code
stringlengths
64
7.01k
docstring
stringlengths
2
15.8k
#vtb def add_route(app, fn, context=default_context): transmute_func = TransmuteFunction( fn, args_not_from_request=["request"] ) handler = create_handler(transmute_func, context=context) get_swagger_spec(app).add_func(transmute_func, context) for p in transmute_func.paths: aiohttp_path = _convert_to_aiohttp_path(p) resource = app.router.add_resource(aiohttp_path) for method in transmute_func.methods: resource.add_route(method, handler)
a decorator that adds a transmute route to the application.
#vtb def get_roles_for_permission(permission, brain_or_object): obj = api.get_object(brain_or_object) valid_roles = get_valid_roles_for(obj) for item in obj.ac_inherited_permissions(1): name, value = item[:2] if name == permission: permission = Permission(name, value, obj) roles = permission.getRoles() return filter(lambda r: r in valid_roles, roles) raise ValueError("The permission {} is invalid.".format(permission))
Return the roles of the permission that is granted on the object Code extracted from `IRoleManager.rolesOfPermission` :param permission: The permission to get the roles :param brain_or_object: Catalog brain or object :returns: List of roles having the permission
#vtb def remove_move(name): try: delattr(_MovedItems, name) except AttributeError: try: del moves.__dict__[name] except KeyError: raise AttributeError("no such move, %r" % (name,))
Remove item from six.moves.
#vtb def from_start_and_end(cls, start, end, aa=None, helix_type=): start = numpy.array(start) end = numpy.array(end) if aa is None: rise_per_residue = _helix_parameters[helix_type][1] aa = int((numpy.linalg.norm(end - start) / rise_per_residue) + 1) instance = cls(aa=aa, helix_type=helix_type) instance.move_to(start=start, end=end) return instance
Creates a `Helix` between `start` and `end`. Parameters ---------- start : 3D Vector (tuple or list or numpy.array) The coordinate of the start of the helix primitive. end : 3D Vector (tuple or list or numpy.array) The coordinate of the end of the helix primitive. aa : int, optional Number of amino acids in the `Helix`. If `None, an appropriate number of residues are added. helix_type : str, optional Type of helix, can be: 'alpha', 'pi', '3-10', 'PPI', 'PPII', 'collagen'.
#vtb def liftover(self, intersecting_region): if not self.intersects(intersecting_region): raise RetrotransposonError("trying to lift " + str(intersecting_region) + " from genomic to transposon coordinates " + "in " + str(self) + ", but it doesn't " + "intersect!") if self.pairwise_alignment is not None: return self.pairwise_alignment.liftover(self.chrom, self.repeat_name(), intersecting_region.start, intersecting_region.end, trim=True) return self.liftover_coordinates(intersecting_region)
Lift a region that overlaps the genomic occurrence of the retrotransposon to consensus sequence co-ordinates. This method will behave differently depending on whether this retrotransposon occurrance contains a full alignment or not. If it does, the alignment is used to do the liftover and an exact result is provided. If it does not, the coordinates are used to do the liftover, padding either the genomic region or consensus sequence (whichever is shorter) with equally spaced gaps to make the size of both match. :param intersecting_region: a region that intersects this occurrence. :return: list of GenomicInterval objects. This is a list because a genomic deletion of part of the retrotransposon can fragment the intersecting region and result in more than one returned interval.
#vtb def otu_iter_nexson_proxy(nexson_proxy, otu_sort=None): nexml_el = nexson_proxy._nexml_el og_order = nexml_el[] ogd = nexml_el[] for og_id in og_order: og = ogd[og_id] if otu_sort is None: for k, v in og: yield nexson_proxy._create_otu_proxy(k, v) else: key_list = list(og.keys()) if otu_sort is True: key_list.sort() else: key_list.sort(key=otu_sort) for k in key_list: v = og[k] yield nexson_proxy._create_otu_proxy(k, v)
otu_sort can be None (not sorted or stable), True (sorted by ID lexigraphically) or a key function for a sort function on list of otuIDs Note that if there are multiple OTU groups, the NexSON specifies the order of sorting of the groups (so the sort argument here only refers to the sorting of OTUs within a group)
#vtb def get_cds_ranges_for_transcript(self, transcript_id): headers = {"content-type": "application/json"} self.attempt = 0 ext = "/overlap/id/{}?feature=cds".format(transcript_id) r = self.ensembl_request(ext, headers) cds_ranges = [] for cds_range in json.loads(r): if cds_range["Parent"] != transcript_id: continue start = cds_range["start"] end = cds_range["end"] cds_ranges.append((start, end)) return cds_ranges
obtain the sequence for a transcript from ensembl
#vtb def last_available_business_date(self, asset_manager_id, asset_ids, page_no=None, page_size=None): self.logger.info() url = % self.endpoint params = {: [asset_manager_id], : .join(asset_ids)} if page_no: params[] = page_no if page_size: params[] = page_size response = self.session.get(url, params=params) if response.ok: self.logger.info("Received %s assets' last available business date", len(response.json())) return response.json() else: self.logger.error(response.text) response.raise_for_status()
Returns the last available business date for the assets so we know the starting date for new data which needs to be downloaded from data providers. This method can only be invoked by system user
#vtb def _get_pattern_for_schema(self, schema_name, httpStatus): defaultPattern = if self._is_http_error_rescode(httpStatus) else model = self._models().get(schema_name) patterns = self._find_patterns(model) return patterns[0] if patterns else defaultPattern
returns the pattern specified in a response schema
#vtb def release(self, conn): self._pool_lock.acquire() self._pool.put(ConnectionWrapper(self._pool, conn)) self._current_acquired -= 1 self._pool_lock.release()
Release a previously acquired connection. The connection is put back into the pool.
#vtb def cli(env, volume_id, reason, immediate): file_storage_manager = SoftLayer.FileStorageManager(env.client) if not (env.skip_confirmations or formatting.no_going_back(volume_id)): raise exceptions.CLIAbort() cancelled = file_storage_manager.cancel_snapshot_space( volume_id, reason, immediate) if cancelled: if immediate: click.echo( % volume_id) else: click.echo( % volume_id) else: click.echo( % volume_id)
Cancel existing snapshot space for a given volume.
#vtb def request_add_sensor(self, sock, msg): self.add_sensor(Sensor(int, % len(self._sensors), , , params=[-10, 10])) return Message.reply(, )
add a sensor
#vtb def fullName(self): if self.givenName and self.sn: return "{0} {1}".format(self.givenName, self.sn) if self.givenName: return self.givenName if self.sn: return self.sn return self.uid
Returns a reliable full name (firstName lastName) for every member (as of the writing of this comment.)
#vtb def custom_parser(cards: list, parser: Optional[Callable[[list], Optional[list]]]=None) -> Optional[list]: if not parser: return cards else: return parser(cards)
parser for CUSTOM [1] issue mode, please provide your custom parser as argument
#vtb def read(self, size=None): if not self._is_open: raise IOError() if self._current_offset < 0: raise IOError( .format( self._current_offset)) if self._file_data is None or self._current_offset >= self._size: return b if size is None: size = self._size if self._current_offset + size > self._size: size = self._size - self._current_offset start_offset = self._current_offset self._current_offset += size return self._file_data[start_offset:self._current_offset]
Reads a byte string from the file-like object at the current offset. The function will read a byte string of the specified size or all of the remaining data if no size was specified. Args: size (Optional[int]): number of bytes to read, where None is all remaining data. Returns: bytes: data read. Raises: IOError: if the read failed. OSError: if the read failed.
#vtb def mode_number(self, rows: List[Row], column: NumberColumn) -> Number: most_frequent_list = self._get_most_frequent_values(rows, column) if not most_frequent_list: return 0.0 most_frequent_value = most_frequent_list[0] if not isinstance(most_frequent_value, Number): raise ExecutionError(f"Invalid valus for mode_number: {most_frequent_value}") return most_frequent_value
Takes a list of rows and a column and returns the most frequent value under that column in those rows.
#vtb def wploader(self): if self.target_system not in self.wploader_by_sysid: self.wploader_by_sysid[self.target_system] = mavwp.MAVWPLoader() return self.wploader_by_sysid[self.target_system]
per-sysid wploader
#vtb def transform_qubits(self: TSelf_Operation, func: Callable[[Qid], Qid]) -> TSelf_Operation: return self.with_qubits(*(func(q) for q in self.qubits))
Returns the same operation, but with different qubits. Args: func: The function to use to turn each current qubit into a desired new qubit. Returns: The receiving operation but with qubits transformed by the given function.
