Dataset Preview
Duplicate
The full dataset viewer is not available (click to read why). Only showing a preview of the rows.
The dataset generation failed
Error code:   DatasetGenerationError
Exception:    CastError
Message:      Couldn't cast
record: string
text: string
to
{'text': Value('string')}
because column names don't match
Traceback:    Traceback (most recent call last):
                File "/usr/local/lib/python3.12/site-packages/datasets/builder.py", line 1872, in _prepare_split_single
                  for key, table in generator:
                                    ^^^^^^^^^
                File "/src/services/worker/src/worker/job_runners/config/parquet_and_info.py", line 609, in wrapped
                  for item in generator(*args, **kwargs):
                              ^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/usr/local/lib/python3.12/site-packages/datasets/packaged_modules/json/json.py", line 260, in _generate_tables
                  self._cast_table(pa_table, json_field_paths=json_field_paths),
                  ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/usr/local/lib/python3.12/site-packages/datasets/packaged_modules/json/json.py", line 120, in _cast_table
                  pa_table = table_cast(pa_table, self.info.features.arrow_schema)
                             ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/usr/local/lib/python3.12/site-packages/datasets/table.py", line 2272, in table_cast
                  return cast_table_to_schema(table, schema)
                         ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/usr/local/lib/python3.12/site-packages/datasets/table.py", line 2218, in cast_table_to_schema
                  raise CastError(
              datasets.table.CastError: Couldn't cast
              record: string
              text: string
              to
              {'text': Value('string')}
              because column names don't match
              
              The above exception was the direct cause of the following exception:
              
              Traceback (most recent call last):
                File "/src/services/worker/src/worker/job_runners/config/parquet_and_info.py", line 1342, in compute_config_parquet_and_info_response
                  parquet_operations, partial, estimated_dataset_info = stream_convert_to_parquet(
                                                                        ^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/src/services/worker/src/worker/job_runners/config/parquet_and_info.py", line 907, in stream_convert_to_parquet
                  builder._prepare_split(split_generator=splits_generators[split], file_format="parquet")
                File "/usr/local/lib/python3.12/site-packages/datasets/builder.py", line 1739, in _prepare_split
                  for job_id, done, content in self._prepare_split_single(
                                               ^^^^^^^^^^^^^^^^^^^^^^^^^^^
                File "/usr/local/lib/python3.12/site-packages/datasets/builder.py", line 1922, in _prepare_split_single
                  raise DatasetGenerationError("An error occurred while generating the dataset") from e
              datasets.exceptions.DatasetGenerationError: An error occurred while generating the dataset

Need help to make the dataset viewer work? Make sure to review how to configure the dataset viewer, and open a discussion for direct support.

