answer
stringlengths
17
10.2M
package com.philihp.weblabora.model; import static com.philihp.weblabora.model.TerrainTypeEnum.*; import java.lang.reflect.Constructor; import java.lang.reflect.InvocationTargetException; import java.util.List; import com.philihp.weblabora.model.building.*; public class CommandUse implements MoveCommand, InvalidDuringSettlement { @Override public void execute(Board board, CommandParameters params) throws WeblaboraException { String buildingId = params.get(0); UsageParam usageParam = null; boolean usingPrior = params.getSuffix().contains("*"); switch (params.size()) { case 1: usageParam = new UsageParam(""); break; case 2: usageParam = new UsageParam(params.get(1)); break; default: usageParam = new UsageParam(""); Integer x = null; for (int i = 1; i < params.size(); i++) { if(x == null) { x = Integer.parseInt(params.get(i)); } else { usageParam.pushCoordinate( x, Integer.parseInt(params.get(i))); x = null; } } if(x != null) { throw new WeblaboraException("Coordinate building usage parameters must come in pairs. Parsed "+x+" for the x, but no y number."); } break; } execute(board, BuildingEnum.valueOf(buildingId), usageParam, usingPrior, params.getPlaceClergyman()); System.out.println("Using " + buildingId + " with " + usageParam); } public static void execute(Board board, BuildingEnum buildingId, UsageParam param, boolean usingPrior, boolean placeClergyman) throws WeblaboraException { Building building = board.findBuildingInstance(buildingId); Player buildingOwner = building.getLocation().getLandscape().getPlayer(); Terrain location = building.getLocation(); if (placeClergyman) { if (usingPrior) { buildingOwner.placePrior(location); } else { buildingOwner.placeClergyman(location); } } building.use(board, param); } }
package com.redhat.ceylon.compiler.js; import java.io.BufferedReader; import java.io.File; import java.io.FileInputStream; import java.io.FileOutputStream; import java.io.FileReader; import java.io.IOException; import java.io.InputStreamReader; import java.io.PrintWriter; import java.nio.channels.FileChannel; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import java.util.Map; import net.minidev.json.JSONObject; import net.minidev.json.JSONValue; import com.redhat.ceylon.cmr.ceylon.CeylonUtils; import com.redhat.ceylon.cmr.impl.JULLogger; import com.redhat.ceylon.cmr.impl.ShaSigner; import com.redhat.ceylon.compiler.Options; import com.redhat.ceylon.compiler.loader.JsModuleManagerFactory; import com.redhat.ceylon.compiler.typechecker.TypeChecker; import com.redhat.ceylon.compiler.typechecker.TypeCheckerBuilder; import com.redhat.ceylon.compiler.typechecker.context.PhasedUnit; import com.redhat.ceylon.compiler.typechecker.tree.Message; /** A simple program that takes the main JS module file and replaces #include markers with the contents of other files. * * @author Enrique Zamudio */ public class Stitcher { private static String VERSION=" public static void copyFile(File sourceFile, File destFile) throws IOException { if (!destFile.exists()) { destFile.createNewFile(); } try (FileInputStream fIn = new FileInputStream(sourceFile); FileChannel source = fIn.getChannel(); FileOutputStream fOut = new FileOutputStream(destFile); FileChannel destination = fOut.getChannel()) { long transfered = 0; long bytes = source.size(); while (transfered < bytes) { transfered += destination.transferFrom(source, 0, source.size()); destination.position(transfered); } } finally { } } private static void compileLanguageModule(List<String> sources, PrintWriter writer, String clmod) throws IOException { final File clSrcDir = new File("../ceylon.language/src/ceylon/language/"); final File clSrcDirJs = new File("../ceylon.language/runtime-js"); File tmpdir = File.createTempFile("ceylonjs", "clsrc"); tmpdir.delete(); tmpdir = new File(tmpdir.getAbsolutePath()); tmpdir.mkdir(); tmpdir.deleteOnExit(); final File tmpout = new File(tmpdir, "modules"); tmpout.mkdir(); tmpout.deleteOnExit(); Options opts = Options.parse(new ArrayList<String>(Arrays.asList( "-rep", "build/runtime", "-nocomments", "-optimize", "-out", tmpout.getAbsolutePath(), "-nomodule"))); //Typecheck the whole language module System.out.println("Compiling language module from Ceylon source"); TypeCheckerBuilder tcb = new TypeCheckerBuilder().addSrcDirectory(clSrcDir.getParentFile().getParentFile()) .addSrcDirectory(new File(clSrcDir.getParentFile().getParentFile().getParentFile(), "runtime-js")); tcb.setRepositoryManager(CeylonUtils.repoManager().systemRepo(opts.getSystemRepo()) .userRepos(opts.getRepos()).outRepo(opts.getOutDir()).buildManager()); //This is to use the JSON metamodel JsModuleManagerFactory.setVerbose(true); tcb.moduleManagerFactory(new JsModuleManagerFactory((Map<String,Object>)JSONValue.parse(clmod))); TypeChecker tc = tcb.getTypeChecker(); tc.process(); if (tc.getErrors() > 0) { System.exit(1); } for (String line : sources) { //Compile these files System.out.println("Compiling " + line); final List<String> includes = new ArrayList<String>(); for (String filename : line.split(",")) { final boolean isJsSrc = filename.trim().endsWith(".js"); final File src = new File(isJsSrc ? clSrcDirJs : clSrcDir, isJsSrc ? filename.trim() : String.format("%s.ceylon", filename.trim())); if (src.exists() && src.isFile() && src.canRead()) { includes.add(src.getPath()); } else { throw new IllegalArgumentException("Invalid Ceylon language module source " + src); } } //Compile only the files specified in the line //Set this before typechecking to share some decls that otherwise would be private JsCompiler.compilingLanguageModule=true; JsCompiler jsc = new JsCompiler(tc, opts).stopOnErrors(false); jsc.setFiles(includes); jsc.generate(); File compsrc = new File(tmpout, String.format("ceylon/language/%s/ceylon.language-%<s.js", VERSION)); if (compsrc.exists() && compsrc.isFile() && compsrc.canRead()) { try (BufferedReader jsr = new BufferedReader(new FileReader(compsrc))) { String jsline = null; while ((jsline = jsr.readLine()) != null) { if (!jsline.contains("=require('")) { writer.println(jsline); } } } finally { compsrc.delete(); } } else { System.out.println("WTF??? No generated js for language module!!!!"); System.exit(1); } } } private static void stitch(File infile, PrintWriter writer, List<String> sourceFiles) throws IOException { BufferedReader reader = new BufferedReader(new InputStreamReader(new FileInputStream(infile), "UTF-8")); try { String line = null; String clModel = null; while ((line = reader.readLine()) != null) { line = line.trim(); if (line.length() > 0) { if (line.equals("//#METAMODEL")) { System.out.println("Generating language module metamodel in JSON..."); TypeCheckerBuilder tcb = new TypeCheckerBuilder().usageWarnings(false); tcb.addSrcDirectory(new File("../ceylon.language/src")); TypeChecker tc = tcb.getTypeChecker(); tc.process(); MetamodelVisitor mmg = null; for (PhasedUnit pu : tc.getPhasedUnits().getPhasedUnits()) { if (!pu.getCompilationUnit().getErrors().isEmpty()) { System.out.println("whoa, errors in the language module " + pu.getCompilationUnit().getLocation()); for (Message err : pu.getCompilationUnit().getErrors()) { System.out.println(err.getMessage()); } } if (mmg == null) { mmg = new MetamodelVisitor(pu.getPackage().getModule()); } pu.getCompilationUnit().visit(mmg); } writer.print("var $$METAMODEL$$="); clModel = JSONObject.toJSONString(mmg.getModel()); writer.print(clModel); writer.println(";"); writer.flush(); } else if (line.equals("//#COMPILED")) { System.out.println("Compiling language module sources"); compileLanguageModule(sourceFiles, writer, clModel); } else if (!line.endsWith("//IGNORE")) { writer.println(line); } } } } finally { if (reader != null) reader.close(); } } public static void main(String[] args) throws IOException { if (args.length < 3) { System.err.println("This program requires 3 arguments to run:"); System.err.println("1. The path to the main JS file"); System.err.println("2. The path to the list of language module files to compile from Ceylon source"); System.err.println("3. The path of the resulting JS file"); System.exit(1); return; } File infile = new File(args[0]); if (infile.exists() && infile.isFile() && infile.canRead()) { File outfile = new File(args[2]); if (!outfile.getParentFile().exists()) { outfile.getParentFile().mkdirs(); } VERSION=outfile.getParentFile().getName(); ArrayList<String> clsrc = new ArrayList<String>(); File clSourcesPath = new File(args[1]); if (!(clSourcesPath.exists() && clSourcesPath.isFile() && clSourcesPath.canRead())) { throw new IllegalArgumentException("Invalid language module sources list " + args[2]); } try (BufferedReader listReader = new BufferedReader(new FileReader(clSourcesPath))) { String line; //Copy the files to a temporary dir while ((line = listReader.readLine()) != null) { if (!line.startsWith("#") && line.length() > 0) { clsrc.add(line); } } } finally { } try (PrintWriter writer = new PrintWriter(outfile, "UTF-8")) { stitch(infile, writer, clsrc); } finally { ShaSigner.sign(outfile, new JULLogger(), true); } } else { System.err.println("Input file is invalid: " + infile); System.exit(2); } } }
package com.softserverinc.edu.entities; import org.apache.commons.lang3.builder.EqualsBuilder; import org.apache.commons.lang3.builder.HashCodeBuilder; import org.apache.commons.lang3.builder.ToStringBuilder; import org.apache.commons.lang3.builder.ToStringStyle; import javax.persistence.*; import java.util.Date; @Entity public class WorkLog { @Id @GeneratedValue @Column(unique = true, nullable = false) private Long id; @ManyToOne @JoinColumn(name = "issueId" ,referencedColumnName = "id", nullable = false) private Issue issue; @ManyToOne @JoinColumn(name = "userId", referencedColumnName = "id", nullable = false) private User user; @Column(nullable = false) private Date time; @Column(name = "amount") private Long amount; public WorkLog() { } public Long getId() { return id; } public void setId(Long id) { this.id = id; } public Issue getIssue() { return issue; } public void setIssueId(Issue issueId) { this.issue = issueId; } public User getUserId() { return user; } public void setUserId(User userId) { this.user = userId; } public Date getTime() { return time; } public void setTime(Date time) { this.time = time; } public Long getAmount() { return amount; } public void setAmount(Long amount) { this.amount = amount; } @Override public boolean equals(Object obj) { return EqualsBuilder.reflectionEquals(this, obj); } @Override public int hashCode() { return HashCodeBuilder.reflectionHashCode(this); } @Override public String toString() { return ToStringBuilder.reflectionToString(this, ToStringStyle.MULTI_LINE_STYLE); } }
package com.stackmob.customcode; import com.stackmob.core.InvalidSchemaException; import com.stackmob.core.DatastoreException; import com.stackmob.core.customcode.CustomCodeMethod; import com.stackmob.core.rest.ProcessedAPIRequest; import com.stackmob.core.rest.ResponseToProcess; import com.stackmob.sdkapi.SDKServiceProvider; import com.stackmob.sdkapi.*; import java.net.HttpURLConnection; import java.util.*; import com.stripe.model.Customer; public class CreateCustomer implements CustomCodeMethod { @Override public String getMethodName() { return "createCustomer"; } @Override public List<String> getParams() { return Arrays.asList("token", "username"); } @Override public ResponseToProcess execute(ProcessedAPIRequest request, SDKServiceProvider serviceProvider) { DataService ds = serviceProvider.getDataService(); List<SMCondition> query = new ArrayList<SMCondition>(); Map<String, List<SMObject>> results = new HashMap<String, List<SMObject>>(); String username = request.getParams().get("username"); try { query.add(new SMEquals("username", new SMString(username))); results.put("results", ds.readObjects("pnuser", query)); } catch (InvalidSchemaException ise) { } catch (DatastoreException dse) {} return new ResponseToProcess(HttpURLConnection.HTTP_OK, results); } }
package com.tterrag.k9.mappings.srg; import java.io.IOException; import java.util.ArrayList; import java.util.Collections; import java.util.List; import java.util.Set; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import org.apache.commons.io.IOUtils; import com.google.common.base.Charsets; import com.google.common.collect.Sets; import com.tterrag.k9.mappings.MappingType; import com.tterrag.k9.mappings.NameType; import com.tterrag.k9.mappings.Parser; import com.tterrag.k9.mappings.SignatureHelper; import com.tterrag.k9.util.annotation.NonNull; import com.tterrag.k9.util.annotation.Nullable; import lombok.RequiredArgsConstructor; @RequiredArgsConstructor public class TsrgParser implements Parser<ZipFile, SrgMapping> { private static final SignatureHelper sigHelper = new SignatureHelper(); private final SrgDatabase db; @Override public List<SrgMapping> parse(ZipFile zip) throws IOException { Set<String> staticMethods; List<String> lines; try { ZipEntry staticMethodsEntry = zip.getEntry("config/static_methods.txt"); // This file no longer exists in tsrgv2 versions (starting at 1.17) if (staticMethodsEntry != null) { staticMethods = Sets.newHashSet(IOUtils.readLines(zip.getInputStream(staticMethodsEntry), Charsets.UTF_8)); } else { staticMethods = Collections.emptySet(); } lines = IOUtils.readLines(zip.getInputStream(zip.getEntry("config/joined.tsrg")), Charsets.UTF_8); } finally { zip.close(); } List<SrgMapping> ret = new ArrayList<>(); SrgMapping currentClass = null; int fieldNumber = 2; for (String line : lines) { SrgMapping mapping; if (line.startsWith("tsrg2 ")) { // TSRGv2 support, skip header line and check that this is standard name set if (!line.startsWith("tsrg2 obf srg")) { throw new UnsupportedOperationException("Custom names in tsrgv2 is not supported yet"); } // So we can support extra names on the end, e.g. "obf srg id" which is present in newer MCPConfig exports fieldNumber = line.split(" ").length - 1; continue; } if (!line.startsWith("\t")) { String[] names = line.split(" "); mapping = currentClass = new SrgMapping(db, MappingType.CLASS, names[0], names[1], null, null, null); } else if (!line.startsWith("\t\t")) { String[] data = line.substring(1).split(" "); if (data.length == fieldNumber) { mapping = new SrgMapping(db, MappingType.FIELD, data[0], data[1], null, null, currentClass.getIntermediate()); } else { // TSRGv2 Support MappingType type = data[1].startsWith("(") ? MappingType.METHOD : MappingType.FIELD; mapping = new SrgMapping(db, type, data[0], data[2], data[1], null, currentClass.getIntermediate()) { private @Nullable String srgDesc; @Override public @NonNull String getIntermediateDesc() { if (srgDesc == null) { srgDesc = sigHelper.mapSignature(NameType.INTERMEDIATE, getOriginalDesc(), this, db); } return srgDesc; } }; if (staticMethods.contains(data[2])) { mapping.setStatic(true); } } } else { if (line.trim().equals("static")) { // Mark the previous method mapping as static ret.get(ret.size() - 1).setStatic(true); } // NO-OP (params) continue; } ret.add(mapping); } return ret; } }
package com.wrapper.spotify; import com.google.gson.JsonObject; import com.google.gson.JsonParser; import com.wrapper.spotify.exceptions.SpotifyWebApiException; import com.wrapper.spotify.exceptions.detailed.*; import org.apache.http.*; import org.apache.http.auth.AuthScope; import org.apache.http.auth.UsernamePasswordCredentials; import org.apache.http.client.CredentialsProvider; import org.apache.http.client.cache.CacheResponseStatus; import org.apache.http.client.cache.HttpCacheContext; import org.apache.http.client.config.CookieSpecs; import org.apache.http.client.config.RequestConfig; import org.apache.http.client.entity.UrlEncodedFormEntity; import org.apache.http.client.methods.*; import org.apache.http.config.ConnectionConfig; import org.apache.http.impl.client.BasicCredentialsProvider; import org.apache.http.impl.client.CloseableHttpClient; import org.apache.http.impl.client.cache.CacheConfig; import org.apache.http.impl.client.cache.CachingHttpClients; import org.apache.http.util.EntityUtils; import java.io.IOException; import java.net.URI; import java.nio.charset.Charset; import java.util.List; import java.util.logging.Level; public class SpotifyHttpManager implements IHttpManager { private static final int DEFAULT_CACHE_MAX_ENTRIES = 1000; private static final int DEFAULT_CACHE_MAX_OBJECT_SIZE = 8192; private final HttpHost proxy; private final UsernamePasswordCredentials proxyCredentials; private final Integer cacheMaxEntries; private final Integer cacheMaxObjectSize; private static CloseableHttpClient httpClient = CachingHttpClients.custom().build(); /** * Construct a new SpotifyHttpManager instance. * * @param builder The builder. */ public SpotifyHttpManager(Builder builder) { this.proxy = builder.proxy; this.proxyCredentials = builder.proxyCredentials; this.cacheMaxEntries = builder.cacheMaxEntries; this.cacheMaxObjectSize = builder.cacheMaxObjectSize; CacheConfig cacheConfig = CacheConfig.custom() .setMaxCacheEntries(cacheMaxEntries != null ? cacheMaxEntries : DEFAULT_CACHE_MAX_ENTRIES) .setMaxObjectSize(cacheMaxEntries != null ? cacheMaxEntries : DEFAULT_CACHE_MAX_OBJECT_SIZE) .setSharedCache(false) .build(); ConnectionConfig connectionConfig = ConnectionConfig .custom() .setCharset(Charset.forName("UTF-8")) .build(); new BasicCredentialsProvider(); CredentialsProvider credentialsProvider = new BasicCredentialsProvider(); if (proxy != null) { credentialsProvider.setCredentials( new AuthScope(proxy.getHostName(), proxy.getPort(), null, proxy.getSchemeName()), proxyCredentials ); } RequestConfig requestConfig = RequestConfig .custom() .setCookieSpec(CookieSpecs.DEFAULT) .setProxy(proxy) .build(); httpClient = CachingHttpClients .custom() .setCacheConfig(cacheConfig) .setDefaultConnectionConfig(connectionConfig) .setDefaultCredentialsProvider(credentialsProvider) .setDefaultRequestConfig(requestConfig) .build(); } public HttpHost getProxy() { return proxy; } public UsernamePasswordCredentials getProxyCredentials() { return proxyCredentials; } public Integer getCacheMaxEntries() { return cacheMaxEntries; } public Integer getCacheMaxObjectSize() { return cacheMaxObjectSize; } @Override public String get(URI uri, Header[] headers) throws IOException, SpotifyWebApiException { assert (uri != null); assert (headers != null); final HttpGet httpGet = new HttpGet(); httpGet.setURI(uri); httpGet.setHeaders(headers); String responseBody = getResponseBody(execute(httpGet)); httpGet.releaseConnection(); return responseBody; } @Override public String post(URI uri, Header[] headers, List<NameValuePair> postParameters) throws IOException, SpotifyWebApiException { assert (uri != null); assert (headers != null); assert (postParameters != null); final HttpPost httpPost = new HttpPost(); httpPost.setURI(uri); httpPost.setHeaders(headers); httpPost.setEntity(new UrlEncodedFormEntity(postParameters)); String responseBody = getResponseBody(execute(httpPost)); httpPost.releaseConnection(); return responseBody; } @Override public String put(URI uri, Header[] headers, List<NameValuePair> putParameters) throws IOException, SpotifyWebApiException { assert (uri != null); assert (headers != null); assert (putParameters != null); final HttpPut httpPut = new HttpPut(); httpPut.setURI(uri); httpPut.setHeaders(headers); httpPut.setEntity(new UrlEncodedFormEntity(putParameters)); String responseBody = getResponseBody(execute(httpPut)); httpPut.releaseConnection(); return responseBody; } @Override public String delete(URI uri, Header[] headers) throws IOException, SpotifyWebApiException { assert (uri != null); assert (headers != null); final HttpDelete httpDelete = new HttpDelete(); httpDelete.setURI(uri); httpDelete.setHeaders(headers); String responseBody = getResponseBody(execute(httpDelete)); httpDelete.releaseConnection(); return responseBody; } private HttpResponse execute(HttpRequestBase method) throws IOException { HttpCacheContext context = HttpCacheContext.create(); HttpResponse response = httpClient.execute(method, context); try { CacheResponseStatus responseStatus = context.getCacheResponseStatus(); switch (responseStatus) { case CACHE_HIT: SpotifyApi.LOGGER.log( Level.CONFIG, "A response was generated from the cache with no requests sent upstream"); break; case CACHE_MODULE_RESPONSE: SpotifyApi.LOGGER.log( Level.CONFIG, "The response was generated directly by the caching module"); break; case CACHE_MISS: SpotifyApi.LOGGER.log( Level.CONFIG, "The response came from an upstream server"); break; case VALIDATED: SpotifyApi.LOGGER.log( Level.CONFIG, "The response was generated from the cache after validating the entry with the origin server"); break; } } catch (Exception e) { e.printStackTrace(); } return response; } private String getResponseBody(HttpResponse httpResponse) throws IOException, SpotifyWebApiException { final StatusLine statusLine = httpResponse.getStatusLine(); final String responseBody = EntityUtils.toString(httpResponse.getEntity(), "UTF-8"); final JsonObject jsonObject = new JsonParser().parse(responseBody).getAsJsonObject(); final String errorMessage; if (jsonObject.has("error") && jsonObject.get("error").getAsJsonObject().has("message")) { errorMessage = jsonObject.getAsJsonObject("error").get("message").getAsString(); } else { errorMessage = statusLine.getReasonPhrase(); } switch (statusLine.getStatusCode()) { case HttpStatus.SC_OK: return responseBody; case HttpStatus.SC_CREATED: return responseBody; case HttpStatus.SC_ACCEPTED: return responseBody; case HttpStatus.SC_NO_CONTENT: throw new NoContentException(statusLine.getReasonPhrase()); case HttpStatus.SC_NOT_MODIFIED: return responseBody; case HttpStatus.SC_BAD_REQUEST: throw new BadRequestException(errorMessage); case HttpStatus.SC_UNAUTHORIZED: throw new UnauthorizedException(errorMessage); case HttpStatus.SC_FORBIDDEN: throw new ForbiddenException(errorMessage); case HttpStatus.SC_NOT_FOUND: throw new NotFoundException(errorMessage); case 429: // TOO_MANY_REQUESTS (additional status code, RFC 6585) throw new TooManyRequestsException(errorMessage); case HttpStatus.SC_INTERNAL_SERVER_ERROR: throw new InternalServerErrorException(errorMessage); case HttpStatus.SC_BAD_GATEWAY: throw new BadGatewayException(errorMessage); case HttpStatus.SC_SERVICE_UNAVAILABLE: throw new ServiceUnavailableException(errorMessage); default: return responseBody; } } public static class Builder { private HttpHost proxy; private UsernamePasswordCredentials proxyCredentials; private Integer cacheMaxEntries; private Integer cacheMaxObjectSize; public Builder setProxy(HttpHost proxy) { this.proxy = proxy; return this; } public Builder setProxyCredentials(UsernamePasswordCredentials proxyCredentials) { this.proxyCredentials = proxyCredentials; return this; } public Builder setCacheMaxEntries(Integer cacheMaxEntries) { this.cacheMaxEntries = cacheMaxEntries; return this; } public Builder setCacheMaxObjectSize(Integer cacheMaxObjectSize) { this.cacheMaxObjectSize = cacheMaxObjectSize; return this; } public SpotifyHttpManager build() { return new SpotifyHttpManager(this); } } }
package com.xiaogua.better.file; import java.io.BufferedInputStream; import java.io.BufferedReader; import java.io.BufferedWriter; import java.io.File; import java.io.FileInputStream; import java.io.FileOutputStream; import java.io.FileWriter; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.io.OutputStreamWriter; import java.io.RandomAccessFile; import java.text.DecimalFormat; import java.util.ArrayList; import java.util.LinkedList; import java.util.List; import java.util.Queue; import java.util.Stack; import org.apache.commons.io.FilenameUtils; import org.apache.commons.io.IOUtils; public class FileCommonUtil extends org.apache.commons.io.FileUtils { public static String getSystemLineSeparator() { return System.getProperty("line.separator", "\n"); } /** * BufferedReader */ public static BufferedReader getBufferedReader(String filePath, String encoding) throws Exception { return new BufferedReader(new InputStreamReader(new FileInputStream(filePath), encoding)); } /** * BufferedWriter */ public BufferedWriter getBufferedWriter(String filePath, String encoding) throws Exception { return getBufferedWriter(filePath, encoding, false); } /** * BufferedWriter */ public BufferedWriter getBufferedWriter(String filePath, String encoding,boolean append) throws Exception { OutputStreamWriter osw = new OutputStreamWriter(new FileOutputStream(filePath,append), encoding); BufferedWriter bw = new BufferedWriter(osw); return bw; } public static void cleanFileContent(String filePath) { cleanFileContent(new File(filePath)); } public static void cleanFileContent(File file) { FileOutputStream out = null; try { out = new FileOutputStream(file); out.write(new byte[0]); } catch (Exception e) { e.printStackTrace(); } finally { IOUtils.closeQuietly(out); } } public static void appendContentToFile(String filePath, String content) { FileWriter writer = null; try { writer = new FileWriter(filePath, true); writer.write(content); writer.close(); } catch (Exception e) { e.printStackTrace(); } finally { IOUtils.closeQuietly(writer); } } public static void appendContentToFile(String fileName, String content, String encoding) { RandomAccessFile randomFile = null; try { if (encoding == null) { encoding = "utf-8"; } randomFile = new RandomAccessFile(fileName, "rw"); long fileLength = randomFile.length(); randomFile.seek(fileLength); randomFile.write(content.getBytes(encoding)); randomFile.close(); } catch (Exception e) { e.printStackTrace(); } finally { IOUtils.closeQuietly(randomFile); } } /** * txt */ public static String getFileExtension(String filePath) { return FilenameUtils.getExtension(filePath); } /** * e:/test_tmp/sys.xmlsys */ public static String getFileBaseName(String filePath) { return FilenameUtils.getBaseName(filePath); } /** * sys.xml */ public static String getFileName(String filePath) { return FilenameUtils.getName(filePath); } /** * , e:/test_tmp/sys.xmle:/test_tmp/ */ public static String getFullPathNoFile(String filePath) { return FilenameUtils.getFullPath(filePath); } /** * ,, e:/test_tmp/sys.xmle:/test_tmp */ public static String getFullPathNoEndSeparator(String filePath) { return FilenameUtils.getFullPathNoEndSeparator(filePath); } public static boolean isEndOfExtension(String filePath, String suffix) { if (filePath == null || suffix == null) { return false; } return FilenameUtils.isExtension(filePath, suffix); } public static boolean isEndOfExtension(String filePath, String[] suffixArr) { return isEndOfExtension(filePath, suffixArr, false); } public static boolean isEndOfExtension(String filePath, String[] suffixArr, boolean ignoreCase) { if (filePath == null) { return false; } if (suffixArr == null || suffixArr.length == 0) { return false; } if (ignoreCase) { filePath = filePath.toLowerCase(); for (int i = 0, len = suffixArr.length; i < len; i++) { suffixArr[i] = (suffixArr[i] == null ? null : suffixArr[i].toLowerCase()); } } return FilenameUtils.isExtension(filePath, suffixArr); } /** * e:/test_tmp/sys.xml e:/test_tmp/sys */ public static String removeExtension(String filePath) { return FilenameUtils.removeExtension(filePath); } /** * * * @param size * @return */ public static String getReadableSize(long size) { final String[] units = new String[] { "B", "KB", "MB", "GB", "TB" }; final int unitIndex = (int) (Math.log10(size) / 3); final double unitValue = 1 << (unitIndex * 10); final String readableSize = new DecimalFormat("#,##0.#").format(size / unitValue) + " " + units[unitIndex]; return readableSize; } /** * * * @param filename * @return * @throws IOException */ public static int getFileTotalLine(String filename) throws Exception { InputStream is = new BufferedInputStream(new FileInputStream(filename)); try { byte[] c = new byte[1024]; int count = 0; int readChars = 0; boolean empty = true; while ((readChars = is.read(c)) != -1) { empty = false; for (int i = 0; i < readChars; ++i) { if (c[i] == '\n') { ++count; } } } return (count == 0 && !empty) ? 1 : count; } finally { is.close(); } } /** * * * @param filePath * @return */ public static String getFileLastLine(String filePath) { RandomAccessFile raf; String lastLine = ""; try { raf = new RandomAccessFile(filePath, "r"); long len = raf.length(); if (len != 0L) { long pos = len - 1; while (pos > 0) { pos raf.seek(pos); if (raf.readByte() == '\n') { lastLine = raf.readLine(); break; } } } raf.close(); } catch (Exception e) { e.printStackTrace(); } return lastLine; } /** * * * @param filePath * @param fileSize * @throws Exception */ public static void fastCreateBigFile(String filePath, int fileSize) throws Exception { RandomAccessFile r = new RandomAccessFile(filePath, "rw"); r.setLength(fileSize); r.close(); } /** * * * @param file * @throws IOException */ public static List<File> getFileListByDFS(File file) throws IOException { Stack<File> stack = new Stack<File>(); stack.push(file); File fileInStack = null; List<File> fileList = new ArrayList<File>(); while (!stack.isEmpty()) { fileInStack = stack.pop(); File[] files = fileInStack.listFiles(); for (File eachFile : files) { if (eachFile.isFile()) { fileList.add(eachFile); } else { stack.push(eachFile); } } } return fileList; } /** * * * @param file * @throws IOException */ public static List<File> getFileListByBFS(File file) throws IOException { Queue<File> queue = new LinkedList<File>(); queue.offer(file); File fileInQueue = null; List<File> fileList = new ArrayList<File>(); while (queue.size() > 0) { fileInQueue = queue.poll(); File[] files = fileInQueue.listFiles(); for (File eachFile : files) { if (eachFile.isFile()) { fileList.add(eachFile); } else { queue.offer(eachFile); } } } return fileList; } }
package de.linkvt.bachelor.config; import de.linkvt.bachelor.web.converters.message.FunctionalSyntaxHttpMessageConverter; import de.linkvt.bachelor.web.converters.message.ManchesterSyntaxHttpMessageConverter; import de.linkvt.bachelor.web.converters.message.OntologySyntax; import de.linkvt.bachelor.web.converters.message.OwlXmlHttpMessageConverter; import de.linkvt.bachelor.web.converters.message.RdfXmlOntologyHttpMessageConverter; import de.linkvt.bachelor.web.converters.message.TurtleOntologyHttpMessageConverter; import de.linkvt.bachelor.web.converters.parameter.StringToFeaturesConverter; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.boot.autoconfigure.web.HttpMessageConverters; import org.springframework.context.annotation.Bean; import org.springframework.context.annotation.Configuration; import org.springframework.format.FormatterRegistry; import org.springframework.http.MediaType; import org.springframework.http.converter.HttpMessageConverter; import org.springframework.web.servlet.config.annotation.ContentNegotiationConfigurer; import org.springframework.web.servlet.config.annotation.WebMvcConfigurerAdapter; import java.util.ArrayList; import java.util.List; /** * Configures the web module. */ @Configuration public class WebMvcConfig extends WebMvcConfigurerAdapter { @Autowired private StringToFeaturesConverter converter; @Override public void addFormatters(FormatterRegistry registry) { registry.addConverter(converter); } @Override public void configureContentNegotiation(ContentNegotiationConfigurer configurer) { configurer.ignoreAcceptHeader(true) .favorParameter(true) .ignoreUnknownPathExtensions(false) .defaultContentType(MediaType.TEXT_PLAIN) .mediaType("owx", OntologySyntax.OWL_XML.getMediaType()) .mediaType("owl", OntologySyntax.RDF_XML.getMediaType()) .mediaType("rdf", OntologySyntax.RDF_XML.getMediaType()) .mediaType("xml", OntologySyntax.RDF_XML.getMediaType()) .mediaType("ofn", OntologySyntax.FUNCTIONAL.getMediaType()) .mediaType("omn", OntologySyntax.MANCHESTER.getMediaType()) .mediaType("ttl", OntologySyntax.TURTLE.getMediaType()); } @Bean public HttpMessageConverters customConverters() { List<HttpMessageConverter<?>> converters = new ArrayList<>(); converters.add(new FunctionalSyntaxHttpMessageConverter()); converters.add(new ManchesterSyntaxHttpMessageConverter()); converters.add(new OwlXmlHttpMessageConverter()); converters.add(new RdfXmlOntologyHttpMessageConverter()); converters.add(new TurtleOntologyHttpMessageConverter()); return new HttpMessageConverters(converters); } }
package edu.columbia.tjw.item.algo; import java.io.Serializable; import java.util.ArrayList; import java.util.LinkedList; import java.util.List; /** * Code cloned from streaminer project, and updated to use more primitives for performance reasons. * <p> * Original javadoc follows. * <p> * This class is an implementation of the Greenwald-Khanna algorithm for computing * epsilon-approximate quantiles of large data sets. In its pure form it is an offline * algorithm. But it is used as a black box by many online algorithms for computing * epsilon-approximate quantiles on data streams.<br> * Our implementation widely adapts the original idea published by <i>Michael Greenwald * </i> and <i>Sanjeev Khanna</i> in their paper <i>"Space-Efficient Online Computation * of Quantile Summaries"</i>. Contrary to their idea this implementation uses a list * rather than a tree structure to maintain the elements. * * @author Markus Kokott, Carsten Przyluczky */ public class GKQuantiles implements Serializable { private static final long serialVersionUID = 0x3b9df13d1769c5bdL; /** * This value specifies the error bound. */ private final double _epsilon; private List<QuantileBlock> summary; private double minimum; private double maximum; private int stepsUntilMerge; /** * GK needs 1 / (2 * epsilon) elements to complete it's initial phase */ private boolean initialPhase; private int count; public GKQuantiles() { this(0.05); } /** * Creates a new GKQuantiles object that computes epsilon-approximate quantiles. * * @param epsilon_ The maximum error bound for quantile estimation. */ public GKQuantiles(double epsilon_) { if (!(epsilon_ > 0 && epsilon_ < 1)) { throw new RuntimeException("Epsilon must be in [0, 1]"); } this._epsilon = epsilon_; this.minimum = Double.MAX_VALUE; this.maximum = Double.MIN_VALUE; double mergingSteps = Math.floor(1.0 / (2.0 * _epsilon)); this.stepsUntilMerge = (int) mergingSteps; this.summary = new ArrayList<QuantileBlock>(); this.count = 0; this.initialPhase = true; } public void offer(double value) { insertItem(value); incrementCount(); if (count % stepsUntilMerge == 0 && !initialPhase) { compress(); } } /** * Estimates appropriate quantiles (i.e. values that holds epsilon accuracy). Note that if * the query parameter doesn't lay in [0,1] <code>Double.NaN</code> is returned! The same * result will be returned if an empty instance of GK is queried. * * @param q a <code>float</code> value * @return an estimated quantile represented by a {@link Double}. Will return {@link Double#NaN} * if <code>phi</code> isn't between 0 and 1 or this instance of <code>GKQuantiles</code> is empty. */ public double getQuantile(double q) { if (count == 0 || q < 0 || q > 1) { return Double.NaN; } if (count == 1) { return minimum; } if (count == 2) { if (q < 0.5) { return minimum; } if (q >= 0.5) { return maximum; } } int wantedRank = (int) (q * count); int currentMinRank = 0; int currentMaxRank = 0; double tolerance = (_epsilon * count); // if the wanted range is as most epsilon * count ranks smaller than the maximum the maximum // will always be an appropriate estimate if (wantedRank > count - tolerance) { return maximum; } // if the wanted range is as most epsilon * count ranks greater than the minimum the minimum // will always be an appropriate estimate if (wantedRank < tolerance) { return minimum; } QuantileBlock lastTuple = summary.get(0); // usually a range is estimated during this loop. it's element's value will be returned for (QuantileBlock nextBlock : summary) { currentMinRank += nextBlock.getOffset(); currentMaxRank = currentMinRank + nextBlock.getRange(); if (currentMaxRank - wantedRank <= tolerance) { lastTuple = nextBlock; if (wantedRank - currentMinRank <= tolerance) { return nextBlock.getValue(); } } } return lastTuple.getValue(); } /** * Checks whether <code>item</code> is a new extreme value (i.e. minimum or maximum) or lays between those values * and calls the appropriate insert method. * * @param item {@link Double} value of current element */ private void insertItem(double item) { if (item < minimum) { insertAsNewMinimum(item); return; } if (item >= maximum) { insertAsNewMaximum(item); return; } insertInBetween(item); } /** * This method will be called every time an element arrives whose value is smaller than the value * of the current minimum. Contrary to "normal" elements, the minimum's range have to be zero. * * @param item - new element with a {@link Double} value smaller than the current minimum of the summary. */ private void insertAsNewMinimum(double item) { minimum = item; QuantileBlock newTuple = new QuantileBlock(item, 1, 0); summary.add(0, newTuple); } /** * This method will be called every time an element arrives whose value is greater than the value * of the current maximum. Contrary to "normal" elements, the maximum's range have to be zero. * * @param item - new element with a {@link Double} value greater than the current maximum of the summary. */ private void insertAsNewMaximum(double item) { if (item == maximum) { QuantileBlock newTuple = new QuantileBlock(item, 1, computeRangeForNewTuple(summary.get(summary.size() - 1))); summary.add(summary.size() - 2, newTuple); } else { maximum = item; QuantileBlock newTuple = new QuantileBlock(item, 1, 0); summary.add(newTuple); } } /** * Every time a new element gets processed this method is called to insert this element into * the summary. During initial phase element's ranges have to be zero. After this phase every * new element's range depends on its successor. * * @param item - a new arrived element represented by a {@link Double} value. */ private void insertInBetween(double item) { QuantileBlock newTuple = new QuantileBlock(item, 1, 0); for (int i = 0; i < summary.size() - 1; i++) { QuantileBlock current = summary.get(i); QuantileBlock next = summary.get(i + 1); if (item >= current.getValue() && item < next.getValue()) { // while GK have seen less than 1 / (2*epsilon) elements, all elements must have an // offset of 0 if (!initialPhase) { newTuple.setRange(computeRangeForNewTuple(next)); } summary.add(i + 1, newTuple); return; } } } /** * Increments <code>count</code> and ends the initial phase if enough elements have been seen. */ private void incrementCount() { count++; if (count == stepsUntilMerge) { initialPhase = false; } } /** * Due to space efficiency the summary is compressed periodically */ private void compress() { if (this.summary.size() < 2) { // We don't compress if there's nothing to compress. return; } List<List<QuantileBlock>> partitions = getPartitionsOfSummary(); List<QuantileBlock> mergedSummary = new ArrayList<QuantileBlock>(); // just merge tuples per partition and concatenate the single resulting working sets mergedSummary.addAll(partitions.get(partitions.size() - 1)); for (int i = partitions.size() - 2; i > 0; i { mergedSummary.addAll(mergeWorkingSet(partitions.get(i))); } mergedSummary.addAll(partitions.get(0)); mergedSummary = sortWorkingSet(mergedSummary); summary = mergedSummary; } private List<QuantileBlock> mergeWorkingSet(List<QuantileBlock> workingSet) { // recursion stops here if (workingSet.size() < 2) { return workingSet; } LinkedList<QuantileBlock> mergedWorkingSet = new LinkedList<QuantileBlock>(); // resulting working // set LinkedList<QuantileBlock> currentWorkingSet = new LinkedList<QuantileBlock>(); // elements for // this step of recursion LinkedList<QuantileBlock> remainingWorkingSet = new LinkedList<QuantileBlock>(); // remaining elements // after this step // of recursion remainingWorkingSet.addAll(workingSet); int index = 1; int bandOfChildren = computeBandOfTuple(workingSet.get(0)); int bandOfParent = computeBandOfTuple(workingSet.get(index)); currentWorkingSet.add(workingSet.get(0)); remainingWorkingSet.removeFirst(); // we are looking for the next tuple that have a greater band than the first element because that // element will be the limit for the first element to get merged into while (bandOfChildren == bandOfParent && workingSet.size() - 1 > index) { // the working set will be partitioned into a working set for the current step of recursion and // a partition that contains all elements that have to be processed in later steps currentWorkingSet.add(workingSet.get(index)); remainingWorkingSet.remove(workingSet.get(index)); index++; bandOfParent = computeBandOfTuple(workingSet.get(index)); } QuantileBlock parent = workingSet.get(index); // there is no real parent. all elements have the same band if (bandOfParent == bandOfChildren) { currentWorkingSet.add(parent); mergedWorkingSet.addAll(mergeSiblings(currentWorkingSet)); return mergedWorkingSet; } int capacityOfParent = computeCapacityOfTuple(parent); // an element can be merged into it's parent if the resulting tuple isn't full (i.e. capacityOfParent > 1 // after merging) while (capacityOfParent > currentWorkingSet.getLast().getOffset() && currentWorkingSet.size() > 1) { merge(currentWorkingSet.getLast(), parent); currentWorkingSet.removeLast(); capacityOfParent = computeCapacityOfTuple(parent); } // checking whether all children were merged into parent or some were left over if (currentWorkingSet.isEmpty()) { mergedWorkingSet.addAll(mergeWorkingSet(remainingWorkingSet)); } // if there are some children left, some of them can probably be merged into siblings. // if there is any child left over, parent can't be merged into any other tuple, so it must be removed // from the elements in the remaining working set. else { remainingWorkingSet.remove(parent); mergedWorkingSet.addAll(mergeSiblings(currentWorkingSet)); mergedWorkingSet.add(parent); mergedWorkingSet.addAll(mergeWorkingSet(remainingWorkingSet)); } return mergedWorkingSet; } /** * this method merges elements that have the same band * * @param workingSet - a {@link LinkedList} of {@link QuantileBlock} * @return a {@link LinkedList} of {@link QuantileBlock} with smallest possible size in respect to * GKs merging operation. */ private LinkedList<QuantileBlock> mergeSiblings(LinkedList<QuantileBlock> workingSet) { // nothing left to merge if (workingSet.size() < 2) { return workingSet; } LinkedList<QuantileBlock> mergedSiblings = new LinkedList<QuantileBlock>(); // it is only possible to merge an element into a sibling, if this sibling is the element's // direct neighbor to the right QuantileBlock lastSibling = workingSet.getLast(); workingSet.removeLast(); boolean canStillMerge = true; // as long as the rightmost element can absorb elements, it will absorb his sibling to the left while (canStillMerge && !workingSet.isEmpty()) { if (this.areMergeable(workingSet.getLast(), lastSibling)) { merge(workingSet.getLast(), lastSibling); workingSet.removeLast(); } else { canStillMerge = false; } } mergedSiblings.add(lastSibling); // recursion mergedSiblings.addAll(mergeSiblings(workingSet)); return mergedSiblings; } /** * call this method to merge the element <code>left</code> into the element <code>right</code>. * Please note, that only elements with smaller value and a band not greater than <code>right * </code> can be element <code>left</code>. * * @param left - element the will be deleted after merging * @param right - element that will contain the offset of element <code>left</code> after merging */ private void merge(QuantileBlock left, QuantileBlock right) { right.setOffset(right.getOffset() + left.getOffset()); } /** * The range of an element depends on range and offset of it's succeeding element. * This methods computes the current element's range. * * @return range of current element as {@link Integer} value */ private int computeRangeForNewTuple(QuantileBlock successor) { if (initialPhase) { return 0; } //this is how it's done during algorithm detail in the paper double range = 2.0 * _epsilon * count; range = Math.floor(range); //this is the more adequate version presented at section "empirical measurements" int successorRange = successor.getRange(); int successorOffset = successor.getOffset(); if (successorRange + successorOffset - 1 >= 0) { return (successorRange + successorOffset - 1); } return (int) range; } /** * Partitions a list into {@link LinkedList}s of {@link QuantileBlock}, so that bands of elements * in a single {@link LinkedList} are monotonically increasing. * * @return a {@link LinkedList} containing {@link LinkedList}s of {@link Double} which are * the partitions of {@link #summary} */ private List<List<QuantileBlock>> getPartitionsOfSummary() { List<List<QuantileBlock>> partitions = new LinkedList<List<QuantileBlock>>(); List<QuantileBlock> workingSet = summary; LinkedList<QuantileBlock> currentPartition = new LinkedList<QuantileBlock>(); QuantileBlock lastTuple; QuantileBlock lastButOneTuple; // assuring that the minimum and maximum won't appear in a partition with other elements QuantileBlock minimum = workingSet.get(0); QuantileBlock maximum = workingSet.get(workingSet.size() - 1); workingSet.remove(0); workingSet.remove(workingSet.size() - 1); // adding the minimum as the first element into partitions currentPartition = new LinkedList<QuantileBlock>(); currentPartition.add(minimum); partitions.add(currentPartition); currentPartition = new LinkedList<QuantileBlock>(); // nothing left to partitioning if (workingSet.size() < 2) { partitions.add(workingSet); // adding the maximum as the very last element into partitions currentPartition = new LinkedList<QuantileBlock>(); currentPartition.add(maximum); partitions.add(currentPartition); return partitions; } // we process the working set from the very last element to the very first one while (workingSet.size() >= 2) { lastTuple = workingSet.get(workingSet.size() - 1); lastButOneTuple = workingSet.get(workingSet.size() - 2); currentPartition.addFirst(lastTuple); // every time we find an element whose band is greater than the current one the current partition // ended and we have to add a new partition to the resulting list if (isPartitionBorder(lastButOneTuple, lastTuple)) { partitions.add(currentPartition); currentPartition = new LinkedList<QuantileBlock>(); } else { // here got's the last element inserted into an partition if (workingSet.size() == 2) { currentPartition.addFirst(lastButOneTuple); } } workingSet.remove(workingSet.size() - 1); } partitions.add(currentPartition); // adding the maximum as a partition of it's own at the very last position currentPartition = new LinkedList<QuantileBlock>(); currentPartition.add(maximum); partitions.add(currentPartition); return partitions; } /** * Call this method to get the current capacity of an element. * * @param tuple - a {@link QuantileBlock} * @return {@link Integer} value representing the <code>tuple</code>'s capacity */ private int computeCapacityOfTuple(QuantileBlock tuple) { int offset = tuple.getOffset(); double currentMaxCapacity = Math.floor(2.0 * _epsilon * count); return (int) (currentMaxCapacity - offset); } /** * A tuple's band depend on the number of seen elements (<code>count</code>) and the * tuple's range. * <ul> * <li> While GK hasn't finished it's initial phase, all elements have to be put into a * band of their own. This is done using a band -1. * <li> If count and range are logarithmically equal the tuple's band will be 0 * <li> Else the tuple's band will be a value between 1 and <i>log(2*epsilon*count)</i> * </ul> * Please refer to the paper if you are interested in the formula for computing bands. * * @param tuple - a {@link QuantileBlock} * @return {@link Integer} value specifying <code>tuple</code>'s band */ private int computeBandOfTuple(QuantileBlock tuple) { double p = Math.floor(2 * _epsilon * count); // this will be true for new tuples if (areLogarithmicallyEqual(p, tuple.getRange())) { return 0; } // initial phase if (tuple.getRange() == 0) { return -1; } int alpha = 0; double lowerBound = 0d; double upperBound = 0d; while (alpha < (Math.log(p) / Math.log(2))) { alpha++; int twoPowAlpha = 2 << alpha; lowerBound = p - twoPowAlpha - (p % twoPowAlpha); if (lowerBound <= tuple.getRange()) { int twoPowAlphaM1 = 2 << (alpha - 1); upperBound = p - twoPowAlphaM1 - (p % twoPowAlphaM1); if (upperBound >= tuple.getRange()) { return alpha; } } } return alpha; } /** * Checks if two given values are logarithmically equal, i.e. the floored logarithm of * <code>valueOne</code> equals the floored logarithm of <code>valueTwo</code>. * * @param valueOne - a {@link Double} representing a {@link QuantileBlock}s band * @param valueTwo - a {@link Double} representing a {@link QuantileBlock}s band * @return <code>true</code> if both values are logarithmically equal */ private boolean areLogarithmicallyEqual(double valueOne, double valueTwo) { return (Math.floor(Math.log(valueOne)) == Math.floor(Math.log(valueTwo))); } /** * To check whether a pair of elements are mergeable or not you should use this method. Its * decision takes into account the bands and values of the given elements. * * @param tuple The element that will be deleted after merging. * @param parent The element that will absorb <code>tuple</code> during merge. * @return <code>true</code> if given elements are mergeable or <code>false</code> else. */ private boolean areMergeable(QuantileBlock tuple, QuantileBlock parent) { int capacityOfParent = computeCapacityOfTuple(parent); // return true if parent's capacity suffices to absorb tuple and tuple's band isn't greater than parent's if (capacityOfParent > tuple.getOffset() && computeBandOfTuple(parent) >= computeBandOfTuple(tuple)) { return true; } return false; } /** * Bands of elements in a partition are monotonically increasing from the first to the last element. * So a partition border is found if a preceding element has a greater band than the current * element. This method checks this condition for given elements. * * @param left preceding element. * @param right current element. * @return <code>true</code> if a partition boarder exists between the given elements or <code> * false</code> else. */ private boolean isPartitionBorder(QuantileBlock left, QuantileBlock right) { if (computeBandOfTuple(left) > computeBandOfTuple(right)) { return true; } return false; } /** * Sorts a {@link LinkedList} of {@link QuantileBlock}. * * @param workingSet - partitions of summary as a {@link LinkedList} of {@link QuantileBlock}. * @return the given working set in ascending order. */ private static List<QuantileBlock> sortWorkingSet(List<QuantileBlock> workingSet) { List<QuantileBlock> sortedWorkingSet = new ArrayList<QuantileBlock>(); while (workingSet.size() > 1) { QuantileBlock currentMinimum = workingSet.get(0); for (int i = 0; i < workingSet.size(); i++) { if (currentMinimum.getValue() > workingSet.get(i).getValue()) { currentMinimum = workingSet.get(i); } } workingSet.remove(currentMinimum); sortedWorkingSet.add(currentMinimum); } sortedWorkingSet.add(workingSet.get(0)); return sortedWorkingSet; } public int getCount() { return this.count; } @Override public String toString() { StringBuffer s = new StringBuffer(); s.append(getClass().getCanonicalName()); s.append(" {"); s.append(" epsilon="); s.append(_epsilon); s.append(" }"); return s.toString(); } /** * This is just a wrapper class to hold all needed informations of an element. It contains the following * informations: * <ul> * <li><b>value</b>: the value of the element</li> * <li><b>offset</b>: the difference between the least rank of this element and the rank of the preceding * element.</li> * <li><b>range</b>: the span between this elements least and most rank</li> * <ul> */ private static final class QuantileBlock implements Serializable { private static final long serialVersionUID = 0x80ca623569742e28L; private final double value; private int offset; private int range; public QuantileBlock(Double value, Integer offset, Integer range) { this.value = value; this.offset = offset; this.range = range; } public double getValue() { return value; } public int getOffset() { return offset; } public void setOffset(int offset) { this.offset = offset; } public int getRange() { return range; } public void setRange(int range) { this.range = range; } @Override public String toString() { String out = "( " + value + ", " + offset + ", " + range + " )"; return out; } } }
package edu.neu.ccs.pyramid.eval; import java.util.stream.IntStream; public class MicroMeasures extends LabelBasedMeasures { /** * Construct function: initialize each variables. * * @param numLabels */ public MicroMeasures(int numLabels) { super(numLabels); } /** * Returns the average Micro precision for all labels. * @return average precision */ public double getPrecision() { int tp = IntStream.of(truePositives).sum(); int fp = IntStream.of(falsePositives).sum(); int fn = IntStream.of(falseNegatives).sum(); return ConfusionMatrixMeasures.precision(tp,fp,fn); } /** * Returns the average Micro recall for all labels. * @return average recall */ public double getRecall() { int tp = IntStream.of(truePositives).sum(); int fp = IntStream.of(falsePositives).sum(); int fn = IntStream.of(falseNegatives).sum(); return ConfusionMatrixMeasures.recall(tp,fp,fn); } /** * Returns the average Micro specificity for all labels. * @return average specificity */ public double getSpecificity() { int tn = IntStream.of(trueNegatives).sum(); int fp = IntStream.of(falsePositives).sum(); int fn = IntStream.of(falseNegatives).sum(); return ConfusionMatrixMeasures.specificity(tn,fp,fn); } /** * Returns the average Micro F score for all labels. * @param beta * @return average F score */ public double getFScore(double beta) { int tp = IntStream.of(truePositives).sum(); int fp = IntStream.of(falsePositives).sum(); int fn = IntStream.of(falseNegatives).sum(); return ConfusionMatrixMeasures.fScore(tp,fp,fn,beta); } /** * Returns the average Micro F1 score for all labels. * @return average F1 score */ public double getF1Score() { return getFScore(1.0); } @Override public String toString() { return "Micro-Precision: \t" + getPrecision() + "\nMicro-Recall: \t" + getRecall() + "\nMicro-Specificity: \t" + getSpecificity() + "\nMicro-F1Score: \t" + getF1Score(); } }
package function.coverage.comparison; import function.annotation.base.Gene; import function.annotation.base.Exon; import function.coverage.base.CoverageCommand; import function.genotype.base.SampleManager; import global.Data; import utils.LogManager; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import utils.FormatManager; import utils.MathManager; /** * * @author qwang, nick */ public class ExonClean { int totalBases = 0; int totalCleanedBases = 0; double caseCoverage = 0; double ctrlCoverage = 0; ArrayList<SortedExon> exonList = new ArrayList<>(); HashMap<String, SortedExon> cleanedExonMap = new HashMap<>(); public void addExon(String name, float caseAvg, float ctrlAvg, float absDiff, int regionSize) { exonList.add(new SortedExon(name, caseAvg, ctrlAvg, absDiff, regionSize)); totalBases += regionSize; } private double getAllCoverage() { return (caseCoverage * SampleManager.getCaseNum() + ctrlCoverage * SampleManager.getCtrlNum()) / SampleManager.getListSize(); } protected double getCutoff() { //make sure the list has included all data and sortd. Collections.sort(exonList); int i; float cutoff; float[] data = new float[exonList.size()]; float meandata = 0; //calculate mean data for (i = 0; i < data.length; i++) { data[i] = exonList.get(i).getCovDiff(); meandata += data[i]; } meandata /= data.length; float total_variation = 0; for (i = 0; i < data.length; i++) { data[i] = (data[i] - meandata) * (data[i] - meandata); total_variation += data[i]; } data[0] /= total_variation; for (i = 1; i < data.length; i++) { data[i] = data[i - 1] + data[i] / total_variation; } for (i = 0; i < data.length; i++) { data[i] = data[i] - (float) (i + 1) / (float) data.length; } int index = 0; double max_value = Double.MIN_VALUE; for (i = 0; i < data.length; i++) { if (data[i] > max_value) { max_value = data[i]; index = i; } } cutoff = exonList.get(index).getCovDiff(); LogManager.writeAndPrint("\nThe automated cutoff value for absolute mean coverage difference for sites is " + Float.toString(cutoff)); if (CoverageCommand.exonCleanCutoff != Data.NO_FILTER) { cutoff = CoverageCommand.exonCleanCutoff; LogManager.writeAndPrint("User specified cutoff value " + FormatManager.getSixDegitDouble(cutoff) + " is applied instead."); } return cutoff; } public void initCleanedRegionMap() { double cutoff = getCutoff(); for (SortedExon sortedRegion : exonList) { if (sortedRegion.getCutoff() < cutoff && sortedRegion.getCaseAvg() + sortedRegion.getCtrlAvg() > 0) { totalCleanedBases += sortedRegion.getLength(); ctrlCoverage += sortedRegion.getCtrlAvg() * sortedRegion.getLength(); caseCoverage += sortedRegion.getCaseAvg() * sortedRegion.getLength(); cleanedExonMap.put(sortedRegion.getName(), sortedRegion); } } caseCoverage = MathManager.devide(caseCoverage, totalBases); ctrlCoverage = MathManager.devide(ctrlCoverage, totalBases); } public String getCleanedGeneStrByExon(Gene gene) { StringBuilder sb = new StringBuilder(); int size = 0; sb.append(gene.getName()); sb.append(" ").append(gene.getChr()).append(" ("); boolean isFirst = true; for (Exon exon : gene.getExonList()) { String exonIdStr = gene.getName() + "_" + exon.getIdStr(); if (cleanedExonMap.containsKey(exonIdStr)) { size += exon.getLength(); if (isFirst) { isFirst = false; } else { sb.append(","); } sb.append(exon.getStartPosition()); sb.append("..").append(exon.getEndPosition()); } } sb.append(") ").append(size); if (size > 0 && !gene.getChr().isEmpty()) { return sb.toString(); } else { return ""; } } public String getCleanedGeneSummaryStrByExon(Gene gene) { int geneSize = 0; double caseAvg = 0; double ctrlAvg = 0; for (Exon exon : gene.getExonList()) { String regionIdStr = gene.getName() + "_" + exon.getIdStr(); SortedExon sortedExon = cleanedExonMap.get(regionIdStr); if (sortedExon != null) { geneSize += sortedExon.getLength(); caseAvg += (double) sortedExon.getLength() * sortedExon.getCaseAvg(); ctrlAvg += (double) sortedExon.getLength() * sortedExon.getCtrlAvg(); } } return getGeneStr(gene, geneSize, caseAvg, ctrlAvg); } private String getGeneStr(Gene gene, int geneSize, double caseAvg, double ctrlAvg) { StringBuilder sb = new StringBuilder(); sb.append(gene.getName()).append(","); sb.append(gene.getChr()).append(","); sb.append(gene.getLength()).append(","); caseAvg = MathManager.devide(caseAvg, geneSize); ctrlAvg = MathManager.devide(ctrlAvg, geneSize); sb.append(FormatManager.getSixDegitDouble(caseAvg)).append(","); sb.append(FormatManager.getSixDegitDouble(ctrlAvg)).append(","); double absDiff = MathManager.abs(caseAvg, ctrlAvg); sb.append(FormatManager.getSixDegitDouble(absDiff)).append(","); sb.append(geneSize); return sb.toString(); } public void outputLog() { int numExonsTotal = exonList.size(); int numExonsPruned = numExonsTotal - cleanedExonMap.size(); LogManager.writeAndPrint("The number of exons before pruning is " + numExonsTotal); LogManager.writeAndPrint("The number of exons after pruning is " + cleanedExonMap.size()); LogManager.writeAndPrint("The number of exons pruned is " + numExonsPruned); double percentExonsPruned = (double) numExonsPruned / (double) numExonsTotal * 100; LogManager.writeAndPrint("The % of exons pruned is " + FormatManager.getSixDegitDouble(percentExonsPruned) + "%"); LogManager.writeAndPrint("The total number of bases before pruning is " + FormatManager.getSixDegitDouble((double) totalBases / 1000000.0) + " MB"); LogManager.writeAndPrint("The total number of bases after pruning is " + FormatManager.getSixDegitDouble((double) totalCleanedBases / 1000000.0) + " MB"); LogManager.writeAndPrint("The % of bases pruned is " + FormatManager.getSixDegitDouble(100.0 - (double) totalCleanedBases / (double) totalBases * 100) + "%"); LogManager.writeAndPrint("The average coverage rate for all samples after pruning is " + FormatManager.getSixDegitDouble(getAllCoverage() * 100) + "%"); LogManager.writeAndPrint("The average number of bases well covered for all samples after pruning is " + FormatManager.getSixDegitDouble(getAllCoverage() * totalBases / 1000000.0) + " MB"); LogManager.writeAndPrint("The average coverage rate for cases after pruning is " + FormatManager.getSixDegitDouble(caseCoverage * 100) + "%"); LogManager.writeAndPrint("The average number of bases well covered for cases after pruning is " + FormatManager.getSixDegitDouble(caseCoverage * totalBases / 1000000.0) + " MB"); LogManager.writeAndPrint("The average coverage rate for controls after pruning is " + FormatManager.getSixDegitDouble(ctrlCoverage * 100) + "%"); LogManager.writeAndPrint("The average number of bases well covered for controls after pruning is " + FormatManager.getSixDegitDouble(ctrlCoverage * totalBases / 1000000.0) + " MB"); } }
package org.duracloud.sync; import org.duracloud.sync.backup.SyncBackupManager; import org.duracloud.sync.config.SyncToolConfig; import org.duracloud.sync.config.SyncToolConfigParser; import org.duracloud.sync.endpoint.DuraStoreChunkSyncEndpoint; import org.duracloud.sync.endpoint.SyncEndpoint; import org.duracloud.sync.mgmt.ChangedList; import org.duracloud.sync.mgmt.StatusManager; import org.duracloud.sync.mgmt.SyncManager; import org.duracloud.sync.monitor.DirectoryUpdateMonitor; import org.duracloud.sync.util.LogUtil; import org.duracloud.sync.walker.DeleteChecker; import org.duracloud.sync.walker.DirWalker; import org.duracloud.sync.walker.RestartDirWalker; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import java.io.BufferedReader; import java.io.IOException; import java.io.InputStreamReader; public class SyncTool { private final Logger logger = LoggerFactory.getLogger(SyncTool.class); private SyncToolConfig syncConfig; private SyncManager syncManager; private SyncBackupManager syncBackupManager; private DirectoryUpdateMonitor dirMonitor; private SyncEndpoint syncEndpoint; private DirWalker dirWalker; private LogUtil logUtil; private SyncToolConfig processCommandLineArgs(String[] args) { SyncToolConfigParser syncConfigParser = new SyncToolConfigParser(); syncConfig = syncConfigParser.processCommandLine(args); return syncConfig; } /** * Determines if the sync directory list has been changed since the * previous run. If it has, a restart cannot occur. * @return true if sync directories have not been changed, false otherwise */ private boolean restartPossible() { SyncToolConfigParser syncConfigParser = new SyncToolConfigParser(); SyncToolConfig prevConfig = syncConfigParser.retrievePrevConfig(syncConfig.getBackupDir()); if(prevConfig != null) { return syncConfig.getSyncDirs().equals(prevConfig.getSyncDirs()); } else { return false; } } private void setupLogging(){ logUtil = new LogUtil(); logUtil.setupLogger(syncConfig.getBackupDir()); } private void startSyncManager() { syncEndpoint = new DuraStoreChunkSyncEndpoint(syncConfig.getHost(), syncConfig.getPort(), syncConfig.getContext(), syncConfig.getUsername(), syncConfig.getPassword(), syncConfig.getSpaceId(), syncConfig.syncDeletes(), syncConfig.getMaxFileSize()); syncManager = new SyncManager(syncConfig.getSyncDirs(), syncEndpoint, syncConfig.getNumThreads(), syncConfig.getPollFrequency()); syncManager.beginSync(); } private long startSyncBackupManager(boolean restart) { syncBackupManager = new SyncBackupManager(syncConfig.getBackupDir(), syncConfig.getPollFrequency()); long lastBackup = 0; if(restart) { lastBackup = syncBackupManager.attemptRestart(); } syncBackupManager.startupBackups(); return lastBackup; } private void startDirWalker() { dirWalker = DirWalker.start(syncConfig.getSyncDirs()); } private void startRestartDirWalker(long lastBackup) { dirWalker = RestartDirWalker.start(syncConfig.getSyncDirs(), lastBackup); } private void startDeleteChecker() { DeleteChecker.start(syncEndpoint.getFilesList(), syncConfig.getSyncDirs()); } private void startDirMonitor() { dirMonitor = new DirectoryUpdateMonitor(syncConfig.getSyncDirs(), syncConfig.getPollFrequency(), syncConfig.syncDeletes()); dirMonitor.startMonitor(); } private void listenForExit() { StatusManager statusManager = StatusManager.getInstance(); BufferedReader br = new BufferedReader(new InputStreamReader(System.in)); boolean exit = false; while(!exit) { String input; try { input = br.readLine(); if(input.equalsIgnoreCase("exit") || input.equalsIgnoreCase("x")) { exit = true; } else if(input.equalsIgnoreCase("config") || input.equalsIgnoreCase("c")) { System.out.println(syncConfig.getPrintableConfig()); } else if(input.equalsIgnoreCase("status") || input.equalsIgnoreCase("s")) { System.out.println(statusManager.getPrintableStatus()); } else if(input.startsWith("l ")) { logUtil.setLogLevel(input.substring(2)); System.out.println("Log level set to " + logUtil.getLogLevel()); } else { System.out.println(getPrintableHelp()); } } catch(IOException e) { logger.warn(e.getMessage(), e); } } closeSyncTool(); } private void waitForExit() { StatusManager statusManager = StatusManager.getInstance(); int loops = 0; boolean exit = false; while(!exit) { if(dirWalker.walkComplete()) { if(ChangedList.getInstance().getListSize() <= 0) { if(statusManager.getInWork() <= 0) { exit = true; System.out.println("Sync Tool processing " + "complete, final status:"); System.out.println(statusManager.getPrintableStatus()); break; } } } if(loops >= 600) { // Print status every 10 minutes System.out.println(statusManager.getPrintableStatus()); loops = 0; } sleep(10000); } closeSyncTool(); } private void sleep(long millis) { try { Thread.sleep(millis); } catch (InterruptedException e) { } } private void closeSyncTool() { syncBackupManager.endBackups(); syncManager.endSync(); dirMonitor.stopMonitor(); long inWork = StatusManager.getInstance().getInWork(); if(inWork > 0) { System.out.println("\nThe Sync Tool will exit after the remaining " + inWork + " work items have completed\n"); } } public void runSyncTool(SyncToolConfig syncConfig) { this.syncConfig = syncConfig; setupLogging(); System.out.print("\nStarting up the Sync Tool ..."); startSyncManager(); System.out.print("..."); boolean restart = restartPossible(); System.out.print("..."); long lastBackup = startSyncBackupManager(restart); System.out.print("..."); if(restart && lastBackup > 0) { logger.info("Running Sync Tool re-start file check"); startRestartDirWalker(lastBackup); System.out.print("..."); } else { logger.info("Running Sync Tool complete file check"); startDirWalker(); System.out.print("..."); } if(syncConfig.syncDeletes()) { startDeleteChecker(); } System.out.print("..."); startDirMonitor(); System.out.println("... Startup Complete"); if(syncConfig.exitOnCompletion()) { System.out.println(syncConfig.getPrintableConfig()); System.out.println("The Sync Tool will exit when processing " + "is complete.\n"); waitForExit(); } else { printWelcome(); listenForExit(); } } private void printWelcome() { System.out.println(syncConfig.getPrintableConfig()); System.out.println(getPrintableHelp()); } public String getPrintableHelp() { StringBuilder help = new StringBuilder(); help.append("\n help.append(" Sync Tool Help"); help.append("\n help.append("The following commands are available:\n"); help.append("x - Exits the Sync Tool\n"); help.append("c - Prints the Sync Tool configuration\n"); help.append("s - Prints the Sync Tool status\n"); help.append("l <Level> - Changes the log level to <Level> (may "); help.append("be any of DEBUG, INFO, WARN, ERROR)\n"); help.append("Location of logs: " + logUtil.getLogLocation() + "\n"); help.append(" return help.toString(); } public static void main(String[] args) throws Exception { SyncTool syncTool = new SyncTool(); SyncToolConfig syncConfig = syncTool.processCommandLineArgs(args); syncTool.runSyncTool(syncConfig); } }
package io.github.data4all.model.drawing; /** * A Point is a Object that can hold an x and y coordinate There is no further * logic in this class * * @author tbrose */ public class Point { private final float x; private final float y; public Point(float x, float y) { this.x = x; this.y = y; } public float getX() { return x; } public float getY() { return y; } @Override public int hashCode() { return Float.valueOf(x).hashCode() + Float.valueOf(y).hashCode(); } @Override public boolean equals(Object o) { return (o == this) || ((o instanceof Point) && x == ((Point) o).getX() && y == ((Point) o) .getY()); } public boolean equalsTo(float x, float y) { return this.x == x && this.y == y; } /* (non-Javadoc) * @see java.lang.Object#toString() */ @Override public String toString() { return "Point[x=" + x + ",y=" + y + "]"; } public static double getBeta(Point a, Point b, Point c) { // Calculate the two vectors if (a != null && b != null && c != null) { Point x = new Point(a.getX() - b.getX(), a.getY() - b.getY()); Point y = new Point(c.getX() - b.getX(), c.getY() - b.getY()); return Math.acos((x.getX() * y.getX() + x.getY() * y.getY()) / (Math.hypot(x.getX(), x.getY()) * Math.hypot(y.getX(), y.getY()))); } else { throw new IllegalArgumentException("parameters cannot be null"); } } }
package thredds.server.wms; import org.springframework.web.servlet.ModelAndView; import org.springframework.web.servlet.mvc.AbstractController; import org.simpleframework.xml.load.Persister; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import javax.servlet.ServletException; import thredds.server.wms.responses.*; import thredds.servlet.ThreddsConfig; import thredds.servlet.DatasetHandler; import thredds.servlet.UsageLog; import thredds.util.Version; import java.io.File; import java.io.IOException; import java.util.EnumSet; import java.util.Map; import java.util.HashMap; import ucar.nc2.dataset.NetcdfDataset; import ucar.nc2.dt.GridDataset; import uk.ac.rdg.resc.ncwms.styles.ColorPalette; import uk.ac.rdg.resc.ncwms.usagelog.UsageLogEntry; import uk.ac.rdg.resc.ncwms.controller.RequestParams; import uk.ac.rdg.resc.ncwms.controller.ColorScaleRange; import uk.ac.rdg.resc.ncwms.exceptions.WmsException; import uk.ac.rdg.resc.ncwms.exceptions.MetadataException; import uk.ac.rdg.resc.ncwms.exceptions.Wms1_1_1Exception; import uk.ac.rdg.resc.ncwms.config.Config; public class WMSController extends AbstractController { private static org.slf4j.Logger log = org.slf4j.LoggerFactory.getLogger(WMSController.class); private static org.slf4j.Logger logServerStartup = org.slf4j.LoggerFactory.getLogger("catalogInit"); public static final Version WMS_VER_1_1_1 = new Version( "1.1.1"); public static final Version WMS_VER_1_3_0 = new Version( "1.3.0"); private boolean allow; protected String getPath() { return "wms/"; } private Config config; private Map<String, ColorScaleRange> colorRange; public void init() throws ServletException { allow = ThreddsConfig.getBoolean("WMS.allow", false); logServerStartup.info("initializing WMS: " + allow); if (allow) { String paletteLocation = this.getServletContext().getRealPath("/WEB-INF/" + ThreddsConfig.get("WMS.paletteLocationDir", "palettes")); String OGCMetaXmlFile = this.getServletContext().getRealPath("/WEB-INF/" + ThreddsConfig.get("WMS.ogcMetaXML", "OGCMeta.xml")); File configFile = null; try { configFile = new File(OGCMetaXmlFile); config = new Persister().read(Config.class, configFile); } catch (Exception e) { logServerStartup.debug("Loaded configuration from " + OGCMetaXmlFile); throw new ServletException("Cannot read OGC config file " + e.toString()); } File paletteLocationDir = new File(paletteLocation); if (paletteLocationDir.exists() && paletteLocationDir.isDirectory()) { ColorPalette.loadPalettes(paletteLocationDir); } else { log.info("Directory of palette files does not exist or is not a directory"); } colorRange = new HashMap<String, ColorScaleRange>(); // LOOK Problem - global setting NetcdfDataset.setDefaultEnhanceMode(EnumSet.of(NetcdfDataset.Enhance.ScaleMissingDefer, NetcdfDataset.Enhance.CoordSystems)); } } public void destroy() { NetcdfDataset.shutdown(); } protected ModelAndView handleRequestInternal(HttpServletRequest req, HttpServletResponse res) throws ServletException, IOException { String jspPage = ""; ModelAndView result = null; log.info( UsageLog.setupRequestContext( req ) ); if (allow) { Map<String, Object> model = new HashMap<String, Object>(); UsageLogEntry usageLogEntry = new UsageLogEntry(req); GridDataset dataset = null; String errMessage = ""; RequestParams params = new RequestParams(req.getParameterMap()); String versionString = params.getWmsVersion(); try { if ( versionString == null) { //for Google! versionString = "1.1.1"; } String request = params.getMandatoryString("request"); dataset = openDataset(req, res); FileBasedResponse response; log.debug("Processing request: (version): " + versionString ); if (request.equalsIgnoreCase("GetCapabilities")) { String service = params.getMandatoryString( "service" ); if ( ! service.equalsIgnoreCase( "WMS" ) ) { throw new WmsException( "The SERVICE parameter must be WMS" ); } errMessage = "Error encountered while processing GetCapabilities request"; long startupDate = this.getApplicationContext().getStartupDate(); GetCapabilities getCap = new GetCapabilities(params, dataset, usageLogEntry); getCap.setConfig(config); getCap.setStartupDate(startupDate); response = getCap; } else if (request.equalsIgnoreCase("GetMap")) { errMessage = "Error encountered while processing GetMap request "; WmsGetMap getMapHandler = new WmsGetMap(params, dataset, usageLogEntry); response = getMapHandler; // LOOK how do we close the log messages ? log.info( "GetMap: " + UsageLog.closingMessageForRequestContext(HttpServletResponse.SC_OK, -1)); } else if (request.equalsIgnoreCase("GetLegendGraphic")) { errMessage = "Error encountered while processing GetLegendGraphic request "; response = new GetLegendGraphic(params, dataset, usageLogEntry); } else if (request.equalsIgnoreCase("GetFeatureInfo")) { errMessage = "Error encountered while processing GetFeatureInfo request "; response = new GetFeatureInfo(params, dataset, usageLogEntry); } else if (request.equals("GetMetadata")) { errMessage = "Error encountered while processing GetMetadata request "; MetadataResponse metaController = new MetadataResponse(params, dataset, usageLogEntry); metaController.setConfig(config); response = metaController; } // else if (request.equals("GetKML")) { // } else if (request.equals("GetKMLRegion")) { else throw new WmsException( "Unsupported REQUEST parameter" ); result = response.processRequest(res, req); closeDataset(dataset); return result; } catch (MetadataException me) { log.debug("MetadataException: " + me.toString()); } catch (WmsException e) { log.debug("WMS Exception! " + errMessage); if ( versionString.equals("1.1.1")) { model.put( "exception", new Wms1_1_1Exception( e)); jspPage = "displayWms1_1_1Exception"; } else if ( versionString.equals("1.3.0")) { model.put( "exception", e ); jspPage = "displayWmsException"; } else { model.put( "exception", e ); jspPage = "displayWmsException"; } return new ModelAndView(jspPage, model); } catch (java.net.SocketException se) { // Google Earth does thius a lot for some reason log.info( "handleRequestInternal(): " + UsageLog.closingMessageForRequestContext(HttpServletResponse.SC_BAD_REQUEST, -10), se); return null; } catch (Throwable t) { log.info( "handleRequestInternal(): " + UsageLog.closingMessageForRequestContext(HttpServletResponse.SC_INTERNAL_SERVER_ERROR, -1), t); res.sendError( HttpServletResponse.SC_INTERNAL_SERVER_ERROR ); return null; } finally { //if ((result == null) || (result.getModel() == null) || (result.getModel().get("dataset") == null)) { closeDataset(dataset); // } // else use DatasetCloser HandlerInterceptor } } else { // ToDo - Server not configured to support WMS. Should // response code be 404 (Not Found) instead of 403 (Forbidden)? res.sendError(HttpServletResponse.SC_FORBIDDEN, "Service not supported"); log.info( "handleRequestInternal(): " + UsageLog.closingMessageForRequestContext(HttpServletResponse.SC_FORBIDDEN, -1)); return null; } log.info( "handleRequestInternal(): " + UsageLog.closingMessageForRequestContext(HttpServletResponse.SC_INTERNAL_SERVER_ERROR, -3)); return null; } //Clearly, this is something STOLEN from WCSServlet private GridDataset openDataset(HttpServletRequest req, HttpServletResponse res) throws WmsException { log.debug("in openDataset"); GridDataset dataset; String datasetPath = req.getPathInfo(); try { dataset = DatasetHandler.openGridDataset(req, res, datasetPath); //System.out.println("**openGridDataset "+dataset.getLocationURI()); } catch (IOException e) { log.warn("WMSController: Failed to open dataset <" + datasetPath + ">: " + e.getMessage()); throw new WmsException("Failed to open dataset, \"" + datasetPath + "\"."); } if (dataset == null) { log.debug("WMSController: Unknown dataset <" + datasetPath + ">."); throw new WmsException("Unknown dataset, \"" + datasetPath + "\"."); } log.debug("leave openDataset"); return dataset; } private void closeDataset(GridDataset dataset) { if (dataset == null) return; try { //System.out.println("**Controller closed "+dataset.getLocationURI()); dataset.close(); } catch (IOException ioe) { log.warn("Failed to properly close the dataset", ioe); } } }
package io.sigpipe.sing.stat; public class SummaryStatistics { private long num; private double min; private double max; private double mean; private double std; private double var; public SummaryStatistics(RunningStatistics rs) { this.num = rs.n(); this.min = rs.min(); this.max = rs.max(); this.mean = rs.mean(); this.var = rs.var(); this.std = rs.std(); } public double num() { return this.num; } public double min() { return this.min; } public double max() { return this.max; } public double mean() { return this.mean; } public double std() { return this.std; } public double var() { return this.var; } @Override public String toString() { String str = ""; str += "Number of Samples: " + num + System.lineSeparator(); str += "Mean: " + mean + System.lineSeparator(); str += "Variance: " + var() + System.lineSeparator(); str += "Std Dev: " + std() + System.lineSeparator(); str += "Min: " + min + System.lineSeparator(); str += "Max: " + max; return str; } }
package jfdi.ui.commandhandlers; import java.util.ArrayList; import java.util.Comparator; import java.util.logging.Logger; import com.google.common.eventbus.Subscribe; import edu.emory.mathcs.backport.java.util.Collections; import jfdi.common.utilities.JfdiLogger; import jfdi.logic.events.AddTaskDoneEvent; import jfdi.logic.events.AddTaskFailedEvent; import jfdi.logic.events.AliasDoneEvent; import jfdi.logic.events.AliasFailedEvent; import jfdi.logic.events.CommandRedoneEvent; import jfdi.logic.events.CommandUndoneEvent; import jfdi.logic.events.DeleteTaskDoneEvent; import jfdi.logic.events.DeleteTaskFailedEvent; import jfdi.logic.events.ExitCalledEvent; import jfdi.logic.events.FilesReplacedEvent; import jfdi.logic.events.HelpRequestedEvent; import jfdi.logic.events.InitializationFailedEvent; import jfdi.logic.events.InvalidCommandEvent; import jfdi.logic.events.ListDoneEvent; import jfdi.logic.events.MarkTaskDoneEvent; import jfdi.logic.events.MarkTaskFailedEvent; import jfdi.logic.events.MoveDirectoryDoneEvent; import jfdi.logic.events.MoveDirectoryFailedEvent; import jfdi.logic.events.NoSurpriseEvent; import jfdi.logic.events.RedoFailedEvent; import jfdi.logic.events.RenameTaskDoneEvent; import jfdi.logic.events.RenameTaskFailedEvent; import jfdi.logic.events.RescheduleTaskDoneEvent; import jfdi.logic.events.RescheduleTaskFailedEvent; import jfdi.logic.events.SearchDoneEvent; import jfdi.logic.events.ShowDirectoryEvent; import jfdi.logic.events.SurpriseEvent; import jfdi.logic.events.UnaliasDoneEvent; import jfdi.logic.events.UnaliasFailEvent; import jfdi.logic.events.UndoFailedEvent; import jfdi.logic.events.UnmarkTaskDoneEvent; import jfdi.logic.events.UnmarkTaskFailEvent; import jfdi.logic.events.UseDirectoryDoneEvent; import jfdi.logic.events.UseDirectoryFailedEvent; import jfdi.logic.interfaces.Command; import jfdi.storage.apis.TaskAttributes; import jfdi.storage.exceptions.FilePathPair; import jfdi.ui.Constants; import jfdi.ui.Constants.ListStatus; import jfdi.ui.Constants.MsgType; import jfdi.ui.MainController; import jfdi.ui.items.ListItem; public class CommandHandler { public MainController controller; public Logger logger = JfdiLogger.getLogger(); @Subscribe public void handleAddTaskDoneEvent(AddTaskDoneEvent e) { TaskAttributes task = e.getTask(); appendTaskToDisplayList(task, true); if (shouldSort()) { sortDisplayList(); } controller.relayFb( String.format(Constants.CMD_SUCCESS_ADDED, task.getDescription()), MsgType.SUCCESS); logger.fine(String.format(Constants.LOG_ADDED_SUCCESS, task.getId())); controller.updateNotiBubbles(); } @Subscribe public void handleAddTaskFailEvent(AddTaskFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_ADD_UNKNOWN, MsgType.ERROR); logger.fine(String.format(Constants.LOG_ADD_FAIL_UNKNOWN)); break; case EMPTY_DESCRIPTION: controller.relayFb(Constants.CMD_ERROR_CANT_ADD_EMPTY, MsgType.ERROR); logger.fine(String.format(Constants.LOG_ADD_FAIL_EMPTY)); break; case DUPLICATED_TASK: controller.relayFb(Constants.CMD_ERROR_CANT_ADD_DUPLICATE, MsgType.ERROR); logger.fine(String.format(Constants.LOG_ADD_FAIL_DUPLICATE)); break; default: break; } } @Subscribe public void handleAliasDoneEvent(AliasDoneEvent e) { controller.relayFb( String.format(Constants.CMD_SUCCESS_ALIAS, e.getAlias(), e.getCommand()), MsgType.SUCCESS); } @Subscribe public void handleAliasFailEvent(AliasFailedEvent e) { switch (e.getError()) { case INVALID_PARAMETERS: controller.relayFb( String.format(Constants.CMD_ERROR_CANT_ALIAS_INVALID, e.getAlias(), e.getCommand()), MsgType.ERROR); // logger.fine(String.format(format, args)); break; case DUPLICATED_ALIAS: controller.relayFb( String.format(Constants.CMD_ERROR_CANT_ALIAS_DUPLICATED, e.getAlias()), MsgType.ERROR); // logger.fine(String.format(format, args)); break; case UNKNOWN: controller.relayFb( String.format(Constants.CMD_ERROR_CANT_ALIAS_UNKNOWN, e.getCommand()), MsgType.ERROR); // logger.fine(String.format(format, args)); break; default: break; } } @Subscribe public void handleCommandRedoneEvent(CommandRedoneEvent e) { Class<? extends Command> cmdType = e.getCommandType(); switchContext(controller.displayStatus, true); controller.relayFb( String.format(Constants.CMD_SUCCESS_REDONE, cmdType.toString()), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleCommandUndoneEvent(CommandUndoneEvent e) { Class<? extends Command> cmdType = e.getCommandType(); switchContext(controller.displayStatus, true); controller.relayFb( String.format(Constants.CMD_SUCCESS_UNDONE, cmdType.toString()), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleDeleteTaskDoneEvent(DeleteTaskDoneEvent e) { ArrayList<Integer> deletedIds = e.getDeletedIds(); Collections.sort(deletedIds, Comparator.reverseOrder()); int indexCount = -1; for (int screenId : deletedIds) { indexCount = screenId - 1; controller.importantList.remove(indexCount); logger.fine(String.format(Constants.LOG_DELETED_SUCCESS, screenId)); } controller.relayFb(Constants.CMD_SUCCESS_DELETED, MsgType.SUCCESS); indexCount = 1; for (ListItem item : controller.importantList) { if (item.getIndex() != indexCount) { item.setIndex(indexCount); } indexCount++; } controller.updateNotiBubbles(); } @Subscribe public void handleDeleteTaskFailEvent(DeleteTaskFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_DELETE_UNKNOWN, MsgType.ERROR); logger.fine(Constants.LOG_DELETE_FAIL_UNKNOWN); break; case NON_EXISTENT_ID: for (Integer screenId : e.getInvalidIds()) { controller.relayFb(String.format( Constants.CMD_ERROR_CANT_DELETE_NO_ID, screenId), MsgType.ERROR); } logger.fine(Constants.LOG_DELETE_FAIL_NOID); break; default: break; } } @Subscribe public void handleExitCalledEvent(ExitCalledEvent e) { System.out.printf("\nMoriturus te saluto.\n"); System.exit(0); logger.fine(Constants.LOG_USER_EXIT); } @Subscribe public void handleHelpRequestEvent(HelpRequestedEvent e) { switchContext(ListStatus.HELP, false); controller.showHelpDisplay(); controller.relayFb(Constants.CMD_SUCCESS_HELP, MsgType.SUCCESS); } @Subscribe public void handleFilesReplacedEvent(FilesReplacedEvent e) { String fb = ""; for (FilePathPair item : e.getFilePathPairs()) { fb += String.format("\n" + Constants.CMD_ERROR_INIT_FAIL_REPLACED, item.getOldFilePath(), item.getNewFilePath()); } controller.appendFb(fb, MsgType.WARNING); controller.updateNotiBubbles(); } @Subscribe public void handleInitializationFailedEvent(InitializationFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_INIT_FAIL_UNKNOWN, MsgType.ERROR); break; case INVALID_PATH: controller.relayFb( String.format(Constants.CMD_ERROR_INIT_FAIL_INVALID, e.getPath()), MsgType.ERROR); break; default: break; } } @Subscribe public void handleInvalidCommandEvent(InvalidCommandEvent e) { controller.relayFb( String.format(Constants.CMD_WARNING_DONTKNOW, e.getInputString()), MsgType.WARNING); logger.fine(Constants.LOG_INVALID_COMMAND); } @Subscribe public void handleListDoneEvent(ListDoneEvent e) { if (!controller.isUpdate) { switch (e.getListType()) { case ALL: switchContext(ListStatus.ALL, false); break; case COMPLETED: switchContext(ListStatus.COMPLETE, false); break; case INCOMPLETE: switchContext(ListStatus.INCOMPLETE, false); break; case OVERDUE: switchContext(ListStatus.OVERDUE, false); break; case UPCOMING: switchContext(ListStatus.UPCOMING, false); break; default: break; } listTasks(e.getItems(), false); controller.relayFb(Constants.CMD_SUCCESS_LISTED, MsgType.SUCCESS); } updateBubble(e); } @Subscribe public void handleMarkTaskDoneEvent(MarkTaskDoneEvent e) { ArrayList<Integer> doneIds = e.getScreenIds(); Collections.sort(doneIds, Comparator.reverseOrder()); int indexCount = -1; for (Integer screenId : doneIds) { indexCount = screenId - 1; controller.importantList.get(indexCount).setMarkT(); controller.importantList.get(indexCount).strikeOut(); refreshDisplay(); // controller.displayList(controller.displayStatus); // logger.fine(String.format(Constants.LOG_DELETED_SUCCESS, num)); } controller.relayFb( String.format(Constants.CMD_SUCCESS_MARKED, indexCount + 1), MsgType.SUCCESS); controller.updateNotiBubbles(); } private void refreshDisplay() { controller.listMain.refresh(); } @Subscribe public void handleMarkTaskFailEvent(MarkTaskFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_MARK_UNKNOWN, MsgType.ERROR); // logger.fine(Constants.LOG_DELETE_FAIL_UNKNOWN); break; case NON_EXISTENT_ID: // NEED TO CHANGE TO INDEX SOON???? for (Integer screenId : e.getInvalidIds()) { controller.relayFb(String.format( Constants.CMD_ERROR_CANT_MARK_NO_ID, screenId), MsgType.ERROR); } // logger.fine(Constants.LOG_DELETE_FAIL_NOID); break; default: break; } } @Subscribe public void handleMoveDirectoryDoneEvent(MoveDirectoryDoneEvent e) { switchContext(ListStatus.INCOMPLETE, true); controller.relayFb( String.format(Constants.CMD_SUCCESS_MOVED, e.getNewDirectory()), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleMoveDirectoryFailEvent(MoveDirectoryFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb( String.format(Constants.CMD_ERROR_MOVE_FAIL_UNKNOWN, e.getNewDirectory()), MsgType.ERROR); break; case INVALID_PATH: controller.relayFb( String.format(Constants.CMD_ERROR_MOVE_FAIL_INVALID, e.getNewDirectory()), MsgType.ERROR); break; default: break; } } @Subscribe public void handleNoSurpriseEvent(NoSurpriseEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_SURP_FAIL_UNKNOWN, MsgType.ERROR); break; case NO_TASKS: controller.relayFb(Constants.CMD_ERROR_SURP_FAIL_NO_TASKS, MsgType.ERROR); break; default: break; } } @Subscribe public void handleRedoFailedEvent(RedoFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_REDO_FAIL_UNKNOWN, MsgType.ERROR); break; case NONTHING_TO_REDO: controller.relayFb(Constants.CMD_ERROR_REDO_FAIL_NO_TASKS, MsgType.ERROR); break; default: break; } } @Subscribe public void handleRenameTaskDoneEvent(RenameTaskDoneEvent e) { TaskAttributes task = e.getTask(); int count = 0; for (int i = 0; i < controller.importantList.size(); i++) { if (controller.getIdFromIndex(i) == task.getId()) { controller.importantList.get(i).setDescription( task.getDescription()); count = i; break; } } controller.relayFb( String.format(Constants.CMD_SUCCESS_RENAMED, count + 1, task.getDescription()), MsgType.SUCCESS); logger.fine(String.format(Constants.LOG_RENAMED_SUCCESS, task.getId())); controller.updateNotiBubbles(); } @Subscribe public void handleRenameTaskFailEvent(RenameTaskFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_RENAME_UNKNOWN, MsgType.ERROR); logger.fine(Constants.LOG_RENAME_FAIL_UNKNOWN); break; case NON_EXISTENT_ID: // NEED TO CHANGE TO INDEX SOON???? controller.relayFb( String.format(Constants.CMD_ERROR_CANT_RENAME_NO_ID, e.getScreenId()), MsgType.ERROR); logger.fine(Constants.LOG_RENAME_FAIL_NOID); break; case NO_CHANGES: controller.relayFb( String.format(Constants.CMD_ERROR_CANT_RENAME_NO_CHANGES, e.getDescription()), MsgType.ERROR); logger.fine(Constants.LOG_RENAME_FAIL_NOCHANGE); break; case DUPLICATED_TASK: controller.relayFb(Constants.CMD_ERROR_CANT_RENAME_DUPLICATE, MsgType.ERROR); logger.fine(String.format(Constants.LOG_RENAME_FAIL_DUPLICATE)); break; default: break; } } @Subscribe public void handleRescheduleTaskDoneEvent(RescheduleTaskDoneEvent e) { int count = 0; TaskAttributes task = e.getTask(); for (int i = 0; i < controller.importantList.size(); i++) { if (controller.getIdFromIndex(i) == task.getId()) { controller.importantList.get(i).setTimeDate( task.getStartDateTime(), task.getEndDateTime()); count = i; break; } } if (shouldSort()) { sortDisplayList(); } controller.relayFb( String.format(Constants.CMD_SUCCESS_RESCHEDULED, count + 1), MsgType.SUCCESS); logger.fine(String.format(Constants.LOG_RESCHED_SUCCESS, task.getId())); controller.updateNotiBubbles(); } @Subscribe public void handleRescheduleTaskFailEvent(RescheduleTaskFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_RESCHEDULE_UNKNOWN, MsgType.ERROR); logger.fine(Constants.LOG_RESCHE_FAIL_UNKNOWN); break; case NON_EXISTENT_ID: // NEED TO CHANGE TO INDEX SOON???? controller.relayFb( String.format(Constants.CMD_ERROR_CANT_RESCHEDULE_NO_ID, e.getScreenId()), MsgType.ERROR); logger.fine(Constants.LOG_RESCHE_FAIL_NOID); break; case NO_CHANGES: controller.relayFb( Constants.CMD_ERROR_CANT_RESCHEDULE_NO_CHANGES + e.getStartDateTime() + " - to - " + e.getEndDateTime() + " -!", MsgType.ERROR); logger.fine(Constants.LOG_RESCHE_FAIL_NOCHANGE); break; case DUPLICATED_TASK: controller.relayFb(Constants.CMD_ERROR_CANT_RESCHEDULE_DUPLICATE, MsgType.ERROR); logger.fine(String.format(Constants.LOG_RESCHE_FAIL_DUPLICATE)); break; default: break; } } @Subscribe public void handleSearchDoneEvent(SearchDoneEvent e) { listTasks(e.getResults(), false); switchContext(ListStatus.SEARCH, false); for (String key : e.getKeywords()) { controller.searchCmd += key + " "; } //controller.switchTabSkin(); controller.setHighlights(e.getKeywords()); controller.relayFb(Constants.CMD_SUCCESS_SEARCH, MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleShowDirectoryEvent(ShowDirectoryEvent e) { controller.relayFb( String.format(Constants.CMD_SUCCESS_SHOWDIRECTORY, e.getPwd()), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleSurpriseEvent(SurpriseEvent e) { controller.importantList.clear(); TaskAttributes task = e.getTask(); appendTaskToDisplayList(task, false); switchContext(ListStatus.ALL, false); switchContext(ListStatus.SURPRISE, false); controller.relayFb(Constants.CMD_SUCCESS_SURPRISED, MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleUnaliasDoneEvent(UnaliasDoneEvent e) { controller.relayFb( String.format(Constants.CMD_SUCCESS_UNALIAS, e.getAlias()), MsgType.SUCCESS); } @Subscribe public void handleUnaliasFailEvent(UnaliasFailEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb( String.format(Constants.CMD_ERROR_CANT_UNALIAS_UNKNOWN, e.getAlias()), MsgType.ERROR); // logger.fine(Constants.LOG_RESCHE_FAIL_UNKNOWN); break; case NON_EXISTENT_ALIAS: // NEED TO CHANGE TO INDEX SOON???? controller.relayFb( String.format(Constants.CMD_ERROR_CANT_UNALIAS_NO_ALIAS, e.getAlias()), MsgType.ERROR); // logger.fine(Constants.LOG_RESCHE_FAIL_NOID); break; default: break; } } @Subscribe public void handleUndoFailedEvent(UndoFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_UNDO_FAIL_UNKNOWN, MsgType.ERROR); break; case NONTHING_TO_UNDO: controller.relayFb(Constants.CMD_ERROR_UNDO_FAIL_NO_TASKS, MsgType.ERROR); break; default: break; } } @Subscribe public void handleUnmarkTaskDoneEvent(UnmarkTaskDoneEvent e) { ArrayList<Integer> undoneIds = e.getScreenIds(); Collections.sort(undoneIds, Comparator.reverseOrder()); int indexCount = -1; for (Integer screenId : undoneIds) { indexCount = screenId - 1; controller.importantList.get(indexCount).setMarkF(); controller.importantList.get(indexCount).removeStrike(); refreshDisplay(); // controller.displayList(controller.displayStatus); // logger.fine(String.format(Constants.LOG_DELETED_SUCCESS, num)); } controller.relayFb( String.format(Constants.CMD_SUCCESS_UNMARKED, indexCount + 1), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleUnmarkTaskFailEvent(UnmarkTaskFailEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb(Constants.CMD_ERROR_CANT_UNMARK_UNKNOWN, MsgType.ERROR); // logger.fine(Constants.LOG_DELETE_FAIL_UNKNOWN); break; case NON_EXISTENT_ID: // NEED TO CHANGE TO INDEX SOON???? for (Integer screenId : e.getInvalidIds()) { controller.relayFb(String.format( Constants.CMD_ERROR_CANT_UNMARK_NO_ID, screenId), MsgType.ERROR); } // logger.fine(Constants.LOG_DELETE_FAIL_NOID); break; default: break; } } @Subscribe public void handleUseDirectoryDoneEvent(UseDirectoryDoneEvent e) { switchContext(ListStatus.INCOMPLETE, true); controller.relayFb( String.format(Constants.CMD_SUCCESS_USED, e.getNewDirectory()), MsgType.SUCCESS); controller.updateNotiBubbles(); } @Subscribe public void handleUseDirectoryFailEvent(UseDirectoryFailedEvent e) { switch (e.getError()) { case UNKNOWN: controller.relayFb( String.format(Constants.CMD_ERROR_USE_FAIL_UNKNOWN, e.getNewDirectory()), MsgType.ERROR); break; case INVALID_PATH: controller.relayFb( String.format(Constants.CMD_ERROR_USE_FAIL_INVALID, e.getNewDirectory()), MsgType.ERROR); break; default: break; } } public void setController(MainController controller) { this.controller = controller; } /** * Sets the display list to the given ArrayList of tasks which match the context. * * @param tasks * the ArrayList of tasks to be displayed */ private void listTasks(ArrayList<TaskAttributes> tasks, boolean shouldCheckContext) { controller.importantList.clear(); for (TaskAttributes task : tasks) { appendTaskToDisplayList(task, shouldCheckContext); } } /** * Appends a task to the list of tasks displayed. * * @param task * the task to be appended */ private void appendTaskToDisplayList(TaskAttributes task, boolean shouldCheckContext) { if (shouldCheckContext && !isSameContext(task)) { return; } int onScreenId = controller.importantList.size() + 1; ListItem listItem; if (task.isCompleted()) { listItem = new ListItem(onScreenId, task, true); controller.importantList.add(listItem); controller.importantList.get(controller.importantList.size() - 1).strikeOut(); listItem.strikeOut(); } else { listItem = new ListItem(onScreenId, task, false); controller.importantList.add(listItem); controller.importantList.get(controller.importantList.size() - 1) .getStyleClass().add("itemBox"); } } private void sortDisplayList() { ArrayList<TaskAttributes> taskList = new ArrayList<TaskAttributes>(); controller.importantList.forEach(listItem -> taskList.add(listItem.getItem())); Collections.sort(taskList); listTasks(taskList, false); } private boolean shouldSort() { return controller.displayStatus.equals(ListStatus.OVERDUE) || controller.displayStatus.equals(ListStatus.UPCOMING); } private boolean isSameContext(TaskAttributes task) { switch (controller.displayStatus) { case ALL: return true; case SEARCH: return false; case SURPRISE: return false; case HELP: return false; case COMPLETE: return task.isCompleted(); case INCOMPLETE: return !task.isCompleted(); case OVERDUE: return task.isOverdue(); case UPCOMING: return task.isUpcoming(); default: assert false; return false; } } private void switchContext(ListStatus status, Boolean isListing) { if (status.equals(ListStatus.HELP)) { controller.beforeHelp = controller.displayStatus; } controller.displayStatus = status; if (isListing) { controller.transListCmd(); } controller.switchTabSkin(); } private void updateBubble(ListDoneEvent e) { Integer count = e.getItems().size(); switch (e.getListType()) { case INCOMPLETE: controller.incompletePlaceHdr.set(count.toString()); break; case OVERDUE: controller.overduePlaceHdr.set(count.toString()); break; case UPCOMING: controller.upcomingPlaceHdr.set(count.toString()); break; default: break; } } }
package me.nallar.modpatcher; import net.minecraft.launchwrapper.ITweaker; import net.minecraft.launchwrapper.Launch; import net.minecraft.launchwrapper.LaunchClassLoader; import java.io.*; import java.lang.reflect.*; import java.util.*; /** * Tries to ensure that our transformer is last */ public class ModPatcherTweaker implements ITweaker { @SuppressWarnings("unchecked") public static void add() { List<String> newTweaks = (List<String>) Launch.blackboard.get("TweakClasses"); newTweaks.add(ModPatcherTweaker.class.getName()); } private static void inject() { LaunchClassLoaderUtil.addTransformer(ModPatcherTransformer.getInstance()); try { Class<?> mixinEnvironmentClass = Class.forName("org.spongepowered.asm.mixin.MixinEnvironment", false, ModPatcherTweaker.class.getClassLoader()); Field f = mixinEnvironmentClass.getDeclaredField("excludeTransformers"); f.setAccessible(true); Set<String> vals = (Set<String>) f.get(null); vals.add(ModPatcherTransformer.class.getName()); } catch (ClassNotFoundException ignored) { // TODO Silence this once confirmed working? PatcherLog.trace("Failed to find mixin environment, normal for non-spongepowered", ignored); } catch (NoSuchFieldException | IllegalAccessException e) { PatcherLog.warn("Failed to add mixin transformer exclusion for our transformer", e); } } @Override public void acceptOptions(List<String> list, File file, File file1, String s) { } @Override public void injectIntoClassLoader(LaunchClassLoader launchClassLoader) { inject(); } @Override public String getLaunchTarget() { throw new UnsupportedOperationException("ModPatcherTweaker is not a primary tweaker."); } @Override public String[] getLaunchArguments() { inject(); LaunchClassLoaderUtil.dumpTransformersIfEnabled(); return new String[0]; } }
package net.aicomp.javachallenge2015; import java.util.ArrayList; import java.util.Random; import java.util.Scanner; import org.apache.commons.cli.CommandLine; import org.apache.commons.cli.CommandLineParser; import org.apache.commons.cli.DefaultParser; import org.apache.commons.cli.HelpFormatter; import org.apache.commons.cli.Options; import org.apache.commons.cli.ParseException; public class Bookmaker { private static boolean DEBUG = false; private static final int PLAYERS_NUM = 4; private static final int MAP_WIDTH = 40; private static final int BLOCK_WIDTH = 5; private static final int INITIAL_LIFE = 5; private static final int FORCED_END_TURN = 10000; private static final int PANEL_REBIRTH_TURN = 5 * 4; public static final int PLAYER_REBIRTH_TURN = 5 * 4; public static final int ATTACKED_PAUSE_TURN = 5 * 4; public static final int MUTEKI_TURN = 10 * 4; private static final int REPULSION = 7; public static final int ACTION_TIME_LIMIT = 2000; private static final int TIME_TO_FALL = 1 * 4; public static final String READY = "Ready"; public static final String UP = "U"; public static final String DOWN = "D"; public static final String RIGHT = "R"; public static final String LEFT = "L"; public static final String ATTACK = "A"; public static final String NONE = "N"; public static final String[] DIRECTION = { UP, LEFT, DOWN, RIGHT }; private static Player[] players; private static Random rnd; private static int turn; private static int[][] board = new int[MAP_WIDTH][MAP_WIDTH]; private static final String EXEC_COMMAND = "a"; private static final String PAUSE_COMMAND = "p"; private static final String UNPAUSE_COMMAND = "u"; public static void main(String[] args) throws InterruptedException, ParseException { Options options = new Options() .addOption( EXEC_COMMAND, true, "The command and arguments with double quotation marks to execute AI program (e.g. -a \"java MyAI\")") .addOption( PAUSE_COMMAND, true, "The command and arguments with double quotation marks to pause AI program (e.g. -p \"echo pause\")") .addOption( UNPAUSE_COMMAND, true, "The command and arguments with double quotation marks to unpause AI program (e.g. -u \"echo unpause\")"); CommandLineParser parser = new DefaultParser(); CommandLine line = parser.parse(options, args); if (!hasCompleteArgs(line)) { HelpFormatter help = new HelpFormatter(); help.printHelp("java -jar JavaChallenge2015.jar [OPTIONS]\n" + "[OPTIONS]: ", "", options, "", true); return; } String[] execAICommands = line.getOptionValues(EXEC_COMMAND); String[] pauseAICommands = line.getOptionValues(PAUSE_COMMAND); String[] unpauseAICommands = line.getOptionValues(UNPAUSE_COMMAND); rnd = new Random(System.currentTimeMillis()); turn = 0; players = new Player[PLAYERS_NUM]; for (int i = 0; i < players.length; i++) { players[i] = new Player(INITIAL_LIFE, execAICommands[i], pauseAICommands[i], unpauseAICommands[i]); } rebirthPhase(); while (!isFinished()) { int turnPlayer = turn % PLAYERS_NUM; String command = infromationPhase(turnPlayer); printLOG(command); // DEBUG if (DEBUG && turnPlayer == 0 && players[turnPlayer].isOnBoard() && !players[turnPlayer].isPausing(turn)) { command = new Scanner(System.in).next(); } actionPhase(turnPlayer, command); rebirthPhase(); turn++; } System.out.println("Game Finished!"); } /** * * * @param line * @author J.Kobayashi * @return 4 * {@code true}{@code false} */ private static boolean hasCompleteArgs(CommandLine line) { if (line == null) { return false; } if (line.getOptionValues(EXEC_COMMAND) == null || line.getOptionValues(EXEC_COMMAND).length != PLAYERS_NUM) { return false; } if (line.getOptionValues(PAUSE_COMMAND) == null || line.getOptionValues(PAUSE_COMMAND).length != PLAYERS_NUM) { return false; } if (line.getOptionValues(UNPAUSE_COMMAND) == null || line.getOptionValues(UNPAUSE_COMMAND).length != PLAYERS_NUM) { return false; } return true; } private static void printLOG(String command) { System.out.println(turn); for (Player player : players) { System.out.print(player.life + " "); } System.out.println(); for (int x = 0; x < MAP_WIDTH; x++) { outer: for (int y = 0; y < MAP_WIDTH; y++) { if (DEBUG) { for (int playerID = 0; playerID < PLAYERS_NUM; playerID++) { Player player = players[playerID]; if (player.isOnBoard() && player.x == x && player.y == y) { char c = (char) (playerID + 'A'); System.out.print(c + "" + c); continue outer; } } } System.out.print(" " + board[x][y]); } System.out.println(); } for (Player player : players) { if (player.isOnBoard()) { System.out.println(player.x + " " + player.y + " " + Bookmaker.DIRECTION[player.dir]); } else { System.out.println((-1) + " " + (-1) + " " + Bookmaker.DIRECTION[player.dir]); } } System.out.println(command); } private static void rebirthPhase() { for (int i = 0; i < MAP_WIDTH; i++) { for (int j = 0; j < MAP_WIDTH; j++) { if (board[i][j] < 0) { board[i][j]++; } else if (board[i][j] == 1) { board[i][j] = -PANEL_REBIRTH_TURN; } else if (board[i][j] > 1) { board[i][j] } } } for (int i = 0; i < PLAYERS_NUM; i++) { Player p = players[i]; if (p.isOnBoard() && !p.isMuteki(turn)) { if (board[p.x][p.y] < 0) { p.drop(turn); } } else if (p.isAlive() && !p.isOnBoard() && p.rebirthTurn == turn) { search: while (true) { int x = nextInt(); int y = nextInt(); for (int j = 0; j < PLAYERS_NUM; j++) { if (i == j) { continue; } Player other = players[j]; if (other.isOnBoard() && dist(x, y, other.x, other.y) <= REPULSION) { continue search; } } p.reBirthOn(x, y, turn); p.dir = nextDir(); break; } } } } private static String infromationPhase(int turnPlayer) { if (!players[turnPlayer].isAlive()) { return NONE; } ArrayList<Integer> lifes = new ArrayList<Integer>(); ArrayList<String> wheres = new ArrayList<String>(); for (int i = 0; i < PLAYERS_NUM; i++) { lifes.add(players[i].life); if (players[i].isOnBoard()) { wheres.add(players[i].x + " " + players[i].y); } else { wheres.add((-1) + " " + (-1)); } } String command = players[turnPlayer].getAction(turnPlayer, turn, board, lifes, wheres); return command; } private static void actionPhase(int turnPlayer, String command) { Player p = players[turnPlayer]; if (!p.isOnBoard() || p.isPausing(turn) || command.equals(NONE)) { return; } if (command.equals(ATTACK)) { int xNow = p.x / BLOCK_WIDTH; int yNow = p.y / BLOCK_WIDTH; for (int x = 0; x < MAP_WIDTH; x++) { for (int y = 0; y < MAP_WIDTH; y++) { int xBlock = x / BLOCK_WIDTH; int yBlock = y / BLOCK_WIDTH; if (p.dir == 0) { if (yBlock == yNow && xBlock < xNow && board[x][y] == 0) { board[x][y] = dist(xBlock, yBlock, xNow, yNow) * TIME_TO_FALL; } } else if (p.dir == 1) { if (xBlock == xNow && yBlock < yNow && board[x][y] == 0) { board[x][y] = dist(xBlock, yBlock, xNow, yNow) * TIME_TO_FALL; } } else if (p.dir == 2) { if (yBlock == yNow && xBlock > xNow && board[x][y] == 0) { board[x][y] = dist(xBlock, yBlock, xNow, yNow) * TIME_TO_FALL; } } else if (p.dir == 3) { if (xBlock == xNow && yBlock > yNow && board[x][y] == 0) { board[x][y] = dist(xBlock, yBlock, xNow, yNow) * TIME_TO_FALL; } } } } p.attackedPause(turn); return; } { int tox = -1, toy = -1; if (command.equals(UP)) { tox = p.x - 1; toy = p.y; } else if (command.equals(RIGHT)) { tox = p.x; toy = p.y + 1; } else if (command.equals(DOWN)) { tox = p.x + 1; toy = p.y; } else if (command.equals(LEFT)) { tox = p.x; toy = p.y - 1; } else { return; } if (!isInside(tox, toy)) { return; } p.directTo(command); for (int i = 0; i < PLAYERS_NUM; i++) { if (!players[i].isOnBoard() || i == turnPlayer) { continue; } if (dist(tox, toy, players[i].x, players[i].y) < REPULSION) { return; } } p.moveTo(tox, toy); } } private static int dist(int x1, int y1, int x2, int y2) { return Math.abs(x1 - x2) + Math.abs(y1 - y2); } private static int nextInt() { int ret = (int) (rnd.nextDouble() * MAP_WIDTH); return ret; } private static int nextDir() { int rng = rnd.nextInt(4); return rng; } private static boolean isInside(int x, int y) { return 0 <= x && x < MAP_WIDTH && 0 <= y && y < MAP_WIDTH; } private static boolean isFinished() { int livingCnt = 0; for (int i = 0; i < players.length; i++) { if (players[i].life > 0) { livingCnt++; } } return livingCnt == 1 || turn > FORCED_END_TURN; } }
package net.gigimoi.zombietc.weapon; import net.gigimoi.zombietc.EntityZZombie; import net.gigimoi.zombietc.TileBarricade; import net.gigimoi.zombietc.event.GameManager; import net.gigimoi.zombietc.helpers.MouseOverHelper; import net.gigimoi.zombietc.helpers.TextAlignment; import net.gigimoi.zombietc.helpers.TextRenderHelper; import net.gigimoi.zombietc.net.MessageTryShoot; import net.gigimoi.zombietc.net.MessageReload; import net.gigimoi.zombietc.net.MessageShoot; import net.gigimoi.zombietc.ZombieTC; import net.gigimoi.zombietc.helpers.TextureHelper; import net.gigimoi.zombietc.pathfinding.Point3; import net.gigimoi.zombietc.proxy.ClientProxy; import net.minecraft.block.Block; import net.minecraft.client.entity.EntityClientPlayerMP; import net.minecraft.entity.Entity; import net.minecraft.entity.EntityLivingBase; import net.minecraft.entity.player.EntityPlayer; import net.minecraft.entity.player.EntityPlayerMP; import net.minecraft.init.Blocks; import net.minecraft.item.Item; import net.minecraft.item.ItemStack; import net.minecraft.nbt.NBTTagCompound; import net.minecraft.tileentity.TileEntity; import net.minecraft.util.MovingObjectPosition; import net.minecraft.util.ResourceLocation; import net.minecraft.util.Vec3; import net.minecraft.world.World; import net.minecraftforge.client.IItemRenderer; import net.minecraftforge.client.event.RenderGameOverlayEvent; import net.minecraftforge.client.model.AdvancedModelLoader; import net.minecraftforge.client.model.IModelCustom; import org.lwjgl.opengl.GL11; import scala.util.Right; import java.util.ArrayList; import java.util.List; import java.util.Random; public class ItemWeapon extends Item implements IItemRenderer { public static ItemWeapon radomVis = new ItemWeapon("Radom Vis", FireMechanism.semiAutomatic, 1, 1, 9, 90, 20, 1).barrelLength(1f).sightHeight(0.1f); public static ItemWeapon stormRifle = new ItemWeapon("Storm Rifle", FireMechanism.automatic, 0.5, 6, 30, 120, 20, 3).barrelLength(2f).sightHeight(1f); public static ItemWeapon thompson = new ItemWeapon("Thompson", FireMechanism.automatic, 0.5, 6, 30, 120, 20, 2).barrelLength(1.8f).sightHeight(0.1f); public static ItemWeapon karbine = new ItemWeapon("Karbine", FireMechanism.semiAutomatic, 0.7, 1, 9, 90, 20, 20).barrelLength(2.5f).sightHeight(0.1f); public FireMechanism fireMechanism; public double inventoryScale; double adsLift; public int clipSize; public int initialAmmo; public int reloadTime; public int fireDelay; private float barrelLength; private float sightHeight; public ItemWeapon barrelLength(float length) { this.barrelLength = length; return this; } public ItemWeapon sightHeight(float height) { this.sightHeight = height; return this; } public ItemWeapon(String name, FireMechanism fireMechanism, double inventoryScale, double adsLift, int clipSize, int initialAmmo, int reloadTime, int fireDelay) { this.setUnlocalizedName(name); setMaxStackSize(1); this.fireMechanism = fireMechanism; this.inventoryScale = inventoryScale; this.adsLift = adsLift; this.clipSize = clipSize; this.initialAmmo = initialAmmo; this.reloadTime = reloadTime; this.fireDelay = fireDelay; ZombieTC.proxy.registerWeaponRender(this); } @Override public boolean handleRenderType(ItemStack item, ItemRenderType type) { return true; } @Override public boolean shouldUseRenderHelper(ItemRenderType type, ItemStack item, ItemRendererHelper helper) { return true; } public IModelCustom modelGun; public static IModelCustom modelFlash; private static Random _r = new Random(); @Override public void renderItem(ItemRenderType type, ItemStack stack, Object... data) { GL11.glPushMatrix(); if(type == ItemRenderType.EQUIPPED_FIRST_PERSON) { //EntityPlayer player = (EntityPlayer) data[1]; GL11.glTranslated(0, 1, 0); } if(type == ItemRenderType.INVENTORY) { GL11.glScaled(0.8 * inventoryScale, 0.8 * inventoryScale, 0.8 * inventoryScale); } if(type == ItemRenderType.EQUIPPED) { GL11.glRotated(90, 0, 1, 0); GL11.glTranslated(0, 1, 0); } ensureTagCompund(stack); GL11.glScaled(0.2f, 0.2f, 0.2f); GL11.glRotated(90, 1, 0, 0); GL11.glRotated(135, 0, 0, 1); GL11.glRotated(0, 0, 1, 0); if(type != ItemRenderType.INVENTORY && stack.getTagCompound().getBoolean("InSights") && stack.getTagCompound().getInteger("Reload Timer") == 0) { GL11.glTranslated(-1, 3.45, -0.65 + -adsLift / 5f); } if(type != ItemRenderType.INVENTORY && stack.getTagCompound().getInteger("Reload Timer") > 0) { GL11.glRotated(10, 0, 1, 0); GL11.glRotated(50, 0, 0, -1); } if(type == ItemRenderType.INVENTORY) { GL11.glRotated(-45, 0, 1, 0); } boolean shoot = false; if(stack.getTagCompound().getBoolean("Shoot")) { shoot = true; stack.getTagCompound().setBoolean("Shoot", false); } if(modelGun == null) { modelGun = AdvancedModelLoader.loadModel(new ResourceLocation(ZombieTC.MODID, "models/guns/" + getUnlocalizedName().substring(5) + ".obj")); } if(modelFlash == null) { modelFlash = AdvancedModelLoader.loadModel(new ResourceLocation(ZombieTC.MODID, "models/muzzleflash.obj")); } TextureHelper.bindTexture(new ResourceLocation(ZombieTC.MODID, "textures/models/guns/" + getUnlocalizedName().substring(5) + ".png")); if(type == ItemRenderType.ENTITY) { GL11.glScaled(0.5, 0.5, 0.5); } modelGun.renderAll(); if(shoot) { TextureHelper.bindTexture(new ResourceLocation(ZombieTC.MODID, "textures/models/muzzleflash.png")); GL11.glTranslated(_r.nextInt(100) / 100f - 0.5f, _r.nextInt(100) / 100f - 0.3f, _r.nextInt(100) / 100f - 0.5f); GL11.glTranslated(-barrelLength * 4, 0, sightHeight * 1.5f); modelFlash.renderAll(); } GL11.glPopMatrix(); } @Override public ItemStack onItemRightClick(ItemStack stack, World world, EntityPlayer player) { ensureTagCompund(stack); stack.getTagCompound().setBoolean("InSights",!stack.getTagCompound().getBoolean("InSights")); return stack; } @Override public boolean hitEntity(ItemStack stack, EntityLivingBase attacker, EntityLivingBase attacked) { return false; //TODO: Deal no damage } public void ensureTagCompund(ItemStack stack) { if(!stack.hasTagCompound()) { stack.setTagCompound(new NBTTagCompound()); stack.getTagCompound().setBoolean("InSights", false); stack.getTagCompound().setBoolean("Shoot", false); stack.getTagCompound().setInteger("ShootCooldown", 0); stack.getTagCompound().setInteger("Rounds", clipSize); stack.getTagCompound().setInteger("Ammo", initialAmmo); stack.getTagCompound().setInteger("Reload Time", 0); } } @Override public void onUpdate(ItemStack stack, World world, Entity entity, int p_77663_4_, boolean p_77663_5_) { ensureTagCompund(stack); NBTTagCompound tag = stack.getTagCompound(); if(tag.getInteger("Reload Timer") > 0) { tag.setInteger("Reload Timer", tag.getInteger("Reload Timer") - 1); if(tag.getInteger("Reload Timer") == 0) { tag.setInteger("Rounds", clipSize); tag.setInteger("ShootCooldown", 0); } } if(ZombieTC.editorModeManager.enabled) { return; } if(entity != null) { if(world.isRemote && entity.getClass() != EntityClientPlayerMP.class) { return; } if(!world.isRemote && entity.getClass() == EntityPlayerMP.class) { return; } EntityPlayer player = (EntityPlayer)entity; tag.setInteger("ShootCooldown", tag.getInteger("ShootCooldown") - 1); if(player.getHeldItem() == stack) { player.swingProgress = 0f; player.isSwingInProgress = false; player.swingProgressInt = 0; if(world.isRemote) { if(ClientProxy.reload.isPressed() && tag.getInteger("Reload Timer") == 0 && tag.getInteger("Rounds") != clipSize) { tag.setInteger("Reload Timer", reloadTime); ZombieTC.network.sendToServer(new MessageReload(player)); } if(tag.getInteger("Reload Timer") == 0 && fireMechanism.checkFire(this, stack)) { if(tag.getInteger("Rounds") > 0) { tag.setInteger("ShootCooldown", fireDelay); tag.setBoolean("Shoot", true); tag.setInteger("Rounds", tag.getInteger("Rounds") - 1); //player.cameraYaw += 1; ZombieTC.proxy.playSound("pistolShoot", (float)player.posX, (float)player.posY, (float)player.posZ); ZombieTC.network.sendToServer(new MessageTryShoot(player)); //<fuckmefuckmefuckme> ArrayList<Integer> damages = new ArrayList<Integer>(); ArrayList<Integer> tickers = new ArrayList<Integer>(); List blocks = new ArrayList<Block>(); List<Point3> blockBarricades = (List<Point3>)GameManager.blockBarricades.clone(); for(int i = 0; i < blockBarricades.size(); i++) { Point3 vec = GameManager.blockBarricades.get(i); blocks.add(world.getBlock((int)vec.xCoord, (int)vec.yCoord, (int)vec.zCoord)); TileEntity te = world.getTileEntity((int) vec.xCoord, (int) vec.yCoord, (int) vec.zCoord); damages.add(((TileBarricade)te).damage); tickers.add(((TileBarricade)te).ticker); world.setBlock((int) vec.xCoord, (int) vec.yCoord, (int) vec.zCoord, Blocks.air); } MovingObjectPosition trace = MouseOverHelper.getMouseOver(5000.0F); for(int i = 0; i < blockBarricades.size(); i++) { Point3 vec = blockBarricades.get(i); world.setBlock((int) vec.xCoord, (int) vec.yCoord, (int) vec.zCoord, (Block) blocks.get(i)); TileBarricade te = (TileBarricade)world.getTileEntity((int) vec.xCoord, (int) vec.yCoord, (int) vec.zCoord); te.damage = damages.get(i); te.ticker = tickers.get(i); } //</fuckmefuckmefuckme> if(trace.typeOfHit == MovingObjectPosition.MovingObjectType.ENTITY) { Entity hit = trace.entityHit; if(hit != null && hit.getClass() == EntityZZombie.class) { ZombieTC.network.sendToServer(new MessageShoot(player, trace.entityHit, this)); } } } } } } } super.onUpdate(stack, world, entity, p_77663_4_, p_77663_5_); } public void drawUIFor(ItemStack stack, RenderGameOverlayEvent event) { ensureTagCompund(stack); NBTTagCompound tag = stack.getTagCompound(); int rounds = tag.getInteger("Rounds"); int totalAmmo = tag.getInteger("Ammo"); String out = "Ammo: " + rounds + "/" + clipSize + " - " + totalAmmo; TextRenderHelper.drawString(out, event.resolution.getScaledWidth() - 2, 2, TextAlignment.Right); if(tag.getInteger("Reload Timer") > 0) { TextRenderHelper.drawString("Reloading...", event.resolution.getScaledWidth() - 2, 12, TextAlignment.Right); } } }
package net.minecraftforge.common; import static net.minecraftforge.common.ForgeVersion.Status.*; import java.io.InputStream; import java.net.URL; import java.util.Map; import com.google.common.io.ByteStreams; import com.google.gson.Gson; import net.minecraftforge.fml.common.versioning.ArtifactVersion; import net.minecraftforge.fml.common.versioning.DefaultArtifactVersion; public class ForgeVersion { //This number is incremented every time we remove deprecated code/major API changes, never reset public static final int majorVersion = 11; //This number is incremented every minecraft release, never reset public static final int minorVersion = 14; //This number is incremented every time a interface changes or new major feature is added, and reset every Minecraft version public static final int revisionVersion = 2; //This number is incremented every time Jenkins builds Forge, and never reset. Should always be 0 in the repo code. public static final int buildVersion = 0; private static Status status = PENDING; private static String target = null; public static int getMajorVersion() { return majorVersion; } public static int getMinorVersion() { return minorVersion; } public static int getRevisionVersion() { return revisionVersion; } public static int getBuildVersion() { return buildVersion; } public static Status getStatus() { return status; } public static String getTarget() { return target; } public static String getVersion() { return String.format("%d.%d.%d.%d", majorVersion, minorVersion, revisionVersion, buildVersion); } public static enum Status { PENDING, FAILED, UP_TO_DATE, OUTDATED, AHEAD, BETA, BETA_OUTDATED } public static void startVersionCheck() { new Thread("Forge Version Check") { @SuppressWarnings("unchecked") @Override public void run() { try { URL url = new URL("http://files.minecraftforge.net/maven/net/minecraftforge/forge/promotions_slim.json"); InputStream con = url.openStream(); String data = new String(ByteStreams.toByteArray(con)); con.close(); Map<String, Object> json = new Gson().fromJson(data, Map.class); //String homepage = (String)json.get("homepage"); Map<String, String> promos = (Map<String, String>)json.get("promos"); String rec = promos.get(MinecraftForge.MC_VERSION + "-recommended"); String lat = promos.get(MinecraftForge.MC_VERSION + "-latest"); ArtifactVersion current = new DefaultArtifactVersion(getVersion()); if (rec != null) { ArtifactVersion recommended = new DefaultArtifactVersion(rec); int diff = recommended.compareTo(current); if (diff == 0) status = UP_TO_DATE; else if (diff < 0) { status = AHEAD; if (lat != null) { if (current.compareTo(new DefaultArtifactVersion(lat)) < 0) { status = OUTDATED; target = lat; } } } else { status = OUTDATED; target = rec; } } else if (lat != null) { if (current.compareTo(new DefaultArtifactVersion(lat)) < 0) { status = BETA_OUTDATED; target = lat; } else status = BETA; } else status = BETA; } catch (Exception e) { e.printStackTrace(); status = FAILED; } } }.start(); } }
