code
stringlengths
3
1.05M
repo_name
stringlengths
5
104
path
stringlengths
4
251
language
stringclasses
1 value
license
stringclasses
15 values
size
int64
3
1.05M
""" incisive: Tiny library for handling csv ======================================= """ from .core import read_csv, write_csv, format_to_csv __version__ = '0.1.0' __title__ = 'incisive' __author__ = 'Taurus Olson' __license__ = 'MIT'
TaurusOlson/incisive
incisive/__init__.py
Python
mit
238
# Copyright 2013-2020 Lawrence Livermore National Security, LLC and other # Spack Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) from spack import * class PyTraceback2(PythonPackage): """Backports of the traceback module""" homepage = "https://github.com/testing-cabal/traceback2" url = "https://pypi.io/packages/source/t/traceback2/traceback2-1.4.0.tar.gz" version('1.4.0', sha256='05acc67a09980c2ecfedd3423f7ae0104839eccb55fc645773e1caa0951c3030') depends_on('py-setuptools', type='build') depends_on('py-pbr', type='build') # test-requirements.txt depends_on('py-contextlib2', type='test') depends_on('py-fixtures', type='test') depends_on('py-testtools', type='test') depends_on('py-unittest2', type='test')
iulian787/spack
var/spack/repos/builtin/packages/py-traceback2/package.py
Python
lgpl-2.1
836
# Copyright 2016 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import division, print_function from nototools import summary from nototools.py23 import unichr class HbInputGenerator(object): """Provides functions to generate harbuzz input. The input is returned as a list of strings, suitable for passing into subprocess.call or something similar. """ def __init__(self, font): self.font = font self.memo = {} self.reverse_cmap = build_reverse_cmap(self.font) self.widths = {} glyph_set = font.getGlyphSet() for name in glyph_set.keys(): glyph = glyph_set[name] if glyph.width: width = glyph.width elif hasattr(glyph._glyph, "xMax"): width = abs(glyph._glyph.xMax - glyph._glyph.xMin) else: width = 0 self.widths[name] = width # some stripped fonts don't have space try: space_name = font["cmap"].tables[0].cmap[0x20] self.space_width = self.widths[space_name] except: self.space_width = -1 def all_inputs(self, warn=False): """Generate harfbuzz inputs for all glyphs in a given font.""" inputs = [] glyph_set = self.font.getGlyphSet() for name in self.font.getGlyphOrder(): is_zero_width = glyph_set[name].width == 0 cur_input = self.input_from_name(name, pad=is_zero_width) if cur_input is not None: inputs.append(cur_input) elif warn: print("not tested (unreachable?): %s" % name) return inputs def input_from_name(self, name, seen=None, pad=False): """Given glyph name, return input to harbuzz to render this glyph. Returns input in the form of a (features, text) tuple, where `features` is a list of feature tags to activate and `text` is an input string. Argument `seen` is used by the method to avoid following cycles when recursively looking for possible input. `pad` can be used to add whitespace to text output, for non-spacing glyphs. Can return None in two situations: if no possible input is found (no simple unicode mapping or substitution rule exists to generate the glyph), or if the requested glyph already exists in `seen` (in which case this path of generating input should not be followed further). """ if name in self.memo: return self.memo[name] inputs = [] # avoid following cyclic paths through features if seen is None: seen = set() if name in seen: return None seen.add(name) # see if this glyph has a simple unicode mapping if name in self.reverse_cmap: text = unichr(self.reverse_cmap[name]) inputs.append(((), text)) # check the substitution features inputs.extend(self._inputs_from_gsub(name, seen)) seen.remove(name) # since this method sometimes returns None to avoid cycles, the # recursive calls that it makes might have themselves returned None, # but we should avoid returning None here if there are other options inputs = [i for i in inputs if i is not None] if not inputs: return None features, text = min(inputs) # can't pad if we don't support space if pad and self.space_width > 0: width, space = self.widths[name], self.space_width padding = " " * (width // space + (1 if width % space else 0)) text = padding + text self.memo[name] = features, text return self.memo[name] def _inputs_from_gsub(self, name, seen): """Check GSUB for possible input yielding glyph with given name. The `seen` argument is passed in from the original call to input_from_name(). """ inputs = [] if "GSUB" not in self.font: return inputs gsub = self.font["GSUB"].table if gsub.LookupList is None: return inputs for lookup_index, lookup in enumerate(gsub.LookupList.Lookup): for st in lookup.SubTable: # see if this glyph can be a single-glyph substitution if lookup.LookupType == 1: for glyph, subst in st.mapping.items(): if subst == name: inputs.append( self._input_with_context( gsub, [glyph], lookup_index, seen ) ) # see if this glyph is a ligature elif lookup.LookupType == 4: for prefix, ligatures in st.ligatures.items(): for ligature in ligatures: if ligature.LigGlyph == name: glyphs = [prefix] + list(ligature.Component) inputs.append( self._input_with_context( gsub, glyphs, lookup_index, seen ) ) return inputs def _input_with_context(self, gsub, glyphs, target_i, seen): """Given GSUB, input glyphs, and target lookup index, return input to harfbuzz to render the input glyphs with the target lookup activated. """ inputs = [] # try to get a feature tag to activate this lookup for feature in gsub.FeatureList.FeatureRecord: if target_i in feature.Feature.LookupListIndex: inputs.append( self._sequence_from_glyph_names(glyphs, (feature.FeatureTag,), seen) ) for cur_i, lookup in enumerate(gsub.LookupList.Lookup): # try contextual substitutions if lookup.LookupType == 5: for st in lookup.SubTable: # TODO handle format 3 if st.Format == 1: inputs.extend( self._input_from_5_1( gsub, st, glyphs, target_i, cur_i, seen ) ) if st.Format == 2: inputs.extend( self._input_from_5_2( gsub, st, glyphs, target_i, cur_i, seen ) ) # try chaining substitutions if lookup.LookupType == 6: for st in lookup.SubTable: # TODO handle format 2 if st.Format == 1: inputs.extend( self._input_from_6_1( gsub, st, glyphs, target_i, cur_i, seen ) ) if st.Format == 3: inputs.extend( self._input_from_6_3( gsub, st, glyphs, target_i, cur_i, seen ) ) inputs = [i for i in inputs if i is not None] return min(inputs) if inputs else None def _input_from_5_1(self, gsub, st, glyphs, target_i, cur_i, seen): """Return inputs from GSUB type 5.1 (simple context) rules.""" inputs = [] for ruleset in st.SubRuleSet: for rule in ruleset.SubRule: if not any( subst_lookup.LookupListIndex == target_i for subst_lookup in rule.SubstLookupRecord ): continue for prefix in st.Coverage.glyphs: input_glyphs = [prefix] + rule.Input if not self._is_sublist(input_glyphs, glyphs): continue inputs.append( self._input_with_context(gsub, input_glyphs, cur_i, seen) ) return inputs def _input_from_5_2(self, gsub, st, glyphs, target_i, cur_i, seen): """Return inputs from GSUB type 5.2 (class-based context) rules.""" inputs = [] prefixes = st.Coverage.glyphs class_defs = st.ClassDef.classDefs.items() for ruleset in st.SubClassSet: if ruleset is None: continue for rule in ruleset.SubClassRule: classes = [[n for n, c in class_defs if c == cls] for cls in rule.Class] input_lists = [prefixes] + classes input_glyphs = self._min_permutation(input_lists, glyphs) if not ( any( subst_lookup.LookupListIndex == target_i for subst_lookup in rule.SubstLookupRecord ) and self._is_sublist(input_glyphs, glyphs) ): continue inputs.append(self._input_with_context(gsub, input_glyphs, cur_i, seen)) return inputs def _input_from_6_1(self, gsub, st, glyphs, target_i, cur_i, seen): """Return inputs from GSUB type 6.1 (simple chaining) rules.""" inputs = [] for ruleset in st.ChainSubRuleSet: for rule in ruleset.ChainSubRule: if not any( subst_lookup.LookupListIndex == target_i for subst_lookup in rule.SubstLookupRecord ): continue for prefix in st.Coverage.glyphs: input_glyphs = [prefix] + rule.Input if not self._is_sublist(input_glyphs, glyphs): continue if rule.LookAhead: input_glyphs = input_glyphs + rule.LookAhead if rule.Backtrack: bt = list(reversed(rule.Backtrack)) input_glyphs = bt + input_glyphs inputs.append( self._input_with_context(gsub, input_glyphs, cur_i, seen) ) return inputs def _input_from_6_3(self, gsub, st, glyphs, target_i, cur_i, seen): """Return inputs from GSUB type 6.3 (coverage-based chaining) rules.""" input_lists = [c.glyphs for c in st.InputCoverage] input_glyphs = self._min_permutation(input_lists, glyphs) if not ( any( subst_lookup.LookupListIndex == target_i for subst_lookup in st.SubstLookupRecord ) and self._is_sublist(input_glyphs, glyphs) ): return [] if st.LookAheadCoverage: la = [min(c.glyphs) for c in st.LookAheadCoverage] input_glyphs = input_glyphs + la if st.BacktrackCoverage: bt = list(reversed([min(c.glyphs) for c in st.BacktrackCoverage])) input_glyphs = bt + input_glyphs return [self._input_with_context(gsub, input_glyphs, cur_i, seen)] def _sequence_from_glyph_names(self, glyphs, features, seen): """Return a sequence of glyphs from glyph names.""" text = [] for glyph in glyphs: cur_input = self.input_from_name(glyph, seen) if cur_input is None: return None cur_features, cur_text = cur_input features += cur_features text.append(cur_text) return features, "".join(text) def _min_permutation(self, lists, target): """Deterministically select a permutation, containing target list as a sublist, of items picked one from each input list. """ if not all(lists): return [] i = 0 j = 0 res = [None for _ in range(len(lists))] for cur_list in lists: if j < len(target) and target[j] in cur_list: res[i] = target[j] j += 1 else: res[i] = min(cur_list) i += 1 if j < len(target): return [] return res def _is_sublist(self, lst, sub): """Return whether sub is a sub-list of lst.""" return any(lst[i : i + len(sub)] == sub for i in range(1 + len(lst) - len(sub))) def build_reverse_cmap(font): """Build a dictionary mapping glyph names to unicode values. Maps each name to its smallest unicode value. """ cmap_items = summary.get_largest_cmap(font).items() return {n: v for v, n in reversed(sorted(cmap_items))}
googlefonts/nototools
nototools/hb_input.py
Python
apache-2.0
13,368
# Copyright 2017 Rice University # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import tensorflow as tf from itertools import chain class BayesianEncoder(object): def __init__(self, config): self.inputs = [ev.placeholder(config) for ev in config.evidence] exists = [ev.exists(i) for ev, i in zip(config.evidence, self.inputs)] zeros = tf.zeros([config.batch_size, config.latent_size], dtype=tf.float32) # Compute the denominator used for mean and covariance for ev in config.evidence: ev.init_sigma(config) d = [tf.where(exist, tf.tile([1. / tf.square(ev.sigma)], [config.batch_size]), tf.zeros(config.batch_size)) for ev, exist in zip(config.evidence, exists)] d = 1. + tf.reduce_sum(tf.stack(d), axis=0) denom = tf.tile(tf.reshape(d, [-1, 1]), [1, config.latent_size]) # Compute the mean of Psi with tf.variable_scope('mean'): # 1. compute encoding self.encodings = [ev.encode(i, config) for ev, i in zip(config.evidence, self.inputs)] encodings = [encoding / tf.square(ev.sigma) for ev, encoding in zip(config.evidence, self.encodings)] # 2. pick only encodings from valid inputs that exist, otherwise pick zero encoding encodings = [tf.where(exist, enc, zeros) for exist, enc in zip(exists, encodings)] # 3. tile the encodings according to each evidence type encodings = [[enc] * ev.tile for ev, enc in zip(config.evidence, encodings)] encodings = tf.stack(list(chain.from_iterable(encodings))) # 4. compute the mean of non-zero encodings self.psi_mean = tf.reduce_sum(encodings, axis=0) / denom # Compute the covariance of Psi with tf.variable_scope('covariance'): I = tf.ones([config.batch_size, config.latent_size], dtype=tf.float32) self.psi_covariance = I / denom class BayesianDecoder(object): def __init__(self, config, initial_state, infer=False): cells1, cells2 = [], [] for _ in range(config.decoder.num_layers): cells1.append(tf.nn.rnn_cell.GRUCell(config.decoder.units)) cells2.append(tf.nn.rnn_cell.GRUCell(config.decoder.units)) self.cell1 = tf.nn.rnn_cell.MultiRNNCell(cells1) self.cell2 = tf.nn.rnn_cell.MultiRNNCell(cells2) # placeholders self.initial_state = [initial_state] * config.decoder.num_layers self.nodes = [tf.placeholder(tf.int32, [config.batch_size], name='node{0}'.format(i)) for i in range(config.decoder.max_ast_depth)] self.edges = [tf.placeholder(tf.bool, [config.batch_size], name='edge{0}'.format(i)) for i in range(config.decoder.max_ast_depth)] # projection matrices for output self.projection_w = tf.get_variable('projection_w', [self.cell1.output_size, config.decoder.vocab_size]) self.projection_b = tf.get_variable('projection_b', [config.decoder.vocab_size]) # setup embedding with tf.variable_scope('decoder'): emb = tf.get_variable('emb', [config.decoder.vocab_size, config.decoder.units]) def loop_fn(prev, _): prev = tf.nn.xw_plus_b(prev, self.projection_w, self.projection_b) prev_symbol = tf.argmax(prev, 1) return tf.nn.embedding_lookup(emb, prev_symbol) loop_function = loop_fn if infer else None emb_inp = (tf.nn.embedding_lookup(emb, i) for i in self.nodes) # the decoder (modified from tensorflow's seq2seq library to fit tree RNNs) # TODO: update with dynamic decoder (being implemented in tf) once it is released with tf.variable_scope('rnn'): self.state = self.initial_state self.outputs = [] prev = None for i, inp in enumerate(emb_inp): if loop_function is not None and prev is not None: with tf.variable_scope('loop_function', reuse=True): inp = loop_function(prev, i) if i > 0: tf.get_variable_scope().reuse_variables() with tf.variable_scope('cell1'): # handles CHILD_EDGE output1, state1 = self.cell1(inp, self.state) with tf.variable_scope('cell2'): # handles SIBLING_EDGE output2, state2 = self.cell2(inp, self.state) output = tf.where(self.edges[i], output1, output2) self.state = [tf.where(self.edges[i], state1[j], state2[j]) for j in range(config.decoder.num_layers)] self.outputs.append(output) if loop_function is not None: prev = output
capergroup/bayou
src/main/python/bayou/models/low_level_evidences/architecture.py
Python
apache-2.0
5,511
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright (c) 2014 Midokura Europe SARL, All Rights Reserved. # All Rights Reserved # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import logging from midonetclient import url_provider from midonetclient import util from midonetclient import vendor_media_type as mt LOG = logging.getLogger(__name__) class ChainRuleUrlProviderMixin(url_provider.UrlProviderMixin): """ChainRule URL provider mixin This mixin provides URLs for chain rules. """ def chain_url(self, chain_id): return self.template_url("chain_template", chain_id) def chains_url(self): return self.resource_url("chains") def rule_url(self, rule_id): return self.template_url("rule_template", rule_id) def rules_url(self, chain_id): return self.chain_url(chain_id) + "/rules" class ChainRuleClientMixin(ChainRuleUrlProviderMixin): """ChainRule mixin Mixin that defines all the Neutron chain rule operations in MidoNet API. """ @util.convert_case def create_chain(self, chain): LOG.info("create_chain %r", chain) return self.client.post(self.chains_url(), mt.APPLICATION_CHAIN_JSON, body=chain) def delete_chain(self, chain_id): LOG.info("delete_chain %r", chain_id) self.client.delete(self.chain_url(chain_id)) @util.convert_case def get_chain(self, chain_id, fields=None): LOG.info("get_chain %r", chain_id) return self.client.get(self.chain_url(chain_id), mt.APPLICATION_CHAIN_JSON) @util.convert_case def get_chains(self, filters=None, fields=None, sorts=None, limit=None, marker=None, page_reverse=False): LOG.info("get_chains") return self.client.get(self.chains_url(), mt.APPLICATION_CHAIN_COLLECTION_JSON) @util.convert_case def update_chain(self, chain): LOG.info("update_chain %r", chain) return self.client.put(self.chain_url(chain["id"]), mt.APPLICATION_CHAIN_JSON, chain) @util.convert_case def create_chain_rule(self, rule): LOG.info("create_chain_rule %r", rule) # convert_case converted to camel return self.client.post(self.rules_url(rule["chainId"]), mt.APPLICATION_RULE_JSON, body=rule) def delete_chain_rule(self, rule_id): LOG.info("delete_chain_rule %r", rule_id) self.client.delete(self.rule_url(rule_id)) @util.convert_case def get_chain_rule(self, rule_id): LOG.info("get_chain_rule %r", rule_id) return self.client.get(self.rule_url(rule_id), mt.APPLICATION_RULE_JSON) @util.convert_case def get_chain_rules(self, chain_id): LOG.info("get_chain_rules %r", chain_id) return self.client.get(self.rules_url(chain_id), mt.APPLICATION_RULE_COLLECTION_JSON)
celebdor/python-midonetclient
src/midonetclient/neutron/chain_rule.py
Python
apache-2.0
3,528
from growler_guys import scrape_growler_guys
ryanpitts/growlerbot
scrapers/__init__.py
Python
mit
45
import matplotlib.pyplot as plt import numpy as np import pdb if __name__ == "__main__": fig, ax = plt.subplots(figsize=(10,5)) for clients in (10, 50, 100, 200): median_data = np.zeros(5) for k in (1, 2, 3, 4, 5): data = np.loadtxt("loss_" + str(clients) + "_" + str(k) + ".csv", delimiter=',') median_data[k-1] = data.shape[0] print str(clients) + " median is " + str(np.median(median_data)) print str(clients) + " stddev is " + str(np.std(median_data)) data1 = np.loadtxt("loss_10_2.csv", delimiter=',') data2 = np.loadtxt("loss_50_2.csv", delimiter=',') data3 = np.loadtxt("loss_100_2.csv", delimiter=',') data4 = np.loadtxt("loss_200_2.csv", delimiter=',') plt.plot(data1, color="black", label="10 clients", lw=5) plt.plot(data2, color="red", label="50 clients", lw=5) plt.plot(data3, color="orange", label="100 clients", lw=5) plt.plot(data4, color="green", label="200 clients", lw=5) plt.legend(loc='best', ncol=1, fontsize=18) plt.xlabel("Time (s)", fontsize=22) plt.ylabel("Training Error", fontsize=22) axes = plt.gca() axes.set_ylim([0, 0.5]) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) plt.setp(ax.get_xticklabels(), fontsize=18) plt.setp(ax.get_yticklabels(), fontsize=18) plt.tight_layout() plt.show()
DistributedML/TorML
eurosys-eval/results_tor_no_tor/makeplot.py
Python
mit
1,404
from django.db import models class Report(models.Model): id = models.IntegerField(primary_key = True) name = models.CharField(max_length = 200) url = models.CharField(max_length = 10) def __unicode__(self): return self.url
fedorahungary/fedinv
fedinv/swag_reports/models.py
Python
gpl-2.0
233
### # Copyright (c) 2013, Frumious Bandersnatch # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright notice, # this list of conditions, and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions, and the following disclaimer in the # documentation and/or other materials provided with the distribution. # * Neither the name of the author of this software nor the name of # contributors to this software may be used to endorse or promote products # derived from this software without specific prior written consent. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF # SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. ### import supybot.conf as conf import supybot.registry as registry def configure(advanced): # This will be called by supybot to configure this module. advanced is # a bool that specifies whether the user identified himself as an advanced # user or not. You should effect your configuration by manipulating the # registry as appropriate. from supybot.questions import expect, anything, something, yn conf.registerPlugin('Goo', True) Goo = conf.registerPlugin('Goo') # This is where your configuration variables (if any) should go. For example: # conf.registerGlobalValue(Goo, 'someConfigVariableName', # registry.Boolean(False, """Help for someConfigVariableName.""")) # vim:set shiftwidth=4 tabstop=4 expandtab textwidth=79:
kg-bot/SupyBot
plugins/Goo/config.py
Python
gpl-3.0
2,348
#!/usr/bin/env python """:mod:`Redirection <testbed.resources._redirect>` tests.""" __copyright__ = "Copyright (C) 2014 Ivan D Vasin" __docformat__ = "restructuredtext" import json as _json import unittest as _unittest from urllib import quote as _percent_encode import napper as _napper import spruce.logging as _logging import testbed.testing as _testbedtest class TestRedirections(_testbedtest.TestTestbed): @property def webservice_path(self): return '/redirect' @property def webservice_probe_path(self): return self._redirect_path def _create_requests_session(self): return _napper.WebRequestSession(follow_redirects=False) class TestResponseRedirection(TestRedirections): def test_get_response_redirect(self): response = self.request('get', self._redirect_path) self.assert_response_redirect_response(response, loc=self._redirect_loc) def test_get_response_redirect_as_html(self): response = self.request('get', self._redirect_path, accept_mediaranges=('text/html', '*/*; q=0.01')) self.assert_response_redirect_response(response, loc=self._redirect_loc, contenttype='text/html') def test_post_response_redirect(self): response = self.request('post', self._redirect_path) self.assert_response_redirect_response(response, loc=self._redirect_loc) def test_post_response_redirect_as_html(self): response = self.request('post', self._redirect_path, accept_mediaranges=('text/html', '*/*; q=0.01')) self.assert_response_redirect_response(response, loc=self._redirect_loc, contenttype='text/html') def test_postget_response_redirect(self): response = self.request('postget', self._redirect_path) self.assert_response_redirect_response(response, loc=self._redirect_loc) def test_postget_response_redirect_as_html(self): response = self.request('postget', self._redirect_path, accept_mediaranges=('text/html', '*/*; q=0.01')) self.assert_response_redirect_response(response, loc=self._redirect_loc, contenttype='text/html') @property def _redirect_loc(self): return 'aoeu' @property def _redirect_path(self): return 'response;loc={}'\ .format(_percent_encode(_json.dumps(self._redirect_loc), safe='')) class _TestRedirectionsCorsWithUntrustedOriginMixin(object): def assert_response_redirect_response(self, response, **kwargs): kwargs_ = {} try: kwargs_['contenttype'] = kwargs['contenttype'] except KeyError: pass self.assert_cors_rejected_response(response, exc_name='CorsOriginForbidden', **kwargs_) class TestRedirectionsCorsActualWithTrustedOrigin\ (_testbedtest.TestCorsWithTrustedOrigin, _testbedtest.TestCorsActual, TestRedirections): pass class TestRedirectionsCorsActualWithUntrustedOrigin\ (_TestRedirectionsCorsWithUntrustedOriginMixin, _testbedtest.TestCorsWithUntrustedOrigin, _testbedtest.TestCorsActual, TestRedirections): pass class TestRedirectionsCorsPreflightWithTrustedOrigin\ (_testbedtest.TestCorsWithTrustedOrigin, _testbedtest.TestCorsPreflight, TestRedirections): def assert_response_redirect_response(self, response, **kwargs): kwargs_ = {} try: kwargs_['contenttype'] = kwargs['contenttype'] except KeyError: pass self.assert_cors_preflight_accepted_response(response, **kwargs_) class TestRedirectionsCorsPreflightWithUntrustedOrigin\ (_TestRedirectionsCorsWithUntrustedOriginMixin, _testbedtest.TestCorsWithUntrustedOrigin, _testbedtest.TestCorsPreflight, TestRedirections): pass if __name__ == '__main__': _logging.basicConfig() _unittest.main()
nisavid/testbed
testbed/tests/redirect.py
Python
lgpl-3.0
4,763
#!/usr/bin/env python # ********************************************************************** # # Copyright (c) 2003-2011 ZeroC, Inc. All rights reserved. # # This copy of Ice is licensed to you under the terms described in the # ICE_LICENSE file included in this distribution. # # ********************************************************************** import os, sys path = [ ".", "..", "../..", "../../..", "../../../.." ] head = os.path.dirname(sys.argv[0]) if len(head) > 0: path = [os.path.join(head, p) for p in path] path = [os.path.abspath(p) for p in path if os.path.exists(os.path.join(p, "scripts", "TestUtil.py")) ] if len(path) == 0: raise "can't find toplevel directory!" sys.path.append(os.path.join(path[0])) from scripts import * print "tests with regular server." TestUtil.clientServerTest(additionalClientOptions = "--Ice.Warn.AMICallback=0") print "tests with AMD server." TestUtil.clientServerTest(additionalClientOptions = "--Ice.Warn.AMICallback=0", server="serveramd") print "tests with TIE server." TestUtil.clientServerTest(additionalClientOptions = "--Ice.Warn.AMICallback=0", server="servertie") print "tests with AMD TIE server." TestUtil.clientServerTest(additionalClientOptions = "--Ice.Warn.AMICallback=0", server="serveramdtie") print "tests with collocated server." TestUtil.collocatedTest()
joshmoore/zeroc-ice
cs/test/Ice/operations/run.py
Python
gpl-2.0
1,339
from direct.directnotify import DirectNotifyGlobal from toontown.classicchars.DistributedDaisyAI import DistributedDaisyAI class DistributedSockHopDaisyAI(DistributedDaisyAI): notify = DirectNotifyGlobal.directNotify.newCategory("DistributedSockHopDaisyAI")
silly-wacky-3-town-toon/SOURCE-COD
toontown/classicchars/DistributedSockHopDaisyAI.py
Python
apache-2.0
263
""" """ from neoteric.util.compat import unittest from neoteric.resource.tracker import ResourceTracker, DuplicateResourceError class ResourceTrackerTests(unittest.TestCase): def test_all(self): r = ResourceTracker() r['test'] = 'abc123' self.assertEqual(r['test'], 'abc123') with self.assertRaises(DuplicateResourceError): r['test'] = 'def456' r.pop('test') with self.assertRaises(KeyError): r['test']
j3ffhubb/neoteric
tests/neoteric/resource/test_tracker.py
Python
gpl-3.0
482
from __future__ import annotations import copy from typing import Dict, List from bson import ObjectId from mongoengine import DoesNotExist from monkey_island.cc.models.edge import Edge RIGHT_ARROW = "\u2192" class EdgeService(Edge): @staticmethod def get_all_edges() -> List[EdgeService]: return EdgeService.objects() @staticmethod def get_or_create_edge(src_node_id, dst_node_id, src_label, dst_label) -> EdgeService: edge = None try: edge = EdgeService.objects.get(src_node_id=src_node_id, dst_node_id=dst_node_id) except DoesNotExist: edge = EdgeService(src_node_id=src_node_id, dst_node_id=dst_node_id) finally: if edge: edge.update_label(node_id=src_node_id, label=src_label) edge.update_label(node_id=dst_node_id, label=dst_label) return edge @staticmethod def get_by_dst_node(dst_node_id: ObjectId) -> List[EdgeService]: return EdgeService.objects(dst_node_id=dst_node_id) @staticmethod def get_edge_by_id(edge_id: ObjectId) -> EdgeService: return EdgeService.objects.get(id=edge_id) def update_label(self, node_id: ObjectId, label: str): if self.src_node_id == node_id: self.src_label = label elif self.dst_node_id == node_id: self.dst_label = label else: raise DoesNotExist( "Node id provided does not match with any endpoint of an self provided." ) self.save() @staticmethod def update_all_dst_nodes(old_dst_node_id: ObjectId, new_dst_node_id: ObjectId): for edge in EdgeService.objects(dst_node_id=old_dst_node_id): edge.dst_node_id = new_dst_node_id edge.save() @staticmethod def get_tunnel_edges_by_src(src_node_id) -> List[EdgeService]: try: return EdgeService.objects(src_node_id=src_node_id, tunnel=True) except DoesNotExist: return [] def disable_tunnel(self): self.tunnel = False self.save() def update_based_on_scan_telemetry(self, telemetry: Dict): machine_info = copy.deepcopy(telemetry["data"]["machine"]) new_scan = {"timestamp": telemetry["timestamp"], "data": machine_info} ip_address = machine_info.pop("ip_addr") domain_name = machine_info.pop("domain_name") self.scans.append(new_scan) self.ip_address = ip_address self.domain_name = domain_name self.save() def update_based_on_exploit(self, exploit: Dict): self.exploits.append(exploit) self.save() if exploit["result"]: self.set_exploited() def set_exploited(self): self.exploited = True self.save() def get_group(self) -> str: if self.exploited: return "exploited" if self.tunnel: return "tunnel" if self.scans or self.exploits: return "scan" return "empty" def get_label(self) -> str: return f"{self.src_label} {RIGHT_ARROW} {self.dst_label}"
guardicore/monkey
monkey/monkey_island/cc/services/edge/edge.py
Python
gpl-3.0
3,128
#!/usr/bin/python # -*- coding: utf-8 -*- # @Author: Aldo Sotolongo # @Date: 2017-01-13 15:17:37 # @Last Modified by: Aldo Sotolongo # @Last Modified time: 2017-01-15 21:04:43 # Description: Small program to get some info about shares in ZFS Storage Appliance. from __future__ import print_function import json import requests from requests.packages.urllib3.exceptions import InsecureRequestWarning # to disable warning #InsecureRequestWarning: Unverified HTTPS request is being made. Adding certificate #verification is strongly advised. See: #https://urllib3.readthedocs.io/en/latest/advanced-usage.html#ssl-warnings requests.packages.urllib3.disable_warnings(InsecureRequestWarning) URL = "https://192.168.100.150:215/api" ZAUTH = ("useradm", "password") HEADER = {"Content-Type": "application/json"} def getpools(): """Get all Pools""" pools = [] req = requests.get(URL + "/storage/v1/pools", auth=ZAUTH, verify=False, headers=HEADER) j = json.loads(req.text) req.close() for item in j.values(): for pool in item: pools.append(pool["name"]) pools = [str(x) for x in pools] return sorted(pools) def getprojects(poolname): """Get all projects in a pool""" projects = [] req = requests.get(URL + "/storage/v1/pools/{}/projects".format(poolname), auth=ZAUTH, verify=False, headers=HEADER) j = json.loads(req.text) req.close() for item in j.values(): for project in item: projects.append(project["name"]) projects = [str(x) for x in projects] return sorted(projects) def printlunsinproject(poolname, project): """Print LUNS info for a project""" req = requests.get(URL + "/storage/v1/pools/{}/projects/{}/luns".format(poolname, project), auth=ZAUTH, verify=False, headers=HEADER) j = json.loads(req.text) req.close() for item in j.values(): if item: for lun in sorted(item): initiatorgroup = [str(i) for i in lun["initiatorgroup"]] print("{:15} {:8.2f} {:15} {:20} {:10} {:34} {:8} {:25} {:8} {:4}" .format(lun["name"], (lun["volsize"]/(1024*1024*1024)), lun["targetgroup"], initiatorgroup, lun["status"], lun["lunguid"], lun["pool"], lun["project"], lun["logbias"], lun["assignednumber"])) def printfsinproject(poolname, project): """Print Filesystems info for a project""" req = requests.get(URL + "/storage/v1/pools/{}/projects/{}/filesystems" .format(poolname, project), auth=ZAUTH, verify=False, headers=HEADER) j = json.loads(req.text) req.close() for item in j.values(): if item: for fs in sorted(item): print("{:20} {:8.2f} {:40} {:8} {:22} {:8.2f} {:8.2f} {:10} {:10} {:5} {:40} {:50}" .format(fs["name"], (fs["space_total"]/(1024*1024*1024)), fs["mountpoint"], fs["pool"], fs["project"], (fs["quota"]/(1024*1024*1024)), (fs["reservation"]/(1024*1024*1024)), fs["root_user"], fs["root_group"], fs["root_permissions"], fs["sharesmb"], fs["sharenfs"])) def main(): """Main function for script""" pools = getpools() projects4pool = {} # Get LUN Info print("="*230) print("{:15} {:8} {:15} {:20} {:10} {:34} {:8} {:25} {:8} {:4}" .format("LUN", "Size(GB)", "TargetGroup", "InitiatorGroup", "status", "lunguid", "Pool", "Project", "logbias", "assignednumber")) print("="*230) for pool in pools: projects4pool[pool] = getprojects(pool) for keypool, values in projects4pool.iteritems(): for projvalue in values: printlunsinproject(keypool, projvalue) # Get Filesystems Info print("="*230) print("{:20} {:8} {:40} {:8} {:22} {:8} {:8} {:10} {:10} {:5} {:40} {:50}" .format("FSNAME", "space(GB)", "mountpoint", "pool", "project", "quota", "reserv", "root_user", "root_group", "perm", "sharesmb", "sharenfs")) print("="*230) for pool in pools: for keypool, values in projects4pool.iteritems(): for projvalue in values: printfsinproject(keypool, projvalue) if __name__ == "__main__": main()
aldenso/tools
ZFS/zfssainfo.py
Python
gpl-2.0
4,422
from flask import Blueprint from flask import session second = Blueprint('schedule', __name__) @second.route('/') def home(): names = session['names'] return str(names)
tacksoo/excel2pdf
schedule.py
Python
mit
178
#!/usr/bin/env python # Copyright (C) 2005, 2018 by INRIA import numpy as np # import siconos.numerics * fails with py.test! import siconos.numerics as SN def mcp_function(n, z, F): M = np.array([[2., 1.], [1., 2.]]) q = np.array([-5., -6.]) F[:] = np.dot(M,z) + q pass def mcp_Nablafunction (n, z, nabla_F): M = np.array([[2., 1.], [1., 2.]]) nabla_F[:] = M pass # solution zsol = np.array([4./3., 7./3.]) wsol = np.array([0. , 0.]) # problem #mcp=N.MCP(1,1,mcp_function,mcp_Nablafunction) ztol = 1e-8 def test_new(): mcp=SN.MixedComplementarityProblem2(1, 1, mcp_function, mcp_Nablafunction) def test_mcp_newton_FBLSA(): mcp = SN.MixedComplementarityProblem2(0, 2, mcp_function, mcp_Nablafunction) z = np.array([0., 0.]) w = np.array([0., 0.]) SO = SN.SolverOptions(mcp, SN.SICONOS_MCP_NEWTON_FBLSA) info = SN.mcp_newton_FBLSA(mcp, z, w, SO) #print("z = ", z) #print("w = ", w) assert (np.linalg.norm(z-zsol) <= ztol) assert not info def test_mcp_newton_minFBLSA(): mcp = SN.MixedComplementarityProblem2(0, 2, mcp_function, mcp_Nablafunction) z = np.array([0., 0.]) w = np.array([0., 0.]) SO = SN.SolverOptions(mcp, SN.SICONOS_MCP_NEWTON_MINFBLSA) info = SN.mcp_newton_minFBLSA(mcp, z, w, SO) #print("z = ", z) #print("w = ", w) assert (np.linalg.norm(z-zsol) <= ztol) assert not info
fperignon/siconos
numerics/swig/tests/test_mcp2.py
Python
apache-2.0
1,437
import os BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) SECRET_KEY = os.environ['SECRET_KEY'] DEBUG = os.environ['DEBUG'] ALLOWED_HOSTS = os.environ['ALLOWED_HOSTS'] ROOT_URLCONF = 'mywebsite.urls' WSGI_APPLICATION = 'mywebsite.wsgi.application' INSTALLED_APPS = ( 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'portfolio', ) MIDDLEWARE_CLASSES = ( 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.auth.middleware.SessionAuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'django.middleware.security.SecurityMiddleware', ) TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [os.path.join(BASE_DIR, 'templates').replace('\\', '/')], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True STATIC_URL = '/static/' STATICFILES_DIRS = ( os.path.join(BASE_DIR, 'static'), ) SITE_ID = 1
tpeek/Personal-Website
mywebsite/mywebsite/settings.py
Python
mit
1,864
# Django settings for demo project. DEBUG = True TEMPLATE_DEBUG = DEBUG ADMINS = ( # ('Your Name', 'your_email@domain.com'), ) MANAGERS = ADMINS DATABASE_ENGINE = '' # 'postgresql_psycopg2', 'postgresql', 'mysql', 'sqlite3' or 'oracle'. DATABASE_NAME = '' # Or path to database file if using sqlite3. DATABASE_USER = '' # Not used with sqlite3. DATABASE_PASSWORD = '' # Not used with sqlite3. DATABASE_HOST = '' # Set to empty string for localhost. Not used with sqlite3. DATABASE_PORT = '' # Set to empty string for default. Not used with sqlite3. # Local time zone for this installation. Choices can be found here: # http://en.wikipedia.org/wiki/List_of_tz_zones_by_name # although not all choices may be available on all operating systems. # If running in a Windows environment this must be set to the same as your # system time zone. TIME_ZONE = 'America/Chicago' # Language code for this installation. All choices can be found here: # http://www.i18nguy.com/unicode/language-identifiers.html LANGUAGE_CODE = 'en-us' SITE_ID = 1 # If you set this to False, Django will make some optimizations so as not # to load the internationalization machinery. USE_I18N = True # Absolute path to the directory that holds media. # Example: "/home/media/media.lawrence.com/" MEDIA_ROOT = '' # URL that handles the media served from MEDIA_ROOT. Make sure to use a # trailing slash if there is a path component (optional in other cases). # Examples: "http://media.lawrence.com", "http://example.com/media/" MEDIA_URL = '' # URL prefix for admin media -- CSS, JavaScript and images. Make sure to use a # trailing slash. # Examples: "http://foo.com/media/", "/media/". ADMIN_MEDIA_PREFIX = '/media/' # Make this unique, and don't share it with anybody. SECRET_KEY = '@n$c$o_7^imv1u$m^@5*b8z!d!(o@ar98nvdm-*vsuz_=q2@*5' # List of callables that know how to import templates from various sources. TEMPLATE_LOADERS = ( 'django.template.loaders.filesystem.load_template_source', 'django.template.loaders.app_directories.load_template_source', # 'django.template.loaders.eggs.load_template_source', ) MIDDLEWARE_CLASSES = ( 'django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.middleware.doc.XViewMiddleware', ) ROOT_URLCONF = 'demo.urls' TEMPLATE_DIRS = ( # Put strings here, like "/home/html/django_templates" or "C:/www/django/templates". # Always use forward slashes, even on Windows. # Don't forget to use absolute paths, not relative paths. "templates/", ) INSTALLED_APPS = ( 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'ajax', )
qingfeng/django-ajax-tag
demo/settings.py
Python
bsd-2-clause
2,844
import test s = """<entry> <id>tag:search.twitter.com,2005,1142881099</id> <published>2009-01-23T20:04:53Z</published> </entry> """ print s.find(">") print len(s.split(':')) print len(s.split('>')[2].split(':')) def h(x=1, y=3, z=4): return[x, y, z] print h(1,2) print h(1,z=5) # test.testEqual(h(1, 2), [1, 2, 4]) # test.testEqual(h(1, z = 5), [1, 3, 5]) def enum(L): res = [] n = 1 for item in L: res.append((n, item)) n = n + 1 return res # # test.testEqual(enum(["a", "b", "c"]), [(1, "a"), (2, "b"), (3, "c")]) print enum(["a", "b", "c"]) students = [("Jamal", 98, "A+"), ("Eloise", 87, "B+"), ("Madeline", 99, "A+")] outfile = open("grades.csv","w") # output the header row outfile.write("Name, score, grade\n") # output each of the rows: for student in students: outfile.write("%s, %d, %s\n" % student) outfile.close() s = """ Michelle loves to play ball""" print s s = """<entry> <id>tag:search.twitter.com,2005,1142881099</id> <published>2009-01-23T20:04:53Z</published> </entry> """ print (s.split(':')) print len(s.split(':')) print len(s.split('>')[2].split(':')) # def f(list): # newlist= [] # for x in list: # if "z" in x: # newlist=newlist.append(x.split[0]) # return newlist # words= ['Amazing', 'corny', 'zany'] # print f(words) # # # def f(list): # newlist= [] # for x in list: # s=x.split() # first=s[0] # newlist=newlist.append(first) # return newlist # # words= ['Amazing', 'corny', 'zany'] # print f(words) def interp(x, y): mystr = 'That is %d in a row, %s. Congratulations!' %(x,y) return mystr print interp(5,'sir') test.testEqual(interp(5, "sir"), "That is 5 in a row, sir. Congratulations!") test.testEqual(interp(6, "your highness"), "That is 6 in a row, your highness. Congratulations!") def h(x=1,y=3 ,z=4): return[x, y, z] print h() def enum(L): res = [] n = 1 for item in L: res.append((n, item)) n = n + 1 return res print enum(["a", "b", "c"]) def f(list): newlist= [] for x in list: if 'z' in x: newlist.append(x[0]) return newlist words= ['Amazing', 'corny', 'zany'] print f(words) # def function(sentence): # #print input # answer = [] # for word in sentence.split(): # if word not in answer: # answer.append(word) def f(list): newlist= [] for x in list: if 'z' in x: newlist.append(x[0]) # return newlist return [x[0] for x in list if 'z' in x] words=['amazing', 'corny', 'zany'] print f(words) print map ((lambda value: 5*value), [1,2,3]) def g(list): return sorted(list, key= lambda x: x[-1]) # PROBLEM SET 8 fall_list = ["leaves","apples","autumn","bicycles","pumpkin","squash","excellent"] # Write code to sort the list fall_list in reverse alphabetical order. # Assign the sorted list to the variable sorted_fall_list. sorted_fall_list= sorted(fall_list, reverse=True) print sorted_fall_list # Now write code to sort the list fall_list by length of the word, longest to shortest. # Assign this sorted list to the variable length_fall_list. length_fall_list= sorted(fall_list, key=lambda x: len(x), reverse=True) print length_fall_list food_amounts = [{"sugar_grams":245,"carbohydrate":83,"fiber":67},{"carbohydrate":74,"sugar_grams":52,"fiber":26},{"fiber":47,"carbohydrate":93,"sugar_grams":6}] # Write code to sort the list food_amounts by the key "sugar_grams", from lowest to highest. # Assign the sorted list to the variable sorted_sugar. sorted_sugar= sorted(food_amounts, key = lambda x: x["sugar_grams"]) print sorted_sugar # Now write code to sort the list food_amounts by # the value of the key "carbohydrate" minus the value of the key "fiber" in each one, from lowest to highest. # Assign this sorted list to the variable raw_carb_sort. raw_carb_sort = sorted(food_amounts, key= lambda x: x["carbohydrate"]- x["fiber"]) print raw_carb_sort # Convert this string concatenation to one using string interpolation. # Assign the result to the variable t. x = 12 fname = "Joe" our_email = "scammer@dontfallforthis.com" s = "Hello, " + fname + ", you may have won $" + str(x) + " million dollars. Please send your bank account number to " + our_email + " and we will deposit your winnings." t = "" print "hello, %s, you may have won $%d million dollars. Please send your bank account number to %s and we will deposit your winnings." %(fname, x, our_email) # Write code, using string interpolation and the variables nm, min_mt, and mile_amt, to produce the string # "Albert walked 0.67 miles today in 50 minutes." Assign it to albert_str. nm = "Albert" min_amt = 50 mile_amt = 0.673892 albert_str= "%s walked %0.2f miles today in %d minutes." %(nm, mile_amt, min_amt) print albert_str # Define a function called walk_reporter, which takes as input: # - a string that represents someone's name, # - a float that represents the number of miles they walked, # - and an integer that represents the number of minutes they spent walking. # # The function should RETURN a string in the format: # "[NAME STR] walked [MILE FLOAT with TWO digits after the decimal] miles in # [MINUTES INT] minutes." # You MUST use string interpolation in the function. # You should NOT use raw_input to get the inputs; they are passed in as parameters. def walk_reporter(name, miles, minutes): return "%s walked %0.2f miles in %d minutes." %(name, miles, minutes) print walk_reporter("michelle", 2.345, 10) test.testEqual(walk_reporter("Jamie",5.233679,202), "Jamie walked 5.23 miles in 202 minutes.", "walk_reporter test 1") def f(list): newlist= [] for x in list: if 'z' in x: newlist.append(x[0]) return newlist words= ['Amazing', 'corny', 'zany'] print f(words) def f(list): return [x[0] for x in list if 'z' in x] test.testEqual(f(['Amazing', 'corny', 'zany']), ['A', 'z']) #While studying i went through the textbook and redid some of the manuel accumulation problems. See if you can go back on my work, i think it will help you study! x=raw_input("enter word") things4=map(lambda x: x + "-" + x + "-", x) print "".join(things4)
mgooel/106-Extra-Credit
practice.py
Python
mit
6,103
from pygame.locals import * import pygame from util import save_yaml from dialog import FloatDialog from util import gamedir import json import os from tempsprites import Tempsprites from button import render_text class Journal(list): """ >>> from journal import Journal >>> j = Journal() >>> j.autosave = False >>> j.write('Hello world') >>> j.write('Love me') >>> j.read() ['', 'Hello world', '', 'Love me'] >>> j.bufferlen = 2 >>> j.read() ['', 'Hello world'] >>> j.prev() >>> j.read() ['', 'Hello world'] >>> j.next() >>> j.read() ['', 'Love me'] """ bufferlen = 30 bookmark = 0 autosave = True def write(self, s): self.append('') self += s.split('\n') if self.autosave: self.savetoslot() def read(self): if len(self) >= self.bufferlen: return self.__getitem__(slice(self.bookmark, self.bookmark+self.bufferlen)) else: return self def next(self): self.bookmark += self.bufferlen if self.bookmark >= len(self): self.bookmark = len(self) - self.bufferlen def scrollup(self): self.prev() def scrolldown(self): self.next() def prev(self): self.bookmark -= self.bufferlen if self.bookmark <= 0: self.bookmark = 0 def savetoslot(self): savedir = gamedir[0] filename = os.path.join(savedir,'journal','journal.yaml') if not os.path.exists(os.path.dirname(filename)): os.makedirs(os.path.dirname(filename)) open(filename, 'w').write(json.dumps(self,indent=4)) class JournalView(FloatDialog, Tempsprites): def __init__(self, rect, frontend, journal, layer=5, title=''): self._layer = layer self.journal = journal self.frontend = frontend FloatDialog.__init__(self, rect, frontend, layer) if self.journal is None: self.journal = self.frontend.game.journal self.rect = rect book = self.frontend.imagecache['spellbookForFlare.png'].copy() book = pygame.transform.smoothscale(book, (self.rect.w, self.rect.h)) self.image.blit(book, (0,0)) self.mb_rect = pygame.Rect(self.rect.x +200, self.rect.y + 10, self.rect.w - 400, self.rect.h - 200) self.bg = self.image.copy() self.up = self.frontend.eventstack.register_event("wheelup", self, self.journal.prev) self.down = self.frontend.eventstack.register_event("wheeldown", self, self.journal.next) def delete(self): self.frontend.eventstack.unregister_event(self.up) self.frontend.eventstack.unregister_event(self.down) FloatDialog.delete(self) def update(self): self.image.blit(self.bg, (0,0)) x = self.mb_rect.x y = self.mb_rect.y for line in self.journal.read(): lineimg=render_text(line, 16, (0,0,0)) y += lineimg.get_rect().h if y >= self.mb_rect.y + self.mb_rect.h: x = self.mb_rect.w/2 + 300 y = self.mb_rect.y self.image.blit(lineimg,(x,y))
ajventer/mirthless
src/lib/journal.py
Python
mit
3,165
# if k is even, return True # else return False def even(k): return str(k)[-1] in ('0', '2', '4', '6', '8') if __name__ == '__main__': #test1 print('k = 4') print(even(4)) #test2 print('k = 5') print(even(5))
maxiee/DataStructuresAlgorithmsPythonExercises
chapter1/r_1_2.py
Python
gpl-2.0
239
# Copyright (c) 2012 Adi Roiban. # See LICENSE for details. from __future__ import ( absolute_import, print_function, with_statement, unicode_literals, ) import os class ProjectPaths(object): """ Container for common path used by the build system. """ def __init__(self, os_name, build_folder_name, folders, filesystem): build_folder_name = build_folder_name.rstrip(b'/') build_folder_name = build_folder_name.rstrip(b'\\') self.fs = filesystem self._os_name = os_name self.product = os.path.abspath(b'.') self.build = self.fs.join([self.product, build_folder_name]) self.dist = self.fs.join([self.product, folders['dist']]) self.publish = self.fs.join([self.product, folders['publish']]) self.python_executable = self.getPythonExecutable(os_name=os_name) self.python_scripts = self.getPythonScripts() self.brink_package = os.path.dirname(__file__) def getPythonExecutable(self, os_name=None): """ Return the path to the Python executable for an OS. """ if os_name is None: os_name = os.name if os_name == 'win': return self.fs.join(['lib', 'python.exe']) else: return self.fs.join(['bin', 'python']) def getPythonScripts(self, os_name=None): """ Return the path to the Python scripts folder for an OS. """ if os_name is None: os_name = os.name if os_name in ['nt', 'win']: return self.fs.join(['lib', 'Scripts']) else: return self.fs.join(['bin'])
chevah/brink
brink/paths.py
Python
bsd-3-clause
1,656
# this progrma will implement the merge sort # keep care of using python 3.5 def arraycopy(to, start, end, source): "copy the array" for index in range(start, end): to[index] = source[index] def mergeparts(v, start, middle, end, work): "merge the two part into one in array v" ipart1 = start; ipart2 = middle; for index in range(start, end): if ipart1 < middle and (ipart2 >= end or v[ipart1] <= v[ipart2]): work[index] = v[ipart1] ipart1 += 1 else: work[index] = v[ipart2] ipart2 += 1 def top2bottom(v, start, end, work): "top to bottom mode recursive" if(end - start >= 2): imiddle = (start + end)//2; # split the array top2bottom(v, start, imiddle, work) top2bottom(v, imiddle, end, work) # merge two part mergeparts(v, start, imiddle, end, work) # copy the sort array arraycopy(v, start, end, work) def mergesort(v, n, work): "merge sort" top2bottom(v, 0, n, work) print(""" Merge sort implement using python 3.5 top-bottom mode. """) # sort the list array = [1, 4, 89, 67, 90, 34, 56, 23, 15, 48] work = list(range(len(array))) print("souce array: ", array) # use the merge sort mergesort(array, len(array), work) print("after using merge sort: ", array) input("\n\nPress enter to exit.")