#vtb def make_name(self): if self.title: self.name = six.text_type(make_name(self.title_for_name, maxlength=self.__name_length__))
Autogenerates a :attr:`name` from :attr:`title_for_name`
#vtb def coerce_to_target_dtype(self, other): dtype, _ = infer_dtype_from(other, pandas_dtype=True) if is_dtype_equal(self.dtype, dtype): return self if self.is_bool or is_object_dtype(dtype) or is_bool_dtype(dtype): return self elif (self.is_datetime or is_datetime64_dtype(dtype) or is_datetime64tz_dtype(dtype)): if not ((is_datetime64_dtype(dtype) or is_datetime64tz_dtype(dtype)) and self.is_datetime): return self.astype(object) if str(mytz) != str(othertz): return self.astype(object) raise AssertionError("possible recursion in " "coerce_to_target_dtype: {} {}".format( self, other)) elif (self.is_timedelta or is_timedelta64_dtype(dtype)): if not (is_timedelta64_dtype(dtype) and self.is_timedelta): return self.astype(object) raise AssertionError("possible recursion in " "coerce_to_target_dtype: {} {}".format( self, other)) try: return self.astype(dtype) except (ValueError, TypeError, OverflowError): pass return self.astype(object)
coerce the current block to a dtype compat for other we will return a block, possibly object, and not raise we can also safely try to coerce to the same dtype and will receive the same block
#vtb def LinearContrast(alpha=1, per_channel=False, name=None, deterministic=False, random_state=None): params1d = [ iap.handle_continuous_param(alpha, "alpha", value_range=None, tuple_to_uniform=True, list_to_choice=True) ] func = adjust_contrast_linear return _ContrastFuncWrapper( func, params1d, per_channel, dtypes_allowed=["uint8", "uint16", "uint32", "int8", "int16", "int32", "float16", "float32", "float64"], dtypes_disallowed=["uint64", "int64", "float96", "float128", "float256", "bool"], name=name if name is not None else ia.caller_name(), deterministic=deterministic, random_state=random_state )
Adjust contrast by scaling each pixel value to ``127 + alpha*(I_ij-127)``. dtype support:: See :func:`imgaug.augmenters.contrast.adjust_contrast_linear`. Parameters ---------- alpha : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional Multiplier to linearly pronounce (>1.0), dampen (0.0 to 1.0) or invert (<0.0) the difference between each pixel value and the center value, e.g. ``127`` for ``uint8``. * If a number, then that value will be used for all images. * If a tuple ``(a, b)``, then a value from the range ``[a, b]`` will be used per image. * If a list, then a random value will be sampled from that list per image. * If a StochasticParameter, then a value will be sampled per image from that parameter. per_channel : bool or float, optional Whether to use the same value for all channels (False) or to sample a new value for each channel (True). If this value is a float ``p``, then for ``p`` percent of all images `per_channel` will be treated as True, otherwise as False. name : None or str, optional See :func:`imgaug.augmenters.meta.Augmenter.__init__`. deterministic : bool, optional See :func:`imgaug.augmenters.meta.Augmenter.__init__`. random_state : None or int or numpy.random.RandomState, optional See :func:`imgaug.augmenters.meta.Augmenter.__init__`. Returns ------- _ContrastFuncWrapper Augmenter to perform contrast adjustment by linearly scaling the distance to 128.
#vtb def declare_list(self, name, sep=os.pathsep): self._declare_special(name, sep, ListVariable)
Declare an environment variable as a list-like special variable. This can be used even if the environment variable is not present. :param name: The name of the environment variable that should be considered list-like. :param sep: The separator to be used. Defaults to the value of ``os.pathsep``.
#vtb def _restore_stdout(self): if self.buffer: if self._mirror_output: output = sys.stdout.getvalue() error = sys.stderr.getvalue() if output: if not output.endswith(): output += self._original_stdout.write(STDOUT_LINE % output) if error: if not error.endswith(): error += self._original_stderr.write(STDERR_LINE % error) sys.stdout = self._original_stdout sys.stderr = self._original_stderr self._stdout_buffer.seek(0) self._stdout_buffer.truncate() self._stderr_buffer.seek(0) self._stderr_buffer.truncate()
Unhook stdout and stderr if buffering is enabled.
#vtb def prompt_save_images(args): if args[] or args[]: return if (args[] or args[]) and (args[] or args[]): save_msg = ( ) try: save_images = utils.confirm_input(input(save_msg)) except (KeyboardInterrupt, EOFError): return args[] = save_images args[] = not save_images
Prompt user to save images when crawling (for pdf and HTML formats).
#vtb def IV(abf,T1,T2,plotToo=True,color=): rangeData=abf.average_data([[T1,T2]]) AV,SD=rangeData[:,0,0],rangeData[:,0,1] Xs=abf.clampValues(T1) if plotToo: new(abf) pylab.margins(.1,.1) annotate(abf) return AV,SD
Given two time points (seconds) return IV data. Optionally plots a fancy graph (with errorbars) Returns [[AV],[SD]] for the given range.
#vtb def show_worst_drawdown_periods(returns, top=5): drawdown_df = timeseries.gen_drawdown_table(returns, top=top) utils.print_table( drawdown_df.sort_values(, ascending=False), name=, float_format=.format, )
Prints information about the worst drawdown periods. Prints peak dates, valley dates, recovery dates, and net drawdowns. Parameters ---------- returns : pd.Series Daily returns of the strategy, noncumulative. - See full explanation in tears.create_full_tear_sheet. top : int, optional Amount of top drawdowns periods to plot (default 5).
#vtb def DeleteAttachment(self, attachment_link, options=None): if options is None: options = {} path = base.GetPathFromLink(attachment_link) attachment_id = base.GetResourceIdOrFullNameFromLink(attachment_link) return self.DeleteResource(path, , attachment_id, None, options)
Deletes an attachment. :param str attachment_link: The link to the attachment. :param dict options: The request options for the request. :return: The deleted Attachment. :rtype: dict
#vtb def read_index_iter(self): with fopen(self.vpk_path, ) as f: f.seek(self.header_length) while True: if self.version > 0 and f.tell() > self.tree_length + self.header_length: raise ValueError("Error parsing index (out of bounds)") ext = _read_cstring(f) if ext == : break while True: path = _read_cstring(f) if path == : break if path != : path = os.path.join(path, ) else: path = while True: name = _read_cstring(f) if name == : break (crc32, preload_length, archive_index, archive_offset, file_length, suffix, ) = metadata = list(struct.unpack("IHHIIH", f.read(18))) if suffix != 0xffff: raise ValueError("Error while parsing index") if archive_index == 0x7fff: metadata[3] = self.header_length + self.tree_length + archive_offset metadata = (f.read(preload_length),) + tuple(metadata[:-1]) yield path + name + + ext, metadata
Generator function that reads the file index from the vpk file yeilds (file_path, metadata)
#vtb def load_from_namespace(module_name): class_inst = None name = "py3status.modules.{}".format(module_name) py_mod = __import__(name) components = name.split(".") for comp in components[1:]: py_mod = getattr(py_mod, comp) class_inst = py_mod.Py3status() return class_inst
Load a py3status bundled module.
#vtb def _add_loss_summaries(total_loss): loss_averages = tf.train.ExponentialMovingAverage(0.9, name=) losses = tf.get_collection() loss_averages_op = loss_averages.apply(losses + [total_loss]) for l in losses + [total_loss]: tf.summary.scalar(l.op.name + , l) tf.summary.scalar(l.op.name, loss_averages.average(l)) return loss_averages_op
Add summaries for losses in CIFAR-10 model. Generates moving average for all losses and associated summaries for visualizing the performance of the network. Args: total_loss: Total loss from loss(). Returns: loss_averages_op: op for generating moving averages of losses.
#vtb def _download_libraries(self, libname): self._logger.info("Downloading and generating Enrichr library gene sets......") s = retry(5) ENRICHR_URL = query_string = response = s.get( ENRICHR_URL + query_string % libname, timeout=None) if not response.ok: raise Exception() mkdirs(DEFAULT_CACHE_PATH) genesets_dict = {} outname = "enrichr.%s.gmt"%libname gmtout = open(os.path.join(DEFAULT_CACHE_PATH, outname), "w") for line in response.iter_lines(chunk_size=1024, decode_unicode=): line=line.strip() k = line.split("\t")[0] v = list(map(lambda x: x.split(",")[0], line.split("\t")[2:])) genesets_dict.update({ k: v}) outline = "%s\t\t%s\n"%(k, "\t".join(v)) gmtout.write(outline) gmtout.close() return genesets_dict
download enrichr libraries.