package monto.eclipse.launching; import java.util.Arrays; import java.util.List; import java.util.stream.Collectors; import java.util.stream.Stream; import org.eclipse.core.runtime.CoreException; import org.eclipse.core.runtime.IProgressMonitor; import org.eclipse.debug.core.DebugEvent; import org.eclipse.debug.core.DebugPlugin; import org.eclipse.debug.core.ILaunch; import org.eclipse.debug.core.ILaunchConfiguration; import org.eclipse.debug.core.model.IBreakpoint; import org.eclipse.debug.core.model.ILaunchConfigurationDelegate; import monto.eclipse.Activator; import monto.eclipse.launching.debug.MontoDebugTarget; import monto.eclipse.launching.debug.MontoLineBreakpoint; import monto.service.command.CommandMessage; import monto.service.command.Commands; import monto.service.gson.GsonMonto; import monto.service.launching.DebugLaunchConfiguration; import monto.service.launching.LaunchConfiguration; import monto.service.launching.debug.Breakpoint; import monto.service.product.Products; import monto.service.types.Language; import monto.service.types.Source; public class LaunchConfigurationDelegate implements ILaunchConfigurationDelegate { private static int runSessionIdCounter = 0; private static int debugSessionIdCounter = 1000000000; @Override public void launch(ILaunchConfiguration configuration, String mode, ILaunch launch, IProgressMonitor monitor) throws CoreException { String mainClassPhysicalName = configuration.getAttribute(MainClassLaunchConfigurationTab.ATTR_PHYSICAL_NAME, ""); String mainClassLogicalName = configuration.getAttribute(MainClassLaunchConfigurationTab.ATTR_LOGICAL_NAME, ""); String mainClassLanguage = configuration.getAttribute(MainClassLaunchConfigurationTab.ATTR_LAGUAGE, ""); Source source = new Source(mainClassPhysicalName, mainClassLogicalName); Language language = new Language(mainClassLanguage); if (mode.equals("run")) { runSessionIdCounter += 1; Activator.sendCommandMessage( new CommandMessage(runSessionIdCounter, 1, Commands.RUN_LAUNCH_CONFIGURATION, language, GsonMonto.toJsonTree(new LaunchConfiguration(source)))); launch.addProcess(createMontoProcess(launch, runSessionIdCounter, mode)); } else if (mode.equals("debug")) { debugSessionIdCounter += 1; IBreakpoint[] eclipseBreakpoints = DebugPlugin.getDefault().getBreakpointManager().getBreakpoints(Activator.PLUGIN_ID); List<Breakpoint> breakpoints = Arrays.stream(eclipseBreakpoints).flatMap(eclipseBreakpoint -> { if (eclipseBreakpoint != null && eclipseBreakpoint instanceof MontoLineBreakpoint) { MontoLineBreakpoint montoBreakpoint = (MontoLineBreakpoint) eclipseBreakpoint; try { return Stream.of( new Breakpoint(montoBreakpoint.getSource(), montoBreakpoint.getLineNumber())); } catch (CoreException e) { System.err.printf("Couldn't translate MontoLineBreakpoint to Breakpoint: %s (%s)", e.getClass().getName(), e.getMessage()); e.printStackTrace(); } } return Stream.empty(); }).collect(Collectors.toList()); Activator.sendCommandMessage(new CommandMessage(debugSessionIdCounter, 1, Commands.DEBUG_LAUNCH_CONFIGURATION, language, GsonMonto.toJsonTree(new DebugLaunchConfiguration(source, breakpoints)))); MontoProcess process = createMontoProcess(launch, debugSessionIdCounter, mode); MontoDebugTarget debugTarget = new MontoDebugTarget(debugSessionIdCounter, launch, process); Activator.getDefault().getDemultiplexer().addProductListener(Products.HIT_BREAKPOINT, debugTarget::onBreakpointHit); launch.addProcess(process); launch.addDebugTarget(debugTarget); debugTarget.fireEvent(DebugEvent.CREATE); } } MontoProcess createMontoProcess(ILaunch launch, int sessionId, String mode) { MontoProcess process = new MontoProcess(launch, sessionId, mode); Activator.getDefault().getDemultiplexer().addProductListener(Products.STREAM_OUTPUT, process::onStreamOutputProduct); Activator.getDefault().getDemultiplexer().addProductListener(Products.PROCESS_TERMINATED, process::onProcessTerminatedProduct); return process; } }
package nl.topicus.jdbc; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.InputStream; import java.nio.channels.Channels; import java.sql.CallableStatement; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.SQLFeatureNotSupportedException; import java.sql.Savepoint; import java.sql.Statement; import java.util.ArrayList; import java.util.Arrays; import java.util.Collections; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Map.Entry; import java.util.Objects; import java.util.Properties; import java.util.function.Supplier; import org.json.JSONException; import org.json.JSONObject; import org.json.JSONTokener; import com.google.api.core.InternalApi; import com.google.auth.Credentials; import com.google.auth.oauth2.AccessToken; import com.google.auth.oauth2.GoogleCredentials; import com.google.auth.oauth2.ServiceAccountCredentials; import com.google.auth.oauth2.UserCredentials; import com.google.cloud.ReadChannel; import com.google.cloud.Timestamp; import com.google.cloud.spanner.BatchClient; import com.google.cloud.spanner.DatabaseAdminClient; import com.google.cloud.spanner.DatabaseClient; import com.google.cloud.spanner.DatabaseId; import com.google.cloud.spanner.Instance; import com.google.cloud.spanner.Operation; import com.google.cloud.spanner.ResultSets; import com.google.cloud.spanner.Spanner; import com.google.cloud.spanner.SpannerException; import com.google.cloud.spanner.Struct; import com.google.cloud.spanner.Type; import com.google.cloud.spanner.Type.StructField; import com.google.cloud.spanner.Value; import com.google.cloud.storage.Blob; import com.google.cloud.storage.Storage; import com.google.cloud.storage.StorageOptions; import com.google.common.annotations.VisibleForTesting; import com.google.common.base.Preconditions; import com.google.rpc.Code; import com.google.spanner.admin.database.v1.UpdateDatabaseDdlMetadata; import nl.topicus.jdbc.MetaDataStore.TableKeyMetaData; import nl.topicus.jdbc.exception.CloudSpannerSQLException; import nl.topicus.jdbc.resultset.CloudSpannerResultSet; import nl.topicus.jdbc.statement.CloudSpannerPreparedStatement; import nl.topicus.jdbc.statement.CloudSpannerStatement; import nl.topicus.jdbc.transaction.CloudSpannerTransaction; /** * JDBC Driver for Google Cloud Spanner. * * @author loite * */ public class CloudSpannerConnection extends AbstractCloudSpannerConnection { public static class CloudSpannerDatabaseSpecification { public final String project; public final String instance; public final String database; private final String key; public CloudSpannerDatabaseSpecification(String instance, String database) { this(null, instance, database); } public CloudSpannerDatabaseSpecification(String project, String instance, String database) { Preconditions.checkNotNull(instance); Preconditions.checkNotNull(database); this.project = project; this.instance = instance; this.database = database; this.key = Objects.toString(project, "") + "/" + instance + "/" + database; } @Override public int hashCode() { return key.hashCode(); } @Override public boolean equals(Object o) { if (!(o instanceof CloudSpannerDatabaseSpecification)) return false; return ((CloudSpannerDatabaseSpecification) o).key.equals(key); } } private static final String GOOGLE_CLOUD_STORAGE_PREFIX = "gs: private final CloudSpannerDriver driver; private final CloudSpannerDatabaseSpecification database; private Spanner spanner; private String clientId; private DatabaseClient dbClient; private DatabaseAdminClient adminClient; private boolean autoCommit = true; private boolean closed; private boolean readOnly; /** * Special mode for Cloud Spanner: When the connection is in this mode, queries will be executed * using the {@link BatchClient} instead of the default {@link DatabaseClient} */ private boolean originalBatchReadOnly; private boolean batchReadOnly; private final RunningOperationsStore operations = new RunningOperationsStore(); private final String url; private final Properties suppliedProperties; private boolean originalAllowExtendedMode; private boolean allowExtendedMode; private boolean originalAsyncDdlOperations; private boolean asyncDdlOperations; private boolean originalAutoBatchDdlOperations; private boolean autoBatchDdlOperations; private final List<String> autoBatchedDdlOperations = new ArrayList<>(); private boolean originalReportDefaultSchemaAsNull = true; private boolean reportDefaultSchemaAsNull = true; private boolean useCustomHost = false; private String simulateProductName; private Integer simulateMajorVersion; private Integer simulateMinorVersion; private CloudSpannerTransaction transaction; private Timestamp lastCommitTimestamp; private MetaDataStore metaDataStore; private static int nextConnectionID = 1; private final Logger logger; private Map<String, Class<?>> typeMap = new HashMap<>(); @VisibleForTesting CloudSpannerConnection() { this(null); } @VisibleForTesting CloudSpannerConnection(DatabaseClient dbClient, BatchClient batchClient) { this.driver = null; this.database = null; this.url = null; this.suppliedProperties = null; this.logger = null; this.dbClient = dbClient; this.transaction = new CloudSpannerTransaction(dbClient, batchClient, this); this.metaDataStore = new MetaDataStore(this); } @VisibleForTesting CloudSpannerConnection(CloudSpannerDatabaseSpecification database) { this.driver = null; this.database = database; this.url = null; this.suppliedProperties = null; this.logger = null; this.transaction = new CloudSpannerTransaction(null, null, this); this.metaDataStore = new MetaDataStore(this); } CloudSpannerConnection(CloudSpannerDriver driver, String url, CloudSpannerDatabaseSpecification database, String credentialsPath, String oauthToken, Properties suppliedProperties, boolean useCustomHost) throws SQLException { this.driver = driver; this.database = database; this.url = url; this.suppliedProperties = suppliedProperties; int logLevel = CloudSpannerDriver.getLogLevel(); synchronized (CloudSpannerConnection.class) { logger = new Logger(nextConnectionID++); logger.setLogLevel(logLevel); } try { Credentials credentials = null; if (credentialsPath != null) { credentials = getCredentialsFromFile(credentialsPath); } else if (oauthToken != null) { credentials = getCredentialsFromOAuthToken(oauthToken); } if (credentials != null) { if (credentials instanceof UserCredentials) { clientId = ((UserCredentials) credentials).getClientId(); } if (credentials instanceof ServiceAccountCredentials) { clientId = ((ServiceAccountCredentials) credentials).getClientId(); } } String host = null; if (useCustomHost) { // Extract host from url int endIndex = url.indexOf(';'); if (endIndex == -1) { endIndex = url.length(); } host = url.substring("jdbc:cloudspanner:".length(), endIndex); } spanner = driver.getSpanner(database.project, credentials, host); dbClient = spanner.getDatabaseClient( DatabaseId.of(spanner.getOptions().getProjectId(), database.instance, database.database)); BatchClient batchClient = spanner.getBatchClient( DatabaseId.of(spanner.getOptions().getProjectId(), database.instance, database.database)); adminClient = spanner.getDatabaseAdminClient(); transaction = new CloudSpannerTransaction(dbClient, batchClient, this); metaDataStore = new MetaDataStore(this); } catch (SpannerException e) { throw new CloudSpannerSQLException( "Error when opening Google Cloud Spanner connection: " + e.getMessage(), e); } catch (IOException e) { throw new CloudSpannerSQLException( "Error when opening Google Cloud Spanner connection: " + e.getMessage(), Code.UNKNOWN, e); } } public static GoogleCredentials getCredentialsFromOAuthToken(String oauthToken) { GoogleCredentials credentials = null; if (oauthToken != null && oauthToken.length() > 0) { credentials = GoogleCredentials.create(new AccessToken(oauthToken, null)); } return credentials; } public static GoogleCredentials getCredentialsFromFile(String credentialsPath) throws IOException { if (credentialsPath == null || credentialsPath.length() == 0) throw new IllegalArgumentException("credentialsPath may not be null or empty"); GoogleCredentials credentials = null; if (credentialsPath.startsWith(GOOGLE_CLOUD_STORAGE_PREFIX)) { try { Storage storage = StorageOptions.newBuilder().build().getService(); String bucketName = getBucket(credentialsPath); String blobName = getBlob(credentialsPath); Blob blob = storage.get(bucketName, blobName); ReadChannel reader = blob.reader(); InputStream inputStream = Channels.newInputStream(reader); credentials = GoogleCredentials.fromStream(inputStream, CloudSpannerOAuthUtil.HTTP_TRANSPORT_FACTORY); } catch (Exception e) { throw new IllegalArgumentException( "Invalid credentials path: " + credentialsPath + ". Reason: " + e.getMessage(), e); } } else { File credentialsFile = new File(credentialsPath); if (!credentialsFile.isFile()) { throw new IOException(String.format("Error reading credential file %s: File does not exist", credentialsPath)); } try (InputStream credentialsStream = new FileInputStream(credentialsFile)) { credentials = GoogleCredentials.fromStream(credentialsStream, CloudSpannerOAuthUtil.HTTP_TRANSPORT_FACTORY); } } return credentials; } static String getBucket(String storageUrl) { Preconditions.checkArgument(storageUrl.startsWith(GOOGLE_CLOUD_STORAGE_PREFIX), String.format("Storage URL must start with %s", GOOGLE_CLOUD_STORAGE_PREFIX)); Preconditions.checkArgument(storageUrl.substring(5).contains("/"), "Storage URL must contain a blob name"); return storageUrl.substring(5, storageUrl.indexOf('/', 5)); } static String getBlob(String storageUrl) { Preconditions.checkArgument(storageUrl.startsWith(GOOGLE_CLOUD_STORAGE_PREFIX), String.format("Storage URL must start with %s", GOOGLE_CLOUD_STORAGE_PREFIX)); Preconditions.checkArgument(storageUrl.substring(5).contains("/"), "Storage URL must contain a blob name"); return storageUrl.substring(storageUrl.indexOf('/', 5) + 1); } public static String getServiceAccountProjectId(String credentialsPath) { String project = null; if (credentialsPath != null) { try (InputStream credentialsStream = new FileInputStream(credentialsPath)) { JSONObject json = new JSONObject(new JSONTokener(credentialsStream)); project = json.getString("project_id"); } catch (IOException | JSONException ex) { // ignore } } return project; } Spanner getSpanner() { return spanner; } public String getSimulateProductName() { return simulateProductName; } @Override public void setSimulateProductName(String productName) { this.simulateProductName = productName; } public Integer getSimulateMajorVersion() { return simulateMajorVersion; } @Override public void setSimulateMajorVersion(Integer majorVersion) { this.simulateMajorVersion = majorVersion; } public Integer getSimulateMinorVersion() { return simulateMinorVersion; } @Override public void setSimulateMinorVersion(Integer minorVersion) { this.simulateMinorVersion = minorVersion; } /** * Execute one or more DDL-statements on the database and wait for it to finish or return after * syntax check (when running in async mode). Calling this method will also automatically commit * the currently running transaction. * * @param inputSql The DDL-statement(s) to execute. Some statements may end up not being sent to * Cloud Spanner if they contain IF [NOT] EXISTS clauses. The driver will check whether the * condition is met, and only then will it be sent to Cloud Spanner. * @return Nothing * @throws SQLException If an error occurs during the execution of the statement. */ public Void executeDDL(List<String> inputSql) throws SQLException { if (!getAutoCommit()) commit(); // Check for IF [NOT] EXISTS statements List<String> sql = getActualSql(inputSql); if (!sql.isEmpty()) { try { Operation<Void, UpdateDatabaseDdlMetadata> operation = adminClient.updateDatabaseDdl(database.instance, database.database, sql, null); if (asyncDdlOperations) { operations.addOperation(sql, operation); } else { do { operation = operation.waitFor(); } while (!operation.isDone()); } return operation.getResult(); } catch (SpannerException e) { throw new CloudSpannerSQLException("Could not execute DDL statement(s) " + String.join("\n;\n", sql) + ": " + e.getMessage(), e); } } return null; } private List<String> getActualSql(List<String> sql) throws SQLException { List<DDLStatement> statements = DDLStatement.parseDdlStatements(sql); List<String> actualSql = new ArrayList<>(sql.size()); for (DDLStatement statement : statements) { if (statement.shouldExecute(this)) { actualSql.add(statement.getSql()); } } return actualSql; } /** * Clears the asynchronous DDL-operations that have finished. * * @return The number of operations that were cleared */ public int clearFinishedDDLOperations() { return operations.clearFinishedOperations(); } /** * Waits for all asynchronous DDL-operations that have been issued by this connection to finish. * * @throws SQLException If a database exception occurs while waiting for the operations to finish * */ public void waitForDdlOperations() throws SQLException { operations.waitForOperations(); } /** * Returns a ResultSet containing all asynchronous DDL-operations started by this connection. It * does not contain DDL-operations that have been started by other connections or by other means. * * @param statement The statement that requested the operations * @return A ResultSet with the DDL-operations * @throws SQLException If a database error occurs */ public ResultSet getRunningDDLOperations(CloudSpannerStatement statement) throws SQLException { return operations.getOperations(statement); } @Override public String getProductName() { if (getSimulateProductName() != null) return getSimulateProductName(); return "Google Cloud Spanner"; } @Override public CloudSpannerStatement createStatement() throws SQLException { checkClosed(); return new CloudSpannerStatement(this, dbClient); } @Override public CloudSpannerPreparedStatement prepareStatement(String sql) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public CallableStatement prepareCall(String sql) throws SQLException { checkClosed(); throw new SQLFeatureNotSupportedException(); } @Override public String nativeSQL(String sql) throws SQLException { checkClosed(); return sql; } @Override public void setAutoCommit(boolean autoCommit) throws SQLException { checkClosed(); if (autoCommit != this.autoCommit && isBatchReadOnly()) { throw new CloudSpannerSQLException( "The connection is currently in batch read-only mode. Please turn off batch read-only before changing auto-commit mode.", Code.FAILED_PRECONDITION); } this.autoCommit = autoCommit; } @Override public boolean getAutoCommit() throws SQLException { checkClosed(); return autoCommit; } @Override public void commit() throws SQLException { checkClosed(); lastCommitTimestamp = getTransaction().commit(); } @Override public void rollback() throws SQLException { checkClosed(); getTransaction().rollback(); } public CloudSpannerTransaction getTransaction() { return transaction; } @Override public void close() throws SQLException { if (closed) return; getTransaction().rollback(); closed = true; driver.closeConnection(this); } @InternalApi void markClosed() { closed = true; } @Override public boolean isClosed() throws SQLException { return closed; } @Override public CloudSpannerDatabaseMetaData getMetaData() throws SQLException { checkClosed(); return new CloudSpannerDatabaseMetaData(this); } @Override public void setReadOnly(boolean readOnly) throws SQLException { checkClosed(); if (readOnly != this.readOnly) { if (getTransaction().isRunning()) { throw new CloudSpannerSQLException( "There is currently a transaction running. Commit or rollback the running transaction before changing read-only mode.", Code.FAILED_PRECONDITION); } if (isBatchReadOnly()) { throw new CloudSpannerSQLException( "The connection is currently in batch read-only mode. Please turn off batch read-only before changing read-only mode.", Code.FAILED_PRECONDITION); } } this.readOnly = readOnly; } @Override public boolean isReadOnly() throws SQLException { checkClosed(); return readOnly; } @Override public void setTransactionIsolation(int level) throws SQLException { checkClosed(); if (level != Connection.TRANSACTION_SERIALIZABLE) { throw new CloudSpannerSQLException( "Transaction level " + level + " is not supported. Only Connection.TRANSACTION_SERIALIZABLE is supported", Code.INVALID_ARGUMENT); } } @Override public int getTransactionIsolation() throws SQLException { checkClosed(); return Connection.TRANSACTION_SERIALIZABLE; } @Override public Statement createStatement(int resultSetType, int resultSetConcurrency) throws SQLException { checkClosed(); return new CloudSpannerStatement(this, dbClient); } @Override public PreparedStatement prepareStatement(String sql, int resultSetType, int resultSetConcurrency) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public Statement createStatement(int resultSetType, int resultSetConcurrency, int resultSetHoldability) throws SQLException { checkClosed(); return new CloudSpannerStatement(this, dbClient); } @Override public PreparedStatement prepareStatement(String sql, int resultSetType, int resultSetConcurrency, int resultSetHoldability) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public PreparedStatement prepareStatement(String sql, int autoGeneratedKeys) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public PreparedStatement prepareStatement(String sql, int[] columnIndexes) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public PreparedStatement prepareStatement(String sql, String[] columnNames) throws SQLException { checkClosed(); return new CloudSpannerPreparedStatement(sql, this, dbClient); } @Override public String getUrl() { return url; } @Override public String getClientId() { return clientId; } @Override public boolean isValid(int timeout) throws SQLException { if (isClosed()) return false; Statement statement = createStatement(); statement.setQueryTimeout(timeout); try (ResultSet rs = statement.executeQuery("SELECT 1")) { if (rs.next()) return true; } return false; } @Override public CloudSpannerArray createArrayOf(String typeName, Object[] elements) throws SQLException { checkClosed(); return CloudSpannerArray.createArray(typeName, elements); } public TableKeyMetaData getTable(String name) throws SQLException { return metaDataStore.getTable(name); } @Override public Properties getSuppliedProperties() { return suppliedProperties; } @Override public boolean isAllowExtendedMode() { return allowExtendedMode; } @Override public int setAllowExtendedMode(boolean allowExtendedMode) { this.allowExtendedMode = allowExtendedMode; return 1; } boolean isOriginalAllowExtendedMode() { return originalAllowExtendedMode; } void setOriginalAllowExtendedMode(boolean allowExtendedMode) { this.originalAllowExtendedMode = allowExtendedMode; } @Override public boolean isAsyncDdlOperations() { return asyncDdlOperations; } @Override public int setAsyncDdlOperations(boolean asyncDdlOperations) { this.asyncDdlOperations = asyncDdlOperations; return 1; } boolean isOriginalAsyncDdlOperations() { return originalAsyncDdlOperations; } void setOriginalAsyncDdlOperations(boolean asyncDdlOperations) { this.originalAsyncDdlOperations = asyncDdlOperations; } @Override public boolean isAutoBatchDdlOperations() { return autoBatchDdlOperations; } @Override public int setAutoBatchDdlOperations(boolean autoBatchDdlOperations) { clearAutoBatchedDdlOperations(); this.autoBatchDdlOperations = autoBatchDdlOperations; return 1; } boolean isOriginalAutoBatchDdlOperations() { return originalAutoBatchDdlOperations; } void setOriginalAutoBatchDdlOperations(boolean autoBatchDdlOperations) { this.originalAutoBatchDdlOperations = autoBatchDdlOperations; } @Override public boolean isReportDefaultSchemaAsNull() { return reportDefaultSchemaAsNull; } @Override public int setReportDefaultSchemaAsNull(boolean reportDefaultSchemaAsNull) { this.reportDefaultSchemaAsNull = reportDefaultSchemaAsNull; return 1; } boolean isOriginalReportDefaultSchemaAsNull() { return originalReportDefaultSchemaAsNull; } void setOriginalReportDefaultSchemaAsNull(boolean reportDefaultSchemaAsNull) { this.originalReportDefaultSchemaAsNull = reportDefaultSchemaAsNull; } /** * Set a dynamic connection property, such as AsyncDdlOperations * * @param propertyName The name of the dynamic connection property * @param propertyValue The value to set * @return 1 if the property was set, 0 if not (this complies with the normal behaviour of * executeUpdate(...) methods) * @throws SQLException Throws {@link SQLException} if a database error occurs */ public int setDynamicConnectionProperty(String propertyName, String propertyValue) throws SQLException { return getPropertySetter(propertyName).apply(Boolean.valueOf(propertyValue)); } /** * Reset a dynamic connection property to its original value, such as AsyncDdlOperations * * @param propertyName The name of the dynamic connection property * @return 1 if the property was reset, 0 if not (this complies with the normal behaviour of * executeUpdate(...) methods) * @throws SQLException Throws {@link SQLException} if a database error occurs */ public int resetDynamicConnectionProperty(String propertyName) throws SQLException { return getPropertySetter(propertyName).apply(getOriginalValueGetter(propertyName).get()); } private Supplier<Boolean> getOriginalValueGetter(String propertyName) { if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ALLOW_EXTENDED_MODE))) { return this::isOriginalAllowExtendedMode; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ASYNC_DDL_OPERATIONS))) { return this::isOriginalAsyncDdlOperations; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.AUTO_BATCH_DDL_OPERATIONS))) { return this::isOriginalAutoBatchDdlOperations; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.REPORT_DEFAULT_SCHEMA_AS_NULL))) { return this::isOriginalReportDefaultSchemaAsNull; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.BATCH_READ_ONLY_MODE))) { return this::isOriginalBatchReadOnly; } // Return a no-op to avoid null checks return () -> false; } @FunctionalInterface static interface SqlFunction<T, R> { R apply(T t) throws SQLException; } private SqlFunction<Boolean, Integer> getPropertySetter(String propertyName) { if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ALLOW_EXTENDED_MODE))) { return this::setAllowExtendedMode; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ASYNC_DDL_OPERATIONS))) { return this::setAsyncDdlOperations; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.AUTO_BATCH_DDL_OPERATIONS))) { return this::setAutoBatchDdlOperations; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.REPORT_DEFAULT_SCHEMA_AS_NULL))) { return this::setReportDefaultSchemaAsNull; } if (propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.BATCH_READ_ONLY_MODE))) { return this::setBatchReadOnly; } // Return a no-op to avoid null checks return x -> 0; } public ResultSet getDynamicConnectionProperties(CloudSpannerStatement statement) throws SQLException { return getDynamicConnectionProperty(statement, null); } public ResultSet getDynamicConnectionProperty(CloudSpannerStatement statement, String propertyName) throws SQLException { Map<String, String> values = new HashMap<>(); if (propertyName == null || propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ALLOW_EXTENDED_MODE))) { values.put(ConnectionProperties.getPropertyName(ConnectionProperties.ALLOW_EXTENDED_MODE), String.valueOf(isAllowExtendedMode())); } if (propertyName == null || propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.ASYNC_DDL_OPERATIONS))) { values.put(ConnectionProperties.getPropertyName(ConnectionProperties.ASYNC_DDL_OPERATIONS), String.valueOf(isAsyncDdlOperations())); } if (propertyName == null || propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.AUTO_BATCH_DDL_OPERATIONS))) { values.put( ConnectionProperties.getPropertyName(ConnectionProperties.AUTO_BATCH_DDL_OPERATIONS), String.valueOf(isAutoBatchDdlOperations())); } if (propertyName == null || propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.REPORT_DEFAULT_SCHEMA_AS_NULL))) { values.put( ConnectionProperties.getPropertyName(ConnectionProperties.REPORT_DEFAULT_SCHEMA_AS_NULL), String.valueOf(isReportDefaultSchemaAsNull())); } if (propertyName == null || propertyName.equalsIgnoreCase( ConnectionProperties.getPropertyName(ConnectionProperties.BATCH_READ_ONLY_MODE))) { values.put(ConnectionProperties.getPropertyName(ConnectionProperties.BATCH_READ_ONLY_MODE), String.valueOf(isBatchReadOnly())); } return createResultSet(statement, values); } private ResultSet createResultSet(CloudSpannerStatement statement, Map<String, String> values) throws SQLException { List<Struct> rows = new ArrayList<>(values.size()); for (Entry<String, String> entry : values.entrySet()) { rows.add(Struct.newBuilder().set("NAME").to(Value.string(entry.getKey())).set("VALUE") .to(Value.string(entry.getValue())).build()); } com.google.cloud.spanner.ResultSet rs = ResultSets.forRows( Type.struct(StructField.of("NAME", Type.string()), StructField.of("VALUE", Type.string())), rows); return new CloudSpannerResultSet(statement, rs, null); } public ResultSet getLastCommitTimestamp(CloudSpannerStatement statement) throws SQLException { com.google.cloud.spanner.ResultSet rs = ResultSets.forRows( Type.struct(StructField.of("COMMIT_TIMESTAMP", Type.timestamp())), Arrays.asList(Struct.newBuilder().set("COMMIT_TIMESTAMP").to(lastCommitTimestamp).build())); return new CloudSpannerResultSet(statement, rs, null); } /** * * @return The commit timestamp of the last transaction that committed succesfully */ @Override public Timestamp getLastCommitTimestamp() { return lastCommitTimestamp; } /** * * @return The read timestamp for the current read-only transaction, or null if there is no * read-only transaction */ @Override public Timestamp getReadTimestamp() { return transaction == null ? null : transaction.getReadTimestamp(); } /** * * @return A new connection with the same URL and properties as this connection. You can use this * method if you want to open a new connection to the same database, for example to run a * number of statements in a different transaction than the transaction you are currently * using on this connection. * @throws SQLException If an error occurs while opening the new connection */ public CloudSpannerConnection createCopyConnection() throws SQLException { return (CloudSpannerConnection) DriverManager.getConnection(getUrl(), getSuppliedProperties()); } public Logger getLogger() { return logger; } @Override public Map<String, Class<?>> getTypeMap() throws SQLException { checkClosed(); return typeMap; } @Override public void setTypeMap(Map<String, Class<?>> map) throws SQLException { checkClosed(); this.typeMap = map; } /** * * @return The number of nodes of this Cloud Spanner instance * @throws SQLException If an exception occurs when trying to get the number of nodes */ public int getNodeCount() throws SQLException { try { if (database != null && database.instance != null) { Instance instance = getSpanner().getInstanceAdminClient().getInstance(database.instance); return instance == null ? 0 : instance.getNodeCount(); } return 0; } catch (SpannerException e) { throw new CloudSpannerSQLException(e); } } /** * Prepare the current transaction by writing the mutations to the XA_TRANSACTIONS table instead * of persisting them in the actual tables. * * @param xid The id of the prepared transaction * @throws SQLException If an exception occurs while saving the mutations to the database for * later commit */ public void prepareTransaction(String xid) throws SQLException { getTransaction().prepareTransaction(xid); } /** * Commit a previously prepared transaction. * * @param xid The id of the prepared transaction * @throws SQLException If an error occurs when writing the mutations to the database */ public void commitPreparedTransaction(String xid) throws SQLException { getTransaction().commitPreparedTransaction(xid); } /** * Rollback a previously prepared transaction. * * @param xid The id of the prepared transaction to rollback * @throws SQLException If an error occurs while rolling back the prepared transaction */ public void rollbackPreparedTransaction(String xid) throws SQLException { getTransaction().rollbackPreparedTransaction(xid); } public List<String> getAutoBatchedDdlOperations() { return Collections.unmodifiableList(autoBatchedDdlOperations); } public void clearAutoBatchedDdlOperations() { autoBatchedDdlOperations.clear(); } public void addAutoBatchedDdlOperation(String sql) { autoBatchedDdlOperations.add(sql); } @Override public boolean isBatchReadOnly() { return batchReadOnly; } @Override public int setBatchReadOnly(boolean batchReadOnly) throws SQLException { checkClosed(); if (batchReadOnly != this.batchReadOnly) { if (getAutoCommit()) { throw new CloudSpannerSQLException( "The connection is currently in auto-commit mode. Please turn off auto-commit before changing batch read-only mode.", Code.FAILED_PRECONDITION); } if (getTransaction().isRunning()) { throw new CloudSpannerSQLException( "There is currently a transaction running. Commit or rollback the running transaction before changing batch read-only mode.", Code.FAILED_PRECONDITION); } } this.batchReadOnly = batchReadOnly; return 1; } boolean isOriginalBatchReadOnly() { return originalBatchReadOnly; } void setOriginalBatchReadOnly(boolean originalBatchReadOnly) { this.originalBatchReadOnly = originalBatchReadOnly; } private void checkSavepointPossible() throws SQLException { checkClosed(); if (getAutoCommit()) throw new CloudSpannerSQLException("Savepoints are not supported in autocommit mode", Code.FAILED_PRECONDITION); if (isReadOnly() || isBatchReadOnly()) throw new CloudSpannerSQLException("Savepoints are not supported in read-only mode", Code.FAILED_PRECONDITION); } @Override public Savepoint setSavepoint() throws SQLException { checkSavepointPossible(); CloudSpannerSavepoint savepoint = CloudSpannerSavepoint.generated(); transaction.setSavepoint(savepoint); return savepoint; } @Override public Savepoint setSavepoint(String name) throws SQLException { checkSavepointPossible(); Preconditions.checkNotNull(name); CloudSpannerSavepoint savepoint = CloudSpannerSavepoint.named(name); transaction.setSavepoint(savepoint); return savepoint; } @Override public void rollback(Savepoint savepoint) throws SQLException { checkSavepointPossible(); Preconditions.checkNotNull(savepoint); transaction.rollbackSavepoint(savepoint); } @Override public void releaseSavepoint(Savepoint savepoint) throws SQLException { checkSavepointPossible(); Preconditions.checkNotNull(savepoint); transaction.releaseSavepoint(savepoint); } @Override public boolean isUseCustomHost() { return useCustomHost; } void setUseCustomHost(boolean useCustomHost) { this.useCustomHost = useCustomHost; } }
package mu.nu.nullpo.game.subsystem.mode; import mu.nu.nullpo.game.component.Block; import mu.nu.nullpo.game.component.Controller; import mu.nu.nullpo.game.component.Piece; import mu.nu.nullpo.game.event.EventReceiver; import mu.nu.nullpo.game.play.GameEngine; import mu.nu.nullpo.game.play.GameManager; import mu.nu.nullpo.util.CustomProperties; import mu.nu.nullpo.util.GeneralUtil; /** * AVALANCHE FEVER MARATHON mode (Release Candidate 1) */ public class AvalancheFeverMode extends DummyMode { /** Current version */ private static final int CURRENT_VERSION = 0; /** Enabled piece types */ private static final int[] PIECE_ENABLE = {0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0}; /** Block colors */ private static final int[] BLOCK_COLORS = { Block.BLOCK_COLOR_RED, Block.BLOCK_COLOR_GREEN, Block.BLOCK_COLOR_BLUE, Block.BLOCK_COLOR_YELLOW, Block.BLOCK_COLOR_PURPLE }; private static final int[] CHAIN_POWERS = { 4, 10, 18, 22, 30, 48, 80, 120, 160, 240, 280, 288, 342, 400, 440, 480, 520, 560, 600, 640, 680, 720, 760, 800 //Amitie }; public int[] tableGravityChangeScore = { 15000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 150000, 250000, 400000, Integer.MAX_VALUE }; public int[] tableGravityValue = { 1, 2, 3, 4, 6, 8, 10, 20, 30, 60, 120, 180, 300, -1 }; /** Fever map files list */ private static final String[] FEVER_MAPS = { "Fever", "15th", "15thDS", "7" }; /** Names of chain display settings */ private static final String[] CHAIN_DISPLAY_NAMES = {"OFF", "YELLOW", "SIZE"}; /** Number of ranking records */ private static final int RANKING_MAX = 10; /** Time limit */ private static final int TIME_LIMIT = 3600; /** GameManager object (Manages entire game status) */ private GameManager owner; /** EventReceiver object (This receives many game events, can also be used for drawing the fonts.) */ private EventReceiver receiver; /** Current numbertableGravityChangeLevel level1 */ private int gravityindex; /** Amount of points earned from most recent clear */ private int lastscore, lastmultiplier; /** Elapsed time from last line clear (lastscore is displayed to screen until this reaches to 120) */ private int scgettime; /** Selected game type */ private int mapSet; /** Outline type */ private int outlinetype; /** Version number */ private int version; /** Current round's ranking rank */ private int rankingRank; /** Rankings' line counts */ private int[][][] rankingScore; /** Rankings' times */ private int[][][] rankingTime; /** Flag for all clear */ private int zenKeshiDisplay; /** Flag set to true if first group in the chain is larger minimum size */ //private boolean firstExtra; /** Amount of garbage sent */ private int garbageSent, garbageAdd; /** Number of colors to use */ private int numColors; /** Time limit left */ private int timeLimit; /** Time added to limit */ private int timeLimitAdd; /** Time to display added time */ private int timeLimitAddDisplay; /** Fever map CustomProperties */ private CustomProperties propFeverMap; /** Chain levels for Fever Mode */ private int feverChain; /** Chain level boundaries for Fever Mode */ private int feverChainMin, feverChainMax; /** Flag set to true when last piece caused a clear */ private boolean cleared; /** Flag for all-clears */ private boolean zenKeshi; /** Number of all clears */ private int zenKeshiCount; /** Max chain */ private int maxChain; /** List of subsets in selected map */ private String[] mapSubsets; /** Last chain hit number */ private int chain; /** Time to display last chain */ private int chainDisplay; /** Fever chain count when last chain hit occurred */ private int feverChainDisplay; /** Type of chain display */ private int chainDisplayType; /** Score before adding zenkeshi bonus and max chain bonus */ private int scoreBeforeBonus; /** Zenkeshi bonus and max chain bonus amounts */ private int zenKeshiBonus, maxChainBonus; /** Number of boards played */ private int boardsPlayed; /** Blocks cleared */ private int blocksCleared; /** Current level */ private int level; /** Blocks blocksCleared needed to reach next level */ private int toNextLevel; /** Level at start of chain */ private int chainLevelMultiplier; /* * Mode name */ @Override public String getName() { return "AVALANCHE 1P FEVER MARATHON (RC1)"; } /* * Initialization */ @Override public void playerInit(GameEngine engine, int playerID) { owner = engine.owner; receiver = engine.owner.receiver; lastscore = 0; lastmultiplier = 0; scgettime = 0; outlinetype = 0; zenKeshiDisplay = 0; garbageSent = 0; garbageAdd = 0; //firstExtra = false; cleared = false; zenKeshi = false; zenKeshiCount = 0; maxChain = 0; scoreBeforeBonus = 0; zenKeshiBonus = 0; maxChainBonus = 0; boardsPlayed = 0; blocksCleared = 0; timeLimit = TIME_LIMIT; timeLimitAdd = 0; timeLimitAddDisplay = 0; chain = 0; chainDisplay = 0; feverChainDisplay = 0; chainDisplayType = 0; feverChain = 5; rankingRank = -1; rankingScore = new int[3][FEVER_MAPS.length][RANKING_MAX]; rankingTime = new int[3][FEVER_MAPS.length][RANKING_MAX]; if(owner.replayMode == false) { loadSetting(owner.modeConfig); loadRanking(owner.modeConfig, engine.ruleopt.strRuleName); version = CURRENT_VERSION; } else { loadSetting(owner.replayProp); } engine.framecolor = GameEngine.FRAME_COLOR_PURPLE; engine.clearMode = GameEngine.CLEAR_COLOR; engine.garbageColorClear = true; engine.colorClearSize = 4; engine.ignoreHidden = true; engine.lineGravityType = GameEngine.LINE_GRAVITY_CASCADE; for(int i = 0; i < Piece.PIECE_COUNT; i++) engine.nextPieceEnable[i] = (PIECE_ENABLE[i] == 1); engine.randomBlockColor = true; engine.blockColors = BLOCK_COLORS; engine.connectBlocks = false; engine.cascadeDelay = 1; engine.cascadeClearDelay = 10; /* engine.fieldWidth = 6; engine.fieldHeight = 12; engine.fieldHiddenHeight = 2; */ } /** * Set the gravity rate * @param engine GameEngine */ public void setSpeed(GameEngine engine) { if (mapSet == 0) { int speedlv = engine.statistics.score; if (speedlv < 0) speedlv = 0; if (speedlv > 5000) speedlv = 5000; while(speedlv >= tableGravityChangeScore[gravityindex]) gravityindex++; engine.speed.gravity = tableGravityValue[gravityindex]; } else { engine.speed.gravity = 1; } engine.speed.denominator = 256; } public boolean onReady(GameEngine engine, int playerID) { if(engine.statc[0] == 0) { loadMapSetFever(engine, playerID, mapSet, true); engine.numColors = numColors; loadFeverMap(engine, playerID, feverChain); timeLimit = TIME_LIMIT; timeLimitAdd = 0; timeLimitAddDisplay = 0; if(outlinetype == 0) engine.blockOutlineType = GameEngine.BLOCK_OUTLINE_NORMAL; if(outlinetype == 1) engine.blockOutlineType = GameEngine.BLOCK_OUTLINE_SAMECOLOR; if(outlinetype == 2) engine.blockOutlineType = GameEngine.BLOCK_OUTLINE_NONE; if (numColors == 3) level = 1; else if (numColors == 4) level = 5; else if (numColors == 5) level = 10; chainLevelMultiplier = level; toNextLevel = 15; zenKeshiCount = 0; maxChain = 0; scoreBeforeBonus = 0; zenKeshiBonus = 0; maxChainBonus = 0; blocksCleared = 0; } return false; } /* * Called at settings screen */ @Override public boolean onSetting(GameEngine engine, int playerID) { // Menu if(engine.owner.replayMode == false) { if(engine.ctrl.isMenuRepeatKey(Controller.BUTTON_UP)) { engine.statc[2] if(engine.statc[2] < 0) engine.statc[2] = 3; engine.playSE("cursor"); } // Down if(engine.ctrl.isMenuRepeatKey(Controller.BUTTON_DOWN)) { engine.statc[2]++; if(engine.statc[2] > 3) engine.statc[2] = 0; engine.playSE("cursor"); } // Configuration changes int change = 0; if(engine.ctrl.isMenuRepeatKey(Controller.BUTTON_LEFT)) change = -1; if(engine.ctrl.isMenuRepeatKey(Controller.BUTTON_RIGHT)) change = 1; if(change != 0) { engine.playSE("change"); switch(engine.statc[2]) { case 0: mapSet += change; if(mapSet < 0) mapSet = FEVER_MAPS.length - 1; if(mapSet > FEVER_MAPS.length - 1) mapSet = 0; break; case 1: outlinetype += change; if(outlinetype < 0) outlinetype = 2; if(outlinetype > 2) outlinetype = 0; break; case 2: numColors += change; if(numColors < 3) numColors = 5; if(numColors > 5) numColors = 3; break; case 3: chainDisplayType += change; if(chainDisplayType < 0) chainDisplayType = 2; if(chainDisplayType > 2) chainDisplayType = 0; break; } } if(engine.ctrl.isPush(Controller.BUTTON_A) && (engine.statc[3] >= 5)) { engine.playSE("decide"); saveSetting(owner.modeConfig); receiver.saveModeConfig(owner.modeConfig); return false; } // Cancel if(engine.ctrl.isPush(Controller.BUTTON_B)) { engine.quitflag = true; } engine.statc[3]++; } else { engine.statc[3]++; engine.statc[2] = -1; if(engine.statc[3] >= 60) { return false; } } return true; } /* * Render the settings screen */ @Override public void renderSetting(GameEngine engine, int playerID) { if(engine.owner.replayMode == false) { receiver.drawMenuFont(engine, playerID, 0, (engine.statc[2] * 2) + 1, "b", EventReceiver.COLOR_RED); } receiver.drawMenuFont(engine, playerID, 0, 0, "MAP SET", EventReceiver.COLOR_BLUE); receiver.drawMenuFont(engine, playerID, 1, 1, FEVER_MAPS[mapSet].toUpperCase(), (engine.statc[2] == 0)); receiver.drawMenuFont(engine, playerID, 0, 2, "OUTLINE", EventReceiver.COLOR_BLUE); String strOutline = ""; if(outlinetype == 0) strOutline = "NORMAL"; if(outlinetype == 1) strOutline = "COLOR"; if(outlinetype == 2) strOutline = "NONE"; receiver.drawMenuFont(engine, playerID, 1, 3, strOutline, (engine.statc[2] == 1)); receiver.drawMenuFont(engine, playerID, 0, 4, "COLORS", EventReceiver.COLOR_BLUE); receiver.drawMenuFont(engine, playerID, 1, 5, String.valueOf(numColors), (engine.statc[2] == 2)); receiver.drawMenuFont(engine, playerID, 0, 6, "SHOW CHAIN", EventReceiver.COLOR_BLUE); receiver.drawMenuFont(engine, playerID, 1, 7, CHAIN_DISPLAY_NAMES[chainDisplayType], (engine.statc[2] == 3)); } /* * Called for initialization during "Ready" screen */ @Override public void startGame(GameEngine engine, int playerID) { engine.comboType = GameEngine.COMBO_TYPE_DISABLE; engine.tspinEnable = false; engine.useAllSpinBonus = false; engine.tspinAllowKick = false; engine.speed.are = 30; engine.speed.areLine = 30; engine.speed.das = 10; engine.speed.lockDelay = 60; setSpeed(engine); } /* * Render score */ @Override public void renderLast(GameEngine engine, int playerID) { receiver.drawScoreFont(engine, playerID, 0, 0, "AVALANCHE FEVER MARATHON", EventReceiver.COLOR_DARKBLUE); receiver.drawScoreFont(engine, playerID, 0, 1, "(" + FEVER_MAPS[mapSet].toUpperCase() + " " + numColors + " COLORS)", EventReceiver.COLOR_DARKBLUE); if( (engine.stat == GameEngine.STAT_SETTING) || ((engine.stat == GameEngine.STAT_RESULT) && (owner.replayMode == false)) ) { if((owner.replayMode == false) && (engine.ai == null)) { receiver.drawScoreFont(engine, playerID, 3, 3, "SCORE TIME", EventReceiver.COLOR_BLUE); for(int i = 0; i < RANKING_MAX; i++) { receiver.drawScoreFont(engine, playerID, 0, 4 + i, String.format("%2d", i + 1), EventReceiver.COLOR_YELLOW); receiver.drawScoreFont(engine, playerID, 3, 4 + i, String.valueOf(rankingScore[numColors-3][mapSet][i]), (i == rankingRank)); receiver.drawScoreFont(engine, playerID, 14, 4 + i, GeneralUtil.getTime(rankingTime[numColors-3][mapSet][i]), (i == rankingRank)); } } } else { receiver.drawScoreFont(engine, playerID, 0, 3, "SCORE", EventReceiver.COLOR_BLUE); String strScore; if((lastscore == 0) || (lastmultiplier == 0) || (scgettime <= 0)) { strScore = String.valueOf(engine.statistics.score); } else { strScore = String.valueOf(engine.statistics.score) + "(+" + String.valueOf(lastscore) + "X" + String.valueOf(lastmultiplier) + ")"; } receiver.drawScoreFont(engine, playerID, 0, 4, strScore); receiver.drawScoreFont(engine, playerID, 0, 6, "LEVEL", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 0, 7, String.valueOf(level)); receiver.drawScoreFont(engine, playerID, 0, 9, "TIME", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 0, 10, GeneralUtil.getTime(engine.statistics.time)); receiver.drawScoreFont(engine, playerID, 0, 12, "LIMIT TIME", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 0, 13, GeneralUtil.getTime(timeLimit)); if (timeLimitAddDisplay > 0) receiver.drawScoreFont(engine, playerID, 0, 14, "(+" + (timeLimitAdd/60) + " SEC.)"); String timeStr = String.valueOf(timeLimit/60); if (timeStr.length() == 1) timeStr = "0" + timeStr; receiver.drawMenuFont(engine, playerID, 2, 0, timeStr, EventReceiver.COLOR_RED); receiver.drawScoreFont(engine, playerID, 11, 6, "BOARDS", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 11, 7, String.valueOf(boardsPlayed)); receiver.drawScoreFont(engine, playerID, 11, 9, "ZENKESHI", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 11, 10, String.valueOf(zenKeshiCount)); receiver.drawScoreFont(engine, playerID, 11, 12, "MAX CHAIN", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 11, 13, String.valueOf(maxChain)); receiver.drawScoreFont(engine, playerID, 11, 15, "OJAMA SENT", EventReceiver.COLOR_BLUE); String strSent = String.valueOf(garbageSent); if(garbageAdd > 0) { strSent = strSent + "(+" + String.valueOf(garbageAdd)+ ")"; } receiver.drawScoreFont(engine, playerID, 11, 16, strSent); receiver.drawScoreFont(engine, playerID, 11, 18, "CLEARED", EventReceiver.COLOR_BLUE); receiver.drawScoreFont(engine, playerID, 11, 19, String.valueOf(blocksCleared)); int textHeight = 13; if (engine.field != null) textHeight = engine.field.getHeight()+1; if (chain > 0 && chainDisplay > 0 && chainDisplayType != 0) { int color = EventReceiver.COLOR_YELLOW; if (chainDisplayType == 2) { if (chain >= feverChainDisplay) color = EventReceiver.COLOR_GREEN; else if (chain == feverChainDisplay-2) color = EventReceiver.COLOR_ORANGE; else if (chain < feverChainDisplay-2) color = EventReceiver.COLOR_RED; } receiver.drawMenuFont(engine, playerID, chain > 9 ? 0 : 1, textHeight, chain + " CHAIN!", color); } if (zenKeshiDisplay > 0) receiver.drawMenuFont(engine, playerID, 0, textHeight+1, "ZENKESHI!", EventReceiver.COLOR_YELLOW); } } public boolean onMove (GameEngine engine, int playerID) { cleared = false; zenKeshi = false; return false; } /* * Called after every frame */ @Override public void onLast(GameEngine engine, int playerID) { if (scgettime > 0) scgettime if (engine.timerActive) { if (chainDisplay > 0) chainDisplay if (zenKeshiDisplay > 0) zenKeshiDisplay if (timeLimit > 0) { if (timeLimit == 1) engine.playSE("levelstop"); timeLimit } } if (timeLimitAddDisplay > 0) timeLimitAddDisplay // timeMeter engine.meterValue = (timeLimit * receiver.getMeterMax(engine)) / TIME_LIMIT; engine.meterColor = GameEngine.METER_COLOR_GREEN; if(timeLimit <= 1800) engine.meterColor = GameEngine.METER_COLOR_YELLOW; if(timeLimit <= 900) engine.meterColor = GameEngine.METER_COLOR_ORANGE; if(timeLimit <= 300) engine.meterColor = GameEngine.METER_COLOR_RED; } @Override public boolean onGameOver(GameEngine engine, int playerID) { if(engine.statc[0] == 0) { scoreBeforeBonus = engine.statistics.score; if (numColors >= 5) zenKeshiBonus = zenKeshiCount*zenKeshiCount*1000; else if (numColors == 4) zenKeshiBonus = zenKeshiCount*(zenKeshiCount+1)*500; else zenKeshiBonus = zenKeshiCount*(zenKeshiCount+3)*250; maxChainBonus = maxChain*maxChain*2000; engine.statistics.score += zenKeshiBonus + maxChainBonus; } return false; } /* * Hard drop */ @Override public void afterHardDropFall(GameEngine engine, int playerID, int fall) { engine.statistics.score += fall; } /* * Hard drop */ @Override public void afterSoftDropFall(GameEngine engine, int playerID, int fall) { engine.statistics.score += fall; } /* * Calculate score */ @Override public void calcScore(GameEngine engine, int playerID, int avalanche) { // Line clear bonus int pts = avalanche*10; if (avalanche > 0) { cleared = true; if (engine.field.isEmpty()) { engine.playSE("bravo"); zenKeshi = true; zenKeshiDisplay = 120; zenKeshiCount++; // engine.statistics.score += 2100; } chain = engine.chain; if (chain == 1) chainLevelMultiplier = level; if (chain > maxChain) maxChain = chain; blocksCleared += avalanche; toNextLevel -= avalanche; if (toNextLevel <= 0) { toNextLevel = 15; if (level < 99) level++; } pts *= chainLevelMultiplier; chainDisplay = 60; feverChainDisplay = feverChain; engine.playSE("combo" + Math.min(chain, 20)); int multiplier = engine.field.colorClearExtraCount; if (engine.field.colorsCleared > 1) multiplier += (engine.field.colorsCleared-1)*2; if (chain > CHAIN_POWERS.length) multiplier += CHAIN_POWERS[CHAIN_POWERS.length-1]; else multiplier += CHAIN_POWERS[chain-1]; if (multiplier > 999) multiplier = 999; if (multiplier < 1) multiplier = 1; lastscore = pts; lastmultiplier = multiplier; scgettime = 120; int score = pts*multiplier; engine.statistics.scoreFromLineClear += score; engine.statistics.score += score; garbageAdd += ((avalanche*10*multiplier)+119)/120; setSpeed(engine); } } public boolean lineClearEnd(GameEngine engine, int playerID) { if (garbageAdd > 0) { garbageSent += garbageAdd; garbageAdd = 0; } int feverChainNow = feverChain; if (cleared) { boardsPlayed++; timeLimitAdd = 0; if (zenKeshi && timeLimit > 0) { if (timeLimit > 0) timeLimitAdd += 180; feverChain += 2; if (feverChain > feverChainMax) feverChain = feverChainMax; } if (timeLimit > 0) { int addTime = (engine.chain-2)*60; if (addTime > 0) timeLimitAdd += addTime; if (timeLimitAdd > 0) { timeLimit += timeLimitAdd; timeLimitAddDisplay = 120; } } int chainShort = feverChainNow - engine.chain; if (chainShort <= 0) { engine.playSE("cool"); if (feverChain < feverChainMax) feverChain++; } else if(chainShort == 2) { engine.playSE("regret"); feverChain } else if (chainShort > 2) { engine.playSE("regret"); feverChain-=2; } if (feverChain < feverChainMin) feverChain = feverChainMin; if (timeLimit > 0) loadFeverMap(engine, playerID, feverChain); } else if (engine.field != null) { if (!engine.field.getBlockEmpty(2, 0) || !engine.field.getBlockEmpty(3, 0)) { engine.stat = GameEngine.STAT_GAMEOVER; engine.gameActive = false; engine.resetStatc(); engine.statc[1] = 1; } } // time if((timeLimit <= 0) && (engine.timerActive == true)) { engine.gameActive = false; engine.timerActive = false; engine.resetStatc(); engine.stat = GameEngine.STAT_ENDINGSTART; } return false; } /* * Render results screen */ @Override public void renderResult(GameEngine engine, int playerID) { receiver.drawMenuFont(engine, playerID, 0, 1, "PLAY DATA", EventReceiver.COLOR_ORANGE); receiver.drawMenuFont(engine, playerID, 0, 3, "SCORE", EventReceiver.COLOR_BLUE); String strScoreBefore = String.format("%10d", scoreBeforeBonus); receiver.drawMenuFont(engine, playerID, 0, 4, strScoreBefore, EventReceiver.COLOR_GREEN); receiver.drawMenuFont(engine, playerID, 0, 5, "ZENKESHI", EventReceiver.COLOR_BLUE); String strZenKeshi = String.format("%10d", zenKeshiCount); receiver.drawMenuFont(engine, playerID, 0, 6, strZenKeshi); String strZenKeshiBonus = "+" + zenKeshiBonus; receiver.drawMenuFont(engine, playerID, 10-strZenKeshiBonus.length(), 7, strZenKeshiBonus, EventReceiver.COLOR_GREEN); receiver.drawMenuFont(engine, playerID, 0, 8, "MAX CHAIN", EventReceiver.COLOR_BLUE); String strMaxChain = String.format("%10d", maxChain); receiver.drawMenuFont(engine, playerID, 0, 9, strMaxChain); String strMaxChainBonus = "+" + maxChainBonus; receiver.drawMenuFont(engine, playerID, 10-strMaxChainBonus.length(), 10, strMaxChainBonus, EventReceiver.COLOR_GREEN); receiver.drawMenuFont(engine, playerID, 0, 11, "TOTAL", EventReceiver.COLOR_BLUE); String strScore = String.format("%10d", engine.statistics.score); receiver.drawMenuFont(engine, playerID, 0, 12, strScore, EventReceiver.COLOR_RED); receiver.drawMenuFont(engine, playerID, 0, 13, "TIME", EventReceiver.COLOR_BLUE); String strTime = String.format("%10s", GeneralUtil.getTime(engine.statistics.time)); receiver.drawMenuFont(engine, playerID, 0, 14, strTime); if(rankingRank != -1) { receiver.drawMenuFont(engine, playerID, 0, 15, "RANK", EventReceiver.COLOR_BLUE); String strRank = String.format("%10d", rankingRank + 1); receiver.drawMenuFont(engine, playerID, 0, 16, strRank); } } /* * Called when saving replay */ @Override public void saveReplay(GameEngine engine, int playerID, CustomProperties prop) { saveSetting(prop); // Update rankings if((owner.replayMode == false) && (engine.ai == null)) { updateRanking(engine.statistics.score, engine.statistics.time, mapSet, numColors); if(rankingRank != -1) { saveRanking(owner.modeConfig, engine.ruleopt.strRuleName); receiver.saveModeConfig(owner.modeConfig); } } } /** * Load settings from property file * @param prop Property file */ private void loadSetting(CustomProperties prop) { mapSet = prop.getProperty("avalanchefever.gametype", 0); outlinetype = prop.getProperty("avalanchefever.outlinetype", 0); numColors = prop.getProperty("avalanchefever.numcolors", 5); version = prop.getProperty("avalanchefever.version", 0); chainDisplayType = prop.getProperty("avalanchefever.chainDisplayType", 1); } /** * Save settings to property file * @param prop Property file */ private void saveSetting(CustomProperties prop) { prop.setProperty("avalanchefever.gametype", mapSet); prop.setProperty("avalanchefever.outlinetype", outlinetype); prop.setProperty("avalanchefever.numcolors", numColors); prop.setProperty("avalanchefever.version", version); prop.setProperty("avalanchefever.chainDisplayType", chainDisplayType); } private void loadMapSetFever(GameEngine engine, int playerID, int id, boolean forceReload) { if((propFeverMap == null) || (forceReload)) { propFeverMap = receiver.loadProperties("config/map/avalanche/" + FEVER_MAPS[id] + "Endless.map"); feverChainMin = propFeverMap.getProperty("minChain", 3); feverChainMax = propFeverMap.getProperty("maxChain", 15); String subsets = propFeverMap.getProperty("sets"); mapSubsets = subsets.split(","); } } private void loadFeverMap(GameEngine engine, int playerID, int chain) { engine.createFieldIfNeeded(); engine.field.reset(); engine.field.stringToField(propFeverMap.getProperty( mapSubsets[engine.random.nextInt(mapSubsets.length)] + "." + numColors + "colors." + chain + "chain")); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_CONNECT_LEFT, false); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_CONNECT_DOWN, false); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_CONNECT_UP, false); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_CONNECT_RIGHT, false); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_GARBAGE, false); engine.field.setAllAttribute(Block.BLOCK_ATTRIBUTE_ANTIGRAVITY, false); engine.field.setAllSkin(engine.getSkin()); engine.field.shuffleColors(BLOCK_COLORS, numColors, engine.random); } /** * Read rankings from property file * @param prop Property file * @param ruleName Rule name */ private void loadRanking(CustomProperties prop, String ruleName) { for(int i = 0; i < RANKING_MAX; i++) { for(int j = 0; j < FEVER_MAPS.length; j++) { for(int colors = 3; colors <= 5; colors++) { rankingScore[colors-3][j][i] = prop.getProperty("avalanchefever.ranking." + ruleName + "." + colors + "colors." + FEVER_MAPS[j] + ".score." + i, 0); rankingTime[colors-3][j][i] = prop.getProperty("avalanchefever.ranking." + ruleName + "." + colors + "colors." + FEVER_MAPS[j] + ".time." + i, -1); } } } } /** * Save rankings to property file * @param prop Property file * @param ruleName Rule name */ private void saveRanking(CustomProperties prop, String ruleName) { for(int i = 0; i < RANKING_MAX; i++) { for(int j = 0; j < FEVER_MAPS.length; j++) { for(int colors = 3; colors <= 5; colors++) { prop.setProperty("avalanchefever.ranking." + ruleName + "." + colors + "colors." + FEVER_MAPS[j] + ".score." + i, rankingScore[colors-3][j][i]); prop.setProperty("avalanchefever.ranking." + ruleName + "." + colors + "colors." + FEVER_MAPS[j] + ".time." + i, rankingTime[colors-3][j][i]); } } } } /** * Update rankings * @param sc Score * @param li Lines * @param time Time */ private void updateRanking(int sc, int time, int type, int colors) { rankingRank = checkRanking(sc, time, type, colors); if(rankingRank != -1) { // Shift down ranking entries for(int i = RANKING_MAX - 1; i > rankingRank; i rankingScore[colors-3][type][i] = rankingScore[colors-3][type][i - 1]; rankingTime[colors-3][type][i] = rankingTime[colors-3][type][i - 1]; } // Add new data rankingScore[colors-3][type][rankingRank] = sc; rankingTime[colors-3][type][rankingRank] = time; } } /** * Calculate ranking position * @param sc Score * @param time Time * @return Position (-1 if unranked) */ private int checkRanking(int sc, int time, int type, int colors) { for(int i = 0; i < RANKING_MAX; i++) { if(sc > rankingScore[colors-3][type][i]) { return i; } else if((sc == rankingScore[colors-3][type][i]) && (time < rankingTime[colors-3][type][i])) { return i; } } return -1; } }
/* * ProcessLineOfHapmap */ package net.maizegenetics.pal.alignment; import java.util.LinkedList; import java.util.Queue; import net.maizegenetics.baseplugins.FileLoadPlugin; import net.maizegenetics.util.BitUtil; import net.maizegenetics.util.OpenBitSet; /** * * @author terry */ public class ProcessLineOfHapmap implements Runnable { private static int myNumInstances = 0; private static Queue myInstances = new LinkedList(); private String[][] myTokens; private int mySite; private int myNumTaxa; private int myLineInFile; private boolean myComplete = false; private OpenBitSet[][] myData; private byte[][] myAlleles; private int[][] myAlleleMappings; private int myNumAlleles; private int myNumDataRows; private boolean myRetainRareAlleles; private boolean myIsSBit; private int myNumSitesToProcess; private ProcessLineOfHapmap(byte[][] alleles, OpenBitSet[][] data, boolean retainRareAlleles, String[][] tokens, int numSitesToProcess, int site, int numTaxa, int lineInFile, boolean isSBit) { setVariables(alleles, data, retainRareAlleles, tokens, numSitesToProcess, site, numTaxa, lineInFile, isSBit); } public static ProcessLineOfHapmap getInstance(byte[][] alleles, OpenBitSet[][] data, boolean retainRareAlleles, String[][] tokens, int numSitesToProcess, int site, int numTaxa, int lineInFile, boolean isSBit) { if (myNumInstances <= 35) { return new ProcessLineOfHapmap(alleles, data, retainRareAlleles, tokens, numSitesToProcess, site, numTaxa, lineInFile, isSBit); } else { ProcessLineOfHapmap result; while ((result = (ProcessLineOfHapmap) myInstances.poll()) == null) { } result.setVariables(alleles, data, retainRareAlleles, tokens, numSitesToProcess, site, numTaxa, lineInFile, isSBit); return result; } } private void setVariables(byte[][] alleles, OpenBitSet[][] data, boolean retainRareAlleles, String[][] tokens, int numSitesToProcess, int site, int numTaxa, int lineInFile, boolean isSBit) { myData = data; myTokens = tokens; myNumSitesToProcess = numSitesToProcess; if (myNumSitesToProcess > 64) { throw new IllegalStateException("ProcessLineOfHapmap: setVariables: Can't process more than 64 sites: " + myNumSitesToProcess); } mySite = site; myNumTaxa = numTaxa; myLineInFile = lineInFile; myComplete = false; myAlleles = alleles; myNumAlleles = myAlleles[0].length; myAlleleMappings = new int[myNumSitesToProcess][16]; for (int s = 0; s < myNumSitesToProcess; s++) { for (int i = 0; i < 16; i++) { myAlleleMappings[s][i] = -1; } } myRetainRareAlleles = retainRareAlleles; myNumDataRows = myNumAlleles; if (myRetainRareAlleles) { myNumDataRows++; } if (myNumDataRows != myData.length) { throw new IllegalStateException("ProcessLineOfHapmap: setVariables: number of data rows: " + myNumDataRows + " should equal first dimension of data array: " + myData.length); } myIsSBit = isSBit; } private void clearVariables() { myData = null; myTokens = null; myAlleles = null; myAlleleMappings = null; } public void run() { try { if (myComplete) { throw new IllegalStateException("ImportUtils: ProcessLineOfHapmap: run: trying to run completed instance."); } myComplete = true; byte[][] data = new byte[myNumSitesToProcess][myNumTaxa]; for (int s = 0; s < myNumSitesToProcess; s++) { for (int i = 0; i < myNumTaxa; i++) { try { data[s][i] = NucleotideAlignmentConstants.getNucleotideDiploidByte(myTokens[s][ImportUtils.NUM_HAPMAP_NON_TAXA_HEADERS + i]); } catch (IndexOutOfBoundsException ex) { throw new IllegalStateException("Number of Taxa: " + myNumTaxa + " does not match number of values at line in file: " + (myLineInFile + s) + " site: " + mySite + s); } catch (Exception e) { throw new IllegalStateException("Problem with line in file: " + (myLineInFile + s), e); } } } setAlleles(data); if (myIsSBit) { setSBits(data); } else { setTBits(data); } clearVariables(); myInstances.offer(this); } catch (Exception e) { e.printStackTrace(); } } private void setAlleles(byte[][] data) { for (int s = 0; s < myNumSitesToProcess; s++) { int[][] alleles = AlignmentUtils.getAllelesSortedByFrequency(data[s]); int resultSize = alleles[0].length; for (int i = 0; i < myNumAlleles; i++) { if (i < resultSize) { myAlleles[mySite + s][i] = (byte) alleles[0][i]; myAlleleMappings[s][myAlleles[mySite + s][i]] = i; } else { myAlleles[mySite + s][i] = Alignment.UNKNOWN_ALLELE; } } } } private void setSBits(byte[][] data) { int numLongs = BitUtil.bits2words(myNumTaxa); for (int s = 0; s < myNumSitesToProcess; s++) { long[][] bits = new long[myNumDataRows][numLongs]; byte[] cb = new byte[2]; for (int l = 0; l < numLongs - 1; l++) { long bitmask = 0x1L; for (int t = l * 64, n = l * 64 + 64; t < n; t++) { cb[0] = (byte) ((data[s][t] >>> 4) & 0xf); cb[1] = (byte) (data[s][t] & 0xf); for (int i = 0; i < 2; i++) { if (cb[i] != Alignment.UNKNOWN_ALLELE) { int index = myAlleleMappings[s][cb[i]]; if (index == -1) { if (myRetainRareAlleles) { bits[myNumAlleles][l] |= bitmask; } } else { bits[index][l] |= bitmask; } } } bitmask = bitmask << 1; } } int lastLong = numLongs - 1; int numRemaining = myNumTaxa % 64; if (numRemaining == 0) { numRemaining = 64; } long bitmask = 0x1L; for (int t = lastLong * 64, n = lastLong * 64 + numRemaining; t < n; t++) { cb[0] = (byte) ((data[s][t] >>> 4) & 0xf); cb[1] = (byte) (data[s][t] & 0xf); for (int i = 0; i < 2; i++) { if (cb[i] != Alignment.UNKNOWN_ALLELE) { int index = myAlleleMappings[s][cb[i]]; if (index == -1) { if (myRetainRareAlleles) { bits[myNumAlleles][lastLong] |= bitmask; } } else { bits[index][lastLong] |= bitmask; } } } bitmask = bitmask << 1; } for (int i = 0; i < myNumDataRows; i++) { myData[i][mySite + s] = new OpenBitSet(bits[i], numLongs); } } } private void setTBits(byte[][] data) { if (mySite % 64 != 0) { throw new IllegalStateException("ProcessLineOfHapmap: setTBits: starting site must begin a word: " + mySite); } int wordNum = mySite / 64; long[] bits = new long[myNumDataRows]; for (int t = 0; t < myNumTaxa; t++) { for (int j = 0; j < myNumDataRows; j++) { bits[j] = 0; } byte[] cb = new byte[2]; long bitmask = 0x1L; for (int s = 0; s < myNumSitesToProcess; s++) { cb[0] = (byte) ((data[s][t] >>> 4) & 0xf); cb[1] = (byte) (data[s][t] & 0xf); for (int i = 0; i < 2; i++) { if (cb[i] != Alignment.UNKNOWN_ALLELE) { int index = myAlleleMappings[s][cb[i]]; if (index == -1) { if (myRetainRareAlleles) { bits[myNumAlleles] |= bitmask; } } else { bits[index] |= bitmask; } } } bitmask = bitmask << 1; } for (int i = 0; i < myNumDataRows; i++) { myData[i][t].setLong(wordNum, bits[i]); } } } }
package org.appwork.utils.swing.table.columns; import java.awt.Component; import java.util.regex.Pattern; import javax.swing.BorderFactory; import javax.swing.Icon; import javax.swing.JLabel; import javax.swing.JTable; import org.appwork.utils.swing.renderer.RenderLabel; import org.appwork.utils.swing.table.ExtColumn; import org.appwork.utils.swing.table.ExtDefaultRowSorter; import org.appwork.utils.swing.table.ExtTableModel; public abstract class ExtTextColumn<E> extends ExtColumn<E> { private static final long serialVersionUID = 2114805529462086691L; protected RenderLabel label; public ExtTextColumn(final String name, final ExtTableModel<E> table) { super(name, table); this.label = new RenderLabel(); this.label.setBorder(BorderFactory.createEmptyBorder(0, 5, 0, 5)); this.label.setOpaque(false); this.prepareTableCellRendererComponent(this.label); this.setRowSorter(new ExtDefaultRowSorter<E>() { @Override public int compare(final E o1, final E o2) { if (this.isSortOrderToggle()) { return ExtTextColumn.this.getStringValue(o1).compareTo(ExtTextColumn.this.getStringValue(o2)); } else { return ExtTextColumn.this.getStringValue(o2).compareTo(ExtTextColumn.this.getStringValue(o1)); } } }); } @Override public Object getCellEditorValue() { return null; } /** * @param value * @return */ protected Icon getIcon(final E value) { return null; } protected abstract String getStringValue(E value); @SuppressWarnings("unchecked") @Override public Component getTableCellRendererComponent(final JTable table, final Object value, final boolean isSelected, final boolean hasFocus, final int row, final int column) { this.prepareLabel((E) value); this.label.setText(this.getStringValue((E) value)); this.label.setToolTipText(this.getToolTip((E) value)); this.label.setEnabled(this.isEnabled((E) value)); this.label.setIcon(this.getIcon((E) value)); return this.label; } public String getToolTip(final E obj) { final String v = this.getStringValue(obj); if (v != null && v.length()>0) { return "<html>" + v.replaceAll("\r\n", "<br>") + "</html>"; } else { return null; } } @Override public boolean isEditable(final E obj) { return false; } @Override public boolean isEnabled(final E obj) { return true; } @Override public boolean isSortable(final E obj) { return true; } @Override protected boolean matchSearch(final E object, final Pattern pattern) { return pattern.matcher(this.getStringValue(object)).matches(); } /** * @param value */ protected void prepareLabel(final E value) { // TODO Auto-generated method stub } /** * Should be overwritten to prepare the componente for the TableCellRenderer * (e.g. setting tooltips) */ protected void prepareTableCellRendererComponent(final JLabel jlr) { } @Override public void setValue(final Object value, final E object) { } }
package com.pineone.icbms.so.util; import org.apache.kafka.common.serialization.StringDeserializer; import org.apache.kafka.common.serialization.StringSerializer; import org.springframework.beans.factory.annotation.Value; import org.springframework.stereotype.Component; @Component public class Settings2 { /** * broker(kafka) list */ public static String brokerList = "localhost:9092"; @Value("${mq.broker.list}") public void setBrokerList(String _brokerList) { brokerList = _brokerList; } public static String getBrokerList() { return brokerList; } /** * Zookeeper list */ public static String zookeeperList = "localhost:2181"; public static String getZookeeperList() { return zookeeperList; } @Value("${mq.zookeeper.list}") public void setZookeeperList(String _zookeeperList) { zookeeperList = _zookeeperList; } /** * consumer Poll timeout */ public static long pollTimeout = 3000L; @Value("${mq.consumer.pool_timeout}") public void setPollTimeout(long _pollTimeout) { pollTimeout = _pollTimeout; } public static long getPollTimeout() { return pollTimeout; } /** * ENABLE_AUTO_COMMIT_CONFIG */ public static String enableAutoCommitConfig = "true"; @Value("${mq.consumer.enable_auto_commit}") public void setEnableAutoCommitConfig(String _enableAutoCommitConfig) { enableAutoCommitConfig = _enableAutoCommitConfig; } public static String getEnableAutoCommitConfig() { return enableAutoCommitConfig; } /** * AUTO_COMMIT_INTERVAL_MS_CONFIG */ public static String autoCommitIntervalMsConfig = "1000"; @Value("${mq.consumer.auto_commit_interval_ms}") public void setAutoCommitIntervalMsConfig(String _autoCommitIntervalMsConfig) { autoCommitIntervalMsConfig = _autoCommitIntervalMsConfig; } public static String getAutoCommitIntervalMsConfig() { return autoCommitIntervalMsConfig; } /** * SESSION_TIMEOUT_MS_CONFIG */ public static String sessionTimeoutMsConfig= "15000"; @Value("${mq.consumer.session_timeout_ms}") public void setSessionTimeoutMsConfig(String _sessionTimeoutMsConfig) { sessionTimeoutMsConfig = _sessionTimeoutMsConfig; } public static String getSessionTimeoutMsConfig() { return sessionTimeoutMsConfig; } /** * AUTO_OFFSET_RESET_CONFIG */ public static String autoOffsetResetConfig= "earliest"; @Value("${mq.consumer.auto_offset_reset}") public void setAutoOffsetResetConfig(String _autoOffsetResetConfig) { autoOffsetResetConfig = _autoOffsetResetConfig; } public static String getAutoOffsetResetConfig() { return autoOffsetResetConfig; } /** * KEY_DESERIALIZER_CLASS_CONFIG */ public static String KEY_DESERIALIZER_CLASS_CONFIG = StringDeserializer.class.getName(); /** * VALUE_DESERIALIZER_CLASS_CONFIG */ public static String VALUE_DESERIALIZER_CLASS_CONFIG = StringDeserializer.class.getName(); /** * ACKS_CONFIG */ public static String acksConfig= "1"; @Value("${mq.producer.acks}") public void setAcksConfig(String _acksConfig) { acksConfig = _acksConfig; } public static String getAcksConfig() { return acksConfig; } /** * RETRIES_CONFIG */ public static int retriesConfig = 0; @Value("${mq.producer.retries}") public void setRetriesConfig(int _retriesConfig) { retriesConfig = _retriesConfig; } public static int getRetriesConfig() { return retriesConfig; } /** * BATCH_SIZE_CONFIG */ public static int batchSizeConfig= 16384; @Value("${mq.producer.batch_size}") public void setBatchSizeConfig(int _batchSizeConfig) { batchSizeConfig = _batchSizeConfig; } public static int getBatchSizeConfig() { return batchSizeConfig; } /** * LINGER_MS_CONFIG */ public static int lingerMsConfig= 1; @Value("${mq.producer.linger_ms}") public void setLingerMsConfig(int _lingerMsConfig) { lingerMsConfig = _lingerMsConfig; } public static int getLingerMsConfig() { return lingerMsConfig; } /** * BUFFER_MEMORY_CONFIG */ public static int bufferMemoryConfig= 33554432; @Value("${mq.producer.buffer_memory}") public void setBufferMemoryConfig(int _bufferMemoryConfig) { bufferMemoryConfig = _bufferMemoryConfig; } public static int getBufferMemoryConfig() { return bufferMemoryConfig; } /** * KEY_SERIALIZER_CLASS_CONFIG */ public static String KEY_SERIALIZER_CLASS_CONFIG = StringSerializer.class.getName(); /** * VALUE_SERIALIZER_CLASS_CONFIG */ public static String VALUE_SERIALIZER_CLASS_CONFIG = StringSerializer.class.getName(); /** * kafka topic: contextmodel<BR/> */ public static String TOPIC_CONTEXT_MODEL = "contextmodel"; /** * kafka topic: orchestrationservice<BR/> */ public static String TOPIC_ORCHESTRATION_SERVICE = "orchestrationservice"; /** * kafka topic: virtual object<BR/> */ public static String TOPIC_VIRTUAL_OBJECT = "virtualobject"; /** * kafka topic: devicecontrol<BR/> */ public static String TOPIC_DEVICE_CONTROL = "devicecontrol"; /** * kafka topic: logging */ public static String TOPIC_LOGGING = "logging"; /** * each serviceprocessor handler count */ public static int HANDLER_COUNT = 1; /** * CONTEXTMODEL serviceprocessor handler count */ public static int HANDLER_CONTEXTMODEL_COUNT = HANDLER_COUNT; /** * ORCHESTRATIONSERVICE serviceprocessor handler count */ public static int HANDLER_ORCHESTRATIONSERVICE_COUNT = HANDLER_COUNT; /** * VIRTUALOBJECT serviceprocessor handler count */ public static int HANDELR_VIRTUALOBJECT_COUNT = HANDLER_COUNT; /** * DEVICECONTROL serviceprocessor handler count */ public static int HANDLER_DEVICECONTROL_COUNT = HANDLER_COUNT; /** * class path for class loader */ public static String deviceDriverPath= "/"; @Value("${so.device.driver.path}") public void setDeviceDriverPath(String _deviceDriverPath) { deviceDriverPath = _deviceDriverPath; } public static String getDeviceDriverPath() { return deviceDriverPath; } }
package org.apache.ibatis.type; import java.sql.CallableStatement; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; public class EnumTypeHandler extends BaseTypeHandler implements TypeHandler { private Class type; public EnumTypeHandler(Class type) { this.type = type; } public void setNonNullParameter(PreparedStatement ps, int i, Object parameter, JdbcType jdbcType) throws SQLException { if (jdbcType == null) { ps.setString(i, parameter.toString()); } else { ps.setObject(i, parameter.toString(), jdbcType.TYPE_CODE); } } public Object getNullableResult(ResultSet rs, String columnName) throws SQLException { String s = rs.getString(columnName); return s == null ? null : Enum.valueOf(type, s); } public Object getNullableResult(CallableStatement cs, int columnIndex) throws SQLException { String s = cs.getString(columnIndex); return s == null ? null : Enum.valueOf(type, s); } }
package org.reactfx.util; import static org.reactfx.util.Either.*; import static org.reactfx.util.LL.*; import static org.reactfx.util.Tuples.*; import java.util.AbstractList; import java.util.ArrayList; import java.util.Collections; import java.util.List; import java.util.NoSuchElementException; import java.util.Optional; import java.util.function.BiFunction; import java.util.function.Function; import java.util.function.ToIntFunction; import org.reactfx.util.LL.Cons; public abstract class FingerTree<T, S> { public static abstract class NonEmptyFingerTree<T, S> extends FingerTree<T, S> { private NonEmptyFingerTree(ToSemigroup<? super T, S> semigroup) { super(semigroup); } @Override public Either<FingerTree<T, S>, NonEmptyFingerTree<T, S>> caseEmpty() { return right(this); } public abstract S getSummary(); @Override public BiIndex locate( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position) { if(navigate.apply(getSummary(), position).isRight()) { throw new IndexOutOfBoundsException("Position " + position + " is out of bounds"); } return locate0(navigate, position); } @Override public BiIndex locateProgressively( ToIntFunction<? super S> metric, int position) { Lists.checkPosition(position, measure(metric)); return locateProgressively0(metric, position); } @Override public BiIndex locateRegressively( ToIntFunction<? super S> metric, int position) { Lists.checkPosition(position, measure(metric)); return locateRegressively0(metric, position); } public Tuple3<FingerTree<T, S>, T, FingerTree<T, S>> splitAt(int leaf) { Lists.checkIndex(leaf, getLeafCount()); return split0(leaf).map((l, r0) -> r0.split0(1).map((m, r) -> t(l, m.getLeaf0(0), r))); } public Tuple3<FingerTree<T, S>, Tuple2<T, Integer>, FingerTree<T, S>> split( ToIntFunction<? super S> metric, int position) { Lists.checkPosition(position, measure(metric)); return split((s, i) -> { int n = metric.applyAsInt(s); return i <= n ? left(i) : right(i - n); }, position); } public Tuple3<FingerTree<T, S>, Tuple2<T, Integer>, FingerTree<T, S>> split( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position) { if(navigate.apply(getSummary(), position).isRight()) { throw new IndexOutOfBoundsException("Position " + position + " is out of bounds"); } BiIndex loc = locate0(navigate, position); return splitAt(loc.major).map((l, m, r) -> t(l, t(m, loc.minor), r)); } @Override public NonEmptyFingerTree<T, S> join(FingerTree<T, S> rightTree) { return appendTree(rightTree); } final NonEmptyFingerTree<T, S> appendTree(FingerTree<T, S> right) { if(this.getDepth() >= right.getDepth()) { return appendLte(right).unify( Function.identity(), two -> two.map(this::branch)); } else { return ((NonEmptyFingerTree<T, S>) right).prependTree(this); } } final NonEmptyFingerTree<T, S> prependTree(FingerTree<T, S> left) { if(this.getDepth() >= left.getDepth()) { return prependLte(left).unify( Function.identity(), two -> two.map(this::branch)); } else { return ((NonEmptyFingerTree<T, S>) left).appendTree(this); } } abstract List<T> subList(int from, int to); abstract BiIndex locate0( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position); abstract BiIndex locateProgressively0( ToIntFunction<? super S> metric, int position); abstract BiIndex locateRegressively0( ToIntFunction<? super S> metric, int position); abstract Either<? extends NonEmptyFingerTree<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> appendLte(FingerTree<T, S> right); abstract Either<? extends NonEmptyFingerTree<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> prependLte(FingerTree<T, S> left); } private static final class Empty<T, S> extends FingerTree<T, S> { Empty(ToSemigroup<? super T, S> semigroup) { super(semigroup); } @Override public String toString() { return"<emtpy tree>"; } @Override public Either<FingerTree<T, S>, NonEmptyFingerTree<T, S>> caseEmpty() { return left(this); } @Override public int getDepth() { return 0; } @Override public int getLeafCount() { return 0; } @Override public FingerTree<T, S> join(FingerTree<T, S> rightTree) { return rightTree; } @Override public List<T> asList() { return Collections.emptyList(); } @Override T getLeaf0(int index) { throw new IndexOutOfBoundsException(); } @Override NonEmptyFingerTree<T, S> updateLeaf0(int index, T data) { throw new IndexOutOfBoundsException(); } @Override T getData() { throw new NoSuchElementException(); } @Override public Optional<S> getSummaryOpt() { return Optional.empty(); } @Override public <R> R fold( R acc, BiFunction<? super R, ? super T, ? extends R> reduction) { return acc; } @Override <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf) { assert Lists.isValidRange(startLeaf, endLeaf, 0); return acc; } @Override <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction) { assert Lists.isValidRange(startPosition, endPosition, 0); return acc; } @Override S getSummaryBetween0(int startLeaf, int endLeaf) { throw new AssertionError("Unreachable code"); } @Override S getSummaryBetween0( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary) { throw new AssertionError("Unreachable code"); } @Override Tuple2<FingerTree<T, S>, FingerTree<T, S>> split0( int beforeLeaf) { assert beforeLeaf == 0; return t(this, this); } } private static class Leaf<T, S> extends NonEmptyFingerTree<T, S> { private final T data; private final S summary; Leaf(ToSemigroup<? super T, S> semigroup, T data) { super(semigroup); this.data = data; this.summary = semigroup.apply(data); } @Override public String toString() { return "Leaf(" + data + ")"; } @Override public int getDepth() { return 1; } @Override public int getLeafCount() { return 1; } @Override public List<T> asList() { return Collections.singletonList(data); } @Override List<T> subList(int from, int to) { return from == to ? Collections.emptyList() : Collections.singletonList(data); } @Override T getLeaf0(int index) { assert index == 0; return data; } @Override NonEmptyFingerTree<T, S> updateLeaf0(int index, T data) { assert index == 0; return leaf(data); } @Override T getData() { return data; } @Override public S getSummary() { return summary; } @Override public Optional<S> getSummaryOpt() { return Optional.of(summary); } @Override BiIndex locateProgressively0(ToIntFunction<? super S> metric, int position) { assert Lists.isValidPosition(position, measure(metric)); return new BiIndex(0, position); } @Override BiIndex locateRegressively0(ToIntFunction<? super S> metric, int position) { assert Lists.isValidPosition(position, measure(metric)); return new BiIndex(0, position); } @Override public <R> R fold( R acc, BiFunction<? super R, ? super T, ? extends R> reduction) { return reduction.apply(acc, data); } @Override <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf) { assert 0 <= startLeaf; assert endLeaf <= 1; if(startLeaf < endLeaf) { return reduction.apply(acc, data); } else { return acc; } } @Override <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction) { assert Lists.isValidRange(startPosition, endPosition, measure(metric)); return rangeReduction.apply(acc, data, startPosition, endPosition); } @Override S getSummaryBetween0(int startLeaf, int endLeaf) { assert startLeaf == 0 && endLeaf == 1; return summary; } @Override S getSummaryBetween0( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary) { assert Lists.isNonEmptyRange(startPosition, endPosition, measure(metric)) : "Didn't expect empty range [" + startPosition + ", " + endPosition + ")"; if(startPosition == 0 && endPosition == measure(metric)) { return summary; } else { return subSummary.apply(data, startPosition, endPosition); } } @Override Either<Leaf<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> appendLte( FingerTree<T, S> right) { assert right.getDepth() <= this.getDepth(); return right.caseEmpty() .mapLeft(emptyRight -> this) .mapRight(nonEmptyRight -> t(this, nonEmptyRight)); } @Override Either<Leaf<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> prependLte( FingerTree<T, S> left) { assert left.getDepth() <= this.getDepth(); return left.caseEmpty() .mapLeft(emptyLeft -> this) .mapRight(nonEmptyLeft -> t(nonEmptyLeft, this)); } @Override Tuple2<FingerTree<T, S>, FingerTree<T, S>> split0(int beforeLeaf) { assert Lists.isValidPosition(beforeLeaf, 1); if(beforeLeaf == 0) { return t(empty(), this); } else { return t(this, empty()); } } @Override BiIndex locate0( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position) { return navigate.apply(summary, position).unify( inl -> new BiIndex(0, inl), inr -> { throw new AssertionError("Unreachable code"); }); } } private static final class Branch<T, S> extends NonEmptyFingerTree<T, S> { private final Cons<NonEmptyFingerTree<T, S>> children; private final int depth; private final int leafCount; private final S summary; private Branch( ToSemigroup<? super T, S> semigroup, Cons<NonEmptyFingerTree<T, S>> children) { super(semigroup); assert children.size() == 2 || children.size() == 3; FingerTree<T, S> head = children.head(); int headDepth = head.getDepth(); assert children.all(n -> n.getDepth() == headDepth); this.children = children; this.depth = 1 + headDepth; this.leafCount = children.fold(0, (s, n) -> s + n.getLeafCount()); this.summary = children.mapReduce1( NonEmptyFingerTree<T, S>::getSummary, semigroup::reduce); } @Override public String toString() { return "Branch" + children; } @Override public int getDepth() { return depth; } @Override public int getLeafCount() { return leafCount; } @Override public List<T> asList() { return subList0(0, leafCount); } @Override List<T> subList(int from, int to) { NonEmptyFingerTree<T, S> ch1 = children.head(); int n1 = ch1.getLeafCount(); if(to <= n1) { return ch1.subList(from, to); } else if(from >= n1) { LL<? extends NonEmptyFingerTree<T, S>> tail = children.tail(); NonEmptyFingerTree<T, S> ch2 = tail.head(); int n2 = ch2.getLeafCount(); if(to <= n1 + n2) { return ch2.subList(from - n1, to - n1); } else if(from >= n1 + n2) { return tail.tail().head().subList(from - n1 - n2, to - n1 - n2); } } return subList0(from, to); } private List<T> subList0(int from, int to) { return new AbstractList<T>() { @Override public T get(int index) { Lists.checkIndex(index, to - from); return getLeaf(from + index); } @Override public int size() { return to - from; } @Override public List<T> subList(int start, int end) { Lists.checkRange(start, end, to - from); return Branch.this.subList(from + start, from + end); } }; } @Override final T getData() { throw new UnsupportedOperationException("Only leaf nodes hold data"); } @Override final T getLeaf0(int index) { assert Lists.isValidIndex(index, getLeafCount()); return getLeaf0(index, children); } private T getLeaf0(int index, LL<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); int headSize = head.getLeafCount(); if(index < headSize) { return head.getLeaf0(index); } else { return getLeaf0(index - headSize, nodes.tail()); } } @Override NonEmptyFingerTree<T, S> updateLeaf0(int index, T data) { assert Lists.isValidIndex(index, getLeafCount()); return branch(updateLeaf0(index, data, children)); } private Cons<NonEmptyFingerTree<T, S>> updateLeaf0( int index, T data, LL<? extends NonEmptyFingerTree<T, S>> nodes) { NonEmptyFingerTree<T, S> head = nodes.head(); int headSize = head.getLeafCount(); if(index < headSize) { return cons(head.updateLeaf0(index, data), nodes.tail()); } else { return cons(head, updateLeaf0(index - headSize, data, nodes.tail())); } } @Override final BiIndex locateProgressively0(ToIntFunction<? super S> metric, int position) { assert Lists.isValidPosition(position, measure(metric)); return locateProgressively0(metric, position, children); } private BiIndex locateProgressively0( ToIntFunction<? super S> metric, int position, LL<? extends NonEmptyFingerTree<T, S>> nodes) { NonEmptyFingerTree<T, S> head = nodes.head(); int headLen = head.measure(metric); if(position < headLen || (position == headLen && nodes.tail().isEmpty())) { return head.locateProgressively0(metric, position); } else { return locateProgressively0(metric, position - headLen, nodes.tail()) .adjustMajor(head.getLeafCount()); } } @Override final BiIndex locateRegressively0(ToIntFunction<? super S> metric, int position) { assert Lists.isValidPosition(position, measure(metric)); return locateRegressively0(metric, position, children); } private BiIndex locateRegressively0( ToIntFunction<? super S> metric, int position, LL<? extends NonEmptyFingerTree<T, S>> nodes) { NonEmptyFingerTree<T, S> head = nodes.head(); int headLen = head.measure(metric); if(position <= headLen) { return head.locateRegressively0(metric, position); } else { return locateRegressively0(metric, position - headLen, nodes.tail()) .adjustMajor(head.getLeafCount()); } } @Override public final <R> R fold( R acc, BiFunction<? super R, ? super T, ? extends R> reduction) { return children.fold(acc, (r, n) -> n.fold(r, reduction)); } @Override final <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf) { assert Lists.isNonEmptyRange(startLeaf, endLeaf, getLeafCount()); return foldBetween0(acc, reduction, startLeaf, endLeaf, children); } private <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf, LL<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); int headSize = head.getLeafCount(); int headTo = Math.min(endLeaf, headSize); int tailFrom = Math.max(startLeaf - headSize, 0); int tailTo = endLeaf - headSize; if(startLeaf < headTo) { acc = head.foldBetween0(acc, reduction, startLeaf, headTo); } if(tailFrom < tailTo) { acc = foldBetween0(acc, reduction, tailFrom, tailTo, nodes.tail()); } return acc; } @Override final <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction) { assert Lists.isNonEmptyRange(startPosition, endPosition, measure(metric)); return foldBetween0(acc, reduction, metric, startPosition, endPosition, rangeReduction, children); } private <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction, LL<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); int headLen = head.measure(metric); int headTo = Math.min(endPosition, headLen); int tailFrom = Math.max(startPosition - headLen, 0); int tailTo = endPosition - headLen; if(startPosition < headTo) { acc = head.foldBetween0(acc, reduction, metric, startPosition, headTo, rangeReduction); } if(tailFrom < tailTo) { acc = foldBetween0(acc, reduction, metric, tailFrom, tailTo, rangeReduction, nodes.tail()); } return acc; } @Override public S getSummary() { return summary; } @Override public Optional<S> getSummaryOpt() { return Optional.of(summary); } @Override final S getSummaryBetween0(int startLeaf, int endLeaf) { assert Lists.isNonEmptyRange(startLeaf, endLeaf, getLeafCount()); if(startLeaf == 0 && endLeaf == getLeafCount()) { return summary; } else { return getSummaryBetween0(startLeaf, endLeaf, children); } } private S getSummaryBetween0( int startLeaf, int endLeaf, LL<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); int headSize = head.getLeafCount(); int headTo = Math.min(endLeaf, headSize); int tailFrom = Math.max(startLeaf - headSize, 0); int tailTo = endLeaf - headSize; if(startLeaf < headTo && tailFrom < tailTo) { return semigroup.reduce( head.getSummaryBetween0(startLeaf, headTo), getSummaryBetween0(tailFrom, tailTo, nodes.tail())); } else if(startLeaf < headTo) { return head.getSummaryBetween0(startLeaf, headTo); } else if(tailFrom < tailTo) { return getSummaryBetween0(tailFrom, tailTo, nodes.tail()); } else { throw new AssertionError("Didn't expect empty range: " + "[" + startLeaf + ", " + endLeaf + ")"); } } @Override final S getSummaryBetween0( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary) { int len = measure(metric); assert Lists.isNonEmptyRange(startPosition, endPosition, len); if(startPosition == 0 && endPosition == len) { return getSummary(); } else { return getSummaryBetween0(metric, startPosition, endPosition, subSummary, children); } } private S getSummaryBetween0( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary, LL<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); int headLen = head.measure(metric); int headTo = Math.min(endPosition, headLen); int tailFrom = Math.max(startPosition - headLen, 0); int tailTo = endPosition - headLen; if(startPosition < headTo && tailFrom < tailTo) { return semigroup.reduce( head.getSummaryBetween0( metric, startPosition, headTo, subSummary), getSummaryBetween0(metric, tailFrom, tailTo, subSummary, nodes.tail())); } else if(startPosition < headTo) { return head.getSummaryBetween0(metric, startPosition, headTo, subSummary); } else if(tailFrom < tailTo) { return getSummaryBetween0(metric, tailFrom, tailTo, subSummary, nodes.tail()); } else { throw new AssertionError("Didn't expect empty range: [" + startPosition + ", " + endPosition + ")"); } } @Override Either<Branch<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> appendLte( FingerTree<T, S> suffix) { assert suffix.getDepth() <= this.getDepth(); if(suffix.getDepth() == this.getDepth()) { return right(t(this, (NonEmptyFingerTree<T, S>) suffix)); } else if(children.size() == 2) { return children.mapFirst2((left, right) -> { return right.appendLte(suffix).unify( r -> left(branch(left, r)), mr -> left(mr.map((m, r) -> branch(left, m, r)))); }); } else { assert children.size() == 3; return children.mapFirst3((left, middle, right) -> { return right.appendLte(suffix) .mapLeft(r -> branch(left, middle, r)) .mapRight(mr -> t(branch(left, middle), mr.map(this::branch))); }); } } @Override Either<Branch<T, S>, Tuple2<NonEmptyFingerTree<T, S>, NonEmptyFingerTree<T, S>>> prependLte( FingerTree<T, S> prefix) { assert prefix.getDepth() <= this.getDepth(); if(prefix.getDepth() == this.getDepth()) { return right(t((NonEmptyFingerTree<T, S>) prefix, this)); } else if(children.size() == 2) { return children.mapFirst2((left, right) -> { return left.prependLte(prefix).unify( l -> left(branch(l, right)), lm -> left(lm.map((l, m) -> branch(l, m, right)))); }); } else { assert children.size() == 3; return children.mapFirst3((left, middle, right) -> { return left.prependLte(prefix) .mapLeft(l -> branch(l, middle, right)) .mapRight(lm -> t(lm.map(this::branch), branch(middle, right))); }); } } @Override Tuple2<FingerTree<T, S>, FingerTree<T, S>> split0(int beforeLeaf) { assert Lists.isValidPosition(beforeLeaf, getLeafCount()); if(beforeLeaf == 0) { return t(empty(), this); } else { return split0(beforeLeaf, children); } } private Tuple2<FingerTree<T, S>, FingerTree<T, S>> split0( int beforeLeaf, LL<? extends FingerTree<T, S>> nodes) { assert beforeLeaf > 0; FingerTree<T, S> head = nodes.head(); int headSize = head.getLeafCount(); if(beforeLeaf <= headSize) { return head.split0(beforeLeaf) .map((l, r) -> t(l, concat(cons(r, nodes.tail())))); } else { return split0(beforeLeaf - headSize, nodes.tail()) .map((l, r) -> t(head.join(l), r)); } } @Override BiIndex locate0( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position) { assert navigate.apply(summary, position).isLeft(); return locate0(navigate, position, children); } private BiIndex locate0( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position, LL<? extends NonEmptyFingerTree<T, S>> nodes) { NonEmptyFingerTree<T, S> head = nodes.head(); return navigate.apply(head.getSummary(), position).unify( posInl -> head.locate0(navigate, posInl), posInr -> locate0(navigate, posInr, nodes.tail()) .adjustMajor(head.getLeafCount())); } } public static <T, S> FingerTree<T, S> empty( ToSemigroup<? super T, S> statisticsProvider) { return new Empty<>(statisticsProvider); } public static <T, S> FingerTree<T, S> mkTree( List<? extends T> initialItems, ToSemigroup<? super T, S> statisticsProvider) { if(initialItems.isEmpty()) { return new Empty<>(statisticsProvider); } List<NonEmptyFingerTree<T, S>> leafs = new ArrayList<>(initialItems.size()); for(T item: initialItems) { leafs.add(new Leaf<T, S>(statisticsProvider, item)); } return mkTree(leafs); } private static <T, S> FingerTree<T, S> mkTree(List<NonEmptyFingerTree<T, S>> trees) { while(trees.size() > 1) { for(int i = 0; i < trees.size(); ++i) { if(trees.size() - i >= 5 || trees.size() - i == 3) { NonEmptyFingerTree<T, S> t1 = trees.get(i); NonEmptyFingerTree<T, S> t2 = trees.get(i + 1); NonEmptyFingerTree<T, S> t3 = trees.get(i + 2); Branch<T, S> branch = t1.branch(t1, t2, t3); trees.set(i, branch); trees.subList(i + 1, i + 3).clear(); } else { // (trees.size() - i) is 4 or 2 NonEmptyFingerTree<T, S> t1 = trees.get(i); NonEmptyFingerTree<T, S> t2 = trees.get(i + 1); Branch<T, S> b = t1.branch(t1, t2); trees.set(i, b); trees.remove(i + 1); } } } return trees.get(0); } private static <T, S> FingerTree<T, S> concat( Cons<? extends FingerTree<T, S>> nodes) { FingerTree<T, S> head = nodes.head(); return nodes.tail().fold( head, FingerTree::join); } final ToSemigroup<? super T, S> semigroup; private FingerTree(ToSemigroup<? super T, S> semigroup) { this.semigroup = semigroup; } public abstract int getDepth(); public abstract int getLeafCount(); public abstract Optional<S> getSummaryOpt(); public abstract Either<FingerTree<T, S>, NonEmptyFingerTree<T, S>> caseEmpty(); public final boolean isEmpty() { return getDepth() == 0; } public S getSummary(S whenEmpty) { return getSummaryOpt().orElse(whenEmpty); } public T getLeaf(int index) { Lists.checkIndex(index, getLeafCount()); return getLeaf0(index); } abstract T getLeaf0(int index); public Tuple2<T, BiIndex> get( ToIntFunction<? super S> metric, int index) { return caseEmpty().unify( emptyTree -> { throw new IndexOutOfBoundsException("empty tree"); }, neTree -> { int size = metric.applyAsInt(neTree.getSummary()); Lists.checkIndex(index, size); BiIndex location = locateProgressively(metric, index); return t(getLeaf(location.major), location); }); } public <E> E get( ToIntFunction<? super S> metric, int index, BiFunction<? super T, Integer, ? extends E> leafAccessor) { return locateProgressively(metric, index) .map((major, minor) -> leafAccessor.apply(getLeaf(major), minor)); } public NonEmptyFingerTree<T, S> updateLeaf(int index, T data) { Lists.checkIndex(index, getLeafCount()); return updateLeaf0(index, data); } abstract NonEmptyFingerTree<T, S> updateLeaf0(int index, T data); public BiIndex locate( BiFunction<? super S, Integer, Either<Integer, Integer>> navigate, int position) { return caseEmpty().unify( emptyTree -> { throw new IndexOutOfBoundsException("no leafs to locate in"); }, neTree -> { throw new AssertionError("This method must be overridden in non-empty tree"); }); } public BiIndex locateProgressively( ToIntFunction<? super S> metric, int position) { return caseEmpty().unify( emptyTree -> { throw new IndexOutOfBoundsException("no leafs to locate in"); }, neTree -> { throw new AssertionError("This method must be overridden in non-empty tree"); }); } public BiIndex locateRegressively( ToIntFunction<? super S> metric, int position) { return caseEmpty().unify( emptyTree -> { throw new IndexOutOfBoundsException("no leafs to locate in"); }, neTree -> { throw new AssertionError("This method must be overridden in non-empty tree"); }); } public abstract <R> R fold( R acc, BiFunction<? super R, ? super T, ? extends R> reduction); public <R> R foldBetween( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf) { Lists.checkRange(startLeaf, endLeaf, getLeafCount()); if(startLeaf == endLeaf) { return acc; } else { return foldBetween0(acc, reduction, startLeaf, endLeaf); } } abstract <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, int startLeaf, int endLeaf); public <R> R foldBetween( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction) { Lists.checkRange(startPosition, endPosition, measure(metric)); if(startPosition == endPosition) { return acc; } else { return foldBetween0( acc, reduction, metric, startPosition, endPosition, rangeReduction); } } abstract <R> R foldBetween0( R acc, BiFunction<? super R, ? super T, ? extends R> reduction, ToIntFunction<? super S> metric, int startPosition, int endPosition, TetraFunction<? super R, ? super T, Integer, Integer, ? extends R> rangeReduction); public Optional<S> getSummaryBetween(int startLeaf, int endLeaf) { Lists.checkRange(startLeaf, endLeaf, getLeafCount()); return startLeaf == endLeaf ? Optional.empty() : Optional.of(getSummaryBetween0(startLeaf, endLeaf)); } abstract S getSummaryBetween0( int startLeaf, int endLeaf); public Optional<S> getSummaryBetween( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary) { Lists.checkRange(startPosition, endPosition, measure(metric)); return startPosition == endPosition ? Optional.empty() : Optional.of(getSummaryBetween0(metric, startPosition, endPosition, subSummary)); } abstract S getSummaryBetween0( ToIntFunction<? super S> metric, int startPosition, int endPosition, TriFunction<? super T, Integer, Integer, ? extends S> subSummary); public Tuple2<FingerTree<T, S>, FingerTree<T, S>> split(int beforeLeaf) { Lists.checkPosition(beforeLeaf, getLeafCount()); return split0(beforeLeaf); } abstract Tuple2<FingerTree<T, S>, FingerTree<T, S>> split0(int beforeLeaf); public FingerTree<T, S> removeLeafs(int fromLeaf, int toLeaf) { Lists.checkRange(fromLeaf, toLeaf, getLeafCount()); if(fromLeaf == toLeaf) { return this; } else if(fromLeaf == 0 && toLeaf == getLeafCount()) { return empty(); } else { FingerTree<T, S> left = split0(fromLeaf)._1; FingerTree<T, S> right = split0(toLeaf)._2; return left.join(right); } } public FingerTree<T, S> insertLeaf(int position, T data) { Lists.checkPosition(position, getLeafCount()); return split0(position) .map((l, r) -> l.join(leaf(data)).join(r)); } public abstract FingerTree<T, S> join(FingerTree<T, S> rightTree); public NonEmptyFingerTree<T, S> append(T data) { return leaf(data).prependTree(this); } public NonEmptyFingerTree<T, S> prepend(T data) { return leaf(data).appendTree(this); } public abstract List<T> asList(); abstract T getData(); // valid for leafs only Empty<T, S> empty() { return new Empty<>(semigroup); } Leaf<T, S> leaf(T data) { return new Leaf<>(semigroup, data); } Branch<T, S> branch(NonEmptyFingerTree<T, S> left, NonEmptyFingerTree<T, S> right) { return branch(LL.of(left, right)); } Branch<T, S> branch( NonEmptyFingerTree<T, S> left, NonEmptyFingerTree<T, S> middle, NonEmptyFingerTree<T, S> right) { return branch(LL.of(left, middle, right)); } Branch<T, S> branch(Cons<NonEmptyFingerTree<T, S>> children) { return new Branch<>(semigroup, children); } final int measure(ToIntFunction<? super S> metric) { return getSummaryOpt().map(metric::applyAsInt).orElse(0); } }
package org.ensembl.healthcheck.testcase.compara; import java.sql.Connection; import java.sql.ResultSet; import java.sql.Statement; import java.util.Map; import java.util.Vector; import org.ensembl.healthcheck.DatabaseRegistry; import org.ensembl.healthcheck.DatabaseRegistryEntry; import org.ensembl.healthcheck.DatabaseType; import org.ensembl.healthcheck.ReportManager; import org.ensembl.healthcheck.Species; import org.ensembl.healthcheck.testcase.MultiDatabaseTestCase; /** * Check compara taxon table against core meta ones. */ public class CheckTaxon extends MultiDatabaseTestCase { /** * Create a new instance of MetaCrossSpecies */ public CheckTaxon() { addToGroup("compara_external_foreign_keys"); setDescription("Check that the attributes of the taxon table (genus, species," + " common_name and classification) correspond to the meta data in the core DB and vice versa."); setTeamResponsible("Compara"); } /** * Check that the attributes of the taxon table (genus, species, common_name and * classification) correspond to the meta data in the core DB and vice versa. * NB: A warning message is displayed if some dnafrags cannot be checked because * there is not any connection to the corresponding core database. * * @param dbr * The database registry containing all the specified databases. * @return true if the all the taxa in compara.taxon table which have a counterpart in * the compara.genome_db table match the corresponding core databases. */ public boolean run(DatabaseRegistry dbr) { boolean result = true; // Get compara DB connection DatabaseRegistryEntry[] allComparaDBs = dbr.getAll(DatabaseType.COMPARA); if (allComparaDBs.length == 0) { result = false; ReportManager.problem(this, "", "Cannot find compara database"); usage(); return false; } Map speciesDbrs = getSpeciesDatabaseMap(dbr, true); for (int i = 0; i < allComparaDBs.length; i++) { result &= checkTaxon(allComparaDBs[i], speciesDbrs); } return result; } /** * Check that the attributes of the taxon table (genus, species, common_name and * classification) correspond to the meta data in the core DB and vice versa. * NB: A warning message is displayed if some dnafrags cannot be checked because * there is not any connection to the corresponding core database. * * @param comparaDbre * The database registry entry for Compara DB * @param Map * HashMap of DatabaseRegistryEntry[], one key/value pair for each Species. * @return true if the all the taxa in compara.taxon table which have a counterpart in * the compara.genome_db table match the corresponding core databases. */ public boolean checkTaxon(DatabaseRegistryEntry comparaDbre, Map speciesDbrs) { boolean result = true; Connection comparaCon = comparaDbre.getConnection(); // Get list of species in compara Vector comparaSpecies = new Vector(); String sql = "SELECT DISTINCT genome_db.name FROM genome_db WHERE assembly_default = 1" + " AND name <> 'Ancestral sequences'"; try { Statement stmt = comparaCon.createStatement(); ResultSet rs = stmt.executeQuery(sql); while (rs.next()) { comparaSpecies.add(Species.resolveAlias(rs.getString(1).toLowerCase().replace(' ', '_'))); } rs.close(); stmt.close(); } catch (Exception e) { e.printStackTrace(); } //Check that don't have duplicate entries in the ncbi_taxa_name table String useful_sql = "SELECT taxon_id,name,name_class,count(*) FROM ncbi_taxa_name GROUP BY taxon_id,name,name_class HAVING count(*) > 1;"; String[] failures = getColumnValues(comparaCon, useful_sql); if (failures.length > 0) { ReportManager.problem(this, comparaCon, "FAILED ncbi_taxa_name contains duplicate entries "); ReportManager.problem(this, comparaCon, "FAILURE DETAILS: There are " + failures.length + " ncbi_taxa_names with more than 1 entry"); ReportManager.problem(this, comparaCon, "USEFUL SQL: " + useful_sql); result = false; } else { result = true; } boolean allSpeciesFound = true; for (int i = 0; i < comparaSpecies.size(); i++) { Species species = (Species) comparaSpecies.get(i); DatabaseRegistryEntry[] speciesDbr = (DatabaseRegistryEntry[]) speciesDbrs.get(species); if (speciesDbr != null) { Connection speciesCon = speciesDbr[0].getConnection(); String sql1, sql2; /* Get taxon_id */ String taxon_id = getRowColumnValue(speciesCon, "SELECT meta_value FROM meta WHERE meta_key = \"species.taxonomy_id\""); /* Check name */ sql1 = "SELECT \"name\", name " + " FROM ncbi_taxa_name WHERE name_class = \"scientific name\" AND taxon_id = " + taxon_id; sql2 = "SELECT \"name\", GROUP_CONCAT(meta_value ORDER BY meta_id DESC SEPARATOR \" \") " + " FROM (SELECT meta_id, meta_key, meta_value FROM meta " + " WHERE meta_key = \"species.classification\" ORDER BY meta_id LIMIT 2) AS name " + " GROUP BY meta_key"; result &= compareQueries(comparaCon, sql1, speciesCon, sql2); /* Check common_name */ sql1 = "SELECT \"common_name\", name " + " FROM ncbi_taxa_name WHERE name_class = \"genbank common name\" AND taxon_id = " + taxon_id; sql2 = "SELECT \"common_name\", meta_value FROM meta" + " WHERE meta_key = \"species.common_name\" and meta_value != \"\""; result &= compareQueries(comparaCon, sql1, speciesCon, sql2); /* Check classification */ /* This check is quite complex as the axonomy is stored in very different ways in compara and core DBs. In compara, the tree structure is stored in the ncbi_taxa_node table while the names are in the ncbi_taxa_name table. In the core DB, the taxonomy is stored in the meta table as values of the key "species.classification" and they should be sorted by meta_id. In the core DB, only the abbreviated lineage is described which means that we have to ignore ncbi_taxa_node with the genbank_hidden_flag set. On top of that, we want to compare the classification in one single SQL. Therefore, we are getting the results recursivelly and then execute a dumb SQL query with result itself */ String comparaClassification = new String(""); String values1[] = getRowValues(comparaCon, "SELECT rank, parent_id, genbank_hidden_flag FROM ncbi_taxa_node WHERE taxon_id = " + taxon_id); if (values1.length == 0) { /* if no rows are fetched, this taxon is missing from compara DB */ ReportManager.problem(this, comparaCon, "No taxon for " + species.toString()); } else { String this_taxon_id = values1[1]; while (!this_taxon_id.equals("0")) { values1 = getRowValues(comparaCon, "SELECT rank, parent_id, genbank_hidden_flag FROM ncbi_taxa_node WHERE taxon_id = " + this_taxon_id); if ( //values1[2].equals("0") && !values1[1].equals("1") && !values1[1].equals("0") && !values1[0].equals("subgenus") && !values1[0].equals("subspecies")) { String taxonName = getRowColumnValue(comparaCon, "SELECT name FROM ncbi_taxa_name " + "WHERE name_class = \"scientific name\" AND taxon_id = " + this_taxon_id); if (!taxonName.equals("Fungi/Metazoa group")) { comparaClassification += " " + taxonName; } } this_taxon_id = values1[1]; } sql1 = "SELECT \"classification\", \"" + comparaClassification + "\""; /* It will be much better to run this using GROUP_CONCAT() but our MySQL server does not support it yet */ sql2 = "SELECT \"classification\", \""; String[] values2 = getColumnValues(speciesCon, "SELECT meta_value FROM meta WHERE meta_key = \"species.classification\"" + " ORDER BY meta_id"); /* Skip first value as it is part of the species name and not the lineage */ for (int a = 1; a < values2.length; a++) { sql2 += " " + values2[a]; } sql2 += "\""; result &= compareQueries(comparaCon, sql1, speciesCon, sql2); } } else { ReportManager.problem(this, comparaCon, "No connection for " + species.toString()); allSpeciesFound = false; } } if (!allSpeciesFound) { usage(); } return result; } /** * Prints the usage through the ReportManager * * @param * The database registry containing all the specified databases. * @return true if the all the dnafrags are top_level seq_regions in their corresponding * core database. */ private void usage() { ReportManager.problem(this, "USAGE", "run-healthcheck.sh -d ensembl_compara_.+ " + " -d2 .+_core_.+ CheckTaxon"); } } // CheckTopLevelDnaFrag
package hm.binkley.labs; import reactor.Environment; import reactor.bus.EventBus; import java.io.IOException; import java.util.concurrent.CountDownLatch; import static java.lang.System.out; import static reactor.bus.selector.Selectors.T; public final class ReagentMain { public static void main(final String... args) throws InterruptedException, IOException { try (final Environment __ = Environment.initialize()) { // Because main() exits before bus can process, force it to wait final CountDownLatch done = new CountDownLatch(1); final EventBus bus = EventBus.create(Environment.get()); bus.on(T(Foo.class), ev -> { out.println(ev); done.countDown(); }); bus.notify(new Bar()); done.await(); } } public abstract static class Foo { @Override public String toString() { return "I'm a Foo!"; } } public static final class Bar extends Foo { @Override public String toString() { return "I'm a Bar!"; } } }
package api.web.gw2.mapping.v2.guild.id.members; import api.web.gw2.mapping.core.DateValue; import api.web.gw2.mapping.core.IdValue; import api.web.gw2.mapping.core.OptionalValue; import java.time.ZonedDateTime; import java.util.Optional; public final class JsonpMember implements Member { @IdValue private String name = ""; // NOI18N. @IdValue private String rank = ""; // NOI18N. @DateValue @OptionalValue private Optional<ZonedDateTime> joined = Optional.empty(); /** * Creates a new empty instance. */ public JsonpMember() { } @Override public String getName() { return name; } @Override public String getRank() { return rank; } @Override public Optional<ZonedDateTime> getJoined() { return joined; } }
package org.ensembl.healthcheck.testcase.generic; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.List; import java.util.Map; import org.apache.commons.lang.StringUtils; import org.ensembl.healthcheck.DatabaseRegistry; import org.ensembl.healthcheck.DatabaseRegistryEntry; import org.ensembl.healthcheck.DatabaseType; import org.ensembl.healthcheck.ReportManager; import org.ensembl.healthcheck.Team; import org.ensembl.healthcheck.testcase.MultiDatabaseTestCase; import org.ensembl.healthcheck.testcase.Priority; import org.ensembl.healthcheck.util.ConnectionBasedSqlTemplateImpl; import org.ensembl.healthcheck.util.MapRowMapper; import org.ensembl.healthcheck.util.SqlTemplate; import org.ensembl.healthcheck.util.StringListMapRowMapper; /** * Check that all xrefs from a certain source (e.g. HGNC, EntrezGene) are consistently assigned to the same Ensembl object type. */ public class XrefLevels extends MultiDatabaseTestCase { /** * Creates a new instance of XrefLevels */ public XrefLevels() { addToGroup("release"); addToGroup("core_xrefs"); addToGroup("post-compara-handover"); setDescription("Check that all xrefs from a certain source (e.g. HGNC, EntrezGene) are consistently assigned to the same Ensembl object type across all species"); setPriority(Priority.AMBER); setEffect("Causes BioMart to require specific workarounds for each case."); setFix("Manually fix affected xrefs."); setTeamResponsible(Team.CORE); } /** * This only applies to core and Vega databases. */ public void types() { removeAppliesToType(DatabaseType.OTHERFEATURES); removeAppliesToType(DatabaseType.CDNA); removeAppliesToType(DatabaseType.RNASEQ); } /** * Run the test. * * @param dbr * The database registry containing all the specified databases. */ public boolean run(DatabaseRegistry dbr) { boolean result = true; // easier to do this in SQL than Java // Create an in-memory SQL database via h2 driver try { Class.forName("org.h2.Driver"); // memory:tablename Connection tempDB = DriverManager.getConnection("jdbc:h2:mem:XrefLevels"); createTempTable(tempDB); // master list of species, sources and objects DatabaseRegistryEntry masterDBRE = null; PreparedStatement masterPrep = null; String masterTable = "healthcheck_xref"; DatabaseRegistryEntry[] dbres = dbr.getAll(); if (dbres.length == 0) { return true; } for (DatabaseRegistryEntry dbre : dbres) { if (masterDBRE == null) { masterDBRE = dbre; masterPrep = tempDB.prepareStatement("INSERT INTO " + masterTable + " (species, source, object) VALUES (?,?,?)"); } // fill with the list of sources and object types from each species logger.fine("Adding sources and objects for " + dbre.getName()); Statement stmt = dbre.getConnection().createStatement(); // can't do this in one query as the databases being written to and read from might be on separate servers ResultSet rs = stmt .executeQuery("SELECT e.db_name, ox.ensembl_object_type FROM external_db e, xref x, object_xref ox WHERE e.external_db_id=x.external_db_id AND x.xref_id=ox.xref_id GROUP BY e.db_name, ox.ensembl_object_type"); while (rs.next()) { String species = dbre.getSpecies().toString(); if (species == null || species.equalsIgnoreCase("unknown")) { species = dbre.getAlias(); } masterPrep.setString(1, species); masterPrep.setString(2, rs.getString("db_name")); masterPrep.setString(3, rs.getString("ensembl_object_type")); masterPrep.execute(); } stmt.close(); } PreparedStatement sourcePrep = tempDB.prepareStatement("select distinct source from "+masterTable); ResultSet sources = sourcePrep.executeQuery(); while (sources.next()) { String source = sources.getString("source"); String query = "select object,species from "+ masterTable +" where source = ?"; MapRowMapper<String,List<String>> mapper = new StringListMapRowMapper(); SqlTemplate template = new ConnectionBasedSqlTemplateImpl(tempDB); Map<String,List<String>> map = template.queryForMap(query, mapper, source); if (map.size() != 1) { // more than one list in the map implies there are at least two object types referenced // figure out which species are different String message = "Source:"+source+", types differ between species. "; int smallest = 1000; String smallestType = ""; for (Map.Entry<String, List<String>> entry: map.entrySet()) { List<String> species = entry.getValue(); if (species.size() < smallest) { smallest = species.size(); smallestType = entry.getKey(); } message = message.concat(entry.getKey() + " has " + species.size() + " species. "); } List<String> minoritySpecies = map.get(smallestType); message = message.concat("Problem species are:"+ StringUtils.join(minoritySpecies,",")); ReportManager.problem(this, "", message); result = false; } } dropTempTable(tempDB); tempDB.close(); } catch (ClassNotFoundException e) { // TODO Auto-generated catch block for making h2 database connection. // Somebody do this properly! e.printStackTrace(); } catch (SQLException e) { e.printStackTrace(); } return result; } // run private void createTempTable(Connection conn) { // making a temporary table in memory rather than affecting production DB try { Statement stmt = conn.createStatement(); stmt.execute("CREATE TABLE healthcheck_xref (species VARCHAR(255), source VARCHAR(255), object VARCHAR(255))"); logger.fine("Created table healthcheck_xref in temporary H2 DB"); } catch (SQLException se) { se.printStackTrace(); } } private void dropTempTable(Connection conn) { try { Statement stmt = conn.createStatement(); stmt.execute("DROP TABLE IF EXISTS healthcheck_xref"); logger.fine("Dropped table healthcheck_xref in temporary DB"); } catch (SQLException se) { se.printStackTrace(); } } } // XrefLevels
package org.craft.launch.task.tasks; import java.io.*; import org.apache.commons.io.*; import org.craft.launch.*; public class LWJGLSetup { private static boolean loaded; /** * Load LWJGL in given folder */ public static void load(File folder) throws Exception { if(!loaded) { if(!folder.exists()) folder.mkdirs(); if(folder.isDirectory()) { OperatingSystem os = OperatingSystem.getOS(); if(os == OperatingSystem.WINDOWS) { if(!new File(folder.getPath() + "/jinput-dx8_64.dll").exists()) { extractFromClasspath("windows/jinput-dx8_64.dll", folder); extractFromClasspath("windows/jinput-dx8.dll", folder); extractFromClasspath("windows/jinput-raw_64.dll", folder); extractFromClasspath("windows/jinput-raw.dll", folder); extractFromClasspath("windows/lwjgl.dll", folder); extractFromClasspath("windows/lwjgl64.dll", folder); extractFromClasspath("windows/OpenAL32.dll", folder); extractFromClasspath("windows/OpenAL64.dll", folder); } else { System.out.println("Natives already exist."); } } else if(os == OperatingSystem.SOLARIS) { if(!new File(folder.getPath() + "/liblwjgl.so").exists()) { extractFromClasspath("solaris/liblwjgl.so", folder); extractFromClasspath("solaris/liblwjgl64.so", folder); extractFromClasspath("solaris/libopenal.so", folder); extractFromClasspath("solaris/libopenal64.so", folder); } else { System.out.println("Natives already exist."); } } else if(os == OperatingSystem.LINUX) { if(!new File(folder.getPath() + "/liblwjgl.so").exists()) { extractFromClasspath("linux/liblwjgl.so", folder); extractFromClasspath("linux/liblwjgl64.so", folder); extractFromClasspath("linux/libopenal.so", folder); extractFromClasspath("linux/libopenal64.so", folder); } else { System.out.println("Natives already exist."); } } else if(os == OperatingSystem.MACOSX) { if(!new File(folder.getPath() + "/openal.dylib").exists()) { extractFromClasspath("macosx/liblwjgl.jnilib", folder); extractFromClasspath("macosx/liblwjgl-osx.jnilib", folder); extractFromClasspath("macosx/openal.dylib", folder); } else { System.out.println("Natives already exist."); } } else { System.err.println("Operating System couldn't be iditified"); } System.setProperty("net.java.games.input.librarypath", folder.getAbsolutePath()); System.setProperty("org.lwjgl.librarypath", folder.getAbsolutePath()); } loaded = true; } } /** * Extract given file from classpath into given folder */ private static void extractFromClasspath(String fileName, File folder) { try { String[] split = fileName.split("" + File.separatorChar); FileOutputStream out = new FileOutputStream(new File(folder, split[split.length - 1])); IOUtils.copy(LWJGLSetup.class.getResourceAsStream("/" + fileName), out); out.flush(); out.close(); } catch(Exception e) { e.printStackTrace(); } } }