smileboywtu/Algorithms-Python3
sort/merge-sort/merge-sort.py
Python
gpl-2.0
1,401
#!/usr/bin/env python # encoding: utf-8 """ generateSequences.py Created by Brant Faircloth on 2009-03-28. Copyright (c) 2009 Brant Faircloth. All rights reserved. """ import pdb import motif import numpy def generateSequence(motifs, outfile, max_rep = 14): for m in motifs: motif_length = m[0] for seq in m[1:]: prime5_seq = 'NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN' #len=36 prime3_seq = 'NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN' #len=36 #pdb.set_trace() rep_number = numpy.random.randint(6,max_rep) prime5_end = numpy.random.randint(16,36) prime3_end = numpy.random.randint(16,36) insert = seq*rep_number start = len(prime5_seq[:prime5_end]) end = start + len(insert) seq_id = '>%s_%s_%s_(%s,%s)' % (motif_length, seq, rep_number, start, end) test_seq = prime5_seq[:prime5_end] + insert + prime3_seq[:prime3_end] outfile.write('%s\n%s\n' % (seq_id, test_seq)) def main(): motifs = (motif.mononucleotide, motif.dinucleotide, motif.trinucleotide, motif.tetranucleotide, motif.pentanucleotide, motif.hexanucleotide) outfile = open('testRepeats.fa', 'w') generateSequence(motifs, outfile) outfile.close() if __name__ == '__main__': main()
brantfaircloth/msatcommander
msat/helper/generateSequences.py
Python
gpl-2.0
1,336
#!/usr/bin/python # -*- coding: utf-8 -*- """Tests for the 4n6time SQLite database output module CLI arguments helper.""" import argparse import unittest from plaso.cli.helpers import sqlite_4n6time_output from plaso.lib import errors from plaso.output import sqlite_4n6time from tests.cli import test_lib as cli_test_lib from tests.cli.helpers import test_lib class SQLite4n6TimeOutputArgumentsHelperTEst( test_lib.OutputModuleArgumentsHelperTest): """Tests the 4n6time SQLite database output module CLI arguments helper.""" _EXPECTED_OUTPUT = u'\n'.join([ (u'usage: cli_helper.py [--append] [--evidence EVIDENCE] ' u'[--fields FIELDS]'), u' [--additional_fields ADDITIONAL_FIELDS]', u'', u'Test argument parser.', u'', u'optional arguments:', u' --additional_fields ADDITIONAL_FIELDS', (u' Defines extra fields to be included in the ' u'output, in'), u' addition to the default fields, which are', u' datetime,host,source,sourcetype,user,type.', (u' --append Defines whether the intention is to append ' u'to an'), (u' already existing database or overwrite it. ' u'Defaults to'), u' overwrite.', (u' --evidence EVIDENCE Set the evidence field to a specific value, ' u'defaults'), u' to empty.', (u' --fields FIELDS Defines which fields should be indexed in ' u'the'), u' database.', u'']) def testAddArguments(self): """Tests the AddArguments function.""" argument_parser = argparse.ArgumentParser( prog=u'cli_helper.py', description=u'Test argument parser.', add_help=False, formatter_class=cli_test_lib.SortedArgumentsHelpFormatter) sqlite_4n6time_output.SQLite4n6TimeOutputArgumentsHelper.AddArguments( argument_parser) output = self._RunArgparseFormatHelp(argument_parser) self.assertEqual(output, self._EXPECTED_OUTPUT) def testParseOptions(self): """Tests the ParseOptions function.""" options = cli_test_lib.TestOptions() output_mediator = self._CreateOutputMediator() output_module = sqlite_4n6time.SQLite4n6TimeOutputModule(output_mediator) with self.assertRaises(errors.BadConfigOption): sqlite_4n6time_output.SQLite4n6TimeOutputArgumentsHelper.ParseOptions( options, output_module) options.write = u'4n6time.sqlite' sqlite_4n6time_output.SQLite4n6TimeOutputArgumentsHelper.ParseOptions( options, output_module) with self.assertRaises(errors.BadConfigObject): sqlite_4n6time_output.SQLite4n6TimeOutputArgumentsHelper.ParseOptions( options, None) if __name__ == '__main__': unittest.main()
dc3-plaso/plaso
tests/cli/helpers/sqlite_4n6time_output.py
Python
apache-2.0
2,905
# Copyright 2022 The Brax Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # pylint:disable=redefined-builtin """Common math functions used by multiple brax modules.""" from typing import Tuple from brax import jumpy as jp Vector3 = jp.ndarray Quaternion = jp.ndarray def rotate(vec: Vector3, quat: Quaternion): """Rotates a vector vec by a unit quaternion quat. Args: vec: (3,) a vector quat: (4,) a quaternion Returns: ndarray(3) containing vec rotated by quat. """ s, u = quat[0], quat[1:] r = 2 * (jp.dot(u, vec) * u) + (s * s - jp.dot(u, u)) * vec r = r + 2 * s * jp.cross(u, vec) return r def inv_rotate(vec: Vector3, quat: Quaternion): """Rotates a vector by the inverse of a unit quaternion. Args: vec: (3,) a vector quat: (4,) a quaternion Returns: A vector rotated by quat^{-1} """ return rotate(vec, quat_inv(quat)) def ang_to_quat(ang: Vector3): """Converts angular velocity to a quaternion. Args: ang: (3,) angular velocity Returns: A rotation quaternion. """ return jp.array([0, ang[0], ang[1], ang[2]]) def euler_to_quat(v: Vector3) -> Quaternion: """Converts euler rotations in degrees to quaternion.""" # this follows the Tait-Bryan intrinsic rotation formalism: x-y'-z'' c1, c2, c3 = jp.cos(v * jp.pi / 360) s1, s2, s3 = jp.sin(v * jp.pi / 360) w = c1 * c2 * c3 - s1 * s2 * s3 x = s1 * c2 * c3 + c1 * s2 * s3 y = c1 * s2 * c3 - s1 * c2 * s3 z = c1 * c2 * s3 + s1 * s2 * c3 return jp.array([w, x, y, z]) def quat_to_axis_angle(q: Quaternion) -> Tuple[Vector3, jp.ndarray]: """Returns the axis-angle representation of a quaternion. Args: q: (4,) a quaternion Returns: The angle of axis-angle of this quaternion, in the range [-pi, pi]. """ # TODO: replace with more accurate safe function # avoid the singularity at 0: epsilon = 0.00001 # safety 1e-6 jitter added because both sqrt and arctan2 have bad gradients denom = jp.sqrt(epsilon + 1 - q[0] * q[0]) angle = 2. * jp.arctan2( jp.sqrt(epsilon + q[1] * q[1] + q[2] * q[2] + q[3] * q[3]), q[0]) angle += jp.where(angle > jp.pi, x=-2 * jp.pi, y=0) angle += jp.where(angle < -jp.pi, x=2 * jp.pi, y=0) return q[1:] / denom, angle def signed_angle(axis: Vector3, ref_p: Vector3, ref_c: Vector3) -> jp.ndarray: """Calculates the signed angle between two vectors along an axis. Args: axis: (3,) common axis around which to calculate change in angle ref_p: (3,) vector pointing at 0-degrees offset in the parent's frame ref_c: (3,) vector pointing at 0-degrees offset in the child's frame Returns: The signed angle between two parts. """ return jp.arctan2(jp.dot(jp.cross(ref_p, ref_c), axis), jp.dot(ref_p, ref_c)) def quat_mul(u: Quaternion, v: Quaternion) -> Quaternion: """Multiplies two quaternions. Args: u: (4,) quaternion (w,x,y,z) v: (4,) quaternion (w,x,y,z) Returns: A quaternion u * v. """ return jp.array([ u[0] * v[0] - u[1] * v[1] - u[2] * v[2] - u[3] * v[3], u[0] * v[1] + u[1] * v[0] + u[2] * v[3] - u[3] * v[2], u[0] * v[2] - u[1] * v[3] + u[2] * v[0] + u[3] * v[1], u[0] * v[3] + u[1] * v[2] - u[2] * v[1] + u[3] * v[0], ]) def quat_rot_axis(axis: Vector3, angle: jp.ndarray) -> Vector3: """Provides a quaternion that describes rotating around axis v by angle. Args: axis: (3,) axis (x,y,z) angle: () float angle to rotate by Returns: A quaternion that rotates around v by angle """ qx = axis[0] * jp.sin(angle / 2) qy = axis[1] * jp.sin(angle / 2) qz = axis[2] * jp.sin(angle / 2) qw = jp.cos(angle / 2) return jp.array([qw, qx, qy, qz]) def quat_inv(q: Quaternion) -> Quaternion: """Calculates the inverse of quaternion q. Args: q: (4,) quaternion [w, x, y, z] Returns: The inverse of q, where qmult(q, inv_quat(q)) = [1, 0, 0, 0]. """ return q * jp.array([1, -1, -1, -1]) def normalize(v: Vector3, epsilon=1e-6) -> Vector3: """Normalizes a vector.""" return v / (epsilon + jp.safe_norm(v))
google/brax
brax/math.py
Python
apache-2.0
4,570
""" Infrastructure code for testing Gabble by pretending to be a Jabber server. """ import base64 import os import hashlib import sys import random import re import traceback import ns import constants as cs import servicetest from servicetest import ( assertEquals, assertLength, assertContains, wrap_channel, EventPattern, call_async, unwrap, Event) import twisted from twisted.words.xish import domish, xpath from twisted.words.protocols.jabber.client import IQ from twisted.words.protocols.jabber import xmlstream from twisted.internet import reactor, ssl import dbus def make_result_iq(stream, iq, add_query_node=True): result = IQ(stream, "result") result["id"] = iq["id"] to = iq.getAttribute('to') if to is not None: result["from"] = to query = iq.firstChildElement() if query and add_query_node: result.addElement((query.uri, query.name)) return result def acknowledge_iq(stream, iq): stream.send(make_result_iq(stream, iq)) def send_error_reply(stream, iq, error_stanza=None): result = IQ(stream, "error") result["id"] = iq["id"] query = iq.firstChildElement() to = iq.getAttribute('to') if to is not None: result["from"] = to if query: result.addElement((query.uri, query.name)) if error_stanza: result.addChild(error_stanza) stream.send(result) def request_muc_handle(q, conn, stream, muc_jid): servicetest.call_async(q, conn, 'RequestHandles', 2, [muc_jid]) event = q.expect('dbus-return', method='RequestHandles') return event.value[0][0] def make_muc_presence(affiliation, role, muc_jid, alias, jid=None, photo=None): presence = domish.Element((None, 'presence')) presence['from'] = '%s/%s' % (muc_jid, alias) x = presence.addElement((ns.MUC_USER, 'x')) item = x.addElement('item') item['affiliation'] = affiliation item['role'] = role if jid is not None: item['jid'] = jid if photo is not None: presence.addChild( elem(ns.VCARD_TEMP_UPDATE, 'x')( elem('photo')(unicode(photo)) )) return presence def sync_stream(q, stream): """Used to ensure that Gabble has processed all stanzas sent to it.""" iq = IQ(stream, "get") id = iq['id'] iq.addElement(('http://jabber.org/protocol/disco#info', 'query')) stream.send(iq) q.expect('stream-iq', query_ns='http://jabber.org/protocol/disco#info', predicate=(lambda event: event.stanza['id'] == id and event.iq_type == 'result')) class GabbleAuthenticator(xmlstream.Authenticator): def __init__(self, username, password, resource=None): self.username = username self.password = password self.resource = resource self.bare_jid = None self.full_jid = None self._event_func = lambda e: None xmlstream.Authenticator.__init__(self) def set_event_func(self, event_func): self._event_func = event_func class JabberAuthenticator(GabbleAuthenticator): "Trivial XML stream authenticator that accepts one username/digest pair." # Patch in fix from http://twistedmatrix.com/trac/changeset/23418. # This monkeypatch taken from Gadget source code from twisted.words.xish.utility import EventDispatcher def _addObserver(self, onetime, event, observerfn, priority, *args, **kwargs): if self._dispatchDepth > 0: self._updateQueue.append(lambda: self._addObserver(onetime, event, observerfn, priority, *args, **kwargs)) return self._oldAddObserver(onetime, event, observerfn, priority, *args, **kwargs) EventDispatcher._oldAddObserver = EventDispatcher._addObserver EventDispatcher._addObserver = _addObserver def __init__(self, username, password, resource=None, emit_events=False): GabbleAuthenticator.__init__(self, username, password, resource) self.emit_events = emit_events def streamStarted(self, root=None): if root: self.xmlstream.sid = '%x' % random.randint(1, sys.maxint) self.xmlstream.sendHeader() self.xmlstream.addOnetimeObserver( "/iq/query[@xmlns='jabber:iq:auth']", self.initialIq) def initialIq(self, iq): if self.emit_events: self._event_func(Event('auth-initial-iq', authenticator=self, iq=iq, id=iq["id"])) else: self.respondToInitialIq(iq) self.xmlstream.addOnetimeObserver('/iq/query/username', self.secondIq) def respondToInitialIq(self, iq): result = IQ(self.xmlstream, "result") result["id"] = iq["id"] query = result.addElement('query') query["xmlns"] = "jabber:iq:auth" query.addElement('username', content='test') query.addElement('password') query.addElement('digest') query.addElement('resource') self.xmlstream.send(result) def secondIq(self, iq): if self.emit_events: self._event_func(Event('auth-second-iq', authenticator=self, iq=iq, id=iq["id"])) else: self.respondToSecondIq(self, iq) def respondToSecondIq(self, iq): username = xpath.queryForNodes('/iq/query/username', iq) assert map(str, username) == [self.username] digest = xpath.queryForNodes('/iq/query/digest', iq) expect = hashlib.sha1(self.xmlstream.sid + self.password).hexdigest() assert map(str, digest) == [expect] resource = xpath.queryForNodes('/iq/query/resource', iq) assertLength(1, resource) if self.resource is not None: assertEquals(self.resource, str(resource[0])) self.bare_jid = '%s@localhost' % self.username self.full_jid = '%s/%s' % (self.bare_jid, resource) result = IQ(self.xmlstream, "result") result["id"] = iq["id"] self.xmlstream.send(result) self.xmlstream.dispatch(self.xmlstream, xmlstream.STREAM_AUTHD_EVENT) class XmppAuthenticator(GabbleAuthenticator): def __init__(self, username, password, resource=None): GabbleAuthenticator.__init__(self, username, password, resource) self.authenticated = False def streamInitialize(self, root): if root: self.xmlstream.sid = root.getAttribute('id') if self.xmlstream.sid is None: self.xmlstream.sid = '%x' % random.randint(1, sys.maxint) self.xmlstream.sendHeader() def streamIQ(self): features = elem(xmlstream.NS_STREAMS, 'features')( elem(ns.NS_XMPP_BIND, 'bind'), elem(ns.NS_XMPP_SESSION, 'session'), ) self.xmlstream.send(features) self.xmlstream.addOnetimeObserver( "/iq/bind[@xmlns='%s']" % ns.NS_XMPP_BIND, self.bindIq) self.xmlstream.addOnetimeObserver( "/iq/session[@xmlns='%s']" % ns.NS_XMPP_SESSION, self.sessionIq) def streamSASL(self): features = domish.Element((xmlstream.NS_STREAMS, 'features')) mechanisms = features.addElement((ns.NS_XMPP_SASL, 'mechanisms')) mechanism = mechanisms.addElement('mechanism', content='PLAIN') self.xmlstream.send(features) self.xmlstream.addOnetimeObserver("/auth", self.auth) def streamStarted(self, root=None): self.streamInitialize(root) if self.authenticated: # Initiator authenticated itself, and has started a new stream. self.streamIQ() else: self.streamSASL() def auth(self, auth): assert (base64.b64decode(str(auth)) == '\x00%s\x00%s' % (self.username, self.password)) success = domish.Element((ns.NS_XMPP_SASL, 'success')) self.xmlstream.send(success) self.xmlstream.reset() self.authenticated = True def bindIq(self, iq): resource = xpath.queryForString('/iq/bind/resource', iq) if self.resource is not None: assertEquals(self.resource, resource) else: assert resource is not None result = IQ(self.xmlstream, "result") result["id"] = iq["id"] bind = result.addElement((ns.NS_XMPP_BIND, 'bind')) self.bare_jid = '%s@localhost' % self.username self.full_jid = '%s/%s' % (self.bare_jid, resource) jid = bind.addElement('jid', content=self.full_jid) self.xmlstream.send(result) self.xmlstream.dispatch(self.xmlstream, xmlstream.STREAM_AUTHD_EVENT) def sessionIq(self, iq): self.xmlstream.send(make_result_iq(self.xmlstream, iq)) class StreamEvent(servicetest.Event): def __init__(self, type_, stanza, stream): servicetest.Event.__init__(self, type_, stanza=stanza) self.stream = stream self.to = stanza.getAttribute("to") class IQEvent(StreamEvent): def __init__(self, stream, iq): StreamEvent.__init__(self, 'stream-iq', iq, stream) self.iq_type = iq.getAttribute("type") self.iq_id = iq.getAttribute("id") query = iq.firstChildElement() if query: self.query = query self.query_ns = query.uri self.query_name = query.name if query.getAttribute("node"): self.query_node = query.getAttribute("node") else: self.query = None class PresenceEvent(StreamEvent): def __init__(self, stream, stanza): StreamEvent.__init__(self, 'stream-presence', stanza, stream) self.presence_type = stanza.getAttribute('type') statuses = xpath.queryForNodes('/presence/status', stanza) if statuses: self.presence_status = str(statuses[0]) class MessageEvent(StreamEvent): def __init__(self, stream, stanza): StreamEvent.__init__(self, 'stream-message', stanza, stream) self.message_type = stanza.getAttribute('type') class StreamFactory(twisted.internet.protocol.Factory): def __init__(self, streams, jids): self.streams = streams self.jids = jids self.presences = {} self.mappings = dict(map (lambda jid, stream: (jid, stream), jids, streams)) # Make a copy of the streams self.factory_streams = list(streams) self.factory_streams.reverse() # Do not add observers for single instances because it's unnecessary and # some unit tests need to respond to the roster request, and we shouldn't # answer it for them otherwise we break compatibility if len(streams) > 1: # We need to have a function here because lambda keeps a reference on # the stream and jid and in the for loop, there is no context def addObservers(stream, jid): stream.addObserver('/iq', lambda x: \ self.forward_iq(stream, jid, x)) stream.addObserver('/presence', lambda x: \ self.got_presence(stream, jid, x)) for (jid, stream) in self.mappings.items(): addObservers(stream, jid) def protocol(self, *args): return self.factory_streams.pop() def got_presence (self, stream, jid, stanza): stanza.attributes['from'] = jid self.presences[jid] = stanza for dest_jid in self.presences.keys(): # Dispatch the new presence to other clients stanza.attributes['to'] = dest_jid self.mappings[dest_jid].send(stanza) # Don't echo the presence twice if dest_jid != jid: # Dispatch other client's presence to this stream presence = self.presences[dest_jid] presence.attributes['to'] = jid stream.send(presence) def lost_presence(self, stream, jid): if self.presences.has_key(jid): del self.presences[jid] for dest_jid in self.presences.keys(): presence = domish.Element(('jabber:client', 'presence')) presence['from'] = jid presence['to'] = dest_jid presence['type'] = 'unavailable' self.mappings[dest_jid].send(presence) def forward_iq(self, stream, jid, stanza): stanza.attributes['from'] = jid query = stanza.firstChildElement() # Fake other accounts as being part of our roster if query and query.uri == ns.ROSTER: roster = make_result_iq(stream, stanza) query = roster.firstChildElement() for roster_jid in self.mappings.keys(): if jid != roster_jid: item = query.addElement('item') item['jid'] = roster_jid item['subscription'] = 'both' stream.send(roster) return to = stanza.getAttribute('to') dest = None if to is not None: dest = self.mappings.get(to) if dest is not None: dest.send(stanza) class BaseXmlStream(xmlstream.XmlStream): initiating = False namespace = 'jabber:client' pep_support = True disco_features = [] handle_privacy_lists = True def __init__(self, event_func, authenticator): xmlstream.XmlStream.__init__(self, authenticator) self.event_func = event_func self.addObserver('//iq', lambda x: event_func( IQEvent(self, x))) self.addObserver('//message', lambda x: event_func( MessageEvent(self, x))) self.addObserver('//presence', lambda x: event_func( PresenceEvent(self, x))) self.addObserver('//event/stream/authd', self._cb_authd) if self.handle_privacy_lists: self.addObserver("/iq/query[@xmlns='%s']" % ns.PRIVACY, self._cb_priv_list) def _cb_priv_list(self, iq): send_error_reply(self, iq) def _cb_authd(self, _): # called when stream is authenticated assert self.authenticator.full_jid is not None assert self.authenticator.bare_jid is not None self.addObserver( "/iq[@to='localhost']/query[@xmlns='http://jabber.org/protocol/disco#info']", self._cb_disco_iq) self.addObserver( "/iq[@to='%s']/query[@xmlns='http://jabber.org/protocol/disco#info']" % self.authenticator.bare_jid, self._cb_bare_jid_disco_iq) self.event_func(servicetest.Event('stream-authenticated')) def _cb_disco_iq(self, iq): nodes = xpath.queryForNodes( "/iq/query[@xmlns='http://jabber.org/protocol/disco#info']", iq) query = nodes[0] for feature in self.disco_features: query.addChild(elem('feature', var=feature)) iq['type'] = 'result' iq['from'] = iq['to'] self.send(iq) def _cb_bare_jid_disco_iq(self, iq): # advertise PEP support nodes = xpath.queryForNodes( "/iq/query[@xmlns='http://jabber.org/protocol/disco#info']", iq) query = nodes[0] identity = query.addElement('identity') identity['category'] = 'pubsub' identity['type'] = 'pep' iq['type'] = 'result' iq['from'] = iq['to'] self.send(iq) def onDocumentEnd(self): self.event_func(servicetest.Event('stream-closed')) # We don't chain up XmlStream.onDocumentEnd() because it will # disconnect the TCP connection making tests as # connect/disconnect-timeout.py not working def send_stream_error(self, error='system-shutdown'): # Yes, there are meant to be two different STREAMS namespaces. go_away = \ elem(xmlstream.NS_STREAMS, 'error')( elem(ns.STREAMS, error) ) self.send(go_away) class JabberXmlStream(BaseXmlStream): version = (0, 9) class XmppXmlStream(BaseXmlStream): version = (1, 0) class GoogleXmlStream(BaseXmlStream): version = (1, 0) pep_support = False disco_features = [ns.GOOGLE_ROSTER, ns.GOOGLE_JINGLE_INFO, ns.GOOGLE_MAIL_NOTIFY, ns.GOOGLE_QUEUE, ] def _cb_bare_jid_disco_iq(self, iq): # Google talk doesn't support PEP :( iq['type'] = 'result' iq['from'] = iq['to'] self.send(iq) def make_connection(bus, event_func, params=None, suffix=''): # Gabble accepts a resource in 'account', but the value of 'resource' # overrides it if there is one. test_name = re.sub('(.*tests/twisted/|\./)', '', sys.argv[0]) account = 'test%s@localhost/%s' % (suffix, test_name) default_params = { 'account': account, 'password': 'pass', 'resource': 'Resource', 'server': 'localhost', 'port': dbus.UInt32(4242), 'fallback-socks5-proxies': dbus.Array([], signature='s'), 'require-encryption': False, } if params: default_params.update(params) # Allow omitting the 'password' param if default_params['password'] is None: del default_params['password'] # Allow omitting the 'account' param if default_params['account'] is None: del default_params['account'] jid = default_params.get('account', None) conn = servicetest.make_connection(bus, event_func, 'gabble', 'jabber', default_params) return (conn, jid) def make_stream(event_func, authenticator=None, protocol=None, resource=None, suffix=''): # set up Jabber server if authenticator is None: authenticator = XmppAuthenticator('test%s' % suffix, 'pass', resource=resource) authenticator.set_event_func(event_func) if protocol is None: protocol = XmppXmlStream stream = protocol(event_func, authenticator) return stream def disconnect_conn(q, conn, stream, expected_before=[], expected_after=[]): call_async(q, conn, 'Disconnect') tmp = expected_before + [ EventPattern('dbus-signal', signal='StatusChanged', args=[cs.CONN_STATUS_DISCONNECTED, cs.CSR_REQUESTED]), EventPattern('stream-closed')] before_events = q.expect_many(*tmp) stream.sendFooter() tmp = expected_after + [EventPattern('dbus-return', method='Disconnect')] after_events = q.expect_many(*tmp) return before_events[:-2], after_events[:-1] def exec_test_deferred(fun, params, protocol=None, timeout=None, authenticator=None, num_instances=1, do_connect=True): # hack to ease debugging domish.Element.__repr__ = domish.Element.toXml colourer = None if sys.stdout.isatty() or 'CHECK_FORCE_COLOR' in os.environ: colourer = servicetest.install_colourer() bus = dbus.SessionBus() queue = servicetest.IteratingEventQueue(timeout) queue.verbose = ( os.environ.get('CHECK_TWISTED_VERBOSE', '') != '' or '-v' in sys.argv) conns = [] jids = [] streams = [] resource = params.get('resource') if params is not None else None for i in range(0, num_instances): if i == 0: suffix = '' else: suffix = str(i) try: (conn, jid) = make_connection(bus, queue.append, params, suffix) except Exception, e: # Crap. This is normally because the connection's still kicking # around on the bus. Let's bin any connections we *did* manage to # get going and then bail out unceremoniously. print e for conn in conns: conn.Disconnect() os._exit(1) conns.append(conn) jids.append(jid) streams.append(make_stream(queue.append, protocol=protocol, authenticator=authenticator, resource=resource, suffix=suffix)) factory = StreamFactory(streams, jids) port = reactor.listenTCP(4242, factory, interface='localhost') def signal_receiver(*args, **kw): if kw['path'] == '/org/freedesktop/DBus' and \ kw['member'] == 'NameOwnerChanged': bus_name, old_name, new_name = args if new_name == '': for i, conn in enumerate(conns): stream = streams[i] jid = jids[i] if conn._requested_bus_name == bus_name: factory.lost_presence(stream, jid) break queue.append(Event('dbus-signal', path=unwrap(kw['path']), signal=kw['member'], args=map(unwrap, args), interface=kw['interface'])) match_all_signals = bus.add_signal_receiver( signal_receiver, None, # signal name None, # interface None, path_keyword='path', member_keyword='member', interface_keyword='interface', byte_arrays=True ) error = None try: if do_connect: for conn in conns: conn.Connect() queue.expect('dbus-signal', signal='StatusChanged', args=[cs.CONN_STATUS_CONNECTING, cs.CSR_REQUESTED]) queue.expect('stream-authenticated') queue.expect('dbus-signal', signal='PresencesChanged', args=[{1L: (cs.PRESENCE_AVAILABLE, u'available', '')}]) queue.expect('dbus-signal', signal='StatusChanged', args=[cs.CONN_STATUS_CONNECTED, cs.CSR_REQUESTED]) if len(conns) == 1: fun(queue, bus, conns[0], streams[0]) else: fun(queue, bus, conns, streams) except Exception, e: traceback.print_exc() error = e queue.verbose = False if colourer: sys.stdout = colourer.fh d = port.stopListening() # Does the Connection object still exist? for i, conn in enumerate(conns): if not bus.name_has_owner(conn.object.bus_name): # Connection has already been disconnected and destroyed continue try: if conn.GetStatus() == cs.CONN_STATUS_CONNECTED: # Connection is connected, properly disconnect it disconnect_conn(queue, conn, streams[i]) else: # Connection is not connected, call Disconnect() to destroy it conn.Disconnect() except dbus.DBusException, e: pass except Exception, e: traceback.print_exc() error = e try: conn.Disconnect() raise AssertionError("Connection didn't disappear; " "all subsequent tests will probably fail") except dbus.DBusException, e: pass except Exception, e: traceback.print_exc() error = e match_all_signals.remove() if error is None: d.addBoth((lambda *args: reactor.crash())) else: # please ignore the POSIX behind the curtain d.addBoth((lambda *args: os._exit(1))) def exec_test(fun, params=None, protocol=None, timeout=None, authenticator=None, num_instances=1, do_connect=True): reactor.callWhenRunning( exec_test_deferred, fun, params, protocol, timeout, authenticator, num_instances, do_connect) reactor.run() # Useful routines for server-side vCard handling current_vcard = domish.Element(('vcard-temp', 'vCard')) def expect_and_handle_get_vcard(q, stream): get_vcard_event = q.expect('stream-iq', query_ns=ns.VCARD_TEMP, query_name='vCard', iq_type='get') iq = get_vcard_event.stanza vcard = iq.firstChildElement() assert vcard.name == 'vCard', vcard.toXml() # Send back current vCard result = make_result_iq(stream, iq, add_query_node=False) result.addChild(current_vcard) stream.send(result) def expect_and_handle_set_vcard(q, stream, check=None): global current_vcard set_vcard_event = q.expect('stream-iq', query_ns=ns.VCARD_TEMP, query_name='vCard', iq_type='set') iq = set_vcard_event.stanza vcard = iq.firstChildElement() assert vcard.name == 'vCard', vcard.toXml() if check is not None: check(vcard) # Update current vCard current_vcard = vcard stream.send(make_result_iq(stream, iq)) def _elem_add(elem, *children): for child in children: if isinstance(child, domish.Element): elem.addChild(child) elif isinstance(child, unicode): elem.addContent(child) else: raise ValueError( 'invalid child object %r (must be element or unicode)', child) def elem(a, b=None, attrs={}, **kw): r""" >>> elem('foo')().toXml() u'<foo/>' >>> elem('foo', x='1')().toXml() u"<foo x='1'/>" >>> elem('foo', x='1')(u'hello').toXml() u"<foo x='1'>hello</foo>" >>> elem('foo', x='1')(u'hello', ... elem('http://foo.org', 'bar', y='2')(u'bye')).toXml() u"<foo x='1'>hello<bar xmlns='http://foo.org' y='2'>bye</bar></foo>" >>> elem('foo', attrs={'xmlns:bar': 'urn:bar', 'bar:cake': 'yum'})( ... elem('bar:e')(u'i') ... ).toXml() u"<foo xmlns:bar='urn:bar' bar:cake='yum'><bar:e>i</bar:e></foo>" """ class _elem(domish.Element): def __call__(self, *children): _elem_add(self, *children) return self if b is not None: elem = _elem((a, b)) else: elem = _elem((None, a)) # Can't just update kw into attrs, because that *modifies the parameter's # default*. Thanks python. allattrs = {} allattrs.update(kw) allattrs.update(attrs) # First, let's pull namespaces out realattrs = {} for k, v in allattrs.iteritems(): if k.startswith('xmlns:'): abbr = k[len('xmlns:'):] elem.localPrefixes[abbr] = v else: realattrs[k] = v for k, v in realattrs.iteritems(): if k == 'from_': elem['from'] = v else: elem[k] = v return elem def elem_iq(server, type, **kw): class _iq(IQ): def __call__(self, *children): _elem_add(self, *children) return self iq = _iq(server, type) for k, v in kw.iteritems(): if k == 'from_': iq['from'] = v else: iq[k] = v return iq def make_presence(_from, to='test@localhost', type=None, show=None, status=None, caps=None, photo=None): presence = domish.Element((None, 'presence')) presence['from'] = _from presence['to'] = to if type is not None: presence['type'] = type if show is not None: presence.addElement('show', content=show) if status is not None: presence.addElement('status', content=status) if caps is not None: cel = presence.addElement(('http://jabber.org/protocol/caps', 'c')) for key,value in caps.items(): cel[key] = value # <x xmlns="vcard-temp:x:update"><photo>4a1...</photo></x> if photo is not None: x = presence.addElement((ns.VCARD_TEMP_UPDATE, 'x')) x.addElement('photo').addContent(photo) return presence
mlundblad/telepathy-gabble
tests/twisted/gabbletest.py
Python
lgpl-2.1
27,467
# -*- coding: utf-8 -*- # # This file is part of Invenio Demosite. # Copyright (C) 2012, 2013, 2014, 2015 CERN. # # Invenio Demosite is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 2 of the # License, or (at your option) any later version. # # Invenio Demosite is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Invenio; if not, write to the Free Software Foundation, Inc., # 59 Temple Place, Suite 330, Boston, MA 02111-1307, USA. """Workflow for articles.""" from __future__ import absolute_import, print_function from datetime import date from invenio.base.i18n import _, language_list_long from invenio.modules.deposit import fields from invenio.modules.deposit.field_widgets import CKEditorWidget, \ ColumnInput, ExtendedListWidget, ItemWidget, date_widget, plupload_widget from invenio.modules.deposit.filter_utils import sanitize_html, \ strip_prefixes, strip_string from invenio.modules.deposit.form import WebDepositForm from invenio.modules.deposit.types import SimpleRecordDeposition from invenio.modules.deposit.validation_utils import doi_syntax_validator, \ list_length, required_if from werkzeug.local import LocalProxy from wtforms import validators def keywords_autocomplete(form, field, term, limit=50): """Return keywords for autocomplete.""" return [{'value': "Keyword 1"}, {'value': "Keyword 2"}] def missing_doi_warning(dummy_form, field, submit=False, fields=None): """Field processor. Checking for existence of a DOI, and otherwise asking people to provide it. """ if not field.errors and not field.data: field.add_message("Please provide a DOI if possible.", state="warning") raise StopIteration() # # Helpers # def filter_empty_helper(keys=None): """Remove empty elements from a list.""" def _inner(elem): if isinstance(elem, dict): for k, v in elem.items(): if (keys is None or k in keys) and v: return True return False else: return bool(elem) return _inner # # Forms # class AuthorInlineForm(WebDepositForm): """Author inline form.""" name = fields.TextField( placeholder=_("Family name, First name"), widget_classes='form-control', # autocomplete=map_result( # dummy_autocomplete, # authorform_mapper # ), widget=ColumnInput(class_="col-xs-6"), validators=[ required_if( 'affiliation', [lambda x: bool(x.strip()), ], # non-empty message=_( "Creator name is required if you specify affiliation.") ), ], ) affiliation = fields.TextField( placeholder=_("Affiliation"), widget_classes='form-control', widget=ColumnInput(class_="col-xs-4 col-pad-0"), ) class ArticleForm(WebDepositForm): """Article form.""" # # Fields # doi = fields.TextField( label=_("Digital Object Identifier"), placeholder=_("e.g. 10.1234/foo.bar..."), widget_classes="form-control", icon='fa fa-barcode fa-fw', validators=[ doi_syntax_validator, ], filters=[ strip_string, strip_prefixes("doi:", "http://dx.doi.org/"), ], processors=[ missing_doi_warning, ], ) publication_date = fields.Date( label=_('Publication date'), icon='fa fa-calendar fa-fw', description=_('Required. Format: YYYY-MM-DD.'), default=date.today(), validators=[validators.DataRequired()], widget=date_widget, widget_classes='input-sm', export_key='imprint.date', ) title = fields.TextField( label=_('Title'), export_key='title.title', icon='fa fa-book fa-fw', widget_classes="form-control", validators=[validators.DataRequired()], ) authors = fields.DynamicFieldList( fields.FormField( AuthorInlineForm, widget=ExtendedListWidget( item_widget=ItemWidget(), html_tag='div', ), ), label=_('Authors'), add_label=_('Add another author'), icon='fa fa-user fa-fw', min_entries=1, widget_classes='', export_key='authors', validators=[validators.DataRequired(), list_length( min_num=1, element_filter=filter_empty_helper(), )], ) abstract = fields.TextAreaField( label=_("Description"), description=_('Required.'), default='', icon='fa fa-pencil fa-fw', validators=[validators.DataRequired(), ], widget=CKEditorWidget( toolbar=[ ['PasteText', 'PasteFromWord'], ['Bold', 'Italic', 'Strike', '-', 'Subscript', 'Superscript', ], ['NumberedList', 'BulletedList'], ['Undo', 'Redo', '-', 'Find', 'Replace', '-', 'RemoveFormat'], ['SpecialChar', 'ScientificChar'], ['Source'], ['Maximize'], ], disableNativeSpellChecker=False, extraPlugins='scientificchar', removePlugins='elementspath', ), filters=[ sanitize_html(), strip_string, ], export_key='abstract.summary', ) journal_title = fields.TextField( label=_("Journal title"), description=_("Optional."), validators=[ required_if( 'journal_volume', [lambda x: bool(x.strip()), ], # non-empty message=_("Journal title is required if you specify either " "volume, issue or pages.") ), required_if( 'journal_issue', [lambda x: bool(x.strip()), ], # non-empty message=_("Journal title is required if you specify either " "volume, issue or pages.") ), required_if( 'journal_pages', [lambda x: bool(x.strip()), ], # non-empty message=_("Journal title is required if you specify either " "volume, issue or pages.") ), ], export_key='journal_info.title', widget_classes='form-control', ) journal_volume = fields.TextField( label=_("Volume"), description=_("Optional."), export_key='journal_info.volume', widget_classes='form-control', ) journal_issue = fields.TextField( label=_("Issue"), description=_("Optional."), export_key='journal_info.issue', widget_classes='form-control', ) journal_pages = fields.TextField( label=_("Pages"), description=_("Optional."), export_key='journal_info.pagination', widget_classes='form-control', ) language = fields.SelectField( choices=LocalProxy(lambda: language_list_long( enabled_langs_only=False)), default='english', icon='fa fa-globe fa-fw', widget_classes='form-control', ) keywords = fields.DynamicFieldList( fields.TextField( widget_classes='form-control', autocomplete=keywords_autocomplete, widget=ColumnInput(class_="col-xs-10"), ), label=_('Keywords'), add_label=_('Add another keyword'), icon='fa fa-tags fa-fw', widget_classes='', min_entries=1, ) notes = fields.TextAreaField( label=_("Notes"), description=_('Optional.'), default='', validators=[validators.optional()], filters=[ strip_string, ], widget_classes='form-control', icon='fa fa-pencil fa-fw', export_key='comment', ) plupload_file = fields.FileUploadField( label="", widget=plupload_widget, export_key=False ) # # Form configuration # _title = _('New article') _subtitle = _('Instructions: (i) Press "Save" to save your upload for ' 'editing later, as many times you like. (ii) Upload or ' 'remove extra files in the bottom of the form. (iii) When ' 'ready, press "Submit" to finalize your upload.') groups = [ ('Basic Information', ['doi', 'publication_date', 'title', 'authors', 'abstract', ], { 'indication': 'required', }), ('Journal', ['journal_title', 'journal_volume', 'journal_issue', 'journal_pages'], { 'indication': 'required' }), ('Additional information', ['language', 'keywords', 'notes'], { 'indication': 'optional', }) ] field_sizes = { 'plupload_file': 'col-md-12', } # # Workflow # class article(SimpleRecordDeposition): """Article.""" name = _("Article") name_plural = _("Articles") group = _("Articles & Preprints") draft_definitions = { 'default': ArticleForm, } @classmethod def process_sip_metadata(cls, deposition, metadata): """Map keywords to match jsonalchemy configuration.""" metadata['keywords'] = map( lambda x: {'term': x}, metadata['keywords'] )
hachreak/invenio-demosite
invenio_demosite/modules/deposit/workflows/article.py
Python
gpl-2.0
9,880
from attest import Tests, assert_hook from attest.hook import ExpressionEvaluator suite = Tests() @suite.test def eval(): value = 1 + 1 samples = { 'isinstance(value, int)': 'True', 'value == int("2")': "(2 == 2)", 'type(value).__name__': "'int'", 'value == 5 - 3': '(2 == 2)', '{"value": value}': "{'value': 2}", '[v for v in [value]]': '[2]', } for expr, result in samples.iteritems(): expr = ExpressionEvaluator(expr, globals(), locals()) expr.late_visit() ev = repr(expr) assert ev == result assert bool(ev) is True @suite.test def initpy_with_relative_import(): # Ensure that packages with an __init__.py file that use both assert_hook # and relative imports are hooked properly. from . import dummy
dag/attest
attest/tests/hook.py
Python
bsd-2-clause
829
# Copyright 2012 Knowledge Economy Developments Ltd # # Henry Gomersall # heng@kedevelopments.co.uk # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. from pyfftw import FFTW, n_byte_align, n_byte_align_empty import numpy import struct from timeit import Timer import unittest class FFTWBaseTest(unittest.TestCase): def reference_fftn(self, a, axes): return numpy.fft.fftn(a, axes=axes) def __init__(self, *args, **kwargs): super(FFTWBaseTest, self).__init__(*args, **kwargs) self.make_shapes() if not hasattr(self, 'assertRaisesRegex'): self.assertRaisesRegex = self.assertRaisesRegexp def setUp(self): self.input_dtype = numpy.complex64 self.output_dtype = numpy.complex64 self.np_fft_comparison = numpy.fft.fft self.direction = 'FFTW_FORWARD' return def tearDown(self): return def get_input_dtype_alignment(self): return self.input_dtype([]).real.dtype.alignment def get_output_dtype_alignment(self): return self.input_dtype([]).real.dtype.alignment def make_shapes(self): self.input_shapes = { 'small_1d': (16,), '1d': (2048,), '2d': (256, 2048), '3d': (5, 256, 2048)} self.output_shapes = { 'small_1d': (16,), '1d': (2048,), '2d': (256, 2048), '3d': (5, 256, 2048)} def create_test_arrays(self, input_shape, output_shape, axes=None): a = self.input_dtype(numpy.random.randn(*input_shape) +1j*numpy.random.randn(*input_shape)) b = self.output_dtype(numpy.random.randn(*output_shape) +1j*numpy.random.randn(*output_shape)) return a, b def timer_routine(self, pyfftw_callable, numpy_fft_callable, comparison_string='numpy.fft'): N = 100 t = Timer(stmt=pyfftw_callable) t_numpy_fft = Timer(stmt=numpy_fft_callable) t_str = ("%.2f" % (1000.0/N*t.timeit(N)))+' ms' t_numpy_str = ("%.2f" % (1000.0/N*t_numpy_fft.timeit(N)))+' ms' print('One run: '+ t_str + \ ' (versus ' + t_numpy_str + ' for ' + comparison_string + \ ')') def run_validate_fft(self, a, b, axes, fft=None, ifft=None, force_unaligned_data=False, create_array_copies=True, threads=1, flags=('FFTW_ESTIMATE',)): ''' Run a validation of the FFTW routines for the passed pair of arrays, a and b, and the axes argument. a and b are assumed to be the same shape (but not necessarily the same layout in memory). fft and ifft, if passed, should be instantiated FFTW objects. If force_unaligned_data is True, the flag FFTW_UNALIGNED will be passed to the fftw routines. The threads argument runs the validation with multiple threads. flags is passed to the creation of the FFTW object. ''' if create_array_copies: # Don't corrupt the original mutable arrays a = a.copy() b = b.copy() a_orig = a.copy() flags = list(flags) if force_unaligned_data: flags.append('FFTW_UNALIGNED') if fft == None: fft = FFTW(a,b,axes=axes, direction='FFTW_FORWARD', flags=flags, threads=threads) else: fft.update_arrays(a,b) if ifft == None: ifft = FFTW(b, a, axes=axes, direction='FFTW_BACKWARD', flags=flags, threads=threads) else: ifft.update_arrays(b,a) a[:] = a_orig # Test the forward FFT by comparing it to the result from numpy.fft fft.execute() ref_b = self.reference_fftn(a, axes=axes) # This is actually quite a poor relative error, but it still # sometimes fails. I assume that numpy.fft has different internals # to fftw. self.assertTrue(numpy.allclose(b, ref_b, rtol=1e-2, atol=1e-3)) # Test the inverse FFT by comparing the result to the starting # value (which is scaled as per FFTW being unnormalised). ifft.execute() # The scaling is the product of the lengths of the fft along # the axes along which the fft is taken. scaling = numpy.prod(numpy.array(a.shape)[list(axes)]) self.assertEqual(ifft.N, scaling) self.assertEqual(fft.N, scaling) self.assertTrue(numpy.allclose(a/scaling, a_orig, rtol=1e-2, atol=1e-3)) return fft, ifft def run_test_suites(test_suites, run_tests=None): '''From each test case (derived from TestCase) in test_suites, load and run all the test cases within. If run_tests is not None, then it should be a dictionary with keys being the test suite class name, and the values being a list of test methods to run. Alternatively, the key can be 'all' in which case all the test suites will be run with the provided list of test suites. ''' suite = unittest.TestSuite() for test_class in test_suites: tests = unittest.TestLoader().loadTestsFromTestCase(test_class) if run_tests is not None: if test_class.__name__ in run_tests: this_suite_run = set(run_tests[test_class.__name__]) else: this_suite_run = set() if 'all' in run_tests: this_suite_run = this_suite_run.union(run_tests['all']) _tests = [] for each_test in tests: if (each_test.id().split('.')[-1] in this_suite_run): _tests.append(each_test) tests = _tests suite.addTests(tests) unittest.TextTestRunner(verbosity=2).run(suite)
fredRos/pyFFTW
test/test_pyfftw_base.py
Python
gpl-3.0
6,478
#! /usr/bin/env python3 """Iterator for BLAST M8 (BLAST+ output format 6) files Copyright: b6.py monitor iterate over and return entries of a B6/M8 file Copyright (C) 2015 William Brazelton, Alex Hyer This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. """ from collections import OrderedDict import os import sys __author__ = 'Alex Hyer' __email__ = 'theonehyer@gmail.com' __license__ = 'GPLv3' __maintainer__ = 'Alex Hyer' __status__ = 'Production' __version__ = '5.0.1' class FormatError(Exception): """A simple exception that is raised when an input file is formatted incorrectly """ def __init__(self,*args,**kwargs): Exception.__init__(self,*args,**kwargs) class B6Entry: """A simple class to store data from B6/M8 entries and write them Attributes: fs_order (dict): dictionary storing the original order of the format specifiers with names as keys and indices as values query (str): query ID (sequence aligned with) subject (str): subject ID (sequence aligned to) identity (float): percentage of aligned bases between the subject and query that are identical length (int): length of alignment (number of aligned bases) mismatches (int): number of mismatches in the alignment gaps (int): number of gaps in the alignment query_start (int): alignment start position in query sequence query_end (int): alignment end position in query sequence subject_start (int): alignment start position in subject sequence subject_end (int): alignment end position in subject sequence evalue (float): E-value of alignment bitscore (float): Bit score of alignment custom_fs (dict): OrderedDict of non-default format specifiers """ def __init__(self): """Initialize variables to store B6/M8 entry data""" self.fs_order = None self.query = None self.subject = None self.identity = None self.length = None self.mismatches = None self.gaps = None self.query_start = None self.query_end = None self.subject_start = None self.subject_end = None self.evalue = None self.bitscore = None self.custom_fs = None # Store additional format specifiers def write(self, default: bool=False): """Restore B6/M8 entry to original format Args: default (bool): output entry in default BLAST+ B6 format Returns: str: properly formatted string containing the B6/M8 entry """ none_type = type(None) if default: # Default order of format specifiers ordered_vals = [getattr(self, i) for i in ['query', 'subject', 'identity', 'length', 'mismatches', 'gaps', 'query_start', 'query_end', 'subject_start', 'subject_end', 'evalue', 'bitscore']] else: # Original order of B6 entry format specifiers try: ordered_vals = [self.custom_fs[i] if i in self.custom_fs else getattr(self, i) for i in self.fs_order] except TypeError: ordered_vals = [getattr(self, i) for i in self.fs_order] # Format entry for writing fstr = "\t".join(['-' if type(i) == none_type else str(i) for i in ordered_vals]) return '{}{}'.format(fstr, os.linesep) class B6Reader(): """Class to read from B6/M8 files and store lines as B6Entry objects Attributes: handle (file): B6/M8 file handle, can be any iterator so long as it it returns subsequent "lines" of a B6/M8 entry filename (str): name of the B6 file current_line (int): current line in file [default: 0] """ def __init__(self, handle): """Initialize variables to store B6/M8 file information""" self.handle = handle self.filename = handle.name self.current_line = 0 def iterate(self, start_line=None, header: list=['qaccver', 'saccver', 'pident', 'length', 'mismatch', 'gapopen', 'qstart', 'qend', 'sstart', 'send', 'evalue', 'bitscore'], comments: bool=False): """Iterate over B6/M8 file and return B6/M8 entries Args: start_line (str): Next B6/M8 entry. If 'handle' has been partially read and you want to start iterating at the next entry, read the next B6/M8 entry and pass it to this variable when calling b6_iter. See 'Examples' for proper usage. header (list): List of custom format specifiers if B6 file not in default Blast+ 6 format comments (bool): Yields comments if True, else skips lines starting with "#" Yields: B6Entry: class containing all B6/M8 data Examples: The following two examples demonstrate how to use b6_iter. Note: These doctests will not pass, examples are only in doctest format as per convention. bio_utils uses pytests for testing. >>> for entry in b6_iter(open('test.b6out')): ... print(entry.query) # Query ID ... print(entry.subject) # Subject ID ... print(entry.identity) # Percent identity between seqs ... print(entry.mismatches) # Number mismatches in alignment ... print(entry.gaps) # Number gaps in alignment ... print(entry.query_start) # Start of alignment on query ... print(entry.query_end) # End of alignment on query ... print(entry.subject_start) # Start of align on subject ... print(entry.subject_end) # End of alignment on subject ... print(entry.evalue) # E-value of alignment ... print(entry.bitscore) # Bitscore of alignment ... print(entry.write()) # Reconsitituted B6 entry >>> b6_handle = open('test.b6out') >>> next(b6_handle) # Skip first line/entry >>> next_line = next(b6_handle) # Store next entry >>> for entry in b6_iter(b6_handle, start_line=next_line): ... print(entry.query) # Query ID ... print(entry.subject) # Subject ID ... print(entry.identity) # Percent identity between seqs ... print(entry.mismatches) # Number mismatches in alignment ... print(entry.gaps) # Number gaps in alignment ... print(entry.query_start) # Start of alignment on query ... print(entry.query_end) # End of alignment on query ... print(entry.subject_start) # Start of align on subject ... print(entry.subject_end) # End of alignment on subject ... print(entry.evalue) # E-value of alignment ... print(entry.bitscore) # Bitscore of alignment ... print(entry.write()) # Reconstituted B6 entry """ handle = self.handle # Speed tricks: reduces function calls split = str.split strip = str.strip # Map attribute names to default format specifier names def_map = {'query_end': ('qend', str), 'mismatches': ('mismatch', int), 'identity': ('pident', float), 'query': ('qaccver', str), 'query_start': ('qstart', int), 'subject_start': ('sstart', int), 'bitscore': ('bitscore', float), 'evalue': ('evalue', float), 'gaps': ('gapopen', int), 'subject_end': ('send', int), 'length': ('length', int), 'subject': ('saccver', str) } def_map_rev = {j[0]: k for k, j in def_map.items()} def_specs = list(def_map_rev.keys()) uheader = list(OrderedDict.fromkeys(header)) spec_order = [def_map_rev[i] if i in def_map_rev else i \ for i in uheader] # Store order of format specifiers h = {} for index, specifier in enumerate(header): if specifier not in h: # Ignor duplicate columns h[specifier] = index # Begin reading text if start_line is None: line = next(handle) # Read first B6/M8 entry else: line = start_line # Set header to given header # Check if input is text or bytestream if (isinstance(line, bytes)): def next_line(i): return next(i).decode('utf-8') line = strip(line.decode('utf-8')) else: next_line = next line = strip(line) # Manual 'for' loop isn't needed to read the file properly and quickly, # unlike fasta_iter and fastq_iter, but it is necessary begin iterating # partway through a file when the user gives a starting line. try: # Manually construct a for loop to improve speed by using 'next' while True: # Loop until StopIteration Exception raised self.current_line += 1 data = B6Entry() data.fs_order = spec_order # All entries store original order if line.startswith('#') and not comments: line = strip(next_line(handle)) continue elif line.startswith('#') and comments: yield line line = strip(next_line(handle)) continue split_line = split(line, '\t') # Replace empty values with None spec_values = [None if i == '-' else i for i in split_line] # Add default specifiers def_attrs = data.__dict__.keys() for attr in def_attrs: try: def_spec, spec_type = def_map[attr] except KeyError: continue try: value = spec_values[h[def_spec]] except KeyError: # Custom format, no value continue except IndexError: current_line = self.current_line raise FormatError("line {!s}: the number of columns " "is less than the number of specifiers"\ .format(current_line)) if type(value) != type(None): try: value = spec_type(value) except ValueError: current_line = self.current_line raise FormatError("line {!s}: {} is of wrong type"\ .format(current_line, def_spec)) setattr(data, attr, value) # Add non-default specifiers to custom_fs attribute custom_specs = [i for i in sorted(h, key=h.get, reverse=False) \ if i not in def_specs] if custom_specs: data.custom_fs = OrderedDict() for key in custom_specs: try: value = spec_values[h[key]] except IndexError: current_line = self.current_line raise FormatError("line {!s}: the number of " "columns is less than the number of " "specifiers".format(current_line)) data.custom_fs[key] = value line = strip(next_line(handle)) # Raises StopIteration at EOF yield data except StopIteration: # Yield last B6/M8 entry yield data
Brazelton-Lab/bio_utils
bio_utils/iterators/b6.py
Python
gpl-3.0
12,735
# # Copyright 2001 - 2006 Ludek Smid [http://www.ospace.net/] # # This file is part of IGE - Outer Space. # # IGE - Outer Space is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # IGE - Outer Space is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with IGE - Outer Space; if not, write to the Free Software # Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA # from ige.ospace.Const import * from ige.IDataHolder import makeIDataHolder ## General turnsPerDay = 24 rotationMod = 384.0 playerTimeout = 60 * 60 * 24 * 21 # 21 days novicePlayerTimeout = 60 * 60 * 24 * 7 # 7 days messageTimeout = 60 * 60 * 24 * 14 # 14 days ## New player startingPopulation = 9000 startingBio = 1000 startingMin = 1000 startingEn = 1000 startingScannerPwr = 100 ## Production maxProdQueueLen = 10 buildOnSamePlanetMod = 1 buildOnAnotherPlanetMod = 2 unusedProdMod = 0.75 ## Environment envInterval = 1000 envAutoMod = 10.0 envMax = 200 envSelfUpgradeChance = {"H": 5, "C": 1, "B": 500} # in ten thousandths (10 000) planetSpec = {} planetSpec[u'A'] = makeIDataHolder( minBio = 0, maxBio = 0, upgradeTo = None, downgradeTo = None, ) planetSpec[u'G'] = makeIDataHolder( minBio = 0, maxBio = 0, upgradeTo = None, downgradeTo = None, ) planetSpec[u'C'] = makeIDataHolder( minBio = 0, maxBio = 6, upgradeTo = u'D', upgradeEnReqs = (5, 180), downgradeTo = None, ) planetSpec[u'R'] = makeIDataHolder( minBio = 0, maxBio = 6, upgradeTo = u'D', upgradeEnReqs = (5, 180), downgradeTo = None, ) planetSpec[u'D'] = makeIDataHolder( minBio = 6, maxBio = 12, upgradeTo = u'H', upgradeEnReqs = (25, 150), downgradeTo = u'R', ) planetSpec[u'H'] = makeIDataHolder( minBio = 12, maxBio = 25, upgradeTo = u'M', upgradeEnReqs = (50, 125), downgradeTo = u'D', ) planetSpec[u'M'] = makeIDataHolder( minBio = 25, maxBio = 75, upgradeTo = u'E', upgradeEnReqs = (50, 100), downgradeTo = u'H', ) planetSpec[u'E'] = makeIDataHolder( minBio = 75, maxBio = 125, upgradeTo = u"I", upgradeEnReqs = (50, 100), downgradeTo = u'M', ) planetSpec[u"I"] = makeIDataHolder( # gaia minBio = 125, maxBio = 200, upgradeTo = None, downgradeTo = u"E", ) ## New colony settings colonyMinBio = 600 colonyMinMin = 600 colonyMinEn = 600 ## Storage popPerSlot = 0 bioPerSlot = 0 minPerSlot = 0 enPerSlot = 0 popBaseStor = 4800 bioBaseStor = 4800 minBaseStor = 4800 enBaseStor = 4800 autoMinStorTurns = 6 autoReqStorTurns = 1 maxPopReserve = 1.125 tlPopReserve = 250 ## Resources stratResRate = turnsPerDay * 6 ## Population popGrowthRate = 0.02 popMinGrowthRate = int(1000 * popGrowthRate) popDieRate = 0.1 popMinDieRate = 100 popKillMod = 0.25 popSlotKillMod = 5 # how many people per 1 DMG get killed when slot is hit popSlotHP = 100 # HP of habitable structures on slot (where people live) ## Research maxRsrchQueueLen = 10 techBaseImprovement = 1 techMaxImprovement = 5 techImprCostMod = {1:480, 2:480, 3:720, 4:960, 5:1200, 6: 1440, 7: 1680} #per level sciPtsPerCitizen = {1: 0, 2: 0.00075, 3: 0.00150, 4: 0.00175, 5: 0.00200, 6: 0.002125, 7: 0.00225, 99: 0} #per level techImprEff = {1:0.750, 2:0.875, 3:1.000, 4:1.125, 5:1.250} #per sublevel #maxSciPtsTL = {1:100, 2:200, 3:300, 4:400, 5:500, 6:600, 7:700} #sciPtsStepFraction = 0.25 ## Scanner maxSignature = 100 scannerMinPwr = 1 level1InfoScanPwr = 1000 level2InfoScanPwr = 1200 level3InfoScanPwr = 1400 level4InfoScanPwr = 1600 maxScanPwr = 200000 mapForgetScanPwr = 0.94 partnerScanPwr = 300000 ## Fleets maxCmdQueueLen = 10 signatureBase = 1.10 operProdRatio = 0.001 combatRetreatWait = 3 starGateDamage = 0.2 # damage for 100% speed boost (double for 200%, etc...) shipDecayRatio = 0.04 maxDamageAbsorb = 5 # max absorbed damage for tech "damageAbsorb" property. # max seq_mod equipments of equipType; anything not in list is unlimited maxEquipType = { 'ECM' : 1, # +Missile DEF 'Combat Bonuses' : 1, # +%ATT, +%DEF 'Combat Modifiers' : 1, # +ATT, +DEF 'Shields' : 1, # not hardshields 'Stealth' : 1, 'Auto Repair' : 1, } ## Buildings repairRatio = 0.02 repairRunningRatio = 0.01 decayRatio = 0.02 storCapacityOfOfflineStruct = 1.0 plShieldRegen = 0.05 #regen rate of planetary shield ## Diplomacy baseRelationChange = -5 relLostWhenAttacked = -1000000 defaultRelation = REL_NEUTRAL contactTimeout = 6 * turnsPerDay voteForImpPeriod = 6 * turnsPerDay ratioNeededForImp = 0.6666 pactDescrs = {} pactDescrs[PACT_ALLOW_CIVILIAN_SHIPS] = makeIDataHolder( targetRel = 500, relChng = 10, validityInterval = (0, 10000), ) pactDescrs[PACT_ALLOW_MILITARY_SHIPS] = makeIDataHolder( targetRel = 750, relChng = 8, validityInterval = (0, 10000), ) pactDescrs[PACT_ALLOW_TANKING] = makeIDataHolder( targetRel = 750, relChng = 7, validityInterval = (0, 10000), ) pactDescrs[PACT_MINOR_CP_COOP] = makeIDataHolder( targetRel = 1000, relChng = 6, effectivity = 0.05, validityInterval = (625, 10000), ) pactDescrs[PACT_MAJOR_CP_COOP] = makeIDataHolder( targetRel = 1000, relChng = 1, effectivity = 0.05, validityInterval = (875, 10000), ) pactDescrs[PACT_SHARE_SCANNER] = makeIDataHolder( targetRel = 1000, relChng = 1, validityInterval = (625, 10000), ) pactDescrs[PACT_MINOR_SCI_COOP] = makeIDataHolder( targetRel = 750, relChng = 1, effectivity = 0.05, validityInterval = (625, 10000), ) pactDescrs[PACT_MAJOR_SCI_COOP] = makeIDataHolder( targetRel = 1000, relChng = 1, effectivity = 0.05, validityInterval = (875, 10000), ) ## Morale baseGovPwr = 50000 maxMorale = 100.0 minMoraleTrgt = 30.0 revoltThr = 25.0 moraleChngPerc = 0.03 moraleHighPopPenalty = 2.0 moraleBasePop = 10000 moraleLowPop = 5000 moraleLowPopBonus = 40.0 moraleLostWhenSurrender = 0.0 moraleLostNoFood = 1.0 moraleModPlHit = 96.0 # how many morale point per 1 per cent of damage moralePerPointChance = 5.0 # for every point below revoltThr % chance for revolt moraleProdStep = 10 moraleProdBonus = [-0.875, -0.75, -0.625, -0.50, -0.375, -0.25, -0.125, 0.0, 0.0, 0.125, 0.25] ## Revolt revoltDestrBio = 0.05 revoltDestrMin = 0.05 revoltDestrEn = 0.05 revoltPenalty = 0.75 ## Messages messageMaxAge = turnsPerDay * 3 ## Asteroid asteroidPerHPBioMod = - 0.01 asteroidPerHPMinMod = + 0.001 asteroidGenerPerc = 0.001 asteroidMinPlMinAbund = 10 asteroidModPwr = 2.0 asteroidTargetInSystem = 0.2 asteroidMinHP = 100 asteroidMaxHP = 1000 asteroidMinSpeed = 2.0 asteroidMaxSpeed = 4.0 asteroidMisDef = 1 asteroidDef = 4 asteroidAttack = 4 asteroidImpactDelay = 6 ## Projects projECOINIT3PlBio = 1 ## Ships shipImprovementMod = 1.05 shipMaxImprovements = 5 shipMaxDesigns = 40 shipExpToLevel = {0:1, 1:2, 2:2, 3:3, 4:3, 5:3, 6:3, 7:4, 8:4, 9:4, 10:4, 11:4, 12:4, 13:4, 15:5} shipDefLevel = 5 shipLevelEff = {1:0.50, 2:0.75, 3:1.00, 4:1.25, 5:1.50} shipBaseExpMod = 20 shipBaseExp = {0:10, 1:20, 2:40, 3:80, 4:160} shipTargetPerc = [25, 50, 90, 100] shipMinUpgrade = 120 shipUpgradeMod = 1.375 shipUpgradePts = [1, 3, 10] weaponDmgDegrade = [1.0, 0.5, 0.25, 0.125] ## EMR emrMinDuration = 36 emrMaxDuration = 60 emrPeriod = 576 emrSeasons = [None, None, None, None] emrSeasons[0] = makeIDataHolder( name = "spring", startTime = 0, endTime = 143, emrLevelMin = 0.75, emrLevelMax = 1.25, ) emrSeasons[1] = makeIDataHolder( name = "summer", startTime = 144, endTime = 287, emrLevelMin = 0.50, emrLevelMax = 1.00, ) emrSeasons[2] = makeIDataHolder( name = "fall", startTime = 287, endTime = 431, emrLevelMin = 0.50, emrLevelMax = 1.50, ) emrSeasons[3] = makeIDataHolder( name = "winter", startTime = 432, endTime = 575, emrLevelMin = 1.00, emrLevelMax = 1.50, ) ## General pirateInfluenceRange = 7.5 # in parsecs pirateGovPwr = int(500000 * 1.25) ## Fame pirateGainFamePropability = lambda d: 2 - d * 0.2 pirateLoseFameProbability = lambda d: 1 - (15 - d) * 0.2 pirateCaptureInRangeFame = 1 pirateSurvivalFame = 1 pirateCaptureOutOfRangeFame = -1 ## Colonization pirateColonyCostMod = 1.5 # base multiplier - all other multipliers are multiplied by this pirateTL3StratResColonyCostMod = 0.25 piratePlayerZoneCostMod = 1.25 pirateColonyFameZoneCost = lambda d: min(d * 0.1 + pirateTL3StratResColonyCostMod,1) pirateColonyPlayerZoneCost = lambda d: piratePlayerZoneCostMod + (d - 15) * 0.01 * piratePlayerZoneCostMod ## Techs pirateCanStealImprovements = 3 pirateGrantHSE = 60*24*3600 #60 days; AI only pirateGrantASSEM = 105*24*3600 #105 days; AI only pirateGrantCOND = 105*24*3600 #105 days; AI only ## Timed events (not implemented) pirateTimerMod = 3*24*3600 # +/- up to 3 days for each grant pirateTimerRum = 20*24*3600 #20 days; grant Brewery, Rum strategic resource, and Drunken Factory (110% Pirate Prison; requires Rum) pirateTimerEnslavement = 60*24*3600 #60 days; grant Prison pirateTimerEDENStructure = 120*24*3600 #120 days; grant EDEN Factory (you have discovered a prototype factory...; 135% Pirate Prison; requires Rum) pirateTimerBerserk = 150*24*3600 #150 days; grant "Berserk" ship module (major defense penalty; major ATT bonus; requires Rum) pirateTimerSlaveMine = 180*24*3600 #180 days; grant Slave Mine (mining facility with hamster wheel for power; 160% Pirate Prison; requires Rum) ## Bonuses galLeaderBonus = 0.05 galImperatorBonus = 0.10 ## Combat combatStructureHitMod = 0.75 combatShipHitMod = 0.75 combatHitXferMod = 3.00 combatStructDefense = 1
mozts2005/OuterSpace
server/res/rules/standard/rules.py
Python
gpl-2.0
10,205