#vtb def _set_config(c): gl_attribs = [glcanvas.WX_GL_RGBA, glcanvas.WX_GL_DEPTH_SIZE, c[], glcanvas.WX_GL_STENCIL_SIZE, c[], glcanvas.WX_GL_MIN_RED, c[], glcanvas.WX_GL_MIN_GREEN, c[], glcanvas.WX_GL_MIN_BLUE, c[], glcanvas.WX_GL_MIN_ALPHA, c[]] gl_attribs += [glcanvas.WX_GL_DOUBLEBUFFER] if c[] else [] gl_attribs += [glcanvas.WX_GL_STEREO] if c[] else [] return gl_attribs
Set gl configuration
#vtb def error(self): status_code, error_msg, payload = self.check_error() if status_code != 200 and not error_msg and not payload: return "Async error (%s). Status code: %r" % (self.async_id, status_code) return error_msg
Check if the async response is an error. Take care to call `is_done` before calling `error`. Note that the error messages are always encoded as strings. :raises CloudUnhandledError: When not checking `is_done` first :return: the error value/payload, if found. :rtype: str
#vtb def fluxfrac(*mags): Ftot = 0 for mag in mags: Ftot += 10**(-0.4*mag) F1 = 10**(-0.4*mags[0]) return F1/Ftot
Returns fraction of total flux in first argument, assuming all are magnitudes.
#vtb def GetUserInfo(knowledge_base, user): if "\\" in user: domain, user = user.split("\\", 1) users = [ u for u in knowledge_base.users if u.username == user and u.userdomain == domain ] else: users = [u for u in knowledge_base.users if u.username == user] if not users: return else: return users[0]
Get a User protobuf for a specific user. Args: knowledge_base: An rdf_client.KnowledgeBase object. user: Username as string. May contain domain like DOMAIN\\user. Returns: A User rdfvalue or None
#vtb def __geomToPointList(self, geom): if arcpyFound and isinstance(geom, arcpy.Multipoint): feature_geom = [] fPart = [] for part in geom: fPart = [] for pnt in part: fPart.append(Point(coord=[pnt.X, pnt.Y], wkid=geom.spatialReference.factoryCode, z=pnt.Z, m=pnt.M)) feature_geom.append(fPart) return feature_geom
converts a geometry object to a common.Geometry object
#vtb def get_hash(self): if self._hash is None: self._hash = self._source.get_hash(self._handle).strip() return self._hash
Returns the associated hash for this template version Returns: str: Hash for this version
#vtb def RGB_color_picker(obj): digest = hashlib.sha384(str(obj).encode()).hexdigest() subsize = int(len(digest) / 3) splitted_digest = [digest[i * subsize: (i + 1) * subsize] for i in range(3)] max_value = float(int("f" * subsize, 16)) components = ( int(d, 16) / max_value for d in splitted_digest) return Color(rgb2hex(components))
Build a color representation from the string representation of an object This allows to quickly get a color from some data, with the additional benefit that the color will be the same as long as the (string representation of the) data is the same:: >>> from colour import RGB_color_picker, Color Same inputs produce the same result:: >>> RGB_color_picker("Something") == RGB_color_picker("Something") True ... but different inputs produce different colors:: >>> RGB_color_picker("Something") != RGB_color_picker("Something else") True In any case, we still get a ``Color`` object:: >>> isinstance(RGB_color_picker("Something"), Color) True
#vtb def build_dependencies(self): for m in self.modules: m.build_dependencies() for p in self.packages: p.build_dependencies()
Recursively build the dependencies for sub-modules and sub-packages. Iterate on node's modules then packages and call their build_dependencies methods.
#vtb def __setup(): global __collaborators, __flag_first import f311 __flag_first = False for pkgname in f311.COLLABORATORS_C: try: pkg = importlib.import_module(pkgname) a99.get_python_logger().info("Imported collaborator package ".format(pkgname)) try: if hasattr(pkg, "_setup_filetypes"): pkg._setup_filetypes() else: _collect_classes(pkg) __collaborators[pkgname] = pkg except: a99.get_python_logger().exception( "Actually, package gave error".format(pkgname)) raise except: a99.get_python_logger().warning("Failed to import package '{}".format(pkgname))
Will be executed in the first time someone calls classes_*()
#vtb def createPolyline(self, points, strokewidth=1, stroke=): style_dict = {:, :strokewidth, :stroke} myStyle = StyleBuilder(style_dict) p = Polyline(points=points) p.set_style(myStyle.getStyle()) return p
Creates a Polyline @type points: string in the form "x1,y1 x2,y2 x3,y3" @param points: all points relevant to the polygon @type strokewidth: string or int @param strokewidth: width of the pen used to draw @type stroke: string (either css constants like "black" or numerical values like "#FFFFFF") @param stroke: color with which to draw the outer limits @return: a polyline object
#vtb def remove_programmer(programmer_id): log.debug(, programmer_id) lines = programmers_txt().lines() lines = filter( lambda x: not x.strip().startswith(programmer_id + ), lines) programmers_txt().write_lines(lines)
remove programmer. :param programmer_id: programmer id (e.g. 'avrisp') :rtype: None
#vtb def logistic_regression(X, y, coef_only=False, alpha=0.05, as_dataframe=True, remove_na=False, **kwargs): from pingouin.utils import _is_sklearn_installed _is_sklearn_installed(raise_error=True) from sklearn.linear_model import LogisticRegression if isinstance(X, pd.DataFrame): names = X.keys().tolist() elif isinstance(X, pd.Series): names = [X.name] else: names = [] assert 0 < alpha < 1 assert y.ndim == 1, X = np.asarray(X) y = np.asarray(y) if X.ndim == 1: X = X[..., np.newaxis] if remove_na: X, y = rm_na(X, y[..., np.newaxis], paired=True, axis=) y = np.squeeze(y) y_gd = np.isfinite(y).all() X_gd = np.isfinite(X).all() assert y_gd, assert X_gd, assert y.shape[0] == X.shape[0], if np.unique(y).size != 2: raise ValueError() if not names: names = [ + str(i + 1) for i in range(X.shape[1])] names.insert(0, "Intercept") if not in kwargs: kwargs[] = if not in kwargs: kwargs[] = lom = LogisticRegression(**kwargs) lom.fit(X, y) coef = np.append(lom.intercept_, lom.coef_) if coef_only: return coef X_design = np.column_stack((np.ones(X.shape[0]), X)) n, p = X_design.shape denom = (2 * (1 + np.cosh(lom.decision_function(X)))) denom = np.tile(denom, (p, 1)).T fim = np.dot((X_design / denom).T, X_design) crao = np.linalg.inv(fim) se = np.sqrt(np.diag(crao)) z_scores = coef / se pval = np.array([2 * norm.sf(abs(z)) for z in z_scores]) crit = norm.ppf(1 - alpha / 2) ll = coef - crit * se ul = coef + crit * se ll_name = % (100 * alpha / 2) ul_name = % (100 * (1 - alpha / 2)) stats = {: names, : coef, : se, : z_scores, : pval, ll_name: ll, ul_name: ul} if as_dataframe: return pd.DataFrame.from_dict(stats) else: return stats
(Multiple) Binary logistic regression. Parameters ---------- X : np.array or list Predictor(s). Shape = (n_samples, n_features) or (n_samples,). y : np.array or list Dependent variable. Shape = (n_samples). Must be binary. coef_only : bool If True, return only the regression coefficients. alpha : float Alpha value used for the confidence intervals. CI = [alpha / 2 ; 1 - alpha / 2] as_dataframe : bool If True, returns a pandas DataFrame. If False, returns a dictionnary. remove_na : bool If True, apply a listwise deletion of missing values (i.e. the entire row is removed). **kwargs : optional Optional arguments passed to sklearn.linear_model.LogisticRegression. Returns ------- stats : dataframe or dict Logistic regression summary:: 'names' : name of variable(s) in the model (e.g. x1, x2...) 'coef' : regression coefficients 'se' : standard error 'z' : z-scores 'pval' : two-tailed p-values 'CI[2.5%]' : lower confidence interval 'CI[97.5%]' : upper confidence interval Notes ----- This is a wrapper around the :py:class:`sklearn.linear_model.LogisticRegression` class. Results have been compared against statsmodels and JASP. Note that the first coefficient is always the constant term (intercept) of the model. This function will not run if NaN values are either present in the target or predictors variables. Please remove them before runing the function. Adapted from a code found at https://gist.github.com/rspeare/77061e6e317896be29c6de9a85db301d Examples -------- 1. Simple binary logistic regression >>> import numpy as np >>> from pingouin import logistic_regression >>> np.random.seed(123) >>> x = np.random.normal(size=30) >>> y = np.random.randint(0, 2, size=30) >>> lom = logistic_regression(x, y) >>> lom.round(2) names coef se z pval CI[2.5%] CI[97.5%] 0 Intercept -0.27 0.37 -0.73 0.46 -0.99 0.45 1 x1 0.06 0.32 0.19 0.85 -0.56 0.68 2. Multiple binary logistic regression >>> np.random.seed(42) >>> z = np.random.normal(size=30) >>> X = np.column_stack((x, z)) >>> lom = logistic_regression(X, y) >>> print(lom['coef'].values) [-0.34933805 -0.0226106 -0.39453532] 3. Using a Pandas DataFrame >>> import pandas as pd >>> df = pd.DataFrame({'x': x, 'y': y, 'z': z}) >>> lom = logistic_regression(df[['x', 'z']], df['y']) >>> print(lom['coef'].values) [-0.34933805 -0.0226106 -0.39453532] 4. Return only the coefficients >>> logistic_regression(X, y, coef_only=True) array([-0.34933805, -0.0226106 , -0.39453532]) 4. Passing custom parameters to sklearn >>> lom = logistic_regression(X, y, solver='sag', max_iter=10000) >>> print(lom['coef'].values) [-0.34941889 -0.02261911 -0.39451064]
#vtb def _generate_iam_invoke_role_policy(self): invoke_pol = { "Version": "2012-10-17", "Statement": [ { "Effect": "Allow", "Resource": ["*"], "Action": ["lambda:InvokeFunction"] } ] } self.tf_conf[][][] = { : self.resource_name + , : , : json.dumps(invoke_pol) }
Generate the policy for the IAM role used by API Gateway to invoke the lambda function. Terraform name: aws_iam_role.invoke_role
#vtb def _dusty_hosts_config(hosts_specs): rules = .join([.format(spec[], spec[]) for spec in hosts_specs]) return config_file.create_config_section(rules)
Return a string of all host rules required to match the given spec. This string is wrapped in the Dusty hosts header and footer so it can be easily removed later.