text
string
"GCTACGACACGAACGATCTCGATACTATTCCGGCTGCATCAATCGAATCATTTGCCGGTGTGGGCTACTTCTTCGATCTCGCCGGTATAAAAGAAGGCG(...TRUNCATED)
"TTAATCATCGGTGCAGCCACAAATAATTCAACCGGCAACGGAATGTCAGATTCCGGAATCGCTCTCATGTCAGGCCACTCACCCTCATATATAGATATT(...TRUNCATED)
"GCTCATTTAAAAACACTTGACGTGTTTACTTGATGTTTGTTGTGTCATCTTCACTGTAATTGTTCGAGTACTTATTTCCTCAAAAAAATTACGGGTTCT(...TRUNCATED)
"CAATGTGTTCGAGGACTGCTGTGCCGATCCGTATGATCCGAACGTGGCAAGCGTACAGCATGACATCGCGCTGCGCAACTGTGACGACGTGGAGATCCG(...TRUNCATED)
"GTACCGTCCCAGGCGCTGACCGTCTCTGGCTAATGTCTTGGCGCCGTGCATGGAGCTTTCCTCGTCGGCGGTGGCGAGGATGGTCAGTGGTTGCTTGAG(...TRUNCATED)
"AACAACACCAGAAGAAATAGCAAACGTAGTATACGCATTCACACACCTAATGACCCCTGTAACAGGCCAATACCTAGCAGCAGACTGCGGACAAACAAT(...TRUNCATED)
"ATCATTTATTGTACAGGCAATTTCTAAAGTAAACAATGGCTATCCGGTTTCCGGGATTTATACCTTTGGGTGTCCAGAAACCGGGATTTAAACCTTTGC(...TRUNCATED)
"CTGGGCGTGGTCAAGGGCGCGGTTGATACCGGCGCCATGATCAGGGGGATGTGATGCAGGCGCTCAAGCACATGGAAGCACCGTTGGCGGCGCGTCCGC(...TRUNCATED)
"CCTCATCAAGCCACCTCCAGCCGCTTTTCCCCCTCCTATATCGGATTTAAGGTCCACCTCATGTGCCCGCATTCTCGATGTCAGCAAGTGTATAGGGAC(...TRUNCATED)
"CGTCCAGCGCGCGCCGGGTCTGCAGCGTCAGTGCCCGAAAAGCCCGCCGCCGGTTGTCGAAGGCCTGGTATTCGGCGCGCACCGCTTCATCGGCCTGGG(...TRUNCATED)
End of preview.

OpenGenome2

OpenGenome2 is a database of nearly 9 trillion base pairs of curated DNA from across all domains of life. Collected from diverse species and public data sources, OpenGenome2 was used to train Evo 2 models. Please refer to the Evo 2 preprint or github repository for further details and usage examples.

We provide OpenGenome2 in two formats, the dataset is organized into two main directories to reflect this:

  • fasta which contain the DNA sequences
  • jsonl which include the specific preprocessed sequences used for Evo 2 pretraining, such as adding special tokens and phylogenetic tags

This dataset was specifically curated and preprocessed for training the Evo 2 family of genomic language models and can be used for training models or bioinformatics.

Dataset Statistics

  • Total size: 8.8 trillion base pairs
  • Coverage: All domains of life (Bacteria, Archaea, Eukaryota, Viruses)
  • Formats available: FASTA, JSONL

Data Sources

The dataset combines sequences from various public databases and repositories:

  • Prokaryotic genomes: GTDBv220, IMG/PR
  • Metagenomics: MGD DB
  • Viral sequences: IMG/VR
  • Eukaryotic data: NCBI, Ensembl (from which we identified mRNAs, genomic windows)
  • Eukaryotic elements: Eukaryotic Promoter Database new (EPDnew)
  • RNA sequences: RNAcentral, Rfam
  • Organellar genomes: Various organelles

Training Data Composition

Evo 2 uses a two stage to train on OpenGenome2, first pretraining on a focused dataset at shorter sequence length and then longer sequence length with more full genomes and special tags.

Phase 1: Pretraining

Dataset Number of Tokens (billions) Composition Evo 2 Dataloader Weight
GTDBv220 + IMG/PR 351 18.93% 18.00%
Metagenomics (MGD DB) 854 46.06% 24.00%
IMG/VR 34 1.83% 3.00%
Euk mRNA stitched 99 5.34% 9.00%
Eukaryotic mRNAs (Ensembl, NCBI) 89 4.80% 9.00%
Euk 5kb windows stitched 405 21.84% 35.00%
Organelles 3 0.16% 0.50%
ncRNA (RNAcentral, Rfam, Ensembl, NCBI) 19 1.02% 2.00%
Eukaryotic Promoter Database new (EPDnew) 0.11 0.01% 0.02%