package org.jmist.framework.services; import java.rmi.registry.LocateRegistry; import java.rmi.registry.Registry; import java.util.Iterator; import java.util.LinkedList; import java.util.List; import java.util.UUID; import java.util.concurrent.Executor; import org.jmist.framework.IJob; import org.jmist.framework.IProgressMonitor; import org.jmist.framework.ITaskWorker; import org.jmist.packages.DummyProgressMonitor; /** * A job that submits a parallelizable job to a remote * <code>JobServiceMaster<code>. This class may potentially use multiple * threads to process tasks. * @author bkimmel */ public final class ThreadServiceWorkerJob implements IJob { /** * Initializes the address of the master and the amount of time to idle * when no task is available. * @param masterHost The URL of the master. * @param idleTime The time (in milliseconds) to idle when no task is * available. * @param executor The <code>Executor</code> to use to process tasks * (must not use an unbounded queue). */ public ThreadServiceWorkerJob(String masterHost, long idleTime, Executor executor) { this.masterHost = masterHost; this.idleTime = idleTime; this.executor = executor; } /* (non-Javadoc) * @see org.jmist.framework.IJob#go(org.jmist.framework.IProgressMonitor) */ @Override public void go(IProgressMonitor monitor) { try { monitor.notifyIndeterminantProgress(); monitor.notifyStatusChanged("Looking up master..."); Registry registry = LocateRegistry.getRegistry(this.masterHost); this.service = (IJobMasterService) registry.lookup("IJobMasterService"); while (monitor.notifyIndeterminantProgress()) { this.executor.execute(new Worker(monitor.createChildProgressMonitor())); } monitor.notifyStatusChanged("Cancelled."); } catch (Exception e) { monitor.notifyStatusChanged("Exception: " + e.toString()); System.err.println("Client exception: " + e.toString()); e.printStackTrace(); } finally { monitor.notifyCancelled(); } } /** * An entry in the <code>ITaskWorker</code> cache. * @author bkimmel */ private class WorkerCacheEntry { /** * The <code>UUID</code> of the job that the <code>ITaskWorker</code> * processes tasks for. */ public final UUID jobId; /** * The cached <code>ITaskWorker</code>. */ public final ITaskWorker worker; /** * Initializes the cache entry. * @param jobId The <code>UUID</code> of the job that the * <code>ITaskWorker</code> processes tasks for. * @param worker The <code>ITaskWorker</code> to be cached. */ public WorkerCacheEntry(UUID jobId, ITaskWorker worker) { this.jobId = jobId; this.worker = worker; } } /** * Searches for the <code>ITaskWorker</code> to use to process tasks for * the job with the specified <code>UUID</code> in the local cache. * @param jobId The <code>UUID</code> of the job whose * <code>ITaskWorker</code> to search for. * @return The <code>ITaskWorker</code> corresponding to the job with the * specified <code>UUID</code>, or <code>null</code> if the * <code>ITaskWorker</code> for that job is not in the cache. */ private synchronized ITaskWorker getCachedTaskWorker(UUID jobId) { assert(jobId != null); Iterator<WorkerCacheEntry> i = this.workerCache.iterator(); /* Search for the worker for the specified job. */ while (i.hasNext()) { WorkerCacheEntry entry = i.next(); if (entry.jobId.compareTo(jobId) == 0) { /* Remove the entry and re-insert it at the end of the list. * This will ensure that when an item is removed from the list, * the item that is removed will always be the least recently * used. */ i.remove(); this.workerCache.add(entry); return entry.worker; } } /* cache miss */ return null; } /** * Ensures that the specified <code>ITaskWorker</code> is cached. * @param jobId The <code>UUID</code> of the job whose tasks are to be * processed by <code>worker</code>. * @param worker The <code>ITaskWorker</code> to add to the cache. */ private synchronized void addWorkerToCache(UUID jobId, ITaskWorker worker) { assert(jobId != null); assert(worker != null); /* First check to see if the worker for the specified job is already in * the cache. */ if (this.getCachedTaskWorker(jobId) == null) { /* Add the worker to the cache. */ this.workerCache.add(new WorkerCacheEntry(jobId, worker)); /* If the cache has exceeded capacity, then remove the least * recently used entry. */ assert(this.maxCachedWorkers > 0); while (this.workerCache.size() > this.maxCachedWorkers) { this.workerCache.remove(0); } } } /** * Obtains the task worker to process tasks for the job with the specified * <code>UUID</code>. * @param jobId The <code>UUID</code> of the job to obtain the task worker * for. * @return The <code>ITaskWorker</code> to process tasks for the job with * the specified <code>UUID</code>, or <code>null</code> if the job * is invalid or has already been completed. */ private ITaskWorker getTaskWorker(UUID jobId) { /* First try to obtain the worker from the cache. */ ITaskWorker worker = this.getCachedTaskWorker(jobId); if (worker != null) { return worker; } /* If the task worker was not in the cache, then use the service to * obtain the task worker. */ worker = this.service.getTaskWorker(jobId); /* If we were able to get the worker from the service, add it to the * cache so that we don't have to call the service next time. */ if (worker != null) { this.addWorkerToCache(jobId, worker); } return worker; } /** * Used to process tasks in threads. * @author bkimmel */ private class Worker implements Runnable { /** * Initializes the progress monitor to report to. * @param monitor The <code>IProgressMonitor</code> to report * the progress of the task to. */ public Worker(IProgressMonitor monitor) { this.monitor = monitor; } /* (non-Javadoc) * @see java.lang.Runnable#run() */ @Override public void run() { this.monitor.notifyIndeterminantProgress(); this.monitor.notifyStatusChanged("Requesting task..."); TaskDescription taskDesc = service.requestTask(); if (taskDesc != null) { this.monitor.notifyStatusChanged("Obtaining task worker..."); ITaskWorker worker = getTaskWorker(taskDesc.getJobId()); if (worker == null) { this.monitor.notifyStatusChanged("Could not obtain worker..."); this.monitor.notifyCancelled(); return; } this.monitor.notifyStatusChanged("Performing task..."); Object results = worker.performTask(taskDesc.getTask(), monitor); this.monitor.notifyStatusChanged("Submitting task results..."); service.submitTaskResults(taskDesc.getJobId(), taskDesc.getTaskId(), results); } else { /* taskDesc == null */ this.monitor.notifyStatusChanged("Idling..."); try { Thread.sleep(idleTime); } catch (InterruptedException e) { // continue. } } this.monitor.notifyComplete(); } /** * The <code>IProgressMonitor</code> to report to. */ private final IProgressMonitor monitor; } /** The URL of the master. */ private final String masterHost; /** * The amount of time (in milliseconds) to idle when no task is available. */ private final long idleTime; /** The <code>Executor</code> to use to process tasks. */ private final Executor executor; /** * The <code>IJobMasterService</code> to obtain tasks from and submit * results to. */ private IJobMasterService service = null; /** * A list of recently used <code>ITaskWorker</code>s and their associated * job's <code>UUID</code>s, in order from least recently used to most * recently used. */ private final List<WorkerCacheEntry> workerCache = new LinkedList<WorkerCacheEntry>(); /** * The maximum number of <code>ITaskWorker</code>s to retain in the cache. */ private final int maxCachedWorkers = 5; }
package org.egordorichev.lasttry.item; import org.egordorichev.lasttry.entity.Player; import org.egordorichev.lasttry.entity.Stat; import java.util.List; public class Modifier { // Accessories // Defense public static final Modifier hard = new Modifier("Hard", Type.ACCESSORY, new Stat(Stat.Type.DEFENSE, +1)); public static final Modifier guarding = new Modifier("Guarding", Type.ACCESSORY, new Stat(Stat.Type.DEFENSE, +2)); public static final Modifier armored = new Modifier("Armored", Type.ACCESSORY, new Stat(Stat.Type.DEFENSE, +3)); public static final Modifier warding = new Modifier("Warding", Type.ACCESSORY, new Stat(Stat.Type.DEFENSE, +4)); // Mana public static final Modifier arcane = new Modifier("Arcane", Type.ACCESSORY, new Stat(Stat.Type.MANA, +20)); // Critical Strike Chance public static final Modifier precise = new Modifier("Precise", Type.ACCESSORY, new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +2)); public static final Modifier lucky = new Modifier("Lucky", Type.ACCESSORY, new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +4)); // Damage public static final Modifier jagged = new Modifier("Jagged", Type.ACCESSORY, new Stat(Stat.Type.DAMAGE, +1)); public static final Modifier spiked = new Modifier("Spiked", Type.ACCESSORY, new Stat(Stat.Type.DAMAGE, +2)); public static final Modifier angry = new Modifier("Angry", Type.ACCESSORY, new Stat(Stat.Type.DAMAGE, +3)); public static final Modifier menacing = new Modifier("Menacing", Type.ACCESSORY, new Stat(Stat.Type.DAMAGE, +4)); // Movement Speed public static final Modifier brisk = new Modifier("Brisk", Type.ACCESSORY, new Stat(Stat.Type.MOVEMENT_SPEED, +1)); public static final Modifier fleeting = new Modifier("Fleeting", Type.ACCESSORY, new Stat(Stat.Type.MOVEMENT_SPEED, +2)); public static final Modifier hasty = new Modifier("Hasty", Type.ACCESSORY, new Stat(Stat.Type.MOVEMENT_SPEED, +3)); public static final Modifier quick = new Modifier("Quick", Type.ACCESSORY, new Stat(Stat.Type.MOVEMENT_SPEED, +4)); // Melee Speed public static final Modifier wild = new Modifier("Wild", Type.ACCESSORY, new Stat(Stat.Type.MELEE_SPEED, +1)); public static final Modifier rash = new Modifier("Rash", Type.ACCESSORY, new Stat(Stat.Type.MELEE_SPEED, +2)); public static final Modifier intrepid = new Modifier("Intrepid", Type.ACCESSORY, new Stat(Stat.Type.MELEE_SPEED, +3)); public static final Modifier violent = new Modifier("Violent", Type.ACCESSORY, new Stat(Stat.Type.MELEE_SPEED, +4)); // Universal public static final Modifier keen = new Modifier("Keen", Type.UNIVERSAL, new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +3)); public static final Modifier superior = new Modifier("Superior", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, +10), new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +3), new Stat(Stat.Type.KNOCKBACK, +10)); public static final Modifier forceful = new Modifier("Forceful", Type.UNIVERSAL, new Stat(Stat.Type.KNOCKBACK, +15)); public static final Modifier broken = new Modifier("Broken", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, -30), new Stat(Stat.Type.KNOCKBACK, -20)); public static final Modifier damaged = new Modifier("Damaged", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, -15)); public static final Modifier shoddy = new Modifier("Shoddy", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, -10), new Stat(Stat.Type.KNOCKBACK, -15)); public static final Modifier hurtful = new Modifier("Hurtful", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, +10)); public static final Modifier strong = new Modifier("Strong", Type.UNIVERSAL, new Stat(Stat.Type.KNOCKBACK, +15)); public static final Modifier unpleasant = new Modifier("Unpleasant", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, +5), new Stat(Stat.Type.KNOCKBACK, +15)); public static final Modifier weak = new Modifier("Weak", Type.UNIVERSAL, new Stat(Stat.Type.KNOCKBACK, -10)); public static final Modifier ruthless = new Modifier("Ruthless", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, +18), new Stat(Stat.Type.KNOCKBACK, -10)); public static final Modifier demonic = new Modifier("Demonic", Type.UNIVERSAL, new Stat(Stat.Type.DAMAGE, +15), new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +5)); public static final Modifier zealous = new Modifier("Zealous", Type.UNIVERSAL, new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +5)); // Common public static final Modifier quick = new Modifier("Quick", Type.COMMON, new Stat(Stat.Type.SPEED, +10)); public static final Modifier deady = new Modifier("Deadly", Type.COMMON, new Stat(Stat.Type.DAMAGE, +10), new Stat(Stat.Type.SPEED, +10)); public static final Modifier aglie = new Modifier("Aglie", Type.COMMON, new Stat(Stat.Type.SPEED, +10), new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +3)); public static final Modifier nimble = new Modifier("Nimble", Type.COMMON, new Stat(Stat.Type.SPEED, +5)); public static final Modifier murderous = new Modifier("Murderous", Type.COMMON, new Stat(Stat.Type.DAMAGE, +7), new Stat(Stat.Type.SPEED, +6), new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +3)); public static final Modifier slow = new Modifier("Slow", Type.COMMON, new Stat(Stat.Type.SPEED, -15)); public static final Modifier sluggish = new Modifier("Sluggish", Type.COMMON, new Stat(Stat.Type.SPEED, -20)); public static final Modifier lazy = new Modifier("Lazy", Type.COMMON, new Stat(Stat.Type.SPEED, -8)); public static final Modifier annoying = new Modifier("Annoying", Type.COMMON, new Stat(Stat.Type.DAMAGE, -20), new Stat(Stat.Type.SPEED, -15)); // Melee public static final Modifier large = new Modifier("Large", Type.MELEE, new Stat(Stat.Type.SIZE, +12)); public static final Modifier massive = new Modifier("Massive", Type.MELEE, new Stat(Stat.Type.SIZE, +18)); public static final Modifier dangerous = new Modifier("Dangerous", Type.MELEE, new Stat(Stat.Type.DAMAGE, +5), new Stat(Stat.Type.CRITICAL_STRIKE_CHANCE, +2), new Stat(Stat.Type.SIZE, +5)); public static final Modifier savage = new Modifier("Savage", Type.MELEE, new Stat(Stat.Type.DAMAGE, +10), new Stat(Stat.Type.SIZE, 10), new Stat(Stat.Type.KNOCKBACK, +10)); public enum Type { ACCESSORY, UNIVERSAL, COMMON, MELEE, RANGED, MAGIC } protected String name; protected Type type; protected Stat[] stats; protected float value; public Modifier(String name, Type type, Stat... stats) { this.name = name; this.type = type; this.stats = stats; this.value = value; } public void apply(Player player) { // TODO } public void remove(Player player) { // TODO } public String getName() { return this.name; } public Type getType() { return this.type; } public Stat[] getStats() { return this.stats; } public float getValue() { return this.value; } }
package org.jmist.packages.geometry.primitive; import org.jmist.framework.IntersectionRecorder; import org.jmist.framework.Material; import org.jmist.framework.SingleMaterialGeometry; import org.jmist.toolkit.Box3; import org.jmist.toolkit.Point2; import org.jmist.toolkit.Point3; import org.jmist.toolkit.Polynomial; import org.jmist.toolkit.Ray3; import org.jmist.toolkit.Sphere; import org.jmist.toolkit.Vector3; /** * A torus primitive <code>Geometry</code>. * @author bkimmel */ public final class TorusGeometry extends SingleMaterialGeometry { /** * Creates a new <code>TorusGeometry</code>. * @param major The major radius of the torus (i.e., the distance from the * center of the torus to a point in the center of the tube. * @param minor The minor radius of the torus (i.e., the radius of the * tube). * @param material The <code>Material</code> to apply to this * <code>TorusGeometry</code>. */ public TorusGeometry(double major, double minor, Material material) { super(material); this.major = major; this.minor = minor; } /* (non-Javadoc) * @see org.jmist.framework.Geometry#intersect(org.jmist.toolkit.Ray3, org.jmist.framework.IntersectionRecorder) */ @Override public void intersect(Ray3 ray, IntersectionRecorder recorder) { Vector3 orig = ray.origin().vectorFrom(Point3.ORIGIN); Vector3 dir = ray.direction().unit(); double sqRadius1 = major * major; double sqRadius2 = minor * minor; double s2NormOfDir = dir.squaredLength(); double s2NormOfOrig = orig.squaredLength(); double dirDotOrig = dir.dot(orig); double K = s2NormOfOrig - (sqRadius1 + sqRadius2); Polynomial f = new Polynomial( K * K - 4.0 * sqRadius1 * (sqRadius2 - orig.y() * orig.y()), 4.0 * dirDotOrig * (s2NormOfOrig - (sqRadius1 + sqRadius2)) + 8.0 * sqRadius1 * dir.y() * orig.y(), 2.0 * s2NormOfDir * (s2NormOfOrig - (sqRadius1 + sqRadius2)) + 4.0 * ((dirDotOrig * dirDotOrig) + sqRadius1 * dir.y() * dir.y()), 4.0 * dirDotOrig * s2NormOfDir, s2NormOfDir * s2NormOfDir ); double[] x = f.roots(); if (x.length > 1) { // sort roots for (int i = 1; i < x.length; i++) { if (x[i] < x[i - 1]) { double temp = x[i]; int j; for (j = i - 2; j >= 0; j if (x[i] > x[j]) break; x[i] = x[++j]; x[j] = temp; } } for (int i = 0; i < x.length; i++) super.newIntersection(ray, x[i], i % 2 == 0); } } /* (non-Javadoc) * @see org.jmist.framework.AbstractGeometry#getNormal(org.jmist.framework.AbstractGeometry.GeometryIntersection) */ @Override protected Vector3 getNormal(GeometryIntersection x) { Point3 p = x.location(); Vector3 rel = new Vector3(p.x(), 0.0, p.z()); double length = rel.length(); if (length > 0.0) { rel = rel.times(major / length); return p.vectorFrom(Point3.ORIGIN.plus(rel)); } else return Vector3.K; } /* (non-Javadoc) * @see org.jmist.framework.AbstractGeometry#getTextureCoordinates(org.jmist.framework.AbstractGeometry.GeometryIntersection) */ @Override protected Point2 getTextureCoordinates(GeometryIntersection x) { Vector3 cp = x.location().vectorFrom(Point3.ORIGIN); Vector3 R = new Vector3(cp.x(), 0.0, cp.z()).unit(); Vector3 r = cp.minus(R.times(major)).unit(); return new Point2( (Math.PI + Math.atan2(-cp.z(), cp.x())) / (2.0 * Math.PI), (Math.PI + Math.atan2(cp.y(), R.dot(r))) / (2.0 * Math.PI) ); } /* (non-Javadoc) * @see org.jmist.framework.Geometry#isClosed() */ @Override public boolean isClosed() { return true; } /* (non-Javadoc) * @see org.jmist.framework.Bounded3#boundingBox() */ @Override public Box3 boundingBox() { return new Box3( -(major + minor), -minor, -(major + minor), major + minor , minor, major + minor ); } /* (non-Javadoc) * @see org.jmist.framework.Bounded3#boundingSphere() */ @Override public Sphere boundingSphere() { return new Sphere(Point3.ORIGIN, major + minor); } /** * The major radius of the torus (i.e., the distance from the center of the * torus to a point in the center of the tube. */ private final double major; /** * The minor radius of the torus (i.e., the radius of the tube). */ private final double minor; }
package org.ohmage.request.survey; import java.io.BufferedWriter; import java.io.IOException; import java.io.OutputStreamWriter; import java.io.Writer; import java.util.ArrayList; import java.util.Arrays; import java.util.Collections; import java.util.Date; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.List; import java.util.Map; import java.util.Set; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import org.apache.log4j.Logger; import org.json.JSONArray; import org.json.JSONObject; import org.ohmage.annotator.ErrorCodes; import org.ohmage.cache.SurveyResponsePrivacyStateCache; import org.ohmage.cache.UserBin; import org.ohmage.dao.SurveyResponseReadDao; import org.ohmage.domain.configuration.Configuration; import org.ohmage.domain.survey.read.CustomChoiceItem; import org.ohmage.domain.survey.read.PromptResponseMetadata; import org.ohmage.domain.survey.read.SurveyResponseReadIndexedResult; import org.ohmage.domain.survey.read.SurveyResponseReadResult; import org.ohmage.exception.DataAccessException; import org.ohmage.exception.ServiceException; import org.ohmage.exception.ValidationException; import org.ohmage.request.InputKeys; import org.ohmage.request.UserRequest; import org.ohmage.service.CampaignServices; import org.ohmage.service.SurveyResponseReadServices; import org.ohmage.service.UserCampaignServices; import org.ohmage.util.CookieUtils; import org.ohmage.util.JsonUtils; import org.ohmage.util.StringUtils; import org.ohmage.validator.DateValidators; import org.ohmage.validator.SurveyResponseReadValidators; /** * <p>Allows a requester to read survey responses. Supervisors can read survey * responses anytime. Survey response owners (i.e., participants) can read * their own responses anytime. Authors can only read shared responses. * Analysts can read shared responses only if the campaign is shared.</p> * <table border="1"> * <tr> * <td>Parameter Name</td> * <td>Description</td> * <td>Required</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#AUTH_TOKEN}</td> * <td>The requesting user's authentication token.</td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#CLIENT}</td> * <td>A string describing the client that is making this request.</td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#CAMPAIGN_URN}</td> * <td>The campaign URN to use when retrieving responses.</td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#USER_LIST}</td> * <td>A comma-separated list of usernames to retrieve responses for * or the value {@value URN_SPECIAL_ALL}</td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#COLUMN_LIST}</td> * <td>A comma-separated list of the columns to retrieve responses for * or the value {@value #_URN_SPECIAL_ALL}. If {@value #_URN_SPECIAL_ALL} * is not used, the only allowed values are: * {@value #_URN_CONTEXT_CLIENT}, * {@value #_URN_CONTEXT_TIMESTAMP}, * {@value #_URN_CONTEXT_URN_CONTEXT_TIMEZONE}, * {@value #_URN_CONTEXT_UTC_TIMESTAMP}, * {@value #_URN_CONTEXT_LAUNCH_CONTEXT_LONG}, * {@value #_URN_CONTEXT_LAUNCH_CONTEXT_SHORT}, * {@value #_URN_CONTEXT_LOCATION_STATUS}, * {@value #_URN_CONTEXT_LOCATION_LATITUDE}, * {@value #_URN_CONTEXT_LOCATION_TIMESTAMP}, * {@value #_URN_CONTEXT_LOCATION_ACCURACY}, * {@value #_URN_CONTEXT_LOCATION_PROVIDER}, * {@value #_URN_USER_ID}, * {@value #_URN_SURVEY_ID}, * {@value #_URN_SURVEY_TITLE}, * {@value #_URN_SURVEY_DESCRIPTION}, * {@value #_URN_SURVEY_PRIVACY_STATE}, * {@value #_URN_REPEATABLE_SET_ID}, * {@value #_URN_REPEATABLE_SET_ITERATION}, * {@value #_URN_PROMPT_RESPONSE} * </td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#OUTPUT_FORMAT}</td> * <td>The desired output format of the results. Must be one of * {@value #_OUTPUT_FORMAT_JSON_ROWS}, {@value #_OUTPUT_FORMAT_JSON_COLUMNS}, * or, {@value #_OUTPUT_FORMAT_CSV}</td> * <td>true</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#PROMPT_ID_LIST}</td> * <td>A comma-separated list of prompt ids to retrieve responses for * or the value {@link #_URN_SPECIAL_ALL}. This key is only * optional if {@value org.ohmage.request.InputKeys#SURVEY_ID_LIST} * is not present.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#SURVEY_ID_LIST}</td> * <td>A comma-separated list of survey ids to retrieve responses for * or the value {@link #_URN_SPECIAL_ALL}. This key is only * optional if {@value org.ohmage.request.InputKeys#PROMPT_ID_LIST} * is not present.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#START_DATE}</td> * <td>The start date to use for results between dates. * Required if end date is present.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#END_DATE}</td> * <td>The end date to use for results between dates. * Required if start date is present.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#SORT_ORDER}</td> * <td>The sort order to use i.e., the SQL order by.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#SUPPRESS_METADATA}</td> * <td>For {@value #_OUTPUT_FORMAT_CSV} output, whether to suppress the * metadata section from the output</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#PRETTY_PRINT}</td> * <td>For JSON-based output, whether to pretty print the output</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#RETURN_ID}</td> * <td>For {@value #_OUTPUT_FORMAT_JSON_ROWS} output, whether to return * the id on each result. The web front-end uses the id value to perform * updates.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#PRIVACY_STATE}</td> * <td>Filters the results by their associated privacy state.</td> * <td>false</td> * </tr> * <tr> * <td>{@value org.ohmage.request.InputKeys#COLLAPSE}</td> * <td>Filters the results by uniqueness.</td> * <td>false</td> * </tr> * </table> * * @author Joshua Selsky */ public final class SurveyResponseReadRequest extends UserRequest { private static final Logger LOGGER = Logger.getLogger(SurveyResponseReadRequest.class); private final Date startDate; private final Date endDate; private final String campaignUrn; private final List<String> userList; private final List<String> promptIdList; private final List<String> surveyIdList; private final List<String> columnList; private final String outputFormat; private final Boolean prettyPrint; private final Boolean suppressMetadata; private final Boolean returnId; private final String sortOrder; private final String privacyState; private final Boolean collapse; private Configuration configuration; private List<SurveyResponseReadResult> surveyResponseList; private static final int MAGIC_CUSTOM_CHOICE_INDEX = 100; private static final List<String> ALLOWED_COLUMN_URN_LIST; private static final List<String> ALLOWED_OUTPUT_FORMAT_LIST; private static final List<String> ALLOWED_SORT_ORDER_LIST; public static final String URN_SPECIAL_ALL = "urn:ohmage:special:all"; public static final List<String> URN_SPECIAL_ALL_LIST; public static final String URN_CONTEXT_CLIENT = "urn:ohmage:context:client"; public static final String URN_CONTEXT_TIMESTAMP = "urn:ohmage:context:timestamp"; public static final String URN_CONTEXT_TIMEZONE = "urn:ohmage:context:timezone"; public static final String URN_CONTEXT_UTC_TIMESTAMP = "urn:ohmage:context:utc_timestamp"; public static final String URN_CONTEXT_LAUNCH_CONTEXT_LONG = "urn:ohmage:context:launch_context_long"; public static final String URN_CONTEXT_LAUNCH_CONTEXT_SHORT = "urn:ohmage:context:launch_context_short"; public static final String URN_CONTEXT_LOCATION_STATUS = "urn:ohmage:context:location:status"; public static final String URN_CONTEXT_LOCATION_LATITUDE = "urn:ohmage:context:location:latitude"; public static final String URN_CONTEXT_LOCATION_LONGITUDE = "urn:ohmage:context:location:longitude"; public static final String URN_CONTEXT_LOCATION_TIMESTAMP = "urn:ohmage:context:location:timestamp"; public static final String URN_CONTEXT_LOCATION_ACCURACY = "urn:ohmage:context:location:accuracy"; public static final String URN_CONTEXT_LOCATION_PROVIDER = "urn:ohmage:context:location:provider"; public static final String URN_USER_ID = "urn:ohmage:user:id"; public static final String URN_SURVEY_ID = "urn:ohmage:survey:id"; public static final String URN_SURVEY_TITLE = "urn:ohmage:survey:title"; public static final String URN_SURVEY_DESCRIPTION = "urn:ohmage:survey:description"; public static final String URN_SURVEY_PRIVACY_STATE = "urn:ohmage:survey:privacy_state"; public static final String URN_REPEATABLE_SET_ID = "urn:ohmage:repeatable_set:id"; public static final String URN_REPEATABLE_SET_ITERATION = "urn:ohmage:repeatable_set:iteration"; public static final String URN_PROMPT_RESPONSE = "urn:ohmage:prompt:response"; private static final String URN_PROMPT_ID_PREFIX = "urn:ohmage:prompt:id:"; // output format constants - these are the output formats the requester // can select from public static final String OUTPUT_FORMAT_JSON_ROWS = "json-rows"; public static final String OUTPUT_FORMAT_JSON_COLUMNS = "json-columns"; public static final String OUTPUT_FORMAT_CSV = "csv"; // FIXME: some of these constants belong elsewhere with the survey response // upload prompt type hierarchy where there all still a bunch of hard-coded // strings private static final String SKIPPED = "SKIPPED"; private static final String NOT_DISPLAYED = "NOT_DISPLAYED"; private static final String VALUE = "value"; private static final String SINGLE_CHOICE_CUSTOM = "single_choice_custom"; private static final String MULTI_CHOICE_CUSTOM = "multi_choice_custom"; private static final String CUSTOM_CHOICES = "custom_choices"; private static final String CHOICE_ID = "choice_id"; private static final String CHOICE_VALUE = "choice_value"; private static final String GLOBAL = "global"; private static final String CUSTOM = "custom"; static { ALLOWED_COLUMN_URN_LIST = Arrays.asList(new String[] { URN_CONTEXT_CLIENT, URN_CONTEXT_TIMESTAMP, URN_CONTEXT_TIMEZONE, URN_CONTEXT_UTC_TIMESTAMP, URN_CONTEXT_LAUNCH_CONTEXT_LONG, URN_CONTEXT_LAUNCH_CONTEXT_SHORT, URN_CONTEXT_LOCATION_STATUS, URN_CONTEXT_LOCATION_LATITUDE, URN_CONTEXT_LOCATION_LONGITUDE, URN_CONTEXT_LOCATION_TIMESTAMP, URN_CONTEXT_LOCATION_ACCURACY, URN_CONTEXT_LOCATION_PROVIDER, URN_USER_ID, URN_SURVEY_ID, URN_SURVEY_TITLE, URN_SURVEY_DESCRIPTION, URN_SURVEY_PRIVACY_STATE, URN_REPEATABLE_SET_ID, URN_REPEATABLE_SET_ITERATION, URN_PROMPT_RESPONSE }); ALLOWED_OUTPUT_FORMAT_LIST = Arrays.asList(new String[] {OUTPUT_FORMAT_JSON_ROWS, OUTPUT_FORMAT_JSON_COLUMNS, OUTPUT_FORMAT_CSV}); ALLOWED_SORT_ORDER_LIST = Arrays.asList(new String[] {InputKeys.SORT_ORDER_SURVEY, InputKeys.SORT_ORDER_TIMESTAMP, InputKeys.SORT_ORDER_USER}); URN_SPECIAL_ALL_LIST = Collections.unmodifiableList(Arrays.asList(new String[]{URN_SPECIAL_ALL})); } /** * Creates a survey response read request. * * @param httpRequest The request to retrieve parameters from. */ public SurveyResponseReadRequest(HttpServletRequest httpRequest) { // Handle user-password or token-based authentication super(httpRequest, TokenLocation.EITHER, false); Date tStartDateAsDate = null; Date tEndDateAsDate = null; String tCampaignUrn = getParameter(InputKeys.CAMPAIGN_URN); String tOutputFormat = getParameter(InputKeys.OUTPUT_FORMAT); String tSortOrder = getParameter(InputKeys.SORT_ORDER); String tPrivacyState = getParameter(InputKeys.PRIVACY_STATE); List<String> tUserListAsList = null; List<String> tPromptIdListAsList = null; List<String> tSurveyIdListAsList = null; List<String> tColumnListAsList = null; Boolean tPrettyPrintAsBoolean = null; Boolean tSuppressMetadataAsBoolean = null; Boolean tReturnIdAsBoolean = null; Boolean tCollapseAsBoolean = null; if(! isFailed()) { LOGGER.info("Creating a survey response read request."); try { // FIXME constant-ify the hard-coded strings, maybe even for // logging messages (possibly AOP-ify logging) // Also, move validation to the SurveyResponseReadValidators // And check for multiple copies of params LOGGER.info("Making sure campaign_urn parameter is present."); if(tCampaignUrn == null) { setFailed(ErrorCodes.CAMPAIGN_INVALID_ID, "The required campaign URN was not present."); throw new ValidationException("The required campaign URN was not present."); } LOGGER.info("Validating start_date and end_date parameters."); try { if(! StringUtils.isEmptyOrWhitespaceOnly(getParameter(InputKeys.START_DATE))) { tStartDateAsDate = DateValidators.validateISO8601Date(getParameter(InputKeys.START_DATE)); } else { tStartDateAsDate = null; } if(! StringUtils.isEmptyOrWhitespaceOnly(getParameter(InputKeys.END_DATE))) { tEndDateAsDate = DateValidators.validateISO8601Date(getParameter(InputKeys.END_DATE)); } else { tEndDateAsDate = null; } if((tStartDateAsDate != null && tEndDateAsDate == null) || (tStartDateAsDate == null && tEndDateAsDate != null)) { setFailed(ErrorCodes.SERVER_INVALID_DATE, "Missing start_date or end_date"); } } catch (ValidationException e) { // FIXME the DateValidators methods should take a Request parameter to fail setFailed(ErrorCodes.SERVER_INVALID_DATE, "Invalid start_date or end_date"); throw e; } LOGGER.info("Validating privacy_state parameter."); if(! StringUtils.isEmptyOrWhitespaceOnly(tPrivacyState) && ! SurveyResponsePrivacyStateCache.instance().getKeys().contains(tPrivacyState)) { setFailed(ErrorCodes.SURVEY_INVALID_PRIVACY_STATE, "Found unknown privacy_state: " + tPrivacyState); throw new ValidationException("Found unknown privacy_state: " + tPrivacyState); } LOGGER.info("Validating user_list parameter."); tUserListAsList = SurveyResponseReadValidators.validateUserList(this, getParameter(InputKeys.USER_LIST)); LOGGER.info("Validating prompt_id_list and survey_id_list parameters."); List<String> tList = SurveyResponseReadValidators.validatePromptIdSurveyIdLists(this, getParameter(InputKeys.PROMPT_ID_LIST), getParameter(InputKeys.SURVEY_ID_LIST)); // Now check whether it's a prompt id list or a survey id list if(StringUtils.isEmptyOrWhitespaceOnly(getParameter(InputKeys.PROMPT_ID_LIST))) { LOGGER.info("Found " + tList.size() + " survey ids to query against."); tSurveyIdListAsList = tList; tPromptIdListAsList = Collections.emptyList(); } else { LOGGER.info("Found " + tList.size() + " prompt ids to query against."); tSurveyIdListAsList = Collections.emptyList(); tPromptIdListAsList = tList; } LOGGER.info("Validating column_list parameter."); tColumnListAsList = SurveyResponseReadValidators.validateColumnList(this, getParameter(InputKeys.COLUMN_LIST), ALLOWED_COLUMN_URN_LIST); LOGGER.info("Validating output_format parameter."); tOutputFormat = SurveyResponseReadValidators.validateOutputFormat(this, tOutputFormat, ALLOWED_OUTPUT_FORMAT_LIST); LOGGER.info("Validating sort_order parameter."); tSortOrder = SurveyResponseReadValidators.validateSortOrder(this, tSortOrder, ALLOWED_SORT_ORDER_LIST); LOGGER.info("Validating suppress_metadata parameter."); tSuppressMetadataAsBoolean = SurveyResponseReadValidators.validateSuppressMetadata(this, getParameter(InputKeys.SUPPRESS_METADATA)); LOGGER.info("Validating pretty_print parameter."); tPrettyPrintAsBoolean = SurveyResponseReadValidators.validatePrettyPrint(this, getParameter(InputKeys.PRETTY_PRINT)); LOGGER.info("Validating return_id parameter."); tReturnIdAsBoolean = SurveyResponseReadValidators.validateReturnId(this, getParameter(InputKeys.RETURN_ID)); LOGGER.info("Validating collapse parameter."); tCollapseAsBoolean = SurveyResponseReadValidators.validateCollapse(this, getParameter(InputKeys.COLLAPSE)); } catch (ValidationException e) { LOGGER.info(e); } } this.campaignUrn = tCampaignUrn; this.collapse = tCollapseAsBoolean; this.columnList = tColumnListAsList; this.endDate = tEndDateAsDate; this.outputFormat = tOutputFormat; this.prettyPrint = tPrettyPrintAsBoolean; this.privacyState = tPrivacyState; this.promptIdList = tPromptIdListAsList; this.returnId = tReturnIdAsBoolean; this.sortOrder = tSortOrder; this.startDate = tStartDateAsDate; this.suppressMetadata = tSuppressMetadataAsBoolean; this.surveyIdList = tSurveyIdListAsList; this.userList = tUserListAsList; } /** * Services this request. */ @Override public void service() { LOGGER.info("Servicing a survey response read request."); if(! authenticate(AllowNewAccount.NEW_ACCOUNT_DISALLOWED)) { return; } try { LOGGER.info("Populating the requester with their associated campaigns and roles."); UserCampaignServices.populateUserWithCampaignRoleInfo(this, this.getUser()); LOGGER.info("Verifying that requester belongs to the campaign specified by campaign ID."); UserCampaignServices.campaignExistsAndUserBelongs(this, this.getUser(), this.campaignUrn); LOGGER.info("Verifying that the requester has a role that allows reading of survey responses for each of the users in the list."); UserCampaignServices.requesterCanViewUsersSurveyResponses(this, this.campaignUrn, this.getUser().getUsername(), (String[]) userList.toArray()); if(! this.userList.equals(URN_SPECIAL_ALL_LIST)) { LOGGER.info("Checking the user list to make sure all of the users belong to the campaign ID."); UserCampaignServices.verifyUsersExistInCampaign(this, this.campaignUrn, this.userList); } LOGGER.info("Retrieving campaign configuration."); this.configuration = CampaignServices.findCampaignConfiguration(this, this.campaignUrn); if(! this.promptIdList.isEmpty() && ! this.promptIdList.equals(URN_SPECIAL_ALL_LIST)) { LOGGER.info("Verifying that the prompt ids in the query belong to the campaign."); SurveyResponseReadServices.verifyPromptIdsBelongToConfiguration(this, this.promptIdList, this.configuration); } if(! this.surveyIdList.isEmpty() && ! this.surveyIdList.equals(URN_SPECIAL_ALL_LIST)) { LOGGER.info("Verifying that the survey ids in the query belong to the campaign."); SurveyResponseReadServices.verifySurveyIdsBelongToConfiguration(this, this.surveyIdList, this.configuration); } LOGGER.info("Dispatching to the data layer."); this.surveyResponseList = SurveyResponseReadDao.retrieveSurveyResponses(this, this.userList, this.campaignUrn, this.promptIdList, this.surveyIdList, this.startDate, this.endDate, this.sortOrder, this.configuration); LOGGER.info("Filtering survey response results according to our privacy rules and the requester's role."); SurveyResponseReadServices.performPrivacyFilter(this.getUser(), this.campaignUrn, surveyResponseList, this.privacyState); } catch(ServiceException e) { e.logException(LOGGER); } catch(DataAccessException e) { e.logException(LOGGER); } } /** * Builds the output depending on the state of this request and whatever * output format the requester selected. */ @Override public void respond(HttpServletRequest httpRequest, HttpServletResponse httpResponse) { Writer writer = null; try { // Prepare for sending the response to the client writer = new BufferedWriter(new OutputStreamWriter(getOutputStream(httpRequest, httpResponse))); String responseText = null; // Sets the HTTP headers to disable caching expireResponse(httpResponse); final String token = this.getUser().getToken(); if(token != null) { CookieUtils.setCookieValue(httpResponse, InputKeys.AUTH_TOKEN, token, (int) (UserBin.getTokenRemainingLifetimeInMillis(token) / MILLIS_IN_A_SECOND)); } // Set the content type depending on the output format the // requester requested. if(OUTPUT_FORMAT_CSV.equals(this.outputFormat)) { httpResponse.setContentType("text/csv"); httpResponse.setHeader("Content-Disposition", "attachment; f.txt"); } else { httpResponse.setContentType("application/json"); } // Build the appropriate response if(! isFailed()) { List<String> columnList = this.columnList; List<String> outputColumns = new ArrayList<String>(); List<SurveyResponseReadIndexedResult> indexedResultList = new ArrayList<SurveyResponseReadIndexedResult>(); // Build the column headers // Each column is a Map with a list containing the values for each row if(URN_SPECIAL_ALL.equals(columnList.get(0))) { outputColumns.addAll(ALLOWED_COLUMN_URN_LIST); } else { outputColumns.addAll(columnList); } if(columnList.contains(URN_PROMPT_RESPONSE) || URN_SPECIAL_ALL.equals(columnList.get(0))) { // The logic here is that if the user is requesting results for survey ids, they want all of the prompts // for those survey ids // So, loop through the results and find all of the unique prompt ids by forcing them into a Set Set<String> promptIdSet = new HashSet<String>(); if(0 != surveyResponseList.size()) { for(SurveyResponseReadResult result : surveyResponseList) { promptIdSet.add(URN_PROMPT_ID_PREFIX + result.getPromptId()); } outputColumns.addAll(promptIdSet); } } // get rid of urn:ohmage:prompt:response because it has been replaced with specific prompt ids // the list will be unchanged if it didn't already contain urn:ohmage:prompt:response outputColumns.remove(URN_PROMPT_RESPONSE); // For every result found by the query, the prompt responses need to be rolled up so they are all stored // with their associated survey response and metadata. Each prompt response is returned from the db in its // own row and the rows can have different sort orders. boolean isCsv = OUTPUT_FORMAT_CSV.equals(this.outputFormat); for(SurveyResponseReadResult result : surveyResponseList) { if(indexedResultList.isEmpty()) { // first time thru indexedResultList.add(new SurveyResponseReadIndexedResult(result, isCsv)); } else { int numberOfIndexedResults = indexedResultList.size(); boolean found = false; for(int i = 0; i < numberOfIndexedResults; i++) { if(indexedResultList.get(i).getKey().keysAreEqual(result.getUsername(), result.getTimestamp(), result.getSurveyId(), result.getRepeatableSetId(), result.getRepeatableSetIteration())) { found = true; indexedResultList.get(i).addPromptResponse(result, isCsv); } } if(! found) { indexedResultList.add(new SurveyResponseReadIndexedResult(result, isCsv)); } } } // For csv and json-columns output, the custom choices need to be converted // into unique-ified list in order for visualiztions and export to work // properly. The key is the prompt id. Map<String, List<CustomChoiceItem>> uniqueCustomChoiceMap = null; // will be converted into a choice glossary // for the custom types Map<String, Integer> uniqueCustomChoiceIndexMap = null; // Now find the custom choice prompts (if there are any) and // unique-ify the entries for their choice glossaries, create // their choice glossaries, and clean up the display value // (i.e., remove all the custom_choices stuff and leave only // the value or values the user selected). for(SurveyResponseReadIndexedResult result : indexedResultList) { Map<String, PromptResponseMetadata> promptResponseMetadataMap = result.getPromptResponseMetadataMap(); Iterator<String> responseMetadataKeyIterator = promptResponseMetadataMap.keySet().iterator(); while(responseMetadataKeyIterator.hasNext()) { String promptId = (responseMetadataKeyIterator.next()); PromptResponseMetadata metadata = promptResponseMetadataMap.get(promptId); if(SINGLE_CHOICE_CUSTOM.equals(metadata.getPromptType()) || MULTI_CHOICE_CUSTOM.equals(metadata.getPromptType())) { List<CustomChoiceItem> customChoiceItems = null; if(null == uniqueCustomChoiceMap) { // lazily initialized in case there are no custom choices uniqueCustomChoiceMap = new HashMap<String, List<CustomChoiceItem>>(); } if(! uniqueCustomChoiceMap.containsKey(promptId)) { customChoiceItems = new ArrayList<CustomChoiceItem>(); uniqueCustomChoiceMap.put(promptId, customChoiceItems); } else { customChoiceItems = uniqueCustomChoiceMap.get(promptId); } String tmp = (String) result.getPromptResponseMap().get(promptId); if(! (SKIPPED.equals(tmp) || NOT_DISPLAYED.equals(tmp))) { // All of the data for the choice_glossary for custom types is stored in its JSON response JSONObject customChoiceResponse = new JSONObject((String) result.getPromptResponseMap().get(promptId)); // Since the glossary will not contain the custom choices, the result's display value // can simply be the values the user chose. // The value will either be a string (single_choice_custom) or an array (multi_choice_custom) Integer singleChoiceValue = JsonUtils.getIntegerFromJsonObject(customChoiceResponse, VALUE); if(null != singleChoiceValue) { result.getPromptResponseMap().put(promptId, singleChoiceValue); } else { result.getPromptResponseMap().put(promptId, JsonUtils.getJsonArrayFromJsonObject(customChoiceResponse, VALUE)); } JSONArray customChoices = JsonUtils.getJsonArrayFromJsonObject(customChoiceResponse, CUSTOM_CHOICES); for(int i = 0; i < customChoices.length(); i++) { JSONObject choice = JsonUtils.getJsonObjectFromJsonArray(customChoices, i); // If the choice_id is >= 100, it means that is it a choice that the user added // In the current system, users cannot remove choices int originalId = choice.getInt(CHOICE_ID); CustomChoiceItem cci = null; boolean isGlobal = false; if(originalId < MAGIC_CUSTOM_CHOICE_INDEX) { cci = new CustomChoiceItem(originalId, result.getUsername(), choice.getString(CHOICE_VALUE), GLOBAL); isGlobal = true; } else { cci = new CustomChoiceItem(originalId, result.getUsername(), choice.getString(CHOICE_VALUE), CUSTOM); } if(! customChoiceItems.contains(cci)) { if(isGlobal) { cci.setId(cci.getOriginalId()); customChoiceItems.add(cci); } else { if(null == uniqueCustomChoiceIndexMap) { uniqueCustomChoiceIndexMap = new HashMap<String, Integer>(); } if(! uniqueCustomChoiceIndexMap.containsKey(promptId)) { uniqueCustomChoiceIndexMap.put(promptId, MAGIC_CUSTOM_CHOICE_INDEX - 1); } int uniqueId = uniqueCustomChoiceIndexMap.get(promptId) + 1; cci.setId(uniqueId); customChoiceItems.add(cci); uniqueCustomChoiceIndexMap.put(promptId, uniqueId); } } } } } } } int numberOfSurveys = indexedResultList.size(); int numberOfPrompts = this.surveyResponseList.size(); // Delete the original result list this.surveyResponseList.clear(); this.surveyResponseList = null; if(OUTPUT_FORMAT_JSON_ROWS.equals(this.outputFormat)) { responseText = SurveyResponseReadServices.generateJsonRowsOutput(this, numberOfSurveys, numberOfPrompts, indexedResultList, outputColumns, uniqueCustomChoiceMap); } else if(OUTPUT_FORMAT_JSON_COLUMNS.equals(this.outputFormat)) { if(indexedResultList.isEmpty()) { responseText = SurveyResponseReadServices.generateZeroResultJsonColumnOutput(this, outputColumns); } else { responseText = SurveyResponseReadServices.generateMultiResultJsonColumnOutput(this, numberOfSurveys, numberOfPrompts, indexedResultList, outputColumns, uniqueCustomChoiceMap); } } else if(OUTPUT_FORMAT_CSV.equals(this.outputFormat)) { if(indexedResultList.isEmpty()) { responseText = SurveyResponseReadServices.generateZeroResultCsvOutput(this, outputColumns); } else { responseText = SurveyResponseReadServices.generateMultiResultCsvOutput(this, numberOfSurveys, numberOfPrompts, indexedResultList, outputColumns, uniqueCustomChoiceMap); } } } else { // Even for CSV output, the error messages remain JSON responseText = getFailureMessage(); } LOGGER.info("Writing survey response read output."); writer.write(responseText); } // FIXME and catch the actual exceptions catch(Exception e) { LOGGER.error("An unrecoverable exception occurred while generating a survey response read response", e); try { writer.write(getFailureMessage()); } catch (Exception ee) { LOGGER.error("Caught Exception when attempting to write to HTTP output stream", ee); } } finally { if(null != writer) { try { writer.flush(); writer.close(); writer = null; } catch (IOException ioe) { LOGGER.error("Caught IOException when attempting to free resources", ioe); } } } } /* Methods for retrieving output formatting variables */ // FIXME: these should just be passed (within one object) to the methods that write the output public Boolean getPrettyPrint() { return prettyPrint; } public Boolean getSuppressMetadata() { return suppressMetadata; } public Boolean getReturnId() { return returnId; } public Boolean getCollapse() { return collapse; } public Configuration getConfiguration() { return configuration; } public String getCampaignUrn() { return campaignUrn; } }
package org.ihtsdo.otf.snomedboot; import java.io.FileNotFoundException; import java.nio.file.Path; import java.util.ArrayList; import java.util.List; class ReleaseFiles { private Path conceptPath; private Path descriptionPath; private Path textDefinitionPath; private Path relationshipPath; private Path statedRelationshipPath; private List<Path> refsetPaths; public ReleaseFiles() { refsetPaths = new ArrayList<>(); } public Path getConceptPath() { return conceptPath; } public void setConceptPath(Path conceptPath) { this.conceptPath = conceptPath; } public Path getDescriptionPath() { return descriptionPath; } public void setDescriptionPath(Path descriptionPath) { this.descriptionPath = descriptionPath; } public Path getTextDefinitionPath() { return textDefinitionPath; } public void setTextDefinitionPath(Path textDefinitionPath) { this.textDefinitionPath = textDefinitionPath; } public Path getRelationshipPath() { return relationshipPath; } public void setRelationshipPath(Path relationshipPath) { this.relationshipPath = relationshipPath; } public Path getStatedRelationshipPath() { return statedRelationshipPath; } public void setStatedRelationshipPath(Path statedRelationshipPath) { this.statedRelationshipPath = statedRelationshipPath; } public List<Path> getRefsetPaths() { return refsetPaths; } public void setRefsetPaths(List<Path> refsetPaths) { this.refsetPaths = refsetPaths; } public void assertFullSet() throws FileNotFoundException { if (conceptPath == null) { throw new FileNotFoundException("Concept RF2 file not found."); } else if (descriptionPath == null) { throw new FileNotFoundException("Description RF2 file not found."); } else if (relationshipPath == null) { throw new FileNotFoundException("Relationship RF2 file not found."); } } @Override public String toString() { return "ReleaseFiles{" + "conceptPath=" + conceptPath + ", descriptionPath=" + descriptionPath + ", textDefinitionPath=" + textDefinitionPath + ", relationshipPath=" + relationshipPath + ", statedRelationshipPath=" + statedRelationshipPath + ", refsetPaths=" + refsetPaths + '}'; } }
package org.influxdb.impl; import java.lang.reflect.Field; import java.time.Instant; import java.time.format.DateTimeFormatter; import java.time.format.DateTimeFormatterBuilder; import java.time.temporal.ChronoField; import java.util.LinkedList; import java.util.List; import java.util.Objects; import java.util.Map.Entry; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.ConcurrentMap; import java.util.concurrent.TimeUnit; import org.influxdb.InfluxDBMapperException; import org.influxdb.annotation.Column; import org.influxdb.annotation.Measurement; import org.influxdb.dto.QueryResult; /** * Main class responsible for mapping a QueryResult to a POJO. * * @author fmachado */ public class InfluxDBResultMapper { /** * Data structure used to cache classes used as measurements. */ private static final ConcurrentMap<String, ConcurrentMap<String, Field>> CLASS_FIELD_CACHE = new ConcurrentHashMap<>(); private static final int FRACTION_MIN_WIDTH = 0; private static final int FRACTION_MAX_WIDTH = 9; private static final boolean ADD_DECIMAL_POINT = true; /** * When a query is executed without {@link TimeUnit}, InfluxDB returns the <tt>time</tt> * column as an ISO8601 date. */ private static final DateTimeFormatter ISO8601_FORMATTER = new DateTimeFormatterBuilder() .appendPattern("yyyy-MM-dd'T'HH:mm:ss") .appendFraction(ChronoField.NANO_OF_SECOND, FRACTION_MIN_WIDTH, FRACTION_MAX_WIDTH, ADD_DECIMAL_POINT) .appendPattern("X") .toFormatter(); /** * <p> * Process a {@link QueryResult} object returned by the InfluxDB client inspecting the internal * data structure and creating the respective object instances based on the Class passed as * parameter. * </p> * * @param queryResult the InfluxDB result object * @param clazz the Class that will be used to hold your measurement data * @param <T> the target type * @return a {@link List} of objects from the same Class passed as parameter and sorted on the * same order as received from InfluxDB. * @throws InfluxDBMapperException If {@link QueryResult} parameter contain errors, * <tt>clazz</tt> parameter is not annotated with &#64;Measurement or it was not * possible to define the values of your POJO (e.g. due to an unsupported field type). */ public <T> List<T> toPOJO(final QueryResult queryResult, final Class<T> clazz) throws InfluxDBMapperException { Objects.requireNonNull(queryResult, "queryResult"); Objects.requireNonNull(clazz, "clazz"); throwExceptionIfMissingAnnotation(clazz); throwExceptionIfResultWithError(queryResult); cacheMeasurementClass(clazz); List<T> result = new LinkedList<T>(); String measurementName = getMeasurementName(clazz); queryResult.getResults().stream() .filter(internalResult -> Objects.nonNull(internalResult) && Objects.nonNull(internalResult.getSeries())) .forEach(internalResult -> { internalResult.getSeries().stream() .filter(series -> series.getName().equals(measurementName)) .forEachOrdered(series -> { parseSeriesAs(series, clazz, result); }); }); return result; } void throwExceptionIfMissingAnnotation(final Class<?> clazz) { if (!clazz.isAnnotationPresent(Measurement.class)) { throw new IllegalArgumentException( "Class " + clazz.getName() + " is not annotated with @" + Measurement.class.getSimpleName()); } } void throwExceptionIfResultWithError(final QueryResult queryResult) { if (queryResult.getError() != null) { throw new InfluxDBMapperException("InfluxDB returned an error: " + queryResult.getError()); } queryResult.getResults().forEach(seriesResult -> { if (seriesResult.getError() != null) { throw new InfluxDBMapperException("InfluxDB returned an error with Series: " + seriesResult.getError()); } }); } void cacheMeasurementClass(final Class<?>... classVarAgrs) { for (Class<?> clazz : classVarAgrs) { if (CLASS_FIELD_CACHE.containsKey(clazz.getName())) { continue; } ConcurrentMap<String, Field> initialMap = new ConcurrentHashMap<>(); ConcurrentMap<String, Field> influxColumnAndFieldMap = CLASS_FIELD_CACHE.putIfAbsent(clazz.getName(), initialMap); if (influxColumnAndFieldMap == null) { influxColumnAndFieldMap = initialMap; } for (Field field : clazz.getDeclaredFields()) { Column colAnnotation = field.getAnnotation(Column.class); if (colAnnotation != null) { influxColumnAndFieldMap.put(colAnnotation.name(), field); } } } } String getMeasurementName(final Class<?> clazz) { return ((Measurement) clazz.getAnnotation(Measurement.class)).name(); } <T> List<T> parseSeriesAs(final QueryResult.Series series, final Class<T> clazz, final List<T> result) { int columnSize = series.getColumns().size(); ConcurrentMap<String, Field> colNameAndFieldMap = CLASS_FIELD_CACHE.get(clazz.getName()); try { T object = null; for (List<Object> row : series.getValues()) { for (int i = 0; i < columnSize; i++) { Field correspondingField = colNameAndFieldMap.get(series.getColumns().get(i)/*InfluxDB columnName*/); if (correspondingField != null) { if (object == null) { object = clazz.newInstance(); } setFieldValue(object, correspondingField, row.get(i)); } } // When the "GROUP BY" clause is used, "tags" are returned as Map<String,String> and // accordingly with InfluxDB documentation // https://docs.influxdata.com/influxdb/v1.2/concepts/glossary/#tag-value // "tag" values are always String. if (series.getTags() != null && !series.getTags().isEmpty()) { for (Entry<String, String> entry : series.getTags().entrySet()) { Field correspondingField = colNameAndFieldMap.get(entry.getKey()/*InfluxDB columnName*/); if (correspondingField != null) { // I don't think it is possible to reach here without a valid "object" setFieldValue(object, correspondingField, entry.getValue()); } } } if (object != null) { result.add(object); object = null; } } } catch (InstantiationException | IllegalAccessException e) { throw new InfluxDBMapperException(e); } return result; } <T> void setFieldValue(final T object, final Field field, final Object value) throws IllegalArgumentException, IllegalAccessException { if (value == null) { return; } Class<?> fieldType = field.getType(); try { if (!field.isAccessible()) { field.setAccessible(true); } if (fieldValueModified(fieldType, field, object, value) || fieldValueForPrimitivesModified(fieldType, field, object, value) || fieldValueForPrimitiveWrappersModified(fieldType, field, object, value)) { return; } String msg = "Class '%s' field '%s' is from an unsupported type '%s'."; throw new InfluxDBMapperException( String.format(msg, object.getClass().getName(), field.getName(), field.getType())); } catch (ClassCastException e) { String msg = "Class '%s' field '%s' was defined with a different field type and caused a ClassCastException. " + "The correct type is '%s' (current field value: '%s')."; throw new InfluxDBMapperException( String.format(msg, object.getClass().getName(), field.getName(), value.getClass().getName(), value)); } } <T> boolean fieldValueModified(final Class<?> fieldType, final Field field, final T object, final Object value) throws IllegalArgumentException, IllegalAccessException { if (String.class.isAssignableFrom(fieldType)) { field.set(object, String.valueOf(value)); return true; } if (Instant.class.isAssignableFrom(fieldType)) { Instant instant; if (value instanceof String) { instant = Instant.from(ISO8601_FORMATTER.parse(String.valueOf(value))); } else if (value instanceof Long) { instant = Instant.ofEpochMilli((Long) value); } else if (value instanceof Double) { instant = Instant.ofEpochMilli(((Double) value).longValue()); } else { throw new InfluxDBMapperException("Unsupported type " + field.getClass() + " for field " + field.getName()); } field.set(object, instant); return true; } return false; } <T> boolean fieldValueForPrimitivesModified(final Class<?> fieldType, final Field field, final T object, final Object value) throws IllegalArgumentException, IllegalAccessException { if (double.class.isAssignableFrom(fieldType)) { field.setDouble(object, ((Double) value).doubleValue()); return true; } if (long.class.isAssignableFrom(fieldType)) { field.setLong(object, ((Double) value).longValue()); return true; } if (int.class.isAssignableFrom(fieldType)) { field.setInt(object, ((Double) value).intValue()); return true; } if (boolean.class.isAssignableFrom(fieldType)) { field.setBoolean(object, Boolean.valueOf(String.valueOf(value)).booleanValue()); return true; } return false; } <T> boolean fieldValueForPrimitiveWrappersModified(final Class<?> fieldType, final Field field, final T object, final Object value) throws IllegalArgumentException, IllegalAccessException { if (Double.class.isAssignableFrom(fieldType)) { field.set(object, value); return true; } if (Long.class.isAssignableFrom(fieldType)) { field.set(object, Long.valueOf(((Double) value).longValue())); return true; } if (Integer.class.isAssignableFrom(fieldType)) { field.set(object, Integer.valueOf(((Double) value).intValue())); return true; } if (Boolean.class.isAssignableFrom(fieldType)) { field.set(object, Boolean.valueOf(String.valueOf(value))); return true; } return false; } }
package org.javarosa.core.model; import org.javarosa.core.model.condition.IConditionExpr; import org.javarosa.core.model.instance.FormInstance; import org.javarosa.core.model.instance.TreeReference; import org.javarosa.core.model.util.restorable.RestoreUtils; import org.javarosa.core.util.externalizable.DeserializationException; import org.javarosa.core.util.externalizable.ExtUtil; import org.javarosa.core.util.externalizable.ExtWrapNullable; import org.javarosa.core.util.externalizable.ExtWrapTagged; import org.javarosa.core.util.externalizable.Externalizable; import org.javarosa.core.util.externalizable.PrototypeFactory; import java.io.DataInputStream; import java.io.DataOutputStream; import java.io.IOException; import java.util.Collections; import java.util.Comparator; import java.util.Vector; public class ItemsetBinding implements Externalizable { /** * note that storing both the ref and expr for everything is kind of redundant, but we're forced * to since it's nearly impossible to convert between the two w/o having access to the underlying * xform/xpath classes, which we don't from the core model project */ public TreeReference nodesetRef; //absolute ref of itemset source nodes public IConditionExpr nodesetExpr; //path expression for source nodes; may be relative, may contain predicates public TreeReference contextRef; //context ref for nodesetExpr; ref of the control parent (group/formdef) of itemset question //note: this is only here because its currently impossible to both (a) get a form control's parent, and (b) //convert expressions into refs while preserving predicates. once these are fixed, this field can go away public TreeReference labelRef; //absolute ref of label public IConditionExpr labelExpr; //path expression for label; may be relative, no predicates public boolean labelIsItext; //if true, content of 'label' is an itext id public boolean copyMode; //true = copy subtree; false = copy string value public TreeReference copyRef; //absolute ref to copy public TreeReference valueRef; //absolute ref to value public IConditionExpr valueExpr; //path expression for value; may be relative, no predicates (must be relative if copy mode) public TreeReference sortRef; //absolute ref to sort public IConditionExpr sortExpr; //path expression for sort; may be relative, no predicates (must be relative if copy mode) private TreeReference destRef; //ref that identifies the repeated nodes resulting from this itemset // dynamic choices, not serialized private Vector<SelectChoice> choices; public Vector<SelectChoice> getChoices() { return choices; } public void setChoices(Vector<SelectChoice> choices) { if (this.choices != null) { clearChoices(); } this.choices = choices; sortChoices(); } private void sortChoices() { if (this.sortRef != null) { // Perform sort Collections.sort(choices, new Comparator<SelectChoice>() { @Override public int compare(SelectChoice choice1, SelectChoice choice2) { return choice1.evaluatedSortProperty.compareTo(choice2.evaluatedSortProperty); } }); // Re-set indices after sorting for (int i = 0; i < choices.size(); i++) { choices.get(i).setIndex(i); } } } public void clearChoices() { this.choices = null; } public void setDestRef(QuestionDef q) { destRef = FormInstance.unpackReference(q.getBind()).clone(); if (copyMode) { destRef.add(copyRef.getNameLast(), TreeReference.INDEX_UNBOUND); } } public TreeReference getDestRef() { return destRef; } public IConditionExpr getRelativeValue() { TreeReference relRef = null; if (copyRef == null) { relRef = valueRef; //must be absolute in this case } else if (valueRef != null) { relRef = valueRef.relativize(copyRef); } return relRef != null ? RestoreUtils.refToPathExpr(relRef) : null; } @Override public void readExternal(DataInputStream in, PrototypeFactory pf) throws IOException, DeserializationException { nodesetRef = (TreeReference)ExtUtil.read(in, TreeReference.class, pf); nodesetExpr = (IConditionExpr)ExtUtil.read(in, new ExtWrapTagged(), pf); contextRef = (TreeReference)ExtUtil.read(in, TreeReference.class, pf); labelRef = (TreeReference)ExtUtil.read(in, TreeReference.class, pf); labelExpr = (IConditionExpr)ExtUtil.read(in, new ExtWrapTagged(), pf); valueRef = (TreeReference)ExtUtil.read(in, new ExtWrapNullable(TreeReference.class), pf); valueExpr = (IConditionExpr)ExtUtil.read(in, new ExtWrapNullable(new ExtWrapTagged()), pf); copyRef = (TreeReference)ExtUtil.read(in, new ExtWrapNullable(TreeReference.class), pf); labelIsItext = ExtUtil.readBool(in); copyMode = ExtUtil.readBool(in); sortRef = (TreeReference)ExtUtil.read(in, new ExtWrapNullable(TreeReference.class), pf); sortExpr = (IConditionExpr)ExtUtil.read(in, new ExtWrapNullable(new ExtWrapTagged()), pf); } @Override public void writeExternal(DataOutputStream out) throws IOException { ExtUtil.write(out, nodesetRef); ExtUtil.write(out, new ExtWrapTagged(nodesetExpr)); ExtUtil.write(out, contextRef); ExtUtil.write(out, labelRef); ExtUtil.write(out, new ExtWrapTagged(labelExpr)); ExtUtil.write(out, new ExtWrapNullable(valueRef)); ExtUtil.write(out, new ExtWrapNullable(valueExpr == null ? null : new ExtWrapTagged(valueExpr))); ExtUtil.write(out, new ExtWrapNullable(copyRef)); ExtUtil.writeBool(out, labelIsItext); ExtUtil.writeBool(out, copyMode); ExtUtil.write(out, new ExtWrapNullable(sortRef)); ExtUtil.write(out, new ExtWrapNullable(sortExpr == null ? null : new ExtWrapTagged(sortExpr))); } }
package org.jboss.netty.handler.ssl; import static org.jboss.netty.channel.Channels.*; import java.nio.ByteBuffer; import java.nio.channels.ClosedChannelException; import java.util.LinkedList; import java.util.Queue; import java.util.concurrent.ConcurrentLinkedQueue; import java.util.concurrent.Executor; import java.util.concurrent.atomic.AtomicBoolean; import javax.net.ssl.SSLEngine; import javax.net.ssl.SSLEngineResult; import javax.net.ssl.SSLException; import javax.net.ssl.SSLEngineResult.HandshakeStatus; import javax.net.ssl.SSLEngineResult.Status; import org.jboss.netty.buffer.ChannelBuffer; import org.jboss.netty.buffer.ChannelBuffers; import org.jboss.netty.channel.Channel; import org.jboss.netty.channel.ChannelEvent; import org.jboss.netty.channel.ChannelFuture; import org.jboss.netty.channel.ChannelFutureListener; import org.jboss.netty.channel.ChannelHandlerContext; import org.jboss.netty.channel.ChannelPipeline; import org.jboss.netty.channel.ChannelStateEvent; import org.jboss.netty.channel.Channels; import org.jboss.netty.channel.DownstreamMessageEvent; import org.jboss.netty.channel.MessageEvent; import org.jboss.netty.handler.codec.frame.FrameDecoder; import org.jboss.netty.logging.InternalLogger; import org.jboss.netty.logging.InternalLoggerFactory; import org.jboss.netty.util.internal.ImmediateExecutor; public class SslHandler extends FrameDecoder { private static final InternalLogger logger = InternalLoggerFactory.getInstance(SslHandler.class); private static final ByteBuffer EMPTY_BUFFER = ByteBuffer.allocate(0); private static SslBufferPool defaultBufferPool; /** * Returns the default {@link SslBufferPool} used when no pool is * specified in the constructor. */ public static synchronized SslBufferPool getDefaultBufferPool() { if (defaultBufferPool == null) { defaultBufferPool = new SslBufferPool(); } return defaultBufferPool; } private final SSLEngine engine; private final SslBufferPool bufferPool; private final Executor delegatedTaskExecutor; private final boolean startTls; final Object handshakeLock = new Object(); private boolean initialHandshake; private boolean handshaking; private volatile boolean handshaken; private volatile ChannelFuture handshakeFuture; private final AtomicBoolean sentFirstMessage = new AtomicBoolean(); private final AtomicBoolean sentCloseNotify = new AtomicBoolean(); final Queue<ChannelFuture> closeFutures = new ConcurrentLinkedQueue<ChannelFuture>(); private final Queue<PendingWrite> pendingUnencryptedWrites = new LinkedList<PendingWrite>(); private final Queue<MessageEvent> pendingEncryptedWrites = new LinkedList<MessageEvent>(); /** * Creates a new instance. * * @param engine the {@link SSLEngine} this handler will use */ public SslHandler(SSLEngine engine) { this(engine, getDefaultBufferPool(), ImmediateExecutor.INSTANCE); } /** * Creates a new instance. * * @param engine the {@link SSLEngine} this handler will use * @param bufferPool the {@link SslBufferPool} where this handler will * acquire the buffers required by the {@link SSLEngine} */ public SslHandler(SSLEngine engine, SslBufferPool bufferPool) { this(engine, bufferPool, ImmediateExecutor.INSTANCE); } /** * Creates a new instance. * * @param engine the {@link SSLEngine} this handler will use * @param startTls {@code true} if the first write request shouldn't be * encrypted by the {@link SSLEngine} */ public SslHandler(SSLEngine engine, boolean startTls) { this(engine, getDefaultBufferPool(), startTls); } /** * Creates a new instance. * * @param engine the {@link SSLEngine} this handler will use * @param bufferPool the {@link SslBufferPool} where this handler will * acquire the buffers required by the {@link SSLEngine} * @param startTls {@code true} if the first write request shouldn't be * encrypted by the {@link SSLEngine} */ public SslHandler(SSLEngine engine, SslBufferPool bufferPool, boolean startTls) { this(engine, bufferPool, startTls, ImmediateExecutor.INSTANCE); } /** * Creates a new instance. * * @param engine * the {@link SSLEngine} this handler will use * @param delegatedTaskExecutor * the {@link Executor} which will execute the delegated task * that {@link SSLEngine#getDelegatedTask()} will return */ public SslHandler(SSLEngine engine, Executor delegatedTaskExecutor) { this(engine, getDefaultBufferPool(), delegatedTaskExecutor); } /** * Creates a new instance. * * @param engine * the {@link SSLEngine} this handler will use * @param bufferPool * the {@link SslBufferPool} where this handler will acquire * the buffers required by the {@link SSLEngine} * @param delegatedTaskExecutor * the {@link Executor} which will execute the delegated task * that {@link SSLEngine#getDelegatedTask()} will return */ public SslHandler(SSLEngine engine, SslBufferPool bufferPool, Executor delegatedTaskExecutor) { this(engine, bufferPool, false, delegatedTaskExecutor); } /** * Creates a new instance. * * @param engine * the {@link SSLEngine} this handler will use * @param startTls * {@code true} if the first write request shouldn't be encrypted * by the {@link SSLEngine} * @param delegatedTaskExecutor * the {@link Executor} which will execute the delegated task * that {@link SSLEngine#getDelegatedTask()} will return */ public SslHandler(SSLEngine engine, boolean startTls, Executor delegatedTaskExecutor) { this(engine, getDefaultBufferPool(), startTls, delegatedTaskExecutor); } /** * Creates a new instance. * * @param engine * the {@link SSLEngine} this handler will use * @param bufferPool * the {@link SslBufferPool} where this handler will acquire * the buffers required by the {@link SSLEngine} * @param startTls * {@code true} if the first write request shouldn't be encrypted * by the {@link SSLEngine} * @param delegatedTaskExecutor * the {@link Executor} which will execute the delegated task * that {@link SSLEngine#getDelegatedTask()} will return */ public SslHandler(SSLEngine engine, SslBufferPool bufferPool, boolean startTls, Executor delegatedTaskExecutor) { if (engine == null) { throw new NullPointerException("engine"); } if (bufferPool == null) { throw new NullPointerException("bufferPool"); } if (delegatedTaskExecutor == null) { throw new NullPointerException("delegatedTaskExecutor"); } this.engine = engine; this.bufferPool = bufferPool; this.delegatedTaskExecutor = delegatedTaskExecutor; this.startTls = startTls; } /** * Returns the {@link SSLEngine} which is used by this handler. */ public SSLEngine getEngine() { return engine; } /** * Starts an SSL / TLS handshake for the specified channel. * * @return a {@link ChannelFuture} which is notified when the handshake * succeeds or fails. */ public ChannelFuture handshake(Channel channel) throws SSLException { ChannelFuture handshakeFuture; synchronized (handshakeLock) { if (handshaking) { return this.handshakeFuture; } else { engine.beginHandshake(); runDelegatedTasks(); handshakeFuture = this.handshakeFuture = newHandshakeFuture(channel); handshaking = true; } } wrapNonAppData(context(channel), channel); return handshakeFuture; } /** * Sends an SSL {@code close_notify} message to the specified channel and * destroys the underlying {@link SSLEngine}. */ public ChannelFuture close(Channel channel) throws SSLException { ChannelHandlerContext ctx = context(channel); engine.closeOutbound(); return wrapNonAppData(ctx, channel); } private ChannelHandlerContext context(Channel channel) { return channel.getPipeline().getContext(getClass()); } @Override public void handleDownstream( final ChannelHandlerContext context, final ChannelEvent evt) throws Exception { if (evt instanceof ChannelStateEvent) { ChannelStateEvent e = (ChannelStateEvent) evt; switch (e.getState()) { case OPEN: case CONNECTED: case BOUND: if (Boolean.FALSE.equals(e.getValue()) || e.getValue() == null) { closeOutboundAndChannel(context, e); return; } } } if (!(evt instanceof MessageEvent)) { context.sendDownstream(evt); return; } MessageEvent e = (MessageEvent) evt; if (!(e.getMessage() instanceof ChannelBuffer)) { context.sendDownstream(evt); return; } // Do not encrypt the first write request if this handler is // created with startTLS flag turned on. if (startTls && sentFirstMessage.compareAndSet(false, true)) { context.sendDownstream(evt); return; } // Otherwise, all messages are encrypted. ChannelBuffer msg = (ChannelBuffer) e.getMessage(); PendingWrite pendingWrite = new PendingWrite(evt.getFuture(), msg.toByteBuffer(msg.readerIndex(), msg.readableBytes())); synchronized (pendingUnencryptedWrites) { boolean offered = pendingUnencryptedWrites.offer(pendingWrite); assert offered; } wrap(context, evt.getChannel()); } @Override public void channelDisconnected(ChannelHandlerContext ctx, ChannelStateEvent e) throws Exception { // Make sure the handshake future is notified when a connection has // been closed during handshake. synchronized (handshakeLock) { if (handshaking) { handshakeFuture.setFailure(new ClosedChannelException()); } } try { super.channelDisconnected(ctx, e); } finally { unwrap(ctx, e.getChannel(), ChannelBuffers.EMPTY_BUFFER, 0, 0); engine.closeOutbound(); if (!sentCloseNotify.get() && handshaken) { try { engine.closeInbound(); } catch (SSLException ex) { logger.debug("Failed to clean up SSLEngine.", ex); } } } } @Override protected Object decode( ChannelHandlerContext ctx, Channel channel, ChannelBuffer buffer) throws Exception { if (buffer.readableBytes() < 2) { return null; } int packetLength = buffer.getShort(buffer.readerIndex()) & 0xFFFF; if ((packetLength & 0x8000) != 0) { // Detected a SSLv2 packet packetLength &= 0x7FFF; packetLength += 2; } else if (buffer.readableBytes() < 5) { return null; } else { // Detected a SSLv3 / TLSv1 packet packetLength = (buffer.getShort(buffer.readerIndex() + 3) & 0xFFFF) + 5; } if (buffer.readableBytes() < packetLength) { return null; } ChannelBuffer frame; try { frame = unwrap(ctx, channel, buffer, buffer.readerIndex(), packetLength); } finally { buffer.skipBytes(packetLength); } if (frame == null && engine.isInboundDone()) { synchronized (closeFutures) { for (;;) { ChannelFuture future = closeFutures.poll(); if (future == null) { break; } Channels.close(ctx, future); } } } return frame; } private ChannelFuture wrap(ChannelHandlerContext context, Channel channel) throws SSLException { ChannelFuture future = null; ChannelBuffer msg; ByteBuffer outNetBuf = bufferPool.acquire(); boolean success = true; boolean offered = false; boolean needsUnwrap = false; try { loop: for (;;) { // Acquire a lock to make sure unencrypted data is polled // in order and their encrypted counterpart is offered in // order. synchronized (pendingUnencryptedWrites) { PendingWrite pendingWrite = pendingUnencryptedWrites.peek(); if (pendingWrite == null) { break; } ByteBuffer outAppBuf = pendingWrite.outAppBuf; SSLEngineResult result; try { synchronized (handshakeLock) { result = engine.wrap(outAppBuf, outNetBuf); } } finally { if (!outAppBuf.hasRemaining()) { pendingUnencryptedWrites.remove(); } } if (result.bytesProduced() > 0) { outNetBuf.flip(); msg = ChannelBuffers.buffer(outNetBuf.remaining()); msg.writeBytes(outNetBuf.array(), 0, msg.capacity()); outNetBuf.clear(); if (pendingWrite.outAppBuf.hasRemaining()) { // pendingWrite's future shouldn't be notified if // only partial data is written. future = succeededFuture(channel); } else { future = pendingWrite.future; } MessageEvent encryptedWrite = new DownstreamMessageEvent( channel, future, msg, channel.getRemoteAddress()); if (Thread.holdsLock(pendingEncryptedWrites)) { offered = pendingEncryptedWrites.offer(encryptedWrite); } else { synchronized (pendingEncryptedWrites) { offered = pendingEncryptedWrites.offer(encryptedWrite); } } assert offered; } else { HandshakeStatus handshakeStatus = result.getHandshakeStatus(); switch (handshakeStatus) { case NEED_WRAP: if (outAppBuf.hasRemaining()) { break; } else { break loop; } case NEED_UNWRAP: needsUnwrap = true; break loop; case NEED_TASK: runDelegatedTasks(); break; case FINISHED: case NOT_HANDSHAKING: if (handshakeStatus == HandshakeStatus.FINISHED) { setHandshakeSuccess(channel); } if (result.getStatus() == Status.CLOSED) { success = false; } break loop; default: throw new IllegalStateException( "Unknown handshake status: " + result.getHandshakeStatus()); } } } } } catch (SSLException e) { success = false; setHandshakeFailure(channel, e); throw e; } finally { bufferPool.release(outNetBuf); if (offered) { flushPendingEncryptedWrites(context); } if (!success) { // Mark all remaining pending writes as failure if anything // wrong happened before the write requests are wrapped. // Please note that we do not call setFailure while a lock is // acquired, to avoid a potential dead lock. for (;;) { PendingWrite pendingWrite; synchronized (pendingUnencryptedWrites) { pendingWrite = pendingUnencryptedWrites.poll(); if (pendingWrite == null) { break; } } pendingWrite.future.setFailure( new IllegalStateException("SSLEngine already closed")); } } } if (needsUnwrap) { unwrap(context, channel, ChannelBuffers.EMPTY_BUFFER, 0, 0); } if (future == null) { future = succeededFuture(channel); } return future; } private void flushPendingEncryptedWrites(ChannelHandlerContext ctx) { // Avoid possible dead lock and data integrity issue // which is caused by cross communication between more than one channel // in the same VM. if (Thread.holdsLock(pendingEncryptedWrites)) { return; } synchronized (pendingEncryptedWrites) { if (pendingEncryptedWrites.isEmpty()) { return; } } synchronized (pendingEncryptedWrites) { MessageEvent e; while ((e = pendingEncryptedWrites.poll()) != null) { ctx.sendDownstream(e); } } } private ChannelFuture wrapNonAppData(ChannelHandlerContext ctx, Channel channel) throws SSLException { ChannelFuture future = null; ByteBuffer outNetBuf = bufferPool.acquire(); SSLEngineResult result; try { for (;;) { synchronized (handshakeLock) { result = engine.wrap(EMPTY_BUFFER, outNetBuf); } if (result.bytesProduced() > 0) { outNetBuf.flip(); ChannelBuffer msg = ChannelBuffers.buffer(outNetBuf.remaining()); msg.writeBytes(outNetBuf.array(), 0, msg.capacity()); outNetBuf.clear(); if (channel.isConnected()) { future = future(channel); write(ctx, future, msg); } } switch (result.getHandshakeStatus()) { case FINISHED: setHandshakeSuccess(channel); runDelegatedTasks(); break; case NEED_TASK: runDelegatedTasks(); break; case NEED_UNWRAP: if (!Thread.holdsLock(handshakeLock)) { // unwrap shouldn't be called when this method was // called by unwrap - unwrap will keep running after // this method returns. unwrap(ctx, channel, ChannelBuffers.EMPTY_BUFFER, 0, 0); } break; case NOT_HANDSHAKING: case NEED_WRAP: break; default: throw new IllegalStateException( "Unexpected handshake status: " + result.getHandshakeStatus()); } if (result.bytesProduced() == 0) { break; } } } catch (SSLException e) { setHandshakeFailure(channel, e); throw e; } finally { bufferPool.release(outNetBuf); } if (future == null) { future = succeededFuture(channel); } return future; } private ChannelBuffer unwrap( ChannelHandlerContext ctx, Channel channel, ChannelBuffer buffer, int offset, int length) throws SSLException { ByteBuffer inNetBuf = buffer.toByteBuffer(offset, length); ByteBuffer outAppBuf = bufferPool.acquire(); try { boolean needsWrap = false; loop: for (;;) { SSLEngineResult result; synchronized (handshakeLock) { if (initialHandshake && !engine.getUseClientMode() && !engine.isInboundDone() && !engine.isOutboundDone()) { handshake(channel); initialHandshake = false; } try { result = engine.unwrap(inNetBuf, outAppBuf); } catch (SSLException e) { throw e; } switch (result.getHandshakeStatus()) { case NEED_UNWRAP: if (inNetBuf.hasRemaining()) { break; } else { break loop; } case NEED_WRAP: wrapNonAppData(ctx, channel); break; case NEED_TASK: runDelegatedTasks(); break; case FINISHED: setHandshakeSuccess(channel); needsWrap = true; break loop; case NOT_HANDSHAKING: needsWrap = true; break loop; default: throw new IllegalStateException( "Unknown handshake status: " + result.getHandshakeStatus()); } } } if (needsWrap) { wrap(ctx, channel); } outAppBuf.flip(); if (outAppBuf.hasRemaining()) { ChannelBuffer frame = ChannelBuffers.buffer(outAppBuf.remaining()); frame.writeBytes(outAppBuf.array(), 0, frame.capacity()); return frame; } else { return null; } } catch (SSLException e) { setHandshakeFailure(channel, e); throw e; } finally { bufferPool.release(outAppBuf); } } private void runDelegatedTasks() { for (;;) { final Runnable task; synchronized (handshakeLock) { task = engine.getDelegatedTask(); } if (task == null) { break; } delegatedTaskExecutor.execute(new Runnable() { public void run() { synchronized (handshakeLock) { task.run(); } } }); } } private void setHandshakeSuccess(Channel channel) { synchronized (handshakeLock) { handshaking = false; handshaken = true; if (handshakeFuture == null) { handshakeFuture = newHandshakeFuture(channel); } } handshakeFuture.setSuccess(); } private void setHandshakeFailure(Channel channel, SSLException cause) { synchronized (handshakeLock) { if (!handshaking) { return; } handshaking = false; handshaken = false; if (handshakeFuture == null) { handshakeFuture = newHandshakeFuture(channel); } } handshakeFuture.setFailure(cause); } private void closeOutboundAndChannel( final ChannelHandlerContext context, final ChannelStateEvent e) throws SSLException { unwrap(context, e.getChannel(), ChannelBuffers.EMPTY_BUFFER, 0, 0); if (!engine.isInboundDone()) { if (sentCloseNotify.compareAndSet(false, true)) { engine.closeOutbound(); synchronized (closeFutures) { ChannelFuture closeNotifyFuture = wrapNonAppData(context, e.getChannel()); closeNotifyFuture.addListener(new ChannelFutureListener() { public void operationComplete(ChannelFuture closeNotifyFuture) throws Exception { boolean offered = closeFutures.offer(e.getFuture()); assert offered; } }); } return; } } context.sendDownstream(e); } private static ChannelFuture newHandshakeFuture(Channel channel) { ChannelFuture future = future(channel); future.addListener(new ChannelFutureListener() { public void operationComplete(ChannelFuture future) throws Exception { if (!future.isSuccess()) { fireExceptionCaught(future.getChannel(), future.getCause()); } } }); return future; } private static final class PendingWrite { final ChannelFuture future; final ByteBuffer outAppBuf; PendingWrite(ChannelFuture future, ByteBuffer outAppBuf) { this.future = future; this.outAppBuf = outAppBuf; } } }
package com.intellij.psi; import com.intellij.lang.*; import com.intellij.openapi.application.ex.ApplicationManagerEx; import com.intellij.openapi.diagnostic.Logger; import com.intellij.openapi.util.Comparing; import com.intellij.openapi.util.Key; import com.intellij.openapi.util.Pair; import com.intellij.openapi.util.TextRange; import com.intellij.openapi.vfs.VirtualFile; import com.intellij.psi.impl.DebugUtil; import com.intellij.psi.impl.SharedPsiElementImplUtil; import com.intellij.psi.impl.source.LightPsiFileImpl; import com.intellij.psi.impl.source.PsiFileImpl; import com.intellij.psi.impl.source.jsp.CompositeLanguageParsingUtil; import com.intellij.psi.impl.source.jsp.JspImplUtil; import com.intellij.psi.impl.source.jsp.jspJava.JspWhileStatement; import com.intellij.psi.impl.source.jsp.jspJava.OuterLanguageElement; import com.intellij.psi.impl.source.parsing.ChameleonTransforming; import com.intellij.psi.impl.source.parsing.ParseUtil; import com.intellij.psi.impl.source.tree.*; import com.intellij.psi.jsp.JspElementType; import com.intellij.psi.util.PsiTreeUtil; import com.intellij.psi.xml.XmlFile; import com.intellij.psi.xml.XmlText; import com.intellij.testFramework.LightVirtualFile; import com.intellij.util.IncorrectOperationException; import com.intellij.util.ReflectionCache; import com.intellij.xml.util.XmlUtil; import org.jetbrains.annotations.Nullable; import java.util.*; public class CompositeLanguageFileViewProvider extends SingleRootFileViewProvider { private static final Logger LOG = Logger.getInstance("#com.intellij.psi.CompositeLanguageFileViewProvider"); public static final Key<Object> UPDATE_IN_PROGRESS = new Key<Object>("UPDATE_IN_PROGRESS"); public static final Key<Object> DO_NOT_UPDATE_AUX_TREES = new Key<Object>("DO_NOT_UPDATE_AUX_TREES"); public static final Key<Integer> OUTER_LANGUAGE_MERGE_POINT = new Key<Integer>("OUTER_LANGUAGE_MERGE_POINT"); private final Map<Language, PsiFile> myRoots = new HashMap<Language, PsiFile>(); private Set<Language> myRelevantLanguages; public Set<Language> getRelevantLanguages() { if (myRelevantLanguages != null) return myRelevantLanguages; Set<Language> relevantLanguages = new HashSet<Language>(); final Language baseLanguage = getBaseLanguage(); relevantLanguages.add(baseLanguage); relevantLanguages.addAll(myRoots.keySet()); return myRelevantLanguages = new LinkedHashSet<Language>(relevantLanguages); } public void contentsSynchronized() { super.contentsSynchronized(); myRelevantLanguages = null; } private final Map<PsiFile, Set<OuterLanguageElement>> myOuterLanguageElements = new HashMap<PsiFile, Set<OuterLanguageElement>>(); private Set<PsiFile> myRootsInUpdate = new HashSet<PsiFile>(4); public CompositeLanguageFileViewProvider(final PsiManager manager, final VirtualFile file) { super(manager, file); } public CompositeLanguageFileViewProvider(final PsiManager manager, final VirtualFile virtualFile, final boolean physical) { super(manager, virtualFile, physical); } public CompositeLanguageFileViewProvider clone() { final CompositeLanguageFileViewProvider viewProvider = cloneInner(); final PsiFileImpl psiFile = (PsiFileImpl)viewProvider.getPsi(getBaseLanguage()); // copying main tree final FileElement treeClone = (FileElement)psiFile.calcTreeElement().clone(); // base language tree clone psiFile.setTreeElementPointer(treeClone); // should not use setTreeElement here because cloned file still have VirtualFile (SCR17963) treeClone.setPsiElement(psiFile); final XmlText[] xmlTexts = JspImplUtil.gatherTexts((XmlFile)psiFile); for (Map.Entry<Language, PsiFile> entry : myRoots.entrySet()) { final PsiFile root = entry.getValue(); if (root != psiFile) { if (root instanceof PsiFileImpl) { final PsiFileImpl copy = (PsiFileImpl)viewProvider.getPsi(entry.getKey()); if (copy == null) continue; // Unreleivant language due to partial parsing. JspImplUtil.copyRoot((PsiFileImpl)root, xmlTexts, copy); } else { if (root instanceof LightPsiFileImpl) { final LightPsiFileImpl lightFile = (LightPsiFileImpl)root; final LightPsiFileImpl clone = lightFile.copyLight(viewProvider); clone.setOriginalFile(root); viewProvider.myRoots.put(entry.getKey(), clone); } } } } return viewProvider; } protected CompositeLanguageFileViewProvider cloneInner() { return new CompositeLanguageFileViewProvider(getManager(), new LightVirtualFile(getVirtualFile().getName(), getVirtualFile().getFileType(), getContents(), getModificationStamp()), false); } @Nullable protected PsiFile getPsiInner(Language target) { PsiFile file = super.getPsiInner(target); if (file != null) return file; file = myRoots.get(target); if (file == null) { synchronized (PsiLock.LOCK) { file = createFile(target); myRoots.put(target, file); } } return file; } public synchronized PsiFile getCachedPsi(Language target) { if (target == getBaseLanguage()) return super.getCachedPsi(target); return myRoots.get(target); } public void checkAllTreesEqual() { final String psiText = getPsi(getBaseLanguage()).getText(); for (Map.Entry<Language, PsiFile> entry : myRoots.entrySet()) { final PsiFile psiFile = entry.getValue(); LOG.assertTrue(psiFile.getTextLength() == psiText.length(), entry.getKey().getID() + " tree text differs from base!"); LOG.assertTrue(psiFile.getText().equals(psiText), entry.getKey().getID() + " tree text differs from base!"); } } public void registerOuterLanguageElement(OuterLanguageElement element, PsiFile root) { if (myRoots.get(root.getLanguage()) != root) { return; // Not mine. Probably comes from air elements parsing. } Set<OuterLanguageElement> outerLanguageElements = myOuterLanguageElements.get(root); if (outerLanguageElements == null) { outerLanguageElements = new TreeSet<OuterLanguageElement>(new Comparator<OuterLanguageElement>() { public int compare(final OuterLanguageElement languageElement, final OuterLanguageElement languageElement2) { if (languageElement.equals(languageElement2)) return 0; final int result = languageElement.getTextRange().getStartOffset() - languageElement2.getTextRange().getStartOffset(); if (result != 0) return result; return languageElement.getTextRange().getEndOffset() - languageElement2.getTextRange().getEndOffset(); } }); myOuterLanguageElements.put(root, outerLanguageElements); } outerLanguageElements.add(element); } public void reparseRoots(final Set<Language> rootsToReparse) { for (final Language lang : rootsToReparse) { final PsiFile cachedRoot = myRoots.get(lang); if (cachedRoot != null) { if (myRootsInUpdate.contains(cachedRoot)) continue; try { myRootsInUpdate.add(cachedRoot); reparseRoot(lang, cachedRoot); } finally { myRootsInUpdate.remove(cachedRoot); } } } } public FileElement[] getKnownTreeRoots() { final List<FileElement> knownRoots = new ArrayList<FileElement>(); knownRoots.addAll(Arrays.asList(super.getKnownTreeRoots())); for (PsiFile psiFile : myRoots.values()) { if (psiFile == null || !(psiFile instanceof PsiFileImpl)) continue; final FileElement fileElement = ((PsiFileImpl)psiFile).getTreeElement(); if (fileElement == null) continue; knownRoots.add(fileElement); } return knownRoots.toArray(new FileElement[knownRoots.size()]); } protected void reparseRoot(final Language lang, final PsiFile cachedRoot) { LOG.debug("JspxFile: reparseRoot " + getVirtualFile().getName()); final ASTNode oldFileTree = cachedRoot.getNode(); if (oldFileTree == null || oldFileTree.getFirstChildNode()instanceof ChameleonElement) { if (cachedRoot instanceof PsiFileImpl) ((PsiFileImpl)cachedRoot).setTreeElementPointer(null); cachedRoot.subtreeChanged(); return; } final PsiFile fileForNewText = createFile(lang); assert fileForNewText != null; final ASTNode newFileTree = fileForNewText.getNode(); if (LOG.isDebugEnabled()) { LOG.debug("Old Tree:\n" + DebugUtil.treeToString(oldFileTree, false, true)); LOG.debug("New Tree:\n" + DebugUtil.treeToString(newFileTree, false, true)); } ChameleonTransforming.transformChildren(newFileTree, true); ChameleonTransforming.transformChildren(oldFileTree, true); CompositeLanguageParsingUtil.mergeTreeElements((TreeElement)newFileTree.getFirstChildNode(), (TreeElement)oldFileTree.getFirstChildNode(), (CompositeElement)oldFileTree); checkConsistensy(cachedRoot); } public void updateOuterLanguageElements(final Set<Language> languagesToSkip) { for (Map.Entry<Language, PsiFile> entry : myRoots.entrySet()) { final PsiFile psiFile = entry.getValue(); final Language updatedLanguage = entry.getKey(); if (languagesToSkip.contains(updatedLanguage)) continue; Set<OuterLanguageElement> outerSet = myOuterLanguageElements.get(psiFile); if (outerSet == null) // not parsed yet { continue; } try { myRootsInUpdate.add(psiFile); Set<OuterLanguageElement> languageElements = outerSet; if (languageElements == null) { languageElements = recalcOuterElements(psiFile); } for (final OuterLanguageElement outerElement : languageElements) { final FileElement file = TreeUtil.getFileElement(outerElement); if (file == null) { languageElements.clear(); languageElements = recalcOuterElements(psiFile); break; } } Iterator<OuterLanguageElement> i = languageElements.iterator(); while (i.hasNext()) { final OuterLanguageElement outerElement = i.next(); final FileElement file = TreeUtil.getFileElement(outerElement); if (file == null || file.getPsi() != psiFile) { i.remove(); } } XmlText prevText = null; int outerCount = 0; i = languageElements.iterator(); while (i.hasNext()) { final OuterLanguageElement outerElement = i.next(); XmlText nextText = outerElement.getFollowingText(); final int start = prevText != null ? prevText.getTextRange().getEndOffset() : outerCount != 0 ? outerElement.getTextRange().getStartOffset() : 0; if (nextText != null && !nextText.isValid()) { final PsiElement nextSibiling = outerElement.getNextSibling(); assert nextSibiling == null || nextSibiling instanceof OuterLanguageElement; nextText = nextSibiling != null ? ((OuterLanguageElement)nextSibiling).getFollowingText() : null; final int end = nextText != null ? nextText.getTextRange().getStartOffset() : getContents().length(); assert start <= end; final TextRange textRange = new TextRange(start, end); outerElement.setRange(textRange); if (nextSibiling != null) { outerElement.putUserData(OUTER_LANGUAGE_MERGE_POINT, end - nextSibiling.getTextRange().getLength() - start); TreeUtil.remove(((OuterLanguageElement)nextSibiling)); final OuterLanguageElement next = i.next(); assert next == nextSibiling; i.remove(); } } else { int end; if (nextText != null) { end = nextText.getTextRange().getStartOffset(); end += nextText.displayToPhysical(0); } else { end = i.hasNext() ? outerElement.getTextRange().getEndOffset() : getContents().length(); } assert start <= end; final TextRange textRange = new TextRange(start, end); if (!textRange.equals(outerElement.getTextRange())) { outerElement.setRange(textRange); } } prevText = nextText; ++outerCount; } } finally { myRootsInUpdate.remove(psiFile); } checkConsistensy(psiFile); } } private Set<OuterLanguageElement> recalcOuterElements(final PsiFile psiFile) { psiFile.accept(new PsiElementVisitor() { public void visitReferenceExpression(PsiReferenceExpression expression) { } public void visitElement(PsiElement element) { if (element instanceof OuterLanguageElement) { final OuterLanguageElement outerLanguageElement = ((OuterLanguageElement)element); final FileElement file = TreeUtil.getFileElement(outerLanguageElement); if (file.getPsi() == psiFile) { registerOuterLanguageElement(outerLanguageElement, psiFile); } } else { element.acceptChildren(this); } } }); return myOuterLanguageElements.get(psiFile); } @Nullable public PsiElement findElementAt(int offset, Class<? extends Language> lang) { final PsiFile mainRoot = getPsi(getBaseLanguage()); PsiElement ret = null; for (final Language language : getRelevantLanguages()) { if (!ReflectionCache.isAssignable(lang, language.getClass())) continue; if (lang.equals(Language.class) && !getPrimaryLanguages().contains(language)) continue; final PsiFile psiRoot = getPsi(language); final PsiElement psiElement; psiElement = findElementAt(psiRoot, offset); if (psiElement == null || psiElement instanceof OuterLanguageElement) continue; if (ret == null || psiRoot != mainRoot) { ret = psiElement; } } return ret; } @Nullable public PsiElement findElementAt(int offset) { return findElementAt(offset, Language.class); } @Nullable public PsiReference findReferenceAt(int offset) { TextRange minRange = new TextRange(0, getContents().length()); PsiReference ret = null; for (final Language language : getPrimaryLanguages()) { final PsiElement psiRoot = getPsi(language); final PsiReference reference = SharedPsiElementImplUtil.findReferenceAt(psiRoot, offset); if (reference == null) continue; final TextRange textRange = reference.getRangeInElement().shiftRight(reference.getElement().getTextRange().getStartOffset()); if (minRange.contains(textRange)) { minRange = textRange; ret = reference; } } return ret; } protected void checkConsistensy(final PsiFile oldFile) { if (oldFile.getNode().getTextLength() != getContents().length() || !oldFile.getNode().getText().equals(getContents().toString())) { String message = "Check consistency failed for: " + oldFile; message += "\n oldFile.getNode().getTextLength() = " + oldFile.getNode().getTextLength(); message += "\n getContents().length() = " + getContents().length(); if (ApplicationManagerEx.getApplicationEx().isInternal()) { message += "\n oldFileText:\n" + oldFile.getNode().getText(); message += "\n contentsText:\n" + getContents().toString(); message += "\n jspText:\n" + getPsi(getBaseLanguage()).getNode().getText(); } LOG.assertTrue(false, message); } } public LanguageExtension[] getLanguageExtensions() { return new LanguageExtension[0]; } @Nullable protected PsiFile createFile(Language lang) { final PsiFile psiFile = super.createFile(lang); if (psiFile != null) return psiFile; if (getRelevantLanguages().contains(lang)) { final ParserDefinition parserDefinition = lang.getParserDefinition(); assert parserDefinition != null; return parserDefinition.createFile(this); } return null; } public void rootChanged(PsiFile psiFile) { if (myRootsInUpdate.contains(psiFile)) return; if (psiFile.getLanguage() == getBaseLanguage()) { super.rootChanged(psiFile); // rest of sync mechanism is now handled by JspxAspect } else if (!myRootsInUpdate.contains(getPsi(getBaseLanguage()))) doHolderToXmlChanges(psiFile); } private void doHolderToXmlChanges(final PsiFile psiFile) { putUserData(UPDATE_IN_PROGRESS, Boolean.TRUE); boolean buffersDiffer = false; final Language language = getBaseLanguage(); final List<Pair<OuterLanguageElement, Pair<StringBuffer, StringBuffer>>> javaFragments = new ArrayList<Pair<OuterLanguageElement, Pair<StringBuffer, StringBuffer>>>(); try { StringBuffer currentBuffer = null; StringBuffer currentDecodedBuffer = null; LeafElement element = TreeUtil.findFirstLeaf(psiFile.getNode()); if (element == null) return; do { if (element instanceof OuterLanguageElement) { currentDecodedBuffer = new StringBuffer(); currentBuffer = new StringBuffer(); javaFragments.add(Pair.create((OuterLanguageElement)element, Pair.create(currentBuffer, currentDecodedBuffer))); } else { String text = element.getText(); if (element instanceof PsiWhiteSpace && text.endsWith("]]>")) { text = text.substring(0, text.length() - "]]>".length()); } final String decoded = language != StdLanguages.JSP ? XmlUtil.decode(text) : text; assert currentDecodedBuffer != null; currentDecodedBuffer.append(decoded); currentBuffer.append(text); } if (!buffersDiffer && !Comparing.equal(currentBuffer, currentDecodedBuffer)) { buffersDiffer = true; } } while ((element = ParseUtil.nextLeaf(element, null)) != null); if (!buffersDiffer) { myRootsInUpdate.add(psiFile); } for (final Pair<OuterLanguageElement, Pair<StringBuffer, StringBuffer>> pair : javaFragments) { final XmlText followingText = pair.getFirst().getFollowingText(); final String newText = pair.getSecond().getSecond().toString(); if (followingText != null && followingText.isValid() && !followingText.getValue().equals(newText)) { followingText.setValue(newText); } } } catch (IncorrectOperationException e) { LOG.error(e); } finally { updateOuterLanguageElementsIn(psiFile); if (!buffersDiffer) { myRootsInUpdate.remove(psiFile); } putUserData(UPDATE_IN_PROGRESS, null); } } private void updateOuterLanguageElementsIn(final PsiFile psiFile) { final HashSet<Language> set = new HashSet<Language>(getRelevantLanguages()); set.remove(psiFile.getLanguage()); updateOuterLanguageElements(set); } public void normalizeOuterLanguageElements(PsiFile root) { if (!myRootsInUpdate.contains(root)) { try { myRootsInUpdate.add(root); normalizeOuterLanguageElementsInner(root); } finally { myRootsInUpdate.remove(root); } } else { normalizeOuterLanguageElementsInner(root); } } private void normalizeOuterLanguageElementsInner(final PsiFile lang) { final Set<OuterLanguageElement> outerElements = myOuterLanguageElements.get(lang); if (outerElements == null) return; final Iterator<OuterLanguageElement> iterator = outerElements.iterator(); final List<OuterLanguageElement> toRemove = new ArrayList<OuterLanguageElement>(); OuterLanguageElement prev = null; while (iterator.hasNext()) { final OuterLanguageElement outer = iterator.next(); if (outer == null) { iterator.remove(); continue; } if (prev != null && prev.getFollowingText() == null && outer.getTextRange().getStartOffset() == prev.getTextRange().getEndOffset()) { final CompositeElement prevParent = prev.getTreeParent(); final JspWhileStatement outerWhile = PsiTreeUtil.getParentOfType(outer, JspWhileStatement.class); if (prevParent != null && prevParent.getElementType() == JspElementType.JSP_TEMPLATE_EXPRESSION || outerWhile != null) { final JspWhileStatement prevWhile = PsiTreeUtil.getParentOfType(prev, JspWhileStatement.class); if (prevWhile == null || prevWhile == outerWhile || prevWhile.getStartOffset() != prev.getStartOffset()) { toRemove.add(prev); prev = mergeOuterLanguageElements(outer, prev); } else { prev = outer; } } else { toRemove.add(outer); prev = mergeOuterLanguageElements(prev, outer); } } else { prev = outer; } } outerElements.removeAll(toRemove); } private static OuterLanguageElement mergeOuterLanguageElements(final OuterLanguageElement prev, final OuterLanguageElement outer) { final TextRange textRange = new TextRange(Math.min(prev.getTextRange().getStartOffset(), outer.getTextRange().getStartOffset()), Math.max(prev.getTextRange().getEndOffset(), outer.getTextRange().getEndOffset())); prev.setRange(textRange); if (prev.getFollowingText() == null) prev.setFollowingText(outer.getFollowingText()); final CompositeElement parent = prev.getTreeParent(); if (parent != null) parent.subtreeChanged(); final CompositeElement removedParent = outer.getTreeParent(); TreeUtil.remove(outer); if (removedParent != null) removedParent.subtreeChanged(); return prev; } public Set<PsiFile> getRootsInUpdate() { return myRootsInUpdate; } }
package org.jtrfp.trcl; import java.util.Comparator; import java.util.List; import java.util.TreeSet; import org.jtrfp.trcl.math.Vect3D; import org.jtrfp.trcl.obj.PositionedRenderable; import org.jtrfp.trcl.obj.VisibleEverywhere; public class GridCubeProximitySorter extends AbstractSubmitter<List<PositionedRenderable>> { private double [] center = new double[]{0,0,0}; public GridCubeProximitySorter setCenter(double [] center){ this.center=center; return this; } private final TreeSet<List<PositionedRenderable>> sortedSet = new TreeSet<List<PositionedRenderable>>(new Comparator<List<PositionedRenderable>>(){ @Override public int compare(List<PositionedRenderable> _left, List<PositionedRenderable> _right) { synchronized(_left){ synchronized(_right){ if(_left.isEmpty()&&_right.isEmpty()) return 0; if(_left.isEmpty()) return -1; if(_right.isEmpty()) return 1; double [] left=_left.get(0).getPosition(); double [] right=_right.get(0).getPosition(); if((left==right)&&left==null)return Integer.MAX_VALUE; if(left==null)return Integer.MIN_VALUE; if(right==null)return Integer.MAX_VALUE; if(_left.get(0) instanceof VisibleEverywhere) left=new double[]{center[0],center[1],center[2]+left[2]*1114112}; if(_right.get(0) instanceof VisibleEverywhere) right=new double[]{center[0],center[1],center[2]+right[2]*1114112}; final int diff = (int)(Vect3D.taxicabDistance(center,left)-Vect3D.taxicabDistance(center,right)); return diff!=0?diff:_left.hashCode()-_right.hashCode(); }}//end sync() }//end compare() @Override public boolean equals(Object o){ return o.getClass()==this.getClass(); } }); @Override public void submit(List<PositionedRenderable> item) { if(item==null)return; if(item.isEmpty())return; synchronized(sortedSet){sortedSet.add(item);} } public GridCubeProximitySorter reset(){ synchronized(sortedSet){sortedSet.clear();} return this; } public GridCubeProximitySorter dumpPositionedRenderables(Submitter<PositionedRenderable> sub){ synchronized(sortedSet){ for(List<PositionedRenderable> gc:sortedSet){ sub.submit(gc); }//end for(...) }//end sync(sortedSet) return this; }//end dumpPositionedRenderables(...) }//end GridCubeProximitySorter
package org.jtrfp.trcl.gui; import java.awt.BorderLayout; import java.awt.FlowLayout; import java.awt.Font; import java.awt.GridBagConstraints; import java.awt.GridBagLayout; import java.awt.Insets; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.io.File; import java.io.FileInputStream; import java.util.ArrayList; import java.util.Collection; import java.util.HashSet; import java.util.Iterator; import java.util.List; import java.util.ListIterator; import javax.swing.DefaultListModel; import javax.swing.ImageIcon; import javax.swing.JButton; import javax.swing.JComponent; import javax.swing.JFileChooser; import javax.swing.JFrame; import javax.swing.JLabel; import javax.swing.JList; import javax.swing.JOptionPane; import javax.swing.JPanel; import javax.swing.JScrollPane; import javax.swing.JTabbedPane; import javax.swing.ListSelectionModel; import javax.swing.SwingConstants; import javax.swing.SwingUtilities; import javax.swing.border.EtchedBorder; import javax.swing.border.TitledBorder; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import javax.swing.filechooser.FileFilter; import org.jtrfp.jfdt.Parser; import org.jtrfp.jtrfp.FileLoadException; import org.jtrfp.jtrfp.pod.PodFile; import org.jtrfp.trcl.coll.CollectionActionDispatcher; import org.jtrfp.trcl.conf.TRConfigurationFactory.TRConfiguration; import org.jtrfp.trcl.core.Feature; import org.jtrfp.trcl.core.FeatureFactory; import org.jtrfp.trcl.core.Features; import org.jtrfp.trcl.core.GraphStabilizationListener; import org.jtrfp.trcl.core.PODRegistry; import org.jtrfp.trcl.core.TRConfigRootFactory.TRConfigRoot; import org.jtrfp.trcl.core.TRFactory.TR; import org.jtrfp.trcl.file.VOXFile; import org.jtrfp.trcl.snd.SoundSystem; import org.springframework.stereotype.Component; @Component public class ConfigWindowFactory implements FeatureFactory<TR>{ /* public static void main(String [] args){ new ConfigWindow().setVisible(true); }//end main() */ public class ConfigWindow extends JFrame implements GraphStabilizationListener, Feature<TR>{ //private TRConfiguration config; //private JComboBox audioBufferSizeCB; //private JSlider modStereoWidthSlider; private JList podList,missionList; private DefaultListModel podLM=new DefaultListModel(), missionLM=new DefaultListModel(); private boolean needRestart=false; private final JFileChooser fileChooser = new JFileChooser(); private final Collection<ConfigurationTab> tabs; //private final TRConfigRoot cMgr; private final JTabbedPane tabbedPane; private PODRegistry podRegistry; private PodCollectionListener podCollectionListener = new PodCollectionListener(); private TR tr; private TRConfigRoot trConfigRoot; private TRConfiguration trConfiguration; private JLabel lblConfigpath = new JLabel("[config path not set]"); public ConfigWindow(){ this(new ArrayList<ConfigurationTab>()); } public ConfigWindow(Collection<ConfigurationTab> tabs){ setTitle("Settings"); setSize(340,540); final TR tr = getTr(); //this.cMgr = Features.get(tr, TRConfigRoot.class); this.tabs = tabs; //config = Features.get(tr, TRConfiguration.class); tabbedPane = new JTabbedPane(JTabbedPane.TOP); getContentPane().add(tabbedPane, BorderLayout.CENTER); JPanel generalTab = new JPanel(); tabbedPane.addTab("General", new ImageIcon(ConfigWindow.class.getResource("/org/freedesktop/tango/22x22/mimetypes/application-x-executable.png")), generalTab, null); GridBagLayout gbl_generalTab = new GridBagLayout(); gbl_generalTab.columnWidths = new int[]{0, 0}; gbl_generalTab.rowHeights = new int[]{0, 188, 222, 0}; gbl_generalTab.columnWeights = new double[]{1.0, Double.MIN_VALUE}; gbl_generalTab.rowWeights = new double[]{0.0, 1.0, 0.0, Double.MIN_VALUE}; generalTab.setLayout(gbl_generalTab); JPanel settingsLoadSavePanel = new JPanel(); GridBagConstraints gbc_settingsLoadSavePanel = new GridBagConstraints(); gbc_settingsLoadSavePanel.insets = new Insets(0, 0, 5, 0); gbc_settingsLoadSavePanel.anchor = GridBagConstraints.WEST; gbc_settingsLoadSavePanel.gridx = 0; gbc_settingsLoadSavePanel.gridy = 0; generalTab.add(settingsLoadSavePanel, gbc_settingsLoadSavePanel); settingsLoadSavePanel.setBorder(new TitledBorder(new EtchedBorder(EtchedBorder.LOWERED, null, null), "Overall Settings", TitledBorder.LEADING, TitledBorder.TOP, null, null)); FlowLayout flowLayout_1 = (FlowLayout) settingsLoadSavePanel.getLayout(); flowLayout_1.setAlignment(FlowLayout.LEFT); JButton btnSave = new JButton("Export..."); btnSave.setToolTipText("Export these settings to an external file"); settingsLoadSavePanel.add(btnSave); btnSave.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { exportSettings(); }}); JButton btnLoad = new JButton("Import..."); btnLoad.setToolTipText("Import an external settings file"); settingsLoadSavePanel.add(btnLoad); btnLoad.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { importSettings(); }}); JButton btnConfigReset = new JButton("Reset"); btnConfigReset.setToolTipText("Reset all settings to defaults"); settingsLoadSavePanel.add(btnConfigReset); btnConfigReset.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { defaultSettings(); }}); JPanel registeredPODsPanel = new JPanel(); registeredPODsPanel.setBorder(new TitledBorder(new EtchedBorder(EtchedBorder.LOWERED, null, null), "Registered PODs", TitledBorder.LEFT, TitledBorder.TOP, null, null)); GridBagConstraints gbc_registeredPODsPanel = new GridBagConstraints(); gbc_registeredPODsPanel.insets = new Insets(0, 0, 5, 0); gbc_registeredPODsPanel.fill = GridBagConstraints.BOTH; gbc_registeredPODsPanel.gridx = 0; gbc_registeredPODsPanel.gridy = 1; generalTab.add(registeredPODsPanel, gbc_registeredPODsPanel); GridBagLayout gbl_registeredPODsPanel = new GridBagLayout(); gbl_registeredPODsPanel.columnWidths = new int[]{272, 0}; gbl_registeredPODsPanel.rowHeights = new int[]{76, 0, 0}; gbl_registeredPODsPanel.columnWeights = new double[]{1.0, Double.MIN_VALUE}; gbl_registeredPODsPanel.rowWeights = new double[]{1.0, 1.0, Double.MIN_VALUE}; registeredPODsPanel.setLayout(gbl_registeredPODsPanel); JPanel podListPanel = new JPanel(); GridBagConstraints gbc_podListPanel = new GridBagConstraints(); gbc_podListPanel.insets = new Insets(0, 0, 5, 0); gbc_podListPanel.fill = GridBagConstraints.BOTH; gbc_podListPanel.gridx = 0; gbc_podListPanel.gridy = 0; registeredPODsPanel.add(podListPanel, gbc_podListPanel); podListPanel.setLayout(new BorderLayout(0, 0)); JScrollPane podListScrollPane = new JScrollPane(); podListPanel.add(podListScrollPane, BorderLayout.CENTER); podList = new JList(podLM); podList.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); podListScrollPane.setViewportView(podList); JPanel podListOpButtonPanel = new JPanel(); podListOpButtonPanel.setBorder(null); GridBagConstraints gbc_podListOpButtonPanel = new GridBagConstraints(); gbc_podListOpButtonPanel.anchor = GridBagConstraints.NORTH; gbc_podListOpButtonPanel.gridx = 0; gbc_podListOpButtonPanel.gridy = 1; registeredPODsPanel.add(podListOpButtonPanel, gbc_podListOpButtonPanel); FlowLayout flowLayout = (FlowLayout) podListOpButtonPanel.getLayout(); flowLayout.setAlignment(FlowLayout.LEFT); JButton addPodButton = new JButton("Add..."); addPodButton.setIcon(new ImageIcon(ConfigWindow.class.getResource("/org/freedesktop/tango/16x16/actions/list-add.png"))); addPodButton.setToolTipText("Add a POD to the registry to be considered when running a game."); podListOpButtonPanel.add(addPodButton); addPodButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { notifyNeedRestart(); addPOD(); }}); JButton removePodButton = new JButton("Remove"); removePodButton.setIcon(new ImageIcon(ConfigWindow.class.getResource("/org/freedesktop/tango/16x16/actions/list-remove.png"))); removePodButton.setToolTipText("Remove a POD file from being considered when playing a game"); podListOpButtonPanel.add(removePodButton); removePodButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { //podLM.removeElement(podList.getSelectedValue()); notifyNeedRestart(); getPodRegistry().getPodCollection().remove(podList.getSelectedValue()); }}); JButton podEditButton = new JButton("Edit..."); podEditButton.setIcon(null); podEditButton.setToolTipText("Edit the selected POD path"); podListOpButtonPanel.add(podEditButton); podEditButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { notifyNeedRestart(); editPODPath(); }}); JPanel missionPanel = new JPanel(); GridBagConstraints gbc_missionPanel = new GridBagConstraints(); gbc_missionPanel.fill = GridBagConstraints.BOTH; gbc_missionPanel.gridx = 0; gbc_missionPanel.gridy = 2; generalTab.add(missionPanel, gbc_missionPanel); missionPanel.setBorder(new TitledBorder(new EtchedBorder(EtchedBorder.LOWERED, null, null), "Missions", TitledBorder.LEADING, TitledBorder.TOP, null, null)); GridBagLayout gbl_missionPanel = new GridBagLayout(); gbl_missionPanel.columnWidths = new int[]{0, 0}; gbl_missionPanel.rowHeights = new int[]{0, 0, 0}; gbl_missionPanel.columnWeights = new double[]{1.0, Double.MIN_VALUE}; gbl_missionPanel.rowWeights = new double[]{1.0, 0.0, Double.MIN_VALUE}; missionPanel.setLayout(gbl_missionPanel); JScrollPane scrollPane = new JScrollPane(); GridBagConstraints gbc_scrollPane = new GridBagConstraints(); gbc_scrollPane.insets = new Insets(0, 0, 5, 0); gbc_scrollPane.fill = GridBagConstraints.BOTH; gbc_scrollPane.gridx = 0; gbc_scrollPane.gridy = 0; missionPanel.add(scrollPane, gbc_scrollPane); missionList = new JList(missionLM); missionList.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); scrollPane.setViewportView(missionList); JPanel missionListOpButtonPanel = new JPanel(); GridBagConstraints gbc_missionListOpButtonPanel = new GridBagConstraints(); gbc_missionListOpButtonPanel.anchor = GridBagConstraints.NORTH; gbc_missionListOpButtonPanel.gridx = 0; gbc_missionListOpButtonPanel.gridy = 1; missionPanel.add(missionListOpButtonPanel, gbc_missionListOpButtonPanel); JButton addVOXButton = new JButton("Add..."); addVOXButton.setIcon(new ImageIcon(ConfigWindow.class.getResource("/org/freedesktop/tango/16x16/actions/list-add.png"))); addVOXButton.setToolTipText("Add an external VOX file as a mission"); missionListOpButtonPanel.add(addVOXButton); addVOXButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { addVOX(); }}); final JButton removeVOXButton = new JButton("Remove"); removeVOXButton.setIcon(new ImageIcon(ConfigWindow.class.getResource("/org/freedesktop/tango/16x16/actions/list-remove.png"))); removeVOXButton.setToolTipText("Remove the selected mission"); missionListOpButtonPanel.add(removeVOXButton); removeVOXButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { //TODO: missionLM.remove(missionList.getSelectedIndex()); }}); final JButton editVOXButton = new JButton("Edit..."); editVOXButton.setToolTipText("Edit the selected Mission's VOX path"); missionListOpButtonPanel.add(editVOXButton); editVOXButton.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { editVOXPath(); }}); missionList.addListSelectionListener(new ListSelectionListener(){ @Override public void valueChanged(ListSelectionEvent evt) { final String val = (String)missionList.getSelectedValue(); if(val == null) missionList.setSelectedIndex(0); else if(isBuiltinVOX(val)){ removeVOXButton.setEnabled(false); editVOXButton.setEnabled(false); }else{ removeVOXButton.setEnabled(true); editVOXButton.setEnabled(true); } }}); JPanel okCancelPanel = new JPanel(); getContentPane().add(okCancelPanel, BorderLayout.SOUTH); okCancelPanel.setLayout(new BorderLayout(0, 0)); JButton btnOk = new JButton("OK"); btnOk.setToolTipText("Apply these settings and close the window"); okCancelPanel.add(btnOk, BorderLayout.WEST); btnOk.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { //Keep settings, save to disk try {getTrConfigRoot().saveConfigurations();} catch(Exception e){e.printStackTrace();} applySettingsEDT(); ConfigWindow.this.setVisible(false); } }); JButton btnCancel = new JButton("Cancel"); btnCancel.setToolTipText("Close the window without applying settings"); okCancelPanel.add(btnCancel, BorderLayout.EAST); //final TRConfigRoot cfgRoot = getTrConfigRoot(); //final String cFilePath = cfgRoot.getConfigSaveURI(); //JLabel lblConfigpath = new JLabel(cFilePath); lblConfigpath.setIcon(null); lblConfigpath.setToolTipText("Default config file path"); lblConfigpath.setHorizontalAlignment(SwingConstants.CENTER); lblConfigpath.setFont(new Font("Dialog", Font.BOLD, 6)); okCancelPanel.add(lblConfigpath, BorderLayout.CENTER); btnCancel.addActionListener(new ActionListener(){ @Override public void actionPerformed(ActionEvent arg0) { //dispatchComponentConfigs(); //Revert to original getTrConfigRoot().loadConfigurations(); ConfigWindow.this.setVisible(false); }}); }//end constructor @Override public void setVisible(boolean isVisible){ if(isVisible) try {getTrConfigRoot().saveConfigurations();} catch(Exception e){e.printStackTrace();} super.setVisible(isVisible); }//end setVisible(...) private void applySettingsEDT(){ final TRConfigRoot configRoot = getTrConfigRoot(); final TRConfiguration config = getTrConfiguration(); config.setVoxFile((String)missionList.getSelectedValue()); //config.setModStereoWidth((double)modStereoWidthSlider.getValue()/100.); //config.setAudioLinearFiltering(chckbxLinearInterpolation.isSelected()); //config.setAudioBufferLag(chckbxBufferLag.isSelected()); {HashSet<String>pList=new HashSet<String>(); //for(int i=0; i<podLM.getSize();i++) // pList.add((String)podLM.getElementAt(i)); //podLM.clear();//Clear so we don't get a double-copy when the dispatcher populates it. //final Collection<String> podCollection = getPodRegistry().getPodCollection(); //podCollection.clear(); //for(String pod:pList) //podCollection.add(pod); HashSet<String>vxList=new HashSet<String>(); for(int i=0; i<missionLM.getSize();i++) vxList.add((String)missionLM.getElementAt(i)); config.setMissionList(vxList);} //soundOutputSelectorGUI.applySettings(config); try{configRoot.saveConfigurations();} catch(Exception e){e.printStackTrace();} //writeSettingsTo(cMgr.getConfigFilePath()); if(needRestart) notifyOfRestart(); //final AudioBufferSize abs = (AudioBufferSize)audioBufferSizeCB.getSelectedItem(); //config.setAudioBufferSize(abs.getSizeInFrames()); //Apply the component configs //gatherComponentConfigs(); }//end applySettings() /* private void gatherComponentConfigs(){ Map<String,Object> configs = config.getComponentConfigs(); for(ConfigurationTab tab:tabs){ System.out.println("Putting tab "+tab.getTabName()+" With entries:"); System.out.print("\t"); ControllerConfigTabConf conf = (ControllerConfigTabConf)tab.getConfigBean(); for(Entry ent: conf.getControllerConfigurations().entrySet()){ System.out.print(" "+ent.getKey()); } System.out.println(); configs.put(tab.getConfigBeanClass().getName(), tab.getConfigBean());} }//end gatherComponentConfigs() */ /* private void dispatchComponentConfigs(){ Map<String,Object> configs = config.getComponentConfigs(); for(ConfigurationTab tab:tabs) tab.setConfigBean(configs.get(tab.getConfigBeanClass().getName())); }//end dispatchComponentConfigs() */ private void readSettingsToPanel(){ final TRConfiguration config = getTrConfiguration(); //Initial settings - These do not listen to the config states! final SoundSystem soundSystem = Features.get(getTr(), SoundSystem.class); //modStereoWidthSlider.setValue((int)(config.getModStereoWidth()*100.)); //chckbxLinearInterpolation.setSelected(soundSystem.isLinearFiltering()); //chckbxBufferLag.setSelected(soundSystem.isBufferLag()); /*final int bSize = config.getAudioBufferSize(); for(AudioBufferSize abs:AudioBufferSize.values()) if(abs.getSizeInFrames()==bSize) audioBufferSizeCB.setSelectedItem(abs); */ missionLM.removeAllElements(); for(String vox:config.getMissionList()){ if(isBuiltinVOX(vox)) missionLM.addElement(vox); else if(checkVOX(new File(vox))) missionLM.addElement(vox); }//end for(vox) String missionSelection = config.getVoxFile(); for(int i=0; i<missionLM.getSize(); i++){ if(((String)missionLM.get(i)).contentEquals(missionSelection))missionList.setSelectedIndex(i);} /* podLM.removeAllElements(); final Collection<String> podRegistryCollection = getPodRegistry().getPodCollection(); //final DefaultListModel podList = config.getPodList(); for(String path : podRegistryCollection){ if(path!=null) if(checkPOD(new File(path))) podLM.addElement(path);} */ //soundOutputSelectorGUI.readToPanel(config); //Undo any flags set by the listeners. needRestart=false; }//end readSettings() private boolean isBuiltinVOX(String vox){ return vox.contentEquals(TRConfiguration.AUTO_DETECT) || vox.contentEquals("Fury3") || vox.contentEquals("TV") || vox.contentEquals("FurySE"); }//end isBuiltinVOX private void notifyOfRestart(){ JOptionPane.showMessageDialog(this, "Some changes won't take effect until the program is restarted."); needRestart=false; } private void addPOD(){ fileChooser.setFileFilter(new FileFilter(){ @Override public boolean accept(File file) { return file.getName().toUpperCase().endsWith(".POD")||file.isDirectory(); } @Override public String getDescription() { return "Terminal Reality .POD files"; }}); if(fileChooser.showOpenDialog(this)!=JFileChooser.APPROVE_OPTION) return; final File file = fileChooser.getSelectedFile(); if(!checkPOD(file)) return; //podLM.addElement(file.getAbsolutePath()); getPodRegistry().getPodCollection().add(file.getAbsolutePath()); }//end addPOD() private void addVOX() { fileChooser.setFileFilter(new FileFilter() { @Override public boolean accept(File file) { return file.getName().toUpperCase().endsWith(".VOX")||file.isDirectory(); } @Override public String getDescription() { return "Terminal Reality .VOX files"; } }); if (fileChooser.showOpenDialog(this) != JFileChooser.APPROVE_OPTION) return; final File file = fileChooser.getSelectedFile(); if(file!=null) missionLM.addElement(file.getAbsolutePath()); }//end addVOX() private boolean writeSettingsToNormalConf(){ try{ //cMgr.saveConfigurations(f); final TRConfigRoot configRoot = getTrConfigRoot(); //configRoot.setConfigSaveURI(f.getPath()); configRoot.saveConfigurations(); return true; }catch(Exception e){JOptionPane.showMessageDialog( this, "Failed to write the config file.\n" + e.getLocalizedMessage()+"\n"+e.getClass().getName(), "File write failure", JOptionPane.ERROR_MESSAGE); return false;} }//end writeSettings() private boolean writeSettingsTo(File f){ try{/* //cMgr.saveConfigurations(f); final TRConfigRoot configRoot = getTrConfigRoot(); configRoot.setConfigSaveURI(f.getPath()); configRoot.saveConfigurations(); */ getTrConfigRoot().saveConfigurations(f); return true; }catch(Exception e){JOptionPane.showMessageDialog( this, "Failed to write the config file.\n" + e.getLocalizedMessage()+"\n"+e.getClass().getName(), "File write failure", JOptionPane.ERROR_MESSAGE); return false;} }//end writeSettingsTo(...) private void exportSettings(){ fileChooser.setFileFilter(new FileFilter(){ @Override public boolean accept(File file) { return file.getName().toLowerCase().endsWith(".config.trcl.xml")||file.isDirectory(); } @Override public String getDescription() { return "Terminal Recall Config Files"; }}); fileChooser.showSaveDialog(this); File f = fileChooser.getSelectedFile(); if(f==null)return; writeSettingsTo(f); }//end exportSettings() private void editVOXPath(){ JOptionPane.showMessageDialog(this, "Not yet implemented."); //TODO /* final String result = JOptionPane.showInputDialog(this, "Edit VOX Path", missionLM.get(missionList.getSelectedIndex())); if(result==null)// Clicked Cancel return;// Do nothing if(checkVOX(new File(result))) missionLM.set(missionList.getSelectedIndex(), result); */ }//end editVOXPath() private void editPODPath(){ JOptionPane.showMessageDialog(this, "Not yet implemented."); //TODO /* final String result = JOptionPane.showInputDialog(this, "Edit POD Path", podLM.get(missionList.getSelectedIndex())); if(result==null)// Clicked Cancel return;// Do nothing if(checkPOD(new File(result))) podLM.set(podList.getSelectedIndex(), result); */ }//end editPODPath() private boolean readSettingsFromFile(File f){ try{/* FileInputStream is = new FileInputStream(f); XMLDecoder xmlDec = new XMLDecoder(is); xmlDec.setExceptionListener(new ExceptionListener(){ @Override public void exceptionThrown(Exception e) { e.printStackTrace(); }}); TRConfiguration src =(TRConfiguration)xmlDec.readObject(); xmlDec.close(); TRConfiguration config = getTrConfiguration(); */ this.getTrConfigRoot().loadConfigurations(f); /*if(config!=null) BeanUtils.copyProperties(config, src); else setTrConfiguration(config = src);*/ }catch(Exception e){JOptionPane.showMessageDialog( this, "Failed to read the specified file:\n" + e.getLocalizedMessage(), "File read failure", JOptionPane.ERROR_MESSAGE);return false;} return true; }//end readSettingsFromFile(...) private void importSettings(){ fileChooser.setFileFilter(new FileFilter(){ @Override public boolean accept(File file) { return file.getName().toLowerCase().endsWith(".config.trcl.xml")||file.isDirectory(); } @Override public String getDescription() { return "Terminal Recall Config Files"; }}); fileChooser.showOpenDialog(this); File f = fileChooser.getSelectedFile(); if(f==null)return; readSettingsFromFile(f); readSettingsToPanel(); }//end exportSettings() private void defaultSettings(){ JOptionPane.showMessageDialog(this, "Not yet implemented."); //TODO /* try{BeanUtils.copyProperties(config, new TRConfiguration());} catch(Exception e){e.printStackTrace();} readSettingsToPanel(); */ } private boolean checkFile(File f){ if(f.exists()) return true; JOptionPane.showMessageDialog(this, "The specified path could not be opened from disk:\n"+f.getAbsolutePath(), "File Not Found", JOptionPane.ERROR_MESSAGE); return false; }//end checkFile private boolean checkPOD(File file){ if(!checkFile(file)) return false; try{new PodFile(file).getData();} catch(FileLoadException e){ JOptionPane.showMessageDialog(this, "Failed to parse the specified POD: \n"+e.getLocalizedMessage(), "POD failed format check.", JOptionPane.ERROR_MESSAGE); e.printStackTrace(); return false;} return true; }//end checkPOD(...) private boolean checkVOX(File file){ if (!checkFile(file)) return false; try { FileInputStream fis = new FileInputStream(file); new Parser().readToNewBean(fis, VOXFile.class); fis.close(); } catch (Exception e) { JOptionPane.showMessageDialog( this, "Failed to parse the specified VOX: \n" + e.getLocalizedMessage(), "VOX failed format check", JOptionPane.ERROR_MESSAGE); e.printStackTrace(); return false; } return true; }//end checkVOX(...) @Override public void apply(TR target) { setPodRegistry(Features.get(target, PODRegistry.class)); final TR tr; setTr (tr = Features.get(Features.getSingleton(), TR.class)); setTrConfigRoot (Features.get(Features.getSingleton(), TRConfigRoot.class )); setTrConfiguration(Features.get(tr, TRConfiguration.class)); final CollectionActionDispatcher<String> podRegistryCollection = getPodRegistry().getPodCollection(); podRegistryCollection.addTarget(podCollectionListener, true); } @Override public void destruct(TR target) { // TODO Auto-generated method stub } public void registerConfigTab(final ConfigurationTab configTab) { final String name = configTab.getTabName(); final ImageIcon icon = configTab.getTabIcon(); final JComponent content = configTab.getContent(); try{ SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { tabbedPane.addTab(name,icon,content); }}); }catch(Exception e){e.printStackTrace();} //dispatchComponentConfigs(); }//end registerConfigTab(...) public PODRegistry getPodRegistry() { return podRegistry; } public void setPodRegistry(PODRegistry podRegistry) { this.podRegistry = podRegistry; } private class PodCollectionListener implements List<String> { @Override public boolean add(final String element) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.addElement(element); }}); return true;//Meh. } @Override public void add(final int index, final String element) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.add(index, element); }}); } @Override public boolean addAll(final Collection<? extends String> arg0) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { for(String s : arg0 ) podLM.addElement(s); }}); return true;//Meh. } @Override public boolean addAll(int arg0, Collection<? extends String> arg1) { throw new UnsupportedOperationException(); } @Override public void clear() { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.clear(); }}); } @Override public boolean contains(Object arg0) { throw new UnsupportedOperationException(); } @Override public boolean containsAll(Collection<?> arg0) { throw new UnsupportedOperationException(); } @Override public String get(int arg0) { throw new UnsupportedOperationException(); } @Override public int indexOf(Object arg0) { throw new UnsupportedOperationException(); } @Override public boolean isEmpty() { throw new UnsupportedOperationException(); } @Override public Iterator<String> iterator() { throw new UnsupportedOperationException(); } @Override public int lastIndexOf(Object arg0) { throw new UnsupportedOperationException(); } @Override public ListIterator<String> listIterator() { throw new UnsupportedOperationException(); } @Override public ListIterator<String> listIterator(int arg0) { throw new UnsupportedOperationException(); } @Override public boolean remove(final Object elementToRemove) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.removeElement(elementToRemove); }}); return true; //Meh. } @Override public String remove(final int indexOfElementToRemove) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.remove(indexOfElementToRemove); }}); return null;//Meh. } @Override public boolean removeAll(final Collection<?> elementsToRemove) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { boolean result = false; for(Object o : elementsToRemove) result |= podLM.removeElement(o); }}); return true;//Meh. } @Override public boolean retainAll(Collection<?> arg0) { throw new UnsupportedOperationException(); } @Override public String set(final int index, final String element) { SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { podLM.set(index, element); }}); return null;//Meh. } @Override public int size() { return podLM.size(); } @Override public List<String> subList(int arg0, int arg1) { throw new UnsupportedOperationException(); } @Override public Object[] toArray() { throw new UnsupportedOperationException(); } @Override public <T> T[] toArray(T[] arg0) { throw new UnsupportedOperationException(); } }//end PodCollectionListener public TR getTr() { return tr; } public void setTr(TR tr) { this.tr = tr; } public TRConfigRoot getTrConfigRoot() { return trConfigRoot; } public void setTrConfigRoot(TRConfigRoot trConfigRoot) { this.trConfigRoot = trConfigRoot; final String cFilePath = trConfigRoot.getConfigSaveURI(); SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { lblConfigpath.setText(cFilePath); }}); }//end setTrConfigRoot(...) public TRConfiguration getTrConfiguration() { return trConfiguration; } public void setTrConfiguration(TRConfiguration trConfiguration) { this.trConfiguration = trConfiguration; } public void notifyNeedRestart(){ needRestart = true; } @Override public void graphStabilized(Object target) { if(getTrConfiguration() != null) readSettingsToPanel(); } }//end ConfigWindow @Override public Feature<TR> newInstance(TR target) { final ConfigWindow result = new ConfigWindow(); return result; } @Override public Class<TR> getTargetClass() { return TR.class; } @Override public Class<? extends Feature> getFeatureClass() { return ConfigWindow.class; } }//end ConfigWindowFactory