#vtb def modify_schema(self, field_schema): field_schema[] = self.maximum_value if self.exclusive: field_schema[] = True
Modify field schema.
#vtb def normalize_url(url): if not url or len(url) == 0: return if not url.startswith(): url = + url if len(url) > 1 and url.endswith(): url = url[0:len(url) - 1] return url
Return a normalized url with trailing and without leading slash. >>> normalize_url(None) '/' >>> normalize_url('/') '/' >>> normalize_url('/foo/bar') '/foo/bar' >>> normalize_url('foo/bar') '/foo/bar' >>> normalize_url('/foo/bar/') '/foo/bar'
#vtb def visualize(G, settings, filename="dependencies", no_graphviz=False): error = settings["error"] if no_graphviz: write_dot_file(G, filename) return 0 write_dot_file(G, "tempdot") renderer = "svg" if re.search("\.jpg$", filename, re.IGNORECASE): renderer = "jpg" elif re.search("\.jpeg$", filename, re.IGNORECASE): renderer = "jpg" elif re.search("\.svg$", filename, re.IGNORECASE): renderer = "svg" elif re.search("\.png$", filename, re.IGNORECASE): renderer = "png" elif re.search("\.gif$", filename, re.IGNORECASE): renderer = "gif" elif re.search("\.ps$", filename, re.IGNORECASE): renderer = "ps" elif re.search("\.pdf$", filename, re.IGNORECASE): renderer = "pdf" else: renderer = "svg" filename += ".svg" command = "dot -T{} tempdot -o {}".format(renderer, filename) p = Popen(command, shell=True) p.communicate() if p.returncode: errmes = "Either graphviz is not installed, or its not on PATH" os.remove("tempdot") error(errmes) sys.exit(1) os.remove("tempdot") return 0
Uses networkX to draw a graphviz dot file either (a) calls the graphviz command "dot" to turn it into a SVG and remove the dotfile (default), or (b) if no_graphviz is True, just output the graphviz dot file Args: a NetworkX DiGraph the settings dictionary a filename (a default is provided a flag indicating whether graphviz should *not* be called Returns: 0 if everything worked will cause fatal error on failure
#vtb def check_row(state, index, missing_msg=None, expand_msg=None): if missing_msg is None: missing_msg = "The system wants to verify row {{index + 1}} of your query result, but couldnre trying to fetch the row at index {}".format( n_sol, index ) ) if index >= n_stu: _msg = state.build_message(missing_msg, fmt_kwargs=msg_kwargs) state.do_test(_msg) return state.to_child( append_message={"msg": expand_msg, "kwargs": msg_kwargs}, student_result={k: [v[index]] for k, v in stu_res.items()}, solution_result={k: [v[index]] for k, v in sol_res.items()}, )
Zoom in on a particular row in the query result, by index. After zooming in on a row, which is represented as a single-row query result, you can use ``has_equal_value()`` to verify whether all columns in the zoomed in solution query result have a match in the student query result. Args: index: index of the row to zoom in on (zero-based indexed). missing_msg: if specified, this overrides the automatically generated feedback message in case the row is missing in the student query result. expand_msg: if specified, this overrides the automatically generated feedback message that is prepended to feedback messages that are thrown further in the SCT chain. :Example: Suppose we are testing the following SELECT statements * solution: ``SELECT artist_id as id, name FROM artists LIMIT 5`` * student : ``SELECT artist_id, name FROM artists LIMIT 2`` We can write the following SCTs: :: # fails, since row 3 at index 2 is not in the student result Ex().check_row(2) # passes, since row 2 at index 1 is in the student result Ex().check_row(0)
#vtb def replace(self, **kwargs): return SlashSeparatedCourseKey( kwargs.pop(, self.org), kwargs.pop(, self.course), kwargs.pop(, self.run), **kwargs )
Return: a new :class:`SlashSeparatedCourseKey` with specific ``kwargs`` replacing their corresponding values. Using CourseLocator's replace function results in a mismatch of __init__ args and kwargs. Replace tries to instantiate a SlashSeparatedCourseKey object with CourseLocator args and kwargs.
#vtb def dtype(self): try: return self.data.dtype except AttributeError: return numpy.dtype( % (self._sample_type, self._sample_bytes))
Pixel data type.
#vtb def reverse(view, *args, **kwargs): s `reverse` as `args` and `kwargs` arguments, respectively. The special optional keyword argument `query` is a dictionary of query (or GET) parameters that can be appended to the `reverse`d URL. Example: reverse(, categoryId = 5, query = {: 2}) is equivalent to django.core.urlresolvers.reverse(, kwargs = {: 5}) + queryquery{}?{}'.format(base, django.utils.http.urlencode(query)) else: return base
User-friendly reverse. Pass arguments and keyword arguments to Django's `reverse` as `args` and `kwargs` arguments, respectively. The special optional keyword argument `query` is a dictionary of query (or GET) parameters that can be appended to the `reverse`d URL. Example: reverse('products:category', categoryId = 5, query = {'page': 2}) is equivalent to django.core.urlresolvers.reverse('products:category', kwargs = {'categoryId': 5}) + '?page=2'
#vtb def hacking_assert_equal(logical_line, noqa): r if noqa: return methods = [, ] for method in methods: start = logical_line.find( % method) + 1 if start != 0: break else: return comparisons = [ast.Eq, ast.NotEq] checker = AssertTrueFalseChecker(methods, comparisons) checker.visit(ast.parse(logical_line)) if checker.error: yield start,
r"""Check that self.assertEqual and self.assertNotEqual are used. Okay: self.assertEqual(x, y) Okay: self.assertNotEqual(x, y) H204: self.assertTrue(x == y) H204: self.assertTrue(x != y) H204: self.assertFalse(x == y) H204: self.assertFalse(x != y)
#vtb def delete_feed(self, pid): logger.info("delete_feed(pid=\"%s\") [lid=%s]", pid, self.__lid) return self.__delete_point(R_FEED, pid)
Delete a feed, identified by its local id. Raises [IOTException](./Exceptions.m.html#IoticAgent.IOT.Exceptions.IOTException) containing the error if the infrastructure detects a problem Raises [LinkException](../Core/AmqpLink.m.html#IoticAgent.Core.AmqpLink.LinkException) if there is a communications problem between you and the infrastructure `pid` (required) (string) local identifier of your feed you want to delete
#vtb def send(self, url, data, headers): eventlet.spawn(self._send_payload, (url, data, headers))
Spawn an async request to a remote webserver.