#!/usr/bin/env python # -*- coding: utf-8 -*- """ video decoding for the AR.Drone. parts of code from Bastian Venthur, Jean-Baptiste Passot, Florian Lacrampe. """ # < imports >-------------------------------------------------------------------------------------- import array import cProfile import datetime import logging import struct import sys try: import psyco except ImportError: pass # print "Please install psyco for better video decoding performance." import bitReader as bitReader # < variáveis globais >---------------------------------------------------------------------------- # logging level w_logLvl = logging.ERROR # from zig-zag back to normal wa_ZIG_ZAG_POSITIONS = array.array ( 'B', ( 0, 1, 8, 16, 9, 2, 3, 10, 17, 24, 32, 25, 18, 11, 4, 5, 12, 19, 26, 33, 40, 48, 41, 34, 27, 20, 13, 6, 7, 14, 21, 28, 35, 42, 49, 56, 57, 50, 43, 36, 29, 22, 15, 23, 30, 37, 44, 51, 58, 59, 52, 45, 38, 31, 39, 46, 53, 60, 61, 54, 47, 55, 62, 63 )) # inverse quantization wa_IQUANT_TAB = array.array ( 'B', ( 3, 5, 7, 9, 11, 13, 15, 17, 5, 7, 9, 11, 13, 15, 17, 19, 7, 9, 11, 13, 15, 17, 19, 21, 9, 11, 13, 15, 17, 19, 21, 23, 11, 13, 15, 17, 19, 21, 23, 25, 13, 15, 17, 19, 21, 23, 25, 27, 15, 17, 19, 21, 23, 25, 27, 29, 17, 19, 21, 23, 25, 27, 29, 31 )) # upscaling the 8x8 b- and r-blocks to 16x16 wa_SCALE_TAB = array.array ( 'B', ( 0, 0, 1, 1, 2, 2, 3, 3, 0, 0, 1, 1, 2, 2, 3, 3, 8, 8, 9, 9, 10, 10, 11, 11, 8, 8, 9, 9, 10, 10, 11, 11, 16, 16, 17, 17, 18, 18, 19, 19, 16, 16, 17, 17, 18, 18, 19, 19, 24, 24, 25, 25, 26, 26, 27, 27, 24, 24, 25, 25, 26, 26, 27, 27, 4, 4, 5, 5, 6, 6, 7, 7, 4, 4, 5, 5, 6, 6, 7, 7, 12, 12, 13, 13, 14, 14, 15, 15, 12, 12, 13, 13, 14, 14, 15, 15, 20, 20, 21, 21, 22, 22, 23, 23, 20, 20, 21, 21, 22, 22, 23, 23, 28, 28, 29, 29, 30, 30, 31, 31, 28, 28, 29, 29, 30, 30, 31, 31, 32, 32, 33, 33, 34, 34, 35, 35, 32, 32, 33, 33, 34, 34, 35, 35, 40, 40, 41, 41, 42, 42, 43, 43, 40, 40, 41, 41, 42, 42, 43, 43, 48, 48, 49, 49, 50, 50, 51, 51, 48, 48, 49, 49, 50, 50, 51, 51, 56, 56, 57, 57, 58, 58, 59, 59, 56, 56, 57, 57, 58, 58, 59, 59, 36, 36, 37, 37, 38, 38, 39, 39, 36, 36, 37, 37, 38, 38, 39, 39, 44, 44, 45, 45, 46, 46, 47, 47, 44, 44, 45, 45, 46, 46, 47, 47, 52, 52, 53, 53, 54, 54, 55, 55, 52, 52, 53, 53, 54, 54, 55, 55, 60, 60, 61, 61, 62, 62, 63, 63, 60, 60, 61, 61, 62, 62, 63, 63 )) # count leading zeros look up table wa_CLZLUT = array.array ( 'B', ( 8, 7, 6, 6, 5, 5, 5, 5, 4, 4, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 )) # map pixels from four 8x8 blocks to one 16x16 wa_MB_TO_GOB_MAP = array.array ( 'B', [ 0, 1, 2, 3, 4, 5, 6, 7, 16, 17, 18, 19, 20, 21, 22, 23, 32, 33, 34, 35, 36, 37, 38, 39, 48, 49, 50, 51, 52, 53, 54, 55, 64, 65, 66, 67, 68, 69, 70, 71, 80, 81, 82, 83, 84, 85, 86, 87, 96, 97, 98, 99, 100, 101, 102, 103, 112, 113, 114, 115, 116, 117, 118, 119, 8, 9, 10, 11, 12, 13, 14, 15, 24, 25, 26, 27, 28, 29, 30, 31, 40, 41, 42, 43, 44, 45, 46, 47, 56, 57, 58, 59, 60, 61, 62, 63, 72, 73, 74, 75, 76, 77, 78, 79, 88, 89, 90, 91, 92, 93, 94, 95, 104, 105, 106, 107, 108, 109, 110, 111, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 144, 145, 146, 147, 148, 149, 150, 151, 160, 161, 162, 163, 164, 165, 166, 167, 176, 177, 178, 179, 180, 181, 182, 183, 192, 193, 194, 195, 196, 197, 198, 199, 208, 209, 210, 211, 212, 213, 214, 215, 224, 225, 226, 227, 228, 229, 230, 231, 240, 241, 242, 243, 244, 245, 246, 247, 136, 137, 138, 139, 140, 141, 142, 143, 152, 153, 154, 155, 156, 157, 158, 159, 168, 169, 170, 171, 172, 173, 174, 175, 184, 185, 186, 187, 188, 189, 190, 191, 200, 201, 202, 203, 204, 205, 206, 207, 216, 217, 218, 219, 220, 221, 222, 223, 232, 233, 234, 235, 236, 237, 238, 239, 248, 249, 250, 251, 252, 253, 254, 255 ] ) wa_MB_ROW_MAP = array.array ( 'B', [ i / 16 for i in wa_MB_TO_GOB_MAP ] ) wa_MB_COL_MAP = array.array ( 'B', [ i % 16 for i in wa_MB_TO_GOB_MAP ] ) # an array of zeros. It is much faster to take the zeros from here than to # generate a new list when needed. wa_ZEROS = array.array ( 'i', [ 0 for i in xrange ( 256 ) ] ) # constants needed for the inverse discrete cosine transform. wi_FIX_0_298631336 = 2446 wi_FIX_0_390180644 = 3196 wi_FIX_0_541196100 = 4433 wi_FIX_0_765366865 = 6270 wi_FIX_0_899976223 = 7373 wi_FIX_1_175875602 = 9633 wi_FIX_1_501321110 = 12299 wi_FIX_1_847759065 = 15137 wi_FIX_1_961570560 = 16069 wi_FIX_2_053119869 = 16819 wi_FIX_2_562915447 = 20995 wi_FIX_3_072711026 = 25172 wi_CONST_BITS = 13 wi_PASS1_BITS = 1 wi_F1 = wi_CONST_BITS - wi_PASS1_BITS - 1 wi_F2 = wi_CONST_BITS - wi_PASS1_BITS wi_F3 = wi_CONST_BITS + wi_PASS1_BITS + 3 # tuning parameter for get_block wi_TRIES = 16 wi_MASK = 2 ** ( wi_TRIES * 32 ) - 1 wi_SHIFT = 32 * ( wi_TRIES - 1 ) # ------------------------------------------------------------------------------------------------- # _first_half # ------------------------------------------------------------------------------------------------- def _first_half ( f_data ): """ helper function used to precompute the zero values in a 12 bit datum. """ # sherlock logger # l_log = logging.getLogger ( "_first_half" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) # f_data has to be 12 bits wide li_stream_len = 0 # count the zeros li_zero_count = wa_CLZLUT [ f_data >> 4 ] ; f_data = ( f_data << ( li_zero_count + 1 )) & 0b111111111111 # 0xfff li_stream_len += li_zero_count + 1 # get number of remaining bits to read li_to_read = 0 if li_zero_count <= 1 else li_zero_count - 1 li_additional = f_data >> ( 12 - li_to_read ) f_data = ( f_data << li_to_read ) & 0b111111111111 # 0xfff li_stream_len += li_to_read # add as many zeros to out_list as indicated by li_additional bits # if li_zero_count is 0, tmp = 0 else the 1 merged with li_additional bits li_tmp = 0 if ( 0 == li_zero_count ) else (( 1 << li_to_read ) | li_additional ) # sherlock logger # l_log.debug ( "<<" ) return [ li_stream_len, li_tmp ] # ------------------------------------------------------------------------------------------------- # _second_half # ------------------------------------------------------------------------------------------------- def _second_half ( f_data ): """ helper function to precompute the nonzeror values in a 15 bit datum. """ # sherlock logger # l_log = logging.getLogger ( "_second_half" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) # f_data has to be 15 bits wide li_stream_len = 0 li_zero_count = wa_CLZLUT [ f_data >> 7 ] f_data = ( f_data << ( li_zero_count + 1 )) & 0b111111111111111 # 0x7fff li_stream_len += li_zero_count + 1 # 01 == EOB lv_eob = False if li_zero_count == 1: lv_eob = True # sherlock logger # l_log.debug ( "<< (E01)" ) return [ li_stream_len, None, lv_eob ] # get number of remaining bits to read li_to_read = 0 if li_zero_count == 0 else li_zero_count - 1 li_additional = f_data >> ( 15 - li_to_read ) f_data = ( f_data << li_to_read ) & 0b111111111111111 # 0x7fff li_stream_len += li_to_read li_tmp = ( 1 << li_to_read ) | li_additional # get one more bit for the sign li_tmp = -li_tmp if f_data >> ( 15 - 1 ) else li_tmp li_tmp = int ( li_tmp ) li_stream_len += 1 # sherlock logger # l_log.debug ( "<<" ) return [ li_stream_len, li_tmp, lv_eob ] # precompute all 12 and 15 bit values for the entropy decoding process wai_FH = [ _first_half ( li_i ) for li_i in xrange ( 2 ** 12 ) ] wai_SH = [ _second_half ( li_i ) for li_i in xrange ( 2 ** 15 ) ] # ------------------------------------------------------------------------------------------------- # get_block # ------------------------------------------------------------------------------------------------- def get_block ( f_bitreader, fv_has_coeff ): """ read a 8x8 block from the data stream. takes care of the huffman-, RLE, zig-zag and idct and returns a list of 64 ints. """ # sherlock logger # l_log = logging.getLogger ( "get_block" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) # read the first 10 bits in a 16 bit datum la_out_list = wa_ZEROS [ 0:64 ] la_out_list [ 0 ] = int ( f_bitreader.read ( 10 )) * wa_IQUANT_TAB [ 0 ] if ( not fv_has_coeff ): # sherlock logger # l_log.debug ( "<< (E01)" ) return inverse_dct ( la_out_list ) li_i = 1 while ( True ): _ = f_bitreader.read ( 32 * wi_TRIES, False ) li_stream_len = 0 ####################################################################### for li_j in xrange ( wi_TRIES ): l_data = ( _ << li_stream_len ) & wi_MASK l_data >>= wi_SHIFT li_l, li_tmp = wai_FH [ l_data >> 20 ] li_stream_len += li_l l_data = ( l_data << li_l ) & 0xffffffff li_i += li_tmp li_l, li_tmp, lv_eob = wai_SH [ l_data >> 17 ] li_stream_len += li_l if ( lv_eob ): f_bitreader.read ( li_stream_len ) # sherlock logger # l_log.debug ( "<< (E02)" ) return inverse_dct ( la_out_list ) li_j = wa_ZIG_ZAG_POSITIONS [ li_i ] la_out_list [ li_j ] = li_tmp * wa_IQUANT_TAB [ li_j ] li_i += 1 ####################################################################### f_bitreader.read ( li_stream_len ) # sherlock logger # l_log.debug ( "<<" ) return inverse_dct ( la_out_list ) # ------------------------------------------------------------------------------------------------- # get_gob # ------------------------------------------------------------------------------------------------- def get_gob ( f_bitreader, f_picture, f_slicenr, f_width ): """ read a group of blocks. does not return data, the picture parameter is modified in place instead. """ # sherlock logger # l_log = logging.getLogger ( "get_gob" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) # the first gob has a special header if ( f_slicenr > 0 ): f_bitreader.align () li_gobsc = f_bitreader.read ( 22 ) if ( 0b0000000000000000111111 == li_gobsc ): print "weeeee" # sherlock logger # l_log.debug ( "<< (E01)" ) return False elif ( not ( li_gobsc & 0b0000000000000000100000 ) or # 0x20 ( li_gobsc & 0b1111111111111111000000 )): # 0x3fffc0 print "Got wrong GOBSC, aborting.", bin ( li_gobsc ) # sherlock logger # l_log.debug ( "<< (E02)" ) return False _ = f_bitreader.read ( 5 ) li_offset = f_slicenr * 16 * f_width for li_i in xrange ( f_width / 16 ): get_mb ( f_bitreader, f_picture, f_width, li_offset + 16 * li_i ) # sherlock logger # l_log.debug ( "<<" ) # ------------------------------------------------------------------------------------------------- # get_mb # ------------------------------------------------------------------------------------------------- def get_mb ( f_bitreader, f_picture, f_width, f_offset ): """ get macro block. does not return data but modifies the picture parameter in place. """ # sherlock logger # l_log = logging.getLogger ( "get_mb" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) li_mbc = f_bitreader.read ( 1 ) if ( 0 == li_mbc ): li_mbdesc = f_bitreader.read ( 8 ) # assert ( li_mbdesc >> 7 & 1 ) if ( li_mbdesc >> 6 & 1 ): li_mbdiff = f_bitreader.read ( 2 ) li_y = get_block ( f_bitreader, li_mbdesc & 1 ) li_y.extend ( get_block ( f_bitreader, li_mbdesc >> 1 & 1 )) li_y.extend ( get_block ( f_bitreader, li_mbdesc >> 2 & 1 )) li_y.extend ( get_block ( f_bitreader, li_mbdesc >> 3 & 1 )) la_cb = get_block ( f_bitreader, li_mbdesc >> 4 & 1 ) la_cr = get_block ( f_bitreader, li_mbdesc >> 5 & 1 ) # ycbcr to rgb for li_i in xrange ( 256 ): li_j = wa_SCALE_TAB [ li_i ] li_Y = li_y [ li_i ] - 16 li_B = la_cb [ li_j ] - 128 li_R = la_cr [ li_j ] - 128 li_r = ( 298 * li_Y + 409 * li_R + 128 ) >> 8 li_g = ( 298 * li_Y - 100 * li_B - 208 * li_R + 128 ) >> 8 li_b = ( 298 * li_Y + 516 * li_B + 128 ) >> 8 li_r = 0 if ( li_r < 0 ) else li_r li_r = 255 if ( li_r > 255 ) else li_r li_g = 0 if ( li_g < 0 ) else li_g li_g = 255 if ( li_g > 255 ) else li_g li_b = 0 if ( li_b < 0 ) else li_b li_b = 255 if ( li_b > 255 ) else li_b # re-order the pixels li_row = wa_MB_ROW_MAP [ li_i ] li_col = wa_MB_COL_MAP [ li_i ] f_picture [ f_offset + li_row * f_width + li_col ] = ''.join ((chr ( li_r ), chr ( li_g ), chr ( li_b ))) else: print "mbc was not zero" # sherlock logger # l_log.debug ( "<<" ) # ------------------------------------------------------------------------------------------------- # get_pheader # ------------------------------------------------------------------------------------------------- def get_pheader ( f_bitreader ): """ read the picture header. returns the width and height of the image. """ # sherlock logger # l_log = logging.getLogger ( "get_pheader" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) f_bitreader.align () li_psc = f_bitreader.read ( 22 ) # assert ( 0b0000000000000000100000 == li_psc ) li_pformat = f_bitreader.read ( 2 ) # assert ( 0b00 != li_pformat ) if ( 1 == li_pformat ): # CIF li_width, li_height = 88, 72 else: # VGA li_width, li_height = 160, 120 li_presolution = f_bitreader.read ( 3 ) # assert ( 0b000 != li_presolution ) # double resolution presolution - 1 times li_width = li_width << ( li_presolution - 1 ) li_height = li_height << ( li_presolution - 1 ) # l_log.debug ( "width: %d / height: %d" % ( li_width, li_height )) li_ptype = f_bitreader.read ( 3 ) li_pquant = f_bitreader.read ( 5 ) li_pframe = f_bitreader.read ( 32 ) # sherlock logger # l_log.debug ( "<<" ) return li_width, li_height # ------------------------------------------------------------------------------------------------- # inverse_dct # ------------------------------------------------------------------------------------------------- def inverse_dct ( f_block ): """ inverse discrete cosine transform. """ # sherlock logger # l_log = logging.getLogger ( "inverse_dct" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) la_workspace = wa_ZEROS [ 0:64 ] la_data = wa_ZEROS [ 0:64 ] for li_pointer in xrange ( 8 ): if (( 0 == f_block [ li_pointer + 8 ] ) and ( 0 == f_block [ li_pointer + 16 ] ) and ( 0 == f_block [ li_pointer + 24 ] ) and ( 0 == f_block [ li_pointer + 32 ] ) and ( 0 == f_block [ li_pointer + 40 ] ) and ( 0 == f_block [ li_pointer + 48 ] ) and ( 0 == f_block [ li_pointer + 56 ] )): li_dcval = f_block [ li_pointer ] << wi_PASS1_BITS for li_i in xrange ( 8 ): la_workspace [ li_pointer + li_i * 8 ] = li_dcval continue li_z2 = f_block [ li_pointer + 16 ] li_z3 = f_block [ li_pointer + 48 ] li_z1 = ( li_z2 + li_z3 ) * wi_FIX_0_541196100 li_tmp2 = li_z1 + li_z3 * -wi_FIX_1_847759065 li_tmp3 = li_z1 + li_z2 * wi_FIX_0_765366865 li_z2 = f_block [ li_pointer ] li_z3 = f_block [ li_pointer + 32 ] li_tmp0 = ( li_z2 + li_z3 ) << wi_CONST_BITS li_tmp1 = ( li_z2 - li_z3 ) << wi_CONST_BITS li_tmp10 = li_tmp0 + li_tmp3 li_tmp13 = li_tmp0 - li_tmp3 li_tmp11 = li_tmp1 + li_tmp2 li_tmp12 = li_tmp1 - li_tmp2 li_tmp0 = f_block [ li_pointer + 56 ] li_tmp1 = f_block [ li_pointer + 40 ] li_tmp2 = f_block [ li_pointer + 24 ] li_tmp3 = f_block [ li_pointer + 8 ] li_z1 = li_tmp0 + li_tmp3 li_z2 = li_tmp1 + li_tmp2 li_z3 = li_tmp0 + li_tmp2 li_z4 = li_tmp1 + li_tmp3 li_z5 = ( li_z3 + li_z4 ) * wi_FIX_1_175875602 li_tmp0 *= wi_FIX_0_298631336 li_tmp1 *= wi_FIX_2_053119869 li_tmp2 *= wi_FIX_3_072711026 li_tmp3 *= wi_FIX_1_501321110 li_z1 *= -wi_FIX_0_899976223 li_z2 *= -wi_FIX_2_562915447 li_z3 *= -wi_FIX_1_961570560 li_z4 *= -wi_FIX_0_390180644 li_z3 += li_z5 li_z4 += li_z5 li_tmp0 += li_z1 + li_z3 li_tmp1 += li_z2 + li_z4 li_tmp2 += li_z2 + li_z3 li_tmp3 += li_z1 + li_z4 la_workspace [ li_pointer + 0 ] = (( li_tmp10 + li_tmp3 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 56 ] = (( li_tmp10 - li_tmp3 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 8 ] = (( li_tmp11 + li_tmp2 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 48 ] = (( li_tmp11 - li_tmp2 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 16 ] = (( li_tmp12 + li_tmp1 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 40 ] = (( li_tmp12 - li_tmp1 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 24 ] = (( li_tmp13 + li_tmp0 + ( 1 << wi_F1 )) >> wi_F2 ) la_workspace [ li_pointer + 32 ] = (( li_tmp13 - li_tmp0 + ( 1 << wi_F1 )) >> wi_F2 ) for li_pointer in xrange ( 0, 64, 8 ): li_z2 = la_workspace [ li_pointer + 2 ] li_z3 = la_workspace [ li_pointer + 6 ] li_z1 = ( li_z2 + li_z3 ) * wi_FIX_0_541196100 li_tmp2 = li_z1 + li_z3 * -wi_FIX_1_847759065 li_tmp3 = li_z1 + li_z2 * wi_FIX_0_765366865 li_tmp0 = ( la_workspace [ li_pointer ] + la_workspace [ li_pointer + 4 ] ) << wi_CONST_BITS li_tmp1 = ( la_workspace [ li_pointer ] - la_workspace [ li_pointer + 4 ] ) << wi_CONST_BITS li_tmp10 = li_tmp0 + li_tmp3 li_tmp13 = li_tmp0 - li_tmp3 li_tmp11 = li_tmp1 + li_tmp2 li_tmp12 = li_tmp1 - li_tmp2 li_tmp0 = la_workspace [ li_pointer + 7 ] li_tmp1 = la_workspace [ li_pointer + 5 ] li_tmp2 = la_workspace [ li_pointer + 3 ] li_tmp3 = la_workspace [ li_pointer + 1 ] li_z1 = li_tmp0 + li_tmp3 li_z2 = li_tmp1 + li_tmp2 li_z3 = li_tmp0 + li_tmp2 li_z4 = li_tmp1 + li_tmp3 li_z5 = ( li_z3 + li_z4 ) * wi_FIX_1_175875602 li_tmp0 *= wi_FIX_0_298631336 li_tmp1 *= wi_FIX_2_053119869 li_tmp2 *= wi_FIX_3_072711026 li_tmp3 *= wi_FIX_1_501321110 li_z1 *= -wi_FIX_0_899976223 li_z2 *= -wi_FIX_2_562915447 li_z3 *= -wi_FIX_1_961570560 li_z4 *= -wi_FIX_0_390180644 li_z3 += li_z5 li_z4 += li_z5 li_tmp0 += li_z1 + li_z3 li_tmp1 += li_z2 + li_z4 li_tmp2 += li_z2 + li_z3 li_tmp3 += li_z1 + li_z4 la_data [ li_pointer + 0 ] = ( li_tmp10 + li_tmp3 ) >> wi_F3 la_data [ li_pointer + 7 ] = ( li_tmp10 - li_tmp3 ) >> wi_F3 la_data [ li_pointer + 1 ] = ( li_tmp11 + li_tmp2 ) >> wi_F3 la_data [ li_pointer + 6 ] = ( li_tmp11 - li_tmp2 ) >> wi_F3 la_data [ li_pointer + 2 ] = ( li_tmp12 + li_tmp1 ) >> wi_F3 la_data [ li_pointer + 5 ] = ( li_tmp12 - li_tmp1 ) >> wi_F3 la_data [ li_pointer + 3 ] = ( li_tmp13 + li_tmp0 ) >> wi_F3 la_data [ li_pointer + 4 ] = ( li_tmp13 - li_tmp0 ) >> wi_F3 # sherlock logger # l_log.debug ( "<<" ) return la_data # ------------------------------------------------------------------------------------------------- # read_picture # ------------------------------------------------------------------------------------------------- def read_picture ( f_data ): """ convert an AR.Drone image packet to rgb-string. @param f_data : image packet. @return width, height, image and time to decode the image. """ # sherlock logger # l_log = logging.getLogger ( "read_picture" ) # l_log.setLevel ( w_logLvl ) # l_log.debug ( ">>" ) f_bitreader = bitReader.bitReader ( f_data ) ll_ti = datetime.datetime.now () li_width, li_height = get_pheader ( f_bitreader ) li_slices = li_height / 16 li_blocks = li_width / 16 lai_image = [ 0 for li_i in xrange ( li_width * li_height ) ] for li_i in xrange ( 0, li_slices ): get_gob ( f_bitreader, lai_image, li_i, li_width ) f_bitreader.align () li_eos = f_bitreader.read ( 22 ) # assert ( 0b0000000000000000111111 == li_eos ) ll_tf = datetime.datetime.now () # sherlock logger # l_log.debug ( "<<" ) return li_width, li_height, ''.join ( lai_image ), ( ll_tf - ll_ti ).microseconds / 1000000. # ------------------------------------------------------------------------------------------------- # # ------------------------------------------------------------------------------------------------- try: psyco.bind ( bitReader ) psyco.bind ( get_block ) psyco.bind ( get_gob ) psyco.bind ( get_mb ) psyco.bind ( inverse_dct ) psyco.bind ( read_picture ) except NameError: pass # print "Unable to bind video decoding methods with psyco. Proceeding anyways, but video decoding will be slow!" # ------------------------------------------------------------------------------------------------- # main # ------------------------------------------------------------------------------------------------- def main (): l_fh = open ( "framewireshark.raw", 'r' ) # l_fh = open ( "videoframe.raw", 'r' ) l_data = l_fh.read () l_fh.close () li_runs = 20 li_t = 0 for li_i in xrange ( li_runs ): li_width, li_height, lai_image, li_ti = read_picture ( l_data ) #show_image ( lai_image, li_width, li_height ) li_t += li_ti print print "avg time:\t", li_t / li_runs, "sec" print "avg fps.:\t", 1 / ( li_t / li_runs ), "fps" if ( "image" in sys.argv ): import pygame pygame.init () li_W, li_H = 320, 240 l_screen = pygame.display.set_mode (( li_W, li_H )) l_surface = pygame.image.fromstring ( lai_image, ( li_width, li_height ), "RGB" ) screen.blit ( l_surface, ( 0, 0 )) pygame.display.flip () raw_input () # ------------------------------------------------------------------------------------------------- # the bootstrap process # ------------------------------------------------------------------------------------------------- if ( "__main__" == __name__ ): if ( "profile" in sys.argv ): cProfile.run ( "main ()" ) else: main () # < the end >-------------------------------------------------------------------------------------- #
projeto-si-lansab/si-lansab
ARDrone/arVideo.py
Python
gpl-2.0
27,307
import logging from abc import (ABCMeta, abstractmethod) from treeherder.model.models import MatcherManager logger = logging.getLogger(__name__) class Detector(object): __metaclass__ = ABCMeta name = None """Class that is called with a list of lines that correspond to unmatched, intermittent, failures from a specific job and that returns the indicies of the subset of that list that should be added as new targets for failure classification.""" def __init__(self, db_object): self.db_object = db_object @abstractmethod def __call__(self, failure_lines): pass class TestFailureDetector(Detector): def __call__(self, text_log_errors): rv = [] with_failure_lines = [(i, item) for (i, item) in enumerate(text_log_errors) if item.metadata and item.metadata.failure_line] for i, text_log_error in with_failure_lines: failure = text_log_error.metadata.failure_line if (failure.action == "test_result" and failure.test and failure.status and failure.expected): rv.append(i) return rv class ManualDetector(Detector): """Small hack; this ensures that there's a matcher object indicating that a match was by manual association, but which never automatically matches any lines""" def __call__(self, text_log_errors): return [] def register(): for obj in [ManualDetector, TestFailureDetector]: MatcherManager.register_detector(obj)
MikeLing/treeherder
treeherder/autoclassify/detectors.py
Python
mpl-2.0
1,557
# -*- coding: utf-8 -*- from setuptools import setup, find_packages setup( name = "python-gitlab", version = "0.1", packages = find_packages(), install_requires = ['requests', 'markdown'], # metadata for upload to PyPI author = "Itxaka Serrano Garcia", author_email = "itxakaserrano@gmail.com", description = "See the README.md file for more information", license = "GPL3", keywords = "gitlab git wrapper", url = "http://github.com/itxaka/python-gitlab/", )
erikjwaxx/python-gitlab-1
setup.py
Python
gpl-3.0
502
#!/usr/bin/python3 from gi.repository import Gtk, GObject from util import trackers import singletons import constants as c import status class PowerWidget(Gtk.Frame): """ PowerWidget is a child of InfoPanel, and is only shown if we're on a system that can run on battery power. It is usually only visible if the system is actually currently running on battery power. """ __gsignals__ = { 'power-state-changed': (GObject.SignalFlags.RUN_LAST, None, ()), } def __init__(self): super(PowerWidget, self).__init__() self.set_shadow_type(Gtk.ShadowType.NONE) self.get_style_context().add_class("powerwidget") self.path_widget_pairs = [] self.box = Gtk.Box(orientation=Gtk.Orientation.HORIZONTAL) self.add(self.box) self.box.show_all() self.power_client = singletons.UPowerClient self.battery_critical = False trackers.con_tracker_get().connect(self.power_client, "power-state-changed", self.on_power_state_changed) trackers.con_tracker_get().connect(self.power_client, "percentage-changed", self.on_percentage_changed) self.power_client.rescan_devices() self.on_power_state_changed(self.power_client) def refresh(self): self.on_power_state_changed(self.power_client) def on_power_state_changed(self, client): for widget in self.box.get_children(): widget.destroy() self.path_widget_pairs = [] self.battery_critical = False self.construct_icons() self.emit("power-state-changed") def on_percentage_changed(self, client, battery): battery_path = battery.get_object_path() for path, widget in self.path_widget_pairs: if path == battery_path: self.update_battery_tooltip(widget, battery) break def construct_icons(self): """ The upower dbus interface actually tells us what icon name to use. """ batteries = self.power_client.get_batteries() for path, battery in batteries: if status.Debug: print("powerWidget: Updating battery info: %s - icon: %s - percentage: %s" % (path, battery.get_property("icon-name"), battery.get_property("percentage"))) image = Gtk.Image.new_from_icon_name(battery.get_property("icon-name"), Gtk.IconSize.LARGE_TOOLBAR) self.update_battery_tooltip(image, battery) self.box.pack_start(image, False, False, 4) self.path_widget_pairs.append((path, image)) self._should_show = True self.box.show_all() def update_battery_tooltip(self, widget, battery): text = "" try: pct = int(battery.get_property("percentage")) if pct > 0: text = _("%d%%" % pct) if pct < c.BATTERY_CRITICAL_PERCENT: self.battery_critical = True except Exception as e: pass widget.set_tooltip_text(text) def should_show(self): return not self.power_client.full_and_on_ac_or_no_batteries()
leigh123linux/cinnamon-screensaver
src/widgets/powerWidget.py
Python
gpl-2.0
3,343
#!/usr/bin/env python # Copyright 2017 The Kubernetes Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Need to figure out why this only fails on travis # pylint: disable=bad-continuation """Executes a command.""" import argparse import os import subprocess import sys def check_with_log(*cmd): """Log and run the command, raising on errors.""" print >>sys.stderr, 'Run:', cmd print >>sys.stderr, subprocess.check_call(cmd) def check_no_log(*cmd): """Run the command, raising on errors, no logs""" try: subprocess.check_call(cmd) except: raise subprocess.CalledProcessError(cmd='subprocess.check_call', returncode=1) def check_output(*cmd): """Log and run the command, return output, raising on errors.""" print >>sys.stderr, 'Run:', cmd return subprocess.check_output(cmd) def main(target, buildfile): """Build & push to canary.""" check_with_log( 'docker', 'build', '-t', target, '--no-cache=true', '--pull=true', '--file=%s' % buildfile, '.' ) check_with_log('docker', 'inspect', target) email = os.environ.get('DOCKER_EMAIL') user = os.environ.get('DOCKER_USER') pwd = os.environ.get('DOCKER_PASSWORD') if check_output('docker', 'version', '--format=\'{{.Client.Version}}\'').startswith('1.9'): print >>sys.stderr, 'Docker 1.9, use --email' email = '--email=not@val.id' print >>sys.stderr, 'Logging in as %r' % user check_no_log('docker', 'login', email or '', '--username=%s' % user, '--password=%s' % pwd) os.environ.pop('DOCKER_EMAIL', None) os.environ.pop('DOCKER_USER', None) os.environ.pop('DOCKER_PASSWORD', None) check_with_log('docker', 'push', target) check_with_log('docker', 'logout') if __name__ == '__main__': PARSER = argparse.ArgumentParser() PARSER.add_argument( '--owner', help='Owner of the job') PARSER.add_argument( '--target', help='Build target') PARSER.add_argument( '--file', help='Build files') ARGS = PARSER.parse_args() if not ARGS.target or not ARGS.file: raise ValueError('--target and --file must be set!') if ARGS.owner: os.environ['OWNER'] = ARGS.owner main(ARGS.target, ARGS.file)
mikedanese/test-infra
scenarios/canarypush.py
Python
apache-2.0
2,752
# Copyright 2017 The Oppia Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Main process for training classifiers.""" # Preconfigure before starting main worker process. # This step should be performed before importing any of the # third party libraries. import logging import sys import time import vm_config vm_config.configure() # pylint: disable=wrong-import-position from core.domain import job_services import vmconf def main(): """Main process of VM.""" try: job_data = job_services.get_next_job() if not job_data: logging.info('No pending job requests.') return classifier_data = job_services.train_classifier( job_data['algorithm_id'], job_data['training_data']) status = job_services.store_job_result( job_data['job_id'], classifier_data) if status != 200: logging.warning( 'Failed to store result of the job with \'%s\' job_id', job_data['job_id']) return except KeyboardInterrupt: logging.info('Exiting') sys.exit(0) except Exception as e: # pylint: disable=broad-except # Log any exceptions that arises during processing of job. logging.error(e.message) finally: if vmconf.DEFAULT_WAITING_METHOD == vmconf.FIXED_TIME_WAITING: time.sleep(vmconf.FIXED_TIME_WAITING_PERIOD) if __name__ == '__main__': while True: main()
prasanna08/oppia-ml
main.py
Python
apache-2.0
1,996
#!/usr/bin/env python """Spout tests""" import time import pytest import python_pachyderm from python_pachyderm.service import pps_proto, pfs_proto def test_create_spout(): client = python_pachyderm.Client() client.delete_all() client.create_pipeline( pipeline_name="pipeline-create-spout", transform=pps_proto.Transform( cmd=["sh"], image="alpine", ), spout=pps_proto.Spout(), ) assert len(list(client.list_pipeline())) == 1 @pytest.mark.timeout(45) def test_spout_commit(): client = python_pachyderm.Client() client.delete_all() client.create_pipeline( pipeline_name="pipeline-spout-commit", transform=pps_proto.Transform( cmd=["bash"], stdin=[ "echo 'commit time' >> file.txt", "pachctl put file pipeline-spout-commit@master:/file.txt -f file.txt", ], ), spout=pps_proto.Spout(), ) c = client.subscribe_commit( repo_name="pipeline-spout-commit", branch="master", state=pfs_proto.FINISHED, origin_kind=pfs_proto.USER, ) next(c) commit_infos = list(client.list_commit("pipeline-spout-commit")) assert len(commit_infos) == 1
kalugny/pypachy
tests/test_spout.py
Python
mit
1,279
from django.db import models from django.core.urlresolvers import reverse class TextBit(models.Model): name = models.CharField(max_length=100, primary_key=True) content = models.TextField() def get_update_url(self): return reverse('textbits:update', args=[self.pk]) def __unicode__(self): return self.name class Title(models.Model): field = models.CharField(max_length=100, primary_key=True) name = models.CharField(max_length=100) @classmethod def load(cls): try: return cls.objects.get() except cls.DoesNotExist: return cls() def __unicode__(self): return self.name
DArtagan/teetimer
extra/models.py
Python
mit
674
#!/usr/bin/python # -*- coding: utf-8 -*- """ ================================================================================ mingus - Music theory Python package, midi package Copyright (C) 2008-2009, Bart Spaans This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. ================================================================================ """ from Sequencer import Sequencer from SequencerObserver import SequencerObserver __all__ = [ 'Sequencer', 'SequencerObserver', 'MidiFileIn', 'MidiFileOut', 'MidiTrack', 'fluidsynth', ]
spiderbit/canta-ng
mingus/midi/__init__.py
Python
gpl-3.0
1,177
# Copyright (C) 2012 David Morton # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. from scipy.cluster.vq import kmeans, vq import numpy from spikepy.developer.methods import ClusteringMethod from spikepy.common.valid_types import ValidInteger, ValidOption class ClusteringKMeans(ClusteringMethod): ''' This class implements a k-means clustering method. ''' name = 'K-means' description = 'K-means clustering algorithm with random initial centroids.' is_stochastic = True restarts = ValidInteger(1, 10000, default=10) choices = ['Use BIC'] + map(str, range(1, 21)) number_of_clusters = ValidOption(*choices, default='3', description= 'The number of clusters, or estimate the number of clusters via minimizing the Baysian Information Criterion.') def run(self, features, number_of_clusters='3', restarts=10): if number_of_clusters != 'Use BIC': k = int(number_of_clusters) if k == 1: result = numpy.zeros(len(features), dtype=numpy.int32) return [result] return [vq(features, kmeans(features, k, iter=restarts)[0])[0]] else: return [vq(features, bic_kmeans(features, iter=restarts)[0])[0]] def bic_kmeans(features, **kwargs): ''' Run kmeans on features with **kwargs given to scipy.cluster.vq.kmeans for different numbers of clusters, k. Choose, finally, the clustering that minimizes the Beysian Information Criterion or BIC. ''' max_k = int(2*numpy.log(len(features))) base_distances = vq(features, numpy.array([numpy.average(features, axis=0)]))[1] base_std = numpy.std(base_distances) centers_list = [] bic_list = [] distances_list = [] for k in range(1, max_k+1): centers = kmeans(features, k, **kwargs)[0] clusters, distances = vq(features, centers) bic = calculate_bic(clusters, distances, base_std) centers_list.append(centers) distances_list.append(distances) bic_list.append(bic) best_index = numpy.argmin(bic_list) return centers_list[best_index], distances_list[best_index] def calculate_bic(clusters, distances, base_std): ''' Calculates the most naive form of the BIC given the clusters (codebook) and the distances from the cluster centroids. ''' cluster_ids = numpy.unique(clusters) variance = numpy.average(distances) first_term = len(clusters)*numpy.log(variance/base_std) k = len(cluster_ids) second_term = k*numpy.log(len(clusters)) print 'k', k print '1', first_term print '2', second_term return first_term + second_term def get_clustered_data(clusters, data, cluster_id): ''' Return the data which is part of cluster with cluster_id provided. Inputs: clusters: 1-d numpy array of integers data: n-d numpy array who's first dimension (len) is equal to len(clusters) cluster_id: The particular cluster_id you want data for. ''' return numpy.take(data, numpy.nonzero(clusters==cluster_id))
davidlmorton/spikepy
spikepy/builtins/methods/clustering_k_means/__init__.py
Python
gpl-3.0
3,719
from __future__ import unicode_literals import sys import io from contextlib import contextmanager import unittest from mcinfo import cli @contextmanager def redirect_stdout_stdin(new_stdout, new_stdin): old_stdout, sys.stdout = sys.stdout, new_stdout old_stdin, sys.stdin = sys.stdin, new_stdin try: yield new_stdout, new_stdin finally: sys.stdout = old_stdout sys.stdin = old_stdin @contextmanager def redirect_stdout(new_stdout): old_stdout, sys.stdout = sys.stdout, new_stdout try: yield new_stdout finally: sys.stdout = old_stdout class TestCLI(unittest.TestCase): def test_handle_req_normal(self): req = "test" expected_out = 'Warning: This is test data! It is not at all useful ' \ 'for you.\nRecipes:\n' self.assertEqual(cli.handle_req(req), expected_out) def test_handle_req_nbt(self): req = "nbt:test" expected_out = '{ } example nbt structure\n [All tags from 3]\n '\ ' [All tags from other]\n [All tags from ' \ 'things]\n a_byte: B A byte. This one has 256 ' \ 'possible values.\n a_string: txt A string! what ' \ 'did you expect, the spanish inquisition?\n list: ' \ '[ ] example list\n txt the string.' self.assertEqual(cli.handle_req(req), expected_out) def test_main_with_args(self): expected_out = 'Warning: This is test data! It is not at all useful ' \ 'for you.\nRecipes:\n' args = ["test"] new_stdout = io.StringIO() with redirect_stdout(new_stdout): cli.main(args) new_stdout.seek(0) out = new_stdout.read() self.assertEqual(out, expected_out) def test_main_interactive(self): new_stdin = io.StringIO("test\nexit\n") new_stdout = io.StringIO() with redirect_stdout_stdin(new_stdout, new_stdin): cli.main([]) new_stdout.seek(0) out = new_stdout.read() expected_out = "> Warning: This is test data! It is not at all " \ "useful for you.\nRecipes:\n\n> " self.assertEqual(out, expected_out)
randomdude999/mcinfo
tests/test_cli.py
Python
mit
2,303
import soundcloud class Player(object): def __init__(self): self.client = soundcloud.Client(client_id="REMOVED FOR SECURITY PURPOSES") self.user_id = "REMOVED" def get_url(self, resource): """Grabs the permalink for whatever SoundCloud resource you'd like. For example, for the latest track, choose the '/tracks' resource. See developers.soundcloud.com/docs/api/reference for more info.""" info = self.client.get(resource, user_id=self.user_id) url = info[0].obj['permalink_url'] return url def player(self, track_url, width="325px", height=None): """The actual Soundcloud player""" embed_info = self.client.get('/oembed', url=track_url, maxwidth=width, maxheight=height) return embed_info.obj['html']
Acour83/ashflashtheorig
media.py
Python
mit
964
# -*- coding: utf-8 -*- try: import BaseHTTPServer as server except ImportError: import http.server as server try: from urlparse import parse_qs except ImportError: from urllib.parse import parse_qs import json import pyfttt # https://wiki.python.org/moin/BaseHttpServer # https://docs.python.org/2/library/basehttpserver.html # http://www.iana.org/assignments/http-status-codes/http-status-codes.xhtml # make a key with hashlib.sha1(b"hello" + b"world").hexdigest() (should have something unique in there) # https://docs.python.org/2/library/basehttpserver.html # TODO: get charset from browser instead of assuming utf-8? # TODO: handle HEAD (get response, but no body) # Parse out the url: z=urllib.parse.urlparse('http://blah.com/api/1.0/somekey/blah?woop=21&blah=12') # parse the query part urllib.parse.parse_qs(z.query) VALID_KEYS = ['6adfb183a4a2c94a2f92dab5ade762a47889a5a1', 'KEY'] class basic_handler(server.BaseHTTPRequestHandler): def parse_path(self): """ parse the path, setting api_key, api_version, etc.""" print("PATH IS [{}]".format(self.path)) path = self.path[1:].split('/') self.valid = True if len(path) < 4: self.send_error(400, message='Malformed path') self.valid = False return pass if path[0] != 'api': self.send_error(404) self.valid = False return try: self.api_version = float(path[1]) except ValueError: self.send_error(404, message='Unsupported API version') self.api_version = None self.valid = False return if self.api_version not in [1.0]: self.send_error(404, message='Unsupported API version') self.valid = False return self.api_key = path[2] if self.api_key not in VALID_KEYS: self.send_error(403) self.valid = False return self.api_command = path[3] if self.api_command not in ['test', 'blah']: self.send_error(400, message="Unknown command '{}'".format(self.api_command)) self.valid = False return self.api_arguments = path[4:] def do_GET(self): return self.do_GETPOST() def do_POST(self): return self.do_GETPOST() def do_GETPOST(self): self.server_version = 'pyfttt/{}'.format(pyfttt.__version__) self.parse_path() if not self.valid: return #print("COMMAND: {}".format(self.api_command)) #print("OPTIONS: {}".format(self.api_arguments)) if self.command == 'POST': data_length = int(self.headers['Content-Length']) # Payload must be under 1k if data_length > 1000: self.send_error(413) return data_raw = self.rfile.read(data_length) if self.headers['Content-Type'] == 'application/json': data_parsed = json.loads(bytes.decode(data_raw)) elif self.headers['Content-Type'] == 'application/x-www-form-urlencoded': data_parsed = parse_qs(data_raw) else: self.send_error(400, message="Unsupported Content Type '{}'".format(self.headers['Content-Type'])) return #print("\tGot Data: [{}]".format(data_parsed)) self.send_response(200) self.send_header("Content-type", "application/json") self.end_headers() stuff = {'brian': 35, 'lori': 35, 'address': {'house': 2351, 'street': 'fairview ave e'}} self.wfile.write(json.dumps(stuff, indent=4).encode('UTF-8')) def run_server(host='', port=7777, handler=basic_handler): httpd = server.HTTPServer(server_address=(host,port), RequestHandlerClass=handler) httpd.serve_forever() run_server(port=7777, handler=basic_handler) # print("Got a POST request") # print("\tClient Address: {}".format(self.client_address)) # print("\tCommand: {}".format(self.command)) # print("\tPath: {}".format(self.path.split('/'))) # print("\tRequest Version: {}".format(self.request_version)) # print("\tHeaders: {}".format(self.headers)) # print("\t\tContent-Length: {}".format(int(self.headers['Content-Length']))) # print("\tServer Version: {}".format(self.server_version))
Haynie-Research-and-Development/jarvis
deps/lib/python3.4/site-packages/pyfttt/server.py
Python
gpl-2.0
4,646
# -*- coding: utf-8 -*- # YAFF is yet another force-field code. # Copyright (C) 2011 Toon Verstraelen <Toon.Verstraelen@UGent.be>, # Louis Vanduyfhuys <Louis.Vanduyfhuys@UGent.be>, Center for Molecular Modeling # (CMM), Ghent University, Ghent, Belgium; all rights reserved unless otherwise # stated. # # This file is part of YAFF. # # YAFF is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License # as published by the Free Software Foundation; either version 3 # of the License, or (at your option) any later version. # # YAFF is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, see <http://www.gnu.org/licenses/> # # -- from __future__ import division import numpy as np import h5py as h5 import pkg_resources from yaff import * from yaff.conversion.gaussian import _scan_g09_forces, _scan_g09_time, \ _scan_g09_pos_vel, _scan_to_line def test_scan_forces(): fn_log = pkg_resources.resource_filename(__name__, '../../data/test/gaussian_sioh4_md.log') with open(fn_log) as f: numbers, frc = _scan_g09_forces(f) assert numbers[0] == 14 assert numbers[1] == 8 assert numbers[-1] == 1 assert len(numbers) == 9 assert frc[0,0] == 0.000014646 assert frc[1,-1] == 0.005043566 assert frc[-1,1] == 0.002557226 assert frc.shape == (9, 3) def test_scan_time(): fn_log = pkg_resources.resource_filename(__name__, '../../data/test/gaussian_sioh4_md.log') with open(fn_log) as f: time, step, ekin, epot, etot = _scan_g09_time(f) assert time == 0.0 assert step == 2 assert ekin == 0.0306188 assert epot == -592.9048374 assert etot == -592.8742186 time, step, ekin, epot, etot = _scan_g09_time(f) assert time == 1.125278*femtosecond assert step == 3 assert ekin == 0.0244215 assert epot == -592.8986401 assert etot == -592.8742186 def test_scan_pos_vel(): vel_unit = np.sqrt(amu)/second fn_log = pkg_resources.resource_filename(__name__, '../../data/test/gaussian_sioh4_md.log') with open(fn_log) as f: _scan_to_line(f, " Cartesian coordinates: (bohr)") # skip first one, has different format pos, vel = _scan_g09_pos_vel(f) assert pos[0,0] == -1.287811626725E-02 assert pos[-1,-1] == 2.710579145562E+00 assert pos.shape == (9, 3) assert vel[1, 0] == 5.750552889614E+13*vel_unit assert vel[-2, 2] == 1.741570818851E+13*vel_unit assert vel.shape == (9, 3) def test_to_hdf(): vel_unit = np.sqrt(amu)/second fn_xyz = pkg_resources.resource_filename(__name__, '../../data/test/gaussian_sioh4_md.xyz') fn_log = pkg_resources.resource_filename(__name__, '../../data/test/gaussian_sioh4_md.log') with h5.File('yaff.conversion.test.test_gaussian.test_to_hdf5.h5', driver='core', backing_store=False) as f: system = System.from_file(fn_xyz) system.to_hdf5(f) # Actual trajectory conversion, twice for i in range(2): offset = 2*i g09log_to_hdf5(f, fn_log) assert 'trajectory' in f assert get_last_trajectory_row(f['trajectory']) == 2+offset assert 'pos' in f['trajectory'] assert f['trajectory/pos'].shape == (2+offset, 9, 3) assert f['trajectory/pos'][offset,0,0] == -1.287811626725E-02 assert f['trajectory/pos'][-1,-1,-1] == 2.710239686065E+00 assert 'vel' in f['trajectory'] assert f['trajectory/vel'].shape == (2+offset, 9, 3) assert f['trajectory/vel'][offset,0,0] == -6.493457131863E+13*vel_unit assert f['trajectory/vel'][-1,-1,-1] == 4.186482857132E+12*vel_unit assert 'frc' in f['trajectory'] assert f['trajectory/frc'].shape == (2+offset, 9, 3) assert f['trajectory/frc'][offset,0,0] == 0.002725302 assert f['trajectory/frc'][-1,-1,-1] == 0.008263482 assert 'time' in f['trajectory'] assert f['trajectory/time'].shape == (2+offset, 1) assert f['trajectory/time'][offset] == 0.0 assert f['trajectory/time'][-1] == 1.125278*femtosecond assert 'step' in f['trajectory'] assert f['trajectory/step'].shape == (2+offset, 1) assert f['trajectory/step'][offset] == 2 assert f['trajectory/step'][-1] == 3 assert 'epot' in f['trajectory'] assert f['trajectory/epot'].shape == (2+offset, 1) assert f['trajectory/epot'][offset] == -592.9048374 assert f['trajectory/epot'][-1] == -592.8986401 assert 'ekin' in f['trajectory'] assert f['trajectory/ekin'].shape == (2+offset, 1) assert f['trajectory/ekin'][offset] == 0.0306188 assert f['trajectory/ekin'][-1] == 0.0244215 assert 'etot' in f['trajectory'] assert f['trajectory/etot'].shape == (2+offset, 1) assert f['trajectory/etot'][offset] == -592.8742186 assert f['trajectory/etot'][-1] == -592.8742186 f.close()
molmod/yaff
yaff/conversion/test/test_gaussian.py
Python
gpl-3.0
5,408
try: from setuptools import setup except ImportError: from distutils.core import setup config = { 'description': 'This is a DMARC report parser that accepts either an XML or zipped file as input at an attachment via email', 'author': 'Elmer Thomas', 'url': '', 'download_url': '', 'author_email': 'elmer.thomas@sendgrid.com', 'version': '0.1', 'install_requires': ['nose', 'Flask', 'Flask-SQLAlchemy', 'Jinja2', 'Werkzeug', 'distribute', 'wsgiref', 'mysql-python', 'requests', 'simplejson', 'configobj'], 'packages': ['dmarc_parser'], 'scripts': [], 'name': 'DMARC Parser' } setup(**config)
thinkingserious/sendgrid-python-dmarc-parser
setup.py
Python
mit
608
__all__ = ('ForwardRefPolicy', 'TypeHintWarning', 'typechecked', 'check_return_type', 'check_argument_types', 'check_type', 'TypeWarning', 'TypeChecker', 'typeguard_ignore') import collections.abc import gc import inspect import sys import threading from collections import OrderedDict from enum import Enum from functools import wraps, partial from inspect import Parameter, isclass, isfunction, isgeneratorfunction from io import TextIOBase, RawIOBase, IOBase, BufferedIOBase from traceback import extract_stack, print_stack from types import CodeType, FunctionType from typing import ( Callable, Any, Union, Dict, List, TypeVar, Tuple, Set, Sequence, get_type_hints, TextIO, Optional, IO, BinaryIO, Type, Generator, overload, Iterable, AsyncIterable, Iterator, AsyncIterator, AbstractSet, TYPE_CHECKING) from unittest.mock import Mock from warnings import warn from weakref import WeakKeyDictionary, WeakValueDictionary # Python 3.8+ try: from typing_extensions import Literal except ImportError: try: from typing import Literal except ImportError: Literal = None # Python 3.5.4+ / 3.6.2+ try: from typing_extensions import NoReturn except ImportError: try: from typing import NoReturn except ImportError: NoReturn = None # Python 3.6+ try: from inspect import isasyncgenfunction, isasyncgen from typing import AsyncGenerator except ImportError: AsyncGenerator = None def isasyncgen(obj): return False def isasyncgenfunction(func): return False # Python 3.8+ try: from typing import ForwardRef evaluate_forwardref = ForwardRef._evaluate except ImportError: from typing import _ForwardRef as ForwardRef evaluate_forwardref = ForwardRef._eval_type if TYPE_CHECKING: _F = TypeVar("_F") def typeguard_ignore(f: _F) -> _F: """This decorator is a noop during static type-checking.""" return f else: from typing import no_type_check as typeguard_ignore _type_hints_map = WeakKeyDictionary() # type: Dict[FunctionType, Dict[str, Any]] _functions_map = WeakValueDictionary() # type: Dict[CodeType, FunctionType] _missing = object() T_CallableOrType = TypeVar('T_CallableOrType', bound=Callable[..., Any]) class ForwardRefPolicy(Enum): """Defines how unresolved forward references are handled.""" ERROR = 1 #: propagate the :exc:`NameError` from :func:`~typing.get_type_hints` WARN = 2 #: remove the annotation and emit a TypeHintWarning #: replace the annotation with the argument's class if the qualified name matches, else remove #: the annotation GUESS = 3 class TypeHintWarning(UserWarning): """ A warning that is emitted when a type hint in string form could not be resolved to an actual type. """ class _TypeCheckMemo: __slots__ = 'globals', 'locals', 'typevars' def __init__(self, globals: Dict[str, Any], locals: Dict[str, Any]): self.globals = globals self.locals = locals self.typevars = {} # type: Dict[Any, type] def _strip_annotation(annotation): if isinstance(annotation, str): return annotation.strip("'") else: return annotation class _CallMemo(_TypeCheckMemo): __slots__ = 'func', 'func_name', 'arguments', 'is_generator', 'type_hints' def __init__(self, func: Callable, frame_locals: Optional[Dict[str, Any]] = None, args: tuple = None, kwargs: Dict[str, Any] = None, forward_refs_policy=ForwardRefPolicy.ERROR): super().__init__(func.__globals__, frame_locals) self.func = func self.func_name = function_name(func) self.is_generator = isgeneratorfunction(func) signature = inspect.signature(func) if args is not None and kwargs is not None: self.arguments = signature.bind(*args, **kwargs).arguments else: assert frame_locals is not None, 'frame must be specified if args or kwargs is None' self.arguments = frame_locals self.type_hints = _type_hints_map.get(func) if self.type_hints is None: while True: if sys.version_info < (3, 5, 3): frame_locals = dict(frame_locals) try: hints = get_type_hints(func, localns=frame_locals) except NameError as exc: if forward_refs_policy is ForwardRefPolicy.ERROR: raise typename = str(exc).split("'", 2)[1] for param in signature.parameters.values(): if _strip_annotation(param.annotation) == typename: break else: raise func_name = function_name(func) if forward_refs_policy is ForwardRefPolicy.GUESS: if param.name in self.arguments: argtype = self.arguments[param.name].__class__ stripped = _strip_annotation(param.annotation) if stripped == argtype.__qualname__: func.__annotations__[param.name] = argtype msg = ('Replaced forward declaration {!r} in {} with {!r}' .format(stripped, func_name, argtype)) warn(TypeHintWarning(msg)) continue msg = 'Could not resolve type hint {!r} on {}: {}'.format( param.annotation, function_name(func), exc) warn(TypeHintWarning(msg)) del func.__annotations__[param.name] else: break self.type_hints = OrderedDict() for name, parameter in signature.parameters.items(): if name in hints: annotated_type = hints[name] # PEP 428 discourages it by MyPy does not complain if parameter.default is None: annotated_type = Optional[annotated_type] if parameter.kind == Parameter.VAR_POSITIONAL: self.type_hints[name] = Tuple[annotated_type, ...] elif parameter.kind == Parameter.VAR_KEYWORD: self.type_hints[name] = Dict[str, annotated_type] else: self.type_hints[name] = annotated_type if 'return' in hints: self.type_hints['return'] = hints['return'] _type_hints_map[func] = self.type_hints def resolve_forwardref(maybe_ref, memo: _TypeCheckMemo): if isinstance(maybe_ref, ForwardRef): if sys.version_info < (3, 9, 0): return evaluate_forwardref(maybe_ref, memo.globals, memo.locals) else: return evaluate_forwardref(maybe_ref, memo.globals, memo.locals, frozenset()) else: return maybe_ref def get_type_name(type_): # typing.* types don't have a __name__ on Python 3.7+ return getattr(type_, '__name__', None) or getattr(type_, '_name', None) or str(type_) def find_function(frame) -> Optional[Callable]: """ Return a function object from the garbage collector that matches the frame's code object. This process is unreliable as several function objects could use the same code object. Fortunately the likelihood of this happening with the combination of the function objects having different type annotations is a very rare occurrence. :param frame: a frame object :return: a function object if one was found, ``None`` if not """ func = _functions_map.get(frame.f_code) if func is None: for obj in gc.get_referrers(frame.f_code): if inspect.isfunction(obj): if func is None: # The first match was found func = obj else: # A second match was found return None # Cache the result for future lookups if func is not None: _functions_map[frame.f_code] = func else: raise LookupError('target function not found') return func def qualified_name(obj) -> str: """ Return the qualified name (e.g. package.module.Type) for the given object. Builtins and types from the :mod:`typing` package get special treatment by having the module name stripped from the generated name. """ type_ = obj if inspect.isclass(obj) else type(obj) module = type_.__module__ qualname = type_.__qualname__ return qualname if module in ('typing', 'builtins') else '{}.{}'.format(module, qualname) def function_name(func: Callable) -> str: """ Return the qualified name of the given function. Builtins and types from the :mod:`typing` package get special treatment by having the module name stripped from the generated name. """ # For partial functions and objects with __call__ defined, __qualname__ does not exist module = func.__module__ qualname = getattr(func, '__qualname__', repr(func)) return qualname if module == 'builtins' else '{}.{}'.format(module, qualname) def check_callable(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not callable(value): raise TypeError('{} must be a callable'.format(argname)) if getattr(expected_type, "__args__", None): try: signature = inspect.signature(value) except (TypeError, ValueError): return if hasattr(expected_type, '__result__'): # Python 3.5 argument_types = expected_type.__args__ check_args = argument_types is not Ellipsis else: # Python 3.6 argument_types = expected_type.__args__[:-1] check_args = argument_types != (Ellipsis,) if check_args: # The callable must not have keyword-only arguments without defaults unfulfilled_kwonlyargs = [ param.name for param in signature.parameters.values() if param.kind == Parameter.KEYWORD_ONLY and param.default == Parameter.empty] if unfulfilled_kwonlyargs: raise TypeError( 'callable passed as {} has mandatory keyword-only arguments in its ' 'declaration: {}'.format(argname, ', '.join(unfulfilled_kwonlyargs))) num_mandatory_args = len([ param.name for param in signature.parameters.values() if param.kind in (Parameter.POSITIONAL_ONLY, Parameter.POSITIONAL_OR_KEYWORD) and param.default is Parameter.empty]) has_varargs = any(param for param in signature.parameters.values() if param.kind == Parameter.VAR_POSITIONAL) if num_mandatory_args > len(argument_types): raise TypeError( 'callable passed as {} has too many arguments in its declaration; expected {} ' 'but {} argument(s) declared'.format(argname, len(argument_types), num_mandatory_args)) elif not has_varargs and num_mandatory_args < len(argument_types): raise TypeError( 'callable passed as {} has too few arguments in its declaration; expected {} ' 'but {} argument(s) declared'.format(argname, len(argument_types), num_mandatory_args)) def check_dict(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not isinstance(value, dict): raise TypeError('type of {} must be a dict; got {} instead'. format(argname, qualified_name(value))) if expected_type is not dict: if (hasattr(expected_type, "__args__") and expected_type.__args__ not in (None, expected_type.__parameters__)): key_type, value_type = expected_type.__args__ if key_type is not Any or value_type is not Any: for k, v in value.items(): check_type('keys of {}'.format(argname), k, key_type, memo) check_type('{}[{!r}]'.format(argname, k), v, value_type, memo) def check_typed_dict(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: declared_keys = frozenset(expected_type.__annotations__) if hasattr(expected_type, '__required_keys__'): required_keys = expected_type.__required_keys__ else: # py3.8 and lower required_keys = declared_keys if expected_type.__total__ else frozenset() existing_keys = frozenset(value) extra_keys = existing_keys - declared_keys if extra_keys: keys_formatted = ', '.join('"{}"'.format(key) for key in sorted(extra_keys)) raise TypeError('extra key(s) ({}) in {}'.format(keys_formatted, argname)) missing_keys = required_keys - existing_keys if missing_keys: keys_formatted = ', '.join('"{}"'.format(key) for key in sorted(missing_keys)) raise TypeError('required key(s) ({}) missing from {}'.format(keys_formatted, argname)) for key, argtype in get_type_hints(expected_type).items(): argvalue = value.get(key, _missing) if argvalue is not _missing: check_type('dict item "{}" for {}'.format(key, argname), argvalue, argtype, memo) def check_list(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not isinstance(value, list): raise TypeError('type of {} must be a list; got {} instead'. format(argname, qualified_name(value))) if expected_type is not list: if hasattr(expected_type, "__args__") and expected_type.__args__ not in \ (None, expected_type.__parameters__): value_type = expected_type.__args__[0] if value_type is not Any: for i, v in enumerate(value): check_type('{}[{}]'.format(argname, i), v, value_type, memo) def check_sequence(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not isinstance(value, collections.abc.Sequence): raise TypeError('type of {} must be a sequence; got {} instead'. format(argname, qualified_name(value))) if hasattr(expected_type, "__args__") and expected_type.__args__ not in \ (None, expected_type.__parameters__): value_type = expected_type.__args__[0] if value_type is not Any: for i, v in enumerate(value): check_type('{}[{}]'.format(argname, i), v, value_type, memo) def check_set(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not isinstance(value, AbstractSet): raise TypeError('type of {} must be a set; got {} instead'. format(argname, qualified_name(value))) if expected_type is not set: if hasattr(expected_type, "__args__") and expected_type.__args__ not in \ (None, expected_type.__parameters__): value_type = expected_type.__args__[0] if value_type is not Any: for v in value: check_type('elements of {}'.format(argname), v, value_type, memo) def check_tuple(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: # Specialized check for NamedTuples is_named_tuple = False if sys.version_info < (3, 8, 0): is_named_tuple = hasattr(expected_type, '_field_types') # deprecated since python 3.8 else: is_named_tuple = hasattr(expected_type, '__annotations__') if is_named_tuple: if not isinstance(value, expected_type): raise TypeError('type of {} must be a named tuple of type {}; got {} instead'. format(argname, qualified_name(expected_type), qualified_name(value))) if sys.version_info < (3, 8, 0): field_types = expected_type._field_types else: field_types = expected_type.__annotations__ for name, field_type in field_types.items(): check_type('{}.{}'.format(argname, name), getattr(value, name), field_type, memo) return elif not isinstance(value, tuple): raise TypeError('type of {} must be a tuple; got {} instead'. format(argname, qualified_name(value))) if getattr(expected_type, '__tuple_params__', None): # Python 3.5 use_ellipsis = expected_type.__tuple_use_ellipsis__ tuple_params = expected_type.__tuple_params__ elif getattr(expected_type, '__args__', None): # Python 3.6+ use_ellipsis = expected_type.__args__[-1] is Ellipsis tuple_params = expected_type.__args__[:-1 if use_ellipsis else None] else: # Unparametrized Tuple or plain tuple return if use_ellipsis: element_type = tuple_params[0] for i, element in enumerate(value): check_type('{}[{}]'.format(argname, i), element, element_type, memo) elif tuple_params == ((),): if value != (): raise TypeError('{} is not an empty tuple but one was expected'.format(argname)) else: if len(value) != len(tuple_params): raise TypeError('{} has wrong number of elements (expected {}, got {} instead)' .format(argname, len(tuple_params), len(value))) for i, (element, element_type) in enumerate(zip(value, tuple_params)): check_type('{}[{}]'.format(argname, i), element, element_type, memo) def check_union(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if hasattr(expected_type, '__union_params__'): # Python 3.5 union_params = expected_type.__union_params__ else: # Python 3.6+ union_params = expected_type.__args__ for type_ in union_params: try: check_type(argname, value, type_, memo) return except TypeError: pass typelist = ', '.join(get_type_name(t) for t in union_params) raise TypeError('type of {} must be one of ({}); got {} instead'. format(argname, typelist, qualified_name(value))) def check_class(argname: str, value, expected_type, memo: _TypeCheckMemo) -> None: if not isclass(value): raise TypeError('type of {} must be a type; got {} instead'.format( argname, qualified_name(value))) # Needed on Python 3.7+ if expected_type is Type: return expected_class = None if hasattr(expected_type, "__args__") and expected_type.__args__: expected_class = expected_type.__args__[0] if expected_class: if expected_class is Any: return elif isinstance(expected_class, TypeVar): check_typevar(argname, value, expected_class, memo, True) elif not issubclass(value, expected_class): raise TypeError('{} must be a subclass of {}; got {} instead'.format( argname, qualified_name(expected_class), qualified_name(value))) def check_typevar(argname: str, value, typevar: TypeVar, memo: _TypeCheckMemo, subclass_check: bool = False) -> None: bound_type = resolve_forwardref(memo.typevars.get(typevar, typevar.__bound__), memo) value_type = value if subclass_check else type(value) subject = argname if subclass_check else 'type of ' + argname if bound_type is None: # The type variable hasn't been bound yet -- check that the given value matches the # constraints of the type variable, if any if typevar.__constraints__: constraints = [resolve_forwardref(c, memo) for c in typevar.__constraints__] if value_type not in constraints: typelist = ', '.join(get_type_name(t) for t in constraints if t is not object) raise TypeError('{} must be one of ({}); got {} instead'. format(subject, typelist, qualified_name(value_type))) elif typevar.__covariant__ or typevar.__bound__: if not issubclass(value_type, bound_type): raise TypeError( '{} must be {} or one of its subclasses; got {} instead'. format(subject, qualified_name(bound_type), qualified_name(value_type))) elif typevar.__contravariant__: if not issubclass(bound_type, value_type): raise TypeError( '{} must be {} or one of its superclasses; got {} instead'. format(subject, qualified_name(bound_type), qualified_name(value_type))) else: # invariant if value_type is not bound_type: raise TypeError( '{} must be exactly {}; got {} instead'. format(subject, qualified_name(bound_type), qualified_name(value_type))) if typevar not in memo.typevars: # Bind the type variable to a concrete type memo.typevars[typevar] = value_type def check_literal(argname: str, value, expected_type, memo: _TypeCheckMemo): def get_args(literal): try: args = literal.__args__ except AttributeError: # Instance of Literal from typing_extensions args = literal.__values__ retval = [] for arg in args: if isinstance(arg, Literal.__class__) or getattr(arg, '__origin__', None) is Literal: # The first check works on py3.6 and lower, the second one on py3.7+ retval.extend(get_args(arg)) elif isinstance(arg, (int, str, bytes, bool, type(None), Enum)): retval.append(arg) else: raise TypeError('Illegal literal value: {}'.format(arg)) return retval final_args = tuple(get_args(expected_type)) if value not in final_args: raise TypeError('the value of {} must be one of {}; got {} instead'. format(argname, final_args, value)) def check_number(argname: str, value, expected_type): if expected_type is complex and not isinstance(value, (complex, float, int)): raise TypeError('type of {} must be either complex, float or int; got {} instead'. format(argname, qualified_name(value.__class__))) elif expected_type is float and not isinstance(value, (float, int)): raise TypeError('type of {} must be either float or int; got {} instead'. format(argname, qualified_name(value.__class__))) def check_io(argname: str, value, expected_type): if expected_type is TextIO: if not isinstance(value, TextIOBase): raise TypeError('type of {} must be a text based I/O object; got {} instead'. format(argname, qualified_name(value.__class__))) elif expected_type is BinaryIO: if not isinstance(value, (RawIOBase, BufferedIOBase)): raise TypeError('type of {} must be a binary I/O object; got {} instead'. format(argname, qualified_name(value.__class__))) elif not isinstance(value, IOBase): raise TypeError('type of {} must be an I/O object; got {} instead'. format(argname, qualified_name(value.__class__))) def check_protocol(argname: str, value, expected_type): # TODO: implement proper compatibility checking and support non-runtime protocols if getattr(expected_type, '_is_runtime_protocol', False): if not isinstance(value, expected_type): raise TypeError('type of {} ({}) is not compatible with the {} protocol'. format(argname, type(value).__qualname__, expected_type.