package org.encuestame.core.persistence.pojo; import java.io.Serializable; import java.util.Date; import java.util.HashSet; import java.util.Set; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.FetchType; import javax.persistence.GeneratedValue; import static javax.persistence.GenerationType.IDENTITY; import javax.persistence.Id; import javax.persistence.OneToMany; import javax.persistence.Table; import javax.persistence.Temporal; import javax.persistence.TemporalType; import javax.persistence.UniqueConstraint; /** * SecUsers. * * @author Picado, Juan juan@encuestame.org * @since October 17, 2009 */ @Entity @Table(name = "sec_users", uniqueConstraints = @UniqueConstraint(columnNames = "email")) public class SecUsers implements Serializable { private Integer uid; private String name; private String email; private String username; private String password; private Boolean status; private String inviteCode; private Date dateNew; private String publisher; private String owner; private String twitter; private Set<SecGroupUser> secGroupUsers = new HashSet<SecGroupUser>(0); private Set<SecUserPermission> secUserPermissions = new HashSet<SecUserPermission>( 0); private Set<CatLocationUser> catLocationUsers = new HashSet<CatLocationUser>( 0); private Set<SurveyResultMod> surveyResultMods = new HashSet<SurveyResultMod>( 0); private Set<ProjectUser> projectUsers = new HashSet<ProjectUser>(0); private Set<QuestionColettion> questionColettions = new HashSet<QuestionColettion>( 0); private Set<Surveys> surveyses = new HashSet<Surveys>(0); public SecUsers() { } public SecUsers(String name, String email, String password, boolean status, Date dateNew, String publisher) { this.name = name; this.email = email; this.password = password; this.status = status; this.dateNew = dateNew; this.publisher = publisher; } public SecUsers(String name, String email, String username, String password, Boolean status, String inviteCode, Date dateNew, String publisher, String owner, String twitter, Set<SecGroupUser> secGroupUsers, Set<SecUserPermission> secUserPermissions, Set catLocationUsers, Set surveyResultMods, Set<ProjectUser> projectUsers, Set<QuestionColettion> questionColettions, Set<Surveys> surveyses) { this.name = name; this.email = email; this.username = username; this.password = password; this.status = status; this.inviteCode = inviteCode; this.dateNew = dateNew; this.publisher = publisher; this.owner = owner; this.twitter = twitter; this.secGroupUsers = secGroupUsers; this.secUserPermissions = secUserPermissions; this.catLocationUsers = catLocationUsers; this.surveyResultMods = surveyResultMods; this.projectUsers = projectUsers; this.questionColettions = questionColettions; this.surveyses = surveyses; } @Id @GeneratedValue(strategy = IDENTITY) @Column(name = "uid", unique = true, nullable = false) public Integer getUid() { return this.uid; } public void setUid(Integer uid) { this.uid = uid; } @Column(name = "name", nullable = false, length = 50) public String getName() { return this.name; } public void setName(String name) { this.name = name; } @Column(name = "email", unique = true, nullable = false, length = 100) public String getEmail() { return this.email; } public void setEmail(String email) { this.email = email; } @Column(name = "username") public String getUsername() { return this.username; } public void setUsername(String username) { this.username = username; } @Column(name = "password", nullable = false) public String getPassword() { return this.password; } public void setPassword(String password) { this.password = password; } @Column(name = "status", nullable = false) public Boolean isStatus() { return this.status; } public void setStatus(boolean status) { this.status = status; } @Column(name = "invite_code") public String getInviteCode() { return this.inviteCode; } public void setInviteCode(String inviteCode) { this.inviteCode = inviteCode; } @Temporal(TemporalType.TIMESTAMP) @Column(name = "date_new", nullable = false, length = 0) public Date getDateNew() { return this.dateNew; } public void setDateNew(Date dateNew) { this.dateNew = dateNew; } @Column(name = "publisher", nullable = true, length = 2) public String getPublisher() { return this.publisher; } public void setPublisher(String publisher) { this.publisher = publisher; } @Column(name = "owner", length = 2) public String getOwner() { return this.owner; } public void setOwner(String owner) { this.owner = owner; } @Column(name = "twitter", length = 2) public String getTwitter() { return this.twitter; } public void setTwitter(String twitter) { this.twitter = twitter; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<SecGroupUser> getSecGroupUsers() { return this.secGroupUsers; } public void setSecGroupUsers(Set<SecGroupUser> secGroupUsers) { this.secGroupUsers = secGroupUsers; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<SecUserPermission> getSecUserPermissions() { return this.secUserPermissions; } public void setSecUserPermissions(Set<SecUserPermission> secUserPermissions) { this.secUserPermissions = secUserPermissions; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<CatLocationUser> getCatLocationUsers() { return this.catLocationUsers; } public void setCatLocationUsers(Set<CatLocationUser> catLocationUsers) { this.catLocationUsers = catLocationUsers; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<SurveyResultMod> getSurveyResultMods() { return this.surveyResultMods; } public void setSurveyResultMods(Set<SurveyResultMod> surveyResultMods) { this.surveyResultMods = surveyResultMods; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<ProjectUser> getProjectUsers() { return this.projectUsers; } public void setProjectUsers(Set<ProjectUser> projectUsers) { this.projectUsers = projectUsers; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<QuestionColettion> getQuestionColettions() { return this.questionColettions; } public void setQuestionColettions(Set<QuestionColettion> questionColettions) { this.questionColettions = questionColettions; } @OneToMany(fetch = FetchType.LAZY, mappedBy = "secUsers") public Set<Surveys> getSurveyses() { return this.surveyses; } public void setSurveyses(Set<Surveys> surveyses) { this.surveyses = surveyses; } }
package org.lightmare.deploy; import java.util.concurrent.Callable; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.Future; import java.util.concurrent.ThreadFactory; import org.lightmare.cache.MetaContainer; import org.lightmare.libraries.LibraryLoader; import org.lightmare.utils.ObjectUtils; /** * Manager class for application deployment * * @author levan * */ public class LoaderPoolManager { // Amount of deployment thread pool private static final int LOADER_POOL_SIZE = 5; // Name prefix of deployment threads private static final String LOADER_THREAD_NAME = "Ejb-Loader-Thread-%s"; /** * Gets class loader for existing {@link org.lightmare.deploy.MetaCreator} * instance * * @return {@link ClassLoader} */ protected static ClassLoader getCurrent() { ClassLoader current; MetaCreator creator = MetaContainer.getCreator(); ClassLoader creatorLoader; if (ObjectUtils.notNull(creator)) { // Gets class loader for this deployment creatorLoader = creator.getCurrent(); if (ObjectUtils.notNull(creatorLoader)) { current = creatorLoader; } else { // Gets default, context class loader for current thread current = LibraryLoader.getContextClassLoader(); } } else { current = LibraryLoader.getContextClassLoader(); } return current; } /** * Implementation of {@link ThreadFactory} interface for application loading * * @author levan * */ private static final class LoaderThreadFactory implements ThreadFactory { /** * Constructs and sets thread name * * @param thread */ private void nameThread(Thread thread) { String name = String.format(LOADER_THREAD_NAME, thread.getId()); thread.setName(name); } /** * Sets priority of {@link Thread} instance * * @param thread */ private void setPriority(Thread thread) { thread.setPriority(Thread.MAX_PRIORITY); } /** * Sets {@link ClassLoader} to passed {@link Thread} instance * * @param thread */ private void setContextClassLoader(Thread thread) { ClassLoader parent = getCurrent(); thread.setContextClassLoader(parent); } /** * Configures (sets name, priority and {@link ClassLoader}) passed * {@link Thread} instance * * @param thread */ private void configureThread(Thread thread) { nameThread(thread); setPriority(thread); setContextClassLoader(thread); } @Override public Thread newThread(Runnable runnable) { Thread thread = new Thread(runnable); configureThread(thread); return thread; } } // Thread pool for deploying and removal of beans and temporal resources private static ExecutorService LOADER_POOL = Executors.newFixedThreadPool( LOADER_POOL_SIZE, new LoaderThreadFactory()); private static boolean invalid() { return LOADER_POOL == null || LOADER_POOL.isShutdown() || LOADER_POOL.isTerminated(); } /** * Checks and if not valid reopens deploy {@link ExecutorService} instance * * @return {@link ExecutorService} */ protected static ExecutorService getLoaderPool() { if (invalid()) { synchronized (LoaderPoolManager.class) { if (invalid()) { LOADER_POOL = Executors.newFixedThreadPool( LOADER_POOL_SIZE, new LoaderThreadFactory()); } } } return LOADER_POOL; } public static void submit(Runnable runnable) { getLoaderPool().submit(runnable); } public static <T> Future<T> submit(Callable<T> callable) { Future<T> future = getLoaderPool().submit(callable); return future; } /** * Clears existing {@link ExecutorService}s from loader threads */ public static void reload() { synchronized (LoaderPoolManager.class) { LOADER_POOL.shutdown(); LOADER_POOL = null; } getLoaderPool(); } }
package com.akjava.gwt.three.client.gwt.model; import com.akjava.gwt.lib.client.LogUtils; import com.akjava.gwt.three.client.js.core.Face3; import com.akjava.gwt.three.client.js.math.UV; import com.akjava.gwt.three.client.js.math.Vector2; import com.akjava.gwt.three.client.js.math.Vector4; import com.akjava.gwt.three.client.js.math.Vertex; import com.google.gwt.core.client.JavaScriptObject; import com.google.gwt.core.client.JsArray; import com.google.gwt.core.client.JsArrayNumber; import com.google.gwt.json.client.JSONObject; public class JSONModelFile extends JavaScriptObject{ protected JSONModelFile(){} public static JSONModelFile create(){ return create("GWT JSONModelFile r63"); } @SuppressWarnings("unchecked") public static JSONModelFile create(String generatedBy){ JSONModelFile f=(JSONModelFile) JSONModelFile.createObject(); MetaData mdata=(MetaData) MetaData.createObject(); mdata.setFormatVersion(3.1); f.setMetaData(mdata); f.setNormals((JsArrayNumber) JavaScriptObject.createArray()); f.setColors((JsArrayNumber) JavaScriptObject.createArray()); f.setVertices((JsArrayNumber) JavaScriptObject.createArray()); f.setFaces((JsArrayNumber) JavaScriptObject.createArray()); f.setUvs((JsArray<JsArrayNumber>) JsArray.createArray()); f.setMaterials((JsArray<ModelMaterials>) JsArray.createArray()); f.setSkinIndices((JsArrayNumber) JavaScriptObject.createArray()); f.setSkinWeights((JsArrayNumber) JavaScriptObject.createArray()); f.getMaterials().push(ModelMaterials.createDefault()); return f; } public final String getJsonText(){ return new JSONObject(this).toString(); } public native final void setVertices (JsArrayNumber vertices)/*-{ this["vertices"]=vertices; }-*/; public native final double getScale()/*-{ return this["scale"]; }-*/; public native final void setScale(double scale)/*-{ this["scale"]=scale; }-*/; public native final JsArrayNumber getVertices ()/*-{ return this["vertices"]; }-*/; public native final void setFaces (JsArrayNumber faces)/*-{ this["faces"]=faces; }-*/; public native final JsArrayNumber getFaces ()/*-{ return this["faces"]; }-*/; public native final void setNormals (JsArrayNumber normals)/*-{ this["normals"]=normals; }-*/; public native final JsArrayNumber getNormals ()/*-{ return this["normals"]; }-*/; public native final void setColors (JsArrayNumber colors)/*-{ this["colors"]=colors; }-*/; public native final JsArrayNumber getColors ()/*-{ return this["colors"]; }-*/; public native final JsArrayNumber getSkinWeights ()/*-{ return this["skinWeights"]; }-*/; public native final void setSkinWeights(JsArrayNumber skinWeights)/*-{ this["skinWeights"]=skinWeights; }-*/; public native final void setSkinIndices (JsArrayNumber skinIndices)/*-{ this["skinIndices"]=skinIndices; }-*/; public native final JsArrayNumber getSkinIndices ()/*-{ return this["skinIndices"]; }-*/; public native final void setUvs (JsArray<JsArrayNumber> uvs)/*-{ this["uvs"]=uvs; }-*/; public native final JsArray<JsArrayNumber> getUvs ()/*-{ return this["uvs"]; }-*/; public native final void setMaterials (JsArray<ModelMaterials> materials)/*-{ this["materials"]=materials; }-*/; public native final JsArray<ModelMaterials> getMaterials ()/*-{ return this["materials"]; }-*/; public native final JavaScriptObject getAnimation ()/*-{ return this["animation"]; }-*/; public native final void setAnimation (JavaScriptObject animation)/*-{ this["animation"]=animation; }-*/; public native final JsArray<JavaScriptObject> getBones ()/*-{ return this["bones"]; }-*/; public native final void setBones (JsArray<JavaScriptObject> bones)/*-{ this["bones"]=bones; }-*/; public native final JsArray<JavaScriptObject> getMorphTargets ()/*-{ return this["morphTargets"]; }-*/; public native final void setMorphTargets (JsArray<JavaScriptObject> morphTargets)/*-{ this["morphTargets"]=morphTargets; }-*/; public native final JsArray<JavaScriptObject> getMorphColors ()/*-{ return this["morphColors"]; }-*/; public native final void setMorphColors (JsArray<JavaScriptObject> morphColors)/*-{ this["morphColors"]=morphColors; }-*/; public final void setSkinIndicesAndWeights(JsArray<Vector4> indices,JsArray<Vector4> weights){ JsArrayNumber indicesArray=(JsArrayNumber) JsArrayNumber.createArray(); for(int i=0;i<indices.length();i++){ indicesArray.push(indices.get(i).getX()); indicesArray.push(indices.get(i).getY()); } JsArrayNumber weightsArray=(JsArrayNumber) JsArrayNumber.createArray(); for(int i=0;i<weights.length();i++){ weightsArray.push(weights.get(i).getX()); weightsArray.push(weights.get(i).getY()); } LogUtils.log("indicesArray.length"+indicesArray.length()); LogUtils.log("weightsArray.length"+weightsArray.length()); setSkinIndices(indicesArray); setSkinWeights(weightsArray); } public final void setVertices(JsArray<Vertex> vx){ JsArrayNumber nums=(JsArrayNumber) JsArrayNumber.createArray(); for(int i=0;i<vx.length();i++){ nums.push(vx.get(i).getPosition().getX()); nums.push(vx.get(i).getPosition().getY()); nums.push(vx.get(i).getPosition().getZ()); } setVertices(nums); } /* * single uv only */ public final void setGeometryUvs(JsArray<JsArray<Vector2>> uvs){ @SuppressWarnings("unchecked") JsArray<JsArrayNumber> uvArray=(JsArray<JsArrayNumber>) JsArray.createArray(); JsArrayNumber nums=(JsArrayNumber) JsArrayNumber.createArray(); uvArray.push(nums); //LogUtils.log("uvs:"+uvs.length()); for(int i=0;i<uvs.length();i++){ JsArray<Vector2> u=uvs.get(i); //LogUtils.log("uvs:-u"+u.length()); for(int j=0;j<u.length();j++){ Vector2 uv=u.get(j); nums.push(uv.getX()); nums.push(uv.getY()); } } setUvs(uvArray); } /** * call setUvs first * @param faces */ public final void setFaces(JsArray<Face3> faces){ boolean hasUv=getUvs().length()>0; JsArrayNumber nums=(JsArrayNumber) JsArrayNumber.createArray(); int faceIndex=0; for(int i=0;i<faces.length();i++){ Face3 face=faces.get(i); if(face.isFace4()){ int v=1;if(hasUv){v=8+1;}; nums.push(v); // quad nums.push(face.getA()); nums.push(face.getB()); nums.push(face.getC()); nums.push(face.getD()); if(hasUv){//uv is same as vx nums.push(faceIndex); nums.push(faceIndex+1); nums.push(faceIndex+2); nums.push(faceIndex+3); } faceIndex+=4; }else{ int v=0;if(hasUv){v=8+0;}; nums.push(v); // triangle nums.push(face.getA()); nums.push(face.getB()); nums.push(face.getC()); if(hasUv){//uv is same as vx nums.push(faceIndex); nums.push(faceIndex+1); nums.push(faceIndex+2); } faceIndex+=3; } } setFaces(nums); } public native final void setMetaData(MetaData meta)/*-{ this["metadata"]=meta; }-*/; public native final MetaData getMetaData()/*-{ return this["metadata"]; }-*/; public final JSONModelFile clone(){ JSONModelFile newFile=create(); //metadata newFile.setMetaData(this.getMetaData().clone()); newFile.setScale(this.getScale()); //TODO clone completly newFile.setMaterials(this.getMaterials());//warning shared if(this.getMorphTargets()!=null){ newFile.setMorphTargets(this.getMorphTargets()); } if(this.getMorphColors()!=null){ newFile.setMorphColors(this.getMorphColors()); } if(this.getBones()!=null){ newFile.setBones(this.getBones()); } if(this.getAnimation()!=null){ newFile.setAnimation(this.getAnimation()); } //clone uvs if(this.getUvs()!=null){ JsArray<JsArrayNumber> valuesUvs=this.getUvs(); for(int i=0;i<valuesUvs.length();i++){ JsArrayNumber uvs=valuesUvs.get(i); JsArrayNumber array=(JsArrayNumber) JavaScriptObject.createArray(); for(int j=0;j<uvs.length();j++){ array.push(uvs.get(j)); } newFile.getUvs().push(array); } } //clone faces,normals,colors,vertices,skinIndices,skinWeights if(this.getFaces()!=null){ JsArrayNumber values=this.getFaces(); for(int i=0;i<values.length();i++){ newFile.getFaces().push(values.get(i)); } } if(this.getNormals()!=null){ JsArrayNumber values=this.getNormals(); for(int i=0;i<values.length();i++){ newFile.getNormals().push(values.get(i)); } } if(this.getColors()!=null){ JsArrayNumber values=this.getColors(); for(int i=0;i<values.length();i++){ newFile.getColors().push(values.get(i)); } } if(this.getVertices()!=null){ JsArrayNumber values=this.getVertices(); for(int i=0;i<values.length();i++){ newFile.getVertices().push(values.get(i)); } } if(this.getSkinIndices()!=null){ JsArrayNumber values=this.getSkinIndices(); for(int i=0;i<values.length();i++){ newFile.getSkinIndices().push(values.get(i)); } } if(this.getSkinWeights()!=null){ JsArrayNumber values=this.getSkinWeights(); for(int i=0;i<values.length();i++){ newFile.getSkinWeights().push(values.get(i)); } } return newFile; } }
package org.lightmare.utils.fs.codecs; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import java.net.URL; import java.util.Enumeration; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import org.lightmare.utils.IOUtils; import org.lightmare.utils.ObjectUtils; import org.lightmare.utils.StringUtils; import org.lightmare.utils.fs.FileType; /** * Implementation of {@link DirUtils} for ear files * * @author Levan Tsinadze * @since 0.0.81-SNAPSHOT */ public class ExtUtils extends DirUtils { public static final FileType type = FileType.EAR; private File tmpFile; public ExtUtils(String path) { super(path); } public ExtUtils(File file) { super(file); } public ExtUtils(URL url) throws IOException { super(url); } @Override public FileType getType() { return type; } /** * Extracts ear file into the temporary file * * @throws IOException */ protected void exctractEar() throws IOException { tmpFile = File.createTempFile(realFile.getName(), StringUtils.EMPTY_STRING); tmpFile.delete(); tmpFile.mkdir(); addTmpFile(tmpFile); ZipFile zipFile = getEarFile(); Enumeration<? extends ZipEntry> zipFileEntries = zipFile.entries(); while (zipFileEntries.hasMoreElements()) { ZipEntry entry = zipFileEntries.nextElement(); exctractFile(entry); } } protected void exctractFile(ZipEntry entry) throws IOException { InputStream extStream = getEarFile().getInputStream(entry); File file = new File(tmpFile, entry.getName()); File parrent = file.getParentFile(); if (ObjectUtils.notTrue(parrent.exists())) { parrent.mkdirs(); addTmpFile(parrent); } // Caches temporal files addTmpFile(file); if (ObjectUtils.notTrue(entry.isDirectory())) { if (ObjectUtils.notTrue(file.exists())) { file.createNewFile(); } OutputStream out = new FileOutputStream(file); IOUtils.write(extStream, out); } else { file.mkdir(); } } @Override protected void scanArchive(Object... args) throws IOException { exctractEar(); super.realFile = tmpFile; super.path = tmpFile.getPath(); super.isDirectory = tmpFile.isDirectory(); super.scanArchive(args); } }
package org.apache.batik.apps.svgbrowser; import java.awt.BorderLayout; import java.awt.CardLayout; import java.awt.Component; import java.awt.Container; import java.awt.FlowLayout; import java.awt.Frame; import java.awt.Rectangle; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.awt.event.KeyEvent; import java.awt.event.KeyAdapter; import java.util.Map; import java.util.Hashtable; import java.util.Enumeration; import javax.swing.AbstractButton; import javax.swing.border.Border; import javax.swing.BorderFactory; import javax.swing.ButtonGroup; import javax.swing.Icon; import javax.swing.ImageIcon; import javax.swing.JButton; import javax.swing.JCheckBox; import javax.swing.JDialog; import javax.swing.JLabel; import javax.swing.JList; import javax.swing.JPanel; import javax.swing.JRadioButton; import javax.swing.JScrollPane; import javax.swing.JTabbedPane; import javax.swing.JTextField; import javax.swing.ListCellRenderer; import javax.swing.UIManager; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import org.apache.batik.ext.swing.JGridBagPanel; import org.apache.batik.ext.swing.GridBagConstants; import org.apache.batik.util.PreferenceManager; import org.apache.batik.util.gui.CSSMediaPanel; import org.apache.batik.util.gui.LanguageDialog; import org.apache.batik.util.gui.UserStyleDialog; /** * Dialog that displays user preferences. * * @author <a href="mailto:vhardy@apache.org">Vincent Hardy</a> * @version $Id$ */ public class PreferenceDialog extends JDialog implements GridBagConstants { /** * The return value if 'OK' is chosen. */ public final static int OK_OPTION = 0; /** * The return value if 'Cancel' is chosen. */ public final static int CANCEL_OPTION = 1; // GUI Resources Keys public static final String ICON_USER_LANGUAGE = "PreferenceDialog.icon.userLanguagePref"; public static final String ICON_USER_STYLESHEET = "PreferenceDialog.icon.userStylesheetPref"; public static final String ICON_BEHAVIOR = "PreferenceDialog.icon.behaviorsPref"; public static final String ICON_NETWORK = "PreferenceDialog.icon.networkPref"; public static final String LABEL_USER_OPTIONS = "PreferenceDialog.label.user.options"; public static final String LABEL_BEHAVIOR = "PreferenceDialog.label.behavior"; public static final String LABEL_NETWORK = "PreferenceDialog.label.network"; public static final String LABEL_USER_LANGUAGE = "PreferenceDialog.label.user.language"; public static final String LABEL_USER_STYLESHEET = "PreferenceDialog.label.user.stylesheet"; public static final String LABEL_USER_FONT = "PreferenceDialog.label.user.font"; public static final String LABEL_APPLICATIONS = "PreferenceDialog.label.applications"; public static final String LABEL_SHOW_RENDERING = "PreferenceDialog.label.show.rendering"; public static final String LABEL_AUTO_ADJUST_WINDOW = "PreferenceDialog.label.auto.adjust.window"; public static final String LABEL_ENABLE_DOUBLE_BUFFERING = "PreferenceDialog.label.enable.double.buffering"; public static final String LABEL_SHOW_DEBUG_TRACE = "PreferenceDialog.label.show.debug.trace"; public static final String LABEL_SELECTION_XOR_MODE = "PreferenceDialog.label.selection.xor.mode"; public static final String LABEL_IS_XML_PARSER_VALIDATING = "PreferenceDialog.label.is.xml.parser.validating"; public static final String LABEL_ENFORCE_SECURE_SCRIPTING = "PreferenceDialog.label.enforce.secure.scripting"; public static final String LABEL_SECURE_SCRIPTING_TOGGLE = "PreferenceDialog.label.secure.scripting.toggle"; public static final String LABEL_GRANT_SCRIPT_FILE_ACCESS = "PreferenceDialog.label.grant.script.file.access"; public static final String LABEL_GRANT_SCRIPT_NETWORK_ACCESS = "PreferenceDialog.label.grant.script.network.access"; public static final String LABEL_LOAD_JAVA = "PreferenceDialog.label.load.java"; public static final String LABEL_LOAD_ECMASCRIPT = "PreferenceDialog.label.load.ecmascript"; public static final String LABEL_HOST = "PreferenceDialog.label.host"; public static final String LABEL_PORT = "PreferenceDialog.label.port"; public static final String LABEL_OK = "PreferenceDialog.label.ok"; public static final String LABEL_LOAD_SCRIPTS = "PreferenceDialog.label.load.scripts"; public static final String LABEL_ORIGIN_ANY = "PreferenceDialog.label.origin.any"; public static final String LABEL_ORIGIN_DOCUMENT = "PreferenceDialog.label.origin.document"; public static final String LABEL_ORIGIN_EMBED = "PreferenceDialog.label.origin.embed"; public static final String LABEL_ORIGIN_NONE = "PreferenceDialog.label.origin.none"; public static final String LABEL_SCRIPT_ORIGIN = "PreferenceDialog.label.script.origin"; public static final String LABEL_RESOURCE_ORIGIN = "PreferenceDialog.label.resource.origin"; public static final String LABEL_CANCEL = "PreferenceDialog.label.cancel"; public static final String TITLE_BROWSER_OPTIONS = "PreferenceDialog.title.browser.options"; public static final String TITLE_BEHAVIOR = "PreferenceDialog.title.behavior"; public static final String TITLE_SECURITY = "PreferenceDialog.title.security"; public static final String TITLE_NETWORK = "PreferenceDialog.title.network"; public static final String TITLE_DIALOG = "PreferenceDialog.title.dialog"; public static final String CONFIG_HOST_TEXT_FIELD_LENGTH = "PreferenceDialog.config.host.text.field.length"; public static final String CONFIG_PORT_TEXT_FIELD_LENGTH = "PreferenceDialog.config.port.text.field.length"; public static final String CONFIG_OK_MNEMONIC = "PreferenceDialog.config.ok.mnemonic"; public static final String CONFIG_CANCEL_MNEMONIC = "PreferenceDialog.config.cancel.mnemonic"; // Following are the preference keys used in the // PreferenceManager model. public static final String PREFERENCE_KEY_LANGUAGES = "preference.key.languages"; public static final String PREFERENCE_KEY_IS_XML_PARSER_VALIDATING = "preference.key.is.xml.parser.validating"; public static final String PREFERENCE_KEY_USER_STYLESHEET = "preference.key.user.stylesheet"; public static final String PREFERENCE_KEY_SHOW_RENDERING = "preference.key.show.rendering"; public static final String PREFERENCE_KEY_AUTO_ADJUST_WINDOW = "preference.key.auto.adjust.window"; public static final String PREFERENCE_KEY_ENABLE_DOUBLE_BUFFERING = "preference.key.enable.double.buffering"; public static final String PREFERENCE_KEY_SHOW_DEBUG_TRACE = "preference.key.show.debug.trace"; public static final String PREFERENCE_KEY_SELECTION_XOR_MODE = "preference.key.selection.xor.mode"; public static final String PREFERENCE_KEY_PROXY_HOST = "preference.key.proxy.host"; public static final String PREFERENCE_KEY_CSS_MEDIA = "preference.key.cssmedia"; public static final String PREFERENCE_KEY_PROXY_PORT = "preference.key.proxy.port"; public static final String PREFERENCE_KEY_ENFORCE_SECURE_SCRIPTING = "preference.key.enforce.secure.scripting"; public static final String PREFERENCE_KEY_GRANT_SCRIPT_FILE_ACCESS = "preference.key.grant.script.file.access"; public static final String PREFERENCE_KEY_GRANT_SCRIPT_NETWORK_ACCESS = "preferenced.key.grant.script.network.access"; public static final String PREFERENCE_KEY_LOAD_ECMASCRIPT = "preference.key.load.ecmascript"; public static final String PREFERENCE_KEY_LOAD_JAVA = "preference.key.load.java.script"; public static final String PREFERENCE_KEY_ALLOWED_SCRIPT_ORIGIN = "preference.key.allowed.script.origin"; public static final String PREFERENCE_KEY_ALLOWED_EXTERNAL_RESOURCE_ORIGIN = "preference.key.allowed.external.resource.origin"; /** * <tt>PreferenceManager</tt> used to store and retrieve * preferences */ protected PreferenceManager model; /** * Allows selection of the desired configuration panel */ protected ConfigurationPanelSelector configPanelSelector; /** * Allows selection of the user languages */ protected LanguageDialog.Panel languagePanel; /** * Allows selection of a user stylesheet */ protected UserStyleDialog.Panel userStylesheetPanel; protected JCheckBox showRendering; protected JCheckBox autoAdjustWindow; protected JCheckBox showDebugTrace; protected JCheckBox enableDoubleBuffering; protected JCheckBox selectionXorMode; protected JCheckBox isXMLParserValidating; protected JCheckBox enforceSecureScripting; protected JCheckBox grantScriptFileAccess; protected JCheckBox grantScriptNetworkAccess; protected JCheckBox loadJava; protected JCheckBox loadEcmascript; protected ButtonGroup scriptOriginGroup; protected ButtonGroup resourceOriginGroup; protected JTextField host, port; protected CSSMediaPanel cssMediaPanel; /** * Code indicating whether the dialog was OKayed * or cancelled */ protected int returnCode; /** * Default constructor */ public PreferenceDialog(PreferenceManager model){ super((Frame)null, true); if(model == null){ throw new IllegalArgumentException(); } this.model = model; buildGUI(); initializeGUI(); pack(); } /** * Returns the preference manager used by this dialog. */ public PreferenceManager getPreferenceManager() { return model; } /** * Initializes the GUI components with the values * from the model. */ protected void initializeGUI(){ // Initialize language. The set of languages is // defined by a String. String languages = model.getString(PREFERENCE_KEY_LANGUAGES); languagePanel.setLanguages(languages); // Initializes the User Stylesheet String userStylesheetPath = model.getString(PREFERENCE_KEY_USER_STYLESHEET); userStylesheetPanel.setPath(userStylesheetPath); // Initializes the browser options showRendering.setSelected(model.getBoolean(PREFERENCE_KEY_SHOW_RENDERING)); autoAdjustWindow.setSelected(model.getBoolean(PREFERENCE_KEY_AUTO_ADJUST_WINDOW)); enableDoubleBuffering.setSelected(model.getBoolean(PREFERENCE_KEY_ENABLE_DOUBLE_BUFFERING)); showDebugTrace.setSelected(model.getBoolean(PREFERENCE_KEY_SHOW_DEBUG_TRACE)); selectionXorMode.setSelected(model.getBoolean(PREFERENCE_KEY_SELECTION_XOR_MODE)); isXMLParserValidating.setSelected(model.getBoolean(PREFERENCE_KEY_IS_XML_PARSER_VALIDATING)); enforceSecureScripting.setSelected(model.getBoolean(PREFERENCE_KEY_ENFORCE_SECURE_SCRIPTING)); grantScriptFileAccess.setSelected(model.getBoolean(PREFERENCE_KEY_GRANT_SCRIPT_FILE_ACCESS)); grantScriptNetworkAccess.setSelected(model.getBoolean(PREFERENCE_KEY_GRANT_SCRIPT_NETWORK_ACCESS)); loadJava.setSelected(model.getBoolean(PREFERENCE_KEY_LOAD_JAVA)); loadEcmascript.setSelected(model.getBoolean(PREFERENCE_KEY_LOAD_ECMASCRIPT)); String allowedScriptOrigin = "" + model.getInteger(PREFERENCE_KEY_ALLOWED_SCRIPT_ORIGIN); if (allowedScriptOrigin == null || "".equals(allowedScriptOrigin)) { allowedScriptOrigin = "" + ResourceOrigin.NONE; } Enumeration e = scriptOriginGroup.getElements(); while (e.hasMoreElements()) { AbstractButton ab = (AbstractButton)e.nextElement(); String ac = ab.getActionCommand(); if (allowedScriptOrigin.equals(ac)) { ab.setSelected(true); } } String allowedResourceOrigin = "" + model.getInteger(PREFERENCE_KEY_ALLOWED_EXTERNAL_RESOURCE_ORIGIN); if (allowedResourceOrigin == null || "".equals(allowedResourceOrigin)) { allowedResourceOrigin = "" + ResourceOrigin.NONE; } e = resourceOriginGroup.getElements(); while (e.hasMoreElements()) { AbstractButton ab = (AbstractButton)e.nextElement(); String ac = ab.getActionCommand(); if (allowedResourceOrigin.equals(ac)) { ab.setSelected(true); } } showRendering.setEnabled (!model.getBoolean(PREFERENCE_KEY_ENABLE_DOUBLE_BUFFERING)); grantScriptFileAccess.setEnabled (model.getBoolean(PREFERENCE_KEY_ENFORCE_SECURE_SCRIPTING)); grantScriptNetworkAccess.setEnabled (model.getBoolean(PREFERENCE_KEY_ENFORCE_SECURE_SCRIPTING)); // Initialize the proxy options host.setText(model.getString(PREFERENCE_KEY_PROXY_HOST)); port.setText(model.getString(PREFERENCE_KEY_PROXY_PORT)); // Initialize the CSS media cssMediaPanel.setMedia(model.getString(PREFERENCE_KEY_CSS_MEDIA)); // Sets the dialog's title setTitle(Resources.getString(TITLE_DIALOG)); } /** * Stores current setting in PreferenceManager model */ protected void savePreferences(){ model.setString(PREFERENCE_KEY_LANGUAGES, languagePanel.getLanguages()); model.setString(PREFERENCE_KEY_USER_STYLESHEET, userStylesheetPanel.getPath()); model.setBoolean(PREFERENCE_KEY_SHOW_RENDERING, showRendering.isSelected()); model.setBoolean(PREFERENCE_KEY_AUTO_ADJUST_WINDOW, autoAdjustWindow.isSelected()); model.setBoolean(PREFERENCE_KEY_ENABLE_DOUBLE_BUFFERING, enableDoubleBuffering.isSelected()); model.setBoolean(PREFERENCE_KEY_SHOW_DEBUG_TRACE, showDebugTrace.isSelected()); model.setBoolean(PREFERENCE_KEY_SELECTION_XOR_MODE, selectionXorMode.isSelected()); model.setBoolean(PREFERENCE_KEY_IS_XML_PARSER_VALIDATING, isXMLParserValidating.isSelected()); model.setBoolean(PREFERENCE_KEY_ENFORCE_SECURE_SCRIPTING, enforceSecureScripting.isSelected()); model.setBoolean(PREFERENCE_KEY_GRANT_SCRIPT_FILE_ACCESS, grantScriptFileAccess.isSelected()); model.setBoolean(PREFERENCE_KEY_GRANT_SCRIPT_NETWORK_ACCESS, grantScriptNetworkAccess.isSelected()); model.setBoolean(PREFERENCE_KEY_LOAD_JAVA, loadJava.isSelected()); model.setBoolean(PREFERENCE_KEY_LOAD_ECMASCRIPT, loadEcmascript.isSelected()); model.setInteger(PREFERENCE_KEY_ALLOWED_SCRIPT_ORIGIN, (new Integer(scriptOriginGroup.getSelection().getActionCommand())).intValue()); model.setInteger(PREFERENCE_KEY_ALLOWED_EXTERNAL_RESOURCE_ORIGIN, (new Integer(resourceOriginGroup.getSelection().getActionCommand())).intValue()); model.setString(PREFERENCE_KEY_PROXY_HOST, host.getText()); model.setString(PREFERENCE_KEY_PROXY_PORT, port.getText()); model.setString(PREFERENCE_KEY_CSS_MEDIA, cssMediaPanel.getMediaAsString()); } /** * Builds the UI for this dialog */ protected void buildGUI(){ JPanel panel = new JPanel(new BorderLayout()); Component config = buildConfigPanel(); Component list = buildConfigPanelList(); panel.add(list, BorderLayout.WEST); panel.add(config, BorderLayout.CENTER); panel.add(buildButtonsPanel(), BorderLayout.SOUTH); panel.setBorder(BorderFactory.createEmptyBorder(2, 2, 0, 0)); getContentPane().add(panel); } /** * Creates the OK/Cancel buttons panel */ protected JPanel buildButtonsPanel() { JPanel p = new JPanel(new FlowLayout(FlowLayout.RIGHT)); JButton okButton = new JButton(Resources.getString(LABEL_OK)); okButton.setMnemonic(Resources.getCharacter(CONFIG_OK_MNEMONIC)); JButton cancelButton = new JButton(Resources.getString(LABEL_CANCEL)); cancelButton.setMnemonic(Resources.getCharacter(CONFIG_CANCEL_MNEMONIC)); p.add(okButton); p.add(cancelButton); okButton.addActionListener(new ActionListener(){ public void actionPerformed(ActionEvent e){ setVisible(false); returnCode = OK_OPTION; savePreferences(); dispose(); } }); cancelButton.addActionListener(new ActionListener(){ public void actionPerformed(ActionEvent e){ setVisible(false); returnCode = CANCEL_OPTION; dispose(); } }); addKeyListener(new KeyAdapter(){ public void keyPressed(KeyEvent e){ if(e.getKeyCode() == KeyEvent.VK_ESCAPE){ setVisible(false); returnCode = CANCEL_OPTION; dispose(); } } }); return p; } protected Component buildConfigPanelList(){ String[] configList = { Resources.getString(LABEL_NETWORK), Resources.getString(LABEL_USER_LANGUAGE), Resources.getString(LABEL_BEHAVIOR), Resources.getString(LABEL_USER_STYLESHEET), }; final JList list = new JList(configList); list.addListSelectionListener(new ListSelectionListener(){ public void valueChanged(ListSelectionEvent evt){ if(!evt.getValueIsAdjusting()){ configPanelSelector.select(list.getSelectedValue().toString()); } } }); list.setVisibleRowCount(4); // Set Cell Renderer ClassLoader cl = this.getClass().getClassLoader(); Map map= new Hashtable(); map.put(Resources.getString(LABEL_USER_LANGUAGE), new ImageIcon(cl.getResource(Resources.getString(ICON_USER_LANGUAGE)))); map.put(Resources.getString(LABEL_USER_STYLESHEET), new ImageIcon(cl.getResource(Resources.getString(ICON_USER_STYLESHEET)))); map.put(Resources.getString(LABEL_BEHAVIOR), new ImageIcon(cl.getResource(Resources.getString(ICON_BEHAVIOR)))); map.put(Resources.getString(LABEL_NETWORK), new ImageIcon(cl.getResource(Resources.getString(ICON_NETWORK)))); list.setCellRenderer(new IconCellRenderer(map)); list.setSelectedIndex(0); return new JScrollPane(list); } protected Component buildConfigPanel(){ JPanel configPanel = new JPanel(); CardLayout cardLayout = new CardLayout(); configPanel.setLayout(cardLayout); configPanel.add(buildUserLanguage(), Resources.getString(LABEL_USER_LANGUAGE)); configPanel.add(buildUserStyleSheet(), Resources.getString(LABEL_USER_STYLESHEET)); configPanel.add(buildBehavior(), Resources.getString(LABEL_BEHAVIOR)); configPanel.add(buildNetwork(), Resources.getString(LABEL_NETWORK)); configPanel.add(buildApplications(), Resources.getString(LABEL_APPLICATIONS)); configPanelSelector = new ConfigurationPanelSelector(configPanel, cardLayout); return configPanel; } protected Component buildUserOptions(){ JTabbedPane p = new JTabbedPane(); p.add(buildUserLanguage(), Resources.getString(LABEL_USER_LANGUAGE)); p.add(buildUserStyleSheet(), Resources.getString(LABEL_USER_STYLESHEET)); p.add(buildUserFont(), Resources.getString(LABEL_USER_FONT)); return p; } protected Component buildUserLanguage(){ languagePanel = new LanguageDialog.Panel(); return languagePanel; } protected Component buildUserStyleSheet(){ JPanel panel = new JPanel(new BorderLayout()); panel.setBorder(BorderFactory.createEmptyBorder(4, 4, 4, 4)); userStylesheetPanel = new UserStyleDialog.Panel(); panel.add(userStylesheetPanel, BorderLayout.NORTH); cssMediaPanel = new CSSMediaPanel(); panel.add(cssMediaPanel, BorderLayout.SOUTH); return panel; } protected Component buildUserFont(){ return new JButton("User Font"); } protected Component buildBehavior(){ JGridBagPanel p = new JGridBagPanel(); showRendering = new JCheckBox(Resources.getString(LABEL_SHOW_RENDERING)); autoAdjustWindow = new JCheckBox(Resources.getString(LABEL_AUTO_ADJUST_WINDOW)); enableDoubleBuffering = new JCheckBox(Resources.getString(LABEL_ENABLE_DOUBLE_BUFFERING)); enableDoubleBuffering.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent evt) { showRendering.setEnabled(!enableDoubleBuffering.isSelected()); } }); showDebugTrace = new JCheckBox(Resources.getString(LABEL_SHOW_DEBUG_TRACE)); selectionXorMode = new JCheckBox(Resources.getString(LABEL_SELECTION_XOR_MODE)); isXMLParserValidating = new JCheckBox(Resources.getString(LABEL_IS_XML_PARSER_VALIDATING)); enforceSecureScripting = new JCheckBox(Resources.getString(LABEL_SECURE_SCRIPTING_TOGGLE)); grantScriptFileAccess = new JCheckBox(Resources.getString(LABEL_GRANT_SCRIPT_FILE_ACCESS)); grantScriptNetworkAccess = new JCheckBox(Resources.getString(LABEL_GRANT_SCRIPT_NETWORK_ACCESS)); JGridBagPanel scriptSecurityPanel = new JGridBagPanel(); scriptSecurityPanel.add(enforceSecureScripting, 0, 0, 1, 1, WEST, HORIZONTAL, 1, 0); scriptSecurityPanel.add(grantScriptFileAccess, 1, 0, 1, 1, WEST, HORIZONTAL, 1, 0); scriptSecurityPanel.add(grantScriptNetworkAccess, 1, 1, 1, 1, WEST, HORIZONTAL, 1, 0); enforceSecureScripting.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { grantScriptFileAccess.setEnabled(enforceSecureScripting.isSelected()); grantScriptNetworkAccess.setEnabled(enforceSecureScripting.isSelected()); } }); loadJava = new JCheckBox(Resources.getString(LABEL_LOAD_JAVA)); loadEcmascript = new JCheckBox(Resources.getString(LABEL_LOAD_ECMASCRIPT)); JGridBagPanel loadScriptPanel = new JGridBagPanel(); loadScriptPanel.add(loadJava, 0, 0, 1, 1, WEST, NONE, 1, 0); loadScriptPanel.add(loadEcmascript, 1, 0, 1, 1, WEST, NONE, 1, 0); JPanel scriptOriginPanel = new JPanel(); scriptOriginGroup = new ButtonGroup(); JRadioButton rb = null; rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_ANY)); rb.setActionCommand("" + ResourceOrigin.ANY); scriptOriginGroup.add(rb); scriptOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_DOCUMENT)); rb.setActionCommand("" + ResourceOrigin.DOCUMENT); scriptOriginGroup.add(rb); scriptOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_EMBED)); rb.setActionCommand("" + ResourceOrigin.EMBEDED); scriptOriginGroup.add(rb); scriptOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_NONE)); rb.setActionCommand("" + ResourceOrigin.NONE); scriptOriginGroup.add(rb); scriptOriginPanel.add(rb); JPanel resourceOriginPanel = new JPanel(); resourceOriginGroup = new ButtonGroup(); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_ANY)); rb.setActionCommand("" + ResourceOrigin.ANY); resourceOriginGroup.add(rb); resourceOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_DOCUMENT)); rb.setActionCommand("" + ResourceOrigin.DOCUMENT); resourceOriginGroup.add(rb); resourceOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_EMBED)); rb.setActionCommand("" + ResourceOrigin.EMBEDED); resourceOriginGroup.add(rb); resourceOriginPanel.add(rb); rb = new JRadioButton(Resources.getString(LABEL_ORIGIN_NONE)); rb.setActionCommand("" + ResourceOrigin.NONE); resourceOriginGroup.add(rb); resourceOriginPanel.add(rb); JTabbedPane browserOptions = new JTabbedPane(); // browserOptions.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); p.add(showRendering, 0, 0, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(autoAdjustWindow, 0, 1, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(enableDoubleBuffering, 0, 2, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(showDebugTrace, 0, 3, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(selectionXorMode, 0, 4, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(isXMLParserValidating, 0, 5, 2, 1, WEST, HORIZONTAL, 1, 0); p.add(new JLabel(), 0, 11, 2, 1, WEST, BOTH, 1, 1); browserOptions.addTab(Resources.getString(TITLE_BEHAVIOR), p); p.setBorder(BorderFactory.createEmptyBorder(10, 10, 10, 10)); p = new JGridBagPanel(); p.add(new JLabel(Resources.getString(LABEL_ENFORCE_SECURE_SCRIPTING)), 0, 6, 1, 1, NORTHWEST, NONE, 0, 0); p.add(scriptSecurityPanel, 1, 6, 1, 1, WEST, NONE, 0, 0); p.add(new JLabel(Resources.getString(LABEL_LOAD_SCRIPTS)), 0, 8, 1, 1, WEST, NONE, 0, 0); p.add(loadScriptPanel, 1, 8, 1, 1, WEST, NONE, 1, 0); p.add(new JLabel(Resources.getString(LABEL_SCRIPT_ORIGIN)), 0, 9, 1, 1, WEST, NONE, 0, 0); p.add(scriptOriginPanel, 1, 9, 1, 1, WEST, NONE, 1, 0); p.add(new JLabel(Resources.getString(LABEL_RESOURCE_ORIGIN)), 0, 10, 1, 1, WEST, NONE, 0, 0); p.add(resourceOriginPanel, 1, 10, 1, 1, WEST, NONE, 1, 0); p.add(new JLabel(), 0, 11, 2, 1, WEST, BOTH, 1, 1); browserOptions.addTab(Resources.getString(TITLE_SECURITY), p); p.setBorder(BorderFactory.createEmptyBorder(10, 10, 10, 10)); JGridBagPanel borderedPanel = new JGridBagPanel(); borderedPanel.add(browserOptions, 0, 0, 1, 1, WEST, BOTH, 1, 1); borderedPanel.setBorder(BorderFactory.createCompoundBorder (BorderFactory.createTitledBorder (BorderFactory.createEtchedBorder(), Resources.getString(TITLE_BROWSER_OPTIONS)), BorderFactory.createEmptyBorder(10, 10, 10, 10))); return borderedPanel; } protected Component buildNetwork(){ JGridBagPanel p = new JGridBagPanel(); host = new JTextField(Resources.getInteger(CONFIG_HOST_TEXT_FIELD_LENGTH)); JLabel hostLabel = new JLabel(Resources.getString(LABEL_HOST)); port = new JTextField(Resources.getInteger(CONFIG_PORT_TEXT_FIELD_LENGTH)); JLabel portLabel = new JLabel(Resources.getString(LABEL_PORT)); p.add(hostLabel, 0, 0, 1, 1, WEST, HORIZONTAL, 0, 0); p.add(host, 0, 1, 1, 1, CENTER, HORIZONTAL, 1, 0); p.add(portLabel, 1, 0, 1, 1, WEST, HORIZONTAL, 0, 0); p.add(port, 1, 1, 1, 1, CENTER, HORIZONTAL, 0, 0); p.add(new JLabel(""), 2, 1, 1, 1, CENTER, HORIZONTAL, 0, 0); p.setBorder(BorderFactory.createCompoundBorder (BorderFactory.createTitledBorder (BorderFactory.createEtchedBorder(), Resources.getString(TITLE_NETWORK)), BorderFactory.createEmptyBorder(10, 10, 10, 10))); return p; } protected Component buildApplications(){ return new JButton("Applications"); } /** * Shows the dialog * @return OK_OPTION or CANCEL_OPTION */ public int showDialog(){ pack(); show(); return returnCode; } public static void main(String[] args){ Map defaults = new Hashtable(); defaults.put(PREFERENCE_KEY_LANGUAGES, "fr"); defaults.put(PREFERENCE_KEY_SHOW_RENDERING, Boolean.TRUE); defaults.put(PREFERENCE_KEY_SELECTION_XOR_MODE, Boolean.FALSE); defaults.put(PREFERENCE_KEY_IS_XML_PARSER_VALIDATING, Boolean.FALSE); defaults.put(PREFERENCE_KEY_AUTO_ADJUST_WINDOW, Boolean.TRUE); defaults.put(PREFERENCE_KEY_ENABLE_DOUBLE_BUFFERING, Boolean.TRUE); defaults.put(PREFERENCE_KEY_SHOW_DEBUG_TRACE, Boolean.TRUE); defaults.put(PREFERENCE_KEY_PROXY_HOST, "webcache.eng.sun.com"); defaults.put(PREFERENCE_KEY_PROXY_PORT, "8080"); XMLPreferenceManager manager = new XMLPreferenceManager(args[0], defaults); PreferenceDialog dlg = new PreferenceDialog(manager); int c = dlg.showDialog(); if(c == OK_OPTION){ try{ manager.save(); System.out.println("Done Saving options"); System.exit(0); }catch(Exception e){ System.err.println("Could not save options"); e.printStackTrace(); } } } } class ConfigurationPanelSelector { private CardLayout layout; private Container container; public ConfigurationPanelSelector(Container container, CardLayout layout){ this.layout = layout; this.container = container; } public void select(String panelName){ layout.show(container, panelName); } } class IconCellRendererOld extends JLabel implements ListCellRenderer { Map iconMap; public IconCellRendererOld(Map iconMap){ this.iconMap = iconMap; setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5)); } public Component getListCellRendererComponent ( JList list, Object value, // value to display int index, // cell index boolean isSelected, // is the cell selected boolean cellHasFocus) // the list and the cell have the focus { String s = value.toString(); setText(s); ImageIcon icon = (ImageIcon)iconMap.get(s); if(icon != null){ setIcon(icon); setHorizontalAlignment(CENTER); setHorizontalTextPosition(CENTER); setVerticalTextPosition(BOTTOM); } // if (isSelected) { setBackground(java.awt.Color.red); // list.getSelectionBackground()); setForeground(list.getSelectionForeground()); /*} else { setBackground(list.getBackground()); setForeground(list.getForeground()); }*/ // setEnabled(list.isEnabled()); // setFont(list.getFont()); return this; } } class IconCellRenderer extends JLabel implements ListCellRenderer { protected Map map; protected static Border noFocusBorder; /** * Constructs a default renderer object for an item * in a list. */ public IconCellRenderer(Map map) { super(); this.map = map; noFocusBorder = BorderFactory.createEmptyBorder(1, 1, 1, 1); setOpaque(true); setBorder(noFocusBorder); } public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { setComponentOrientation(list.getComponentOrientation()); if (isSelected) { setBackground(list.getSelectionBackground()); setForeground(list.getSelectionForeground()); } else { setBackground(list.getBackground()); setForeground(list.getForeground()); } setBorder((cellHasFocus) ? UIManager.getBorder("List.focusCellHighlightBorder") : noFocusBorder); /*if (value instanceof Icon) { setIcon((Icon)value); setText(""); } else { setIcon(null); setText((value == null) ? "" : value.toString()); }*/ setText(value.toString()); ImageIcon icon = (ImageIcon)map.get(value.toString()); if(icon != null){ setIcon(icon); setHorizontalAlignment(CENTER); setHorizontalTextPosition(CENTER); setVerticalTextPosition(BOTTOM); } setEnabled(list.isEnabled()); setFont(list.getFont()); return this; } /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void validate() {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void revalidate() {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void repaint(long tm, int x, int y, int width, int height) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void repaint(Rectangle r) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ protected void firePropertyChange(String propertyName, Object oldValue, Object newValue) { // Strings get interned... if (propertyName=="text") super.firePropertyChange(propertyName, oldValue, newValue); } /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, byte oldValue, byte newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, char oldValue, char newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, short oldValue, short newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, int oldValue, int newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, long oldValue, long newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, float oldValue, float newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, double oldValue, double newValue) {} /** * Overridden for performance reasons. * See the <a href="#override">Implementation Note</a> * for more information. */ public void firePropertyChange(String propertyName, boolean oldValue, boolean newValue) {} }
package com.ecyrd.jspwiki.providers; import java.io.InputStream; import java.io.OutputStream; import java.io.IOException; import java.io.FileNotFoundException; import java.io.File; import java.io.FilenameFilter; import java.io.FileOutputStream; import java.io.FileInputStream; import java.util.Collection; import java.util.Properties; import java.util.ArrayList; import java.util.Iterator; import java.util.Date; import java.util.List; import java.util.Collections; import org.apache.log4j.Category; import com.ecyrd.jspwiki.*; import com.ecyrd.jspwiki.attachment.Attachment; /** * Provides basic, versioning attachments. * * <PRE> * Structure is as follows: * attachment_dir/ * ThisPage/ * attachment.doc/ * attachment.properties * 1.doc * 2.doc * 3.doc * picture.png/ * attachment.properties * 1.png * 2.png * ThatPage/ * picture.png/ * attachment.properties * 1.png * * </PRE> * * The names of the directories will be URLencoded. * <p> * "attachment.properties" consists of the following items: * <UL> * <LI>1.author = author name for version 1 (etc) * </UL> */ public class BasicAttachmentProvider implements WikiAttachmentProvider { private String m_storageDir; public static final String PROP_STORAGEDIR = "jspwiki.basicAttachmentProvider.storageDir"; public static final String PROPERTY_FILE = "attachment.properties"; public static final String DIR_EXTENSION = "-att"; public static final String ATTDIR_EXTENSION = "-dir"; static final Category log = Category.getInstance( BasicAttachmentProvider.class ); public void initialize( Properties properties ) throws NoRequiredPropertyException, IOException { m_storageDir = WikiEngine.getRequiredProperty( properties, PROP_STORAGEDIR ); } /** * Finds storage dir, and if it exists, makes sure that it is valid. * * @param wikipage Page to which this attachment is attached. */ private File findPageDir( String wikipage ) throws ProviderException { wikipage = mangleName( wikipage ); File f = new File( m_storageDir, wikipage+DIR_EXTENSION ); if( f.exists() && !f.isDirectory() ) { throw new ProviderException("Storage dir '"+f.getAbsolutePath()+"' is not a directory!"); } return f; } private static String mangleName( String wikiname ) { String res = TextUtil.urlEncodeUTF8( wikiname ); return res; } private static String unmangleName( String filename ) { return TextUtil.urlDecodeUTF8( filename ); } /** * Finds the dir in which the attachment lives. */ private File findAttachmentDir( Attachment att ) throws ProviderException { File f = new File( findPageDir(att.getParentName()), mangleName(att.getFileName()+ATTDIR_EXTENSION) ); return f; } /** * Goes through the repository and decides which version is * the newest one in that directory. * * @return Latest version number in the repository, or 0, if * there is no page in the repository. */ private int findLatestVersion( Attachment att ) throws ProviderException { // File pageDir = findPageDir( att.getName() ); File attDir = findAttachmentDir( att ); // log.debug("Finding pages in "+attDir.getAbsolutePath()); String[] pages = attDir.list( new AttachmentVersionFilter() ); if( pages == null ) { return 0; // No such thing found. } int version = 0; for( int i = 0; i < pages.length; i++ ) { // log.debug("Checking: "+pages[i]); int cutpoint = pages[i].indexOf( '.' ); if( cutpoint > 0 ) { String pageNum = ( cutpoint > 0 ) ? pages[i].substring( 0, cutpoint ) : pages[i] ; try { int res = Integer.parseInt( pageNum ); if( res > version ) { version = res; } } catch( NumberFormatException e ) {} // It's okay to skip these. } } return version; } /** * Returns the file extension. For example "test.png" returns "png". * <p> * If file has no extension, will return "bin" */ protected static String getFileExtension( String filename ) { String fileExt = "bin"; int dot = filename.lastIndexOf('.'); if( dot >= 0 && dot < filename.length()-1 ) { fileExt = mangleName( filename.substring( dot+1 ) ); } return fileExt; } /** * Writes the page properties back to the file system. * Note that it WILL overwrite any previous properties. */ private void putPageProperties( Attachment att, Properties properties ) throws IOException, ProviderException { File attDir = findAttachmentDir( att ); File propertyFile = new File( attDir, PROPERTY_FILE ); OutputStream out = new FileOutputStream( propertyFile ); properties.store( out, " JSPWiki page properties for "+ att.getName()+ ". DO NOT MODIFY!" ); out.close(); } /** * Reads page properties from the file system. */ private Properties getPageProperties( Attachment att ) throws IOException, ProviderException { Properties props = new Properties(); File propertyFile = new File( findAttachmentDir(att), PROPERTY_FILE ); if( propertyFile != null && propertyFile.exists() ) { InputStream in = new FileInputStream( propertyFile ); props.load(in); in.close(); } return props; } public void putAttachmentData( Attachment att, InputStream data ) throws ProviderException, IOException { OutputStream out = null; File attDir = findAttachmentDir( att ); if(!attDir.exists()) { attDir.mkdirs(); } int latestVersion = findLatestVersion( att ); // System.out.println("Latest version is "+latestVersion); try { int versionNumber = latestVersion+1; File newfile = new File( attDir, versionNumber+"."+ getFileExtension(att.getFileName()) ); log.info("Uploading attachment "+att.getFileName()+" to page "+att.getParentName()); log.info("Saving attachment contents to "+newfile.getAbsolutePath()); out = new FileOutputStream(newfile); FileUtil.copyContents( data, out ); out.close(); Properties props = getPageProperties( att ); String author = att.getAuthor(); if( author == null ) { author = "unknown"; } props.setProperty( versionNumber+".author", author ); putPageProperties( att, props ); } catch( IOException e ) { log.error( "Could not save attachment data: ", e ); throw (IOException) e.fillInStackTrace(); } finally { if( out != null ) out.close(); } } public String getProviderInfo() { return ""; } private File findFile( File dir, Attachment att ) throws FileNotFoundException, ProviderException { int version = att.getVersion(); if( version == WikiProvider.LATEST_VERSION ) { version = findLatestVersion( att ); } File f = new File( dir, version+"."+getFileExtension(att.getFileName()) ); if( !f.exists() ) { throw new FileNotFoundException("No such file: "+f.getAbsolutePath()+" exists."); } return f; } public InputStream getAttachmentData( Attachment att ) throws IOException, ProviderException { File attDir = findAttachmentDir( att ); File f = findFile( attDir, att ); return new FileInputStream( f ); } public Collection listAttachments( WikiPage page ) throws ProviderException { Collection result = new ArrayList(); File dir = findPageDir( page.getName() ); if( dir != null ) { String[] attachments = dir.list(); if( attachments != null ) { for( int i = 0; i < attachments.length; i++ ) { File f = new File( dir, attachments[i] ); if( f.isDirectory() ) { String attachmentName = unmangleName( attachments[i] ); if( attachmentName.endsWith( ATTDIR_EXTENSION ) ) { attachmentName = attachmentName.substring( 0, attachmentName.length()-ATTDIR_EXTENSION.length() ); } Attachment att = getAttachmentInfo( page, attachmentName, WikiProvider.LATEST_VERSION ); if( att == null ) { throw new ProviderException("Attachment disappeared while reading information:"+ " if you did not touch the repository, there is a serious bug somewhere. "+ "Attachment = "+attachments[i]+ ", decoded = "+attachmentName ); } result.add( att ); } } } } return result; } public Collection findAttachments( QueryItem[] query ) { return null; } // FIXME: Very unoptimized. public List listAllChanged( Date timestamp ) throws ProviderException { File attDir = new File( m_storageDir ); if( !attDir.exists() ) { throw new ProviderException("Specified attachment directory "+m_storageDir+" does not exist!"); } ArrayList list = new ArrayList(); String[] pagesWithAttachments = attDir.list( new AttachmentFilter() ); for( int i = 0; i < pagesWithAttachments.length; i++ ) { String pageId = pagesWithAttachments[i]; pageId = pageId.substring( 0, pageId.length()-DIR_EXTENSION.length() ); Collection c = listAttachments( new WikiPage(pageId) ); for( Iterator it = c.iterator(); it.hasNext(); ) { Attachment att = (Attachment) it.next(); if( att.getLastModified().after( timestamp ) ) { list.add( att ); } } } Collections.sort( list, new PageTimeComparator() ); return list; } public Attachment getAttachmentInfo( WikiPage page, String name, int version ) throws ProviderException { File dir = new File( findPageDir( page.getName() ), mangleName(name)+ATTDIR_EXTENSION ); if( !dir.exists() ) { // log.debug("Attachment dir not found - thus no attachment can exist."); return null; } Attachment att = new Attachment( page.getName(), name ); if( version == WikiProvider.LATEST_VERSION ) { version = findLatestVersion(att); } att.setVersion( version ); // System.out.println("Fetching info on version "+version); try { Properties props = getPageProperties(att); att.setAuthor( props.getProperty( version+".author" ) ); File f = findFile( dir, att ); att.setSize( f.length() ); att.setLastModified( new Date(f.lastModified()) ); } catch( IOException e ) { log.error("Can't read page properties", e ); throw new ProviderException("Cannot read page properties: "+e.getMessage()); } // FIXME: Check for existence of this particular version. return att; } public List getVersionHistory( Attachment att ) { ArrayList list = new ArrayList(); try { int latest = findLatestVersion( att ); for( int i = 1; i <= latest; i++ ) { Attachment a = getAttachmentInfo( new WikiPage(att.getParentName()), att.getFileName(), i ); if( a != null ) { list.add( a ); } } } catch( ProviderException e ) { log.error("Getting version history failed for page: "+att,e); // FIXME: SHould this fail? } return list; } public void deleteVersion( Attachment att ) throws ProviderException { // FIXME: Does nothing yet. } public void deleteAttachment( Attachment att ) throws ProviderException { // FIXME: Does nothing yet. } /** * Returns only those directories that contain attachments. */ public class AttachmentFilter implements FilenameFilter { public boolean accept( File dir, String name ) { return name.endsWith( DIR_EXTENSION ); } } /** * Accepts only files that are actual versions, no control files. */ public class AttachmentVersionFilter implements FilenameFilter { public boolean accept( File dir, String name ) { return !name.equals( PROPERTY_FILE ); } } }
package com.github.assisstion.ModulePack.logging; import java.awt.BorderLayout; import java.awt.Color; import java.util.List; import java.util.function.Consumer; import java.util.logging.Logger; import javax.lang.model.SourceVersion; import javax.swing.JPanel; import javax.swing.JProgressBar; import javax.swing.JScrollPane; import javax.swing.JTextPane; import javax.swing.SwingWorker; import javax.swing.text.BadLocationException; import javax.swing.text.DefaultCaret; import javax.swing.text.Style; import javax.swing.text.StyleConstants; import javax.swing.text.StyledDocument; import com.github.assisstion.ModulePack.Pair; import com.github.assisstion.ModulePack.annotation.CompileVersion; import com.github.assisstion.ModulePack.annotation.Dependency; @Dependency(Pair.class) @CompileVersion(SourceVersion.RELEASE_8) // Consumer<T> public class LoggerPane extends JPanel implements Consumer<String>{ public Logger log; private static final long serialVersionUID = 1022490441168101112L; protected JTextPane textPane; private JScrollPane scrollPane; protected LogWorker worker; protected ProgressWorker progress; private JProgressBar progressBar; protected Style style; protected StyledDocument document; //protected String separator; protected Color color = Color.BLACK; protected String separator; protected boolean reverseOrder; public LoggerPane(Logger log, boolean showProgress, boolean reverseOrder){ this(log, showProgress, "\n", reverseOrder); } public LoggerPane(Logger log, boolean showProgress, String separator){ this(log, showProgress, separator, false); } public LoggerPane(Logger log, boolean showProgress){ this(log, showProgress, "\n", false); } /** * Create the frame. */ public LoggerPane(Logger log, boolean showProgress, String separator, boolean reverseOrder){ //setTitle(); setLayout(new BorderLayout(0, 0)); this.log = log; this.reverseOrder = reverseOrder; LogHandler handler = new LogHandler(this); log.addHandler(handler); scrollPane = new JScrollPane(); add(scrollPane); textPane = new JTextPane(); scrollPane.setViewportView(textPane); textPane.setEditable(false); progressBar = new JProgressBar(0, 0); progressBar.setEnabled(false); progressBar.setStringPainted(false); if(showProgress){ add(progressBar, BorderLayout.SOUTH); } if(!reverseOrder){ DefaultCaret caret = (DefaultCaret) textPane.getCaret(); caret.setUpdatePolicy(DefaultCaret.ALWAYS_UPDATE); } document = textPane.getStyledDocument(); style = document.addStyle("text-style", null); StyleConstants.setForeground(style, Color.BLACK); worker = new LogWorker(); progress = new ProgressWorker(); this.separator = separator; } /* public void setSeparator(String separator){ this.separator = separator; } public String getSeparator(){ return separator; } */ public void setProgress(Pair<Integer, Integer> values){ progress.push(values); } public class LogWorker extends SwingWorker<Object, Pair<String, Color>>{ protected void push(Pair<String, Color> message){ publish(message); } @Override protected Object doInBackground() throws Exception{ return null; } @Override protected void process(List<Pair<String, Color>> messages){ for(Pair<String, Color> messageOne : messages){ String tempSeparator = ""; if(!textPane.getText().equals("")){ tempSeparator = separator; } StyleConstants.setForeground(style, messageOne.getValueTwo()); try{ if(reverseOrder){ document.insertString(0, messageOne.getValueOne() + tempSeparator, style); } else{ document.insertString(document.getLength(), tempSeparator + messageOne.getValueOne(), style); } } catch(BadLocationException e){ // TODO Auto-generated catch block e.printStackTrace(); } } } } public class ProgressWorker extends SwingWorker<Object, Pair<Integer, Integer>>{ protected void push(Pair<Integer, Integer> progress){ publish(progress); } @Override protected Object doInBackground() throws Exception{ return null; } @Override protected void process(List<Pair<Integer, Integer>> integerPairs){ for(Pair<Integer, Integer> pairOne : integerPairs){ if(pairOne.getValueTwo().equals(0)){ progressBar.setEnabled(false); progressBar.setStringPainted(false); } else{ progressBar.setEnabled(true); progressBar.setStringPainted(true); } progressBar.setValue(pairOne.getValueOne()); progressBar.setMaximum(pairOne.getValueTwo()); } } } @Override public void accept(String t){ worker.push(new Pair<String, Color>(t, color)); } }
package org.ow2.petals.activitibpmn; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DEFAULT_ENGINE_ENABLE_BPMN_VALIDATION; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DEFAULT_ENGINE_ENABLE_JOB_EXECUTOR; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DEFAULT_MONIT_TRACE_DELAY; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DEFAULT_SCHEDULED_LOGGER_CORE_SIZE; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.ENGINE_ENABLE_BPMN_VALIDATION; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.ENGINE_ENABLE_JOB_EXECUTOR; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.MONIT_TRACE_DELAY; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.SCHEDULED_LOGGER_CORE_SIZE; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.Activiti.PETALS_SENDER_COMP_NAME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DATABASE_SCHEMA_UPDATE; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DATABASE_TYPE; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_DRIVER; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_MAX_ACTIVE_CONNECTIONS; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_MAX_CHECKOUT_TIME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_MAX_IDLE_CONNECTIONS; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_MAX_WAIT_TIME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.DEFAULT_JDBC_URL_DATABASE_FILENAME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_DRIVER; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_MAX_ACTIVE_CONNECTIONS; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_MAX_CHECKOUT_TIME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_MAX_IDLE_CONNECTIONS; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_MAX_WAIT_TIME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_PASSWORD; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_URL; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.DBServer.JDBC_USERNAME; import static org.ow2.petals.activitibpmn.ActivitiSEConstants.IntegrationOperation.ITG_OP_GETTASKS; import java.io.File; import java.net.MalformedURLException; import java.util.Iterator; import java.util.List; import java.util.Map; import java.util.Map.Entry; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.Executors; import java.util.concurrent.ScheduledExecutorService; import java.util.concurrent.TimeUnit; import java.util.logging.Level; import java.util.logging.Logger; import javax.jbi.JBIException; import javax.xml.namespace.QName; import org.activiti.engine.ActivitiException; import org.activiti.engine.ProcessEngine; import org.activiti.engine.ProcessEngineConfiguration; import org.activiti.engine.RuntimeService; import org.activiti.engine.impl.asyncexecutor.AsyncExecutor; import org.activiti.engine.impl.cfg.ProcessEngineConfigurationImpl; import org.apache.cxf.Bus; import org.apache.cxf.BusFactory; import org.apache.cxf.transport.ConduitInitiatorManager; import org.ow2.easywsdl.wsdl.api.Endpoint; import org.ow2.easywsdl.wsdl.api.WSDLException; import org.ow2.petals.activitibpmn.event.AbstractEventListener; import org.ow2.petals.activitibpmn.event.ProcessInstanceCanceledEventListener; import org.ow2.petals.activitibpmn.event.ProcessInstanceCompletedEventListener; import org.ow2.petals.activitibpmn.event.ProcessInstanceStartedEventListener; import org.ow2.petals.activitibpmn.event.ServiceTaskStartedEventListener; import org.ow2.petals.activitibpmn.incoming.ActivitiService; import org.ow2.petals.activitibpmn.incoming.integration.GetTasksOperation; import org.ow2.petals.activitibpmn.incoming.integration.exception.OperationInitializationException; import org.ow2.petals.activitibpmn.outgoing.PetalsSender; import org.ow2.petals.activitibpmn.outgoing.cxf.transport.PetalsCxfTransportFactory; import org.ow2.petals.component.framework.listener.AbstractListener; import org.ow2.petals.component.framework.se.AbstractServiceEngine; import org.ow2.petals.component.framework.su.AbstractServiceUnitManager; import org.ow2.petals.component.framework.util.EndpointOperationKey; import org.ow2.petals.component.framework.util.WSDLUtilImpl; /** * The component class of the Activiti BPMN Service Engine. * @author Bertrand Escudie - Linagora */ public class ActivitiSE extends AbstractServiceEngine { /** * The Activiti BPMN Engine. */ private ProcessEngine activitiEngine; /** * A map used to get the Activiti Operation associated with (end-point Name + Operation) */ private final Map<EndpointOperationKey, ActivitiService> activitiServices = new ConcurrentHashMap<EndpointOperationKey, ActivitiService>(); /** * An executor service to log MONIT trace about end of process instances */ private ScheduledExecutorService scheduledLogger = null; /** * Delay to wait before to log some MONIT traces */ // TODO: monitTraceDelay should be hot-changed private int monitTraceDelay = DEFAULT_MONIT_TRACE_DELAY; /** * Core size of the thread pool in charge of logging delayed MONIT traces */ // TODO: scheduledLoggerCoreSize should be hot-changed private int scheduledLoggerCoreSize = DEFAULT_SCHEDULED_LOGGER_CORE_SIZE; /** * The Activiti Async Executor service */ private AsyncExecutor activitiAsyncExecutor = null; /** * Activation flag of the Activiti job executor */ private boolean enableActivitiJobExecutor = DEFAULT_ENGINE_ENABLE_JOB_EXECUTOR; /** * Activation flag of the BPMN validation on process deployments into the Activiti engine */ private boolean enableActivitiBpmnValidation = DEFAULT_ENGINE_ENABLE_BPMN_VALIDATION; /** * Event listener fired when a process is started */ private AbstractEventListener processInstanceStartedEventListener; /** * Event listener fired when a process is completed */ private AbstractEventListener processInstanceCompletedEventListener; /** * Event listener fired when a process is canceled */ private AbstractEventListener processInstanceCanceledEventListener; /** * Event listener fired when a service task is started */ private AbstractEventListener serviceTaskStartedEventListener; /** * @return the Activiti Engine */ public ProcessEngine getProcessEngine() { return this.activitiEngine; } /** * @param eptAndOperation * the end-point Name and operation Name * @param activitiservice * the Activiti service * @return the map with the inserted elements */ public void registerActivitiService(final EndpointOperationKey eptAndOperation, final ActivitiService activitiservice) { this.activitiServices.put(eptAndOperation, activitiservice); } /** * @param eptName * the end-point name */ public void removeActivitiService(final String eptName) { final Iterator<Entry<EndpointOperationKey, ActivitiService>> itEptOperationToActivitiOperation = this.activitiServices .entrySet().iterator(); while (itEptOperationToActivitiOperation.hasNext()) { final Entry<EndpointOperationKey, ActivitiService> entry = itEptOperationToActivitiOperation.next(); if (entry.getKey().getEndpointName().equals(eptName)) { itEptOperationToActivitiOperation.remove(); } } } /** * @param logLevel */ public void logEptOperationToActivitiOperation(final Logger logger, final Level logLevel) { if (logger.isLoggable(logLevel)) { for (final Map.Entry<EndpointOperationKey, ActivitiService> entry : this.activitiServices.entrySet()) { final EndpointOperationKey key = entry.getKey(); logger.log(logLevel, "*** Endpoint Operation "); logger.log(logLevel, key.toString()); logger.log(logLevel, " entry.getValue().log(logger, logLevel); logger.log(logLevel, "******************* "); } } } /** * @param eptAndOperation * the end-point Name and operation Name * @return the Activiti Service associated with this end-point name and operation Name */ public ActivitiService getActivitiServices(final EndpointOperationKey eptAndOperation) { return this.activitiServices.get(eptAndOperation); } @Override public void doInit() throws JBIException { this.getLogger().fine("Start ActivitiSE.doInit()"); try { // JDBC Driver final String jdbcDriverConfigured = this.getComponentExtensions().get(JDBC_DRIVER); final String jdbcDriver; if (jdbcDriverConfigured == null || jdbcDriverConfigured.trim().isEmpty()) { this.getLogger().info("No JDBC Driver configured for database. Default value used."); jdbcDriver = DEFAULT_JDBC_DRIVER; } else { jdbcDriver = jdbcDriverConfigured; } // JDBC URL final String jdbcUrlConfigured = this.getComponentExtensions().get(JDBC_URL); final String jdbcUrl; if (jdbcUrlConfigured == null || jdbcUrlConfigured.trim().isEmpty()) { // $PETALS_HOME/data/repository/components/<se-bpmn>/h2-activiti.db this.getLogger().info("No JDBC URL configured for database. Default value used."); final File databaseFile = new File(this.getContext().getWorkspaceRoot(), DEFAULT_JDBC_URL_DATABASE_FILENAME); try { jdbcUrl = String.format("jdbc:h2:%s", databaseFile.toURI().toURL().toExternalForm()); } catch (final MalformedURLException e) { // This exception should not occur. It's a bug throw new JBIException("The defaul JDBC URL is invalid !!", e); } } else { jdbcUrl = jdbcUrlConfigured; } final String jdbcUsername = this.getComponentExtensions().get(JDBC_USERNAME); final String jdbcPassword = this.getComponentExtensions().get(JDBC_PASSWORD); final String jdbcMaxActiveConnectionsConfigured = this.getComponentExtensions().get( JDBC_MAX_ACTIVE_CONNECTIONS); int jdbcMaxActiveConnections; if (jdbcMaxActiveConnectionsConfigured == null || jdbcMaxActiveConnectionsConfigured.trim().isEmpty()) { this.getLogger().info("No JDBC Max Active Connections configured for database. Default value used."); jdbcMaxActiveConnections = DEFAULT_JDBC_MAX_ACTIVE_CONNECTIONS; } else { try { jdbcMaxActiveConnections = Integer.parseInt(jdbcMaxActiveConnectionsConfigured); } catch (final NumberFormatException e) { this.getLogger().warning( "Invalid value for the number of JDBC Max Active Connections. Default value used."); jdbcMaxActiveConnections = DEFAULT_JDBC_MAX_ACTIVE_CONNECTIONS; } } final String jdbcMaxIdleConnectionsConfigured = this.getComponentExtensions() .get(JDBC_MAX_IDLE_CONNECTIONS); int jdbcMaxIdleConnections; if (jdbcMaxIdleConnectionsConfigured == null || jdbcMaxIdleConnectionsConfigured.trim().isEmpty()) { this.getLogger().info("No JDBC Max Idle Connections configured for database. Default value used."); jdbcMaxIdleConnections = DEFAULT_JDBC_MAX_IDLE_CONNECTIONS; } else { try { jdbcMaxIdleConnections = Integer.parseInt(jdbcMaxIdleConnectionsConfigured); } catch (final NumberFormatException e) { this.getLogger().warning( "Invalid value for the number of JDBC Max Idle Connections. Default value used."); jdbcMaxIdleConnections = DEFAULT_JDBC_MAX_IDLE_CONNECTIONS; } } final String jdbcMaxCheckoutTimeConfigured = this.getComponentExtensions().get(JDBC_MAX_CHECKOUT_TIME); int jdbcMaxCheckoutTime; if (jdbcMaxCheckoutTimeConfigured == null || jdbcMaxCheckoutTimeConfigured.trim().isEmpty()) { this.getLogger().info("No JDBC Max Checkout Time configured for database. Default value used."); jdbcMaxCheckoutTime = DEFAULT_JDBC_MAX_CHECKOUT_TIME; } else { try { jdbcMaxCheckoutTime = Integer.parseInt(jdbcMaxCheckoutTimeConfigured); } catch (final NumberFormatException e) { this.getLogger().warning( "Invalid value for the number of JDBC Max Checkout Time. Default value used."); jdbcMaxCheckoutTime = DEFAULT_JDBC_MAX_CHECKOUT_TIME; } } final String jdbcMaxWaitTimeConfigured = this.getComponentExtensions().get(JDBC_MAX_WAIT_TIME); int jdbcMaxWaitTime; if (jdbcMaxWaitTimeConfigured == null || jdbcMaxWaitTimeConfigured.trim().isEmpty()) { this.getLogger().info("No JDBC Max Wait Time configured for database. Default value used."); jdbcMaxWaitTime = DEFAULT_JDBC_MAX_WAIT_TIME; } else { try { jdbcMaxWaitTime = Integer.parseInt(jdbcMaxWaitTimeConfigured); } catch (final NumberFormatException e) { this.getLogger().warning("Invalid value for the number of JDBC Max Wait Time. Default value used."); jdbcMaxWaitTime = DEFAULT_JDBC_MAX_WAIT_TIME; } } /* DATABASE_TYPE Possible values: {h2, mysql, oracle, postgres, mssql, db2}. */ final String databaseType = this.getComponentExtensions().get(DATABASE_TYPE); /* DATABASE_SCHEMA_UPDATE Possible values: {false, true, create-drop } */ final String databaseSchemaUpdate = this.getComponentExtensions().get(DATABASE_SCHEMA_UPDATE); this.getLogger().config("DB configuration:"); this.getLogger().config(" - " + JDBC_DRIVER + " = " + jdbcDriver); this.getLogger().config(" - " + JDBC_URL + " = " + jdbcUrl); this.getLogger().config(" - " + JDBC_USERNAME + " = " + jdbcUsername); this.getLogger().config(" - " + JDBC_PASSWORD + " = " + jdbcPassword); this.getLogger().config(" - " + JDBC_MAX_ACTIVE_CONNECTIONS + " = " + jdbcMaxActiveConnections); this.getLogger().config(" - " + JDBC_MAX_IDLE_CONNECTIONS + " = " + jdbcMaxIdleConnections); this.getLogger().config(" - " + JDBC_MAX_CHECKOUT_TIME + " = " + jdbcMaxCheckoutTime); this.getLogger().config(" - " + JDBC_MAX_WAIT_TIME + " = " + jdbcMaxWaitTime); this.getLogger().config(" - " + DATABASE_TYPE + " = " + databaseType); this.getLogger().config(" - " + DATABASE_SCHEMA_UPDATE + " = " + databaseSchemaUpdate); // Caution: // - only the value "false", ignoring case and spaces will disable the job executor, // - only the value "true", ignoring case and spaces will enable the job executor, // - otherwise, the default value is used. final String enableActivitiJobExecutorConfigured = this.getComponentExtensions().get( ENGINE_ENABLE_JOB_EXECUTOR); if (enableActivitiJobExecutorConfigured == null || enableActivitiJobExecutorConfigured.trim().isEmpty()) { this.getLogger().info( "The activation of the Activiti job executor is not configured. Default value used."); this.enableActivitiJobExecutor = DEFAULT_ENGINE_ENABLE_JOB_EXECUTOR; } else { this.enableActivitiJobExecutor = enableActivitiJobExecutorConfigured.trim().equalsIgnoreCase("false") ? false : (enableActivitiJobExecutorConfigured.trim().equalsIgnoreCase("true") ? true : DEFAULT_ENGINE_ENABLE_JOB_EXECUTOR); } // Caution: // - only the value "false", ignoring case and spaces will disable the BPMN validation, // - only the value "true", ignoring case and spaces will enable the BPMN validation, // - otherwise, the default value is used. final String enableActivitiBpmnValidationConfigured = this.getComponentExtensions().get( ENGINE_ENABLE_BPMN_VALIDATION); if (enableActivitiBpmnValidationConfigured == null || enableActivitiBpmnValidationConfigured.trim().isEmpty()) { this.getLogger() .info("The activation of the BPMN validation during process deployments is not configured. Default value used."); this.enableActivitiBpmnValidation = DEFAULT_ENGINE_ENABLE_BPMN_VALIDATION; } else { this.enableActivitiBpmnValidation = enableActivitiBpmnValidationConfigured.trim().equalsIgnoreCase( "false") ? false : (enableActivitiBpmnValidationConfigured.trim().equalsIgnoreCase("true") ? true : DEFAULT_ENGINE_ENABLE_BPMN_VALIDATION); } this.getLogger().config("Activiti engine configuration:"); this.getLogger().config(" - " + ENGINE_ENABLE_JOB_EXECUTOR + " = " + this.enableActivitiJobExecutor); this.getLogger() .config(" - " + ENGINE_ENABLE_BPMN_VALIDATION + " = " + this.enableActivitiBpmnValidation); final String monitTraceDelayConfigured = this.getComponentExtensions().get(MONIT_TRACE_DELAY); if (monitTraceDelayConfigured == null || monitTraceDelayConfigured.trim().isEmpty()) { this.getLogger().info("No MONIT trace delay configured. Default value used."); this.monitTraceDelay = DEFAULT_MONIT_TRACE_DELAY; } else { try { this.monitTraceDelay = Integer.parseInt(monitTraceDelayConfigured); } catch (final NumberFormatException e) { this.getLogger().warning("Invalid value for the MONIT trace delay. Default value used."); this.monitTraceDelay = DEFAULT_MONIT_TRACE_DELAY; } } final String scheduledLoggerCoreSizeConfigured = this.getComponentExtensions().get( SCHEDULED_LOGGER_CORE_SIZE); if (scheduledLoggerCoreSizeConfigured == null || scheduledLoggerCoreSizeConfigured.trim().isEmpty()) { this.getLogger() .info("No core size of the thread pool in charge of logging MONIT traces is configured. Default value used."); this.scheduledLoggerCoreSize = DEFAULT_SCHEDULED_LOGGER_CORE_SIZE; } else { try { this.scheduledLoggerCoreSize = Integer.parseInt(scheduledLoggerCoreSizeConfigured); } catch (final NumberFormatException e) { this.getLogger() .warning( "Invalid value for the core size of the thread pool in charge of logging MONIT traces. Default value used."); this.scheduledLoggerCoreSize = DEFAULT_SCHEDULED_LOGGER_CORE_SIZE; } } this.getLogger().config("Other configuration parameters:"); this.getLogger().config(" - " + MONIT_TRACE_DELAY + " = " + this.monitTraceDelay); this.getLogger().config(" - " + SCHEDULED_LOGGER_CORE_SIZE + " = " + this.scheduledLoggerCoreSize); /* TODO Test Activiti database connection configuration */ /* TODO Test the Database Schema Version * What about databaseSchemaUpdate values "true" and "create-drop" */ /* TODO Set the non set value with default value */ /* Create an Activiti ProcessEngine with database configuration */ final ProcessEngineConfiguration pec = ProcessEngineConfiguration .createStandaloneProcessEngineConfiguration(); pec.setJdbcDriver(jdbcDriver); pec.setJdbcUrl(jdbcUrl); pec.setJdbcUsername(jdbcUsername).setJdbcPassword(jdbcPassword); pec.setJdbcMaxActiveConnections(jdbcMaxActiveConnections); pec.setJdbcMaxIdleConnections(jdbcMaxIdleConnections); pec.setJdbcMaxCheckoutTime(jdbcMaxCheckoutTime); pec.setJdbcMaxWaitTime(jdbcMaxWaitTime); if (databaseType != null && !databaseType.trim().isEmpty()) { pec.setDatabaseType(databaseType); } pec.setDatabaseSchemaUpdate(databaseSchemaUpdate); pec.setJobExecutorActivate(false); // We register the Petals transport into Apache CXF this.registerCxfPetalsTransport(); // As recommended by Activiti team, we prefer the Async Job Executor pec.setJobExecutorActivate(false); // The Async job is enabled ... pec.setAsyncExecutorEnabled(this.enableActivitiJobExecutor); // ... but must be started when starting the SE pec.setAsyncExecutorActivate(false); this.activitiEngine = pec.buildProcessEngine(); this.activitiAsyncExecutor = this.enableActivitiJobExecutor ? pec.getAsyncExecutor() : null; // Caution: Beans of the configuration are initialized when building the process engine if (pec instanceof ProcessEngineConfigurationImpl) { // We add to the BPMN engine the bean in charge of sending Petals message exchange final AbstractListener petalsSender = new PetalsSender(); petalsSender.init(this); ((ProcessEngineConfigurationImpl) pec).getBeans().put(PETALS_SENDER_COMP_NAME, petalsSender); } else { this.getLogger().warning("The implementation of the process engine configuration is not the expected one ! No Petals services can be invoked !"); } // Register integration operation final List<Endpoint> integrationEndpoints = WSDLUtilImpl.getEndpointList(this.getNativeWsdl() .getDescription()); if (integrationEndpoints.size() > 1) { throw new JBIException("Unexpected endpoint number supporting integration services"); } else if (integrationEndpoints.size() == 1) { try { final Endpoint endpoint = integrationEndpoints.get(0); final String integrationEndpointName = endpoint.getName(); final QName integrationInterfaceName = endpoint.getService().getInterface().getQName(); this.activitiServices .put(new EndpointOperationKey(integrationEndpointName, integrationInterfaceName, ITG_OP_GETTASKS), new GetTasksOperation(this.activitiEngine.getTaskService(), this.activitiEngine .getRepositoryService(), this.getLogger())); } catch (final OperationInitializationException | WSDLException e) { this.getLogger().log(Level.WARNING, "Integration operations are not completly initialized", e); } } else { this.getLogger().warning("No endpoint exists to execute integration operations"); } } catch( final ActivitiException e ) { throw new JBIException( "An error occurred while creating the Activiti BPMN Engine.", e ); } finally { this.getLogger().fine("End ActivitiSE.doInit()"); } } @Override public void doStart() throws JBIException { this.getLogger().fine("Start ActivitiSE.doStart()"); this.scheduledLogger = Executors.newScheduledThreadPool(this.scheduledLoggerCoreSize, new ScheduledLoggerThreadFactory(ActivitiSE.this.getContext().getComponentName())); // Create & Register event listeners final RuntimeService runtimeService = this.activitiEngine.getRuntimeService(); this.processInstanceStartedEventListener = new ProcessInstanceStartedEventListener(this.getLogger()); runtimeService.addEventListener(this.processInstanceStartedEventListener, this.processInstanceStartedEventListener.getListenEventType()); this.processInstanceCompletedEventListener = new ProcessInstanceCompletedEventListener(this.scheduledLogger, this.monitTraceDelay, this.getLogger()); runtimeService.addEventListener(this.processInstanceCompletedEventListener, this.processInstanceCompletedEventListener.getListenEventType()); this.processInstanceCanceledEventListener = new ProcessInstanceCanceledEventListener(this.scheduledLogger, this.monitTraceDelay, this.getLogger()); runtimeService.addEventListener(this.processInstanceCanceledEventListener, this.processInstanceCanceledEventListener.getListenEventType()); this.serviceTaskStartedEventListener = new ServiceTaskStartedEventListener(this.getLogger()); runtimeService.addEventListener(this.serviceTaskStartedEventListener, this.serviceTaskStartedEventListener.getListenEventType()); try { // Startup Activiti engine against running states of the SE: // - Activiti Engine must be started when the SE is in state 'STOPPED' to be able to deploy process // definitions // - In state 'STOPPED', the SE will not process incoming requests, so no process instance creation and no // user task completion will occur // - To avoid the executions of activities trigerred by timer or other events, the Activiti job executor // must be stopped when the SE is in state 'STOPPED' if (this.enableActivitiJobExecutor) { if (this.activitiAsyncExecutor != null) { if (this.activitiAsyncExecutor.isActive()) { this.getLogger().warning("Activiti Job Executor already started !!"); } else { this.activitiAsyncExecutor.start(); } } else { this.getLogger().warning("No Activiti Job Executor exists !!"); } } else { this.getLogger().info("Activiti Job Executor not started because it is not activated."); } // TODO: Add JMX operation to start/stop the Activiti job executor when the component is started // TODO: Add JMX operation to disable/enable the Activiti job executor when the component is running } catch( final ActivitiException e ) { throw new JBIException( "An error occurred while starting the Activiti BPMN Engine.", e ); } finally { this.getLogger().fine("End ActivitiSE.doStart()"); } } @Override public void doStop() throws JBIException { this.getLogger().fine("Start ActivitiSE.doStop()"); try { // Stop the Activiti Job Executor */ if (this.enableActivitiJobExecutor) { if (this.activitiAsyncExecutor != null) { if (this.activitiAsyncExecutor.isActive()) { this.activitiAsyncExecutor.shutdown(); } else { this.getLogger().warning("Activiti Job Executor not started !!"); } } else { this.getLogger().warning("No Activiti Job Executor exists !!"); } } else { this.getLogger().info("Activiti Job Executor not stopped because it is not activated."); } } catch (final ActivitiException e) { throw new JBIException("An error occurred while stopping the Activiti BPMN Engine.", e); } finally { this.getLogger().fine("End ActivitiSE.doStop()"); } // Deregister event listeners final RuntimeService runtimeService = this.activitiEngine.getRuntimeService(); runtimeService.removeEventListener(this.processInstanceStartedEventListener); runtimeService.removeEventListener(this.processInstanceCompletedEventListener); runtimeService.removeEventListener(this.processInstanceCanceledEventListener); runtimeService.removeEventListener(this.serviceTaskStartedEventListener); try { this.scheduledLogger.shutdown(); // TODO: The timeout should be configurable this.scheduledLogger.awaitTermination(5000, TimeUnit.MILLISECONDS); } catch (final InterruptedException e) { this.getLogger().log(Level.WARNING, "The termination of the scheduled logger was interrupted", e); } } @Override public void doShutdown() throws JBIException { this.getLogger().fine("Start ActivitiSE.doShutdown()"); try { this.activitiEngine.close(); } catch( final ActivitiException e ) { throw new JBIException( "An error occurred while shutdowning the Activiti BPMN Engine.", e ); } finally { this.getLogger().fine("End ActivitiSE.doShutdown()"); } } @Override protected AbstractServiceUnitManager createServiceUnitManager() { return new ActivitiSuManager(this, this.enableActivitiBpmnValidation); } private void registerCxfPetalsTransport() { final Bus bus = BusFactory.getThreadDefaultBus(); final PetalsCxfTransportFactory cxfPetalsTransport = new PetalsCxfTransportFactory(); final ConduitInitiatorManager extension = bus.getExtension(ConduitInitiatorManager.class); extension.registerConduitInitiator(PetalsCxfTransportFactory.TRANSPORT_ID, cxfPetalsTransport); // TODO: Set a timeout at CXF client level (it should be the same than the tiemout at NMR level) // TODO: Add unit tests about timeout } }
package org.sahagin.runlib.srctreegen; import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Map; import org.apache.commons.lang3.tuple.Pair; import org.eclipse.jdt.core.dom.IAnnotationBinding; import org.eclipse.jdt.core.dom.IMemberValuePairBinding; import org.eclipse.jdt.core.dom.IMethodBinding; import org.eclipse.jdt.core.dom.ITypeBinding; import org.eclipse.jdt.core.dom.IVariableBinding; import org.sahagin.runlib.external.CaptureStyle; import org.sahagin.runlib.external.Locale; import org.sahagin.runlib.external.Page; import org.sahagin.runlib.external.Pages; import org.sahagin.runlib.external.TestDoc; import org.sahagin.runlib.external.TestDocs; import org.sahagin.share.AcceptableLocales; public class ASTUtils { // Get the method annotation whose class name is equals to annotationClass canonical name. // Return null if specified name annotation is not found. public static IAnnotationBinding getAnnotationBinding( IAnnotationBinding[] annotations, String annotationClassName) { if (annotations == null) { return null; } if (annotationClassName == null) { throw new NullPointerException(); } for (IAnnotationBinding annotation : annotations) { String qName = annotation.getAnnotationType().getBinaryName(); assert qName != null; if (qName.equals(annotationClassName)) { return annotation; } } return null; } // Get the method annotation whose class equals to annotationClass. // Return null if specified name annotation is not found. private static IAnnotationBinding getAnnotationBinding( IAnnotationBinding[] annotations, Class<?> annotationClass) { if (annotationClass == null) { throw new NullPointerException(); } return getAnnotationBinding(annotations, annotationClass.getCanonicalName()); } // returns null if specified varName annotation is not found private static Object getAnnotationValue(IAnnotationBinding annotation, String varName) { if (annotation == null) { throw new NullPointerException(); } if (varName == null) { throw new NullPointerException(); } for (IMemberValuePairBinding value : annotation.getDeclaredMemberValuePairs()) { if (value.getName() != null && value.getName().equals(varName)) { assert value.getValue() != null; // annotation value cannot be null assert !(value.getValue() instanceof IVariableBinding); return value.getValue(); } } return null; } // - for example, returns string "STEP_IN" for CaptureStyle.STEP_IN // returns null if specified varName annotation is not found private static String getEnumAnnotationFieldName(IAnnotationBinding annotation, String varName) { if (annotation == null) { throw new NullPointerException(); } if (varName == null) { throw new NullPointerException(); } for (IMemberValuePairBinding value : annotation.getDeclaredMemberValuePairs()) { if (value.getName() != null && value.getName().equals(varName)) { assert value.getValue() != null; // annotation value cannot be null assert value.getValue() instanceof IVariableBinding; IVariableBinding varBinding = (IVariableBinding) value.getValue(); assert varBinding.isEnumConstant(); return varBinding.getName(); } } return null; } // returns default value if varName value is not specified private static CaptureStyle getAnnotationCaptureStyleValue( IAnnotationBinding annotation, String varName) { String fieldName = getEnumAnnotationFieldName(annotation, varName); if (fieldName == null) { return CaptureStyle.getDefault(); } CaptureStyle resultCaptureStyle = CaptureStyle.valueOf(fieldName); if (resultCaptureStyle == null) { throw new RuntimeException("invalid captureStyle: " + fieldName); } return resultCaptureStyle; } // returns default value if varName value is not specified private static Locale getAnnotationLocaleValue( IAnnotationBinding annotation, String varName) { String fieldName = getEnumAnnotationFieldName(annotation, varName); if (fieldName == null) { return Locale.getDefault(); } Locale resultLocale = Locale.valueOf(fieldName); if (resultLocale == null) { throw new RuntimeException("invalid locale: " + fieldName); } return resultLocale; } // return empty list and null pair if no TestDoc is found private static Pair<Map<Locale, String>, CaptureStyle> getAllTestDocs( IAnnotationBinding[] annotations) { IAnnotationBinding testDocAnnotation = getAnnotationBinding(annotations, TestDoc.class); IAnnotationBinding testDocsAnnotation = getAnnotationBinding(annotations, TestDocs.class); if (testDocAnnotation != null && testDocsAnnotation != null) { throw new RuntimeException("don't use @TestDoc and @TestDocs at the same place"); } // all testDoc value on @TestDoc and @TestDocs List<IAnnotationBinding> allTestDocAnnotations = new ArrayList<IAnnotationBinding>(2); CaptureStyle resultCaptureStyle = null; if (testDocAnnotation != null) { // get @TestDoc allTestDocAnnotations.add(testDocAnnotation); resultCaptureStyle = getAnnotationCaptureStyleValue(testDocAnnotation, "capture"); } else if (testDocsAnnotation != null) { // get @TestDoc from @TestDocs Object value = getAnnotationValue(testDocsAnnotation, "value"); Object[] values = (Object[]) value; for (Object element : values) { IAnnotationBinding binding = (IAnnotationBinding) element; if (getEnumAnnotationFieldName(binding, "capture") != null) { throw new RuntimeException( "capture must be set on not @TestDoc but @TestDocs"); } allTestDocAnnotations.add(binding); } resultCaptureStyle = getAnnotationCaptureStyleValue(testDocsAnnotation, "capture"); } // get resultTestDocMap Map<Locale, String> resultTestDocMap = new HashMap<Locale, String>(allTestDocAnnotations.size()); for (IAnnotationBinding eachTestDocAnnotation : allTestDocAnnotations) { Object value = getAnnotationValue(eachTestDocAnnotation, "value"); Locale locale = getAnnotationLocaleValue(eachTestDocAnnotation, "locale"); resultTestDocMap.put(locale, (String) value); } return Pair.of(resultTestDocMap, resultCaptureStyle); } // return empty list and null pair if no Page is found private static Map<Locale, String> getAllPageTestDocs( IAnnotationBinding[] annotations) { IAnnotationBinding pageAnnotation = getAnnotationBinding(annotations, Page.class); IAnnotationBinding pagesAnnotation = getAnnotationBinding(annotations, Pages.class); if (pageAnnotation != null && pagesAnnotation != null) { throw new RuntimeException("don't use @Page and @Pages at the same place"); } // all testDoc value on @Page and @Pages List<IAnnotationBinding> allPageAnnotations = new ArrayList<IAnnotationBinding>(2); if (pageAnnotation != null) { // get @Page allPageAnnotations.add(pageAnnotation); } else if (pagesAnnotation != null) { // get @Page from @Pages Object value = getAnnotationValue(pagesAnnotation, "value"); Object[] values = (Object[]) value; for (Object element : values) { allPageAnnotations.add((IAnnotationBinding) element); } } // get resultPageMap Map<Locale, String> resultPageMap = new HashMap<Locale, String>(allPageAnnotations.size()); for (IAnnotationBinding eachPageAnnotation : allPageAnnotations) { Object value = getAnnotationValue(eachPageAnnotation, "value"); Locale locale = getAnnotationLocaleValue(eachPageAnnotation, "locale"); resultPageMap.put(locale, (String) value); } return resultPageMap; } // first... value // second... captureStyle value. // return null pair if no TestDoc is found private static Pair<String, CaptureStyle> getTestDoc( IAnnotationBinding[] annotations, AcceptableLocales locales) { Pair<Map<Locale, String>, CaptureStyle> allTestDocs = getAllTestDocs(annotations); Map<Locale, String> testDocMap = allTestDocs.getLeft(); if (testDocMap.isEmpty()) { return Pair.of(null, null); // no @TestDoc found } String testDoc = null; for (Locale locale : locales.getLocales()) { String value = testDocMap.get(locale); if (value != null) { testDoc = value; break; } } if (testDoc == null) { // set empty string if no locale matched data is found return Pair.of("", allTestDocs.getRight()); } else { return Pair.of(testDoc, allTestDocs.getRight()); } } // return null if no Page found private static String getPageTestDoc( IAnnotationBinding[] annotations, AcceptableLocales locales) { Map<Locale, String> allPages = getAllPageTestDocs(annotations); if (allPages.isEmpty()) { return null; // no @Page found } for (Locale locale : locales.getLocales()) { String value = allPages.get(locale); if (value != null) { return value; } } // set empty string if no locale matched data is found return ""; } // return null if not found public static String getPageTestDoc(ITypeBinding type, AcceptableLocales locales) { return getPageTestDoc(type.getAnnotations(), locales); } // return null if not found public static String getTestDoc(ITypeBinding type, AcceptableLocales locales) { Pair<String, CaptureStyle> pair = getTestDoc(type.getAnnotations(), locales); return pair.getLeft(); } // return null pair if not found public static Pair<String, CaptureStyle> getTestDoc( IMethodBinding method, AcceptableLocales locales) { return getTestDoc(method.getAnnotations(), locales); } public static String getTestDoc( IVariableBinding variable, AcceptableLocales locales) { return getTestDoc(variable.getAnnotations(), locales).getLeft(); } }
package com.googlecode.jmxtrans.model.output; import com.googlecode.jmxtrans.model.Query; import com.googlecode.jmxtrans.model.Result; import com.googlecode.jmxtrans.util.BaseOutputWriter; import com.googlecode.jmxtrans.util.ValidationException; import org.apache.commons.lang.StringUtils; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import java.io.BufferedReader; import java.io.DataOutputStream; import java.io.InputStreamReader; import java.net.Socket; import java.net.UnknownHostException; import java.util.LinkedList; import java.util.List; import java.util.Map; public class OpenTSDBWriter extends BaseOutputWriter { private static final Logger log = LoggerFactory.getLogger(OpenTSDBWriter.class); private String host; private Integer port; private Map<String, String> tags; private String tagName; String addTags(String resultString) throws UnknownHostException { resultString = addTag(resultString, "host", java.net.InetAddress.getLocalHost().getHostName()); if (tags != null) for (Map.Entry<String, String> tagEntry : tags.entrySet()) { resultString = addTag(resultString, tagEntry.getKey(), tagEntry.getValue()); } return resultString; } String addTag(String resultString, String tagName, String tagValue) { String tagFormat = " %s=%s"; resultString += String.format(tagFormat, tagName, tagValue); return resultString; } String getResultString(String className, String attributeName, long epoch, Object value) { String resultStringFormat = "put %s.%s %d %s"; return String.format(resultStringFormat, className, attributeName, epoch, value); } String getResultString(String className, String attributeName, long epoch, Object value, String tagName, String tagValue) { String taggedResultStringFormat = "put %s.%s %d %s %s=%s"; return String.format(taggedResultStringFormat, className, attributeName, epoch, value, tagName, tagValue); } List<String> resultParser(Result result) throws UnknownHostException { List<String> resultStrings = new LinkedList<String>(); Map<String, Object> values = result.getValues(); if (values == null) return resultStrings; String attributeName = result.getAttributeName(); String className = result.getClassNameAlias() == null ? result.getClassName() : result.getClassNameAlias(); if (values.containsKey(attributeName) && values.size() == 1) { String resultString = getResultString(className, attributeName, (long)(result.getEpoch()/1000L), values.get(attributeName)); resultString = addTags(resultString); if (getTypeNames().size() > 0) { resultString = addTag(resultString, StringUtils.join(getTypeNames(), ""), getConcatedTypeNameValues(result.getTypeName())); } resultStrings.add(resultString); } else { for (Map.Entry<String, Object> valueEntry: values.entrySet() ) { String resultString = getResultString(className, attributeName, (long)(result.getEpoch()/1000L), valueEntry.getValue(), tagName, valueEntry.getKey()); resultString = addTags(resultString); if (getTypeNames().size() > 0) { resultString = addTag(resultString, StringUtils.join(getTypeNames(), ""), getConcatedTypeNameValues(result.getTypeName())); } resultStrings.add(resultString); } } return resultStrings; } @Override public void doWrite(Query query) throws Exception { Socket socket = new Socket(host, port); DataOutputStream out = new DataOutputStream( socket.getOutputStream()); for (Result result : query.getResults()) { for(String resultString: resultParser(result)) { if (isDebugEnabled()) System.out.println(resultString); out.writeBytes(resultString + "\n"); } } socket.close(); } @Override public void validateSetup(Query query) throws ValidationException { host = (String) this.getSettings().get(HOST); port = (Integer) this.getSettings().get(PORT); tags = (Map<String, String>) this.getSettings().get("tags"); tagName = this.getStringSetting("tagName", "type"); } }
package com.hp.hpl.jena.db.impl; import java.util.ArrayList; import java.util.Iterator; import java.util.List; import com.hp.hpl.jena.graph.*; import com.hp.hpl.jena.util.iterator.ExtendedIterator; import com.hp.hpl.jena.util.iterator.MapFiller; import com.hp.hpl.jena.util.iterator.MapMany; /** * @author hkuno * @version $Version$ * * TripleStoreGraph is an abstract superclass for TripleStoreGraph * implementations. By "triple store," we mean that the subjects, predicate * and object URI's are stored in a single collection (denormalized). * */ public class SpecializedGraphReifier_RDB implements SpecializedGraphReifier { /** * holds PSet */ public IPSet m_pset; /** * caches a copy of LSet properties */ public DBPropLSet m_dbPropLSet; /** * holds ID of graph in database (defaults to "0") */ public IDBID my_GID = new DBIDInt(0); // lset name private String m_lsetName; // lset classname private String m_className; // cache of reified statement status private ReifCacheMap m_reifCache; public PSet_ReifStore_RDB m_reif; // constructors /** * Constructor * Create a new instance of a TripleStore graph. */ SpecializedGraphReifier_RDB(DBPropLSet lProp, IPSet pSet) { m_pset = pSet; m_dbPropLSet = lProp; m_reifCache = new ReifCacheMap(1); m_reif = (PSet_ReifStore_RDB) m_pset; } /** * Constructor * * Create a new instance of a TripleStore graph, taking * DBPropLSet and a PSet as arguments */ public SpecializedGraphReifier_RDB(IPSet pSet) { m_pset = pSet; m_reifCache = new ReifCacheMap(1); m_reif = (PSet_ReifStore_RDB) m_pset; } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraphReifier#add(com.hp.hpl.jena.graph.Node, com.hp.hpl.jena.graph.Triple, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void add(Node n, Triple t, CompletionFlag complete) throws Reifier.AlreadyReifiedException { ReifCache rs = m_reifCache.load((Node_URI) t.getSubject()); if (rs != null) throw new Reifier.AlreadyReifiedException(n); m_reif.storeReifStmt(n, t, my_GID); complete.setDone(); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraphReifier#delete(com.hp.hpl.jena.graph.Node, com.hp.hpl.jena.graph.Triple, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void delete(Node n, Triple t, CompletionFlag complete) { m_reifCache.flushAll(); m_reif.deleteReifStmt( n, t, my_GID); complete.setDone(); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraphReifier#contains(com.hp.hpl.jena.graph.Node, com.hp.hpl.jena.graph.Triple, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public boolean contains(Node n, Triple t, CompletionFlag complete) { if ( true ) throw new RuntimeException("SpecializedGraphReifier.contains called"); return false; } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraphReifier#findReifiedNodes(com.hp.hpl.jena.graph.TripleMatch, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public ExtendedIterator findReifiedNodes(Triple t, CompletionFlag complete) { complete.setDone(); return m_reif.findReifStmtURIByTriple(t, my_GID); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraphReifier#findReifiedTriple(com.hp.hpl.jena.graph.Node, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public Triple findReifiedTriple(Node n, CompletionFlag complete) { ExtendedIterator it = m_reif.findReifStmt(n, true, my_GID); Triple res = null; if ( it.hasNext() ) { List l = (List) it.next(); if ( !it.hasNext() ) res = new Triple((Node)l.get(1), (Node)l.get(2), (Node)l.get(3)); } complete.setDone(); return res; } /** Find all the triples corresponding to a given reified node. * In a perfect world, there would only ever be one, but when a user calls * add(Triple) there is nothing in RDF that prevents them from adding several * subjects,predicates or objects for the same statement. * * The resulting Triples may be incomplete, in which case some of the * nodes may be Node_ANY. * * For example, if an application had previously done: * add( new Triple( a, rdf.subject A )) and * add( new Triple( a, rdf.object B )) and * add( new Triple( a, rdf.object B2 )) * * Then the result of findReifiedTriple(a, flag) will be an iterator containing * Triple(A, ANY, B) and Triple(ANY, ANY, B2). * * @param n is the Node for which we are querying. * @param complete is true if we know we've returned all the triples which may exist. * @return ExtendedIterator. */ public ExtendedIterator findReifiedTriples(Node n, CompletionFlag complete) { complete.setDone(); return m_reif.findReifStmt(n, false, my_GID); } /** * Attempt to add all the triples from a graph to the specialized graph * * Caution - this call changes the graph passed in, deleting from * it each triple that is successfully added. * * Node that when calling add, if complete is true, then the entire * graph was added successfully and the graph g will be empty upon * return. If complete is false, then some triples in the graph could * not be added. Those triples remain in g after the call returns. * * If the triple can't be stored for any reason other than incompatability * (for example, a lack of disk space) then the implemenation should throw * a runtime exception. * * @param g is a graph containing triples to be added * @param complete is true if a subsequent call to contains(triple) will return true for any triple in g. */ public void add(Graph g, CompletionFlag complete) { throw new RuntimeException("sorry, not implemented"); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#add(com.hp.hpl.jena.graph.Triple, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void add(Triple frag, CompletionFlag complete) throws Reifier.AlreadyReifiedException { StmtMask fragMask = new StmtMask(frag); if (fragMask.hasNada()) return; boolean fragHasType = fragMask.hasType(); Node stmtURI = frag.getSubject(); ReifCache cachedFrag = m_reifCache.load(stmtURI); if (cachedFrag == null) { // not in database m_reif.storeFrag(stmtURI, frag, fragMask, my_GID); complete.setDone(); } else { StmtMask cachedMask = cachedFrag.getStmtMask(); if (cachedMask.hasIntersect(fragMask)) { // see if this is a duplicate fragment boolean dup = fragHasType && cachedMask.hasType(); if (dup == false) { // not a type fragement; have to search db ExtendedIterator it = m_reif.findFrag (stmtURI, frag, fragMask, my_GID); dup = it.hasNext(); } if (!dup && cachedMask.isStmt()) { throw new Reifier.AlreadyReifiedException(frag.getSubject()); } // cannot perform a reificiation m_reif.storeFrag(stmtURI, frag, fragMask, my_GID); m_reifCache.flush(cachedFrag); } else { // reification may be possible; update if possible, else compact if (cachedFrag.canMerge(fragMask)) { if ( cachedFrag.canUpdate(fragMask) ) { m_reif.updateFrag(stmtURI, frag, fragMask, my_GID); cachedFrag.setMerge(fragMask); } else fragCompact(stmtURI); } else { // reification not possible m_reif.storeFrag(stmtURI, frag, fragMask, my_GID); } } } complete.setDone(); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#delete(com.hp.hpl.jena.graph.Triple, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void delete(Triple frag, CompletionFlag complete) { StmtMask fragMask = new StmtMask(frag); if (fragMask.hasNada()) return; boolean fragHasType = fragMask.hasType(); Node stmtURI = frag.getSubject(); ResultSetTripleIterator it = m_reif.findFrag(stmtURI, frag, fragMask, my_GID); if ( it.hasNext() ) { it.next(); Triple dbFrag = it.m_triple; StmtMask dbMask = new StmtMask(dbFrag); if ( dbMask.equals(fragMask) ) { /* last fragment in this tuple; can just delete it */ it.deleteRow(); it.close(); } else { /* remove fragment from row */ m_reif.nullifyFrag(stmtURI, fragMask, my_GID); /* compact remaining fragments, if possible */ it.close(); fragCompact(stmtURI); } // remove cache entry, if any ReifCache cachedFrag = m_reifCache.lookup(stmtURI); if ( cachedFrag != null ) m_reifCache.flush(cachedFrag); } complete.setDone(); } /* fragCompact * * Compact fragments for a given statement URI. * * first, find the unique row for stmtURI that with the HasType Statement fragment. * if no such row exists, we are done. then, get all fragments for stmtURI and * try to merge them with the hasType fragment, deleting each as they are merged. */ protected void fragCompact ( Node stmtURI ) { ResultSetTripleIterator itHasType; itHasType = m_reif.findReifStmt(stmtURI,true,my_GID); if ( itHasType.hasNext() ) { /* something to do */ itHasType.next(); if ( itHasType.hasNext() ) throw new RuntimeException("Multiple HasType fragments for URI"); StmtMask htMask = new StmtMask(itHasType.m_triple); itHasType.close(); // now, look at fragments and try to merge them with the hasType fragement ResultSetTripleIterator itFrag = m_reif.findReifStmt(stmtURI,false,my_GID); StmtMask upMask = new StmtMask(); while ( itFrag.hasNext() ) { StmtMask fm = new StmtMask(itFrag.m_triple); if ( fm.hasType() ) continue; // got the hasType fragment again if ( htMask.hasIntersect(fm) ) break; // can't merge all fragments // at this point, we can merge in the current fragment m_reif.updateFrag(stmtURI, itFrag.m_triple, fm, my_GID); htMask.setMerge(fm); itFrag.deleteRow(); } } } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#add(java.util.List, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void add(List triples, CompletionFlag complete) { ArrayList remainingTriples = new ArrayList(); for( int i=0; i< triples.size(); i++) { CompletionFlag partialResult = new CompletionFlag(); add( (Triple)triples.get(i), partialResult); if( !partialResult.isDone()) remainingTriples.add(triples.get(i)); } triples.clear(); if( remainingTriples.isEmpty()) complete.setDone(); else triples.addAll(remainingTriples); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#delete(java.util.List, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public void delete(List triples, CompletionFlag complete) { boolean result = true; Iterator it = triples.iterator(); while(it.hasNext()) { CompletionFlag partialResult = new CompletionFlag(); delete( (Triple)it.next(), partialResult); result = result && partialResult.isDone(); } if( result ) complete.setDone(); } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#tripleCount() */ public int tripleCount() { // A very inefficient, but simple implementation ExtendedIterator it = find(new StandardTripleMatch(null, null, null), new CompletionFlag()); int count = 0; while (it.hasNext()) { count++; } it.close(); return count; } /* (non-Javadoc) * @see com.hp.hpl.jena.db.impl.SpecializedGraph#find(com.hp.hpl.jena.graph.TripleMatch, com.hp.hpl.jena.db.impl.SpecializedGraph.CompletionFlag) */ public ExtendedIterator find(TripleMatch t, CompletionFlag complete) { Node stmtURI = t.getSubject(); // note: can be null ExtendedIterator nodes = m_reif.findReifNodes(stmtURI, my_GID); ExtendedIterator allTriples = new MapMany(nodes, new ExpandReifiedTriples(this)); return allTriples.filterKeep(new TripleMatchFilter(t)); } public class ExpandReifiedTriples implements MapFiller { SpecializedGraphReifier_RDB m_sgr; ExpandReifiedTriples( SpecializedGraphReifier_RDB sgr) { m_sgr = sgr; } /* (non-Javadoc) * @see com.hp.hpl.jena.util.iterator.MapFiller#refill(java.lang.Object, java.util.ArrayList) */ public boolean refill(Object x, ArrayList pending) { Node node = (Node) x; boolean addedToPending = false; ResultSetTripleIterator it = m_reif.findReifStmt(node, false, my_GID); while( it.hasNext()) { it.next(); if ( it.getHasType() ) { pending.add( new Triple( node, Reifier.type, Reifier.Statement )); addedToPending = true; } Triple t = (Triple)it.getRow(); if( !t.getSubject().equals(Node.ANY)) { pending.add( new Triple( node, Reifier.subject, t.getSubject() )); addedToPending = true; } if( !t.getPredicate().equals(Node.ANY)) { pending.add( new Triple( node, Reifier.predicate, t.getPredicate() )); addedToPending = true; } if( !t.getObject().equals(Node.ANY)) { pending.add( new Triple( node, Reifier.object, t.getObject() )); addedToPending = true; } } return addedToPending; } } /** * Tests if a triple is contained in the specialized graph. * @param t is the triple to be tested * @param complete is true if the graph can guarantee that * no other specialized graph * could hold any matching triples. * @return boolean result to indicte if the tripple was contained */ public boolean contains(Triple t, CompletionFlag complete) { // A very inefficient, but simple implementation TripleMatch m = new StandardTripleMatch(t.getSubject(), t.getPredicate(), t.getObject()); ExtendedIterator it = find(m, complete); boolean result = it.hasNext(); it.close(); return result; } /* * @see com.hp.hpl.jena.db.impl.SpecializedGraph#getLSetName() */ public String getLSetName() { return m_lsetName; } /* * @see com.hp.hpl.jena.db.impl.SpecializedGraph#getClassName() */ public String getClassName() { return m_className; } /* * @see com.hp.hpl.jena.db.impl.SpecializedGraph#close() */ public void close() { m_reif.close(); } /* * @see com.hp.hpl.jena.db.impl.SpecializedGraph#clear() */ public void clear() { m_reif.removeStatementsFromDB(my_GID); } public class ReifCacheMap { protected int cacheSize = 1; protected ReifCache[] cache; protected boolean[] inUse; ReifCacheMap(int size) { int i; inUse = new boolean[size]; for (i = 0; i < size; i++) inUse[i] = false; } ReifCache lookup(Node stmtURI) { int i; for (i = 0; i < cacheSize; i++) { if (inUse[i] && (cache[i].getStmtURI().equals(stmtURI))) return cache[i]; } return null; } public void flushAll() { int i; for (i = 0; i < cacheSize; i++) inUse[i] = false; } public void flush(ReifCache entry) { flushAll(); // optimize later } public ReifCache load(Node stmtURI) { ReifCache entry = lookup(stmtURI); if (entry != null) return entry; flushAll(); StmtMask m = new StmtMask(); Triple t; int cnt = 0; ResultSetTripleIterator it = m_reif.findReifStmt(stmtURI,false,my_GID); while (it.hasNext()) { cnt++; StmtMask n = new StmtMask((Triple) it.next()); if ( it.getHasType() ) n.setHasType(); if ( n.hasNada() ) throw new RuntimeException("Fragment has no data"); m.setMerge(n); } if (m.hasSPOT() && (cnt == 1)) m.setIsStmt(); inUse[0] = true; cache[0] = new ReifCache(stmtURI, m, cnt); return cache[0]; } protected Triple fragToTriple(Triple t, StmtMask s) { Triple res; Node_URI n = (Node_URI) t.getSubject(); if (s.hasProp()) return new Triple(n, t.getPredicate(), Node.ANY); else if (s.hasObj()) return new Triple(n, Node.ANY, t.getObject()); else return new Triple(n, Node.ANY, Node.ANY); } } class ReifCache { protected Node stmtURI; protected StmtMask mask; protected int tripleCnt; ReifCache( Node s, StmtMask m, int cnt ) { stmtURI = s; mask = m; tripleCnt = cnt; } public StmtMask getStmtMask() { return mask; } public int getCnt() { return tripleCnt; } public Node getStmtURI() { return stmtURI; } public void setMask ( StmtMask m ) { mask = m; } public void setCnt ( int cnt ) { tripleCnt = cnt; } public void incCnt ( int cnt ) { tripleCnt++; } public void decCnt ( int cnt ) { tripleCnt public boolean canMerge ( StmtMask fragMask ) { return (!mask.hasIntersect(fragMask)); } public boolean canUpdate ( StmtMask fragMask ) { return ( canMerge(fragMask) && (tripleCnt == 1)); } public void setMerge ( StmtMask fragMask ) { mask.setMerge(fragMask); } } static boolean isReifProp ( Node_URI p ) { return p.equals(Reifier.subject) || p.equals(Reifier.predicate)|| p.equals(Reifier.object) || p.equals(Reifier.type); } class StmtMask { protected int mask; public static final int HasSubj = 1; public static final int HasProp = 2; public static final int HasObj = 4; public static final int HasType = 8; public static final int HasSPOT = 15; public static final int IsStmt = 16; public static final int HasNada = 0; public boolean hasSubj () { return (mask ^ HasSubj) == HasSubj; }; public boolean hasProp () { return (mask ^ HasProp) == HasProp; }; public boolean hasObj () { return (mask ^ HasObj) == HasObj; }; public boolean hasType () { return (mask ^ HasType) == HasType; }; public boolean hasSPOT () { return (mask ^ HasSPOT) == HasSPOT; }; public boolean isStmt () { return (mask ^ IsStmt) == IsStmt; }; public boolean hasNada () { return mask == HasNada; }; public boolean hasOneBit () { return ( (mask == HasSubj) || (mask == HasProp) || (mask == HasObj) || ( mask == HasType) ); } // note: have SPOT does not imply a reification since // 1) there may be multiple fragments for prop, obj // 2) the fragments may be in multiple tuples StmtMask ( Triple t ) { mask = HasNada; Node_URI p = (Node_URI) t.getPredicate(); if ( p != null ) { if ( p.equals(Reifier.subject) ) mask = HasSubj; else if ( p.equals(Reifier.predicate) ) mask = HasProp; else if ( p.equals(Reifier.object) ) mask = HasObj; else if ( p.equals(Reifier.type) ) { Node_URI o = (Node_URI) t.getObject(); if ( o.equals(Reifier.Statement) ) mask = HasType; } } } StmtMask () { mask = HasNada; }; public void setMerge ( StmtMask m ) { mask |= m.mask; } public void setHasType () { mask |= HasType; } public void setIsStmt () { mask |= IsStmt; } public boolean hasIntersect ( StmtMask m ) { return (mask & m.mask) != 0; } public boolean equals ( StmtMask m ) { return mask == m.mask; } } }
