-----
$903$
$7630$
-----EXPLANATION:-----
i) For the first test case, since the string is started with "$c$", so output is ($302$+$300$+$301$)=$903$
ii)For the second test case, since the string is started with "$s$", so output is ($1918$+$1903$+$1904$+$1905$)=$7630$ | {"inputs": ["2\ncab\nsdef"], "outputs": ["903\n7630"]} | 503 | 25 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given an integer array nums. In one operation, you can replace any element in nums with any integer.
nums is considered continuous if both of the following conditions are fulfilled:
All elements in nums are unique.
The difference between the maximum element and the minimum element in nums equals nums.length - 1.
For example, nums = [4, 2, 5, 3] is continuous, but nums = [1, 2, 3, 5, 6] is not continuous.
Return the minimum number of operations to make nums continuous.
Please complete the following python code precisely:
```python
class Solution:
def minOperations(self, nums: List[int]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(nums = [4,2,5,3]) == 0\n assert candidate(nums = [1,2,3,5,6]) == 1\n assert candidate(nums = [1,10,100,1000]) == 3\n\n\ncheck(Solution().minOperations)"} | 163 | 81 |
coding | Solve the programming task below in a Python markdown code block.
Chef appeared for a placement test.
There is a problem worth X points. Chef finds out that the problem has exactly 10 test cases. It is known that each test case is worth the same number of points.
Chef passes N test cases among them. Determine the score Chef will get.
NOTE: See sample explanation for more clarity.
------ Input Format ------
- First line will contain T, number of test cases. Then the test cases follow.
- Each test case contains of a single line of input, two integers X and N, the total points for the problem and the number of test cases which pass for Chef's solution.
------ Output Format ------
For each test case, output the points scored by Chef.
------ Constraints ------
$1 ≤ T ≤ 100$
$10 ≤ X ≤ 200$
$0 ≤ N ≤ 10$
$X$ is a multiple of $10$.
----- Sample Input 1 ------
4
10 3
100 10
130 4
70 0
----- Sample Output 1 ------
3
100
52
0
----- explanation 1 ------
Test Case $1$: The problem is worth $10$ points and since there are $10$ test cases, each test case is worth $1$ point. Since Chef passes $3$ test cases, his score will be $1 \cdot 3 = 3$ points.
Test Case $2$: The problem is worth $100$ points and since there are $10$ test cases, each test case is worth $10$ points. Since Chef passes all the $10$ test cases, his score will be $10 \cdot 10 = 100$ points.
Test Case $3$: The problem is worth $130$ points and since there are $10$ test cases, each test case is worth $13$ points. Since Chef passes $4$ test cases, his score will be $13 \cdot 4 = 52$ points.
Test Case $4$: The problem is worth $70$ points and since there are $10$ test cases, each test case is worth $7$ points. Since Chef passes $0$ test cases, his score will be $7 \cdot 0 = 0$ points. | {"inputs": ["4\n10 3\n100 10\n130 4\n70 0\n"], "outputs": ["3\n100\n52\n0\n"]} | 515 | 46 |
coding | Solve the programming task below in a Python markdown code block.
Peter is a person with erratic sleep habits. He goes to sleep at twelve o'lock every midnight. He gets up just after one hour of sleep on some days; he may even sleep for twenty-three hours on other days. His sleeping duration changes in a cycle, where he always sleeps for only one hour on the first day of the cycle.
Unfortunately, he has some job interviews this month. No doubt he wants to be in time for them. He can take anhydrous caffeine to reset his sleeping cycle to the beginning of the cycle anytime. Then he will wake up after one hour of sleep when he takes caffeine. But of course he wants to avoid taking caffeine as possible, since it may affect his health and accordingly his very important job interviews.
Your task is to write a program that reports the minimum amount of caffeine required for Peter to attend all his interviews without being late, where the information about the cycle and the schedule of his interviews are given. The time for move to the place of each interview should be considered negligible.
Input
The input consists of multiple datasets. Each dataset is given in the following format:
T
t1 t2 ... tT
N
D1 M1
D2 M2
...
DN MN
T is the length of the cycle (1 ≤ T ≤ 30); ti (for 1 ≤ i ≤ T ) is the amount of sleep on the i-th day of the cycle, given in hours (1 ≤ ti ≤ 23); N is the number of interviews (1 ≤ N ≤ 100); Dj (for 1 ≤ j ≤ N) is the day of the j-th interview (1 ≤ Dj ≤ 100); Mj (for 1 ≤ j ≤ N) is the hour when the j-th interview starts (1 ≤ Mj ≤ 23).
The numbers in the input are all integers. t1 is always 1 as stated above. The day indicated by 1 is the first day in the cycle of Peter's sleep.
The last dataset is followed by a line containing one zero. This line is not a part of any dataset and should not be processed.
Output
For each dataset, print the minimum number of times Peter needs to take anhydrous caffeine.
Example
Input
2
1 23
3
1 1
2 1
3 1
0
Output
2 | {"inputs": ["2\n0 5\n3\n1 1\n2 1\n3 1\n0", "2\n0 5\n3\n1 1\n2 2\n3 1\n0", "2\n0 1\n3\n1 1\n2 2\n3 1\n0", "2\n0 1\n3\n2 1\n2 2\n3 1\n0", "2\n1 5\n3\n1 1\n2 1\n3 1\n0", "2\n0 5\n3\n1 2\n2 2\n3 1\n0", "2\n0 1\n3\n1 1\n2 0\n3 1\n0", "2\n0 2\n3\n1 1\n2 2\n3 1\n0"], "outputs": ["2\n", "2\n", "0\n", "0\n", "2\n", "2\n", "1\n", "0\n"]} | 508 | 222 |
coding | Solve the programming task below in a Python markdown code block.
— Thanks a lot for today.
— I experienced so many great things.
— You gave me memories like dreams... But I have to leave now...
— One last request, can you...
— Help me solve a Codeforces problem?
— ......
— What?
Chtholly has been thinking about a problem for days:
If a number is palindrome and length of its decimal representation without leading zeros is even, we call it a zcy number. A number is palindrome means when written in decimal representation, it contains no leading zeros and reads the same forwards and backwards. For example 12321 and 1221 are palindromes and 123 and 12451 are not. Moreover, 1221 is zcy number and 12321 is not.
Given integers k and p, calculate the sum of the k smallest zcy numbers and output this sum modulo p.
Unfortunately, Willem isn't good at solving this kind of problems, so he asks you for help!
-----Input-----
The first line contains two integers k and p (1 ≤ k ≤ 10^5, 1 ≤ p ≤ 10^9).
-----Output-----
Output single integer — answer to the problem.
-----Examples-----
Input
2 100
Output
33
Input
5 30
Output
15
-----Note-----
In the first example, the smallest zcy number is 11, and the second smallest zcy number is 22.
In the second example, $(11 + 22 + 33 + 44 + 55) \operatorname{mod} 30 = 15$. | {"inputs": ["1 1\n", "1 1\n", "5 30\n", "7 30\n", "7 26\n", "7 21\n", "7 20\n", "5 30\n"], "outputs": ["0\n", "0\n", "15\n", "8\n", "22\n", "14\n", "8\n", "15\n"]} | 370 | 96 |
coding | Solve the programming task below in a Python markdown code block.
Polycarp invited all his friends to the tea party to celebrate the holiday. He has n cups, one for each of his n friends, with volumes a_1, a_2, ..., a_{n}. His teapot stores w milliliters of tea (w ≤ a_1 + a_2 + ... + a_{n}). Polycarp wants to pour tea in cups in such a way that: Every cup will contain tea for at least half of its volume Every cup will contain integer number of milliliters of tea All the tea from the teapot will be poured into cups All friends will be satisfied.
Friend with cup i won't be satisfied, if there exists such cup j that cup i contains less tea than cup j but a_{i} > a_{j}.
For each cup output how many milliliters of tea should be poured in it. If it's impossible to pour all the tea and satisfy all conditions then output -1.
-----Input-----
The first line contains two integer numbers n and w (1 ≤ n ≤ 100, $1 \leq w \leq \sum_{i = 1}^{n} a_{i}$).
The second line contains n numbers a_1, a_2, ..., a_{n} (1 ≤ a_{i} ≤ 100).
-----Output-----
Output how many milliliters of tea every cup should contain. If there are multiple answers, print any of them.
If it's impossible to pour all the tea and satisfy all conditions then output -1.
-----Examples-----
Input
2 10
8 7
Output
6 4
Input
4 4
1 1 1 1
Output
1 1 1 1
Input
3 10
9 8 10
Output
-1
-----Note-----
In the third example you should pour to the first cup at least 5 milliliters, to the second one at least 4, to the third one at least 5. It sums up to 14, which is greater than 10 milliliters available. | {"inputs": ["1 1\n1\n", "1 1\n2\n", "1 1\n1\n", "1 1\n2\n", "1 2\n2\n", "1 0\n2\n", "1 1\n20\n", "1 1\n38\n"], "outputs": ["1 \n", "1 \n", "1 ", "1 ", "2\n", "-1\n", "-1\n", "-1\n"]} | 464 | 104 |
coding | Solve the programming task below in a Python markdown code block.
# A History Lesson
The Pony Express was a mail service operating in the US in 1859-60.
It reduced the time for messages to travel between the Atlantic and Pacific coasts to about 10 days, before it was made obsolete by the [transcontinental telegraph](https://en.wikipedia.org/wiki/First_transcontinental_telegraph).
# How it worked
There were a number of *stations*, where:
* The rider switched to a fresh horse and carried on, or
* The mail bag was handed over to the next rider
# Kata Task
`stations` is a list/array of distances (miles) from one station to the next along the Pony Express route.
Implement the `riders` method/function, to return how many riders are necessary to get the mail from one end to the other.
**NOTE:** Each rider travels as far as he can, but never more than 100 miles.
---
*Good Luck.
DM.*
---
See also
* The Pony Express
* The Pony Express (missing rider)
Also feel free to reuse/extend the following starter code:
```python
def riders(stations):
``` | {"functional": "_inputs = [[[18, 15]], [[43, 23, 40, 13]], [[33, 8, 16, 47, 30, 30, 46]], [[6, 24, 6, 8, 28, 8, 23, 47, 17, 29, 37, 18, 40, 49]], [[50, 50]], [[50, 50, 25, 50, 24]], [[50, 50, 25, 50, 25]], [[50, 50, 25, 50, 26]], [[90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90, 90]]]\n_outputs = [[1], [2], [3], [4], [1], [2], [2], [3], [100]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(riders(*i), o[0])"} | 251 | 749 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You want to build some obstacle courses. You are given a 0-indexed integer array obstacles of length n, where obstacles[i] describes the height of the ith obstacle.
For every index i between 0 and n - 1 (inclusive), find the length of the longest obstacle course in obstacles such that:
You choose any number of obstacles between 0 and i inclusive.
You must include the ith obstacle in the course.
You must put the chosen obstacles in the same order as they appear in obstacles.
Every obstacle (except the first) is taller than or the same height as the obstacle immediately before it.
Return an array ans of length n, where ans[i] is the length of the longest obstacle course for index i as described above.
Please complete the following python code precisely:
```python
class Solution:
def longestObstacleCourseAtEachPosition(self, obstacles: List[int]) -> List[int]:
``` | {"functional": "def check(candidate):\n assert candidate(obstacles = [1,2,3,2]) == [1,2,3,3]\n assert candidate(obstacles = [2,2,1]) == [1,2,1]\n assert candidate(obstacles = [3,1,5,6,4,2]) == [1,1,2,3,2,2]\n\n\ncheck(Solution().longestObstacleCourseAtEachPosition)"} | 204 | 107 |
coding | Solve the programming task below in a Python markdown code block.
You planned a trip using trains and buses.
The train fare will be A yen (the currency of Japan) if you buy ordinary tickets along the way, and B yen if you buy an unlimited ticket.
Similarly, the bus fare will be C yen if you buy ordinary tickets along the way, and D yen if you buy an unlimited ticket.
Find the minimum total fare when the optimal choices are made for trains and buses.
-----Constraints-----
- 1 \leq A \leq 1 000
- 1 \leq B \leq 1 000
- 1 \leq C \leq 1 000
- 1 \leq D \leq 1 000
- All input values are integers.
-----Input-----
Input is given from Standard Input in the following format:
A
B
C
D
-----Output-----
Print the minimum total fare.
-----Sample Input-----
600
300
220
420
-----Sample Output-----
520
The train fare will be 600 yen if you buy ordinary tickets, and 300 yen if you buy an unlimited ticket.
Thus, the optimal choice for trains is to buy an unlimited ticket for 300 yen.
On the other hand, the optimal choice for buses is to buy ordinary tickets for 220 yen.
Therefore, the minimum total fare is 300 + 220 = 520 yen. | {"inputs": ["555\n1\n8\n4", "555\n2\n6\n6", "555\n3\n6\n6", "555\n9\n6\n6", "555\n2\n28\n4", "555\n0\n28\n4", "555\n1\n11\n0", "555\n1\n11\n1"], "outputs": ["5\n", "8\n", "9\n", "15\n", "6\n", "4\n", "1\n", "2\n"]} | 329 | 131 |
coding | Solve the programming task below in a Python markdown code block.
We have weather records at AtCoder Town for some consecutive three days. A string of length 3, S, represents the records - if the i-th character is S, it means it was sunny on the i-th day; if that character is R, it means it was rainy on that day.
Find the maximum number of consecutive rainy days in this period.
-----Constraints-----
- |S| = 3
- Each character of S is S or R.
-----Input-----
Input is given from Standard Input in the following format:
S
-----Output-----
Print the maximum number of consecutive rainy days in the period.
-----Sample Input-----
RRS
-----Sample Output-----
2
We had rain on the 1-st and 2-nd days in the period. Here, the maximum number of consecutive rainy days is 2, so we should print 2. | {"inputs": ["SRR", "RRR", "RSS", "SSR", "RST", "SRS", "TSR", "USR"], "outputs": ["2\n", "3\n", "1\n", "1\n", "1\n", "1\n", "1\n", "1\n"]} | 189 | 68 |
coding | Solve the programming task below in a Python markdown code block.
You are given a sequence A_1, A_2, ..., A_N and an integer K.
Print the maximum possible length of a sequence B that satisfies the following conditions:
* B is a (not necessarily continuous) subsequence of A.
* For each pair of adjacents elements of B, the absolute difference of the elements is at most K.
Constraints
* 1 \leq N \leq 300,000
* 0 \leq A_i \leq 300,000
* 0 \leq K \leq 300,000
* All values in input are integers.
Input
Input is given from Standard Input in the following format:
N K
A_1
A_2
:
A_N
Output
Print the answer.
Example
Input
10 3
1
5
4
3
8
6
9
7
2
4
Output
7 | {"inputs": ["8 3\n0\n2\n4\n0\n5\n6\n9\n7\n4\n4", "8 3\n1\n5\n2\n3\n6\n6\n9\n8\n4\n1", "10 3\n1\n5\n4\n3\n8\n6\n9\n7\n4\n4", "10 3\n1\n5\n4\n3\n6\n6\n9\n7\n4\n4", "10 3\n0\n1\n4\n3\n6\n6\n9\n7\n4\n4", "10 3\n1\n5\n4\n3\n8\n6\n9\n7\n3\n4", "10 1\n0\n1\n4\n0\n5\n9\n9\n7\n8\n4", "10 3\n1\n5\n2\n0\n6\n6\n9\n8\n4\n1"], "outputs": ["7\n", "7\n", "8\n", "9\n", "10\n", "7\n", "3\n", "5\n"]} | 220 | 245 |
coding | Solve the programming task below in a Python markdown code block.
Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them.
Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club.
For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX".
Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song.
Input
The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word.
Output
Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space.
Examples
Input
WUBWUBABCWUB
Output
ABC
Input
WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB
Output
WE ARE THE CHAMPIONS MY FRIEND
Note
In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya.
In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" — between them Vasya added two "WUB". | {"inputs": ["A\n", "U\n", "B\n", "T\n", "UB\n", "WU\n", "UC\n", "XU\n"], "outputs": ["A\n", "U\n", "B \n", "T \n", "UB\n", "WU\n", "UC \n", "XU \n"]} | 537 | 78 |
coding | Solve the programming task below in a Python markdown code block.
###Task:
You have to write a function `pattern` which creates the following pattern (see examples) up to the desired number of rows.
* If the Argument is 0 or a Negative Integer then it should return "" i.e. empty string.
* If any even number is passed as argument then the pattern should last upto the largest odd number which is smaller than the passed even number.
###Examples:
pattern(9):
1
333
55555
7777777
999999999
pattern(6):
1
333
55555
```Note: There are no spaces in the pattern```
```Hint: Use \n in string to jump to next line```
Also feel free to reuse/extend the following starter code:
```python
def pattern(n):
``` | {"functional": "_inputs = [[4], [1], [5], [0], [-25]]\n_outputs = [['1\\n333'], ['1'], ['1\\n333\\n55555'], [''], ['']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(pattern(*i), o[0])"} | 208 | 193 |
coding | Solve the programming task below in a Python markdown code block.
The executive chef is trying to bring some competitive spirit into his kitchen. He wants to split the chefs into two teams based on their age - he'll form the young and the old team. To make it fair, he will split them evenly or give the young team one person advantage when there is an odd number of chefs. Ages of all employees are unique. The executive chef also rated all chefs according to their cooking skills. Rating of a team is equal to the sum of ratings of its members. The chefs have developed a habit of coming to work late. The executive chef wants to keep the teams as fair as possible at all times and is therefore forced to change the teams each time one of the chefs comes to work in the morning. He needs your help with this task.
------ Input ------
The first line contains the number of chefs N. The following N lines describe the chefs in order as they come to work. Each chef is described by two integers, his or her age A_{i} and rating R_{i}.
------ Output ------
Every time a new chef joins the kitchen, output the absolute difference between team ratings.
------ Constraints ------
$1 ≤ N ≤ 10^{5}$
$1 ≤ A_{i} ≤ 10^{9}$
$1 ≤ R_{i} ≤ 1000$
----- Sample Input 1 ------
5
2 3
1 7
5 5
3 1
8 15
----- Sample Output 1 ------
3
4
5
4
9 | {"inputs": ["5\n2 3\n1 7\n5 5\n3 1\n8 15", "5\n2 3\n1 7\n4 5\n3 1\n8 15", "5\n2 3\n1 7\n4 6\n4 1\n8 15", "5\n1 3\n1 7\n4 6\n4 1\n8 25", "5\n2 3\n1 7\n4 6\n4 1\n3 15", "5\n1 3\n1 7\n0 6\n4 1\n8 15", "5\n1 3\n1 7\n4 9\n4 1\n8 25", "5\n2 1\n2 1\n8 18\n5 1\n2 1"], "outputs": ["3\n4\n5\n4\n9", "3\n4\n5\n4\n9\n", "3\n4\n4\n3\n10\n", "3\n4\n4\n3\n20\n", "3\n4\n4\n3\n18\n", "3\n4\n2\n1\n0\n", "3\n4\n1\n0\n23\n", "1\n0\n16\n17\n16\n"]} | 333 | 300 |
coding | Solve the programming task below in a Python markdown code block.
## Your Job
Find the sum of all multiples of `n` below `m`
## Keep in Mind
* `n` and `m` are natural numbers (positive integers)
* `m` is **excluded** from the multiples
## Examples
Also feel free to reuse/extend the following starter code:
```python
def sum_mul(n, m):
``` | {"functional": "_inputs = [[4, 123], [123, 4567], [2, 10], [2, 2], [7, 7], [7, 2], [21, 3], [0, 2], [2, 0], [4, -7], [-7, 4]]\n_outputs = [[1860], [86469], [20], [0], [0], [0], [0], ['INVALID'], ['INVALID'], ['INVALID'], ['INVALID']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(sum_mul(*i), o[0])"} | 96 | 264 |
coding | Solve the programming task below in a Python markdown code block.