__qualname__)) # Equality checks are applied to these origin_type_checkers = { AbstractSet: check_set, Callable: check_callable, collections.abc.Callable: check_callable, dict: check_dict, Dict: check_dict, list: check_list, List: check_list, Sequence: check_sequence, collections.abc.Sequence: check_sequence, collections.abc.Set: check_set, set: check_set, Set: check_set, tuple: check_tuple, Tuple: check_tuple, type: check_class, Type: check_class, Union: check_union } _subclass_check_unions = hasattr(Union, '__union_set_params__') if Literal is not None: origin_type_checkers[Literal] = check_literal generator_origin_types = (Generator, collections.abc.Generator, Iterator, collections.abc.Iterator, Iterable, collections.abc.Iterable) asyncgen_origin_types = (AsyncIterator, collections.abc.AsyncIterator, AsyncIterable, collections.abc.AsyncIterable) if AsyncGenerator is not None: asyncgen_origin_types += (AsyncGenerator,) if hasattr(collections.abc, 'AsyncGenerator'): asyncgen_origin_types += (collections.abc.AsyncGenerator,) def check_type(argname: str, value, expected_type, memo: Optional[_TypeCheckMemo] = None, *, globals: Optional[Dict[str, Any]] = None, locals: Optional[Dict[str, Any]] = None) -> None: """ Ensure that ``value`` matches ``expected_type``. The types from the :mod:`typing` module do not support :func:`isinstance` or :func:`issubclass` so a number of type specific checks are required. This function knows which checker to call for which type. :param argname: name of the argument to check; used for error messages :param value: value to be checked against ``expected_type`` :param expected_type: a class or generic type instance :param globals: dictionary of global variables to use for resolving forward references (defaults to the calling frame's globals) :param locals: dictionary of local variables to use for resolving forward references (defaults to the calling frame's locals) """ if expected_type is Any or isinstance(value, Mock): return if expected_type is None: # Only happens on < 3.6 expected_type = type(None) if memo is None: frame = sys._getframe(1) if globals is None: globals = frame.f_globals if locals is None: locals = frame.f_locals memo = _TypeCheckMemo(globals, locals) expected_type = resolve_forwardref(expected_type, memo) origin_type = getattr(expected_type, '__origin__', None) if origin_type is not None: checker_func = origin_type_checkers.get(origin_type) if checker_func: checker_func(argname, value, expected_type, memo) else: check_type(argname, value, origin_type, memo) elif isclass(expected_type): if issubclass(expected_type, Tuple): check_tuple(argname, value, expected_type, memo) elif issubclass(expected_type, (float, complex)): check_number(argname, value, expected_type) elif _subclass_check_unions and issubclass(expected_type, Union): check_union(argname, value, expected_type, memo) elif isinstance(expected_type, TypeVar): check_typevar(argname, value, expected_type, memo) elif issubclass(expected_type, IO): check_io(argname, value, expected_type) elif issubclass(expected_type, dict) and hasattr(expected_type, '__annotations__'): check_typed_dict(argname, value, expected_type, memo) elif getattr(expected_type, '_is_protocol', False): check_protocol(argname, value, expected_type) else: expected_type = (getattr(expected_type, '__extra__', None) or origin_type or expected_type) if expected_type is bytes: # As per https://github.com/python/typing/issues/552 if not isinstance(value, (bytearray, bytes, memoryview)): raise TypeError('type of {} must be bytes-like; got {} instead' .format(argname, qualified_name(value))) elif not isinstance(value, expected_type): raise TypeError( 'type of {} must be {}; got {} instead'. format(argname, qualified_name(expected_type), qualified_name(value))) elif isinstance(expected_type, TypeVar): # Only happens on < 3.6 check_typevar(argname, value, expected_type, memo) elif isinstance(expected_type, Literal.__class__): # Only happens on < 3.7 when using Literal from typing_extensions check_literal(argname, value, expected_type, memo) elif (isfunction(expected_type) and getattr(expected_type, "__module__", None) == "typing" and getattr(expected_type, "__qualname__", None).startswith("NewType.") and hasattr(expected_type, "__supertype__")): # typing.NewType, should check against supertype (recursively) return check_type(argname, value, expected_type.__supertype__, memo) def check_return_type(retval, memo: Optional[_CallMemo] = None) -> bool: """ Check that the return value is compatible with the return value annotation in the function. :param retval: the value about to be returned from the call :return: ``True`` :raises TypeError: if there is a type mismatch """ if memo is None: # faster than inspect.currentframe(), but not officially # supported in all python implementations frame = sys._getframe(1) try: func = find_function(frame) except LookupError: return True # This can happen with the Pydev/PyCharm debugger extension installed memo = _CallMemo(func, frame.f_locals) if 'return' in memo.type_hints: if memo.type_hints['return'] is NoReturn: raise TypeError('{}() was declared never to return but it did'.format(memo.func_name)) try: check_type('the return value', retval, memo.type_hints['return'], memo) except TypeError as exc: # suppress unnecessarily long tracebacks raise TypeError(*exc.args) from None return True def check_argument_types(memo: Optional[_CallMemo] = None) -> bool: """ Check that the argument values match the annotated types. Unless both ``args`` and ``kwargs`` are provided, the information will be retrieved from the previous stack frame (ie. from the function that called this). :return: ``True`` :raises TypeError: if there is an argument type mismatch """ if memo is None: # faster than inspect.currentframe(), but not officially # supported in all python implementations frame = sys._getframe(1) try: func = find_function(frame) except LookupError: return True # This can happen with the Pydev/PyCharm debugger extension installed memo = _CallMemo(func, frame.f_locals) for argname, expected_type in memo.type_hints.items(): if argname != 'return' and argname in memo.arguments: value = memo.arguments[argname] description = 'argument "{}"'.format(argname) try: check_type(description, value, expected_type, memo) except TypeError as exc: # suppress unnecessarily long tracebacks raise TypeError(*exc.args) from None return True class TypeCheckedGenerator: def __init__(self, wrapped: Generator, memo: _CallMemo): rtype_args = [] if hasattr(memo.type_hints['return'], "__args__"): rtype_args = memo.type_hints['return'].__args__ self.__wrapped = wrapped self.__memo = memo self.__yield_type = rtype_args[0] if rtype_args else Any self.__send_type = rtype_args[1] if len(rtype_args) > 1 else Any self.__return_type = rtype_args[2] if len(rtype_args) > 2 else Any self.__initialized = False def __iter__(self): return self def __next__(self): return self.send(None) def __getattr__(self, name: str) -> Any: return getattr(self.__wrapped, name) def throw(self, *args): return self.__wrapped.throw(*args) def close(self): self.__wrapped.close() def send(self, obj): if self.__initialized: check_type('value sent to generator', obj, self.__send_type, memo=self.__memo) else: self.__initialized = True try: value = self.__wrapped.send(obj) except StopIteration as exc: check_type('return value', exc.value, self.__return_type, memo=self.__memo) raise check_type('value yielded from generator', value, self.__yield_type, memo=self.__memo) return value class TypeCheckedAsyncGenerator: def __init__(self, wrapped: AsyncGenerator, memo: _CallMemo): rtype_args = memo.type_hints['return'].__args__ self.__wrapped = wrapped self.__memo = memo self.__yield_type = rtype_args[0] self.__send_type = rtype_args[1] if len(rtype_args) > 1 else Any self.__initialized = False async def __aiter__(self): return self def __anext__(self): return self.asend(None) def __getattr__(self, name: str) -> Any: return getattr(self.__wrapped, name) def athrow(self, *args): return self.__wrapped.athrow(*args) def aclose(self): return self.__wrapped.aclose() async def asend(self, obj): if self.__initialized: check_type('value sent to generator', obj, self.__send_type, memo=self.__memo) else: self.__initialized = True value = await self.__wrapped.asend(obj) check_type('value yielded from generator', value, self.__yield_type, memo=self.__memo) return value @overload def typechecked(*, always: bool = False) -> Callable[[T_CallableOrType], T_CallableOrType]: ... @overload def typechecked(func: T_CallableOrType, *, always: bool = False) -> T_CallableOrType: ... def typechecked(func=None, *, always=False, _localns: Optional[Dict[str, Any]] = None): """ Perform runtime type checking on the arguments that are passed to the wrapped function. The return value is also checked against the return annotation if any. If the ``__debug__`` global variable is set to ``False``, no wrapping and therefore no type checking is done, unless ``always`` is ``True``. This can also be used as a class decorator. This will wrap all type annotated methods, including ``@classmethod``, ``@staticmethod``, and ``@property`` decorated methods, in the class with the ``@typechecked`` decorator. :param func: the function or class to enable type checking for :param always: ``True`` to enable type checks even in optimized mode """ if func is None: return partial(typechecked, always=always, _localns=_localns) if not __debug__ and not always: # pragma: no cover return func if isclass(func): prefix = func.__qualname__ + '.' for key, attr in func.__dict__.items(): if inspect.isfunction(attr) or inspect.ismethod(attr) or inspect.isclass(attr): if attr.__qualname__.startswith(prefix) and getattr(attr, '__annotations__', None): setattr(func, key, typechecked(attr, always=always, _localns=func.__dict__)) elif isinstance(attr, (classmethod, staticmethod)): if getattr(attr.__func__, '__annotations__', None): wrapped = typechecked(attr.__func__, always=always, _localns=func.__dict__) setattr(func, key, type(attr)(wrapped)) elif isinstance(attr, property): kwargs = dict(doc=attr.__doc__) for name in ("fset", "fget", "fdel"): property_func = getattr(attr, name) if property_func is None: continue kwargs[name] = typechecked( property_func, always=always, _localns=func.__dict__ ) setattr(func, key, property(**kwargs)) return func # Find the frame in which the function was declared, for resolving forward references later if _localns is None: _localns = sys._getframe(1).f_locals # Find either the first Python wrapper or the actual function python_func = inspect.unwrap(func, stop=lambda f: hasattr(f, '__code__')) if not getattr(func, '__annotations__', None): warn('no type annotations present -- not typechecking {}'.format(function_name(func))) return func def wrapper(*args, **kwargs): memo = _CallMemo(python_func, _localns, args=args, kwargs=kwargs) check_argument_types(memo) retval = func(*args, **kwargs) try: check_return_type(retval, memo) except TypeError as exc: raise TypeError(*exc.args) from None # If a generator is returned, wrap it if its yield/send/return types can be checked if inspect.isgenerator(retval) or isasyncgen(retval): return_type = memo.type_hints.get('return') if return_type: origin = getattr(return_type, '__origin__', None) if origin in generator_origin_types: return TypeCheckedGenerator(retval, memo) elif origin is not None and origin in asyncgen_origin_types: return TypeCheckedAsyncGenerator(retval, memo) return retval async def async_wrapper(*args, **kwargs): memo = _CallMemo(python_func, _localns, args=args, kwargs=kwargs) check_argument_types(memo) retval = await func(*args, **kwargs) check_return_type(retval, memo) return retval if inspect.iscoroutinefunction(func): if python_func.__code__ is not async_wrapper.__code__: return wraps(func)(async_wrapper) else: if python_func.__code__ is not wrapper.__code__: return wraps(func)(wrapper) # the target callable was already wrapped return func class TypeWarning(UserWarning): """ A warning that is emitted when a type check fails. :ivar str event: ``call`` or ``return`` :ivar Callable func: the function in which the violation occurred (the called function if event is ``call``, or the function where a value of the wrong type was returned from if event is ``return``) :ivar str error: the error message contained by the caught :class:`TypeError` :ivar frame: the frame in which the violation occurred """ __slots__ = ('func', 'event', 'message', 'frame') def __init__(self, memo: Optional[_CallMemo], event: str, frame, exception: Union[str, TypeError]): # pragma: no cover self.func = memo.func self.event = event self.error = str(exception) self.frame = frame if self.event == 'call': caller_frame = self.frame.f_back event = 'call to {}() from {}:{}'.format( function_name(self.func), caller_frame.f_code.co_filename, caller_frame.f_lineno) else: event = 'return from {}() at {}:{}'.format( function_name(self.func), self.frame.f_code.co_filename, self.frame.f_lineno) super().__init__('[{thread_name}] {event}: {self.error}'.format( thread_name=threading.current_thread().name, event=event, self=self)) @property def stack(self): """Return the stack where the last frame is from the target function.""" return extract_stack(self.frame) def print_stack(self, file: TextIO = None, limit: int = None) -> None: """ Print the traceback from the stack frame where the target function was run. :param file: an open file to print to (prints to stdout if omitted) :param limit: the maximum number of stack frames to print """ print_stack(self.frame, limit, file) class TypeChecker: """ A type checker that collects type violations by hooking into :func:`sys.setprofile`. :param packages: list of top level modules and packages or modules to include for type checking :param all_threads: ``True`` to check types in all threads created while the checker is running, ``False`` to only check in the current one :param forward_refs_policy: how to handle unresolvable forward references in annotations .. deprecated:: 2.6 Use :func:`~.importhook.install_import_hook` instead. This class will be removed in v3.0. """ def __init__(self, packages: Union[str, Sequence[str]], *, all_threads: bool = True, forward_refs_policy: ForwardRefPolicy = ForwardRefPolicy.ERROR): assert check_argument_types() warn('TypeChecker has been deprecated and will be removed in v3.0. ' 'Use install_import_hook() or the pytest plugin instead.', DeprecationWarning) self.all_threads = all_threads self.annotation_policy = forward_refs_policy self._call_memos = {} # type: Dict[Any, _CallMemo] self._previous_profiler = None self._previous_thread_profiler = None self._active = False if isinstance(packages, str): self._packages = (packages,) else: self._packages = tuple(packages) @property def active(self) -> bool: """Return ``True`` if currently collecting type violations.""" return self._active def should_check_type(self, func: Callable) -> bool: if not func.__annotations__: # No point in checking if there are no type hints return False elif isasyncgenfunction(func): # Async generators cannot be supported because the return arg is of an opaque builtin # type (async_generator_wrapped_value) return False else: # Check types if the module matches any of the package prefixes return any(func.__module__ == package or func.__module__.startswith(package + '.') for package in self._packages) def start(self): if self._active: raise RuntimeError('type checker already running') self._active = True # Install this instance as the current profiler self._previous_profiler = sys.getprofile() sys.setprofile(self) # If requested, set this instance as the default profiler for all future threads # (does not affect existing threads) if self.all_threads: self._previous_thread_profiler = threading._profile_hook threading.setprofile(self) def stop(self): if self._active: if sys.getprofile() is self: sys.setprofile(self._previous_profiler) else: # pragma: no cover warn('the system profiling hook has changed unexpectedly') if self.all_threads: if threading._profile_hook is self: threading.setprofile(self._previous_thread_profiler) else: # pragma: no cover warn('the threading profiling hook has changed unexpectedly') self._active = False def __enter__(self): self.start() return self def __exit__(self, exc_type, exc_val, exc_tb): self.stop() def __call__(self, frame, event: str, arg) -> None: # pragma: no cover if not self._active: # This happens if all_threads was enabled and a thread was created when the checker was # running but was then stopped. The thread's profiler callback can't be reset any other # way but this. sys.setprofile(self._previous_thread_profiler) return # If an actual profiler is running, don't include the type checking times in its results if event == 'call': try: func = find_function(frame) except Exception: func = None if func is not None and self.should_check_type(func): memo = self._call_memos[frame] = _CallMemo( func, frame.f_locals, forward_refs_policy=self.annotation_policy) if memo.is_generator: return_type_hint = memo.type_hints['return'] if return_type_hint is not None: origin = getattr(return_type_hint, '__origin__', None) if origin in generator_origin_types: # Check the types of the yielded values memo.type_hints['return'] = return_type_hint.__args__[0] else: try: check_argument_types(memo) except TypeError as exc: warn(TypeWarning(memo, event, frame, exc)) if self._previous_profiler is not None: self._previous_profiler(frame, event, arg) elif event == 'return': if self._previous_profiler is not None: self._previous_profiler(frame, event, arg) if arg is None: # a None return value might mean an exception is being raised but we have no way of # checking return memo = self._call_memos.get(frame) if memo is not None: try: if memo.is_generator: check_type('yielded value', arg, memo.type_hints['return'], memo) else: check_return_type(arg, memo) except TypeError as exc: warn(TypeWarning(memo, event, frame, exc)) if not memo.is_generator: del self._call_memos[frame] elif self._previous_profiler is not None: self._previous_profiler(frame, event, arg)
glenngillen/dotfiles
.vscode/extensions/ms-python.python-2021.5.842923320/pythonFiles/lib/jedilsp/typeguard/__init__.py
Python
mit
46,364
#!/usr/bin/env python # Calculate a table of dihedral angle interactions used in the alpha-helix # and beta-sheet regions of the frustrated protein model described in # provided in figure 8 of the supplemental materials section of: # AI Jewett, A Baumketner and J-E Shea, PNAS, 101 (36), 13192-13197, (2004) # Note that the "A" and "B" parameters were incorrectly reported to be # 5.4*epsilon and 6.0*epsilon. The values used were 5.6 and 6.0 epsilon. # The phiA and phiB values were 57.29577951308232 degrees (1 rad) # and 180 degrees, respectively. Both expA and expB were 6.0. # # To generate the table used for the alpha-helix (1 degree resolution) use this: # ./calc_dihedral_table.py 6.0 57.29577951308232 6 5.6 180 6 0.0 359 360 # To generate the table used for the beta-sheets (1 degree resolution) use this: # ./calc_dihedral_table.py 5.6 57.29577951308232 6 6.0 180 6 0.0 359 360 # # (If you're curious as to why I set the location of the minima at phi_alpha # to 1.0 radians (57.2957795 degrees), there was no particularly good reason. # I think the correct value turns out to be something closer to 50 degrees.) from math import * import sys # The previous version included the repulsive core term def U(phi, A, phiA, expA, B, phiB, expB, use_radians=False): conv_units = pi/180.0 if use_radians: conv_units = 1.0 termA = pow(cos(0.5*(phi-phiA)*conv_units), expA) termB = pow(cos(0.5*(phi-phiB)*conv_units), expB) return -A*termA - B*termB # The previous version included the repulsive core term def F(phi, A, phiA, expA, B, phiB, expB, use_radians=False): conv_units = pi/180.0 if use_radians: conv_units = 1.0 termA = (0.5*sin(0.5*(phi-phiA)*conv_units) * expA * pow(cos(0.5*(phi-phiA)*conv_units), expA-1.0)) termB = (0.5*sin(0.5*(phi-phiB)*conv_units) * expB * pow(cos(0.5*(phi-phiB)*conv_units), expB-1.0)) return -conv_units*(A*termA + B*termB) if len(sys.argv) != 10: sys.stderr.write("Error: expected 9 arguments:\n" "\n" "Usage: "+sys.argv[0]+" A phiA expA B phiB expB phiMin phiMax N\n\n") sys.exit(-1) A = float(sys.argv[1]) phiA = float(sys.argv[2]) expA = float(sys.argv[3]) B = float(sys.argv[4]) phiB = float(sys.argv[5]) expB = float(sys.argv[6]) phi_min = float(sys.argv[7]) phi_max = float(sys.argv[8]) N = int(sys.argv[9]) for i in range(0,N): phi = phi_min + i*(phi_max - phi_min)/(N-1) U_phi = U(phi, A, phiA, expA, B, phiB, expB, use_radians=False) F_phi = F(phi, A, phiA, expA, B, phiB, expB, use_radians=False) print(str(i+1)+' '+str(phi)+' '+str(U_phi)+' '+str(F_phi))
crtrott/lammps
tools/moltemplate/examples/coarse_grained_examples/protein_folding_examples/1bead+chaperone/frustrated/moltemplate_files/generate_tables/calc_dihedral_table.py
Python
gpl-2.0
2,713
# -*- coding: utf-8 -*- # 213. House Robber II # Note: This is an extension of House Robber. # # After robbing those houses on that street, the thief has found himself a new place for his thievery # so that he will not get too much attention. This time, all houses at this place are arranged in a circle. # That means the first house is the neighbor of the last one. # Meanwhile, the security system for these houses remain the same as for those in the previous street. # # Given a list of non-negative integers representing the amount of money of each house, # determine the maximum amount of money you can rob tonight without alerting the police. # http://bookshadow.com/weblog/2015/05/20/leetcode-house-robber-ii/ # # 讨论是否抢劫第一件房屋。如果是,则不可以抢最后一件房屋。否则,可以抢最后一间房屋。 # # 以此为依据,将环形DP问题转化为两趟线性DP问题,可以复用House Robber的代码。 # # 另外需要特判一下只有一件房屋的情形。 class Solution(object): def rob(self, nums): """ :type nums: List[int] :rtype: int """ if len(nums) == 1: return nums[0] return max(self.robLinear(nums[1:]), self.robLinear(nums[:-1])) def robLinear(self, nums): dp = [0] * len(nums) if not nums: return 0 elif len(nums) == 1: return nums[0] dp[0] = nums[0] dp[1] = max(nums[0], nums[1]) for i in range(2, len(nums)): dp[i] = max(dp[i - 2] + nums[i], dp[i - 1]) return dp[-1] if __name__ == '__main__': print Solution().rob([1, 2, 2, 1])
gengwg/leetcode
213_house_robber_ii.py
Python
apache-2.0
1,670
# Copyright (c) 2019, CRS4 # # Permission is hereby granted, free of charge, to any person obtaining a copy of # this software and associated documentation files (the "Software"), to deal in # the Software without restriction, including without limitation the rights to # use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of # the Software, and to permit persons to whom the Software is furnished to do so, # subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS # FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR # COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER # IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN # CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. try: import simplejson as json except ImportError: import json from rest_framework.views import APIView from rest_framework import permissions, status from rest_framework.response import Response from rest_framework.exceptions import NotFound from django.db import IntegrityError from reviews_manager.models import ROIsAnnotationStep, ClinicalAnnotationStep from reviews_manager.serializers import ClinicalAnnotationStepROIsTreeSerializer from clinical_annotations_manager.models import SliceAnnotation, CoreAnnotation, FocusRegionAnnotation from clinical_annotations_manager.serializers import SliceAnnotationSerializer, SliceAnnotationDetailsSerializer,\ CoreAnnotationSerializer, CoreAnnotationDetailsSerializer, FocusRegionAnnotationSerializer, \ FocusRegionAnnotationDetailsSerializer import logging logger = logging.getLogger('promort') class AnnotatedROIsTreeList(APIView): permission_classes = (permissions.IsAuthenticated,) def _get_clinical_annotation_step_id(self, clinical_annotation_step_label): try: obj = ClinicalAnnotationStep.objects.get(label=clinical_annotation_step_label) return obj.id except ClinicalAnnotationStep.DoesNotExist: raise NotFound('There is no Clinical Annotation step with label \'%s\'' % clinical_annotation_step_label) def _update_annotation(self, roi_data, clinical_annotation_step_label): clinical_annotation_id = self._get_clinical_annotation_step_id(clinical_annotation_step_label) annotation_status = {'annotated': False} annotations = roi_data.pop('clinical_annotations') for annotation in annotations: if annotation['annotation_step'] == int(clinical_annotation_id): annotation_status['annotated'] = True roi_data.update(annotation_status) def get(self, request, rois_annotation_step, clinical_annotation_step, format=None): try: obj = ROIsAnnotationStep.objects.get(label=rois_annotation_step) except ROIsAnnotationStep.DoesNotExist: raise NotFound('There is no ROIsAnnotationStep with ID %s' % rois_annotation_step) serializer = ClinicalAnnotationStepROIsTreeSerializer(obj) rois_tree = serializer.data for slice in rois_tree['slices']: self._update_annotation(slice, clinical_annotation_step) for core in slice['cores']: self._update_annotation(core, clinical_annotation_step) for focus_region in core['focus_regions']: self._update_annotation(focus_region, clinical_annotation_step) return Response(rois_tree, status=status.HTTP_200_OK) class ClinicalAnnotationStepAnnotationsList(APIView): permission_classes = (permissions.IsAuthenticated,) def get(self, request, clinical_annotation_step): annotations = [] slice_annotations = SliceAnnotation.objects.filter(annotation_step__label=clinical_annotation_step) annotations.extend(SliceAnnotationSerializer(slice_annotations, many=True).data) core_annotations = CoreAnnotation.objects.filter(annotation_step__label=clinical_annotation_step) annotations.extend(CoreAnnotationSerializer(core_annotations, many=True).data) focus_region_annotations = FocusRegionAnnotation.objects.filter(annotation_step__label=clinical_annotation_step) annotations.extend(FocusRegionAnnotationSerializer(focus_region_annotations, many=True).data) return Response(annotations, status=status.HTTP_200_OK) def delete(self, request, clinical_annotation_step): SliceAnnotation.objects.filter(annotation_step__label=clinical_annotation_step).delete() CoreAnnotation.objects.filter(annotation_step__label=clinical_annotation_step).delete() FocusRegionAnnotation.objects.filter(annotation_step__label=clinical_annotation_step).delete() return Response(status=status.HTTP_204_NO_CONTENT) class SliceAnnotationList(APIView): permission_classes = (permissions.IsAuthenticated,) def get(self, request, slice_id, format=None): slice_annotations = SliceAnnotation.objects.filter(slice=slice_id) serializer = SliceAnnotationSerializer(slice_annotations, many=True) return Response(serializer.data, status=status.HTTP_200_OK) class ClinicalAnnotationStepObject(APIView): def _get_clinical_annotation_step_id(self, clinical_annotation_step_label): try: obj = ClinicalAnnotationStep.objects.get(label=clinical_annotation_step_label) return obj.id except ClinicalAnnotationStep.DoesNotExist: raise NotFound('There is no Clinical Annotation step with label \'%s\'' % clinical_annotation_step_label) class SliceAnnotationDetail(ClinicalAnnotationStepObject): permission_classes = (permissions.IsAuthenticated,) def _get_annotation(self, slice_id, annotation_step_label): annotation_step_id = self._get_clinical_annotation_step_id(annotation_step_label) try: return SliceAnnotation.objects.get(slice=slice_id, annotation_step=annotation_step_id) except SliceAnnotation.DoesNotExist: raise NotFound('There is no annotation for slice %r related to annotation step %r' % (slice_id, annotation_step_label)) def get(self, request, slice_id, label, format=None): slice_annotation = self._get_annotation(slice_id, label) serializer = SliceAnnotationDetailsSerializer(slice_annotation) return Response(serializer.data, status=status.HTTP_200_OK) def post(self, request, slice_id, label, format=None): slice_annotation_data = request.data slice_annotation_data['slice'] = slice_id slice_annotation_data['annotation_step'] = self._get_clinical_annotation_step_id(label) slice_annotation_data['author'] = request.user.username serializer = SliceAnnotationSerializer(data=slice_annotation_data) if serializer.is_valid(): try: serializer.save() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'duplicated annotation for slice %d of annotation step %s' % (slice_id, label) }, status=status.HTTP_409_CONFLICT) return Response(serializer.data, status=status.HTTP_201_CREATED) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) def delete(self, request, slice_id, label, format=None): slice_annotation = self._get_annotation(slice_id, label) try: slice_annotation.delete() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'unable to complete delete operation, there are still references to this object' }, status=status.HTTP_409_CONFLICT) return Response(status=status.HTTP_204_NO_CONTENT) class CoreAnnotationList(APIView): permissions = (permissions.IsAuthenticated,) def get(self, request, core_id, format=None): core_annotations = CoreAnnotation.objects.filter(core=core_id) serializer = CoreAnnotationSerializer(core_annotations, many=True) return Response(serializer.data, status=status.HTTP_200_OK) class CoreAnnotationDetail(ClinicalAnnotationStepObject): permission_classes = (permissions.IsAuthenticated,) def _get_annotation(self, core_id, annotation_step_label): annotation_step_id = self._get_clinical_annotation_step_id(annotation_step_label) try: return CoreAnnotation.objects.get(core=core_id, annotation_step=annotation_step_id) except CoreAnnotation.DoesNotExist: raise NotFound('There is no annotation for core %r related to annotation step %r' % (core_id, annotation_step_id)) def get(self, request, core_id, label, format=None): core_annotation = self._get_annotation(core_id, label) serializer = CoreAnnotationDetailsSerializer(core_annotation) return Response(serializer.data, status=status.HTTP_200_OK) def post(self, request, core_id, label, format=None): core_annotation_data = request.data core_annotation_data['core'] = core_id core_annotation_data['annotation_step'] = self._get_clinical_annotation_step_id(label) core_annotation_data['author'] = request.user.username serializer = CoreAnnotationSerializer(data=core_annotation_data) if serializer.is_valid(): try: serializer.save() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'duplicated annotation for core %d of annotation step %s' % (core_id, label) }, status=status.HTTP_409_CONFLICT) return Response(serializer.data, status=status.HTTP_201_CREATED) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) def delete(self, request, core_id, label, format=None): core_annotation = self._get_annotation(core_id, label) try: core_annotation.delete() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'unable to complete delete operation, there are still references to this object' }, status=status.HTTP_409_CONFLICT) return Response(status=status.HTTP_204_NO_CONTENT) class FocusRegionAnnotationList(APIView): permissions = (permissions.IsAuthenticated,) def get(self, request, focus_region_id, format=None): focus_region_annotations = FocusRegionAnnotation.objects.filter(focus_region=focus_region_id) serializer = FocusRegionAnnotationSerializer(focus_region_annotations, many=True) return Response(serializer.data, status=status.HTTP_200_OK) class FocusRegionAnnotationDetail(ClinicalAnnotationStepObject): permission_classes = (permissions.IsAuthenticated,) def _get_annotation(self, focus_region_id, annotation_step_label): annotation_step_id = self._get_clinical_annotation_step_id(annotation_step_label) try: return FocusRegionAnnotation.objects.get(focus_region=focus_region_id, annotation_step=annotation_step_id) except FocusRegionAnnotation.DoesNotExist: raise NotFound('There is no annotation for focus_region %r related to annotation step %r' % (focus_region_id, annotation_step_id)) def get(self, request, focus_region_id, label, format=None): focus_region_annotation = self._get_annotation(focus_region_id, label) serializer = FocusRegionAnnotationDetailsSerializer(focus_region_annotation) return Response(serializer.data, status=status.HTTP_200_OK) def _prepare_gleason_elements(self, gleason_elements): for element in gleason_elements: element['json_path'] = json.dumps(element['json_path']) try: element['cellular_density_helper_json'] = json.dumps(element['cellular_density_helper_json']) except KeyError: element['cellular_density_helper_json'] = None return gleason_elements def post(self, request, focus_region_id, label, format=None): focus_region_annotation_data = request.data focus_region_annotation_data['focus_region'] = focus_region_id focus_region_annotation_data['annotation_step'] = self._get_clinical_annotation_step_id(label) focus_region_annotation_data['author'] = request.user.username if focus_region_annotation_data.get('gleason_elements'): focus_region_annotation_data['gleason_elements'] = \ self._prepare_gleason_elements(focus_region_annotation_data['gleason_elements']) if focus_region_annotation_data.get('cellular_density_helper_json'): focus_region_annotation_data['cellular_density_helper_json'] = \ json.dumps(focus_region_annotation_data['cellular_density_helper_json']) serializer = FocusRegionAnnotationSerializer(data=focus_region_annotation_data) if serializer.is_valid(): try: serializer.save() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'duplicated annotation for focus region %d of annotation step %d' % (focus_region_id, label) }, status=status.HTTP_409_CONFLICT) return Response(serializer.data, status=status.HTTP_201_CREATED) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) def delete(self, request, focus_region_id, label, format=None): focus_region_annotation = self._get_annotation(focus_region_id, label) try: focus_region_annotation.delete() except IntegrityError: return Response({ 'status': 'ERROR', 'message': 'unable to complete delete operation, there are still references to this object' }, status=status.HTTP_409_CONFLICT) return Response(status=status.HTTP_204_NO_CONTENT)
lucalianas/ProMort
promort/clinical_annotations_manager/views.py
Python
mit
14,550
from changes.models import User from changes.testutils import APITestCase class UserDetailsTest(APITestCase): def test_simple(self): user = self.create_user(email='foobar@example.com') path = '/api/0/users/{0}/'.format(user.id) resp = self.client.get(path) assert resp.status_code == 200 data = self.unserialize(resp) assert data['id'] == user.id.hex class UpdateUserTest(APITestCase): def test_simple(self): user = self.create_user( email='foobar@example.com', is_admin=False, ) path = '/api/0/users/{0}/'.format(user.id) # ensure endpoint requires authentication resp = self.client.post(path, data={ 'is_admin': '1' }) assert resp.status_code == 401 self.login_default() # ensure endpoint requires admin resp = self.client.post(path, data={ 'is_admin': '1' }) assert resp.status_code == 403 self.login_default_admin() # test setting is_admin resp = self.client.post(path, data={ 'is_admin': '1' }) assert resp.status_code == 200 data = self.unserialize(resp) assert data['isAdmin'] is True user = User.query.get(user.id) assert user.is_admin is True
alex/changes
tests/changes/api/test_user_details.py
Python
apache-2.0
1,350
# -*- coding: utf-8 -*- """ /*************************************************************************** DsgTools A QGIS plugin Brazilian Army Cartographic Production Tools ------------------- begin : 2016-01-18 git sha : $Format:%H$ copyright : (C) 2016 by Luiz Andrade - Cartographic Engineer @ Brazilian Army email : luiz.claudio@dsg.eb.mil.br ***************************************************************************/ /*************************************************************************** * * * This program is free software; you can redistribute it and/or modify * * it under the terms of the GNU General Public License as published by * * the Free Software Foundation; either version 2 of the License, or * * (at your option) any later version. * * * ***************************************************************************/ """ ##DSG=group ##Inventario=vector ##Override_CRS=boolean False ##CRS=crs ##VRT=output raster import processing from processing.core.GeoAlgorithmExecutionException import GeoAlgorithmExecutionException from qgis.core import QgsVectorLayer, QgsRasterLayer, QgsSpatialIndex, QgsFeatureRequest, QgsCoordinateTransform, QgsFeature, QgsCoordinateReferenceSystem from qgis.PyQt.QtCore import QSettings import os #script methods def createVrt(inventario, vrt): #Camada de inventario layer = processing.getObject(Inventario) count = 0 size = layer.featureCount() p = 0 progress.setPercentage(p) rasterList = [] for feature in layer.getFeatures(): filename = feature['fileName'] raster = QgsRasterLayer(filename, filename) if Override_CRS: raster.setCrs( QgsCoordinateReferenceSystem(int(CRS.split(':')[-1]), QgsCoordinateReferenceSystem.EpsgCrsId) ) rasterList.append(raster) ovr = filename+'.ovr' if not os.path.isfile(ovr): progress.setText('Fazendo Pirâmides...') #('gdalogr:overviews', input, levels=8, clean=False, resampling_method=0(nearest), format=1(Gtiff .ovr)) processing.runalg('gdalogr:overviews', raster, '4 8 32 128', True, 0, 1) if int(float(count)/size*100) != p: p = int(float(count)/size*100) progress.setPercentage(p) count += 1 progress.setText('Fazendo raster virtual...') processing.runalg('gdalogr:buildvirtualraster', rasterList, 0, False, False, VRT) #end of script methods #Making the actual work s = QSettings() oldValidation = s.value( "/Projections/defaultBehaviour") s.setValue( "/Projections/defaultBehaviour", "useGlobal" ) createVrt(Inventario, VRT) s.setValue( "/Projections/defaultBehaviour", oldValidation ) #ending the actual work
lcoandrade/DsgTools
core/Misc/QGIS_Scripts/virtual_raster_inloco.py
Python
gpl-2.0
3,081
""" Django settings for chatbot_website project. Generated by 'django-admin startproject' using Django 1.10. For more information on this file, see https://docs.djangoproject.com/en/1.10/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.10/ref/settings/ """ import os # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.10/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = os.environ['CHATBOT_SECRET_KEY'] # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = [] # Application definition INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'channels', 'chatbot_interface', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'chatbot_website.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'chatbot_website.wsgi.application' # Database # https://docs.djangoproject.com/en/1.10/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Password validation # https://docs.djangoproject.com/en/1.10/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] CHANNEL_LAYERS = { "default": { "BACKEND": "asgi_redis.RedisChannelLayer", "CONFIG": { "hosts": [os.environ.get('REDIS_URL', 'redis://localhost:6379')], }, "ROUTING": "chatbot_interface.routing.channel_routing", }, } LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'handlers': { 'file_django': { 'level': 'DEBUG', 'class': 'logging.FileHandler', 'filename': 'logs/debug_django.log', }, 'file_chatbot': { 'level': 'DEBUG', 'class': 'logging.FileHandler', 'filename': 'logs/debug_chatbot.log', }, 'console': { 'level': 'DEBUG', 'class': 'logging.StreamHandler', 'stream': 'ext://sys.stdout', }, }, 'loggers': { 'django': { 'handlers': ['console', 'file_django'], 'level': 'INFO', 'propagate': True, }, 'chatbot_interface': { 'handlers': ['console', 'file_chatbot'], 'level': os.getenv('DJANGO_LOG_LEVEL', 'INFO'), }, }, } # Internationalization # https://docs.djangoproject.com/en/1.10/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.10/howto/static-files/ STATIC_URL = '/static/'
Catherine-Chu/DeepQA
chatbot_website/chatbot_website/settings.py
Python
apache-2.0
4,300
from __future__ import division from __future__ import print_function from __future__ import absolute_import import fs_uae_launcher.fsui as fsui from .IRCPanel import IRCPanel from .Netplay import Netplay class LobbyPanel(IRCPanel): def __init__(self, parent): IRCPanel.__init__(self, parent) self.channel = Netplay.lobby #self.layout = fsui.VerticalLayout() """ label = fsui.BoldLabel(self, "Lobby (and Server Messages)") self.layout.add(label, fill=True) self.layout.add_spacer(6) self.main = fsui.Panel(self) self.main.layout = fsui.HorizontalLayout() self.output = fsui.TextArea(self.main) self.main.layout.add(self.output, expand=4, fill=True) self.main.layout.add_spacer(6) self.users = fsui.TextArea(self.main) self.main.layout.add(self.users, expand=1, fill=True) self.layout.add(self.main, expand=True, fill=True) self.layout.add_spacer(6) self.input = fsui.TextField(self) self.input.on_activate = self.on_input self.layout.add(self.input, fill=True) #self.browse_button = fsui.Button(self, "Browse") #self.layout.add(self.browse_button) #self.browse_button = fsui.Button(self, "Browse") #self.layout.add(self.browse_button) #self.channel = "#FS-UAE" """ #def on_destroy(self): # print("on_destroy") # self.irc.stop() """ def append_text(self, message): self.output.append_text(message + "\n") def on_input(self): message = self.input.get_text() self.input.set_text("") if message.startswith("/"): #message = message[1:] #parts = message.split(" ") #command = parts[0].lower() #args = parts[1:] #name = "command_" + command #try: # method = getattr(self, name) #except AttributeError: # self.append_text("Unknown command: " + command) #else: # method(args) if not self.irc.handle_command_string(message): self.append_text("Unknown command: " + message) else: self.append_text(u"<{0}> {1}".format(IRC.my_nick, message)) self.irc.privmsg(Netplay.lobby, message) """
lunixbochs/fs-uae-gles
launcher/fs_uae_launcher/LobbyPanel.py
Python
gpl-2.0
2,483
# txt2sif.py -- Convert .txt into a .sif format import sys import argparse def main(): parser = argparse.ArgumentParser(description='Convert .txt to .sif') parser.add_argument('txt', help="""txt file to convert. Fields are : <gene 1 name in ACSN> <name of relationship> <gene 2 name in ACSN> <semi-colon separated list of PubMedID >. Columns are TAB separated """) parser.add_argument('sif', help='SIF file to create.') args = parser.parse_args() # read the txt file and convert it into a sif file with open(args.txt, 'r') as fdr: with open(args.sif, 'w') as fdw: for line in fdr: line_split = line.split('\t') fdw.write("%s\t%s\t%s\n" % (line_split[0], line_split[1], line_split[2])) fdw.close() fdr.close() if __name__ == "__main__": main()
chagaz/sfan
code/txt2sif.py
Python
mit
857
# This code is so you can run the samples without installing the package import sys import os sys.path.insert(0, os.path.join(os.path.dirname(__file__), '..')) # testinfo = "f 10 0.033, s, f 20 0.033, s, f 30 0.033, s, f 30 0.033, s, q" tags = "particles, Flower" import pyglet import summa from summa.director import director from summa.actions import * from summa.layer import * from summa.particle_systems import * class L(Layer): def __init__(self): super( L, self).__init__() # p = Fireworks() # p = Explosion() # p = Fire() p = Flower() # p = Sun() # p = Spiral() # p = Meteor() # p = Galaxy() p.position = (320,240) self.add( p ) def main(): director.init( resizable=True ) main_scene = summa.scene.Scene() main_scene.add( L() ) director.run( main_scene ) if __name__ == '__main__': main()
shackra/thomas-aquinas
tests/test_particle_flower.py
Python
bsd-3-clause
911
import wx import sys import os for item in ("libsrvr", "../server/lib"): if os.path.exists(item): sys.path.insert(0, item) break import sequip from FinishConstrHandlers import FinishConstrHandlers from DependencyPanel import DependencyPanel from config import Config from ige.ospace import Rules from ige.ospace.Rules import Techs from ConstructionDlg import ConstructionDlg from AttributesListCtrl import AttributesListCtrl stratRes = { 0: "None", 1: "Uranium", 2: "Titanium", 3: "Chromium", 4: "Silicium", 5: "Carboneum", 6: "Antimatter", 7: "Plutonium", 8: "Wolframium", 100: "Mutagen", 1000: "Unnilseptium" } MENU_EXIT = 101 MENU_SHOW_B = 102 MENU_SHOW_C = 103 MENU_SHOW_H = 104 MENU_IMPROVEMENT_1 = 105 MENU_IMPROVEMENT_2 = 106 MENU_IMPROVEMENT_3 = 107 MENU_IMPROVEMENT_4 = 108 MENU_IMPROVEMENT_5 = 109 MENU_LEVEL_1 = 110 MENU_LEVEL_2 = 111 MENU_LEVEL_3 = 112 MENU_LEVEL_4 = 113 MENU_LEVEL_5 = 114 MENU_LEVEL_6 = 120 MENU_LEVEL_99 = 115 MENU_VIEW_LEVEL = 116 MENU_VIEW_RACE = 117 MENU_VIEW_REQ_LEVEL = 118 MENU_CONSTRUCTION_DLG = 119 def bool2Text(value): if value: return "Yes" else: return "No" def structWeapons2Text(array): string = '' i = 0 j = 0 for weaponNum in array: if i > 3: break if weaponNum > 0: if j > 0: string += ', ' string += '%d' % ( weaponNum ) string += ["S", "M", "L", "P", "?","?","?","?","?","?"][i] j += 1 i += 1 return string def perc2Text(value): string = '%d%%' % (value * 100) return string def perc100_2Text(value): string = '%d%%' % (value) return string V_NONE = 0x00 V_STRUCT = 0x01 V_HULL = 0x02 V_SEQUIP = 0x04 V_PROJECT = 0x08 V_EFF = 0x10 V_ALL = V_STRUCT|V_HULL|V_SEQUIP|V_PROJECT techAttrs = {} defaultAttr = ('Not specified', V_NONE, True, None, int) def addAttr(attr, descr, props, showIfDefault, default = 0, convertor = str): global techAttrs techAttrs[attr] = (descr, props, showIfDefault, default, convertor) addAttr('buildProd', 'Constr. reqs - construction points', V_ALL, 0) addAttr('operBio', 'Operational reqs - biomatter', V_ALL, 0) addAttr('operMin', 'Operational reqs - minerals', V_ALL, 0) addAttr('operEn', 'Operational reqs - energy', V_ALL, 0) addAttr('operWorkers', 'Operational reqs - workers', V_ALL, 0) addAttr('prodBio', 'Production - biomatter', V_STRUCT|V_EFF, 0) addAttr('prodMin', 'Production - minerals', V_STRUCT|V_EFF, 0) addAttr('prodEn', 'Production - energy', V_STRUCT|V_EFF, 0) addAttr('prodPop', 'Production - population', V_STRUCT|V_EFF, 0) addAttr('prodProd', 'Production - constr. points', V_STRUCT|V_PROJECT|V_EFF, 0) addAttr('prodSci', 'Production - research points', V_STRUCT|V_PROJECT|V_EFF, 0) addAttr('prodEnv', 'Production - env. effect', V_STRUCT|V_EFF, 0) addAttr('storBio', 'Storage - biomatter', V_STRUCT|V_EFF, 0) addAttr('storMin', 'Storage - minerals', V_STRUCT|V_EFF, 0) addAttr('storEn', 'Storage - energy', V_ALL|V_EFF, 0) addAttr('storPop', 'Accommodate population', V_STRUCT|V_EFF, 0) addAttr('revoltThr', 'Lowers revolt threshold by', V_STRUCT|V_PROJECT|V_EFF, 0) addAttr('moraleTrgt', 'Increases max morale by', V_STRUCT|V_PROJECT|V_EFF, 0) addAttr('govPwr', 'Government power', V_STRUCT|V_EFF, 0) addAttr('maxHP', 'Hit points', V_STRUCT|V_HULL|V_SEQUIP|V_EFF, 0) addAttr('scannerPwr', 'Scanner power', V_STRUCT|V_SEQUIP|V_EFF, 0) addAttr('planetShield', 'Planetary shield', V_STRUCT|V_EFF, 0) addAttr('systemAtt', 'Fleet attack (bonus)', V_STRUCT|V_EFF, 0) addAttr('systemDef', 'Fleet defense (bonus)', V_STRUCT|V_EFF, 0) addAttr('refuelMax', 'Maximum refuel percent', V_STRUCT|V_EFF, 0, convertor = perc100_2Text) addAttr('refuelInc', 'Refuel increase percent', V_STRUCT|V_EFF, 0, convertor = perc100_2Text) addAttr('trainShipInc', 'Exp. points per turn', V_STRUCT|V_EFF, 0, convertor = float) addAttr('trainShipMax', 'Exp. cap (base exp multiple)', V_STRUCT|V_EFF, 0) addAttr('fleetSpeedBoost', 'Boost speed of fleets', V_STRUCT|V_EFF, 0, convertor = float) addAttr('structWeapons', 'Weapons', V_STRUCT, 0, convertor = structWeapons2Text) addAttr('weaponClass', 'Target class', V_SEQUIP, True, convertor = sequip.cclass2Text) addAttr('weaponDmgMin', 'Weapon minimum damage', V_SEQUIP|V_EFF, 0) addAttr('weaponDmgMax', 'Weapon maximum damage', V_SEQUIP|V_EFF, 0) addAttr('weaponIsMissile', 'Missile weapon (ECM counts)', V_SEQUIP|V_HULL, 0, convertor = bool2Text) addAttr('weaponIgnoreShield', 'Weapon ignore shield', V_SEQUIP|V_HULL, 0, convertor = bool2Text) addAttr('weaponAtt', 'Weapon attack', V_SEQUIP|V_EFF, 0) addAttr('weaponROF', 'Weapon Rate Of Fire', V_SEQUIP, 0, convertor = float) addAttr('minHull', 'Minimum required hull', V_SEQUIP|V_HULL, 0, convertor = sequip.cclass2Text) addAttr('weight', 'Weight', V_SEQUIP|V_HULL, 0) addAttr('slots', 'Slots', V_SEQUIP|V_HULL, 0) addAttr('maxWeight', 'Maximum payload', V_HULL, 0) addAttr('engPwr', 'Engine power', V_SEQUIP|V_EFF, 0) addAttr('signature', 'Scan signature', V_SEQUIP|V_HULL, 0) addAttr('signatureCloak', 'Signature visibility', V_SEQUIP|V_HULL, 0) addAttr('signatureDecloak', 'Signature visibility', V_SEQUIP|V_HULL, 0) addAttr('minSignature', 'Min. signature', V_SEQUIP|V_HULL, 0) addAttr('combatDef', 'Combat defence', V_SEQUIP|V_HULL|V_EFF, 0) addAttr('combatAtt', 'Combat attack', V_SEQUIP|V_HULL|V_EFF, 0) addAttr('missileDef', 'Missile defence', V_SEQUIP|V_EFF, 0) addAttr('combatAttPerc', 'Combat defense (extra)', V_SEQUIP|V_HULL|V_EFF, 0, convertor = perc2Text) addAttr('combatDefPerc', 'Combat attack (extra)', V_SEQUIP|V_HULL|V_EFF, 0, convertor = perc2Text) addAttr('missileDefPerc', 'Missile defence (extra)', V_SEQUIP|V_EFF, 0, convertor = perc2Text) addAttr('shieldPerc', 'Shield strength', V_SEQUIP|V_HULL|V_EFF, 0, convertor = perc2Text) addAttr('shieldRechargeFix', 'Shield recharge fixed', V_SEQUIP|V_HULL|V_EFF, 0) addAttr('shieldRechargePerc', 'Shield recharge percent', V_SEQUIP|V_HULL|V_EFF, 0, convertor = perc2Text) addAttr('damageAbsorb', 'Armor damage absorbstion', V_SEQUIP|V_HULL, 0) addAttr('addMP', 'Device MP', V_SEQUIP|V_HULL, 0) def getChildren(tech): return tech.researchEnables[1] + tech.researchEnables[2] + tech.researchEnables[3] + \ tech.researchEnables[4] + tech.researchEnables[5] def getParent(tech): if tech.researchRequires: return Rules.techs[tech.researchRequires[0][0]] else: return None class App(wx.App): """Application class.""" def OnInit(self): self.frame = TechViewer(None, -1, "OuterSpace Technology viewer") self.frame.Show() self.SetTopWindow(self.frame) return True class TechViewer(wx.Frame): def __init__(self, parent, id, title): wx.Frame.__init__(self, parent, id, title, pos = wx.DefaultPosition, size = (800, 600)) wx.EVT_CLOSE(self, self.OnClose) self.selected = None global config if config.Races.Bionic == None: config.Races.Bionic = 1 if config.Races.Human == None: config.Races.Human = 1 if config.Races.Cyborg == None: config.Races.Cyborg = 1 if config.View.Improvement == None: config.View.Improvement = 3 if config.View.Level == None: config.View.Level = 1 if config.View.Race == None: config.View.Race = 1 if config.Levels.Level1 == None: config.Levels.Level1 = 1 if config.Levels.Level2 == None: config.Levels.Level2 = 1 if config.Levels.Level3 == None: config.Levels.Level3 = 1 if config.Levels.Level4 == None: config.Levels.Level4 = 1 if config.Levels.Level5 == None: config.Levels.Level5 = 1 if config.Levels.Level6 == None: config.Levels.Level6 = 1 if config.Levels.Level99 == None: config.Levels.Level99 = 1 self.showBionic = config.Races.Bionic == "1" self.showHuman = config.Races.Human == "1" self.showCyborg = config.Races.Cyborg == "1" self.improvement = int(config.View.Improvement) self.levels = { 1: config.Levels.Level1 == "1", 2: config.Levels.Level2 == "1", 3: config.Levels.Level3 == "1", 4: config.Levels.Level4 == "1", 5: config.Levels.Level5 == "1", 6: config.Levels.Level6 == "1", 99: config.Levels.Level99 == "1" } self.viewLevel = config.View.Level == "1" self.viewRace = config.View.Race == "1" self.viewReqLevel = config.View.ReqLevel == "1" self.currentTech = None self.Centre(wx.BOTH) splitter = wx.SplitterWindow(self, -1, style = wx.SP_3D)# | wx.SP_NOBORDER | wx.NO_3D) def EmptyHandler(evt): pass wx.EVT_ERASE_BACKGROUND(splitter, EmptyHandler) tID = wx.NewId() self.tree = wx.TreeCtrl(splitter, tID, style = wx.TR_HAS_BUTTONS) wx.EVT_TREE_SEL_CHANGED(self, tID, self.OnSelChanged) self.rightPanel = wx.Panel(splitter, -1, style = wx.SP_NOBORDER | wx.NO_3D) box = wx.BoxSizer(wx.VERTICAL) tID = wx.NewId() self.list = AttributesListCtrl(self.rightPanel, tID, style = wx.LC_REPORT | wx.SUNKEN_BORDER) self.list.InsertColumn(0, "Name") self.list.InsertColumn(1, "Value") self.list.SetColumnWidth(0, 350) self.list.SetColumnWidth(1, wx.LIST_AUTOSIZE) self.finishHandlers = FinishConstrHandlers(self.list, self.improvement) self.prodBio = DependencyPanel(self.rightPanel, "Bio production depends on:", wx.GREEN, wx.BLACK) self.prodEn = DependencyPanel(self.rightPanel, "Energy production depends on:", wx.BLUE, wx.WHITE) self.prodCon = DependencyPanel(self.rightPanel, "Construction points production depends on:", wx.BLACK, wx.WHITE) box.Add(self.list, 1, wx.EXPAND) box.Add(wx.StaticLine(self.rightPanel, -1), 0, wx.EXPAND | wx.ALL, 4) box.Add(self.prodBio, 0, wx.EXPAND | wx.WEST, 4) box.Add(wx.StaticLine(self.rightPanel, -1), 0, wx.EXPAND | wx.ALL, 4) box.Add(self.prodEn, 0, wx.EXPAND | wx.WEST, 4) box.Add(wx.StaticLine(self.rightPanel, -1), 0, wx.EXPAND | wx.ALL, 4) box.Add(self.prodCon, 0, wx.EXPAND | wx.WEST, 4) box.Fit(self.rightPanel) self.rightPanel.SetSizer(box) splitter.SplitVertically(self.tree, self.rightPanel, 360) splitter.SetMinimumPaneSize(20) menuBar = wx.MenuBar() menu = wx.Menu() menu.AppendCheckItem(MENU_SHOW_B, "Show &Bionic") menu.Check(MENU_SHOW_B, self.showBionic) menu.AppendCheckItem(MENU_SHOW_C, "Show &Cyborg") menu.Check(MENU_SHOW_C, self.showCyborg) menu.AppendCheckItem(MENU_SHOW_H, "Show &Human") menu.Check(MENU_SHOW_H, self.showHuman) menu.AppendSeparator() menu.Append(MENU_EXIT, "E&xit") menuBar.Append(menu, "&Race") menu = wx.Menu() menu.AppendRadioItem(MENU_IMPROVEMENT_1, "Improvement 1") menu.AppendRadioItem(MENU_IMPROVEMENT_2, "Improvement 2") menu.AppendRadioItem(MENU_IMPROVEMENT_3, "Improvement 3") menu.AppendRadioItem(MENU_IMPROVEMENT_4, "Improvement 4") menu.AppendRadioItem(MENU_IMPROVEMENT_5, "Improvement 5") menuBar.Append(menu, "&Improvement") menu = wx.Menu() menu.AppendCheckItem(MENU_LEVEL_1, "Level 1") menu.AppendCheckItem(MENU_LEVEL_2, "Level 2") menu.AppendCheckItem(MENU_LEVEL_3, "Level 3") menu.AppendCheckItem(MENU_LEVEL_4, "Level 4") menu.AppendCheckItem(MENU_LEVEL_5, "Level 5") menu.AppendCheckItem(MENU_LEVEL_6, "Level 6") menu.AppendSeparator() menu.AppendCheckItem(MENU_LEVEL_99, "Additional") menuBar.Append(menu, "&Level") menu = wx.Menu() menu.AppendCheckItem(MENU_VIEW_LEVEL, "Level") menu.AppendCheckItem(MENU_VIEW_RACE, "Race") menu.AppendCheckItem(MENU_VIEW_REQ_LEVEL, "Required parent tech level") menuBar.Append(menu, "&View") menu = wx.Menu() menu.Append(MENU_CONSTRUCTION_DLG, "Show construction dialog") menuBar.Append(menu, "Ship &construction") self.SetMenuBar(menuBar) wx.EVT_MENU(self, MENU_EXIT, self.OnQuitMenu) wx.EVT_MENU(self, MENU_SHOW_B, self.OnShowBionic) wx.EVT_MENU(self, MENU_SHOW_C, self.OnShowCyborg) wx.EVT_MENU(self, MENU_SHOW_H, self.OnShowHuman) wx.EVT_MENU(self, MENU_IMPROVEMENT_1, self.OnImprovement1) wx.EVT_MENU(self, MENU_IMPROVEMENT_2, self.OnImprovement2) wx.EVT_MENU(self, MENU_IMPROVEMENT_3, self.OnImprovement3) wx.EVT_MENU(self, MENU_IMPROVEMENT_4, self.OnImprovement4) wx.EVT_MENU(self, MENU_IMPROVEMENT_5, self.OnImprovement5) wx.EVT_UPDATE_UI(self, MENU_IMPROVEMENT_1, self.OnImprovement1Update) wx.EVT_UPDATE_UI(self, MENU_IMPROVEMENT_2, self.OnImprovement2Update) wx.EVT_UPDATE_UI(self, MENU_IMPROVEMENT_3, self.OnImprovement3Update) wx.EVT_UPDATE_UI(self, MENU_IMPROVEMENT_4, self.OnImprovement4Update) wx.EVT_UPDATE_UI(self, MENU_IMPROVEMENT_5, self.OnImprovement5Update) wx.EVT_MENU(self, MENU_LEVEL_1, self.OnLevel1) wx.EVT_MENU(self, MENU_LEVEL_2, self.OnLevel2) wx.EVT_MENU(self, MENU_LEVEL_3, self.OnLevel3) wx.EVT_MENU(self, MENU_LEVEL_4, self.OnLevel4) wx.EVT_MENU(self, MENU_LEVEL_5, self.OnLevel5) wx.EVT_MENU(self, MENU_LEVEL_6, self.OnLevel6) wx.EVT_MENU(self, MENU_LEVEL_99, self.OnLevel99) wx.EVT_UPDATE_UI(self, MENU_LEVEL_1, self.OnLevel1Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_2, self.OnLevel2Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_3, self.OnLevel3Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_4, self.OnLevel4Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_5, self.OnLevel5Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_6, self.OnLevel6Update) wx.EVT_UPDATE_UI(self, MENU_LEVEL_99, self.OnLevel99Update) wx.EVT_MENU(self, MENU_VIEW_LEVEL, self.OnViewLevel) wx.EVT_MENU(self, MENU_VIEW_RACE, self.OnViewRace) wx.EVT_MENU(self, MENU_VIEW_REQ_LEVEL, self.OnViewReqLevel) wx.EVT_UPDATE_UI(self, MENU_VIEW_LEVEL, self.OnViewLevelUpdate) wx.EVT_UPDATE_UI(self, MENU_VIEW_RACE, self.OnViewRaceUpdate) wx.EVT_UPDATE_UI(self, MENU_VIEW_REQ_LEVEL, self.OnViewReqLevelUpdate) wx.EVT_MENU(self, MENU_CONSTRUCTION_DLG, self.OnConstruction) self.PopulateTree() return None def OnClose(self, event): global config config.Races.Bionic = int(self.showBionic) config.Races.Human = int(self.showHuman) config.Races.Cyborg = int(self.showCyborg) config.View.Improvement = self.improvement config.View.Level = int(self.viewLevel) config.View.Race = int(self.viewRace) config.View.ReqLevel = int(self.viewReqLevel) config.Levels.Level1 = int(self.levels[1]) config.Levels.Level2 = int(self.levels[2]) config.Levels.Level3 = int(self.levels[3]) config.Levels.Level4 = int(self.levels[4]) config.Levels.Level5 = int(self.levels[5]) config.Levels.Level6 = int(self.levels[6]) config.Levels.Level99 = int(self.levels[99]) self.Destroy() def OnSelChanged(self, event): item = event.GetItem() tech = self.tree.GetItemData(item).GetData() self.DisplayTech(tech) self.currentTech = tech def OnQuitMenu(self, event): self.Close(True) def OnConstruction(self, event): global config constrDlg = ConstructionDlg(None, -1, config, self.improvement) constrDlg.ShowModal() constrDlg.Destroy() def OnImprovement1(self, event): self.SetImprovement(1) def OnImprovement2(self, event): self.SetImprovement(2) def OnImprovement3(self, event): self.SetImprovement(3) def OnImprovement4(self, event): self.SetImprovement(4) def OnImprovement5(self, event): self.SetImprovement(5) def SetImprovement(self, number): self.improvement = number self.finishHandlers.improvement = number self.DisplayTech(self.currentTech) def OnImprovement1Update(self, event): event.Check(self.improvement == 1) def OnImprovement2Update(self, event): event.Check(self.improvement == 2) def OnImprovement3Update(self, event): event.Check(self.improvement == 3) def OnImprovement4Update(self, event): event.Check(self.improvement == 4) def OnImprovement5Update(self, event): event.Check(self.improvement == 5) def OnLevel1(self, event): if self.levels[1]: self.levels[1] = False self.levels[2] = False self.levels[3] = False self.levels[4] = False self.levels[5] = False self.levels[6] = False else: self.levels[1] = True self.PopulateTree() def OnLevel2(self, event): if self.levels[2]: self.levels[2] = False self.levels[3] = False self.levels[4] = False self.levels[5] = False self.levels[6] = False else: self.levels[1] = True self.levels[2] = True self.PopulateTree() def OnLevel3(self, event): if self.levels[3]: self.levels[3] = False self.levels[4] = False self.levels[5] = False self.levels[6] = False else: self.levels[1] = True self.levels[2] = True self.levels[3] = True self.PopulateTree() def OnLevel4(self, event): if self.levels[4]: self.levels[4] = False self.levels[5] = False self.levels[6] = False else: self.levels[1] = True self.levels[2] = True self.levels[3] = True self.levels[4] = True self.PopulateTree() def OnLevel5(self, event): if self.levels[5]: self.levels[5] = False self.levels[6] = False else: self.levels[1] = True self.levels[2] = True self.levels[3] = True self.levels[4] = True self.levels[5] = True self.PopulateTree() def OnLevel6(self, event): if self.levels[6]: self.levels[6] = False else: self.levels[1] = True self.levels[2] = True self.levels[3] = True self.levels[4] = True self.levels[5] = True self.levels[6] = True self.PopulateTree() def OnLevel99(self, event): self.levels[99] = not self.levels[99] self.PopulateTree() def OnLevel1Update(self, event): event.Check(self.levels[1]) def OnLevel2Update(self, event): event.Check(self.levels[2]) def OnLevel3Update(self, event): event.Check(self.levels[3]) def OnLevel4Update(self, event): event.Check(self.levels[4]) def OnLevel5Update(self, event): event.Check(self.levels[5]) def OnLevel6Update(self, event): event.Check(self.levels[6]) def OnLevel99Update(self, event): event.Check(self.levels[99]) def OnViewLevel(self, event): self.viewLevel = not self.viewLevel self.PopulateTree() def OnViewLevelUpdate(self, event): event.Check(self.viewLevel) def OnViewRace(self, event): self.viewRace = not self.viewRace self.PopulateTree() def OnViewRaceUpdate(self, event): event.Check(self.viewRace) def OnViewReqLevel(self, event): self.viewReqLevel = not self.viewReqLevel self.PopulateTree() def OnViewReqLevelUpdate(self, event): event.Check(self.viewReqLevel) def OnShowBionic(self, event): self.showBionic = event.IsChecked() self.PopulateTree() def OnShowCyborg(self, event): self.showCyborg = event.IsChecked() self.PopulateTree() def OnShowHuman(self, event): self.showHuman = event.IsChecked() self.PopulateTree() def PopulateTree(self): self.tree.Freeze() self.tree.DeleteAllItems() root = self.tree.AddRoot("Technologies") self.techs = {} self.AppendRootTechs(root) self.AppendChildTechs(root) self.tree.Expand(root) self.tree.SetScrollPos(wx.VERTICAL, 0) self.tree.Thaw() def DisplayTech(self, tech): self.list.DeleteAllItems() self.prodBio.Clear() self.prodEn.Clear() self.prodCon.Clear() if tech == None: return i = 0 techType = V_NONE & ( getattr(tech ,'isStructure', 0) * V_STRUCT | getattr(tech ,'isShipHull', 0) * V_HULL | getattr(tech ,'isShipEquip', 0) * V_SEQUIP | getattr(tech ,'isProject', 0) * V_PROJECT ) if techType == V_NONE: if getattr(tech ,'isStructure', 0): techType = V_STRUCT elif getattr(tech ,'isShipHull', 0): techType = V_HULL elif getattr(tech ,'isShipEquip', 0): techType = V_SEQUIP elif getattr(tech ,'isProject', 0): techType = V_PROJECT for attribute in dir(tech): value = getattr(tech, attribute) descr, props, showIfDef, default, convertor = techAttrs.get(attribute, defaultAttr) if techType & props and (value != default or showIfDef): self.list.InsertStringItem(i, descr) if V_EFF & props: item = self.list.GetItem(i) itemFont = item.GetFont() itemFont.SetWeight(wx.BOLD) item.SetFont(itemFont) self.list.SetItem(item) if convertor != str: value = Rules.techImprEff[self.improvement] * value else: value = int(round(Rules.techImprEff[self.improvement] * value)) self.list.SetStringItem(i, 1, str(convertor(value))) i = i + 1 text = "" for res in getattr(tech, "researchReqSRes", [0]): text += stratRes[res] text += ", " text = text[:-2] if len(text) > 0: self.list.InsertStringItem(i, "Strategic resource") self.list.SetStringItem(i, 1, text) if getattr(tech, "finishConstrHandler", None) != None or getattr(tech, "deployHandlerFunction", None) != None: fceF = None fceD = None if getattr(tech, "finishConstrHandler", None) != None: fceF = tech.finishConstrHandler.__name__ if getattr(tech, "deployHandlerFunction", None) != None: fceD = tech.deployHandlerFunction.__name__ fce = None if fceF != "noop": fce = fceF if fce == None and fceD != "noop": fce = fceD if fce != None and fce in dir(self.finishHandlers): i = getattr(self.finishHandlers, fce)(i, tech) if getattr(tech, "prodProdMod", None) != None: b, m, e, d = tech.prodProdMod self.prodCon.SetEnv(b) self.prodCon.SetMineral(m) self.prodCon.SetEnergy(e) self.prodCon.SetNothing(d) if getattr(tech, "prodBioMod", None) != None: b, m, e, d = tech.prodBioMod self.prodBio.SetEnv(b) self.prodBio.SetMineral(m) self.prodBio.SetEnergy(e) self.prodBio.SetNothing(d) if getattr(tech, "prodEnMod", None) != None: b, m, e, d = tech.prodEnMod self.prodEn.SetEnv(b) self.prodEn.SetMineral(m) self.prodEn.SetEnergy(e) self.prodEn.SetNothing(d) def addNode(self, parentNode, tech): raceColours = { "C": wx.RED, "B": wx.NamedColour("MEDIUM FOREST GREEN"), "H": wx.BLUE, "HC": wx.NamedColour("BROWN"), "CH": wx.NamedColour("BROWN"), "BH": wx.NamedColour("GOLD"), "HB": wx.NamedColour("GOLD"), "BC": wx.NamedColour("LIGHT MAGENTA"), "CB": wx.NamedColour("LIGHT MAGENTA") } dataItem = wx.TreeItemData(tech) title = tech.name colour = wx.BLACK if len(tech.researchRaces) < 3 and self.viewRace: title += " - " + tech.researchRaces appendByRace = False if self.showBionic and "B" in tech.researchRaces: appendByRace |= True if self.showHuman and "H" in tech.researchRaces: appendByRace |= True if self.showCyborg and "C" in tech.researchRaces: appendByRace |= True appendByLevel = False if self.levels[tech.level]: appendByLevel |= True treeItem = None parent = getParent(tech) reqlvl = 0 if parent != None: for lvl in range (1,6): todo = parent.researchEnables[lvl] for current in todo: if 1000 in Rules.techs[current].researchReqSRes: continue if tech.id == Rules.techs[current].id: reqlvl = lvl break if reqlvl == lvl: break if appendByRace and appendByLevel and parentNode != None: if self.viewReqLevel: itemText = "[%d]--" % reqlvl else: itemText = "" if self.viewLevel: itemText = "%s%s (%d)" % (itemText, title, tech.level) else: itemText = "%s%s" % (itemText, title) treeItem = self.tree.AppendItem(parentNode, itemText, data = dataItem) if tech.researchRaces in raceColours: self.tree.SetItemTextColour(treeItem, raceColours[tech.researchRaces]) return treeItem def AppendRootTechs(self, root): for tl in range(1, 10): for tech in Rules.techs.itervalues(): if tech.researchRequires or tl != tech.level or 1000 in tech.researchReqSRes: continue self.techs[tech] = self.addNode(root, tech) if self.levels[99]: self.level99Root = self.tree.AppendItem(root, "Level 99", data = None) for tech in Rules.techs.itervalues(): if tech.researchRequires or 99 != tech.level or 1000 in tech.researchReqSRes: continue self.techs[tech] = self.addNode(self.level99Root, tech) self.tree.SortChildren(self.level99Root) self.tree.Expand(self.level99Root) def AppendChildTechs(self, root): for tech in Rules.techs.itervalues(): if tech.researchRequires: continue todo = getChildren(tech) while todo: current = Rules.techs[todo.pop(0)] if 1000 in current.researchReqSRes: continue self.AppendChild(root, current) todo.extend(getChildren(current)) def AppendChild(self, root, child): parent = getParent(child) self.techs[child] = self.addNode(self.techs[parent], child) if self.techs[parent] != None: self.tree.Expand(self.techs[parent]) self.tree.SortChildren(self.techs[parent]) config = Config("config.ini") app = App(False) app.MainLoop() config.save("config.ini")