Phase 2: Context Extension

Dataset Number of Tokens (billions) Composition Evo 2 Dataloader Weight
TAGGED/Long: GTDBv220 + IMG/PR 351 4.08% 24.00%
Metagenomics (MGD DB) 854 9.93% 5.00%
TAGGED/Long: IMG/VR 34 0.40% 2.00%
ncRNA (RNAcentral, Rfam, Ensembl, NCBI) 19 0.22% 1.00%
Eukaryotic Promoter Database new (EPDnew) 0.11 0.00% 0.01%
Organelles 3 0.03% 0.25%
Euk mRNA stitched 99 1.15% 4.50%
Eukaryotic mRNAs (Ensembl, NCBI) 89 1.04% 4.50%
Euk 5kb windows stitched 405 4.71% 5.00%
Tagged/Long: NCBI Eukaryote: Animalia 4,907 104.00% 36.00%
Tagged/Long: NCBI Eukaryote: Plantae 1,652 96.00% 12.00%
Tagged/Long: NCBI Eukaryote: Fungi 156 24.00% 4.00%
Tagged/Long: NCBI Eukaryote: Protista 17 0.00% 0.80%
Tagged/Long: NCBI Eukaryote: Chromista 13 6.00% 0.80%

Citation

If you use OpenGenome2 in your research, please cite:

@article{Brixi2025.02.18.638918,
    author = {Brixi, Garyk and Durrant, Matthew G and Ku, Jerome and Poli, Michael and Brockman, Greg and Chang, Daniel and Gonzalez, Gabriel A and King, Samuel H and Li, David B and Merchant, Aditi T and Naghipourfar, Mohsen and Nguyen, Eric and Ricci-Tam, Chiara and Romero, David W and Sun, Gwanggyu and Taghibakshi, Ali and Vorontsov, Anton and Yang, Brandon and Deng, Myra and Gorton, Liv and Nguyen, Nam and Wang, Nicholas K and Adams, Etowah and Baccus, Stephen A and Dillmann, Steven and Ermon, Stefano and Guo, Daniel and Ilango, Rajesh and Janik, Ken and Lu, Amy X and Mehta, Reshma and Mofrad, Mohammad R.K. and Ng, Madelena Y and Pannu, Jaspreet and Re, Christopher and Schmok, Jonathan C and St. John, John and Sullivan, Jeremy and Zhu, Kevin and Zynda, Greg and Balsam, Daniel and Collison, Patrick and Costa, Anthony B. and Hernandez-Boussard, Tina and Ho, Eric and Liu, Ming-Yu and McGrath, Tom and Powell, Kimberly and Burke, Dave P. and Goodarzi, Hani and Hsu, Patrick D and Hie, Brian},
    title = {Genome modeling and design across all domains of life with Evo 2},
    elocation-id = {2025.02.18.638918},
    year = {2025},
    doi = {10.1101/2025.02.18.638918},
    publisher = {Cold Spring Harbor Laboratory},
    URL = {https://www.biorxiv.org/content/early/2025/02/21/2025.02.18.638918},
    eprint = {https://www.biorxiv.org/content/early/2025/02/21/2025.02.18.638918.full.pdf},
    journal = {bioRxiv}
}

OpenGenome2 incorporates data from multiple public databases. Please also cite the original data sources as appropriate, and refer to the Evo 2 preprint for further details.

GTDB (Genome Taxonomy Database): Parks, D. H., Chuvochina, M., Rinke, C., Mussig, A. J., Chaumeil, P.-A., & Hugenholtz, P. (2022). GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic Acids Research, 50(D1), D785–D794.

Metagenomics (MGD DB): Durrant, M. G., Perry, N. T., Pai, J. J., Jangid, A. R., Athukoralage, J. S., Hiraizumi, M., McSpedon, J. P., Pawluk, A., Nishimura, H., Konermann, S., & Hsu, P. D. (2024). Bridge RNAs direct programmable recombination of target and donor DNA. Nature, 630(8018), 984–993.

Additional data sources include NCBI, Ensembl, IMG/VR, RNAcentral, Rfam, and EPDnew databases.

License

Apache 2.0

Downloads last month
1,255