package org.spongepowered.api.entity; import com.flowpowered.math.imaginary.Quaterniond; import com.flowpowered.math.matrix.Matrix4d; import com.flowpowered.math.vector.Vector3d; import org.spongepowered.api.Sponge; import org.spongepowered.api.world.Location; import org.spongepowered.api.world.World; public interface Transform { static Transform of(World world) { return Sponge.getRegistry().requireFactory(Factory.class).create(Location.of(world, Vector3d.ZERO), Vector3d.ZERO, Vector3d.ONE); } static Transform of(Location location) { return Sponge.getRegistry().requireFactory(Factory.class).create(location, Vector3d.ZERO, Vector3d.ONE); } static Transform of(World world, Vector3d position) { return Sponge.getRegistry().requireFactory(Factory.class).create(Location.of(world, position), Vector3d.ZERO, Vector3d.ONE); } static Transform of(World world, Vector3d position, Vector3d rotation) { return Sponge.getRegistry().requireFactory(Factory.class).create(Location.of(world, position), rotation, Vector3d.ONE); } static Transform of(Location location, Vector3d rotation, Vector3d scale) { return Sponge.getRegistry().requireFactory(Factory.class).create(location, rotation, scale); } boolean isValid(); Location getLocation(); /** * Creates a copy of this transform and sets the {@link Location}. * * @param location The new location * @return A new transform */ Transform withLocation(Location location); World getWorld(); /** * Creates a copy of this transform and sets the {@link World}. * * @param world The new world * @return A new transform */ Transform withWorld(World world); /** * Gets the coordinates of this transform. * * @return The coordinates */ Vector3d getPosition(); /** * Creates a copy of this transform while setting the position of the new * one. * * @param position The position * @return A new transform */ Transform withPosition(Vector3d position); /** * Gets the rotation of this transform, as a {@link Vector3d}. * * <p>The format of the rotation is represented by:</p> * <ul> * <li><code>x -> pitch</code></li> * <li><code>y -> yaw</code></li> * <li><code>z -> roll</code></li> * </ul> * * @return The rotation vector */ Vector3d getRotation(); /** * Creates a copy of this transform and sets the rotation as a quaternion. * * <p>Quaternions are objectively better than the Euler angles preferred by * Minecraft. This is for compatibility with the flow-math library.</p> * * @param rotation The new rotation * @return A new transform */ Transform withRotation(Vector3d rotation); /** * Creates a copy of this transform and sets the rotation. * * <p>The format of the rotation is represented by:</p> * <ul> * <li><code>x -> pitch</code></li> * <li><code>y -> yaw</code></li> * <li><code>z -> roll</code></li> * </ul> * * @param rotation The new rotation * @return A new transform */ Transform withRotation(Quaterniond rotation); /** * Returns the rotation as a quaternion. * * <p>Quaternions are objectively better than the Euler angles preferred by * Minecraft. This is for compatibility with the flow-math library.</p> * * @return The rotation */ Quaterniond getRotationAsQuaternion(); /** * Gets the pitch component of this transform rotation. * * @return The pitch */ double getPitch(); /** * Gets the yaw component of this transform rotation. * * @return The yaw */ double getYaw(); /** * Gets the roll component of this transform rotation. * * @return The roll */ double getRoll(); /** * Gets the scale of the transform for each axis. * * @return The scale */ Vector3d getScale(); /** * Creates a copy of this transform and sets the scale for each axis. * * @param scale The scale * @return A new transform */ Transform withScale(Vector3d scale); /** * "Adds" another transform to this one. This is equivalent to adding the * translation, rotation and scale individually. * * <p>Returns the results as a new copy.</p> * * @param other The transform to add * @return A new transform */ Transform add(Transform other); /** * Adds a translation to this transform. * * <p>Returns the results as a new copy.</p> * * @param translation The translation to add * @return A new transform */ Transform translate(Vector3d translation); /** * Adds a rotation to this transform. Returns the results as a new copy. * * @param rotation The rotation to add * @return A new transform */ Transform rotate(Vector3d rotation); /** * Adds a rotation to this transform. * * <p>Quaternions are objectively better than the Euler angles preferred by * Minecraft. This is the preferred method when dealing with rotation * additions. This is for compatibility with the flow-math library.</p> * * <p>Returns the results as a new copy.</p> * * @param rotation The rotation to add * @return A new transform */ Transform rotate(Quaterniond rotation); /** * "Adds" a scale to this transform. Scales are multiplicative, so this * actually multiplies the current scale. * * <p>Returns the results as a new copy.</p> * * @param scale The scale to add * @return A new transform */ Transform scale(Vector3d scale); /** * Returns a matrix representation of this transform. * * <p>This includes the position, rotation and scale. To apply the transform * to a vector, use the following:</p> * * <blockquote><code>Vector3d original = ...;<br /> * Transform transform = ...;<br /><br /> * Vector3d transformed = * transform.toMatrix().transform(original.toVector4(1)).toVector3();<br /> * }</code></blockquote> * * <p>This converts the original 3D vector to 4D by appending 1 as the w * coordinate, applies the transformation, then converts it back to 3D by * dropping the w coordinate.</p> * * <p>Using a 4D matrix and a w coordinate with value 1 is what allows for * the position to be included in the transformation applied by the matrix. * </p> * * @return The transform as a matrix */ Matrix4d toMatrix(); interface Factory { Transform create(Location location, Vector3d rotation, Vector3d scale); } }
package com.michaldabski.filemanager.folders; import java.io.File; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.Collection; import java.util.HashSet; import java.util.List; import android.app.AlertDialog; import android.app.Dialog; import android.app.Fragment; import android.app.ProgressDialog; import android.content.ActivityNotFoundException; import android.content.DialogInterface; import android.content.DialogInterface.OnClickListener; import android.content.Intent; import android.net.Uri; import android.os.AsyncTask; import android.os.Build; import android.os.Bundle; import android.text.TextUtils; import android.util.Log; import android.view.ActionMode; import android.view.LayoutInflater; import android.view.Menu; import android.view.MenuInflater; import android.view.MenuItem; import android.view.View; import android.view.ViewGroup; import android.view.WindowManager; import android.widget.AbsListView; import android.widget.AbsListView.MultiChoiceModeListener; import android.widget.AbsListView.OnScrollListener; import android.widget.AdapterView; import android.widget.AdapterView.OnItemClickListener; import android.widget.AdapterView.OnItemLongClickListener; import android.widget.EditText; import android.widget.HeaderViewListAdapter; import android.widget.ListAdapter; import android.widget.ListView; import android.widget.ShareActionProvider; import android.widget.TextView; import android.widget.Toast; import com.michaldabski.filemanager.AppPreferences; import com.michaldabski.filemanager.FileManagerApplication; import com.michaldabski.filemanager.R; import com.michaldabski.filemanager.clipboard.Clipboard; import com.michaldabski.filemanager.clipboard.Clipboard.FileAction; import com.michaldabski.filemanager.clipboard.FileOperationListener; import com.michaldabski.filemanager.favourites.FavouriteFolder; import com.michaldabski.filemanager.favourites.FavouritesManager; import com.michaldabski.filemanager.favourites.FavouritesManager.FolderAlreadyFavouriteException; import com.michaldabski.filemanager.folders.FileAdapter.OnFileSelectedListener; import com.michaldabski.utils.AsyncResult; import com.michaldabski.utils.FilePreviewCache; import com.michaldabski.utils.FileUtils; import com.michaldabski.utils.FontApplicator; import com.michaldabski.utils.IntentUtils; import com.michaldabski.utils.ListViewUtils; import com.michaldabski.utils.OnResultListener; public class FolderFragment extends Fragment implements OnItemClickListener, OnScrollListener, OnItemLongClickListener, MultiChoiceModeListener, OnFileSelectedListener { private static final String LOG_TAG = "FolderFragment"; private final int DISTANCE_TO_HIDE_ACTIONBAR = 0; public static final String EXTRA_DIR = "directory", EXTRA_SELECTED_FILES = "selected_files", EXTRA_SCROLL_POSITION = "scroll_position"; File currentDir, nextDir = null; int topVisibleItem=0; List<File> files = null; @SuppressWarnings("rawtypes") AsyncTask loadFilesTask=null; ListView listView = null; FileAdapter fileAdapter; private ActionMode actionMode = null; private final HashSet<File> selectedFiles = new HashSet<File>(); private ShareActionProvider shareActionProvider; // set to true when selection shouldnt be cleared from switching out fragments boolean preserveSelection = false; FilePreviewCache thumbCache; public ListView getListView() { return listView; } private void setListAdapter(FileAdapter fileAdapter) { this.fileAdapter = fileAdapter; if (listView != null) { listView.setAdapter(fileAdapter); listView.setSelection(topVisibleItem); getView().findViewById(R.id.layoutMessage).setVisibility(View.GONE); listView.setVisibility(View.VISIBLE); } } FontApplicator getFontApplicator() { FolderActivity folderActivity = (FolderActivity) getActivity(); return folderActivity.getFontApplicator(); } void showProgress() { if (getView() != null) { getListView().setVisibility(View.GONE); getView().findViewById(R.id.layoutMessage).setVisibility(View.VISIBLE); getView().findViewById(R.id.tvMessage).setVisibility(View.GONE); } } FileManagerApplication getApplication() { if (getActivity() == null) return null; return (FileManagerApplication) getActivity().getApplication(); } AppPreferences getPreferences() { if (getApplication() == null) return null; return getApplication().getAppPreferences(); } @SuppressWarnings("unchecked") @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setRetainInstance(true); Log.d(LOG_TAG, "Fragment created"); if (savedInstanceState != null) { this.topVisibleItem = savedInstanceState.getInt(EXTRA_SCROLL_POSITION, 0); this.selectedFiles.addAll((HashSet<File>) savedInstanceState.getSerializable(EXTRA_SELECTED_FILES)); } Bundle arguments = getArguments(); if (arguments != null && arguments.containsKey(EXTRA_DIR)) currentDir = new File(arguments.getString(EXTRA_DIR)); else currentDir = getPreferences().getStartFolder(); setHasOptionsMenu(true); loadFileList(); } void showMessage(CharSequence message) { View view = getView(); if (view != null) { getListView().setVisibility(View.GONE); view.findViewById(R.id.layoutMessage).setVisibility(View.VISIBLE); view.findViewById(R.id.progress).setVisibility(View.GONE); TextView tvMessage = (TextView) view.findViewById(R.id.tvMessage); tvMessage.setText(message); } } void showMessage(int message) { showMessage(getString(message)); } void showList() { getListView().setVisibility(View.VISIBLE); getView().findViewById(R.id.layoutMessage).setVisibility(View.GONE); } @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { View view = inflater.inflate(R.layout.fragment_list, container, false); this.listView = (ListView) view.findViewById(android.R.id.list); if (Build.VERSION.SDK_INT >= Build.VERSION_CODES.KITKAT) listView.setFastScrollAlwaysVisible(true); return view; } @Override public void onLowMemory() { super.onLowMemory(); if (thumbCache != null) { if (getView() == null) thumbCache.evictAll(); else thumbCache.trimToSize(1024*1024); } } void loadFileList() { if (loadFilesTask != null) return; this.loadFilesTask = new AsyncTask<File, Void, AsyncResult<File[]>>() { @Override protected AsyncResult<File[]> doInBackground(File... params) { try { File[] files =params[0].listFiles(FileUtils.DEFAULT_FILE_FILTER); if (files == null) throw new NullPointerException(getString(R.string.cannot_read_directory_s, params[0].getName())); if (isCancelled()) throw new Exception("Task cancelled"); Arrays.sort(files, getPreferences().getFileSortingComparator()); return new AsyncResult<File[]>(files); } catch (Exception e) { return new AsyncResult<File[]>(e); } } @Override protected void onCancelled(AsyncResult<File[]> result) { loadFilesTask = null; } @Override protected void onPostExecute(AsyncResult<File[]> result) { Log.d("folder fragment", "Task finished"); loadFilesTask = null; FileAdapter adapter; try { files = Arrays.asList(result.getResult()); if (files.isEmpty()) { showMessage(R.string.folder_empty); return; } adapter = new FileAdapter(getActivity(), files, getApplication().getFileIconResolver()); final int cardPreference = getPreferences().getCardLayout(); if (cardPreference == AppPreferences.CARD_LAYOUT_ALWAYS || (cardPreference == AppPreferences.CARD_LAYOUT_MEDIA && FileUtils.isMediaDirectory(currentDir))) { if (thumbCache == null) thumbCache = new FilePreviewCache(); adapter = new FileCardAdapter(getActivity(), files, thumbCache, getApplication().getFileIconResolver()); } else adapter = new FileAdapter(getActivity(), files, getApplication().getFileIconResolver()); adapter.setSelectedFiles(selectedFiles); adapter.setOnFileSelectedListener(FolderFragment.this); adapter.setFontApplicator(getFontApplicator()); setListAdapter(adapter); } catch (Exception e) { // exception was thrown while loading files showMessage(e.getMessage()); adapter = new FileAdapter(getActivity(), getApplication().getFileIconResolver()); } getActivity().invalidateOptionsMenu(); } }.executeOnExecutor(AsyncTask.THREAD_POOL_EXECUTOR, currentDir); } @Override public void onCreateOptionsMenu(Menu menu, MenuInflater inflater) { super.onCreateOptionsMenu(menu, inflater); inflater.inflate(R.menu.folder_browser, menu); menu.findItem(R.id.menu_selectAll).setVisible(!(files == null || files.isEmpty())); if (getApplication().getFavouritesManager().isFolderFavourite(currentDir)) { menu.findItem(R.id.menu_unfavourite).setVisible(true); menu.findItem(R.id.menu_favourite).setVisible(false); } else { menu.findItem(R.id.menu_unfavourite).setVisible(false); menu.findItem(R.id.menu_favourite).setVisible(true); } } @Override public void onPrepareOptionsMenu(Menu menu) { super.onPrepareOptionsMenu(menu); menu.findItem(R.id.menu_paste).setVisible(Clipboard.getInstance().isEmpty() == false); menu.findItem(R.id.menu_navigate_up).setVisible(currentDir.getParentFile() != null); } void showEditTextDialog(int title, int okButtonText, final OnResultListener<CharSequence> enteredTextResult, CharSequence hint, CharSequence defaultValue) { View view = getActivity().getLayoutInflater().inflate(R.layout.dialog_edittext, (ViewGroup) getActivity().getWindow().getDecorView(), false); final EditText editText = (EditText) view.findViewById(android.R.id.edit); editText.setHint(hint); editText.setText(defaultValue); if (TextUtils.isEmpty(defaultValue) == false) { int end = defaultValue.toString().indexOf('.'); if (end > 0) editText.setSelection(0, end); } final Dialog dialog = new AlertDialog.Builder(getActivity()) .setTitle(title) .setView(view) .setPositiveButton(okButtonText, new OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { enteredTextResult.onResult(new AsyncResult<CharSequence>(editText.getText())); } }) .setNegativeButton(android.R.string.cancel, null) .create(); dialog.show(); dialog.getWindow().setSoftInputMode(WindowManager.LayoutParams.SOFT_INPUT_STATE_ALWAYS_VISIBLE); } @Override public boolean onOptionsItemSelected(MenuItem item) { switch (item.getItemId()) { case R.id.menu_selectAll: selectFiles(this.files); return true; case R.id.menu_navigate_up: String newFolder = currentDir.getParent(); if (newFolder != null) { Bundle args = new Bundle(1); args.putString(EXTRA_DIR, newFolder); FolderFragment fragment = new FolderFragment(); fragment.setArguments(args); FolderActivity activity = (FolderActivity) getActivity(); activity.showFragment(fragment); } return true; case R.id.menu_favourite: try { final String directoryName = FileUtils.getFolderDisplayName(currentDir); FavouritesManager favouritesManager = getApplication().getFavouritesManager(); favouritesManager.addFavourite(new FavouriteFolder(currentDir, directoryName)); getActivity().invalidateOptionsMenu(); } catch (FolderAlreadyFavouriteException e1) { e1.printStackTrace(); } return true; case R.id.menu_unfavourite: FavouritesManager favouritesManager = getApplication().getFavouritesManager(); favouritesManager.removeFavourite(currentDir); getActivity().invalidateOptionsMenu(); return true; case R.id.menu_create_folder: showEditTextDialog(R.string.create_folder, R.string.create, new OnResultListener<CharSequence>() { @Override public void onResult(AsyncResult<CharSequence> result) { try { String name = result.getResult().toString(); File newFolder = new File(currentDir, name); if (newFolder.mkdirs()) { refreshFolder(); Toast.makeText(getActivity(), R.string.folder_created_successfully, Toast.LENGTH_SHORT).show(); navigateTo(newFolder); } else Toast.makeText(getActivity(), R.string.folder_could_not_be_created, Toast.LENGTH_SHORT).show(); } catch (Exception e) { e.printStackTrace(); Toast.makeText(getActivity(), e.getMessage(), Toast.LENGTH_SHORT).show(); } } }, "", ""); return true; case R.id.menu_paste: pasteFiles(); return true; case R.id.menu_refresh: refreshFolder(); return true; } return super.onOptionsItemSelected(item); } public void pasteFiles() { new AsyncTask<Clipboard, Float, Exception>() { ProgressDialog progressDialog; @Override protected void onPreExecute() { super.onPreExecute(); progressDialog = new ProgressDialog(getActivity()); progressDialog.setTitle(getActivity().getString(R.string.pasting_files_)); progressDialog.setIndeterminate(false); progressDialog.setCancelable(false); progressDialog.setProgressStyle(ProgressDialog.STYLE_HORIZONTAL); progressDialog.show(); } @Override protected void onProgressUpdate(Float... values) { float progress = values[0]; progressDialog.setMax(100); progressDialog.setProgress((int) (progress * 100)); } @Override protected Exception doInBackground(Clipboard... params) { try { final int total = FileUtils.countFilesIn(params[0].getFiles()); final int[] progress = {0}; params[0].paste(currentDir, new FileOperationListener() { @Override public void onFileProcessed(String filename) { progress[0]++; publishProgress((float)progress[0] / (float)total); } @Override public boolean isOperationCancelled() { return isCancelled(); } }); return null; } catch (IOException e) { e.printStackTrace(); return e; } } @Override protected void onCancelled() { progressDialog.dismiss(); refreshFolder(); }; @Override protected void onPostExecute(Exception result) { progressDialog.dismiss(); refreshFolder(); if (result == null) { Clipboard.getInstance().clear(); Toast.makeText(getActivity(), R.string.files_pasted, Toast.LENGTH_SHORT).show(); } else { new AlertDialog.Builder(getActivity()) .setMessage(result.getMessage()) .setPositiveButton(android.R.string.ok, null) .show(); } }; }.executeOnExecutor(AsyncTask.THREAD_POOL_EXECUTOR, Clipboard.getInstance()); } @Override public void onViewCreated(View view, final Bundle savedInstanceState) { super.onViewCreated(view, savedInstanceState); getFontApplicator().applyFont(view); loadFileList(); if (selectedFiles.isEmpty() == false) { selectFiles(selectedFiles); } final String directoryName = FileUtils.getFolderDisplayName(currentDir); getActivity().setTitle(directoryName); getListView().setOnItemClickListener(FolderFragment.this); getListView().setOnScrollListener(this); getListView().setOnItemLongClickListener(this); getListView().setMultiChoiceModeListener(this); getActivity().getActionBar().setSubtitle(FileUtils.getUserFriendlySdcardPath(currentDir)); if (topVisibleItem <= DISTANCE_TO_HIDE_ACTIONBAR) setActionbarVisibility(true); // add listview header to push items below the actionbar ListViewUtils.addListViewHeader(getListView(), getActivity()); if (fileAdapter != null) setListAdapter(fileAdapter); FolderActivity activity = (FolderActivity) getActivity(); activity.setLastFolder(currentDir); } @Override public void onDestroyView() { finishActionMode(true); listView = null; super.onDestroyView(); } @Override public void onDestroy() { if (loadFilesTask != null) loadFilesTask.cancel(true); if (thumbCache != null) thumbCache.evictAll(); super.onDestroy(); } @Override public void onSaveInstanceState(Bundle outState) { super.onSaveInstanceState(outState); outState.putInt(EXTRA_SCROLL_POSITION, topVisibleItem); outState.putSerializable(EXTRA_SELECTED_FILES, selectedFiles); } void navigateTo(File folder) { nextDir = folder; FolderActivity activity = (FolderActivity) getActivity(); FolderFragment fragment = new FolderFragment(); Bundle args = new Bundle(); args.putString(EXTRA_DIR, folder.getAbsolutePath()); fragment.setArguments(args); activity.showFragment(fragment); } void openFile(File file) { if (file.isDirectory()) throw new IllegalArgumentException("File cannot be a directory!"); Intent intent = IntentUtils.createFileOpenIntent(file); try { startActivity(intent); } catch (ActivityNotFoundException e) { startActivity(Intent.createChooser(intent, getString(R.string.open_file_with_, file.getName()))); } catch (Exception e) { new AlertDialog.Builder(getActivity()) .setMessage(e.getMessage()) .setTitle(R.string.error) .setPositiveButton(android.R.string.ok, null) .show(); } } @Override public void onItemClick(AdapterView<?> adapterView, View arg1, int position, long arg3) { Object selectedObject = adapterView.getItemAtPosition(position); if (selectedObject instanceof File) { if (actionMode == null) { File selectedFile = (File) selectedObject; if (selectedFile.isDirectory()) navigateTo(selectedFile); else openFile(selectedFile); } else { toggleFileSelected((File) selectedObject); } } } void setActionbarVisibility(boolean visible) { if (actionMode == null || visible == true) // cannot hide CAB ((FolderActivity) getActivity()).setActionbarVisible(visible); } @Override public void onScroll(AbsListView view, int firstVisibleItem, int visibleItemCount, int totalItemCount) { if (firstVisibleItem < this.topVisibleItem - DISTANCE_TO_HIDE_ACTIONBAR) { setActionbarVisibility(true); this.topVisibleItem = firstVisibleItem; } else if (firstVisibleItem > this.topVisibleItem + DISTANCE_TO_HIDE_ACTIONBAR) { setActionbarVisibility(false); this.topVisibleItem = firstVisibleItem; } ListAdapter adapter = view.getAdapter(); if (adapter instanceof HeaderViewListAdapter) { HeaderViewListAdapter headerViewListAdapter = (HeaderViewListAdapter) adapter; if (headerViewListAdapter.getWrappedAdapter() instanceof FileCardAdapter) { int startPrefetch = firstVisibleItem + visibleItemCount-headerViewListAdapter.getHeadersCount(); ((FileCardAdapter) headerViewListAdapter.getWrappedAdapter()).prefetchImages(startPrefetch, visibleItemCount); } } } @Override public void onScrollStateChanged(AbsListView view, int scrollState) { } @Override public boolean onItemLongClick(AdapterView<?> arg0, View arg1, int arg2, long arg3) { setFileSelected((File) arg0.getItemAtPosition(arg2), true); return true; } void showFileInfo(Collection<File> files) { final CharSequence title; final StringBuilder message = new StringBuilder(); if (files.size() == 1) title = ((File) files.toArray()[0]).getName(); else title = getString(R.string._d_objects, files.size()); if (files.size() > 1) message.append(FileUtils.combineFileNames(files)).append("\n\n"); message.append(getString(R.string.size_s, FileUtils.formatFileSize(files))).append('\n'); message.append(getString(R.string.mime_type_s, FileUtils.getCollectiveMimeType(files))); new AlertDialog.Builder(getActivity()) .setTitle(title) .setMessage(message) .setPositiveButton(android.R.string.ok, null) .show(); } @Override public boolean onActionItemClicked(ActionMode mode, MenuItem item) { switch (item.getItemId()) { case R.id.action_delete: new AlertDialog.Builder(getActivity()) .setMessage(getString(R.string.delete_d_items_, selectedFiles.size())) .setPositiveButton(R.string.delete, new OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { int n = FileUtils.deleteFiles(selectedFiles); Toast.makeText(getActivity(), getString(R.string._d_files_deleted, n), Toast.LENGTH_SHORT).show(); refreshFolder(); finishActionMode(false); } }) .setNegativeButton(android.R.string.cancel, null) .show(); return true; case R.id.action_selectAll: if (isEverythingSelected()) clearFileSelection(); else selectFiles(files); return true; case R.id.action_info: if (selectedFiles.isEmpty()) return true; showFileInfo(selectedFiles); return true; case R.id.action_copy: Clipboard.getInstance().addFiles(selectedFiles, FileAction.Copy); Toast.makeText(getActivity(), R.string.objects_copied_to_clipboard, Toast.LENGTH_SHORT).show(); finishActionMode(false); return true; case R.id.action_cut: Clipboard clipboard = Clipboard.getInstance(); clipboard.addFiles(selectedFiles, FileAction.Cut); Toast.makeText(getActivity(), R.string.objects_cut_to_clipboard, Toast.LENGTH_SHORT).show(); finishActionMode(false); return true; case R.id.action_rename: final File fileToRename = (File) selectedFiles.toArray()[0]; showEditTextDialog(fileToRename.isDirectory()?R.string.rename_folder:R.string.rename_file, R.string.rename, new OnResultListener<CharSequence>() { @Override public void onResult(AsyncResult<CharSequence> result) { try { String newName = result.getResult().toString(); if (fileToRename.renameTo(new File(fileToRename.getParentFile(), newName))) { finishActionMode(false); refreshFolder(); Toast.makeText(getActivity(), R.string.file_renamed, Toast.LENGTH_SHORT).show(); } else Toast.makeText(getActivity(), getActivity().getString(R.string.file_could_not_be_renamed_to_s, newName), Toast.LENGTH_SHORT).show(); } catch (Exception e) { e.printStackTrace(); Toast.makeText(getActivity(), e.getMessage(), Toast.LENGTH_SHORT).show(); } } }, fileToRename.getName(), fileToRename.getName()); return true; case R.id.menu_add_homescreen_icon: for (File file : selectedFiles) IntentUtils.createShortcut(getActivity(), file); Toast.makeText(getActivity(), R.string.shortcut_created, Toast.LENGTH_SHORT).show(); actionMode.finish(); return true; } return false; } protected void refreshFolder() { showProgress(); loadFileList(); } void updateActionMode() { if (actionMode != null) { actionMode.invalidate(); int count = selectedFiles.size(); actionMode.setTitle(getString(R.string._d_objects, count)); actionMode.setSubtitle(FileUtils.combineFileNames(selectedFiles)); if (shareActionProvider != null) { final Intent shareIntent; if (selectedFiles.isEmpty()) shareIntent = null; else if (selectedFiles.size() == 1) { File file = (File) selectedFiles.toArray()[0]; shareIntent = new Intent(Intent.ACTION_SEND); shareIntent.setType(FileUtils.getFileMimeType(file)); shareIntent.putExtra(Intent.EXTRA_STREAM, Uri.fromFile(file)); } else { ArrayList<Uri> fileUris = new ArrayList<Uri>(selectedFiles.size()); for (File file : selectedFiles) if (file.isDirectory() == false) { fileUris.add(Uri.fromFile(file)); } shareIntent = new Intent(Intent.ACTION_SEND_MULTIPLE); shareIntent.putParcelableArrayListExtra(Intent.EXTRA_STREAM, fileUris); shareIntent.setType(FileUtils.getCollectiveMimeType(selectedFiles)); } shareActionProvider.setShareIntent(shareIntent); } } } @Override public boolean onCreateActionMode(ActionMode mode, Menu menu) { setActionbarVisibility(true); getActivity().getMenuInflater().inflate(R.menu.action_file, menu); MenuItem shareMenuItem = menu.findItem(R.id.action_share); shareActionProvider = (ShareActionProvider) shareMenuItem.getActionProvider(); this.preserveSelection = false; return true; } void finishSelection() { if (listView != null) listView.setChoiceMode(ListView.CHOICE_MODE_NONE); clearFileSelection(); } void finishActionMode(boolean preserveSelection) { this.preserveSelection = preserveSelection; if (actionMode != null) actionMode.finish(); } @Override public void onDestroyActionMode(ActionMode mode) { actionMode = null; shareActionProvider = null; if (preserveSelection == false) finishSelection(); Log.d(LOG_TAG, "Action mode destroyed"); } @Override public boolean onPrepareActionMode(ActionMode mode, Menu menu) { int count = selectedFiles.size(); if (count == 1) { menu.findItem(R.id.action_rename).setVisible(true); menu.findItem(R.id.menu_add_homescreen_icon).setTitle(R.string.add_to_homescreen); } else { menu.findItem(R.id.action_rename).setVisible(false); menu.findItem(R.id.menu_add_homescreen_icon).setTitle(R.string.add_to_homescreen_multiple); } // show Share button if no folder was selected boolean allowShare = (count > 0); if (allowShare) { for (File file : selectedFiles) if (file.isDirectory()) { allowShare = false; break; } } menu.findItem(R.id.action_share).setVisible(allowShare); return true; } @Override public void onItemCheckedStateChanged(ActionMode mode, int position, long id, boolean checked) { } void toggleFileSelected(File file) { setFileSelected(file, !selectedFiles.contains(file)); } void clearFileSelection() { if (listView != null) listView.clearChoices(); selectedFiles.clear(); updateActionMode(); if (fileAdapter != null) fileAdapter.notifyDataSetChanged(); Log.d(LOG_TAG, "Selection cleared"); } boolean isEverythingSelected() { return selectedFiles.size() == files.size(); } void selectFiles(Collection<File> files) { if (files == null || files.isEmpty()) return; if (actionMode == null) { listView.setChoiceMode(ListView.CHOICE_MODE_MULTIPLE); actionMode = getActivity().startActionMode(this); } selectedFiles.addAll(files); updateActionMode(); if (fileAdapter != null) fileAdapter.notifyDataSetChanged(); } void setFileSelected(File file, boolean selected) { if (actionMode == null) { listView.setChoiceMode(ListView.CHOICE_MODE_MULTIPLE); actionMode = getActivity().startActionMode(this); } if (selected) selectedFiles.add(file); else selectedFiles.remove(file); updateActionMode(); if (fileAdapter != null) fileAdapter.notifyDataSetChanged(); if (selectedFiles.isEmpty()) finishActionMode(false); } @Override public void onFileSelected(File file) { toggleFileSelected(file); } }
package org.testng.reporters; import org.testng.IInvokedMethod; import org.testng.IReporter; import org.testng.IResultMap; import org.testng.ISuite; import org.testng.ISuiteResult; import org.testng.ITestClass; import org.testng.ITestContext; import org.testng.ITestNGMethod; import org.testng.ITestResult; import org.testng.Reporter; import org.testng.collections.Lists; import org.testng.internal.Utils; import org.testng.log4testng.Logger; import org.testng.reporters.util.StackTraceTools; import org.testng.xml.XmlSuite; import java.io.BufferedWriter; import java.io.File; import java.io.FileWriter; import java.io.IOException; import java.io.PrintWriter; import java.text.DecimalFormat; import java.text.NumberFormat; import java.util.Arrays; import java.util.Collection; import java.util.Comparator; import java.util.List; import java.util.Map; import java.util.Set; /** * Reported designed to render self-contained HTML top down view of a testing * suite. * * @author Paul Mendelson * @since 5.2 * @version $Revision: 719 $ */ public class EmailableReporter implements IReporter { private static final Logger L = Logger.getLogger(EmailableReporter.class); private PrintWriter m_out; private int m_row; private int m_methodIndex; private int m_rowTotal; /** Creates summary of the run */ @Override public void generateReport(List<XmlSuite> xml, List<ISuite> suites, String outdir) { try { m_out = createWriter(outdir); } catch (IOException e) { L.error("output file", e); return; } startHtml(m_out); generateSuiteSummaryReport(suites); generateMethodSummaryReport(suites); generateMethodDetailReport(suites); endHtml(m_out); m_out.flush(); m_out.close(); } protected PrintWriter createWriter(String outdir) throws IOException { new File(outdir).mkdirs(); return new PrintWriter(new BufferedWriter(new FileWriter(new File(outdir, "emailable-report.html")))); } /** Creates a table showing the highlights of each test method with links to the method details */ protected void generateMethodSummaryReport(List<ISuite> suites) { m_methodIndex = 0; m_out.println("<a id=\"summary\"></a>"); startResultSummaryTable("passed"); for (ISuite suite : suites) { if(suites.size()>1) { titleRow(suite.getName(), 4); } Map<String, ISuiteResult> r = suite.getResults(); for (ISuiteResult r2 : r.values()) { ITestContext testContext = r2.getTestContext(); String testName = testContext.getName(); resultSummary(suite, testContext.getFailedConfigurations(), testName, "failed", " (configuration methods)"); resultSummary(suite, testContext.getFailedTests(), testName, "failed", ""); resultSummary(suite, testContext.getSkippedConfigurations(), testName, "skipped", " (configuration methods)"); resultSummary(suite, testContext.getSkippedTests(), testName, "skipped", ""); resultSummary(suite, testContext.getPassedTests(), testName, "passed", ""); } } m_out.println("</table>"); } /** Creates a section showing known results for each method */ protected void generateMethodDetailReport(List<ISuite> suites) { m_methodIndex = 0; for (ISuite suite : suites) { Map<String, ISuiteResult> r = suite.getResults(); for (ISuiteResult r2 : r.values()) { ITestContext testContext = r2.getTestContext(); if (r.values().size() > 0) { m_out.println("<h1>" + testContext.getName() + "</h1>"); } resultDetail(testContext.getFailedConfigurations()); resultDetail(testContext.getFailedTests()); resultDetail(testContext.getSkippedConfigurations()); resultDetail(testContext.getSkippedTests()); resultDetail(testContext.getPassedTests()); } } } /** * @param tests */ private void resultSummary(ISuite suite, IResultMap tests, String testname, String style, String details) { if (tests.getAllResults().size() > 0) { StringBuffer buff = new StringBuffer(); String lastClassName = ""; int mq = 0; int cq = 0; for (ITestNGMethod method : getMethodSet(tests, suite)) { m_row += 1; m_methodIndex += 1; ITestClass testClass = method.getTestClass(); String className = testClass.getName(); if (mq == 0) { titleRow(testname + " &#8212; " + style + details, 4); } if (!className.equalsIgnoreCase(lastClassName)) { if (mq > 0) { cq += 1; m_out.println("<tr class=\"" + style + (cq % 2 == 0 ? "even" : "odd") + "\">" + "<td rowspan=\"" + mq + "\">" + lastClassName + buff); } mq = 0; buff.setLength(0); lastClassName = className; } Set<ITestResult> resultSet = tests.getResults(method); long end = Long.MIN_VALUE; long start = Long.MAX_VALUE; for (ITestResult testResult : tests.getResults(method)) { if (testResult.getEndMillis() > end) { end = testResult.getEndMillis(); } if (testResult.getStartMillis() < start) { start = testResult.getStartMillis(); } } mq += 1; if (mq > 1) { buff.append("<tr class=\"" + style + (cq % 2 == 0 ? "odd" : "even") + "\">"); } String description = method.getDescription(); String testInstanceName = resultSet.toArray(new ITestResult[]{})[0].getTestName(); buff.append("<td><a href=\"#m" + m_methodIndex + "\">" + qualifiedName(method) + " " + (description != null && description.length() > 0 ? "(\"" + description + "\")" : "") + "</a>" + (null == testInstanceName ? "" : "<br>(" + testInstanceName + ")") + "</td>" + "<td class=\"numi\">" + resultSet.size() + "</td>" + "<td>" + start + "</td>" + "<td class=\"numi\">" + (end - start) + "</td>" + "</tr>"); } if (mq > 0) { cq += 1; m_out.println("<tr class=\"" + style + (cq % 2 == 0 ? "even" : "odd") + "\">" + "<td rowspan=\"" + mq + "\">" + lastClassName + buff); } } } /** Starts and defines columns result summary table */ private void startResultSummaryTable(String style) { tableStart(style); m_out.println("<tr><th>Class</th>" + "<th>Method</th><th># of<br/>Scenarios</th><th>Start</th><th>Time<br/>(ms)</th></tr>"); m_row = 0; } private String qualifiedName(ITestNGMethod method) { StringBuilder addon = new StringBuilder(); String[] groups = method.getGroups(); int length = groups.length; if (length > 0 && !"basic".equalsIgnoreCase(groups[0])) { addon.append("("); for (int i = 0; i < length; i++) { if (i > 0) { addon.append(", "); } addon.append(groups[i]); } addon.append(")"); } return "<b>" + method.getMethodName() + "</b> " + addon; } private void resultDetail(IResultMap tests) { for (ITestResult result : tests.getAllResults()) { ITestNGMethod method = result.getMethod(); m_methodIndex++; String cname = method.getTestClass().getName(); m_out.println("<a id=\"m" + m_methodIndex + "\"></a><h2>" + cname + ":" + method.getMethodName() + "</h2>"); Set<ITestResult> resultSet = tests.getResults(method); generateForResult(result, method, resultSet.size()); m_out.println("<p class=\"totop\"><a href=\"#summary\">back to summary</a></p>"); } } private void generateForResult(ITestResult ans, ITestNGMethod method, int resultSetSize) { int rq = 0; rq += 1; Object[] parameters = ans.getParameters(); boolean hasParameters = parameters != null && parameters.length > 0; if (hasParameters) { if (rq == 1) { tableStart("param"); m_out.print("<tr>"); for (int x = 1; x <= parameters.length; x++) { m_out .print("<th style=\"padding-left:1em;padding-right:1em\">Parameter + x + "</th>"); } m_out.println("</tr>"); } m_out.print("<tr" + (rq % 2 == 0 ? " class=\"stripe\"" : "") + ">"); for (Object p : parameters) { m_out.println("<td style=\"padding-left:.5em;padding-right:2em\">" + (p != null ? Utils.escapeHtml(p.toString()) : "null") + "</td>"); } m_out.println("</tr>"); } List<String> msgs = Reporter.getOutput(ans); boolean hasReporterOutput = msgs.size() > 0; Throwable exception=ans.getThrowable(); boolean hasThrowable = exception!=null; if (hasReporterOutput||hasThrowable) { String indent = " style=\"padding-left:3em\""; if (hasParameters) { m_out.println("<tr" + (rq % 2 == 0 ? " class=\"stripe\"" : "") + "><td" + indent + " colspan=\"" + parameters.length + "\">"); } else { m_out.println("<div" + indent + ">"); } if (hasReporterOutput) { if(hasThrowable) { m_out.println("<h3>Test Messages</h3>"); } for (String line : msgs) { m_out.println(line + "<br/>"); } } if(hasThrowable) { boolean wantsMinimalOutput = ans.getStatus()==ITestResult.SUCCESS; if(hasReporterOutput) { m_out.println("<h3>" +(wantsMinimalOutput?"Expected Exception":"Failure") +"</h3>"); } generateExceptionReport(exception,method); } if (hasParameters) { m_out.println("</td></tr>"); } else { m_out.println("</div>"); } } if (hasParameters) { if (rq == resultSetSize) { m_out.println("</table>"); } } } protected void generateExceptionReport(Throwable exception,ITestNGMethod method) { generateExceptionReport(exception, method, exception.getLocalizedMessage()); } private void generateExceptionReport(Throwable exception,ITestNGMethod method,String title) { m_out.println("<p>" + Utils.escapeHtml(title) + "</p>"); StackTraceElement[] s1= exception.getStackTrace(); Throwable t2= exception.getCause(); if(t2 == exception) { t2= null; } int maxlines= Math.min(100,StackTraceTools.getTestRoot(s1, method)); for(int x= 0; x <= maxlines; x++) { m_out.println((x>0 ? "<br/>at " : "") + Utils.escapeHtml(s1[x].toString())); } if(maxlines < s1.length) { m_out.println("<br/>" + (s1.length-maxlines) + " lines not shown"); } if(t2 != null) { generateExceptionReport(t2, method, "Caused by " + t2.getLocalizedMessage()); } } /** * @param tests * @param suite * @return */ private Collection<ITestNGMethod> getMethodSet(IResultMap tests, ISuite suite) { List<IInvokedMethod> r = Lists.newArrayList(); List<IInvokedMethod> invokedMethods = suite.getAllInvokedMethods(); for (IInvokedMethod im : invokedMethods) { if (tests.getAllMethods().contains(im.getTestMethod())) { r.add(im); } } Arrays.sort(r.toArray(new IInvokedMethod[r.size()]), new TestSorter()); List<ITestNGMethod> result = Lists.newArrayList(); for (IInvokedMethod m : r) { result.add(m.getTestMethod()); } return result; } public void generateSuiteSummaryReport(List<ISuite> suites) { tableStart("param"); m_out.print("<tr><th>Test</th>"); tableColumnStart("Methods<br/>Passed"); tableColumnStart("Scenarios<br/>Passed"); tableColumnStart("# skipped"); tableColumnStart("# failed"); tableColumnStart("Total<br/>Time"); tableColumnStart("Included<br/>Groups"); tableColumnStart("Excluded<br/>Groups"); m_out.println("</tr>"); NumberFormat formatter = new DecimalFormat(" int qty_tests = 0; int qty_pass_m = 0; int qty_pass_s = 0; int qty_skip = 0; int qty_fail = 0; long time_start = Long.MAX_VALUE; long time_end = Long.MIN_VALUE; for (ISuite suite : suites) { if (suites.size() > 1) { titleRow(suite.getName(), 7); } Map<String, ISuiteResult> tests = suite.getResults(); for (ISuiteResult r : tests.values()) { qty_tests += 1; ITestContext overview = r.getTestContext(); startSummaryRow(overview.getName()); int q = getMethodSet(overview.getPassedTests(), suite).size(); qty_pass_m += q; summaryCell(q,Integer.MAX_VALUE); q = overview.getPassedTests().size(); qty_pass_s += q; summaryCell(q,Integer.MAX_VALUE); q = getMethodSet(overview.getSkippedTests(), suite).size(); qty_skip += q; summaryCell(q,0); q = getMethodSet(overview.getFailedTests(), suite).size(); qty_fail += q; summaryCell(q,0); time_start = Math.min(overview.getStartDate().getTime(), time_start); time_end = Math.max(overview.getEndDate().getTime(), time_end); summaryCell(formatter.format( (overview.getEndDate().getTime() - overview.getStartDate().getTime()) / 1000.) + " seconds", true); summaryCell(overview.getIncludedGroups()); summaryCell(overview.getExcludedGroups()); m_out.println("</tr>"); } } if (qty_tests > 1) { m_out.println("<tr class=\"total\"><td>Total</td>"); summaryCell(qty_pass_m,Integer.MAX_VALUE); summaryCell(qty_pass_s,Integer.MAX_VALUE); summaryCell(qty_skip,0); summaryCell(qty_fail,0); summaryCell(formatter.format((time_end - time_start) / 1000.) + " seconds", true); m_out.println("<td colspan=\"2\">&nbsp;</td></tr>"); } m_out.println("</table>"); } private void summaryCell(String[] val) { StringBuffer b = new StringBuffer(); for (String v : val) { b.append(v + " "); } summaryCell(b.toString(),true); } private void summaryCell(String v,boolean isgood) { m_out.print("<td class=\"numi"+(isgood?"":"_attn")+"\">" + v + "</td>"); } private void startSummaryRow(String label) { m_row += 1; m_out.print("<tr" + (m_row % 2 == 0 ? " class=\"stripe\"" : "") + "><td style=\"text-align:left;padding-right:2em\">" + label + "</td>"); } private void summaryCell(int v,int maxexpected) { summaryCell(String.valueOf(v),v<=maxexpected); m_rowTotal += v; } private void tableStart(String cssclass) { m_out.println("<table cellspacing=0 cellpadding=0" + (cssclass != null ? " class=\"" + cssclass + "\"" : " style=\"padding-bottom:2em\"") + ">"); m_row = 0; } private void tableColumnStart(String label) { m_out.print("<th class=\"numi\">" + label + "</th>"); } private void titleRow(String label, int cq) { m_out.println("<tr><th colspan=\"" + cq + "\">" + label + "</th></tr>"); m_row = 0; } protected void writeStyle(String[] formats,String[] targets) { } /** Starts HTML stream */ protected void startHtml(PrintWriter out) { out.println("<!DOCTYPE html PUBLIC \"- out.println("<html xmlns=\"http: out.println("<head>"); out.println("<title>TestNG: Unit Test</title>"); out.println("<style type=\"text/css\">"); out.println("table caption,table.info_table,table.param,table.passed,table.failed {margin-bottom:10px;border:1px solid #000099;border-collapse:collapse;empty-cells:show;}"); out.println("table.info_table td,table.info_table th,table.param td,table.param th,table.passed td,table.passed th,table.failed td,table.failed th {"); out.println("border:1px solid #000099;padding:.25em .5em .25em .5em"); out.println("}"); out.println("table.param th {vertical-align:bottom}"); out.println("td.numi,th.numi,td.numi_attn {"); out.println("text-align:right"); out.println("}"); out.println("tr.total td {font-weight:bold}"); out.println("table caption {"); out.println("text-align:center;font-weight:bold;"); out.println("}"); out.println("table.passed tr.stripe td,table tr.passedodd td {background-color: #00AA00;}"); out.println("table.passed td,table tr.passedeven td {background-color: #33FF33;}"); out.println("table.passed tr.stripe td,table tr.skippedodd td {background-color: #cccccc;}"); out.println("table.passed td,table tr.skippedodd td {background-color: #dddddd;}"); out.println("table.failed tr.stripe td,table tr.failedodd td,table.param td.numi_attn {background-color: #FF3333;}"); out.println("table.failed td,table tr.failedeven td,table.param tr.stripe td.numi_attn {background-color: #DD0000;}"); out.println("tr.stripe td,tr.stripe th {background-color: #E6EBF9;}"); out.println("p.totop {font-size:85%;text-align:center;border-bottom:2px black solid}"); out.println("div.shootout {padding:2em;border:3px #4854A8 solid}"); out.println("</style>"); out.println("</head>"); out.println("<body>"); } /** Finishes HTML stream */ protected void endHtml(PrintWriter out) { out.println("</body></html>"); } /** Arranges methods by classname and method name */ private class TestSorter implements Comparator<IInvokedMethod> { /** Arranges methods by classname and method name */ @Override public int compare(IInvokedMethod o1, IInvokedMethod o2) { // System.out.println("Comparing " + o1.getMethodName() + " " + o1.getDate() // + " and " + o2.getMethodName() + " " + o2.getDate()); return (int) (o1.getDate() - o2.getDate()); // int r = ((T) o1).getTestClass().getName().compareTo(((T) o2).getTestClass().getName()); // if (r == 0) { // r = ((T) o1).getMethodName().compareTo(((T) o2).getMethodName()); // return r; } } }
package com.namelessmc.java_api.modules.store; import com.google.gson.JsonObject; import com.namelessmc.java_api.NamelessAPI; import com.namelessmc.java_api.exception.NamelessException; import com.namelessmc.java_api.NamelessUser; import org.checkerframework.checker.nullness.qual.Nullable; import java.util.UUID; public class StoreCustomer { private final NamelessAPI api; private final int id; private final @Nullable Integer userId; private final @Nullable String username; private final @Nullable String identifier; StoreCustomer(NamelessAPI api, JsonObject json) { this.api = api; this.id = json.get("customer_id").getAsInt(); this.userId = json.has("user_id") ? json.get("user_id").getAsInt() : null; this.username = json.has("username") ? json.get("username").getAsString() : null; this.identifier = json.has("identifier") ? json.get("identifier").getAsString() : null; if (this.username == null && this.identifier == null) { throw new IllegalStateException("Username and identifier cannot be null at the same time"); } } public int id() { return this.id; } public @Nullable NamelessUser user() throws NamelessException { return this.userId != null ? this.api.user(this.userId) : null; } public @Nullable String username() { return this.username; } public @Nullable String identifier() { return this.identifier; } public @Nullable UUID identifierAsUuid() { // Unlike NamelessMC, the store module sends UUIDs with dashes return this.identifier != null ? UUID.fromString(this.identifier) : null; } }
package org.xtx.ut4converter.t3d; import org.xtx.ut4converter.export.UTPackageExtractor; import org.xtx.ut4converter.tools.Geometry; import org.xtx.ut4converter.ucore.UPackageRessource; import org.xtx.ut4converter.ucore.ue2.TerrainLayer; import org.xtx.ut4converter.ucore.ue4.LandscapeCollisionComponent; import org.xtx.ut4converter.ucore.ue4.LandscapeComponent; import org.xtx.ut4converter.ucore.ue4.LandscapeComponentAlphaLayer; import javax.vecmath.Point2d; import java.io.File; import java.util.*; import java.util.concurrent.atomic.AtomicInteger; import java.util.stream.Collectors; /** * Very basic implementation of Unreal Engine 4 terrain * * @author XtremeXp */ public class T3DUE4Terrain extends T3DActor { private File landscapeMatFile; private UPackageRessource landscapeMaterial; private UPackageRessource landscapeHoleMaterial; private int collisionMipLevel; private int collisionThickness = 16; /** * Max component size */ private final int maxComponentSize = 255; private int componentSizeQuads; private int subsectionSizeQuads; private short numSubsections; private boolean bUsedForNavigation; private LandscapeCollisionComponent[][] collisionComponents; private LandscapeComponent[][] landscapeComponents; /** * Creates an Unreal Engine 4 terrain from Unreal Engine 3 terrain * * @param ue3Terrain Unreal Engine 4 terrain */ public T3DUE4Terrain(final T3DUE3Terrain ue3Terrain) { super(ue3Terrain.getMapConverter(), ue3Terrain.t3dClass); initialise(); this.name = ue3Terrain.name; this.location = ue3Terrain.location; this.rotation = Geometry.UE123ToUE4Rotation(ue3Terrain.rotation); this.scale3d = ue3Terrain.scale3d; // compute the number of collision components from terrain size and max component size /** * In our example: * NumPatchesX=20 * NumPatchesY=20 * MaxComponentSize=4 * * In UE3 a component size could have height and width different (SectionSizeX and SectionSizeY properties) * in UE4 these properties have been replaced by ComponentSizeQuads so it's always a square so we need to compute the number of components needed for UE4 terrain */ // in UE4 compQuadSize is always either 7x7 or 15x15 or 31x31 or 63x63 or 127*127 or 255*255 //int compQuadSize = ue3Terrain.getTerrainActorMembers().getMaxComponentSize() * ue3Terrain.getTerrainActorMembers().getMaxTesselationLevel(); // FIXME global, UE3Terrain conversion buggy with multi component so as a temp fix we do only one big component that fits the whole square int compQuadSize = computeQuadSize(ue3Terrain.getTerrainHeight().getHeight(), ue3Terrain.getTerrainHeight().getWidth()); // since collision data and landscape data are the same compSize and subSectionSize are the same this.componentSizeQuads = compQuadSize; this.subsectionSizeQuads = compQuadSize; this.numSubsections = 1; // Ceil(20 / (4*4)) = Ceil(1.25) = 2 int nbCompX = (int) Math.ceil(ue3Terrain.getTerrainActorMembers().getNumPatchesX() * 1f / compQuadSize); // Ceil(20 / (4*4)) = Ceil(1.25) = 2 int nbCompY = (int) Math.ceil(ue3Terrain.getTerrainActorMembers().getNumPatchesY() * 1f / compQuadSize); collisionComponents = new LandscapeCollisionComponent[nbCompX][nbCompY]; landscapeComponents = new LandscapeComponent[nbCompX][nbCompY]; final List<Integer> heightMap = ue3Terrain.getTerrainHeight().getHeightMap(); final short terrainWidth = ue3Terrain.getTerrainHeight().getWidth(); final short terrainHeight = ue3Terrain.getTerrainHeight().getHeight(); // TODO handle visibility data (not visible terrain parts) final List<Boolean> visData = new LinkedList<>(); // vis data in UT3 is 0 1 0 0 0 0 1 1 for (final Integer vis : ue3Terrain.getTerrainInfoData().getData()) { if (vis == 0) { visData.add(Boolean.FALSE); } else { visData.add(Boolean.TRUE); } } // compute new alpha values for all alpha layers to fit the sum = 255 final Map<Integer, List<Integer>> newAlphaValueLayersByTerrainLayerIdx = fixAlphaLayersValuesByTerrainLayerIndex(ue3Terrain); for (org.xtx.ut4converter.ucore.ue3.TerrainLayer terrainLayer : ue3Terrain.getTerrainLayers()) { ue3Terrain.getAlphaLayers().set(terrainLayer.getAlphaMapIndex(), newAlphaValueLayersByTerrainLayerIdx.get(terrainLayer.getIndex())); } buildLandscapeAndCollisionComponents(compQuadSize, nbCompX, nbCompY, heightMap, ue3Terrain.getAlphaLayers(), visData, terrainWidth, terrainHeight); } /** * // IN Unreal Engine 4 the sum of all alpha values given an alpha index is always 255 (FF in hexa) * // as such we have to modify the current alpha values for UE3 so the sum of all alpha values for all layers given an alpha index is 255 * // e.g: AlphaValue(L1, X) = 64 * // e.g: AlphaValue(L2, X) = 200 * // e.g: AlphaValue(L3, X) = 240 * // Sum of all layers in UT4 must equals to * // AlphaValueNEW(L1, X) = 255 * ((AlphaValue(L1, X) / (AlphaValue(L1, X) +AlphaValue(L2, X) +AlphaValue(L3, X))) = 32.38 -> 32 * // AlphaValueNEW(L1, X) = 255 * (64 / (64 +200 +240)) = 32.38 -> 32 * @param ue3Terrain * @return */ private Map<Integer, List<Integer>> fixAlphaLayersValuesByTerrainLayerIndex(T3DUE3Terrain ue3Terrain) { // FIXME better alpha values but not yet perfect final Map<Integer, List<Integer>> newAlphaValueLayersByTerrainLayerIdx = new HashMap<>(); final List<Integer> allLayersAlphaValueSum = new LinkedList<>(); // precompute sum of all alphalayers given an alpha value index for (int alphaValueIdx = 0; alphaValueIdx < ue3Terrain.getAlphaLayers().get(0).size(); alphaValueIdx++) { for (int i = 0; i < ue3Terrain.getTerrainLayers().size(); i++) { allLayersAlphaValueSum.add(ue3Terrain.getAlphaLayers().get(i).get(alphaValueIdx)); } } for (int terrainLayerIdx = 0; terrainLayerIdx < ue3Terrain.getTerrainLayers().size(); terrainLayerIdx++) { final org.xtx.ut4converter.ucore.ue3.TerrainLayer terrainLayer = ue3Terrain.getTerrainLayers().get(terrainLayerIdx); final List<Integer> alphaValues = ue3Terrain.getAlphaLayers().get(terrainLayer.getAlphaMapIndex()); final List<Integer> newAlphaValues = new ArrayList<>(); for (int alphaValueIdx = 0; alphaValueIdx < alphaValues.size(); alphaValueIdx++) { int alphaValueAllLayersSum = allLayersAlphaValueSum.get(alphaValueIdx); Integer oldAlphaValue = alphaValues.get(alphaValueIdx); int alphaValueOtherLayersSum = alphaValueAllLayersSum - oldAlphaValue; int newAlphaValue; // first alpha layer in UT4 is always rendered if (terrainLayer.getAlphaMapIndex() == 0) { // AlphaLayer 1: 240 // AlphaLayer 2: 20 // AlphaLayer 3: 40 int newOldAlphaValue = 255 * ue3Terrain.getTerrainLayers().size() - alphaValueOtherLayersSum; alphaValueAllLayersSum += (newOldAlphaValue - oldAlphaValue); oldAlphaValue = newOldAlphaValue; alphaValueAllLayersSum += (255 - oldAlphaValue); oldAlphaValue = 255; } newAlphaValue = (int) (255f * ((oldAlphaValue * 1f) / (alphaValueAllLayersSum * 1f))); newAlphaValues.add(newAlphaValue); } newAlphaValueLayersByTerrainLayerIdx.put(terrainLayer.getIndex(), newAlphaValues); } return newAlphaValueLayersByTerrainLayerIdx; } /** * Compute quadsize of UE4 terrain. * in UE4 compQuadSize is always either 7x7 or 15x15 or 31x31 or 63x63 or 127*127 or 255*255 * * @param terrainHeight * @param terrainWidth * @return */ private int computeQuadSize(final int terrainHeight, final int terrainWidth) { int compQuadSize = Math.max(terrainHeight, terrainWidth); // we fit to the best UE4 quadSize if (compQuadSize <= 7) { compQuadSize = 7; } else if (compQuadSize <= 15) { compQuadSize = 15; } else if (compQuadSize <= 31) { compQuadSize = 31; } else if (compQuadSize <= 127) { compQuadSize = 127; } else if (compQuadSize <= 255) { compQuadSize = 255; } else { // not supported compQuadSize = 255; } return compQuadSize; } /** * Build landscape collision and heigh components * @param compQuadSize * @param nbCompX * @param nbCompY * @param heightMap * @param alphaLayersData * @param visibilityData * @param terrainWidth * @param terrainHeight */ private void buildLandscapeAndCollisionComponents(int compQuadSize, int nbCompX, int nbCompY, final List<Integer> heightMap, final List<List<Integer>> alphaLayersData, final List<Boolean> visibilityData, short terrainWidth, short terrainHeight) { // size of heightmap values for components int ue4CompHeightDataSize = (compQuadSize + 1) * (compQuadSize + 1); int compIdx = 0; // min terrain height will become the default value long minTerrainHeight = heightMap.stream().mapToInt(a -> a).min().orElse(32768); for (int compIdxX = 0; compIdxX < nbCompX; compIdxX++) { for (int compIdxY = 0; compIdxY < nbCompY; compIdxY++) { // create component final LandscapeCollisionComponent lcc = new LandscapeCollisionComponent(mapConverter, this, compIdx, compQuadSize); lcc.setSectionBaseX(compIdxX * compQuadSize); lcc.setSectionBaseY(compIdxY * compQuadSize); // fill up heighdata for this component for (int i = 0; i < ue4CompHeightDataSize; i++) { final Integer heightMatchIdx = getDataIndexForComponentHeightIndex(i, compQuadSize, compIdxX, compIdxY, terrainWidth, terrainHeight); if (heightMatchIdx != -1) { lcc.getHeightData().add(heightMap.get(heightMatchIdx).longValue()); } // outside of original UE2/3 terrain square set default value else { lcc.getHeightData().add(minTerrainHeight); } } // fill up visibility data for this component if (visibilityData != null) { for (int i = 0; i < ue4CompHeightDataSize; i++) { final Integer visibilityMatchIdx = getDataIndexForComponentHeightIndex(i, compQuadSize, compIdxX, compIdxY, terrainWidth, terrainHeight); if (visibilityMatchIdx != -1) { lcc.getVisibilityData().add(visibilityData.get(visibilityMatchIdx)); } // outside of original UE2/3 terrain square set to not rendering else { lcc.getVisibilityData().add(Boolean.FALSE); } } } // fill up alpha layers for this component final List<LandscapeComponentAlphaLayer> alphaLayers = new LinkedList<>(); for (int layerNum = 0; layerNum < alphaLayersData.size(); layerNum++) { // increment the layer num since the first layer (0) is used by heightmap final LandscapeComponentAlphaLayer landscapeComponentAlphaLayer = new LandscapeComponentAlphaLayer(layerNum); final List<Integer> alphaData = alphaLayersData.get(layerNum); for (int alphaIdx = 0; alphaIdx < ue4CompHeightDataSize; alphaIdx++) { final Integer alphaMatchIdx = getDataIndexForComponentHeightIndex(alphaIdx, compQuadSize, compIdxX, compIdxY, terrainWidth, terrainHeight); if (alphaMatchIdx != -1) { landscapeComponentAlphaLayer.getAlphaData().add(alphaData.get(alphaMatchIdx)); } // outside of original UE2/3 terrain square set to not rendering else { landscapeComponentAlphaLayer.getAlphaData().add(0); } } alphaLayers.add(landscapeComponentAlphaLayer); } collisionComponents[compIdxX][compIdxY] = lcc; final LandscapeComponent lc = new LandscapeComponent(mapConverter, this, lcc, alphaLayers); lc.setName("LC_" + compIdx); landscapeComponents[compIdxX][compIdxY] = lc; lcc.setRenderComponent(lc); compIdx ++; } } } /** * Given a component height index and the height data of original UE3 terrain, return the height * related to this index within the UE4 terrain * * FIXME only works if there is only one component for whole terrain else would give bad index (if compIdxX > 0 or compIdxY > 0) * * @param compHeightIdx Component height index * @param compQuadSize Quad Size for UE4 terrain * @param compIdxX UE4 terrain component X coordinate * @param compIdxY UE4 terrain component Y coordinate * @param ue3GlobalWidth UE3 terrain width (might be different from the new UE4 terrain width due to QuadSize list restrictions) * @return */ private Integer getDataIndexForComponentHeightIndex(int compHeightIdx, int compQuadSize, int compIdxX, int compIdxY, int ue3GlobalWidth, int ue3GlobalHeight) { // let's say in UE3 our terrain was a 21x21 square (ue3GlobalWidth) // and our UE4 converted terrain a 31*31 square // some heightvalues will be out of the UE3 terrain and will be needed to be set to default value (32768) // local coordinates within the UE4 component of height index final Point2d compHeightIdxCoord = getCoordinatesForIndexInSquareSize(compHeightIdx, (compQuadSize + 1), 0); // global coordinates within the UE4 terrain of this height index final Point2d compHeightIdxGlobalCoord = new Point2d(compIdxX * (compQuadSize + 1) + compHeightIdxCoord.x, compIdxY * (compQuadSize + 1) + compHeightIdxCoord.y); // this point is outside the original UE3 square return -1 if (compHeightIdxGlobalCoord.x > (ue3GlobalWidth - 1) || compHeightIdxGlobalCoord.y > (ue3GlobalHeight - 1)) { return -1; } else { return compIdxX * (compQuadSize + 1) + compIdxY * (compQuadSize + 1) + compHeightIdx - (int)(compHeightIdxGlobalCoord.y * (compQuadSize - ue3GlobalWidth + 1)); } } public static Point2d getCoordinatesForIndexInSquareSize(final int globalIndex, final int width, final int height) { return new Point2d(globalIndex % width, (int) Math.floor((globalIndex * 1f) / width)); } /** * Creates t3d ue4 terrain from unreal engine 2 terrain * * @param ue2Terrain */ public T3DUE4Terrain(final T3DUE2Terrain ue2Terrain) { super(ue2Terrain.getMapConverter(), ue2Terrain.t3dClass); initialise(); this.name = ue2Terrain.name; this.location = ue2Terrain.location; this.rotation = Geometry.UE123ToUE4Rotation(ue2Terrain.rotation); this.scale3d = ue2Terrain.getTerrainScale(); if (!ue2Terrain.getLayers().isEmpty()) { landscapeMaterial = ue2Terrain.getLayers().get(0).getTexture(); } short ue2TerrainWidth = (short) (ue2Terrain.getHeightMapTextureDimensions().width); short ue2TerrainHeight = (short) (ue2Terrain.getHeightMapTextureDimensions().height); // E.G: 128X128 -> 127 int compQuadSize = computeQuadSize(ue2TerrainHeight -1, ue2TerrainWidth - 1); this.componentSizeQuads = compQuadSize; this.subsectionSizeQuads = this.componentSizeQuads; this.numSubsections = 1; // E.G: 128 / (127 + 1) = 1 int nbCompX = ue2Terrain.getHeightMapTextureDimensions().width / (componentSizeQuads + 1); int nbCompY = ue2Terrain.getHeightMapTextureDimensions().height / (componentSizeQuads + 1); collisionComponents = new LandscapeCollisionComponent[nbCompX][nbCompY]; landscapeComponents = new LandscapeComponent[nbCompX][nbCompY]; // FIXME visibility data seems not working final List<Boolean> visibilityData = convertUe2Visibility(ue2Terrain); final List<List<Integer>> alphaLayers = ue2Terrain.getLayers().stream().map(TerrainLayer::getAlphaMap).collect(Collectors.toList()); final Map<Integer, List<Integer>> newAlphaValuesByLayerIdx = new HashMap<>(); final List<Integer> allLayersAlphaValueSum = new LinkedList<>(); // precompute sum of all alphalayers given an alpha value index for (int alphaValueIdx = 0; alphaValueIdx < ue2Terrain.getLayers().get(0).getAlphaMap().size(); alphaValueIdx++) { for (int i = 0; i < ue2Terrain.getLayers().size(); i++) { allLayersAlphaValueSum.add(ue2Terrain.getLayers().get(i).getAlphaMap().get(alphaValueIdx)); } } int layerIdx = 0; for (final TerrainLayer terrainLayer : ue2Terrain.getLayers()) { final List<Integer> newAlphaValues = new ArrayList<>(); for (int alphaValueIdx = 0; alphaValueIdx < terrainLayer.getAlphaMap().size(); alphaValueIdx++) { int newAlphaValue = 0; int alphaValueAllLayersSum = allLayersAlphaValueSum.get(alphaValueIdx); int oldAlphaValue = terrainLayer.getAlphaMap().get(alphaValueIdx); int alphaValueOtherLayersSum = alphaValueAllLayersSum - oldAlphaValue; // first alpha layer in UT4 is always rendered if (layerIdx == 0) { // AlphaLayer 1: 240 // AlphaLayer 2: 20 // AlphaLayer 3: 40 int newOldAlphaValue = 255 * ue2Terrain.getLayers().size() - alphaValueOtherLayersSum; alphaValueAllLayersSum += (newOldAlphaValue - oldAlphaValue); oldAlphaValue = newOldAlphaValue; alphaValueAllLayersSum += (255 - oldAlphaValue); oldAlphaValue = 255; } newAlphaValue = (int) (255f * ((oldAlphaValue * 1f) / (alphaValueAllLayersSum * 1f))); newAlphaValues.add(newAlphaValue); } newAlphaValuesByLayerIdx.put(layerIdx, newAlphaValues); layerIdx++; } // replace alpha values with new ones newAlphaValuesByLayerIdx.forEach((layerIdx2, newAlphaMapValues) -> { ue2Terrain.getLayers().get(layerIdx2).setAlphaMap(newAlphaMapValues); }); buildLandscapeAndCollisionComponents(compQuadSize, nbCompX, nbCompY, ue2Terrain.getHeightMap(), alphaLayers, visibilityData, ue2TerrainWidth, ue2TerrainHeight); // In Unreal Engine 2, terrain pivot is "centered" // unlike UE3/4, so need update location if (this.location != null && this.scale3d != null) { double offsetX = (nbCompX * this.scale3d.x * this.componentSizeQuads) / 2; double offsetY = (nbCompY * this.scale3d.y * this.componentSizeQuads) / 2; this.location.x -= (offsetX + 100); this.location.y -= (offsetY + 100); this.location.z *= mapConverter.getScale(); } } /** * Convert visibility data from unreal engine 2 terrain. Adapted code from * UT3 converter * * e.g (UE2): * "QuadVisibilityBitmap(0)=-65540, QuadVisibilityBitmap(0)=-1, ..." e.g: * (UE4): "CustomProperties DominantLayerData fffffffffff...." * * @param ue2Terrain * Terrain from unreal engine 2 ut game (ut2003, ut2004 or unreal * 2) */ private List<Boolean> convertUe2Visibility(T3DUE2Terrain ue2Terrain) { List<Boolean> globalVisibility = new ArrayList<>(); if (ue2Terrain.getQuadVisibilityBitmaps() == null || !ue2Terrain.getQuadVisibilityBitmaps().isEmpty()) { StringBuilder tmpRadix; Map<Integer, Long> visMap = ue2Terrain.getQuadVisibilityBitmaps(); for (int i = 0; i < ue2Terrain.getTotalSquares() / 32; i++) { if (visMap != null && visMap.containsKey(i)) { Long visibility = visMap.get(i); tmpRadix = new StringBuilder(); // -1 means 32 squares are rendered if (visibility == -1) { for (int j = 0; j < 32; j++) { globalVisibility.add(Boolean.TRUE); } } else { // "-134217728" visibility++; // "-134217727" -> --111111111111111111111111111 // (rendered squares in "reverse" order) String radix = Long.toString(visibility, 2); radix = radix.replaceAll("-", ""); for (int k = 0; k < (32 - radix.length()); k++) { tmpRadix.append("0"); } radix = tmpRadix + radix; for (int j = 31; j >= 0; j globalVisibility.add(radix.charAt(j) == '1'); } } } else { for (int j = 0; j < 32; j++) { globalVisibility.add(Boolean.TRUE); } } } } return globalVisibility; } private void initialise() { numSubsections = 1; bUsedForNavigation = true; } @Override public boolean isValidWriting() { return landscapeComponents.length > 0; } @Override public void convert() { if (landscapeMaterial != null) { landscapeMaterial.export(UTPackageExtractor.getExtractor(mapConverter, landscapeMaterial)); } if (landscapeHoleMaterial != null) { landscapeHoleMaterial.export(UTPackageExtractor.getExtractor(mapConverter, landscapeHoleMaterial)); } super.convert(); } @Override public String toString() { return toT3d(); } public String toT3d() { sbf.append(IDT).append("Begin Actor Class=Landscape Name=").append(name).append("\n"); for (int x = 0; x < collisionComponents.length; x++) { for (int y = 0; y < collisionComponents[0].length; y++) { sbf.append(IDT).append("\tBegin Object Class=LandscapeHeightfieldCollisionComponent Name=\"").append(collisionComponents[x][y].getName()).append("\"\n"); sbf.append(IDT).append("\tEnd Object\n"); } } for (int x = 0; x < landscapeComponents.length; x++) { for (int y = 0; y < landscapeComponents[0].length; y++) { sbf.append(IDT).append("\tBegin Object Class=LandscapeComponent Name=\"").append(landscapeComponents[x][y].getName()).append("\"\n"); sbf.append(IDT).append("\tEnd Object\n"); } } sbf.append(IDT).append("\tBegin Object Class=SceneComponent Name=\"RootComponent0\"\n"); sbf.append(IDT).append("\tEnd Object\n"); for (int x = 0; x < collisionComponents.length; x++) { for (int y = 0; y < collisionComponents[0].length; y++) { collisionComponents[x][y].toT3d(sbf, null); } } for (int x = 0; x < landscapeComponents.length; x++) { for (int y = 0; y < landscapeComponents[0].length; y++) { landscapeComponents[x][y].toT3d(sbf, null); } } sbf.append(IDT).append("\tBegin Object Name=\"RootComponent0\"\n"); writeLocRotAndScale(); sbf.append(IDT).append("\tEnd Object\n"); // needs a guid or else would crash on import sbf.append(IDT).append("\tLandscapeGuid=").append(T3DUtils.randomGuid()).append("\n"); // use the UT4X landscape material (UT4X_LandscapeMat.uasset) AtomicInteger terrainIdx = new AtomicInteger(); // compute index of this terrain in map mapConverter.getT3dLvlConvertor().getConvertedActors().forEach(e -> { if (e.getChildren() != null && !e.getChildren().isEmpty() && e.getChildren().get(0) instanceof T3DUE4Terrain) { if (e.getChildren().get(0) == this) { return; } terrainIdx.getAndIncrement(); } }); sbf.append(IDT).append("\tLandscapeMaterial=Material'").append(mapConverter.getUt4ReferenceBaseFolder()).append("/UT4X_LandscapeMat_").append(terrainIdx.getAcquire()).append(".UT4X_LandscapeMat_").append(terrainIdx.getAcquire()).append("'\n"); int idx = 0; for (int x = 0; x < landscapeComponents.length; x++) { for (int y = 0; y < landscapeComponents[0].length; y++) { sbf.append(IDT).append("\tLandscapeComponents(").append(idx).append(")=LandscapeComponent'").append(landscapeComponents[x][y].getName()).append("'\n"); idx++; } } idx = 0; for (int x = 0; x < collisionComponents.length; x++) { for (int y = 0; y < collisionComponents[0].length; y++) { sbf.append(IDT).append("\tCollisionComponents(").append(idx).append(")=CollisionComponent'").append(collisionComponents[x][y].getName()).append("'\n"); idx++; } } sbf.append(IDT).append("\tComponentSizeQuads=").append(componentSizeQuads).append("\n"); sbf.append(IDT).append("\tSubsectionSizeQuads=").append(subsectionSizeQuads).append("\n"); sbf.append(IDT).append("\tNumSubsections=").append(numSubsections).append("\n"); sbf.append(IDT).append("\tRootComponent=RootComponent0\n"); writeEndActor(); return sbf.toString(); } public LandscapeCollisionComponent[][] getCollisionComponents() { return collisionComponents; } public LandscapeComponent[][] getLandscapeComponents() { return landscapeComponents; } public File getLandscapeMatFile() { return landscapeMatFile; } public void setLandscapeMatFile(File landscapeMatFile) { this.landscapeMatFile = landscapeMatFile; } }
package org.zalando.nakadi.domain; import com.google.common.base.Preconditions; import java.util.Objects; public class NakadiCursor { public static final int VERSION_LENGTH = 3; /** * - ZERO is reserved for old offset format, e.g. those previous to timelines: "000000000000000010" * - ONE is reserved for the first version of timeline offsets: "001-0000-000000000000000A" **/ public enum Version { ZERO("000"), ONE("001"),; public final String code; Version(final String code) { Preconditions.checkArgument( code.length() == VERSION_LENGTH, "Version field length should be equal to " + VERSION_LENGTH); this.code = code; } } private final Timeline timeline; private final String partition; // NO BEGIN HERE - only real offset! private final String offset; public NakadiCursor( final Timeline timeline, final String partition, final String offset) { this.timeline = timeline; this.partition = partition; this.offset = offset; } public Timeline getTimeline() { return timeline; } public String getTopic() { return timeline.getTopic(); } public String getPartition() { return partition; } public String getOffset() { return offset; } @Override public boolean equals(final Object o) { if (this == o) { return true; } if (!(o instanceof NakadiCursor)) { return false; } final NakadiCursor that = (NakadiCursor) o; return Objects.equals(this.timeline, that.timeline) && Objects.equals(this.partition, that.partition) && Objects.equals(this.offset, that.offset); } // TODO: Remove method one subscriptions are transferred to use timelines. public NakadiCursor withOffset(final String offset) { return new NakadiCursor(timeline, partition, offset); } @Override public int hashCode() { int result = timeline.hashCode(); result = 31 * result + partition.hashCode(); result = 31 * result + offset.hashCode(); return result; } @Override public String toString() { return "NakadiCursor{" + "partition='" + partition + '\'' + ", offset='" + offset + '\'' + ", timeline='" + timeline + '\'' + '}'; } }
//@@author A0139961U package seedu.tache.logic.commands; import seedu.tache.commons.exceptions.IllegalValueException; import seedu.tache.logic.commands.exceptions.CommandException; /** * Adds a task to the task manager. */ public class SaveCommand extends Command { public static final String COMMAND_WORD = "save"; public static final String MESSAGE_USAGE = COMMAND_WORD + ": Changes the save location of the" + "data files based on the directory entered or selected.\n" + "Parameters: DIRECTORY \n" + "Example: " + COMMAND_WORD + " C:\\Users\\user\\Desktop"; public static final String MESSAGE_SUCCESS = "Save location changed to: %1$s"; public final String newPath; public SaveCommand(String newDirectory) { this.newPath = newDirectory; } @Override public CommandResult execute() throws CommandException { assert storage != null; storage.setTaskManagerFilePath(newPath + "\\taskmanager.xml"); return new CommandResult(String.format(MESSAGE_SUCCESS, newPath)); } }
//@@author A0150120H package seedu.tache.logic.commands; import java.util.Stack; /* * Class to handle the Undo history. Uses a First-In-Last-Out data structure * This class follows the Singleton Pattern */ public class UndoHistory { private Stack<Undoable> data; private static UndoHistory currentInstance; /** * Creates a new UndoHistory object. * This should only be called once in the entire exectution */ private UndoHistory() { data = new Stack<Undoable>(); } /** * Saves an Undoable Command into history * @param target Undoable Command to be saved */ public void push(Undoable target) { data.push(target); } /** * Removes and returns the latest Undoable Command from history. * @return Undoable object if history is populated, null otherwise */ public Undoable pop() { if (data.isEmpty()) { return null; } else { return data.pop(); } } /** * Clears all history */ public void clear() { data = new Stack<Undoable>(); } /** * Returns an instance of this class. It is guaranteed to be the same instance throughout execution. * @return instance of this class */ public static UndoHistory getInstance() { if (currentInstance == null) { currentInstance = new UndoHistory(); } return currentInstance; } }
package seedu.todo.controllers; import java.io.IOException; import java.util.Map; import seedu.todo.MainApp; import seedu.todo.commons.core.Config; import seedu.todo.commons.util.ConfigUtil; import seedu.todo.commons.util.StringUtil; import seedu.todo.controllers.concerns.Renderer; import seedu.todo.models.TodoListDB; /** * Controller to declare aliases * * @author louietyj * */ public class AliasController implements Controller { private static final String NAME = "Alias"; private static final String DESCRIPTION = "Shows current aliases or updates them."; private static final String COMMAND_SYNTAX = "alias [<alias key> <alias value>]"; private static final String SPACE = " "; private static final int ARGS_LENGTH = 2; private static final String MESSAGE_SHOWING = "Showing all aliases."; private static final String MESSAGE_SAVE_SUCCESS = "Successfully saved alias!"; private static final String INVALID_NUM_PARAMS = "Seems like you have provided an invalid number of parameters!"; private static final String MESSAGE_INVALID_INPUT = "Invalid alias parameters! Alias inputs must consist solely " + "of alphabetical characters."; private static final String SAVE_ERROR = "There was an error saving your aliases. Please try again."; private static CommandDefinition commandDefinition = new CommandDefinition(NAME, DESCRIPTION, COMMAND_SYNTAX); public static CommandDefinition getCommandDefinition() { return commandDefinition; } @Override public float inputConfidence(String input) { // TODO return input.toLowerCase().startsWith("alias") ? 1 : 0; } @Override public void process(String input) { String params = input.replaceFirst("alias", "").trim(); if (params.length() <= 0) { Renderer.renderAlias(MESSAGE_SHOWING); return; } String[] args = params.split(SPACE, ARGS_LENGTH); String aliasKey = null; String aliasValue = null; // Best-effort matching, disambiguate if wrong. validate: { switch (args.length) { case 0: break; case 1: aliasKey = args[0]; break; case 2: // All good! aliasKey = args[0]; aliasValue = args[1]; break validate; default: aliasKey = args[0]; aliasValue = args[0]; break; } renderDisambiguation(aliasKey, aliasValue, INVALID_NUM_PARAMS); return; } if (!validateAlias(aliasKey) || !validateAlias(aliasValue)) { renderDisambiguation(aliasKey, aliasValue, MESSAGE_INVALID_INPUT); return; } // Persist alias mapping try { saveAlias(aliasKey, aliasValue); } catch (IOException e) { Renderer.renderAlias(SAVE_ERROR); return; } Renderer.renderAlias(MESSAGE_SAVE_SUCCESS); } /** * Persists an alias mapping to the database. * * @param db TodoListDB singleton * @param aliasKey * @param aliasValue * @throws IOException */ private static void saveAlias(String aliasKey, String aliasValue) throws IOException { Config config = MainApp.getConfig(); Map<String, String> aliases = config.getAliases(); aliases.put(aliasKey, aliasValue); ConfigUtil.saveConfig(config, MainApp.getConfigFilePath()); } /** * Validates that string is sanitized and safe for aliasing. * * @param alias string to check * @return true if string is sanitized, false otherwise */ private static boolean validateAlias(String alias) { return alias.chars().allMatch(Character::isLetter); } private static void renderDisambiguation(String aliasKey, String aliasValue, String message) { String sanitizedAliasKey = StringUtil.sanitize(aliasKey); sanitizedAliasKey = StringUtil.replaceEmpty(sanitizedAliasKey, "<alias key>"); String sanitizedAliasValue = StringUtil.sanitize(aliasValue); sanitizedAliasValue = StringUtil.replaceEmpty(sanitizedAliasValue, "<alias value>"); Renderer.renderDisambiguation(String.format("alias %s %s", sanitizedAliasKey, sanitizedAliasValue), message); } }
package seedu.todo.logic.parser; import static seedu.todo.commons.core.Messages.MESSAGE_INVALID_COMMAND_FORMAT; import static seedu.todo.commons.core.Messages.MESSAGE_UNKNOWN_COMMAND; import java.time.LocalDateTime; import java.time.ZoneId; import java.util.*; import java.util.regex.Matcher; import java.util.regex.Pattern; import seedu.todo.commons.exceptions.IllegalValueException; import seedu.todo.commons.util.StringUtil; import seedu.todo.logic.commands.*; import seedu.todo.model.task.Priority; import seedu.todo.model.task.Recurrence.Frequency; import com.joestelmach.natty.*; /** * Parses user input. */ public class ToDoListParser { /** * Parses user input into command for execution. * * @param userInput full user input string * @return the command based on the user input */ public Command parseCommand(String userInput) { final Matcher matcher = ParserFormats.BASIC_COMMAND_FORMAT.matcher(userInput.trim()); if (!matcher.matches()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, HelpCommand.MESSAGE_USAGE)); } final String commandWord = matcher.group("commandWord"); final String arguments = matcher.group("arguments"); switch (commandWord) { case AddCommand.COMMAND_WORD: return prepareAdd(arguments); case ClearCommand.COMMAND_WORD: return new ClearCommand(); case DeleteCommand.COMMAND_WORD: return prepareDelete(arguments); case ExitCommand.COMMAND_WORD: return new ExitCommand(); case HelpCommand.COMMAND_WORD: return new HelpCommand(); case MarkCommand.COMMAND_WORD: return prepareMark(arguments); case SearchCommand.COMMAND_WORD: return prepareSearch(arguments); case SeeCommand.COMMAND_WORD: return new SeeCommand(); case TagCommand.COMMAND_WORD: return prepareTag(arguments); case UntagCommand.COMMAND_WORD: return prepareUntag(arguments); case UnmarkCommand.COMMAND_WORD: return prepareUnmark(arguments); case UndoCommand.COMMAND_WORD: return new UndoCommand(); case UpdateCommand.COMMAND_WORD: return prepareUpdate(arguments); case StoreCommand.COMMAND_WORD: return prepareStore(arguments); case ResetCommand.COMMAND_WORD: return new ResetCommand(); default: return new IncorrectCommand(MESSAGE_UNKNOWN_COMMAND); } } private String matchNameResult(Matcher matcher) { return matcher.group("name"); } private String matchDetailResult(Matcher matcher) { return matcher.group("detail"); } private String matchOnDateTimeResult(Matcher matcher) { return matcher.group("onDateTime"); } private String matchByDateTimeResult(Matcher matcher) { return matcher.group("byDateTime"); } private String matchPriorityResult(Matcher matcher) { return matcher.group("priority"); } private String matchRecurrenceResult(Matcher matcher) { return matcher.group("rec"); } /** * Parses arguments in the context of the add task command. * * @param args full command args string * @return the prepared command */ private Command prepareAdd(String args) { Pattern[] dataPatterns = {ParserFormats.ADD_PRIORITY_FT, ParserFormats.ADD_PRIORITY_ON, ParserFormats.ADD_PRIORITY_BY, ParserFormats.ADD_PRIORITY_FL, ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_FT, ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_BY, ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_ON, ParserFormats.ADD_TASK_ARGS_FORMAT_FT, ParserFormats.ADD_TASK_ARGS_FORMAT_BY, ParserFormats.ADD_TASK_ARGS_FORMAT_ON, ParserFormats.ADD_TASK_ARGS_FORMAT_FLOAT}; //add buy chicken on friday by wednesday priority high every year ; chicken kfc Matcher matcher; try { for (Pattern p : dataPatterns) { matcher = p.matcher(args.trim()); if (matcher.matches()) { if (p.equals(ParserFormats.ADD_TASK_ARGS_FORMAT_FT)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), matchByDateTimeResult(matcher), Priority.DEFAULT_PRIORITY, Frequency.NONE); } else if (p.equals(ParserFormats.ADD_TASK_ARGS_FORMAT_ON)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), null, Priority.DEFAULT_PRIORITY, Frequency.NONE); } else if (p.equals(ParserFormats.ADD_TASK_ARGS_FORMAT_BY)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), null, matchByDateTimeResult(matcher), Priority.DEFAULT_PRIORITY, Frequency.NONE); } else if (p.equals(ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_FT)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), matchByDateTimeResult(matcher), Priority.DEFAULT_PRIORITY, Frequency.valueOf(matchRecurrenceResult(matcher).toUpperCase().trim())); } else if (p.equals(ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_BY)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), null, matchByDateTimeResult(matcher), Priority.DEFAULT_PRIORITY, Frequency.valueOf(matchRecurrenceResult(matcher).toUpperCase().trim())); } else if (p.equals(ParserFormats.ADD_TASK_ARGS_RECUR_FORMAT_ON)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), null, Priority.DEFAULT_PRIORITY, Frequency.valueOf(matchRecurrenceResult(matcher).toUpperCase().trim())); } else if (p.equals(ParserFormats.ADD_PRIORITY_FT)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), matchByDateTimeResult(matcher), matchPriorityResult(matcher), Frequency.NONE); } else if (p.equals(ParserFormats.ADD_PRIORITY_FL)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), null, null, matchPriorityResult(matcher), Frequency.NONE); } else if (p.equals(ParserFormats.ADD_PRIORITY_ON)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), matchOnDateTimeResult(matcher), null, matchPriorityResult(matcher), Frequency.NONE); } else if (p.equals(ParserFormats.ADD_PRIORITY_BY)) { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), null, matchByDateTimeResult(matcher), matchPriorityResult(matcher), Frequency.NONE); } else { return new AddCommand(matchNameResult(matcher), matchDetailResult(matcher), null, null, Priority.DEFAULT_PRIORITY, Frequency.NONE); } } } } catch (IllegalValueException ive) { return new IncorrectCommand(ive.getMessage()); } catch (IllegalArgumentException ive) { return new IncorrectCommand(ive.getMessage()); } return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, AddCommand.MESSAGE_USAGE)); } /** * Parses arguments in the context of the delete task command. * * @param args full command args string * @return the prepared command */ private Command prepareDelete(String args) { Optional<Integer> index = parseIndex(args); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, DeleteCommand.MESSAGE_USAGE)); } return new DeleteCommand(index.get()); } /** * Parses arguments in the context of the mark task command. * * @param args full command args string * @return the prepared command */ private Command prepareMark(String args) { Optional<Integer> index = parseIndex(args); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, MarkCommand.MESSAGE_USAGE)); } return new MarkCommand(index.get()); } /** * Parses arguments in the context of the unmark task command. * * @param args full command args string * @return the prepared command */ private Command prepareUnmark(String args) { Optional<Integer> index = parseIndex(args); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UnmarkCommand.MESSAGE_USAGE)); } return new UnmarkCommand(index.get()); } /** * Parses arguments in the context of the tag task command. * * @param args full command args string * @return the prepared command */ private Command prepareTag(String args) { try { String tempArgs = args.trim(); String indexString = tempArgs.substring(0, 1); Optional<Integer> index = parseIndex(indexString); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, TagCommand.MESSAGE_USAGE)); } String tagNames = tempArgs.substring(1); return new TagCommand(index.get(), tagNames); } catch (Exception e) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, TagCommand.MESSAGE_USAGE)); } } /** * Parses arguments in the context of the untag task command. * * @param args full command args string * @return the prepared command */ private Command prepareUntag(String args) { try { String tempArgs = args.trim(); String indexString = tempArgs.substring(0, 1); Optional<Integer> index = parseIndex(indexString); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UntagCommand.MESSAGE_USAGE)); } String tagNames = tempArgs.substring(1); return new UntagCommand(index.get(), tagNames); } catch (Exception e) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UntagCommand.MESSAGE_USAGE)); } } /** * Returns the specified index in the {@code command} IF a positive unsigned * integer is given as the index. Returns an {@code Optional.empty()} * otherwise. */ private Optional<Integer> parseIndex(String command) { final Matcher matcher = ParserFormats.TASK_INDEX_ARGS_FORMAT.matcher(command.trim()); if (!matcher.matches()) { return Optional.empty(); } String index = matcher.group("targetIndex"); if (!StringUtil.isUnsignedInteger(index)) { return Optional.empty(); } return Optional.of(Integer.parseInt(index)); } /** * Parses arguments in the context of the add task command. * * @param args full command args string * @return the prepared command */ private Command prepareUpdate(String args) { String tempArgs = args.trim(); if (tempArgs.length() < 1) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UpdateCommand.MESSAGE_USAGE)); } String indexString = tempArgs.split(" ")[0]; Optional<Integer> index = parseIndex(indexString); if (!index.isPresent()) { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UpdateCommand.MESSAGE_USAGE)); } tempArgs = tempArgs.substring(indexString.length()).trim(); Matcher matcher; matcher = ParserFormats.UPDATE_TASK_ARGS_FORMAT.matcher(tempArgs.trim()); if (matcher.matches()) { return new UpdateCommand(index.get(), matchNameResult(matcher).trim(), matchOnDateTimeResult(matcher), matchByDateTimeResult(matcher), matchPriorityResult(matcher), matchDetailResult(matcher), matchRecurrenceResult(matcher)); } else { return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, UpdateCommand.MESSAGE_USAGE)); } } /** * Parses arguments in the context of the search task command. * * @param args full command args string * @return the prepared command */ private Command prepareSearch(String args) { Pattern[] dataPatterns = { ParserFormats.SEARCH_TASK_ARGS_FORMAT_ON, ParserFormats.SEARCH_TASK_ARGS_FORMAT_BEFORE, ParserFormats.SEARCH_TASK_ARGS_FORMAT_AFTER, ParserFormats.SEARCH_TASK_ARGS_FORMAT_FT, ParserFormats.KEYWORDS_ARGS_FORMAT, ParserFormats.SEARCH_PRIORITY }; String tempArgs = args.trim(); Matcher matcher; for (Pattern p : dataPatterns) { matcher = p.matcher(tempArgs); if (matcher.matches()) { if (p.equals(ParserFormats.SEARCH_TASK_ARGS_FORMAT_ON)) { return new SearchCommand(matchOnDateTimeResult(matcher), 0); } else if (p.equals(ParserFormats.SEARCH_TASK_ARGS_FORMAT_BEFORE)) { return new SearchCommand(matcher.group("beforeDateTime"), 1); } else if (p.equals(ParserFormats.SEARCH_TASK_ARGS_FORMAT_AFTER)) { return new SearchCommand(matcher.group("afterDateTime"), 2); } else if (p.equals(ParserFormats.SEARCH_TASK_ARGS_FORMAT_FT)) { return new SearchCommand(matcher.group("fromDateTime") + "@" + matcher.group("tillDateTime"), 3); } else if (p.equals(ParserFormats.KEYWORDS_ARGS_FORMAT) && tempArgs.indexOf("tag") != 0 && tempArgs.indexOf("done") != 0 && tempArgs.indexOf("undone") != 0 && tempArgs.indexOf("priority") != 0) { return new SearchCommand(matcher.group("keywords"), 4); } else if (p.equals(ParserFormats.SEARCH_PRIORITY)) { return new SearchCommand(matchPriorityResult(matcher), 8); } } } if (tempArgs.indexOf("tag") == 0) { return new SearchCommand(tempArgs, 5); } if (tempArgs.indexOf("done") == 0) { return new SearchCommand(tempArgs, 6); } if (tempArgs.indexOf("undone") == 0) { return new SearchCommand(tempArgs, 7); } return new IncorrectCommand(String.format(MESSAGE_INVALID_COMMAND_FORMAT, SearchCommand.MESSAGE_USAGE)); } /** * Parses arguments in the context of the store command. * * @param args full command args string * @return the prepared command */ private Command prepareStore(String args) { args = args.trim(); return new StoreCommand(args); } }
package test.dr.evomodel.substmodel; import dr.evolution.datatype.DataType; import dr.evolution.datatype.TwoStateCovarion; import dr.evolution.datatype.TwoStates; import dr.evomodel.substmodel.BinaryCovarionModel; import dr.evomodel.substmodel.FrequencyModel; import dr.evomodel.substmodel.GeneralSubstitutionModel; import dr.evomodel.substmodel.SubstitutionModelUtils; import dr.inference.model.Parameter; import dr.math.matrixAlgebra.IllegalDimension; import dr.math.matrixAlgebra.Matrix; import dr.math.matrixAlgebra.Vector; import junit.framework.Test; import junit.framework.TestCase; import junit.framework.TestSuite; /** * BinaryCovarionModel Tester. * * @author Alexei Drummond * @version 1.0 * @since <pre>08/26/2007</pre> */ public class BinaryCovarionModelTest extends TestCase { public BinaryCovarionModelTest(String name) { super(name); } @Override public void setUp() throws Exception { super.setUp(); frequencies = new Parameter.Default(new double[]{0.5, 0.5}); hiddenFrequencies = new Parameter.Default(new double[]{0.5, 0.5}); alpha = new Parameter.Default(0.0); switchingRate = new Parameter.Default(1.0); model = new BinaryCovarionModel(TwoStateCovarion.INSTANCE, frequencies, hiddenFrequencies, alpha, switchingRate, BinaryCovarionModel.Version.VERSION1); dataType = model.getDataType(); } @Override public void tearDown() throws Exception { super.tearDown(); } /** * Tests that pi*Q = 0 */ public void testEquilibriumDistribution() { alpha.setParameterValue(0, 0.1); switchingRate.setParameterValue(0, 1.0); model.setupMatrix(); double[] pi = model.getFrequencyModel().getFrequencies(); try { Matrix m = new Matrix(model.getQ()); Vector p = new Vector(pi); Vector y = m.product(p); assertEquals(0.0, y.norm(), 1e-14); } catch (IllegalDimension illegalDimension) { } } public void testTransitionProbabilitiesAgainstEqualBaseFreqsEqualRates() { // with alpha == 1, the transition probability should be the same as binary jukes cantor alpha.setParameterValue(0, 1.0); switchingRate.setParameterValue(0, 1.0); model.setupMatrix(); double[] matrix = new double[16]; double[] pi = model.getFrequencyModel().getFrequencies(); for (double distance = 0.01; distance <= 1.005; distance += 0.01) { model.getTransitionProbabilities(distance, matrix); double pChange = (matrix[1] + matrix[3]) * pi[0] + (matrix[4] + matrix[6]) * pi[1] + (matrix[9] + matrix[11]) * pi[2] + (matrix[12] + matrix[14]) * pi[3]; // analytical result for the probability of a mismatch in binary jukes cantor model double jc = 0.5 * (1 - Math.exp(-2.0 * distance)); assertEquals(pChange, jc, 1e-14); } } public void testTransitionProbabilitiesUnequalBaseFreqsEqualRates() { // with alpha == 1, the transition probability should be the same as binary jukes cantor alpha.setParameterValue(0, 1.0); switchingRate.setParameterValue(0, 1.0); frequencies.setParameterValue(0, 0.25); frequencies.setParameterValue(1, 0.75); FrequencyModel freqModel = new FrequencyModel(TwoStates.INSTANCE, frequencies); GeneralSubstitutionModel modelToCompare = new GeneralSubstitutionModel(TwoStates.INSTANCE, freqModel, null, 0); model.setupMatrix(); double[] matrix = new double[16]; double[] m = new double[4]; double[] pi = model.getFrequencyModel().getFrequencies(); for (double distance = 0.01; distance <= 1.005; distance += 0.01) { model.getTransitionProbabilities(distance, matrix); modelToCompare.getTransitionProbabilities(distance, m); double pChange = (matrix[1] + matrix[3]) * pi[0] + (matrix[4] + matrix[6]) * pi[1] + (matrix[9] + matrix[11]) * pi[2] + (matrix[12] + matrix[14]) * pi[3]; double pChange2 = m[1] * frequencies.getParameterValue(0) + m[2] * frequencies.getParameterValue(1); System.out.println(distance + "\t" + pChange2 + "\t" + pChange); assertEquals(pChange2, pChange, 1e-14); } } public void testTransitionProbabilitiesUnequalBaseFreqsUnequalRateFreqsEqualRates() { // with alpha == 1, the transition probability should be the same as binary jukes cantor alpha.setParameterValue(0, 1.0); switchingRate.setParameterValue(0, 1.0); frequencies.setParameterValue(0, 0.25); frequencies.setParameterValue(1, 0.75); hiddenFrequencies.setParameterValue(0, 0.1); hiddenFrequencies.setParameterValue(1, 0.9); FrequencyModel freqModel = new FrequencyModel(TwoStates.INSTANCE, frequencies); GeneralSubstitutionModel modelToCompare = new GeneralSubstitutionModel(TwoStates.INSTANCE, freqModel, null, 0); model.setupMatrix(); double[] matrix = new double[16]; double[] m = new double[4]; double[] pi = model.getFrequencyModel().getFrequencies(); for (double distance = 0.01; distance <= 1.005; distance += 0.01) { model.getTransitionProbabilities(distance, matrix); modelToCompare.getTransitionProbabilities(distance, m); double pChange = (matrix[1] + matrix[3]) * pi[0] + (matrix[4] + matrix[6]) * pi[1] + (matrix[9] + matrix[11]) * pi[2] + (matrix[12] + matrix[14]) * pi[3]; double pChange2 = m[1] * frequencies.getParameterValue(0) + m[2] * frequencies.getParameterValue(1); //System.out.println(distance + "\t" + pChange2 + "\t" + pChange); assertEquals(pChange2, pChange, 1e-14); } } public void testTransitionProbabilitiesAgainstMatLab() { // test againt Matlab results for alpha = 0.5 and switching rate = 1.0 // and visible state base frequencies = 0.25, 0.75 alpha.setParameterValue(0, 0.5); switchingRate.setParameterValue(0, 1.0); frequencies.setParameterValue(0, 0.25); frequencies.setParameterValue(1, 0.75); model.setupMatrix(); double[] matrix = new double[16]; double[] pi = model.getFrequencyModel().getFrequencies(); System.out.println(pi[0] + " " + pi[1] + " " + pi[2] + " " + pi[3]); System.out.println(SubstitutionModelUtils.toString(model.getQ(), dataType, 2)); int index = 0; for (double distance = 0.01; distance <= 1.005; distance += 0.01) { model.getTransitionProbabilities(distance, matrix); double pChange = (matrix[1] + matrix[3]) * pi[0] + (matrix[4] + matrix[6]) * pi[1] + (matrix[9] + matrix[11]) * pi[2] + (matrix[12] + matrix[14]) * pi[3]; double pChangeIndependent = TwoStateCovarionModelTest.matLabPChange[index]; //System.out.println(distance + "\t" + pChange + "\t" + pChangeIndependent); assertEquals(pChange, pChangeIndependent, 1e-14); index += 1; } } public static Test suite() { return new TestSuite(BinaryCovarionModelTest.class); } BinaryCovarionModel model; DataType dataType; Parameter frequencies; Parameter hiddenFrequencies; Parameter switchingRate; Parameter alpha; }
package de.danoeh.antennapod.feed; import java.io.File; import java.util.ArrayList; import java.util.Collections; import java.util.Date; import java.util.List; import java.util.concurrent.Executor; import java.util.concurrent.Executors; import java.util.concurrent.ThreadFactory; import de.danoeh.antennapod.AppConfig; import de.danoeh.antennapod.activity.AudioplayerActivity; import de.danoeh.antennapod.asynctask.DownloadStatus; import de.danoeh.antennapod.service.PlaybackService; import de.danoeh.antennapod.storage.*; import de.danoeh.antennapod.util.FeedtitleComparator; import de.danoeh.antennapod.util.comparator.FeedItemPubdateComparator; import android.annotation.SuppressLint; import android.content.Context; import android.content.Intent; import android.database.Cursor; import android.os.AsyncTask; import android.os.Debug; import android.os.Handler; import android.os.Message; import android.util.Log; /** * Singleton class Manages all feeds, categories and feeditems * * * */ public class FeedManager { private static final String TAG = "FeedManager"; public static final String ACITON_FEED_LIST_UPDATE = "de.danoeh.antennapod.action.feed.feedlistUpdate"; public static final String ACTION_UNREAD_ITEMS_UPDATE = "de.danoeh.antennapod.action.feed.unreadItemsUpdate"; public static final String ACTION_QUEUE_UPDATE = "de.danoeh.antennapod.action.feed.queueUpdate"; public static final String EXTRA_FEED_ITEM_ID = "de.danoeh.antennapod.extra.feed.feedItemId"; public static final String EXTRA_FEED_ID = "de.danoeh.antennapod.extra.feed.feedId"; /** Number of completed Download status entries to store. */ private static final int DOWNLOAD_LOG_SIZE = 50; private static FeedManager singleton; private List<Feed> feeds; private ArrayList<FeedCategory> categories; /** Contains all items where 'read' is false */ private List<FeedItem> unreadItems; /** Contains completed Download status entries */ private ArrayList<DownloadStatus> downloadLog; /** Contains the queue of items to be played. */ private List<FeedItem> queue; private DownloadRequester requester; /** Should be used to change the content of the arrays from another thread. */ private Handler contentChanger; /** Ensures that there are no parallel db operations. */ private Executor dbExec; /** Prevents user from starting several feed updates at the same time. */ private static boolean isStartingFeedRefresh = false; private FeedManager() { feeds = Collections.synchronizedList(new ArrayList<Feed>()); categories = new ArrayList<FeedCategory>(); unreadItems = Collections.synchronizedList(new ArrayList<FeedItem>()); requester = DownloadRequester.getInstance(); downloadLog = new ArrayList<DownloadStatus>(); queue = Collections.synchronizedList(new ArrayList<FeedItem>()); contentChanger = new Handler(); dbExec = Executors.newSingleThreadExecutor(new ThreadFactory() { @Override public Thread newThread(Runnable r) { Thread t = new Thread(r); t.setPriority(Thread.MIN_PRIORITY); return t; } }); } public static FeedManager getInstance() { if (singleton == null) { singleton = new FeedManager(); } return singleton; } /** * Play FeedMedia and start the playback service + launch Mediaplayer * Activity. * * @param context * for starting the playbackservice * @param media * that shall be played * @param showPlayer * if Mediaplayer activity shall be started * @param startWhenPrepared * if Mediaplayer shall be started after it has been prepared */ public void playMedia(Context context, FeedMedia media, boolean showPlayer, boolean startWhenPrepared, boolean shouldStream) { // Start playback Service Intent launchIntent = new Intent(context, PlaybackService.class); launchIntent.putExtra(PlaybackService.EXTRA_MEDIA_ID, media.getId()); launchIntent.putExtra(PlaybackService.EXTRA_FEED_ID, media.getItem() .getFeed().getId()); launchIntent.putExtra(PlaybackService.EXTRA_START_WHEN_PREPARED, startWhenPrepared); launchIntent .putExtra(PlaybackService.EXTRA_SHOULD_STREAM, shouldStream); context.startService(launchIntent); if (showPlayer) { // Launch Mediaplayer context.startActivity(PlaybackService.getPlayerActivityIntent( context, media)); } } /** Remove media item that has been downloaded. */ public boolean deleteFeedMedia(Context context, FeedMedia media) { boolean result = false; if (media.isDownloaded()) { File mediaFile = new File(media.file_url); if (mediaFile.exists()) { result = mediaFile.delete(); } media.setDownloaded(false); media.setFile_url(null); setFeedMedia(context, media); } if (AppConfig.DEBUG) Log.d(TAG, "Deleting File. Result: " + result); return result; } /** Remove a feed with all its items and media files and its image. */ public void deleteFeed(final Context context, final Feed feed) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); DownloadRequester requester = DownloadRequester.getInstance(); adapter.open(); // delete image file if (feed.getImage() != null) { if (feed.getImage().isDownloaded() && feed.getImage().getFile_url() != null) { File imageFile = new File(feed.getImage().getFile_url()); imageFile.delete(); } } else if (requester.isDownloadingFile(feed.getImage())) { requester.cancelDownload(context, feed.getImage() .getDownloadId()); } // delete stored media files and mark them as read for (FeedItem item : feed.getItems()) { if (!item.isRead()) { unreadItems.remove(item); } if (queue.contains(item)) { removeQueueItem(item, adapter); } if (item.getMedia() != null && item.getMedia().isDownloaded()) { File mediaFile = new File(item.getMedia().getFile_url()); mediaFile.delete(); } else if (item.getMedia() != null && requester.isDownloadingFile(item.getMedia())) { requester.cancelDownload(context, item.getMedia() .getDownloadId()); } } adapter.removeFeed(feed); adapter.close(); contentChanger.post(new Runnable() { @Override public void run() { feeds.remove(feed); sendFeedUpdateBroadcast(context); } }); } }); } private void sendUnreadItemsUpdateBroadcast(Context context, FeedItem item) { Intent update = new Intent(ACTION_UNREAD_ITEMS_UPDATE); if (item != null) { update.putExtra(EXTRA_FEED_ID, item.getFeed().getId()); update.putExtra(EXTRA_FEED_ITEM_ID, item.getId()); } context.sendBroadcast(update); } private void sendQueueUpdateBroadcast(Context context, FeedItem item) { Intent update = new Intent(ACTION_QUEUE_UPDATE); if (item != null) { update.putExtra(EXTRA_FEED_ID, item.getFeed().getId()); update.putExtra(EXTRA_FEED_ITEM_ID, item.getId()); } context.sendBroadcast(update); } private void sendFeedUpdateBroadcast(Context context) { context.sendBroadcast(new Intent(ACITON_FEED_LIST_UPDATE)); } /** * Sets the 'read'-attribute of a FeedItem. Should be used by all Classes * instead of the setters of FeedItem. */ public void markItemRead(final Context context, final FeedItem item, final boolean read) { if (AppConfig.DEBUG) Log.d(TAG, "Setting item with title " + item.getTitle() + " as read/unread"); item.read = read; setFeedItem(context, item); contentChanger.post(new Runnable() { @Override public void run() { if (read == true) { unreadItems.remove(item); } else { unreadItems.add(item); Collections.sort(unreadItems, new FeedItemPubdateComparator()); } sendUnreadItemsUpdateBroadcast(context, item); } }); } /** * Sets the 'read' attribute of all FeedItems of a specific feed to true * * @param context */ public void markFeedRead(Context context, Feed feed) { for (FeedItem item : feed.getItems()) { if (unreadItems.contains(item)) { markItemRead(context, item, true); } } } /** Marks all items in the unread items list as read */ public void markAllItemsRead(final Context context) { if (AppConfig.DEBUG) Log.d(TAG, "marking all items as read"); for (FeedItem item : unreadItems) { item.read = true; } unreadItems.clear(); sendUnreadItemsUpdateBroadcast(context, null); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); for (FeedItem item : unreadItems) { setFeedItem(item, adapter); } adapter.close(); } }); } @SuppressLint("NewApi") public void refreshAllFeeds(final Context context) { if (AppConfig.DEBUG) Log.d(TAG, "Refreshing all feeds."); if (!isStartingFeedRefresh) { isStartingFeedRefresh = true; AsyncTask<Void, Void, Void> updateWorker = new AsyncTask<Void, Void, Void>() { @Override protected void onPostExecute(Void result) { if (AppConfig.DEBUG) Log.d(TAG, "All feeds have been sent to the downloadmanager"); isStartingFeedRefresh = false; } @Override protected Void doInBackground(Void... params) { for (Feed feed : feeds) { refreshFeed(context, feed); } return null; } }; if (android.os.Build.VERSION.SDK_INT > android.os.Build.VERSION_CODES.GINGERBREAD_MR1) { updateWorker.executeOnExecutor(AsyncTask.THREAD_POOL_EXECUTOR); } else { updateWorker.execute(); } } } /** * Notifies the feed manager that the an image file is invalid. It will try * to redownload it */ public void notifyInvalidImageFile(Context context, FeedImage image) { Log.i(TAG, "The feedmanager was notified about an invalid image download. It will now try to redownload the image file"); requester.downloadImage(context, image); } public void refreshFeed(Context context, Feed feed) { requester.downloadFeed(context, new Feed(feed.getDownload_url(), new Date())); } public void addDownloadStatus(final Context context, final DownloadStatus status) { downloadLog.add(status); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); if (downloadLog.size() > DOWNLOAD_LOG_SIZE) { adapter.removeDownloadStatus(downloadLog.remove(0)); } adapter.setDownloadStatus(status); adapter.close(); } }); } public void addQueueItem(final Context context, final FeedItem item) { contentChanger.post(new Runnable() { @Override public void run() { queue.add(item); sendQueueUpdateBroadcast(context, item); } }); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setQueue(queue); adapter.close(); } }); } /** Removes all items in queue */ public void clearQueue(final Context context) { if (AppConfig.DEBUG) Log.d(TAG, "Clearing queue"); queue.clear(); sendQueueUpdateBroadcast(context, null); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setQueue(queue); adapter.close(); } }); } /** Uses external adapter. */ public void removeQueueItem(FeedItem item, PodDBAdapter adapter) { boolean removed = queue.remove(item); if (removed) { adapter.setQueue(queue); } } /** Uses its own adapter. */ public void removeQueueItem(final Context context, FeedItem item) { boolean removed = queue.remove(item); if (removed) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setQueue(queue); adapter.close(); } }); } sendQueueUpdateBroadcast(context, item); } public void moveQueueItem(final Context context, FeedItem item, int delta) { if (AppConfig.DEBUG) Log.d(TAG, "Moving queue item"); int itemIndex = queue.indexOf(item); int newIndex = itemIndex + delta; if (newIndex >= 0 && newIndex < queue.size()) { FeedItem oldItem = queue.set(newIndex, item); queue.set(itemIndex, oldItem); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setQueue(queue); adapter.close(); } }); } sendQueueUpdateBroadcast(context, item); } public boolean isInQueue(FeedItem item) { return queue.contains(item); } public FeedItem getFirstQueueItem() { if (queue.isEmpty()) { return null; } else { return queue.get(0); } } private void addNewFeed(final Context context, final Feed feed) { contentChanger.post(new Runnable() { @Override public void run() { feeds.add(feed); Collections.sort(feeds, new FeedtitleComparator()); sendFeedUpdateBroadcast(context); } }); dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setCompleteFeed(feed); adapter.close(); } }); } /** * Updates an existing feed or adds it as a new one if it doesn't exist. * * @return The saved Feed with a database ID */ public Feed updateFeed(Context context, final Feed newFeed) { // Look up feed in the feedslist final Feed savedFeed = searchFeedByLink(newFeed.getLink()); if (savedFeed == null) { if (AppConfig.DEBUG) Log.d(TAG, "Found no existing Feed with title " + newFeed.getTitle() + ". Adding as new one."); // Add a new Feed addNewFeed(context, newFeed); return newFeed; } else { if (AppConfig.DEBUG) Log.d(TAG, "Feed with title " + newFeed.getTitle() + " already exists. Syncing new with existing one."); // Look for new or updated Items for (int idx = 0; idx < newFeed.getItems().size(); idx++) { final FeedItem item = newFeed.getItems().get(idx); FeedItem oldItem = searchFeedItemByIdentifyingValue(savedFeed, item.getIdentifyingValue()); if (oldItem == null) { // item is new final int i = idx; item.setFeed(savedFeed); contentChanger.post(new Runnable() { @Override public void run() { savedFeed.getItems().add(i, item); } }); markItemRead(context, item, false); } } // update attributes savedFeed.setLastUpdate(newFeed.getLastUpdate()); savedFeed.setType(newFeed.getType()); setFeed(context, savedFeed); return savedFeed; } } /** Get a Feed by its link */ private Feed searchFeedByLink(String link) { for (Feed feed : feeds) { if (feed.getLink().equals(link)) { return feed; } } return null; } /** * Returns true if a feed with the given download link is already in the * feedlist. */ public boolean feedExists(String downloadUrl) { for (Feed feed : feeds) { if (feed.getDownload_url().equals(downloadUrl)) { return true; } } return false; } /** Get a FeedItem by its identifying value. */ private FeedItem searchFeedItemByIdentifyingValue(Feed feed, String identifier) { for (FeedItem item : feed.getItems()) { if (item.getIdentifyingValue().equals(identifier)) { return item; } } return null; } /** Updates Information of an existing Feed. Uses external adapter. */ public void setFeed(Feed feed, PodDBAdapter adapter) { if (adapter != null) { adapter.setFeed(feed); } else { Log.w(TAG, "Adapter in setFeed was null"); } } /** Updates Information of an existing Feeditem. Uses external adapter. */ public void setFeedItem(FeedItem item, PodDBAdapter adapter) { if (adapter != null) { adapter.setSingleFeedItem(item); } else { Log.w(TAG, "Adapter in setFeedItem was null"); } } /** Updates Information of an existing Feedimage. Uses external adapter. */ public void setFeedImage(FeedImage image, PodDBAdapter adapter) { if (adapter != null) { adapter.setImage(image); } else { Log.w(TAG, "Adapter in setFeedImage was null"); } } /** * Updates Information of an existing Feedmedia object. Uses external * adapter. */ public void setFeedImage(FeedMedia media, PodDBAdapter adapter) { if (adapter != null) { adapter.setMedia(media); } else { Log.w(TAG, "Adapter in setFeedMedia was null"); } } /** * Updates Information of an existing Feed. Creates and opens its own * adapter. */ public void setFeed(final Context context, final Feed feed) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setFeed(feed); adapter.close(); } }); } /** * Updates information of an existing FeedItem. Creates and opens its own * adapter. */ public void setFeedItem(final Context context, final FeedItem item) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setSingleFeedItem(item); adapter.close(); } }); } /** * Updates information of an existing FeedImage. Creates and opens its own * adapter. */ public void setFeedImage(final Context context, final FeedImage image) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setImage(image); adapter.close(); } }); } /** * Updates information of an existing FeedMedia object. Creates and opens * its own adapter. */ public void setFeedMedia(final Context context, final FeedMedia media) { dbExec.execute(new Runnable() { @Override public void run() { PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); adapter.setMedia(media); adapter.close(); } }); } /** Get a Feed by its id */ public Feed getFeed(long id) { for (Feed f : feeds) { if (f.id == id) { return f; } } Log.e(TAG, "Couldn't find Feed with id " + id); return null; } /** Get a Feed Image by its id */ public FeedImage getFeedImage(long id) { for (Feed f : feeds) { FeedImage image = f.getImage(); if (image != null && image.getId() == id) { return image; } } return null; } /** Get a Feed Item by its id and its feed */ public FeedItem getFeedItem(long id, Feed feed) { if (feed != null) { for (FeedItem item : feed.getItems()) { if (item.getId() == id) { return item; } } } Log.e(TAG, "Couldn't find FeedItem with id " + id); return null; } /** Get a FeedMedia object by the id of the Media object and the feed object */ public FeedMedia getFeedMedia(long id, Feed feed) { if (feed != null) { for (FeedItem item : feed.getItems()) { if (item.getMedia().getId() == id) { return item.getMedia(); } } } Log.e(TAG, "Couldn't find FeedMedia with id " + id); if (feed == null) Log.e(TAG, "Feed was null"); return null; } /** Get a FeedMedia object by the id of the Media object. */ public FeedMedia getFeedMedia(long id) { for (Feed feed : feeds) { for (FeedItem item : feed.getItems()) { if (item.getMedia() != null && item.getMedia().getId() == id) { return item.getMedia(); } } } Log.w(TAG, "Couldn't find FeedMedia with id " + id); return null; } public DownloadStatus getDownloadStatus(FeedFile feedFile) { for (DownloadStatus status : downloadLog) { if (status.getFeedFile() == feedFile) { return status; } } return null; } /** Reads the database */ public void loadDBData(Context context) { updateArrays(context); } public void updateArrays(Context context) { feeds.clear(); categories.clear(); PodDBAdapter adapter = new PodDBAdapter(context); adapter.open(); extractFeedlistFromCursor(context, adapter); extractDownloadLogFromCursor(context, adapter); extractQueueFromCursor(context, adapter); adapter.close(); Collections.sort(feeds, new FeedtitleComparator()); Collections.sort(unreadItems, new FeedItemPubdateComparator()); } private void extractFeedlistFromCursor(Context context, PodDBAdapter adapter) { if (AppConfig.DEBUG) Log.d(TAG, "Extracting Feedlist"); Cursor feedlistCursor = adapter.getAllFeedsCursor(); if (feedlistCursor.moveToFirst()) { do { Date lastUpdate = new Date( feedlistCursor .getLong(PodDBAdapter.KEY_LAST_UPDATE_INDEX)); Feed feed = new Feed(lastUpdate); feed.id = feedlistCursor.getLong(PodDBAdapter.KEY_ID_INDEX); feed.setTitle(feedlistCursor .getString(PodDBAdapter.KEY_TITLE_INDEX)); feed.setLink(feedlistCursor .getString(PodDBAdapter.KEY_LINK_INDEX)); feed.setDescription(feedlistCursor .getString(PodDBAdapter.KEY_DESCRIPTION_INDEX)); feed.setPaymentLink(feedlistCursor .getString(PodDBAdapter.KEY_PAYMENT_LINK_INDEX)); feed.setAuthor(feedlistCursor .getString(PodDBAdapter.KEY_AUTHOR_INDEX)); feed.setLanguage(feedlistCursor .getString(PodDBAdapter.KEY_LANGUAGE_INDEX)); feed.setType(feedlistCursor .getString(PodDBAdapter.KEY_TYPE_INDEX)); long imageIndex = feedlistCursor .getLong(PodDBAdapter.KEY_IMAGE_INDEX); if (imageIndex != 0) { feed.setImage(adapter.getFeedImage(imageIndex)); feed.getImage().setFeed(feed); } feed.file_url = feedlistCursor .getString(PodDBAdapter.KEY_FILE_URL_INDEX); feed.download_url = feedlistCursor .getString(PodDBAdapter.KEY_DOWNLOAD_URL_INDEX); feed.setDownloaded(feedlistCursor .getInt(PodDBAdapter.KEY_DOWNLOADED_INDEX) > 0); // Get FeedItem-Object Cursor itemlistCursor = adapter.getAllItemsOfFeedCursor(feed); feed.setItems(extractFeedItemsFromCursor(context, feed, itemlistCursor, adapter)); itemlistCursor.close(); feeds.add(feed); } while (feedlistCursor.moveToNext()); } feedlistCursor.close(); } private ArrayList<FeedItem> extractFeedItemsFromCursor(Context context, Feed feed, Cursor itemlistCursor, PodDBAdapter adapter) { if (AppConfig.DEBUG) Log.d(TAG, "Extracting Feeditems of feed " + feed.getTitle()); ArrayList<FeedItem> items = new ArrayList<FeedItem>(); ArrayList<String> mediaIds = new ArrayList<String>(); if (itemlistCursor.moveToFirst()) { do { FeedItem item = new FeedItem(); item.id = itemlistCursor.getLong(PodDBAdapter.KEY_ID_INDEX); item.setFeed(feed); item.setTitle(itemlistCursor .getString(PodDBAdapter.KEY_TITLE_INDEX)); item.setLink(itemlistCursor .getString(PodDBAdapter.KEY_LINK_INDEX)); item.setDescription(itemlistCursor .getString(PodDBAdapter.KEY_DESCRIPTION_INDEX)); item.setContentEncoded(itemlistCursor .getString(PodDBAdapter.KEY_CONTENT_ENCODED_INDEX)); item.setPubDate(new Date(itemlistCursor .getLong(PodDBAdapter.KEY_PUBDATE_INDEX))); item.setPaymentLink(itemlistCursor .getString(PodDBAdapter.KEY_PAYMENT_LINK_INDEX)); long mediaId = itemlistCursor .getLong(PodDBAdapter.KEY_MEDIA_INDEX); if (mediaId != 0) { mediaIds.add(String.valueOf(mediaId)); item.setMedia(new FeedMedia(mediaId, item)); } item.read = (itemlistCursor.getInt(PodDBAdapter.KEY_READ_INDEX) > 0) ? true : false; item.setItemIdentifier(itemlistCursor .getString(PodDBAdapter.KEY_ITEM_IDENTIFIER_INDEX)); if (!item.read) { unreadItems.add(item); } // extract chapters boolean hasSimpleChapters = itemlistCursor .getInt(PodDBAdapter.KEY_HAS_SIMPLECHAPTERS_INDEX) > 0; if (hasSimpleChapters) { Cursor chapterCursor = adapter .getSimpleChaptersOfFeedItemCursor(item); if (chapterCursor.moveToFirst()) { item.setSimpleChapters(new ArrayList<SimpleChapter>()); do { SimpleChapter chapter = new SimpleChapter( item, chapterCursor .getLong(PodDBAdapter.KEY_SC_START_INDEX), chapterCursor .getString(PodDBAdapter.KEY_TITLE_INDEX), chapterCursor .getString(PodDBAdapter.KEY_SC_LINK_INDEX)); chapter.setId(chapterCursor .getLong(PodDBAdapter.KEY_ID_INDEX)); item.getSimpleChapters().add(chapter); } while (chapterCursor.moveToNext()); } chapterCursor.close(); } items.add(item); } while (itemlistCursor.moveToNext()); } extractMediafromFeedItemlist(adapter, items, mediaIds); Collections.sort(items, new FeedItemPubdateComparator()); return items; } private void extractMediafromFeedItemlist(PodDBAdapter adapter, ArrayList<FeedItem> items, ArrayList<String> mediaIds) { ArrayList<FeedItem> itemsCopy = new ArrayList<FeedItem>(items); Cursor cursor = adapter.getFeedMediaCursor(mediaIds .toArray(new String[mediaIds.size()])); if (cursor.moveToFirst()) { do { long mediaId = cursor.getLong(PodDBAdapter.KEY_ID_INDEX); // find matching feed item FeedItem item = getMatchingItemForMedia(mediaId, itemsCopy); itemsCopy.remove(item); if (item != null) { item.setMedia(new FeedMedia( mediaId, item, cursor.getInt(PodDBAdapter.KEY_DURATION_INDEX), cursor.getInt(PodDBAdapter.KEY_POSITION_INDEX), cursor.getLong(PodDBAdapter.KEY_SIZE_INDEX), cursor.getString(PodDBAdapter.KEY_MIME_TYPE_INDEX), cursor.getString(PodDBAdapter.KEY_FILE_URL_INDEX), cursor.getString(PodDBAdapter.KEY_DOWNLOAD_URL_INDEX), cursor.getInt(PodDBAdapter.KEY_DOWNLOADED_INDEX) > 0)); } } while (cursor.moveToNext()); cursor.close(); } } private FeedItem getMatchingItemForMedia(long mediaId, ArrayList<FeedItem> items) { for (FeedItem item : items) { if (item.getMedia() != null && item.getMedia().getId() == mediaId) { return item; } } return null; } private void extractDownloadLogFromCursor(Context context, PodDBAdapter adapter) { if (AppConfig.DEBUG) Log.d(TAG, "Extracting DownloadLog"); Cursor logCursor = adapter.getDownloadLogCursor(); if (logCursor.moveToFirst()) { do { long id = logCursor.getLong(PodDBAdapter.KEY_ID_INDEX); long feedfileId = logCursor .getLong(PodDBAdapter.KEY_FEEDFILE_INDEX); int feedfileType = logCursor .getInt(PodDBAdapter.KEY_FEEDFILETYPE_INDEX); FeedFile feedfile = null; switch (feedfileType) { case PodDBAdapter.FEEDFILETYPE_FEED: feedfile = getFeed(feedfileId); break; case PodDBAdapter.FEEDFILETYPE_FEEDIMAGE: feedfile = getFeedImage(feedfileId); break; case PodDBAdapter.FEEDFILETYPE_FEEDMEDIA: feedfile = getFeedMedia(feedfileId); } if (feedfile != null) { // otherwise ignore status boolean successful = logCursor .getInt(PodDBAdapter.KEY_SUCCESSFUL_INDEX) > 0; int reason = logCursor .getInt(PodDBAdapter.KEY_REASON_INDEX); Date completionDate = new Date( logCursor .getLong(PodDBAdapter.KEY_COMPLETION_DATE_INDEX)); downloadLog.add(new DownloadStatus(id, feedfile, successful, reason, completionDate)); } } while (logCursor.moveToNext()); } logCursor.close(); } private void extractQueueFromCursor(Context context, PodDBAdapter adapter) { if (AppConfig.DEBUG) Log.d(TAG, "Extracting Queue"); Cursor cursor = adapter.getQueueCursor(); if (cursor.moveToFirst()) { do { int index = cursor.getInt(PodDBAdapter.KEY_ID_INDEX); Feed feed = getFeed(cursor .getLong(PodDBAdapter.KEY_QUEUE_FEED_INDEX)); if (feed != null) { FeedItem item = getFeedItem( cursor.getLong(PodDBAdapter.KEY_FEEDITEM_INDEX), feed); if (item != null) { queue.add(index, item); } } } while (cursor.moveToNext()); } cursor.close(); } public List<Feed> getFeeds() { return feeds; } public List<FeedItem> getUnreadItems() { return unreadItems; } public ArrayList<DownloadStatus> getDownloadLog() { return downloadLog; } public List<FeedItem> getQueue() { return queue; } }