In genetics 2 differents DNAs sequences can code for the same protein.
This is due to the redundancy of the genetic code, in fact 2 different tri-nucleotide can code for the same amino-acid.
For example the tri-nucleotide 'TTT' and the tri-nucleotide 'TTC' both code for the amino-acid 'F'. For more information you can take a look [here](https://en.wikipedia.org/wiki/DNA_codon_table).
Your goal in this kata is to define if two differents DNAs sequences code for exactly the same protein. Your function take the 2 sequences you should compare.
For some kind of simplicity here the sequences will respect the following rules:
- It is a full protein sequence beginning with a Start codon and finishing by an Stop codon
- It will only contain valid tri-nucleotide.
The translation hash is available for you under a translation hash `$codons` [Ruby] or `codons` [Python and JavaScript].
To better understand this kata you can take a look at this [one](https://www.codewars.com/kata/5708ef48fe2d018413000776), it can help you to start.
Also feel free to reuse/extend the following starter code:
```python
def code_for_same_protein(seq1,seq2):
``` | {"functional": "_inputs = [['ATGTCGTCAATTTAA', 'ATGTCGTCAATTTAA'], ['ATGTTTTAA', 'ATGTTCTAA'], ['ATGTTTTAA', 'ATGATATAA'], ['ATGTTTGGGAATAATTAAGGGTAA', 'ATGTTCGGGAATAATGGGAGGTAA']]\n_outputs = [[True], [True], [False], [False]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(code_for_same_protein(*i), o[0])"} | 304 | 240 |
coding | Solve the programming task below in a Python markdown code block.
Currently, XXOC's rap is a string consisting of zeroes, ones, and question marks. Unfortunately, haters gonna hate. They will write $x$ angry comments for every occurrence of subsequence 01 and $y$ angry comments for every occurrence of subsequence 10. You should replace all the question marks with 0 or 1 in such a way that the number of angry comments would be as small as possible.
String $b$ is a subsequence of string $a$, if it can be obtained by removing some characters from $a$. Two occurrences of a subsequence are considered distinct if sets of positions of remaining characters are distinct.
-----Input-----
The first line contains string $s$ — XXOC's rap ($1 \le |s| \leq 10^5$). The second line contains two integers $x$ and $y$ — the number of angry comments XXOC will recieve for every occurrence of 01 and 10 accordingly ($0 \leq x, y \leq 10^6$).
-----Output-----
Output a single integer — the minimum number of angry comments.
-----Examples-----
Input
0?1
2 3
Output
4
Input
?????
13 37
Output
0
Input
?10?
239 7
Output
28
Input
01101001
5 7
Output
96
-----Note-----
In the first example one of the optimum ways to replace is 001. Then there will be $2$ subsequences 01 and $0$ subsequences 10. Total number of angry comments will be equal to $2 \cdot 2 + 0 \cdot 3 = 4$.
In the second example one of the optimum ways to replace is 11111. Then there will be $0$ subsequences 01 and $0$ subsequences 10. Total number of angry comments will be equal to $0 \cdot 13 + 0 \cdot 37 = 0$.
In the third example one of the optimum ways to replace is 1100. Then there will be $0$ subsequences 01 and $4$ subsequences 10. Total number of angry comments will be equal to $0 \cdot 239 + 4 \cdot 7 = 28$.
In the fourth example one of the optimum ways to replace is 01101001. Then there will be $8$ subsequences 01 and $8$ subsequences 10. Total number of angry comments will be equal to $8 \cdot 5 + 8 \cdot 7 = 96$. | {"inputs": ["0?1\n2 3\n", "?10?\n239 7\n", "?01?\n7 239\n", "?????\n13 37\n", "01101001\n5 7\n", "?\n940946 502068\n", "1?\n930967 495068\n", "?0?\n333391 358196\n"], "outputs": ["4\n", "28\n", "28\n", "0\n", "96\n", "0\n", "0\n", "0\n"]} | 597 | 157 |
coding | Solve the programming task below in a Python markdown code block.
As we all know, F.C. Barcelona is the best soccer team of our era! Their entangling and mesmerizing game style usually translates into very high ball possession, consecutive counter-attack plays and goals. Lots of goals, thanks to the natural talent of their attacker and best player in history, Lionel Andres Messi.
However, at the most prestigious tournament of individual teams, the UEFA Champions League, there are no guarantees and believe it or not, Barcelona is in trouble.... They are tied versus Chelsea, which is a very defending team that usually relies on counter-strike to catch opposing teams off guard and we are in the last minute of the match. So Messi decided to settle things down for good and now he is conducting the ball on his teams' midfield and he will start a lethal counter-attack :D
After dribbling the 2 strikers from Chelsea, he now finds himself near the center of the field and he won't be able to dribble the entire team on his own, so he will need to pass the ball to one of his teammates, run forward and receive the ball once again to score the final goal.
Exactly K players are with him on his counter-attack and the coach, Tito Villanova knows that this counter-attack will end in a goal only if after exactly N passes are performed between the players, Messi ends up with the ball.
(Note that the ball only needs to end with Messi after exactly N passes are performed between all the K+1 players, i.e. Messi can receive the ball several times during the N passes. See the 2nd test case explanation for further clarification. )
However, he realized that there are many scenarios possible for this, so he asked you, his assistant coach, to tell him in how many ways can Messi score the important victory goal. So help him!!
-----Input-----
Input will contain a number T denoting the number of test cases.
Then T test cases follow, each one consisting of two space-sparated integers N and K.
-----Output-----
For each test case, output a single integer, the number of ways the winning play might happen modulo 1000000007 (109+7).
-----Constraints-----
- 1 ≤ T ≤ 100
- 2 ≤ N ≤ 1000
- 1 ≤ K ≤ 10
-----Example-----
Input:
2
2 4
4 2
Output:
4
6
-----Explanation-----
In the first test case, say four players with Messi are Xavi, Busquets, Iniesta and Jordi Alba. Then the ways of the winning play to happen when exactly 2 passes are to be performed are:
1) Messi - Xavi - Messi
2) Messi - Busquets - Messi
3) Messi - Iniesta - Messi
4) Messi - Alba - Messi
In the second test case, also say that two players with Messi are Xavi and Iniesta. There are 6 ways for the winning play to happen when exactly 4 passes are performed. All the examples of such winning play are:
1) Messi - Xavi - Messi - Iniesta - Messi
2) Messi - Xavi - Iniesta - Xavi - Messi
3) Messi - Xavi - Messi - Xavi - Messi
4) Messi - Iniesta - Messi - Iniesta - Messi
5) Messi - Iniesta - Messi - Xavi - Messi
6) Messi - Iniesta - Xavi - Iniesta - Messi | {"inputs": ["2\n2 4\n4 2", "2\n3 4\n4 2", "2\n3 4\n4 3", "2\n3 1\n4 2", "2\n3 1\n4 3", "2\n6 1\n4 3", "2\n6 2\n4 3", "2\n6 2\n4 1"], "outputs": ["4\n6", "12\n6\n", "12\n21\n", "0\n6\n", "0\n21\n", "1\n21\n", "22\n21\n", "22\n1\n"]} | 738 | 149 |
coding | Solve the programming task below in a Python markdown code block.
Polycarp and Vasiliy love simple logical games. Today they play a game with infinite chessboard and one pawn for each player. Polycarp and Vasiliy move in turns, Polycarp starts. In each turn Polycarp can move his pawn from cell (x, y) to (x - 1, y) or (x, y - 1). Vasiliy can move his pawn from (x, y) to one of cells: (x - 1, y), (x - 1, y - 1) and (x, y - 1). Both players are also allowed to skip move.
There are some additional restrictions — a player is forbidden to move his pawn to a cell with negative x-coordinate or y-coordinate or to the cell containing opponent's pawn The winner is the first person to reach cell (0, 0).
You are given the starting coordinates of both pawns. Determine who will win if both of them play optimally well.
-----Input-----
The first line contains four integers: x_{p}, y_{p}, x_{v}, y_{v} (0 ≤ x_{p}, y_{p}, x_{v}, y_{v} ≤ 10^5) — Polycarp's and Vasiliy's starting coordinates.
It is guaranteed that in the beginning the pawns are in different cells and none of them is in the cell (0, 0).
-----Output-----
Output the name of the winner: "Polycarp" or "Vasiliy".
-----Examples-----
Input
2 1 2 2
Output
Polycarp
Input
4 7 7 4
Output
Vasiliy
-----Note-----
In the first sample test Polycarp starts in (2, 1) and will move to (1, 1) in the first turn. No matter what his opponent is doing, in the second turn Polycarp can move to (1, 0) and finally to (0, 0) in the third turn. | {"inputs": ["2 1 2 2\n", "4 7 7 4\n", "0 1 0 2\n", "0 1 1 0\n", "0 1 1 1\n", "0 1 1 2\n", "0 1 2 0\n", "0 1 2 1\n"], "outputs": ["Polycarp\n", "Vasiliy\n", "Polycarp\n", "Polycarp\n", "Polycarp\n", "Polycarp\n", "Polycarp\n", "Polycarp\n"]} | 444 | 135 |
coding | Solve the programming task below in a Python markdown code block.
In the 2-D world of Flatland, the Circles were having their sports day and wanted to end it with a nice formation. So, they called upon Mr. Sphere from Spaceland for help. Mr Sphere decides to arrange the Circles in square formations. He starts with $N$ Circles and forms the largest possible square using these Circles. He then takes the remaining Circles and repeats the procedure. A square of side $S$ requires $S^2$ Circles to create.
Find the number of squares he will be able to form at the end of the process.
-----Input:-----
- First line will contain $T$, number of testcases. Then the testcases follow.
- Each testcase contains of a single integer $N$.
-----Output:-----
For each testcase, output a single integer denoting the number of squares.
-----Constraints-----
- $1 \leq T \leq 1000$
- $1 \leq N \leq 1000$
-----Sample Input:-----
2
85
114
-----Sample Output:-----
2
4
-----EXPLANATION:-----
Test case 1 : Mr Sphere forms a square of side 9 using 81 Circles and then forms a square of side 2 using the remaining 4. | {"inputs": ["2\n85\n114"], "outputs": ["2\n4"]} | 289 | 21 |
coding | Solve the programming task below in a Python markdown code block.
Create a function that takes any sentence and redistributes the spaces (and adds additional spaces if needed) so that each word starts with a vowel. The letters should all be in the same order but every vowel in the sentence should be the start of a new word. The first word in the new sentence may start without a vowel. It should return a string in all lowercase with no punctuation (only alphanumeric characters).
EXAMPLES
'It is beautiful weather today!' becomes 'it isb e a ut if ulw e ath ert od ay'
'Coding is great' becomes 'c od ing isgr e at'
'my number is 0208-533-2325' becomes 'myn umb er is02085332325'
Also feel free to reuse/extend the following starter code:
```python
def vowel_start(st):
``` | {"functional": "_inputs = [['It is beautiful weather today!'], ['Coding is great'], ['my number is 0208-533-2325'], ['oranges, apples, melon, pineapple'], ['under_score']]\n_outputs = [['it isb e a ut if ulw e ath ert od ay'], ['c od ing isgr e at'], ['myn umb er is02085332325'], ['or ang es appl esm el onp in e appl e'], ['und ersc or e']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(vowel_start(*i), o[0])"} | 196 | 262 |
coding | Solve the programming task below in a Python markdown code block.
Seven is a hungry number and its favourite food is number 9. Whenever it spots 9
through the hoops of 8, it eats it! Well, not anymore, because you are
going to help the 9 by locating that particular sequence (7,8,9) in an array of digits
and tell 7 to come after 9 instead. Seven "ate" nine, no more!
(If 9 is not in danger, just return the same array)
Also feel free to reuse/extend the following starter code:
```python
def hungry_seven(arr):
``` | {"functional": "_inputs = [[[7, 8, 9]], [[7, 7, 7, 8, 9]], [[8, 7, 8, 9, 8, 9, 7, 8]], [[8, 7, 8, 7, 9, 8]]]\n_outputs = [[[8, 9, 7]], [[8, 9, 7, 7, 7]], [[8, 8, 9, 8, 9, 7, 7, 8]], [[8, 7, 8, 7, 9, 8]]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(hungry_seven(*i), o[0])"} | 134 | 283 |
coding | Solve the programming task below in a Python markdown code block.
You are policeman and you are playing a game with Slavik. The game is turn-based and each turn consists of two phases. During the first phase you make your move and during the second phase Slavik makes his move.
There are $n$ doors, the $i$-th door initially has durability equal to $a_i$.
During your move you can try to break one of the doors. If you choose door $i$ and its current durability is $b_i$ then you reduce its durability to $max(0, b_i - x)$ (the value $x$ is given).
During Slavik's move he tries to repair one of the doors. If he chooses door $i$ and its current durability is $b_i$ then he increases its durability to $b_i + y$ (the value $y$ is given). Slavik cannot repair doors with current durability equal to $0$.
The game lasts $10^{100}$ turns. If some player cannot make his move then he has to skip it.
Your goal is to maximize the number of doors with durability equal to $0$ at the end of the game. You can assume that Slavik wants to minimize the number of such doors. What is the number of such doors in the end if you both play optimally?
-----Input-----
The first line of the input contains three integers $n$, $x$ and $y$ ($1 \le n \le 100$, $1 \le x, y \le 10^5$) — the number of doors, value $x$ and value $y$, respectively.
The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 10^5$), where $a_i$ is the initial durability of the $i$-th door.
-----Output-----
Print one integer — the number of doors with durability equal to $0$ at the end of the game, if you and Slavik both play optimally.
-----Examples-----
Input
6 3 2
2 3 1 3 4 2
Output
6
Input
5 3 3
1 2 4 2 3
Output
2
Input
5 5 6
1 2 6 10 3
Output
2
-----Note-----
Clarifications about the optimal strategy will be ignored. | {"inputs": ["1 1 1\n1\n", "1 2 3\n3\n", "1 2 3\n3\n", "1 1 1\n1\n", "1 2 1\n1\n", "1 1 3\n3\n", "1 2 1\n2\n", "1 3 1\n2\n"], "outputs": ["1\n", "0\n", "0\n", "1\n", "1\n", "0\n", "1\n", "1\n"]} | 535 | 118 |
coding | Solve the programming task below in a Python markdown code block.
Rng is going to a festival.
The name of the festival is given to you as a string S, which ends with `FESTIVAL`, from input. Answer the question: "Rng is going to a festival of what?" Output the answer.
Here, assume that the name of "a festival of s" is a string obtained by appending `FESTIVAL` to the end of s. For example, `CODEFESTIVAL` is a festival of `CODE`.
Constraints
* 9 \leq |S| \leq 50
* S consists of uppercase English letters.
* S ends with `FESTIVAL`.
Input
Input is given from Standard Input in the following format:
S
Output
Print the answer to the question: "Rng is going to a festival of what?"
Examples
Input
CODEFESTIVAL
Output
CODE
Input
CODEFESTIVALFESTIVAL
Output
CODEFESTIVAL
Input
YAKINIKUFESTIVAL
Output
YAKINIKU | {"inputs": ["CODEFESTIVAM", "CPDEFESTIVAM", "BPDEFDSTIVBM", "MBVITSDFEDPB", "MBWITSDFEDPB", "BPCEFDSTIWBM", "CPCEFDSTJWBM", "WPCEFDSTJCAM"], "outputs": ["CODE\n", "CPDE\n", "BPDE\n", "MBVI\n", "MBWI\n", "BPCE\n", "CPCE\n", "WPCE\n"]} | 228 | 108 |
coding | Solve the programming task below in a Python markdown code block.
Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya has a number consisting of n digits without leading zeroes. He represented it as an array of digits without leading zeroes. Let's call it d. The numeration starts with 1, starting from the most significant digit. Petya wants to perform the following operation k times: find the minimum x (1 ≤ x < n) such that dx = 4 and dx + 1 = 7, if x is odd, then to assign dx = dx + 1 = 4, otherwise to assign dx = dx + 1 = 7. Note that if no x was found, then the operation counts as completed and the array doesn't change at all.
You are given the initial number as an array of digits and the number k. Help Petya find the result of completing k operations.
Input
The first line contains two integers n and k (1 ≤ n ≤ 105, 0 ≤ k ≤ 109) — the number of digits in the number and the number of completed operations. The second line contains n digits without spaces representing the array of digits d, starting with d1. It is guaranteed that the first digit of the number does not equal zero.
Output
In the single line print the result without spaces — the number after the k operations are fulfilled.
Examples
Input
7 4
4727447
Output
4427477
Input
4 2
4478
Output
4478
Note
In the first sample the number changes in the following sequence: 4727447 → 4427447 → 4427477 → 4427447 → 4427477.
In the second sample: 4478 → 4778 → 4478. | {"inputs": ["2 0\n47\n", "3 8\n276\n", "3 8\n167\n", "3 8\n278\n", "3 8\n262\n", "3 8\n187\n", "3 8\n155\n", "3 8\n161\n"], "outputs": ["47\n", "276\n", "167\n", "278\n", "262\n", "187\n", "155\n", "161\n"]} | 469 | 132 |
coding | Solve the programming task below in a Python markdown code block.
You are given an array $a$ of length $n$ that has a special condition: every element in this array has at most 7 divisors. Find the length of the shortest non-empty subsequence of this array product of whose elements is a perfect square.
A sequence $a$ is a subsequence of an array $b$ if $a$ can be obtained from $b$ by deletion of several (possibly, zero or all) elements.
-----Input-----
The first line contains an integer $n$ ($1 \le n \le 10^5$) — the length of $a$.
The second line contains $n$ integers $a_1$, $a_2$, $\ldots$, $a_{n}$ ($1 \le a_i \le 10^6$) — the elements of the array $a$.
-----Output-----
Output the length of the shortest non-empty subsequence of $a$ product of whose elements is a perfect square. If there are several shortest subsequences, you can find any of them. If there's no such subsequence, print "-1".
-----Examples-----
Input
3
1 4 6
Output
1
Input
4
2 3 6 6
Output
2
Input
3
6 15 10
Output
3
Input
4
2 3 5 7
Output
-1
-----Note-----
In the first sample, you can choose a subsequence $[1]$.
In the second sample, you can choose a subsequence $[6, 6]$.
In the third sample, you can choose a subsequence $[6, 15, 10]$.
In the fourth sample, there is no such subsequence. | {"inputs": ["1\n1\n", "1\n1\n", "2\n1 1\n", "1\n998\n", "1\n998\n", "2\n1 1\n", "2\n2 1\n", "2\n2 2\n"], "outputs": ["1", "1", "1", "-1", "-1", "1", "1\n", "2\n"]} | 388 | 92 |
coding | Solve the programming task below in a Python markdown code block.
Mahmoud has n line segments, the i-th of them has length a_{i}. Ehab challenged him to use exactly 3 line segments to form a non-degenerate triangle. Mahmoud doesn't accept challenges unless he is sure he can win, so he asked you to tell him if he should accept the challenge. Given the lengths of the line segments, check if he can choose exactly 3 of them to form a non-degenerate triangle.
Mahmoud should use exactly 3 line segments, he can't concatenate two line segments or change any length. A non-degenerate triangle is a triangle with positive area.
-----Input-----
The first line contains single integer n (3 ≤ n ≤ 10^5) — the number of line segments Mahmoud has.