Lukc/ospace-lukc
client-TechViewer/TechViewer.py
Python
gpl-2.0
24,696
from xssnotifier.main import main main()
mattiaslundberg/xssnotifier-server
run.py
Python
bsd-2-clause
42
import os import sys import unittest sys.path.append(os.getcwd()) from parsing.file_parser import * class FileParserTest(unittest.TestCase): def test_parse_tape(self): self.assertEqual(parse_tape_from_file('tape: (asd,a,asd)', 0), ['asd', 'a', 'asd']) self.assertEqual(parse_tape_from_file('tape: (,a,asd)', 0), ['', 'a', 'asd']) self.assertEqual(parse_tape_from_file('tape: (,,)', 0), ['', '', '']) self.assertEqual(parse_tape_from_file('tape: (asd,a,)', 0), ['asd', 'a', '']) self.assertEqual(parse_tape_from_file('tape: (ada#dsd,a,afdas)d)', 0), ['ada#dsd', 'a', 'afdas)d']) with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tpe: (asd,a,asd)', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tape: (asda,asd)', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tape: (asdaasd)', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tape: (asd,a,asd', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tape: asd,a,asd)', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('tape (asd,a,asd)', 0), '') with self.assertRaises(SyntacticError): self.assertEqual(parse_tape_from_file('(tape asd,a,asd)', 0), '') def test_parse_states(self): self.assertEqual(parse_states_from_file('states: {1,2,3,4,5}', 0), set([1, 2, 3, 4, 5])) self.assertEqual(parse_states_from_file('states: {1}', 0), set([1])) self.assertEqual(parse_states_from_file('states: {}', 0), set()) with self.assertRaises(SyntacticError): self.assertEqual(parse_states_from_file('stes: {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_states_from_file('states {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_states_from_file('states: {1,2,3', 0), 0) def test_parse_initial(self): self.assertEqual(parse_initial_from_file('initial: 0', 0), 0) self.assertEqual(parse_initial_from_file('initial: 123', 0), 123) self.assertEqual(parse_initial_from_file('initial: 10', 0), 10) self.assertEqual(parse_initial_from_file('initial: 00', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_initial_from_file('initial 0', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_initial_from_file('inial: 0', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_initial_from_file('inial:', 0), 0) def test_parse_rule(self): self.assertEqual(parse_rule_from_file('(0,b,a,b,0,Right)', 0), [0, 'b', 'a', 'b', 0, 'Right']) self.assertEqual(parse_rule_from_file('(0,_,_,_,1,None)', 0), [0, '_', '_', '_', 1, 'None']) self.assertEqual(parse_rule_from_file('(0,_,_,_,1,Left)', 0), [0, '_', '_', '_', 1, 'Left']) with self.assertRaises(SyntacticError): self.assertEqual(parse_rule_from_file('(0,_,_,_,1,No)', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_rule_from_file('(0,_,_,_,None)', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_rule_from_file('(a,_,_,_,1,None)', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_rule_from_file('(0,_,_,_,b,None)', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_rule_from_file('(0,_,_,_,1,None', 0), 0) def test_parse_accept_states(self): self.assertEqual(parse_accept_states_from_file('accept: {1}', 0), set([1])) self.assertEqual(parse_accept_states_from_file('accept: {1}', 0), set([1])) self.assertEqual(parse_accept_states_from_file('accept: {}', 0), set()) with self.assertRaises(SyntacticError): self.assertEqual(parse_accept_states_from_file('acce: {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_accept_states_from_file('accept {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_accept_states_from_file('accept: {1,2,3', 0), 0) def test_parse_reject_states(self): self.assertEqual(parse_reject_states_from_file('reject: {1}', 0), set([1])) self.assertEqual(parse_reject_states_from_file('reject: {1}', 0), set([1])) self.assertEqual(parse_reject_states_from_file('reject: {}', 0), set()) with self.assertRaises(SyntacticError): self.assertEqual(parse_reject_states_from_file('acce: {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_reject_states_from_file('reject {}', 0), 0) with self.assertRaises(SyntacticError): self.assertEqual(parse_reject_states_from_file('reject: {1,2,3', 0), 0) if __name__ == '__main__': unittest.main()
ytsvetkov/TuringMachine
unittests/test_file_parser.py
Python
gpl-3.0
5,658
from django.contrib import admin from admin_views.admin import AdminViews from django.shortcuts import redirect from example_project.example_app.models import TestModel class TestAdmin(AdminViews): admin_views = ( ('Process This', 'process'), # Admin view ('Go to LJW', 'http://www.ljworld.com'), # Direct URL ) def process(self, *args, **kwargs): return redirect('http://www.cnn.com') admin.site.register(TestModel, TestAdmin)
frankwiles/django-admin-views
example_project/example_project/example_app/admin.py
Python
bsd-3-clause
490
#!/usr/bin/env python # -*- coding: utf-8 -*- # Copyright (C) 2013- Yan Shoshitaishvili aka. zardus # Ruoyu Wang aka. fish # Andrew Dutcher aka. rhelmot # Kevin Borgolte aka. cao # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software Foundation, # Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA # Standard library imports import logging import os import random import shlex import socket import subprocess import time import warnings LOG = logging.getLogger("idalink") # Local imports from .rpyc import classic as rpyc_classic from .memory import CachedIDAMemory, CachedIDAPermissions # Constants MODULE_DIR = os.path.dirname(os.path.realpath(__file__)) IDA_DIR = os.path.join(os.path.dirname(os.path.realpath(__file__)), "support/") LOGFILE = "/tmp/idalink-{port}.log" def which(filename): if '/' in filename: if os.path.exists(filename) and \ os.access(filename, os.X_OK): return filename return None path_entries = os.getenv('PATH').split(os.path.pathsep) for entry in path_entries: filepath = os.path.join(entry, filename) if os.path.exists(filepath) and \ os.access(filepath, os.X_OK): return filepath return None # Helper functions def _ida_spawn(filename, ida_path, port, mode="oneshot", processor_type="metapc"): """Internal helper function to open IDA on the the file we want to analyse. """ ida_realpath = os.path.expanduser(ida_path) file_realpath = os.path.realpath(os.path.expanduser(filename)) logfile = LOGFILE.format(port=port) LOG.info("Launching IDA (%s) on %s, listening on port %d, logging to %s", ida_realpath, file_realpath, port, logfile) # :note: We run IDA through screen because otherwise its UI will hang. # We also setup the environment for IDA. # The other parameters are: # -A Automatic mode # -S Run a script (our server script) # -L Log all output to our logfile # -p Set the processor type command_tpl = "screen -S idalink-{server_port} -d -m " \ "'{module_dir}/support/ida_env.sh' '{ida_path}' " \ "-M -A "\ "-S'{module_dir}/server.py {server_port} {server_mode}' " \ "-L'{logfile}' -p{processor} '{file}'" command = shlex.split(command_tpl.format(module_dir=MODULE_DIR, ida_path=ida_realpath, server_port=port, server_mode=mode, logfile=logfile, processor=processor_type, file=file_realpath)) # :note: The above is a bit more Pythonic, if it breaks, use this: # screen_name = "idalink-{}".format(port) # screen = ["screen", "-S", screen_name, "-d", "-m", "-L", "--"] # # ida_env = "{}/support/ida_env.sh".format(MODULE_DIR) # ida_options = ["-M", "-A", # "-p{}".format(processor_type), # "-S{}/server.py {}".format(MODULE_DIR, port), # idalink # "-L{}".format(logfile)] # logfile # # ida = [ida_env, ida_realpath] # command = screen + ida + ida_options + [file_realpath] LOG.debug("IDA command is %s", " ".join(command)) subprocess.call(command) def _ida_connect(port): link = rpyc_classic.connect("localhost", port) LOG.debug("Connected to port %d", port) idc = link.root.getmodule("idc") idaapi = link.root.getmodule("idaapi") idautils = link.root.getmodule("idautils") return link, idc, idaapi, idautils class IDALinkError(Exception): pass class RemoteIDALink(object): def __init__(self, filename): self.filename = filename self.link = None self.idc = __import__('idc') self.idaapi = __import__('idaapi') self.idautils = __import__('idautils') self.memory = CachedIDAMemory(self) self.permissions = CachedIDAPermissions(self) class IDALink(object): def __init__(self, link, idc, idaapi, idautils, filename=None, pull_memory=True): self.filename = filename self.link = link self.idc = idc self.idaapi = idaapi self.idautils = idautils self.remote_idalink_module = link.root.getmodule("idalink") self.remote_link = self.remote_idalink_module.RemoteIDALink(filename) self._memory = None self.pull_memory = pull_memory self._permissions = None @property def memory(self): if self._memory is None: self._memory = CachedIDAMemory(self) if self.pull_memory: self._memory.pull_defined() return self._memory @memory.deleter def memory(self): self._memory = None @property def permissions(self): if self._permissions is None: self._permissions = CachedIDAPermissions(self) return self._permissions @permissions.deleter def permissions(self): self._permissions = None class idalink(object): def __init__(self, filename, ida_prog, retries=60, port=None, spawn=True, pull_memory=True, processor_type="metapc"): if port is None: port = random.randint(40000, 49999) # TODO: check if port is in use self._link = None self._filename = os.path.realpath(os.path.join(os.getcwd(), filename)) self._retries = retries self._port = port self._pull_memory = pull_memory progname = which(ida_prog) if progname is None: raise IDALinkError("Could not find executable %s" % ida_prog) if spawn: _ida_spawn(self._filename, progname, port, processor_type) def __enter__(self): for _ in range(self._retries): # TODO: detect IDA failure intelligently try: time.sleep(1) LOG.debug("Trying to connect to IDA on port %d", self._port) self._link = IDALink(*_ida_connect(self._port), filename=self._filename, pull_memory=self._pull_memory) break except socket.error: LOG.debug("... failed. Retrying.") if self._link is None: raise IDALinkError(("Failed to connect to IDA on port {} for " "file {}").format(self._port, self._filename)) return self._link def __exit__(self, type_, value, traceback): try: if self._link: self._link.idc.Exit(0) except EOFError: LOG.warning("EOF on link socket, IDA might still be running!") @property def link(self): """Helper property to support the use of idalink without having to use a with statement. This property will likely be deprecated and might be removed at any point in the future. """ warnings.warn("link property is pending deprecation", PendingDeprecationWarning) if self._link is None: self.__enter__() return self._link
chubbymaggie/idalink
idalink/idalink.py
Python
gpl-3.0
8,058
# Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # flake8: noqa # <REGION compute_custom_machine_type_extra_mem_no_helper> # <IMPORTS/> # <INGREDIENT get_image_from_family /> # <INGREDIENT disk_from_image /> # <INGREDIENT create_instance /> # <INGREDIENT create_custom_instances_extra_mem /> # </REGION compute_custom_machine_type_extra_mem_no_helper>
googleapis/python-compute
samples/recipes/instances/custom_machine_types/extra_mem_no_helper.py
Python
apache-2.0
895
#!/usr/bin/env python # ---------------------------------------------------------------------- # Numenta Platform for Intelligent Computing (NuPIC) # Copyright (C) 2013, Numenta, Inc. Unless you have an agreement # with Numenta, Inc., for a separate license for this software code, the # following terms and conditions apply: # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero Public License version 3 as # published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. # See the GNU Affero Public License for more details. # # You should have received a copy of the GNU Affero Public License # along with this program. If not, see http://www.gnu.org/licenses. # # http://numenta.org/licenses/ # ---------------------------------------------------------------------- from copy import copy import os import shutil from StringIO import StringIO import sys import tempfile import unittest2 as unittest import uuid from pkg_resources import resource_filename from mock import Mock, patch from pkg_resources import resource_filename from xml.parsers.expat import ExpatError # ParseError not present in xml module for python2.6 try: from xml.etree.ElementTree import ParseError except ImportError: from xml.parsers.expat import ExpatError as ParseError import nupic import nupic.support.configuration_custom as configuration import configuration_test class ConfigurationCustomTest(unittest.TestCase): def setUp(self): if "NTA_DYNAMIC_CONF_DIR" in os.environ: # Remove it to make sure our in-proc tests won't accidentally # mess with actual files oldNtaDynamicConfDir = os.environ["NTA_DYNAMIC_CONF_DIR"] del os.environ["NTA_DYNAMIC_CONF_DIR"] self.addCleanup(os.environ.update, dict(NTA_DYNAMIC_CONF_DIR=oldNtaDynamicConfDir)) self.files = dict() tmpDir = tempfile.mkdtemp() self.addCleanup(shutil.rmtree, tmpDir) with open(os.path.join(tmpDir, 'nupic-default.xml-unittest'), 'w') as fp: with open(resource_filename(__name__, 'conf/nupic-default.xml')) as inp: fp.write(inp.read()) self.files['nupic-default.xml'] = fp.name with open(os.path.join(tmpDir, 'nupic-site.xml-unittest'), 'w') as fp: with open(resource_filename(__name__, 'conf/nupic-site.xml')) as inp: fp.write(inp.read()) self.files['nupic-site.xml'] = fp.name with open(os.path.join(tmpDir, 'nupic-custom.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/nupic-custom.xml')) as inp: fp.write(inp.read()) self.files['nupic-custom.xml'] = fp.name self.customParam = 'nupic.custom.hello' self.customValue = 'world' configuration.Configuration.clear() #################################################################### # Custom Configuration Tests # Todo: Share tests between two configuration_test files #################################################################### @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testCustomFileCreated(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.setCustomProperty('param', 'val') self.assertTrue(os.path.exists(self.files['nupic-custom.xml'])) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGet(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>'+self.customParam+'</name>', ' <value>'+self.customValue+'</value>', ' </property>', '</configuration>'))) self.assertEqual( configuration.Configuration.get(self.customParam), self.customValue) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testSetCustomProperty(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get environ.get.return_value = None configuration.Configuration.clear() findConfigFile.side_effect = self.files.get with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>' + self.customParam + '</name>', ' <value>' + self.customValue + '</value>', ' </property>', '</configuration>'))) configuration.Configuration.setCustomProperty('PersistProp', 'PersistVal') self.assertEqual( configuration.Configuration.get('PersistProp'),'PersistVal') configuration.Configuration.clear() self.assertEqual( configuration.Configuration.get('PersistProp'),'PersistVal') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testSetCustomProperties(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get environ.get.return_value = None findConfigFile.side_effect = self.files.get with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>' + self.customParam + '</name>', ' <value>' + self.customValue + '</value>', ' </property>', '</configuration>'))) configuration.Configuration.clear() originalProps = copy(configuration.Configuration.dict()) configuration.Configuration.setCustomProperties( {'PersistProp' : 'PersistVal', 'apple' : 'pear'}) expectedProps = {'PersistProp' : 'PersistVal', 'apple' : 'pear'} expectedProps.update(originalProps) self.assertEqual(configuration.Configuration.dict(), expectedProps) configuration.Configuration.clear() self.assertEqual(configuration.Configuration.dict(), expectedProps) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testDictWithTemp(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>param</name>', ' <value>value</value>', ' </property>', ' <property>', ' <name>param2</name>', ' <value>value2</value>', ' </property>', '</configuration>'))) customDict = configuration.Configuration.dict() self.assertTrue('param' in customDict) self.assertTrue('param2' in customDict) self.assertEqual(customDict['param'], 'value') self.assertEqual(customDict['param2'], 'value2') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testCustomConfigOverrides(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() paramNames = configuration.Configuration.dict().keys() customValue = 'NewValue' with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>'+paramNames[0]+'</name>', ' <value>'+customValue+'</value>', ' </property>', '</configuration>'))) configuration.Configuration.clear() self.assertEqual(configuration.Configuration.get(paramNames[0]), \ customValue) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testCustomConfigDict(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>CustomParam</name>', ' <value>CustomValue</value>', ' </property>', '</configuration>'))) configuration.Configuration.clear() self.assertEqual(configuration.Configuration.get('CustomParam'), \ 'CustomValue') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testClearInvalidFile(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<foo/>'))) configuration.Configuration.clear() with patch('sys.stderr', new_callable=StringIO): self.assertRaises(RuntimeError, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testSetInvalidFile(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<foo/>'))) with patch('sys.stderr', new_callable=StringIO): with self.assertRaises(RuntimeError) as cm: configuration.Configuration.setCustomProperty('foo', 'value') self.assertIn("Expected top-level element to be 'configuration'", cm.exception.args[0]) with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join((''))) with patch('sys.stderr', new_callable=StringIO): with self.assertRaises(RuntimeError) as cm: configuration.Configuration.setCustomProperty('foo', 'value') self.assertIn("File contents of custom configuration is corrupt.", cm.exception.args[0]) # NTA_CONF_PATH is not being mocked out in this test, so we have to mock out # findConfigFile to return the right path to the config file. findConfigFile.return_value = self.files['nupic-custom.xml'] configuration.Configuration.resetCustomConfig() configuration.Configuration.setCustomProperty('foo', 'value') self.assertEqual(configuration.Configuration.getCustomDict(), {'foo': 'value'}) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetCustomDict(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-custom.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>CustomParam</name>', ' <value>CustomValue</value>', ' </property>', '</configuration>'))) self.assertEqual(configuration.Configuration.getCustomDict(), dict(CustomParam='CustomValue')) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetCustomDictNoFile(self, findConfigFile, environ): environ.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.resetCustomConfig() self.assertEqual(configuration.Configuration.getCustomDict(), dict()) del self.files['nupic-custom.xml'] ############################################### # Replicated Tests From configuration_test.py ############################################### @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetStringMissingRaisesKeyError(self, findConfigFileMock, environMock): findConfigFileMock.side_effect = self.files.get environMock.get.return_value = None configuration.Configuration.clear() with self.assertRaises(KeyError): configuration.Configuration.getString(uuid.uuid1().hex) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetString(self, findConfigFileMock, environMock): environMock.get.return_value = None findConfigFileMock.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foo', 'bar') result = configuration.Configuration.getString('foo') self.assertEqual(result, 'bar') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetBoolMissingRaisesKeyError(self, findConfigFileMock, environMock): findConfigFileMock.side_effect = self.files.get environMock.get.return_value = None configuration.Configuration.clear() with self.assertRaises(KeyError): configuration.Configuration.getBool(uuid.uuid1().hex) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetBoolOutOfRangeRaisesValueError(self, findConfigFileMock, environMock): environMock.get.return_value = None findConfigFileMock.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foobool2', '2') with self.assertRaises(ValueError): configuration.Configuration.getBool('foobool2') configuration.Configuration.set('fooboolneg1', '-1') with self.assertRaises(ValueError): configuration.Configuration.getBool('fooboolneg1') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetBool(self, findConfigFileMock, environMock): environMock.get.return_value = None findConfigFileMock.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foobool0', '0') result = configuration.Configuration.getBool('foobool0') self.assertEqual(result, False) configuration.Configuration.set('foobool1', '1') result = configuration.Configuration.getBool('foobool1') self.assertEqual(result, True) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetIntMissingRaisesKeyError(self, findConfigFileMock, environMock): findConfigFileMock.side_effect = self.files.get environMock.get.return_value = None configuration.Configuration.clear() with self.assertRaises(KeyError): configuration.Configuration.getInt(uuid.uuid1().hex) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetInt(self, findConfigFileMock, environMock): environMock.get.return_value = None findConfigFileMock.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('fooint', '-127') result = configuration.Configuration.getInt('fooint') self.assertEqual(result, -127) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetFloatMissingRaisesKeyError(self, findConfigFileMock, environMock): findConfigFileMock.side_effect = self.files.get environMock.get.return_value = None configuration.Configuration.clear() with self.assertRaises(KeyError): configuration.Configuration.getFloat(uuid.uuid1().hex) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetFloat(self, findConfigFileMock, environMock): environMock.get.return_value = None findConfigFileMock.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foofloat', '-127.65') result = configuration.Configuration.getFloat('foofloat') self.assertEqual(result, -127.65) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetMissingReturnsNone(self, findConfigFile, environ): findConfigFile.side_effect = self.files.get environ.get.return_value = None configuration.Configuration.clear() result = configuration.Configuration.get(str(uuid.uuid4())) self.assertTrue(result is None) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testSetAndGet(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foo', 'bar') result = configuration.Configuration.get('foo') self.assertTrue(result == 'bar') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testDict(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foo', 'bar') configuration.Configuration.set('apple', 'banana') result = configuration.Configuration.dict() self.assertTrue(isinstance(result, dict)) self.assertTrue('foo' in result) self.assertTrue(result['foo'] == 'bar') self.assertTrue('apple' in result) self.assertTrue(result['apple'] == 'banana') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testDictReadsFilesFirstTime(self, findConfigFile, environ): # pylint: disable=W0613 environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() result = configuration.Configuration.dict() self.assertTrue(isinstance(result, dict)) self.assertTrue(len(result) == 1, result) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testDictReplacesKeysFromEnvironment(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() key = str(uuid.uuid4()) env = {'NTA_CONF_PROP_' + key: 'foo'} environ.keys.side_effect = env.keys environ.__getitem__.side_effect = env.__getitem__ result = configuration.Configuration.dict() self.assertTrue(key in result) self.assertTrue(result[key] == 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testClear(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() configuration.Configuration.set('foo', 'bar') configuration.Configuration.set('apple', 'banana') self.assertTrue(configuration.Configuration.get('foo') == 'bar') self.assertTrue(configuration.Configuration.get('apple') == 'banana') configuration.Configuration.clear() self.assertTrue(configuration.Configuration.get('foo') is None) self.assertTrue(configuration.Configuration.get('apple') is None) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testGetFromEnvironment(self, findConfigFile, environ): findConfigFile.side_effect = self.files.get configuration.Configuration.clear() key = str(uuid.uuid4()) environ.get.side_effect = {'NTA_CONF_PROP_' + key: 'foo'}.get self.assertTrue(configuration.Configuration.get(key) == 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileFromPath(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() prefix, _, filename = self.files['nupic-default.xml'].rpartition(os.sep) configuration.Configuration.readConfigFile(filename, prefix) self.assertTrue(configuration.Configuration.get('dummy') == 'dummy value') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileUnexpectedElementAtRoot(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<foo/>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises(RuntimeError, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileMissingDocumentRoot(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises((ExpatError, ParseError), configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileMissingNonPropertyConfigurationChildren( self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <foo>bar<baz/></foo>', '</configuration>'))) self.assertEqual(configuration.Configuration.dict(), \ dict(dummy='dummy value')) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileEmptyValue(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>foo</name>', ' </property>', '</configuration>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises(Exception, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileEmptyNameAndValue(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name></name>', ' <value></value>', ' </property>', '</configuration>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises(RuntimeError, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileMissingEnvVars(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>foo</name>', ' <value>${env.foo}</value>', ' </property>', '</configuration>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises(RuntimeError, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileMalformedEnvReference(self, findConfigFile, environ): # pylint: disable=W0613 environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>foo</name>', ' <value>${env.foo</value>', ' </property>', '</configuration>'))) with patch('sys.stderr', new_callable=StringIO): self.assertRaises(RuntimeError, configuration.Configuration.get, 'foo') @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testReadConfigFileEnvironmentOverride(self, findConfigFile, environ): environ.get.return_value = None findConfigFile.side_effect = self.files.get configuration.Configuration.clear() with open(self.files['nupic-default.xml'], 'w') as fp: fp.write('\n'.join(( '<?xml version="1.0"?>', '<?xml-stylesheet type="text/xsl" href="configuration.xsl"?>', '<configuration>', ' <property>', ' <name>foo</name>', ' <value>${env.NTA_CONF_PROP_foo}</value>', ' </property>', '</configuration>'))) env = {'NTA_CONF_PROP_foo': 'bar'} environ.__getitem__.side_effect = env.__getitem__ environ.get.side_effect = env.get environ.__contains__.side_effect = env.__contains__ result = configuration.Configuration.get('foo') self.assertEqual(result, 'bar') @patch.object(configuration.Configuration, 'getConfigPaths', spec=configuration.Configuration.getConfigPaths) def testFindConfigFile(self, getConfigPaths): prefix, _, filename = self.files['nupic-default.xml'].rpartition(os.sep) def replacePaths(**_): return [prefix] getConfigPaths.side_effect = replacePaths configuration.Configuration.clear() result = configuration.Configuration.findConfigFile(filename) self.assertTrue(result == self.files['nupic-default.xml']) getConfigPaths.assert_called_with() @patch.object(configuration.Configuration, 'getConfigPaths', spec=configuration.Configuration.getConfigPaths) def testFindConfigFileReturnsNoneForMissingFile(self, getConfigPaths): prefix, _, _ = self.files['nupic-default.xml'].rpartition(os.sep) def replacePaths(**_): return [prefix] getConfigPaths.side_effect = replacePaths configuration.Configuration.clear() result = configuration.Configuration.findConfigFile(str(uuid.uuid4())) self.assertTrue(result is None) getConfigPaths.assert_called_with() @patch.object(configuration.Configuration, '_configPaths', spec=configuration.Configuration._configPaths) @patch.object(configuration.os, 'environ', spec=dict) def testGetConfigPaths( self, environ, configPaths): # pylint: disable=W0613 result = configuration.Configuration.getConfigPaths() self.assertEqual(result, configPaths) @unittest.skip('NUP-2081') @patch.object(configuration.Configuration, '_configPaths', spec=configuration.Configuration._configPaths) @patch.object(configuration.os, 'environ', spec=dict) def testGetConfigPathsForNone( self, environ, configPaths): # pylint: disable=W0613 configuration.Configuration._configPaths = None # pylint: disable=W0212 result = configuration.Configuration.getConfigPaths() self.assertTrue(isinstance(result, list)) self.assertListEqual(result, [resource_filename("nupic", os.path.join("config", "default"))]) @patch.object(configuration.Configuration, '_configPaths', spec=configuration.Configuration._configPaths) @patch.object(configuration.os, 'environ', spec=dict) def testGetConfigPathsForNoneWithNTA_CONF_PATHInEnv( self, environ, configPaths): # pylint: disable=W0613 configuration.Configuration._configPaths = None # pylint: disable=W0212 env = {'NTA_CONF_PATH': ''} environ.__getitem__.side_effect = env.__getitem__ environ.get.side_effect = env.get environ.__contains__.side_effect = env.__contains__ result = configuration.Configuration.getConfigPaths() self.assertTrue(isinstance(result, list)) self.assertEqual(len(result), 1) self.assertEqual(result[0], env['NTA_CONF_PATH']) def testSetConfigPathsForNoneWithNTA_CONF_PATHInEnv(self): paths = [Mock()] configuration.Configuration.setConfigPaths(paths) self.assertEqual( paths, configuration.Configuration._configPaths) # pylint: disable=W0212 @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testEmptyGetCustomDict(self, findConfigFile, environMock): findConfigFile.side_effect = self.files.get environMock.__getitem__.side_effect = dict( NTA_DYNAMIC_CONF_DIR=os.path.dirname(self.files['nupic-custom.xml'])).get configuration.Configuration.resetCustomConfig() self.assertEqual(configuration.Configuration.getCustomDict(), dict()) @patch.object(configuration.os, 'environ', spec=dict) @patch.object(configuration.Configuration, 'findConfigFile', spec=configuration.Configuration.findConfigFile) def testConfiguration(self, findConfigFile, environ): configuration.Configuration.clear() findConfigFile.side_effect = self.files.get with open(self.files['nupic-default.xml'], 'w') as fp: with open(resource_filename(__name__, 'conf/testFile1.xml')) as inp: fp.write(inp.read()) with open(self.files['nupic-site.xml'], 'w') as fp: with open(resource_filename(__name__, 'conf/testFile2.xml')) as inp: fp.write(inp.read()) env = {'USER': 'foo', 'HOME': 'bar'} environ.__getitem__.side_effect = env.__getitem__ environ.get.side_effect = env.get environ.__contains__.side_effect = env.__contains__ environ.keys.side_effect = env.keys # Test the resulting configuration self.assertEqual(configuration.Configuration.get('database.host'), 'TestHost') self.assertEqual(configuration.Configuration.get('database.password'), 'pass') self.assertEqual(configuration.Configuration.get('database.emptypassword'), '') self.assertEqual(configuration.Configuration.get('database.missingfield'), None) self.assertEqual(configuration.Configuration.get('database.user'), 'root') expectedValue = 'foo' actualValue = configuration.Configuration.get( 'var.environment.standalone.user') self.assertTrue(actualValue == expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) expectedValue = "The user " + os.environ['USER'] + " rocks!" actualValue = configuration.Configuration.get( 'var.environment.user.in.the.middle') self.assertTrue(actualValue == expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) expectedValue = ("User " + os.environ['USER'] + " and home " + os.environ['HOME'] + " in the middle") actualValue = configuration.Configuration.get( 'var.environment.user.and.home.in.the.middle') self.assertTrue(actualValue == expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) env['NTA_CONF_PROP_database_host'] = 'FooBar' self.assertEqual(configuration.Configuration.get('database.host'), 'FooBar') allProps = configuration.Configuration.dict() self.assertTrue(allProps['database.host'] == 'FooBar') del env['NTA_CONF_PROP_database_host'] environ.__getitem__.side_effect = env.__getitem__ environ.get.side_effect = env.get environ.__contains__.side_effect = env.__contains__ # Change a property configuration.Configuration.set('database.host', 'matrix') self.assertEqual(configuration.Configuration.get('database.host'), 'matrix') @patch.object(configuration.os, 'environ', spec=dict) def testConfiguration2(self, environ): configuration.Configuration.clear() tmpDir = tempfile.mkdtemp() self.addCleanup(shutil.rmtree, tmpDir) with open(os.path.join(tmpDir, 'nupic-default.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/testFile1.xml')) as inp: fp.write(inp.read()) with open(os.path.join(tmpDir, 'nupic-site.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/testFile2.xml')) as inp: fp.write(inp.read()) env = { 'USER': 'foo', 'HOME': 'bar', 'NTA_CONF_PATH': tmpDir } environ.__getitem__.side_effect = env.__getitem__ environ.get.side_effect = env.get environ.__contains__.side_effect = env.__contains__ environ.keys.side_effect = env.keys # Test the resulting configuration self.assertEqual(configuration.Configuration.get('database.host'), 'TestHost') self.assertEqual(configuration.Configuration.get('database.password'), 'pass') self.assertEqual( configuration.Configuration.get('database.emptypassword'), '') self.assertEqual(configuration.Configuration.get('database.missingfield'), None) self.assertEqual(configuration.Configuration.get('database.user'), 'root') expectedValue = 'foo' actualValue = configuration.Configuration.get( 'var.environment.standalone.user') self.assertEqual(actualValue, expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) expectedValue = "The user " + os.environ['USER'] + " rocks!" actualValue = configuration.Configuration.get( 'var.environment.user.in.the.middle') self.assertEqual(actualValue, expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) expectedValue = ("User " + os.environ['USER'] + " and home " + os.environ['HOME'] + " in the middle") actualValue = configuration.Configuration.get( 'var.environment.user.and.home.in.the.middle') self.assertEqual(actualValue, expectedValue, "expected {0!r}, but got {1!r}".format(expectedValue, actualValue)) env['NTA_CONF_PROP_database_host'] = 'FooBar' self.assertEqual(configuration.Configuration.get('database.host'), 'FooBar') allProps = configuration.Configuration.dict() self.assertEqual(allProps['database.host'], 'FooBar') del env['NTA_CONF_PROP_database_host'] # Change a property configuration.Configuration.set('database.host', 'matrix') self.assertEqual(configuration.Configuration.get('database.host'), 'matrix') configuration.Configuration.clear() tmpDir = tempfile.mkdtemp() self.addCleanup(shutil.rmtree, tmpDir) with open(os.path.join(tmpDir, 'nupic-default.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/testFile1.xml')) as inp: fp.write(inp.read()) with open(os.path.join(tmpDir, 'nupic-site.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/testFile2.xml')) as inp: fp.write(inp.read()) tmpDir2 = tempfile.mkdtemp() self.addCleanup(shutil.rmtree, tmpDir2) with open(os.path.join(tmpDir2, 'nupic-site.xml'), 'w') as fp: with open(resource_filename(__name__, 'conf/testFile3.xml')) as inp: fp.write(inp.read()) env['NTA_CONF_PATH'] = os.pathsep.join([tmpDir, tmpDir2]) # Test the resulting configuration self.assertEqual(configuration.Configuration.get('database.host'), 'TestHost') self.assertEqual(configuration.Configuration.get('database.password'), 'pass') self.assertEqual( configuration.Configuration.get('database.emptypassword'), '') self.assertEqual(configuration.Configuration.get('database.missingfield'), None) self.assertEqual(configuration.Configuration.get('database.user'), 'root') # Change a property configuration.Configuration.set('database.host', 'matrix') self.assertEqual(configuration.Configuration.get('database.host'), 'matrix') if __name__ == '__main__': unittest.main(argv=[sys.argv[0], "--verbose"] + sys.argv[1:])
runt18/nupic
tests/unit/nupic/support/custom_configuration_test.py
Python
agpl-3.0
42,200
from . version import __version__
ksomemo/ciserviceex
ciserviceex/__init__.py
Python
mit
35
# coding: utf-8 from typing import Union, Callable from .path import Path class Protection(Path): """Useful to protect samples from being pulled apart when setting up a test. """ def __init__(self, time: float, cmd: float, condition1: Union[str, bool, Callable], condition2: Union[str, bool, Callable], value1: float, value2: float, value0: float = 0, verbose: bool = False) -> None: """Sets the args and initializes parent class. Args: time: cmd: condition1 (:obj:`str`): Representing the first condition. See :ref:`generator path` for more info. condition2 (:obj:`str`): Representing the second condition. See :ref:`generator path` for more info. value1: Value to send when ``condition1`` is met. value2: Value to send when ``condition2`` is met. value0: Value to send when no condition is reached. verbose: Note: By default will send ``value0``. While ``condition1`` is met, will return ``value1``. While ``condition2`` is met, will return ``value2``. If ``condition1`` and ``condition2`` are met simultaneously, the first one met will prevail. If met at the same time, ``condition1`` will prevail. """ Path.__init__(self, time, cmd) self.value = (value0, value1, value2) self.condition1 = self.parse_condition(condition1) self.condition2 = self.parse_condition(condition2) s = '<' if '<' in condition1 else '>' self.lbl1 = condition1.split(s)[0] s = '<' if '<' in condition2 else '>' self.lbl2 = condition2.split(s)[0] self.verbose = verbose self.status = 0 def get_cmd(self, data: dict) -> float: if self.status == 0: if self.condition1(data): self.status = 1 elif self.condition2(data): self.status = 2 return self.value[self.status] if self.status == 1 and data[self.lbl1] and not self.condition1(data): self.status = 0 elif self.status == 2 and data[self.lbl2] and not self.condition2(data): self.status = 0 return self.value[self.status]
LaboratoireMecaniqueLille/crappy
crappy/blocks/generator_path/protection.py
Python
gpl-2.0
2,204
import argparse import pandas as pd from data_utils import clean_tweet def main(): from data_utils import RUBTSOVA_HEADER parser = argparse.ArgumentParser() parser.add_argument('files', metavar='F', nargs='+', help='CSV files to process', type=argparse.FileType('r')) parser.add_argument('-o', '--output', help='Output file', type=argparse.FileType('w+'), required=True) args = parser.parse_args() for f in args.files: df = pd.read_csv(f, header=None, sep=';', index_col=False, names=RUBTSOVA_HEADER) for tweet in df['ttext']: text = clean_tweet(tweet) args.output.write(text + ' ') if __name__ == "__main__": main()
tech-team/sentiment
preprocess/rubtsova_csv_to_corpus.py
Python
mit
839
from __future__ import print_function from gocd_cli.command import BaseCommand from gocd_cli.utils import get_settings __all__ = ['Decrypt', 'Encrypt'] class BaseEncryptionCommand(object): _encryption_module = None _settings = None @property def settings(self): if self._settings is None: self._settings = get_settings() return self._settings @property def encryption_module(self): if self._encryption_module is None: mod = self.settings.get('encryption_module') or 'gocd_cli.encryption.caesar' self._encryption_module = __import__(mod, fromlist=('',)) return self._encryption_module class Encrypt(BaseCommand, BaseEncryptionCommand): usage = """One of either plaintext or key can be passed in Flags: plaintext: A string to encrypt key: A configuration key from the settings file """ usage_summary = 'Encrypts the passed in plaintext or key to ciphertext' def __init__(self, server, plaintext=None, key=None): self.server = server self._plaintext = plaintext self._key = key @property def plaintext(self): if self._key: return self.settings.get(self._key) else: return self._plaintext def label(self): if self._key: return '{0}_encrypted'.format(self._key.replace('_encrypted', '')) else: return 'Ciphertext' def run(self): ciphertext = self.encryption_module.encrypt(self.plaintext) return self._return_value('{0}\n{1}'.format( 'encryption_module = {0}'.format(self.encryption_module.__name__), '{0} = {1}'.format(self.label(), ciphertext) ), exit_code=0) class Decrypt(BaseCommand, BaseEncryptionCommand): usage = """One of either ciphertext or key can be passed in Flags: ciphertext: A string to decrypt key: A configuration key from the settings file """ usage_summary = 'Decrypts the passed in ciphertext or key to plaintext' def __init__(self, server, ciphertext=None, key=None): self.server = server self._ciphertext = ciphertext self._key = key @property def ciphertext(self): if self._key: return self.settings.get(self._key) else: return self._ciphertext def label(self): if self._key: return self._key.replace('_encrypted', '') else: return 'Plaintext' def run(self): plaintext = self.encryption_module.decrypt(self.ciphertext) return self._return_value('{0}\n{1}'.format( 'encryption_module = {0}'.format(self.encryption_module.__name__), '{0} = {1}'.format(self.label(), plaintext), ), exit_code=0)
gaqzi/py-gocd-cli
gocd_cli/commands/settings.py
Python
mit
2,834
#!/usr/bin/env python # Standard packages import sys import cyvcf2 import argparse import geneimpacts from cyvcf2 import VCF def get_effects(variant, annotation_keys): effects = [] effects += [geneimpacts.SnpEff(e, annotation_keys) for e in variant.INFO.get("ANN").split(",")] return effects def get_top_impact(effects): top_impact = geneimpacts.Effect.top_severity(effects) if isinstance(top_impact, list): top_impact = top_impact[0] return top_impact def get_genes(effects): genes_list = [] for effect in effects: if effect.gene not in genes_list: genes_list.append(effect.gene) return genes_list def get_transcript_effects(effects): transcript_effects = dict() for effect in effects: if effect.transcript is not None: transcript_effects[effect.transcript] = "{biotype}|{effect}".format(biotype=effect.biotype, effect=effect.impact_severity) return transcript_effects if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument('-a', '--annotated_vcf', help="snpEff annotated VCF file to scan") parser.add_argument('-o', '--output', help="File for output information") args = parser.parse_args() sys.stdout.write("Parsing VCFAnno VCF with CyVCF2\n") reader = cyvcf2.VCFReader(args.annotated_vcf) desc = reader["ANN"]["Description"] annotation_keys = [x.strip("\"'") for x in re.split("\s*\|\s*", desc.split(":", 1)[1].strip('" '))] sys.stdout.write("Parsing VCFAnno VCF\n") vcf = VCF(args.annotated_vcf) for variant in vcf: effects = get_effects(variant, annotation_keys) top_impact = get_top_impact(effects) gene_effects = dict() for effect in effects: if effect.gene not in gene_effects.keys(): if effect.transcript is not None:
GastonLab/ddb-scripts
specialist/scan_multi-gene_annotated_snpEff.py
Python
mit
1,956
from moksha.api.streams import PollingDataStream from jqplotdemo.controllers.plots import get_plot_data, make_data, get_pie_data class JQPlotDemoStream(PollingDataStream): frequency = 1.0 def poll(self): self.send_message('jqplot.demo.plot', get_plot_data()) self.send_message('jqplot.demo.pie', get_pie_data())
ralphbean/moksha
moksha/apps/demo/MokshaJQPlotDemo/jqplotdemo/streams.py
Python
apache-2.0
338
#!/usr/bin/env python """Web authentication classes for the GUI.""" import collections from django import http import logging from grr.lib import access_control from grr.lib import config_lib from grr.lib import log from grr.lib import registry class BaseWebAuthManager(object): """A class managing web authentication. This class is responsible for deciding if the user will have access to the web interface and for generating the token that will be passed to the functions that deal with data. Checks are done using a decorator function. """ __metaclass__ = registry.MetaclassRegistry def SecurityCheck(self, func, request, *args, **kwargs): """A decorator applied to protected web handlers. Args: func: The wrapped function to call. request: The web request. Returns: A django http response object. This will get called for all requests that get passed through one of our handlers that is wrapped in @SecurityCheck. """ def RedirectBase(self): """Return a redirect to the main GRR page.""" return http.HttpResponsePermanentRedirect(config_lib.CONFIG["AdminUI.url"]) class BasicWebAuthManager(BaseWebAuthManager): """Manager using basic auth using the config file.""" def __init__(self): """Constructor.""" # Reuse the basic ACL manager functions for accessing the config. self._aclmanager = access_control.BasicAccessControlManager() super(BasicWebAuthManager, self).__init__() def SecurityCheck(self, func, request, *args, **kwargs): """Wrapping function.""" event_id = log.LOGGER.GetNewEventId() # Modify request adding an event_id attribute to track the event request.event_id = event_id request.user = "" authorized = False try: auth_type, authorization = request.META.get( "HTTP_AUTHORIZATION", " ").split(" ", 1) if auth_type == "Basic": user, password = authorization.decode("base64").split(":", 1) # Check the hash is ok auth_obj = collections.namedtuple("AuthObj", "user_provided_hash") auth_obj.user_provided_hash = password if self._aclmanager.user_manager.CheckUserAuth(user, auth_obj): authorized = True # The password is ok - update the user request.user = user except (IndexError, KeyError): pass if not authorized: result = http.HttpResponse("Unauthorized", status=401) result["WWW-Authenticate"] = "Basic realm='Secure Area'" return result # Modify this to implement additional checking (e.g. enforce SSL). response = func(request, *args, **kwargs) return response class NullWebAuthManager(BaseWebAuthManager): """Null web auth manager always returns test user unless set.""" def __init__(self, *args, **kwargs): super(NullWebAuthManager, self).__init__(*args, **kwargs) self.username = "test" def SetUserName(self, username): self.username = username def SecurityCheck(self, func, request, *args, **kwargs): """A decorator applied to protected web handlers.""" request.event_id = "1" request.user = self.username request.token = access_control.ACLToken("Testing", "Just a test") return func(request, *args, **kwargs) # Global to store the configured web auth manager. WEBAUTH_MANAGER = None def SecurityCheck(func): """A decorator applied to protected web handlers.""" def Wrapper(request, *args, **kwargs): """Wrapping function.""" if WEBAUTH_MANAGER is None: raise RuntimeError("Attempt to initialize before WEBAUTH_MANAGER set.") return WEBAUTH_MANAGER.SecurityCheck(func, request, *args, **kwargs) return Wrapper class WebAuthInit(registry.InitHook): pre = ["GuiPluginsInit"] def RunOnce(self): """Run this once on init.""" global WEBAUTH_MANAGER # pylint: disable=global-statement # pylint: disable=g-bad-name WEBAUTH_MANAGER = BaseWebAuthManager.NewPlugin( config_lib.CONFIG["AdminUI.webauth_manager"])() # pylint: enable=g-bad-name logging.info("Using webauth manager %s", WEBAUTH_MANAGER)
MiniSEC/GRR_clone
gui/webauth.py
Python
apache-2.0
4,111
#! /usr/bin/env python """ Created on Thu Jun 29 11:02:28 2017 @author: njlyons """ from matplotlib.backend_bases import Event from matplotlib.pyplot import gcf from numpy.testing import assert_equal from landlab import RasterModelGrid, imshow_grid from landlab.plot.event_handler import query_grid_on_button_press def test_query_grid_on_button_press(): rmg = RasterModelGrid((5, 5)) imshow_grid(rmg, rmg.nodes, cmap="RdYlBu") # Programmatically create an event near the grid center. event = Event("simulated_event", gcf().canvas) event.xdata = int(rmg.number_of_node_columns * 0.5) event.ydata = int(rmg.number_of_node_rows * 0.5) results = query_grid_on_button_press(event, rmg) x_coord = results["grid location"]["x_coord"] y_coord = results["grid location"]["x_coord"] msg = "Items: Simulated matplotlib event and query results." assert_equal(x_coord, event.xdata, msg) assert_equal(y_coord, event.ydata, msg) msg = "Items: Node ID and grid coordinates of simulated matplotlib event." node = rmg.grid_coords_to_node_id(event.xdata, event.ydata) assert_equal(results["node"]["ID"], node, msg)
landlab/landlab
tests/plot/test_event_handler.py
Python
mit
1,165
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding field 'WikiPage.rating_sum' db.add_column(u'mezzanine_wiki_wikipage', u'rating_sum', self.gf('django.db.models.fields.IntegerField')(default=0), keep_default=False) # Adding field 'WikiPage.created' db.add_column(u'mezzanine_wiki_wikipage', 'created', self.gf('django.db.models.fields.DateTimeField')(null=True), keep_default=False) # Adding field 'WikiPage.updated' db.add_column(u'mezzanine_wiki_wikipage', 'updated', self.gf('django.db.models.fields.DateTimeField')(null=True), keep_default=False) # Adding field 'WikiPage.in_sitemap' db.add_column(u'mezzanine_wiki_wikipage', 'in_sitemap', self.gf('django.db.models.fields.BooleanField')(default=True), keep_default=False) def backwards(self, orm): # Deleting field 'WikiPage.rating_sum' db.delete_column(u'mezzanine_wiki_wikipage', u'rating_sum') # Deleting field 'WikiPage.created' db.delete_column(u'mezzanine_wiki_wikipage', 'created') # Deleting field 'WikiPage.updated' db.delete_column(u'mezzanine_wiki_wikipage', 'updated') # Deleting field 'WikiPage.in_sitemap' db.delete_column(u'mezzanine_wiki_wikipage', 'in_sitemap') models = { u'auth.group': { 'Meta': {'object_name': 'Group'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': u"orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, u'auth.permission': { 'Meta': {'ordering': "(u'content_type__app_label', u'content_type__model', u'codename')", 'unique_together': "((u'content_type', u'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['contenttypes.ContentType']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, u'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Group']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Permission']"}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, u'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, u'mezzanine_wiki.wikicategory': { 'Meta': {'object_name': 'WikiCategory'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'site': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['sites.Site']"}), 'slug': ('django.db.models.fields.CharField', [], {'max_length': '2000', 'null': 'True', 'blank': 'True'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '500'}) }, u'mezzanine_wiki.wikipage': { 'Meta': {'ordering': "('title',)", 'object_name': 'WikiPage'}, '_meta_title': ('django.db.models.fields.CharField', [], {'max_length': '500', 'null': 'True', 'blank': 'True'}), 'allow_comments': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'categories': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "'wikipages'", 'blank': 'True', 'to': u"orm['mezzanine_wiki.WikiCategory']"}), u'comments_count': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'content': ('mezzanine_wiki.fields.WikiTextField', [], {}), 'created': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'date_created': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_modified': ('django.db.models.fields.DateTimeField', [], {}), 'description': ('django.db.models.fields.TextField', [], {'blank': 'True'}), 'expiry_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'featured_image': ('mezzanine.core.fields.FileField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'gen_description': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'in_sitemap': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), u'keywords_string': ('django.db.models.fields.CharField', [], {'max_length': '500', 'blank': 'True'}), 'publish_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), u'rating_average': ('django.db.models.fields.FloatField', [], {'default': '0'}), u'rating_count': ('django.db.models.fields.IntegerField', [], {'default': '0'}), u'rating_sum': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'short_url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'site': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['sites.Site']"}), 'slug': ('django.db.models.fields.CharField', [], {'max_length': '2000', 'null': 'True', 'blank': 'True'}), 'status': ('django.db.models.fields.IntegerField', [], {'default': '2'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '500'}), 'updated': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "u'wikipages'", 'to': u"orm['auth.User']"}) }, u'mezzanine_wiki.wikipagerevision': { 'Meta': {'ordering': "('-date_created',)", 'object_name': 'WikiPageRevision'}, 'content': ('mezzanine_wiki.fields.WikiTextField', [], {}), 'date_created': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_modified': ('django.db.models.fields.DateTimeField', [], {}), 'description': ('django.db.models.fields.CharField', [], {'max_length': '400', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'page': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['mezzanine_wiki.WikiPage']"}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "u'wikipagerevisions'", 'to': u"orm['auth.User']"}) }, u'sites.site': { 'Meta': {'ordering': "(u'domain',)", 'object_name': 'Site', 'db_table': "u'django_site'"}, 'domain': ('django.db.models.fields.CharField', [], {'max_length': '100'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) } } complete_apps = ['mezzanine_wiki']
dfalk/mezzanine-wiki
mezzanine_wiki/migrations/0006_auto__add_field_wikipage_rating_sum__add_field_wikipage_created__add_f.py
Python
bsd-2-clause
9,474
# Lesson 1 def iterative_factorial(n): result = 1 for i in range(1, n + 1): result *= i return result print(iterative_factorial(5)) # "Recursion" is the act of calling a function from within itself. Some functions naturally work better recursively. # Recursion is easier to work out if you write it down on paper. def factorial(n): if n > 1: return n * factorial(n - 1) else: # Recursive functions generally have a "base case", from which they stop recursing. return 1 # NOTE: It's helpful to draw out the "frames" of each function call print(factorial(5))
JonTheBurger/python_class
chapter 4/lessons/recursion.py
Python
mit
609
# -*- coding: utf-8 -*- from __future__ import unicode_literals import sys from winsys._compat import unittest import uuid import winerror import win32api import win32con import win32evtlog import win32security import pywintypes from winsys.tests import utils as testutils from winsys import event_logs, registry, utils LOG_NAME = event_logs.DEFAULT_LOG_NAME GUID = "_winsys-%s" % uuid.uuid1() # # Utility functions # def yield_logs(computer=None, log_name=LOG_NAME): hLog = win32evtlog.OpenEventLog(computer, log_name) try: while True: entries = win32evtlog.ReadEventLog( hLog, win32evtlog.EVENTLOG_BACKWARDS_READ | win32evtlog.EVENTLOG_SEQUENTIAL_READ, 0 ) if entries: for entry in entries: yield entry else: break finally: win32evtlog.CloseEventLog(hLog) # # TESTS # @unittest.skipUnless(testutils.i_am_admin(), "These tests must be run as Administrator") class TestEventLogs(unittest.TestCase): # # Fixtures # def setUp(self): event_logs.EventSource.create(GUID, LOG_NAME) self.registry_root = registry.registry(r"HKLM\SYSTEM\CurrentControlSet\Services\Eventlog") def tearDown(self): event_logs.event_source(r"%s\%s" %(LOG_NAME, GUID)).delete() # # Event Source # def test_create_source(self): log_name = "System" guid = "_winsys-test_create_source-%s" % uuid.uuid1() try: source = event_logs.EventSource.create(guid, log_name) self.assertTrue(self.registry_root + log_name + guid) except: raise else: source.delete() self.assertFalse(bool(self.registry_root + log_name + guid)) def test_create_source_at_default(self): guid = "_winsys-test_create_source_at_default-%s" % uuid.uuid1() try: source = event_logs.EventSource.create(guid) self.assertTrue(self.registry_root + event_logs.DEFAULT_LOG_NAME + guid) except: raise else: source.delete() self.assertFalse(bool(self.registry_root + event_logs.DEFAULT_LOG_NAME + guid)) def test_event_sources(self): log_name = "System" self.assertEqual( set(s.name for s in event_logs.event_sources(log_name)), set(r.name for r in self.registry_root + log_name) ) self.assertTrue(all(isinstance(s, event_logs.EventSource) for s in event_logs.event_sources(log_name))) def test_event_source_from_event_source(self): for s in event_logs.event_sources(): self.assertTrue(isinstance(s, event_logs.EventSource)) self.assertTrue(event_logs.event_source(s) is s) break def test_event_source_from_none(self): self.assertTrue(event_logs.event_source(None) is None) def test_event_source_from_bad_string(self): with self.assertRaises(event_logs.x_event_logs): event_logs.event_source("") def test_event_source_from_good_string(self): self.assertTrue( isinstance( event_logs.event_source(r"%s\%s" %(LOG_NAME, GUID)), event_logs.EventSource ) ) def test_event_source_from_good_string_default_log(self): self.assertTrue( isinstance( event_logs.event_source(GUID), event_logs.EventSource ) ) def test_event_source_as_string(self): self.assertTrue(event_logs.event_source(GUID).as_string()) def test_event_source_log_event(self): data = str(GUID).encode("utf8") event_logs.event_source(GUID).log_event(data=data) for event in yield_logs(): if event.SourceName == GUID and event.Data == data: self.assertTrue(True) break else: self.assertTrue(False) # # Event logs # def test_event_logs(self): self.assertEqual( set(s.name for s in event_logs.event_logs()), set(r.name for r in self.registry_root.keys()) ) self.assertTrue(all(isinstance(s, event_logs.EventLog) for s in event_logs.event_logs())) def test_event_log_from_event_log(self): for l in event_logs.event_logs(): self.assertTrue(isinstance(l, event_logs.EventLog)) self.assertTrue(event_logs.event_log(l) is l) break def test_event_log_from_none(self): self.assertTrue(event_logs.event_log(None) is None) def test_event_log_from_bad_string(self): with self.assertRaises(event_logs.x_event_logs): event_logs.event_log ("") def test_event_log_from_good_string(self): self.assertTrue( isinstance( event_logs.event_log(LOG_NAME), event_logs.EventLog ) ) def test_event_log_clear_no_save(self): log_name = "Internet Explorer" source_name = "_winsys-%s" % uuid.uuid1() source = event_logs.EventSource.create(source_name, log_name) log = event_logs.event_log(log_name) hLog = win32evtlog.OpenEventLog(None, log_name) try: log.log_event(source, message="hello") self.assertNotEquals(win32evtlog.GetNumberOfEventLogRecords(hLog), 0) log.clear() self.assertEqual(win32evtlog.GetNumberOfEventLogRecords(hLog), 0) finally: win32evtlog.CloseEventLog(hLog) source.delete() def test_event_log_clear_with_save(self): log_name = "Internet Explorer" source_name = "_winsys-%s" % uuid.uuid1() source = event_logs.EventSource.create(source_name, log_name) log = event_logs.event_log(log_name) hLog = win32evtlog.OpenEventLog(None, log_name) try: log.log_event(source, message="hello") self.assertNotEquals(win32evtlog.GetNumberOfEventLogRecords(hLog), 0) log.clear() self.assertEqual(win32evtlog.GetNumberOfEventLogRecords(hLog), 0) finally: win32evtlog.CloseEventLog(hLog) source.delete() # # Module-level functions # def test_log_event(self): data = str(GUID).encode("utf8") event_logs.log_event("%s\\%s" %(LOG_NAME, GUID), data=data) for event in yield_logs(): if event.SourceName == GUID and event.Data == data: self.assertTrue(True) break else: self.assertTrue(False) if __name__ == "__main__": unittest.main() if sys.stdout.isatty(): raw_input("Press enter...")