package de.geeksfactory.opacclient.apis; import java.io.IOException; import java.io.UnsupportedEncodingException; import java.net.URLEncoder; import java.text.ParseException; import java.text.SimpleDateFormat; import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Locale; import java.util.Map; import java.util.regex.Matcher; import java.util.regex.Pattern; import org.apache.http.NameValuePair; import org.apache.http.client.ClientProtocolException; import org.apache.http.client.CookieStore; import org.apache.http.client.entity.UrlEncodedFormEntity; import org.apache.http.impl.client.BasicCookieStore; import org.apache.http.message.BasicNameValuePair; import org.json.JSONException; import org.json.JSONObject; import org.jsoup.Jsoup; import org.jsoup.nodes.Document; import org.jsoup.nodes.Element; import org.jsoup.select.Elements; import de.geeksfactory.opacclient.NotReachableException; import de.geeksfactory.opacclient.i18n.StringProvider; import de.geeksfactory.opacclient.objects.Account; import de.geeksfactory.opacclient.objects.AccountData; import de.geeksfactory.opacclient.objects.Detail; import de.geeksfactory.opacclient.objects.DetailledItem; import de.geeksfactory.opacclient.objects.Filter; import de.geeksfactory.opacclient.objects.Filter.Option; import de.geeksfactory.opacclient.objects.Library; import de.geeksfactory.opacclient.objects.SearchRequestResult; import de.geeksfactory.opacclient.objects.SearchResult; import de.geeksfactory.opacclient.objects.SearchResult.MediaType; import de.geeksfactory.opacclient.objects.SearchResult.Status; import de.geeksfactory.opacclient.searchfields.DropdownSearchField; import de.geeksfactory.opacclient.searchfields.SearchField; import de.geeksfactory.opacclient.searchfields.SearchQuery; import de.geeksfactory.opacclient.searchfields.TextSearchField; /** * Implementation of Fleischmann iOpac, including account support Seems to work * in all the libraries currently supported without any modifications. * * @author Johan von Forstner, 17.09.2013 * */ public class IOpac extends BaseApi implements OpacApi { protected String opac_url = ""; protected String dir = "/iopac"; protected JSONObject data; protected boolean initialised = false; protected Library library; protected int resultcount = 10; protected String reusehtml; protected String rechnr; protected int results_total; protected int maxProlongCount = -1; CookieStore cookieStore = new BasicCookieStore(); protected static HashMap<String, MediaType> defaulttypes = new HashMap<String, MediaType>(); static { defaulttypes.put("b", MediaType.BOOK); defaulttypes.put("o", MediaType.BOOK); defaulttypes.put("e", MediaType.BOOK); defaulttypes.put("p", MediaType.BOOK); defaulttypes.put("j", MediaType.BOOK); defaulttypes.put("g", MediaType.BOOK); defaulttypes.put("k", MediaType.BOOK); defaulttypes.put("a", MediaType.BOOK); defaulttypes.put("c", MediaType.AUDIOBOOK); defaulttypes.put("u", MediaType.AUDIOBOOK); defaulttypes.put("l", MediaType.AUDIOBOOK); defaulttypes.put("q", MediaType.CD_SOFTWARE); defaulttypes.put("r", MediaType.CD_SOFTWARE); defaulttypes.put("v", MediaType.MOVIE); defaulttypes.put("d", MediaType.CD_MUSIC); defaulttypes.put("n", MediaType.SCORE_MUSIC); defaulttypes.put("s", MediaType.BOARDGAME); defaulttypes.put("z", MediaType.MAGAZINE); defaulttypes.put("x", MediaType.MAGAZINE); } @Override public void start() throws IOException, NotReachableException { } @Override public void init(Library lib) { super.init(lib); this.library = lib; this.data = lib.getData(); try { this.opac_url = data.getString("baseurl"); if (data.has("maxprolongcount")) this.maxProlongCount = data.getInt("maxprolongcount"); if (data.has("dir")) this.dir = data.getString("dir"); } catch (JSONException e) { throw new RuntimeException(e); } } protected int addParameters(SearchQuery query, List<NameValuePair> params, int index) { if (query.getValue().equals("")) return index; params.add(new BasicNameValuePair(query.getKey(), query.getValue())); return index + 1; } @Override public SearchRequestResult search(List<SearchQuery> queries) throws IOException, NotReachableException, OpacErrorException { List<NameValuePair> params = new ArrayList<NameValuePair>(); int index = 0; start(); for (SearchQuery query : queries) { index = addParameters(query, params, index); } params.add(new BasicNameValuePair("Anzahl", "10")); params.add(new BasicNameValuePair("pshStart", "Suchen")); if (index == 0) { throw new OpacErrorException( stringProvider.getString(StringProvider.NO_CRITERIA_INPUT)); } String html = httpPost(opac_url + "/cgi-bin/di.exe", new UrlEncodedFormEntity(params, "iso-8859-1"), getDefaultEncoding()); return parse_search(html, 1); } protected SearchRequestResult parse_search(String html, int page) throws OpacErrorException, NotReachableException { Document doc = Jsoup.parse(html); if (doc.select("h4").size() > 0) { if (doc.select("h4").text().trim().startsWith("0 gefundene Medien")) { // nothing found return new SearchRequestResult(new ArrayList<SearchResult>(), 0, 1, 1); } else if (!doc.select("h4").text().trim() .contains("gefundene Medien") && !doc.select("h4").text().trim() .contains("Es wurden mehr als")) { // error throw new OpacErrorException(doc.select("h4").text().trim()); } } else if (doc.select("h1").size() > 0) { if (doc.select("h1").text().trim().contains("RUNTIME ERROR")) { // Server Error throw new NotReachableException(); } else { throw new OpacErrorException(stringProvider.getFormattedString( StringProvider.UNKNOWN_ERROR_WITH_DESCRIPTION, doc .select("h1").text().trim())); } } else { return null; } updateRechnr(doc); reusehtml = html; results_total = -1; if (doc.select("h4").text().trim().contains("Es wurden mehr als")) { results_total = 200; } else { String resultnumstr = doc.select("h4").first().text(); resultnumstr = resultnumstr.substring(0, resultnumstr.indexOf(" ")) .trim(); results_total = Integer.parseInt(resultnumstr); } List<SearchResult> results = new ArrayList<SearchResult>(); Elements tables = doc.select("table").first().select("tr:has(td)"); Map<String, Integer> colmap = new HashMap<String, Integer>(); Element thead = doc.select("table").first().select("tr:has(th)") .first(); int j = 0; for (Element th : thead.select("th")) { String text = th.text().trim().toLowerCase(Locale.GERMAN); if (text.contains("cover")) colmap.put("cover", j); else if (text.contains("titel")) colmap.put("title", j); else if (text.contains("verfasser")) colmap.put("author", j); else if (text.contains("mtyp")) colmap.put("category", j); else if (text.contains("jahr")) colmap.put("year", j); else if (text.contains("signatur")) colmap.put("shelfmark", j); else if (text.contains("info")) colmap.put("info", j); else if (text.contains("abteilung")) colmap.put("department", j); else if (text.contains("verliehen") || text.contains("verl.")) colmap.put("returndate", j); else if (text.contains("anz.res")) colmap.put("reservations", j); j++; } if (colmap.size() == 0) { colmap.put("cover", 0); colmap.put("title", 1); colmap.put("author", 2); colmap.put("publisher", 3); colmap.put("year", 4); colmap.put("department", 5); colmap.put("shelfmark", 6); colmap.put("returndate", 7); colmap.put("category", 8); } for (int i = 0; i < tables.size(); i++) { Element tr = tables.get(i); SearchResult sr = new SearchResult(); if (tr.select("td").get(colmap.get("cover")).select("img").size() > 0) { String imgUrl = tr.select("td").get(colmap.get("cover")) .select("img").first().attr("src"); sr.setCover(imgUrl); } // Media Type if (colmap.get("category") != null) { String mType = tr.select("td").get(colmap.get("category")) .text().trim().replace("\u00a0", ""); if (data.has("mediatypes")) { try { sr.setType(MediaType.valueOf(data.getJSONObject( "mediatypes").getString( mType.toLowerCase(Locale.GERMAN)))); } catch (JSONException e) { sr.setType(defaulttypes.get(mType .toLowerCase(Locale.GERMAN))); } catch (IllegalArgumentException e) { sr.setType(defaulttypes.get(mType .toLowerCase(Locale.GERMAN))); } } else { sr.setType(defaulttypes.get(mType .toLowerCase(Locale.GERMAN))); } } // Title and additional info String title = ""; String additionalInfo = ""; if (colmap.get("info") != null) { Element info = tr.select("td").get(colmap.get("info")); title = info.select("a[title=Details-Info]").text().trim(); String authorIn = info.text().substring(0, info.text().indexOf(title)); if (authorIn.contains(":")) { authorIn = authorIn.replaceFirst("^([^:]*):(.*)$", "$1"); additionalInfo += " - " + authorIn; } } else { title = tr.select("td").get(colmap.get("title")).text().trim() .replace("\u00a0", ""); if (title.contains("(")) { additionalInfo += title.substring(title.indexOf("(")); title = title.substring(0, title.indexOf("(") - 1).trim(); } // Author if (colmap.containsKey("author")) { String author = tr.select("td").get(colmap.get("author")) .text().trim().replace("\u00a0", ""); additionalInfo += " - " + author; } } // Publisher if (colmap.containsKey("publisher")) { String publisher = tr.select("td").get(colmap.get("publisher")) .text().trim().replace("\u00a0", ""); additionalInfo += " (" + publisher; } // Year if (colmap.containsKey("year")) { String year = tr.select("td").get(colmap.get("year")).text() .trim().replace("\u00a0", ""); additionalInfo += ", " + year + ")"; } sr.setInnerhtml("<b>" + title + "</b><br>" + additionalInfo); // Status String status = tr.select("td").get(colmap.get("returndate")) .text().trim().replace("\u00a0", ""); if (status.equals("") || status.toLowerCase(Locale.GERMAN).contains("onleihe") || status.contains("verleihbar") || status.contains("entleihbar") || status.contains("ausleihbar")) { sr.setStatus(Status.GREEN); } else { sr.setStatus(Status.RED); sr.setInnerhtml(sr.getInnerhtml() + "<br><i>" + stringProvider.getString(StringProvider.LENT_UNTIL) + " " + status + "</i>"); } // In some libraries (for example search for "atelier" in Preetz) // the results are sorted differently than their numbers suggest, so // we need to detect the number ("recno") from the link String link = tr.select("a[href^=/cgi-bin/di.exe?page=]").attr( "href"); Map<String, String> params = getQueryParamsFirst(link); if (params.containsKey("recno")) { int recno = Integer.valueOf(params.get("recno")); sr.setNr(10 * (page - 1) + recno - 1); } else { // the above should work, but fall back to this if it doesn't sr.setNr(10 * (page - 1) + i); } // In some libraries (for example Preetz) we can detect the media ID // here using another link present in the search results Elements idLinks = tr.select("a[href^=/cgi-bin/di.exe?cMedNr]"); if (idLinks.size() > 0) { Map<String, String> idParams = getQueryParamsFirst(idLinks.first().attr("href")); String id = idParams.get("cMedNr"); sr.setId(id); } else { sr.setId(null); } results.add(sr); } resultcount = results.size(); return new SearchRequestResult(results, results_total, page); } @Override public SearchRequestResult searchGetPage(int page) throws IOException, NotReachableException, OpacErrorException { if (!initialised) start(); String html = httpGet(opac_url + "/cgi-bin/di.exe?page=" + page + "&rechnr=" + rechnr + "&Anzahl=10&FilNr=", getDefaultEncoding()); return parse_search(html, page); } @Override public SearchRequestResult filterResults(Filter filter, Option option) throws IOException, NotReachableException { return null; } @Override public DetailledItem getResultById(String id, String homebranch) throws IOException, NotReachableException { if (id == null && reusehtml != null) { return parse_result(reusehtml); } String html = httpGet(opac_url + "/cgi-bin/di.exe?cMedNr=" + id + "&mode=23", getDefaultEncoding()); return parse_result(html); } @Override public DetailledItem getResult(int position) throws IOException { int page = Double.valueOf(Math.floor(position / 10)).intValue() + 1; String html = httpGet(opac_url + "/cgi-bin/di.exe?page=" + page + "&rechnr=" + rechnr + "&Anzahl=10&recno=" + (position + 1) + "&FilNr=", getDefaultEncoding()); return parse_result(html); } protected DetailledItem parse_result(String html) throws IOException { Document doc = Jsoup.parse(html); DetailledItem result = new DetailledItem(); String id = null; if (doc.select("input[name=mednr]").size() > 0) id = doc.select("input[name=mednr]").first().val().trim(); else { for (Element a : doc.select("table").last().select("td a")) { if (a.attr("href").contains("mednr=")) { id = a.attr("href"); break; } } Integer idPosition = id.indexOf("mednr=") + 6; id = id.substring(idPosition, id.indexOf("&", idPosition)).trim(); } result.setId(id); Elements table = doc.select("table").get(1).select("tr"); // GET COVER IMAGE String imgUrl = table.get(0) .select("img[src^=http://images-eu.amazon.com]").attr("src") .replace("TZZZZZZZ", "L"); result.setCover(imgUrl); // GET INFORMATION Map<String, String> e = new HashMap<String, String>(); for (Element element : table) { String detail = element.select("td").text().trim() .replace("\u00a0", ""); String title = element.select("th").text().trim() .replace("\u00a0", ""); if (!title.equals("")) { if (title.contains("verliehen bis")) { if (detail.equals("")) { e.put(DetailledItem.KEY_COPY_STATUS, "verfügbar"); } else { e.put(DetailledItem.KEY_COPY_STATUS, "verliehen bis " + detail); } } else if (title.contains("Abteilung")) { e.put(DetailledItem.KEY_COPY_DEPARTMENT, detail); } else if (title.contains("Signatur")) { e.put(DetailledItem.KEY_COPY_SHELFMARK, detail); } else if (title.contains("Titel")) { result.setTitle(detail); } else if (!title.contains("Cover")) { result.addDetail(new Detail(title, detail)); } } } // GET RESERVATION INFO if ("verfügbar".equals(e.get(DetailledItem.KEY_COPY_STATUS)) || doc.select( "a[href^=/cgi-bin/di.exe?mode=10], input.resbutton") .size() == 0) { result.setReservable(false); } else { result.setReservable(true); if (doc.select("a[href^=/cgi-bin/di.exe?mode=10]").size() > 0) { // Reservation via link result.setReservation_info(doc .select("a[href^=/cgi-bin/di.exe?mode=10]").first() .attr("href").substring(1).replace(" ", "")); } else { // Reservation via form (method="get") Element form = doc.select("input.resbutton").first().parent(); result.setReservation_info(generateQuery(form)); } } result.addCopy(e); return result; } private String generateQuery(Element form) throws UnsupportedEncodingException { StringBuilder builder = new StringBuilder(); builder.append(form.attr("action").substring(1)); int i = 0; for (Element input : form.select("input")) { builder.append(i == 0 ? "?" : "&"); builder.append(input.attr("name") + "=" + URLEncoder.encode(input.attr("value"), "UTF-8")); i++; } return builder.toString(); } @Override public ReservationResult reservation(DetailledItem item, Account account, int useraction, String selection) throws IOException { String reservation_info = item.getReservation_info(); // STEP 1: Login page String html = httpGet(opac_url + "/" + reservation_info, getDefaultEncoding()); Document doc = Jsoup.parse(html); if (doc.select("table").first().text().contains("kann nicht")) { return new ReservationResult(MultiStepResult.Status.ERROR, doc .select("table").first().text().trim()); } if (doc.select("form[name=form1]").size() == 0) return new ReservationResult(MultiStepResult.Status.ERROR); Element form = doc.select("form[name=form1]").first(); List<BasicNameValuePair> params = new ArrayList<BasicNameValuePair>(); params.add(new BasicNameValuePair("sleKndNr", account.getName())); params.add(new BasicNameValuePair("slePw", account.getPassword())); params.add(new BasicNameValuePair("pshLogin", "Reservieren")); for (Element input : form.select("input[type=hidden]")) { params.add(new BasicNameValuePair(input.attr("name"), input .attr("value"))); } // STEP 2: Confirmation page html = httpPost(opac_url + "/cgi-bin/di.exe", new UrlEncodedFormEntity( params), getDefaultEncoding()); doc = Jsoup.parse(html); if (doc.select("form[name=form1]").size() > 0) { // STEP 3: There is another confirmation needed form = doc.select("form[name=form1]").first(); html = httpGet(opac_url + "/" + generateQuery(form), getDefaultEncoding()); doc = Jsoup.parse(html); } if (doc.select("h1").text().contains("fehlgeschlagen") || doc.select("h1").text().contains("Achtung")) { return new ReservationResult(MultiStepResult.Status.ERROR, doc .select("table").first().text().trim()); } else { return new ReservationResult(MultiStepResult.Status.OK); } } @Override public ProlongResult prolong(String media, Account account, int useraction, String Selection) throws IOException { String html = httpGet(opac_url + "/" + media, getDefaultEncoding()); Document doc = Jsoup.parse(html); if (doc.select("table th").size() > 0) { if (doc.select("h1").size() > 0) { if (doc.select("h1").first().text().contains("Hinweis")) { return new ProlongResult(MultiStepResult.Status.ERROR, doc .select("table th").first().text()); } } try { Element form = doc.select("form[name=form1]").first(); String sessionid = form.select("input[name=sessionid]").attr( "value"); String mednr = form.select("input[name=mednr]").attr("value"); httpGet(opac_url + "/cgi-bin/di.exe?mode=8&kndnr=" + account.getName() + "&mednr=" + mednr + "&sessionid=" + sessionid + "&psh100=Verl%C3%A4ngern", getDefaultEncoding()); return new ProlongResult(MultiStepResult.Status.OK); } catch (Throwable e) { e.printStackTrace(); return new ProlongResult(MultiStepResult.Status.ERROR); } } return new ProlongResult(MultiStepResult.Status.ERROR); } @Override public ProlongAllResult prolongAll(Account account, int useraction, String selection) throws IOException { return null; } @Override public CancelResult cancel(String media, Account account, int useraction, String selection) throws IOException, OpacErrorException { String html = httpGet(opac_url + "/" + media, getDefaultEncoding()); Document doc = Jsoup.parse(html); try { Element form = doc.select("form[name=form1]").first(); String sessionid = form.select("input[name=sessionid]").attr( "value"); String mednr = form.select("input[name=mednr]").attr("value"); httpGet(opac_url + "/cgi-bin/di.exe?mode=9&kndnr=" + account.getName() + "&mednr=" + mednr + "&sessionid=" + sessionid + "&psh100=Stornieren", getDefaultEncoding()); return new CancelResult(MultiStepResult.Status.OK); } catch (Throwable e) { e.printStackTrace(); throw new NotReachableException(); } } @Override public AccountData account(Account account) throws IOException, JSONException, OpacErrorException { List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("sleKndNr", account.getName())); params.add(new BasicNameValuePair("slePw", account.getPassword())); params.add(new BasicNameValuePair("pshLogin", "Login")); String html = httpPost(opac_url + "/cgi-bin/di.exe", new UrlEncodedFormEntity(params, "iso-8859-1"), getDefaultEncoding()); Document doc = Jsoup.parse(html); AccountData res = new AccountData(account.getId()); List<Map<String, String>> medien = new ArrayList<Map<String, String>>(); List<Map<String, String>> reserved = new ArrayList<Map<String, String>>(); if (doc.select("a[name=AUS]").size() > 0) { parse_medialist(medien, doc, 1); } if (doc.select("a[name=RES]").size() > 0) { parse_reslist(reserved, doc, 1); } res.setLent(medien); res.setReservations(reserved); if (medien.isEmpty() && reserved.isEmpty()) { if (doc.select("h1").size() > 0) { if (doc.select("h4").text().trim() .contains("keine ausgeliehenen Medien")) { // There is no lent media, but the server is working // correctly } else if (doc.select("h1").text().trim() .contains("RUNTIME ERROR")) { // Server Error throw new NotReachableException(); } else { throw new OpacErrorException( stringProvider .getFormattedString( StringProvider.UNKNOWN_ERROR_ACCOUNT_WITH_DESCRIPTION, doc.select("h1").text().trim())); } } else { throw new OpacErrorException( stringProvider .getString(StringProvider.UNKNOWN_ERROR_ACCOUNT)); } } return res; } protected void parse_medialist(List<Map<String, String>> medien, Document doc, int offset) throws ClientProtocolException, IOException { Elements copytrs = doc.select("a[name=AUS] ~ table").first() .select("tr"); doc.setBaseUri(opac_url); SimpleDateFormat sdf = new SimpleDateFormat("dd.MM.yyyy", Locale.GERMAN); int trs = copytrs.size(); if (trs < 2) return; assert (trs > 0); JSONObject copymap = new JSONObject(); try { if (data.has("accounttable")) copymap = data.getJSONObject("accounttable"); } catch (JSONException e) { } for (int i = 1; i < trs; i++) { Element tr = copytrs.get(i); Map<String, String> e = new HashMap<String, String>(); if (copymap.optInt("title", 0) >= 0) e.put(AccountData.KEY_LENT_TITLE, tr.child(copymap.optInt("title", 0)).text().trim() .replace("\u00a0", "")); if (copymap.optInt("author", 0) >= 1) e.put(AccountData.KEY_LENT_AUTHOR, tr.child(copymap.optInt("author", 1)).text().trim() .replace("\u00a0", "")); int prolongCount = 0; if (copymap.optInt("prolongcount", 3) >= 0) prolongCount = Integer.parseInt(tr .child(copymap.optInt("prolongcount", 3)).text().trim() .replace("\u00a0", "")); /* * not needed currently, because in Schleswig books can only be pro- * longed once, so the prolong count is visible from the renewable * status e.put(AccountData.KEY_LENT_STATUS, * String.valueOf(prolongCount) + "x verl."); */ if (maxProlongCount != -1) { e.put(AccountData.KEY_LENT_RENEWABLE, prolongCount < maxProlongCount ? "Y" : "N"); } if (copymap.optInt("deadline", 4) >= 0) e.put(AccountData.KEY_LENT_DEADLINE, tr.child(copymap.optInt("deadline", 4)).text().trim() .replace("\u00a0", "")); try { e.put(AccountData.KEY_LENT_DEADLINE_TIMESTAMP, String .valueOf(sdf .parse(e.get(AccountData.KEY_LENT_DEADLINE)) .getTime())); } catch (ParseException e1) { e1.printStackTrace(); } if (copymap.optInt("prolongurl", 5) >= 0) { String link = tr.child(copymap.optInt("prolongurl", 5)) .select("a").attr("href"); e.put(AccountData.KEY_LENT_LINK, link); // find media number with regex Pattern pattern = Pattern.compile("mednr=([^&]*)&"); Matcher matcher = pattern.matcher(link); matcher.find(); if (matcher.group() != null) { e.put(AccountData.KEY_LENT_ID, matcher.group(1)); } } medien.add(e); } assert (medien.size() == trs - 1); } protected void parse_reslist(List<Map<String, String>> medien, Document doc, int offset) throws ClientProtocolException, IOException { Elements copytrs = doc.select("a[name=RES] ~ table:contains(Titel)") .first().select("tr"); doc.setBaseUri(opac_url); int trs = copytrs.size(); if (trs < 2) return; assert (trs > 0); for (int i = 1; i < trs; i++) { Element tr = copytrs.get(i); Map<String, String> e = new HashMap<String, String>(); e.put(AccountData.KEY_RESERVATION_TITLE, tr.child(0).text().trim() .replace("\u00a0", "")); e.put(AccountData.KEY_RESERVATION_AUTHOR, tr.child(1).text().trim() .replace("\u00a0", "")); e.put(AccountData.KEY_RESERVATION_READY, tr.child(4).text().trim() .replace("\u00a0", "")); e.put(AccountData.KEY_RESERVATION_CANCEL, tr.child(5).select("a") .attr("href")); medien.add(e); } assert (medien.size() == trs - 1); } private SearchField createSearchField(Element descTd, Element inputTd) { String name = descTd.select("span, blockquote").text().replace(":", "") .trim().replace("\u00a0", ""); if (inputTd.select("select").size() > 0 && !name.equals("Treffer/Seite") && !name.equals("Medientypen") && !name.equals("Treffer pro Seite")) { Element select = inputTd.select("select").first(); DropdownSearchField field = new DropdownSearchField(); field.setDisplayName(name); field.setId(select.attr("name")); List<Map<String, String>> options = new ArrayList<Map<String, String>>(); for (Element option : select.select("option")) { Map<String, String> map = new HashMap<String, String>(); map.put("key", option.attr("value")); map.put("value", option.text()); options.add(map); } field.setDropdownValues(options); return field; } else if (inputTd.select("input").size() > 0) { TextSearchField field = new TextSearchField(); Element input = inputTd.select("input").first(); field.setDisplayName(name); field.setId(input.attr("name")); field.setHint(""); return field; } else { return null; } } @Override public List<SearchField> getSearchFields() throws IOException { List<SearchField> fields = new ArrayList<SearchField>(); // Extract all search fields, except media types String html; try { html = httpGet(opac_url + dir + "/search_expert.htm", getDefaultEncoding()); } catch (NotReachableException e) { html = httpGet(opac_url + dir + "/iopacie.htm", getDefaultEncoding()); } Document doc = Jsoup.parse(html); Elements trs = doc .select("form tr:has(input:not([type=submit], [type=reset])), form tr:has(select)"); for (Element tr : trs) { Elements tds = tr.select("td"); if (tds.size() == 4) { // Two search fields next to each other in one row SearchField field1 = createSearchField(tds.get(0), tds.get(1)); SearchField field2 = createSearchField(tds.get(2), tds.get(3)); if (field1 != null) fields.add(field1); if (field2 != null) fields.add(field2); } else if (tds.size() == 2 || (tds.size() == 3 && tds.get(2).children().size() == 0)) { SearchField field = createSearchField(tds.get(0), tds.get(1)); if (field != null) fields.add(field); } } if (fields.size() == 0 && doc.select("[name=sleStichwort]").size() > 0) { TextSearchField field = new TextSearchField(); Element input = doc.select("input[name=sleStichwort]").first(); field.setDisplayName(stringProvider .getString(StringProvider.FREE_SEARCH)); field.setId(input.attr("name")); field.setHint(""); fields.add(field); } // Extract available media types. // We have to parse JavaScript. Doing this with RegEx is evil. // But not as evil as including a JavaScript VM into the app. // And I honestly do not see another way. Pattern pattern_key = Pattern .compile("mtyp\\[[0-9]+\\]\\[\"typ\"\\] = \"([^\"]+)\";"); Pattern pattern_value = Pattern .compile("mtyp\\[[0-9]+\\]\\[\"bez\"\\] = \"([^\"]+)\";"); List<Map<String, String>> mediatypes = new ArrayList<Map<String, String>>(); try { html = httpGet(opac_url + dir + "/mtyp.js", getDefaultEncoding()); String[] parts = html.split("new Array\\(\\);"); for (String part : parts) { Matcher matcher1 = pattern_key.matcher(part); String key = ""; String value = ""; if (matcher1.find()) { key = matcher1.group(1); } Matcher matcher2 = pattern_value.matcher(part); if (matcher2.find()) { value = matcher2.group(1); } if (value != "") { Map<String, String> mediatype = new HashMap<String, String>(); mediatype.put("key", key); mediatype.put("value", value); mediatypes.add(mediatype); } } } catch (IOException e) { try { html = httpGet(opac_url + dir + "/frames/search_form.php?bReset=1?bReset=1", getDefaultEncoding()); doc = Jsoup.parse(html); for (Element opt : doc.select("#imtyp option")) { Map<String, String> mediatype = new HashMap<String, String>(); mediatype.put("key", opt.attr("value")); mediatype.put("value", opt.text()); mediatypes.add(mediatype); } } catch (IOException e1) { e1.printStackTrace(); } } if (mediatypes.size() > 0) { DropdownSearchField mtyp = new DropdownSearchField(); mtyp.setDisplayName("Medientypen"); mtyp.setId("Medientyp"); mtyp.setDropdownValues(mediatypes); fields.add(mtyp); } return fields; } @Override public boolean isAccountSupported(Library library) { if (data.has("account")) { try { return data.getBoolean("account"); } catch (JSONException e) { return true; } } return true; } @Override public boolean isAccountExtendable() { return false; } @Override public String getAccountExtendableInfo(Account account) throws IOException, NotReachableException { return null; } @Override public String getShareUrl(String id, String title) { return opac_url + "/cgi-bin/di.exe?cMedNr=" + id + "&mode=23"; } @Override public int getSupportFlags() { return SUPPORT_FLAG_ENDLESS_SCROLLING | SUPPORT_FLAG_CHANGE_ACCOUNT; } public void updateRechnr(Document doc) { String url = null; for (Element a : doc.select("table a")) { if (a.attr("href").contains("rechnr=")) { url = a.attr("href"); break; } } if (url == null) return; Integer rechnrPosition = url.indexOf("rechnr=") + 7; rechnr = url .substring(rechnrPosition, url.indexOf("&", rechnrPosition)); } }
package tigase.cluster; import tigase.cluster.api.ClusterControllerIfc; import tigase.cluster.api.ClusteredComponentIfc; import tigase.cluster.api.SessionManagerClusteredIfc; import tigase.cluster.strategy.ClusteringStrategyIfc; import tigase.server.ComponentInfo; import tigase.server.Message; import tigase.server.Packet; import tigase.server.xmppsession.SessionManager; import tigase.stats.StatisticsList; import tigase.util.DNSResolver; import tigase.util.TigaseStringprepException; import tigase.xmpp.BareJID; import tigase.xmpp.JID; import tigase.xmpp.StanzaType; import tigase.xmpp.XMPPResourceConnection; import tigase.xmpp.XMPPSession; import java.util.Arrays; import java.util.concurrent.ConcurrentHashMap; import java.util.Date; import java.util.logging.Level; import java.util.logging.Logger; import java.util.Map; import javax.script.Bindings; /** * Class SessionManagerClusteredOld * * * Created: Tue Nov 22 07:07:11 2005 * * @author <a href="mailto:artur.hefczyc@tigase.org">Artur Hefczyc</a> * @version $Rev$ */ public class SessionManagerClustered extends SessionManager implements ClusteredComponentIfc, SessionManagerClusteredIfc { /** Field description */ public static final String CLUSTER_STRATEGY_VAR = "clusterStrategy"; /** Field description */ public static final String MY_DOMAIN_NAME_PROP_KEY = "domain-name"; /** Field description */ public static final String STRATEGY_CLASS_PROP_KEY = "sm-cluster-strategy-class"; /** Field description */ public static final String STRATEGY_CLASS_PROP_VAL = "tigase.cluster.strategy.DefaultClusteringStrategy"; /** Field description */ public static final String STRATEGY_CLASS_PROPERTY = "--sm-cluster-strategy-class"; /** Field description */ public static final int SYNC_MAX_BATCH_SIZE = 1000; /** * Variable <code>log</code> is a class logger. */ private static final Logger log = Logger.getLogger(SessionManagerClustered.class .getName()); private ClusterControllerIfc clusterController = null; private ComponentInfo cmpInfo = null; private JID my_address = null; private JID my_hostname = null; private int nodesNo = 0; private ClusteringStrategyIfc strategy = null; /** * The method checks whether the given JID is known to the installation, * either user connected to local machine or any of the cluster nodes. False * result does not mean the user is not connected. It means the method does * not know anything about the JID. Some clustering strategies may not cache * online users information. * * @param jid * a user's JID for whom we query information. * * @return true if the user is known as online to the installation, false if * the method does not know. */ @Override public boolean containsJid(BareJID jid) { if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Called for jid: {0}", jid); } return super.containsJid(jid) || strategy.containsJid(jid); } /** * Method description * * * @param packet * * * * @return a value of <code>boolean</code> */ @Override public boolean fastAddOutPacket(Packet packet) { return super.fastAddOutPacket(packet); } /** * Method description * * * @param packet * @param conn */ @Override public void handleLocalPacket(Packet packet, XMPPResourceConnection conn) { if (strategy != null) { strategy.handleLocalPacket(packet, conn); } } /** * Method description * * * @param userId * @param conn */ @Override public void handleLogin(BareJID userId, XMPPResourceConnection conn) { super.handleLogin(userId, conn); strategy.handleLocalUserLogin(userId, conn); } /** * Method description * * * @param binds */ @Override public void initBindings(Bindings binds) { super.initBindings(binds); binds.put(CLUSTER_STRATEGY_VAR, strategy); } /** * The method is called on cluster node connection event. This is a * notification to the component that a new node has connected to the system. * * @param node * is a hostname of a new cluster node connected to the system. */ @Override public void nodeConnected(String node) { log.log(Level.FINE, "Nodes connected: {0}", node); JID jid = JID.jidInstanceNS(getName(), node, null); strategy.nodeConnected(jid); sendAdminNotification("Cluster node '" + node + "' connected (" + (new Date()) + ")", "New cluster node connected: " + node, node); } /** * Method is called on cluster node disconnection event. This is a * notification to the component that there was network connection lost to one * of the cluster nodes. * * @param node * is a hostname of a cluster node generating the event. */ @Override public void nodeDisconnected(String node) { log.log(Level.FINE, "Nodes disconnected: {0}", node); JID jid = JID.jidInstanceNS(getName(), node, null); strategy.nodeDisconnected(jid); // Not sure what to do here, there might be still packets // from the cluster node waiting.... // delTrusted(jid); sendAdminNotification("Cluster node '" + node + "' disconnected (" + (new Date()) + ")", "Cluster node disconnected: " + node, node); } /** * Concurrency control method. Returns preferable number of threads set for * this component. * * * @return preferable number of threads set for this component. */ @Override public int processingInThreads() { return Math.max(nodesNo, super.processingInThreads()); } /** * Concurrency control method. Returns preferable number of threads set for * this component. * * * @return preferable number of threads set for this component. */ @Override public int processingOutThreads() { return Math.max(nodesNo, super.processingOutThreads()); } /** * This is a standard component method for processing packets. The method * takes care of cases where the packet cannot be processed locally, in such a * case it is forwarded to another node. * * * @param packet */ @Override public void processPacket(Packet packet) { if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Received packet: {0}", packet); } // long startTime = System.currentTimeMillis(); // int idx = tIdx; // tIdx = (tIdx + 1) % maxIdx; // long cmdTm = 0; // long clTm = 0; // long chTm = 0; // long smTm = 0; if (packet.isCommand() && processCommand(packet)) { packet.processedBy("SessionManager"); // cmdTm = System.currentTimeMillis() - startTime; } else { XMPPResourceConnection conn = getXMPPResourceConnection(packet); if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Ressource connection found: {0}", conn); } boolean clusterOK = strategy.processPacket(packet, conn); // clTm = System.currentTimeMillis() - startTime; if (conn == null) { if (isBrokenPacket(packet) || processAdminsOrDomains(packet)) { if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Ignoring/dropping packet: {0}", packet); } } else { // Process is as packet to offline user only if there are no other // nodes for the packet to be processed. if (!clusterOK) { // Process packet for offline user processPacket(packet, (XMPPResourceConnection) null); } } } else { processPacket(packet, conn); // smTm = System.currentTimeMillis() - startTime; } } // commandTime[idx] = cmdTm; // clusterTime[idx] = clTm; // checkingTime[idx] = chTm; // smTime[idx] = smTm; } /** * Method description * * * @param packet * @param conn */ @Override public void processPacket(Packet packet, XMPPResourceConnection conn) { super.processPacket(packet, conn); } /** * Allows to obtain various informations about components * * @return information about particular component */ @Override public ComponentInfo getComponentInfo() { cmpInfo = super.getComponentInfo(); cmpInfo.getComponentData().put("ClusteringStrategy", (strategy != null) ? strategy.getClass() : null); return cmpInfo; } /** * If the installation knows about user's JID, that he is connected to the * system, then this method returns all user's connection IDs. As an * optimization we can forward packets to all user's connections directly from * a single node. * * @param jid * a user's JID for whom we query information. * * @return a list of all user's connection IDs. */ @Override public JID[] getConnectionIdsForJid(BareJID jid) { JID[] ids = super.getConnectionIdsForJid(jid); if (ids == null) { ids = strategy.getConnectionIdsForJid(jid); } if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Called for jid: {0}, results: {1}", new Object[] { jid, Arrays.toString(ids) }); } return ids; } /** * Loads the component's default configuration to the configuration management * subsystem. * * @param params * is a Map with system-wide default settings found in * init.properties file or similar location. * * @return a Map with all default component settings generated from the * default parameters in init.properties file. */ @Override public Map<String, Object> getDefaults(Map<String, Object> params) { Map<String, Object> props = super.getDefaults(params); String strategy_class = (String) params.get(STRATEGY_CLASS_PROPERTY); if (strategy_class == null) { strategy_class = STRATEGY_CLASS_PROP_VAL; } props.put(STRATEGY_CLASS_PROP_KEY, strategy_class); try { ClusteringStrategyIfc strat_tmp = (ClusteringStrategyIfc) Class.forName( strategy_class).newInstance(); Map<String, Object> strat_defs = strat_tmp.getDefaults(params); if (strat_defs != null) { props.putAll(strat_defs); } } catch (Exception e) { log.log(Level.SEVERE, "Can not instantiate clustering strategy for class: " + strategy_class, e); } String[] local_domains = DNSResolver.getDefHostNames(); if (params.get(GEN_VIRT_HOSTS) != null) { local_domains = ((String) params.get(GEN_VIRT_HOSTS)).split(","); } // defs.put(LOCAL_DOMAINS_PROP_KEY, LOCAL_DOMAINS_PROP_VAL); props.put(MY_DOMAIN_NAME_PROP_KEY, local_domains[0]); if (params.get(CLUSTER_NODES) != null) { String[] cl_nodes = ((String) params.get(CLUSTER_NODES)).split(","); nodesNo = cl_nodes.length; } return props; } /** * Method description * * * * * @return a value of <code>String</code> */ @Override public String getDiscoDescription() { return super.getDiscoDescription() + " clustered" + strategy.getInfo(); } // private long calcAverage(long[] timings) { // long res = 0; // for (long ppt : timings) { // res += ppt; // long processingTime = res / timings.length; // return processingTime; /** * Method generates and returns component's statistics. * * @param list * is a collection with statistics to which this component can add * own metrics. */ @Override public void getStatistics(StatisticsList list) { super.getStatistics(list); strategy.getStatistics(list); // list.add(getName(), "Average commandTime on last " + commandTime.length // + " runs [ms]", calcAverage(commandTime), Level.FINE); // list.add(getName(), "Average clusterTime on last " + clusterTime.length // + " runs [ms]", calcAverage(clusterTime), Level.FINE); // list.add(getName(), "Average checkingTime on last " + checkingTime.length // + " runs [ms]", calcAverage(checkingTime), Level.FINE); // list.add(getName(), "Average smTime on last " + smTime.length + // " runs [ms]", // calcAverage(smTime), Level.FINE); } /** * Returns active clustering strategy object. * * @return active clustering strategy object. */ public ClusteringStrategyIfc getStrategy() { return strategy; } /** * Method description * * * * @param p * * * * @return a value of <code>XMPPResourceConnection</code> */ @Override public XMPPResourceConnection getXMPPResourceConnection(Packet p) { return super.getXMPPResourceConnection(p); } /** * Method description * * * * * @return a value of <code>ConcurrentHashMap<JID,XMPPResourceConnection></code> */ @Override public ConcurrentHashMap<JID, XMPPResourceConnection> getXMPPResourceConnections() { return connectionsByFrom; } /** * Method description * * * * * @return a value of <code>ConcurrentHashMap<BareJID,XMPPSession></code> */ @Override public ConcurrentHashMap<BareJID, XMPPSession> getXMPPSessions() { return sessionsByNodeId; } /** * Method checks whether the clustering strategy has a complete JIDs info. * That is whether the strategy knows about all users connected to all nodes. * Some strategies may choose not to share this information among nodes, hence * the methods returns false. Other may synchronize this information and can * provide it to further optimize cluster traffic. * * * @return a true boolean value if the strategy has a complete information * about all users connected to all cluster nodes. */ @Override public boolean hasCompleteJidsInfo() { return strategy.hasCompleteJidsInfo(); } /** * Set's the configures the cluster controller object for cluster * communication and API. * * @param cl_controller */ @Override public void setClusterController(ClusterControllerIfc cl_controller) { clusterController = cl_controller; if (strategy != null) { strategy.setClusterController(clusterController); } // clusterController.removeCommandListener(USER_CONNECTED_CMD, userConnected); // clusterController.removeCommandListener(USER_DISCONNECTED_CMD, userDisconnected); // clusterController.removeCommandListener(USER_PRESENCE_CMD, userPresence); // clusterController.removeCommandListener(REQUEST_SYNCONLINE_CMD, requestSyncOnline); // clusterController.removeCommandListener(RESPOND_SYNCONLINE_CMD, respondSyncOnline); // clusterController.setCommandListener(USER_CONNECTED_CMD, userConnected); // clusterController.setCommandListener(USER_DISCONNECTED_CMD, userDisconnected); // clusterController.setCommandListener(USER_PRESENCE_CMD, userPresence); // clusterController.setCommandListener(REQUEST_SYNCONLINE_CMD, requestSyncOnline); // clusterController.setCommandListener(RESPOND_SYNCONLINE_CMD, respondSyncOnline); } /** * Standard component's configuration method. * * * @param props */ @Override public void setProperties(Map<String, Object> props) { super.setProperties(props); if (props.get(STRATEGY_CLASS_PROP_KEY) != null) { String strategy_class = (String) props.get(STRATEGY_CLASS_PROP_KEY); try { ClusteringStrategyIfc strategy_tmp = (ClusteringStrategyIfc) Class.forName( strategy_class).newInstance(); strategy_tmp.setSessionManagerHandler(this); strategy_tmp.setProperties(props); // strategy_tmp.init(getName()); strategy = strategy_tmp; strategy.setSessionManagerHandler(this); log.log(Level.CONFIG, "Loaded SM strategy: " + strategy_class); // strategy.nodeConnected(getComponentId()); addTrusted(getComponentId()); if (clusterController != null) { strategy.setClusterController(clusterController); } } catch (Exception e) { log.log(Level.SEVERE, "Can not clustering strategy instance for class: " + strategy_class, e); } } try { if (props.get(MY_DOMAIN_NAME_PROP_KEY) != null) { my_hostname = JID.jidInstance((String) props.get(MY_DOMAIN_NAME_PROP_KEY)); my_address = JID.jidInstance(getName(), (String) props.get( MY_DOMAIN_NAME_PROP_KEY), null); } } catch (TigaseStringprepException ex) { log.log(Level.WARNING, "Creating component source address failed stringprep processing: {0}@{1}", new Object[] { getName(), my_hostname }); } } /** * The method intercept user's disconnect event. On user disconnect the method * takes a list of cluster nodes from the strategy and sends a notification to * all those nodes about the event. * * @see SessionManager#closeSession * * @param conn * @param closeOnly */ @Override protected void closeSession(XMPPResourceConnection conn, boolean closeOnly) { if (log.isLoggable(Level.FINEST)) { log.log(Level.FINEST, "Called for conn: {0}, closeOnly: {1}", new Object[] { conn, closeOnly }); } // Exception here should not normally happen, but if it does, then // consequences might be severe, let's catch it then try { if (conn.isAuthorized() && conn.isResourceSet()) { BareJID userId = conn.getBareJID(); strategy.handleLocalUserLogout(userId, conn); } } catch (Exception ex) { log.log(Level.WARNING, "This should not happen, check it out!, ", ex); } // Exception here should not normally happen, but if it does, then // consequences might be severe, let's catch it then try { super.closeSession(conn, closeOnly); } catch (Exception ex) { log.log(Level.WARNING, "This should not happen, check it out!, ", ex); } } private void sendAdminNotification(String msg, String subject, String node) { String message = msg; if (node != null) { message = msg + "\n"; } int cnt = 0; message += node + " connected to " + getDefHostName(); Packet p_msg = Message.getMessage(my_address, my_hostname, StanzaType.normal, message, subject, "xyz", newPacketId(null)); sendToAdmins(p_msg); } } //~ Formatted in Tigase Code Convention on 13/10/15
package com.helpmobile.test; import com.fasterxml.jackson.core.JsonProcessingException; import com.fasterxml.jackson.databind.DeserializationFeature; import com.fasterxml.jackson.databind.ObjectMapper; import com.helpmobile.rest.WorkshopBooking; import com.helpmobile.rest.RestAccess; import java.io.IOException; import org.junit.After; import org.junit.AfterClass; import org.junit.Before; import org.junit.BeforeClass; import org.junit.Test; import static org.junit.Assert.*; /** * * @author terra */ public class CreateWorkshopBookingTest { public CreateWorkshopBookingTest() { } @BeforeClass public static void setUpClass() { } @AfterClass public static void tearDownClass() { } @Before public void setUp() { } @After public void tearDown() { } @Test public void test1() throws IOException { ObjectMapper mapper = new ObjectMapper(); RestAccess restAccess = new RestAccess(); boolean isBooked = restAccess.createWorkshopBooking(new WorkshopBooking(1409,"10795119")); assert(isBooked); } }
package de.lmu.ifi.dbs.elki.math; /** * Do some simple statistics (mean, average). * * This class can repeatedly be fed with data using the add() methods, * The resulting values for mean and average can be queried at any time using * getMean() and getVariance(). * * Trivial code, but replicated a lot. The class is final so it should come at low cost. * * @author Erich Schubert * */ public final class MeanVariance { /** * Sum of values */ public double sum = 0.0; /** * Sum of Squares */ public double sqrSum = 0.0; /** * Number of Samples. */ public double count = 0.0; /** * Empty constructor */ public MeanVariance() { // nothing to do here, initialization done above. } /** * Constructor from full internal data. * * @param sum sum * @param sqrSum sum of squared values * @param count sum of weights */ public MeanVariance(double sum, double sqrSum, double count) { this.sum = sum; this.sqrSum = sqrSum; this.count = count; } /** * Constructor from other instance * * @param other other instance to copy data from. */ public MeanVariance(MeanVariance other) { this.sum = other.sum; this.sqrSum = other.sqrSum; this.count = other.count; } /** * Add data with a given weight * * @param val data * @param weight weight */ public void addData(double val, double weight) { sum += weight * val; sqrSum += weight * val * val; count += weight; } /** * Add a single value with weight 1.0 * * @param val Value */ public void addData(double val) { addData(val, 1.0); } /** * Join the data of another MeanVariance instance. * * @param other */ public void addData(MeanVariance other) { this.sum += other.sum; this.sqrSum += other.sqrSum; this.count += other.count; } /** * Get the number of points the average is based on. * @return number of data points */ public double getCount() { return count; } /** * Return mean * @return mean */ public double getMean() { return sum / count; } /** * Return variance * @return variance */ public double getVariance() { double mu = sum / count; return (sqrSum / count) - (mu * mu); } /** * Return standard deviation * @return stddev */ public double getStddev() { return Math.sqrt(getVariance()); } }
package uk.co.jemos.podam.api; import net.jcip.annotations.Immutable; import net.jcip.annotations.NotThreadSafe; import org.apache.commons.lang3.ArrayUtils; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import uk.co.jemos.podam.api.DataProviderStrategy.Order; import uk.co.jemos.podam.common.AttributeStrategy; import uk.co.jemos.podam.common.ManufacturingContext; import uk.co.jemos.podam.common.PodamConstants; import uk.co.jemos.podam.common.PodamConstructor; import uk.co.jemos.podam.exceptions.PodamMockeryException; import uk.co.jemos.podam.typeManufacturers.TypeManufacturerUtil; import javax.xml.ws.Holder; import java.lang.annotation.Annotation; import java.lang.reflect.*; import java.util.*; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.atomic.AtomicReference; /** * The PODAM factory implementation * * @author mtedone * * @since 1.0.0 * */ @NotThreadSafe @Immutable public class PodamFactoryImpl implements PodamFactory { private static final String RESOLVING_COLLECTION_EXCEPTION_STR = "An exception occurred while resolving the collection"; private static final String MAP_CREATION_EXCEPTION_STR = "An exception occurred while creating a Map object"; /** Application logger */ private static final Logger LOG = LoggerFactory.getLogger(PodamFactoryImpl.class); /** Empty type map */ private static final Map<String, Type> NULL_TYPE_ARGS_MAP = new HashMap<String, Type>(); /** * External factory to delegate production this factory cannot handle * <p> * The default is {@link NullExternalFactory}. * </p> */ private PodamFactory externalFactory = NullExternalFactory.getInstance(); /** * The strategy to use to fill data. * <p> * The default is {@link RandomDataProviderStrategyImpl}. * </p> */ private DataProviderStrategy strategy = new RandomDataProviderStrategyImpl(); /** * The strategy to use to introspect data. * <p> * The default is {@link DefaultClassInfoStrategy}. * </p> */ private ClassInfoStrategy classInfoStrategy = DefaultClassInfoStrategy.getInstance(); /** * Default constructor. */ public PodamFactoryImpl() { this(NullExternalFactory.getInstance(), new RandomDataProviderStrategyImpl()); } /** * Constructor with non-default strategy * * @param strategy * The strategy to use to fill data */ public PodamFactoryImpl(DataProviderStrategy strategy) { this(NullExternalFactory.getInstance(), strategy); } /** * Constructor with non-default external factory * * @param externalFactory * External factory to delegate production this factory cannot * handle */ public PodamFactoryImpl(PodamFactory externalFactory) { this(externalFactory, new RandomDataProviderStrategyImpl()); } /** * Full constructor. * * @param externalFactory * External factory to delegate production this factory cannot * handle * @param strategy * The strategy to use to fill data */ public PodamFactoryImpl(PodamFactory externalFactory, DataProviderStrategy strategy) { this.externalFactory = externalFactory; this.strategy = strategy; } /** * {@inheritDoc} */ @Override public <T> T manufacturePojoWithFullData(Class<T> pojoClass, Type... genericTypeArgs) { ManufacturingContext manufacturingCtx = new ManufacturingContext(); manufacturingCtx.getPojos().put(pojoClass, 0); manufacturingCtx.setConstructorOrdering(Order.HEAVY_FIRST); return doManufacturePojo(pojoClass, manufacturingCtx, genericTypeArgs); } /** * {@inheritDoc} */ @Override public <T> T manufacturePojo(Class<T> pojoClass, Type... genericTypeArgs) { ManufacturingContext manufacturingCtx = new ManufacturingContext(); manufacturingCtx.getPojos().put(pojoClass, 0); return doManufacturePojo(pojoClass, manufacturingCtx, genericTypeArgs); } /** * {@inheritDoc} */ @Override public <T> T populatePojo(T pojo, Type... genericTypeArgs) { ManufacturingContext manufacturingCtx = new ManufacturingContext(); manufacturingCtx.getPojos().put(pojo.getClass(), 0); final Map<String, Type> typeArgsMap = new HashMap<String, Type>(); Type[] genericTypeArgsExtra = TypeManufacturerUtil.fillTypeArgMap(typeArgsMap, pojo.getClass(), genericTypeArgs); try { return this.populatePojoInternal(pojo, manufacturingCtx, typeArgsMap, genericTypeArgsExtra); } catch (InstantiationException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (IllegalAccessException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (InvocationTargetException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (ClassNotFoundException e) { throw new PodamMockeryException(e.getMessage(), e); } } /** * {@inheritDoc} */ @Override public DataProviderStrategy getStrategy() { return strategy; } /** * {@inheritDoc} */ @Override public PodamFactory setStrategy(DataProviderStrategy strategy) { this.strategy = strategy; return this; } /** * {@inheritDoc} */ @Override public ClassInfoStrategy getClassStrategy() { return classInfoStrategy; } /** * {@inheritDoc} */ @Override public PodamFactory setClassStrategy(ClassInfoStrategy classInfoStrategy) { this.classInfoStrategy = classInfoStrategy; return this; } /** * {@inheritDoc} */ @Override public PodamFactory getExternalFactory() { return externalFactory; } /** * {@inheritDoc} */ @Override public PodamFactory setExternalFactory(PodamFactory externalFactory) { this.externalFactory = externalFactory; return this; } private <T> T instantiatePojoWithFactory( Class<?> factoryClass, Class<T> pojoClass, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { // If no publicly accessible constructors are available, // the best we can do is to find a constructor (e.g. // getInstance()) Method[] declaredMethods = factoryClass.getDeclaredMethods(); strategy.sort(declaredMethods, manufacturingCtx.getConstructorOrdering()); // A candidate factory method is a method which returns the // Class type // The parameters to pass to the method invocation Object[] parameterValues = null; for (Method candidateConstructor : declaredMethods) { if (!candidateConstructor.getReturnType().equals(pojoClass)) { continue; } Object factoryInstance = null; if (!Modifier.isStatic(candidateConstructor.getModifiers())) { if (factoryClass.equals(pojoClass)) { continue; } else { factoryInstance = manufacturePojo(factoryClass); } } parameterValues = getParameterValuesForMethod(candidateConstructor, pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgs); try { @SuppressWarnings("unchecked") T retValue = (T) candidateConstructor.invoke(factoryInstance, parameterValues); LOG.debug("Could create an instance using " + candidateConstructor); if (retValue != null) { return retValue; } } catch (Exception t) { LOG.debug( "PODAM could not create an instance for constructor: " + candidateConstructor + ". Will try another one...", t); } } LOG.debug("For class {} PODAM could not possibly create" + " a value statically. Will try other means.", pojoClass); return null; } /** * It creates and returns an instance of the given class if at least one of * its constructors has been annotated with {@link PodamConstructor} * * @param <T> * The type of the instance to return * * @param pojoClass * The class of which an instance is required * @param manufacturingCtx * the manufacturing context * @param typeArgsMap * a map relating the generic class arguments ("&lt;T, V&gt;" for * example) with their actual types * @param genericTypeArgs * The generic type arguments for the current generic class * instance * @return an instance of the given class if at least one of its * constructors has been annotated with {@link PodamConstructor} * @throws SecurityException * If an security was violated */ private <T> T instantiatePojo(Class<T> pojoClass, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws SecurityException { T retValue = null; Constructor<?>[] constructors = pojoClass.getConstructors(); if (constructors.length == 0 || Modifier.isAbstract(pojoClass.getModifiers())) { /* No public constructors, we will try static factory methods */ try { retValue = instantiatePojoWithFactory( pojoClass, pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgs); } catch (Exception e) { LOG.debug("We couldn't create an instance for pojo: " + pojoClass + " with factory methods, will " + " try non-public constructors.", e); } /* Then non-public constructors */ if (retValue == null) { constructors = pojoClass.getDeclaredConstructors(); } } if (retValue == null && constructors.length > 0) { strategy.sort(constructors, manufacturingCtx.getConstructorOrdering()); for (Constructor<?> constructor : constructors) { try { Object[] parameterValues = getParameterValuesForConstructor( constructor, pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgs); // Security hack if (!constructor.isAccessible()) { constructor.setAccessible(true); } @SuppressWarnings("unchecked") T tmp = (T) constructor.newInstance(parameterValues); retValue = tmp; if (retValue != null) { LOG.debug("We could create an instance with constructor: " + constructor); break; } } catch (Exception e) { LOG.debug("We couldn't create an instance for pojo: {} with" + " constructor: {}. Will try with another one.", pojoClass, constructor, e); } } } if (retValue == null) { LOG.debug("For class {} PODAM could not possibly create" + " a value. Will try other means.", pojoClass); } return retValue; } /** * Manufactures and populates the pojo class * * @param <T> The type of the instance to return * @param pojoClass the class to instantiate * @param manufacturingCtx the initialized manufacturing context * @param genericTypeArgs generic arguments for the pojo class * @return instance of @pojoClass or null in case it cannot be instantiated */ private <T> T doManufacturePojo(Class<T> pojoClass, ManufacturingContext manufacturingCtx, Type... genericTypeArgs) { try { Class<?> declaringClass = null; Object declaringInstance = null; AttributeMetadata pojoMetadata = new AttributeMetadata(pojoClass, pojoClass, genericTypeArgs, declaringClass, declaringInstance); return this.manufacturePojoInternal(pojoClass, pojoMetadata, manufacturingCtx, genericTypeArgs); } catch (InstantiationException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (IllegalAccessException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (InvocationTargetException e) { throw new PodamMockeryException(e.getMessage(), e); } catch (ClassNotFoundException e) { throw new PodamMockeryException(e.getMessage(), e); } } private <T> T manufacturePojoInternal(Class<T> pojoClass, AttributeMetadata pojoMetadata, ManufacturingContext manufacturingCtx, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { // reuse object from memoization table @SuppressWarnings("unchecked") T objectToReuse = (T) strategy.getMemoizedObject(pojoMetadata); if (objectToReuse != null) { LOG.debug("Fetched memoized object for {} with parameters {}", pojoClass, Arrays.toString(genericTypeArgs)); return objectToReuse; } else { LOG.debug("Manufacturing {} with parameters {}", pojoClass, Arrays.toString(genericTypeArgs)); } final Map<String, Type> typeArgsMap = new HashMap<String, Type>(); Type[] genericTypeArgsExtra = TypeManufacturerUtil.fillTypeArgMap(typeArgsMap, pojoClass, genericTypeArgs); T retValue = (T) strategy.getTypeValue(pojoMetadata, typeArgsMap, pojoClass); if (null == retValue) { if (pojoClass.isInterface()) { return getValueForAbstractType(pojoClass, pojoMetadata, manufacturingCtx, typeArgsMap, genericTypeArgs); } try { retValue = instantiatePojo(pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgsExtra); } catch (SecurityException e) { throw new PodamMockeryException( "Security exception while applying introspection.", e); } } if (retValue == null) { return getValueForAbstractType(pojoClass, pojoMetadata, manufacturingCtx, typeArgsMap, genericTypeArgs); } else { // update memoization cache with new object // the reference is stored before properties are set so that recursive // properties can use it strategy.cacheMemoizedObject(pojoMetadata, retValue); populatePojoInternal(retValue, manufacturingCtx, typeArgsMap, genericTypeArgsExtra); } return retValue; } private <T> T populatePojoInternal(T pojo, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Class<?> pojoClass = pojo.getClass(); if (pojo instanceof Collection && ((Collection<?>)pojo).isEmpty()) { @SuppressWarnings("unchecked") Collection<Object> collection = (Collection<Object>) pojo; AtomicReference<Type[]> elementGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); Class<?> elementTypeClass = findInheretedCollectionElementType(collection, manufacturingCtx, elementGenericTypeArgs, typeArgsMap, genericTypeArgs); String attributeName = null; Annotation[] annotations = collection.getClass().getAnnotations(); fillCollection(manufacturingCtx, Arrays.asList(annotations), attributeName, collection, elementTypeClass, elementGenericTypeArgs.get()); } else if (pojo instanceof Map && ((Map<?,?>)pojo).isEmpty()) { @SuppressWarnings("unchecked") Map<Object,Object> map = (Map<Object,Object>)pojo; MapArguments mapArguments = findInheretedMapElementType( map, manufacturingCtx, typeArgsMap, genericTypeArgs); fillMap(mapArguments, manufacturingCtx); } Class<?>[] parameterTypes = null; Class<?> attributeType = null; ClassInfo classInfo = classInfoStrategy.getClassInfo(pojo.getClass()); Set<ClassAttribute> classAttributes = classInfo.getClassAttributes(); // According to JavaBeans standards, setters should have only // one argument Object setterArg = null; Iterator<ClassAttribute> iter = classAttributes.iterator(); while (iter.hasNext()) { ClassAttribute attribute = iter.next(); Set<Method> setters = attribute.getSetters(); if (setters.isEmpty()) { if (attribute.getGetters().isEmpty()) { iter.remove(); } continue; } else { iter.remove(); } /* We want to find setter defined the latest */ Method setter = null; for (Method current : setters) { if (setter == null || setter.getDeclaringClass().isAssignableFrom(current.getDeclaringClass())) { setter = current; } } parameterTypes = setter.getParameterTypes(); if (parameterTypes.length != 1) { LOG.warn("Skipping setter with non-single arguments {}", setter); continue; } // A class which has got an attribute to itself (e.g. // recursive hierarchies) attributeType = parameterTypes[0]; // If an attribute has been annotated with // PodamAttributeStrategy, it takes the precedence over any // other strategy. Additionally we don't pass the attribute // metadata for value customisation; if user went to the extent // of specifying a PodamAttributeStrategy annotation for an // attribute they are already customising the value assigned to // that attribute. List<Annotation> pojoAttributeAnnotations = PodamUtils.getAttributeAnnotations( attribute.getAttribute(), setter); AttributeStrategy<?> attributeStrategy = TypeManufacturerUtil.findAttributeStrategy(strategy, pojoAttributeAnnotations, attributeType); if (null != attributeStrategy) { LOG.debug("The attribute: " + attribute.getName() + " will be filled using the following strategy: " + attributeStrategy); setterArg = TypeManufacturerUtil.returnAttributeDataStrategyValue(attributeType, attributeStrategy); } else { AtomicReference<Type[]> typeGenericTypeArgs = new AtomicReference<Type[]>(PodamConstants.NO_TYPES); // If the parameter is a generic parameterized type resolve // the actual type arguments Type genericType = setter.getGenericParameterTypes()[0]; final Type[] typeArguments; if (!(genericType instanceof GenericArrayType)) { attributeType = TypeManufacturerUtil.resolveGenericParameter(genericType, typeArgsMap, typeGenericTypeArgs); typeArguments = typeGenericTypeArgs.get(); } else { typeArguments = PodamConstants.NO_TYPES; } for (int i = 0; i < typeArguments.length; i++) { if (typeArguments[i] instanceof TypeVariable) { Class<?> resolvedType = TypeManufacturerUtil.resolveGenericParameter(typeArguments[i], typeArgsMap, typeGenericTypeArgs); if (!Collection.class.isAssignableFrom(resolvedType) && !Map.class.isAssignableFrom(resolvedType)) { typeArguments[i] = resolvedType; } } } setterArg = manufactureAttributeValue(pojo, manufacturingCtx, attributeType, genericType, pojoAttributeAnnotations, attribute.getName(), typeArgsMap, typeArguments); } try { setter.invoke(pojo, setterArg); } catch(IllegalAccessException e) { LOG.warn("{} is not accessible. Setting it to accessible." + " However this is a security hack and your code" + " should really adhere to JavaBeans standards.", setter.toString()); setter.setAccessible(true); setter.invoke(pojo, setterArg); } } for (ClassAttribute readOnlyAttribute : classAttributes) { Method getter = readOnlyAttribute.getGetters().iterator().next(); if (getter != null && !getter.getReturnType().isPrimitive()) { if (getter.getGenericParameterTypes().length == 0) { Object fieldValue = null; try { fieldValue = getter.invoke(pojo, PodamConstants.NO_ARGS); } catch(Exception e) { LOG.debug("Cannot access {}, skipping", getter); } if (fieldValue != null) { LOG.debug("Populating read-only field {}", getter); Type[] genericTypeArgsAll; Map<String, Type> paramTypeArgsMap; if (getter.getGenericReturnType() instanceof ParameterizedType) { paramTypeArgsMap = new HashMap<String, Type>(typeArgsMap); ParameterizedType paramType = (ParameterizedType) getter.getGenericReturnType(); Type[] actualTypes = paramType.getActualTypeArguments(); TypeManufacturerUtil.fillTypeArgMap(paramTypeArgsMap, getter.getReturnType(), actualTypes); genericTypeArgsAll = TypeManufacturerUtil.fillTypeArgMap(paramTypeArgsMap, getter.getReturnType(), genericTypeArgs); } else { paramTypeArgsMap = typeArgsMap; genericTypeArgsAll = genericTypeArgs; } Class<?> fieldClass = fieldValue.getClass(); Integer depth = manufacturingCtx.getPojos().get(fieldClass); if (depth == null) { depth = -1; } if (depth <= strategy.getMaxDepth(fieldClass)) { manufacturingCtx.getPojos().put(fieldClass, depth + 1); populatePojoInternal(fieldValue, manufacturingCtx, paramTypeArgsMap, genericTypeArgsAll); manufacturingCtx.getPojos().put(fieldClass, depth); } else { LOG.warn("Loop in filling read-only field {} detected.", getter); } } } else { LOG.warn("Skipping invalid getter {}", getter); } } } // It executes any extra methods Collection<Method> extraMethods = classInfoStrategy.getExtraMethods(pojoClass); if (null != extraMethods) { for (Method extraMethod : extraMethods) { Object[] args = getParameterValuesForMethod(extraMethod, pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgs); extraMethod.invoke(pojo, args); } } return pojo; } private Object manufactureAttributeValue(Object pojo, ManufacturingContext manufacturingCtx, Class<?> attributeType, Type genericAttributeType, List<Annotation> annotations, String attributeName, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Object attributeValue = null; Class<?> pojoClass = (pojo instanceof Class ? (Class<?>) pojo : pojo.getClass()); Class<?> realAttributeType; if (attributeType != genericAttributeType && Object.class.equals(attributeType) && genericAttributeType instanceof TypeVariable) { AtomicReference<Type[]> elementGenericTypeArgs = new AtomicReference<Type[]>(PodamConstants.NO_TYPES); realAttributeType = TypeManufacturerUtil.resolveGenericParameter(genericAttributeType, typeArgsMap, elementGenericTypeArgs); } else { realAttributeType = attributeType; } Type[] genericTypeArgsAll = TypeManufacturerUtil.mergeActualAndSuppliedGenericTypes( attributeType, genericAttributeType, genericTypeArgs, typeArgsMap); AttributeMetadata attributeMetadata = new AttributeMetadata( attributeName, realAttributeType, genericAttributeType, genericTypeArgsAll, annotations, pojoClass, pojo); if (realAttributeType.isArray()) { // Array type attributeValue = resolveArrayElementValue(pojo, manufacturingCtx, attributeMetadata, typeArgsMap); // Collection } else if (Collection.class.isAssignableFrom(realAttributeType)) { attributeValue = resolveCollectionValueWhenCollectionIsPojoAttribute( pojo, manufacturingCtx, attributeMetadata, typeArgsMap); // Map } else if (Map.class.isAssignableFrom(realAttributeType)) { attributeValue = resolveMapValueWhenMapIsPojoAttribute(pojo, manufacturingCtx, attributeMetadata, typeArgsMap); } // For any other type, we use the PODAM strategy if (attributeValue == null) { Integer depth = manufacturingCtx.getPojos().get(realAttributeType); if (depth == null) { depth = -1; } if (depth <= strategy.getMaxDepth(pojoClass)) { manufacturingCtx.getPojos().put(realAttributeType, depth + 1); attributeValue = this.manufacturePojoInternal( realAttributeType, attributeMetadata, manufacturingCtx, genericTypeArgsAll); manufacturingCtx.getPojos().put(realAttributeType, depth); } else { attributeValue = resortToExternalFactory(manufacturingCtx, "Loop in {} production detected. Resorting to {} external factory", realAttributeType, genericTypeArgsAll); } } return attributeValue; } /** * Delegates POJO manufacturing to an external factory * * @param <T> * The type of the instance to return * @param manufacturingCtx * the manufacturing context * @param msg * Message to log, must contain two parameters * @param pojoClass * The class of which an instance is required * @param genericTypeArgs * The generic type arguments for the current generic class * instance * @return instance of POJO produced by external factory or null */ private <T> T resortToExternalFactory(ManufacturingContext manufacturingCtx, String msg, Class<T> pojoClass, Type... genericTypeArgs) { LOG.warn(msg, pojoClass, externalFactory.getClass().getName()); if (manufacturingCtx.getConstructorOrdering() == Order.HEAVY_FIRST) { return externalFactory.manufacturePojoWithFullData(pojoClass, genericTypeArgs); } else { return externalFactory.manufacturePojo(pojoClass, genericTypeArgs); } } private Collection<? super Object> resolveCollectionValueWhenCollectionIsPojoAttribute( Object pojo, ManufacturingContext manufacturingCtx, AttributeMetadata attributeMetadata, Map<String, Type> typeArgsMap) { String attributeName = attributeMetadata.getAttributeName(); // This needs to be generic because collections can be of any type Collection<Object> defaultValue = null; if (null != pojo && !Character.isDigit(attributeName.charAt(0))) { defaultValue = PodamUtils.getFieldValue(pojo, attributeName); } Collection<Object> retValue = null; if (null != defaultValue && (defaultValue.getClass().getModifiers() & Modifier.PRIVATE) == 0) { /* Default collection, which is not immutable */ retValue = defaultValue; } else { @SuppressWarnings("unchecked") Class<Collection<Object>> collectionType = (Class<Collection<Object>>) attributeMetadata.getAttributeType(); retValue = strategy.getTypeValue(attributeMetadata, typeArgsMap, collectionType); if (null != retValue && null != defaultValue) { retValue.addAll(defaultValue); } } if (null == retValue) { return null; } try { Class<?> typeClass = null; AtomicReference<Type[]> elementGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); if (ArrayUtils.isEmpty(attributeMetadata.getAttrGenericArgs())) { typeClass = findInheretedCollectionElementType(retValue, manufacturingCtx, elementGenericTypeArgs, typeArgsMap, attributeMetadata.getAttrGenericArgs()); } else { Type actualTypeArgument = attributeMetadata.getAttrGenericArgs()[0]; typeClass = TypeManufacturerUtil.resolveGenericParameter(actualTypeArgument, typeArgsMap, elementGenericTypeArgs); } fillCollection(manufacturingCtx, attributeMetadata.getAttributeAnnotations(), attributeName, retValue, typeClass, elementGenericTypeArgs.get()); } catch (SecurityException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } catch (IllegalArgumentException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } catch (InstantiationException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } catch (IllegalAccessException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } catch (ClassNotFoundException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } catch (InvocationTargetException e) { throw new PodamMockeryException(RESOLVING_COLLECTION_EXCEPTION_STR, e); } return retValue; } /** * Tries to find collection element type from collection object * * @param collection * The collection to be filled * @param manufacturingCtx * the manufacturing context * @param elementGenericTypeArgs * parameter to return generic arguments of collection element * @param typeArgsMap * a map relating the generic class arguments ("&lt;T, V&gt;" for * example) with their actual types * @param genericTypeArgs * The generic type arguments for the current generic class * instance * @return * class type of collection element */ private Class<?> findInheretedCollectionElementType( Collection<Object> collection, ManufacturingContext manufacturingCtx, AtomicReference<Type[]> elementGenericTypeArgs, Map<String, Type> typeArgsMap, Type... genericTypeArgs) { Class<?> pojoClass = collection.getClass(); Class<?> collectionClass = pojoClass; Type[] typeParams = collectionClass.getTypeParameters(); main : while (typeParams.length < 1) { for (Type genericIface : collectionClass.getGenericInterfaces()) { Class<?> clazz = TypeManufacturerUtil.resolveGenericParameter( genericIface,typeArgsMap, elementGenericTypeArgs); if (Collection.class.isAssignableFrom(clazz)) { collectionClass = clazz; typeParams = elementGenericTypeArgs.get(); continue main; } } Type type = collectionClass.getGenericSuperclass(); if (type != null) { Class<?> clazz = TypeManufacturerUtil.resolveGenericParameter( type, typeArgsMap, elementGenericTypeArgs); if (Collection.class.isAssignableFrom(clazz)) { collectionClass = clazz; typeParams = elementGenericTypeArgs.get(); continue main; } } if (Collection.class.equals(collectionClass)) { LOG.warn("Collection {} doesn't have generic types," + "will use Object instead", pojoClass); typeParams = new Type[] { Object.class }; } } Class<?> elementTypeClass = TypeManufacturerUtil.resolveGenericParameter(typeParams[0], typeArgsMap, elementGenericTypeArgs); Type[] elementGenericArgs = ArrayUtils.addAll( elementGenericTypeArgs.get(), genericTypeArgs); elementGenericTypeArgs.set(elementGenericArgs); return elementTypeClass; } private void fillCollection(ManufacturingContext manufacturingCtx, List<Annotation> annotations, String attributeName, Collection<? super Object> collection, Class<?> collectionElementType, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { // If the user defined a strategy to fill the collection elements, // we use it Holder<AttributeStrategy<?>> elementStrategyHolder = new Holder<AttributeStrategy<?>>(); Holder<AttributeStrategy<?>> keyStrategyHolder = null; Integer nbrElements = TypeManufacturerUtil.findCollectionSize(strategy, annotations, collectionElementType, elementStrategyHolder, keyStrategyHolder); AttributeStrategy<?> elementStrategy = elementStrategyHolder.value; try { if (collection.size() > nbrElements) { collection.clear(); } for (int i = collection.size(); i < nbrElements; i++) { // The default Object element; if (null != elementStrategy && (elementStrategy instanceof ObjectStrategy) && Object.class.equals(collectionElementType)) { LOG.debug("Element strategy is ObjectStrategy and collection element is of type Object: using the ObjectStrategy strategy"); element = elementStrategy.getValue(); } else if (null != elementStrategy && !(elementStrategy instanceof ObjectStrategy)) { LOG.debug("Collection elements will be filled using the following strategy: " + elementStrategy); element = TypeManufacturerUtil.returnAttributeDataStrategyValue( collectionElementType, elementStrategy); } else { element = manufactureAttributeValue(collection, manufacturingCtx, collectionElementType, collectionElementType, annotations, attributeName, NULL_TYPE_ARGS_MAP, genericTypeArgs); } collection.add(element); } } catch (UnsupportedOperationException e) { LOG.warn("Cannot fill immutable collection {}", collection.getClass()); } } private Map<? super Object, ? super Object> resolveMapValueWhenMapIsPojoAttribute( Object pojo, ManufacturingContext manufacturingCtx, AttributeMetadata attributeMetadata, Map<String, Type> typeArgsMap) { String attributeName = attributeMetadata.getAttributeName(); Map<Object, Object> defaultValue = null; if (null != pojo && !Character.isDigit(attributeName.charAt(0))) { defaultValue = PodamUtils.getFieldValue(pojo, attributeName); } Map<Object, Object> retValue; if (null != defaultValue && (defaultValue.getClass().getModifiers() & Modifier.PRIVATE) == 0) { /* Default map, which is not immutable */ retValue = defaultValue; } else { @SuppressWarnings("unchecked") Class<Map<Object,Object>> mapType = (Class<Map<Object, Object>>) attributeMetadata.getAttributeType(); retValue = strategy.getTypeValue(attributeMetadata, typeArgsMap, mapType); if (null != retValue && null != defaultValue) { retValue.putAll(defaultValue); } } if (null == retValue) { return null; } try { Class<?> keyClass = null; Class<?> elementClass = null; AtomicReference<Type[]> keyGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); AtomicReference<Type[]> elementGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); if (ArrayUtils.isEmpty(attributeMetadata.getAttrGenericArgs())) { MapArguments mapArgs = findInheretedMapElementType(retValue, manufacturingCtx, typeArgsMap, attributeMetadata.getAttrGenericArgs()); keyClass = mapArgs.getKeyClass(); elementClass = mapArgs.getElementClass(); } else { // Expected only key, value type if (attributeMetadata.getAttrGenericArgs().length != 2) { throw new IllegalStateException( "In a Map only key value generic type are expected," + "but received " + Arrays.toString(attributeMetadata.getAttrGenericArgs())); } Type[] actualTypeArguments = attributeMetadata.getAttrGenericArgs(); keyClass = TypeManufacturerUtil.resolveGenericParameter(actualTypeArguments[0], typeArgsMap, keyGenericTypeArgs); elementClass = TypeManufacturerUtil.resolveGenericParameter(actualTypeArguments[1], typeArgsMap, elementGenericTypeArgs); } MapArguments mapArguments = new MapArguments(); mapArguments.setAttributeName(attributeName); mapArguments.setAnnotations(attributeMetadata.getAttributeAnnotations()); mapArguments.setMapToBeFilled(retValue); mapArguments.setKeyClass(keyClass); mapArguments.setElementClass(elementClass); mapArguments.setKeyGenericTypeArgs(keyGenericTypeArgs.get()); mapArguments .setElementGenericTypeArgs(elementGenericTypeArgs.get()); fillMap(mapArguments, manufacturingCtx); } catch (InstantiationException e) { throw new PodamMockeryException(MAP_CREATION_EXCEPTION_STR, e); } catch (IllegalAccessException e) { throw new PodamMockeryException(MAP_CREATION_EXCEPTION_STR, e); } catch (SecurityException e) { throw new PodamMockeryException(MAP_CREATION_EXCEPTION_STR, e); } catch (ClassNotFoundException e) { throw new PodamMockeryException(MAP_CREATION_EXCEPTION_STR, e); } catch (InvocationTargetException e) { throw new PodamMockeryException(MAP_CREATION_EXCEPTION_STR, e); } return retValue; } /** * Finds key and element type arguments * * @param map * The map being initialized * @param manufacturingCtx * the manufacturing context * @param typeArgsMap * a map relating the generic class arguments ("&lt;T, V&gt;" for * example) with their actual types * @param genericTypeArgs * The generic type arguments for the current generic class * instance * @return * Inherited map key and element types * */ private MapArguments findInheretedMapElementType(Map<Object, Object> map, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) { Class<?> pojoClass = map.getClass(); Class<?> mapClass = pojoClass; AtomicReference<Type[]> elementGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); Type[] typeParams = mapClass.getTypeParameters(); main : while (typeParams.length < 2) { for (Type genericIface : mapClass.getGenericInterfaces()) { Class<?> clazz = TypeManufacturerUtil.resolveGenericParameter( genericIface, typeArgsMap, elementGenericTypeArgs); if (Map.class.isAssignableFrom(clazz)) { typeParams = elementGenericTypeArgs.get(); mapClass = clazz; continue main; } } Type type = mapClass.getGenericSuperclass(); if (type != null) { Class<?> clazz = TypeManufacturerUtil.resolveGenericParameter( type, typeArgsMap, elementGenericTypeArgs); if (Map.class.isAssignableFrom(clazz)) { typeParams = elementGenericTypeArgs.get(); mapClass = clazz; continue main; } } if (Map.class.equals(mapClass)) { LOG.warn("Map {} doesn't have generic types," + "will use Object, Object instead", pojoClass); typeParams = new Type[] { Object.class, Object.class }; } } AtomicReference<Type[]> keyGenericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); Class<?> keyClass = TypeManufacturerUtil.resolveGenericParameter(typeParams[0], typeArgsMap, keyGenericTypeArgs); Class<?> elementClass = TypeManufacturerUtil.resolveGenericParameter( typeParams[1], typeArgsMap, elementGenericTypeArgs); Type[] keyGenericArgs = ArrayUtils.addAll(keyGenericTypeArgs.get(), genericTypeArgs); Type[] elementGenericArgs = ArrayUtils.addAll(elementGenericTypeArgs.get(), genericTypeArgs); MapArguments mapArguments = new MapArguments(); mapArguments.setAnnotations(Arrays.<Annotation>asList(pojoClass.getAnnotations())); mapArguments.setMapToBeFilled(map); mapArguments.setKeyClass(keyClass); mapArguments.setElementClass(elementClass); mapArguments.setKeyGenericTypeArgs(keyGenericArgs); mapArguments.setElementGenericTypeArgs(elementGenericArgs); return mapArguments; } private void fillMap(MapArguments mapArguments, ManufacturingContext manufacturingCtx) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { // If the user defined a strategy to fill the collection elements, // we use it Holder<AttributeStrategy<?>> elementStrategyHolder = new Holder<AttributeStrategy<?>>(); Holder<AttributeStrategy<?>> keyStrategyHolder = new Holder<AttributeStrategy<?>>(); Integer nbrElements = TypeManufacturerUtil.findCollectionSize(strategy, mapArguments.getAnnotations(), mapArguments.getElementClass(), elementStrategyHolder, keyStrategyHolder); AttributeStrategy<?> keyStrategy = keyStrategyHolder.value; AttributeStrategy<?> elementStrategy = elementStrategyHolder.value; Map<? super Object, ? super Object> map = mapArguments.getMapToBeFilled(); try { if (map.size() > nbrElements) { map.clear(); } for (int i = map.size(); i < nbrElements; i++) { Object keyValue = null; Object elementValue = null; MapKeyOrElementsArguments valueArguments = new MapKeyOrElementsArguments(); valueArguments.setAttributeName(mapArguments.getAttributeName()); valueArguments.setMapToBeFilled(mapArguments.getMapToBeFilled()); valueArguments.setAnnotations(mapArguments.getAnnotations()); valueArguments.setKeyOrValueType(mapArguments.getKeyClass()); valueArguments.setElementStrategy(keyStrategy); valueArguments.setGenericTypeArgs(mapArguments .getKeyGenericTypeArgs()); keyValue = getMapKeyOrElementValue(valueArguments, manufacturingCtx); valueArguments.setKeyOrValueType(mapArguments.getElementClass()); valueArguments.setElementStrategy(elementStrategy); valueArguments.setGenericTypeArgs(mapArguments .getElementGenericTypeArgs()); elementValue = getMapKeyOrElementValue(valueArguments, manufacturingCtx); /* ConcurrentHashMap doesn't allow null values */ if (elementValue != null || !(map instanceof ConcurrentHashMap)) { map.put(keyValue, elementValue); } } } catch (UnsupportedOperationException e) { LOG.warn("Cannot fill immutable map {}", map.getClass()); } } private Object getMapKeyOrElementValue( MapKeyOrElementsArguments keyOrElementsArguments, ManufacturingContext manufacturingCtx) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Object retValue = null; if (null != keyOrElementsArguments.getElementStrategy() && ObjectStrategy.class.isAssignableFrom(keyOrElementsArguments .getElementStrategy().getClass()) && Object.class.equals(keyOrElementsArguments .getKeyOrValueType())) { LOG.debug("Element strategy is ObjectStrategy and Map key or value type is of type Object: using the ObjectStrategy strategy"); retValue = keyOrElementsArguments.getElementStrategy().getValue(); } else if (null != keyOrElementsArguments.getElementStrategy() && !ObjectStrategy.class .isAssignableFrom(keyOrElementsArguments .getElementStrategy().getClass())) { LOG.debug("Map key or value will be filled using the following strategy: " + keyOrElementsArguments.getElementStrategy()); retValue = TypeManufacturerUtil.returnAttributeDataStrategyValue( keyOrElementsArguments.getKeyOrValueType(), keyOrElementsArguments.getElementStrategy()); } else { retValue = manufactureAttributeValue( keyOrElementsArguments.getMapToBeFilled(), manufacturingCtx, keyOrElementsArguments.getKeyOrValueType(), keyOrElementsArguments.getKeyOrValueType(), keyOrElementsArguments.getAnnotations(), keyOrElementsArguments.getAttributeName(), NULL_TYPE_ARGS_MAP, keyOrElementsArguments.getGenericTypeArgs()); } return retValue; } private Object resolveArrayElementValue(Object pojo, ManufacturingContext manufacturingCtx, AttributeMetadata attributeMetadata, Map<String, Type> typeArgsMap) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { @SuppressWarnings("unchecked") Class<Object> arrayType = (Class<Object>) attributeMetadata.getAttributeType(); Object array = strategy.getTypeValue(attributeMetadata, typeArgsMap, arrayType); Class<?> componentType = array.getClass().getComponentType(); Type genericComponentType; AtomicReference<Type[]> genericTypeArgs = new AtomicReference<Type[]>( PodamConstants.NO_TYPES); Type genericType = attributeMetadata.getAttributeGenericType(); if (genericType instanceof GenericArrayType) { genericComponentType = ((GenericArrayType) genericType).getGenericComponentType(); if (genericComponentType instanceof TypeVariable) { TypeVariable<?> componentTypeVariable = (TypeVariable<?>) genericComponentType; final Type resolvedType = typeArgsMap.get(componentTypeVariable.getName()); componentType = TypeManufacturerUtil.resolveGenericParameter(resolvedType, typeArgsMap, genericTypeArgs); } } else { genericComponentType = componentType; } // If the user defined a strategy to fill the collection elements, // we use it Holder<AttributeStrategy<?>> elementStrategyHolder = new Holder<AttributeStrategy<?>>(); Holder<AttributeStrategy<?>> keyStrategyHolder = null; Integer nbrElements = TypeManufacturerUtil.findCollectionSize(strategy, attributeMetadata.getAttributeAnnotations(), attributeMetadata.getAttributeType(), elementStrategyHolder, keyStrategyHolder); AttributeStrategy<?> elementStrategy = elementStrategyHolder.value; Object arrayElement = null; for (int i = 0; i < nbrElements; i++) { // The default if (null != elementStrategy && (elementStrategy instanceof ObjectStrategy) && Object.class.equals(componentType)) { LOG.debug("Element strategy is ObjectStrategy and array element is of type Object: using the ObjectStrategy strategy"); arrayElement = elementStrategy.getValue(); } else if (null != elementStrategy && !(elementStrategy instanceof ObjectStrategy)) { LOG.debug("Array elements will be filled using the following strategy: " + elementStrategy); arrayElement = TypeManufacturerUtil.returnAttributeDataStrategyValue(componentType, elementStrategy); } else { arrayElement = manufactureAttributeValue(array, manufacturingCtx, componentType, genericComponentType, attributeMetadata.getAttributeAnnotations(), attributeMetadata.getAttributeName(), typeArgsMap, genericTypeArgs.get()); } Array.set(array, i, arrayElement); } return array; } private Object[] getParameterValuesForConstructor( Constructor<?> constructor, Class<?> pojoClass, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Class<?>[] parameterTypes = constructor.getParameterTypes(); if (parameterTypes.length == 0) { return PodamConstants.NO_ARGS; } else { Object[] parameterValues = new Object[parameterTypes.length]; Annotation[][] parameterAnnotations = constructor.getParameterAnnotations(); Type[] genericTypes = constructor.getGenericParameterTypes(); String ctorName = Arrays.toString(genericTypes); for (int idx = 0; idx < parameterTypes.length; idx++) { List<Annotation> annotations = Arrays .asList(parameterAnnotations[idx]); Type genericType = (idx < genericTypes.length) ? genericTypes[idx] : parameterTypes[idx]; parameterValues[idx] = manufactureParameterValue(pojoClass, idx + ctorName, parameterTypes[idx], genericType, annotations, typeArgsMap, manufacturingCtx, genericTypeArgs); } return parameterValues; } } private Object[] getParameterValuesForMethod( Method method, Class<?> pojoClass, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Class<?>[] parameterTypes = method.getParameterTypes(); if (parameterTypes.length == 0) { return PodamConstants.NO_ARGS; } else { Object[] parameterValues = new Object[parameterTypes.length]; Annotation[][] parameterAnnotations = method.getParameterAnnotations(); Type[] genericTypes = method.getGenericParameterTypes(); String methodName = Arrays.toString(genericTypes); for (int idx = 0; idx < parameterTypes.length; idx++) { List<Annotation> annotations = Arrays .asList(parameterAnnotations[idx]); Type genericType = (idx < genericTypes.length) ? genericTypes[idx] : parameterTypes[idx]; parameterValues[idx] = manufactureParameterValue(pojoClass, idx + methodName, parameterTypes[idx], genericType, annotations, typeArgsMap, manufacturingCtx, genericTypeArgs); } return parameterValues; } } private Object manufactureParameterValue(Class<?> pojoClass, String parameterName, Class<?> parameterType, Type genericType, final List<Annotation> annotations, final Map<String, Type> typeArgsMap, ManufacturingContext manufacturingCtx, Type... genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { AttributeStrategy<?> attributeStrategy = TypeManufacturerUtil.findAttributeStrategy(strategy, annotations, parameterType); if (null != attributeStrategy) { LOG.debug("The parameter: " + genericType + " will be filled using the following strategy: " + attributeStrategy); return TypeManufacturerUtil.returnAttributeDataStrategyValue(parameterType, attributeStrategy); } Map<String, Type> typeArgsMapForParam; if (genericType instanceof ParameterizedType) { typeArgsMapForParam = new HashMap<String, Type>(typeArgsMap); ParameterizedType parametrizedType = (ParameterizedType) genericType; TypeVariable<?>[] argumentTypes = parameterType.getTypeParameters(); Type[] argumentGenericTypes = parametrizedType.getActualTypeArguments(); for (int k = 0; k < argumentTypes.length; k++) { if (argumentGenericTypes[k] instanceof Class) { Class<?> genericParam = (Class<?>) argumentGenericTypes[k]; typeArgsMapForParam.put(argumentTypes[k].getName(), genericParam); } } } else { typeArgsMapForParam = typeArgsMap; } return manufactureAttributeValue(pojoClass, manufacturingCtx, parameterType, genericType, annotations, parameterName, typeArgsMapForParam, genericTypeArgs); } private <T> T getValueForAbstractType(Class<T> pojoClass, AttributeMetadata pojoMetadata, ManufacturingContext manufacturingCtx, Map<String, Type> typeArgsMap, Type[] genericTypeArgs) throws InstantiationException, IllegalAccessException, InvocationTargetException, ClassNotFoundException { Class<? extends T> specificClass = strategy.getSpecificClass(pojoClass); if (!specificClass.equals(pojoClass)) { return this.manufacturePojoInternal(specificClass, pojoMetadata, manufacturingCtx, genericTypeArgs); } Class<?> factory = strategy.getFactoryClass(pojoClass); if (factory != null) { T retValue = instantiatePojoWithFactory(factory, pojoClass, manufacturingCtx, typeArgsMap, genericTypeArgs); if (retValue != null) { return retValue; } } return resortToExternalFactory(manufacturingCtx, "Cannot instantiate a class {}. Resorting to {} external factory", pojoClass, genericTypeArgs); } }
package yokohama.unit.translator; import yokohama.unit.contract.Contract; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.io.Reader; import java.lang.reflect.Modifier; import java.nio.file.Paths; import java.util.Arrays; import java.util.Collections; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Objects; import java.util.Optional; import java.util.TreeMap; import java.util.function.Function; import java.util.stream.Collectors; import java.util.stream.IntStream; import java.util.stream.Stream; import java.util.stream.StreamSupport; import lombok.Getter; import lombok.RequiredArgsConstructor; import lombok.SneakyThrows; import org.apache.commons.collections4.ListUtils; import org.apache.commons.csv.CSVFormat; import org.apache.commons.csv.CSVParser; import org.apache.poi.openxml4j.exceptions.InvalidFormatException; import org.apache.poi.ss.usermodel.Sheet; import org.apache.poi.ss.usermodel.Workbook; import org.apache.poi.ss.usermodel.WorkbookFactory; import yokohama.unit.ast.AnchorExpr; import yokohama.unit.ast.AsExpr; import yokohama.unit.ast.Assertion; import yokohama.unit.ast.BooleanExpr; import yokohama.unit.ast.Cell; import yokohama.unit.ast.CharExpr; import yokohama.unit.ast.ChoiceBinding; import yokohama.unit.ast.ChoiceCollectVisitor; import yokohama.unit.ast.Clause; import yokohama.unit.ast.CodeBlock; import yokohama.unit.ast.CodeBlockExtractVisitor; import yokohama.unit.ast.Definition; import yokohama.unit.ast.DoesNotMatchPredicate; import yokohama.unit.ast.EqualToMatcher; import yokohama.unit.ast.Execution; import yokohama.unit.ast.FloatingPointExpr; import yokohama.unit.ast.FourPhaseTest; import yokohama.unit.ast.Group; import yokohama.unit.ast.Ident; import yokohama.unit.ast.InstanceOfMatcher; import yokohama.unit.ast.InstanceSuchThatMatcher; import yokohama.unit.ast.IntegerExpr; import yokohama.unit.ast.InvocationExpr; import yokohama.unit.ast.Invoke; import yokohama.unit.ast.IsNotPredicate; import yokohama.unit.ast.IsPredicate; import yokohama.unit.ast.Matcher; import yokohama.unit.ast.MatchesPredicate; import yokohama.unit.ast.MethodPattern; import yokohama.unit.ast.NullValueMatcher; import yokohama.unit.ast.Pattern; import yokohama.unit.ast.Phase; import yokohama.unit.ast.Predicate; import yokohama.unit.ast.Proposition; import yokohama.unit.ast.QuotedExpr; import yokohama.unit.ast.RegExpPattern; import yokohama.unit.ast.ResourceExpr; import yokohama.unit.ast.Row; import yokohama.unit.ast.SingleBinding; import yokohama.unit.ast.StringExpr; import yokohama.unit.ast.Table; import yokohama.unit.ast.TableBinding; import yokohama.unit.ast.TableExtractVisitor; import yokohama.unit.ast.TableRef; import yokohama.unit.ast.Test; import yokohama.unit.ast.ThrowsPredicate; import yokohama.unit.ast_junit.Annotation; import yokohama.unit.ast_junit.ArrayExpr; import yokohama.unit.ast_junit.BooleanLitExpr; import yokohama.unit.ast_junit.CatchClause; import yokohama.unit.ast_junit.CharLitExpr; import yokohama.unit.ast_junit.ClassDecl; import yokohama.unit.ast_junit.ClassType; import yokohama.unit.ast_junit.CompilationUnit; import yokohama.unit.ast_junit.DoubleLitExpr; import yokohama.unit.ast_junit.EqualToMatcherExpr; import yokohama.unit.ast_junit.FloatLitExpr; import yokohama.unit.ast_junit.InstanceOfMatcherExpr; import yokohama.unit.ast_junit.IntLitExpr; import yokohama.unit.ast_junit.InvokeExpr; import yokohama.unit.ast_junit.InvokeStaticExpr; import yokohama.unit.ast_junit.InvokeStaticVoidStatement; import yokohama.unit.ast_junit.InvokeVoidStatement; import yokohama.unit.ast_junit.IsStatement; import yokohama.unit.ast_junit.LongLitExpr; import yokohama.unit.ast_junit.Method; import yokohama.unit.ast_junit.NewExpr; import yokohama.unit.ast_junit.NullExpr; import yokohama.unit.ast_junit.NullValueMatcherExpr; import yokohama.unit.ast_junit.PrimitiveType; import yokohama.unit.ast_junit.RegExpMatcherExpr; import yokohama.unit.ast_junit.Statement; import yokohama.unit.ast_junit.StrLitExpr; import yokohama.unit.ast_junit.ThisClassExpr; import yokohama.unit.ast_junit.TryStatement; import yokohama.unit.ast_junit.Type; import yokohama.unit.util.Sym; import yokohama.unit.ast_junit.VarExpr; import yokohama.unit.ast_junit.VarInitStatement; import yokohama.unit.position.Position; import yokohama.unit.position.Span; import yokohama.unit.util.ClassResolver; import yokohama.unit.util.FList; import yokohama.unit.util.GenSym; import yokohama.unit.util.Lists; import yokohama.unit.util.Optionals; import yokohama.unit.util.Pair; import yokohama.unit.util.SUtils; @RequiredArgsConstructor public class AstToJUnitAst { final String name; final String packageName; final ExpressionStrategy expressionStrategy; final MockStrategy mockStrategy; final CombinationStrategy combinationStrategy; final GenSym genSym; final ClassResolver classResolver; final TableExtractVisitor tableExtractVisitor; final CodeBlockExtractVisitor codeBlockExtractVisitor = new CodeBlockExtractVisitor(); final boolean checkContract; public CompilationUnit translate(Group group) { final List<Table> tables = tableExtractVisitor.extractTables(group); Map<String, CodeBlock> codeBlockMap = codeBlockExtractVisitor.extractMap(group); final ChoiceCollectVisitor choiceCollectVisitor = new ChoiceCollectVisitor(tables); return new AstToJUnitAstVisitor( name, packageName, expressionStrategy, mockStrategy, combinationStrategy, genSym, classResolver, tables, codeBlockMap, choiceCollectVisitor, checkContract) .translateGroup(group); } } @RequiredArgsConstructor class AstToJUnitAstVisitor { final String name; final String packageName; final ExpressionStrategy expressionStrategy; final MockStrategy mockStrategy; final CombinationStrategy combinationStrategy; final GenSym genSym; final ClassResolver classResolver; final List<Table> tables; final Map<String, CodeBlock> codeBlockMap; final ChoiceCollectVisitor choiceCollectVisitor; final boolean checkContract; final DataConverterFinder dataConverterFinder = new DataConverterFinder(); static final String MATCHER = "org.hamcrest.Matcher"; static final String CORE_MATCHERS = "org.hamcrest.CoreMatchers"; static final String TEST = "org.junit.Test"; @SneakyThrows(ClassNotFoundException.class) ClassType classTypeOf(String name) { return new ClassType(classResolver.lookup(name)); } Type typeOf(String name) { return classTypeOf(name).toType(); } Annotation annotationOf(String name) { return new Annotation(classTypeOf(name)); } CompilationUnit translateGroup(Group group) { List<Definition> definitions = group.getDefinitions(); List<Method> methods = definitions.stream() .flatMap(definition -> definition.accept( test -> translateTest(test).stream(), fourPhaseTest -> translateFourPhaseTest( fourPhaseTest).stream(), table -> Stream.empty(), codeBlock -> Stream.empty(), heading -> Stream.empty())) .collect(Collectors.toList()); ClassDecl testClass = new ClassDecl(true, name, Optional.empty(), Arrays.asList(), methods); Stream<ClassDecl> auxClasses = Stream.concat( expressionStrategy.auxClasses().stream(), mockStrategy.auxClasses().stream()); List<ClassDecl> classes = Stream.concat(auxClasses, Stream.of(testClass)) .collect(Collectors.toList()); return new CompilationUnit(packageName, classes); } List<Method> translateTest(Test test) { final String name = test.getName(); List<Assertion> assertions = test.getAssertions(); return IntStream.range(0, assertions.size()) .mapToObj(Integer::new) .flatMap(assertionNo -> { Sym env = genSym.generate("env"); List<List<Statement>> bodies = translateAssertion( assertions.get(assertionNo), env); return IntStream.range(0, bodies.size()) .mapToObj(Integer::new) .map(bodyNo -> { String methodName = SUtils.toIdent(name) + "_" + assertionNo + "_" + bodyNo; return new Method( Arrays.asList(annotationOf(TEST)), methodName, Arrays.asList(), Optional.empty(), Arrays.asList(ClassType.EXCEPTION), ListUtils.union( expressionStrategy.env(env), bodies.get(bodyNo))); }); }) .collect(Collectors.toList()); } List<List<Statement>> translateAssertion(Assertion assertion, Sym env) { List<Clause> clauses = assertion.getClauses(); return assertion.getFixture().accept( () -> { List<Statement> body = clauses.stream() .flatMap(clause -> translateClause(clause, env)) .collect(Collectors.toList()); return Arrays.asList(body); }, tableRef -> { List<List<Statement>> table = translateTableRef(tableRef, env); return IntStream.range(0, table.size()) .mapToObj(Integer::new) .map(i -> { return ListUtils.union( table.get(i), clauses.stream() .flatMap(clause -> translateClause(clause, env)) .collect(Collectors.toList())); }).collect(Collectors.toList()); }, bindings -> { List<Pair<List<Ident>, List<List<yokohama.unit.ast.Expr>>>> candidates = choiceCollectVisitor.visitBindings(bindings).collect(Collectors.toList()); List<Map<Ident, yokohama.unit.ast.Expr>> choices = candidatesToChoices(candidates); return choices.stream() .map((Map<Ident, yokohama.unit.ast.Expr> choice) -> Stream.concat( bindings.getBindings() .stream() .flatMap(binding -> translateBinding(binding, choice, env)), clauses.stream() .flatMap(clause -> translateClause(clause, env))) .collect(Collectors.toList())) .collect(Collectors.toList()); }); } private List<Map<Ident, yokohama.unit.ast.Expr>> candidatesToChoices( List<Pair<List<Ident>, List<List<yokohama.unit.ast.Expr>>>> candidates) { return combinationStrategy.generate(candidates) .stream() .map((List<Pair<List<Ident>, List<yokohama.unit.ast.Expr>>> choice) -> choice.stream() .map(p -> Pair.zip(p.getFirst(), p.getSecond())) .flatMap(List::stream)) .map((Stream<Pair<Ident, yokohama.unit.ast.Expr>> choice) -> choice.<Map<Ident, yokohama.unit.ast.Expr>>collect( () -> new HashMap<>(), (m, kv) -> m.put(kv.getFirst(), kv.getSecond()), (m1, m2) -> m1.putAll(m2))) .collect(Collectors.toList()); } Stream<Statement> translateClause(Clause clause, Sym envVar) { /* Disjunctive clause is translated as follows: try { assertThat(...); } catch (Throwable e) { try { assertThat(...); } catch (Throwable e) { assertThat(...); } } */ FList<Proposition> revPropositions = FList.fromReverseList(clause.getPropositions()); return revPropositions.match( () -> { throw new TranslationException( "clause is empty", clause.getSpan()); }, (last, init) -> { Stream<Statement> lastStatements = translateProposition(last, envVar); return init.foldLeft( lastStatements, (statements, prop) -> { Stream<Statement> propStatements = translateProposition(prop, envVar); Sym e = genSym.generate("e"); CatchClause catchClause = new CatchClause( ClassType.THROWABLE, e, statements.collect( Collectors.toList())); Statement tryStatement = new TryStatement( propStatements.collect( Collectors.toList()), Arrays.asList(catchClause), Collections.emptyList()); return Stream.of(tryStatement); }); }); } Stream<Statement> translateProposition( Proposition proposition, Sym envVar) { yokohama.unit.ast.Expr subject = proposition.getSubject(); Predicate predicate = proposition.getPredicate(); return predicate.<Stream<Statement>>accept( isPredicate -> translateIsPredicate(subject, isPredicate, envVar), isNotPredicate -> translateIsNotPredicate(subject, isNotPredicate, envVar), throwsPredicate -> translateThrowsPredicate(subject, throwsPredicate, envVar), matchesPredicate -> translateMatchesPredicate( subject, matchesPredicate, envVar), doesNotMatchPredicate -> translateDoesNotMatchPredicate( subject, doesNotMatchPredicate, envVar)); } Stream<Statement> translateIsPredicate( yokohama.unit.ast.Expr subject, IsPredicate isPredicate, Sym envVar) { Sym message = genSym.generate("message"); Sym actual = genSym.generate("actual"); return StreamCollector.<Statement>empty() .append(translateExpr(subject, actual, Object.class, envVar)) .append(translateMatcher( isPredicate.getComplement(), actual, matcherVar -> StreamCollector.<Statement>empty() .append(expressionStrategy.dumpEnv(message, envVar)) .append(new IsStatement( message, actual, matcherVar, isPredicate.getSpan())) .getStream(), envVar)) .getStream(); } Stream<Statement> translateIsNotPredicate( yokohama.unit.ast.Expr subject, IsNotPredicate isNotPredicate, Sym envVar) { // inhibit `is not instance e of Exception such that...` isNotPredicate.getComplement().accept( equalTo -> null, instanceOf -> null, instanceSuchThat -> { throw new TranslationException( "`instance _ of _ such that` cannot follow `is not`", instanceSuchThat.getSpan()); }, nullValue -> null); Sym message = genSym.generate("message"); Sym actual = genSym.generate("actual"); Sym expected = genSym.generate("expected"); return StreamCollector.<Statement>empty() .append(translateExpr(subject, actual, Object.class, envVar)) .append(translateMatcher( isNotPredicate.getComplement(), actual, matcherVar -> StreamCollector.<Statement>empty() .append(new VarInitStatement( typeOf(MATCHER), expected, new InvokeStaticExpr( classTypeOf(CORE_MATCHERS), Arrays.asList(), "not", Arrays.asList(typeOf(MATCHER)), Arrays.asList(matcherVar), typeOf(MATCHER)), isNotPredicate.getSpan())) .append(expressionStrategy.dumpEnv(message, envVar)) .append(new IsStatement( message, actual, expected, isNotPredicate.getSpan())) .getStream(), envVar)) .getStream(); } Stream<Statement> translateThrowsPredicate( yokohama.unit.ast.Expr subject, ThrowsPredicate throwsPredicate, Sym envVar) { Sym message = genSym.generate("message"); Sym actual = genSym.generate("actual"); Sym __ = genSym.generate("tmp"); return StreamCollector.<Statement>empty() .append(bindThrown( actual, translateExpr(subject, __, Object.class, envVar) .collect(Collectors.toList()), envVar)) .append(translateMatcher( throwsPredicate.getThrowee(), actual, matcherVar -> StreamCollector.<Statement>empty() .append(expressionStrategy.dumpEnv(message, envVar)) .append(new IsStatement( message, actual, matcherVar, throwsPredicate.getSpan())) .getStream(), envVar)) .getStream(); } Stream<Statement> bindThrown( Sym actual, List<Statement> statements, Sym envVar) { Sym e = genSym.generate("ex"); /* Throwable actual; try { // statements actual = null; } catch (XXXXException e) { // extract the cause if wrapped: inserted by the strategy actual = e.get...; } catch (Throwable e) { actual = e; } */ return Stream.of(new TryStatement( ListUtils.union( statements, Arrays.asList(new VarInitStatement( Type.THROWABLE, actual, new NullExpr(), Span.dummySpan()))), Stream.concat(Optionals.toStream( expressionStrategy.catchAndAssignCause(actual)), Stream.of(new CatchClause( ClassType.THROWABLE, e, Arrays.asList(new VarInitStatement( Type.THROWABLE, actual, new VarExpr(e), Span.dummySpan()))))) .collect(Collectors.toList()), Arrays.asList())); } Stream<Statement> translateMatchesPredicate( yokohama.unit.ast.Expr subject, MatchesPredicate matchesPredicate, Sym envVar) { Pattern pattern = matchesPredicate.getPattern(); Sym message = genSym.generate("message"); Sym actual = genSym.generate("actual"); Sym expected = genSym.generate("expected"); return StreamCollector.<Statement>empty() .append(translateExpr(subject, actual, Object.class, envVar)) .append(translatePattern(pattern, expected, envVar)) .append(expressionStrategy.dumpEnv(message, envVar)) .append(new IsStatement( message, actual, expected, matchesPredicate.getSpan())) .getStream(); } Stream<Statement> translateDoesNotMatchPredicate( yokohama.unit.ast.Expr subject, DoesNotMatchPredicate doesNotMatchPredicate, Sym envVar) { Pattern pattern = doesNotMatchPredicate.getPattern(); Sym message = genSym.generate("message"); Sym actual = genSym.generate("actual"); Sym unexpected = genSym.generate("unexpected"); Sym expected = genSym.generate("expected"); return StreamCollector.<Statement>empty() .append(translateExpr(subject, actual, Object.class, envVar)) .append(translatePattern(pattern, unexpected, envVar)) .append(new VarInitStatement( typeOf(MATCHER), expected, new InvokeStaticExpr( classTypeOf(CORE_MATCHERS), Arrays.asList(), "not", Arrays.asList(typeOf(MATCHER)), Arrays.asList(unexpected), typeOf(MATCHER)), doesNotMatchPredicate.getSpan())) .append(expressionStrategy.dumpEnv(message, envVar)) .append(new IsStatement( message, actual, expected, doesNotMatchPredicate.getSpan())) .getStream(); } private String lookupClassName(String name, Span span) { try { return classResolver.lookup(name).getCanonicalName(); } catch (ClassNotFoundException e) { throw new TranslationException(e.getMessage(), span, e); } } Stream<Statement> translateMatcher( Matcher matcher, Sym actual, Function<Sym, Stream<Statement>> cont, Sym envVar) { Sym matcherVar = genSym.generate("matcher"); return matcher.<Stream<Statement>>accept((EqualToMatcher equalTo) -> { Sym objVar = genSym.generate("obj"); return StreamCollector.<Statement>empty() .append(translateExpr(equalTo.getExpr(), objVar, Object.class, envVar)) .append(new VarInitStatement( typeOf(MATCHER), matcherVar, new EqualToMatcherExpr(objVar), equalTo.getSpan())) .append(cont.apply(matcherVar)) .getStream(); }, (InstanceOfMatcher instanceOf) -> { return StreamCollector.<Statement>empty() .append(new VarInitStatement( typeOf(MATCHER), matcherVar, new InstanceOfMatcherExpr( ClassType.of( instanceOf.getClazz(), classResolver)), instanceOf.getSpan())) .append(cont.apply(matcherVar)) .getStream(); }, (InstanceSuchThatMatcher instanceSuchThat) -> { Ident bindVar = instanceSuchThat.getVar(); yokohama.unit.ast.ClassType clazz = instanceSuchThat.getClazz(); List<Proposition> propositions = instanceSuchThat.getPropositions(); Span span = instanceSuchThat.getSpan(); Sym instanceOfVar = genSym.generate("instanceOfMatcher"); Stream<Statement> instanceOfStatements = StreamCollector.<Statement>empty() .append(new VarInitStatement( typeOf(MATCHER), instanceOfVar, new InstanceOfMatcherExpr( ClassType.of( instanceSuchThat.getClazz(), classResolver)), clazz.getSpan())) .append(cont.apply(instanceOfVar)) .getStream(); Stream<Statement> bindStatements = expressionStrategy.bind(envVar, bindVar, actual).stream(); Stream<Statement> suchThatStatements = propositions .stream() .flatMap(proposition -> translateProposition(proposition, envVar)); return StreamCollector.<Statement>empty() .append(instanceOfStatements) .append(bindStatements) .append(suchThatStatements) .getStream(); }, (NullValueMatcher nullValue) -> { return StreamCollector.<Statement>empty() .append(new VarInitStatement( typeOf(MATCHER), matcherVar, new NullValueMatcherExpr(), nullValue.getSpan())) .append(cont.apply(matcherVar)) .getStream(); }); } Stream<Statement> translatePattern( Pattern pattern, Sym var, Sym envVar) { return pattern.accept((Function<RegExpPattern, Stream<Statement>>) regExpPattern -> translateRegExpPattern(regExpPattern, var, envVar)); } Stream<Statement> translateRegExpPattern( RegExpPattern regExpPattern, Sym var, Sym envVar) { regExpPattern.getRegexp(); return Stream.of( new VarInitStatement( typeOf(MATCHER), var, new RegExpMatcherExpr(regExpPattern.getRegexp()), regExpPattern.getSpan())); } Stream<Statement> translateBinding( yokohama.unit.ast.Binding binding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar) { return binding.accept( singleBinding -> translateSingleBinding(singleBinding, envVar), choiceBinding -> translateChoiceBinding(choiceBinding, choice, envVar), tableBinding -> translateTableBinding(tableBinding, choice, envVar)); } Stream<Statement> translateBindingWithContract( yokohama.unit.ast.Binding binding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar, Sym contractVar) { return binding.accept( singleBinding -> translateSingleBindingWithContract(singleBinding, envVar, contractVar), choiceBinding -> translateChoiceBindingWithContract(choiceBinding, choice, envVar, contractVar), tableBinding -> translateTableBindingWithContract(tableBinding, choice, envVar, contractVar)); } Stream<Statement> insertContract(Sym contractVar, Sym objVar) { return checkContract ? Stream.of( new InvokeVoidStatement( ClassType.fromClass(Contract.class), contractVar, "assertSatisfied", Arrays.asList(Type.OBJECT), Arrays.asList(objVar), Span.dummySpan())) : Stream.empty(); } Stream<Statement> translateSingleBinding( SingleBinding singleBinding, Sym envVar) { Ident name = singleBinding.getName(); Sym var = genSym.generate(name.getName()); return Stream.concat( translateExpr(singleBinding.getValue(), var, Object.class, envVar), expressionStrategy.bind(envVar, name, var).stream()); } Stream<Statement> translateSingleBindingWithContract( SingleBinding singleBinding, Sym envVar, Sym contractVar) { Ident name = singleBinding.getName(); Sym var = genSym.generate(name.getName()); return StreamCollector.<Statement>empty() .append(translateExpr(singleBinding.getValue(), var, Object.class, envVar)) .append(insertContract(contractVar, var)) .append(expressionStrategy.bind(envVar, name, var).stream()) .getStream(); } Stream<Statement> translateChoiceBinding( ChoiceBinding choiceBinding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar) { Ident name = choiceBinding.getName(); yokohama.unit.ast.Expr expr = choice.get(name); Sym var = genSym.generate(name.getName()); return Stream.concat( translateExpr(expr, var, Object.class, envVar), expressionStrategy.bind(envVar, name, var).stream()); } Stream<Statement> translateChoiceBindingWithContract( ChoiceBinding choiceBinding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar, Sym contractVar) { Ident name = choiceBinding.getName(); yokohama.unit.ast.Expr expr = choice.get(name); Sym var = genSym.generate(name.getName()); return StreamCollector.<Statement>empty() .append(translateExpr(expr, var, Object.class, envVar)) .append(insertContract(contractVar, var)) .append(expressionStrategy.bind(envVar, name, var).stream()) .getStream(); } Stream<Statement> translateTableBinding( TableBinding tableBinding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar) { List<Ident> idents = tableBinding.getIdents(); return idents.stream().flatMap(ident -> { yokohama.unit.ast.Expr expr = choice.get(ident); Sym var = genSym.generate(ident.getName()); return Stream.concat( translateExpr(expr, var, Object.class, envVar), expressionStrategy.bind(envVar, ident, var).stream()); }); } Stream<Statement> translateTableBindingWithContract( TableBinding tableBinding, Map<Ident, yokohama.unit.ast.Expr> choice, Sym envVar, Sym contractVar) { List<Ident> idents = tableBinding.getIdents(); return idents.stream().flatMap(ident -> { yokohama.unit.ast.Expr expr = choice.get(ident); Sym var = genSym.generate(ident.getName()); return StreamCollector.<Statement>empty() .append(translateExpr(expr, var, Object.class, envVar)) .append(insertContract(contractVar, var)) .append(expressionStrategy.bind(envVar, ident, var).stream()) .getStream(); }); } Stream<Statement> translateExpr( yokohama.unit.ast.Expr expr, Sym var, Class<?> expectedType, Sym envVar) { Sym exprVar = genSym.generate("expr"); Stream<Statement> statements = expr.accept( quotedExpr -> { return expressionStrategy.eval( exprVar, quotedExpr, Type.fromClass(expectedType).box().toClass(), envVar).stream(); }, stubExpr -> { return mockStrategy.stub( exprVar, stubExpr, this, envVar).stream(); }, invocationExpr -> { return translateInvocationExpr(invocationExpr, exprVar, envVar); }, integerExpr -> { return translateIntegerExpr(integerExpr, exprVar, envVar); }, floatingPointExpr -> { return translateFloatingPointExpr(floatingPointExpr, exprVar, envVar); }, booleanExpr -> { return translateBooleanExpr(booleanExpr, exprVar, envVar); }, charExpr -> { return translateCharExpr(charExpr, exprVar, envVar); }, stringExpr -> { return translateStringExpr(stringExpr, exprVar, envVar); }, anchorExpr -> { return translateAnchorExpr(anchorExpr, exprVar, envVar); }, asExpr -> { return translateAsExpr(asExpr, exprVar, envVar); }, resourceExpr -> { return translateResourceExpr(resourceExpr, exprVar, envVar); }); // box or unbox if needed Stream<Statement> boxing = boxOrUnbox(Type.fromClass(expectedType), var, typeOfExpr(expr), exprVar); return Stream.concat(statements, boxing); } Stream<Statement> translateInvocationExpr( InvocationExpr invocationExpr, Sym var, Sym envVar) { yokohama.unit.ast.ClassType classType = invocationExpr.getClassType(); Class<?> clazz = classType.toClass(classResolver); MethodPattern methodPattern = invocationExpr.getMethodPattern(); String methodName = methodPattern.getName(); List<yokohama.unit.ast.Type> argTypes = methodPattern.getParamTypes(); boolean isVararg = methodPattern.isVararg(); Optional<yokohama.unit.ast.Expr> receiver = invocationExpr.getReceiver(); List<yokohama.unit.ast.Expr> args = invocationExpr.getArgs(); Type returnType = typeOfExpr(invocationExpr); Pair<List<Sym>, Stream<Statement>> argVarsAndStatements = setupArgs(argTypes, isVararg, args, envVar); List<Sym> argVars = argVarsAndStatements.getFirst(); Stream<Statement> setupStatements = argVarsAndStatements.getSecond(); Stream<Statement> invocation = generateInvoke( var, classType, methodName, argTypes, isVararg, argVars, receiver, returnType, envVar, invocationExpr.getSpan()); return Stream.concat(setupStatements, invocation); } Stream<Statement> translateIntegerExpr( IntegerExpr integerExpr, Sym var, Sym envVar) { return integerExpr.match(intValue -> { return Stream.<Statement>of(new VarInitStatement( Type.INT, var, new IntLitExpr(intValue), integerExpr.getSpan())); }, longValue -> { return Stream.<Statement>of(new VarInitStatement( Type.LONG, var, new LongLitExpr(longValue), integerExpr.getSpan())); }); } Stream<Statement> translateFloatingPointExpr( FloatingPointExpr floatingPointExpr, Sym var, Sym envVar) { return floatingPointExpr.match(floatValue -> { return Stream.<Statement>of(new VarInitStatement( Type.FLOAT, var, new FloatLitExpr(floatValue), floatingPointExpr.getSpan())); }, doubleValue -> { return Stream.