The second line contains n integers a_1, a_2, ..., a_{n} (1 ≤ a_{i} ≤ 10^9) — the lengths of line segments Mahmoud has.
-----Output-----
In the only line print "YES" if he can choose exactly three line segments and form a non-degenerate triangle with them, and "NO" otherwise.
-----Examples-----
Input
5
1 5 3 2 4
Output
YES
Input
3
4 1 2
Output
NO
-----Note-----
For the first example, he can use line segments with lengths 2, 4 and 5 to form a non-degenerate triangle. | {"inputs": ["3\n4 1 2\n", "3\n2 2 3\n", "3\n2 3 4\n", "3\n5 6 7\n", "3\n2 4 5\n", "3\n1 1 1\n", "3\n1 1 1\n", "3\n5 6 7\n"], "outputs": ["NO\n", "YES\n", "YES\n", "YES\n", "YES\n", "YES\n", "YES\n", "YES\n"]} | 314 | 118 |
coding | Solve the programming task below in a Python markdown code block.
*Based on this Numberphile video: https://www.youtube.com/watch?v=Wim9WJeDTHQ*
---
Multiply all the digits of a nonnegative integer `n` by each other, repeating with the product until a single digit is obtained. The number of steps required is known as the **multiplicative persistence**.
Create a function that calculates the individual results of each step, not including the original number, but including the single digit, and outputs the result as a list/array. If the input is a single digit, return an empty list/array.
## Examples
```
per(1) = []
per(10) = [0]
// 1*0 = 0
per(69) = [54, 20, 0]
// 6*9 = 54 --> 5*4 = 20 --> 2*0 = 0
per(277777788888899) = [4996238671872, 438939648, 4478976, 338688, 27648, 2688, 768, 336, 54, 20, 0]
// 2*7*7*7*7*7*7*8*8*8*8*8*8*9*9 = 4996238671872 --> 4*9*9*6*2*3*8*6*7*1*8*7*2 = 4478976 --> ...
```
Also feel free to reuse/extend the following starter code:
```python
def per(n):
``` | {"functional": "_inputs = [[1234567890], [123456789], [12345678], [1234567], [123456], [12345], [2379], [777], [25], [277777788888899], [3778888999]]\n_outputs = [[[0]], [[362880, 0]], [[40320, 0]], [[5040, 0]], [[720, 0]], [[120, 0]], [[378, 168, 48, 32, 6]], [[343, 36, 18, 8]], [[10, 0]], [[4996238671872, 438939648, 4478976, 338688, 27648, 2688, 768, 336, 54, 20, 0]], [[438939648, 4478976, 338688, 27648, 2688, 768, 336, 54, 20, 0]]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(per(*i), o[0])"} | 404 | 480 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given an integer num. You can swap two digits at most once to get the maximum valued number.
Return the maximum valued number you can get.
Please complete the following python code precisely:
```python
class Solution:
def maximumSwap(self, num: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(num = 2736) == 7236\n assert candidate(num = 9973) == 9973\n\n\ncheck(Solution().maximumSwap)"} | 78 | 55 |
coding | Solve the programming task below in a Python markdown code block.
Given is a string S of length N consisting of lowercase English letters.
Snuke can do this operation any number of times: remove fox occurring as a substring from s and concatenate the remaining parts of s.
What is the minimum possible length of s after some number of operations by Snuke?
-----Constraints-----
- 1 \leq N \leq 2 \times 10^{5}
- s is a string of length N consisting of lowercase English letters.
-----Input-----
Input is given from Standard Input in the following format:
N
s
-----Print-----
Print the minimum possible length of s after some number of operations by Snuke.
-----Sample Input-----
6
icefox
-----Sample Output-----
3
- By removing the fox at the end of icefox, we can turn s into ice. | {"inputs": ["1\nf\n", "3\nfox\n", "6\nicefox\n", "7\nfirebox\n", "48\nffoxoxuvgjyzmehmopfohrupffoxoxfofofoxffoxoxejffo\n", "2365\nooofxfxxffxxxoffofffoxoxfoffxxooxooxoofxfooxxooxofooofxoxfxofxffoxxfxofffofxffxfofofooxofxoxffxofxfoxxxxooffoxfxxoxxxfffxoffoxoffofofffoofxoofxffoofxxoxxfoxfxfofxxxoxooxxoffxxfoxooxoxoxxffffxfooxooxfxxxfxoxxfxofxfofxxfxxfoxfoxffooxoxoxxxfoffooxofoxooxfxfffoffofoxfxfxfooxfoxoffffooofofoxxffoxoofoffxxxxoxooxfxffxffxoofffffoffxfoofffffoofoffoofxxoooxxxooxooxxxooofffxfofxxoffxfofofxxxoooxxxoxxfxoxxfofoxxxffxxoofxfxxxfoofxfxxoxfofxfffxfoxooxfxfxffooxxoxoxfoxfooxxxoffxxfofofffooffxfoxofffxfxofoooofxfooxoxfxxofoooffffxxoffofxooxxfooffofxxxoxxfxofffxxooffxxfoffxxffoffxfxoofofffxxffoxfoxffoxfxoxxfoofxoxxxffofoofooxfooxxxxfxoxxfoxofxfoxoxxffxoooofofxofffxfxxoxxoffoooxffoofoxoxxooxxxxoofxfooxooooxoxxooofxxfxoxfoxfxoffoxfxfffxoofffxxooxxfoffxfoffoooofxffxxxoffooxxxxxoofofoxfoxoxfoxffoooxfffooofxxfofxffxoxfofxooxfffxxofofofoxoxofxoffoxxfxfoxoxoxoxffxxofxxffxffofxxffoxoxfoxfxoofoxxxfxooooxoooffoxofffxfxxfofooffofffffxxxxooxfoxfoffffooooxxxooxxxfofxffxxoffxoxxxxfxfoxooooffxfxxoxfxofoxoffxxxoxxoofoofofoooooxoxxofooxoxfooxooffoofooooxxoxffffxxoxfxfxxfxfxfxoxxxxfoffxofxoofxffxoffoofxfxffoxfoxxooxoxxxfofoxffxffxfxofffxxxoffoffxxxffxxoxffxofffffoooxxofooxoxxofooffoxoofxofoofoofxxxffooxxxoofxxoofxxfooooffoxofxffoxofofoxooxxofofxfxxooooxoofxxxxoofofxxoxxfxfooffoxfoxoffofxofoofxxxxfxofofxfofffoffxxofoofxxxfxooooxxofffoffooxooxffxxooxoxffofxffxfxxxffoffoofofoofffffffxoofxofxoffofxfxoxoxoxfxoxxfxoxoxxxfxooooooofofofoxfofoxooofxxffofoxfffxxxfoxfxxfoffxoxxxofffxfoxfxfxxfxfffxxfxxxfooooxoofxfxooxffffxoxxoxxofofxofxoxxofoxffxxffofxxxoxoooxofofooxoxxfooxooxxoooofofxxfxofxoxoofxoooooooffxoxoxoofxfoxxffofoxxfofxfooxffxfxfxfxxxfoxoxfoffxfxfxfoooxoxxxffofxxooxxoofoxoxoofxoxxxxffffxoffxfxfffoxfofxoxxfooofoxfooxoffoofxfoxoxooooofofxoooffoooofxofoxxxxfooxfofooofooofofxxffxfxfffxxffoxofooxfffoofoxoooofoxoofffffffoxoxfxxooffoxxxofofxoxfoxfxffoffxoxfooxxxxfxooxoxfxofoxxxofxxxxxxfxxoffxfxffofxxooofffxfffoxoxxooooofxfffoxxxoooooffxxofoffooxofxxfxfoooxfxxffxofoxfoffoffxfoofxfffofofofxfxffxxxxfxofxxxoxxoofofxffooofxffoxfooffxfooxofofxofffoxoooxoxxooxfxxofxxxfffxfffxxxxfofoxffofxoxxoxfxoxxoxxfxxfoxfoooxxoxooxfoofffofxxfofxxfoxxfoxfxxooxffoxxxooxfffxxxoffxfxffofooxffxxoxxfxooooxoxfxfxoxxfxfoooxofxxoxfoxfooxfffofxoffxxfxooxxfoxffoxoxoxoxxofoxxxxofoxffxooxfofxfofxxfxxoxfoffooxxffofofxxxxxxoxoxoffffxfffofofxfxxxffoooxxooxfooxxxxoxooxoffxofxxxofffofxfofxfxofoxoxxoxoofxoooo\n"], "outputs": ["1\n", "0\n", "3\n", "7\n", "27\n", "2086\n"]} | 182 | 1,225 |
coding | Solve the programming task below in a Python markdown code block.
Hooray! Berl II, the king of Berland is making a knight tournament. The king has already sent the message to all knights in the kingdom and they in turn agreed to participate in this grand event.
As for you, you're just a simple peasant. There's no surprise that you slept in this morning and were late for the tournament (it was a weekend, after all). Now you are really curious about the results of the tournament. This time the tournament in Berland went as follows:
* There are n knights participating in the tournament. Each knight was assigned his unique number — an integer from 1 to n.
* The tournament consisted of m fights, in the i-th fight the knights that were still in the game with numbers at least li and at most ri have fought for the right to continue taking part in the tournament.
* After the i-th fight among all participants of the fight only one knight won — the knight number xi, he continued participating in the tournament. Other knights left the tournament.
* The winner of the last (the m-th) fight (the knight number xm) became the winner of the tournament.
You fished out all the information about the fights from your friends. Now for each knight you want to know the name of the knight he was conquered by. We think that the knight number b was conquered by the knight number a, if there was a fight with both of these knights present and the winner was the knight number a.
Write the code that calculates for each knight, the name of the knight that beat him.
Input
The first line contains two integers n, m (2 ≤ n ≤ 3·105; 1 ≤ m ≤ 3·105) — the number of knights and the number of fights. Each of the following m lines contains three integers li, ri, xi (1 ≤ li < ri ≤ n; li ≤ xi ≤ ri) — the description of the i-th fight.
It is guaranteed that the input is correct and matches the problem statement. It is guaranteed that at least two knights took part in each battle.
Output
Print n integers. If the i-th knight lost, then the i-th number should equal the number of the knight that beat the knight number i. If the i-th knight is the winner, then the i-th number must equal 0.
Examples
Input
4 3
1 2 1
1 3 3
1 4 4
Output
3 1 4 0
Input
8 4
3 5 4
3 7 6
2 8 8
1 8 1
Output
0 8 4 6 4 8 6 1
Note
Consider the first test case. Knights 1 and 2 fought the first fight and knight 1 won. Knights 1 and 3 fought the second fight and knight 3 won. The last fight was between knights 3 and 4, knight 4 won. | {"inputs": ["3 1\n1 3 2\n", "3 1\n1 3 1\n", "3 1\n1 3 3\n", "2 1\n1 2 1\n", "2 1\n1 2 2\n", "3 2\n1 2 2\n1 3 2\n", "3 2\n1 2 1\n1 3 3\n", "3 2\n2 3 3\n1 3 3\n"], "outputs": ["2 0 2 \n", "0 1 1 \n", "3 3 0 \n", "0 1 \n", "2 0 \n", "2 0 2 \n", "3 1 0 \n", "3 3 0 \n"]} | 642 | 188 |
coding | Solve the programming task below in a Python markdown code block.
Monocarp and Bicarp live in Berland, where every bus ticket consists of $n$ digits ($n$ is an even number). During the evening walk Monocarp and Bicarp found a ticket where some of the digits have been erased. The number of digits that have been erased is even.
Monocarp and Bicarp have decided to play a game with this ticket. Monocarp hates happy tickets, while Bicarp collects them. A ticket is considered happy if the sum of the first $\frac{n}{2}$ digits of this ticket is equal to the sum of the last $\frac{n}{2}$ digits.
Monocarp and Bicarp take turns (and Monocarp performs the first of them). During each turn, the current player must replace any erased digit with any digit from $0$ to $9$. The game ends when there are no erased digits in the ticket.
If the ticket is happy after all erased digits are replaced with decimal digits, then Bicarp wins. Otherwise, Monocarp wins. You have to determine who will win if both players play optimally.
-----Input-----
The first line contains one even integer $n$ $(2 \le n \le 2 \cdot 10^{5})$ — the number of digits in the ticket.
The second line contains a string of $n$ digits and "?" characters — the ticket which Monocarp and Bicarp have found. If the $i$-th character is "?", then the $i$-th digit is erased. Note that there may be leading zeroes. The number of "?" characters is even.
-----Output-----
If Monocarp wins, print "Monocarp" (without quotes). Otherwise print "Bicarp" (without quotes).
-----Examples-----
Input
4
0523
Output
Bicarp
Input
2
??
Output
Bicarp
Input
8
?054??0?
Output
Bicarp
Input
6
???00?
Output
Monocarp
-----Note-----
Since there is no question mark in the ticket in the first example, the winner is determined before the game even starts, and it is Bicarp.
In the second example, Bicarp also wins. After Monocarp chooses an erased digit and replaces it with a new one, Bicap can choose another position with an erased digit and replace it with the same digit, so the ticket is happy. | {"inputs": ["2\n??\n", "2\n??\n", "4\n0523\n", "4\n1928\n", "4\n00??\n", "4\n50??\n", "4\n99??\n", "4\n??99\n"], "outputs": ["Bicarp\n", "Bicarp\n", "Bicarp\n", "Bicarp\n", "Monocarp\n", "Monocarp\n", "Monocarp\n", "Monocarp\n"]} | 524 | 121 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given a 0-indexed integer array nums. You are allowed to permute nums into a new array perm of your choosing.
We define the greatness of nums be the number of indices 0 <= i < nums.length for which perm[i] > nums[i].
Return the maximum possible greatness you can achieve after permuting nums.
Please complete the following python code precisely:
```python
class Solution:
def maximizeGreatness(self, nums: List[int]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(nums = [1,3,5,2,1,3,1]) == 4\n assert candidate(nums = [1,2,3,4]) == 3\n\n\ncheck(Solution().maximizeGreatness)"} | 118 | 63 |
coding | Solve the programming task below in a Python markdown code block.
You are given an integer $N$ followed by $N$ email addresses. Your task is to print a list containing only valid email addresses in lexicographical order.
Valid email addresses must follow these rules:
It must have the username@websitename.extension format type.
The username can only contain letters, digits, dashes and underscores $[a-z],[A-Z],[0-9],[\text{_}-]$.
The website name can only have letters and digits $[a-z],[A-Z],[0-9]$.
The extension can only contain letters $[a-z],[A-Z]$.
The maximum length of the extension is $3$.
Concept
A filter takes a function returning True or False and applies it to a sequence, returning a list of only those members of the sequence where the function returned True. A Lambda function can be used with filters.
Let's say you have to make a list of the squares of integers from $\mbox{0}$ to $\mbox{9}$ (both included).
>> l = list(range(10))
>> l = list(map(lambda x:x*x, l))
Now, you only require those elements that are greater than $10$ but less than $80$.
>> l = list(filter(lambda x: x > 10 and x < 80, l))
Easy, isn't it?
Example
Complete the function fun in the editor below.
fun has the following paramters:
string s: the string to test
Returns
boolean: whether the string is a valid email or not
Input Format
The first line of input is the integer $N$, the number of email addresses.
$N$ lines follow, each containing a string.
Constraints
Each line is a non-empty string.
Sample Input
3
lara@hackerrank.com
brian-23@hackerrank.com
britts_54@hackerrank.com
Sample Output
['brian-23@hackerrank.com', 'britts_54@hackerrank.com', 'lara@hackerrank.com'] | {"inputs": ["3\nlara@hackerrank.com\nbrian-23@hackerrank.com\nbritts_54@hackerrank.com\n"], "outputs": ["['brian-23@hackerrank.com', 'britts_54@hackerrank.com', 'lara@hackerrank.com']\n"]} | 451 | 77 |
coding | Solve the programming task below in a Python markdown code block.
DJ Boy is a new generation child he has never seen numeric keypad of mobile. So one day when Prem showed him his mobile, DJ boy started laughing on him. Prem being smart gave him a problem to solve with some condition. Your task is to help DJ boy to solve this problem:
Given a number N, DJ boy has to tell how many numbers of length N are possible.
Conditions:
1)He can only press digit that are adjacent i.e. to the left, right, up or bottom to current digit.
2)He may press the same key again i.e. numbers like 000 & 080 are possible for length 3.
3)He cannot press * and # keys.
Constraints:
1 ≤ t ≤ 100
0 ≤ N ≤ 10000
MOD: 10^9 + 9
Input:
First line contains T,the number of test cases.
Next t lines contain a number N.
Output:
Print the required number modulo MOD.
SAMPLE INPUT
2
1
2
SAMPLE OUTPUT
10
36 | {"inputs": ["100\n0\n1\n10000\n2\n3\n10\n8973\n6202\n4625\n5469\n2038\n5916\n3405\n5533\n7004\n2469\n9853\n4992\n361\n9819\n3294\n7195\n4036\n9404\n8767\n5404\n1711\n3214\n3100\n3751\n2139\n5437\n4993\n1759\n9572\n6270\n3789\n9623\n2472\n9493\n6170\n5589\n5408\n9576\n2200\n2411\n3123\n2052\n8482\n3484\n2949\n2855\n1758\n6985\n3337\n524\n3468\n5048\n4818\n6568\n8800\n6957\n3083\n4871\n8716\n3733\n1140\n2504\n3356\n3612\n3076\n604\n279\n8484\n1258\n2479\n1974\n5461\n5610\n455\n8945\n8560\n4389\n1781\n6623\n7727\n3385\n1169\n2774\n8203\n7737\n2652\n6238\n820\n7523\n4953\n4553\n8664\n8536\n8988"], "outputs": ["0\n10\n68035405\n36\n138\n1806282\n799804923\n614417274\n488239572\n736488742\n760757087\n599480893\n589709762\n231163758\n23665099\n769123789\n71398755\n120410212\n92450581\n636305854\n780163537\n753406317\n172894851\n602024898\n811389696\n575085933\n353026054\n69307997\n167259556\n905823610\n237945781\n13571345\n185417905\n606929918\n51071759\n544895473\n242296457\n209498771\n879065993\n844859129\n284173183\n787418802\n792982558\n905973874\n138508161\n712808637\n976561149\n66883904\n213247879\n870017062\n299913859\n314122788\n750456647\n383485878\n183320425\n706312346\n525018013\n633533672\n948221219\n178589900\n581589386\n545509751\n398910183\n227478076\n444766090\n772760475\n943743896\n489934438\n142480147\n980888325\n699446347\n417584802\n360665918\n398010958\n604293860\n305358736\n182708964\n158413967\n758072494\n115920170\n53871862\n753576819\n705191169\n603490951\n518991133\n377631676\n268111018\n900057226\n37348617\n776531938\n384963580\n507358970\n279398728\n525281633\n368927902\n613485196\n779310462\n57324162\n129262880\n165697266"]} | 237 | 1,452 |
coding | Solve the programming task below in a Python markdown code block.
Chef would like go shopping to buy ingredients for his special dish. The local grocery store has some special discount offers. If you want to buy some set of ingredients you will pay for all ingredients except the cheapest one. Chef would like to spend as little money as possible. You have to help him. :)
The store is pretty small and stocks only one unit of each ingredients. Opposite each ingredient is a hanging price tag corresponding to it. The salesman walked away for a minute, giving Chef an opportunity to swap some price tags. He would like to swap some tags to minimize his purchase cost.
-----Input-----
The first line of the input contains an integer T denoting the number of test cases. The description of T test cases follows.