#vtb def team(self, name=None, id=None, is_hidden=False, **kwargs): _teams = self.teams(name=name, id=id, **kwargs) if len(_teams) == 0: raise NotFoundError("No team criteria matches") if len(_teams) != 1: raise MultipleFoundError("Multiple teams fit criteria") return _teams[0]
Team of KE-chain. Provides a team of :class:`Team` of KE-chain. You can filter on team name or provide id. :param name: (optional) team name to filter :type name: basestring or None :param id: (optional) id of the user to filter :type id: basestring or None :param is_hidden: (optional) boolean to show non-hidden or hidden teams or both (None) (default is non-hidden) :type is_hidden: bool or None :param kwargs: Additional filtering keyword=value arguments :type kwargs: dict or None :return: List of :class:`Team` :raises NotFoundError: when a user could not be found :raises MultipleFoundError: when more than a single user can be found
#vtb def _extend(self, newsub): current = self while hasattr(current, ): current = current._sub _set(current, , newsub) try: object.__delattr__(self, ) except: pass
Append a subclass (extension) after the base class. For parser internal use.
#vtb def subclass(self, klass): return bool(lib.EnvSubclassP(self._env, self._cls, klass._cls))
True if the Class is a subclass of the given one.
#vtb def put(self, item, *args, **kwargs): if not self.enabled: return timeout = kwargs.pop(, None) if timeout is None: timeout = self.default_timeout cache_key = self.make_key(args, kwargs) with self._cache_lock: self._cache[cache_key] = (time() + timeout, item)
Put an item into the cache, for this combination of args and kwargs. Args: *args: any arguments. **kwargs: any keyword arguments. If ``timeout`` is specified as one of the keyword arguments, the item will remain available for retrieval for ``timeout`` seconds. If ``timeout`` is `None` or not specified, the ``default_timeout`` for this cache will be used. Specify a ``timeout`` of 0 (or ensure that the ``default_timeout`` for this cache is 0) if this item is not to be cached.
#vtb def add_arguments(self, parser): parser.add_argument( , action=, default=False, help="Output what wet actually do it." ) parser.add_argument( , , default=None, help=u"Restrict cleanup to tasks matching the named task.", ) parser.add_argument( , , type=int, default=30, help=u"Only delete tasks that have been resolved for at least the specified number of days (default: 30)", )
Add arguments to the command parser. Uses argparse syntax. See documentation at https://docs.python.org/3/library/argparse.html.
#vtb def render_mail_template(subject_template, body_template, context): try: subject = strip_spaces(render_to_string(subject_template, context)) body = render_to_string(body_template, context) finally: pass return subject, body
Renders both the subject and body templates in the given context. Returns a tuple (subject, body) of the result.
#vtb def use_strategy(new_strategy): def wrapped_class(klass): klass._meta.strategy = new_strategy return klass return wrapped_class
Force the use of a different strategy. This is an alternative to setting default_strategy in the class definition.
#vtb def cart_create(self, items, **kwargs): if isinstance(items, dict): items = [items] if len(items) > 10: raise CartException("You canItem.{0}.OfferListingIdItem.{0}.Quantityoffer_idquantity'] response = self.api.CartCreate(**kwargs) root = objectify.fromstring(response) return AmazonCart(root)
CartCreate. :param items: A dictionary containing the items to be added to the cart. Or a list containing these dictionaries. It is not possible to create an empty cart! example: [{'offer_id': 'rt2ofih3f389nwiuhf8934z87o3f4h', 'quantity': 1}] :return: An :class:`~.AmazonCart`.
#vtb def mel_to_hz(mels, htk=False): mels = np.asanyarray(mels) if htk: return 700.0 * (10.0**(mels / 2595.0) - 1.0) f_min = 0.0 f_sp = 200.0 / 3 freqs = f_min + f_sp * mels min_log_hz = 1000.0 min_log_mel = (min_log_hz - f_min) / f_sp logstep = np.log(6.4) / 27.0 if mels.ndim: log_t = (mels >= min_log_mel) freqs[log_t] = min_log_hz * np.exp(logstep * (mels[log_t] - min_log_mel)) elif mels >= min_log_mel: freqs = min_log_hz * np.exp(logstep * (mels - min_log_mel)) return freqs
Convert mel bin numbers to frequencies Examples -------- >>> librosa.mel_to_hz(3) 200. >>> librosa.mel_to_hz([1,2,3,4,5]) array([ 66.667, 133.333, 200. , 266.667, 333.333]) Parameters ---------- mels : np.ndarray [shape=(n,)], float mel bins to convert htk : bool use HTK formula instead of Slaney Returns ------- frequencies : np.ndarray [shape=(n,)] input mels in Hz See Also -------- hz_to_mel
#vtb def prepare_data(self): result = {} for field in self.fields: data = self.data.get(field.name) result[field.name] = field.prepare_data(data) return result
Prepare widget data for template.
#vtb def compute_ssm(X, metric="seuclidean"): D = distance.pdist(X, metric=metric) D = distance.squareform(D) D /= D.max() return 1 - D
Computes the self-similarity matrix of X.
#vtb def id_request(self, device_id): self.logger.info("\nid_request for device %s", device_id) device_id = device_id.upper() self.direct_command(device_id, , ) sleep(2) status = self.get_buffer_status(device_id) if not status: sleep(1) status = self.get_buffer_status(device_id) return status
Get the device for the ID. ID request can return device type (cat/subcat), firmware ver, etc. Cat is status['is_high'], sub cat is status['id_mid']
#vtb def on_send(self, frame): if frame.cmd == CMD_CONNECT or frame.cmd == CMD_STOMP: if self.heartbeats != (0, 0): frame.headers[HDR_HEARTBEAT] = % self.heartbeats if self.next_outbound_heartbeat is not None: self.next_outbound_heartbeat = monotonic() + self.send_sleep
Add the heartbeat header to the frame when connecting, and bump next outbound heartbeat timestamp. :param Frame frame: the Frame object
#vtb def create_udf_node(name, fields): definition = next(_udf_name_cache[name]) external_name = .format(name, definition) return type(external_name, (BigQueryUDFNode,), fields)
Create a new UDF node type. Parameters ---------- name : str Then name of the UDF node fields : OrderedDict Mapping of class member name to definition Returns ------- result : type A new BigQueryUDFNode subclass
#vtb def visit_Module(self, node): deps = sorted(self.dependencies) headers = [Include(os.path.join("pythonic", "include", *t) + ".hpp") for t in deps] headers += [Include(os.path.join("pythonic", *t) + ".hpp") for t in deps] decls_n_defns = [self.visit(stmt) for stmt in node.body] decls, defns = zip(*[s for s in decls_n_defns if s]) nsbody = [s for ls in decls + defns for s in ls] ns = Namespace(pythran_ward + self.passmanager.module_name, nsbody) self.result = CompilationUnit(headers + [ns])
Build a compilation unit.
#vtb def adjust_internal_tacking_values(self, min_non_zero_index, max_index, total_added): if max_index >= 0: max_value = self.get_highest_equivalent_value(self.get_value_from_index(max_index)) self.max_value = max(self.max_value, max_value) if min_non_zero_index >= 0: min_value = self.get_value_from_index(min_non_zero_index) self.min_value = min(self.min_value, min_value) self.total_count += total_added
Called during decoding and add to adjust the new min/max value and total count Args: min_non_zero_index min nonzero index of all added counts (-1 if none) max_index max index of all added counts (-1 if none)
#vtb def has_method(obj, name): if obj == None: raise Exception("Object cannot be null") if name == None: raise Exception("Method name cannot be null") name = name.lower() for method_name in dir(obj): if method_name.lower() != name: continue method = getattr(obj, method_name) if MethodReflector._is_method(method, method_name): return True return False
Checks if object has a method with specified name. :param obj: an object to introspect. :param name: a name of the method to check. :return: true if the object has the method and false if it doesn't.