<Statement>of(new VarInitStatement( Type.DOUBLE, var, new DoubleLitExpr(doubleValue), floatingPointExpr.getSpan())); }); } Stream<Statement> translateBooleanExpr( BooleanExpr booleanExpr, Sym var, Sym envVar) { boolean booleanValue = booleanExpr.getValue(); return Stream.<Statement>of(new VarInitStatement( Type.BOOLEAN, var, new BooleanLitExpr(booleanValue), booleanExpr.getSpan())); } Stream<Statement> translateCharExpr( CharExpr charExpr, Sym var, Sym envVar) { char charValue = charExpr.getValue(); return Stream.<Statement>of(new VarInitStatement( Type.CHAR, var, new CharLitExpr(charValue), charExpr.getSpan())); } Stream<Statement> translateStringExpr( StringExpr stringExpr, Sym var, Sym envVar) { String strValue = stringExpr.getValue(); return Stream.<Statement>of(new VarInitStatement( Type.STRING, var, new StrLitExpr(strValue), stringExpr.getSpan())); } Stream<Statement> translateAnchorExpr( AnchorExpr anchorExpr, Sym var, Sym envVar) { String anchor = anchorExpr.getAnchor(); CodeBlock codeBlock = codeBlockMap.get(anchor); String code = codeBlock.getCode(); return Stream.<Statement>of(new VarInitStatement( Type.STRING, var, new StrLitExpr(code), anchorExpr.getSpan())); } private Stream<Statement> translateAsExpr(AsExpr asExpr, Sym exprVar, Sym envVar) { Sym sourceVar = genSym.generate("source"); Stream<Statement> source = translateExpr(asExpr.getSourceExpr(), sourceVar, String.class, envVar); yokohama.unit.ast.ClassType classType = asExpr.getClassType(); Class<?> returnType = classType.toClass(classResolver); Stream<Statement> convert = Optionals.match( dataConverterFinder.find(returnType, classResolver.getClassLoader()), () -> { throw new TranslationException( "converter method for " + classType.getName() + " not found", asExpr.getSpan()); }, method -> { Class<?> clazz = method.getDeclaringClass(); int modifier = method.getModifiers(); if (Modifier.isStatic(modifier)) { return Stream.of( new VarInitStatement( Type.fromClass(returnType), exprVar, new InvokeStaticExpr( ClassType.fromClass(clazz), Collections.emptyList(), method.getName(), Arrays.asList(Type.STRING), Arrays.asList(sourceVar), Type.fromClass(returnType)), asExpr.getSpan())); } else { throw new UnsupportedOperationException("non static method"); } }); return Stream.concat(source, convert); } private Stream<Statement> translateResourceExpr( ResourceExpr resourceExpr, Sym exprVar, Sym envVar) { Sym classVar = genSym.generate("clazz"); Sym nameVar = genSym.generate("name"); Stream<Statement> classAndName = Stream.of( new VarInitStatement( Type.CLASS, classVar, new ThisClassExpr(), resourceExpr.getSpan()), new VarInitStatement( Type.STRING, nameVar, new StrLitExpr(resourceExpr.getName()), resourceExpr.getSpan())); Stream<Statement> getResource = Optionals.match( resourceExpr.getClassType(), () -> { return Stream.of( new VarInitStatement( Type.URL, exprVar, new InvokeExpr( ClassType.CLASS, classVar, "getResource", Arrays.asList(Type.STRING), Arrays.asList(nameVar), Type.URL), resourceExpr.getSpan())); }, classType -> { if (classType.toClass(classResolver).equals(java.io.InputStream.class)) { return Stream.of( new VarInitStatement( typeOf("java.io.InputStream"), exprVar, new InvokeExpr( ClassType.CLASS, classVar, "getResourceAsStream", Arrays.asList(Type.STRING), Arrays.asList(nameVar), typeOf("java.io.InputStream")), resourceExpr.getSpan())); } else if (classType.toClass(classResolver).equals(java.net.URI.class)) { Sym urlVar = genSym.generate("url"); return Stream.of( new VarInitStatement( Type.URL, urlVar, new InvokeExpr( ClassType.CLASS, classVar, "getResource", Arrays.asList(Type.STRING), Arrays.asList(nameVar), Type.URL), resourceExpr.getSpan()), new VarInitStatement( typeOf("java.net.URI"), exprVar, new InvokeExpr( classTypeOf("java.net.URL"), urlVar, "toURI", Arrays.asList(), Arrays.asList(), typeOf("java.net.URI")), resourceExpr.getSpan())); } else { throw new TranslationException( "Conversion into " + classType + "not supported", resourceExpr.getSpan()); } }); return Stream.concat(classAndName, getResource); } Stream<Statement> boxOrUnbox( Type toType, Sym toVar, Type fromType, Sym fromVar) { return fromType.<Stream<Statement>>matchPrimitiveOrNot( primitiveType -> { return fromPrimitive( toType, toVar, primitiveType, fromVar); }, nonPrimitiveType -> { return fromNonPrimtive(toType, toVar, fromVar); }); } private Stream<Statement> fromPrimitive( Type toType, Sym toVar, PrimitiveType fromType, Sym fromVar) { return toType.<Stream<Statement>>matchPrimitiveOrNot( primitiveType -> { return Stream.of( new VarInitStatement( toType, toVar, new VarExpr(fromVar), Span.dummySpan())); }, nonPrimitiveType -> { return Stream.of(new VarInitStatement( nonPrimitiveType, toVar, new InvokeStaticExpr( fromType.box(), Arrays.asList(), "valueOf", Arrays.asList(fromType.toType()), Arrays.asList(fromVar), fromType.box().toType()), Span.dummySpan())); }); } private Stream<Statement> fromNonPrimtive( Type toType, Sym toVar, Sym fromVar) { // precondition: fromVar is not primitive return toType.<Stream<Statement>>matchPrimitiveOrNot(primitiveType -> { Sym boxVar = genSym.generate("box"); ClassType boxType; String unboxMethodName; switch (primitiveType.getKind()) { case BOOLEAN: boxType = primitiveType.box(); unboxMethodName = "booleanValue"; break; case BYTE: boxType = ClassType.fromClass(Number.class); unboxMethodName = "byteValue"; break; case SHORT: boxType = ClassType.fromClass(Number.class); unboxMethodName = "shortValue"; break; case INT: boxType = ClassType.fromClass(Number.class); unboxMethodName = "intValue"; break; case LONG: boxType = ClassType.fromClass(Number.class); unboxMethodName = "longValue"; break; case CHAR: boxType = primitiveType.box(); unboxMethodName = "charValue"; break; case FLOAT: boxType = ClassType.fromClass(Number.class); unboxMethodName = "floatValue"; break; case DOUBLE: boxType = ClassType.fromClass(Number.class); unboxMethodName = "doubleValue"; break; default: throw new RuntimeException("should not reach here"); } return Stream.of( new VarInitStatement( boxType.toType(), boxVar, new VarExpr(fromVar), Span.dummySpan()), new VarInitStatement( toType, toVar, new InvokeExpr( boxType, fromVar, unboxMethodName, Collections.emptyList(), Collections.emptyList(), toType), Span.dummySpan())); }, nonPrimitiveType -> { return Stream.of( new VarInitStatement( nonPrimitiveType, toVar, new VarExpr(fromVar), Span.dummySpan())); }); } private Type typeOfExpr(yokohama.unit.ast.Expr expr) { return expr.accept( quotedExpr -> Type.OBJECT, stubExpr -> Type.of( stubExpr.getClassToStub().toType(), classResolver), invocationExpr -> { MethodPattern mp = invocationExpr.getMethodPattern(); return mp.getReturnType( invocationExpr.getClassType(), classResolver) .map(type -> Type.of(type, classResolver)) .get(); }, integerExpr -> integerExpr.match( intValue -> Type.INT, longValue -> Type.LONG), floatingPointExpr -> floatingPointExpr.match( floatValue -> Type.FLOAT, doubleValue -> Type.DOUBLE), booleanExpr -> Type.BOOLEAN, charExpr -> Type.CHAR, stringExpr -> Type.STRING, anchorExpr -> Type.STRING, asExpr -> Type.of(asExpr.getClassType().toType(), classResolver), resourceExpr -> resourceExpr.getClassType() .map(classType -> Type.of(classType.toType(), classResolver)) .orElse(Type.URL)); } List<List<Statement>> translateTableRef( TableRef tableRef, Sym envVar) { String name = tableRef.getName(); List<Ident> idents = tableRef.getIdents(); try { switch(tableRef.getType()) { case INLINE: return translateTable(tables.stream() .filter(table -> table.getName().equals(name)) .findFirst() .get(), idents, envVar); case CSV: return parseCSV(name, CSVFormat.DEFAULT.withHeader(), idents, envVar); case TSV: return parseCSV(name, CSVFormat.TDF.withHeader(), idents, envVar); case EXCEL: return parseExcel(name, idents, envVar); } throw new IllegalArgumentException( "'" + Objects.toString(tableRef) + "' is not a table reference."); } catch (InvalidFormatException | IOException e) { throw new TranslationException(e.getMessage(), tableRef.getSpan(), e); } } List<List<Statement>> translateTable( Table table, List<Ident> idents, Sym envVar) { return table.getRows() .stream() .map(row -> translateRow(row, table.getHeader(), idents, envVar)) .collect(Collectors.toList()); } List<Statement> translateRow( Row row, List<Ident> header, List<Ident> idents, Sym envVar) { return IntStream.range(0, header.size()) .filter(i -> idents.contains(header.get(i))) .mapToObj(Integer::new) .flatMap(i -> { Cell cell = row.getCells().get(i); return cell.accept(exprCell -> { Sym var = genSym.generate(header.get(i).getName()); return Stream.concat(translateExpr(exprCell.getExpr(), var, Object.class, envVar), expressionStrategy.bind(envVar, header.get(i), var).stream()); }, predCell -> { throw new TranslationException( "Expected expression but found predicate", predCell.getSpan()); }); }) .collect(Collectors.toList()); } List<List<Statement>> parseCSV( String fileName, CSVFormat format, List<Ident> idents, Sym envVar) throws IOException { Map<String, Ident> nameToIdent = idents.stream() .collect(() -> new TreeMap<>(), (map, ident) -> map.put(ident.getName(), ident), (m1, m2) -> m1.putAll(m2)); try ( final InputStream in = getClass().getResourceAsStream(fileName); final Reader reader = new InputStreamReader(in, "UTF-8"); final CSVParser parser = new CSVParser(reader, format)) { return StreamSupport.stream(parser.spliterator(), false) .map(record -> parser.getHeaderMap().keySet() .stream() .filter(key -> idents.stream().anyMatch(ident -> ident.getName().equals(key))) .map(key -> nameToIdent.get(key)) .flatMap(ident -> { Sym var = genSym.generate(ident.getName()); return Stream.concat(expressionStrategy.eval(var, new yokohama.unit.ast.QuotedExpr( record.get(ident.getName()), new yokohama.unit.position.Span( Optional.of(Paths.get(fileName)), new Position((int)parser.getCurrentLineNumber(), -1), new Position(-1, -1))), Object.class, envVar).stream(), expressionStrategy.bind(envVar, ident, var).stream()); }) .collect(Collectors.toList())) .collect(Collectors.toList()); } } List<List<Statement>> parseExcel( String fileName, List<Ident> idents, Sym envVar) throws InvalidFormatException, IOException { Map<String, Ident> nameToIdent = idents.stream() .collect(() -> new TreeMap<>(), (map, ident) -> map.put(ident.getName(), ident), (m1, m2) -> m1.putAll(m2)); try (InputStream in = getClass().getResourceAsStream(fileName)) { final Workbook book = WorkbookFactory.create(in); final Sheet sheet = book.getSheetAt(0); final int top = sheet.getFirstRowNum(); final int left = sheet.getRow(top).getFirstCellNum(); List<String> names = StreamSupport.stream(sheet.getRow(top).spliterator(), false) .map(cell -> cell.getStringCellValue()) .collect(Collectors.toList()); return StreamSupport.stream(sheet.spliterator(), false) .skip(1) .map(row -> IntStream.range(0, names.size()) .filter(i -> idents.stream().anyMatch(ident -> ident.getName().equals(names.get(i)))) .mapToObj(Integer::new) .flatMap(i -> { Ident ident = nameToIdent.get(names.get(i)); Sym var = genSym.generate(names.get(i)); return Stream.concat(expressionStrategy.eval(var, new yokohama.unit.ast.QuotedExpr( row.getCell(left + i).getStringCellValue(), new yokohama.unit.position.Span( Optional.of(Paths.get(fileName)), new Position(row.getRowNum() + 1, left + i + 1), new Position(-1, -1))), Object.class, envVar).stream(), expressionStrategy.bind(envVar, ident, var).stream()); }) .collect(Collectors.toList())) .collect(Collectors.toList()); } } List<Method> translateFourPhaseTest(FourPhaseTest fourPhaseTest) { Sym env = genSym.generate("env"); Sym contractVar = genSym.generate("contract"); List<Statement> contract = checkContract ? Arrays.asList( new VarInitStatement( Type.fromClass(Contract.class), contractVar, new NewExpr( "yokohama.unit.contract.GroovyContract", Collections.emptyList(), Collections.emptyList()), fourPhaseTest.getSpan())) : Collections.emptyList(); List<Pair<List<Ident>, List<List<yokohama.unit.ast.Expr>>>> candidates = Optionals.toStream( fourPhaseTest .getSetup() .map(Phase::getLetStatements) .map(List::stream)) .flatMap(x -> x) .flatMap(choiceCollectVisitor::visitLetStatement) .collect(Collectors.toList()); List<Map<Ident, yokohama.unit.ast.Expr>> choices = candidatesToChoices(candidates); IntStream indexes = IntStream.range(0, choices.size()); return indexes.mapToObj(index -> { Map<Ident, yokohama.unit.ast.Expr> choice = choices.get(index); String testName = SUtils.toIdent(fourPhaseTest.getName()) + "_" + index; final Stream<Statement> bindings; final List<String> vars; if (fourPhaseTest.getSetup().isPresent()) { Phase setup = fourPhaseTest.getSetup().get(); bindings = setup.getLetStatements().stream() .flatMap(letStatement -> letStatement.getBindings().stream() .flatMap(binding -> checkContract ? translateBindingWithContract(binding, choice, env, contractVar) : translateBinding(binding, choice, env))); vars = setup.getLetStatements().stream() .flatMap(s -> s.getBindings().stream() .flatMap(b -> b.accept( singleBinding -> Stream.of(singleBinding.getName()), choiceBinding -> Stream.of(choiceBinding.getName()), tableBinding -> tableBinding.getIdents().stream()))) .map(Ident::getName) .collect(Collectors.toList()); } else { bindings = Stream.empty(); vars = Collections.emptyList(); } Optional<Stream<Statement>> setupActions = fourPhaseTest.getSetup() .map(Phase::getStatements) .map(statements -> translateStatements(statements, env)); Optional<Stream<Statement>> exerciseActions = fourPhaseTest.getExercise() .map(Phase::getStatements) .map(statements -> translateStatements(statements, env)); Stream<Statement> testStatements = fourPhaseTest.getVerify().getAssertions().stream() .flatMap(assertion -> translateAssertion(assertion, env) .stream().flatMap(s -> s.stream())); Stream<Statement> contractAfterExercise = checkContract ? vars.stream() .flatMap(name -> { Sym objVar = genSym.generate("obj"); return Stream.concat( expressionStrategy.eval( objVar, new QuotedExpr( name, Span.dummySpan()), Object.class, env).stream(), insertContract(contractVar, objVar)); }) : Stream.empty(); List<Statement> statements = Lists.fromStreams( bindings, setupActions.isPresent() ? setupActions.get() : Stream.empty(), exerciseActions.isPresent() ? exerciseActions.get() : Stream.empty(), contractAfterExercise, testStatements); List<Statement> actionsAfter; if (fourPhaseTest.getTeardown().isPresent()) { Phase teardown = fourPhaseTest.getTeardown().get(); actionsAfter = translateStatements(teardown.getStatements(), env) .collect(Collectors.toList()); } else { actionsAfter = Arrays.asList(); } return new Method( Arrays.asList(annotationOf(TEST)), testName, Arrays.asList(), Optional.empty(), Arrays.asList(ClassType.EXCEPTION), Lists.concat( expressionStrategy.env(env), contract, actionsAfter.size() > 0 ? Arrays.asList( new TryStatement( statements, Arrays.asList(), actionsAfter)) : statements)); }).collect(Collectors.toList()); } Stream<Statement> translateStatements( List<yokohama.unit.ast.Statement> statements, Sym envVar) { return statements.stream() .flatMap(statement -> statement.accept(execution -> translateExecution(execution, envVar), invoke -> translateInvoke(invoke, envVar))); } Stream<Statement> translateExecution( Execution execution, Sym envVar) { Sym __ = genSym.generate("__"); return execution.getExpressions().stream() .flatMap(expression -> expressionStrategy.eval(__, expression, Object.class, envVar).stream()); } Stream<Statement> translateInvoke(Invoke invoke, Sym envVar) { yokohama.unit.ast.ClassType classType = invoke.getClassType(); Class<?> clazz = classType.toClass(classResolver); MethodPattern methodPattern = invoke.getMethodPattern(); String methodName = methodPattern.getName(); List<yokohama.unit.ast.Type> argTypes = methodPattern.getParamTypes(); boolean isVararg = methodPattern.isVararg(); Optional<yokohama.unit.ast.Expr> receiver = invoke.getReceiver(); List<yokohama.unit.ast.Expr> args = invoke.getArgs(); Pair<List<Sym>, Stream<Statement>> argVarsAndStatements = setupArgs(argTypes, isVararg, args, envVar); List<Sym> argVars = argVarsAndStatements.getFirst(); Stream<Statement> setupStatements = argVarsAndStatements.getSecond(); Optional<Type> returnType = invoke.getMethodPattern() .getReturnType(classType, classResolver) .map(type -> Type.of(type, classResolver)); Stream<Statement> invocation; if (returnType.isPresent()) { invocation = generateInvoke(genSym.generate("__"), classType, methodName, argTypes, isVararg, argVars, receiver, returnType.get(), envVar, invoke.getSpan()); } else { invocation = generateInvokeVoid(classType, methodName, argTypes, isVararg, argVars, receiver, envVar, invoke.getSpan()); } return Stream.concat(setupStatements, invocation); } Pair<List<Sym>, Stream<Statement>> setupArgs( List<yokohama.unit.ast.Type> argTypes, boolean isVararg, List<yokohama.unit.ast.Expr> args, Sym envVar) { List<Pair<Sym, Stream<Statement>>> setupArgs; if (isVararg) { int splitAt = argTypes.size() - 1; List<Pair<yokohama.unit.ast.Type, List<yokohama.unit.ast.Expr>>> typesAndArgs = Pair.zip( argTypes, Lists.split(args, splitAt).map((nonVarargs, varargs) -> ListUtils.union( Lists.map(nonVarargs, Arrays::asList), Arrays.asList(varargs)))); setupArgs = Lists.mapInitAndLast(typesAndArgs, typeAndArg -> typeAndArg.map((t, arg) -> { Sym argVar = genSym.generate("arg"); Type paramType = Type.of(t, classResolver); Stream<Statement> expr = translateExpr(arg.get(0), argVar, paramType.toClass(), envVar); return Pair.of(argVar, expr); }), typeAndArg -> typeAndArg.map((t, varargs) -> { Type paramType = Type.of(t, classResolver); List<Pair<Sym, Stream<Statement>>> exprs = varargs.stream().map(vararg -> { Sym varargVar = genSym.generate("vararg"); Stream<Statement> expr = translateExpr(vararg, varargVar, paramType.toClass(), envVar); return Pair.of(varargVar, expr); }).collect(Collectors.toList()); List<Sym> varargVars = Pair.unzip(exprs).getFirst(); Stream<Statement> varargStatements = exprs.stream().flatMap(Pair::getSecond); Sym argVar = genSym.generate("arg"); Stream<Statement> arrayStatement = Stream.of( new VarInitStatement( paramType.toArray(), argVar, new ArrayExpr(paramType.toArray(), varargVars), t.getSpan())); return Pair.of(argVar, Stream.concat(varargStatements, arrayStatement)); })); } else { List<Pair<yokohama.unit.ast.Type, yokohama.unit.ast.Expr>> pairs = Pair.<yokohama.unit.ast.Type, yokohama.unit.ast.Expr>zip( argTypes, args); setupArgs = pairs.stream().map(pair -> pair.map((t, arg) -> { // evaluate actual args and coerce to parameter types Sym argVar = genSym.generate("arg"); Type paramType = Type.of(t, classResolver); Stream<Statement> expr = translateExpr(arg, argVar, paramType.toClass(), envVar); return Pair.of(argVar, expr); })).collect(Collectors.toList()); } List<Sym> argVars = Pair.unzip(setupArgs).getFirst(); Stream<Statement> setupStatements = setupArgs.stream().flatMap(Pair::getSecond); return Pair.of(argVars, setupStatements); } Stream<Statement> generateInvoke( Sym var, yokohama.unit.ast.ClassType classType, String methodName, List<yokohama.unit.ast.Type> argTypes, boolean isVararg, List<Sym> argVars, Optional<yokohama.unit.ast.Expr> receiver, Type returnType, Sym envVar, Span span) { Class<?> clazz = classType.toClass(classResolver); if (receiver.isPresent()) { // invokevirtual Sym receiverVar = genSym.generate("receiver"); Stream<Statement> getReceiver = translateExpr(receiver.get(), receiverVar, clazz, envVar); return Stream.concat(getReceiver, Stream.of(new VarInitStatement( returnType, var, new InvokeExpr( ClassType.of(classType, classResolver), receiverVar, methodName, Lists.mapInitAndLast( Type.listOf(argTypes, classResolver), type -> type, type -> isVararg ? type.toArray(): type), argVars, returnType), span))); } else { // invokestatic return Stream.of(new VarInitStatement( returnType, var, new InvokeStaticExpr( ClassType.of(classType, classResolver), Collections.emptyList(), methodName, Lists.mapInitAndLast( Type.listOf(argTypes, classResolver), type -> type, type -> isVararg ? type.toArray(): type), argVars, returnType), span)); } } Stream<Statement> generateInvokeVoid( yokohama.unit.ast.ClassType classType, String methodName, List<yokohama.unit.ast.Type> argTypes, boolean isVararg, List<Sym> argVars, Optional<yokohama.unit.ast.Expr> receiver, Sym envVar, Span span) { Class<?> clazz = classType.toClass(classResolver); if (receiver.isPresent()) { // invokevirtual Sym receiverVar = genSym.generate("receiver"); Stream<Statement> getReceiver = translateExpr(receiver.get(), receiverVar, clazz, envVar); return Stream.concat(getReceiver, Stream.of( new InvokeVoidStatement( ClassType.of(classType, classResolver), receiverVar, methodName, Lists.mapInitAndLast( Type.listOf(argTypes, classResolver), type -> type, type -> isVararg ? type.toArray(): type), argVars, span))); } else { // invokestatic return Stream.of( new InvokeStaticVoidStatement( ClassType.of(classType, classResolver), Collections.emptyList(), methodName, Lists.mapInitAndLast( Type.listOf(argTypes, classResolver), type -> type, type -> isVararg ? type.toArray(): type), argVars, span)); } } } @RequiredArgsConstructor class StreamCollector<T> { @Getter final Stream<T> stream; StreamCollector<T> append(Stream<T> stream_) { return new StreamCollector<>(Stream.concat(stream, stream_)); } StreamCollector<T> append(List<T> list) { return new StreamCollector<>(Stream.concat(stream, list.stream())); } StreamCollector<T> append(T element) { return new StreamCollector<>(Stream.concat(stream, Stream.of(element))); } public static <T> StreamCollector<T> empty() { return new StreamCollector<>(Stream.empty()); } }
package com.cedarsoftware.ncube; import org.junit.Test; import java.io.File; import java.io.FilenameFilter; import java.net.URL; import java.util.ArrayList; import java.util.List; import static org.junit.Assert.assertEquals; public class TestJsonFormatter { @Test public void testJsonFormatter() throws Exception { // when running a single test. //List<String> s = new ArrayList<String>(); //s.add("testEmptyColumnList.json"); List<String> s = getAllTestFiles(); runAllTests(s); } public List<String> getAllTestFiles() { URL u = getClass().getClassLoader().getResource(""); File dir = new File(u.getFile()); File[] files = dir.listFiles(new FilenameFilter() { // The *CubeError.json are files that have intentional parsing errors // testCubeList.json is an array of cubes and JsonFormatter only knows aboue one cube at a time. public boolean accept(File f, String s) { return s != null && s.endsWith(".json") && !(s.endsWith("idBasedCubeError.json") || s.endsWith("idBasedCubeError2.json") || s.endsWith("testCubeList.json")); } }); List<String> names = new ArrayList<String>(files.length); for (File f : files) { names.add(f.getName()); } return names; } public void runAllTests(List<String> strings) { for (String f : strings) { //System.out.println("Starting " + f); NCube ncube = NCubeManager.getNCubeFromResource(f); String s = ncube.toFormattedJson(); //System.out.println(s); NCube res = NCube.fromSimpleJson(s); assertEquals(res, ncube); } } }
package org.traccar.protocol; import static org.junit.Assert.assertNotNull; import static org.junit.Assert.assertNull; import org.junit.Test; public class TotemProtocolDecoderTest { @Test public void testDecode() throws Exception { TotemProtocolDecoder decoder = new TotemProtocolDecoder(null); decoder.setDataManager(new TestDataManager()); assertNull(decoder.decode(null, null, "$$BB862170017856731|AA$GPRMC,000000.00,V,0000.0000,N,00000.0000,E,000.0,000.0,000000,,,A*73|00.0|00.0|00.0|000000001000|20000000000000|13790000|00000000|00000000|00000000|0.0000|0007|8C23")); assertNotNull(decoder.decode(null, null, "$$B2359772032984289|AA$GPRMC,104446.000,A,5011.3944,N,01439.6637,E,0.00,,290212,,,A*7D|01.8|00.9|01.5|000000100000|20120229104446|14151221|00050000|046D085E|0000|0.0000|1170|29A7")); assertNotNull(decoder.decode(null, null, "$$8B862170017861566|AA180613080657|A|2237.1901|N|11402.1369|E|1.579|178|8.70|100000001000|13811|00000000|253162F5|00000000|0.0000|0014|2B16")); } }
package org.xwalk.core; import android.app.Activity; import android.content.Context; import android.content.Intent; import android.graphics.Rect; import android.util.AttributeSet; import android.view.ViewGroup; import android.webkit.WebSettings; import android.widget.FrameLayout; import org.xwalk.core.client.XWalkDefaultClient; import org.xwalk.core.client.XWalkDefaultDownloadListener; import org.xwalk.core.client.XWalkDefaultNavigationHandler; import org.xwalk.core.client.XWalkDefaultWebChromeClient; public class XWalkView extends FrameLayout { private XWalkContent mContent; private XWalkDevToolsServer mDevToolsServer; private Activity mActivity; private Context mContext; public XWalkView(Context context, Activity activity) { super(context, null); // Make sure mActivity is initialized before calling 'init' method. mActivity = activity; mContext = context; init(context, null); } public Activity getActivity() { if (mActivity != null) { return mActivity; } else if (getContext() instanceof Activity) { return (Activity)getContext(); } // Never achieve here. assert(false); return null; } public Context getViewContext() { return mContext; } /** * Constructors for inflating via XML. */ public XWalkView(Context context, AttributeSet attrs) { super(context, attrs); mContext = context; init(context, attrs); } private void init(Context context, AttributeSet attrs) { // Intialize library, paks and others. XWalkViewDelegate.init(context); initXWalkContent(context, attrs); } private void initXWalkContent(Context context, AttributeSet attrs) { mContent = new XWalkContent(context, attrs, this); addView(mContent, new FrameLayout.LayoutParams( FrameLayout.LayoutParams.MATCH_PARENT, FrameLayout.LayoutParams.MATCH_PARENT)); // Set default XWalkDefaultClient. setXWalkClient(new XWalkDefaultClient(context, this)); // Set default XWalkWebChromeClient and DownloadListener. The default actions // are provided via the following clients if special actions are not needed. setXWalkWebChromeClient(new XWalkDefaultWebChromeClient(context, this)); setDownloadListener(new XWalkDefaultDownloadListener(context)); setNavigationHandler(new XWalkDefaultNavigationHandler(context)); } public void loadUrl(String url) { mContent.loadUrl(url); } public void reload() { mContent.reload(); } public void addJavascriptInterface(Object object, String name) { mContent.addJavascriptInterface(object, name); } public String getUrl() { return mContent.getUrl(); } public String getTitle() { return mContent.getTitle(); } public void clearCache(boolean includeDiskFiles) { mContent.clearCache(includeDiskFiles); } public void clearHistory() { mContent.clearHistory(); } public boolean canGoBack() { return mContent.canGoBack(); } public void goBack() { mContent.goBack(); } public boolean canGoForward() { return mContent.canGoForward(); } public void goForward() { mContent.goForward(); } public boolean requestFocus(int direction, Rect previouslyFocusedRect) { return false; } public void setLayoutParams(ViewGroup.LayoutParams params) { super.setLayoutParams(params); } public XWalkSettings getSettings() { return mContent.getSettings(); } public String getOriginalUrl() { return mContent.getOriginalUrl(); } public void setNetworkAvailable(boolean networkUp) { } public void setInitialScale(int scaleInPercent) { } public void setXWalkWebChromeClient(XWalkWebChromeClient client) { mContent.setXWalkWebChromeClient(client); } public void setXWalkClient(XWalkClient client) { mContent.setXWalkClient(client); } public void stopLoading() { mContent.stopLoading(); } public void pauseTimers() { mContent.pauseTimers(); } public void resumeTimers() { mContent.resumeTimers(); } public void setDownloadListener(DownloadListener listener) { mContent.setDownloadListener(listener); } public void setNavigationHandler(XWalkNavigationHandler handler) { mContent.setNavigationHandler(handler); } // Enables remote debugging and returns the URL at which the dev tools server is listening // for commands. public String enableRemoteDebugging() { // Chrome looks for "devtools_remote" pattern in the name of a unix domain socket // to identify a debugging page final String socketName = getContext().getApplicationContext().getPackageName() + "_devtools_remote"; if (mDevToolsServer == null) { mDevToolsServer = new XWalkDevToolsServer(socketName); mDevToolsServer.setRemoteDebuggingEnabled(true); } // devtools/page is hardcoded in devtools_http_handler_impl.cc (kPageUrlPrefix) return "ws://" + socketName + "/devtools/page/" + mContent.devToolsAgentId(); } public void disableRemoteDebugging() { if (mDevToolsServer == null) return; if (mDevToolsServer.isRemoteDebuggingEnabled()) { mDevToolsServer.setRemoteDebuggingEnabled(false); } mDevToolsServer.destroy(); mDevToolsServer = null; } public void onPause() { mContent.onPause(); } public void onResume() { mContent.onResume(); } public void onDestroy() { disableRemoteDebugging(); } public void onActivityResult(int requestCode, int resultCode, Intent data) { mContent.onActivityResult(requestCode, resultCode, data); } public String getVersion() { return mContent.getVersion(); } // TODO(shouqun): requestFocusFromTouch, setVerticalScrollBarEnabled are // from android.view.View; // For instrumentation test. public XWalkContent getXWalkViewContentForTest() { return mContent; } }
package eco; public class popMethods { //public static int[] unfilledpops = new int[1000]; public static void scanPops(){ // System.out.println("efa"); int x = 0; int y = 0; while(Main.popArray.length > x){ if((Main.popArray[x].people < 100)&& (Main.popArray[x].isUsed == true )){ y= 100- Main.popArray[x].people; Main.unfilledpops[x] = y; // System.out.println(Main.popArray[x].isFarmer); // System.out.println(y); //System.out.println("Wdfe"); } x++; } } public static void unusedAcresFarmersAssignment(){ int x = 0; int y = 0; //int[][] unemployedfarmersArray = new int[1000][200];// put this is in main // System.out.println(x); while((Main.popArray.length > x) && (Main.unusedacres > 5)){ if((Main.popArray[x].acres < 500) && (Main.popArray[x].isFarmer == true) /*&& (Main.popArray[x].people*5 > acres/5)*/ && Main.popArray[x].isUsed == true ){ if(Main.unusedacres < 500){ y = Main.unusedacres; Main.unusedacres = 0; } else { y = 500; Main.unusedacres = Main.unusedacres - 500; } Main.popArray[x].acres = Main.popArray[x].acres + y; y = 0; //System.out.println("fsdf"); } x++; // System.out.println(x); } // System.out.println("efsf"); } public static void popAssigner(){ int x = 0; int y = 0; while(Main.popArray.length > x){ if((Main.popArray[x].people < 100)&&(Main.unusedpops > 0) && (Main.popArray[x].isUsed == true)) { //System.out.println("Kek"); y = Main.unfilledpops[x]; if(Main.unusedpops < y){ // System.out.println("Tres"); Main.popArray[x].people = Main.popArray[x].people + Main.unusedpops; Main.unusedpops = 0; } else { Main.unusedpops = Main.unusedpops - y; Main.popArray[x].people = Main.popArray[x].people + y;} Main.unfilledpops[x] = 0; y = 0; } x++; } } public static int farmertotal(){ int x = 0; int y = 0; while(Main.popArray.length > x) { if(Main.popArray[x].isFarmer == true) { y = y +Main.popArray[x].people; // System.out.println("kejk" +y); } x++; } return y; } public static int warriortotal() { int x = 0; int y = 0; while(Main.popArray.length > x) { if(Main.popArray[x].isWarrior == true) { y = y + Main.popArray[x].people; } x++; } return y; } public static int unemployedFarmerspops() { int x = 0; int y = 0; while(Main.popArray.length > x) { y = y +Main.popArray[x].unemployedfarmers; x++; } return y; } public static int employedFarmerspops() { int x = 0; int y = 0; while(Main.popArray.length > x){ y = y +Main.popArray[x].employedfarmers; x++; } return y; } public static int usedacres() { int x = 0; int y = 0; while(Main.popArray.length > x){ y = y +Main.popArray[x].acres; x++; } return y; } public static void consumecyclewarrior() { //food int x = 0; int y = 0; int p = 0; while(Main.popArray.length > x) { if(Main.popArray[x].isWarrior == true){ y = Warrior.wHunger(Main.popArray[x].people); Main.popArray[x].groupmoney = Main.popArray[x].groupmoney + (Main.wheatPrice*100); Main.uneatenwheat = Main.uneatenwheat - y; } x++; } } public static void farmerconsumecycle() { int x = 0; int y =0; int k = 0; int r = 0; int w = 0; int h = 0; int m =0; // System.out.println("here1"); while(Main.popArray.length > x){ if(Main.popArray[x].isFarmer == true){ y = Wheat.farmPacks(Main.popArray[x].acres); k = Wheat.unemployedFarmers(y, Main.popArray[x].people); r = Wheat.employedFarmers(Main.popArray[x].people,k); w = Wheat.tWheat(r); h = Farmer.fHunger(Main.popArray[x].people); m = Farmer.checkStarvation(h, w); if( m > 0){ w = 0; h = 0; Main.popArray[x].people = Main.popArray[x].people - m; } Main.uneatenwheat = Main.uneatenwheat + (w-h); Main.popArray[x].groupmoney = Main.popArray[x].groupmoney + (Main.wheatPrice*w); // System.out.println(Main.popArray[x].groupmoney+ "kel"); } x++; } } public static void popBuilder(int prefrence){ boolean iscomplete = false; int x = 0; int y = 0; int l = Main.unusedacres; int m = 0; int r = 0; boolean k = false; switch(prefrence){ case 1: while(Main.unusedpops > 0){ while(iscomplete == false){ // System.out.println("eke"); if(Main.unusedpops < 100){ r= Main.unusedpops; // System.out.println("yell"); } if(Main.unusedpops >= 100){ r = 100; } if(Main.unusedpops == 0){ iscomplete = true; } if(Main.unusedacres < 500){ m= Main.unusedacres; // Main.unusedacres = Main.unusedacres - m; } if(Main.unusedacres >= 500){ m = 500; // Main.unusedacres = 0; } Main.unusedacres = Main.unusedacres - m; Main.unusedpops = Main.unusedpops - r; Main.popArray[Main.unusedarray].isUsed = true; Main.popArray[Main.unusedarray].isFarmer = true; Main.popArray[Main.unusedarray].acres = m; Main.popArray[Main.unusedarray].people = r; Main.popArray[Main.unusedarray].groupmoney = 100; m = 0; r = 0; Main.unusedarray++; x++; if(x == 2){ iscomplete = true; // System.out.println(iscomplete); } //iscomplete =false; // x =0; } iscomplete =false; x =0; while(iscomplete == false){ // System.out.println("eke2"); if(Main.unusedpops < 100){ r= Main.unusedpops; // Main.unusedpops; = } if(Main.unusedpops >= 100){ r = 100; } if(Main.unusedpops == 0){ iscomplete = true; } Main.unusedpops = Main.unusedpops - r; Main.popArray[Main.unusedarray].isUsed = true; Main.popArray[Main.unusedarray].isWarrior = true; Main.popArray[Main.unusedarray].people = r; Main.popArray[Main.unusedarray].groupmoney = 100000; Main.unusedarray++; r =0; x++; if(x == 1){ iscomplete = true; } } } break; } } }
package com.clxcommunications.xms; import static com.github.tomakehurst.wiremock.client.WireMock.aResponse; import static com.github.tomakehurst.wiremock.client.WireMock.delete; import static com.github.tomakehurst.wiremock.client.WireMock.deleteRequestedFor; import static com.github.tomakehurst.wiremock.client.WireMock.equalTo; import static com.github.tomakehurst.wiremock.client.WireMock.equalToJson; import static com.github.tomakehurst.wiremock.client.WireMock.get; import static com.github.tomakehurst.wiremock.client.WireMock.getRequestedFor; import static com.github.tomakehurst.wiremock.client.WireMock.matching; import static com.github.tomakehurst.wiremock.client.WireMock.post; import static com.github.tomakehurst.wiremock.client.WireMock.postRequestedFor; import static com.github.tomakehurst.wiremock.client.WireMock.urlEqualTo; import static org.hamcrest.CoreMatchers.instanceOf; import static org.hamcrest.CoreMatchers.is; import static org.hamcrest.CoreMatchers.notNullValue; import static org.hamcrest.CoreMatchers.theInstance; import static org.junit.Assert.assertThat; import static org.junit.Assert.fail; import java.io.IOException; import java.io.InputStream; import java.util.Arrays; import java.util.Set; import java.util.TreeSet; import java.util.concurrent.CyclicBarrier; import java.util.concurrent.ExecutionException; import java.util.concurrent.Future; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicReference; import org.apache.http.concurrent.FutureCallback; import org.apache.http.entity.ContentType; import org.junit.Rule; import org.junit.Test; import org.threeten.bp.OffsetDateTime; import org.threeten.bp.ZoneOffset; import com.clxcommunications.testsupport.TestUtils; import com.clxcommunications.xms.api.ApiError; import com.clxcommunications.xms.api.BatchId; import com.clxcommunications.xms.api.MtBatchBinarySmsResult; import com.clxcommunications.xms.api.MtBatchBinarySmsResultImpl; import com.clxcommunications.xms.api.MtBatchBinarySmsUpdate; import com.clxcommunications.xms.api.MtBatchSmsResult; import com.clxcommunications.xms.api.MtBatchTextSmsCreate; import com.clxcommunications.xms.api.MtBatchTextSmsResult; import com.clxcommunications.xms.api.MtBatchTextSmsResultImpl; import com.clxcommunications.xms.api.MtBatchTextSmsUpdate; import com.clxcommunications.xms.api.Page; import com.clxcommunications.xms.api.PagedBatchResultImpl; import com.fasterxml.jackson.core.JsonParseException; import com.fasterxml.jackson.core.JsonProcessingException; import com.github.tomakehurst.wiremock.core.WireMockConfiguration; import com.github.tomakehurst.wiremock.junit.WireMockRule; import uk.org.lidalia.slf4jtest.TestLoggerFactoryResetRule; public class ApiConnectionIT { /** * A convenient {@link FutureCallback} for use in tests. By default all * callback methods will call {@link #fail(String)}. Override the one that * should succeed. * * @param <T> * the callback result type */ private static class TestCallback<T> implements FutureCallback<T> { @Override public void failed(Exception e) { fail("API call unexpectedly failed with '" + e.getMessage() + "'"); } @Override public void completed(T result) { fail("API call unexpectedly completed with '" + result + "'"); } @Override public void cancelled() { fail("API call unexpectedly cancelled"); } } private final ApiObjectMapper json = new ApiObjectMapper(); @Rule public WireMockRule wm = new WireMockRule( WireMockConfiguration.options() .dynamicPort() .dynamicHttpsPort()); @Rule public TestLoggerFactoryResetRule testLoggerFactoryResetRule = new TestLoggerFactoryResetRule(); @Test public void canPostSimpleBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); MtBatchTextSmsCreate sms = ClxApi.buildBatchTextSms() .from("12345") .addTo("123456789") .addTo("987654321") .body("Hello, world!") .build(); MtBatchTextSmsResult expectedResponse = MtBatchTextSmsResultImpl.builder() .from(sms.from()) .to(sms.to()) .body(sms.body()) .canceled(false) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String path = "/xms/v1/" + username + "/batches"; stubPostResponse(expectedResponse, path); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { MtBatchTextSmsResult result = conn.sendBatch(sms); assertThat(result, is(expectedResponse)); } finally { conn.close(); } verifyPostRequest(path, sms); } @Test public void canPostBatchWithSubstitutions() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); MtBatchTextSmsCreate sms = ClxApi.buildBatchTextSms() .from("12345") .addTo("123456789") .addTo("987654321") .body("Hello, ${name}!") .putParameter("name", ClxApi.buildSubstitution() .putSubstitution("123456789", "Jane") .defaultValue("world") .build()) .build(); MtBatchTextSmsResult expectedResponse = MtBatchTextSmsResultImpl.builder() .from(sms.from()) .to(sms.to()) .body(sms.body()) .parameters(sms.parameters()) .canceled(false) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String path = "/xms/v1/" + username + "/batches"; stubPostResponse(expectedResponse, path); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { MtBatchTextSmsResult result = conn.sendBatch(sms); assertThat(result, is(expectedResponse)); } finally { conn.close(); } verifyPostRequest(path, sms); } @Test(expected = ApiException.class) public void canHandleBatchPostWithError() throws Throwable { String username = TestUtils.freshUsername(); MtBatchTextSmsCreate sms = ClxApi.buildBatchTextSms() .from("12345") .addTo("123456789") .addTo("987654321") .body("Hello, world!") .build(); ApiError apiError = ApiError.of("syntax_constraint_violation", "The syntax constraint was violated"); String response = json.writeValueAsString(apiError); String path = "/xms/v1/" + username + "/batches"; wm.stubFor(post(urlEqualTo(path)) .willReturn(aResponse() .withStatus(400) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response))); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { conn.sendBatch(sms); fail("Expected exception, got none"); } catch (ApiException e) { assertThat(e.getCode(), is(apiError.code())); assertThat(e.getText(), is(apiError.text())); throw e; } finally { conn.close(); } } @Test(expected = JsonParseException.class) public void canHandleBatchPostWithInvalidJson() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); MtBatchTextSmsCreate sms = ClxApi.buildBatchTextSms() .from("12345") .addTo("123456789") .addTo("987654321") .body("Hello, world!") .build(); String response = String.join("\n", "{", " 'to': [", " '123456789',", " '987654321'", " ],", " 'body': 'Hello, world!',", " 'type' 'mt_text',", " 'canceled': false,", " 'id': '" + batchId.id() + "',", " 'from': '12345',", " 'created_at': '2016-10-02T09:34:28.542Z',", " 'modified_at': '2016-10-02T09:34:28.542Z'", "}").replace('\'', '"'); String path = "/xms/v1/" + username + "/batches"; wm.stubFor(post(urlEqualTo(path)) .willReturn(aResponse() .withStatus(400) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response))); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { conn.sendBatch(sms); fail("Expected exception, got none"); } finally { conn.close(); } } @Test public void canUpdateSimpleTextBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); MtBatchTextSmsUpdate sms = ClxApi.buildBatchTextSmsUpdate() .from("12345") .body("Hello, world!") .unsetDeliveryReport() .unsetExpireAt() .build(); MtBatchTextSmsResult expectedResponse = MtBatchTextSmsResultImpl.builder() .from(sms.from()) .addTo("123") .body(sms.body()) .canceled(false) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String path = "/xms/v1/" + username + "/batches/" + batchId.id(); stubPostResponse(expectedResponse, path); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { MtBatchTextSmsResult result = conn.updateBatchAsync(batchId, sms, null).get(); assertThat(result, is(expectedResponse)); } finally { conn.close(); } verifyPostRequest(path, sms); } @Test public void canUpdateSimpleBinaryBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); Set<String> tags = new TreeSet<String>(); tags.add("tag1"); tags.add("tag2"); MtBatchBinarySmsUpdate sms = ClxApi.buildBatchBinarySmsUpdate() .from("12345") .body("howdy".getBytes(TestUtils.US_ASCII)) .unsetExpireAt() .build(); MtBatchBinarySmsResult expectedResponse = MtBatchBinarySmsResultImpl.builder() .from(sms.from()) .addTo("123") .body(sms.body()) .udh((byte) 1, (byte) 0xff) .canceled(false) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String path = "/xms/v1/" + username + "/batches/" + batchId.id(); stubPostResponse(expectedResponse, path); ApiConnection conn = ApiConnection.builder() .username(username) .token("toktok") .endpointHost("localhost", wm.port(), "http") .start(); try { MtBatchBinarySmsResult result = conn.updateBatchAsync(batchId, sms, null).get(); assertThat(result, is(expectedResponse)); } finally { conn.close(); } verifyPostRequest(path, sms); } @Test public void canFetchBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); String path = "/xms/v1/" + username + "/batches/" + batchId.id(); final MtBatchTextSmsResult expected = MtBatchTextSmsResultImpl.builder() .from("12345") .addTo("123456789", "987654321") .body("Hello, world!") .canceled(false) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String response = json.writeValueAsString(expected); wm.stubFor(get( urlEqualTo(path)) .willReturn(aResponse() .withStatus(200) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response))); ApiConnection conn = ApiConnection.builder() .username(username) .token("tok") .endpointHost("localhost", wm.port(), "http") .start(); try { FutureCallback<MtBatchTextSmsResult> testCallback = new TestCallback<MtBatchTextSmsResult>() { @Override public void completed(MtBatchTextSmsResult result) { assertThat(result, is(expected)); } }; MtBatchTextSmsResult result = conn.fetchBatch(batchId, testCallback).get(); assertThat(result, is(expected)); } finally { conn.close(); } wm.verify(getRequestedFor( urlEqualTo(path)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); } @Test public void canHandle404WhenFetchingBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); String path = "/xms/v1/" + username + "/batches/" + batchId.id(); wm.stubFor(get( urlEqualTo(path)) .willReturn(aResponse() .withStatus(404) .withHeader("Content-Type", ContentType.TEXT_PLAIN.toString()) .withBody("BAD"))); ApiConnection conn = ApiConnection.builder() .username(username) .token("tok") .endpointHost("localhost", wm.port(), "http") .start(); /* * The exception we'll receive in the callback. Need to store it to * verify that it is the same exception as received from #get(). */ final AtomicReference<Exception> failException = new AtomicReference<Exception>(); try { /* * Used to make sure callback and test thread are agreeing about the * failException variable. */ final CyclicBarrier barrier = new CyclicBarrier(2); FutureCallback<MtBatchTextSmsResult> testCallback = new TestCallback<MtBatchTextSmsResult>() { @Override public void failed(Exception exception) { if (!failException.compareAndSet(null, exception)) { fail("failed called multiple times"); } try { barrier.await(); } catch (Exception e) { throw new RuntimeException(e); } } }; Future<MtBatchTextSmsResult> future = conn.fetchBatch(batchId, testCallback); // Give plenty of time for the callback to be called. barrier.await(1, TimeUnit.SECONDS); future.get(); fail("unexpected future get success"); } catch (ExecutionException executionException) { /* * The exception cause should be the same as we received in the * callback. */ assertThat(failException.get(), is(theInstance(executionException.getCause()))); assertThat(executionException.getCause(), is(instanceOf(UnexpectedResponseException.class))); UnexpectedResponseException ure = (UnexpectedResponseException) executionException.getCause(); assertThat(ure.getResponse(), notNullValue()); assertThat(ure.getResponse().getStatusLine() .getStatusCode(), is(404)); assertThat( ure.getResponse().getEntity().getContentType().getValue(), is(ContentType.TEXT_PLAIN.toString())); byte[] buf = new byte[100]; int read; InputStream contentStream = null; try { contentStream = ure.getResponse().getEntity().getContent(); read = contentStream.read(buf); } catch (IOException ioe) { throw new AssertionError( "unexpected exception: " + ioe.getMessage(), ioe); } finally { if (contentStream != null) { try { contentStream.close(); } catch (IOException ioe) { throw new AssertionError( "unexpected exception: " + ioe.getMessage(), ioe); } } } assertThat(read, is(3)); assertThat(Arrays.copyOf(buf, 3), is(new byte[] { 'B', 'A', 'D' })); } finally { conn.close(); } wm.verify(getRequestedFor( urlEqualTo(path)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); } @Test public void canCancelBatch() throws Throwable { String username = TestUtils.freshUsername(); BatchId batchId = TestUtils.freshBatchId(); OffsetDateTime smsTime = OffsetDateTime.of(2016, 10, 2, 9, 34, 28, 542000000, ZoneOffset.UTC); String path = "/xms/v1/" + username + "/batches/" + batchId.id(); MtBatchTextSmsResult expected = MtBatchTextSmsResultImpl.builder() .from("12345") .addTo("123456789", "987654321") .body("Hello, world!") .canceled(true) .id(batchId) .createdAt(smsTime) .modifiedAt(smsTime) .build(); String response = json.writeValueAsString(expected); wm.stubFor(delete( urlEqualTo(path)) .willReturn(aResponse() .withStatus(200) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response))); ApiConnection conn = ApiConnection.builder() .username(username) .token("tok") .endpointHost("localhost", wm.port(), "http") .start(); try { MtBatchTextSmsResult result = conn.cancelBatch(batchId).get(); assertThat(result, is(expected)); } finally { conn.close(); } wm.verify(deleteRequestedFor( urlEqualTo(path)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); } @Test public void canListBatchesWithEmpty() throws Exception { String username = TestUtils.freshUsername(); String path = "/xms/v1/" + username + "/batches?page=0"; BatchFilter filter = BatchFilterImpl.builder().build(); final Page<MtBatchSmsResult> expected = PagedBatchResultImpl.builder() .page(0) .size(0) .numPages(0) .build(); String response = json.writeValueAsString(expected); wm.stubFor(get( urlEqualTo(path)) .willReturn(aResponse() .withStatus(200) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response))); ApiConnection conn = ApiConnection.builder() .username(username) .token("tok") .endpointHost("localhost", wm.port(), "http") .start(); try { FutureCallback<Page<MtBatchSmsResult>> testCallback = new TestCallback<Page<MtBatchSmsResult>>() { @Override public void completed(Page<MtBatchSmsResult> result) { assertThat(result, is(expected)); } }; PagedFetcher<MtBatchSmsResult> fetcher = conn.fetchBatches(filter, testCallback); Page<MtBatchSmsResult> result = fetcher.fetchAsync(0, testCallback).get(); assertThat(result, is(expected)); } finally { conn.close(); } wm.verify(getRequestedFor( urlEqualTo(path)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); } @Test public void canListBatchesWithTwoPages() throws Exception { String username = TestUtils.freshUsername(); BatchFilter filter = BatchFilterImpl.builder().build(); // Prepare first page. String path1 = "/xms/v1/" + username + "/batches?page=0"; final Page<MtBatchSmsResult> expected1 = PagedBatchResultImpl.builder() .page(0) .size(0) .numPages(2) .build(); String response1 = json.writeValueAsString(expected1); wm.stubFor(get( urlEqualTo(path1)) .willReturn(aResponse() .withStatus(200) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response1))); // Prepare second page. String path2 = "/xms/v1/" + username + "/batches?page=1"; final Page<MtBatchSmsResult> expected2 = PagedBatchResultImpl.builder() .page(1) .size(0) .numPages(2) .build(); String response2 = json.writeValueAsString(expected2); wm.stubFor(get( urlEqualTo(path2)) .willReturn(aResponse() .withStatus(200) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(response2))); ApiConnection conn = ApiConnection.builder() .username(username) .token("tok") .endpointHost("localhost", wm.port(), "http") .start(); try { FutureCallback<Page<MtBatchSmsResult>> testCallback = new TestCallback<Page<MtBatchSmsResult>>() { @Override public void completed(Page<MtBatchSmsResult> result) { switch (result.page()) { case 0: assertThat(result, is(expected1)); break; case 1: assertThat(result, is(expected2)); break; default: fail("unexpected page: " + result); } } }; PagedFetcher<MtBatchSmsResult> fetcher = conn.fetchBatches(filter, testCallback); Page<MtBatchSmsResult> actual1 = fetcher.fetchAsync(0, testCallback).get(); assertThat(actual1, is(expected1)); Page<MtBatchSmsResult> actual2 = fetcher.fetchAsync(1, testCallback).get(); assertThat(actual2, is(expected2)); } finally { conn.close(); } wm.verify(getRequestedFor( urlEqualTo(path1)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); wm.verify(getRequestedFor( urlEqualTo(path2)) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer tok"))); } /** * Helper that sets up WireMock to respond using a JSON body. * * @param response * the response to give, serialized to JSON * @param path * the path on which to listen * @throws JsonProcessingException * if the given response object could not be serialized */ private void stubPostResponse(Object response, String path) throws JsonProcessingException { byte[] body = json.writeValueAsBytes(response); wm.stubFor(post(urlEqualTo(path)) .willReturn(aResponse() .withStatus(201) .withHeader("Content-Type", "application/json; charset=UTF-8") .withBody(body))); } /** * Helper that sets up WireMock to verify that a request matches a given * object in JSON format. * * @param path * the request path to match * @param request * the request object whose JSON serialization should match * @throws JsonProcessingException * if the given request object could not be serialized */ private void verifyPostRequest(String path, Object request) throws JsonProcessingException { String expectedRequest = json.writeValueAsString(request); wm.verify(postRequestedFor( urlEqualTo(path)) .withRequestBody(equalToJson(expectedRequest)) .withHeader("Content-Type", matching("application/json; charset=UTF-8")) .withHeader("Accept", equalTo("application/json; charset=UTF-8")) .withHeader("Authorization", equalTo("Bearer toktok"))); } }
package com.github.arteam.jgcompare; import com.google.common.collect.ImmutableList; import com.google.common.collect.Iterables; import com.google.common.collect.Lists; import org.junit.Test; import java.util.ArrayList; import java.util.Arrays; import java.util.Iterator; import java.util.List; import java.util.function.BiConsumer; import java.util.function.Predicate; import java.util.function.Supplier; import java.util.stream.Collectors; import java.util.stream.IntStream; import java.util.stream.Stream; import static org.assertj.core.api.Assertions.*; import static org.assertj.core.api.Assertions.assertThat; public class IterablesTest { Iterable<String> source = Lists.newArrayList("as", "q", "def"); Stream<String> stream = Stream.of("as", "q", "def"); @Test public void testAll() { assertThat(Iterables.all(source, it -> !it.isEmpty())).isTrue(); assertThat(stream.allMatch(it -> !it.isEmpty())).isTrue(); } @Test public void testAny() { assertThat(Iterables.any(source, it -> it.length() > 2)).isTrue(); assertThat(stream.anyMatch(it -> it.length() > 2)).isTrue(); } @Test public void testConcat() { List<String> addition = ImmutableList.of("ger", "d", "fm"); List<String> result = ImmutableList.of("as", "q", "def", "ger", "d", "fm"); assertThat(ImmutableList.copyOf(Iterables.concat(source, addition))).isEqualTo(result); assertThat(Stream.concat(stream, addition.stream()).collect(Collectors.toList())).isEqualTo(result); } @Test public void testContains() { assertThat(Iterables.contains(source, "q")).isTrue(); assertThat(stream.anyMatch(s -> s.equals("q"))).isTrue(); } @Test public void testCycle() { ImmutableList<String> expected = ImmutableList.of("as", "q", "def", "as", "q", "def", "as", "q", "def", "as"); Iterator<String> iterator = Iterables.cycle(source).iterator(); List<String> cycled = Lists.newArrayList(); for (int i = 0; i < 10; i++) { cycled.add(iterator.next()); } assertThat(expected).isEqualTo(cycled); String[] streamAsArray = stream.toArray(String[]::new); assertThat(expected).isEqualTo(IntStream.iterate(0, i -> (i + 1) % 3) .mapToObj(i -> streamAsArray[i]) .limit(10) .collect(Collectors.toList())); } @Test public void testFilter() { Iterable<String> result = Iterables.filter(Iterables.filter(source, s -> s.length() > 1), s -> s.startsWith("d")); assertThat(ImmutableList.copyOf(result)).isEqualTo(ImmutableList.of("def")); assertThat(stream .filter(s -> s.length() > 1) .filter(s -> s.startsWith("d")) .collect(Collectors.toList())).isEqualTo(ImmutableList.of("def")); } @Test public void testFind() { assertThat(Iterables.find(source, it -> it.length() == 1)).isEqualTo("q"); assertThat(stream.filter(it -> it.length() == 1).findAny().get()).isEqualTo("q"); } @Test public void testFindDefaultValue() { assertThat(Iterables.find(source, it -> it.length() == 4, "abcd")).isEqualTo("abcd"); assertThat(stream.filter(it -> it.length() == 4).findAny().orElse("abcd")).isEqualTo("abcd"); } @Test public void testFrequency() { List<String> source = ImmutableList.<String>builder() .addAll(this.source) .add("def") .add("try") .add("q") .add("def") .build(); Stream<String> stream = source.stream(); assertThat(Iterables.frequency(source, "def")).isEqualTo(3); assertThat(stream .filter(s -> s.equals("def")) .count()).isEqualTo(3); } @Test public void testGetFirst() { assertThat(Iterables.getFirst(source, "")).isEqualTo("as"); assertThat(stream.findFirst().orElse("")).isEqualTo("as"); } @Test public void testGetLast() { assertThat(Iterables.getLast(source, "")).isEqualTo("def"); assertThat(stream.reduce((l, r) -> r).get()).isEqualTo("def"); } @Test public void testGetOnlyElement() { assertThat(Iterables.getOnlyElement(Iterables.filter(source, s -> s.length() == 3))).isEqualTo("def"); assertThat(stream.filter(s -> s.length() == 3).findFirst().get()).isEqualTo("def"); } @Test public void testGetOnlyElementWithDefault() { assertThat(Iterables.getOnlyElement(Iterables.filter(source, s -> s.length() == 4), "mann")).isEqualTo("mann"); assertThat(stream.filter(s -> s.length() == 4).findFirst().orElse("mann")).isEqualTo("mann"); } @Test public void testIndexOf() { assertThat(Iterables.indexOf(source, it -> it.length() == 1)).isEqualTo(1); // Rather tricky way assertThat(StreamUtils.withIndex(stream) .filter(e -> e.getElement().length() == 1) .map(e -> e.getIndex()) .findFirst() .get()) .isEqualTo(1); } @Test public void testIsEmpty() { assertThat(Iterables.isEmpty(source)).isEqualTo(false); assertThat(stream.noneMatch(s -> true)).isEqualTo(false); } @Test public void testLimit() { assertThat(Lists.newArrayList(Iterables.limit(source, 2))).isEqualTo(Arrays.asList("as", "q")); assertThat(stream.limit(2).collect(Collectors.toList())).isEqualTo(Arrays.asList("as", "q")); } @Test @SuppressWarnings("unchecked") public void testPartition() { List<String> source = ImmutableList.of("trash", "talk", "arg", "loose", "fade", "cross", "dump", "bust"); assertThat(Iterables.partition(source, 3)).containsExactly( ImmutableList.of("trash", "talk", "arg"), ImmutableList.of("loose", "fade", "cross"), ImmutableList.of("dump", "bust")); int partitionSize = 3; List<List<String>> partitions = StreamUtils.withIndex(source.stream()) .collect(ArrayList::new, (lists, el) -> { int place = el.getIndex() % partitionSize; List<String> part; if (place == 0) { part = new ArrayList<>(); lists.add(part); } else { part = lists.get(lists.size() - 1); } part.add(el.getElement()); }, ArrayList::addAll); assertThat(partitions).containsExactly( ImmutableList.of("trash", "talk", "arg"), ImmutableList.of("loose", "fade", "cross"), ImmutableList.of("dump", "bust")); } @Test public void testRemoveAll() { List<String> removed = ImmutableList.of("q", "d"); Iterables.removeAll(source, removed); assertThat(source).containsExactly("as", "def"); assertThat(stream.filter(s -> !removed.contains(s)) .collect(Collectors.toList())).containsExactly("as", "def"); } @Test public void testRemoveIf() { Iterables.removeIf(source, it -> it.length() < 3); assertThat(Arrays.asList("def")).isEqualTo(source); List<String> removed = stream .filter(((Predicate<String>) it -> it.length() < 3).negate()) .collect(Collectors.toList()); assertThat(Arrays.asList("def")).isEqualTo(removed); } @Test public void testRetainAll() { List<String> removed = ImmutableList.of("q", "d"); Iterables.retainAll(source, removed); assertThat(source).containsExactly("q"); assertThat(stream.filter(s -> removed.contains(s)) .collect(Collectors.toList())).containsExactly("q"); } @Test public void testTransform() { assertThat(Lists.newArrayList(Iterables.transform(source, String::length))).isEqualTo(Arrays.asList(2, 1, 3)); assertThat(stream.map(String::length).collect(Collectors.toList())).isEqualTo(Arrays.asList(2, 1, 3)); } @Test public void testTryFind() { assertThat(Iterables.tryFind(source, it -> it.length() == 4).or("abcd")).isEqualTo("abcd"); assertThat(stream.filter(it -> it.length() == 4).findAny().orElse("abcd")).isEqualTo("abcd"); } @Test public void testSkip() { assertThat(Lists.newArrayList(Iterables.skip(source, 2))).isEqualTo(Arrays.asList("def")); assertThat(stream.skip(2).collect(Collectors.toList())).isEqualTo(Arrays.asList("def")); } }
package com.oltruong.teamag.rest; import com.oltruong.teamag.model.Member; import com.oltruong.teamag.model.Task; import com.oltruong.teamag.model.builder.EntityFactory; import com.oltruong.teamag.model.enumeration.MemberType; import com.oltruong.teamag.service.MemberService; import com.oltruong.teamag.service.TaskService; import com.oltruong.teamag.transformer.TaskWebBeanTransformer; import com.oltruong.teamag.utils.TestUtils; import com.oltruong.teamag.webbean.TaskWebBean; import org.joda.time.DateTime; import org.junit.Before; import org.junit.Test; import org.mockito.Mock; import org.slf4j.Logger; import java.util.List; import java.util.function.Supplier; import javax.persistence.EntityExistsException; import javax.persistence.EntityNotFoundException; import javax.ws.rs.core.Response; import static org.assertj.core.api.Assertions.assertThat; import static org.mockito.Matchers.any; import static org.mockito.Matchers.anyLong; import static org.mockito.Matchers.anyString; import static org.mockito.Matchers.eq; import static org.mockito.Matchers.isA; import static org.mockito.Mockito.atLeastOnce; import static org.mockito.Mockito.doThrow; import static org.mockito.Mockito.never; import static org.mockito.Mockito.verify; import static org.mockito.Mockito.when; public class TaskEndPointTest extends AbstractEndPointTest { @Mock private TaskService mockTaskService; @Mock private MemberService mockMemberService; @Mock private Logger mockLogger; private TaskEndPoint taskEndPoint; private Task task; @Before public void prepare() { super.setup(); taskEndPoint = new TaskEndPoint(); TestUtils.setPrivateAttribute(taskEndPoint, mockTaskService, "taskService"); TestUtils.setPrivateAttribute(taskEndPoint, mockMemberService, "memberService"); TestUtils.setPrivateAttribute(taskEndPoint, AbstractEndPoint.class, mockLogger, "LOGGER"); TestUtils.setPrivateAttribute(taskEndPoint, mockLogger, "LOGGER"); TestUtils.setPrivateAttribute(taskEndPoint, AbstractEndPoint.class, mockUriInfo, "uriInfo"); task = EntityFactory.createTask(); when(mockTaskService.persist(eq(task))).thenReturn(task); assertThat(taskEndPoint.getService()).isEqualTo(mockTaskService); } @Test public void getTasks() throws Exception { testFindTasks(mockTaskService::findAll, taskEndPoint::getAll); verify(mockTaskService, atLeastOnce()).findAll(); } @Test public void getTasksWithActivity() throws Exception { testFindTasks(mockTaskService::findTaskWithActivity, taskEndPoint::getTasksWithActivity); verify(mockTaskService, atLeastOnce()).findTaskWithActivity(); } private void testFindTasks(Supplier<List<Task>> taskListSupplier, Supplier<Response> responseSupplier) { List<Task> taskList = EntityFactory.createList(EntityFactory::createTask); Task parentTask = EntityFactory.createTask(); parentTask.setId(EntityFactory.createRandomLong()); taskList.forEach(task -> task.setTask(parentTask)); when(taskListSupplier.get()).thenReturn(taskList); Response response = responseSupplier.get(); checkResponseOK(response); List<TaskWebBean> taskListReturned = (List<TaskWebBean>) response.getEntity(); assertThat(taskListReturned).hasSameSizeAs(taskList); } @Test public void get() throws Exception { when(mockTaskService.find(any())).thenReturn(task); Response response = taskEndPoint.getSingle(randomId); checkResponseOK(response); TaskWebBean taskReturned = (TaskWebBean) response.getEntity(); assertThat(taskReturned).isEqualToComparingFieldByField(TaskWebBeanTransformer.transformTask(task)); verify(mockTaskService).find(eq(randomId)); } @Test public void create() throws Exception { task.setId(randomId); Response response = taskEndPoint.create(task); checkResponseCreated(response); verify(mockTaskService).persist(eq(task)); } @Test public void createWithParamsNull() throws Exception { task.setId(randomId); createWithParams(null, null); } @Test public void createWithParamsYearNull() throws Exception { task.setId(randomId); createWithParams(10, null); } @Test public void createWithParamsMonthNull() throws Exception { task.setId(randomId); createWithParams(null, 2016); } private void createWithParams(Integer month, Integer year) { Response response = taskEndPoint.create(null, month, year, task); checkResponseCreated(response); verify(mockTaskService).persist(eq(task)); } @Test public void createWithParams() throws Exception { task.setId(randomId); Task taskCreated = EntityFactory.createTask(); taskCreated.setId(randomId); when(mockTaskService.persist(any(DateTime.class), any(Member.class), eq(task))).thenReturn(taskCreated); Response response = taskEndPoint.create(randomId, 9, 2015, task); checkResponseCreated(response); } @Test public void createWithParamsException() throws Exception { task.setId(randomId); when(mockTaskService.persist(any(DateTime.class), any(Member.class), eq(task))).thenThrow(new EntityExistsException()); Response response = taskEndPoint.create(randomId, 9, 2015, task); checkResponseBadRequest(response); } @Test public void create_existing() throws Exception { task.setId(randomId); doThrow(new EntityExistsException()).when(mockTaskService).persist(eq(task)); Response response = taskEndPoint.create(task); checkResponseNotAcceptable(response); verify(mockTaskService).persist(eq(task)); verify(mockLogger).warn(anyString(), isA(EntityExistsException.class)); } @Test public void deleteWithParamsNull() throws Exception { task.setId(randomId); deleteWithParams(null, null); } @Test public void deleteWithParamsYearNull() throws Exception { task.setId(randomId); deleteWithParams(10, null); } @Test public void deleteWithParamsMonthNull() throws Exception { task.setId(randomId); deleteWithParams(null, 2016); } private void deleteWithParams(Integer month, Integer year) { Member member = EntityFactory.createMember(); member.setMemberType(MemberType.ADMINISTRATOR); when(mockMemberService.find(randomId)).thenReturn(member); Response response = taskEndPoint.delete(randomId, randomId, month, year); checkResponseNoContent(response); verify(mockTaskService).remove(eq(randomId)); } @Test public void deleteWithParamsForbidden() { Member member = EntityFactory.createMember(); member.setMemberType(MemberType.BASIC); when(mockMemberService.find(randomId)).thenReturn(member); Response response = taskEndPoint.delete(randomId, randomId, null, null); checkResponseForbidden(response); verify(mockTaskService, never()).remove(eq(randomId)); } @Test public void deleteWithParams() throws Exception { task.setId(randomId); Task taskCreated = EntityFactory.createTask(); taskCreated.setId(randomId); when(mockTaskService.persist(any(DateTime.class), any(Member.class), eq(task))).thenReturn(taskCreated); Response response = taskEndPoint.delete(randomId, randomId, 9, 2015); checkResponseNoContent(response); verify(mockTaskService).remove(eq(randomId), eq(randomId), isA(DateTime.class)); } @Test public void updateTask() throws Exception { Task task = EntityFactory.createTask(); assertThat(task.getId()).isNull(); Response response = taskEndPoint.updateTask(randomId, task); checkResponseOK(response); assertThat(task.getId()).isEqualTo(randomId); verify(mockTaskService).merge(eq(task)); } @Test public void delete() throws Exception { Response response = taskEndPoint.delete(randomId); checkResponseNoContent(response); verify(mockTaskService).remove(eq(randomId)); } @Test public void deleteNotFound() throws Exception { doThrow(new EntityNotFoundException()).when(mockTaskService).remove(anyLong()); Response response = taskEndPoint.delete(randomId); checkResponseNotFound(response); verify(mockTaskService).remove(eq(randomId)); } }
// checkstyle: Checks Java source code for adherence to a set of rules. // This library is free software; you can redistribute it and/or // modify it under the terms of the GNU Lesser General Public // This library is distributed in the hope that it will be useful, // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // You should have received a copy of the GNU Lesser General Public // Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA package com.puppycrawl.tools.checkstyle; import static com.puppycrawl.tools.checkstyle.TestUtils.assertUtilsClassHasPrivateConstructor; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertSame; import static org.junit.Assert.assertTrue; import static org.junit.Assert.fail; import java.io.Closeable; import java.io.File; import java.io.IOException; import java.lang.reflect.Constructor; import java.lang.reflect.Field; import java.lang.reflect.Modifier; import java.util.Dictionary; import org.apache.commons.beanutils.ConversionException; import org.junit.Test; import com.puppycrawl.tools.checkstyle.api.TokenTypes; public class UtilsTest { /** After appending to path produces equivalent, but denormalized path */ private static final String PATH_DENORMALIZER = "/levelDown/.././"; /** * Test Utils.countCharInString. */ @Test public void testLengthExpandedTabs() throws Exception { final String s1 = "\t"; assertEquals(8, Utils.lengthExpandedTabs(s1, s1.length(), 8)); final String s2 = " \t"; assertEquals(8, Utils.lengthExpandedTabs(s2, s2.length(), 8)); final String s3 = "\t\t"; assertEquals(16, Utils.lengthExpandedTabs(s3, s3.length(), 8)); final String s4 = " \t "; assertEquals(9, Utils.lengthExpandedTabs(s4, s4.length(), 8)); assertEquals(0, Utils.lengthMinusTrailingWhitespace("")); assertEquals(0, Utils.lengthMinusTrailingWhitespace(" \t ")); assertEquals(3, Utils.lengthMinusTrailingWhitespace(" 23")); assertEquals(3, Utils.lengthMinusTrailingWhitespace(" 23 \t ")); } @Test(expected = ConversionException.class) public void testBadRegex() { Utils.createPattern("["); } @Test public void testFileExtensions() { final String[] fileExtensions = {"java"}; File file = new File("file.pdf"); assertFalse(Utils.fileExtensionMatches(file, fileExtensions)); assertTrue(Utils.fileExtensionMatches(file, (String[]) null)); file = new File("file.java"); assertTrue(Utils.fileExtensionMatches(file, fileExtensions)); file = new File("file."); assertTrue(Utils.fileExtensionMatches(file, "")); } @Test public void testBaseClassnameForCanonicalName() { assertEquals("List", Utils.baseClassname("java.util.List")); } @Test public void testBaseClassnameForSimpleName() { assertEquals("Set", Utils.baseClassname("Set")); } @Test public void testRelativeNormalizedPath() { final String relativePath = Utils.relativizeAndNormalizePath("/home", "/home/test"); assertEquals("test", relativePath); } @Test public void testRelativeNormalizedPathWithNullBaseDirectory() { final String relativePath = Utils.relativizeAndNormalizePath(null, "/tmp"); assertEquals("/tmp", relativePath); } @Test public void testRelativeNormalizedPathWithDenormalizedBaseDirectory() throws IOException { final String sampleAbsolutePath = new File("src/main/java").getCanonicalPath(); final String absoluteFilePath = sampleAbsolutePath + "/SampleFile.java"; final String basePath = sampleAbsolutePath + PATH_DENORMALIZER; final String relativePath = Utils.relativizeAndNormalizePath(basePath, absoluteFilePath); assertEquals("SampleFile.java", relativePath); } @Test public void testIsProperUtilsClass() throws ReflectiveOperationException { assertUtilsClassHasPrivateConstructor(Utils.class); } @Test public void testInvalidPattern() { boolean result = Utils.isPatternValid("some[invalidPattern"); assertFalse(result); } @Test public void testGetExistingConstructor() throws NoSuchMethodException { Constructor<?> constructor = Utils.getConstructor(String.class, String.class); assertEquals(String.class.getConstructor(String.class), constructor); } @Test public void testGetNonExistingConstructor() throws NoSuchMethodException { try { Utils.getConstructor(Math.class); fail(); } catch (IllegalStateException expected) { assertSame(NoSuchMethodException.class, expected.getCause().getClass()); } } @Test public void testInvokeConstructor() throws NoSuchMethodException { Constructor<String> constructor = String.class.getConstructor(String.class); String constructedString = Utils.invokeConstructor(constructor, "string"); assertEquals("string", constructedString); } @SuppressWarnings("rawtypes") @Test public void testInvokeConstructorThatFails() throws NoSuchMethodException { Constructor<Dictionary> constructor = Dictionary.class.getConstructor(); try { Utils.invokeConstructor(constructor); fail(); } catch (IllegalStateException expected) { assertSame(InstantiationException.class, expected.getCause().getClass()); } } @Test public void testGetIntFromAccessibleField() throws NoSuchFieldException { Field field = Integer.class.getField("MAX_VALUE"); assertEquals(Integer.MAX_VALUE, Utils.getIntFromField(field, 0)); } @Test public void testGetIntFromInaccessibleField() throws NoSuchFieldException { Field field = Integer.class.getDeclaredField("value"); try { Utils.getIntFromField(field, 0); } catch (IllegalStateException expected) { // expected } } @Test public void testTokenValueIncorrect() throws NoSuchMethodException { Integer id = Integer.MAX_VALUE - 1; try { Utils.getTokenName(id); fail(); } catch (IllegalArgumentException expected) { assertEquals("given id " + id, expected.getMessage()); } } @Test public void testTokenValueIncorrect2() throws NoSuchMethodException, IllegalAccessException { Integer id = 0; String[] originalValue = null; Field fieldToken = null; try { // overwrite static field with new value Field[] fields = Utils.class.getDeclaredFields(); for (Field field : fields) { field.setAccessible(true); if ("TOKEN_VALUE_TO_NAME".equals(field.getName())) { fieldToken = field; Field modifiersField = Field.class.getDeclaredField("modifiers"); modifiersField.setAccessible(true); modifiersField.setInt(field, field.getModifiers() & ~Modifier.FINAL); originalValue = (String[]) field.get(null); field.set(null, new String[] {null}); } } Utils.getTokenName(id); fail(); } catch (IllegalArgumentException expected) { // restoring original value, to let other tests pass fieldToken.set(null, originalValue); assertEquals("given id " + id, expected.getMessage()); } catch (IllegalAccessException e) { fail(); } catch (NoSuchFieldException e) { fail(); } } @Test public void testTokenIdIncorrect() throws NoSuchMethodException { String id = "NON_EXISTING_VALUE"; try { Utils.getTokenId(id); fail(); } catch (IllegalArgumentException expected) { assertEquals("given name " + id, expected.getMessage()); } } @Test public void testShortDescriptionIncorrect() throws NoSuchMethodException { String id = "NON_EXISTING_VALUE"; try { Utils.getShortDescription(id); fail(); } catch (IllegalArgumentException expected) { assertEquals("given name " + id, expected.getMessage()); } } @Test public void testIsCommentType() throws NoSuchMethodException { assertTrue(Utils.isCommentType(TokenTypes.SINGLE_LINE_COMMENT)); assertTrue(Utils.isCommentType(TokenTypes.BLOCK_COMMENT_BEGIN)); assertTrue(Utils.isCommentType(TokenTypes.BLOCK_COMMENT_END)); assertTrue(Utils.isCommentType(TokenTypes.COMMENT_CONTENT)); } @Test public void testClose() { Utils.close(null); Utils.close(new Closeable() { @Override public void close() throws IOException { } }); } @Test(expected = IllegalStateException.class) public void testCloseWithException() { Utils.close(new Closeable() { @Override public void close() throws IOException { throw new IOException(); } }); } }
package edu.hm.hafner.analysis; import java.io.File; import java.io.FileNotFoundException; import java.io.IOException; import java.io.InputStream; import java.nio.file.Path; import java.nio.file.Paths; import org.apache.commons.io.IOUtils; import org.apache.commons.lang3.StringUtils; import org.junit.jupiter.api.Test; import edu.hm.hafner.analysis.ModuleDetector.FileSystem; import edu.hm.hafner.util.PathUtil; import edu.hm.hafner.util.ResourceTest; import edu.umd.cs.findbugs.annotations.SuppressFBWarnings; import static org.assertj.core.api.Assertions.*; import static org.mockito.ArgumentMatchers.anyString; import static org.mockito.Mockito.*; /** * Tests the class {@link ModuleDetector}. */ @SuppressFBWarnings("DMI") class ModuleDetectorTest extends ResourceTest { private static final String MANIFEST = "MANIFEST.MF"; private static final String MANIFEST_NAME = "MANIFEST-NAME.MF"; private static final Path ROOT = Paths.get(File.pathSeparatorChar == ';' ? "C:\\Windows" : "/tmp"); private static final String PREFIX = new PathUtil().getAbsolutePath(ROOT) + "/"; private static final int NO_RESULT = 0; private static final String PATH_PREFIX_MAVEN = "path/to/maven/"; private static final String PATH_PREFIX_OSGI = "path/to/osgi/"; private static final String PATH_PREFIX_ANT = "path/to/ant/"; private static final String EXPECTED_MAVEN_MODULE = "ADT Business Logic"; private static final String EXPECTED_ANT_MODULE = "checkstyle"; private static final String EXPECTED_OSGI_MODULE = "de.faktorlogik.prototyp"; private InputStream read(final String fileName) { return asInputStream(fileName); } @Test void shouldIdentifyModuleByReadingOsgiBundle() { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(new String[]{PATH_PREFIX_OSGI + ModuleDetector.OSGI_BUNDLE}); when(stub.open(anyString())).thenReturn(read(MANIFEST)); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "something.txt"))) .isEqualTo(EXPECTED_OSGI_MODULE); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "in/between/something.txt"))) .isEqualTo(EXPECTED_OSGI_MODULE); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleByReadingOsgiBundleWithVendorInL10nProperties() { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(new String[]{PATH_PREFIX_OSGI + ModuleDetector.OSGI_BUNDLE}); when(stub.open(anyString())).thenReturn(read(MANIFEST), read("l10n.properties")); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); String expectedName = "de.faktorlogik.prototyp (My Vendor)"; assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "something.txt"))) .isEqualTo(expectedName); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "in/between/something.txt"))) .isEqualTo(expectedName); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleByReadingOsgiBundleWithManifestName() { FileSystem fileSystem = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn( new String[]{PATH_PREFIX_OSGI + ModuleDetector.OSGI_BUNDLE}); when(stub.open(anyString())).thenReturn(read(MANIFEST_NAME), read("l10n.properties")); }); ModuleDetector detector = new ModuleDetector(ROOT, fileSystem); String expectedName = "My Bundle"; assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "something.txt"))) .isEqualTo(expectedName); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_OSGI + "in/between/something.txt"))) .isEqualTo(expectedName); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleByReadingMavenPom() { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn( new String[]{PATH_PREFIX_MAVEN + ModuleDetector.MAVEN_POM}); when(stub.open(anyString())).thenAnswer(fileName -> read(ModuleDetector.MAVEN_POM)); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "something.txt"))).isEqualTo( EXPECTED_MAVEN_MODULE); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "in/between/something.txt"))).isEqualTo( EXPECTED_MAVEN_MODULE); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")).isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleByReadingMavenPomWithoutName() { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(new String[]{PATH_PREFIX_MAVEN + ModuleDetector.MAVEN_POM}); when(stub.open(anyString())).thenAnswer(filename -> read("no-name-pom.xml")); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); String artifactId = "com.avaloq.adt.core"; assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "something.txt"))) .isEqualTo(artifactId); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "in/between/something.txt"))) .isEqualTo(artifactId); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleByReadingAntProjectFile() { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(new String[]{PATH_PREFIX_ANT + ModuleDetector.ANT_PROJECT}); when(stub.open(anyString())).thenAnswer(filename -> read(ModuleDetector.ANT_PROJECT)); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_ANT + "something.txt"))) .isEqualTo(EXPECTED_ANT_MODULE); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_ANT + "in/between/something.txt"))) .isEqualTo(EXPECTED_ANT_MODULE); assertThat(detector.guessModuleName(PREFIX + "path/to/something.txt")) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIgnoreExceptionsDuringParsing() { FileSystem fileSystem = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(new String[NO_RESULT]); when(stub.open(anyString())).thenThrow(new FileNotFoundException("File not found")); }); ModuleDetector detector = new ModuleDetector(ROOT, fileSystem); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_ANT + "something.txt"))) .isEqualTo(StringUtils.EMPTY); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "something.txt"))) .isEqualTo(StringUtils.EMPTY); } @Test void shouldIdentifyModuleIfThereAreMoreEntries() { FileSystem factory = createFileSystemStub(stub -> { String ant = PATH_PREFIX_ANT + ModuleDetector.ANT_PROJECT; String maven = PATH_PREFIX_MAVEN + ModuleDetector.MAVEN_POM; when(stub.find(any(), anyString())).thenReturn(new String[]{ant, maven}); when(stub.open(PREFIX + ant)).thenReturn(read(ModuleDetector.ANT_PROJECT)); when(stub.open(PREFIX + maven)).thenAnswer(filename -> read(ModuleDetector.MAVEN_POM)); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_ANT + "something.txt"))) .isEqualTo(EXPECTED_ANT_MODULE); assertThat(detector.guessModuleName(PREFIX + (PATH_PREFIX_MAVEN + "something.txt"))) .isEqualTo(EXPECTED_MAVEN_MODULE); } @Test void shouldEnsureThatMavenHasPrecedenceOverAnt() { String prefix = "/prefix/"; String ant = prefix + ModuleDetector.ANT_PROJECT; String maven = prefix + ModuleDetector.MAVEN_POM; verifyOrder(prefix, ant, maven, new String[]{ant, maven}); verifyOrder(prefix, ant, maven, new String[]{maven, ant}); } @Test void shouldEnsureThatOsgiHasPrecedenceOverMavenAndAnt() { String prefix = "/prefix/"; String ant = prefix + ModuleDetector.ANT_PROJECT; String maven = prefix + ModuleDetector.MAVEN_POM; String osgi = prefix + ModuleDetector.OSGI_BUNDLE; verifyOrder(prefix, ant, maven, osgi, ant, maven, osgi); verifyOrder(prefix, ant, maven, osgi, ant, osgi, maven); verifyOrder(prefix, ant, maven, osgi, maven, ant, osgi); verifyOrder(prefix, ant, maven, osgi, maven, osgi, ant); verifyOrder(prefix, ant, maven, osgi, osgi, ant, maven); verifyOrder(prefix, ant, maven, osgi, osgi, maven, osgi); } @SuppressWarnings("PMD.UseVarargs") private void verifyOrder(final String prefix, final String ant, final String maven, final String[] foundFiles) { FileSystem factory = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(foundFiles); when(stub.open(ant)).thenReturn(read(ModuleDetector.ANT_PROJECT)); when(stub.open(maven)).thenAnswer(filename -> read(ModuleDetector.MAVEN_POM)); }); ModuleDetector detector = new ModuleDetector(ROOT, factory); assertThat(detector.guessModuleName(prefix + "something.txt")).isEqualTo(EXPECTED_MAVEN_MODULE); } private void verifyOrder(final String prefix, final String ant, final String maven, final String osgi, final String... foundFiles) { FileSystem fileSystem = createFileSystemStub(stub -> { when(stub.find(any(), anyString())).thenReturn(foundFiles); when(stub.open(ant)).thenAnswer(filename -> read(ModuleDetector.ANT_PROJECT)); when(stub.open(maven)).thenAnswer(filename -> read(ModuleDetector.MAVEN_POM)); when(stub.open(osgi)).thenAnswer(filename -> read(MANIFEST)); when(stub.open(prefix + "/" + ModuleDetector.PLUGIN_PROPERTIES)).thenAnswer(filename -> createEmptyStream()); when(stub.open(prefix + "/" + ModuleDetector.BUNDLE_PROPERTIES)).thenAnswer(filename -> createEmptyStream()); }); ModuleDetector detector = new ModuleDetector(ROOT, fileSystem); assertThat(detector.guessModuleName(prefix + "something.txt")).isEqualTo(EXPECTED_OSGI_MODULE); } private InputStream createEmptyStream() { try { return IOUtils.toInputStream("", "UTF-8"); } catch (IOException e) { throw new AssertionError(e); } } private FileSystem createFileSystemStub(final Stub stub) { try { FileSystem fileSystem = mock(FileSystem.class); stub.apply(fileSystem); return fileSystem; } catch (IOException exception) { throw new AssertionError(exception); } } /** * Stubs the {@link PackageDetectors.FileSystem} using a lambda. */ @FunctionalInterface private interface Stub { void apply(FileSystem f) throws IOException; } }
package mho.wheels.misc; import mho.wheels.iterables.ExhaustiveProvider; import mho.wheels.iterables.IterableProvider; import mho.wheels.iterables.IterableUtils; import mho.wheels.iterables.RandomProvider; import mho.wheels.structures.Pair; import org.junit.Test; import java.math.BigDecimal; import java.math.BigInteger; import java.util.Arrays; import java.util.Random; import static mho.wheels.iterables.IterableUtils.*; import static mho.wheels.misc.BigDecimalUtils.*; import static mho.wheels.ordering.Ordering.*; import static org.junit.Assert.*; public class BigDecimalUtilsProperties { private static boolean USE_RANDOM; private static int LIMIT; private static IterableProvider P; private static void initialize() { if (USE_RANDOM) { P = new RandomProvider(new Random(0x6af477d9a7e54fcaL)); LIMIT = 1000; } else { P = ExhaustiveProvider.INSTANCE; LIMIT = 10000; } } @Test public void testAllProperties() { for (boolean useRandom : Arrays.asList(false, true)) { System.out.println("Testing BigDecimalUtils properties " + (useRandom ? "randomly" : "exhaustively")); USE_RANDOM = useRandom; propertiesSetPrecision(); System.out.println(); } System.out.println("Done"); System.out.println(); } private static void propertiesSetPrecision() { initialize(); System.out.println("testing setPrecision(BigDecimal, int) properties..."); Iterable<Pair<BigDecimal, Integer>> ps; if (P instanceof ExhaustiveProvider) { ps = ((ExhaustiveProvider) P).pairsSquareRootOrder(P.bigDecimals(), P.positiveIntegers()); } else { ps = P.pairs(P.bigDecimals(), ((RandomProvider) P).positiveIntegersGeometric(20)); } for (Pair<BigDecimal, Integer> p : take(LIMIT, IterableUtils.filter(q -> ne(q.a, BigDecimal.ZERO), ps))) { assert p.a != null; assert p.b != null; BigDecimal bd = setPrecision(p.a, p.b); assertEquals(p.toString(), bd.precision(), (int) p.b); assertTrue(p.toString(), ne(bd, BigDecimal.ZERO)); } Iterable<Pair<BigDecimal, Integer>> zeroPs; if (P instanceof ExhaustiveProvider) { Iterable<BigDecimal> zeroes = map(i -> new BigDecimal(BigInteger.ZERO, i), P.integers()); zeroPs = ((ExhaustiveProvider) P).pairsSquareRootOrder(zeroes, P.positiveIntegers()); } else { Iterable<BigDecimal> zeroes = map( i -> new BigDecimal(BigInteger.ZERO, i), ((RandomProvider) P).integersGeometric(20) ); zeroPs = P.pairs(zeroes, ((RandomProvider) P).positiveIntegersGeometric(20)); } for (Pair<BigDecimal, Integer> p : take(LIMIT, zeroPs)) { assert p.a != null; assert p.b != null; BigDecimal bd = setPrecision(p.a, p.b); assertTrue(p.toString(), bd.scale() > -1); assertTrue(p.toString(), eq(bd, BigDecimal.ZERO)); } for (Pair<BigDecimal, Integer> p : take(LIMIT, filter(q -> q.b > 1, zeroPs))) { assert p.a != null; assert p.b != null; BigDecimal bd = setPrecision(p.a, p.b); assertTrue( p.toString(), bd.toString().equals("0." + replicate(p.b - 1, '0')) || bd.toString().equals("0E-" + (p.b - 1)) ); } Iterable<Pair<BigDecimal, Integer>> failPs; if (P instanceof ExhaustiveProvider) { failPs = ((ExhaustiveProvider) P).pairsSquareRootOrder(P.bigDecimals(), map(i -> -i, P.naturalIntegers())); } else { failPs = P.pairs(P.bigDecimals(), map(i -> -i, ((RandomProvider) P).naturalIntegersGeometric(20))); } for (Pair<BigDecimal, Integer> p : take(LIMIT, failPs)) { assert p.a != null; assert p.b != null; try { setPrecision(p.a, p.b); fail(p.toString()); } catch (ArithmeticException ignored) {} } } }
package org.broad.igv.ui.action; import junit.framework.AssertionFailedError; import org.broad.igv.AbstractHeadlessTest; import org.broad.igv.feature.BasicFeature; import org.broad.igv.feature.NamedFeature; import org.broad.igv.feature.genome.Genome; import org.broad.igv.util.TestUtils; import org.junit.Before; import org.junit.Ignore; import org.junit.Test; import java.util.ArrayList; import java.util.Arrays; import java.util.Collection; import java.util.List; import static org.junit.Assert.*; public class SearchCommandTest extends AbstractHeadlessTest { @Before public void setUp() throws Exception{ super.setUp(); } @Test public void testSingleChromosomes() throws Exception { int min = 1; int max = 22; String[] chrs = new String[max - min + 1]; String[] nums = new String[max - min + 1]; String chr; for (int cn = min; cn <= max; cn++) { chr = "chr" + cn; chrs[cn - min] = chr; nums[cn - min] = "" + cn; } tstFeatureTypes(chrs, SearchCommand.ResultType.CHROMOSOME); tstFeatureTypes(nums, SearchCommand.ResultType.CHROMOSOME); } @Test public void testChromoWithColon() throws Exception { List<String> chrNames = Arrays.asList("chr10", "chr1", "chr20"); List<List<String>> aliases = Arrays.asList( Arrays.asList("abc:123", "abc:456", "abc:789"), Arrays.asList("xy:12"), Arrays.asList("aaa:bbb")); Collection<Collection<String>> synonymsList = new ArrayList<Collection<String>>(); for (int i = 0; i < chrNames.size(); i++) { List<String> synonyms = new ArrayList<String>(); synonyms.addAll(aliases.get(i)); synonyms.add(chrNames.get(i)); synonymsList.add(synonyms); } if (genome instanceof Genome) { ((Genome) genome).addChrAliases(synonymsList); } SearchCommand cmd; for (int i = 0; i < chrNames.size(); i++) { String chr = chrNames.get(i); List<String> synonyms = aliases.get(i); for (String searchStr : synonyms) { cmd = new SearchCommand(null, searchStr, genome); List<SearchCommand.SearchResult> results = cmd.runSearch(cmd.searchString); assertEquals(1, results.size()); assertEquals(SearchCommand.ResultType.CHROMOSOME, results.get(0).type); assertEquals(chr, results.get(0).chr); } } String[] queries = new String[]{"X:100-1000", "Y:100-1000", "Y:12", "1\t 100", "X\t50", "X\t50\t500"}; tstFeatureTypes(queries, SearchCommand.ResultType.LOCUS); genome = TestUtils.loadGenome(); } @Test public void testSingleFeatures() throws Exception { String[] features = {"EGFR", "ABO", "BRCA1", "egFr"}; tstFeatureTypes(features, SearchCommand.ResultType.FEATURE); } /** * Test that mutations are parsed correctly. They get returned * as type LOCUS. * * @throws Exception */ @Test @Ignore("Fails unless tests are run in separate JVMs") public void testFeatureMuts() throws Exception { String[] features = {"EGFR:M1I", "EGFR:G5R", "egfr:g5r", "egfr:r2*"}; tstFeatureTypes(features, SearchCommand.ResultType.LOCUS); String egfr_seq = "atgcgaccctccgggacggccggggcagcgctcctggcgctgctggctgcgctc"; String[] targets = new String[]{"A", "G", "C", "T", "a", "g", "c", "t"}; String mut_let, tar_let; for (int let = 0; let < egfr_seq.length(); let++) { mut_let = egfr_seq.substring(let, let + 1); if (Math.random() > 0.5) { mut_let = mut_let.toUpperCase(); } tar_let = targets[let % targets.length]; String[] features2 = {"EGFR:" + (let + 1) + mut_let + ">" + tar_let}; tstFeatureTypes(features2, SearchCommand.ResultType.LOCUS); } } /* Run a bunch of queries, test that they all return the same type */ private void tstFeatureTypes(String[] queries, SearchCommand.ResultType type) { SearchCommand cmd; for (String f : queries) { cmd = new SearchCommand(null, f, genome); List<SearchCommand.SearchResult> results = cmd.runSearch(cmd.searchString); try { assertTrue(containsType(results, type)); } catch (AssertionFailedError e) { System.out.println(f + " :" + results.get(0).getMessage()); throw e; } } } private boolean containsType(List<SearchCommand.SearchResult> results, SearchCommand.ResultType check) { boolean contains = false; for (SearchCommand.SearchResult result : results) { contains |= result.type == check; } return contains; } @Test public void testMultiFeatures() throws Exception { tstMultiFeatures(" "); tstMultiFeatures(" "); tstMultiFeatures(" "); tstMultiFeatures(" "); tstMultiFeatures("\t"); tstMultiFeatures("\r\n"); //This should never happen } public void tstMultiFeatures(String delim) throws Exception { //Not sure if this is correct behavior or not String[] tokens = {"EgfR", "ABO", "BRCA1", "chr1:1-100"}; SearchCommand.ResultType[] types = new SearchCommand.ResultType[]{ SearchCommand.ResultType.FEATURE, SearchCommand.ResultType.FEATURE, SearchCommand.ResultType.FEATURE, SearchCommand.ResultType.LOCUS, SearchCommand.ResultType.CHROMOSOME, SearchCommand.ResultType.CHROMOSOME }; String searchStr = tokens[0]; for (int ii = 1; ii < tokens.length; ii++) { searchStr += delim + tokens[ii]; } SearchCommand cmd; cmd = new SearchCommand(null, searchStr, genome); List<SearchCommand.SearchResult> results = cmd.runSearch(cmd.searchString); for (int ii = 0; ii < tokens.length; ii++) { SearchCommand.SearchResult result = results.get(ii); try { assertEquals(types[ii], result.type); assertEquals(tokens[ii].toLowerCase(), result.getLocus().toLowerCase()); } catch (AssertionFailedError e) { System.out.println(searchStr + " :" + result.getMessage()); throw e; } } } @Test public void testMultiChromosomes() throws Exception { String[] tokens = {"chr1", "chr5", "4", "12", "X", "Y"}; String searchStr = tokens[0]; for (int ii = 1; ii < tokens.length; ii++) { searchStr += " " + tokens[ii]; } SearchCommand cmd; cmd = new SearchCommand(null, searchStr, genome); List<SearchCommand.SearchResult> results = cmd.runSearch(cmd.searchString); for (int ii = 0; ii < tokens.length; ii++) { SearchCommand.SearchResult result = results.get(ii); assertEquals(SearchCommand.ResultType.CHROMOSOME, result.type); assertTrue(result.getLocus().contains(tokens[ii])); } } @Test public void testError() throws Exception { String[] tokens = {"ueth", "EGFRa", "BRCA56", "EGFR:?1?"}; tstFeatureTypes(tokens, SearchCommand.ResultType.ERROR); } /** * Saving because we might want these test cases, but don't * want to test checkTokenType specifically */ @Deprecated public void testTokenChecking() { String[] chromos = {"chr3", "chr20", "chrX", "chrY"}; SearchCommand cmd = new SearchCommand(null, "", genome); for (String chr : chromos) { assertEquals(SearchCommand.ResultType.CHROMOSOME, cmd.checkTokenType(chr)); } String[] starts = {"39,239,480", "958392", "0,4829,44", "5"}; String[] ends = {"40,321,111", "5", "48153181,813156", ""}; for (int ii = 0; ii < starts.length; ii++) { String tstr = chromos[ii] + ":" + starts[ii] + "-" + ends[ii]; assertEquals(SearchCommand.ResultType.LOCUS, cmd.checkTokenType(tstr)); tstr = chromos[ii] + "\t" + starts[ii] + " " + ends[ii]; assertEquals(SearchCommand.ResultType.LOCUS, cmd.checkTokenType(tstr)); } String[] errors = {"egfr:1-100", " ", "chr1\t1\t100\tchr2"}; for (String s : errors) { //System.out.println(s); assertEquals(SearchCommand.ResultType.ERROR, cmd.checkTokenType(s)); } } }
package org.fcrepo.binary; import static org.hamcrest.CoreMatchers.is; import static org.junit.Assert.assertNull; import static org.junit.Assert.assertThat; import static org.mockito.Mockito.mock; import static org.mockito.Mockito.when; import static org.modeshape.jcr.api.JcrConstants.JCR_MIME_TYPE; import javax.jcr.Node; import javax.jcr.Property; import javax.jcr.Session; import org.junit.BeforeClass; import org.junit.Test; import org.modeshape.jcr.api.JcrConstants; /** * @todo Add Documentation. * @author cbeer * @date Apr 25, 2013 */ public class PolicyDecisionPointTest { static PolicyDecisionPoint pt; static private String dummyHint; static private String tiffHint; /** * @todo Add Documentation. */ @BeforeClass public static void setupPdp() { pt = new PolicyDecisionPoint(); dummyHint = "dummy-store-id"; Policy policy = new MimeTypePolicy("image/x-dummy-type", dummyHint); pt.addPolicy(policy); tiffHint = "tiff-store-id"; Policy tiffPolicy = new MimeTypePolicy("image/tiff", tiffHint); pt.addPolicy(tiffPolicy); } /** * @todo Add Documentation. */ @Test public void testDummyNode() throws Exception { Session mockSession = mock(Session.class); Node mockRootNode = mock(Node.class); Node mockDsNode = mock(Node.class); when(mockDsNode.getSession()).thenReturn(mockSession); Property mockProperty = mock(Property.class); when(mockProperty.getString()).thenReturn("image/x-dummy-type"); Node mockContentNode = mock(Node.class); when(mockDsNode.getNode(JcrConstants.JCR_CONTENT)). thenReturn(mockContentNode); when(mockContentNode.getProperty(JCR_MIME_TYPE)). thenReturn(mockProperty); String receivedHint = pt.evaluatePolicies(mockDsNode); assertThat(receivedHint, is(dummyHint)); } /** * @todo Add Documentation. */ @Test public void testTiffNode() throws Exception { Session mockSession = mock(Session.class); Node mockRootNode = mock(Node.class); Node mockDsNode = mock(Node.class); when(mockDsNode.getSession()).thenReturn(mockSession); Property mockProperty = mock(Property.class); when(mockProperty.getString()).thenReturn("image/tiff"); Node mockContentNode = mock(Node.class); when(mockDsNode.getNode(JcrConstants.JCR_CONTENT)). thenReturn(mockContentNode); when(mockContentNode.getProperty(JCR_MIME_TYPE)). thenReturn(mockProperty); String receivedHint = pt.evaluatePolicies(mockDsNode); assertThat(receivedHint, is(tiffHint)); } /** * @todo Add Documentation. */ @Test public void testOtherNode() throws Exception { Session mockSession = mock(Session.class); Node mockRootNode = mock(Node.class); Node mockDsNode = mock(Node.class); when(mockDsNode.getSession()).thenReturn(mockSession); Property mockProperty = mock(Property.class); when(mockProperty.getString()).thenReturn("image/x-other"); Node mockContentNode = mock(Node.class); when(mockDsNode.getNode(JcrConstants.JCR_CONTENT)). thenReturn(mockContentNode); when(mockContentNode.getProperty(JCR_MIME_TYPE)). thenReturn(mockProperty); String receivedHint = pt.evaluatePolicies(mockDsNode); assertNull(receivedHint); } }
package org.openlmis.fulfillment.domain; import static junit.framework.TestCase.assertEquals; import static junit.framework.TestCase.assertFalse; import static junit.framework.TestCase.assertTrue; import static org.openlmis.fulfillment.domain.OrderStatus.FULFILLING; import static org.openlmis.fulfillment.domain.OrderStatus.IN_ROUTE; import static org.openlmis.fulfillment.domain.OrderStatus.ORDERED; import static org.openlmis.fulfillment.domain.OrderStatus.READY_TO_PACK; import static org.openlmis.fulfillment.domain.OrderStatus.RECEIVED; import static org.openlmis.fulfillment.domain.OrderStatus.SHIPPED; import static org.openlmis.fulfillment.domain.OrderStatus.TRANSFER_FAILED; import org.junit.Test; import org.openlmis.fulfillment.OrderDataBuilder; public class OrderTest { @Test public void shouldCheckIfStatusIsOrdered() { Order order = new OrderDataBuilder().withOrderedStatus().build(); assertTrue(order.isOrdered()); order = new OrderDataBuilder().withFulfillingStatus().build(); assertFalse(order.isOrdered()); } @Test public void shouldPrepareOrderForLocalFulfill() { Order order = new OrderDataBuilder().build(); order.prepareToLocalFulfill(); assertEquals(ORDERED, order.getStatus()); } @Test public void shouldCheckIfOrderIsExternal() { assertTrue(new OrderDataBuilder().withStatus(TRANSFER_FAILED).build().isExternal()); assertTrue(new OrderDataBuilder().withStatus(IN_ROUTE).build().isExternal()); assertTrue(new OrderDataBuilder().withStatus(READY_TO_PACK).build().isExternal()); assertFalse(new OrderDataBuilder().withStatus(ORDERED).build().isExternal()); assertFalse(new OrderDataBuilder().withStatus(FULFILLING).build().isExternal()); assertFalse(new OrderDataBuilder().withStatus(SHIPPED).build().isExternal()); assertFalse(new OrderDataBuilder().withStatus(RECEIVED).build().isExternal()); } @Test public void shouldCheckIfOrderCanBeShipped() { Order order = new OrderDataBuilder().withOrderedStatus().build(); assertTrue(order.canBeFulfilled()); order = new OrderDataBuilder().withFulfillingStatus().build(); assertTrue(order.canBeFulfilled()); order.setStatus(IN_ROUTE); assertFalse(order.canBeFulfilled()); order.setStatus(TRANSFER_FAILED); assertFalse(order.canBeFulfilled()); order.setStatus(READY_TO_PACK); assertFalse(order.canBeFulfilled()); order.setStatus(RECEIVED); assertFalse(order.canBeFulfilled()); order.setStatus(SHIPPED); assertFalse(order.canBeFulfilled()); } }
package com.kennyc.sample; import android.content.Context; import android.content.Intent; import android.os.Bundle; import android.support.v7.app.AppCompatActivity; import android.support.v7.widget.LinearLayoutManager; import android.support.v7.widget.RecyclerView; import android.view.MenuItem; import android.view.View; import android.view.ViewGroup; import android.widget.TextView; import android.widget.Toast; import com.kennyc.adapters.ArrayRecyclerAdapter; import com.kennyc.adapters.BaseRecyclerAdapter; import com.kennyc.adapters.MenuRecyclerAdapter; import java.util.ArrayList; import java.util.List; public class RVActivity extends AppCompatActivity implements View.OnClickListener { public static Intent createIntent(Context context, int type) { return new Intent(context, RVActivity.class).putExtra("type", type); } private RecyclerView recyclerView; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_rv); recyclerView = (RecyclerView) findViewById(R.id.rv); recyclerView.setLayoutManager(new LinearLayoutManager(getApplicationContext())); List<String> data = new ArrayList<>(100); for (int i = 0; i < 100; i++) { data.add("Position " + i); } RecyclerView.Adapter adapter = null; switch (getIntent().getIntExtra("type", 0)) { case 0: adapter = new ArrayRecyclerAdapter<>(this, android.R.layout.simple_list_item_1, data, this); break; case 1: adapter = new CustomAdapter(this, data, this); break; case 2: adapter = new MenuRecyclerAdapter(this, R.menu.test_menu, this); break; } recyclerView.setAdapter(adapter); } @Override public void onClick(View v) { RecyclerView.Adapter adapter = recyclerView.getAdapter(); if (adapter instanceof ArrayRecyclerAdapter) { Object item = ((ArrayRecyclerAdapter) adapter).getItem(recyclerView.getChildAdapterPosition(v)); Toast.makeText(getApplicationContext(), item.toString(), Toast.LENGTH_SHORT).show(); } else if (adapter instanceof CustomAdapter) { String item = ((CustomAdapter) adapter).getItem(recyclerView.getChildAdapterPosition(v)); Toast.makeText(getApplicationContext(), item, Toast.LENGTH_SHORT).show(); } else { MenuItem item = ((MenuRecyclerAdapter) adapter).getItem(recyclerView.getChildAdapterPosition(v)); Toast.makeText(getApplicationContext(), item.toString(), Toast.LENGTH_SHORT).show(); } } @Override protected void onDestroy() { if (recyclerView.getAdapter() instanceof CustomAdapter) { ((CustomAdapter) recyclerView.getAdapter()).onDestroy(); } super.onDestroy(); } private static class CustomAdapter extends BaseRecyclerAdapter<String, CustomAdapter.VH> { private View.OnClickListener listener; public CustomAdapter(Context context, List<String> data, View.OnClickListener listener) { super(context, data); this.listener = listener; } @Override public CustomAdapter.VH onCreateViewHolder(ViewGroup parent, int viewType) { VH vh = new VH(inflateView(android.R.layout.simple_list_item_1, parent)); vh.textView.setOnClickListener(listener); return vh; } @Override public void onDestroy() { super.onDestroy(); listener = null; } @Override public void onBindViewHolder(CustomAdapter.VH holder, int position) { holder.textView.setText(getItem(position)); } public static class VH extends RecyclerView.ViewHolder { TextView textView; public VH(View view) { super(view); textView = (TextView) view; } } } }
package net.hillsdon.reviki.wiki.renderer.creole; import java.util.ArrayList; import java.util.Collection; import java.util.Collections; import java.util.List; import org.antlr.v4.runtime.ParserRuleContext; import com.google.common.base.Optional; import com.uwyn.jhighlight.renderer.XhtmlRendererFactory; import net.hillsdon.reviki.vc.AttachmentHistory; import net.hillsdon.reviki.vc.PageInfo; import net.hillsdon.reviki.vc.PageStore; import net.hillsdon.reviki.vc.PageStoreException; import net.hillsdon.reviki.web.urls.URLOutputFilter; import net.hillsdon.reviki.wiki.renderer.creole.ast.*; import net.hillsdon.reviki.wiki.renderer.creole.Creole.*; /** * Visitor which walks the parse tree to build a more programmer-friendly AST. * This also performs some non-standard rearrangement in order to replicate * functionality from the old renderer. * * @author msw */ public class Visitor extends CreoleASTBuilder { /** List of attachments on the page. */ private Collection<AttachmentHistory> _attachments = null; public Visitor(final Optional<PageStore> store, final PageInfo page, final URLOutputFilter urlOutputFilter, final LinkPartsHandler linkHandler, final LinkPartsHandler imageHandler) { super(store, page, urlOutputFilter, linkHandler, imageHandler); } public Visitor(final PageStore store, final PageInfo page, final URLOutputFilter urlOutputFilter, final LinkPartsHandler linkHandler, final LinkPartsHandler imageHandler) { super(store, page, urlOutputFilter, linkHandler, imageHandler); } public Visitor(final PageInfo page, final URLOutputFilter urlOutputFilter, final LinkPartsHandler linkHandler, final LinkPartsHandler imageHandler) { super(page, urlOutputFilter, linkHandler, imageHandler); } /** * If a paragraph starts with a sequence of blockable elements, separated by * newlines, render them as blocks and the remaining text (if any) as a * paragraph following this. * * @param paragraph The paragraph to expand out. * @param reversed Whether the paragraph is reversed or not. If so, the final * trailing paragraph has its chunks reversed, to ease re-ordering * later. * @return A list of blocks, which may just consist of the original paragraph. */ protected List<ASTNode> expandParagraph(final Paragraph paragraph, final boolean reversed) { ASTNode inline = paragraph.getChildren().get(0); List<ASTNode> chunks = inline.getChildren(); int numchunks = chunks.size(); // Drop empty inlines, as that means we've examined an entire paragraph. if (numchunks == 0) { return new ArrayList<ASTNode>(); } ASTNode head = chunks.get(0); String sep = (numchunks > 1) ? chunks.get(1).toXHTML() : "\r\n"; List<ASTNode> tail = (numchunks > 1) ? chunks.subList(1, numchunks) : new ArrayList<ASTNode>(); Paragraph rest = new Paragraph(new Inline(tail)); List<ASTNode> out = new ArrayList<ASTNode>(); // Drop leading whitespace if (head.toXHTML().matches("^\r?\n$")) { return expandParagraph(rest, reversed); } // Only continue if there is a hope of expanding it if (head instanceof BlockableNode) { // Check if we have a valid separator ASTNode block = null; if (sep == null || (!reversed && (sep.startsWith("\r\n") || sep.startsWith("\n")) || (reversed && sep.endsWith("\n")) || sep.startsWith("<br"))) { block = ((BlockableNode) head).toBlock(); } // Check if we have a match, and build the result list. if (block != null) { out.add(block); out.addAll(expandParagraph(rest, reversed)); return out; } } if (reversed) { List<ASTNode> rchunks = new ArrayList<ASTNode>(inline.getChildren()); Collections.reverse(rchunks); out.add(new Paragraph(new Inline(rchunks))); } else { out.add(paragraph); } return out; } /** * Render the root node, creole. creole contains zero or more block elements * separated by linebreaks and paragraph breaks. * * The rendering behaviour is to render each block individually, and then * display them sequentially in order. */ @Override public ASTNode visitCreole(final CreoleContext ctx) { List<ASTNode> blocks = new ArrayList<ASTNode>(); for (BlockContext btx : ctx.block()) { ASTNode ren = visit(btx); // If we have a paragraph, rip off initial and trailing inline code and // macros. if (ren instanceof Paragraph) { List<ASTNode> expandedInit = expandParagraph((Paragraph) ren, false); List<ASTNode> expandedTail = new ArrayList<ASTNode>(); // Handle trailing things by extracting the chunks of the final // paragraph, reversing, extracting the prefix again, and then reversing // the result. if (expandedInit.size() > 0 && expandedInit.get(expandedInit.size() - 1) instanceof Paragraph) { Paragraph paragraph = (Paragraph) expandedInit.get(expandedInit.size() - 1); expandedInit.remove(paragraph); List<ASTNode> chunks = new ArrayList<ASTNode>(paragraph.getChildren().get(0).getChildren()); Collections.reverse(chunks); expandedTail = expandParagraph(new Paragraph(new Inline(chunks)), true); Collections.reverse(expandedTail); } blocks.addAll(expandedInit); blocks.addAll(expandedTail); continue; } // Otherwise, just add the block to the list. blocks.add(ren); } // Remove paragraphs just consisting of whitespace List<ASTNode> blocksNonEmpty = new ArrayList<ASTNode>(); for (ASTNode block : blocks) { if (block != null && !(block instanceof Paragraph && ((Paragraph)block).innerXHTML().trim().equals(""))) { blocksNonEmpty.add(block); } } return new Page(blocksNonEmpty); } /** * Render a heading node. This consists of a prefix, the length of which will * tell us the heading level, and some content. */ @Override public ASTNode visitHeading(final HeadingContext ctx) { if (ctx.inline() == null) { return new Plaintext(ctx.HSt().getText()); } return new Heading(ctx.HSt().getText().length(), visit(ctx.inline())); } /** * Render a paragraph node. This consists of a single inline element. */ @Override public ASTNode visitParagraph(final ParagraphContext ctx) { return new Paragraph(visit(ctx.inline())); } /** * Render an inline node. This consists of a list of chunks of smaller markup * units, which are displayed in order. */ @Override public ASTNode visitInline(final InlineContext ctx) { List<ASTNode> chunks = new ArrayList<ASTNode>(); // Merge adjacent Any nodes into long Plaintext nodes, to give a more useful // AST. ASTNode last = null; for (InlinestepContext itx : ctx.inlinestep()) { ASTNode rendered = visit(itx); if (last == null) { last = rendered; } else { if (last instanceof Plaintext && rendered instanceof Plaintext) { last = new Plaintext(((Plaintext) last).getText() + ((Plaintext) rendered).getText()); } else { chunks.add(last); last = rendered; } } } if (last != null) { chunks.add(last); } return new Inline(chunks); } /** * Render an any node. This consists of some plaintext, which is escaped and * displayed with no further processing. */ @Override public ASTNode visitAny(final AnyContext ctx) { return new Plaintext(ctx.getText()); } /** * Render a WikiWords link. */ @Override public ASTNode visitWikiwlink(final WikiwlinkContext ctx) { return new Link(ctx.getText(), ctx.getText(), page(), urlOutputFilter(), linkHandler()); } /** * Render an attachment link. If the attachment doesn't exist, it is rendered * in plain text. */ @Override public ASTNode visitAttachment(final AttachmentContext ctx) { if (store().isPresent()) { // Check if the attachment exists try { if (_attachments == null) { _attachments = unsafeStore().attachments(page()); } for (AttachmentHistory attachment : _attachments) { // Skip deleted attachments if (attachment.isAttachmentDeleted()) { continue; } // Render the link if the name matches if (attachment.getName().equals(ctx.getText())) { return new Link(ctx.getText(), ctx.getText(), page(), urlOutputFilter(), linkHandler()); } } } catch (PageStoreException e) { } } return new Plaintext(ctx.getText()); } /** * Render a raw URL link. */ @Override public ASTNode visitRawlink(final RawlinkContext ctx) { return new Link(ctx.getText(), ctx.getText(), page(), urlOutputFilter(), linkHandler()); } /** * Render bold nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitBold(final BoldContext ctx) { return renderInlineMarkup(Bold.class, "**", "BEnd", ctx.BEnd(), ctx.inline()); } /** * Render italic nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitItalic(final ItalicContext ctx) { return renderInlineMarkup(Italic.class, "//", "IEnd", ctx.IEnd(), ctx.inline()); } /** * Render strikethrough nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitSthrough(final SthroughContext ctx) { return renderInlineMarkup(Strikethrough.class, "--", "SEnd", ctx.SEnd(), ctx.inline()); } /** * Render a link node with no title. */ @Override public ASTNode visitLink(final LinkContext ctx) { return new Link(ctx.InLink().getText(), ctx.InLink().getText(), page(), urlOutputFilter(), linkHandler()); } /** * Render a link node with a title. */ @Override public ASTNode visitTitlelink(final TitlelinkContext ctx) { String target = (ctx.InLink() == null) ? "" : ctx.InLink().getText(); String title = (ctx.InLinkEnd() == null) ? target : ctx.InLinkEnd().getText(); return new Link(target, title, page(), urlOutputFilter(), linkHandler()); } /** * Render an image node. */ @Override public ASTNode visitImglink(final ImglinkContext ctx) { String target = (ctx.InLink() == null) ? "" : ctx.InLink().getText(); String title = (ctx.InLinkEnd() == null) ? target : ctx.InLinkEnd().getText(); return new Image(target, title, page(), urlOutputFilter(), imageHandler()); } /** * Render an image without a title. */ @Override public ASTNode visitSimpleimg(final SimpleimgContext ctx) { return new Image(ctx.InLink().getText(), ctx.InLink().getText(), page(), urlOutputFilter(), imageHandler()); } /** * Render an inline nowiki node. Due to how the lexer works, the contents * include the ending symbol, which must be chopped off. * * TODO: Improve the tokensiation of this. */ @Override public ASTNode visitPreformat(final PreformatContext ctx) { return renderInlineCode(ctx.EndNoWikiInline(), "}}}"); } /** * Render a syntax-highlighted CPP block. This has the same tokenisation * problem as mentioned in {@link #visitPreformat}. */ @Override public ASTNode visitInlinecpp(final InlinecppContext ctx) { return renderInlineCode(ctx.EndCppInline(), "[</c++>]", XhtmlRendererFactory.CPLUSPLUS); } /** * Render a block of literal, unescaped, HTML. */ @Override public ASTNode visitInlinehtml(final InlinehtmlContext ctx) { String code = ctx.EndHtmlInline().getText(); return new Raw(code.substring(0, code.length() - "[</html>]".length())); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode}. */ @Override public ASTNode visitInlinejava(final InlinejavaContext ctx) { return renderInlineCode(ctx.EndJavaInline(), "[</java>]", XhtmlRendererFactory.JAVA); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode}. */ @Override public ASTNode visitInlinexhtml(final InlinexhtmlContext ctx) { return renderInlineCode(ctx.EndXhtmlInline(), "[</xhtml>]", XhtmlRendererFactory.XHTML); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode}. */ @Override public ASTNode visitInlinexml(final InlinexmlContext ctx) { return renderInlineCode(ctx.EndXmlInline(), "[</xml>]", XhtmlRendererFactory.XML); } /** * Render a literal linebreak node. */ @Override public ASTNode visitLinebreak(final LinebreakContext ctx) { return new Linebreak(); } /** * Render a horizontal rule node. */ @Override public ASTNode visitHrule(final HruleContext ctx) { return new HorizontalRule(); } /** * Render an ordered list. List rendering is a bit of a mess at the moment, * but it basically works like this: * * - Lists have a root node, which contains level 1 elements. * * - There are levels 1 through 5. * * - Each level (other than 5) may have child list elements. * * - Each level (other than root) may also have some content, which can be a * new list (ordered or unordered), or inline text. * * The root list node is rendered by displaying all level 1 entities in * sequence, where level n entities are rendered by displaying their content * and then any children they have. * * TODO: Figure out how to have arbitrarily-nested lists. */ @Override public ASTNode visitOlist(final OlistContext ctx) { return renderList(ListType.Ordered, ctx.olist1()); } /** Helper functions for lists. */ protected enum ListCtxType { List2Context, List3Context, List4Context, List5Context, List6Context, List7Context, List8Context, List9Context, List10Context }; protected ParserRuleContext olist(final ParserRuleContext ctx) { switch (ListCtxType.valueOf(ctx.getClass().getSimpleName())) { case List2Context: return ((List2Context) ctx).olist2(); case List3Context: return ((List3Context) ctx).olist3(); case List4Context: return ((List4Context) ctx).olist4(); case List5Context: return ((List5Context) ctx).olist5(); case List6Context: return ((List6Context) ctx).olist6(); case List7Context: return ((List7Context) ctx).olist7(); case List8Context: return ((List8Context) ctx).olist8(); case List9Context: return ((List9Context) ctx).olist9(); case List10Context: return ((List10Context) ctx).olist10(); default: throw new RuntimeException("Unknown list context type"); } } protected ParserRuleContext ulist(final ParserRuleContext ctx) { switch (ListCtxType.valueOf(ctx.getClass().getSimpleName())) { case List2Context: return ((List2Context) ctx).ulist2(); case List3Context: return ((List3Context) ctx).ulist3(); case List4Context: return ((List4Context) ctx).ulist4(); case List5Context: return ((List5Context) ctx).ulist5(); case List6Context: return ((List6Context) ctx).ulist6(); case List7Context: return ((List7Context) ctx).ulist7(); case List8Context: return ((List8Context) ctx).ulist8(); case List9Context: return ((List9Context) ctx).ulist9(); case List10Context: return ((List10Context) ctx).ulist10(); default: throw new RuntimeException("Unknown list context type"); } } protected ASTNode list(final List<? extends ParserRuleContext> ltxs, final InListContext inner) { List<ListItemContext> children = new ArrayList<ListItemContext>(); if (ltxs != null) { for (ParserRuleContext ltx : ltxs) { children.add(new ListItemContext(olist(ltx), ulist(ltx))); } } List<ParserRuleContext> inners = new ArrayList<ParserRuleContext>(); inners.add((ParserRuleContext) inner.olist()); inners.add((ParserRuleContext) inner.ulist()); inners.add((ParserRuleContext) inner.inline()); return renderListItem(children, inners); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist1(final Olist1Context ctx) { return list(ctx.list2(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist2(final Olist2Context ctx) { return list(ctx.list3(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist3(final Olist3Context ctx) { return list(ctx.list4(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist4(final Olist4Context ctx) { return list(ctx.list5(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist5(final Olist5Context ctx) { return list(ctx.list6(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist6(final Olist6Context ctx) { return list(ctx.list7(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist7(final Olist7Context ctx) { return list(ctx.list8(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist8(final Olist8Context ctx) { return list(ctx.list9(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist9(final Olist9Context ctx) { return list(ctx.list10(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitOlist10(final Olist10Context ctx) { return list(null, ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist(final UlistContext ctx) { return renderList(ListType.Unordered, ctx.ulist1()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist1(final Ulist1Context ctx) { return list(ctx.list2(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist2(final Ulist2Context ctx) { return list(ctx.list3(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist3(final Ulist3Context ctx) { return list(ctx.list4(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist4(final Ulist4Context ctx) { return list(ctx.list5(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist5(final Ulist5Context ctx) { return list(ctx.list6(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist6(final Ulist6Context ctx) { return list(ctx.list7(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist7(final Ulist7Context ctx) { return list(ctx.list8(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist8(final Ulist8Context ctx) { return list(ctx.list9(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist9(final Ulist9Context ctx) { return list(ctx.list10(), ctx.inList()); } /** See {@link #visitOlist}. */ @Override public ASTNode visitUlist10(final Ulist10Context ctx) { return list(null, ctx.inList()); } /** * Render a NoWiki block node. This has the same tokenisation problem as * mentioned in {@link #visitPreformat}. */ @Override public ASTNode visitNowiki(final NowikiContext ctx) { return renderBlockCode(ctx.EndNoWikiBlock(), "}}}"); } /** * Like {@link #visitInlinecpp}, but for blocks. */ @Override public ASTNode visitCpp(final CppContext ctx) { return renderBlockCode(ctx.EndCppBlock(), "[</c++>]", XhtmlRendererFactory.CPLUSPLUS); } /** * Render a block of literal, unescaped, HTML. */ @Override public ASTNode visitHtml(final HtmlContext ctx) { String code = ctx.EndHtmlBlock().getText(); return new Raw(code.substring(0, code.length() - "[</html>]".length())); } /** See {@link #visitCpp} and {@link #renderBlockCode}. */ @Override public ASTNode visitJava(final JavaContext ctx) { return renderBlockCode(ctx.EndJavaBlock(), "[</java>]", XhtmlRendererFactory.JAVA); } /** See {@link #visitCpp} and {@link #renderBlockCode}. */ @Override public ASTNode visitXhtml(final XhtmlContext ctx) { return renderBlockCode(ctx.EndXhtmlBlock(), "[</xhtml>]", XhtmlRendererFactory.XHTML); } /** See {@link #visitCpp} and {@link #renderBlockCode}. */ @Override public ASTNode visitXml(final XmlContext ctx) { return renderBlockCode(ctx.EndXmlBlock(), "[</xml>]", XhtmlRendererFactory.XML); } /** * Render a table node. This consists of rendering all rows in sequence. */ @Override public ASTNode visitTable(final TableContext ctx) { List<ASTNode> rows = new ArrayList<ASTNode>(); for (TrowContext rtx : ctx.trow()) { rows.add(visit(rtx)); } return new Table(rows); } /** * Render a table row. A table row consists of a number of cells, and a * possible trailing separator. */ @Override public ASTNode visitTrow(final TrowContext ctx) { List<ASTNode> cells = new ArrayList<ASTNode>(); for (TcellContext rtx : ctx.tcell()) { cells.add(visit(rtx)); } return new TableRow(cells); } /** * Render a table heading cell. */ @Override public ASTNode visitTh(final ThContext ctx) { return new TableHeaderCell((ctx.inline() != null) ? visit(ctx.inline()) : new Plaintext("")); } /** * Render a table cell. */ @Override public ASTNode visitTd(final TdContext ctx) { return new TableCell((ctx.inline() != null) ? visit(ctx.inline()) : new Plaintext("")); } /** * Render a macro. */ @Override public ASTNode visitMacro(final MacroContext ctx) { // If there are no arguments, it's not a macro if (ctx.MacroEndNoArgs() != null) { return new Plaintext("<<" + ctx.MacroName().getText() + ">>"); } return new MacroNode(ctx.MacroName().getText(), cutOffEndTag(ctx.MacroEnd(), ">>"), page(), this); } }