The first line of each test case contains a single integer N denoting the number of ingredients Chef needs to buy. The second line contains N space-separated integers A1, A2, ... , AN denoting the value written on the price tags opposite the needed ingredients. The third line contains a single integer M denoting the number of special offers. The following M lines lists inventory of special offers, one offer per line. Each line contains an integer Ci followed by Ci integers denoting the indices of ingredients constituting the ith discount offer.
-----Output-----
For each test case, output a single line containing the minimal purchase cost.
-----Constraints-----
- T ≤ 5
- 1 ≤ N ≤ 15
- 1 ≤ Ai ≤ 106
- 0 ≤ M ≤ 2N-1
- 2 ≤ Ci ≤ N
- Subtask 1 (15 points): 1 ≤ N ≤ 5
- Subtask 2 (25 points): 1 ≤ N ≤ 10
- Subtask 3 (60 points): 1 ≤ N ≤ 15
-----Example-----
Input:
1
4
1 2 3 4
3
2 1 2
2 3 4
3 1 2 3
Output:
6 | {"inputs": ["1\n4\n1 2 3 4\n3\n2 1 2\n2 3 4\n3 1 2 3"], "outputs": ["6"]} | 441 | 44 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
There are numBottles water bottles that are initially full of water. You can exchange numExchange empty water bottles from the market with one full water bottle.
The operation of drinking a full water bottle turns it into an empty bottle.
Given the two integers numBottles and numExchange, return the maximum number of water bottles you can drink.
Please complete the following python code precisely:
```python
class Solution:
def numWaterBottles(self, numBottles: int, numExchange: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(numBottles = 9, numExchange = 3) == 13\n assert candidate(numBottles = 15, numExchange = 4) == 19\n\n\ncheck(Solution().numWaterBottles)"} | 128 | 67 |
coding | Solve the programming task below in a Python markdown code block.
We have A cards, each of which has an integer 1 written on it. Similarly, we also have B cards with 0s and C cards with -1s.
We will pick up K among these cards. What is the maximum possible sum of the numbers written on the cards chosen?
-----Constraints-----
- All values in input are integers.
- 0 \leq A, B, C
- 1 \leq K \leq A + B + C \leq 2 \times 10^9
-----Input-----
Input is given from Standard Input in the following format:
A B C K
-----Output-----
Print the maximum possible sum of the numbers written on the cards chosen.
-----Sample Input-----
2 1 1 3
-----Sample Output-----
2
Consider picking up two cards with 1s and one card with a 0.
In this case, the sum of the numbers written on the cards is 2, which is the maximum possible value. | {"inputs": ["1 2 5 4", "2 0 1 3", "0 3 8 6", "0 3 8 5", "2 2 3 4", "4 2 0 4", "4 3 4 3", "6 1 1 7"], "outputs": ["0\n", "1\n", "-3\n", "-2\n", "2\n", "4\n", "3\n", "6\n"]} | 219 | 110 |
coding | Solve the programming task below in a Python markdown code block.
The $\text{$gcdSum$}$ of a positive integer is the $gcd$ of that integer with its sum of digits. Formally, $\text{$gcdSum$}(x) = gcd(x, \text{ sum of digits of } x)$ for a positive integer $x$. $gcd(a, b)$ denotes the greatest common divisor of $a$ and $b$ — the largest integer $d$ such that both integers $a$ and $b$ are divisible by $d$.
For example: $\text{$gcdSum$}(762) = gcd(762, 7 + 6 + 2)=gcd(762,15) = 3$.
Given an integer $n$, find the smallest integer $x \ge n$ such that $\text{$gcdSum$}(x) > 1$.
-----Input-----
The first line of input contains one integer $t$ $(1 \le t \le 10^4)$ — the number of test cases.
Then $t$ lines follow, each containing a single integer $n$ $(1 \le n \le 10^{18})$.
All test cases in one test are different.
-----Output-----
Output $t$ lines, where the $i$-th line is a single integer containing the answer to the $i$-th test case.
-----Examples-----
Input
3
11
31
75
Output
12
33
75
-----Note-----
Let us explain the three test cases in the sample.
Test case 1: $n = 11$:
$\text{$gcdSum$}(11) = gcd(11, 1 + 1) = gcd(11,\ 2) = 1$.
$\text{$gcdSum$}(12) = gcd(12, 1 + 2) = gcd(12,\ 3) = 3$.
So the smallest number $\ge 11$ whose $gcdSum$ $> 1$ is $12$.
Test case 2: $n = 31$:
$\text{$gcdSum$}(31) = gcd(31, 3 + 1) = gcd(31,\ 4) = 1$.
$\text{$gcdSum$}(32) = gcd(32, 3 + 2) = gcd(32,\ 5) = 1$.
$\text{$gcdSum$}(33) = gcd(33, 3 + 3) = gcd(33,\ 6) = 3$.
So the smallest number $\ge 31$ whose $gcdSum$ $> 1$ is $33$.
Test case 3: $\ n = 75$:
$\text{$gcdSum$}(75) = gcd(75, 7 + 5) = gcd(75,\ 12) = 3$.
The $\text{$gcdSum$}$ of $75$ is already $> 1$. Hence, it is the answer. | {"inputs": ["3\n6\n5\n4\n", "3\n6\n6\n4\n", "3\n6\n6\n6\n", "3\n6\n3\n6\n", "3\n6\n3\n8\n", "3\n6\n4\n8\n", "3\n4\n4\n75\n", "3\n4\n6\n75\n"], "outputs": ["6\n5\n4\n", "6\n6\n4\n", "6\n6\n6\n", "6\n3\n6\n", "6\n3\n8\n", "6\n4\n8\n", "4\n4\n75\n", "4\n6\n75\n"]} | 676 | 154 |
coding | Solve the programming task below in a Python markdown code block.
The purpose of this kata is to work out just how many bottles of duty free whiskey you would have to buy such that the saving over the normal high street price would effectively cover the cost of your holiday.
You will be given the high street price (normPrice), the duty free discount (discount) and the cost of the holiday.
For example, if a bottle cost £10 normally and the discount in duty free was 10%, you would save £1 per bottle. If your holiday cost £500, the answer you should return would be 500.
All inputs will be integers. Please return an integer. Round down.
Also feel free to reuse/extend the following starter code:
```python
def duty_free(price, discount, holiday_cost):
``` | {"functional": "_inputs = [[12, 50, 1000], [17, 10, 500], [24, 35, 3000], [1400, 35, 10000], [700, 26, 7000]]\n_outputs = [[166], [294], [357], [20], [38]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(duty_free(*i), o[0])"} | 173 | 245 |
coding | Solve the programming task below in a Python markdown code block.
You're given two arrays $a[1 \dots n]$ and $b[1 \dots n]$, both of the same length $n$.
In order to perform a push operation, you have to choose three integers $l, r, k$ satisfying $1 \le l \le r \le n$ and $k > 0$. Then, you will add $k$ to elements $a_l, a_{l+1}, \ldots, a_r$.
For example, if $a = [3, 7, 1, 4, 1, 2]$ and you choose $(l = 3, r = 5, k = 2)$, the array $a$ will become $[3, 7, \underline{3, 6, 3}, 2]$.
You can do this operation at most once. Can you make array $a$ equal to array $b$?
(We consider that $a = b$ if and only if, for every $1 \le i \le n$, $a_i = b_i$)
-----Input-----
The first line contains a single integer $t$ ($1 \le t \le 20$) — the number of test cases in the input.
The first line of each test case contains a single integer $n$ ($1 \le n \le 100\ 000$) — the number of elements in each array.
The second line of each test case contains $n$ integers $a_1, a_2, \ldots, a_n$ ($1 \le a_i \le 1000$).
The third line of each test case contains $n$ integers $b_1, b_2, \ldots, b_n$ ($1 \le b_i \le 1000$).
It is guaranteed that the sum of $n$ over all test cases doesn't exceed $10^5$.
-----Output-----
For each test case, output one line containing "YES" if it's possible to make arrays $a$ and $b$ equal by performing at most once the described operation or "NO" if it's impossible.
You can print each letter in any case (upper or lower).
-----Example-----
Input
4
6
3 7 1 4 1 2
3 7 3 6 3 2
5
1 1 1 1 1
1 2 1 3 1
2
42 42
42 42
1
7
6
Output
YES
NO
YES
NO
-----Note-----
The first test case is described in the statement: we can perform a push operation with parameters $(l=3, r=5, k=2)$ to make $a$ equal to $b$.
In the second test case, we would need at least two operations to make $a$ equal to $b$.
In the third test case, arrays $a$ and $b$ are already equal.
In the fourth test case, it's impossible to make $a$ equal to $b$, because the integer $k$ has to be positive. | {"inputs": ["2\n1\n2\n1\n1\n1\n1\n", "2\n1\n2\n1\n1\n1\n1\n", "2\n1\n1\n1\n1\n1\n1\n", "2\n1\n2\n2\n1\n1\n1\n", "2\n1\n1\n1\n1\n0\n1\n", "2\n1\n2\n2\n1\n0\n1\n", "1\n3\n1 1 1\n1 1 3\n", "1\n3\n2 5 2\n2 3 2\n"], "outputs": ["NO\nYES\n", "NO\nYES\n", "YES\nYES\n", "YES\nYES\n", "YES\nYES\n", "YES\nYES\n", "YES\n", "NO\n"]} | 692 | 182 |
coding | Solve the programming task below in a Python markdown code block.
Vasya learns to type. He has an unusual keyboard at his disposal: it is rectangular and it has n rows of keys containing m keys in each row. Besides, the keys are of two types. Some of the keys have lowercase Latin letters on them and some of the keys work like the "Shift" key on standard keyboards, that is, they make lowercase letters uppercase.
Vasya can press one or two keys with one hand. However, he can only press two keys if the Euclidean distance between the centers of the keys does not exceed x. The keys are considered as squares with a side equal to 1. There are no empty spaces between neighbouring keys.
Vasya is a very lazy boy, that's why he tries to type with one hand as he eats chips with his other one. However, it is possible that some symbol can't be typed with one hand only, because the distance between it and the closest "Shift" key is strictly larger than x. In this case he will have to use his other hand. Having typed the symbol, Vasya returns other hand back to the chips.
You are given Vasya's keyboard and the text. Count the minimum number of times Vasya will have to use the other hand.
Input
The first line contains three integers n, m, x (1 ≤ n, m ≤ 30, 1 ≤ x ≤ 50).
Next n lines contain descriptions of all the keyboard keys. Each line contains the descriptions of exactly m keys, without spaces. The letter keys are marked with the corresponding lowercase letters. The "Shift" keys are marked with the "S" symbol.
Then follow the length of the text q (1 ≤ q ≤ 5·105). The last line contains the text T, which consists of q symbols, which are uppercase and lowercase Latin letters.
Output
If Vasya can type the text, then print the minimum number of times he will have to use his other hand. Otherwise, print "-1" (without the quotes).
Examples
Input
2 2 1
ab
cd
1
A
Output
-1
Input
2 2 1
ab
cd
1
e
Output
-1
Input
2 2 1
ab
cS
5
abcBA
Output
1
Input
3 9 4
qwertyuio
asdfghjkl
SzxcvbnmS
35
TheQuIcKbRoWnFOXjummsovertHeLazYDOG
Output
2
Note
In the first sample the symbol "A" is impossible to print as there's no "Shift" key on the keyboard.
In the second sample the symbol "e" is impossible to print as there's no such key on the keyboard.
In the fourth sample the symbols "T", "G" are impossible to print with one hand. The other letters that are on the keyboard can be printed. Those symbols come up in the text twice, thus, the answer is 2. | {"inputs": ["1 1 50\nS\n1\nS\n", "1 1 65\nS\n1\nS\n", "2 2 1\nab\ndc\n1\ne\n", "2 2 1\nba\ndc\n1\ne\n", "2 2 1\nba\ncc\n1\ne\n", "2 2 1\nab\ncd\n1\ne\n", "2 2 1\nab\ncd\n1\nA\n", "2 1 2\nS\nc\n4\nCSSA\n"], "outputs": ["-1", "-1\n", "-1\n", "-1\n", "-1\n", "-1", "-1", "-1"]} | 650 | 166 |
coding | Solve the programming task below in a Python markdown code block.
Chef is given a binary string S of length N.
In one operation, Chef has to choose exactly K indices and flip their values.
Chef can perform the above operation any number of times. Find the number of distinct binary strings Chef can obtain.
Since the answer might be large, output it module 10^{9} + 7.
------ Input Format ------
- The first line of input will contain a single integer T, denoting the number of test cases.
- Each test case consists of multiple lines of input.
- The first line of each test case contains two space-separated integers N and K, as mentioned in statement.
- The next line contains the binary string S.
------ Output Format ------
For each test case, output the number of distinct binary strings Chef can obtain, modulo 10^{9} + 7.
------ Constraints ------
$1 ≤ T ≤ 10^{4}$
$1 ≤ N ≤ 10^{5}$
$1 ≤ K ≤ N$
- Sum of $N$ over all test cases do not exceed $3 \cdot 10^{5}$.
----- Sample Input 1 ------
2
4 1
0010
2 2
00
----- Sample Output 1 ------
16
2
----- explanation 1 ------
Test case $1$: We can flip $1$ index in an operation. Thus, we can generate all possible binary strings of length $4$. The total number of distinct strings that can be generated are $2^{4} = 16$.
Test case $2$: We have to flip $2$ indices at once. Thus, we can convert $00$ to $11$. The only possible strings that can be generated are $00$ and $11$. Thus, the answer is $2$. | {"inputs": ["2\n4 1\n0010\n2 2\n00\n"], "outputs": ["16\n2\n"]} | 393 | 33 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
The school cafeteria offers circular and square sandwiches at lunch break, referred to by numbers 0 and 1 respectively. All students stand in a queue. Each student either prefers square or circular sandwiches.
The number of sandwiches in the cafeteria is equal to the number of students. The sandwiches are placed in a stack. At each step:
If the student at the front of the queue prefers the sandwich on the top of the stack, they will take it and leave the queue.
Otherwise, they will leave it and go to the queue's end.
This continues until none of the queue students want to take the top sandwich and are thus unable to eat.
You are given two integer arrays students and sandwiches where sandwiches[i] is the type of the ith sandwich in the stack (i = 0 is the top of the stack) and students[j] is the preference of the jth student in the initial queue (j = 0 is the front of the queue). Return the number of students that are unable to eat.
Please complete the following python code precisely:
```python
class Solution:
def countStudents(self, students: List[int], sandwiches: List[int]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(students = [1,1,0,0], sandwiches = [0,1,0,1]) == 0 \n assert candidate(students = [1,1,1,0,0,1], sandwiches = [1,0,0,0,1,1]) == 3\n\n\ncheck(Solution().countStudents)"} | 263 | 88 |
coding | Solve the programming task below in a Python markdown code block.
N integers 1, 2, 3, \ldots N are placed on a circle in clockwise order such that i and (i+1) are adjacent for all 1 ≤ i ≤ N - 1, and 1 and N are also adjacent.
Given an integer K, Ashish repeatedly removes integers from the circle until only one integer remains. He does so in the following manner. In each move, Ashish finds the integer which is on the K-th place from the smallest one in clockwise order and removes it from the circle, i.e. its neighbours now become adjacent.
For example, consider the case when N = 3 and K = 3. Let the circular array [1, 2, 3] denote the integers on the circle. In the first move, 3 is removed since it is the K-th integer starting from 1, which is the smallest integer currently on the circle. Likewise, in the next move 1 is removed and finally only 2 remains. [1, 2, \underline{3}] \rightarrow [\underline{1}, 2] \rightarrow [2].
Since N and K may be very large, Ashish cannot simulate the process himself. Help him find the parity of the last integer that remains after the repeated removals. In other words, report if this integer is odd or even.
------ Input Format ------
- The first line contains a single integer T — the number of test cases. Then the test cases follow.
- The first and only line of each test case contains two integers N and K.
------ Output Format ------
For each test case, output ODD if the last integer that remains after the repeated removals is odd, and EVEN otherwise.
Each letter of the output may be printed in either lowercase or uppercase. For example, the strings odd, Odd, and ODD will all be treated as equivalent.
------ Constraints ------
$1 ≤ T ≤ 10^{5}$
$1 ≤ N ≤ 10^{18}$
$1 ≤ K ≤ N$
----- Sample Input 1 ------
4
4 1
3 3
9 1
3489601027782 8104267
----- Sample Output 1 ------
EVEN
EVEN
ODD
EVEN
----- explanation 1 ------
Test case $1$: The last integer that remains is $4$, which is EVEN.
$[\underline{1}, 2, 3, 4] \rightarrow [\underline{2}, 3, 4] \rightarrow [\underline{3}, 4] \rightarrow [4]$
Test case $2$: The last integer that remains is $2$, which is EVEN.
$[1, 2, \underline{3}] \rightarrow [\underline{1}, 2] \rightarrow [2]$
Test case $3$: The last integer that remains is $9$, which is ODD.
$[\underline{1}, 2, 3, 4, 5, 6, 7, 8, 9] \rightarrow [\underline{2}, 3, 4, 5, 6, 7, 8, 9] \rightarrow \ldots \rightarrow [9]$ | {"inputs": ["4\n4 1\n3 3\n9 1\n3489601027782 8104267"], "outputs": ["EVEN\nEVEN\nODD\nEVEN"]} | 699 | 56 |
coding | Solve the programming task below in a Python markdown code block.
There are $N$ cells numbered 1,2,….., N, and every cell has some positive value. you will be given an array $A_1$,$A_2$,…,$A_N$ where $A_i$ is the value of $ith$ cell and an integer $K$.
There is a monkey who wants to reach the $right$ side of the last ($Nth$) cell, initially, the monkey was left side of the first ($1st$) cell.
In the first step, he can jump into any cell numbered 1,2,….., K.Once he jumped into any cell $i$ next he can only jump to the cell $j$ such that-
- j>i
- j-i <= K
- A[i]%2 == A[j]%2
You have to find out what is the minimum number of steps required to reach the right side of the cell or In case it's not possible to reach the right side of the cell your answer should be $-1$.NOTE: As soon as monkey reach any cell whose distance from the last cell is less than K, then in the last step, he will jump out to the right side of the ($Nth$) cell.
-----Input:-----
- First-line will contain $T$, the number of test cases. Then the test cases follow.
- The first line of each test case contains two space-separated integers $N$ and $K$.
- The second line contains $N$ space-separated integers $A_1$,$A_2$,…,$A_N$
-----Output:-----
For each test case, output in a single line minimum steps or $-1$.
-----Constraints-----
- $1 \leq T \leq 100$
- $1 \leq N \leq 2*10^5$
- $1 \leq K \leq N$
- $0 \leq A_i \leq 10^6$
- $\text{the sum of N over all test cases does not exceed $5*10^{5}$}$
-----Sample Input:-----
1
2 2
3 4
-----Sample Output:-----
2
-----EXPLANATION:-----
in the first step, you can jump into any cell 1 or 2 and then in the second step you will jump
out to the right side of 2nd cell
remember we don't want to reach $Nth$ cell we want to reach the right side of the nth cell. | {"inputs": ["1\n2 2\n3 4"], "outputs": ["2"]} | 543 | 20 |
coding | Solve the programming task below in a Python markdown code block.
Goldbach's Conjecture: For any even number n greater than or equal to 4, there exists at least one pair of prime numbers p1 and p2 such that n = p1 + p2.
This conjecture has not been proved nor refused yet. No one is sure whether this conjecture actually holds. However, one can find such a pair of prime numbers, if any, for a given even number. The problem here is to write a program that reports the number of all the pairs of prime numbers satisfying the condition in the conjecture for a given even number.