operepo/ope
laptop_credential/winsys/tests/test_event_logs.py
Python
mit
6,794
DEBUG = True TOKEN_SECRET = 'keyboard cat' FACEBOOK_SECRET = 'Facebook Client Secret' FOURSQUARE_SECRET = 'Foursquare Client Secret' GOOGLE_SECRET = 'Google Client Secret' LINKEDIN_SECRET = 'LinkedIn Client Secret' TWITTER_CONSUMER_KEY = 'Twitter Consumer Secret' TWITTER_CONSUMER_SECRET = 'Twitter Consumer Secret' TWITTER_CALLBACK_URL = 'http://localhost:3000' SQLALCHEMY_DATABASE_URI = 'sqlite:///app.db'
timsvoice/satellizer
examples/server/python/config.py
Python
mit
407
# Copyright (c) 2012 OpenStack Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. policy_data = """ { "admin_api": "is_admin:True", "cells_scheduler_filter:TargetCellFilter": "is_admin:True", "context_is_admin": "role:admin or role:administrator", "compute:create": "", "compute:create:attach_network": "", "compute:create:attach_volume": "", "compute:get": "", "compute:get_all": "", "compute:get_all_tenants": "", "compute:update": "", "compute:get_instance_metadata": "", "compute:get_all_instance_metadata": "", "compute:get_all_instance_system_metadata": "", "compute:update_instance_metadata": "", "compute:delete_instance_metadata": "", "compute:get_instance_faults": "", "compute:get_diagnostics": "", "compute:get_instance_diagnostics": "", "compute:get_lock": "", "compute:lock": "", "compute:unlock": "", "compute:unlock_override": "is_admin:True", "compute:get_vnc_console": "", "compute:get_spice_console": "", "compute:get_rdp_console": "", "compute:get_serial_console": "", "compute:get_console_output": "", "compute:associate_floating_ip": "", "compute:reset_network": "", "compute:inject_network_info": "", "compute:add_fixed_ip": "", "compute:remove_fixed_ip": "", "compute:attach_volume": "", "compute:detach_volume": "", "compute:attach_interface": "", "compute:detach_interface": "", "compute:set_admin_password": "", "compute:rescue": "", "compute:unrescue": "", "compute:suspend": "", "compute:resume": "", "compute:pause": "", "compute:unpause": "", "compute:start": "", "compute:stop": "", "compute:resize": "", "compute:confirm_resize": "", "compute:revert_resize": "", "compute:rebuild": "", "compute:reboot": "", "compute:snapshot": "", "compute:backup": "", "compute:shelve": "", "compute:shelve_offload": "", "compute:unshelve": "", "compute:security_groups:add_to_instance": "", "compute:security_groups:remove_from_instance": "", "compute:delete": "", "compute:soft_delete": "", "compute:force_delete": "", "compute:restore": "", "compute:swap_volume": "", "compute:volume_snapshot_create": "", "compute:volume_snapshot_delete": "", "compute:v3:servers:start": "", "compute:v3:servers:stop": "", "compute_extension:v3:os-access-ips": "", "compute_extension:accounts": "", "compute_extension:admin_actions:pause": "", "compute_extension:admin_actions:unpause": "", "compute_extension:admin_actions:suspend": "", "compute_extension:admin_actions:resume": "", "compute_extension:admin_actions:lock": "", "compute_extension:admin_actions:unlock": "", "compute_extension:admin_actions:resetNetwork": "", "compute_extension:admin_actions:injectNetworkInfo": "", "compute_extension:admin_actions:createBackup": "", "compute_extension:admin_actions:migrateLive": "", "compute_extension:admin_actions:resetState": "", "compute_extension:admin_actions:migrate": "", "compute_extension:v3:os-admin-actions:reset_network": "", "compute_extension:v3:os-admin-actions:inject_network_info": "", "compute_extension:v3:os-admin-actions:reset_state": "", "compute_extension:v3:os-admin-password": "", "compute_extension:aggregates": "rule:admin_api", "compute_extension:v3:os-aggregates:index": "rule:admin_api", "compute_extension:v3:os-aggregates:create": "rule:admin_api", "compute_extension:v3:os-aggregates:show": "rule:admin_api", "compute_extension:v3:os-aggregates:update": "rule:admin_api", "compute_extension:v3:os-aggregates:delete": "rule:admin_api", "compute_extension:v3:os-aggregates:add_host": "rule:admin_api", "compute_extension:v3:os-aggregates:remove_host": "rule:admin_api", "compute_extension:v3:os-aggregates:set_metadata": "rule:admin_api", "compute_extension:agents": "", "compute_extension:v3:os-agents": "", "compute_extension:attach_interfaces": "", "compute_extension:v3:os-attach-interfaces": "", "compute_extension:baremetal_nodes": "", "compute_extension:cells": "", "compute_extension:cells:create": "rule:admin_api", "compute_extension:cells:delete": "rule:admin_api", "compute_extension:cells:update": "rule:admin_api", "compute_extension:cells:sync_instances": "rule:admin_api", "compute_extension:v3:os-cells": "", "compute_extension:v3:os-cells:create": "rule:admin_api", "compute_extension:v3:os-cells:delete": "rule:admin_api", "compute_extension:v3:os-cells:update": "rule:admin_api", "compute_extension:v3:os-cells:sync_instances": "rule:admin_api", "compute_extension:certificates": "", "compute_extension:v3:os-certificates:create": "", "compute_extension:v3:os-certificates:show": "", "compute_extension:cloudpipe": "", "compute_extension:cloudpipe_update": "", "compute_extension:config_drive": "", "compute_extension:v3:os-config-drive": "", "compute_extension:console_output": "", "compute_extension:v3:os-console-output": "", "compute_extension:consoles": "", "compute_extension:v3:os-remote-consoles": "", "compute_extension:createserverext": "", "compute_extension:v3:os-create-backup": "", "compute_extension:deferred_delete": "", "compute_extension:v3:os-deferred-delete": "", "compute_extension:disk_config": "", "compute_extension:evacuate": "is_admin:True", "compute_extension:v3:os-evacuate": "is_admin:True", "compute_extension:extended_server_attributes": "", "compute_extension:v3:os-extended-server-attributes": "", "compute_extension:extended_status": "", "compute_extension:v3:os-extended-status": "", "compute_extension:extended_availability_zone": "", "compute_extension:v3:os-extended-availability-zone": "", "compute_extension:extended_ips": "", "compute_extension:extended_ips_mac": "", "compute_extension:extended_vif_net": "", "compute_extension:extended_volumes": "", "compute_extension:v3:os-extended-volumes": "", "compute_extension:v3:os-extended-volumes:swap": "", "compute_extension:v3:os-extended-volumes:attach": "", "compute_extension:v3:os-extended-volumes:detach": "", "compute_extension:v3:extensions:discoverable": "", "compute_extension:fixed_ips": "", "compute_extension:flavor_access": "", "compute_extension:flavor_access:addTenantAccess": "rule:admin_api", "compute_extension:flavor_access:removeTenantAccess": "rule:admin_api", "compute_extension:v3:os-flavor-access": "", "compute_extension:v3:os-flavor-access:remove_tenant_access": "rule:admin_api", "compute_extension:v3:os-flavor-access:add_tenant_access": "rule:admin_api", "compute_extension:flavor_disabled": "", "compute_extension:v3:os-flavor-disabled": "", "compute_extension:flavor_rxtx": "", "compute_extension:v3:os-flavor-rxtx": "", "compute_extension:flavor_swap": "", "compute_extension:flavorextradata": "", "compute_extension:flavorextraspecs:index": "", "compute_extension:flavorextraspecs:show": "", "compute_extension:flavorextraspecs:create": "is_admin:True", "compute_extension:flavorextraspecs:update": "is_admin:True", "compute_extension:flavorextraspecs:delete": "is_admin:True", "compute_extension:v3:flavor-extra-specs:index": "", "compute_extension:v3:flavor-extra-specs:show": "", "compute_extension:v3:flavor-extra-specs:create": "is_admin:True", "compute_extension:v3:flavor-extra-specs:update": "is_admin:True", "compute_extension:v3:flavor-extra-specs:delete": "is_admin:True", "compute_extension:flavormanage": "", "compute_extension:v3:flavor-manage": "", "compute_extension:v3:flavors:discoverable": "", "compute_extension:floating_ip_dns": "", "compute_extension:floating_ip_pools": "", "compute_extension:floating_ips": "", "compute_extension:floating_ips_bulk": "", "compute_extension:fping": "", "compute_extension:fping:all_tenants": "is_admin:True", "compute_extension:hide_server_addresses": "", "compute_extension:v3:os-hide-server-addresses": "", "compute_extension:hosts": "rule:admin_api", "compute_extension:v3:os-hosts": "rule:admin_api", "compute_extension:hypervisors": "rule:admin_api", "compute_extension:v3:os-hypervisors": "rule:admin_api", "compute_extension:image_size": "", "compute_extension:v3:image-size": "", "compute_extension:instance_actions": "", "compute_extension:v3:os-instance-actions": "", "compute_extension:instance_actions:events": "is_admin:True", "compute_extension:v3:os-instance-actions:events": "is_admin:True", "compute_extension:instance_usage_audit_log": "", "compute_extension:keypairs": "", "compute_extension:keypairs:index": "", "compute_extension:keypairs:show": "", "compute_extension:keypairs:create": "", "compute_extension:keypairs:delete": "", "compute_extension:v3:os-keypairs": "", "compute_extension:v3:os-keypairs:index": "", "compute_extension:v3:os-keypairs:show": "", "compute_extension:v3:os-keypairs:create": "", "compute_extension:v3:os-keypairs:delete": "", "compute_extension:v3:os-lock-server:lock": "", "compute_extension:v3:os-lock-server:unlock": "", "compute_extension:v3:os-migrate-server:migrate": "", "compute_extension:v3:os-migrate-server:migrate_live": "", "compute_extension:multinic": "", "compute_extension:v3:os-multinic": "", "compute_extension:networks": "", "compute_extension:networks:view": "", "compute_extension:networks_associate": "", "compute_extension:os-tenant-networks": "", "compute_extension:v3:os-pause-server:pause": "", "compute_extension:v3:os-pause-server:unpause": "", "compute_extension:v3:os-pci:pci_servers": "", "compute_extension:v3:os-pci:index": "", "compute_extension:v3:os-pci:detail": "", "compute_extension:v3:os-pci:show": "", "compute_extension:quotas:show": "", "compute_extension:quotas:update": "", "compute_extension:quotas:delete": "", "compute_extension:v3:os-quota-sets:show": "", "compute_extension:v3:os-quota-sets:update": "", "compute_extension:v3:os-quota-sets:delete": "", "compute_extension:v3:os-quota-sets:detail": "", "compute_extension:quota_classes": "", "compute_extension:rescue": "", "compute_extension:v3:os-rescue": "", "compute_extension:security_group_default_rules": "", "compute_extension:security_groups": "", "compute_extension:v3:os-security-groups": "", "compute_extension:server_diagnostics": "", "compute_extension:v3:os-server-diagnostics": "", "compute_extension:server_groups": "", "compute_extension:server_password": "", "compute_extension:v3:os-server-password": "", "compute_extension:server_usage": "", "compute_extension:v3:os-server-usage": "", "compute_extension:v3:os-server-groups": "", "compute_extension:services": "", "compute_extension:v3:os-services": "", "compute_extension:shelve": "", "compute_extension:shelveOffload": "", "compute_extension:v3:os-shelve:shelve": "", "compute_extension:v3:os-shelve:shelve_offload": "", "compute_extension:simple_tenant_usage:show": "", "compute_extension:simple_tenant_usage:list": "", "compute_extension:v3:os-simple-tenant-usage:show": "", "compute_extension:v3:os-simple-tenant-usage:list": "", "compute_extension:unshelve": "", "compute_extension:v3:os-shelve:unshelve": "", "compute_extension:v3:os-suspend-server:suspend": "", "compute_extension:v3:os-suspend-server:resume": "", "compute_extension:users": "", "compute_extension:virtual_interfaces": "", "compute_extension:virtual_storage_arrays": "", "compute_extension:volumes": "", "compute_extension:volume_attachments:index": "", "compute_extension:volume_attachments:show": "", "compute_extension:volume_attachments:create": "", "compute_extension:volume_attachments:update": "", "compute_extension:volume_attachments:delete": "", "compute_extension:v3:os-volumes": "", "compute_extension:volumetypes": "", "compute_extension:zones": "", "compute_extension:availability_zone:list": "", "compute_extension:v3:os-availability-zone:list": "", "compute_extension:availability_zone:detail": "is_admin:True", "compute_extension:v3:os-availability-zone:detail": "is_admin:True", "compute_extension:used_limits_for_admin": "is_admin:True", "compute_extension:v3:os-used-limits": "is_admin:True", "compute_extension:migrations:index": "is_admin:True", "compute_extension:v3:os-migrations:index": "is_admin:True", "compute_extension:os-assisted-volume-snapshots:create": "", "compute_extension:os-assisted-volume-snapshots:delete": "", "compute_extension:console_auth_tokens": "is_admin:True", "compute_extension:v3:os-console-auth-tokens": "is_admin:True", "compute_extension:os-server-external-events:create": "rule:admin_api", "compute_extension:v3:os-server-external-events:create": "rule:admin_api", "volume:create": "", "volume:get": "", "volume:get_all": "", "volume:get_volume_metadata": "", "volume:delete": "", "volume:update": "", "volume:delete_volume_metadata": "", "volume:update_volume_metadata": "", "volume:attach": "", "volume:detach": "", "volume:reserve_volume": "", "volume:unreserve_volume": "", "volume:begin_detaching": "", "volume:roll_detaching": "", "volume:check_attach": "", "volume:check_detach": "", "volume:initialize_connection": "", "volume:terminate_connection": "", "volume:create_snapshot": "", "volume:delete_snapshot": "", "volume:get_snapshot": "", "volume:get_all_snapshots": "", "volume_extension:volume_admin_actions:reset_status": "rule:admin_api", "volume_extension:snapshot_admin_actions:reset_status": "rule:admin_api", "volume_extension:volume_admin_actions:force_delete": "rule:admin_api", "volume_extension:volume_actions:upload_image": "", "volume_extension:types_manage": "", "volume_extension:types_extra_specs": "", "network:get_all": "", "network:get": "", "network:create": "", "network:delete": "", "network:associate": "", "network:disassociate": "", "network:get_vifs_by_instance": "", "network:get_vif_by_mac_address": "", "network:allocate_for_instance": "", "network:deallocate_for_instance": "", "network:validate_networks": "", "network:get_instance_uuids_by_ip_filter": "", "network:get_instance_id_by_floating_address": "", "network:setup_networks_on_host": "", "network:get_floating_ip": "", "network:get_floating_ip_pools": "", "network:get_floating_ip_by_address": "", "network:get_floating_ips_by_project": "", "network:get_floating_ips_by_fixed_address": "", "network:allocate_floating_ip": "", "network:deallocate_floating_ip": "", "network:associate_floating_ip": "", "network:disassociate_floating_ip": "", "network:release_floating_ip": "", "network:migrate_instance_start": "", "network:migrate_instance_finish": "", "network:get_fixed_ip": "", "network:get_fixed_ip_by_address": "", "network:add_fixed_ip_to_instance": "", "network:remove_fixed_ip_from_instance": "", "network:add_network_to_project": "", "network:get_instance_nw_info": "", "network:get_dns_domains": "", "network:add_dns_entry": "", "network:modify_dns_entry": "", "network:delete_dns_entry": "", "network:get_dns_entries_by_address": "", "network:get_dns_entries_by_name": "", "network:create_private_dns_domain": "", "network:create_public_dns_domain": "", "network:delete_dns_domain": "", "network:attach_external_network": "rule:admin_api" } """
tianweizhang/nova
nova/tests/fake_policy.py
Python
apache-2.0
16,571
""" This is the test suite for space.py. """ from unittest import TestCase, main, skip from indra.agent import Agent, X, Y from indra.space import DEF_HEIGHT, DEF_WIDTH from indra.space import Space, distance from indra.tests.test_agent import create_newton, create_hardy, create_leibniz from indra.tests.test_agent import create_ramanujan REP_RAND_TESTS = 20 def create_space(): space = Space("test space") newton = create_newton() space += newton space += create_hardy() space += create_leibniz() return space, newton def create_teeny_space(): """ This space should be full! """ space = Space("test space", 2, 2) space += create_newton() space += create_hardy() space += create_leibniz() space += create_ramanujan() return space class SpaceTestCase(TestCase): def setUp(self): (self.space, self.newton) = create_space() self.teeny_space = create_teeny_space() self.test_agent = Agent("test agent") self.test_agent2 = Agent("test agent 2") self.test_agent3 = Agent("test agent 3") self.test_agent4 = Agent("test agent 4") def tearDown(self): self.space = None self.teeny_space = None self.test_agent = None self.test_agent2 = None self.test_agent3 = None self.test_agent4 = None def test_get_closest_agent(self): closest = self.space.get_closest_agent(self.newton) self.assertTrue(distance(self.newton, closest) <= self.space.get_max_distance()) def test_constrain_x(self): """ Test keeping x in bounds. """ self.assertEqual(self.space.constrain_x(-10), 0) self.assertEqual(self.space.constrain_x(DEF_WIDTH * 2), DEF_WIDTH - 1) def test_constrain_y(self): """ Test keeping y in bounds. """ self.assertEqual(self.space.constrain_y(-10), 0) self.assertEqual(self.space.constrain_x(DEF_HEIGHT * 2), DEF_HEIGHT - 1) def test_grid_size(self): """ Make sure we calc grid size properly. """ self.assertEqual(self.space.grid_size(), DEF_HEIGHT * DEF_WIDTH) def test_is_full(self): """ See if the grid is full. """ self.assertFalse(self.space.is_full()) self.assertTrue(self.teeny_space.is_full()) def test_rand_place_members(self): """ Test rand_place_members() by making sure all agents have a pos when done. """ for agent in self.space: self.assertTrue(self.space[agent].is_located()) def test_place_member_xy(self): """ Test placing an agent at a particular x, y spot. We will run this DEF_HEIGHT times, to test multiple possible placements. """ space = Space("test space") for i in range(DEF_HEIGHT): spot = space.place_member(mbr=self.test_agent, xy=(i, i)) if spot is not None: # the print output will usually be captured by nose, # but that can be turned off with --nocapture. (x, y) = (self.test_agent.get_x(), self.test_agent.get_y()) self.assertEqual((x, y), (i, i)) def test_get_agent_at(self): """ Test getting an agent from some locale. """ space = Space("test space") # before adding agent, all cells are empty: self.assertEqual(space.get_agent_at(1, 1), None) for i in range(DEF_HEIGHT): spot = space.place_member(mbr=self.test_agent, xy=(i, i)) whos_there = space.get_agent_at(i, i) self.assertEqual(whos_there, self.test_agent) def test_rand_x(self): """ Make sure randomly generated X pos is within grid. If constrained, make sure it is within constraints. """ x = self.space.rand_x() self.assertTrue(x >= 0) self.assertTrue(x <= self.space.width) x2 = self.space.rand_x(low=4, high=8) self.assertTrue(x2 >= 4) self.assertTrue(x2 <= 8) def test_rand_y(self): """ Make sure randomly generated Y pos is within grid. """ y = self.space.rand_y() self.assertTrue(y >= 0) self.assertTrue(y <= self.space.height) y2 = self.space.rand_y(low=4, high=8) self.assertTrue(y2 >= 4) self.assertTrue(y2 <= 8) def test_gen_new_pos(self): """ Making sure new pos is within max_move of old pos. Since this test relies on random numbers, let's repeat it. """ for i in range(REP_RAND_TESTS): # test with different max moves: max_move = (i // 2) + 1 (old_x, old_y) = self.newton.get_pos() (new_x, new_y) = self.space.gen_new_pos(self.newton, max_move) if not abs(old_x - new_x) <= max_move: print("Failed test with ", old_x, " ", new_x) if not abs(old_y - new_y) <= max_move: print("Failed test with ", old_y, " ", new_y) self.assertTrue(abs(old_x - new_x) <= max_move) self.assertTrue(abs(old_y - new_y) <= max_move) def test_location(self): """ Test that an added agent has a location. """ n = create_newton() self.space += n self.assertTrue(self.space.get_agent_at(n.pos[X], n.pos[Y]) == n) def test_add_location(self): """ Can we add an agent to a location? """ for i in range(REP_RAND_TESTS): # test with different random positions x, y = self.space.rand_x(), self.space.rand_y() if (x, y) not in self.space.locations: self.newton.set_pos(self.space, x, y) self.space.add_location(x, y, self.newton) self.assertTrue(self.space.get_agent_at(self.newton.pos[X], self.newton.pos[Y]) == self.newton) # def test_move_location(self): # """ # Can we move agent from one location to another? # This test sometimes fails: we need to explore! # """ # for i in range(REP_RAND_TESTS): # test with different random positions # print("Trying a new location: ", i, "th iteration") # print("Previous newton is at ", self.newton.get_x(), self.newton.get_y()) # x, y = self.space.rand_x(), self.space.rand_y() # print("new x, y = ", x, y) # self.space.move_location(x, y, self.newton.get_x(), self.newton.get_y()) # print("Now newton is at ", self.newton.get_x(), self.newton.get_y()) # self.assertTrue(self.space.locations[(x, y)] == self.newton) def test_remove_location(self): """ Test removing location from locations. """ (x, y) = (self.newton.get_x(), self.newton.get_y()) self.space.remove_location(x, y) self.assertTrue((x, y) not in self.space.locations) def test_move(self): """ Test whether moving an agent stays within its max move. """ for i in range(REP_RAND_TESTS): # test with different max moves: max_move = (i // 2) + 1 (old_x, old_y) = (self.newton.get_x(), self.newton.get_y()) self.newton.move(max_move) (new_x, new_y) = (self.newton.get_x(), self.newton.get_y()) self.assertTrue(abs(new_x - old_x) <= max_move) self.assertTrue(abs(new_y - old_y) <= max_move) def test_is_empty(self): """ Is cell empty? """ (x, y) = (self.newton.get_x(), self.newton.get_y()) self.assertFalse(self.space.is_empty(x, y)) @skip("Skipping von neumann test") def test_get_vonneumann_hood(self): """ Get von Neumann neighborhood. """ space = Space("test space") space += self.test_agent space += self.test_agent2 space += self.test_agent3 space += self.test_agent4 for i in range(REP_RAND_TESTS): print("Looping in von Neumann") space.place_member(mbr=self.test_agent, xy=(0, 0)) space.place_member(mbr=self.test_agent2, xy=(0, 1)) hood = space.get_vonneumann_hood(self.test_agent) self.assertTrue(self.test_agent2.name in hood) space.place_member(mbr=self.test_agent3, xy=(1, 0)) hood = space.get_vonneumann_hood(self.test_agent) self.assertTrue(self.test_agent3.name in hood) space.place_member(mbr=self.test_agent4, xy=(0, DEF_HEIGHT)) hood = space.get_vonneumann_hood(self.test_agent) self.assertTrue(self.test_agent4.name not in hood) if __name__ == '__main__': main()
gcallah/Indra
indra/tests/test_space.py
Python
gpl-3.0
8,912
""" =================== Label image regions =================== This example shows how to segment an image with image labelling. The following steps are applied: 1. Thresholding with automatic Otsu method 2. Close small holes with binary closing 3. Remove artifacts touching image border 4. Measure image regions to filter small objects """ import numpy as np import matplotlib.pyplot as plt import matplotlib.patches as mpatches from skimage import data from skimage.filters import threshold_otsu from skimage.segmentation import clear_border from skimage.measure import label from skimage.morphology import closing, square from skimage.measure import regionprops from skimage.color import label2rgb image = data.coins()[50:-50, 50:-50] # apply threshold thresh = threshold_otsu(image) bw = closing(image > thresh, square(3)) # remove artifacts connected to image border cleared = bw.copy() clear_border(cleared) # label image regions label_image = label(cleared) image_label_overlay = label2rgb(label_image, image=image) fig, ax = plt.subplots(ncols=1, nrows=1, figsize=(6, 6)) ax.imshow(image_label_overlay) for region in regionprops(label_image): # skip small images if region.area < 100: continue # draw rectangle around segmented coins minr, minc, maxr, maxc = region.bbox rect = mpatches.Rectangle((minc, minr), maxc - minc, maxr - minr, fill=False, edgecolor='red', linewidth=2) ax.add_patch(rect) plt.show()
Hiyorimi/scikit-image
doc/examples/segmentation/plot_label.py
Python
bsd-3-clause
1,493
# Copyright (c) 2014 Red Hat, Inc. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import functools from oslo_utils import importutils from nova.scheduler import utils class LazyLoader(object): def __init__(self, klass, *args, **kwargs): self.klass = klass self.args = args self.kwargs = kwargs self.instance = None def __getattr__(self, name): return functools.partial(self.__run_method, name) def __run_method(self, __name, *args, **kwargs): if self.instance is None: self.instance = self.klass(*self.args, **self.kwargs) return getattr(self.instance, __name)(*args, **kwargs) class SchedulerClient(object): """Client library for placing calls to the scheduler.""" def __init__(self): self.queryclient = LazyLoader(importutils.import_class( 'nova.scheduler.client.query.SchedulerQueryClient')) self.reportclient = LazyLoader(importutils.import_class( 'nova.scheduler.client.report.SchedulerReportClient')) @utils.retry_select_destinations def select_destinations(self, context, request_spec, filter_properties): return self.queryclient.select_destinations( context, request_spec, filter_properties) def update_aggregates(self, context, aggregates): self.queryclient.update_aggregates(context, aggregates) def delete_aggregate(self, context, aggregate): self.queryclient.delete_aggregate(context, aggregate) def update_resource_stats(self, context, name, stats): self.reportclient.update_resource_stats(context, name, stats) def update_instance_info(self, context, host_name, instance_info): self.queryclient.update_instance_info(context, host_name, instance_info) def delete_instance_info(self, context, host_name, instance_uuid): self.queryclient.delete_instance_info(context, host_name, instance_uuid) def sync_instance_info(self, context, host_name, instance_uuids): self.queryclient.sync_instance_info(context, host_name, instance_uuids)
thomasem/nova
nova/scheduler/client/__init__.py
Python
apache-2.0
2,731
my_file = open("/tmp/my_file", "w") my_file.write("Test string") my_file.close() my_file = open("/tmp/my_file", "r") content = my_file.read() my_file.close() if (content == "Test string"): print("OK") else: print("KO")
Nakrez/RePy
tests/parser/good/file.py
Python
mit
229
# xlreg_py/xlreg/regCred.py """ Registry credentials as seen by client. """ import binascii from xlutil import parse_decimal_version SHA1_BYTES = 20 SHA2_BYTES = 32 class RegCredError(RuntimeError): """ xlReg-related exception. """ class RegCred(object): """ Registry credentials as seen by client. """ __slots__ = ['_name', '_id', '_comms_pub_key', '_sig_pub_key', '_end_points', '_version', ] def __init__(self, name, id_, ck_, sk_, end_points, version): """ Initialize the instance. """ if name is None or name == '': raise RegCredError('nil or empty xlReg name') self._name = name if id_ is None or id_ == '': raise RegCredError('nil or empty xlReg id') id_len = len(id_) if id_len != SHA1_BYTES and id_len != SHA2_BYTES: raise RegCredError('id length not 20 and not 32') self._id = id_ if ck_ is None or ck_ == '': raise RegCredError('nil or empty xlReg commsPubKkey') # NOTE need better check(line) self._comms_pub_key = ck_ if sk_ is None or sk_ == '': raise RegCredError('nil or empty xlReg sigPubKkey') # NOTE need better chesk(s) self._sig_pub_key = sk_ if not end_points: raise RegCredError('nil or empty end_points list') self._end_points = [] for ep_ in end_points: # NOTE currently should begin with 'TcpEndPoint: ' self._end_points.append(ep_) if version is None: raise RegCredError('nil regCred version') # NOTE should check it's a 32-bit value self._version = version # properties def get_name(self): """ Return the name. """ return self._name def get_id(self): """ Return the regCred ID. """ return self._id def get_comms_pub_key(self): """ Return the communications public key. """ return self._comms_pub_key def get_sig_pub_key(self): """ Return the public key for digital signatures. """ return self._sig_pub_key def get_end_points(self): """ Return the associated EndPoint. """ return self._end_points def get_version(self): """ Return the RegCred version number. """ return self._version def __str__(self): """ Stringify the object. """ strings = [] strings.append('regCred {') strings.append(' Name: %s' % self._name) # uncommenting this yields 'odd length string' error # strings.append(" ID: %s" % binascii.b2a_hex(self._id)) strings.append(" ID: %s" % dump_byte_array(self._id)) strings.append( ' CommsPubKey: ' + dump_byte_array( self._comms_pub_key)) strings.append(' SigPubKey: ' + dump_byte_array(self._sig_pub_key)) strings.append(' EndPoints {') for ep_ in self._end_points: strings.append(' ' + ep_) strings.append(' }') strings.append(' Version: ' + self._version.__str__()) strings.append('}') string = "\r\n".join(strings) + "\r\n" return string def dump_byte_array(aaa): """ Stringify a byte array as hex. """ out = '' for bbb in aaa: pair = "%02x" % bbb out += pair return out def parse_reg_cred(line): """ Expect rather loosely formatted registry credentials but require a space after colon (:) or left brace ({) delimiters. """ if line is None or line == "": raise RegCredError("nil or empty regCred string") lines = line.split("\r\n") line_count = len(lines) def skip_line_and_trim(ndx): """ Return the first string containing something other than whitespace. """ if ndx >= line_count: raise RegCredError('no next line') while ndx < line_count: line = lines[ndx].strip() ndx += 1 if line: break return ndx, line ndx = 0 ndx, line = skip_line_and_trim(ndx) if line != 'regCred {': raise RegCredError( "expected 'regCred {' but found '%s': not well-formed" % line) ndx, line = skip_line_and_trim(ndx) parts = line.split(': ') if len(parts) != 2 or parts[0] != 'Name': raise RegCredError('not a well-formed regCred') name = parts[1].strip() if len(name) < 1: raise RegCredError('not a well-formed regCred: empty name') ndx, line = skip_line_and_trim(ndx) parts = line.split(': ') if len(parts) != 2 or parts[0] != 'ID': raise RegCredError('not a well-formed regCred') hex_ = parts[1].strip() id_ = binascii.a2b_hex(hex_) # NOTE could require length of 20 or 32 ndx, line = skip_line_and_trim(ndx) parts = line.split(': ') if len(parts) != 2 or parts[0] != 'CommsPubKey': raise RegCredError('not a well-formed regCred') ck_ = binascii.a2b_hex(parts[1]) ndx, line = skip_line_and_trim(ndx) parts = line.split(': ') if len(parts) != 2 or parts[0] != 'SigPubKey': raise RegCredError('not a well-formed regCred') sk_ = binascii.a2b_hex(parts[1]) ndx, line = skip_line_and_trim(ndx) if line != 'EndPoints {': raise RegCredError('not a well-formed regCred') # collect end_points end_points = [] while True: ndx, line = skip_line_and_trim(ndx) if line == '}': break parts = line.split(': ') if len(parts) != 2: raise RegCredError('not a well-formed regCred end_point') protocol = parts[0].strip() address = parts[1].strip() end_points.append('%s: %s' % (protocol, address)) ndx, line = skip_line_and_trim(ndx) parts = line.split(': ') if len(parts) != 2 or parts[0] != 'Version': raise RegCredError('not a well-formed regCred') vers = parts[1].strip() version = parse_decimal_version(vers) return RegCred(name, id_, ck_, sk_, end_points, version)
jddixon/xlreg_py
src/xlreg/reg_cred.py
Python
mit
6,142
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from collections import OrderedDict from django.utils.translation import ugettext_lazy as _ from horizon import exceptions from horizon import tabs from openstack_dashboard import api from cloudkittydashboard.api import cloudkitty as cloudkitty_api from cloudkittydashboard.dashboards.admin.pricing.pricing \ import tables as pricing_tables from cloudkittydashboard.dashboards.admin.pricing.pricing_versions \ import tables as pricing_versions_tables class PricingTab(tabs.TableTab): table_classes = (pricing_tables.PricingTable,) name = _("Pricing") slug = "pricing_tab" template_name = ("horizon/common/_detail_table.html") preload = False def get_pricing_data(self): try: pricing_infos = cloudkitty_api.cloudkittyclient(self.request).common.pricing_infos.list(pricing_version='all') except Exception: pricing_infos = [] exceptions.handle(self.request, _('Unable to retrieve pricing list.')) pricing = [] for p in pricing_infos: if p.time_based: p.time_based = _("Duration") else: p.time_based = _("Usage") if p.charging_key != "network.bw.total": pricing.append(p) return pricing class PricingVersionsTab(tabs.TableTab): table_classes = (pricing_versions_tables.PricingVersionsTable,) name = _("Pricing Versions") slug = "pricing_versions_tab" template_name = ("horizon/common/_detail_table.html") preload = False def get_pricing_versions_data(self): try: pricing_versions = cloudkitty_api.cloudkittyclient(self.request).common.pricing_vers.list() except Exception: pricing_versions = [] exceptions.handle(self.request, _('Unable to retrieve pricing versions list.')) return pricing_versions class PricingGroupTabs(tabs.TabGroup): slug = "pricing_group_tabs" tabs = (PricingTab, PricingVersionsTab) sticky = True
FNST-OpenStack/cloudkitty-dashboard
cloudkittydashboard/dashboards/admin/pricing/tabs.py
Python
apache-2.0
2,562
class BaseDabbaException(Exception): @property def message(self): return self.args[0] class ProcessingException(BaseDabbaException): def __init__(self, message, slug=None, info=None): super(ProcessingException, self).__init__(message) self.slug = slug self.info = info def to_dict(self): return { 'message': self.message, 'slug': self.slug, 'info': self.info, } class EarlyReturn(BaseDabbaException): def __init__(self, message, job): super(EarlyReturn, self).__init__(message) self.job = job class BadRequest(BaseDabbaException): def __init__(self, message, status_code=500): super(BadRequest, self).__init__(message) self.status_code = status_code
voidfiles/dabba
dabba/exceptions.py
Python
mit
799
#!/usr/bin/env python #===- lib/asan/scripts/asan_symbolize.py -----------------------------------===# # # The LLVM Compiler Infrastructure # # This file is distributed under the University of Illinois Open Source # License. See LICENSE.TXT for details. # #===------------------------------------------------------------------------===# import argparse import bisect import getopt import os import re import subprocess import sys symbolizers = {} DEBUG = False demangle = False binutils_prefix = None sysroot_path = None binary_name_filter = None fix_filename_patterns = None logfile = sys.stdin # FIXME: merge the code that calls fix_filename(). def fix_filename(file_name): if fix_filename_patterns: for path_to_cut in fix_filename_patterns: file_name = re.sub('.*' + path_to_cut, '', file_name) file_name = re.sub('.*asan_[a-z_]*.cc:[0-9]*', '_asan_rtl_', file_name) file_name = re.sub('.*crtstuff.c:0', '???:0', file_name) return file_name def sysroot_path_filter(binary_name): return sysroot_path + binary_name def guess_arch(addr): # Guess which arch we're running. 10 = len('0x') + 8 hex digits. if len(addr) > 10: return 'x86_64' else: return 'i386' class Symbolizer(object): def __init__(self): pass def symbolize(self, addr, binary, offset): """Symbolize the given address (pair of binary and offset). Overriden in subclasses. Args: addr: virtual address of an instruction. binary: path to executable/shared object containing this instruction. offset: instruction offset in the @binary. Returns: list of strings (one string for each inlined frame) describing the code locations for this instruction (that is, function name, file name, line and column numbers). """ return None class LLVMSymbolizer(Symbolizer): def __init__(self, symbolizer_path, default_arch, system, dsym_hints=[]): super(LLVMSymbolizer, self).__init__() self.symbolizer_path = symbolizer_path self.default_arch = default_arch self.system = system self.dsym_hints = dsym_hints self.pipe = self.open_llvm_symbolizer() def open_llvm_symbolizer(self): cmd = [self.symbolizer_path, '--use-symbol-table=true', '--demangle=%s' % demangle, '--functions=short', '--inlining=true', '--default-arch=%s' % self.default_arch] if self.system == 'Darwin': for hint in self.dsym_hints: cmd.append('--dsym-hint=%s' % hint) if DEBUG: print ' '.join(cmd) try: result = subprocess.Popen(cmd, stdin=subprocess.PIPE, stdout=subprocess.PIPE) except OSError: result = None return result def symbolize(self, addr, binary, offset): """Overrides Symbolizer.symbolize.""" if not self.pipe: return None result = [] try: symbolizer_input = '"%s" %s' % (binary, offset) if DEBUG: print symbolizer_input print >> self.pipe.stdin, symbolizer_input while True: function_name = self.pipe.stdout.readline().rstrip() if not function_name: break file_name = self.pipe.stdout.readline().rstrip() file_name = fix_filename(file_name) if (not function_name.startswith('??') or not file_name.startswith('??')): # Append only non-trivial frames. result.append('%s in %s %s' % (addr, function_name, file_name)) except Exception: result = [] if not result: result = None return result def LLVMSymbolizerFactory(system, default_arch, dsym_hints=[]): symbolizer_path = os.getenv('LLVM_SYMBOLIZER_PATH') if not symbolizer_path: symbolizer_path = os.getenv('ASAN_SYMBOLIZER_PATH') if not symbolizer_path: # Assume llvm-symbolizer is in PATH. symbolizer_path = 'llvm-symbolizer' return LLVMSymbolizer(symbolizer_path, default_arch, system, dsym_hints) class Addr2LineSymbolizer(Symbolizer): def __init__(self, binary): super(Addr2LineSymbolizer, self).__init__() self.binary = binary self.pipe = self.open_addr2line() def open_addr2line(self): addr2line_tool = 'addr2line' if binutils_prefix: addr2line_tool = binutils_prefix + addr2line_tool cmd = [addr2line_tool, '-f'] if demangle: cmd += ['--demangle'] cmd += ['-e', self.binary] if DEBUG: print ' '.join(cmd) return subprocess.Popen(cmd, stdin=subprocess.PIPE, stdout=subprocess.PIPE) def symbolize(self, addr, binary, offset): """Overrides Symbolizer.symbolize.""" if self.binary != binary: return None try: print >> self.pipe.stdin, offset function_name = self.pipe.stdout.readline().rstrip() file_name = self.pipe.stdout.readline().rstrip() except Exception: function_name = '' file_name = '' file_name = fix_filename(file_name) return ['%s in %s %s' % (addr, function_name, file_name)] class UnbufferedLineConverter(object): """ Wrap a child process that responds to each line of input with one line of output. Uses pty to trick the child into providing unbuffered output. """ def __init__(self, args, close_stderr=False): # Local imports so that the script can start on Windows. import pty import termios pid, fd = pty.fork() if pid == 0: # We're the child. Transfer control to command. if close_stderr: dev_null = os.open('/dev/null', 0) os.dup2(dev_null, 2) os.execvp(args[0], args) else: # Disable echoing. attr = termios.tcgetattr(fd) attr[3] = attr[3] & ~termios.ECHO termios.tcsetattr(fd, termios.TCSANOW, attr) # Set up a file()-like interface to the child process self.r = os.fdopen(fd, "r", 1) self.w = os.fdopen(os.dup(fd), "w", 1) def convert(self, line): self.w.write(line + "\n") return self.readline() def readline(self): return self.r.readline().rstrip() class DarwinSymbolizer(Symbolizer): def __init__(self, addr, binary): super(DarwinSymbolizer, self).__init__() self.binary = binary self.arch = guess_arch(addr) self.open_atos() def open_atos(self): if DEBUG: print 'atos -o %s -arch %s' % (self.binary, self.arch) cmdline = ['atos', '-o', self.binary, '-arch', self.arch] self.atos = UnbufferedLineConverter(cmdline, close_stderr=True) def symbolize(self, addr, binary, offset): """Overrides Symbolizer.symbolize.""" if self.binary != binary: return None atos_line = self.atos.convert('0x%x' % int(offset, 16)) while "got symbolicator for" in atos_line: atos_line = self.atos.readline() # A well-formed atos response looks like this: # foo(type1, type2) (in object.name) (filename.cc:80) match = re.match('^(.*) \(in (.*)\) \((.*:\d*)\)$', atos_line) if DEBUG: print 'atos_line: ', atos_line if match: function_name = match.group(1) function_name = re.sub('\(.*?\)', '', function_name) file_name = fix_filename(match.group(3)) return ['%s in %s %s' % (addr, function_name, file_name)] else: return ['%s in %s' % (addr, atos_line)] # Chain several symbolizers so that if one symbolizer fails, we fall back # to the next symbolizer in chain. class ChainSymbolizer(Symbolizer): def __init__(self, symbolizer_list): super(ChainSymbolizer, self).__init__() self.symbolizer_list = symbolizer_list def symbolize(self, addr, binary, offset): """Overrides Symbolizer.symbolize.""" for symbolizer in self.symbolizer_list: if symbolizer: result = symbolizer.symbolize(addr, binary, offset) if result: return result return None def append_symbolizer(self, symbolizer): self.symbolizer_list.append(symbolizer) def BreakpadSymbolizerFactory(binary): suffix = os.getenv('BREAKPAD_SUFFIX') if suffix: filename = binary + suffix if os.access(filename, os.F_OK): return BreakpadSymbolizer(filename) return None def SystemSymbolizerFactory(system, addr, binary): if system == 'Darwin': return DarwinSymbolizer(addr, binary) elif system == 'Linux': return Addr2LineSymbolizer(binary) class BreakpadSymbolizer(Symbolizer): def __init__(self, filename): super(BreakpadSymbolizer, self).__init__() self.filename = filename lines = file(filename).readlines() self.files = [] self.symbols = {} self.address_list = [] self.addresses = {} # MODULE mac x86_64 A7001116478B33F18FF9BEDE9F615F190 t fragments = lines[0].rstrip().split() self.arch = fragments[2] self.debug_id = fragments[3] self.binary = ' '.join(fragments[4:]) self.parse_lines(lines[1:]) def parse_lines(self, lines): cur_function_addr = '' for line in lines: fragments = line.split() if fragments[0] == 'FILE': assert int(fragments[1]) == len(self.files) self.files.append(' '.join(fragments[2:])) elif fragments[0] == 'PUBLIC': self.symbols[int(fragments[1], 16)] = ' '.join(fragments[3:]) elif fragments[0] in ['CFI', 'STACK']: pass elif fragments[0] == 'FUNC': cur_function_addr = int(fragments[1], 16) if not cur_function_addr in self.symbols.keys(): self.symbols[cur_function_addr] = ' '.join(fragments[4:]) else: # Line starting with an address. addr = int(fragments[0], 16) self.address_list.append(addr) # Tuple of symbol address, size, line, file number. self.addresses[addr] = (cur_function_addr, int(fragments[1], 16), int(fragments[2]), int(fragments[3])) self.address_list.sort() def get_sym_file_line(self, addr): key = None if addr in self.addresses.keys(): key = addr else: index = bisect.bisect_left(self.address_list, addr) if index == 0: return None else: key = self.address_list[index - 1] sym_id, size, line_no, file_no = self.addresses[key] symbol = self.symbols[sym_id] filename = self.files[file_no] if addr < key + size: return symbol, filename, line_no else: return None def symbolize(self, addr, binary, offset): if self.binary != binary: return None res = self.get_sym_file_line(int(offset, 16)) if res: function_name, file_name, line_no = res result = ['%s in %s %s:%d' % ( addr, function_name, file_name, line_no)] print result return result else: return None class SymbolizationLoop(object): def __init__(self, binary_name_filter=None, dsym_hint_producer=None): if sys.platform == 'win32': # ASan on Windows uses dbghelp.dll to symbolize in-process, which works # even in sandboxed processes. Nothing needs to be done here. self.process_line = self.process_line_echo else: # Used by clients who may want to supply a different binary name. # E.g. in Chrome several binaries may share a single .dSYM. self.binary_name_filter = binary_name_filter self.dsym_hint_producer = dsym_hint_producer self.system = os.uname()[0] if self.system not in ['Linux', 'Darwin', 'FreeBSD']: raise Exception('Unknown system') self.llvm_symbolizers = {} self.last_llvm_symbolizer = None self.dsym_hints = set([]) self.frame_no = 0 self.process_line = self.process_line_posix def symbolize_address(self, addr, binary, offset): # On non-Darwin (i.e. on platforms without .dSYM debug info) always use # a single symbolizer binary. # On Darwin, if the dsym hint producer is present: # 1. check whether we've seen this binary already; if so, # use |llvm_symbolizers[binary]|, which has already loaded the debug # info for this binary (might not be the case for # |last_llvm_symbolizer|); # 2. otherwise check if we've seen all the hints for this binary already; # if so, reuse |last_llvm_symbolizer| which has the full set of hints; # 3. otherwise create a new symbolizer and pass all currently known # .dSYM hints to it. if not binary in self.llvm_symbolizers: use_new_symbolizer = True if self.system == 'Darwin' and self.dsym_hint_producer: dsym_hints_for_binary = set(self.dsym_hint_producer(binary)) use_new_symbolizer = bool(dsym_hints_for_binary - self.dsym_hints) self.dsym_hints |= dsym_hints_for_binary if self.last_llvm_symbolizer and not use_new_symbolizer: self.llvm_symbolizers[binary] = self.last_llvm_symbolizer else: self.last_llvm_symbolizer = LLVMSymbolizerFactory( self.system, guess_arch(addr), self.dsym_hints) self.llvm_symbolizers[binary] = self.last_llvm_symbolizer # Use the chain of symbolizers: # Breakpad symbolizer -> LLVM symbolizer -> addr2line/atos # (fall back to next symbolizer if the previous one fails). if not binary in symbolizers: symbolizers[binary] = ChainSymbolizer( [BreakpadSymbolizerFactory(binary), self.llvm_symbolizers[binary]]) result = symbolizers[binary].symbolize(addr, binary, offset) if result is None: # Initialize system symbolizer only if other symbolizers failed. symbolizers[binary].append_symbolizer( SystemSymbolizerFactory(self.system, addr, binary)) result = symbolizers[binary].symbolize(addr, binary, offset) # The system symbolizer must produce some result. assert result return result def get_symbolized_lines(self, symbolized_lines): if not symbolized_lines: return [self.current_line] else: result = [] for symbolized_frame in symbolized_lines: result.append(' #%s %s' % (str(self.frame_no), symbolized_frame.rstrip())) self.frame_no += 1 return result def process_logfile(self): self.frame_no = 0 for line in logfile: processed = self.process_line(line) print '\n'.join(processed) def process_line_echo(self, line): return [line.rstrip()] def process_line_posix(self, line): self.current_line = line.rstrip() #0 0x7f6e35cf2e45 (/blah/foo.so+0x11fe45) stack_trace_line_format = ( '^( *#([0-9]+) *)(0x[0-9a-f]+) *\((.*)\+(0x[0-9a-f]+)\)') match = re.match(stack_trace_line_format, line) if not match: return [self.current_line] if DEBUG: print line _, frameno_str, addr, binary, offset = match.groups() if frameno_str == '0': # Assume that frame #0 is the first frame of new stack trace. self.frame_no = 0 original_binary = binary if self.binary_name_filter: binary = self.binary_name_filter(binary) symbolized_line = self.symbolize_address(addr, binary, offset) if not symbolized_line: if original_binary != binary: symbolized_line = self.symbolize_address(addr, binary, offset) return self.get_symbolized_lines(symbolized_line) if __name__ == '__main__': parser = argparse.ArgumentParser( formatter_class=argparse.RawDescriptionHelpFormatter, description='ASan symbolization script', epilog='Example of use:\n' 'asan_symbolize.py -c "$HOME/opt/cross/bin/arm-linux-gnueabi-" ' '-s "$HOME/SymbolFiles" < asan.log') parser.add_argument('path_to_cut', nargs='*', help='pattern to be cut from the result file path ') parser.add_argument('-d','--demangle', action='store_true', help='demangle function names') parser.add_argument('-s', metavar='SYSROOT', help='set path to sysroot for sanitized binaries') parser.add_argument('-c', metavar='CROSS_COMPILE', help='set prefix for binutils') parser.add_argument('-l','--logfile', default=sys.stdin, type=argparse.FileType('r'), help='set log file name to parse, default is stdin') args = parser.parse_args() if args.path_to_cut: fix_filename_patterns = args.path_to_cut if args.demangle: demangle = True if args.s: binary_name_filter = sysroot_path_filter sysroot_path = args.s if args.c: binutils_prefix = args.c if args.logfile: logfile = args.logfile else: logfile = sys.stdin loop = SymbolizationLoop(binary_name_filter) loop.process_logfile()
hujiajie/chromium-crosswalk
tools/valgrind/asan/third_party/asan_symbolize.py
Python
bsd-3-clause
16,609