#vtb def copy(self, deep=True): data = self._data.copy(deep=deep) return self._constructor(data).__finalize__(self)
Make a copy of this object's indices and data. When ``deep=True`` (default), a new object will be created with a copy of the calling object's data and indices. Modifications to the data or indices of the copy will not be reflected in the original object (see notes below). When ``deep=False``, a new object will be created without copying the calling object's data or index (only references to the data and index are copied). Any changes to the data of the original will be reflected in the shallow copy (and vice versa). Parameters ---------- deep : bool, default True Make a deep copy, including a copy of the data and the indices. With ``deep=False`` neither the indices nor the data are copied. Returns ------- copy : Series, DataFrame or Panel Object type matches caller. Notes ----- When ``deep=True``, data is copied but actual Python objects will not be copied recursively, only the reference to the object. This is in contrast to `copy.deepcopy` in the Standard Library, which recursively copies object data (see examples below). While ``Index`` objects are copied when ``deep=True``, the underlying numpy array is not copied for performance reasons. Since ``Index`` is immutable, the underlying data can be safely shared and a copy is not needed. Examples -------- >>> s = pd.Series([1, 2], index=["a", "b"]) >>> s a 1 b 2 dtype: int64 >>> s_copy = s.copy() >>> s_copy a 1 b 2 dtype: int64 **Shallow copy versus default (deep) copy:** >>> s = pd.Series([1, 2], index=["a", "b"]) >>> deep = s.copy() >>> shallow = s.copy(deep=False) Shallow copy shares data and index with original. >>> s is shallow False >>> s.values is shallow.values and s.index is shallow.index True Deep copy has own copy of data and index. >>> s is deep False >>> s.values is deep.values or s.index is deep.index False Updates to the data shared by shallow copy and original is reflected in both; deep copy remains unchanged. >>> s[0] = 3 >>> shallow[1] = 4 >>> s a 3 b 4 dtype: int64 >>> shallow a 3 b 4 dtype: int64 >>> deep a 1 b 2 dtype: int64 Note that when copying an object containing Python objects, a deep copy will copy the data, but will not do so recursively. Updating a nested data object will be reflected in the deep copy. >>> s = pd.Series([[1, 2], [3, 4]]) >>> deep = s.copy() >>> s[0][0] = 10 >>> s 0 [10, 2] 1 [3, 4] dtype: object >>> deep 0 [10, 2] 1 [3, 4] dtype: object
#vtb def Shell(device, *command): if command: return device.StreamingShell(.join(command)) else: terminal_prompt = device.InteractiveShell() print(terminal_prompt.decode()) while True: cmd = input() if not cmd: continue elif cmd == : break else: stdout = device.InteractiveShell(cmd, strip_cmd=True, delim=terminal_prompt, strip_delim=True) if stdout: if isinstance(stdout, bytes): stdout = stdout.decode() print(stdout) device.Close()
Runs a command on the device and prints the stdout. Args: command: Command to run on the target.
#vtb def iterate_sequences( consumer_fn, output_template, sequences, length, chunk_length=None, batch_size=None, num_epochs=1, padding_value=0): if not length.shape[0].value: raise ValueError() num_sequences = length.shape[0].value sequences = dict(sequence=sequences, length=length) dataset = tf.data.Dataset.from_tensor_slices(sequences) dataset = dataset.repeat(num_epochs) if chunk_length: dataset = dataset.map(remove_padding).flat_map( lambda x: tf.data.Dataset.from_tensor_slices( chunk_sequence(x, chunk_length, padding_value))) num_chunks = tf.reduce_sum((length - 1) // chunk_length + 1) else: num_chunks = num_sequences if batch_size: dataset = dataset.shuffle(num_sequences // 2) dataset = dataset.batch(batch_size or num_sequences) dataset = dataset.prefetch(num_epochs) iterator = dataset.make_initializable_iterator() with tf.control_dependencies([iterator.initializer]): num_batches = num_epochs * num_chunks // (batch_size or num_sequences) return tf.scan( lambda _1, index: consumer_fn(iterator.get_next()), tf.range(num_batches), output_template, parallel_iterations=1)
Iterate over batches of chunks of sequences for multiple epochs. The batch dimension of the length tensor must be set because it is used to infer buffer sizes. Args: consumer_fn: Function creating the operation to process the data. output_template: Nested tensors of same shape and dtype as outputs. sequences: Nested collection of tensors with batch and time dimension. length: Tensor containing the length for each sequence. chunk_length: Split sequences into chunks of this size; optional. batch_size: Split epochs into batches of this size; optional. num_epochs: How many times to repeat over the data. padding_value: Value used for padding the last chunk after the sequence. Raises: ValueError: Unknown batch size of the length tensor. Returns: Concatenated nested tensors returned by the consumer.
#vtb def applyIndex(self, lst, right): if len(right) != 1: raise exceptions.EvaluationError( % (self.left, self.right)) right = right[0] if isinstance(right, int): return lst[right] raise exceptions.EvaluationError("Can't apply %r to argument (%r): integer expected, got %r" % (self.left, self.right, right))
Apply a list to something else.
#vtb def print_user(user): email = user[] domain = user[][] role = user[] print( .format(domain, email, role))
Prints information about the current user.
#vtb def list_vms(self, allow_clone=False): vbox_vms = [] result = yield from self.execute("list", ["vms"]) for line in result: if len(line) == 0 or line[0] != or line[-1:] != "}": continue vmname, _ = line.rsplit(, 1) vmname = vmname.strip() if vmname == "<inaccessible>": continue extra_data = yield from self.execute("getextradata", [vmname, "GNS3/Clone"]) if allow_clone or len(extra_data) == 0 or not extra_data[0].strip() == "Value: yes": info_results = yield from self.execute("showvminfo", [vmname, "--machinereadable"]) ram = 0 for info in info_results: try: name, value = info.split(, 1) if name.strip() == "memory": ram = int(value.strip()) break except ValueError: continue vbox_vms.append({"vmname": vmname, "ram": ram}) return vbox_vms
Gets VirtualBox VM list.
#vtb def getReflexRuleSetup(self): relations = {} pc = getToolByName(self, ) methods = [obj.getObject() for obj in pc( portal_type=, is_active=True)] bsc = getToolByName(self, ) for method in methods: an_servs_brains = bsc( portal_type=, getMethodUIDs={ "query": method.UID(), "operator": "or" }) analysiservices = {} for analysiservice in an_servs_brains: analysiservice = analysiservice.getObject() service_methods_uid = analysiservice.getAvailableMethodUIDs() query_dict = { : , : True, : , : { "query": service_methods_uid + [], "operator": "or" } } wst_brains = bsc(query_dict) analysiservices[analysiservice.UID()] = { : analysiservice.getId(), : analysiservice.Title(), : analysiservice.getResultOptions() if analysiservice.getResultOptions() else [], : [ (brain.UID, brain.Title) for brain in wst_brains] } relations[method.UID()] = { : method.getId(), : method.Title(), : analysiservices, : analysiservices.keys(), } reflex_rule = self.aq_parent.aq_inner saved_method = reflex_rule.getMethod() relations[] = { : saved_method.UID() if saved_method else , : saved_method.getId() if saved_method else , : saved_method.Title() if saved_method else , : reflex_rule.getReflexRules(), } return json.dumps(relations)
Return a json dict with all the setup data necessary to build the relations: - Relations between methods and analysis services options. - The current saved data the functions returns: {'<method_uid>': { 'analysisservices': { '<as_uid>': {'as_id': '<as_id>', 'as_title':'<as_title>', 'resultoptions': [,,]} '<as_uid>': {'as_id': '<as_id>', 'as_title':'<as_title>', 'resultoptions': [{ 'ResultText': 'Failed', 'ResultValue': '1', 'value': ''}, ... ]} }, 'as_keys': ['<as_uid>', '<as_uid>'], 'method_id': '<method_id>', 'method_tile': '<method_tile>' }, '<method_uid>': { 'analysisservices': { '<as_uid>': {'as_id': '<as_id>', 'as_title':'<as_title>', 'resultoptions': [,,]} '<as_uid>': {'as_id': '<as_id>', 'as_title':'<as_title>', 'resultoptions': [,,]} }, 'as_keys': ['<as_uid>', '<as_uid>'], 'method_id': '<method_id>', 'method_tile': '<method_tile>' }, 'saved_actions': {'rules': [ {'actions': [{'act_row_idx': 0, 'action': 'repeat', 'an_result_id': '', 'analyst': '', 'otherWS': current, 'setresultdiscrete': '', 'setresulton': 'original', 'setresultvalue': '', 'worksheettemplate': '70d48adfb34c4231a145f76a858e94cf',}], 'conditions': [{'analysisservice': 'd802cdbf1f4742c094d45997b1038f9c', 'and_or': 'no', 'cond_row_idx': 0, 'discreteresult': '', 'range0': '12', 'range1': '12'}], 'rulenumber': '1', 'trigger': 'submit'},...], 'method_id': '<method_uid>', 'method_tile': '<method_tile>', 'method_uid': '<method_uid>' } }
#vtb def affine_respective_zoom_matrix(w_range=0.8, h_range=1.1): if isinstance(h_range, (float, int)): zy = h_range elif isinstance(h_range, tuple): zy = np.random.uniform(h_range[0], h_range[1]) else: raise Exception("h_range: float or tuple of 2 floats") if isinstance(w_range, (float, int)): zx = w_range elif isinstance(w_range, tuple): zx = np.random.uniform(w_range[0], w_range[1]) else: raise Exception("w_range: float or tuple of 2 floats") zoom_matrix = np.array([[zx, 0, 0], \ [0, zy, 0], \ [0, 0, 1]]) return zoom_matrix
Get affine transform matrix for zooming/scaling that height and width are changed independently. OpenCV format, x is width. Parameters ----------- w_range : float or tuple of 2 floats The zooming/scaling ratio of width, greater than 1 means larger. - float, a fixed ratio. - tuple of 2 floats, randomly sample a value as the ratio between 2 values. h_range : float or tuple of 2 floats The zooming/scaling ratio of height, greater than 1 means larger. - float, a fixed ratio. - tuple of 2 floats, randomly sample a value as the ratio between 2 values. Returns ------- numpy.array An affine transform matrix.