A sequence of even numbers is given as input. Corresponding to each number, the program should output the number of pairs mentioned above. Notice that we are intereseted in the number of essentially different pairs and therefore you should not count (p1, p2) and (p2, p1) separately as two different pairs.
Input
An integer is given in each input line. You may assume that each integer is even, and is greater than or equal to 4 and less than 215. The end of the input is indicated by a number 0.
Output
Each output line should contain an integer number. No other characters should appear in the output.
Example
Input
6
10
12
0
Output
1
2
1 | {"inputs": ["6\n1\n3\n0", "6\n4\n2\n0", "6\n0\n2\n0", "6\n4\n0\n0", "6\n1\n0\n0", "6\n5\n8\n0", "6\n2\n2\n0", "6\n2\n3\n0"], "outputs": ["1\n0\n0\n", "1\n1\n0\n", "1\n", "1\n1\n", "1\n0\n", "1\n1\n1\n", "1\n0\n0\n", "1\n0\n0\n"]} | 290 | 134 |
coding | Solve the programming task below in a Python markdown code block.
Consider a sequence made up of the consecutive prime numbers. This infinite sequence would start with:
```python
"2357111317192329313741434753596167717379..."
```
You will be given two numbers: `a` and `b`, and your task will be to return `b` elements starting from index `a` in this sequence.
```
For example:
solve(10,5) == `19232` Because these are 5 elements from index 10 in the sequence.
```
Tests go up to about index `20000`.
More examples in test cases. Good luck!
Please also try [Simple time difference](https://www.codewars.com/kata/5b76a34ff71e5de9db0000f2)
Also feel free to reuse/extend the following starter code:
```python
def solve(a, b):
``` | {"functional": "_inputs = [[2, 2], [10, 5], [10, 3], [20, 9], [30, 12], [40, 8], [50, 6], [10000, 5], [20000, 5]]\n_outputs = [['57'], ['19232'], ['192'], ['414347535'], ['616771737983'], ['83899710'], ['031071'], ['02192'], ['09334']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(solve(*i), o[0])"} | 235 | 290 |
coding | Solve the programming task below in a Python markdown code block.
In recreational mathematics, a magic square is an arrangement of distinct numbers (i.e., each number is used once), usually integers, in a square grid, where the numbers in each row, and in each column, and the numbers in the main and secondary diagonals, all add up to the same number, called the "magic constant."
For example, the following "square":
4 9 2 -> 15
3 5 7 -> 15
8 1 6 -> 15
/v v v \
15 15 15 15 15
A 3x3 magic square will have its sums always resulting to 15, this number is called the "magic constant" and changes according to the square size.
In this problem you will have to create a function that receives a 3x3 'square' and returns True if it is magic and False otherwise.
The sum of rows, columns or diagonals should **always** equal **15**.
For example, the above square will be passed like: `[4, 9, 2, 3, 5, 7, 8, 1, 6]` and the output should be True
`[9, 4, 7, 3, 5, 2, 8, 6, 1]` should return False
### Note:
This kata is very easy. If you want to try some more "difficult" ones you may try these :
* [Magic Square - Verify 3x3](https://www.codewars.com/kata/magic-square-verify-3x3)
* [Double Even Magic Square](https://www.codewars.com/kata/double-even-magic-square)
* [Odd Magic Square](https://www.codewars.com/kata/odd-magic-square)
Also feel free to reuse/extend the following starter code:
```python
def is_magical(sq):
``` | {"functional": "_inputs = [[[4, 9, 2, 3, 5, 7, 8, 1, 6]], [[4, 9, 2, 3, 5, 7, 8, 6, 1]], [[1, 2, 3, 4, 5, 6, 7, 8, 9]], [[9, 4, 7, 3, 5, 2, 8, 6, 1]], [[8, 1, 6, 3, 5, 7, 4, 9, 2]]]\n_outputs = [[True], [False], [False], [False], [True]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(is_magical(*i), o[0])"} | 445 | 299 |
coding | Solve the programming task below in a Python markdown code block.
We, the researchers who discovered and investigated the ancient nation Iwashiro, finally discovered the temple in the center of Iwashiro. A lithograph dedicated to the god of Iwashiro was stored in the temple. On the lithograph, two strings were written, one for each sentence and one for the spell.
In Iwashiro, how many times a spell appears in a sentence has an important meaning. However, it is considered that all the characters contained in the spell appear in order, and some of them appear in the sentence in a discrete manner once. For example, if the sentence is "abab" and the spell is "ab", then "ab" appears three times in "abab", including non-continuous ones (three ways: abab, abab, and abab).
Create a program that prints how many times a spell appears in a sentence when it is given a sentence and a spell.
Input
The input is given in the following format.
t
b b
The first line is given the string t that represents the text written on the lithograph. The second line is given the string b that represents the spell written on the lithograph. Both strings are composed of only lowercase letters and have a length of 1 or more and 1000 or less.
Output
Prints how many times a spell appears in a sentence on one line. However, the value to be output can be very large, so instead output the remainder divided by 1,000,000,007.
Examples
Input
abab
ab
Output
3
Input
aaaabaaaabaaaabaaaab
aaaaa
Output
4368
Input
data
structure
Output
0 | {"inputs": ["abaa\nab", "`caa\nca", "accc\nac", "aba`\nab", "`baa\nab", "`baa\nac", "`caa\nac", "`caa\ncb"], "outputs": ["1\n", "2\n", "3\n", "1\n", "0\n", "0\n", "0\n", "0\n"]} | 372 | 84 |
coding | Solve the programming task below in a Python markdown code block.
Chef took an examination two times. In the first attempt, he scored X marks while in the second attempt he scored Y marks. According to the rules of the examination, the best score out of the two attempts will be considered as the final score.
Determine the final score of the Chef.
------ Input Format ------
- The first line contains a single integer T — the number of test cases. Then the test cases follow.
- The first line of each test case contains two integers X and Y — the marks scored by Chef in the first attempt and second attempt respectively.
------ Output Format ------
For each test case, output the final score of Chef in the examination.
------ Constraints ------
$1 ≤ T ≤ 1000$
$0 ≤X, Y ≤100$
----- Sample Input 1 ------
4
40 60
67 55
50 50
1 100
----- Sample Output 1 ------
60
67
50
100
----- explanation 1 ------
Test Case 1: The best score out of the two attempts is $60$.
Test Case 2: The best score out of the two attempts is $67$.
Test Case 3: The best score out of the two attempts is $50$. | {"inputs": ["4\n40 60\n67 55\n50 50\n1 100\n"], "outputs": ["60\n67\n50\n100\n"]} | 290 | 49 |
coding | Solve the programming task below in a Python markdown code block.
Polycarpus is a system administrator. There are two servers under his strict guidance — a and b. To stay informed about the servers' performance, Polycarpus executes commands "ping a" and "ping b". Each ping command sends exactly ten packets to the server specified in the argument of the command. Executing a program results in two integers x and y (x + y = 10; x, y ≥ 0). These numbers mean that x packets successfully reached the corresponding server through the network and y packets were lost.
Today Polycarpus has performed overall n ping commands during his workday. Now for each server Polycarpus wants to know whether the server is "alive" or not. Polycarpus thinks that the server is "alive", if at least half of the packets that we send to this server reached it successfully along the network.
Help Polycarpus, determine for each server, whether it is "alive" or not by the given commands and their results.
-----Input-----
The first line contains a single integer n (2 ≤ n ≤ 1000) — the number of commands Polycarpus has fulfilled. Each of the following n lines contains three integers — the description of the commands. The i-th of these lines contains three space-separated integers t_{i}, x_{i}, y_{i} (1 ≤ t_{i} ≤ 2; x_{i}, y_{i} ≥ 0; x_{i} + y_{i} = 10). If t_{i} = 1, then the i-th command is "ping a", otherwise the i-th command is "ping b". Numbers x_{i}, y_{i} represent the result of executing this command, that is, x_{i} packets reached the corresponding server successfully and y_{i} packets were lost.
It is guaranteed that the input has at least one "ping a" command and at least one "ping b" command.
-----Output-----
In the first line print string "LIVE" (without the quotes) if server a is "alive", otherwise print "DEAD" (without the quotes).
In the second line print the state of server b in the similar format.
-----Examples-----
Input
2
1 5 5
2 6 4
Output
LIVE
LIVE
Input
3
1 0 10
2 0 10
1 10 0
Output
LIVE
DEAD
-----Note-----
Consider the first test case. There 10 packets were sent to server a, 5 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall there were 10 packets sent to server b, 6 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network.
Consider the second test case. There were overall 20 packages sent to server a, 10 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall 10 packets were sent to server b, 0 of them reached it. Therefore, less than half of all packets sent to this server successfully reached it through the network. | {"inputs": ["2\n1 5 5\n2 6 4\n", "2\n1 5 5\n2 8 4\n", "2\n1 5 5\n2 8 6\n", "2\n1 5 5\n2 6 6\n", "2\n1 5 5\n2 1 6\n", "2\n1 5 3\n2 1 6\n", "2\n1 5 5\n2 8 8\n", "2\n1 5 3\n2 1 7\n"], "outputs": ["LIVE\nLIVE\n", "LIVE\nLIVE\n", "LIVE\nLIVE\n", "LIVE\nLIVE\n", "LIVE\nDEAD\n", "LIVE\nDEAD\n", "LIVE\nLIVE\n", "LIVE\nDEAD\n"]} | 703 | 198 |
coding | Solve the programming task below in a Python markdown code block.
There is a sheet of paper that can be represented with a grid of size $n \times m$: $n$ rows and $m$ columns of cells. All cells are colored in white initially.
$q$ operations have been applied to the sheet. The $i$-th of them can be described as follows:
$x_i$ $y_i$ — choose one of $k$ non-white colors and color the entire row $x_i$ and the entire column $y_i$ in it. The new color is applied to each cell, regardless of whether the cell was colored before the operation.
The sheet after applying all $q$ operations is called a coloring. Two colorings are different if there exists at least one cell that is colored in different colors.
How many different colorings are there? Print the number modulo $998\,244\,353$.
-----Input-----
The first line contains a single integer $t$ ($1 \le t \le 10^4$) — the number of testcases.
The first line of the testcase contains four integers $n, m, k$ and $q$ ($1 \le n, m, k, q \le 2 \cdot 10^5$) — the size of the sheet, the number of non-white colors and the number of operations.
The $i$-th of the following $q$ lines contains a description of the $i$-th operation — two integers $x_i$ and $y_i$ ($1 \le x_i \le n$; $1 \le y_i \le m$) — the row and the column the operation is applied to.
The sum of $q$ over all testcases doesn't exceed $2 \cdot 10^5$.
-----Output-----
For each testcase, print a single integer — the number of different colorings modulo $998\,244\,353$.
-----Examples-----
Input
2
1 1 3 2
1 1
1 1
2 2 2 3
2 1
1 1
2 2
Output
3
4
-----Note-----
None | {"inputs": ["1\n2 4 2 5\n2 3\n2 4\n2 1\n1 3\n2 4\n", "2\n1 1 3 2\n1 1\n1 1\n2 2 2 3\n2 1\n1 1\n2 2\n", "3\n5 5 7 6\n1 1\n2 2\n3 3\n4 4\n5 5\n1 5\n5 5 7 5\n1 1\n2 2\n3 3\n4 4\n5 5\n5 5 7 7\n1 1\n2 2\n3 3\n4 4\n5 5\n1 5\n2 3\n"], "outputs": ["4\n", "3\n4\n", "16807\n16807\n16807\n"]} | 475 | 208 |
coding | Solve the programming task below in a Python markdown code block.
Write a function to calculate compound tax using the following table:
For $10 and under, the tax rate should be 10%.
For $20 and under, the tax rate on the first $10 is %10, and the tax on the rest is 7%.
For $30 and under, the tax rate on the first $10 is still %10, the rate for the next $10 is still 7%, and everything else is 5%.
Tack on an additional 3% for the portion of the total above $30.
Return 0 for invalid input(anything that's not a positive real number).
Examples:
An input of 10, should return 1 (1 is 10% of 10)
An input of 21, should return 1.75 (10% of 10 + 7% of 10 + 5% of 1)
* Note that the returned value should be rounded to the nearest penny.
Also feel free to reuse/extend the following starter code:
```python
def tax_calculator(total):
``` | {"functional": "_inputs = [[1], [10], [11], [15], [18], [21], [26], [30], [30.49], [35], [100], [1000000], [0], [-3], [None], ['monkey'], [[]], [{}]]\n_outputs = [[0.1], [1], [1.07], [1.35], [1.56], [1.75], [2], [2.2], [2.21], [2.35], [4.3], [30001.3], [0], [0], [0], [0], [0], [0]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(tax_calculator(*i), o[0])"} | 251 | 307 |
coding | Solve the programming task below in a Python markdown code block.
Limak can repeatedly remove one of the first two characters of a string, for example abcxyx \rightarrow acxyx \rightarrow cxyx \rightarrow cyx.
You are given N different strings S_1, S_2, \ldots, S_N. Among N \cdot (N-1) / 2 pairs (S_i, S_j), in how many pairs could Limak obtain one string from the other?
Constraints
* 2 \leq N \leq 200\,000
* S_i consists of lowercase English letters `a`-`z`.
* S_i \neq S_j
* 1 \leq |S_i|
* |S_1| + |S_2| + \ldots + |S_N| \leq 10^6
Input
Input is given from Standard Input in the following format.
N
S_1
S_2
\vdots
S_N
Output
Print the number of unordered pairs (S_i, S_j) where i \neq j and Limak can obtain one string from the other.
Examples
Input
3
abcxyx
cyx
abc
Output
1
Input
6
b
a
abc
c
d
ab
Output
5 | {"inputs": ["3\nabcxyx\ncyx\nabb", "3\nabxxyc\ncyx\nabb", "6\nb\na\nabb\nc\nd\nab", "6\nb\na\nabb\nc\nd\nba", "3\naxxbyc\ncyx\nabb", "3\naxxbyc\ncyx\naab", "3\naxxbyc\ncyw\naab", "3\naxxbyc\ncyw\nbaa"], "outputs": ["1\n", "0\n", "5\n", "4\n", "0\n", "0\n", "0\n", "0\n"]} | 289 | 145 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given a positive integer n, find the smallest integer which has exactly the same digits existing in the integer n and is greater in value than n. If no such positive integer exists, return -1.
Note that the returned integer should fit in 32-bit integer, if there is a valid answer but it does not fit in 32-bit integer, return -1.
Please complete the following python code precisely:
```python
class Solution:
def nextGreaterElement(self, n: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(n = 12) == 21\n assert candidate(n = 21) == -1\n\n\ncheck(Solution().nextGreaterElement)"} | 124 | 47 |
coding | Solve the programming task below in a Python markdown code block.
A wise king declared a new calendar. "Tomorrow shall be the first day of the calendar, that is, the day 1 of the month 1 of the year 1. Each year consists of 10 months, from month 1 through month 10, and starts from a big month. A common year shall start with a big month, followed by small months and big months one after another. Therefore the first month is a big month, the second month is a small month, the third a big month, ..., and the 10th and last month a small one. A big month consists of 20 days and a small month consists of 19 days. However years which are multiples of three, that are year 3, year 6, year 9, and so on, shall consist of 10 big months and no small month."
Many years have passed since the calendar started to be used. For celebration of the millennium day (the year 1000, month 1, day 1), a royal lottery is going to be organized to send gifts to those who have lived as many days as the number chosen by the lottery. Write a program that helps people calculate the number of days since their birthdate to the millennium day.
Input
The input is formatted as follows.
> n
> Y1 M1 D1
> Y2 M2 D2
> ...
> Yn Mn Dn
Here, the first line gives the number of datasets as a positive integer n, which is less than or equal to 100. It is followed by n datasets. Each dataset is formatted in a line and gives three positive integers, Yi (< 1000), Mi (≤ 10), and Di (≤ 20), that correspond to the year, month and day, respectively, of a person's birthdate in the king's calendar. These three numbers are separated by a space.
Output
For the birthdate specified in each dataset, print in a line the number of days from the birthdate, inclusive, to the millennium day, exclusive. Output lines should not contain any character other than this number.
Sample Input
8
1 1 1
344 3 1
696 5 1
182 9 5
998 8 7
344 2 19
696 4 19
999 10 20
Output for the Sample Input
196470
128976
59710
160715
252
128977
59712
1
Example
Input
8
1 1 1
344 3 1
696 5 1
182 9 5
998 8 7
344 2 19
696 4 19
999 10 20
Output
196470
128976
59710
160715
252
128977
59712
1 | {"inputs": ["8\n1 1 2\n344 3 0\n696 5 0\n73 9 5\n998 8 7\n344 2 19\n696 4 19\n999 10 20", "8\n1 1 2\n344 3 0\n696 5 0\n73 9 5\n998 8 7\n344 2 10\n696 4 19\n999 10 20", "8\n1 1 3\n344 3 0\n696 5 0\n73 9 5\n998 8 7\n344 2 10\n696 4 19\n999 10 20", "8\n1 2 3\n344 3 0\n696 5 0\n73 9 5\n998 8 7\n344 2 10\n696 4 19\n999 10 20", "8\n2 1 1\n344 4 1\n11 5 1\n182 9 5\n998 5 4\n344 2 26\n763 4 33\n999 10 20", "8\n2 1 1\n344 7 1\n11 5 1\n182 9 5\n998 5 4\n344 2 26\n763 4 33\n999 10 20", "8\n2 1 1\n344 7 1\n11 7 1\n182 9 5\n998 5 4\n344 2 26\n763 4 33\n999 10 20", "8\n0 1 1\n344 4 0\n738 4 2\n182 9 5\n998 5 6\n344 5 26\n696 6 19\n231 8 25"], "outputs": ["196469\n128977\n59711\n182150\n252\n128977\n59712\n1\n", "196469\n128977\n59711\n182150\n252\n128986\n59712\n1\n", "196468\n128977\n59711\n182150\n252\n128986\n59712\n1\n", "196448\n128977\n59711\n182150\n252\n128986\n59712\n1\n", "196275\n128956\n194427\n160715\n314\n128970\n46519\n1\n", "196275\n128898\n194427\n160715\n314\n128970\n46519\n1\n", "196275\n128898\n194388\n160715\n314\n128970\n46519\n1\n", "196670\n128957\n51469\n160715\n312\n128912\n59672\n151076\n"]} | 707 | 942 |
coding | Solve the programming task below in a Python markdown code block.
Holidays are coming up really soon. Rick realized that it's time to think about buying a traditional spruce tree. But Rick doesn't want real trees to get hurt so he decided to find some in an $n \times m$ matrix consisting of "*" and ".".
To find every spruce first let's define what a spruce in the matrix is. A set of matrix cells is called a spruce of height $k$ with origin at point $(x, y)$ if:
All cells in the set contain an "*".
For each $1 \le i \le k$ all cells with the row number $x+i-1$ and columns in range $[y - i + 1, y + i - 1]$ must be a part of the set. All other cells cannot belong to the set.
Examples of correct and incorrect spruce trees:
Now Rick wants to know how many spruces his $n \times m$ matrix contains. Help Rick solve this problem.
-----Input-----
Each test contains one or more test cases. The first line contains the number of test cases $t$ ($1 \le t \le 10$).
The first line of each test case contains two integers $n$ and $m$ ($1 \le n, m \le 500$) — matrix size.
Next $n$ lines of each test case contain $m$ characters $c_{i, j}$ — matrix contents. It is guaranteed that $c_{i, j}$ is either a "." or an "*".