package dr.app.beagle.evomodel.branchmodel; import java.util.ArrayList; import java.util.List; import dr.app.beagle.evomodel.substmodel.SubstitutionModel; import dr.evolution.tree.NodeRef; import dr.evomodel.tree.TreeModel; import dr.inference.model.AbstractModel; import dr.inference.model.Model; import dr.inference.model.Parameter; import dr.inference.model.Variable; import dr.util.Author; import dr.util.Citable; import dr.util.Citation; /** * @author Filip Bielejec * @author Andrew Rambaut * @author Marc A. Suchard * @version $Id$ */ @SuppressWarnings("serial") public class EpochBranchModel extends AbstractModel implements BranchModel, Citable { public static final String EPOCH_BRANCH_MODEL = "EpochBranchModel"; public EpochBranchModel(TreeModel tree, List<SubstitutionModel> substitutionModels, Parameter epochTimes) { super(EPOCH_BRANCH_MODEL); this.substitutionModels = substitutionModels; if (substitutionModels == null || substitutionModels.size() == 0) { throw new IllegalArgumentException("EpochBranchModel must be provided with at least one substitution model"); } this.epochTimes = epochTimes; this.tree = tree; for (SubstitutionModel model : substitutionModels) { addModel(model); } addModel(tree); addVariable(epochTimes); }// END: Constructor @Override public Mapping getBranchModelMapping(NodeRef node) { int nModels = substitutionModels.size(); int lastTransitionTime = nModels - 2; double[] transitionTimes = epochTimes.getParameterValues(); double parentHeight = tree.getNodeHeight(tree.getParent(node)); double nodeHeight = tree.getNodeHeight(node); double branchLength = tree.getBranchLength(node); List<Double> weightList = new ArrayList<Double>(); List<Integer> orderList = new ArrayList<Integer>(); if (parentHeight <= transitionTimes[0]) { weightList.add( branchLength ); orderList.add(0); } else { // first case: 0-th transition time if (nodeHeight < transitionTimes[0] && transitionTimes[0] <= parentHeight) { weightList.add( transitionTimes[0] - nodeHeight ); orderList.add(0); } else { // do nothing }// END: 0-th model check // second case: i to i+1 transition times for (int i = 1; i <= lastTransitionTime; i++) { if (nodeHeight < transitionTimes[i]) { if (parentHeight <= transitionTimes[i] && transitionTimes[i - 1] < nodeHeight) { weightList.add( branchLength ); orderList.add(i); } else { double startTime = Math.max(nodeHeight, transitionTimes[i - 1]); double endTime = Math.min(parentHeight, transitionTimes[i]); if (endTime >= startTime) { weightList.add( endTime - startTime ); orderList.add(i); }// END: negative weights check }// END: full branch in middle epoch check }// END: i-th model check }// END: i loop // third case: last transition time if (parentHeight >= transitionTimes[lastTransitionTime] && transitionTimes[lastTransitionTime] > nodeHeight) { weightList.add( parentHeight - transitionTimes[lastTransitionTime] ); orderList.add(nModels - 1); } else if (nodeHeight > transitionTimes[lastTransitionTime]) { weightList.add( branchLength ); orderList.add(nModels - 1); } else { // nothing to add }// END: last transition time check }// END: if branch below first transition time bail out final int[] order = new int[orderList.size()]; final double[] weights = new double[weightList.size()]; for (int i = 0; i < orderList.size(); i++) { order[i] = orderList.get(i); weights[i] = weightList.get(i); } return new Mapping() { @Override public int[] getOrder() { return order; } @Override public double[] getWeights() { return weights; } }; }// END: getBranchModelMapping @Override public boolean requiresMatrixConvolution() { return true; } @Override public List<SubstitutionModel> getSubstitutionModels() { return substitutionModels; } @Override public SubstitutionModel getRootSubstitutionModel() { return substitutionModels.get(substitutionModels.size() - 1); } protected void handleModelChangedEvent(Model model, Object object, int index) { fireModelChanged(); }// END: handleModelChangedEvent @SuppressWarnings("rawtypes") protected void handleVariableChangedEvent(Variable variable, int index, Parameter.ChangeType type) { }// END: handleVariableChangedEvent protected void storeState() { }// END: storeState protected void restoreState() { }// END: restoreState protected void acceptState() { }// END: acceptState /** * @return a list of citations associated with this object */ public List<Citation> getCitations() { List<Citation> citations = new ArrayList<Citation>(); citations.add(new Citation(new Author[]{new Author("F", "Bielejec"), new Author("P", "Lemey"), new Author("G", "Baele"), new Author("A", "Rambaut"), new Author("MA", "Suchard")}, Citation.Status.IN_PREPARATION)); return citations; }// END: getCitations private final TreeModel tree; private final List<SubstitutionModel> substitutionModels; private final Parameter epochTimes; }// END: class
package mobi.hsz.idea.gitignore.util; import mobi.hsz.idea.gitignore.Common; import org.junit.Test; import java.util.regex.Matcher; import java.util.regex.Pattern; public class MatcherUtilTest extends Common<MatcherUtil> { @Test public void testMatch() { final Pattern pattern = Pattern.compile("foo"); final MatcherUtil util = new MatcherUtil(); assertFalse(util.match(null, null)); assertFalse(util.match(null, "foo")); assertFalse(util.match(pattern, null)); assertFalse(util.match(pattern, "fo")); assertTrue(util.match(pattern, "foo")); assertTrue(util.match(pattern, "xfooy")); } @Test public void testMatchAllParts() { final String[] partsA = new String[]{"foo"}; final String[] partsB = new String[]{"foo", "bar"}; assertFalse(MatcherUtil.matchAllParts(null, null)); assertFalse(MatcherUtil.matchAllParts(null, "foo")); assertFalse(MatcherUtil.matchAllParts(partsA, null)); assertFalse(MatcherUtil.matchAllParts(partsA, "fo")); assertTrue(MatcherUtil.matchAllParts(partsA, "foo")); assertTrue(MatcherUtil.matchAllParts(partsA, "xfooy")); assertFalse(MatcherUtil.matchAllParts(partsB, "xfooxba")); assertTrue(MatcherUtil.matchAllParts(partsB, "xfooxbar")); } @Test public void testMatchAnyPart() { final String[] partsA = new String[]{"foo"}; final String[] partsB = new String[]{"foo", "bar"}; assertFalse(MatcherUtil.matchAnyPart(null, null)); assertFalse(MatcherUtil.matchAnyPart(null, "foo")); assertFalse(MatcherUtil.matchAnyPart(partsA, null)); assertFalse(MatcherUtil.matchAnyPart(partsA, "fo")); assertTrue(MatcherUtil.matchAnyPart(partsA, "foo")); assertTrue(MatcherUtil.matchAnyPart(partsA, "xfooy")); assertTrue(MatcherUtil.matchAnyPart(partsB, "xfooxba")); assertTrue(MatcherUtil.matchAnyPart(partsB, "xfooxbar")); } @Test public void testGetParts() { Pattern pattern = Pattern.compile("foo[ba]rbuz.*hi"); assertEquals(MatcherUtil.getParts((Pattern) null).length, 0); assertEquals(MatcherUtil.getParts((Matcher) null).length, 0); assertEquals(MatcherUtil.getParts(pattern).length, 2); assertEquals(MatcherUtil.getParts(pattern.matcher("")).length, 2); pattern = Pattern.compile("$$_!@[fd]"); assertEquals(MatcherUtil.getParts(pattern).length, 0); assertEquals(MatcherUtil.getParts(pattern.matcher("")).length, 0); } }
package dr.app.beauti.traitspanel; import dr.app.beauti.options.BeautiOptions; import dr.app.beauti.options.TraitGuesser; import dr.app.beauti.util.PanelUtils; import dr.app.beauti.*; import dr.evolution.util.*; import dr.gui.table.TableSorter; import org.virion.jam.framework.Exportable; import org.virion.jam.table.HeaderRenderer; import org.virion.jam.table.TableEditorStopper; import org.virion.jam.table.TableRenderer; import org.virion.jam.panels.ActionPanel; import javax.swing.*; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import javax.swing.plaf.BorderUIResource; import javax.swing.table.AbstractTableModel; import javax.swing.table.TableColumn; import java.awt.*; import java.awt.event.ActionEvent; /** * @author Andrew Rambaut * @version $Id: DataPanel.java,v 1.17 2006/09/05 13:29:34 rambaut Exp $ */ public class TraitsPanel extends BeautiPanel implements Exportable { private static final long serialVersionUID = 5283922195494563924L; private final JTable traitsTable; private final TraitsTableModel traitsTableModel; private final JTable dataTable; private final DataTableModel dataTableModel; private final ClearTraitAction clearTraitAction = new ClearTraitAction(); private final GuessLocationsAction guessLocationsAction = new GuessLocationsAction(); private final BeautiFrame frame; private BeautiOptions options = null; private String selectedTrait = null; private CreateTraitDialog createTraitDialog = null; private GuessTraitDialog guessTraitDialog = null; public TraitsPanel(BeautiFrame parent, Action importTraitsAction) { this.frame = parent; traitsTableModel = new TraitsTableModel(); TableSorter sorter = new TableSorter(traitsTableModel); traitsTable = new JTable(sorter); sorter.setTableHeader(traitsTable.getTableHeader()); traitsTable.getColumnModel().getColumn(0).setCellRenderer( new TableRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); traitsTable.getColumnModel().getColumn(0).setPreferredWidth(80); TableEditorStopper.ensureEditingStopWhenTableLosesFocus(traitsTable); traitsTable.getSelectionModel().setSelectionMode(ListSelectionModel.SINGLE_SELECTION); traitsTable.getSelectionModel().addListSelectionListener(new ListSelectionListener() { public void valueChanged(ListSelectionEvent evt) { traitSelectionChanged(); } }); JScrollPane scrollPane1 = new JScrollPane(traitsTable, JScrollPane.VERTICAL_SCROLLBAR_ALWAYS, JScrollPane.HORIZONTAL_SCROLLBAR_ALWAYS); scrollPane1.setOpaque(false); dataTableModel = new DataTableModel(); sorter = new TableSorter(dataTableModel); dataTable = new JTable(sorter); sorter.setTableHeader(dataTable.getTableHeader()); dataTable.getTableHeader().setReorderingAllowed(false); dataTable.getTableHeader().setDefaultRenderer( new HeaderRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); dataTable.getColumnModel().getColumn(0).setCellRenderer( new TableRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); dataTable.getColumnModel().getColumn(0).setPreferredWidth(80); TableColumn col = dataTable.getColumnModel().getColumn(1); ComboBoxRenderer comboBoxRenderer = new ComboBoxRenderer(); comboBoxRenderer.putClientProperty("JComboBox.isTableCellEditor", Boolean.TRUE); col.setCellRenderer(comboBoxRenderer); TableEditorStopper.ensureEditingStopWhenTableLosesFocus(dataTable); dataTable.getSelectionModel().addListSelectionListener(new ListSelectionListener() { public void valueChanged(ListSelectionEvent evt) { // traitSelectionChanged(); } }); JScrollPane scrollPane2 = new JScrollPane(dataTable, JScrollPane.VERTICAL_SCROLLBAR_ALWAYS, JScrollPane.HORIZONTAL_SCROLLBAR_ALWAYS); scrollPane2.setOpaque(false); JToolBar toolBar1 = new JToolBar(); toolBar1.setFloatable(false); toolBar1.setOpaque(false); toolBar1.setLayout(new FlowLayout(FlowLayout.LEFT, 0, 0)); JButton button = new JButton(guessLocationsAction); PanelUtils.setupComponent(button); toolBar1.add(button); button = new JButton(clearTraitAction); PanelUtils.setupComponent(button); toolBar1.add(button); // toolBar1.add(new JToolBar.Separator(new Dimension(12, 12))); ActionPanel actionPanel1 = new ActionPanel(false); actionPanel1.setAddAction(addTraitAction); actionPanel1.setRemoveAction(removeTraitAction); removeTraitAction.setEnabled(false); JToolBar toolBar2 = new JToolBar(); toolBar2.setFloatable(false); toolBar2.setOpaque(false); toolBar2.setLayout(new FlowLayout(FlowLayout.LEFT, 0, 0)); button = new JButton(importTraitsAction); PanelUtils.setupComponent(button); toolBar2.add(button); JPanel controlPanel1 = new JPanel(new FlowLayout(FlowLayout.LEFT)); controlPanel1.setOpaque(false); controlPanel1.add(actionPanel1); JPanel panel1 = new JPanel(new BorderLayout(0, 0)); panel1.setOpaque(false); panel1.add(toolBar2, BorderLayout.NORTH); panel1.add(scrollPane1, BorderLayout.CENTER); panel1.add(controlPanel1, BorderLayout.SOUTH); JPanel panel2 = new JPanel(new BorderLayout(0, 0)); panel2.setOpaque(false); panel2.add(toolBar1, BorderLayout.NORTH); panel2.add(scrollPane2, BorderLayout.CENTER); JSplitPane splitPane = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, panel1, panel2); splitPane.setDividerLocation(240); splitPane.setContinuousLayout(true); splitPane.setBorder(BorderFactory.createEmptyBorder()); splitPane.setOpaque(false); setOpaque(false); setBorder(new BorderUIResource.EmptyBorderUIResource(new Insets(12, 12, 12, 12))); setLayout(new BorderLayout(0, 0)); add(splitPane, BorderLayout.CENTER); } public void setOptions(BeautiOptions options) { this.options = options; int selRow = traitsTable.getSelectedRow(); traitsTableModel.fireTableDataChanged(); if (selRow < 0) { selRow = 0; } traitsTable.getSelectionModel().setSelectionInterval(selRow, selRow); if (selectedTrait == null) { traitsTable.getSelectionModel().setSelectionInterval(0, 0); } // traitsTableModel.fireTableDataChanged(); dataTableModel.fireTableDataChanged(); validate(); repaint(); } public void getOptions(BeautiOptions options) { int selRow = traitsTable.getSelectedRow(); if (selRow >= 0 && options.selecetedTraits.size() > 0) { selectedTrait = options.selecetedTraits.get(selRow); } // options.datesUnits = unitsCombo.getSelectedIndex(); // options.datesDirection = directionCombo.getSelectedIndex(); } public JComponent getExportableComponent() { return dataTable; } private void fireTraitsChanged() { frame.setDirty(); } private void traitSelectionChanged() { int selRow = traitsTable.getSelectedRow(); if (selRow >= 0 && options.selecetedTraits.size() > 0) { selectedTrait = options.selecetedTraits.get(selRow); removeTraitAction.setEnabled(true); } else { selectedTrait = null; removeTraitAction.setEnabled(false); } dataTableModel.fireTableDataChanged(); } public void clearTrait() { // for (int i = 0; i < options.taxonList.getTaxonCount(); i++) { // java.util.Date origin = new java.util.Date(0); // double d = 0.0; // Date date = Date.createTimeSinceOrigin(d, Units.Type.YEARS, origin); // options.taxonList.getTaxon(i).setAttribute("date", date); // // adjust the dates to the current timescale... // timeScaleChanged(); dataTableModel.fireTableDataChanged(); } public void guessTrait() { if( options.taxonList != null ) { // validation of check empty taxonList TraitGuesser guesser = options.traitGuesser; if (guessTraitDialog == null) { guessTraitDialog = new GuessTraitDialog(frame, guesser); } int result = guessTraitDialog.showDialog(); if (result == -1 || result == JOptionPane.CANCEL_OPTION) { return; } guesser.guessTrait = true; // ?? no use? guessTraitDialog.setupGuesser(); try { guesser.guessTrait(options); switch (guesser.traitAnalysisType) { case TRAIT_SPECIES : addTrait(TraitGuesser.Traits.TRAIT_SPECIES.toString(), guesser.traitType); frame.setupSpeciesAnalysis(); break; default: throw new IllegalArgumentException("unknown trait selected"); } } catch (IllegalArgumentException iae) { JOptionPane.showMessageDialog(this, iae.getMessage(), "Unable to guess trait value", JOptionPane.ERROR_MESSAGE); } dataTableModel.fireTableDataChanged(); frame.setDirty(); } else { JOptionPane.showMessageDialog(this, "No taxa loaded yet, please import Alignment file!", "No taxa loaded", JOptionPane.ERROR_MESSAGE); } } private void addTrait() { if (createTraitDialog == null) { createTraitDialog = new CreateTraitDialog(frame); } int result = createTraitDialog.showDialog(options); if (result != JOptionPane.CANCEL_OPTION) { String name = createTraitDialog.getName(); TraitGuesser.TraitType type = createTraitDialog.getType(); if (!options.selecetedTraits.contains(name)) { // The createTraitDialog will have already checked if the // user is overwriting an existing trait options.selecetedTraits.add(name); } options.traitTypes.put(name, type); traitsTableModel.fireTableDataChanged(); int row = options.selecetedTraits.size() - 1; traitsTable.getSelectionModel().setSelectionInterval(row, row); } fireTraitsChanged(); } private void addTrait(String traitName, TraitGuesser.TraitType traitType) { if (!options.selecetedTraits.contains(traitName)) { options.selecetedTraits.add(traitName); } options.traitTypes.put(traitName, traitType); traitsTableModel.fireTableDataChanged(); int row = options.selecetedTraits.size() - 1; traitsTable.getSelectionModel().setSelectionInterval(row, row); } private void removeTrait() { int selRow = traitsTable.getSelectedRow(); String trait = options.selecetedTraits.get(selRow); options.selecetedTraits.remove(trait); options.traitTypes.remove(trait); if (trait.equals(TraitGuesser.Traits.TRAIT_SPECIES.toString())) { frame.removeSepciesAnalysisSetup(); } traitsTableModel.fireTableDataChanged(); fireTraitsChanged(); } public class ClearTraitAction extends AbstractAction { private static final long serialVersionUID = -7281309694753868635L; public ClearTraitAction() { super("Clear trait values"); setToolTipText("Use this tool to remove trait values from each taxon"); } public void actionPerformed(ActionEvent ae) { clearTrait(); } } public class GuessLocationsAction extends AbstractAction { private static final long serialVersionUID = 8514706149822252033L; public GuessLocationsAction() { super("Guess trait values"); setToolTipText("Use this tool to guess the trait values from the taxon labels"); } public void actionPerformed(ActionEvent ae) { guessTrait(); } } AbstractAction addTraitAction = new AbstractAction() { public void actionPerformed(ActionEvent ae) { addTrait(); } }; AbstractAction removeTraitAction = new AbstractAction() { public void actionPerformed(ActionEvent ae) { removeTrait(); } }; class TraitsTableModel extends AbstractTableModel { private static final long serialVersionUID = -6707994233020715574L; String[] columnNames = {"Trait", "Type"}; public TraitsTableModel() { } public int getColumnCount() { return columnNames.length; } public int getRowCount() { if (options == null) return 0; if (options.selecetedTraits == null) return 0; return options.selecetedTraits.size(); } public Object getValueAt(int row, int col) { switch (col) { case 0: return options.selecetedTraits.get(row); case 1: return options.traitTypes.get(options.selecetedTraits.get(row)); } return null; } public void setValueAt(Object aValue, int row, int col) { if (col == 0) { options.selecetedTraits.set(row, aValue.toString()); } else if (col == 1) { options.traitTypes.put(options.selecetedTraits.get(row), (TraitGuesser.TraitType)aValue); } } public boolean isCellEditable(int row, int col) { // if (col == 0) return true; return false; } public String getColumnName(int column) { return columnNames[column]; } public Class getColumnClass(int c) { return getValueAt(0, c).getClass(); } public String toString() { StringBuffer buffer = new StringBuffer(); buffer.append(getColumnName(0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getColumnName(j)); } buffer.append("\n"); for (int i = 0; i < getRowCount(); i++) { buffer.append(getValueAt(i, 0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getValueAt(i, j)); } buffer.append("\n"); } return buffer.toString(); } } class DataTableModel extends AbstractTableModel { private static final long serialVersionUID = -6707994233020715574L; String[] columnNames = {"Taxon", "Value"}; public DataTableModel() { } public int getColumnCount() { return columnNames.length; } public int getRowCount() { if (options == null) return 0; if (options.taxonList == null) return 0; return options.taxonList.getTaxonCount(); } public Object getValueAt(int row, int col) { switch (col) { case 0: return options.taxonList.getTaxonId(row); case 1: Object value = null; if (selectedTrait != null) { value = options.taxonList.getTaxon(row).getAttribute(selectedTrait); } if (value != null) { return value; } else { return "-"; } } return null; } public void setValueAt(Object aValue, int row, int col) { if (col == 1) { // Location location = options.taxonList.getTaxon(row).getLocation(); // if (location != null) { // options.taxonList.getTaxon(row).setLocation(location); if (selectedTrait != null) { options.taxonList.getTaxon(row).setAttribute(selectedTrait, aValue); } } } public boolean isCellEditable(int row, int col) { if (col == 1) { Object t = options.taxonList.getTaxon(row).getAttribute(selectedTrait); return (t != null); } else { return false; } } public String getColumnName(int column) { return columnNames[column]; } public Class getColumnClass(int c) { return getValueAt(0, c).getClass(); } public String toString() { StringBuffer buffer = new StringBuffer(); buffer.append(getColumnName(0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getColumnName(j)); } buffer.append("\n"); for (int i = 0; i < getRowCount(); i++) { buffer.append(getValueAt(i, 0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getValueAt(i, j)); } buffer.append("\n"); } return buffer.toString(); } } }
package net.hillsdon.reviki.wiki.renderer.creole; import java.util.ArrayList; import java.util.List; import org.antlr.v4.runtime.ParserRuleContext; import com.uwyn.jhighlight.renderer.XhtmlRendererFactory; import net.hillsdon.reviki.vc.PageInfo; import net.hillsdon.reviki.web.urls.URLOutputFilter; import net.hillsdon.reviki.wiki.renderer.creole.ast.*; import net.hillsdon.reviki.wiki.renderer.creole.Creole.*; /** * Visitor which walks the parse tree to build a more programmer-friendly AST. * This also performs some non-standard rearrangement in order to replicate * functionality from the old renderer. * * @author msw */ public class Visitor extends CreoleASTBuilder { public Visitor(PageInfo page, URLOutputFilter urlOutputFilter, LinkPartsHandler linkHandler, LinkPartsHandler imageHandler) { super(page, urlOutputFilter, linkHandler, imageHandler); } /** * Render the root node, creole. creole contains zero or more block elements * separated by linebreaks and paragraph breaks. * * The rendering behaviour is to render each block individually, and then * display them sequentially in order. */ @Override public ASTNode visitCreole(CreoleContext ctx) { List<ASTNode> blocks = new ArrayList<ASTNode>(); for (BlockContext btx : ctx.block()) { ASTNode ren = visit(btx); if (ren != null) { blocks.add(ren); } } return new Page(blocks); } /** * Render a heading node. This consists of a prefix, the length of which will * tell us the heading level, and some content. */ @Override public ASTNode visitHeading(HeadingContext ctx) { return new Heading(ctx.HSt().getText().length(), visit(ctx.inline())); } /** * Render a paragraph node. This consists of a single inline element. Leading * and trailing newlines are stripped, and if the paragraph consists solely of * an inline nowiki line, it is instead rendered as a nowiki block, to * replicate old behaviour. */ @Override public ASTNode visitParagraph(ParagraphContext ctx) { ASTNode body = visit(ctx.inline()); ASTNode inner = body; // Drop leading and trailing newlines (TODO: Figure out how to do this in // the grammar, along with all the other stuff) if (body instanceof Inline) { int children = body.getChildren().size(); if (children > 0 && body.getChildren().get(0).toXHTML().equals("\n")) { body = new Inline(body.getChildren().subList(1, children)); children } if (children > 0 && body.getChildren().get(children - 1).toXHTML().equals("\n")) { body = new Inline(body.getChildren().subList(0, children - 1)); } } // If a paragraph contains nothing but an inline nowiki element, render that // as a block nowiki element. Not quite to spec, but replicates old // behaviour. if (body instanceof Inline && body.getChildren().size() == 1) { inner = body.getChildren().get(0); } if (inner instanceof InlineCode) { return ((InlineCode) inner).toBlock(); } // If a paragraph contains only a macro node, remove the enclosing // paragraph. if (inner instanceof MacroNode) { return inner; } return new Paragraph(body); } /** * Render an inline node. This consists of a list of chunks of smaller markup * units, which are displayed in order. */ @Override public ASTNode visitInline(InlineContext ctx) { List<ASTNode> chunks = new ArrayList<ASTNode>(); // Merge adjacent Any nodes into long Plaintext nodes, to give a more useful // AST. ASTNode last = null; for (InlinestepContext itx : ctx.inlinestep()) { ASTNode rendered = visit(itx); if (last == null) { last = rendered; } else { if (last instanceof Plaintext && rendered instanceof Plaintext) { last = new Plaintext(((Plaintext)last).getText() + ((Plaintext)rendered).getText()); } else { chunks.add(last); last = rendered; } } } if (last != null) { chunks.add(last); } return new Inline(chunks); } /** * Render an any node. This consists of some plaintext, which is escaped and * displayed with no further processing. */ @Override public ASTNode visitAny(AnyContext ctx) { return new Plaintext(ctx.getText()); } /** * Render a WikiWords link. */ @Override public ASTNode visitWikiwlink(WikiwlinkContext ctx) { return new Link(ctx.getText(), ctx.getText(), page, urlOutputFilter, linkHandler); } /** * Render an external bugtracker link */ @Override public ASTNode visitEbuglink(EbuglinkContext ctx) { String url = String.format(CreoleRenderer.EXTERNAL_BUG_URL, ctx.BugNum().getText()); return new Link(url, ctx.getText(), page, urlOutputFilter, linkHandler); } /** * Render an internal bugtracker link */ @Override public ASTNode visitIbuglink(IbuglinkContext ctx) { String url = String.format(CreoleRenderer.INTERNAL_BUG_URL, ctx.BugNum().getText()); return new Link(url, ctx.getText(), page, urlOutputFilter, linkHandler); } /** * Render a raw URL link. */ @Override public ASTNode visitRawlink(RawlinkContext ctx) { return new Link(ctx.getText(), ctx.getText(), page, urlOutputFilter, linkHandler); } /** * Render bold nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitBold(BoldContext ctx) { return renderInlineMarkup(Bold.class, "**", "BEnd", ctx.BEnd(), ctx.inline()); } /** * Render italic nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitItalic(ItalicContext ctx) { return renderInlineMarkup(Italic.class, "//", "IEnd", ctx.IEnd(), ctx.inline()); } /** * Render strikethrough nodes, with error recovery by {@link #renderInline}. */ @Override public ASTNode visitSthrough(SthroughContext ctx) { return renderInlineMarkup(Strikethrough.class, "--", "SEnd", ctx.SEnd(), ctx.inline()); } /** * Render a link node with no title. */ @Override public ASTNode visitLink(LinkContext ctx) { return new Link(ctx.InLink().getText(), ctx.InLink().getText(), page, urlOutputFilter, linkHandler); } /** * Render a link node with a title. */ @Override public ASTNode visitTitlelink(TitlelinkContext ctx) { return new Link(ctx.InLink(0).getText(), ctx.InLink(1).getText(), page, urlOutputFilter, linkHandler); } /** * Render an image node. */ @Override public ASTNode visitImglink(ImglinkContext ctx) { return new Image(ctx.InLink(0).getText(), ctx.InLink(1).getText(), page, urlOutputFilter, imageHandler); } /** * Render an image without a title. */ @Override public ASTNode visitSimpleimg(SimpleimgContext ctx) { return new Image(ctx.InLink().getText(), ctx.InLink().getText(), page, urlOutputFilter, imageHandler); } /** * Render an inline nowiki node. Due to how the lexer works, the contents * include the ending symbol, which must be chopped off. * * TODO: Improve the tokensiation of this. */ @Override public ASTNode visitPreformat(PreformatContext ctx) { return renderInlineCode(ctx.EndNoWikiInline(), "}}}"); } /** * Render a syntax-highlighted CPP block. This has the same tokenisation * problem as mentioned in {@link #visitPreformat}. */ @Override public ASTNode visitInlinecpp(InlinecppContext ctx) { return renderInlineCode(ctx.EndCppInline(), "[</c++>]", XhtmlRendererFactory.CPLUSPLUS); } /** * Render a block of literal, unescaped, HTML. */ @Override public ASTNode visitInlinehtml(InlinehtmlContext ctx) { String code = ctx.EndHtmlInline().getText(); return new Raw(code.substring(0, code.length() - "[</html>]".length())); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode} */ @Override public ASTNode visitInlinejava(InlinejavaContext ctx) { return renderInlineCode(ctx.EndJavaInline(), "[</java>]", XhtmlRendererFactory.JAVA); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode} */ @Override public ASTNode visitInlinexhtml(InlinexhtmlContext ctx) { return renderInlineCode(ctx.EndXhtmlInline(), "[</xhtml>]", XhtmlRendererFactory.XHTML); } /** See {@link #visitInlinecpp} and {@link #renderInlineCode} */ @Override public ASTNode visitInlinexml(InlinexmlContext ctx) { return renderInlineCode(ctx.EndXmlInline(), "[</xml>]", XhtmlRendererFactory.XML); } /** * Render a literal linebreak node */ @Override public ASTNode visitLinebreak(LinebreakContext ctx) { return new Linebreak(); } /** * Render a horizontal rule node. */ @Override public ASTNode visitHrule(HruleContext ctx) { return new HorizontalRule(); } /** * Render an ordered list. List rendering is a bit of a mess at the moment, * but it basically works like this: * * - Lists have a root node, which contains level 1 elements. * * - There are levels 1 through 5. * * - Each level (other than 5) may have child list elements. * * - Each level (other than root) may also have some content, which can be a * new list (ordered or unordered), or inline text. * * The root list node is rendered by displaying all level 1 entities in * sequence, where level n entities are rendered by displaying their content * and then any children they have. * * TODO: Figure out how to have arbitrarily-nested lists. */ @Override public ASTNode visitOlist(OlistContext ctx) { return renderList(ListType.Ordered, ctx.olist1()); } /** See {@link #visitOlist} */ @Override public ASTNode visitOlist1(Olist1Context ctx) { ListType type = (ctx.list2().isEmpty() || ctx.list2().get(0).ulist2() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list2(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitOlist2(Olist2Context ctx) { ListType type = (ctx.list3().isEmpty() || ctx.list3().get(0).ulist3() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list3(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitOlist3(Olist3Context ctx) { ListType type = (ctx.list4().isEmpty() || ctx.list4().get(0).ulist4() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list4(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitOlist4(Olist4Context ctx) { ListType type = (ctx.list5().isEmpty() || ctx.list5().get(0).ulist5() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list5(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitOlist5(Olist5Context ctx) { return renderListItem(ListType.Ordered, new ArrayList<ParserRuleContext>(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist(UlistContext ctx) { return renderList(ListType.Unordered, ctx.ulist1()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist1(Ulist1Context ctx) { ListType type = (ctx.list2().isEmpty() || ctx.list2().get(0).ulist2() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list2(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist2(Ulist2Context ctx) { ListType type = (ctx.list3().isEmpty() || ctx.list3().get(0).ulist3() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list3(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist3(Ulist3Context ctx) { ListType type = (ctx.list4().isEmpty() || ctx.list4().get(0).ulist4() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list4(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist4(Ulist4Context ctx) { ListType type = (ctx.list5().isEmpty() || ctx.list5().get(0).ulist5() == null) ? ListType.Ordered : ListType.Unordered; return renderListItem(type, ctx.list5(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** See {@link #visitOlist} */ @Override public ASTNode visitUlist5(Ulist5Context ctx) { return renderListItem(ListType.Unordered, new ArrayList<ParserRuleContext>(), ctx.olist(), ctx.ulist(), ctx.inline()); } /** * Render a NoWiki block node. This has the same tokenisation problem as * mentioned in {@link #visitPreformat}. */ @Override public ASTNode visitNowiki(NowikiContext ctx) { return renderBlockCode(ctx.EndNoWikiBlock(), "}}}"); } /** * Like {@link #visitInlinecpp}, but for blocks. */ @Override public ASTNode visitCpp(CppContext ctx) { return renderBlockCode(ctx.EndCppBlock(), "[</c++>]", XhtmlRendererFactory.CPLUSPLUS); } /** * Render a block of literal, unescaped, HTML. */ @Override public ASTNode visitHtml(HtmlContext ctx) { String code = ctx.EndHtmlBlock().getText(); return new Raw(code.substring(0, code.length() - "[</html>]".length())); } /** See {@link #visitCpp} and {@link #renderBlockCode} */ @Override public ASTNode visitJava(JavaContext ctx) { return renderBlockCode(ctx.EndJavaBlock(), "[</java>]", XhtmlRendererFactory.JAVA); } /** See {@link #visitCpp} and {@link #renderBlockCode} */ @Override public ASTNode visitXhtml(XhtmlContext ctx) { return renderBlockCode(ctx.EndXhtmlBlock(), "[</xhtml>]", XhtmlRendererFactory.XHTML); } /** See {@link #visitCpp} and {@link #renderBlockCode} */ @Override public ASTNode visitXml(XmlContext ctx) { return renderBlockCode(ctx.EndXmlBlock(), "[</xml>]", XhtmlRendererFactory.XML); } /** * Render a table node. This consists of rendering all rows in sequence. */ @Override public ASTNode visitTable(TableContext ctx) { List<ASTNode> rows = new ArrayList<ASTNode>(); for (TrowContext rtx : ctx.trow()) { rows.add(visit(rtx)); } return new Table(rows); } /** * Render a table row. A table row consists of a number of cells, and a * possible trailing separator. At the moment, the trailing separator is * handled explicitly here, rather than nicely in the grammar. * * TODO: Handle the trailing separator in the grammar, and remove the check * here. */ @Override public ASTNode visitTrow(TrowContext ctx) { List<ASTNode> cells = new ArrayList<ASTNode>(); for (TcellContext rtx : ctx.tcell()) { cells.add(visit(rtx)); } // If the last cell is empty, it's a trailing separator - not actually a new // cell. if (cells.size() != 0) { ASTNode last = cells.get(cells.size() - 1); if (last instanceof TableCell && last.getChildren().get(0).toXHTML().matches("^\\W*$")) { cells.remove(last); } } return new TableRow(cells); } /** * Render a table heading cell. */ @Override public ASTNode visitTh(ThContext ctx) { return new TableHeaderCell((ctx.inline() != null) ? visit(ctx.inline()) : new Plaintext("")); } /** * Render a table cell. */ @Override public ASTNode visitTd(TdContext ctx) { return new TableCell((ctx.inline() != null) ? visit(ctx.inline()) : new Plaintext("")); } /** * Render a macro. */ @Override public ASTNode visitMacro(MacroContext ctx) { return new MacroNode(ctx.MacroName().getText(), cutOffEndTag(ctx.MacroEnd(), ">>"), page, urlOutputFilter, linkHandler, imageHandler); } }
package org.example; import javax.crypto.Cipher; import javax.crypto.spec.IvParameterSpec; import javax.crypto.spec.SecretKeySpec; import java.nio.charset.StandardCharsets; import java.util.Base64; public class App { private static final byte[] key = "abcdefghijklmnop".getBytes(); private static final byte[] iv = "0123456789012345".getBytes(); private byte[] encrypt(byte[] input) throws Exception { SecretKeySpec key = new SecretKeySpec(App.key, "AES"); IvParameterSpec iv = new IvParameterSpec(App.iv); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.ENCRYPT_MODE, key, iv); return cipher.doFinal(input); } private byte[] decrypt(byte[] input) throws Exception { SecretKeySpec key = new SecretKeySpec(App.key, "AES"); IvParameterSpec iv = new IvParameterSpec(App.iv); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.DECRYPT_MODE, key, iv); return cipher.doFinal(input); } public static void main(String... args) throws Exception { App app = new App(); { String original = "your name is"; byte[] input = original.getBytes(StandardCharsets.UTF_8); byte[] encrpyted = app.encrypt(input); byte[] decrpypted = app.decrypt(encrpyted); String result = new String(decrpypted, StandardCharsets.UTF_8); System.out.println(String.format(" original: '%s'", original)); System.out.println(String.format("encrypted: '%s'", Base64.getEncoder().encodeToString(encrpyted))); System.out.println(String.format("decrypted: '%s'", Base64.getEncoder().encodeToString(decrpypted))); System.out.println(String.format(" result: '%s'", result)); System.out.println(String.format(" 123456789 123456789 123456789 123456789")); } int loop = 100000; { byte[] headOfReturns = new byte[loop]; long from = System.currentTimeMillis(); for (int i = 0; i < loop; i++) { byte[] ret = app.encrypt(String.format("hoge-%d", i).getBytes(StandardCharsets.UTF_8)); headOfReturns[i] = ret[0]; } long to = System.currentTimeMillis(); System.out.println(); System.out.println(String.format("%d times, elapsed: %d msec,\nreturns: %s", loop, to - from, Base64.getEncoder().encodeToString(headOfReturns))); } { SecretKeySpec key = new SecretKeySpec(App.key, "AES"); IvParameterSpec iv = new IvParameterSpec(App.iv); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.ENCRYPT_MODE, key, iv); byte[] headOfReturns = new byte[loop]; long from = System.currentTimeMillis(); for (int i = 0; i < loop; i++) { byte[] ret = cipher.doFinal(String.format("hoge-%d", i).getBytes(StandardCharsets.UTF_8)); headOfReturns[i] = ret[0]; } long to = System.currentTimeMillis(); System.out.println(); System.out.println(String.format("%d times, elapsed: %d msec,\nreturns: %s", loop, to - from, Base64.getEncoder().encodeToString(headOfReturns))); } } }
package edu.afs.subsystems.drivesubsystem; import edu.wpi.first.wpilibj.command.PIDSubsystem; import edu.wpi.first.wpilibj.Talon; import edu.wpi.first.wpilibj.Gyro; import edu.wpi.first.wpilibj.AnalogChannel; import edu.wpi.first.wpilibj.RobotDrive; import edu.wpi.first.wpilibj.PIDSource; import edu.afs.commands.DriveToShotRangeCommand; import edu.afs.commands.DriveWithJoystickCommand; import edu.afs.robot.OI; import edu.afs.robot.RobotMap; /** * * @author User */ public class DrivePIDSubsystem extends PIDSubsystem { // PID tuning parameters. //TODO: Pick tuning parameters. private static final double K_PROPORTIONAL = 0.03; private static final double K_INTEGRAL = 0.0; private static final double K_DERIVATIVE = 0.0; private static final double STRAIGHT_AHEAD_STEER_ANGLE = 0.0; public static final double DRIVE_MAX_INPUT = 1.0; public static final double DRIVE_MIN_INPUT = -1.0; RobotDrive m_drive; Talon m_leftDrive; Talon m_rightDrive; Gyro m_gyro; AnalogChannel m_gyroChannel; double m_steerAngle; double m_steeringSetPoint; // Implement Singleton design pattern. There // can be only one instance of this subsystem. static DrivePIDSubsystem instance = null; public static DrivePIDSubsystem getInstance () { if (instance == null) { instance = new DrivePIDSubsystem(); } return instance; } // Constructor is private to enforce Singelton. private DrivePIDSubsystem() { super("DrivePIDSubsystem", K_PROPORTIONAL, K_INTEGRAL, K_DERIVATIVE); // Drive set-up. m_leftDrive = new Talon(RobotMap.DRIVE_LEFT_MOTOR_CHANNEL); m_rightDrive = new Talon(RobotMap.DRIVE_RIGHT_MOTOR_CHANNEL); m_drive = new RobotDrive(m_leftDrive, m_rightDrive); m_drive.setSafetyEnabled(false); // Gyro stabilization set-up. m_gyroChannel = new AnalogChannel (RobotMap.GYRO_CHANNEL); m_gyro = new Gyro(m_gyroChannel); getPIDController().disable(); m_steerAngle = 0.0; m_steeringSetPoint = 0.0; } public void initDefaultCommand() { // Set the default command for a subsystem here. setDefaultCommand(new DriveWithJoystickCommand()); } public void driveWithJoystick() { m_drive.arcadeDrive(OI.getInstance().getJoystick()); } // Move bot forward or backwards at specified speed. // No gyro-stabilization of bearing is used. public void driveStraight (double speed) { // TODO: Do any speed value translation here. // Speed input ranges from 1.0 (max forward) to -1.0 // (max reverse). Steer angle input ranges from 1.0 (max CW) to -1.0 // (max CCW). m_drive.drive(speed, STRAIGHT_AHEAD_STEER_ANGLE); } // Move bot forward or backwards at specified speed. // Bearing is gyro-stabilized. public void driveStraightGyroStabilized (double speed) { // TODO: Do any speed value and steer angle translation here. // m_steerAngle is set by PID Controller. // Speed input ranges from 1.0 (max forward) to -1.0 // (max reverse). Steer angle input ranges from 1.0 (max CW) to -1.0 // (max CCW). m_drive.drive(speed, m_steerAngle); } public void initBearingStabilizer(){ // Add gyro and PID set-up code. // TODO: Determine correct tolerance for "close enough" to set point. //getPIDController().setAbsoluteTolerance(???); // Treat input range as continuous so PID controller will correct // angle by shortest path. getPIDController().setContinuous(true); //TODO: Determine output range from gyro (-360.0 to 360.0 degrees?????) //getPIDController().setInputRange(???, ???); getPIDController().setOutputRange(DRIVE_MIN_INPUT, DRIVE_MAX_INPUT); m_gyro.setPIDSourceParameter(PIDSource.PIDSourceParameter.kAngle); //TODO: Set Gyro sensitivity //m_gyro.setSensitivity(?????????????????); //Set gyro zero point. m_gyro.reset(); // Establish set point for straight-ahead driving. // Assume that bot is oriented perpendicular to 10-point goal. // Use the current reading of the gyro. //TODO: Verify that pidGet returns the value we want for comparison. m_steeringSetPoint = m_gyro.pidGet(); getPIDController().setSetpoint(m_steeringSetPoint); getPIDController().enable(); } public void disableBearingStabilizer(){ getPIDController().reset(); m_gyro.reset(); getPIDController().disable(); } //TODO: Make sure that units and range of values make sense for PID inputs // and outputs!!!!!!!!!!!!!! // Called every 20 ms by PID Controller. protected double returnPIDInput() { // Return your input value for the PID loop. //TODO: Determine if any value conversion is needed. return m_gyro.pidGet(); } //TODO: Make sure that units and range of values make sense for PID inputs // and outputs!!!!!!!!!!!!!! // Called every 20 ms by PID Controller. protected void usePIDOutput(double output) { // Use output to drive your system. m_steerAngle = output; } }
package dr.app.beauti.traitspanel; import dr.app.beauti.BeautiFrame; import dr.app.beauti.BeautiPanel; import dr.app.beauti.ComboBoxRenderer; import dr.app.beauti.datapanel.DataPanel; import dr.app.beauti.options.BeautiOptions; import dr.app.beauti.options.TraitData; import dr.app.beauti.options.TraitGuesser; import dr.app.beauti.util.PanelUtils; import dr.app.gui.table.TableEditorStopper; import dr.app.gui.table.TableSorter; import dr.evolution.util.Taxa; import dr.evolution.util.Taxon; import jam.framework.Exportable; import jam.panels.ActionPanel; import jam.table.TableRenderer; import javax.swing.*; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import javax.swing.plaf.BorderUIResource; import javax.swing.table.AbstractTableModel; import javax.swing.table.TableColumn; import java.awt.*; import java.awt.event.ActionEvent; import java.util.ArrayList; /** * @author Andrew Rambaut * @version $Id: DataPanel.java,v 1.17 2006/09/05 13:29:34 rambaut Exp $ */ public class TraitsPanel extends BeautiPanel implements Exportable { private static final long serialVersionUID = 5283922195494563924L; private static final int MINIMUM_TABLE_WIDTH = 140; private static final String ADD_TRAITS_TOOLTIP = "<html>Define a new trait for the current taxa</html>"; private static final String IMPORT_TRAITS_TOOLTIP = "<html>Import one or more traits for these taxa from a tab-delimited<br>" + "file. Taxa should be in the first column and the trait names<br>" + "in the first row</html>"; private static final String GUESS_TRAIT_VALUES_TOOLTIP = "<html>This attempts to extract values for this trait that are<br>" + "encoded in the names of the selected taxa.</html>"; private static final String SET_TRAIT_VALUES_TOOLTIP = "<html>This sets values for this trait for all<br>" + "the selected taxa.</html>"; private static final String CLEAR_TRAIT_VALUES_TOOLTIP = "<html>This clears all the values currently assigned to taxa for<br>" + "this trait.</html>"; private static final String CREATE_TRAIT_PARTITIONS_TOOLTIP = "<html>Create a data partition for the selected traits.</html>"; public final JTable traitsTable; private final TraitsTableModel traitsTableModel; private final JTable dataTable; private final DataTableModel dataTableModel; private final BeautiFrame frame; private final DataPanel dataPanel; private BeautiOptions options = null; private TraitData currentTrait = null; // current trait private CreateTraitDialog createTraitDialog = null; private GuessTraitDialog guessTraitDialog = null; private TraitValueDialog traitValueDialog = null; AddTraitAction addTraitAction = new AddTraitAction(); Action importTraitsAction; CreateTraitPartitionAction createTraitPartitionAction = new CreateTraitPartitionAction(); GuessTraitsAction guessTraitsAction = new GuessTraitsAction(); SetValueAction setValueAction = new SetValueAction(); public TraitsPanel(BeautiFrame parent, DataPanel dataPanel, Action importTraitsAction) { this.frame = parent; this.dataPanel = dataPanel; traitsTableModel = new TraitsTableModel(); // TableSorter sorter = new TableSorter(traitsTableModel); // traitsTable = new JTable(sorter); // sorter.setTableHeader(traitsTable.getTableHeader()); traitsTable = new JTable(traitsTableModel); traitsTable.getTableHeader().setReorderingAllowed(false); traitsTable.getTableHeader().setResizingAllowed(false); // traitsTable.getTableHeader().setDefaultRenderer( // new HeaderRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); TableColumn col = traitsTable.getColumnModel().getColumn(1); ComboBoxRenderer comboBoxRenderer = new ComboBoxRenderer(TraitData.TraitType.values()); comboBoxRenderer.putClientProperty("JComboBox.isTableCellEditor", Boolean.TRUE); col.setCellRenderer(comboBoxRenderer); TableEditorStopper.ensureEditingStopWhenTableLosesFocus(traitsTable); traitsTable.getSelectionModel().setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); traitsTable.getSelectionModel().addListSelectionListener(new ListSelectionListener() { public void valueChanged(ListSelectionEvent evt) { traitSelectionChanged(); // dataTableModel.fireTableDataChanged(); } }); JScrollPane scrollPane1 = new JScrollPane(traitsTable, JScrollPane.VERTICAL_SCROLLBAR_ALWAYS, JScrollPane.HORIZONTAL_SCROLLBAR_ALWAYS); scrollPane1.setOpaque(false); dataTableModel = new DataTableModel(); TableSorter sorter = new TableSorter(dataTableModel); dataTable = new JTable(sorter); sorter.setTableHeader(dataTable.getTableHeader()); dataTable.getTableHeader().setReorderingAllowed(false); // dataTable.getTableHeader().setDefaultRenderer( // new HeaderRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); dataTable.getColumnModel().getColumn(0).setCellRenderer( new TableRenderer(SwingConstants.LEFT, new Insets(0, 4, 0, 4))); dataTable.getColumnModel().getColumn(0).setPreferredWidth(80); col = dataTable.getColumnModel().getColumn(1); comboBoxRenderer = new ComboBoxRenderer(); comboBoxRenderer.putClientProperty("JComboBox.isTableCellEditor", Boolean.TRUE); col.setCellRenderer(comboBoxRenderer); TableEditorStopper.ensureEditingStopWhenTableLosesFocus(dataTable); // dataTable.getSelectionModel().addListSelectionListener(new ListSelectionListener() { // public void valueChanged(ListSelectionEvent evt) { // traitSelectionChanged(); JScrollPane scrollPane2 = new JScrollPane(dataTable, JScrollPane.VERTICAL_SCROLLBAR_ALWAYS, JScrollPane.HORIZONTAL_SCROLLBAR_ALWAYS); scrollPane2.setOpaque(false); JToolBar toolBar1 = new JToolBar(); toolBar1.setFloatable(false); toolBar1.setOpaque(false); toolBar1.setLayout(new FlowLayout(FlowLayout.LEFT, 0, 0)); JButton button; button = new JButton(addTraitAction); PanelUtils.setupComponent(button); button.setToolTipText(ADD_TRAITS_TOOLTIP); toolBar1.add(button); this.importTraitsAction = importTraitsAction; button = new JButton(importTraitsAction); PanelUtils.setupComponent(button); button.setToolTipText(IMPORT_TRAITS_TOOLTIP); toolBar1.add(button); toolBar1.add(new JToolBar.Separator(new Dimension(12, 12))); button = new JButton(guessTraitsAction); PanelUtils.setupComponent(button); button.setToolTipText(GUESS_TRAIT_VALUES_TOOLTIP); toolBar1.add(button); button = new JButton(setValueAction); PanelUtils.setupComponent(button); button.setToolTipText(SET_TRAIT_VALUES_TOOLTIP); toolBar1.add(button); // Don't see the need for a clear values button // button = new JButton(new ClearTraitAction()); // PanelUtils.setupComponent(button); // button.setToolTipText(CLEAR_TRAIT_VALUES_TOOLTIP); // toolBar1.add(button); button = new JButton(createTraitPartitionAction); PanelUtils.setupComponent(button); button.setToolTipText(CREATE_TRAIT_PARTITIONS_TOOLTIP); toolBar1.add(button); ActionPanel actionPanel1 = new ActionPanel(false); actionPanel1.setAddAction(addTraitAction); actionPanel1.setRemoveAction(removeTraitAction); actionPanel1.setAddToolTipText(ADD_TRAITS_TOOLTIP); removeTraitAction.setEnabled(false); JPanel controlPanel1 = new JPanel(new FlowLayout(FlowLayout.LEFT)); controlPanel1.setOpaque(false); controlPanel1.add(actionPanel1); JPanel panel1 = new JPanel(new BorderLayout(0, 0)); panel1.setOpaque(false); panel1.add(scrollPane1, BorderLayout.CENTER); panel1.add(controlPanel1, BorderLayout.SOUTH); panel1.setMinimumSize(new Dimension(MINIMUM_TABLE_WIDTH, 0)); JPanel panel2 = new JPanel(new BorderLayout(0, 0)); panel2.setOpaque(false); panel2.add(toolBar1, BorderLayout.NORTH); panel2.add(scrollPane2, BorderLayout.CENTER); JSplitPane splitPane = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, panel1, panel2); splitPane.setDividerLocation(MINIMUM_TABLE_WIDTH); splitPane.setContinuousLayout(true); splitPane.setBorder(BorderFactory.createEmptyBorder()); splitPane.setOpaque(false); setOpaque(false); setBorder(new BorderUIResource.EmptyBorderUIResource(new Insets(12, 12, 12, 12))); setLayout(new BorderLayout(0, 0)); add(splitPane, BorderLayout.CENTER); add(toolBar1, BorderLayout.NORTH); } public void setOptions(BeautiOptions options) { this.options = options; updateButtons(); // int selRow = traitsTable.getSelectedRow(); // traitsTableModel.fireTableDataChanged(); // if (selRow < 0) { // selRow = 0; // traitsTable.getSelectionModel().setSelectionInterval(selRow, selRow); // if (selectedTrait == null) { // traitsTable.getSelectionModel().setSelectionInterval(0, 0); traitsTableModel.fireTableDataChanged(); dataTableModel.fireTableDataChanged(); validate(); repaint(); } public void getOptions(BeautiOptions options) { // int selRow = traitsTable.getSelectedRow(); // if (selRow >= 0 && options.traitsOptions.selecetedTraits.size() > 0) { // selectedTrait = options.traitsOptions.selecetedTraits.get(selRow); // options.datesUnits = unitsCombo.getSelectedIndex(); // options.datesDirection = directionCombo.getSelectedIndex(); } public JComponent getExportableComponent() { return dataTable; } public void fireTraitsChanged() { if (currentTrait != null) { // if (currentTrait.getName().equalsIgnoreCase(TraitData.Traits.TRAIT_SPECIES.toString())) { // frame.setupStarBEAST(); // } else if (currentTrait != null && currentTrait.getTraitType() == TraitData.TraitType.DISCRETE) { frame.updateDiscreteTraitAnalysis(); } // if (selRow > 0) { // traitsTable.getSelectionModel().setSelectionInterval(selRow-1, selRow-1); // } else if (selRow == 0 && options.traitsOptions.traits.size() > 0) { // options.traitsOptions.traits.size() after remove // traitsTable.getSelectionModel().setSelectionInterval(0, 0); traitsTableModel.fireTableDataChanged(); options.updatePartitionAllLinks(); frame.setDirty(); } } private void traitSelectionChanged() { int selRow = traitsTable.getSelectedRow(); if (selRow >= 0) { currentTrait = options.traits.get(selRow); // traitsTable.getSelectionModel().setSelectionInterval(selRow, selRow); removeTraitAction.setEnabled(true); // } else { // currentTrait = null; // removeTraitAction.setEnabled(false); } if (options.traits.size() <= 0) { currentTrait = null; removeTraitAction.setEnabled(false); } dataTableModel.fireTableDataChanged(); // traitsTableModel.fireTableDataChanged(); } private void updateButtons() { //TODO: better to merge updateButtons() fireTraitsChanged() traitSelectionChanged() into one boolean hasData = options.hasData(); addTraitAction.setEnabled(hasData); importTraitsAction.setEnabled(hasData); createTraitPartitionAction.setEnabled(hasData && options.traits.size() > 0); guessTraitsAction.setEnabled(hasData && options.traits.size() > 0); setValueAction.setEnabled(hasData && options.traits.size() > 0); } public void clearTraitValues(String traitName) { options.clearTraitValues(traitName); dataTableModel.fireTableDataChanged(); } public void guessTrait() { if (options.taxonList == null) { // validation of check empty taxonList return; } if (currentTrait == null) { if (!addTrait()) { return; // if addTrait() cancel then false } } int result; do { TraitGuesser currentTraitGuesser = new TraitGuesser(currentTrait); if (guessTraitDialog == null) { guessTraitDialog = new GuessTraitDialog(frame); } guessTraitDialog.setDescription("Extract values for trait '" + currentTrait + "' from taxa labels"); result = guessTraitDialog.showDialog(); if (result == -1 || result == JOptionPane.CANCEL_OPTION) { return; } guessTraitDialog.setupGuesserFromDialog(currentTraitGuesser); try { int[] selRows = dataTable.getSelectedRows(); if (selRows.length > 0) { Taxa selectedTaxa = new Taxa(); for (int row : selRows) { Taxon taxon = (Taxon) dataTable.getValueAt(row, 0); selectedTaxa.addTaxon(taxon); } currentTraitGuesser.guessTrait(selectedTaxa); } else { currentTraitGuesser.guessTrait(options.taxonList); } } catch (IllegalArgumentException iae) { JOptionPane.showMessageDialog(this, iae.getMessage(), "Unable to guess trait value", JOptionPane.ERROR_MESSAGE); result = -1; } dataTableModel.fireTableDataChanged(); } while (result < 0); } public void setTraitValue() { if (options.taxonList == null) { // validation of check empty taxonList return; } int result; do { if (traitValueDialog == null) { traitValueDialog = new TraitValueDialog(frame); } int[] selRows = dataTable.getSelectedRows(); if (selRows.length > 0) { traitValueDialog.setDescription("Set values for trait '" + currentTrait + "' for selected taxa"); } else { traitValueDialog.setDescription("Set values for trait '" + currentTrait + "' for all taxa"); } result = traitValueDialog.showDialog(); if (result == -1 || result == JOptionPane.CANCEL_OPTION) { return; } // currentTrait.guessTrait = true; // ?? no use? String value = traitValueDialog.getTraitValue(); try { if (selRows.length > 0) { for (int row : selRows) { Taxon taxon = (Taxon) dataTable.getValueAt(row, 0); taxon.setAttribute(currentTrait.getName(), value); } } else { for (Taxon taxon : options.taxonList) { taxon.setAttribute(currentTrait.getName(), value); } } } catch (IllegalArgumentException iae) { JOptionPane.showMessageDialog(this, iae.getMessage(), "Unable to guess trait value", JOptionPane.ERROR_MESSAGE); result = -1; } dataTableModel.fireTableDataChanged(); } while (result < 0); } public boolean addTrait() { return addTrait("Untitled"); } public boolean addTrait(String traitName) { return addTrait(null, traitName, false); } public boolean addTrait(String message, String traitName, boolean isSpeciesTrait) { if (createTraitDialog == null) { createTraitDialog = new CreateTraitDialog(frame); } createTraitDialog.setSpeciesTrait(isSpeciesTrait); createTraitDialog.setTraitName(traitName); createTraitDialog.setMessage(message); int result = createTraitDialog.showDialog(); if (result == JOptionPane.OK_OPTION) { frame.tabbedPane.setSelectedComponent(this); String name = createTraitDialog.getName(); TraitData.TraitType type = createTraitDialog.getType(); TraitData newTrait = new TraitData(options, name, "", type); currentTrait = newTrait; // The createTraitDialog will have already checked if the // user is overwriting an existing trait addTrait(newTrait); if (createTraitDialog.createTraitPartition()) { options.createPartitionForTraits(name, newTrait); } fireTraitsChanged(); updateButtons(); } else if (result == CreateTraitDialog.OK_IMPORT) { boolean done = frame.doImportTraits(); if (done) { if (isSpeciesTrait) { // check that we did indeed import a 'species' trait if (!options.traitExists(TraitData.TRAIT_SPECIES)) { JOptionPane.showMessageDialog(this, "The imported trait file didn't contain a trait\n" + "called '" + TraitData.TRAIT_SPECIES + "', required for *BEAST.\n" + "Please edit it or select a different file.", "Reserved trait name", JOptionPane.WARNING_MESSAGE); return false; } } updateButtons(); } return done; } else if (result == JOptionPane.CANCEL_OPTION) { return false; } return true; } public void createTraitPartition() { int[] selRows = traitsTable.getSelectedRows(); java.util.List<TraitData> traits = new ArrayList<TraitData>(); int discreteCount = 0; int continuousCount = 0; for (int row : selRows) { TraitData trait = options.traits.get(row); traits.add(trait); if (trait.getTraitType() == TraitData.TraitType.DISCRETE) { discreteCount ++; } if (trait.getTraitType() == TraitData.TraitType.CONTINUOUS) { continuousCount ++; } } boolean success = false; if (discreteCount > 0) { if (continuousCount > 0) { JOptionPane.showMessageDialog(TraitsPanel.this, "Don't mix discrete and continuous traits when creating partition(s).", "Mixed Trait Types", JOptionPane.ERROR_MESSAGE); return; } // with discrete traits, create a separate partition for each for (TraitData trait : traits) { java.util.List<TraitData> singleTrait = new ArrayList<TraitData>(); singleTrait.add(trait); if (dataPanel.createFromTraits(singleTrait)) { success = true; } } } else { // with success = dataPanel.createFromTraits(traits); } if (success) { frame.switchToPanel(BeautiFrame.DATA_PARTITIONS); } } public void addTrait(TraitData newTrait) { int selRow = options.addTrait(newTrait); traitsTable.getSelectionModel().setSelectionInterval(selRow, selRow); } private void removeTrait() { int selRow = traitsTable.getSelectedRow(); removeTrait(traitsTable.getValueAt(selRow, 0).toString()); } public void removeTrait(String traitName) { if (options.useStarBEAST && traitName.equalsIgnoreCase(TraitData.TRAIT_SPECIES)) { JOptionPane.showMessageDialog(this, "The trait named '" + traitName + "' is being used by *BEAST.\nTurn *BEAST off before deleting this trait.", "Trait in use", JOptionPane.ERROR_MESSAGE); return; } TraitData traitData = options.getTrait(traitName); if (options.getTraitPartitions(traitData).size() > 0) { JOptionPane.showMessageDialog(this, "The trait named '" + traitName + "' is being used in a partition.\nRemove the partition before deleting this trait.", "Trait in use", JOptionPane.ERROR_MESSAGE); return; } options.removeTrait(traitName); updateButtons(); fireTraitsChanged(); traitSelectionChanged(); } public class ClearTraitAction extends AbstractAction { private static final long serialVersionUID = -7281309694753868635L; public ClearTraitAction() { super("Clear trait values"); } public void actionPerformed(ActionEvent ae) { if (currentTrait != null) clearTraitValues(currentTrait.getName()); // Clear trait values } } public class GuessTraitsAction extends AbstractAction { private static final long serialVersionUID = 8514706149822252033L; public GuessTraitsAction() { super("Guess trait values"); } public void actionPerformed(ActionEvent ae) { guessTrait(); } } public class AddTraitAction extends AbstractAction { public AddTraitAction() { super("Add trait"); } public void actionPerformed(ActionEvent ae) { addTrait(); } } AbstractAction removeTraitAction = new AbstractAction() { public void actionPerformed(ActionEvent ae) { removeTrait(); } }; public class SetValueAction extends AbstractAction { public SetValueAction() { super("Set trait values"); setToolTipText("Use this button to set the trait values of selected taxa"); } public void actionPerformed(ActionEvent ae) { setTraitValue(); } } public class CreateTraitPartitionAction extends AbstractAction { public CreateTraitPartitionAction() { super("Create partition from trait ..."); } public void actionPerformed(ActionEvent ae) { createTraitPartition(); } } class TraitsTableModel extends AbstractTableModel { private static final long serialVersionUID = -6707994233020715574L; String[] columnNames = {"Trait", "Type"}; public TraitsTableModel() { } public int getColumnCount() { return columnNames.length; } public int getRowCount() { if (options == null) return 0; return options.traits.size(); } public Object getValueAt(int row, int col) { switch (col) { case 0: return options.traits.get(row).getName(); case 1: return options.traits.get(row).getTraitType(); } return null; } public void setValueAt(Object aValue, int row, int col) { switch (col) { case 0: String oldName = options.traits.get(row).getName(); options.traits.get(row).setName(aValue.toString()); Object value; for (Taxon t : options.taxonList) { value = t.getAttribute(oldName); t.setAttribute(aValue.toString(), value); // cannot remvoe attribute in Attributable inteface } fireTraitsChanged(); break; case 1: options.traits.get(row).setTraitType((TraitData.TraitType) aValue); break; } } public boolean isCellEditable(int row, int col) { return !options.useStarBEAST || !options.traits.get(row).getName().equalsIgnoreCase(TraitData.TRAIT_SPECIES.toString()); } public String getColumnName(int column) { return columnNames[column]; } public Class getColumnClass(int c) { return getValueAt(0, c).getClass(); } public String toString() { StringBuffer buffer = new StringBuffer(); buffer.append(getColumnName(0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getColumnName(j)); } buffer.append("\n"); for (int i = 0; i < getRowCount(); i++) { buffer.append(getValueAt(i, 0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getValueAt(i, j)); } buffer.append("\n"); } return buffer.toString(); } } class DataTableModel extends AbstractTableModel { private static final long serialVersionUID = -6707994233020715574L; String[] columnNames = {"Taxon", "Value"}; public DataTableModel() { } public int getColumnCount() { return columnNames.length; } public int getRowCount() { if (options == null) return 0; if (options.taxonList == null) return 0; if (currentTrait == null) return 0; return options.taxonList.getTaxonCount(); } public Object getValueAt(int row, int col) { switch (col) { case 0: return options.taxonList.getTaxon(row); case 1: Object value = null; if (currentTrait != null) { value = options.taxonList.getTaxon(row).getAttribute(currentTrait.getName()); } if (value != null) { return value; } else { return ""; } } return null; } public void setValueAt(Object aValue, int row, int col) { if (col == 1) { // Location location = options.taxonList.getTaxon(row).getLocation(); // if (location != null) { // options.taxonList.getTaxon(row).setLocation(location); if (currentTrait != null) { options.taxonList.getTaxon(row).setAttribute(currentTrait.getName(), aValue); } } } public boolean isCellEditable(int row, int col) { if (col == 1) { // Object t = options.taxonList.getTaxon(row).getAttribute(currentTrait.getName()); // return (t != null); return true; } else { return false; } } public String getColumnName(int column) { return columnNames[column]; } public Class getColumnClass(int c) { return getValueAt(0, c).getClass(); } public String toString() { StringBuffer buffer = new StringBuffer(); buffer.append(getColumnName(0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getColumnName(j)); } buffer.append("\n"); for (int i = 0; i < getRowCount(); i++) { buffer.append(getValueAt(i, 0)); for (int j = 1; j < getColumnCount(); j++) { buffer.append("\t"); buffer.append(getValueAt(i, j)); } buffer.append("\n"); } return buffer.toString(); } } }
package tlc2.tool.distributed; import java.io.EOFException; import java.io.PrintWriter; import java.io.StringWriter; import java.io.Writer; import java.net.URI; import java.rmi.RemoteException; import java.util.Date; import java.util.Timer; import java.util.TimerTask; import java.util.concurrent.ExecutorService; import java.util.concurrent.atomic.AtomicBoolean; import tlc2.TLCGlobals; import tlc2.output.EC; import tlc2.output.MP; import tlc2.tool.TLCState; import tlc2.tool.TLCStateVec; import tlc2.tool.WorkerException; import tlc2.tool.distributed.selector.IBlockSelector; import tlc2.tool.fp.FPSet; import tlc2.tool.queue.IStateQueue; import tlc2.tool.queue.StateQueue; import tlc2.util.BitVector; import tlc2.util.IdThread; import tlc2.util.LongVec; public class TLCServerThread extends IdThread { private static int COUNT = 0; /** * Runtime statistics about states send and received by and from the remote * worker. These stats are shown at the end of model checking for every * worker thread. */ private int receivedStates, sentStates; /** * {@link TLCWorker}s maintain a worker-local fingerprint cache. The hit * ratio is kept here for final statistics. A negative value indicates that * the statistic has not been gathered yet. */ private double cacheRateHitRatio = -1L; /** * An {@link IBlockSelector} tunes the amount of states send to a remote * worker. Depending on its concrete implementation it might employ runtime * statistics to assign the ideal amount of states. * * @see TLCServerThread#states */ private final IBlockSelector selector; /** * Current unit of work or null * * @see TLCServerThread#selector */ private TLCState[] states = new TLCState[0]; /** * Periodically check the remote worker's aliveness by spawning a * asynchronous task that is automatically scheduled by the JVM for * re-execution in the defined interval. * <p> * It is the tasks responsibility to detect a stale worker and disconnect * it. * * @see TLCServerThread#keepAliveTimer */ private final TLCTimerTask task; /** * @see TLCServerThread#task */ private final Timer keepAliveTimer; /** * Synchronized flag used to indicate the correct amount of workers to * TCLGlobals. * * Either {@link TLCServerThread#run()} or * {@link TLCServerThread#keepAliveTimer} will flip to false causing * subsequent calls to * {@link TLCServerThread#handleRemoteWorkerLost(StateQueue)} to be a noop. * * Synchronization is required because {@link TLCServerThread#run()} and * {@link TLCTimerTask#run()} are executed as two separate threads. */ private final AtomicBoolean cleanupGlobals = new AtomicBoolean(true); /** * An {@link ExecutorService} used to parallelize calls to the _distributed_ * fingerprint set servers ({@link FPSet}). * <p> * The fingerprint space is partitioned across all {@link FPSet} servers and * thus can be accessed concurrently. */ private final ExecutorService executorService; /** * An RMI proxy for the remote worker. * * @see TLCServerThread#tlcServer */ private final TLCWorkerRMI worker; /** * The {@link TLCServer} master this {@link TLCServerThread} provides the * service of handling a single remote worker. A {@link TLCServer} uses n * {@link TLCWorker}s to calculate the next state relation. To invoke * workers concurrently, it spawns a {@link TLCServerThread} for each * {@link TLCWorkerRMI} RMI proxy. * <p> * {@link TLCServer} and {@link TLCWorkerRMI} form a 1:n mapping and * {@link TLCServerThread} is this mapping. * * @see TLCServerThread#worker */ private final TLCServer tlcServer; /** * Remote worker's address used to label local threads. */ private URI uri; public TLCServerThread(TLCWorkerRMI worker, URI aURI, TLCServer tlc, ExecutorService es, IBlockSelector aSelector) { super(COUNT++); this.executorService = es; this.tlcServer = tlc; this.selector = aSelector; this.uri = aURI; // Create Timer early to avoid NPE in handleRemoteWorkerLost (it tries to cancel the timer) keepAliveTimer = new Timer("TLCWorker KeepAlive Timer [" + uri.toASCIIString() + "]", true); // Wrap the TLCWorker with a SmartProxy. A SmartProxy's responsibility // is to measure the RTT spend to transfer states back and forth. this.worker = new TLCWorkerSmartProxy(worker); // Prefix the thread name with a fixed string and a counter. // This part is used by the external Munin based statistics software to // gather thread contention stats. final String i = String.format("%03d", myGetId()); setName(TLCServer.THREAD_NAME_PREFIX + i + "-[" + uri.toASCIIString() + "]"); // schedule a timer to periodically (60s) check server aliveness task = new TLCTimerTask(); keepAliveTimer.schedule(task, 10000, 60000); } /** * This method gets a state from the queue, generates all the possible next * states of the state, checks the invariants, and updates the state set and * state queue. */ public void run() { TLCGlobals.incNumWorkers(); TLCStateVec[] newStates = null; LongVec[] newFps = null; final IStateQueue stateQueue = this.tlcServer.stateQueue; try { START: while (true) { // blocks until more states available or all work is done states = selector.getBlocks(stateQueue, worker); if (states == null) { synchronized (this.tlcServer) { this.tlcServer.setDone(); this.tlcServer.notify(); } stateQueue.finishAll(); return; } // without initial states no need to bother workers if (states.length == 0) { continue; } // count statistics sentStates += states.length; // real work happens here: // worker computes next states for states boolean workDone = false; while (!workDone) { try { final NextStateResult res = this.worker.getNextStates(states); newStates = res.getNextStates(); receivedStates += newStates[0].size(); newFps = res.getNextFingerprints(); workDone = true; task.setLastInvocation(System.currentTimeMillis()); // Read remote worker cache hits which correspond to // states skipped tlcServer.addStatesGeneratedDelta(res.getStatesComputedDelta()); } catch (RemoteException e) { // If a (remote) {@link TLCWorkerRMI} fails due to the // amount of new states we have sent it, try to lower // the amount of states // and re-send (until we just send a single state) if (isRecoverable(e) && states.length > 1) { MP.printMessage( EC.TLC_DISTRIBUTED_EXCEED_BLOCKSIZE, Integer.toString(states.length / 2)); // states[] exceeds maximum transferable size // (add states back to queue and retry) stateQueue.sEnqueue(states); // half the maximum size and use it as a limit from // now on selector.setMaxTXSize(states.length / 2); // go back to beginning continue START; } else { // non recoverable errors, exit... MP.printMessage( EC.TLC_DISTRIBUTED_WORKER_LOST, getUri().toString()); handleRemoteWorkerLost(stateQueue); return; } } catch (NullPointerException e) { MP.printMessage(EC.TLC_DISTRIBUTED_WORKER_LOST, // have the stack trace on a newline "\n" + throwableToString(e)); handleRemoteWorkerLost(stateQueue); return; } } // add fingerprints to fingerprint manager (delegates to // corresponding fingerprint server) // (Why isn't this done by workers directly? // -> because if the worker crashes while computing states, the // fp set would be inconsistent => making it an "atomic" // operation) BitVector[] visited = this.tlcServer.fpSetManager .putBlock(newFps, executorService); // recreate newly computed states and add them to queue for (int i = 0; i < visited.length; i++) { BitVector.Iter iter = new BitVector.Iter(visited[i]); int index; while ((index = iter.next()) != -1) { TLCState state = newStates[i].elementAt(index); // write state id and state fp to .st file for // checkpointing long fp = newFps[i].elementAt(index); state.uid = this.tlcServer.trace.writeState(state, fp); // add state to state queue for further processing stateQueue.sEnqueue(state); } } } } catch (Throwable e) { TLCState state1 = null, state2 = null; if (e instanceof WorkerException) { state1 = ((WorkerException) e).state1; state2 = ((WorkerException) e).state2; } if (this.tlcServer.setErrState(state1, true)) { if (state1 != null) { try { this.tlcServer.trace.printTrace(state1, state2); } catch (Exception e1) { MP.printError(EC.GENERAL, e1); } } else { MP.printError(EC.GENERAL, e); } stateQueue.finishAll(); synchronized (this.tlcServer) { this.tlcServer.notify(); } } } finally { try { cacheRateHitRatio = worker.getCacheRateRatio(); } catch (RemoteException e) { // Remote worker might crash after return the last next // state computation result but before the cache rate hit // ratio statistic could be read. If this is the case the // final statistic will be reported as negative indicating // that it failed to read the statistic. MP.printWarning( EC.GENERAL, "Failed to read remote worker cache statistic (Expect to see a negative chache hit rate. Does not invalidate model checking results)"); } keepAliveTimer.cancel(); states = new TLCState[0]; // not calling TLCGlobals#decNumWorkers here because at this point // TLCServer is shutting down anyway } } /** * A recoverable error/exception is defined to be a case where the * {@link TLCWorkerRMI} can continue to work if {@link TLCServer} sends less * new states to process. */ private boolean isRecoverable(final Exception e) { final Throwable cause = e.getCause(); return ((cause instanceof EOFException && cause.getMessage() == null) || (cause instanceof RemoteException && cause .getCause() instanceof OutOfMemoryError)); } private String throwableToString(final Exception e) { final Writer result = new StringWriter(); final PrintWriter printWriter = new PrintWriter(result); e.printStackTrace(printWriter); return result.toString(); } /** * Handles the case of a disconnected remote worker * * @param stateQueue */ private void handleRemoteWorkerLost(final IStateQueue stateQueue) { // Cancel the keepAliveTimer which might still be running if an // exception in the this run() method has caused handleRemoteWorkerLost // to be called. keepAliveTimer.cancel(); // This call has to be idempotent, otherwise we see bugs as in // Prevent second invocation of worker de-registration which stamps from // a race condition between the TimerTask (that periodically checks // server aliveness) and the exception handling that kicks in when the // run() method catches an RMI exception. if (cleanupGlobals.compareAndSet(true, false)) { // De-register TLCServerThread at the main server thread locally tlcServer.removeTLCServerThread(this); // Return the undone worklist (if any) if (stateQueue != null) { stateQueue.sEnqueue(states != null ? states : new TLCState[0]); } // Reset states to empty array to signal to TLCServer that we are not // processing any new states. Otherwise statistics will incorrectly // count this TLCServerThread as actively calculating states. states = new TLCState[0]; // Before decrementing the worker count, notify all waiters on // stateQueue to re-evaluate the while loop in isAvail(). The demise // of this worker (who potentially was the lock owner) might causes // another consumer to leave the while loop (become a consumer). // This has to happen _prior_ to calling decNumWorkers. Otherwise // we decrement the total number and the active count by one // simultaneously, leaving isAvail without effect. // This is to work around a design bug in // tlc2.tool.queue.StateQueue's impl. Other IStateQueue impls should // hopefully not be affected by calling notifyAll on them though. if (stateQueue != null) { synchronized (stateQueue) { stateQueue.notifyAll(); } } TLCGlobals.decNumWorkers(); } } /** * @return The current amount of states the corresponding worker is * computing on */ public int getCurrentSize() { return states.length; } /** * @return the url */ public URI getUri() { return this.uri; } /** * @return the receivedStates */ public int getReceivedStates() { return receivedStates; } /** * @return the sentStates */ public int getSentStates() { return sentStates; } /** * @return The hit ratio of the worker-local fingerprint cache. */ public double getCacheRateRatio() { return cacheRateHitRatio; } private class TLCTimerTask extends TimerTask { /** * Timestamp of last successful remote invocation */ private long lastInvocation = 0L; /* (non-Javadoc) * @see java.util.TimerTask#run() */ public void run() { // Check if the last invocation happened within the last minute. If // not, check the worker's aliveness and dispose of it if indeed // lost. long now = new Date().getTime(); if (lastInvocation == 0 || (now - lastInvocation) > 60000) { try { if (!worker.isAlive()) { handleRemoteWorkerLost(tlcServer.stateQueue); } } catch (RemoteException e) { handleRemoteWorkerLost(tlcServer.stateQueue); } } } /** * @param lastInvocation the lastInvocation to set */ public void setLastInvocation(long lastInvocation) { this.lastInvocation = lastInvocation; } } }
package net.java.sip.communicator.impl.gui; import java.awt.*; import java.util.*; import java.util.List; import javax.swing.*; import net.java.sip.communicator.impl.gui.lookandfeel.*; import net.java.sip.communicator.impl.gui.main.*; import net.java.sip.communicator.impl.gui.main.account.*; import net.java.sip.communicator.impl.gui.main.chat.*; import net.java.sip.communicator.impl.gui.main.chat.conference.*; import net.java.sip.communicator.impl.gui.main.configforms.*; import net.java.sip.communicator.impl.gui.main.contactlist.*; import net.java.sip.communicator.impl.gui.main.contactlist.addcontact.*; import net.java.sip.communicator.impl.gui.main.login.*; import net.java.sip.communicator.impl.gui.utils.*; import net.java.sip.communicator.service.contactlist.*; import net.java.sip.communicator.service.gui.*; import net.java.sip.communicator.service.gui.event.*; import net.java.sip.communicator.service.protocol.*; import net.java.sip.communicator.util.*; /** * An implementation of the <tt>UIService</tt> that gives access to other * bundles to this particular swing ui implementation. * * @author Yana Stamcheva */ public class UIServiceImpl implements UIService { private static final Logger logger = Logger.getLogger(UIServiceImpl.class); private PopupDialogImpl popupDialog; private AccountRegWizardContainerImpl wizardContainer; private Map registeredPlugins = new Hashtable(); private Vector pluginComponentListeners = new Vector(); private static final List supportedContainers = new ArrayList(); static { supportedContainers.add(UIService.CONTAINER_MAIN_TOOL_BAR); supportedContainers.add(UIService.CONTAINER_CONTACT_RIGHT_BUTTON_MENU); supportedContainers.add(UIService.CONTAINER_GROUP_RIGHT_BUTTON_MENU); supportedContainers.add(UIService.CONTAINER_TOOLS_MENU); supportedContainers.add(UIService.CONTAINER_HELP_MENU); supportedContainers.add(UIService.CONTAINER_CHAT_TOOL_BAR); supportedContainers.add(UIService.CONTAINER_CALL_HISTORY); supportedContainers.add(UIService.CONTAINER_MAIN_TABBED_PANE); supportedContainers.add(UIService.CONTAINER_CHAT_HELP_MENU); } private static final Hashtable exportedWindows = new Hashtable(); private MainFrame mainFrame; private LoginManager loginManager; private ContactListPanel contactListPanel; private ConfigurationFrame configurationFrame; private boolean exitOnClose = true; /** * Creates an instance of <tt>UIServiceImpl</tt>. */ public UIServiceImpl() { } /** * Initializes all frames and panels and shows the gui. */ public void loadApplicationGui() { this.setDefaultThemePack(); this.mainFrame = new MainFrame(); this.loginManager = new LoginManager(mainFrame); this.contactListPanel = mainFrame.getContactListPanel(); this.popupDialog = new PopupDialogImpl(); this.wizardContainer = new AccountRegWizardContainerImpl(mainFrame); this.configurationFrame = new ConfigurationFrame(mainFrame); mainFrame.setContactList(GuiActivator.getMetaContactListService()); if(ConfigurationManager.isApplicationVisible()) SwingUtilities.invokeLater(new RunApplicationGui()); SwingUtilities.invokeLater(new RunLoginGui()); this.initExportedWindows(); } public void removeComponent(ContainerID containerID, Object component) throws IllegalArgumentException { if (!supportedContainers.contains(containerID)) { throw new IllegalArgumentException( "The constraint that you specified is not" + " supported by this UIService implementation."); } else { if (registeredPlugins.containsKey(containerID)) { ((Vector) registeredPlugins.get(containerID)).remove(component); } this.firePluginEvent(component, containerID, PluginComponentEvent.PLUGIN_COMPONENT_REMOVED); } } public void addComponent(ContainerID containerID, Object component) throws ClassCastException, IllegalArgumentException { if (!supportedContainers.contains(containerID)) { throw new IllegalArgumentException( "The constraint that you specified is not" + " supported by this UIService implementation."); } else if (!(component instanceof Component)) { throw new ClassCastException( "The specified plugin is not a valid swing or awt component."); } else { if (registeredPlugins.containsKey(containerID)) { ((Vector) registeredPlugins.get(containerID)).add(component); } else { Vector plugins = new Vector(); plugins.add(component); registeredPlugins.put(containerID, plugins); } this.firePluginEvent(component, containerID, PluginComponentEvent.PLUGIN_COMPONENT_ADDED); } } public void addComponent(ContainerID containerID, String constraint, Object component) throws ClassCastException, IllegalArgumentException { this.addComponent(containerID, component); } public void addComponent(ContainerID containerID, ContactAwareComponent component) throws ClassCastException, IllegalArgumentException { if (!(component instanceof Component)) { throw new ClassCastException( "The specified plugin is not a valid swing or awt component."); } this.addComponent(containerID, (Component) component); } public void addComponent(ContainerID containerID, String constraint, ContactAwareComponent component) throws ClassCastException, IllegalArgumentException { this.addComponent(containerID, constraint, component); } /** * Implements <code>UISercie.getSupportedContainers</code>. Returns the * list of supported containers by this implementation . * * @see UIService#getSupportedContainers() * @return an Iterator over all supported containers. */ public Iterator getSupportedContainers() { return Collections.unmodifiableList(supportedContainers).iterator(); } public Iterator getComponentsForContainer(ContainerID containerID) throws IllegalArgumentException { if (!supportedContainers.contains(containerID)) throw new IllegalArgumentException( "The container that you specified is not " + "supported by this UIService implementation."); Vector plugins = new Vector(); Object o = registeredPlugins.get(containerID); if (o != null) { plugins = (Vector) o; } return plugins.iterator(); } /** * Not yet implemented. * * @param containerID the ID of the container whose constraints we'll be * retrieving. * * @see UIService#getConstraintsForContainer(ContainerID) * * @return Iterator an <tt>Iterator</tt> for all constraintes supported by * the container corresponding to containerID. */ public Iterator getConstraintsForContainer(ContainerID containerID) { return null; } /** * Creates the corresponding PluginComponentEvent and notifies all * <tt>ContainerPluginListener</tt>s that a plugin component is added or * removed from the container. * * @param pluginComponent the plugin component that is added to the * container. * @param containerID the containerID that corresponds to the container * where the component is added. * @param eventID one of the PLUGIN_COMPONENT_XXX static fields indicating * the nature of the event. */ private void firePluginEvent(Object pluginComponent, ContainerID containerID, int eventID) { PluginComponentEvent evt = new PluginComponentEvent(pluginComponent, containerID, eventID); logger.trace("Will dispatch the following plugin component event: " + evt); synchronized (pluginComponentListeners) { Iterator listeners = this.pluginComponentListeners.iterator(); while (listeners.hasNext()) { PluginComponentListener l = (PluginComponentListener) listeners .next(); switch (evt.getEventID()) { case PluginComponentEvent.PLUGIN_COMPONENT_ADDED: l.pluginComponentAdded(evt); break; case PluginComponentEvent.PLUGIN_COMPONENT_REMOVED: l.pluginComponentRemoved(evt); break; default: logger.error("Unknown event type " + evt.getEventID()); } } } } /** * Implements <code>isVisible</code> in the UIService interface. Checks if * the main application window is visible. * * @return <code>true</code> if main application window is visible, * <code>false</code> otherwise * @see UIService#isVisible() */ public boolean isVisible() { if (mainFrame.isVisible()) { if (mainFrame.getExtendedState() == JFrame.ICONIFIED) return false; else return true; } else return false; } /** * Implements <code>setVisible</code> in the UIService interface. Shows or * hides the main application window depending on the parameter * <code>visible</code>. * * @param isVisible true if we are to show the main application frame and * false otherwise. * * @see UIService#setVisible(boolean) */ public void setVisible(boolean isVisible) { this.mainFrame.setVisible(isVisible); if(isVisible) this.mainFrame.toFront(); } /** * Implements <code>minimize</code> in the UIService interface. Minimizes * the main application window. * * @see UIService#minimize() */ public void minimize() { this.mainFrame.setExtendedState(JFrame.ICONIFIED); } /** * Implements <code>maximize</code> in the UIService interface. Maximizes * the main application window. * * @see UIService#maximize() */ public void maximize() { this.mainFrame.setExtendedState(JFrame.MAXIMIZED_BOTH); } /** * Implements <code>restore</code> in the UIService interface. Restores * the main application window. * * @see UIService#restore() */ public void restore() { if (mainFrame.isVisible()) { if (mainFrame.getState() == JFrame.ICONIFIED) mainFrame.setState(JFrame.NORMAL); mainFrame.toFront(); } else mainFrame.setVisible(true); } /** * Implements <code>resize</code> in the UIService interface. Resizes the * main application window. * * @param height the new height of tha main application frame. * @param width the new width of the main application window. * * @see UIService#resize(int, int) */ public void resize(int width, int height) { this.mainFrame.setSize(width, height); } /** * Implements <code>move</code> in the UIService interface. Moves the main * application window to the point with coordinates - x, y. * * @param x the value of X where the main application frame is to be placed. * @param y the value of Y where the main application frame is to be placed. * * @see UIService#move(int, int) */ public void move(int x, int y) { this.mainFrame.setLocation(x, y); } /** * Implements the <code>UIService.setExitOnMainWindowClose</code>. Sets a * boolean property, which indicates whether the application should be * exited when the main application window is closed. * * @param exitOnClose specifies if closing the main application window * should also be exiting the application. */ public void setExitOnMainWindowClose(boolean exitOnClose) { this.exitOnClose = exitOnClose; if (exitOnClose) mainFrame.setDefaultCloseOperation(JFrame.DISPOSE_ON_CLOSE); else mainFrame.setDefaultCloseOperation(JFrame.HIDE_ON_CLOSE); } /** * Implements the <code>UIService.getExitOnMainWindowClose</code>. * Returns the boolean property, which indicates whether the application * should be exited when the main application window is closed. * * @return determines whether the UI impl would exit the application when * the main application window is closed. */ public boolean getExitOnMainWindowClose() { return this.exitOnClose; } /** * Adds all <tt>ExportedWindow</tt>s to the list of application windows, * which could be used from other bundles. Once registered in the * <tt>UIService</tt> this window could be obtained through the * <tt>getExportedWindow(WindowID)</tt> method and could be shown, * hidden, resized, moved, etc. */ public void initExportedWindows() { AddContactWizard addContactWizard = new AddContactWizard(mainFrame); exportedWindows.put(configurationFrame.getIdentifier(), configurationFrame); exportedWindows.put(addContactWizard.getIdentifier(), addContactWizard); } /** * Registers the given <tt>ExportedWindow</tt> to the list of windows that * could be accessed from other bundles. * * @param window the window to be exported */ public void registerExportedWindow(ExportedWindow window) { exportedWindows.put(window.getIdentifier(), window); } /** * Sets the contact list service to this UI Service implementation. * @param contactList the MetaContactList service */ public void setContactList(MetaContactListService contactList) { this.mainFrame.setContactList(contactList); } public void addPluginComponentListener(PluginComponentListener l) { synchronized (pluginComponentListeners) { pluginComponentListeners.add(l); } } public void removePluginComponentListener(PluginComponentListener l) { synchronized (pluginComponentListeners) { pluginComponentListeners.remove(l); } } /** * Implements <code>getSupportedExportedWindows</code> in the UIService * interface. Returns an iterator over a set of all windows exported by * this implementation. * * @return an Iterator over all windows exported by this implementation of * the UI service. * * @see UIService#getSupportedExportedWindows() */ public Iterator getSupportedExportedWindows() { return Collections.unmodifiableMap(exportedWindows).keySet().iterator(); } /** * Implements the <code>getExportedWindow</code> in the UIService * interface. Returns the window corresponding to the given * <tt>WindowID</tt>. * * @param windowID the id of the window we'd like to retrieve. * * @return a reference to the <tt>ExportedWindow</tt> instance corresponding * to <tt>windowID</tt>. * @see UIService#getExportedWindow(WindowID) */ public ExportedWindow getExportedWindow(WindowID windowID) { if (exportedWindows.containsKey(windowID)) { return (ExportedWindow) exportedWindows.get(windowID); } return null; } /** * Implements the <code>UIService.isExportedWindowSupported</code> method. * Checks if there's an exported component for the given * <tt>WindowID</tt>. * * @param windowID the id of the window that we're making the query for. * * @return true if a window with the corresponding windowID is exported by * the UI service implementation and false otherwise. * * @see UIService#isExportedWindowSupported(WindowID) */ public boolean isExportedWindowSupported(WindowID windowID) { return exportedWindows.containsKey(windowID); } /** * Implements <code>getPopupDialog</code> in the UIService interface. * Returns a <tt>PopupDialog</tt> that could be used to show simple * messages, warnings, errors, etc. * * @return a <tt>PopupDialog</tt> that could be used to show simple * messages, warnings, errors, etc. * * @see UIService#getPopupDialog() */ public PopupDialog getPopupDialog() { return this.popupDialog; } /** * Implements <code>getChat</code> in the UIService interface. If a * chat for the given contact exists already - returns it, otherwise * creates a new one. * * @param contact the contact that we'd like to retrieve a chat window for. * * @return a Chat corresponding to the specified contact. * * @see UIService#getChat(Contact) */ public Chat getChat(Contact contact) { MetaContact metaContact = mainFrame.getContactList() .findMetaContactByContact(contact); ChatWindowManager chatWindowManager = mainFrame.getChatWindowManager(); MetaContactChatPanel chatPanel = chatWindowManager.getContactChat(metaContact); return chatPanel; } /** * Returns the <tt>Chat</tt> corresponding to the given <tt>ChatRoom</tt>. * * @param chatRoom the <tt>ChatRoom</tt> for which the searched chat is * about. * @return the <tt>Chat</tt> corresponding to the given <tt>ChatRoom</tt>. */ public Chat getChat(ChatRoom chatRoom) { ChatWindowManager chatWindowManager = mainFrame.getChatWindowManager(); ConferenceChatPanel chatPanel = chatWindowManager.getMultiChat(chatRoom); return chatPanel; } /** * Returns the selected <tt>Chat</tt>. * * @return the selected <tt>Chat</tt>. */ public Chat getCurrentChat() { ChatWindowManager chatWindowManager = mainFrame.getChatWindowManager(); return chatWindowManager.getSelectedChat(); } /** * Implements the <code>UIService.isContainerSupported</code> method. * Checks if the plugable container with the given ContainerID is supported * by this implementation. * * @param containderID the id of the container that we're making the query * for. * * @return true if the container with the specified id is exported by the * implementation of the UI service and false otherwise. * * @see UIService#isContainerSupported(ContainerID) */ public boolean isContainerSupported(ContainerID containderID) { return supportedContainers.contains(containderID); } /** * Implements the <code>UIService.getAccountRegWizardContainer</code> * method. Returns the current implementation of the * <tt>AccountRegistrationWizardContainer</tt>. * * @see UIService#getAccountRegWizardContainer() * * @return a reference to the currently valid instance of * <tt>AccountRegistrationWizardContainer</tt>. */ public AccountRegistrationWizardContainer getAccountRegWizardContainer() { return this.wizardContainer; } /** * Implements the <code>UIService.getConfigurationWindow</code>. Returns * the current implementation of the <tt>ConfigurationWindow</tt> * interface. * * @see UIService#getConfigurationWindow() * * @return a reference to the currently valid instance of * <tt>ConfigurationWindow</tt>. */ public ConfigurationWindow getConfigurationWindow() { return this.configurationFrame; } public ExportedWindow getAuthenticationWindow( ProtocolProviderService protocolProvider, String realm, UserCredentials userCredentials) { return new AuthenticationWindow(mainFrame, protocolProvider, realm, userCredentials); } /** * Returns the LoginManager. * @return the LoginManager */ public LoginManager getLoginManager() { return loginManager; } /** * Returns the <tt>MainFrame</tt>. This is the class defining the main * application window. * * @return the <tt>MainFrame</tt> */ public MainFrame getMainFrame() { return mainFrame; } /** * The <tt>RunLogin</tt> implements the Runnable interface and is used to * shows the login windows in a seperate thread. */ private class RunLoginGui implements Runnable { public void run() { loginManager.runLogin(mainFrame); } } /** * The <tt>RunApplication</tt> implements the Runnable interface and is used to * shows the main application window in a separate thread. */ private class RunApplicationGui implements Runnable { public void run() { mainFrame.setVisible(true); } } /** * Sets the look&feel and the theme. */ private void setDefaultThemePack() { SIPCommLookAndFeel lf = new SIPCommLookAndFeel(); SIPCommLookAndFeel.setCurrentTheme(new SIPCommDefaultTheme()); // we need to set the UIDefaults class loader so that it may access // resources packed inside OSGI bundles UIManager.put("ClassLoader", getClass().getClassLoader()); try { UIManager.setLookAndFeel(lf); } catch (UnsupportedLookAndFeelException e) { logger.error("The provided Look & Feel is not supported.", e); } } }
package com.sun.star.lib.sandbox; import java.awt.Image; import java.awt.Dimension; import java.awt.Container; import java.awt.BorderLayout; import java.applet.Applet; import java.applet.AppletStub; import java.applet.AppletContext; import java.applet.AudioClip; import java.io.IOException; import java.io.InputStream; import java.io.ByteArrayOutputStream; import java.net.URL; import java.net.MalformedURLException; import java.text.MessageFormat; import java.util.Hashtable; import java.util.Observable; import java.util.MissingResourceException; import java.util.ResourceBundle; public abstract class ExecutionContext extends Observable { private static final boolean DEBUG = false; private static int instances; /* message ids */ protected final static int CMD_LOAD = 1; protected final static int CMD_INIT = 2; protected final static int CMD_START = 3; protected final static int CMD_STOP = 4; protected final static int CMD_DESTROY = 5; protected final static int CMD_DISPOSE = 6; protected final static int LOADED = 1; protected final static int INITED = 2; protected final static int STARTED = 3; protected final static int STOPPED = 4; protected final static int DESTROYED = 5; protected final static int DISPOSED = 6; private int status = DISPOSED; private Object statusLock= new Object(); private boolean bDispatchException; protected ClassContext classContext; private Thread dispatchThread = null; private SandboxThreadGroup threadGroup = null; private String name; protected ResourceBundle resourceBundle; private Object synObj = new Object(); private Message head; private Message tail; private boolean loop = true; protected ExecutionContext() { instances ++; } public void finalize() { instances } public int getStatus() { return status; } Object getSynObject() { return synObj; } class Message { Message next; int id; Message(int id) { this.id = id; } } public void init(String name, ClassContext classContext) throws MissingResourceException { this.name = name; resourceBundle = ResourceBundle.getBundle("sun.applet.resources.MsgAppletViewer"); this.classContext = classContext; threadGroup = new SandboxThreadGroup(classContext.getThreadGroup(), name, classContext.getClassLoader()); threadGroup.setDaemon(true); dispatchThread = new Thread( threadGroup, new Runnable() { public void run() { while( loop ) { if( head != null) { if (DEBUG) System.err.println(" dispatch( head.id ); if (DEBUG) System.err.println(" synchronized( getSynObject() ) { head = head.next; getSynObject().notify(); } } synchronized( getSynObject() ) { if (head == null) { try { getSynObject().wait(); } catch (InterruptedException e ) { if (DEBUG) System.err.println(" break; } } } } if(DEBUG) System.err.println(" } }); dispatchThread.setDaemon(true); dispatchThread.start(); } public void sendEvent(int id) { sendEvent(id, 0); } public void sendEvent(int id, int timeout) { synchronized( getSynObject() ) { try { Message message = new Message(id); if(tail != null) tail.next = message; tail = message; if(head == null) head = tail; getSynObject().notify(); if ( timeout != 0 ) getSynObject().wait( timeout ); } catch( InterruptedException e ) { } } } public void dispose() { //if(DEBUG) System.err.println(" dispose(1000); } public void dispose( long timeout ) { if(DEBUG) System.err.println(" try { try { synchronized( getSynObject() ) { while( head != null ) getSynObject().wait( timeout ); // wait at most one second for each queued command loop = false; getSynObject().notifyAll(); } dispatchThread.join(timeout); } catch(InterruptedException ee) { if(DEBUG) System.err.println(" } if(DEBUG) threadGroup.list(); if ( !threadGroup.isDestroyed() ) threadGroup.destroy(); } catch (Exception ie) { if(DEBUG) System.err.println(" try { threadGroup.stop(); } catch (Exception se) { if(DEBUG) System.err.println(" } } classContext = null; dispatchThread = null; threadGroup.dispose(); threadGroup = null; name = null; resourceBundle = null; synObj = null; head = null; tail = null; } protected void showStatus(String status) { if (DEBUG) System.err.println(" setChanged(); notifyObservers(resourceBundle.getString("appletpanel." + status)); } protected void showStatus(String status, String arg1) { if(DEBUG) System.err.println(" try { Object args[] = new Object[1]; args[0] = arg1; setChanged(); try { notifyObservers(MessageFormat.format(resourceBundle.getString("appletpanel." + status), args)); } catch(MissingResourceException me) {} } catch(Exception ee) { if(DEBUG)System.err.println(" } } public ThreadGroup getThreadGroup() { return threadGroup; } /** * Send an event. Queue it for execution by the handler thread. */ public void dispatch(int id) { try { switch(id) { case CMD_LOAD: if (status == DISPOSED) { xload(); setStatus(LOADED); showStatus("loaded"); } else showStatus("notdisposed"); break; case CMD_INIT: if(status == LOADED || status == DESTROYED) { xinit(); setStatus(INITED); showStatus("inited"); } else showStatus("notloaded"); break; case CMD_START: if (status == INITED || status == STOPPED) { xstart(); setStatus(STARTED); showStatus("started"); } else showStatus("notinited"); break; case CMD_STOP: if (status == STARTED) { xstop(); setStatus(STOPPED); showStatus("stopped"); } else showStatus("notstarted"); break; case CMD_DESTROY: if(status == INITED || status == STOPPED) { xdestroy(); setStatus(DESTROYED); showStatus("destroyed"); } else showStatus("notstopped"); break; case CMD_DISPOSE: if (status == LOADED || status == DESTROYED) { xdispose(); // baseResourceLoader.flush(); showStatus("disposed"); setStatus(DISPOSED); } else showStatus("notdestroyed"); break; default: xExtended(id); } } catch (ClassNotFoundException classNotFoundException) { setDispatchException(); showStatus("notfound", name); if(DEBUG) classNotFoundException.printStackTrace(); } catch (InstantiationException instantiationException) { setDispatchException(); showStatus("nocreate", name); if(DEBUG) instantiationException.printStackTrace(); } catch (IllegalAccessException illegalAccessException) { setDispatchException(); showStatus("noconstruct", name); if(DEBUG) illegalAccessException.printStackTrace(); } catch (Exception exception) { setDispatchException(); showStatus("exception", exception.getMessage()); if(DEBUG) exception.printStackTrace(); } catch (ThreadDeath threadDeath) { setDispatchException(); showStatus("death"); if(DEBUG) threadDeath.printStackTrace(); throw threadDeath; } catch (Error error) { setDispatchException(); showStatus("error", error.getMessage()); if(DEBUG) error.printStackTrace(); } } protected abstract void xload() throws ClassNotFoundException, InstantiationException, IllegalAccessException; protected abstract void xinit(); protected abstract void xstart(); protected abstract void xstop(); protected abstract void xdestroy(); protected abstract void xdispose(); protected void xExtended(int id) { } public void sendLoad() { sendEvent(CMD_LOAD); } public void sendInit() { sendEvent(CMD_INIT); } public void sendStart() { sendEvent(CMD_START); } public void sendStop() { sendEvent(CMD_STOP); } public void sendDestroy() { sendEvent(CMD_DESTROY); } public void sendDispose() { sendEvent(CMD_DISPOSE); } public void startUp() { sendLoad(); sendInit(); sendStart(); } public void shutdown() { sendStop(); sendDestroy(); sendDispose(); } public void restart() { sendStop(); sendDestroy(); sendInit(); sendStart(); } public void reload() { sendStop(); sendDestroy(); sendDispose(); sendLoad(); sendInit(); sendStart(); } /** This function blocks until the status of ExecutionContext is DISPOSED or * an Exeption occurred during a call to the AppletExecutionContext in dispatch. * @see #dispatch * @see #setStatus * @see #setDispatchException */ public void waitForDispose() { if (status == DISPOSED || bDispatchException) return; else { // wait until status is disposed synchronized (statusLock) { while (status != DISPOSED && !bDispatchException) { try { statusLock.wait(); } catch (java.lang.InterruptedException e) { } } } } System.err.println("exit"); } protected void setStatus( int newStatus) { synchronized (statusLock) { status= newStatus; statusLock.notifyAll(); } } protected void setDispatchException() { synchronized (statusLock) { bDispatchException= true; statusLock.notifyAll(); } } }
package org.jastadd.tinytemplate.test; import static org.junit.Assert.assertEquals; import static org.junit.Assert.fail; import org.jastadd.tinytemplate.SimpleContext; import org.jastadd.tinytemplate.TemplateParser.SyntaxError; import org.jastadd.tinytemplate.TinyTemplate; import org.junit.Test; public class TestConditionals { private static final String NL = System.getProperty("line.separator"); /** * Constructor */ public TestConditionals() { TinyTemplate.printWarnings(false); TinyTemplate.throwExceptions(false); } /** * Test alternate form of if-then-else with hash sign instead of dollar sign * @throws SyntaxError */ @Test public void testAlternate_1() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[#if(cond)boo!#(else)mjau#endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", ""); assertEquals("mjau", tc.expand("foo")); } /** * Test an attribute condition * @throws SyntaxError */ @Test public void testAttributeCondition_1() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if(#toString)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, "true"); assertEquals("Woof!", tc.expand("dog")); } /** * Test an attribute condition * @throws SyntaxError */ @Test public void testAttributeCondition_2() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if(#toString)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, "false"); assertEquals("", tc.expand("dog")); } /** * Test a negated attribute condition * @throws SyntaxError */ @Test public void testAttributeCondition_3() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if(!#toString)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, "false"); assertEquals("Woof!", tc.expand("dog")); } /** * Test the if-then conditional * @throws SyntaxError */ @Test public void testConditional_1() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[$if(cond)boo!$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", "true"); assertEquals("boo!", tc.expand("foo")); } /** * Test the if-then conditional * @throws SyntaxError */ @Test public void testConditional_2() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[$if(cond)boo!$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", "not true"); assertEquals("", tc.expand("foo")); } /** * Case sensitive "true" * @throws SyntaxError */ @Test public void testConditional_3() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[$if(cond)boo!$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", "True"); assertEquals("", tc.expand("foo")); } /** * Test the if-then-else conditional * @throws SyntaxError */ @Test public void testConditional_4() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[$if(cond)boo!$(else)mjau$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", ""); assertEquals("mjau", tc.expand("foo")); } /** * Test the if-then-else conditional with negated condition * @throws SyntaxError */ @Test public void testConditional_5() throws SyntaxError { TinyTemplate tt = new TinyTemplate("foo = [[$if(!cond)boo!$(else)mjau$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("cond", ""); assertEquals("boo!", tc.expand("foo")); } /** * Test whitespace before the condition * @throws SyntaxError */ @Test public void testConditional_6() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if \t (x)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("x", true); assertEquals("Woof!", tc.expand("dog")); } /** * Whitespace is trimmed from the condition string * @throws SyntaxError */ @Test public void testConditional_7() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if(\tx )Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("x", true); assertEquals("Woof!", tc.expand("dog")); } /** * Whitespace is trimmed from the condition string * @throws SyntaxError */ @Test public void testConditional_8() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if( ! \tx )Woof!$(else)silence$endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("x", true); assertEquals("silence", tc.expand("dog")); } /** * Extra exclamation marks in condition * @throws SyntaxError */ @Test public void testConditional_9() throws SyntaxError { try { new TinyTemplate("dog = [[$if(!!x)Woof!$(else)silence$endif]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("illegal characters in variable name '!x'", e.getMessage()); } } /** * A dollar sign is allowed for variable conditions * @throws SyntaxError */ @Test public void testConditional_10() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if($x)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, this); tc.bind("x", "true"); assertEquals("Woof!", tc.expand("dog")); } /** * A dollar sign is allowed for variable conditions * @throws SyntaxError */ @Test public void testConditional_11() throws SyntaxError { TinyTemplate tt = new TinyTemplate("dog = [[$if(!$x)Woof!$endif]]"); SimpleContext tc = new SimpleContext(tt, this); tc.bind("x", "true"); assertEquals("", tc.expand("dog")); } @Test public void testConditionError_1() throws SyntaxError { try { new TinyTemplate("dog = [[$if(x%)Woof!$(else)silence$endif]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("illegal characters in variable name 'x%'", e.getMessage()); } } @Test public void testConditionError_2() throws SyntaxError { try { new TinyTemplate("dog = [[$if(#x.y)Woof!$(else)silence$endif]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("the attribute name 'x.y' is not a valid Java identifier", e.getMessage()); } } /** * Test nested conditional * @throws SyntaxError */ @Test public void testNested_1() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "Father = [[" + "$if(x) x\n" + "$if(y)Wednesday$endif y" + "$endif" + "]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("x", "true"); tc.bind("y", "true"); assertEquals(" x" + NL + "Wednesday y", tc.expand("Father")); } /** * Stray else * @throws SyntaxError */ @Test public void testSyntaxError_1() throws SyntaxError { try { new TinyTemplate("dog = [[$else]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("Syntax error at line 1: stray $else", e.getMessage()); } } /** * Stray endif * @throws SyntaxError */ @Test public void testSyntaxError_2() throws SyntaxError { try { new TinyTemplate("dog = [[$endif]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("Syntax error at line 1: stray $endif", e.getMessage()); } } /** * Missing endif * @throws SyntaxError */ @Test public void testSyntaxError_3() throws SyntaxError { try { new TinyTemplate("dog = [[$if(x)]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("Syntax error at line 1: missing $endif", e.getMessage()); } } /** * Missing endif * @throws SyntaxError */ @Test public void testSyntaxError_4() throws SyntaxError { try { new TinyTemplate("dog = [[$if(x)$else]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("Syntax error at line 1: missing $endif", e.getMessage()); } } /** * Extra else inside if-else * @throws SyntaxError */ @Test public void testSyntaxError_5() throws SyntaxError { try { new TinyTemplate("dog = [[\n" + "$if(x)\n" + "$else\n" + "$else]]"); fail("Expected syntax error!"); } catch (SyntaxError e) { assertEquals("Syntax error at line 4: too many $else", e.getMessage()); } } /** * Test trimming leading newline in conditional body * @throws SyntaxError */ @Test public void testTrimming_1() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[" + "$if(bark) \t \n" + "Woof!\n" + "$endif" + "]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", "true"); assertEquals("Woof!" + NL, tc.expand("dog")); } /** * If the conditional is surrounded by whitespace then the surrounding * whitespace up to and including the newline is removed. * @throws SyntaxError */ @Test public void testTrimming_2() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[ $if(bark)Woof!$endif \n]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", "true"); assertEquals("Woof!", tc.expand("dog")); } /** * Don't trim whitespace around the conditional if it has non-whitespace * surrounding it * @throws SyntaxError */ @Test public void testTrimming_3() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[ $if(bark)Woof!$endif ;\n]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", "true"); assertEquals(" Woof! ;" + NL, tc.expand("dog")); } /** * Don't trim whitespace around the conditional if there is another * conditional on the same line * @throws SyntaxError */ @Test public void testTrimming_4() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[ $if(bark)Woof!$endif $if(bark)Woof!$endif\n]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", "true"); assertEquals(" Woof! Woof!" + NL, tc.expand("dog")); } /** * Trim trailing empty line if there is nothing after the <code>endif</code> * @throws SyntaxError */ @Test public void testTrimming_5() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[ $if(bark)\n" + " Woof!\n" + " $endif]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", "true"); assertEquals(" Woof!" + NL, tc.expand("dog")); } /** * Trim empty trailing line if the <code>else</code> is on it's own line * @throws SyntaxError */ @Test public void testTrimming_6() throws SyntaxError { TinyTemplate tt = new TinyTemplate( "dog = [[ $if(!bark)\n" + " Notwoof \n" + " \t$else \n" + " Woof!\n" + " $endif ]]"); SimpleContext tc = new SimpleContext(tt, new Object()); tc.bind("bark", true); assertEquals(" Woof!", tc.expand("dog")); tc.bind("bark", false); assertEquals(" Notwoof ", tc.expand("dog")); } }
package edu.brandeis.cs.steele.wn; import edu.brandeis.cs.steele.util.ArrayUtilities; import java.util.*; import static edu.brandeis.cs.steele.wn.PointerTypeFlags.*; /** Instances of this class enumerate the possible WordNet pointer types, and * are used to label <code>PointerType</code>s. * Each <code>PointerType</code> carries additional information: * <ul> * <li> a human-readable label </li> * <li> an optional reflexive type that labels links pointing the opposite direction </li> * <li> an encoding of parts-of-speech that it applies to </li> * <li> a short string (lemma) that represents it in the dictionary files </li> * </ul> * * @see Pointer * @see POS * @author Oliver Steele, steele@cs.brandeis.edu * @version 1.0 */ public enum PointerType { // All parts of speech ANTONYM("antonym", "!", N | V | ADJ | ADV | LEXICAL), DOMAIN_OF_TOPIC("Domain of synset - TOPIC", ";c", N | V | ADJ | ADV), MEMBER_OF_THIS_DOMAIN_TOPIC("Member of this domain - TOPIC", "-c", N | V | ADJ | ADV), DOMAIN_OF_REGION("Domain of synset - REGION", ";r", N | V | ADJ | ADV), MEMBER_OF_THIS_DOMAIN_REGION("Member of this domain - REGION", "-r", N | V | ADJ | ADV), DOMAIN_OF_USAGE("Domain of synset - USAGE", ";u", N | V | ADJ | ADV), MEMBER_OF_THIS_DOMAIN_USAGE("Member of this domain - USAGE", "-u", N | V | ADJ | ADV), DOMAIN_MEMBER("Domain Member", "-", N | V | ADJ | ADV), DOMAIN("Domain", ";", N | V | ADJ | ADV), // Nouns and Verbs HYPERNYM("hypernym", "@", N | V), INSTANCE_HYPERNYM("instance hypernym", "@i", N | V), HYPONYM("hyponym", "~", N | V), INSTANCE_HYPONYM("instance hyponym", "~i", N | V), DERIVATIONALLY_RELATED("derivationally related", "+", N | V), // Nouns and Adjectives ATTRIBUTE("attribute", "=", N | ADJ), SEE_ALSO("also see", "^", N | ADJ | LEXICAL), // Verbs ENTAILMENT("entailment", "*", V), CAUSE("cause", ">", V), VERB_GROUP("verb group", "$", V), // Nouns MEMBER_MERONYM("member meronym", "%m", N), SUBSTANCE_MERONYM("substance meronym", "%s", N), PART_MERONYM("part meronym", "%p", N), MEMBER_HOLONYM("member holonym", "#m", N), SUBSTANCE_HOLONYM("substance holonym", "#s", N), PART_HOLONYM("part holonym", "#p", N), MEMBER_OF_TOPIC_DOMAIN("Member of TOPIC domain", "-c", N), MEMBER_OF_REGION_DOMAIN("Member of REGION domain", "-r", N), MEMBER_OF_USAGE_DOMAIN("Member of USAGE domain", "-u", N), // Adjectives SIMILAR_TO("similar", "&", ADJ), PARTICIPLE_OF("participle of", "<", ADJ | LEXICAL), PERTAINYM("pertainym", "\\", ADJ | LEXICAL), // Adverbs DERIVED("derived from", "\\", ADV); // from adjective private static final POS[] CATS = {POS.NOUN, POS.VERB, POS.ADJ, POS.ADV, POS.SAT_ADJ}; private static final int[] POS_MASK = {N, V, ADJ, ADV, SAT_ADJ, LEXICAL}; /** A list of all <code>PointerType</code>s. */ public static final PointerType[] TYPES = { ANTONYM, HYPERNYM, HYPONYM, ATTRIBUTE, SEE_ALSO, ENTAILMENT, CAUSE, VERB_GROUP, MEMBER_MERONYM, SUBSTANCE_MERONYM, PART_MERONYM, MEMBER_HOLONYM, SUBSTANCE_HOLONYM, PART_HOLONYM, SIMILAR_TO, PARTICIPLE_OF, PERTAINYM, DERIVED, DOMAIN_OF_TOPIC, MEMBER_OF_THIS_DOMAIN_TOPIC, DOMAIN_OF_REGION, DOMAIN_OF_USAGE, MEMBER_OF_THIS_DOMAIN_REGION, MEMBER_OF_THIS_DOMAIN_USAGE, MEMBER_OF_TOPIC_DOMAIN, MEMBER_OF_REGION_DOMAIN, MEMBER_OF_USAGE_DOMAIN, DERIVATIONALLY_RELATED, INSTANCE_HYPERNYM, INSTANCE_HYPONYM }; static { // seems to be 30 //assert TYPES.length == 32 : "TYPES.length: "+TYPES.length+" "+Arrays.toString(TYPES); } public static final PointerType[] INDEX_ONLY = { DOMAIN_MEMBER, DOMAIN }; static private void setSymmetric(final PointerType a, final PointerType b) { a.symmetricType = b; b.symmetricType = a; } /** * Index-only pointer types are used for the sole purpose of parsing index file records. * They are not used to determine relationships between words. * @param pType * @return True if the pType is an index-only pointer type. Otherwise, it is false. */ public static boolean isIndexOnly(PointerType pType) { for (int i=0; i<INDEX_ONLY.length; ++i) { if (pType.getKey().equals(INDEX_ONLY[i].getKey())) { return true; } } return false; } static { setSymmetric(ANTONYM, ANTONYM); setSymmetric(HYPERNYM, HYPONYM); setSymmetric(INSTANCE_HYPERNYM, INSTANCE_HYPONYM); setSymmetric(MEMBER_MERONYM, MEMBER_HOLONYM); setSymmetric(SUBSTANCE_MERONYM, SUBSTANCE_HOLONYM); setSymmetric(PART_MERONYM, PART_HOLONYM); setSymmetric(SIMILAR_TO, SIMILAR_TO); setSymmetric(ATTRIBUTE, ATTRIBUTE); setSymmetric(DERIVATIONALLY_RELATED, DERIVATIONALLY_RELATED); setSymmetric(DOMAIN_OF_TOPIC, MEMBER_OF_TOPIC_DOMAIN); setSymmetric(DOMAIN_OF_REGION, MEMBER_OF_REGION_DOMAIN); setSymmetric(DOMAIN_OF_USAGE, MEMBER_OF_USAGE_DOMAIN); setSymmetric(DOMAIN_OF_TOPIC, DOMAIN_MEMBER); setSymmetric(DOMAIN_OF_REGION, DOMAIN_MEMBER); setSymmetric(DOMAIN_OF_USAGE, DOMAIN_MEMBER); setSymmetric(VERB_GROUP, VERB_GROUP); } /** Return the <code>PointerType</code> whose key matches <var>key</var>. * @exception NoSuchElementException If <var>key</var> doesn't name any <code>PointerType</code>. */ static PointerType parseKey(final CharSequence key) { for (int i = 0; i < TYPES.length; ++i) { final PointerType type = TYPES[i]; if (type.key.contentEquals(key)) { return type; } } for (int i = 0; i < INDEX_ONLY.length; ++i) { final PointerType type = INDEX_ONLY[i]; if (type.key.contentEquals(key)) { return type; } } throw new NoSuchElementException("unknown link type " + key); } /* * Instance Interface */ private final String label; private final String key; private final int flags; private PointerType symmetricType; private PointerType(final String label, final String key, final int flags) { this.label = label; this.key = key; this.flags = flags; } @Override public String toString() { return getLabel()+" "+getKey(); } public String getLabel() { return label; } public String getKey() { return this.key; } public boolean appliesTo(final POS pos) { return (flags & POS_MASK[ArrayUtilities.indexOf(CATS, pos)]) != 0; } public boolean symmetricTo(final PointerType type) { return symmetricType != null && symmetricType.equals(type); } } /** * Flags for tagging a pointer type with the POS types it apples to. * Separate class to allow PointerType enum constructor to reference it. */ class PointerTypeFlags { static final int N = 1; static final int V = 2; static final int ADJ = 4; static final int ADV = 8; static final int SAT_ADJ = 16; static final int LEXICAL = 32; }