#vtb def parent_suite(self): if self.context and self.context.parent_suite_path: return Suite.load(self.context.parent_suite_path) return None
Get the current parent suite. A parent suite exists when a context within a suite is active. That is, during execution of a tool within a suite, or after a user has entered an interactive shell in a suite context, for example via the command- line syntax 'tool +i', where 'tool' is an alias in a suite. Returns: `Suite` object, or None if there is no current parent suite.
#vtb def blt(f: List[SYM], x: List[SYM]) -> Dict[str, Any]: J = ca.jacobian(f, x) nblock, rowperm, colperm, rowblock, colblock, coarserow, coarsecol = J.sparsity().btf() return { : J, : nblock, : rowperm, : colperm, : rowblock, : colblock, : coarserow, : coarsecol }
Sort equations by dependence
#vtb def get(self, instance, **kw): try: return self._get(instance, **kw) except AttributeError: logger.error("Could not get the value of the computed field " .format(self.get_field_name())) return None
Get the value of the field
#vtb def validate_request(self, path, action, body=None, query=None): path_name, path_spec = self.get_path_spec(path) if path_spec is None: logging.warn("there is no path") return False if action not in path_spec.keys(): logging.warn("this http method is unknown ".format(action)) return False action_spec = path_spec[action] if action == : is_ok, msg = _validate_post_body(body, action_spec) if not is_ok: logging.warn("the general post body did not validate due to ".format(msg)) return False body_is_empty = body in [None, {}, ] if body_is_empty and query is None: return True is_ok, msg = self._validate_body_parameters(body, action_spec) if not is_ok: logging.warn("the parameters in the body did not validate due to ".format(msg)) return False if query is not None and not self._validate_query_parameters(query, action_spec): return False return True
Check if the given request is valid. Validates the body and the query # Rules to validate the BODY: # Let's limit this to mime types that either contain 'text' or 'json' # 1. if body is None, there must not be any required parameters in # the given schema # 2. if the mime type contains 'json', body must not be '', but can # be {} # 3. if the mime type contains 'text', body can be any string # 4. if no mime type ('consumes') is given.. DISALLOW # 5. if the body is empty ('' or {}), there must not be any required parameters # 6. if there is something in the body, it must adhere to the given schema # -> will call the validate body function Args: path: path of the request. action: action of the request(get, post, delete...). body: body of the request. query: dict with the query parameters. Returns: True if the request is valid, False otherwise. TODO: - For every http method, we might want to have some general checks before we go deeper into the parameters - Check form data parameters
#vtb def _find_rule_no(self, mac): ipt_cmd = [, , ] cmdo = dsl.execute(ipt_cmd, self._root_helper, log_output=False) for o in cmdo.split(): if mac in o.lower(): rule_no = o.split()[0] LOG.info(, {: rule_no, : mac}) return rule_no
Find rule number associated with a given mac.
#vtb def modelsClearAll(self): self._logger.info(, self.modelsTableName) with ConnectionFactory.get() as conn: query = % (self.modelsTableName) conn.cursor.execute(query)
Delete all models from the models table Parameters: ----------------------------------------------------------------
#vtb def source(self, format=, accessible=False): if accessible: return self.http.get().value return self.http.get(+format).value
Args: format (str): only 'xml' and 'json' source types are supported accessible (bool): when set to true, format is always 'json'
#vtb def _init_metadata(self): super(LabelOrthoFacesAnswerFormRecord, self)._init_metadata() self._face_values_metadata = { : Id(self.my_osid_object_form._authority, self.my_osid_object_form._namespace, ), : , : , : True, : False, : True, : False, : [{}], : , : [] }
stub
#vtb def enable_apt_repositories(prefix, url, version, repositories): with settings(hide(, , ), warn_only=False, capture=True): sudo( % (prefix, url, version, repositories)) with hide(, ): output = sudo("DEBIAN_FRONTEND=noninteractive /usr/bin/apt-get update") if in output: raise SystemExit(1) else: return True
adds an apt repository
#vtb def plotres(psr,deleted=False,group=None,**kwargs): res, t, errs = psr.residuals(), psr.toas(), psr.toaerrs if (not deleted) and N.any(psr.deleted != 0): res, t, errs = res[psr.deleted == 0], t[psr.deleted == 0], errs[psr.deleted == 0] print("Plotting {0}/{1} nondeleted points.".format(len(res),psr.nobs)) meanres = math.sqrt(N.mean(res**2)) / 1e-6 if group is None: i = N.argsort(t) P.errorbar(t[i],res[i]/1e-6,yerr=errs[i],fmt=,**kwargs) else: if (not deleted) and N.any(psr.deleted): flagmask = psr.flagvals(group)[~psr.deleted] else: flagmask = psr.flagvals(group) unique = list(set(flagmask)) for flagval in unique: f = (flagmask == flagval) flagres, flagt, flagerrs = res[f], t[f], errs[f] i = N.argsort(flagt) P.errorbar(flagt[i],flagres[i]/1e-6,yerr=flagerrs[i],fmt=,**kwargs) P.legend(unique,numpoints=1,bbox_to_anchor=(1.1,1.1)) P.xlabel(); P.ylabel() P.title("{0} - rms res = {1:.2f} us".format(psr.name,meanres))
Plot residuals, compute unweighted rms residual.
#vtb def has_activity(graph: BELGraph, node: BaseEntity) -> bool: return _node_has_modifier(graph, node, ACTIVITY)
Return true if over any of the node's edges, it has a molecular activity.