It is guaranteed that the sum of $n \cdot m$ over all test cases does not exceed $500^2$ ($\sum n \cdot m \le 500^2$).
-----Output-----
For each test case, print single integer — the total number of spruces in the matrix.
-----Examples-----
Input
4
2 3
.*.
***
2 3
.*.
**.
4 5
.***.
*****
*****
*.*.*
5 7
..*.*..
.*****.
*******
.*****.
..*.*..
Output
5
3
23
34
-----Note-----
In the first test case the first spruce of height $2$ has its origin at point $(1, 2)$, the second spruce of height $1$ has its origin at point $(1, 2)$, the third spruce of height $1$ has its origin at point $(2, 1)$, the fourth spruce of height $1$ has its origin at point $(2, 2)$, the fifth spruce of height $1$ has its origin at point $(2, 3)$.
In the second test case the first spruce of height $1$ has its origin at point $(1, 2)$, the second spruce of height $1$ has its origin at point $(2, 1)$, the third spruce of height $1$ has its origin at point $(2, 2)$. | {"inputs": ["4\n2 3\n.*.\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n*.*.*\n5 7\n..*.*..\n.*****.\n*******\n.*****.\n..*.*..\n", "4\n2 3\n..*\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n*.*.*\n5 7\n..*.*..\n.*****.\n*******\n.*****.\n..*.*..\n", "4\n2 3\n..*\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n*.*.*\n1 7\n..*.*..\n.*****.\n*******\n.*****.\n..*.*..\n", "4\n2 3\n..*\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n*.*.*\n5 7\n..*.*..\n.*****.\n*******\n****.*.\n..*.*..\n", "4\n2 3\n..*\n***\n2 3\n.*.\n**.\n4 5\n**.*.\n*****\n*****\n*.*.*\n1 7\n..*.*..\n.*****/\n*******\n.*****.\n..*.*..\n", "4\n2 3\n*..\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n..***\n1 7\n..*.*..\n.*****.\n*******\n.*****.\n..*.*..\n", "4\n2 3\n..*\n***\n2 3\n.*.\n**.\n4 5\n.***.\n*****\n*****\n*.*.*\n5 7\n..*.*..\n..*****\n*******\n.*****.\n..*.*..\n", "4\n2 3\n.*.\n***\n2 3\n.*.\n.**\n4 5\n.***.\n*****\n*****\n*.*.*\n1 7\n..*.*..\n.*****.\n******)\n.*****.\n..*.*..\n"], "outputs": ["5\n3\n23\n34\n", "4\n3\n23\n34\n", "4\n3\n23\n2\n", "4\n3\n23\n32\n", "4\n3\n21\n2\n", "4\n3\n24\n2\n", "4\n3\n23\n31\n", "5\n3\n23\n2\n"]} | 643 | 643 |
coding | Solve the programming task below in a Python markdown code block.
A group of friends (n >= 2) have reunited for a get-together after
a very long time.
They agree that they will make presentations on holiday destinations
or expeditions they have been to only if it satisfies **one simple rule**:
> the holiday/journey being presented must have been visited _only_ by the presenter and no one else from the audience.
Write a program to output the presentation agenda, including the
presenter and their respective presentation titles.
---
### EXAMPLES
```python
presentation_agenda([
{'person': 'Abe', 'dest': ['London', 'Dubai']},
{'person': 'Bond', 'dest': ['Melbourne', 'Dubai']}
]) == [{'person': 'Abe', 'dest': ['London']},
{'person': 'Bond', 'dest': ['Melbourne']}]
presentation_agenda([
{'person': 'Abe', 'dest': ['Dubai']},
{'person': 'Brad', 'dest': ['Dubai']}
]) == []
presentation_agenda([
{'person': 'Abe', 'dest': ['London', 'Dubai']},
{'person': 'Bond', 'dest': ['Melbourne', 'Dubai']},
{'person': 'Carrie', 'dest': ['Melbourne']},
{'person': 'Damu', 'dest': ['Melbourne', 'Dubai', 'Paris']}
]) == [{'person': 'Abe', 'dest': ['London']},
{'person': 'Damu', 'dest': ['Paris']}]
```
Also feel free to reuse/extend the following starter code:
```python
def presentation_agenda(friend_list):
``` | {"functional": "_inputs = [[[{'person': 'Abe', 'dest': ['London', 'Dubai']}, {'person': 'Bond', 'dest': ['Melbourne', 'Dubai']}]], [[{'person': 'Abe', 'dest': ['Dubai']}, {'person': 'Brad', 'dest': ['Dubai']}]], [[{'person': 'Abe', 'dest': ['London', 'Dubai']}, {'person': 'Bond', 'dest': ['Melbourne', 'Dubai']}, {'person': 'Carrie', 'dest': ['Melbourne']}, {'person': 'Damu', 'dest': ['Melbourne', 'Dubai', 'Paris']}]], [[{'person': 'John', 'dest': ['Ahmedabad', 'Baghdad', 'Delhi', 'Dhaka']}, {'person': 'Mickeal Angelo', 'dest': ['Ahmedabad', 'Baghdad', 'Delhi', 'Hong Kong', 'Istanbul', 'Jakarta', 'Mumbai', 'Santiago', 'Singapore']}, {'person': 'Gandalf', 'dest': ['Chennai', 'Hong Kong']}]]]\n_outputs = [[[{'person': 'Abe', 'dest': ['London']}, {'person': 'Bond', 'dest': ['Melbourne']}]], [[]], [[{'person': 'Abe', 'dest': ['London']}, {'person': 'Damu', 'dest': ['Paris']}]], [[{'person': 'John', 'dest': ['Dhaka']}, {'person': 'Mickeal Angelo', 'dest': ['Istanbul', 'Jakarta', 'Mumbai', 'Santiago', 'Singapore']}, {'person': 'Gandalf', 'dest': ['Chennai']}]]]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(presentation_agenda(*i), o[0])"} | 360 | 515 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given an integer array banned and two integers n and maxSum. You are choosing some number of integers following the below rules:
The chosen integers have to be in the range [1, n].
Each integer can be chosen at most once.
The chosen integers should not be in the array banned.
The sum of the chosen integers should not exceed maxSum.
Return the maximum number of integers you can choose following the mentioned rules.
Please complete the following python code precisely:
```python
class Solution:
def maxCount(self, banned: List[int], n: int, maxSum: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(banned = [1,6,5], n = 5, maxSum = 6) == 2\n assert candidate(banned = [1,2,3,4,5,6,7], n = 8, maxSum = 1) == 0\n assert candidate(banned = [11], n = 7, maxSum = 50) == 7\n\n\ncheck(Solution().maxCount)"} | 144 | 109 |
coding | Solve the programming task below in a Python markdown code block.
You are given an integer $n$ ($n \ge 0$) represented with $k$ digits in base (radix) $b$. So,
$$n = a_1 \cdot b^{k-1} + a_2 \cdot b^{k-2} + \ldots a_{k-1} \cdot b + a_k.$$
For example, if $b=17, k=3$ and $a=[11, 15, 7]$ then $n=11\cdot17^2+15\cdot17+7=3179+255+7=3441$.
Determine whether $n$ is even or odd.
-----Input-----
The first line contains two integers $b$ and $k$ ($2\le b\le 100$, $1\le k\le 10^5$) — the base of the number and the number of digits.
The second line contains $k$ integers $a_1, a_2, \ldots, a_k$ ($0\le a_i < b$) — the digits of $n$.
The representation of $n$ contains no unnecessary leading zero. That is, $a_1$ can be equal to $0$ only if $k = 1$.
-----Output-----
Print "even" if $n$ is even, otherwise print "odd".
You can print each letter in any case (upper or lower).
-----Examples-----
Input
13 3
3 2 7
Output
even
Input
10 9
1 2 3 4 5 6 7 8 9
Output
odd
Input
99 5
32 92 85 74 4
Output
odd
Input
2 2
1 0
Output
even
-----Note-----
In the first example, $n = 3 \cdot 13^2 + 2 \cdot 13 + 7 = 540$, which is even.
In the second example, $n = 123456789$ is odd.
In the third example, $n = 32 \cdot 99^4 + 92 \cdot 99^3 + 85 \cdot 99^2 + 74 \cdot 99 + 4 = 3164015155$ is odd.
In the fourth example $n = 2$. | {"inputs": ["3 1\n0\n", "6 1\n0\n", "2 1\n1\n", "3 1\n2\n", "7 1\n3\n", "6 1\n0\n", "3 1\n0\n", "3 1\n2\n"], "outputs": ["even\n", "even\n", "odd\n", "even\n", "odd\n", "even\n", "even\n", "even\n"]} | 563 | 102 |
coding | Solve the programming task below in a Python markdown code block.
Read problems statements in Mandarin Chinese and Russian as well.
John's barn has a fence consisting of N consecutive parts numbered from left to right starting from 1 to N. Each part is initially painted in one of two colors: red or green, whose information is provided you by a string C. The color of i-th part C_{i} will be equal to 'R' if the color of the part is red and 'G' if it is green.
John decided to paint the whole fence in green color. To make the mundane process of painting more entertaining he decided to do it using the following process.
Every minute (until the whole fence is painted green) he will do the following steps:
Choose any part of the fence that is painted red. Let's denote the index of this part as X.
For each part with indices X, X+1, ..., min(N, X + K - 1), flip the color of the corresponding part from red to green and from green to red by repainting.
John is wondering how fast he can repaint the fence. Please help him in finding the minimum number of minutes required in repainting.
------ Input ------
The first line of the input contains an integer T denoting the number of test cases. The description of T test cases follows.
The first line of each test case contains the two integers N and K.
The next line contains the string C.
------ Output ------
For each test case, output a single line containing the answer to the corresponding test case.
------ Constraints ------
$1 ≤ T ≤ 10$
$1 ≤ N, K ≤ 10^{5}$
$C will consist only of uppercase English characters 'R' and 'G'.$
----- Sample Input 1 ------
1
7 3
RGGRGRG
----- Sample Output 1 ------
4
----- explanation 1 ------
Example case 1. One optimal solution (with 4 steps) looks like this:
Choose the 1-st character (1-based index) and get "GRRRGRG".
Choose the 2-st character (1-based index) and get "GGGGGRG".
Choose the 6-th character (1-based index) and get "GGGGGGR".
Choose the 7-th charatcer (1-based index) and get "GGGGGGG".
Now repainting is done :) It took total 4 steps. Hence answer is 4. | {"inputs": ["1\n7 3\nRGGRGRG", "1\n7 2\nRGGRGRG", "1\n7 2\nGRGRGGR", "1\n7 0\nRGGRGRG", "1\n7 3\nGRGRGGR", "1\n7 2\nGHGRRGR", "1\n7 1\nGRGQGGS", "1\n7 0\nQGGQGSH"], "outputs": ["4", "5\n", "3\n", "6\n", "4\n", "2\n", "1\n", "0\n"]} | 514 | 135 |
coding | Solve the programming task below in a Python markdown code block.
Poor Cade has got his number conversions mixed up again!
Fix his ```convert_num()``` function so it correctly converts a base-10 ```int```eger,
to the selected of ```bin```ary or ```hex```adecimal.
```#The output should be a string at all times```
```python
convert_num(number, base):
if 'base' = hex:
return int(number, 16)
if 'base' = bin:
return int(number, 2)
return (Incorrect base input)
```
Please note, invalid ```number``` or ```base``` inputs will be tested.
In the event of an invalid ```number/base``` you should return:
```python
"Invalid number input"
or
"Invalid base input"
```
For each respectively.
Good luck coding! :D
Also feel free to reuse/extend the following starter code:
```python
def convert_num(number, base):
``` | {"functional": "_inputs = [[122, 'bin'], ['dog', 'bin'], [0, 'hex'], [123, 'lol']]\n_outputs = [['0b1111010'], ['Invalid number input'], ['0x0'], ['Invalid base input']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(convert_num(*i), o[0])"} | 207 | 202 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given an integer array nums, return the maximum possible sum of elements of the array such that it is divisible by three.
Please complete the following python code precisely:
```python
class Solution:
def maxSumDivThree(self, nums: List[int]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(nums = [3,6,5,1,8]) == 18\n assert candidate(nums = [4]) == 0\n assert candidate(nums = [1,2,3,4,4]) == 12\n\n\ncheck(Solution().maxSumDivThree)"} | 74 | 75 |
coding | Solve the programming task below in a Python markdown code block.
One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of n different natural numbers from 1 to n to obtain total control over her energy.
But his plan failed. The reason for this was very simple: Hexadecimal didn't perceive any information, apart from numbers written in binary format. This means that if a number in a decimal representation contained characters apart from 0 and 1, it was not stored in the memory. Now Megabyte wants to know, how many numbers were loaded successfully.
Input
Input data contains the only number n (1 ≤ n ≤ 109).
Output
Output the only number — answer to the problem.
Examples
Input
10
Output
2
Note
For n = 10 the answer includes numbers 1 and 10. | {"inputs": ["1\n", "2\n", "7\n", "9\n", "3\n", "4\n", "6\n", "8\n"], "outputs": ["1\n", "1\n", "1\n", "1\n", "1\n", "1\n", "1\n", "1\n"]} | 201 | 70 |
coding | Solve the programming task below in a Python markdown code block.
You are given an array A = [A_{1}, A_{2}, \ldots, A_{N}] containing distinct positive integers.
Let B be a [permutation] of A. Define the *value* of B to be
\sum_{i=1}^N (B_{i} \bmod{B_{i+1}})
where B_{N+1} is treated to be B_{1}.
Find the maximum *value* across all permutations of A.
------ Input Format ------
- The first line of input contains a single integer T, denoting the number of test cases. The description of T test cases follows.
- Each test case consists of two lines of input.
- The first line of each test case contains an integer N — the size of A.
- The second line of each test case contains N space-separated integers — the elements of A.
------ Output Format ------
- For each test case, output a new line containing the answer — the maximum possible value across all permutations of A.
------ Constraints ------
$1 ≤ T ≤ 10^{3}$
$2 ≤ N ≤ 2\cdot 10^{3}$
$1 ≤ A_{i} ≤ 10^{15}$
$A_{i} \neq A_{j}$ for $i \neq j$
- The sum of $N$ across all test cases won't exceed $2\cdot 10^{3}$.
----- Sample Input 1 ------
2
2
5 13
4
11 5 14869010166 19007432007
----- Sample Output 1 ------
8
14869010184
----- explanation 1 ------
Test case $1$: The value of any permutation is $(5 \bmod 13) + (13 \bmod 5) = 5 + 3 = 8$.
Test case $2$: The $6$ cyclic permutations of the given array and their corresponding values are:
- $[5, 11, 14869010166, 19007432007]$ with value $14869010184$
- $[5, 14869010166, 11, 19007432007]$ with value $28$
- $[11, 5, 14869010166, 19007432007]$ with value $14869010175$
- $[11, 14869010166, 5, 19007432007]$ with value $20$
- $[14869010166, 5, 11, 19007432007]$ with value $4138421858$
- $[14869010166, 11, 5, 19007432007]$ with value $4138421857$
Among these, the highest value is $14869010184$. | {"inputs": ["2\n2\n5 13\n4\n11 5 14869010166 19007432007\n"], "outputs": ["8\n14869010184\n"]} | 755 | 64 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given an array of non-negative integers arr, you are initially positioned at start index of the array. When you are at index i, you can jump to i + arr[i] or i - arr[i], check if you can reach any index with value 0.
Notice that you can not jump outside of the array at any time.
Please complete the following python code precisely:
```python
class Solution:
def canReach(self, arr: List[int], start: int) -> bool:
``` | {"functional": "def check(candidate):\n assert candidate(arr = [4,2,3,0,3,1,2], start = 5) == True\n assert candidate(arr = [4,2,3,0,3,1,2], start = 0) == True \n assert candidate(arr = [3,0,2,1,2], start = 2) == False\n\n\ncheck(Solution().canReach)"} | 123 | 100 |
coding | Solve the programming task below in a Python markdown code block.
A teacher asks the class to open their books to a page number. A student can either start turning pages from the front of the book or from the back of the book. They always turn pages one at a time. When they open the book, page $1$ is always on the right side:
When they flip page $1$, they see pages $2$ and $3$. Each page except the last page will always be printed on both sides. The last page may only be printed on the front, given the length of the book. If the book is $n$ pages long, and a student wants to turn to page $\boldsymbol{p}$, what is the minimum number of pages to turn? They can start at the beginning or the end of the book.
Given $n$ and $\boldsymbol{p}$, find and print the minimum number of pages that must be turned in order to arrive at page $\boldsymbol{p}$.
Example
$n=5$
$p=3$
Using the diagram above, if the student wants to get to page $3$, they open the book to page $1$, flip $1$ page and they are on the correct page. If they open the book to the last page, page $5$, they turn $1$ page and are at the correct page. Return $1$.
Function Description
Complete the pageCount function in the editor below.
pageCount has the following parameter(s):
int n: the number of pages in the book
int p: the page number to turn to
Returns
int: the minimum number of pages to turn
Input Format
The first line contains an integer $n$, the number of pages in the book.
The second line contains an integer, $\boldsymbol{p}$, the page to turn to.
Constraints
$1\leq n\leq10^5$
$1\leq p\leq n$
Sample Input 0
6
2
Sample Output 0
1
Explanation 0
If the student starts turning from page $1$, they only need to turn $1$ page:
If a student starts turning from page $\boldsymbol{6}$, they need to turn $2$ pages:
Return the minimum value, $1$.
Sample Input 1
5
4
Sample Output 1
0
Explanation 1
If the student starts turning from page $1$, they need to turn $2$ pages:
If they start turning from page $5$, they do not need to turn any pages:
Return the minimum value, $0$. | {"inputs": ["6\n2\n", "5\n4\n"], "outputs": ["1\n", "0\n"]} | 559 | 26 |
coding | Solve the programming task below in a Python markdown code block.
The chef is trying to decode some pattern problems, Chef wants your help to code it. Chef has one number K to form a new pattern. Help the chef to code this pattern problem.
-----Input:-----
- First-line will contain $T$, the number of test cases. Then the test cases follow.
- Each test case contains a single line of input, one integer $K$.
-----Output:-----
For each test case, output as the pattern.
-----Constraints-----
- $1 \leq T \leq 100$
- $1 \leq K \leq 100$
-----Sample Input:-----
4
1
2
3
4
-----Sample Output:-----
2
23
34
234
345
456
2345
3456
4567
5678
-----EXPLANATION:-----
No need, else pattern can be decode easily. | {"inputs": ["4\n1\n2\n3\n4"], "outputs": ["2\n23\n34\n234\n345\n456\n2345\n3456\n4567\n5678"]} | 216 | 58 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given a 0-indexed string word, consisting of lowercase English letters. You need to select one index and remove the letter at that index from word so that the frequency of every letter present in word is equal.
Return true if it is possible to remove one letter so that the frequency of all letters in word are equal, and false otherwise.
Note:
The frequency of a letter x is the number of times it occurs in the string.
You must remove exactly one letter and cannot choose to do nothing.
Please complete the following python code precisely:
```python
class Solution:
def equalFrequency(self, word: str) -> bool:
``` | {"functional": "def check(candidate):\n assert candidate(word = \"abcc\") == True\n assert candidate(word = \"aazz\") == False\n\n\ncheck(Solution().equalFrequency)"} | 150 | 43 |
coding | Solve the programming task below in a Python markdown code block.
Lesha plays the recently published new version of the legendary game hacknet. In this version character skill mechanism was introduced. Now, each player character has exactly n skills. Each skill is represented by a non-negative integer ai — the current skill level. All skills have the same maximum level A.