#!/usr/bin/pythonTest # -*- coding: utf-8 -*- # # String Names # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Library General Public License for more details. # # The GNU General Public License is available from: # The Free Software Foundation, Inc. # 51 Franklin Street, Fifth Floor # Boston MA 02110-1301 USA # # http://www.gnu.org/licenses/gpl.html # # Copyright 2007-2016 Rick Graves # from six import print_ as print3 from Dict.Get import getReverseDictCarefully class Finished( Exception ): pass dNickProper = dict( ( ('ab', ('abner', 'abigail')), ('abbie', ('abner', 'abigail')), ('abby', ('abigail',)), ('abe', ('abel', 'abraham', 'abram')), ('abertina', ('alberta',)), ('abram', ('abraham',)), ('ada', ('adaline',)), ('addie', ('adelaide',)), ('addy', ('agatha',)), ('adela', ('della', 'dell', 'adaline')), ('adelaide', ('dell', 'della')), ('adeline', ('aline',)), ('ag', ('agatha',)), ('aggie', ('agatha',)), ('aggy', ('augustina', 'augusta', 'agatha', 'agnes')), ('agnes', ('inez', 'agatha', 'nancy')), ('aileen', ('helena', 'helen')), ('al', ('albert', 'allan', 'alan', 'alonzo', 'alanson', 'alfred', 'allen', 'alexander', 'alfonse')), ('albert', ('adelbert',)), ('albertine', ('alberta',)), ('alec', ('alexander',)), ('alex', ('alexandra', 'alexander')), ('alexandra', ('sandra',)), ('alf', ('alfred',)), ('alfie', ('alfred',)), ('alfy', ('alfreda',)), ('algy', ('algernon',)), ('alice', ('elsie',)), ('alicia', ('alice',)), ('aline', ('adaline',)), ('alla', ('alexandria',)), ('allie', ('alberta', 'alicia', 'almena', 'alice')), ('alphonzo', ('alonzo',)), ('ana', ('anastasia',)), ('andy', ('andrew',)), ('angelica', ('angela',)), ('angelina', ('angela',)), ('angeline', ('angela',)), ('ann', ('antonia', 'rosaenna', 'roxanne', 'roxanna', 'rosaenn', 'nancy', 'agnes', 'antoinette')), ('anna', ('annette',)), ('annie', ('anne', 'ann')), ('anselm', ('ansel',)), ('antonia', ('antoinette',)), ('ara', ('arabella',)), ('archie', ('archibald',)), ('arnie', ('arnold',)), ('art', ('arthur',)), ('assene', ('asenath',)), ('babs', ('barbara',)), ('baldie', ('archibald',)), ('barbie', ('barbery', 'barbara')), ('barby', ('barbara',)), ('barney', ('bernard', 'barnard', 'barnabas')), ('bart', ('bartholomew',)), ('bartel', ('bartholomew',)), ('barth', ('bartholomew',)), ('bat', ('bartholomew',)), ('bea', ('beatrice',)), ('becca', ('rebecca',)), ('becky', ('rebecca',)), ('bell', ('belinda',)), ('bella', ('arabella', 'isabella', 'rosabella', 'isabelle')), ('belle', ('rosabel', 'arabella', 'isabella', 'isabelle', 'isabel', 'belinda')), ('ben', ('benedict', 'benjamin')), ('bennett', ('benedict',)), ('bennie', ('benedict',)), ('berny', ('bernard',)), ('berry', ('greenberry', 'littleberry')), ('bert', ('roberta', 'norbert', 'elbert', 'egbert', 'albert', 'herbert', 'delbert', 'hubert', 'alberta', 'gilbert')), ('bertie', ('alberta', 'bertha', 'roberta')), ('bess', ('elizabeth',)), ('beth', ('elizabeth',)), ('betsy', ('elizabeth',)), ('betty', ('elizabeth',)), ('bette', ('elizabeth',)), ('bias', ('tobias',)), ('biddie', ('obedience',)), ('biddy', ('bridget',)), ('bill', ('william',)), ('bird', ('albert',)), ('birdie', ('bertha', 'roberta')), ('bob', ('robert',)), ('bobbie', ('roberta', 'barbara')), ('brad', ('bradford',)), ('bridie', ('bridget',)), ('brie', ('bridget',)), ('bryan', ('brian',)), ('bryant', ('brian',)), ('burt', ('egbert',)), ('cal', ('caleb', 'calvin')), ('cam', ('campbell',)), ('cammy', ('camille',)), ('candy', ('candace',)), ('carl', ('charles',)), ('carlotta', ('charlotte',)), ('carol', ('caroline', 'carolyn')), ('carrie', ('caroline', 'carolyn')), ('casper', ('jasper',)), ('cass', ('caswell', 'cassandra')), ('cassie', ('cathleen', 'caroline', 'catherine', 'carolyn', 'cassandra')), ('cathy', ('katherina', 'kathleen', 'catherine', 'cathleen', 'katherine', 'katharine')), ('ceall', ('lucille',)), ('cecilia', ('sheila',)), ('celia', ('celeste', 'cecilia')), ('chad', ('charles',)), ('charles', ('carl',)), ('charlie', ('charles',)), ('charlotta', ('lotta', 'lotty')), ('charlotte', ('lotta', 'lotty')), ('chaz', ('charles',)), ('chet', ('chester',)), ('chick', ('charles',)), ('chris', ('christina', 'christian', 'christine', 'christiana', 'kristin', 'christopher', 'kristen')), ('christian', ('christopher',)), ('christopher', ('christian',)), ('christy', ('christiana', 'christine')), ('chuck', ('charles',)), ('cilla', ('priscilla', 'cicely')), ('cille', ('lucille',)), ('cindy', ('cynthia', 'lucinda')), ('cissy', ('clarissa', 'cecilia')), ('claire', ('clara',)), ('clara', ('clarissa', 'clarinda')), ('clarice', ('clara',)), ('clarissa', ('clara',)), ('clem', ('clementine',)), ('cliff', ('clifton', 'clifford')), ('clo', ('chloe',)), ('connie', ('constance',)), ('cora', ('corinne',)), ('cordelia', ('delia',)), ('cordy', ('cordelia',)), ('corny', ('cornelia',)), ('court', ('courtney',)), ('crissy', ('chrintina', 'christiana', 'christine', 'chrintine')), ('curg', ('lecurgus',)), ('curt', ('curtis', 'courtney')), ('cy', ('cyrus',)), ('daisy', ('margaret',)), ('dan', ('sheridan', 'daniel')), ('danny', ('sheridan', 'daniel')), ('daph', ('daphne',)), ('daphie', ('daphne',)), ('dave', ('david',)), ('davey', ('david',)), ('davy', ('david',)), ('deannie', ('geraldine',)), ('deb', ('deborah', 'debra')), ('debbie', ('deborah', 'debra')), ('debby', ('deborah',)), ('dee', ('audrey', 'dorothy', 'delores')), ('deedee', ('deidre',)), ('del', ('delbert',)), ('delia', ('fidelia', 'cordelia')), ('delilah', ('dell', 'della')), ('dell', ('delilah',)), ('della', ('adela', 'delilah')), ('delphia', ('philadelphia',)), ('di', ('diana', 'diane')), ('diah', ('obadiah', 'jedediah')), ('dicey', ('edith',)), ('dick', ('zadock', 'melchizedek', 'richard')), ('dina', ('geraldine',)), ('dolly', ('dorothy',)), ('dolph', ('randolph', 'rudolph', 'adolph')), ('don', ('donald',)), ('dora', ('dorothea', 'eudora', 'theodora', 'dorothy', 'eldora', 'isadora', 'medora', 'doris')), ('dorothea', ('dorothy',)), ('dosia', ('theodosia',)), ('dot', ('dorothy',)), ('dotha', ('dorothy',)), ('dottie', ('dorothy',)), ('dotty', ('dorothy',)), ('drew', ('andrew',)), ('dyer', ('obadiah', 'jedediah')), ('eb', ('ebenezer',)), ('eben', ('ebenezer',)), ('ed', ('eduardo', 'edwin', 'edgar', 'edmond', 'edward', 'edmund')), ('edie', ('edith',)), ('edith', ('adaline',)), ('edny', ('edna',)), ('eileen', ('helena', 'helen')), ('elaine', ('eleanor', 'helena', 'helen')), ('eleanor', ('helena', 'ellie', 'ella', 'helen')), ('elenor', ('leonore', 'leonora')), ('eli', ('elijah', 'elisha', 'elias')), ('eliza', ('louise',)), ('ella', ('eleanor', 'luella', 'gabrielle')), ('ellen', ('eleanor', 'helena', 'helen')), ('ellis', ('elisha',)), ('eloise', ('heloise', 'louise')), ('elsie', ('elizabeth', 'alice')), ('emanuel', ('manuel',)), ('emily', ('amelia', 'emeline')), ('emma', ('emeline', 'emily')), ('emmanuel', ('immanuel',)), ('emmy', ('emeline',)), ('eph', ('ephraim',)), ('erin', ('aaron',)), ('erma', ('emma',)), ('ernie', ('ernest', 'earnest')), ('erwin', ('irwin',)), ('essy', ('estella',)), ('esther', ('hester',)), ('etta', ('henrietta', 'loretta')), ('eve', ('evelyn', 'genevieve')), ('ez', ('ezekiel',)), ('fanny', ('frances',)), ('fay', ('faith',)), ('ferdie', ('ferdinand',)), ('fidelia', ('delia',)), ('field', ('winfield',)), ('fina', ('josephine',)), ('flo', ('florence',)), ('flora', ('florence',)), ('floss', ('florence',)), ('flossie', ('florence',)), ('ford', ('clifford',)), ('fran', ('francis', 'francine', 'frances')), ('francie', ('francis', 'francine', 'frances')), ('frank', ('francis', 'franklin')), ('frankie', ('frances',)), ('franky', ('veronica',)), ('fred', ('frederick', 'winnifred', 'wilfred', 'alfred')), ('freddie', ('ferdinand', 'frederick', 'frieda')), ('fredric', ('frederick',)), ('frieda', ('alfreda',)), ('frish', ('frederick',)), ('fritz', ('frederick',)), ('frona', ('sophronia',)), ('fronia', ('sophronia',)), ('gabbie', ('gabrielle',)), ('gabby', ('gabriella', 'gabrielle')), ('gabe', ('gabriel',)), ('gabriella', ('ellie', 'ella')), ('gail', ('abigail',)), ('gatty', ('gertrude',)), ('gency', ('genevieve',)), ('gene', ('eugene',)), ('geoff', ('geoffrey', 'jeffrey')), ('georgiana', ('georgia',)), ('gerrie', ('geraldine',)), ('gerry', ('gerald', 'geraldine')), ('gertie', ('gertrude',)), ('gil', ('gilbert',)), ('gilbert', ('wilber',)), ('ginger', ('virginia',)), ('ginny', ('virginia',)), ('glory', ('gloria',)), ('green', ('greenberry',)), ('greg', ('gregory',)), ('greta', ('margaret',)), ('gum', ('montgomery',)), ('gus', ('augustine', 'augustus')), ('gusie', ('augustina', 'augusta')), ('gwen', ('gwendolyn',)), ('hal', ('harold', 'howard')), ('hank', ('henrietta', 'henry')), ('hannah', ('ann', 'susannah', 'anna')), ('hans', ('john',)), ('harold', ('harry',)), ('harry', ('harold', 'henry')), ('hattie', ('harriet',)), ('hatty', ('harriet',)), ('helen', ('eileen', 'ella', 'eleanor', 'ellie', 'elaine', 'elena', 'aileen')), ('heloise', ('eloise', 'lois')), ('henry', ('harry',)), ('herb', ('herbert',)), ('hessy', ('hester',)), ('hester', ('esther',)), ('hetty', ('mehitabel', 'hester')), ('hez', ('hezekiah',)), ('honey', ('honora',)), ('horatio', ('horace',)), ('howie', ('howard',)), ('hugh', ('hubert',)), ('hugo', ('hubert',)), ('humey', ('posthuma',)), ('ian', ('john',)), ('ib', ('isabella', 'isabelle')), ('iggy', ('ignatius',)), ('ike', ('isaac',)), ('irving', ('irvin',)), ('irwin', ('erwin',)), ('issy', ('isadora', 'isabella', 'isabelle')), ('ivan', ('john',)), ('izzy', ('isidore',)), ('jack', ('john',)), ('jackie', ('jacqueline',)), ('jake', ('jacob',)), ('jamie', ('james',)), ('jane', ('jessie', 'joanna', 'virginia')), ('janet', ('jane', 'jessie')), ('janie', ('jane',)), ('jasper', ('casper',)), ('jayhugh', ('john',)), ('jean', ('john', 'joanna')), ('jeanne', ('jeanette',)), ('jed', ('jedediah',)), ('jeff', ('geoffrey', 'jeffrey')), ('jeffrey', ('geoffrey',)), ('jehu', ('john',)), ('jemma', ('jemima',)), ('jennie', ('jean', 'virginia', 'jennifer')), ('jenny', ('jane', 'genevieve')), ('jeremy', ('jeremiah',)), ('jerry', ('gerald', 'geraldine', 'jeremiah')), ('jesse', ('jessica',)), ('jessica', ('jessie',)), ('jessie', ('jane', 'jessica')), ('jill', ('julia',)), ('jim', ('james',)), ('jimmie', ('james',)), ('jinsey', ('genevieve',)), ('jo', ('josephine',)), ('joan', ('joanna',)), ('joanna', ('jane', 'jean')), ('jody', ('joanna',)), ('joe', ('joshua', 'joseph')), ('joey', ('josephine', 'josophine', 'joseph')), ('johanna', ('joanna',)), ('john', ('ivan', 'ian', 'jonathan', 'johannes')), ('johnny', ('johannes', 'john', 'jonathon')), ('jon', ('jonathan',)), ('jonathan', ('johannes', 'nathaniel')), ('jorge', ('george',)), ('josephine', ('pheney',)), ('josey', ('josephine', 'josophine')), ('josh', ('joshua',)), ('joy', ('joyce',)), ('judie', ('judith',)), ('judy', ('judith',)), ('julie', ('julia',)), ('juliet', ('julia',)), ('justus', ('justin',)), ('karl', ('carl',)), ('kate', ('katherina', 'kathleen', 'catherine', 'katelyn', 'cathleen', 'katherine', 'katharine', 'katelin')), ('katharine', ('kathleen', 'cathleen', 'catherine', 'katherina')), ('kathleen', ('katherina', 'catherine', 'cathleen', 'katherine', 'katharine')), ('kathy', ('kathleen', 'kathryn', 'katherine')), ('katie', ('katherina', 'kathleen', 'catherine', 'cathleen', 'katherine', 'katharine')), ('katy', ('kathleen', 'katherine')), ('kay', ('katherina', 'kathleen', 'catherine', 'katelyn', 'cathleen', 'katherine', 'katharine', 'katelin')), ('ken', ('kenneth',)), ('kim', ('kimberly', 'kimberley')), ('kit', ('katherina', 'christian', 'kathleen', 'catherine', 'cathleen', 'christopher', 'katharine', 'katherine')), ('kittie', ('katherina', 'kathleen', 'catherine', 'cathleen', 'katherine', 'katharine')), ('kristi', ('kristine',)), ('ky', ('hezekiah',)), ('l.b.', ('littleberry',)), ('lanna', ('eleanor',)), ('lanson', ('alanson',)), ('larry', ('laurence', 'lawrence')), ('lars', ('lawrence',)), ('laura', ('laurinda', 'loretta', 'lorinda')), ('laurie', ('laura','laurinda', 'loretta', 'lorinda')), ('laurence', ('lawrence',)), ('lee', ('leroy',)), ('lem', ('lemuel',)), ('lena', ('helena', 'helen', 'madeline', 'arlene')), ('lenny', ('leonard',)), ('leo', ('leonard',)), ('leon', ('napoleon', 'leonidas', 'leonard', 'lionel')), ('leonora', ('eleanor',)), ('les', ('leslie', 'lester')), ('lester', ('leslie',)), ('lettice', ('letitia',)), ('lettie', ('letitia',)), ('letty', ('charlotte',)), ('lewis', ('louis',)), ('libby', ('elizabeth',)), ('lige', ('elijah',)), ('lil', ('lillian', 'delilah')), ('lila', ('delilah',)), ('lilly', ('lillian',)), ('linda', ('melinda', 'belinda')), ('lindy', ('melinda',)), ('link', ('lincoln',)), ('lisa', ('melissa', 'alice')), ('lish', ('elisha',)), ('little', ('littleberry',)), ('livia', ('olivia',)), ('liz', ('elizabeth',)), ('liza', ('elizabeth',)), ('lizabeth', ('elizabeth',)), ('lizzie', ('eliza', 'elizabeth')), ('lloyd', ('floyd',)), ('lodi', ('melody',)), ('lois', ('heloise', 'louise')), ('lola', ('delores',)), ('lolly', ('lillian',)), ('lon', ('alonzo', 'zebulon', 'lawrence')), ('lonzo', ('alonzo',)), ('lorie', ('loretta', 'lorraine')), ('lorrie', ('loretta', 'lorraine')), ('lorry', ('lawrence',)), ('lotta', ('charlotte',)), ('lottie', ('charlotte', 'carlotta')), ('lou', ('louis', 'louise')), ('louie', ('louis',)), ('louise', ('eloise', 'lois')), ('lucas', ('lucias',)), ('lucy', ('lucille', 'lucia', 'lucinda')), ('luella', ('ellie', 'ella')), ('luke', ('lucias', 'lucas')), ('lulu', ('louise',)), ('lum', ('columbus',)), ('lura', ('lurana',)), ('lynn', ('caroline', 'carolyn')), ('mabel', ('mehitabel',)), ('maddie', ('madeline',)), ('maddy', ('madeline', 'madelyn')), ('madge', ('margaret', 'madeline', 'margaretta', 'magdelina')), ('madie', ('madeline', 'madelyn')), ('mae', ('may', 'mary')), ('maggie', ('margaret', 'madeline')), ('maggy', ('margaret',)), ('maisie', ('margaret',)), ('mamie', ('mary',)), ('manda', ('amanda',)), ('mandy', ('amanda', 'miranda')), ('manny', ('emanuel', 'manuel')), ('manuel', ('immanuel', 'emanuel')), ('margaret', ('gretchen', 'daisy')), ('marge', ('margaret', 'marjorie', 'margaretta')), ('margie', ('margaret', 'marjorie')), ('margo', ('margaret',)), ('margy', ('margaret', 'marjorie')), ('maria', ('mariah', 'mary')), ('mariah', ('mary',)), ('marianna', ('marian',)), ('marie', ('mary',)), ('marietta', ('mary',)), ('marion', ('mary',)), ('mark', ('marcus',)), ('marty', ('martha', 'martin')), ('marv', ('marvin',)), ('mary', ('mariah', 'mitzi', 'miriam', 'marilyn', 'maureen')), ('mat', ('martha', 'matilda')), ('matt', ('mathew', 'matthew')), ('matthias', ('matthew',)), ('mattie', ('martha',)), ('matty', ('matilda',)), ('maud', ('madeline', 'matilda')), ('maureen', ('mary',)), ('maury', ('maurice',)), ('may', ('mary',)), ('meg', ('margaret', 'megan')), ('megan', ('margaret',)), ('mehitabel', ('mabel',)), ('mel', ('amelia', 'melissa', 'melinda')), ('melchizedek', ('zadock',)), ('melia', ('amelia',)), ('mena', ('almena',)), ('merci', ('mercedes',)), ('mercy', ('mercedes',)), ('mert', ('myrtle',)), ('merv', ('marvin', 'mervin')), ('mervyn', ('marvin',)), ('michael', ('mitchell',)), ('mickey', ('michelle', 'michael')), ('middy', ('madeline',)), ('midge', ('margaret',)), ('mike', ('michael',)), ('millie', ('camille', 'amelia', 'emeline')), ('milly', ('millicent', 'mildred', 'melissa', 'armilda')), ('mimi', ('jemima',)), ('mina', ('wilhelmina', 'minerva')), ('mindy', ('melinda',)), ('minerva', ('manerva',)), ('minnie', ('wilhelmina', 'minerva')), ('mira', ('elmira', 'miranda')), ('missy', ('melissa',)), ('mitch', ('mitchell',)), ('mitchell', ('michael',)), ('mitty', ('mehitabel', 'submit')), ('mitzi', ('mary', 'miriam')), ('molly', ('mary',)), ('mona', ('ramona',)), ('monty', ('lamont', 'montgomery')), ('morris', ('maurice',)), ('mort', ('mortimer',)), ('mose', ('moses',)), ('moss', ('moses',)), ('mur', ('muriel',)), ('myra', ('almira',)), ('myrt', ('myrtle',)), ('nabby', ('abigail',)), ('nace', ('ignatius',)), ('nada', ('nadine',)), ('nan', ('hannah', 'ann', 'anna', 'nancy')), ('nana', ('ann', 'anna')), ('nancy', ('ann', 'anna')), ('nannie', ('nancy',)), ('nanny', ('hannah', 'ann', 'anna')), ('nap', ('napoleon',)), ('nat', ('jonathan', 'nathaniel')), ('nate', ('nathan', 'nathaniel')), ('nathan', ('jonathan', 'nathaniel')), ('natty', ('nathaniel',)), ('ned', ('edward', 'edmund')), ('neil', ('cornelius',)), ('nell', ('eleanor', 'helena', 'helen')), ('nelle', ('cornelia',)), ('nellie', ('eleanor', 'helena', 'helen')), ('nelly', ('cornelia',)), ('nels', ('nelson',)), ('neppie', ('penelope',)), ('nerva', ('manerva', 'minerva')), ('nervie', ('manerva', 'minerva')), ('nessie', ('agnes',)), ('nettie', ('jeanette', 'henrietta', 'antonia', 'natalie', 'antoinette')), ('newt', ('newton',)), ('nib', ('isabella', 'isabelle')), ('nicey', ('vernisee',)), ('nick', ('dominic', 'nicholas', 'nicodemus')), ('nickie', ('nicholas',)), ('nicky', ('nicholas',)), ('nita', ('juanita',)), ('noel', ('nowell',)), ('nora', ('leonore', 'leonora', 'eleanor')), ('obe', ('obadiah',)), ('obed', ('obadiah', 'obedience')), ('obie', ('obadiah', 'obediah')), ('odo', ('odell',)), ('olive', ('olivia',)), ('ollie', ('oliver',)), ('ophi', ('theophilus',)), ('ora', ('aurelia',)), ('orlando', ('roland',)), ('ossy', ('oswald',)), ('oswald', ('waldo',)), ('ote', ('otis',)), ('ozzy', ('oswald',)), ('paddy', ('patrick',)), ('pam', ('pamela',)), ('pat', ('patience', 'patricia', 'patrick')), ('patsy', ('patrick', 'martha', 'patricia')), ('patty', ('patience', 'martha', 'patricia')), ('peggie', ('margaret',)), ('peggy', ('margaret',)), ('penny', ('penelope',)), ('perce', ('percival',)), ('percy', ('percival',)), ('pete', ('peter',)), ('peter', ('patrick',)), ('phelia', ('orphelia',)), ('phil', ('phillip', 'philip')), ('philadelphia', ('delpha',)), ('pokey', ('pocahontas',)), ('polly', ('paulina', 'mary')), ('pres', ('prescott',)), ('prissy', ('priscilla',)), ('prudy', ('prudence',)), ('rae', ('rachel',)), ('rafe', ('ralph',)), ('raff', ('raphael',)), ('randall', ('randolph',)), ('randy', ('randolph', 'miranda')), ('ray', ('rachel', 'raymond')), ('reba', ('rebecca',)), ('reg', ('reginald',)), ('reggie', ('reginald',)), ('reginald', ('reynold',)), ('rena', ('irene',)), ('rennie', ('irene',)), ('retta', ('henrietta', 'loretta')), ('reynold', ('reginald',)), ('rich', ('aldrich', 'richard')), ('richie', ('aldrich', 'richard')), ('rick', ('derick', 'eric', 'richard', 'ricardo', 'frederick')), ('ricky', ('derick', 'eric', 'broderick', 'richard')), ('rilla', ('avarilla',)), ('rita', ('margarita',)), ('rob', ('robert', 'roberto')), ('robbie', ('roberta',)), ('robby', ('robert',)), ('robin', ('robert',)), ('rod', ('roderick', 'rodney', 'broderick')), ('rodie', ('rhoda',)), ('roland', ('orlando',)), ('rolf', ('rudolph',)), ('rollo', ('rudolph',)), ('ron', ('ronald', 'veronica', 'aaron')), ('ronna', ('veronica',)), ('ronnie', ('ronald', 'veronica', 'aaron')), ('ronny', ('ronald', 'veronica')), ('rose', ('rosabel', 'roseanna', 'rosabella', 'roseann', 'roxanna', 'roxanne', 'rosalyn')), ('rowland', ('roland',)), ('rox', ('roxane',)), ('roxie', ('roxane',)), ('roy', ('leroy',)), ('roz', ('rosabel', 'rosabella', 'rosalyn')), ('rube', ('reuben',)), ('rudy', ('rudolph',)), ('rupert', ('robert',)), ('russ', ('russell',)), ('rusty', ('russell',)), ('sabe', ('isabella', 'isabelle')), ('sabra', ('isabella', 'isabelle')), ('sadie', ('sarah',)), ('sal', ('sarah', 'solomon', 'salvador')), ('sallie', ('sarah',)), ('salmon', ('solomon',)), ('sam', ('samson', 'samuel', 'sampson')), ('sammy', ('samuel',)), ('sandra', ('cassandra',)), ('sandy', ('alexander', 'cassandra', 'sandra')), ('sara', ('sarah',)), ('scott', ('prescott',)), ('sene', ('asenath',)), ('shelly', ('michelle', 'rachel', 'shelton')), ('si', ('silas', 'sylvester')), ('sid', ('sidney',)), ('sig', ('sigismund',)), ('silla', ('drusilla',)), ('sim', ('simeon',)), ('simon', ('simeon',)), ('sis', ('frances',)), ('sly', ('sylvester',)), ('sol', ('solomon',)), ('solly', ('solomon',)), ('sophia', ('sophronia',)), ('stacia', ('eustacia',)), ('stacy', ('eustacia',)), ('stella', ('estella',)), ('steve', ('stephen', 'steven')), ('steven', ('stephen',)), ('sue', ('susannah', 'suzanne', 'susan')), ('sukey', ('susannah',)), ('sully', ('sullivan',)), ('surry', ('sarah',)), ('susan', ('susannah',)), ('susanna', ('ann', 'anna')), ('susannah', ('hannah',)), ('susie', ('susannah', 'suzanne', 'susan')), ('suzanne', ('susannah',)), ('syl', ('sylvester',)), ('tabby', ('tabitha',)), ('tad', ('thaddeus',)), ('tavia', ('octavia',)), ('ted', ('theodore', 'edward', 'edmund')), ('teddy', ('theodore',)), ('terry', ('teresa', 'theresa', 'terence')), ('tess', ('teresa', 'theresa')), ('tessa', ('teresa', 'theresa')), ('tessie', ('teresa', 'theresa')), ('thad', ('thaddeus',)), ('theo', ('theodore', 'theodosia')), ('thom', ('thomas',)), ('thursa', ('theresa',)), ('tibbie', ('isabella', 'isabelle')), ('ticy', ('theresa',)), ('tilda', ('matilda',)), ('tillie', ('matilda',)), ('tim', ('timothy',)), ('timmy', ('timothy',)), ('tina', ('augustina', 'christine', 'christiana', 'christina', 'augusta', 'martina', 'ernestine')), ('tish', ('letitia',)), ('titia', ('letitia',)), ('tobe', ('tobias',)), ('toby', ('tobias',)), ('tom', ('thomas',)), ('tommy', ('thom', 'thomas')), ('tony', ('anthony',)), ('tori', ('victoria',)), ('torie', ('victoria',)), ('torri', ('victoria',)), ('torrie', ('victoria',)), ('tory', ('victoria',)), ('tracy', ('theresa',)), ('tricia', ('patricia',)), ('trina', ('katherina', 'kathleen', 'catherine', 'cathleen', 'katherine', 'katharine')), ('trisha', ('beatrice', 'patricia')), ('trixie', ('beatrice', 'patricia')), ('trudy', ('gertrude',)), ('val', ('valentina', 'valeri', 'valerie')), ('vallie', ('valentina',)), ('van', ('vanessa',)), ('vannie', ('vanessa',)), ('verna', ('laverne',)), ('vester', ('sylvester',)), ('vi', ('vivian',)), ('vic', ('victor',)), ('vick', ('victor',)), ('vicki', ('victoria',)), ('vin', ('vincent',)), ('vina', ('melvina',)), ('vince', ('vincent',)), ('viney', ('lavinia',)), ('virgie', ('virginia',)), ('virginia', ('jane',)), ('vonnie', ('veronica',)), ('waldo', ('oswald',)), ('wallie', ('wallace',)), ('wally', ('wallace','walter')), ('wat', ('walter',)), ('webb', ('webster',)), ('wendy', ('gwendolyn',)), ('wilber', ('gilbert',)), ('will', ('william', 'wilson', 'wilbur')), ('willie', ('wilhelmina', 'william', 'wilson', 'wilfred', 'wilbur')), ('wilma', ('wilhelmina',)), ('win', ('winfield',)), ('winnet', ('winifred',)), ('winnie', ('winifred', 'winnifred')), ('winny', ('winnifred', 'winfield')), ('zach', ('zachariah',)), ('zacharias', ('zachariah',)), ('zachary', ('zachariah',)), ('zadock', ('melchizedek',)), ('zeb', ('zebulon',)), ('zed', ('zedediah',)), ('zeke', ('isaac', 'ezekiel', 'zachariah')), ('zeph', ('zepaniah',)), ('zolly', ('solomon',)) ) ) # ('karen', ('katherina', 'kathleen', 'catherine', 'cathleen', 'katherine', 'katharine')), for sNick in dNickProper: # dNickProper[ sNick ] = frozenset( dNickProper[ sNick ] ) # setMenNames = \ frozenset( ( 'aaron', 'abraham', 'adam', 'adrian', 'ahmed', 'al', 'alan', 'albert', 'alberto', 'alec', 'alejandro', 'alex', 'alexander', 'alfonso', 'alfred', 'alfredo', 'allan', 'allen', 'alvin', 'anders', 'andre', 'andreas', 'andres', 'andrew', 'andy', 'anthony', 'antonio', 'arnold', 'arthur', 'austin', 'avery', 'barry', 'bart', 'ben', 'benjamin', 'bennett', 'bernard', 'bert', 'bill', 'billy', 'blair', 'blake', 'bob', 'bobby', 'brad', 'bradford', 'bradley', 'brandon', 'brendan', 'brent', 'bret', 'brett', 'brian', 'bruce', 'bryan', 'byron', 'calvin', 'cameron', 'campbell', 'carl', 'carlos', 'carlton', 'casey', 'cecil', 'cesar', 'chad', 'charles', 'charlie', 'chester', 'chris', 'christian', 'christopher', 'clarence', 'clark', 'claude', 'clay', 'clayton', 'clifford', 'clyde', 'cody', 'colin', 'conrad', 'corey', 'cory', 'craig', 'curtis', 'dale', 'dan', 'daniel', 'danny', 'darrell', 'darren', 'darryl', 'dave', 'david', 'davis', 'dean', 'denis', 'dennis', 'derek', 'derrick', 'diego', 'dimitri', 'dirk', 'dominic', 'don', 'donald', 'doug', 'douglas', 'duane', 'duncan', 'dustin', 'dwayne', 'dwight', 'dylan', 'earl', 'ed', 'eddie', 'edgar', 'edmund', 'eduardo', 'edward', 'edwin', 'eli', 'eliot', 'elliot', 'elliott', 'elmer', 'emanuel', 'emmanuel', 'enrique', 'eric', 'erik', 'ernest', 'ernesto', 'ethan', 'eugene', 'evan', 'everett', 'fernando', 'fitzgerald', 'floyd', 'forrest', 'francis', 'francisco', 'frank', 'franklin', 'fred', 'frederic', 'frederick', 'fredrick', 'gabriel', 'garrett', 'gary', 'gene', 'geoffrey', 'george', 'gerald', 'gerard', 'gilbert', 'giovanni', 'glen', 'glenn', 'gordon', 'graham', 'grant', 'greg', 'gregg', 'gregory', 'guido', 'guy', 'hamilton', 'hans', 'harold', 'harris', 'harrison', 'harry', 'harvey', 'henry', 'herbert', 'herman', 'howard', 'hugh', 'hunter', 'ian', 'ira', 'isaac', 'ivan', 'jack', 'jackson', 'jacob', 'jacques', 'james', 'jamie', 'jared', 'jason', 'jay', 'jeff', 'jeffery', 'jeffrey', 'jeremiah', 'jeremy', 'jerome', 'jerry', 'jesse', 'jesus', 'jim', 'jimmie', 'jimmy', 'joe', 'joel', 'johan', 'johannes', 'john', 'johnny', 'johnson', 'jon', 'jonah', 'jonathan', 'jonathon', 'jordan', 'jorge', 'jose', 'josef', 'joseph', 'josh', 'joshua', 'juan', 'julian', 'julio', 'julius', 'justin', 'karl', 'keith', 'ken', 'kendall', 'kenneth', 'kent', 'kerry', 'kevin', 'kirk', 'kurt', 'kyle', 'lance', 'larry', 'lars', 'laurence', 'lawrence', 'lee', 'leland', 'leo', 'leon', 'leonard', 'leroy', 'lester', 'lewis', 'liam', 'lloyd', 'lou', 'louis', 'lucas', 'luis', 'luke', 'mackenzie', 'malcolm', 'manuel', 'marc', 'marco', 'marcus', 'mario', 'mark', 'markus', 'marshall', 'martin', 'marvin', 'mathew', 'matt', 'matthew', 'maurice', 'max', 'maxwell', 'melvin', 'michael', 'micheal', 'miguel', 'mike', 'miles', 'milton', 'mitchell', 'mohamed', 'mohammad', 'mohammed', 'morgan', 'morris', 'murray', 'nathan', 'nathaniel', 'neal', 'neil', 'nelson', 'nicholas', 'nick', 'nicolas', 'noah', 'noel', 'norman', 'omar', 'oscar', 'owen', 'paolo', 'patrick', 'paul', 'pedro', 'perry', 'peter', 'phil', 'philip', 'philippe', 'phillip', 'pierce', 'pierre', 'rafael', 'ralph', 'ramon', 'randall', 'randolph', 'randy', 'raul', 'ray', 'raymond', 'reed', 'reginald', 'ricardo', 'richard', 'richardo', 'rick', 'ricky', 'rob', 'robert', 'roberto', 'roderick', 'rodney', 'roger', 'roland', 'rolf', 'ron', 'ronald', 'ronnie', 'ross', 'roy', 'russ', 'russell', 'ryan', 'sam', 'samuel', 'scot', 'scott', 'sean', 'sebastian', 'sergio', 'seth', 'shane', 'shawn', 'sheldon', 'sherman', 'sidney', 'simon', 'simone', 'spencer', 'stan', 'stanley', 'stefan', 'stephan', 'stephen', 'sterling', 'steve', 'steven', 'stewart', 'stuart', 'sydney', 'taylor', 'ted', 'terence', 'terrence', 'terry', 'theodore', 'thomas', 'tim', 'timothy', 'toby', 'todd', 'tom', 'tommy', 'tony', 'travis', 'trevor', 'troy', 'tyler', 'tyrone', 'vernon', 'victor', 'vincent', 'wade', 'walker', 'wallace', 'walter', 'ward', 'warren', 'wayne', 'wesley', 'will', 'willard', 'william', 'willie', 'wilson', 'winston', 'wolfgang', 'zachary') ) setWomenNames = \ frozenset( ( 'abby', 'abigail', 'adele', 'adriana', 'adrienne', 'agnes', 'aileen', 'aimee', 'alana', 'alberta', 'alejandra', 'alessandra', 'alexa', 'alexandra', 'alexandre', 'alexandria', 'alexis', 'ali', 'alice', 'alicia', 'alisa', 'alison', 'alissa', 'allison', 'allyson', 'alma', 'alyce', 'alyssa', 'amanda', 'amber', 'amelia', 'ami', 'amy', 'ana', 'anastasia', 'andrea', 'angel', 'angela', 'angelica', 'angelina', 'angelique', 'angie', 'anita', 'ann', 'anna', 'annabel', 'annabelle', 'anne', 'annemarie', 'annette', 'annie', 'annika', 'antoinette', 'antonia', 'april', 'ariane', 'ariel', 'arielle', 'arlene', 'ashleigh', 'ashley', 'athena', 'audrey', 'autumn', 'barbara', 'beatrice', 'becky', 'belinda', 'bernadette', 'bernice', 'bertha', 'bessie', 'beth', 'bethany', 'betsy', 'betty', 'beverly', 'bianca', 'bonnie', 'brandi', 'brandy', 'brenda', 'bridget', 'brigitte', 'brittany', 'brittney', 'brooke', 'caitlin', 'camille', 'candace', 'candice', 'cara', 'carla', 'carmela', 'carmen', 'carol', 'carole', 'carolina', 'caroline', 'carolyn', 'carrie', 'carroll', 'cassandra', 'caterina', 'catharine', 'catherine', 'cathleen', 'cathy', 'cecelia', 'cecile', 'cecilia', 'celeste', 'celia', 'charlene', 'charlotte', 'chelsea', 'cher', 'cherie', 'cheryl', 'chloe', 'christa', 'christiane', 'christie', 'christina', 'christine', 'christy', 'cindy', 'claire', 'clara', 'clare', 'clarissa', 'claudia', 'colette', 'colleen', 'connie', 'constance', 'corinne', 'courtney', 'cristina', 'crystal', 'cynthia', 'daisy', 'dana', 'daniela', 'daniele', 'danielle', 'daphne', 'dara', 'darcy', 'darlene', 'dawn', 'deanna', 'debbie', 'deborah', 'debra', 'dee', 'deirdre', 'delores', 'dena', 'denise', 'desiree', 'diana', 'diane', 'dianne', 'dina', 'dolores', 'dominique', 'donna', 'doreen', 'doris', 'dorothy', 'edith', 'edna', 'eileen', 'elaine', 'eleanor', 'elena', 'elisa', 'elisabeth', 'elise', 'elissa', 'eliza', 'elizabeth', 'ella', 'ellen', 'ellyn', 'eloise', 'elsa', 'elsie', 'elyse', 'emilia', 'emilie', 'emily', 'emma', 'erica', 'erika', 'erin', 'estelle', 'esther', 'ethel', 'eugenia', 'eva', 'eve', 'evelyn', 'faith', 'fanny', 'fatima', 'fay', 'faye', 'felicia', 'fern', 'fiona', 'florence', 'fran', 'frances', 'francesca', 'francine', 'francois', 'francoise', 'gabriela', 'gabriele', 'gabriella', 'gabrielle', 'gail', 'gale', 'gayle', 'genevieve', 'georgia', 'georgina', 'geraldine', 'gertrude', 'gillian', 'gina', 'ginger', 'giovanna', 'gladys', 'glenda', 'gloria', 'grace', 'greta', 'gretchen', 'gwen', 'gwendolyn', 'hanna', 'hannah', 'harriet', 'hazel', 'heather', 'heidi', 'helen', 'helena', 'helene', 'hilary', 'hilda', 'hillary', 'holly', 'hope', 'ida', 'ilana', 'ilene', 'ines', 'ingrid', 'irene', 'iris', 'isabel', 'isabella', 'isabelle', 'jaclyn', 'jacqueline', 'jacquelyn', 'jaime', 'jamie', 'jana', 'jane', 'janelle', 'janet', 'janice', 'janine', 'janis', 'jasmine', 'jayne', 'jean', 'jeanette', 'jeanne', 'jeannette', 'jenna', 'jennie', 'jennifer', 'jenny', 'jessica', 'jessie', 'jill', 'jillian', 'jo', 'joan', 'joann', 'joanna', 'joanne', 'jocelyn', 'jodi', 'jody', 'joelle', 'johanna', 'josephine', 'joy', 'joyce', 'juanita', 'judith', 'judy', 'julia', 'juliana', 'julianne', 'julie', 'juliet', 'juliette', 'june', 'justine', 'kara', 'karen', 'karin', 'karla', 'katarina', 'kate', 'katharina', 'katharine', 'katherine', 'kathleen', 'kathryn', 'kathy', 'katia', 'katie', 'katrina', 'katy', 'kay', 'kayla', 'kelli', 'kellie', 'kelly', 'kelsey', 'kim', 'kimberley', 'kimberly', 'kirsten', 'kitty', 'krista', 'kristen', 'kristi', 'kristin', 'kristina', 'kristine', 'kristy', 'krystal', 'lara', 'larissa', 'latoya', 'laura', 'laurel', 'lauren', 'laurie', 'lea', 'leah', 'leanne', 'leigh', 'leila', 'leilani', 'lena', 'leslie', 'liana', 'lila', 'lillian', 'lillie', 'lily', 'linda', 'lindsay', 'lindsey', 'lisa', 'lise', 'liz', 'liza', 'lois', 'lora', 'loraine', 'loren', 'loretta', 'lori', 'lorraine', 'louisa', 'louise', 'lucia', 'lucie', 'lucille', 'lucy', 'luisa', 'lydia', 'lyn', 'lynda', 'lynette', 'lynn', 'lynne', 'madeleine', 'madeline', 'mae', 'magdalena', 'maggie', 'mara', 'marcia', 'margaret', 'margarita', 'margo', 'margot', 'marguerite', 'mari', 'maria', 'mariah', 'marian', 'mariana', 'marianna', 'marianne', 'marie', 'marilyn', 'marina', 'marion', 'marisa', 'marissa', 'marjorie', 'marla', 'marlene', 'marsha', 'marta', 'martha', 'martina', 'mary', 'maryam', 'maryann', 'maura', 'maureen', 'maxine', 'may', 'maya', 'meemie', 'meg', 'megan', 'meghan', 'mei', 'melanie', 'melinda', 'melissa', 'melody', 'mercedes', 'meredith', 'meryl', 'mia', 'michaela', 'michele', 'michelle', 'mildred', 'mindy', 'miranda', 'mireille', 'miriam', 'misty', 'moira', 'molly', 'mona', 'monica', 'monika', 'monique', 'muriel', 'myra', 'myrtle', 'nadia', 'nadine', 'nancy', 'nanette', 'naomi', 'natalia', 'natalie', 'natasha', 'nathalie', 'nell', 'nellie', 'new', 'nichole', 'nicola', 'nicole', 'nikki', 'nina', 'noelle', 'nora', 'norma', 'olga', 'oliver', 'olivia', 'paige', 'pam', 'pamela', 'patrice', 'patricia', 'patsy', 'patti', 'paula', 'paulette', 'pauline', 'pearl', 'peggy', 'penelope', 'penny', 'phyllis', 'polly', 'priscilla', 'rachael', 'rachel', 'rachelle', 'ramona', 'raquel', 'rebecca', 'rebekah', 'regina', 'rene', 'renee', 'rhonda', 'rita', 'roberta', 'robin', 'robyn', 'rochelle', 'rosa', 'rosalie', 'rose', 'rosemarie', 'rosemary', 'roxanne', 'ruby', 'ruth', 'sabina', 'sabine', 'sabrina', 'sally', 'samantha', 'sandra', 'sara', 'sarah', 'sasha', 'shana', 'shannon', 'shari', 'sharon', 'shauna', 'sheila', 'shelley', 'shelly', 'sheri', 'sherri', 'sherry', 'sheryl', 'shirley', 'silvia', 'sofia', 'sonia', 'sonja', 'sonya', 'sophia', 'sophie', 'stacey', 'stacy', 'stefanie', 'stella', 'stephanie', 'sue', 'susan', 'susana', 'susanna', 'susannah', 'susanne', 'suzan', 'suzanne', 'sybil', 'sylvia', 'tamara', 'tammy', 'tania', 'tanya', 'tara', 'tatiana', 'teresa', 'terese', 'teri', 'terri', 'terry', 'tessa', 'thelma', 'theresa', 'therese', 'tiffany', 'tina', 'toni', 'tonya', 'tracey', 'tracy', 'tricia', 'trisha', 'ursula', 'valerie', 'vanessa', 'vera', 'veronica', 'vicki', 'vickie', 'victoria', 'viola', 'violet', 'virginia', 'vivian', 'wanda', 'wendy', 'whitney', 'willie', 'wilma', 'winifred', 'xavier', 'yolanda', 'yvette', 'yvonne', 'zoe', 'zulema' ) ) dBegsNicks = \ dict( ty = 'ty', ed = 'ed', jo = 'jo', rod = 'rod', wil = 'willie', es = 'essy', mac = ( 'mac', 'mack' ), mc = ( 'mac', 'mack' ) ) # is = 'issy', # max = ( 'maxine', 'max' ) dBegsNicks[ 'is' ] = 'issy' dBegsNicks[ 'max' ] = ( 'maxine', 'max' ) dNicksBegs = getReverseDictCarefully( dBegsNicks ) dEndsNicks = \ dict( field = 'field', leen = ( 'lena', 'lynn' ), lina = ( 'lena', 'lina', 'lynn' ), lena = 'lina', lene = 'lynn', lyn = 'lynn', rita = 'rita', tina = 'tina', tine = 'tina' ) dNicksEnds = getReverseDictCarefully( dEndsNicks ) dWithinsNicks = \ dict( wood = ( 'woody', 'woodrow', 'elwood' ), scott = 'scott' ) dNicksWithins = getReverseDictCarefully( dWithinsNicks ) def _testNames( sName1, sName2, dOthersNicks, dNicksOthers, fGetSlice ): # from Collect.Test import ContainsAny from Iter.AllVers import iRange # if sName1 in dNicksOthers and \ sName2 in dNicksOthers and \ ContainsAny( dNicksOthers[ sName1 ], dNicksOthers[ sName2 ] ): # raise Finished # # for i in iRange( 2, 6 ): # if len( sName1 ) < i and len( sName2 ) < i: break # sName1Part = fGetSlice( sName1, i ) sName2Part = fGetSlice( sName2, i ) # if sName1Part == sName2Part and \ sName1Part in dOthersNicks and \ ( sName1 == sName1Part or sName2 == sName1Part ): # raise Finished # # if sName1Part in dOthersNicks and \ sName2 in dNicksOthers and \ sName1Part in dNicksOthers[ sName2 ]: # raise Finished # if sName2Part in dOthersNicks and \ sName1 in dNicksOthers and \ sName2Part in dNicksOthers[ sName1 ]: # raise Finished # if sName1Part in dOthersNicks and \ sName2Part in dOthersNicks and \ ( sName1 == sName1Part or sName2 == sName1Part ) and \ ContainsAny( dOthersNicks[ sName1Part ], dOthersNicks[ sName2Part ] ): # raise Finished # def _getPartBeg( s, i ): return s[ : i ] def _getPartEnd( s, i ): return s[ -i : ] def isNickName( sName1, sName2 ): # from Collect.Query import get1stThatMeets from Collect.Test import ContainsAny from Dict.Get import getKeyIter from String.Test import getItemFoundInString # sName1, sName2 = sName1.lower(), sName2.lower() # bNickNames = False # tHaveNicks = ( sName1 in dNickProper, sName2 in dNickProper ) # try: # if tHaveNicks == ( False, False ): # pass # most common result, bypass other tests of tHaveNicks # elif tHaveNicks == ( True, True ): # setPropers1 = dNickProper[ sName1 ] setPropers2 = dNickProper[ sName2 ] # if setPropers1 == setPropers2 or \ ContainsAny( setPropers1, setPropers2 ) or \ sName2 in dNickProper[ sName1 ] or \ sName1 in dNickProper[ sName2 ]: # raise Finished # # elif tHaveNicks == ( True, False ): # if sName2 in dNickProper[ sName1 ]: # raise Finished # # elif tHaveNicks == ( False, True ): # if sName1 in dNickProper[ sName2 ]: # raise Finished # # # # _testNames wull raise Finished if bNickNames set to True _testNames( sName1, sName2, dBegsNicks, dNicksBegs, _getPartBeg ) # _testNames wull raise Finished if bNickNames set to True # # _testNames wull raise Finished if bNickNames set to True _testNames( sName1, sName2, dEndsNicks, dNicksEnds, _getPartEnd ) # _testNames wull raise Finished if bNickNames set to True # if sName1 in dNicksWithins: # def name2HasSubstring( sub ): return sub in sName2 # if get1stThatMeets( getKeyIter( dWithinsNicks ), name2HasSubstring ): raise Finished # if sName2 in dNicksWithins: # def name1HasSubstring( sub ): return sub in sName1 # if get1stThatMeets( getKeyIter( dWithinsNicks ), name1HasSubstring ): raise Finished # # # except Finished: # bNickNames = True # # return bNickNames def isWomensName( sName ): # return sName.lower() in setWomenNames def isMensName( sName ): # return sName.lower() in setMenNames def isNameMisSpelled( sName1, sName2 ): # from Iter.AllVers import lZip from Collect.Query import getBegAndEndIfInOrder # bNameMisSpelled = True # # bPrint= ( sName1, sName2 ) == ( 'John', 'Joel' ) # try: # if not ( sName1 and sName2 ): # if bPrint: print3( 'got blank' ) raise Finished # # if ( isWomensName( sName1 ) and isMensName( sName2 ) ) or \ ( isWomensName( sName2 ) and isMensName( sName1 ) ): # raise Finished # # iLen1, iLen2 = len( sName1 ), len( sName2 ) # # if bPrint: print3( 'sName1, sName2:', sName1, sName2 ) # # if bPrint: print3( 'iLen1, iLen2:', iLen1, iLen2 ) # if min( iLen1, iLen2 ) < 2: # if bPrint: print3( 'too short' ) raise Finished # # if abs( iLen1 - iLen2 ) > 2: # if bPrint: print3( 'different lengths' ) raise Finished # # iHalfLen = min( iLen1, iLen2 ) // 2 # # if bPrint: print3( 'iHalfLen:', iHalfLen ) # sName1, sName2 = sName1.lower(), sName2.lower() # #print3( 'iLen1, iLen2, iHalfLen:', iLen1, iLen2, iHalfLen ) #print3( 'sName1, sName2:', sName1, sName2 ) # if not ( sName1[ : iHalfLen ] == sName2[ : iHalfLen ] or sName1[ -iHalfLen : ] == sName2[ -iHalfLen : ] ): # # if bPrint: print3( 'halfs do not match' ) raise Finished # # sCommon = getBegAndEndIfInOrder( sName1, sName2 ) # # if bPrint: print3( 'sCommon:', sCommon ) # # if bPrint: print3( 'min( iLen1, iLen2 ):', min( iLen1, iLen2 ) # # if bPrint: print3( 'len( sCommon ):', len( sCommon ) ) # if min( iLen1, iLen2 ) - len( sCommon ) > 1: # if bPrint: print3( 'not enough in common with shorter' ) raise Finished # # # if bPrint: print3( 'min( iLen1, iLen2 ) - len( sCommon ):', min( iLen1, iLen2 ) - len( sCommon ) ) # # if bPrint: print3( 'max( iLen1, iLen2 ):', max( iLen1, iLen2 ) ) # lLenNames = lZip( ( iLen1, iLen2 ), ( sName1, sName2 ) ) # lLenNames.sort() # sShort = lLenNames[0][1] sLong = lLenNames[1][1] # # if bPrint: print3( 'sLong, sShort:', sLong, sShort ) # if max( iLen1, iLen2 ) - len( sCommon ) > 1 and \ not sLong.startswith( sShort ): # if bPrint: print3( 'not enough in common with longer' ) raise Finished # # if bPrint: print3( 'max( iLen1, iLen2 ) - len( sCommon ):', max( iLen1, iLen2 ) - len( sCommon ) ) # except Finished: # bNameMisSpelled = False # # return bNameMisSpelled def getFirstMiddleLast( s ): # lParts = s.split() # sFirst, sMiddle, sLast = '', '', '' # if lParts: # sFirst = lParts[ 0 ] sLast = lParts[ -1 ] # if len( lParts ) > 2: sMiddle = ' '.join( lParts[ 1 : -1 ] ) # # return sFirst, sMiddle, sLast def _getInitialOffFront( s ): # while s and s.strip()[ 1 : 3 ] == '. ': # s = s.strip()[ 2 : ] # return s.strip() def getLastGoBySkipNick( s ): # sFirst, sMiddle, sLast = getFirstMiddleLast( s ) # sGoBy = sFirst # if len( sFirst ) == 5 and sFirst[1] == '.' and sFirst[4] == '.': # pass # elif len( sFirst ) == 2 and sFirst.endswith( '.' ): # if sMiddle: sGoBy = _getInitialOffFront( sMiddle ) else: sGoBy = _getInitialOffFront( sLast ) # # return sLast, sGoBy def getGoBySkipNick( s ): # sLast, sGoBy = getLastGoBySkipNick( s ) # return sGoBy def getGoByNickOK( s ): # from String.Get import getTextWithin # sGoBy = getGoBySkipNick( s ) # if '"' in s: # sGoByMaybe = getTextWithin( s, '"','"' ) # if sGoByMaybe: sGoBy = sGoByMaybe # return sGoBy def getLastFirstTitle( s ): # from Iter.AllVers import iFilter, tMap from String.Split import getWhiteCleaned from String.Get import getStripped from String.Names import getGoBySkipNick # s = getWhiteCleaned( s.replace( '.', '. ' ) ) # # print3( s ) tParts = tMap( getStripped, s.split( ',' ) ) # #print3( tParts ) sFirst = ' '.join( tParts[ 1 : ] ) sLast = tParts[ 0 ] sTitle = '' # if len( tParts ) == 3: sTitle = tParts[ 1 ] sFirst = ' '.join( tParts[ 2 : ] ) # if sLast.endswith( ' Jr.' ): # sTitle = ', '.join( iFilter( bool, ( sTitle, 'Jr.' ) ) ) sLast = sLast[ : -4 ].strip() # # if len( sFirst ) == 5 and sFirst[1] == '.' and sFirst[4] == '.': # pass # else: # sFirst = getGoBySkipNick( sFirst ) # # return sLast, sFirst, sTitle if __name__ == "__main__": # lProblems = [] # from Utils.Result import sayTestResult # #print3( isNickName( 'mike', 'Michael' ) tLastGoBy = getLastGoBySkipNick( 'Stephanie Herseth Sandlin' ) # if tLastGoBy != ('Sandlin', 'Stephanie'): # # lProblems.append( 'getLastGoBySkipNick()' ) # # if ( not isNickName( 'bill', 'william' ) or not isNickName( 'jill', 'julie' ) or not isNickName( 'susan', 'sue' ) or not isNickName( 'sue', 'susan' ) or not isNickName( 'rick', 'dick' ) or not isNickName( 'rick', 'richard' ) or not isNickName( 'ed', 'edward' ) or not isNickName( 'tina', 'valentina' ) or not isNickName( 'woody','woodrow' ) or not isNickName( 'lena', 'lynn' ) or not isNickName( 'lynn', 'kathleen' ) or not isNickName( 'steven', 'stephen' ) or not isNickName( 'carol', 'carolyn' ) or not isNickName( 'julie', 'julia' ) or not isNickName( 'kristi', 'Kristine') or not isNickName( 'mike', 'Michael' ) or isNickName( 'bill', 'ralph' ) or isNickName( 'chrstine', 'christine' ) ): # lProblems.append( 'isNickName()' ) # # if not isNameMisSpelled( 'kevin', 'kevn' ): # lProblems.append( 'isNameMisSpelled() kevin/kevn' ) # # if not isNameMisSpelled( 'Kimberley', 'Kimberly' ): # lProblems.append( 'isNameMisSpelled() Kimberley/Kimberly' ) # if not isNameMisSpelled( 'Natalie', 'Nathalie' ): # lProblems.append( 'isNameMisSpelled() Natalie, Nathalie' ) # if not isNameMisSpelled( 'Panayiotis', 'Panayotis' ): # lProblems.append( 'isNameMisSpelled() Panayiotis, Panayotis' ) # if not isNameMisSpelled( 'Chrstine', 'Christine' ): # lProblems.append( 'isNameMisSpelled() Chrstine, Christine' ) # if not isNameMisSpelled( 'Tomas', 'Tom' ): # lProblems.append( 'isNameMisSpelled() Tomas/Tom' ) # if not isNameMisSpelled( 'Alison', 'Allison' ): # lProblems.append( 'isNameMisSpelled() Alison/Allison' ) # if not isNameMisSpelled( 'Nanay', 'Nancy' ): # lProblems.append( 'isNameMisSpelled() Nanay/Nancy' ) # if not isNameMisSpelled( 'Chistopher', 'Christopher' ): # lProblems.append( 'isNameMisSpelled() Chistopher/Christopher' ) # if not isNameMisSpelled( 'Ann', 'Anne' ): # lProblems.append( 'isNameMisSpelled() Ann/Anne' ) # if not isNameMisSpelled( 'Carel', 'Carol' ): # lProblems.append( 'isNameMisSpelled() Carol/Carel' ) # if not isNameMisSpelled( 'Eric', 'Erik' ): # lProblems.append( 'isNameMisSpelled() Eric/Erik' ) # if not isNameMisSpelled( 'Jeegar', 'Jeeger' ): # lProblems.append( 'isNameMisSpelled() Jeegar/Jeeger' ) # if not isNameMisSpelled( 'Georgianna', 'Georgiana' ): # lProblems.append( 'isNameMisSpelled() Georgianna/Georgiana' ) # # if not isNameMisSpelled( 'Jacqueline', 'Jaqueline' ): # lProblems.append( 'isNameMisSpelled() Jacqueline/Jaqueline' ) # if not isNameMisSpelled( 'Josep', 'Joseph' ): # lProblems.append( 'isNameMisSpelled() Josep/Joseph' ) # if not isNameMisSpelled( 'Beverley', 'Beverly' ): # lProblems.append( 'isNameMisSpelled() Beverley/Beverly' ) # if not isNameMisSpelled( 'Heid', 'Heidi' ): # lProblems.append( 'isNameMisSpelled() Heid/Heidi' ) # if not isNameMisSpelled( 'Christine', 'Christina' ): # lProblems.append( 'isNameMisSpelled() Christine/Christina' ) # if not isNameMisSpelled( 'Kimberley', 'Kimberly' ): # lProblems.append( 'isNameMisSpelled() Kimberley/Kimberly' ) # if not isNameMisSpelled( 'Paul', 'Paulo' ): # lProblems.append( 'isNameMisSpelled() Paul/Paulo' ) # if not isNameMisSpelled( 'Dawn', 'Daun' ): # lProblems.append( 'isNameMisSpelled() Dawn/Daun' ) # if not isNameMisSpelled( 'Takao', 'Taka' ): # lProblems.append( 'isNameMisSpelled() Takao/Taka' ) # if not isNameMisSpelled( 'Paul', 'Paulk' ): # lProblems.append( 'isNameMisSpelled() Paul/Paulk' ) # # # # if isNameMisSpelled( 'John', 'Joel' ): # lProblems.append( 'isNameMisSpelled() John/Joel' ) # if isNameMisSpelled( 'Kelsey', 'Kelly' ): # lProblems.append( 'isNameMisSpelled() Kelsey/Kelly' ) # if isNameMisSpelled( 'Mark', 'Mary' ): # lProblems.append( 'isNameMisSpelled() Mark/Mary' ) # if isNameMisSpelled( 'Maria', 'Maya' ): # lProblems.append( 'isNameMisSpelled() Maria/Maya' ) # if isNameMisSpelled( 'John', 'Joan' ): # lProblems.append( 'isNameMisSpelled() John/Joan' ) # if isNameMisSpelled( 'Jan', 'Ryan' ): # lProblems.append( 'isNameMisSpelled() Jan/Ryan' ) # # if getFirstMiddleLast( 'William Jefferson Clinton' ) != \ ( 'William', 'Jefferson', 'Clinton' ): # lProblems.append( 'getFirstMiddleLast()' ) # # if getGoBySkipNick( 'L. Ron Hubbard' ) != 'Ron': # lProblems.append( 'getGoBySkipNick()' ) # # s = 'Paul "Tex" Yearout' # if getGoBySkipNick( s ) != 'Paul': # lProblems.append( 'getGoBySkipNick() got nick' ) # # if getGoByNickOK( s ) != 'Tex': # lProblems.append( 'getGoByNickOK() got nick' ) # # s = 'C. W. Bill Young' # if getGoBySkipNick( s ) != 'Bill': # lProblems.append( 'getGoBySkipNick() two initials' ) # # if getLastGoBySkipNick( s ) != ( 'Young', 'Bill' ): # lProblems.append( 'getLastGoBySkipNick() two initials' ) # # if getLastFirstTitle( 'Kratovil, Jr., Frank M.' ) != ( 'Kratovil', 'Frank', 'Jr.' ): # print3( getLastFirstTitle( 'Kratovil, Jr., Frank M.' ) ) lProblems.append( 'getLastFirstTitle() Kratovil, Jr., Frank M.' ) # # #if 0: if getLastFirstTitle( 'Kagen, Steve' ) != ( 'Kagen', 'Steve', '' ): # lProblems.append( 'getLastFirstTitle() Kagen, Steve' ) # # if getLastFirstTitle( 'Pascrell Jr., Bill' ) != ( 'Pascrell', 'Bill', 'Jr.' ): # print3( getLastFirstTitle( 'Pascrell Jr., Bill' ) ) lProblems.append( 'getLastFirstTitle() Pascrell Jr., Bill' ) # # if getLastFirstTitle( 'Barrett, J.Gresham' ) != ( 'Barrett', 'Gresham', '' ): # print3( getLastFirstTitle( 'Barrett, J.Gresham' ) ) lProblems.append( 'getLastFirstTitle() Barrett, J.Gresham' ) # # if getLastFirstTitle( 'Butterfield, G.K.' ) != ( 'Butterfield', 'G. K.', '' ): # print3( getLastFirstTitle( 'Butterfield, G.K.' ) ) lProblems.append( 'getLastFirstTitle() Butterfield, G.K.' ) # # Patrica and Patrick Forster # if isMensName( "Patricia" ): # lProblems.append( 'isMensName( "Patricia" )' ) # # if isWomensName( "Patrick" ): # lProblems.append( 'isWomensName( "Patrick" )' ) # # if isNameMisSpelled( "Patricia", "Patrick" ): # lProblems.append( 'isNameMisSpelled( "Patricia", "Patrick" )' ) # # if isNickName( "Patricia", "Patrick" ): # lProblems.append( 'isNickName( "Patricia", "Patrick" )' ) # # # # sayTestResult( lProblems )
netvigator/myPyPacks
pyPacks/String/Names.py
Python
gpl-2.0
56,111
from model_mommy import mommy from django.test import TestCase from ..models import Department, Employee class DepartmentTestMommy(TestCase): """Department's modle test case.""" def test_department_creation_mommy(self): """Test create department's model.""" new_department = mommy.make('employees.Department') self.assertTrue(isinstance(new_department, Department)) self.assertEqual(new_department.__str__(), new_department.name) class EmployeeTestMommy(TestCase): """Employee's model test cazse.""" def test_employee_creation_mommy(self): """Test create department's model.""" new_employee = mommy.make('employees.Employee') self.assertTrue(isinstance(new_employee, Employee)) self.assertEqual(new_employee.__str__(), '%s %s' % (new_employee.first_name, new_employee.last_name))
maurobaraldi/ll_interview_application
luizalabs/employees/tests/tests_models.py
Python
gpl-3.0
866
# -*- coding: utf-8 -*- from distutils.core import setup setup( name='django-cms-bootstrap-templates', version='0.0.1', author=u'Arne Schauf', author_email='python.asmaps.de', packages=['cms_bootstrap_templates'], url='https://github.com/asmaps/django-cms-bootstrap-templates', license='MIT licence, see LICENCE file', description='A set of bootstrap3 templates for use with django-cms', long_description=open('README.md').read(), zip_safe=False, include_package_data=True )
asmaps/django-cms-bootstrap-templates
setup.py
Python
mit
520
import os from setuptools import setup, find_packages __VERSION__ = "18.01.0" with open('README.md') as f: long_description = f.read() setup( name='dice_tools', version=__VERSION__, author='DICEhub', author_email='info@dicehub.com', description='DICE application tools', long_description=long_description, url='http://dicehub.com', packages = find_packages(), install_requires=[ 'PyYAML', 'py-lz4framed', 'msgpack-python'], )
dicehub/dice_tools
setup.py
Python
mit
493
# encoding: utf-8 from django.urls import reverse from rest_framework import serializers from entity.serializers import DetailSerializerV2 from externaltools.models import ExternalTool from mainsite.serializers import StripTagsCharField from mainsite.utils import OriginSetting class ExternalToolSerializerV2(DetailSerializerV2): name = StripTagsCharField(max_length=254) clientId = StripTagsCharField(max_length=254, source='client_id') class Meta(DetailSerializerV2.Meta): model = ExternalTool # apispec_definition = ('ExternalTool', {}) def to_representation(self, instance): representation = super(ExternalToolSerializerV2, self).to_representation(instance) representation['launchpoints'] = { lp.launchpoint: { "url": "{}{}".format(OriginSetting.HTTP, reverse("v2_api_externaltools_launch", kwargs=dict( launchpoint=lp.launchpoint, entity_id=lp.cached_externaltool.entity_id ))), "launchUrl": lp.launch_url, "label": lp.label, "iconUrl": lp.icon_url } for lp in instance.cached_launchpoints() } return representation class ExternalToolLaunchSerializerV2(DetailSerializerV2): launchUrl = serializers.URLField(source='launch_url') launchData = serializers.DictField(source='generate_launch_data')
concentricsky/badgr-server
apps/externaltools/serializers_v2.py
Python
agpl-3.0
1,423
''' Created on 21.07.2013 @author: bronikkk ''' import re from ti.sema import * def findReModule(): import config importer = config.data.importer return importer.importedFiles['re'] def findReName(name): module = findReModule() var = module.getScope().findName(name) assert len(var.nodeType) == 1 return list(var.nodeType)[0] def quasiCompile(params, **kwargs): try: pattern = re.compile(params[0].value) cls = findReName(getPatternClassName()) if not cls: return set() res = cls.getClassInstance() res.data = pattern return {res} except: return set() def quasiMatch(params, **kwargs): try: match = params[0].data.match(params[1].value) cls = findReName(getMatchClassName()) if not cls: return set() res = cls.getClassInstance() res.data = match return {res} except: return set() def quasiGroups(params, **kwargs): try: groups = params[0].data.groups() res = TupleSema() res.elems = [set()] for elem in groups: res.elems.append({LiteralValueSema(elem)}) return {res} except: return set() functions = [ ['compile', quasiCompile, 1], ] variables = [ ] modules = [ ] def getPatternClassName(): return 'SRE_Pattern' patternClass = ( getPatternClassName(), [ ['match', quasiMatch, 2], ], [ ] ) def getMatchClassName(): return 'SRE_Match' matchClass = ( getMatchClassName(), [ ['groups', quasiGroups, 1], ], [ ] ) classes = [ patternClass, matchClass ] def getAll(): return (functions, variables, modules, classes)
bronikkk/tirpan
std/re_.py
Python
gpl-3.0
2,038
__RCSID__ = "$Id$" import socket import select import time import os from DIRAC.Core.DISET.private.Transports.BaseTransport import BaseTransport from DIRAC.FrameworkSystem.Client.Logger import gLogger from DIRAC.Core.Utilities.ReturnValues import S_ERROR, S_OK class PlainTransport( BaseTransport ): def initAsClient( self ): timeout = None if 'timeout' in self.extraArgsDict: timeout = self.extraArgsDict[ 'timeout' ] try: self.oSocket = socket.create_connection(self.stServerAddress, timeout) except socket.error as e: if e.args[0] != 115: return S_ERROR( "Can't connect: %s" % str( e ) ) #Connect in progress oL = select.select( [], [ self.oSocket ], [], self.extraArgsDict[ 'timeout' ] )[1] if len( oL ) == 0: self.oSocket.close() return S_ERROR( "Connection timeout" ) errno = self.oSocket.getsockopt( socket.SOL_SOCKET, socket.SO_ERROR ) if errno != 0: return S_ERROR( "Can't connect: %s" % str( ( errno, os.strerror( errno ) ) ) ) self.remoteAddress = self.oSocket.getpeername() return S_OK( self.oSocket ) def initAsServer( self ): if not self.serverMode(): raise RuntimeError( "Must be initialized as server mode" ) try: self.oSocket = socket.socket( socket.AF_INET6, socket.SOCK_STREAM ) except socket.error: # IPv6 is probably disabled on this node, try IPv4 only instead self.oSocket = socket.socket( socket.AF_INET, socket.SOCK_STREAM ) if self.bAllowReuseAddress: self.oSocket.setsockopt( socket.SOL_SOCKET, socket.SO_REUSEADDR, 1 ) self.oSocket.bind( self.stServerAddress ) self.oSocket.listen( self.iListenQueueSize ) return S_OK( self.oSocket ) def close( self ): gLogger.debug( "Closing socket" ) try: self.oSocket.shutdown( socket.SHUT_RDWR ) except: pass self.oSocket.close() def setClientSocket( self, oSocket ): if self.serverMode(): raise RuntimeError( "Mustbe initialized as client mode" ) self.oSocket = oSocket if 'timeout' in self.extraArgsDict: self.oSocket.settimeout( self.extraArgsDict[ 'timeout' ] ) self.remoteAddress = self.oSocket.getpeername() def acceptConnection( self ): #HACK: Was = PlainTransport( self ) oClientTransport = PlainTransport( self.stServerAddress ) oClientSocket, stClientAddress = self.oSocket.accept() oClientTransport.setClientSocket( oClientSocket ) return S_OK( oClientTransport ) def _read( self, bufSize = 4096, skipReadyCheck = False ): start = time.time() timeout = False if 'timeout' in self.extraArgsDict: timeout = self.extraArgsDict[ 'timeout' ] while True: if timeout: if time.time() - start > timeout: return S_ERROR( "Socket read timeout exceeded" ) try: data = self.oSocket.recv( bufSize ) return S_OK( data ) except socket.error as e: if e[0] == 11: time.sleep( 0.001 ) else: return S_ERROR( "Exception while reading from peer: %s" % str( e ) ) except Exception as e: return S_ERROR( "Exception while reading from peer: %s" % str( e ) ) def _write( self, buffer ): sentBytes = 0 timeout = False if 'timeout' in self.extraArgsDict: timeout = self.extraArgsDict[ 'timeout' ] if timeout: start = time.time() while sentBytes < len( buffer ): try: if timeout: if time.time() - start > timeout: return S_ERROR( "Socket write timeout exceeded" ) sent = self.oSocket.send( buffer[ sentBytes: ] ) if sent == 0: return S_ERROR( "Connection closed by peer" ) if sent > 0: sentBytes += sent except socket.error as e: if e[0] == 11: time.sleep( 0.001 ) else: return S_ERROR( "Exception while sending to peer: %s" % str( e ) ) except Exception as e: return S_ERROR( "Error while sending: %s" % str( e ) ) return S_OK( sentBytes ) def checkSanity( *args, **kwargs ): return S_OK( {} ) def delegate( delegationRequest, kwargs ): """ Check delegate! """ return S_OK()
arrabito/DIRAC
Core/DISET/private/Transports/PlainTransport.py
Python
gpl-3.0
4,193
""" configuration module for awsu, contains two objects """ import boto3 import sqlite3 import logging import getpass import datetime import configparser import uuid import requests import json from dateutil.tz import tzutc from urllib.parse import urlencode, quote_plus from os import environ from bs4 import BeautifulSoup import base64 from lxml import etree class Credential(object): """ credential class """ def __init__(self): self.conn = sqlite3.connect(environ.get('HOME') + '/.aws/config.db') self.initialize_database('credentials') def initialize_database(self, table): cur = self.conn.cursor() tables = cur.execute( "SELECT name FROM sqlite_master WHERE type='table'").fetchall() if not table in tables[0]: stmt = '''CREATE TABLE %s( profile text, access_key text, secret_key text, session_token text, expiration text) ''' % table[0] cur.execute(stmt) self.conn.commit() def get_session(self, profile="default"): if profile is None: profile = "default" cur = self.conn.cursor() self.session = cur.execute( "SELECT * FROM credentials WHERE profile=? LIMIT 1", (profile,)) self.session = self.session.fetchone() if self.session is None or self.is_expired(): if self.is_expired(): cur.execute("DELETE FROM credentials WHERE profile=?", (profile,)) self.conn.commit() creds = self.get_credentials(profile) cur.execute("INSERT INTO credentials VALUES(?,?,?,?,?)", creds) self.conn.commit() return { 'AWS_ACCESS_KEY_ID': creds[1], 'AWS_SECRET_ACCESS_KEY': creds[2], 'AWS_SESSION_TOKEN': creds[3], 'AWS_SECURITY_TOKEN': creds[3] } else: return { 'AWS_ACCESS_KEY_ID': self.session[1], 'AWS_SECRET_ACCESS_KEY': self.session[2], 'AWS_SESSION_TOKEN': self.session[3], 'AWS_SECURITY_TOKEN': self.session[3] } def get_credentials(self, profile="default"): """ return aws profile environment variables """ if profile is None: profile = 'default' # get session token if profile != 'saml': session = boto3.Session(profile_name=profile) sts = boto3.client('sts') user = User() token = getpass.getpass("Enter MFA Code : ") if profile == "default": res = sts.get_session_token( DurationSeconds=3600, SerialNumber=user.mfa, TokenCode=token ) elif profile == "saml": config_file = configparser.RawConfigParser() config_file.read(environ.get('HOME') + '/.aws/config') if not config_file.has_section(profile): config_file.add_section(profile) username = str(input("Google Email : ")) idp_id = str(input('IDP ID : ')) sp_id = str(input('SP ID : ')) else: username = config_file.get(profile, 'username') idp_id = config_file.get(profile, 'idpid') sp_id = config_file.get(profile, 'spid') passwd = getpass.getpass('Password : ') google = GoogleSAML(username, passwd, idp_id, sp_id) google.auth() saml_res = google.get_saml_response() doc = etree.fromstring(base64.b64decode(saml_res)) roles = google.parse_roles(doc) role_arn, provider = google.pick_one(roles) config_file.set(profile, 'username', google.username) config_file.set(profile, 'idpid', google.idp_id) config_file.set(profile, 'spid', google.sp_id) config_file.set(profile, 'role_arn', role_arn) config_file.set(profile, 'provider', provider) config_file.set(profile, 'durations', google.duration_seconds) with open(environ.get('HOME') + '/.aws/config', 'w+') as f: try: config_file.write(f) finally: f.close() print("Assuming " + config_file.get(profile, 'role_arn')) sts = boto3.client('sts') res = sts.assume_role_with_saml( RoleArn=config_file.get(profile, 'role_arn'), PrincipalArn=config_file.get(profile, 'provider'), SAMLAssertion=saml_res, DurationSeconds=config_file.get(profile, 'durations')) else: config_file = configparser.RawConfigParser() config_file.read(environ.get('HOME') + '/.aws/credentials') role_arn = config_file.get(profile, 'role_arn') role_name = role_arn.split('/')[-1] random_identifier = str(uuid.uuid4())[4:] role_session = ''.join( [user.username, role_name, random_identifier]) res = sts.assume_role( RoleArn=role_arn, RoleSessionName=role_session, DurationSeconds=3600, SerialNumber=user.mfa, TokenCode=token ) return ( profile, res['Credentials']['AccessKeyId'], res['Credentials']['SecretAccessKey'], res['Credentials']['SessionToken'], res['Credentials']['Expiration'] ) def clean_environment(self): """ remove aws environment variables """ for var in list(environ.keys()): if var.startswith('AWS_'): del environ[var] def is_expired(self): try: stored_date = self.session[4] except: return False now = datetime.datetime.utcnow() session_time = datetime.datetime.strptime( stored_date, '%Y-%m-%d %H:%M:%S+00:00') return now > session_time class User(object): def __init__(self): sts = boto3.client('sts') caller = sts.get_caller_identity() self.arn = caller['Arn'] self.account_id = caller['Account'] self.username = self.get_username() self.mfa = self.get_mfa() def get_username(self): username = str(self.arn).split('/')[-1] return username def get_mfa(self): mfa = "arn:aws:iam::" + self.account_id + ":mfa/" + self.username return mfa class GoogleSAML(object): def __init__(self, username, passwd, idp_id, sp_id): """ method for google saml auth init""" self.username = username self.password = passwd self.idp_id = idp_id self.sp_id = sp_id self.duration_seconds = 3600 payload = { 'idpid': str(self.idp_id), 'spid': str(self.sp_id), 'forceauthn': 'false' } params = urlencode(payload, quote_via=quote_plus) self.url = "https://accounts.google.com/o/saml2/initsso?" + params def auth(self): self.request = requests.Session() res = self.request.get(self.url) res.raise_for_status() page = BeautifulSoup(res.text, 'html.parser') gaia_loginform = page.find( 'form', {'id': 'gaia_loginform'}).get('action') payload = {} payload['gxf'] = page.find('input', {'name': 'gxf'}).get('value') payload['continue'] = page.find( 'input', {'name': 'continue'}).get('value') payload['ltmpl'] = page.find('input', {'name': 'ltmpl'}).get('value') payload['sarp'] = 1 payload['scc'] = 1 payload['oauth'] = page.find('input', {'name': 'oauth'}).get('value') payload['_utf8'] = page.find('input', {'name': '_utf8'}).get('value') payload['bgresponse'] = page.find( 'input', {'name': 'bgresponse'}).get('value') payload['Email'] = self.username payload['Passwd'] = self.password res = self.request.post(gaia_loginform, data=payload) res.raise_for_status() self.request.headers['Referer'] = res.url page = BeautifulSoup(res.text, 'html.parser') payload['ProfileInformation'] = page.find( 'input', {'name': 'ProfileInformation'}).get('value') payload['SessionState'] = page.find( 'input', {'name': 'SessionState'}).get('value') payload['Passwd'] = self.password passwd_challenge_url = page.find( 'form', {'id': 'gaia_loginform'}).get('action') res = self.request.post(passwd_challenge_url, data=payload) res.raise_for_status() self.request.headers['Referer'] = res.url if "challenge/az" in res.url: res = self.auth_prompt(res, payload) self.session_state = res def auth_prompt(self, session, payload): res = BeautifulSoup(session.text, 'html.parser') auth_url = session.url.split('?')[0] data_key = res.find('div', {'data-api-key': True}).get('data-api-key') data_tx_id = res.find('div', {'data-tx-id': True}).get('data-tx-id') params = { 'alt': 'json', 'key': data_key } params = urlencode(params, quote_via=quote_plus) prompt_url = "https://content.googleapis.com/cryptauth/v1/authzen/awaittx?" + params prompt_body = {'txId': data_tx_id} print("Open the Google App, and tap 'Yes' on the prompt to sign in ...") self.request.headers['Referer'] = session.url res_prompt = self.request.post(prompt_url, json=prompt_body) parsed = json.loads(res_prompt.text) payload = { 'challengeId': res.find('input', {'name': 'challengeId'}).get('value'), 'challengeType': res.find('input', {'name': 'challengeType'}).get('value'), 'continue': res.find('input', {'name': 'continue'}).get('value'), 'scc': res.find('input', {'name': 'scc'}).get('value'), 'sarp': res.find('input', {'name': 'sarp'}).get('value'), 'TL': res.find('input', {'name': 'TL'}).get('value'), 'gxf': res.find('input', {'name': 'gxf'}).get('value'), 'token': parsed['txToken'], 'action': res.find('input', {'name': 'action'}).get('value'), 'TrustDevice': 'on', } res = self.request.post(auth_url, data=payload) res.raise_for_status() return res def get_saml_response(self): res = BeautifulSoup(self.session_state.text, 'html.parser') saml_response = res.find( 'input', {'name': 'SAMLResponse'}).get('value') return saml_response def parse_roles(self, doc): roles = {} for x in doc.xpath('//*[@Name = "https://aws.amazon.com/SAML/Attributes/Role"]//text()'): if "arn:aws:iam:" not in x: continue res = x.split(',') roles[res[0]] = res[1] return roles def pick_one(self, roles): while True: for i, role in enumerate(roles): print("[{:>3d}] {}".format(i + 1, role)) prompt = 'Type the number (1 - {:d}) of the role to assume: '.format( len(roles)) choice = input(prompt) try: num = int(choice) return list(roles.items())[num - 1] except: print("Invalid choice, try again")