#vtb def thread( mafs, species ): for m in mafs: new_maf = deepcopy( m ) new_components = get_components_for_species( new_maf, species ) if new_components: remove_all_gap_columns( new_components ) new_maf.components = new_components new_maf.score = 0.0 new_maf.text_size = len(new_components[0].text) yield new_maf
Restrict an list of alignments to a given list of species by: 1) Removing components for any other species 2) Remove any columns containing all gaps Example: >>> import bx.align.maf >>> block1 = bx.align.maf.from_string( ''' ... a score=4964.0 ... s hg18.chr10 52686 44 + 135374737 GTGCTAACTTACTGCTCCACAGAAAACATCAATTCTGCTCATGC ... s rheMac2.chr20 58163346 43 - 88221753 ATATTATCTTAACATTAAAGA-AGAACAGTAATTCTGGTCATAA ... s panTro1.chrUn_random 208115356 44 - 240967748 GTGCTAACTGACTGCTCCAGAGAAAACATCAATTCTGTTCATGT ... s oryCun1.scaffold_175207 85970 22 + 212797 ----------------------AAAATATTAGTTATCACCATAT ... s bosTau2.chr23 23894492 43 + 41602928 AAACTACCTTAATGTCACAGG-AAACAATGTATgctgctgctgc ... ''' ) >>> block2 = bx.align.maf.from_string( ''' ... a score=9151.0 ... s hg18.chr10 52730 69 + 135374737 GCAGGTACAATTCATCAAGAAAG-GAATTACAACTTCAGAAATGTGTTCAAAATATATCCATACTT-TGAC ... s oryCun1.scaffold_175207 85992 71 + 212797 TCTAGTGCTCTCCAATAATATAATAGATTATAACTTCATATAATTATGTGAAATATAAGATTATTTATCAG ... s panTro1.chrUn_random 208115400 69 - 240967748 GCAGCTACTATTCATCAAGAAAG-GGATTACAACTTCAGAAATGTGTTCAAAGTGTATCCATACTT-TGAT ... s rheMac2.chr20 58163389 69 - 88221753 ACACATATTATTTCTTAACATGGAGGATTATATCTT-AAACATGTGTGCaaaatataaatatatat-tcaa ... ''' ) >>> mafs = [ block1, block2 ] >>> threaded = [ t for t in thread( mafs, [ "hg18", "panTro1" ] ) ] >>> len( threaded ) 2 >>> print(threaded[0]) a score=0.0 s hg18.chr10 52686 44 + 135374737 GTGCTAACTTACTGCTCCACAGAAAACATCAATTCTGCTCATGC s panTro1.chrUn_random 208115356 44 - 240967748 GTGCTAACTGACTGCTCCAGAGAAAACATCAATTCTGTTCATGT <BLANKLINE> >>> print(threaded[1]) a score=0.0 s hg18.chr10 52730 69 + 135374737 GCAGGTACAATTCATCAAGAAAGGAATTACAACTTCAGAAATGTGTTCAAAATATATCCATACTTTGAC s panTro1.chrUn_random 208115400 69 - 240967748 GCAGCTACTATTCATCAAGAAAGGGATTACAACTTCAGAAATGTGTTCAAAGTGTATCCATACTTTGAT <BLANKLINE>
#vtb def get_component_tasks(self, component_id): ret = [] for task_id, comp_id in self.task_to_component_map.items(): if comp_id == component_id: ret.append(task_id) return ret
Returns the task ids allocated for the given component id
#vtb def check_stop_times( feed: "Feed", *, as_df: bool = False, include_warnings: bool = False ) -> List: table = "stop_times" problems = [] if feed.stop_times is None: problems.append(["error", "Missing table", table, []]) else: f = feed.stop_times.copy().sort_values(["trip_id", "stop_sequence"]) problems = check_for_required_columns(problems, table, f) if problems: return format_problems(problems, as_df=as_df) if include_warnings: problems = check_for_invalid_columns(problems, table, f) problems = check_column_linked_id( problems, table, f, "trip_id", feed.trips ) v = lambda x: pd.isnull(x) or valid_time(x) for col in ["arrival_time", "departure_time"]: problems = check_column(problems, table, f, col, v) if "timepoint" not in f.columns: f["timepoint"] = np.nan indices = [] prev_tid = None prev_atime = 1 prev_dtime = 1 for i, tid, atime, dtime, tp in f[ ["trip_id", "arrival_time", "departure_time", "timepoint"] ].itertuples(): if tid != prev_tid: if pd.isnull(prev_atime) or pd.isnull(prev_dtime): indices.append(i - 1) if pd.isnull(atime) or pd.isnull(dtime): indices.append(i) elif tp == 1 and (pd.isnull(atime) or pd.isnull(dtime)): indices.append(i) prev_tid = tid prev_atime = atime prev_dtime = dtime if indices: problems.append( [ "error", "First/last/time point arrival/departure time missing", table, indices, ] ) problems = check_column_linked_id( problems, table, f, "stop_id", feed.stops ) cond = f[["trip_id", "stop_sequence"]].dropna().duplicated() problems = check_table( problems, table, f, cond, "Repeated pair (trip_id, stop_sequence)" ) problems = check_column( problems, table, f, "stop_headsign", valid_str, column_required=False ) for col in ["pickup_type", "drop_off_type"]: v = lambda x: x in range(4) problems = check_column( problems, table, f, col, v, column_required=False ) if "shape_dist_traveled" in f.columns: g = f.dropna(subset=["shape_dist_traveled"]) indices = [] prev_tid = None prev_dist = -1 for i, tid, dist in g[["trip_id", "shape_dist_traveled"]].itertuples(): if tid == prev_tid and dist < prev_dist: indices.append(i) prev_tid = tid prev_dist = dist if indices: problems.append( [ "error", "shape_dist_traveled decreases on a trip", table, indices, ] ) v = lambda x: x in range(2) problems = check_column( problems, table, f, "timepoint", v, column_required=False ) if include_warnings: cond = f[["trip_id", "departure_time"]].duplicated() problems = check_table( problems, table, f, cond, "Repeated pair (trip_id, departure_time)", "warning", ) return format_problems(problems, as_df=as_df)
Analog of :func:`check_agency` for ``feed.stop_times``.
#vtb def route(self, path=None, method=, callback=None, name=None, apply=None, skip=None, **config): if callable(path): path, callback = None, path plugins = makelist(apply) skiplist = makelist(skip) if in config: depr("The parameter was renamed to ") plugins += makelist(config.pop()) if config.pop(, False): depr("The no_hooks parameter is no longer used. Add to the"\ " list of skipped plugins instead.") skiplist.append() static = config.get(, False) def decorator(callback): for rule in makelist(path) or yieldroutes(callback): for verb in makelist(method): verb = verb.upper() cfg = dict(rule=rule, method=verb, callback=callback, name=name, app=self, config=config, apply=plugins, skip=skiplist) self.routes.append(cfg) cfg[] = self.routes.index(cfg) self.router.add(rule, verb, cfg[], name=name, static=static) if DEBUG: self.ccache[cfg[]] = self._build_callback(cfg) return callback return decorator(callback) if callback else decorator
A decorator to bind a function to a request URL. Example:: @app.route('/hello/:name') def hello(name): return 'Hello %s' % name The ``:name`` part is a wildcard. See :class:`Router` for syntax details. :param path: Request path or a list of paths to listen to. If no path is specified, it is automatically generated from the signature of the function. :param method: HTTP method (`GET`, `POST`, `PUT`, ...) or a list of methods to listen to. (default: `GET`) :param callback: An optional shortcut to avoid the decorator syntax. ``route(..., callback=func)`` equals ``route(...)(func)`` :param name: The name for this route. (default: None) :param apply: A decorator or plugin or a list of plugins. These are applied to the route callback in addition to installed plugins. :param skip: A list of plugins, plugin classes or names. Matching plugins are not installed to this route. ``True`` skips all. Any additional keyword arguments are stored as route-specific configuration and passed to plugins (see :meth:`Plugin.apply`).
#vtb def _get_image(self, name): document = self._control.document() image = document.resource(QtGui.QTextDocument.ImageResource, QtCore.QUrl(name)) return image
Returns the QImage stored as the ImageResource with 'name'.
#vtb def retrieve_metar(station_icao) -> typing.Tuple[typing.Optional[str], typing.Optional[str]]: url = _BASE_METAR_URL.format(station=station_icao) with requests.get(url) as resp: if not resp.ok: return f \ f \ f, None return None, resp.content.decode().split()[1]
Retrieves a METAR string from an online database Args: station_icao: ICAO of the station Returns: tuple of error, metar_str
#vtb def _add_command(self, name, **parameters): command = self._create_command(name, **parameters) self._commands.append(command) return command
Add a new command to the blueprint. :param name: The command name :type name: str :param parameters: The command parameters :type parameters: dict :rtype: Fluent
#vtb def browser(i): r=find({:, :}) if r[]>0: if r[]!=16: return r out(t find wfe module)!Please, install it via "ck pull repo:ck-web" and try again!returntemplaterepo_uoamodule_uoadata_uoa::actionstartmodule_uoawebbrowseryestemplatecidextra_urlextra_url')})
Input: { (template) - use this web template (repo_uoa) - (module_uoa) - (data_uoa) - view a given entry (extra_url) - extra URL } Output: { return - return code = 0, if successful > 0, if error (error) - error text if return > 0 }
#vtb def read_file(filename): infile = open(filename, ) lines = infile.readlines() infile.close() return lines
Read contents of the specified file. Parameters: ----------- filename : str The name of the file to be read Returns: lines : list of str The contents of the file, split by line