Along with the skills, global ranking of all players was added. Players are ranked according to the so-called Force. The Force of a player is the sum of the following values:
* The number of skills that a character has perfected (i.e., such that ai = A), multiplied by coefficient cf.
* The minimum skill level among all skills (min ai), multiplied by coefficient cm.
Now Lesha has m hacknetian currency units, which he is willing to spend. Each currency unit can increase the current level of any skill by 1 (if it's not equal to A yet). Help him spend his money in order to achieve the maximum possible value of the Force.
Input
The first line of the input contains five space-separated integers n, A, cf, cm and m (1 ≤ n ≤ 100 000, 1 ≤ A ≤ 109, 0 ≤ cf, cm ≤ 1000, 0 ≤ m ≤ 1015).
The second line contains exactly n integers ai (0 ≤ ai ≤ A), separated by spaces, — the current levels of skills.
Output
On the first line print the maximum value of the Force that the character can achieve using no more than m currency units.
On the second line print n integers a'i (ai ≤ a'i ≤ A), skill levels which one must achieve in order to reach the specified value of the Force, while using no more than m currency units. Numbers should be separated by spaces.
Examples
Input
3 5 10 1 5
1 3 1
Output
12
2 5 2
Input
3 5 10 1 339
1 3 1
Output
35
5 5 5
Note
In the first test the optimal strategy is to increase the second skill to its maximum, and increase the two others by 1.
In the second test one should increase all skills to maximum. | {"inputs": ["2 6 0 1 4\n5 1\n", "1 100 1 2 30\n1\n", "1 100 1 2 30\n0\n", "1 100 1 2 59\n0\n", "1 100 2 2 59\n1\n", "1 100 0 2 30\n1\n", "1 100 1 2 42\n0\n", "1 100 0 4 30\n1\n"], "outputs": ["5\n5 5 \n", "62\n31 \n", "60\n30\n", "118\n59\n", "120\n60\n", "62\n31\n", "84\n42\n", "124\n31\n"]} | 488 | 210 |
coding | Solve the programming task below in a Python markdown code block.
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
Input
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
Output
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
Examples
Input
aaaa
aaaA
Output
0
Input
abs
Abz
Output
-1
Input
abcdefg
AbCdEfF
Output
1
Note
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
* http://en.wikipedia.org/wiki/Lexicographical_order | {"inputs": ["a\nZ\n", "q\nq\n", "O\ni\n", "m\na\n", "b\nZ\n", "q\nr\n", "O\nj\n", "m\nb\n"], "outputs": ["-1\n", "0\n", "1\n", "1\n", "-1\n", "-1\n", "1\n", "1\n"]} | 284 | 87 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
The XOR sum of a list is the bitwise XOR of all its elements. If the list only contains one element, then its XOR sum will be equal to this element.
For example, the XOR sum of [1,2,3,4] is equal to 1 XOR 2 XOR 3 XOR 4 = 4, and the XOR sum of [3] is equal to 3.
You are given two 0-indexed arrays arr1 and arr2 that consist only of non-negative integers.
Consider the list containing the result of arr1[i] AND arr2[j] (bitwise AND) for every (i, j) pair where 0 <= i < arr1.length and 0 <= j < arr2.length.
Return the XOR sum of the aforementioned list.
Please complete the following python code precisely:
```python
class Solution:
def getXORSum(self, arr1: List[int], arr2: List[int]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(arr1 = [1,2,3], arr2 = [6,5]) == 0\n assert candidate(arr1 = [12], arr2 = [4]) == 4\n\n\ncheck(Solution().getXORSum)"} | 217 | 65 |
coding | Solve the programming task below in a Python markdown code block.
After acquiring an extraordinary amount of knowledge through programming contests, Malvika decided to harness her expertise to train the next generation of Indian programmers. So, she decided to hold a programming camp. In the camp, she held a discussion session for n members (n-1 students, and herself). They are sitting in a line from left to right numbered through 1 to n.
Malvika is sitting in the nth spot. She wants to teach m topics of competitive programming to the students. As the people taking part in the camp are all newbies, they know none of the topics being taught, i.e., initially, the first n - 1 people in the line know none of the topics, while the nth knows all of them.
It takes one hour for a person to learn a topic from his neighbour. Obviously, one person cannot both teach a topic as well as learn one during the same hour. That is, in any particular hour, a person can either teach a topic that he knows to one of his neighbors, or he can learn a topic from one of his neighbors, or he can sit idly. It is also obvious that if person x is learning from person y at a particular hour, then person y must be teaching person x at that hour.
Also, note that people can work parallely too, i.e., in the same hour when the 4th person is teaching the 3rd person, the 1st person can also teach the 2nd or learn from 2nd.
Find out the minimum number of hours needed so that each person learns all the m topics.
-----Input-----
- The first line of input contains a single integer T denoting number of test cases.
- The only line of each test case contains two space separated integers n, m as defined in the statement.
-----Output-----
- For each test case, output a single integer in a line corresponding to the answer of the problem.
-----Constraints-----
- 1 ≤ T, n, m ≤ 100
-----Example-----
Input:
2
2 1
3 2
Output:
1
4
-----Explanation-----
In the first example, there are two people. Second person is Malvika and she has to teach only one topic to the first person. It will take only one hour to do so.
In the second example, there are three people. The 3rd person is Malvika and she has to teach only two topics to 1st and 2nd person. In the 1st hour, she teaches the 1st topic to the 2nd person. Now, in the 2nd hour, the 2nd person will teach the 1st topic to the 1st person. In the 3rd hour, Malvika will teach the 2nd topic to the 2nd person. Now the 2nd person will teach that topic to the 1st in the 4th hour. So, it takes a total of 4 hours for all the people to know all the topics. | {"inputs": ["2\n2 1\n3 2"], "outputs": ["1\n4"]} | 639 | 22 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
There is an undirected graph consisting of n nodes numbered from 0 to n - 1. You are given a 0-indexed integer array vals of length n where vals[i] denotes the value of the ith node.
You are also given a 2D integer array edges where edges[i] = [ai, bi] denotes that there exists an undirected edge connecting nodes ai and bi.
A star graph is a subgraph of the given graph having a center node containing 0 or more neighbors. In other words, it is a subset of edges of the given graph such that there exists a common node for all edges.
The image below shows star graphs with 3 and 4 neighbors respectively, centered at the blue node.
The star sum is the sum of the values of all the nodes present in the star graph.
Given an integer k, return the maximum star sum of a star graph containing at most k edges.
Please complete the following python code precisely:
```python
class Solution:
def maxStarSum(self, vals: List[int], edges: List[List[int]], k: int) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(vals = [1,2,3,4,10,-10,-20], edges = [[0,1],[1,2],[1,3],[3,4],[3,5],[3,6]], k = 2) == 16\n assert candidate(vals = [-5], edges = [], k = 0) == -5\n\n\ncheck(Solution().maxStarSum)"} | 247 | 100 |
coding | Solve the programming task below in a Python markdown code block.
```if-not:sql
Create a function (or write a script in Shell) that takes an integer as an argument and returns "Even" for even numbers or "Odd" for odd numbers.
```
```if:sql
## SQL Notes:
You will be given a table, `numbers`, with one column `number`.
Return a table with a column `is_even` containing "Even" or "Odd" depending on `number` column values.
### numbers table schema
* number INT
### output table schema
* is_even STRING
```
Also feel free to reuse/extend the following starter code:
```python
def even_or_odd(number):
``` | {"functional": "_inputs = [[2], [1], [0], [1545452], [7], [78], [17], [74156741], [100000], [-123], [-456]]\n_outputs = [['Even'], ['Odd'], ['Even'], ['Even'], ['Odd'], ['Even'], ['Odd'], ['Odd'], ['Even'], ['Odd'], ['Even']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(even_or_odd(*i), o[0])"} | 149 | 240 |
coding | Solve the programming task below in a Python markdown code block.
There are N cities and M roads.
The i-th road (1≤i≤M) connects two cities a_i and b_i (1≤a_i,b_i≤N) bidirectionally.
There may be more than one road that connects the same pair of two cities.
For each city, how many roads are connected to the city?
-----Constraints-----
- 2≤N,M≤50
- 1≤a_i,b_i≤N
- a_i ≠ b_i
- All input values are integers.
-----Input-----
Input is given from Standard Input in the following format:
N M
a_1 b_1
:
a_M b_M
-----Output-----
Print the answer in N lines.
In the i-th line (1≤i≤N), print the number of roads connected to city i.
-----Sample Input-----
4 3
1 2
2 3
1 4
-----Sample Output-----
2
2
1
1
- City 1 is connected to the 1-st and 3-rd roads.
- City 2 is connected to the 1-st and 2-nd roads.
- City 3 is connected to the 2-nd road.
- City 4 is connected to the 3-rd road. | {"inputs": ["4 3\n1 2\n4 3\n1 4", "4 0\n1 2\n2 3\n1 4", "5 0\n1 2\n2 3\n1 4", "6 0\n0 3\n2 3\n1 4", "4 3\n1 2\n2 2\n1 4", "8 0\n1 2\n2 3\n1 4", "4 3\n1 2\n2 3\n1 4", "4 3\n1 2\n2 3\n1 4\n"], "outputs": ["2\n1\n1\n2\n", "0\n0\n0\n0\n", "0\n0\n0\n0\n0\n", "0\n0\n0\n0\n0\n0\n", "2\n3\n0\n1\n", "0\n0\n0\n0\n0\n0\n0\n0\n", "2\n2\n1\n1", "2\n2\n1\n1\n"]} | 281 | 236 |
coding | Solve the programming task below in a Python markdown code block.
For a given weighted directed graph G(V, E), find the distance of the shortest route that meets the following criteria:
* It is a closed cycle where it ends at the same point it starts.
* It visits each vertex exactly once.
Constraints
* 2 ≤ |V| ≤ 15
* 0 ≤ di ≤ 1,000
* There are no multiedge
Input
|V| |E|
s0 t0 d0
s1 t1 d1
:
s|E|-1 t|E|-1 d|E|-1
|V| is the number of vertices and |E| is the number of edges in the graph. The graph vertices are named with the numbers 0, 1,..., |V|-1 respectively.
si and ti represent source and target vertices of i-th edge (directed) and di represents the distance between si and ti (the i-th edge).
Output
Print the shortest distance in a line. If there is no solution, print -1.
Examples
Input
4 6
0 1 2
1 2 3
1 3 9
2 0 1
2 3 6
3 2 4
Output
16
Input
3 3
0 1 1
1 2 1
0 2 1
Output
-1 | {"inputs": ["3 3\n0 0 1\n1 2 1\n0 2 1", "1 1\n0 0 0\n1 2 1\n0 2 1", "3 3\n0 0 1\n2 2 1\n0 2 1", "3 3\n0 1 1\n1 2 1\n0 0 1", "3 3\n0 0 0\n1 2 1\n0 2 1", "3 3\n0 0 1\n2 2 1\n0 2 2", "3 3\n0 2 1\n1 2 1\n0 0 1", "3 3\n0 0 0\n1 0 1\n0 2 1"], "outputs": ["-1\n", "0\n", "-1\n", "-1\n", "-1\n", "-1\n", "-1\n", "-1\n"]} | 305 | 223 |
coding | Solve the programming task below in a Python markdown code block.
Colossal! — exclaimed Hawk-nose. — A programmer! That's exactly what we are looking for.Arkadi and Boris Strugatsky. Monday starts on Saturday
Reading the book "Equations of Mathematical Magic" Roman Oira-Oira and Cristobal Junta found an interesting equation: $a - (a \oplus x) - x = 0$ for some given $a$, where $\oplus$ stands for a bitwise exclusive or (XOR) of two integers (this operation is denoted as ^ or xor in many modern programming languages). Oira-Oira quickly found some $x$, which is the solution of the equation, but Cristobal Junta decided that Oira-Oira's result is not interesting enough, so he asked his colleague how many non-negative solutions of this equation exist. This task turned out to be too difficult for Oira-Oira, so he asks you to help.
-----Input-----
Each test contains several possible values of $a$ and your task is to find the number of equation's solution for each of them. The first line contains an integer $t$ ($1 \le t \le 1000$) — the number of these values.
The following $t$ lines contain the values of parameter $a$, each value is an integer from $0$ to $2^{30} - 1$ inclusive.
-----Output-----
For each value of $a$ print exactly one integer — the number of non-negative solutions of the equation for the given value of the parameter. Print answers in the same order as values of $a$ appear in the input.
One can show that the number of solutions is always finite.
-----Example-----
Input
3
0
2
1073741823
Output
1
2
1073741824
-----Note-----
Let's define the bitwise exclusive OR (XOR) operation. Given two integers $x$ and $y$, consider their binary representations (possibly with leading zeroes): $x_k \dots x_2 x_1 x_0$ and $y_k \dots y_2 y_1 y_0$. Here, $x_i$ is the $i$-th bit of the number $x$ and $y_i$ is the $i$-th bit of the number $y$. Let $r = x \oplus y$ be the result of the XOR operation of $x$ and $y$. Then $r$ is defined as $r_k \dots r_2 r_1 r_0$ where:
$$ r_i = \left\{ \begin{aligned} 1, ~ \text{if} ~ x_i \ne y_i \\ 0, ~ \text{if} ~ x_i = y_i \end{aligned} \right. $$
For the first value of the parameter, only $x = 0$ is a solution of the equation.
For the second value of the parameter, solutions are $x = 0$ and $x = 2$. | {"inputs": ["3\n1\n4\n748143\n", "3\n6\n0\n8755775\n", "3\n0\n2\n507180918\n", "3\n1\n2\n507180918\n", "3\n1\n2\n759698327\n", "3\n1\n1\n326714685\n", "3\n2\n0\n255775825\n", "3\n2\n0\n320732063\n"], "outputs": ["2\n2\n8192\n", "4\n1\n8192\n", "1\n2\n1048576\n", "2\n2\n1048576\n", "2\n2\n16384\n", "2\n2\n65536\n", "2\n1\n65536\n", "2\n1\n1048576\n"]} | 659 | 245 |
coding | Solve the programming task below in a Python markdown code block.
Given is a sequence of integers A_1, A_2, ..., A_N.
If its elements are pairwise distinct, print YES; otherwise, print NO.
-----Constraints-----
- 2 ≤ N ≤ 200000
- 1 ≤ A_i ≤ 10^9
- All values in input are integers.
-----Input-----
Input is given from Standard Input in the following format:
N
A_1 ... A_N
-----Output-----
If the elements of the sequence are pairwise distinct, print YES; otherwise, print NO.
-----Sample Input-----
5
2 6 1 4 5
-----Sample Output-----
YES
The elements are pairwise distinct. | {"inputs": ["5\n2 9 1 4 5", "5\n2 9 1 3 5", "5\n2 9 0 3 5", "5\n2 4 0 3 5", "5\n2 4 1 3 5", "5\n2 4 1 3 2", "5\n1 4 1 3 2", "5\n1 4 1 1 2"], "outputs": ["YES\n", "YES\n", "YES\n", "YES\n", "YES\n", "NO\n", "NO\n", "NO\n"]} | 156 | 142 |
coding | Solve the programming task below in a Python markdown code block.
Chef has an array A consisting of N integers (1-based indexing). He asks you to perform the following operation M times:
for i = 2 to N:
Ai = Ai + Ai-1
Your task is to find the xth element of the array (i.e., Ax) after performing the above operation M times. As the answer could be large, please output it modulo 109 + 7.
-----Input-----
- The first line of input contains an integer T denoting the number of test cases.
- The first line of each test case contains three space-separated integers — N, x, and M — denoting the size of the array, index of the element you need to find, and the amount of times you need to repeat operation before finding the element, respectively. The second line contains N space-separated integers A1, A2, …, AN.
-----Output-----
For each test case, output a single line containing one integer: Ax modulo 109 + 7.
-----Constraints-----
- 1 ≤ T ≤ 10
- 1 ≤ x ≤ N ≤ 105
- 1 ≤ M ≤ 1018
- 1 ≤ Ai ≤ 1018
-----Subtasks-----Subtask 1 (8 points):
- 1 ≤ x ≤ min{2, N}Subtask 2 (24 points):
- 1 ≤ N * M ≤ 106Subtask 3 (68 points): No additional constraints
-----Example-----
Input:
2
3 2 3
1 2 3
3 3 3
1 2 3
Output:
5
15
-----Explanation-----
Values in the array A:
- Before the operations: [1, 2, 3]
- After the first operation: [1, 3, 6]
- After the second operation: [1, 4, 10]
- After the third operation: [1, 5, 15]
Since input file can be fairly large (about 8 MB), it's recommended to use fast I/O (for example, in C++, use scanf/printf instead of cin/cout). | {"inputs": ["2\n3 2 3\n1 2 3\n3 3 3\n1 2 3"], "outputs": ["5\n15"]} | 478 | 39 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
Given two n x n binary matrices mat and target, return true if it is possible to make mat equal to target by rotating mat in 90-degree increments, or false otherwise.
Please complete the following python code precisely:
```python
class Solution:
def findRotation(self, mat: List[List[int]], target: List[List[int]]) -> bool:
``` | {"functional": "def check(candidate):\n assert candidate(mat = [[0,1],[1,0]], target = [[1,0],[0,1]]) == True\n assert candidate(mat = [[0,1],[1,1]], target = [[1,0],[0,1]]) == False\n assert candidate(mat = [[0,0,0],[0,1,0],[1,1,1]], target = [[1,1,1],[0,1,0],[0,0,0]]) == True\n\n\ncheck(Solution().findRotation)"} | 92 | 123 |
coding | Solve the programming task below in a Python markdown code block.
You are asked to write a simple cypher that rotates every character (in range [a-zA-Z], special chars will be ignored by the cipher) by 13 chars. As an addition to the original ROT13 cipher, this cypher will also cypher numerical digits ([0-9]) with 5 chars.
Example:
"The quick brown fox jumps over the 2 lazy dogs"
will be cyphered to:
"Gur dhvpx oebja sbk whzcf bire gur 7 ynml qbtf"
Your task is to write a ROT13.5 (ROT135) method that accepts a string and encrypts it.
Decrypting is performed by using the same method, but by passing the encrypted string again.
Note: when an empty string is passed, the result is also empty.
When passing your succesful algorithm, some random tests will also be applied. Have fun!
Also feel free to reuse/extend the following starter code:
```python
def ROT135(input):
``` | {"functional": "_inputs = [['The quick brown fox jumps over the 2 lazy dogs'], ['Gur dhvpx oebja sbk whzcf bire gur 7 ynml qbtf'], ['1234567890'], ['12_-56789.']]\n_outputs = [['Gur dhvpx oebja sbk whzcf bire gur 7 ynml qbtf'], ['The quick brown fox jumps over the 2 lazy dogs'], ['6789012345'], ['67_-01234.']]\nimport math\ndef _deep_eq(a, b, tol=1e-5):\n if isinstance(a, float) or isinstance(b, float):\n return math.isclose(a, b, rel_tol=tol, abs_tol=tol)\n if isinstance(a, (list, tuple)):\n if len(a) != len(b): return False\n return all(_deep_eq(x, y, tol) for x, y in zip(a, b))\n return a == b\n\nfor i, o in zip(_inputs, _outputs):\n assert _deep_eq(ROT135(*i), o[0])"} | 229 | 271 |
coding | Solve the programming task below in a Python markdown code block.
You have two variables a and b. Consider the following sequence of actions performed with these variables: If a = 0 or b = 0, end the process. Otherwise, go to step 2; If a ≥ 2·b, then set the value of a to a - 2·b, and repeat step 1. Otherwise, go to step 3; If b ≥ 2·a, then set the value of b to b - 2·a, and repeat step 1. Otherwise, end the process.
Initially the values of a and b are positive integers, and so the process will be finite.
You have to determine the values of a and b after the process ends.
-----Input-----
The only line of the input contains two integers n and m (1 ≤ n, m ≤ 10^18). n is the initial value of variable a, and m is the initial value of variable b.
-----Output-----
Print two integers — the values of a and b after the end of the process.
-----Examples-----
Input
12 5
Output
0 1
Input
31 12
Output
7 12
-----Note-----
Explanations to the samples: a = 12, b = 5 $\rightarrow$ a = 2, b = 5 $\rightarrow$ a = 2, b = 1 $\rightarrow$ a = 0, b = 1; a = 31, b = 12 $\rightarrow$ a = 7, b = 12. | {"inputs": ["1 4\n", "2 4\n", "2 1\n", "7 1\n", "4 8\n", "1 2\n", "2 3\n", "1 3\n"], "outputs": ["1 0\n", "2 0\n", "0 1\n", "1 1\n", "4 0\n", "1 0\n", "2 3\n", "1 1\n"]} | 340 | 102 |
coding | Solve the programming task below in a Python markdown code block.
AtCoDeer the deer found N rectangle lying on the table, each with height 1.
If we consider the surface of the desk as a two-dimensional plane, the i-th rectangle i(1≤i≤N) covers the vertical range of [i-1,i] and the horizontal range of [l_i,r_i], as shown in the following figure:
AtCoDeer will move these rectangles horizontally so that all the rectangles are connected.
For each rectangle, the cost to move it horizontally by a distance of x, is x.
Find the minimum cost to achieve connectivity.
It can be proved that this value is always an integer under the constraints of the problem.
-----Constraints-----
- All input values are integers.
- 1≤N≤10^5
- 1≤l_i<r_i≤10^9
-----Partial Score-----
- 300 points will be awarded for passing the test set satisfying 1≤N≤400 and 1≤l_i<r_i≤400.
-----Input-----
The input is given from Standard Input in the following format:
N
l_1 r_1
l_2 r_2
:
l_N r_N
-----Output-----
Print the minimum cost to achieve connectivity.
-----Sample Input-----
3
1 3
5 7
1 3
-----Sample Output-----
2
The second rectangle should be moved to the left by a distance of 2. | {"inputs": ["1\n1 400", "1\n1 400\n", "3\n2 5\n4 6\n2 4", "3\n1 3\n5 8\n1 3", "3\n1 3\n8 8\n1 3", "3\n2 3\n4 4\n2 4", "3\n2 1\n8 8\n1 3", "3\n2 1\n4 9\n1 8"], "outputs": ["0", "0\n", "0\n", "2\n", "5\n", "1\n", "7\n", "3\n"]} | 313 | 146 |
coding | Solve the programming task below in a Python markdown code block.
Roman and Denis are on the trip to the programming competition. Since the trip was long, they soon got bored, and hence decided to came up with something. Roman invented a pizza's recipe, while Denis invented a string multiplication. According to Denis, the result of multiplication (product) of strings $s$ of length $m$ and $t$ is a string $t + s_1 + t + s_2 + \ldots + t + s_m + t$, where $s_i$ denotes the $i$-th symbol of the string $s$, and "+" denotes string concatenation. For example, the product of strings "abc" and "de" is a string "deadebdecde", while the product of the strings "ab" and "z" is a string "zazbz". Note, that unlike the numbers multiplication, the product of strings $s$ and $t$ is not necessarily equal to product of $t$ and $s$.
Roman was jealous of Denis, since he invented such a cool operation, and hence decided to invent something string-related too. Since Roman is beauty-lover, he decided to define the beauty of the string as the length of the longest substring, consisting of only one letter. For example, the beauty of the string "xayyaaabca" is equal to $3$, since there is a substring "aaa", while the beauty of the string "qwerqwer" is equal to $1$, since all neighboring symbols in it are different.
In order to entertain Roman, Denis wrote down $n$ strings $p_1, p_2, p_3, \ldots, p_n$ on the paper and asked him to calculate the beauty of the string $( \ldots (((p_1 \cdot p_2) \cdot p_3) \cdot \ldots ) \cdot p_n$, where $s \cdot t$ denotes a multiplication of strings $s$ and $t$. Roman hasn't fully realized how Denis's multiplication works, so he asked you for a help. Denis knows, that Roman is very impressionable, he guarantees, that the beauty of the resulting string is at most $10^9$.
-----Input-----
The first line contains a single integer $n$ ($2 \leq n \leq 100\,000$) — the number of strings, wroted by Denis.
Next $n$ lines contain non-empty strings $p_1, p_2, \ldots, p_n$, consisting of lowercase english letters.
It's guaranteed, that the total length of the strings $p_i$ is at most $100\,000$, and that's the beauty of the resulting product is at most $10^9$.
-----Output-----
Print exactly one integer — the beauty of the product of the strings.
-----Examples-----
Input
3
a
b
a
Output
3
Input
2
bnn
a
Output
1
-----Note-----
In the first example, the product of strings is equal to "abaaaba".
In the second example, the product of strings is equal to "abanana". | {"inputs": ["3\na\nb\na\n", "2\nbnn\na\n", "2\nnbn\na\n", "2\nbnn\na\n", "3\na\nb\na\n", "6\nw\ng\nc\nj\ny\nf\n", "6\nw\ng\nc\nj\ny\nf\n", "6\nw\nh\nc\nj\ny\nf\n"], "outputs": ["3\n", "1\n", "1\n", "1", "3", "1\n", "1", "1\n"]} | 680 | 130 |
coding | Solve the programming task below in a Python markdown code block.
Vasya came up with a password to register for EatForces — a string s. The password in EatForces should be a string, consisting of lowercase and uppercase Latin letters and digits.
But since EatForces takes care of the security of its users, user passwords must contain at least one digit, at least one uppercase Latin letter and at least one lowercase Latin letter. For example, the passwords "abaCABA12", "Z7q" and "3R24m" are valid, and the passwords "qwerty", "qwerty12345" and "Password" are not.
A substring of string s is a string x = s_l s_{l + 1} ... s_{l + len - 1} (1 ≤ l ≤ |s|, 0 ≤ len ≤ |s| - l + 1). len is the length of the substring. Note that the empty string is also considered a substring of s, it has the length 0.
Vasya's password, however, may come too weak for the security settings of EatForces. He likes his password, so he wants to replace some its substring with another string of the same length in order to satisfy the above conditions. This operation should be performed exactly once, and the chosen string should have the minimal possible length.
Note that the length of s should not change after the replacement of the substring, and the string itself should contain only lowercase and uppercase Latin letters and digits.
Input
The first line contains a single integer T (1 ≤ T ≤ 100) — the number of testcases.
Each of the next T lines contains the initial password s~(3 ≤ |s| ≤ 100), consisting of lowercase and uppercase Latin letters and digits.
Only T = 1 is allowed for hacks.
Output
For each testcase print a renewed password, which corresponds to given conditions.
The length of the replaced substring is calculated as following: write down all the changed positions. If there are none, then the length is 0. Otherwise the length is the difference between the first and the last changed position plus one. For example, the length of the changed substring between the passwords "abcdef" → "a7cdEf" is 4, because the changed positions are 2 and 5, thus (5 - 2) + 1 = 4.
It is guaranteed that such a password always exists.
If there are several suitable passwords — output any of them.
Example
Input
2
abcDCE
htQw27
Output
abcD4E
htQw27
Note
In the first example Vasya's password lacks a digit, he replaces substring "C" with "4" and gets password "abcD4E". That means, he changed the substring of length 1.
In the second example Vasya's password is ok from the beginning, and nothing has to be changed. That is the same as replacing the empty substring with another empty substring (length 0). | {"inputs": ["1\nA00\n", "1\na00\n", "1\n825\n", "1\n000\n", "1\n0a0\n", "1\n0aa\n", "1\n00A\n", "1\n001\n"], "outputs": ["Aa0\n", "aA0\n", "aA5\n", "aA0\n", "Aa0\n", "0Aa\n", "a0A\n", "aA1\n"]} | 644 | 117 |
coding | Solve the programming task below in a Python markdown code block.
Chef's computer has N GB of free space. He wants to save X files, each of size 1 GB and Y files, each of size 2 GB on his computer. Will he be able to do so?
Chef can save all the files on his computer only if the total size of the files is less than or equal to the space available on his computer.
------ Input Format ------
- The first line contains an integer T, denoting the number of test cases. The T test cases then follow:
- The first and only line of each test case contains three integers N, X, Y, denoting the free-space in computer, the number of 1 and 2 GB files respectively.
------ Output Format ------
For each test case, print YES if Chef is able to save the files and NO otherwise.
You may print each character of the string in uppercase or lowercase (for example, the strings yEs, yes, Yes and YES will all be treated as identical).
------ Constraints ------
$1 ≤ T ≤ 100$
$1 ≤ N, X, Y ≤ 100$
----- Sample Input 1 ------
4
6 3 1
2 2 2
4 3 2
5 1 2
----- Sample Output 1 ------
YES
NO
NO
YES
----- explanation 1 ------
Test case $1$: The total size of files is $3 + 1 \cdot 2 =5$, which is smaller than the remaining space on the computer. Thus Chef will be able to save all the files.
Test case $2$: The total size of files is $2 + 2 \cdot 2 =6$, which is greater than the remaining space on the computer. Thus Chef will not be able to save all the files.
Test case $3$: The total size of files is $3 + 2 \cdot 2 =7$, which is greater than the remaining space on the computer. Thus Chef will not be able to save all the files.
Test case $4$: The total size of files is $1 + 2 \cdot 2 =5$, which is equal to the remaining space on the computer. Thus Chef will be able to save all the files. | {"inputs": ["4\n6 3 1\n2 2 2\n4 3 2\n5 1 2\n"], "outputs": ["YES\nNO\nNO\nYES\n"]} | 481 | 44 |
coding | Please solve the programming task below using a self-contained code snippet in a markdown code block.
You are given a 2D array of axis-aligned rectangles. Each rectangle[i] = [xi1, yi1, xi2, yi2] denotes the ith rectangle where (xi1, yi1) are the coordinates of the bottom-left corner, and (xi2, yi2) are the coordinates of the top-right corner.
Calculate the total area covered by all rectangles in the plane. Any area covered by two or more rectangles should only be counted once.
Return the total area. Since the answer may be too large, return it modulo 109 + 7.
Please complete the following python code precisely:
```python
class Solution:
def rectangleArea(self, rectangles: List[List[int]]) -> int:
``` | {"functional": "def check(candidate):\n assert candidate(rectangles = [[0,0,2,2],[1,0,2,3],[1,0,3,1]]) == 6\n assert candidate(rectangles = [[0,0,1000000000,1000000000]]) == 49\n\n\ncheck(Solution().rectangleArea)"} | 168 | 92 |
coding | Solve the programming task below in a Python markdown code block.
Read problem statements in [Hindi], [Bengali], [Mandarin Chinese], [Russian], and [Vietnamese] as well.
Chef has always dreamed of becoming an employee of the "Hack and Manipulate Group". Their work is simple ― attacking networks. They gave Chef the following task to assess his programming skills, but Chef is too busy cooking "Vegetable Gourmet". Can you solve the task for him?
A network consists of $N$ nodes (numbered $1$ through $N$) and $M$ bidirectional connections between pairs of these nodes. A *robust network* is a network that contains a cycle. Shutting down a node means removing that node (and all direct connections it is part of) from the network.
You may shut down at most one node. If the network was robust before it was shut down and is not robust afterwards, this node is called the *point of failure*.
Is the initial network robust? If it is robust, does it have a point of failure? If it does, find the point of failure with the smallest number.
------ Input ------
The first line of the input contains a single integer $T$ denoting the number of test cases. The description of $T$ test cases follows.
The first line of each test case contains two space-separated integers $N$ and $M$.
Each of the following $M$ lines contains two space-separated integers $u$ and $v$ denoting that nodes $u$ and $v$ are directly connected.
------ Output ------
For each test case, print a single line containing one integer ― the smallest number of a point of failure, or $-1$ if the network does not have a point of failure.
------ Constraints ------
$1 ≤ T ≤ 10$
$1 ≤ N ≤ 10^{5}$
$0 ≤ M ≤ 10^{5}$
$1 ≤ u, v ≤ N$
------ Subtasks ------
Subtask #1 (10 points):
$N ≤ 100$
$N - 1 ≤ M ≤ N + 1$
the given graph is connected
Subtask #2 (10 points): $1 ≤ N ≤ 100$
Subtask #3 (30 points): $1 ≤ N ≤ 1,000$
Subtask #4 (50 points): original constraints
----- Sample Input 1 ------
5
5 5
5 1
5 2
1 2
2 3
2 4
5 6
4 5
4 1
4 2
4 3
5 1
5 2
5 5
3 4
3 5
3 1
3 2
4 2
4 1
3 4
6 6
1 2
2 3
3 1
4 5
5 6
6 4
----- Sample Output 1 ------
1
4
2
-1
-1 | {"inputs": ["5\n5 5\n5 1\n5 2\n1 2\n2 3\n2 4\n5 6\n4 5\n4 1\n4 2\n4 3\n5 1\n5 2\n5 5\n3 4\n3 5\n3 1\n3 2\n4 2\n4 1\n3 4\n6 6\n1 2\n2 3\n3 1\n4 5\n5 6\n6 4"], "outputs": ["1\n4\n2\n-1\n-1"]} | 653 | 134 |
coding | Solve the programming task below in a Python markdown code block.
Last year Bob earned by selling memory sticks. During each of n days of his work one of the two following events took place:
* A customer came to Bob and asked to sell him a 2x MB memory stick. If Bob had such a stick, he sold it and got 2x berllars.
* Bob won some programming competition and got a 2x MB memory stick as a prize. Bob could choose whether to present this memory stick to one of his friends, or keep it.
Bob never kept more than one memory stick, as he feared to mix up their capacities, and deceive a customer unintentionally. It is also known that for each memory stick capacity there was at most one customer, who wanted to buy that memory stick. Now, knowing all the customers' demands and all the prizes won at programming competitions during the last n days, Bob wants to know, how much money he could have earned, if he had acted optimally.
Input
The first input line contains number n (1 ≤ n ≤ 5000) — amount of Bob's working days. The following n lines contain the description of the days. Line sell x stands for a day when a customer came to Bob to buy a 2x MB memory stick (0 ≤ x ≤ 2000). It's guaranteed that for each x there is not more than one line sell x. Line win x stands for a day when Bob won a 2x MB memory stick (0 ≤ x ≤ 2000).
Output
Output the maximum possible earnings for Bob in berllars, that he would have had if he had known all the events beforehand. Don't forget, please, that Bob can't keep more than one memory stick at a time.
Examples
Input
7
win 10
win 5
win 3
sell 5
sell 3
win 10
sell 10
Output
1056
Input
3
win 5
sell 6
sell 4
Output
0 | {"inputs": ["1\nsell 17\n", "1\nsell 31\n", "1\nwin 2000\n", "1\nsell 104\n", "1\nsell 2000\n", "2\nwin 2000\nsell 238\n", "2\nwin 2000\nsell 315\n", "2\nwin 2000\nsell 350\n"], "outputs": ["0\n", "0\n", "0", "0\n", "0", "0\n", "0\n", "0\n"]} | 440 | 137 |
coding | Solve the programming task below in a Python markdown code block.
Mathematician Shikhar has invented a new type of fibonacci series in which
fib(1)=a
fib(2)=b
fib(n)=(fib(n-1)+fib(n-2))%1000000007 for all n>2
and now help him find the nth term of this series.
Input contains 3 space separated integers a,b and n.
Input
2 4 35
NOTE You do not need to create a program for this problem you have to write your answers of small input and large input in given code snippet.
To see how to submit solution please check this link
SAMPLE INPUT
2 3 3
SAMPLE OUTPUT
5 | {"inputs": ["2 4 35"], "outputs": ["29860704"]} | 160 | 24 |
coding | Solve the programming task below in a Python markdown code block.
We have a rectangular grid of squares with H horizontal rows and W vertical columns. Let (i,j) denote the square at the i-th row from the top and the j-th column from the left. On this grid, there is a piece, which is initially placed at square (s_r,s_c).
Takahashi and Aoki will play a game, where each player has a string of length N. Takahashi's string is S, and Aoki's string is T. S and T both consist of four kinds of letters: `L`, `R`, `U` and `D`.
The game consists of N steps. The i-th step proceeds as follows:
* First, Takahashi performs a move. He either moves the piece in the direction of S_i, or does not move the piece.
* Second, Aoki performs a move. He either moves the piece in the direction of T_i, or does not move the piece.
Here, to move the piece in the direction of `L`, `R`, `U` and `D`, is to move the piece from square (r,c) to square (r,c-1), (r,c+1), (r-1,c) and (r+1,c), respectively. If the destination square does not exist, the piece is removed from the grid, and the game ends, even if less than N steps are done.
Takahashi wants to remove the piece from the grid in one of the N steps. Aoki, on the other hand, wants to finish the N steps with the piece remaining on the grid. Determine if the piece will remain on the grid at the end of the game when both players play optimally.
Constraints
* 2 \leq H,W \leq 2 \times 10^5
* 2 \leq N \leq 2 \times 10^5
* 1 \leq s_r \leq H
* 1 \leq s_c \leq W
* |S|=|T|=N
* S and T consists of the four kinds of letters `L`, `R`, `U` and `D`.
Input
Input is given from Standard Input in the following format:
H W N
s_r s_c
S
T
Output
If the piece will remain on the grid at the end of the game, print `YES`; otherwise, print `NO`.
Examples
Input
2 3 3
2 2
RRL
LUD
Output
YES
Input
4 3 5
2 2
UDRRR
LLDUD
Output
NO
Input
5 6 11
2 1
RLDRRUDDLRL
URRDRLLDLRD
Output
NO | {"inputs": ["2 3 3\n2 2\nRLR\nLUD", "2 6 3\n2 2\nRLR\nLUD", "2 3 3\n2 0\nRRL\nLUD", "2 5 3\n2 2\nRLR\nLUD", "2 6 3\n1 2\nRLR\nLUD", "2 3 3\n2 1\nRRL\nLUD", "2 5 3\n2 4\nRLR\nLUD", "2 6 3\n1 0\nRLR\nLUD"], "outputs": ["YES\n", "YES\n", "NO\n", "YES\n", "YES\n", "NO\n", "YES\n", "NO\n"]} | 595 | 174 |
coding | Solve the programming task below in a Python markdown code block.
Welcome to PC Koshien, players. At PC Koshien, competitions are currently being held in a total of three categories: programming category, mobile category, and Ichimai's picture CG category.
Given the number of participants in each department, create a program that calculates the total number of participants.
Input
The input is given in the following format.
p m c
The input is one line, the number of participants in the programming department p (0 ≤ p ≤ 10000), the number of participants in the mobile department m (0 ≤ m ≤ 10000), the number of participants in the Ichimai picture CG department c (0) ≤ c ≤ 10000) is given.
Output
Output the total number of participants on one line.
Examples
Input
10 10 20
Output
40
Input
100 0 0
Output
100
Input
1000 1000 1000
Output
3000 | {"inputs": ["8 4 1", "8 8 1", "3 7 1", "6 7 1", "6 0 1", "2 1 1", "2 2 1", "10 4 1"], "outputs": ["13\n", "17\n", "11\n", "14\n", "7\n", "4\n", "5\n", "15\n"]} | 236 | 100 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.