rizkidoank/awsu
awsu/config.py
Python
gpl-3.0
11,653
import unittest from test import support from _testcapi import getargs_keywords import warnings warnings.filterwarnings("ignore", category=DeprecationWarning, message=".*integer argument expected, got float", module=__name__) warnings.filterwarnings("ignore", category=DeprecationWarning, message=".*integer argument expected, got float", module="unittest") """ > How about the following counterproposal. This also changes some of > the other format codes to be a little more regular. > > Code C type Range check > > b unsigned char 0..UCHAR_MAX > h signed short SHRT_MIN..SHRT_MAX > B unsigned char none ** > H unsigned short none ** > k * unsigned long none > I * unsigned int 0..UINT_MAX > i int INT_MIN..INT_MAX > l long LONG_MIN..LONG_MAX > K * unsigned long long none > L long long LLONG_MIN..LLONG_MAX > Notes: > > * New format codes. > > ** Changed from previous "range-and-a-half" to "none"; the > range-and-a-half checking wasn't particularly useful. Plus a C API or two, e.g. PyInt_AsLongMask() -> unsigned long and PyInt_AsLongLongMask() -> unsigned long long (if that exists). """ LARGE = 0x7FFFFFFF VERY_LARGE = 0xFF0000121212121212121242 from _testcapi import UCHAR_MAX, USHRT_MAX, UINT_MAX, ULONG_MAX, INT_MAX, \ INT_MIN, LONG_MIN, LONG_MAX, PY_SSIZE_T_MIN, PY_SSIZE_T_MAX # fake, they are not defined in Python's header files LLONG_MAX = 2**63-1 LLONG_MIN = -2**63 ULLONG_MAX = 2**64-1 class Long: def __int__(self): return 99 class Int: def __int__(self): return 99 class Unsigned_TestCase(unittest.TestCase): def test_b(self): from _testcapi import getargs_b # b returns 'unsigned char', and does range checking (0 ... UCHAR_MAX) self.assertRaises(TypeError, getargs_b, 3.14) self.assertEqual(99, getargs_b(Long())) self.assertEqual(99, getargs_b(Int())) self.assertRaises(OverflowError, getargs_b, -1) self.assertEqual(0, getargs_b(0)) self.assertEqual(UCHAR_MAX, getargs_b(UCHAR_MAX)) self.assertRaises(OverflowError, getargs_b, UCHAR_MAX + 1) self.assertEqual(42, getargs_b(42)) self.assertEqual(42, getargs_b(42)) self.assertRaises(OverflowError, getargs_b, VERY_LARGE) def test_B(self): from _testcapi import getargs_B # B returns 'unsigned char', no range checking self.assertRaises(TypeError, getargs_B, 3.14) self.assertEqual(99, getargs_B(Long())) self.assertEqual(99, getargs_B(Int())) self.assertEqual(UCHAR_MAX, getargs_B(-1)) self.assertEqual(UCHAR_MAX, getargs_B(-1)) self.assertEqual(0, getargs_B(0)) self.assertEqual(UCHAR_MAX, getargs_B(UCHAR_MAX)) self.assertEqual(0, getargs_B(UCHAR_MAX+1)) self.assertEqual(42, getargs_B(42)) self.assertEqual(42, getargs_B(42)) self.assertEqual(UCHAR_MAX & VERY_LARGE, getargs_B(VERY_LARGE)) def test_H(self): from _testcapi import getargs_H # H returns 'unsigned short', no range checking self.assertRaises(TypeError, getargs_H, 3.14) self.assertEqual(99, getargs_H(Long())) self.assertEqual(99, getargs_H(Int())) self.assertEqual(USHRT_MAX, getargs_H(-1)) self.assertEqual(0, getargs_H(0)) self.assertEqual(USHRT_MAX, getargs_H(USHRT_MAX)) self.assertEqual(0, getargs_H(USHRT_MAX+1)) self.assertEqual(42, getargs_H(42)) self.assertEqual(42, getargs_H(42)) self.assertEqual(VERY_LARGE & USHRT_MAX, getargs_H(VERY_LARGE)) def test_I(self): from _testcapi import getargs_I # I returns 'unsigned int', no range checking self.assertRaises(TypeError, getargs_I, 3.14) self.assertEqual(99, getargs_I(Long())) self.assertEqual(99, getargs_I(Int())) self.assertEqual(UINT_MAX, getargs_I(-1)) self.assertEqual(0, getargs_I(0)) self.assertEqual(UINT_MAX, getargs_I(UINT_MAX)) self.assertEqual(0, getargs_I(UINT_MAX+1)) self.assertEqual(42, getargs_I(42)) self.assertEqual(42, getargs_I(42)) self.assertEqual(VERY_LARGE & UINT_MAX, getargs_I(VERY_LARGE)) def test_k(self): from _testcapi import getargs_k # k returns 'unsigned long', no range checking # it does not accept float, or instances with __int__ self.assertRaises(TypeError, getargs_k, 3.14) self.assertRaises(TypeError, getargs_k, Long()) self.assertRaises(TypeError, getargs_k, Int()) self.assertEqual(ULONG_MAX, getargs_k(-1)) self.assertEqual(0, getargs_k(0)) self.assertEqual(ULONG_MAX, getargs_k(ULONG_MAX)) self.assertEqual(0, getargs_k(ULONG_MAX+1)) self.assertEqual(42, getargs_k(42)) self.assertEqual(42, getargs_k(42)) self.assertEqual(VERY_LARGE & ULONG_MAX, getargs_k(VERY_LARGE)) class Signed_TestCase(unittest.TestCase): def test_i(self): from _testcapi import getargs_i # i returns 'int', and does range checking (INT_MIN ... INT_MAX) self.assertRaises(TypeError, getargs_i, 3.14) self.assertEqual(99, getargs_i(Long())) self.assertEqual(99, getargs_i(Int())) self.assertRaises(OverflowError, getargs_i, INT_MIN-1) self.assertEqual(INT_MIN, getargs_i(INT_MIN)) self.assertEqual(INT_MAX, getargs_i(INT_MAX)) self.assertRaises(OverflowError, getargs_i, INT_MAX+1) self.assertEqual(42, getargs_i(42)) self.assertEqual(42, getargs_i(42)) self.assertRaises(OverflowError, getargs_i, VERY_LARGE) def test_l(self): from _testcapi import getargs_l # l returns 'long', and does range checking (LONG_MIN ... LONG_MAX) self.assertRaises(TypeError, getargs_l, 3.14) self.assertEqual(99, getargs_l(Long())) self.assertEqual(99, getargs_l(Int())) self.assertRaises(OverflowError, getargs_l, LONG_MIN-1) self.assertEqual(LONG_MIN, getargs_l(LONG_MIN)) self.assertEqual(LONG_MAX, getargs_l(LONG_MAX)) self.assertRaises(OverflowError, getargs_l, LONG_MAX+1) self.assertEqual(42, getargs_l(42)) self.assertEqual(42, getargs_l(42)) self.assertRaises(OverflowError, getargs_l, VERY_LARGE) def test_n(self): from _testcapi import getargs_n # n returns 'Py_ssize_t', and does range checking # (PY_SSIZE_T_MIN ... PY_SSIZE_T_MAX) self.assertRaises(TypeError, getargs_n, 3.14) self.assertRaises(TypeError, getargs_n, Long()) self.assertRaises(TypeError, getargs_n, Int()) self.assertRaises(OverflowError, getargs_n, PY_SSIZE_T_MIN-1) self.assertEqual(PY_SSIZE_T_MIN, getargs_n(PY_SSIZE_T_MIN)) self.assertEqual(PY_SSIZE_T_MAX, getargs_n(PY_SSIZE_T_MAX)) self.assertRaises(OverflowError, getargs_n, PY_SSIZE_T_MAX+1) self.assertEqual(42, getargs_n(42)) self.assertEqual(42, getargs_n(42)) self.assertRaises(OverflowError, getargs_n, VERY_LARGE) class LongLong_TestCase(unittest.TestCase): def test_L(self): from _testcapi import getargs_L # L returns 'long long', and does range checking (LLONG_MIN ... LLONG_MAX) self.assertRaises(TypeError, getargs_L, "Hello") self.assertEqual(3, getargs_L(3.14)) self.assertEqual(99, getargs_L(Long())) self.assertEqual(99, getargs_L(Int())) self.assertRaises(OverflowError, getargs_L, LLONG_MIN-1) self.assertEqual(LLONG_MIN, getargs_L(LLONG_MIN)) self.assertEqual(LLONG_MAX, getargs_L(LLONG_MAX)) self.assertRaises(OverflowError, getargs_L, LLONG_MAX+1) self.assertEqual(42, getargs_L(42)) self.assertEqual(42, getargs_L(42)) self.assertRaises(OverflowError, getargs_L, VERY_LARGE) def test_K(self): from _testcapi import getargs_K # K return 'unsigned long long', no range checking self.assertRaises(TypeError, getargs_K, 3.14) self.assertRaises(TypeError, getargs_K, Long()) self.assertRaises(TypeError, getargs_K, Int()) self.assertEqual(ULLONG_MAX, getargs_K(ULLONG_MAX)) self.assertEqual(0, getargs_K(0)) self.assertEqual(0, getargs_K(ULLONG_MAX+1)) self.assertEqual(42, getargs_K(42)) self.assertEqual(42, getargs_K(42)) self.assertEqual(VERY_LARGE & ULLONG_MAX, getargs_K(VERY_LARGE)) class Tuple_TestCase(unittest.TestCase): def test_tuple(self): from _testcapi import getargs_tuple ret = getargs_tuple(1, (2, 3)) self.assertEqual(ret, (1,2,3)) # make sure invalid tuple arguments are handled correctly class seq: def __len__(self): return 2 def __getitem__(self, n): raise ValueError self.assertRaises(TypeError, getargs_tuple, 1, seq()) class Keywords_TestCase(unittest.TestCase): def test_positional_args(self): # using all positional args self.assertEqual( getargs_keywords((1,2), 3, (4,(5,6)), (7,8,9), 10), (1, 2, 3, 4, 5, 6, 7, 8, 9, 10) ) def test_mixed_args(self): # positional and keyword args self.assertEqual( getargs_keywords((1,2), 3, (4,(5,6)), arg4=(7,8,9), arg5=10), (1, 2, 3, 4, 5, 6, 7, 8, 9, 10) ) def test_keyword_args(self): # all keywords self.assertEqual( getargs_keywords(arg1=(1,2), arg2=3, arg3=(4,(5,6)), arg4=(7,8,9), arg5=10), (1, 2, 3, 4, 5, 6, 7, 8, 9, 10) ) def test_optional_args(self): # missing optional keyword args, skipping tuples self.assertEqual( getargs_keywords(arg1=(1,2), arg2=3, arg5=10), (1, 2, 3, -1, -1, -1, -1, -1, -1, 10) ) def test_required_args(self): # required arg missing try: getargs_keywords(arg1=(1,2)) except TypeError as err: self.assertEqual(str(err), "Required argument 'arg2' (pos 2) not found") else: self.fail('TypeError should have been raised') def test_too_many_args(self): try: getargs_keywords((1,2),3,(4,(5,6)),(7,8,9),10,111) except TypeError as err: self.assertEqual(str(err), "function takes at most 5 arguments (6 given)") else: self.fail('TypeError should have been raised') def test_invalid_keyword(self): # extraneous keyword arg try: getargs_keywords((1,2),3,arg5=10,arg666=666) except TypeError as err: self.assertEqual(str(err), "'arg666' is an invalid keyword argument for this function") else: self.fail('TypeError should have been raised') def test_main(): tests = [Signed_TestCase, Unsigned_TestCase, Tuple_TestCase, Keywords_TestCase] try: from _testcapi import getargs_L, getargs_K except ImportError: pass # PY_LONG_LONG not available else: tests.append(LongLong_TestCase) support.run_unittest(*tests) if __name__ == "__main__": test_main()
mancoast/CPythonPyc_test
fail/314_test_getargs2.py
Python
gpl-3.0
11,329
from datetime import datetime, timedelta RESOURCE_METHODS = ['GET', 'POST', 'DELETE'] ITEM_METHODS = ['GET', 'PATCH', 'PUT', 'DELETE'] DATE_FORMAT = '%Y-%m-%d %H:%M:%S GMT' schema = { 'name': { 'type': 'string', 'minlength': 3, 'maxlength': 50, 'required': True, }, 'occurred_on': { 'type': 'datetime', 'default': datetime.utcnow(), }, 'source': { 'type': 'string', 'minlength': 2, 'maxlength': 50, 'required': True, }, 'reporter': { 'type': 'string', 'minlength': 3, 'maxlength': 20, 'required': True, }, 'details': { 'type': 'string', 'minlength': 0, 'maxlength': 300, 'required': False }, } event = { 'item_title': 'event', 'additional_lookup': { 'url': 'regex("[\w]+")', 'field': 'name', }, 'cache_control': 'max-age=10, must-revalidate', 'cache_expires': 10, 'resource_methods': ['GET', 'POST'], 'schema': schema } DOMAIN = { 'event': event, } MONGO_HOST = 'localhost' MONGO_PORT = 27017 MONGO_USERNAME = '' MONGO_PASSWORD = '' MONGO_DBNAME = 'historia'
waoliveros/historia
settings.py
Python
mit
1,196
# -*- coding: utf-8 -*- """ Copyright [2009-2021] EMBL-European Bioinformatics Institute Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ import os from pathlib import Path import datetime as dt import pytest from rnacentral_pipeline.databases.psicquic import parser from rnacentral_pipeline.databases.data import ( Entry, Interaction, InteractionIdentifier, Interactor, ) from rnacentral_pipeline.databases.helpers import publications as pub @pytest.fixture(scope="module") def data(): path = Path("data/psicquic/data.tsv") return list(parser.parse(path, os.environ["PGDATABASE"])) def test_can_parse_all_entries(data): assert len(data) == 9 def test_can_parse_correctly(data): assert data[0] == Entry( primary_id="PSICQUIC:URS000000B1C9_9606", accession="PSICQUIC:URS000000B1C9_9606", ncbi_tax_id=9606, database="PSICQUIC", sequence="TGAGGTAGGAGGTTGTATAGTT", regions=[], rna_type="miRNA", url="http://www.ebi.ac.uk/Tools/webservices/psicquic/view/main.xhtml", seq_version="1", description="Homo sapiens (human) hsa-let-7e-5p", references=[ pub.reference("PMID:23671334"), pub.reference("PMID:30670152"), ], species="Homo sapiens", common_name="human", lineage="Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo; Homo sapiens", interactions=[ Interaction( ids=( InteractionIdentifier( key="psicquic", value="URS000000B1C9_9606-0", name="" ), ), interactor1=Interactor( id=InteractionIdentifier( key="RNAcentral", value="URS000000B1C9_9606", name=None ), alt_ids=(), aliases=( InteractionIdentifier( key="RNAcentral", value="Homo sapiens (human) hsa-let-7e-5p", name="recommended name", ), ), taxid=9606, biological_role=( InteractionIdentifier( key="psi-mi", value="MI:0499", name="unspecified role" ), ), experimental_role=( InteractionIdentifier( key="psi-mi", value="MI:0499", name="unspecified role" ), ), interactor_type=( InteractionIdentifier( key="psi-mi", value="MI:0320", name="ribonucleic acid" ), ), xrefs=( InteractionIdentifier( key="go", value="GO:0035278", name="miRNA mediated inhibition of translation", ), ), annotations="-", features=(), stoichiometry=None, participant_identification=(), ), interactor2=Interactor( id=InteractionIdentifier( key="uniprotkb", value="P40763", name=None ), alt_ids=(), aliases=(), taxid=-3, biological_role=( InteractionIdentifier( key="psi-mi", value="MI:0499", name="unspecified role" ), ), experimental_role=( InteractionIdentifier( key="psi-mi", value="MI:0499", name="unspecified role" ), ), interactor_type=( InteractionIdentifier( key="psi-mi", value="MI:0329", name="unknown participant" ), ), xrefs=(), annotations="-", features=(), stoichiometry=None, participant_identification=(), ), methods=(), types=( InteractionIdentifier( key="psi-mi", value="MI:0915", name="physical association" ), ), xrefs=(), annotations=(), confidence=(), source_database=( InteractionIdentifier( key="psi-mi", value="MI:2320", name="aruk-ucl" ), ), is_negative=True, publications=(pub.reference("PMID:30670152"),), create_date=None, update_date=dt.date(2020, 1, 27), host_organisms=None, ) ], )
RNAcentral/rnacentral-import-pipeline
tests/databases/psicquic/parser_test.py
Python
apache-2.0
5,789
#!/usr/bin/env python # # restrict_long_contigs.py # # USAGE: restrict_long_contigs.py [options] <input_directory> \ # <output_directory> # # Options: # -h, --help show this help message and exit # -l MINLEN, --minlen=MINLEN # Minimum length of sequence # -s SUFFIX, --filesuffix=SUFFIX # Suffix to indicate the file was processed # -v, --verbose Give verbose output # # Non-PSL dependencies: Biopython (www.biopython.org) # # A short script that takes as input a directory containing (many) FASTA files # describing biological sequences, and writes to a new, named directory # multiple FASTA files containing the same sequences, but restricted only to # those sequences whose length is greater than a passed value. # # Example usage: You have a directory with many sets of contigs from different # assemblies. This script will produce a new directory of the same data where # the contig lengths are restricted to being greater than a specified length. # # Copyright (C) 2013 The James Hutton Institute # Author: Leighton Pritchard # # Contact: # leighton.pritchard@hutton.ac.uk # # Leighton Pritchard, # Information and Computing Sciences, # James Hutton Institute, # Errol Road, # Invergowrie, # Dundee, # DD6 9LH, # Scotland, # UK # # The MIT License # # Copyright (c) 2010-2014 The James Hutton Institute # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. ### # IMPORTS from Bio import SeqIO from optparse import OptionParser import logging import logging.handlers import os import re import sys ### # GLOBALS # File extensions that indicate FASTA content fasta_ext = ['.fa', '.fas', '.fasta'] ### # FUNCTIONS # Parse cmd-line def parse_cmdline(args): """ Parse command-line arguments. Note that the input and output directories are positional arguments """ usage = "usage: %prog [options] <input_directory> <output_directory>" parser = OptionParser(usage) parser.add_option("-l", "--minlen", dest="minlen", action="store", default=1000, help="Minimum length of sequence") parser.add_option("-s", "--filesuffix", dest="suffix", action="store", default="_restricted", help="Suffix to indicate the file was processed") parser.add_option("-v", "--verbose", dest="verbose", action="store_true", default=False, help="Give verbose output") return parser.parse_args() # Get list of FASTA files from a directory def get_fasta_filenames(indir, extensions=fasta_ext): """ Identifies files in the passed directory whose extensions indicate that they may be FASTA files. Returns the path to the file, including the parent directory. """ filelist = [f for f in os.listdir(indir) if os.path.splitext(f)[-1].lower() in extensions] logger.info("Identified %d FASTA files in %s:" % (len(filelist), indir)) if not len(filelist): # We want there to be at least one file logger.error("No FASTA files found in %s" % indir) sys.exit(1) return filelist # Restrict sequence length in a named FASTA file, writing it to # the named location def restrict_seq_length(infile, outfile, minlen): """ Takes an input FASTA file as infile, and writes out a corresponding file to outfile, where sequences shorter than minlen are not included """ logger.info("Restricting lengths of %s to >=%d;" % (infile, minlen) + " writing to %s" % outfile) SeqIO.write([s for s in SeqIO.parse(infile, 'fasta') if not len(s) < minlen], outfile, 'fasta') # Process FASTA files in the directory def process_files(indir, outdir, minlen, suffix): """ Takes an input directory that contains FASTA files, and writes to the output directory corresponding files (with the suffix appended) that contain only sequences of length greater than minlen. """ for filename in get_fasta_filenames(indir): filestem, ext = os.path.splitext(filename) infilename = os.path.join(indir, filename) outfilename = os.path.join(outdir, ''.join([filestem, suffix, ext])) restrict_seq_length(infilename, outfilename, minlen) ### # SCRIPT if __name__ == '__main__': # Parse command-line # options are options, arguments are the .sff files options, args = parse_cmdline(sys.argv) # We set up logging, and modify loglevel according to whether we need # verbosity or not logger = logging.getLogger('restrict_long_contigs.py') logger.setLevel(logging.DEBUG) err_handler = logging.StreamHandler(sys.stderr) err_formatter = logging.Formatter('%(levelname)s: %(message)s') err_handler.setFormatter(err_formatter) if options.verbose: err_handler.setLevel(logging.INFO) else: err_handler.setLevel(logging.WARNING) logger.addHandler(err_handler) # Report arguments, if verbose logger.info(options) logger.info(args) # If there are not two positional arguments, throw an error if len(args) != 2: logger.error("Not enough arguments: script requires input and " + "output directory") sys.exit(1) indir, outdir = tuple(args) # Make sure that the input directory exists if not os.path.isdir(indir): logger.error("Input directory %s does not exist" % indir) sys.exit(1) # If output directory does not exist, create it. If it does exist, # issue a warning that contents may be overwritten if os.path.isdir(outdir): logger.warning("Contents of %s may be overwritten" % outdir) else: logger.warning("Output directory %s does not exist: creating it" % outdir) os.mkdir(outdir) # Check that the passed suffix is a valid string: escape dodgy characters #try: # suffix = re.escape(options.suffix) #except: # logger.error("Could not escape suffix string: %s" % options.suffix) # sys.exit(1) # Make sure that the minimum length is an integer, and positive if not int(options.minlen) > 0: logger.error("Minimum length must be a positive integer, got %s" % options.minlen) sys.exit(1) # Restrict sequence lengths process_files(indir, outdir, int(options.minlen), options.suffix)
widdowquinn/scripts
bioinformatics/restrict_long_contigs.py
Python
mit
7,563
../../../share/pyshared/FSM.py
Alberto-Beralix/Beralix
i386-squashfs-root/usr/lib/python2.7/dist-packages/FSM.py
Python
gpl-3.0
30
#!/usr/bin/env python """Toy Parser Generator is a lexical and syntactic parser generator for Python. This generator was born from a simple statement: YACC is too complex to use in simple cases (calculators, configuration files, small programming languages, ...). TPG can very simply write parsers that are usefull for most every day needs (even if it can't make your coffee). With a very clear and simple syntax, you can write an attributed grammar that is translated into a recursive descendant parser. TPG generated code is very closed to the original grammar. This means that the parser works "like" the grammar. A grammar rule can be seen as a method of the parser class, symbols as method calls, attributes as method parameters and semantic values as return values. You can also add Python code directly into grammar rules and build abstract syntax trees while parsing. """ # Toy Parser Generator: A Python parser generator # Copyright (C) 2001-2013 Christophe Delord # # This library is free software; you can redistribute it and/or # modify it under the terms of the GNU Lesser General Public # License as published by the Free Software Foundation; either # version 2.1 of the License, or (at your option) any later version. # # This library is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this library; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA # # For further information about TPG you can visit # http://cdsoft.fr/tpg # TODO: # - indent and dedent preprocessor # __tpgname__ = 'TPG' __version__ = '3.2.2' __date__ = '2013-12-29' __description__ = "A Python parser generator" __long_description__ = __doc__ __license__ = 'LGPL' __author__ = 'Christophe Delord' __email__ = 'cdsoft.fr' __url__ = 'http://cdsoft.fr/tpg/' import parser import re import sre_parse import sys # Python 2/3 compatibility __python__ = sys.version_info[0] if __python__ == 3: import collections callable = lambda value: isinstance(value, collections.Callable) exc = lambda: sys.exc_info()[1] if __python__ == 2: exc = lambda: sys.exc_value _id = lambda x: x tab = " "*4 class Error(Exception): """ Error((line, column), msg) Error is the base class for TPG exceptions. Attributes: line : line number from where the error has been raised column : column number from where the error has been raised msg : message associated to the error """ def __init__(self, line_column, msg): self.line, self.column = line_column self.msg = msg def __str__(self): return "%s at line %s, column %s: %s"%(self.__class__.__name__, self.line, self.column, self.msg) class WrongToken(Error): """ WrongToken() WrongToken is raised when the parser can not continue in order to backtrack. """ def __init__(self): Exception.__init__(self) class LexicalError(Error): """ LexicalError((line, column), msg) LexicalError is raised by lexers when a lexical error is encountered. Attributes: line : line number from where the error has been raised column : column number from where the error has been raised msg : message associated to the error """ pass class SyntacticError(Error): """ SyntacticError((line, column), msg) SyntacticError is raised by parsers when they fail. Attributes: line : line number from where the error has been raised column : column number from where the error has been raised msg : message associated to the error """ pass class SemanticError(Error): """ SemanticError(msg) SemanticError is raised by user actions when an error is detected. Attributes: msg : message associated to the error """ def __init__(self, msg): Exception.__init__(self) self.msg = msg def __str__(self): return "%s: %s"%(self.__class__.__name__, self.msg) class LexerOptions: """ LexerOptions(word_bounded, compile_options) LexerOptions is a base class for lexers holding lexers' options. Parameters: word_bounded : if True identifier like regular expressions are added word boundaries compile_options : options given to re.compile to compile regular expressions """ word_re = re.compile(r"^\w+$") def __init__(self, wb, compile_options): if not wb: self.word_bounded = self.not_word_bounded self.compile_options = compile_options def re_compile(self, expr): """ compile expr using self.compile_options as re.compile options """ return re.compile(expr, self.compile_options) def word_bounded(self, expr): """ add word boundaries (\\b) to expr if it looks like an identifier """ if self.word_re.match(expr): return r"\b%s\b"%expr else: return expr def not_word_bounded(self, expr): """ return expr without change. Used to replace word_bounded when wb is False """ return expr class NamedGroupLexer(LexerOptions): r""" NamedGroupLexer(word_bounded, compile_options) NamedGroupLexer is a TPG lexer: - use named group regular expressions (faster but limited to 100 tokens) Attributes: token_re : regular expression containing the whole lexer tokens : dictionnary name -> (value, is_real_token) name is a token name value is a function that compute the value of a token from its text is_real_token is a boleean. True for tokens, False for separators Once the lexer is started more attributes are defined: input : input string being parsed max_pos : maximum position reached in the input string last_token : last token reached in the input string pos : position in the input string of the current token line : line of the current token column : column of the current token cur_token : current token """ def __init__(self, wb, compile_options): LexerOptions.__init__(self, wb, compile_options) self.token_re = [] # [named_regexp] and then regexp self.tokens = {} # name -> value, is_real_token def def_token(self, name, expr, value=_id): """ add a new token to the lexer Parameters: name : name of the token expr : regular expression of the token value : function to compute the token value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the token. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens: self.token_re.append("(?P<%s>%s)"%(name, self.word_bounded(expr))) self.tokens[name] = value, True else: raise SemanticError("Duplicate token definition (%s)"%name) def def_separator(self, name, expr, value=_id): """ add a new separator to the lexer Parameters: name : name of the separator expr : regular expression of the separator value : function to compute the separator value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the separator. Note that separator values are ignored. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens: self.token_re.append("(?P<%s>%s)"%(name, self.word_bounded(expr))) self.tokens[name] = value, False else: raise SemanticError("Duplicate token definition (%s)"%name) def build(self): """ build the token_re attribute from the tokens and separators """ if isinstance(self.token_re, list): self.token_re = self.re_compile("|".join(self.token_re)) def start(self, input): """ start a lexical analysis Parameters: input : input string to be parsed """ self.input = input self.max_pos = 0 self.last_token = None self.build() self.back(None) self.next_token() def eof(self): """ True if the current position of the lexer is the end of the input string """ return self.pos >= len(self.input) and isinstance(self.cur_token, EOFToken) def back(self, token): """ change the current token to token (used for backtracking) """ if token is None: self.pos = 0 self.line, self.column = 1, 1 self.cur_token = None else: self.pos = token.stop self.line, self.column = token.end_line, token.end_column self.cur_token = token def next_token(self): """ return the next token Tokens are Token instances. Separators are ignored. """ if self.cur_token is None: prev_stop = 0 else: prev_stop = self.cur_token.stop while True: if self.pos >= len(self.input): self.cur_token = EOFToken(self.line, self.column, self.pos, prev_stop) return self.cur_token tok = self.token_re.match(self.input, self.pos) if tok: name = tok.lastgroup text = tok.group() value, real_token = self.tokens[name] try: value = value(text) except WrongToken: raise LexicalError((self.line, self.column), "Lexical error in %s"%text) start, stop = tok.span() self.pos = stop tok_line, tok_column = self.line, self.column if '\n' in text: self.line += text.count('\n') self.column = len(text) - text.rfind('\n') else: self.column += len(text) if real_token: self.cur_token = Token(name, text, value, tok_line, tok_column, self.line, self.column, start, stop, prev_stop) if self.pos > self.max_pos: self.max_pos = self.pos self.last_token = self.cur_token return self.cur_token else: w = 20 nl = self.input.find('\n', self.pos, self.pos+w) if nl > -1: err = self.input[self.pos:nl] else: err = self.input[self.pos:self.pos+w] raise LexicalError((self.line, self.column), "Lexical error near %s"%err) def token(self): """ return the current token """ return self.cur_token def extract(self, start, stop): """ extract text from the input string Parameters: start : token from which the extraction starts stop : token where the extraction stops """ return self.input[start.start:stop.prev_stop] class Lexer(NamedGroupLexer): r""" Lexer(word_bounded, compile_options) Lexer is a TPG lexer: - based on NamedGroupLexer - doesn't use named group regular expressions (slower but not limited to 100 tokens) - select the longuest match so the order of token definitions doesn't mater Attributes: tokens : list (name, regexp, value, is_real_token) name is a token name regexp is the regular expression of the token value is a function that computes the value of a token from its text is_real_token is a boleean. True for tokens, False for separators Once the lexer is started more attributes are defined: input : input string being parsed max_pos : maximum position reached in the input string last_token : last token reached in the input string pos : position in the input string of the current token line : line of the current token column : column of the current token cur_token : current token """ def __init__(self, wb, compile_options): LexerOptions.__init__(self, wb, compile_options) self.tokens = [] # [(name, regexp, value, is_real_token)] def def_token(self, name, expr, value=_id): """ adds a new token to the lexer Parameters: name : name of the token expr : regular expression of the token value : function to compute the token value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the token. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens: self.tokens.append((name, self.re_compile(self.word_bounded(expr)), value, True)) else: raise SemanticError("Duplicate token definition (%s)"%name) def def_separator(self, name, expr, value=_id): """ add a new separator to the lexer Parameters: name : name of the separator expr : regular expression of the separator value : function to compute the separator value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the separator. Note that separator values are ignored. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens: self.tokens.append((name, self.re_compile(self.word_bounded(expr)), value, False)) else: raise SemanticError("Duplicate token definition (%s)"%name) def start(self, input): """ start a lexical analysis Parameters: input : input string to be parsed """ self.input = input self.max_pos = 0 self.last_token = None self.back(None) self.next_token() def next_token(self): """ return the next token Tokens are Token instances. Separators are ignored. """ if self.cur_token is None: prev_stop = 0 else: prev_stop = self.cur_token.stop while True: if self.pos >= len(self.input): self.cur_token = EOFToken(self.line, self.column, self.pos, prev_stop) return self.cur_token tok = None text = "" for _name, _regexp, _value, _is_real_token in self.tokens: _tok = _regexp.match(self.input, self.pos) if _tok: _text = _tok.group() if len(_text) > len(text): tok = _tok name = _name text = _text value = _value real_token = _is_real_token if tok: try: value = value(text) except WrongToken: raise LexicalError((self.line, self.column), "Lexical error in %s"%text) start, stop = tok.span() self.pos = stop tok_line, tok_column = self.line, self.column if '\n' in text: self.line += text.count('\n') self.column = len(text) - text.rfind('\n') else: self.column += len(text) if real_token: self.cur_token = Token(name, text, value, tok_line, tok_column, self.line, self.column, start, stop, prev_stop) if self.pos > self.max_pos: self.max_pos = self.pos self.last_token = self.cur_token return self.cur_token else: w = 20 nl = self.input.find('\n', self.pos, self.pos+w) if nl > -1: err = self.input[self.pos:nl] else: err = self.input[self.pos:self.pos+w] raise LexicalError((self.line, self.column), "Lexical error near %s"%err) class CacheNamedGroupLexer(NamedGroupLexer): r""" CacheNamedGroupLexer(word_bounded, compile_options) CacheNamedGroupLexer is a TPG lexer: - based on NamedGroupLexer - the complete token list is built before parsing (faster with very ambigous grammars but needs more memory) Attributes: token_re : regular expression containing the whole lexer tokens : dictionnary name -> (value, is_real_token) name is a token name value is a function that computes the value of a token from its text is_real_token is a boleean. True for tokens, False for separators cache : token list Once the lexer is started more attributes are defined: input : input string being parsed max_pos : maximum position reached in the input string last_token : last token reached in the input string pos : position in the input string of the current token line : line of the current token column : column of the current token cur_token : current token """ def __init__(self, wb, compile_options): NamedGroupLexer.__init__(self, wb, compile_options) def start(self, input): """ start a lexical analysis Parameters: input : input string to be parsed """ self.cache = [] self.input = input self.max_pos = 0 self.last_token = None self.build() self.back(None) while True: token = NamedGroupLexer.next_token(self) token.index = len(self.cache) self.cache.append(token) if isinstance(token, EOFToken): break self.max_pos = 0 self.last_token = None self.back(None) self.next_token() def next_token(self): """ return the next token Tokens are Token instances. Separators are ignored. """ if self.cur_token is None: index = 0 else: index = self.cur_token.index+1 token = self.cache[index] self.pos = token.stop self.line, self.column = token.line, token.column self.cur_token = token if self.pos > self.max_pos: self.max_pos = self.pos self.last_token = self.cur_token return self.cur_token class CacheLexer(Lexer): r""" CacheLexer(word_bounded, compile_options) CacheLexer is a TPG lexer: - based on Lexer - doesn't use named group regular expressions (slower but not limited to 100 tokens) - select the longuest match so the order of token definitions doesn't mater - the complete token list is built before parsing (faster with very ambigous grammars but needs more memory) Attributes: tokens : list (name, regexp, value, is_real_token) name is a token name regexp is the regular expression of the token value is a function that computes the value of a token from its text is_real_token is a boleean. True for tokens, False for separators cache : token list Once the lexer is started more attributes are defined: input : input string being parsed max_pos : maximum position reached in the input string last_token : last token reached in the input string pos : position in the input string of the current token line : line of the current token column : column of the current token cur_token : current token """ def __init__(self, wb, compile_options): Lexer.__init__(self, wb, compile_options) def start(self, input): """ start a lexical analysis Parameters: input : input string to be parsed """ self.cache = [] self.input = input self.max_pos = 0 self.last_token = None self.back(None) while True: token = Lexer.next_token(self) token.index = len(self.cache) self.cache.append(token) if isinstance(token, EOFToken): break self.max_pos = 0 self.last_token = None self.back(None) self.next_token() def next_token(self): """ return the next token Tokens are Token instances. Separators are ignored. """ if self.cur_token is None: index = 0 else: index = self.cur_token.index+1 token = self.cache[index] self.pos = token.stop self.line, self.column = token.line, token.column self.cur_token = token if self.pos > self.max_pos: self.max_pos = self.pos self.last_token = self.cur_token return self.cur_token class ContextSensitiveLexer(LexerOptions): r""" ContextSensitiveLexer(word_bounded, compile_options) ContextSensitiveLexer is a TPG lexer: - context sensitive means that each regular expression is matched when required by the parser. Different tokens can be found at the same position if the parser uses different grammar rules. Attributes: tokens : dictionnary name -> (regexp, value) name is a token name regexp is the regular expression of the token value is a function that computes the value of a token from its text separators : list (name, regexp, value) name is a token name regexp is the regular expression of the token value is a function that computes the value of a token from its text Once the lexer is started more attributes are defined: input : input string being parsed max_pos : maximum position reached in the input string last_token : last token reached in the input string pos : position in the input string of the current token line : line of the current token column : column of the current token cur_token : current token """ def __init__(self, wb, compile_options): LexerOptions.__init__(self, wb, compile_options) self.tokens = {} # name -> (regexp, value) self.separators = [] # [(name, regexp, value)] def def_token(self, name, expr, value=_id): """ add a new token to the lexer Parameters: name : name of the token expr : regular expression of the token value : function to compute the token value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the token. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens and name not in self.separators: self.tokens[name] = self.re_compile(self.word_bounded(expr)), value else: raise SemanticError("Duplicate token definition (%s)"%name) def def_separator(self, name, expr, value=_id): """ add a new separator to the lexer Parameters: name : name of the separator expr : regular expression of the separator value : function to compute the separator value from its text The default for value is the identity function. If value is not callable it is returned whatever the text of the separator. Note that separator values are ignored. """ if not callable(value): value = lambda _, value=value: value if name not in self.tokens and name not in self.separators: self.separators.append((name, self.re_compile(self.word_bounded(expr)), value)) else: raise SemanticError("Duplicate token definition (%s)"%name) def start(self, input): """ start a lexical analysis Parameters: input : input string to be parsed """ self.input = input self.max_pos = 0 self.last_token = None self.back(None) def eof(self): """ True if the current position of the lexer is the end of the input string """ return self.pos >= len(self.input) def back(self, token): """ change the current token to token (used for backtracking) """ if token is None: self.pos = 0 self.line, self.column = 1, 1 self.cur_token = SOFToken() else: self.pos = token.stop self.line, self.column = token.end_line, token.end_column self.cur_token = token self.eat_separators() self.cur_token.next_start = self.pos def eat_separators(self): """ skip separators in the input string from the current position """ done = False while not done: done = True for name, regexp, value in self.separators: sep = regexp.match(self.input, self.pos) if sep: start, stop = sep.span() text = self.input[start:stop] value = value(text) self.pos = stop if '\n' in text: self.line += text.count('\n') self.column = len(text) - text.rfind('\n') else: self.column += len(text) done = False def eat(self, name): """ return the next token value if it matches the expected token name """ regexp, value = self.tokens[name] tok = regexp.match(self.input, self.pos) if tok is None: raise WrongToken else: if self.cur_token is None: prev_stop = 0 else: prev_stop = self.cur_token.stop start, stop = tok.span() text = self.input[start:stop] value = value(text) self.pos = stop tok_line, tok_column = self.line, self.column if '\n' in text: self.line += text.count('\n') self.column = len(text) - text.rfind('\n') else: self.column += len(text) self.cur_token = Token(name, text, value, tok_line, tok_column, self.line, self.column, start, stop, prev_stop) if self.pos > self.max_pos: self.max_pos = self.pos self.last_token = self.cur_token self.eat_separators() self.cur_token.next_start = self.pos return self.cur_token def token(self): """ return the current token """ return self.cur_token def extract(self, start, stop): """ extract text from the input string Parameters: start : the token from which the extraction starts stop : the token where the extraction stops """ start = start and start.next_start or 0 stop = stop and stop.stop or -1 return self.input[start:stop] class Token: """ Token(name, text, value, line, column, end_line, end_column, start, stop, prev_stop) Token object used by lexers Attributes: name : name of the token text : text matched by the regular expression value : value computed from the text line : line of the token in the input string column : column of the token in the input string end_line : line of the end of the token end_column : column of the end of the token start : position of the start in the input string of the token stop : position of the end in the input string of the token prev_stop : position of the end of the previous token """ def __init__(self, name, text, value, line, column, end_line, end_column, start, stop, prev_stop): self.name = name self.text = text self.value = value self.line, self.column = line, column self.end_line, self.end_column = end_line, end_column self.start, self.stop = start, stop self.prev_stop = prev_stop def match(self, name): """ return True is the token name is the name of the expected token Parameters: name : name of the expected token """ return name == self.name def __str__(self): return "line %s, column %s: %s %s %s"%(self.line, self.column, self.name, self.text, self.value) class EOFToken(Token): """ EOFToken(line, column, pos, prev_stop) Token for the end of file (end of the input string). EOFToken is a Token object. Attributes: name : name of the token text : text matched by the regular expression value : value computed from the text line : line of the token in the input string column : column of the token in the input string end_line : line of the end of the token end_column : column of the end of the token start : position of the start in the input string of the token stop : position of the end in the input string of the token prev_stop : position of the end of the previous token """ def __init__(self, line, column, pos, prev_stop): Token.__init__(self, "EOF", "EOF", None, line, column, line, column, pos, pos, prev_stop) class SOFToken(Token): """ SOFToken() Token for the start of file (start of the input string). SOFToken is a Token object. Attributes: name : name of the token text : text matched by the regular expression value : value computed from the text line : line of the token in the input string column : column of the token in the input string end_line : line of the end of the token end_column : column of the end of the token start : position of the start in the input string of the token stop : position of the end in the input string of the token prev_stop : position of the end of the previous token """ def __init__(self): Token.__init__(self, "SOF", "SOF", None, 1, 1, 1, 1, 0, 0, 0) class Py: def __init__(self, level=0): frame = sys._getframe(1+level) self.globals = frame.f_globals self.locals = frame.f_locals def __getitem__(self, item): return eval(item%self, self.globals, self.locals) class ParserMetaClass(type): """ ParserMetaClass is the metaclass of Parser objects. When a ParserMetaClass class is defined, its doc string should contain a grammar. This grammar is parsed by TPGParser and the generated code is added to the class. If the class doesn't have a doc string, nothing is generated """ def __init__(cls, name, bases, dict): super(ParserMetaClass, cls).__init__(name, bases, dict) try: grammar = dict['__doc__'] except KeyError: pass else: parser = TPGParser(sys._getframe(1).f_globals) for attribute, source, code in parser(grammar): setattr(cls, attribute, code) if __python__ == 3: exec("class _Parser(metaclass=ParserMetaClass): pass") else: class _Parser: __metaclass__ = ParserMetaClass class Parser(_Parser): # Parser is the base class for parsers. # # This class can not have a doc string otherwise it would be considered as a grammar. # The metaclass of this class is ParserMetaClass. # # Attributes: # lexer : lexer build from the grammar # # Methods added to the generated parsers: # init_lexer(self) : return a lexer object to scan the tokens defined by the grammar # <rule> : each rule is translated into a method with the same name def __init__(self): """ Parser is the base class for parsers. This class can not have a doc string otherwise it would be considered as a grammar. The metaclass of this class is ParserMetaClass. Attributes: lexer : lexer build from the grammar Methods added to the generated parsers: init_lexer(self) : return a lexer object to scan the tokens defined by the grammar <rule> : each rule is translated into a method with the same name """ self.lexer = self.init_lexer() def eat(self, name): """ eat the current token if it matches the expected token Parameters: name : name of the expected token """ token = self.lexer.token() if token.match(name): self.lexer.next_token() return token.value else: raise WrongToken def eatCSL(self, name): """ eat the current token if it matches the expected token This method replaces eat for context sensitive lexers. Parameters: name : name of the expected token """ token = self.lexer.eat(name) return token.value def __call__(self, input, *args, **kws): """ parse a string starting from the default axiom The default axiom is START. Parameters: input : input string to parse *args : argument list to pass to START **kws : argument dictionnary to pass to START """ return self.parse('START', input, *args, **kws) def parse(self, axiom, input, *args, **kws): """ parse a string starting from a given axiom Parameters: axiom : rule name where the parser starts input : input string to parse *args : argument list to pass to START **kws : argument dictionnary to pass to START """ try: self.lexer.start(input) if __python__ == 2 and isinstance(input, unicode): self.string_prefix = 'ur' else: self.string_prefix = 'r' value = getattr(self, axiom)(*args, **kws) if not self.lexer.eof(): raise WrongToken except WrongToken: if self.lexer.last_token is None: last_token = "" line, column = 1, 1 else: last_token = self.lexer.last_token.text line, column = self.lexer.last_token.line, self.lexer.last_token.column raise SyntacticError((line, column), "Syntax error near %s"%last_token) return value def line(self, token=None): """ return the line number of a token Parameters: token : token object. If None, the current token line is returned. """ if token is None: token = self.lexer.token() if token is None: return 1 return token.line def column(self, token=None): """ return the column number of a token Parameters: token : token object. If None, the current token column is returned. """ if token is None: token =self.lexer.token() if token is None: return 1 return token.column def mark(self): """ return the current token This can be used to get the line or column number of a token or to extract text between two tokens. """ return self.lexer.token() def extract(self, start, stop): """ return the text found between two tokens Parameters : start : token object as returned by mark stop : token object as returned by mark """ return self.lexer.extract(start, stop) def check(self, cond): """ check a condition and backtrack when it is False Parameters: cond : condition to be checked """ if not cond: raise WrongToken return cond def error(self, msg): """ stop the parser and raise a SemanticError exception Parameters: msg : error message to raise """ raise SemanticError(msg) class VerboseParser(Parser): # VerboseParser is the base class for debugging parsers. # # This class can not have a doc string otherwise it would be considered as a grammar. # The metaclass of this class is ParserMetaClass. # It extends the Parser class to log the activity of the lexer. # # Attributes: # lexer : lexer build from the grammar # verbose : level of information # 0 : no information # 1 : print tokens successfully matched # 2 : print tokens matched and not matched # # Methods added to the generated parsers: # init_lexer(self) : return a lexer object to scan the tokens defined by the grammar # <rule> : each rule is translated into a method with the same name verbose = 1 def __init__(self): """ VerboseParser is the base class for debugging parsers. This class can not have a doc string otherwise it would be considered as a grammar. The metaclass of this class is ParserMetaClass. It extends the Parser class to log the activity of the lexer. Attributes: lexer : lexer build from the grammar verbose : level of information 0 : no information 1 : print tokens successfully matched 2 : print tokens matched and not matched Methods added to the generated parsers: init_lexer(self) : return a lexer object to scan the tokens defined by the grammar <rule> : each rule is translated into a method with the same name """ Parser.__init__(self) self.eatcnt = 0 def eat(self, name): """ eat the current token if it matches the expected token Parameters: name : name of the expected token """ self.eatcnt += 1 token = self.lexer.token() try: value = Parser.eat(self, name) if self.verbose >= 1: #print(self.token_info(token, "==", name)) sys.stderr.write(self.token_info(token, "==", name)+"\n") return value except WrongToken: if self.verbose >= 2: #print(self.token_info(token, "!=", name)) sys.stderr.write(self.token_info(token, "!=", name)+"\n") raise def eatCSL(self, name): """ eat the current token if it matches the expected token This method replaces eat for context sensitive lexers. Parameters: name : name of the expected token """ self.eatcnt += 1 try: value = Parser.eatCSL(self, name) if self.verbose >= 1: token = self.lexer.token() #print(self.token_info(token, "==", name)) sys.stderr.write(self.token_info(token, "==", name)+"\n") return value except WrongToken: if self.verbose >= 2: token = Token("???", self.lexer.input[self.lexer.pos:self.lexer.pos+10].replace('\n', ' '), "???", self.lexer.line, self.lexer.column, self.lexer.line, self.lexer.column, self.lexer.pos, self.lexer.pos, self.lexer.pos) #print(self.token_info(token, "!=", name)) sys.stderr.write(self.token_info(token, "!=", name)+"\n") raise def parse(self, axiom, input, *args, **kws): """ parse a string starting from a given axiom Parameters: axiom : rule name where the parser starts input : input string to parse *args : argument list to pass to START **kws : argument dictionnary to pass to START """ self.axiom = axiom return Parser.parse(self, axiom, input, *args, **kws) def token_info(self, token, op, expected): """ return information about a token Parameters: token : token read by the lexer op : result of the comparison made by the lexer (== or !=) expected : name of the expected token """ eatcnt = self.eatcnt callernames = [] stackdepth = 0 name = None while name != self.axiom: stackdepth += 1 name = sys._getframe(stackdepth+1).f_code.co_name if len(callernames) < 10: callernames.insert(0, name) callernames = '.'.join(callernames) found = "(%d,%d) %s %s"%(token.line, token.column, token.name, token.text) return "[%3d][%2d]%s: %s %s %s"%(eatcnt, stackdepth, callernames, found, op, expected) blank_line_re = re.compile("^\s*$") indent_re = re.compile("^\s*") class tpg: """ This class contains some TPG classes to make the parsers usable inside and outside the tpg module """ NamedGroupLexer = NamedGroupLexer Lexer = Lexer CacheNamedGroupLexer = CacheNamedGroupLexer CacheLexer = CacheLexer ContextSensitiveLexer = ContextSensitiveLexer Parser = Parser WrongToken = WrongToken re = re class TPGParser(tpg.Parser): __grammar__ = r""" # This class parses TPG grammar # and generates the Python source and compiled code for the parser set lexer = NamedGroupLexer set lexer_verbose separator spaces '\s+' ; separator comment '\#.*' ; token string ''' "{3} [^"\\]* (?: (?: \\. | "(?!"") ) [^"\\]* )* "{3} | " [^"\\\n]* (?: \\. [^"\\\n]* )* " | '{3} [^'\\]* (?: (?: \\. | '(?!'') ) [^'\\]* )* '{3} | ' [^'\\\n]* (?: \\. [^'\\\n]* )* ' ''' ; token code ''' \{\{ ( \}? [^\}]+ )* \}\} | \$ [^\$\n]* \$ | \$ .*\n ( [ \t]* \$ .*\n )* ''' $ self.Code token ident '\w+' ; token lcbra '\{' ; token rcbra '\}' ; token star2 '\*\*' ; token star '\*' ; START/$self.gen(options, tokens, rules)$ -> OPTIONS/options TOKENS/tokens RULES/rules ; OPTIONS/options -> $ options = self.Options(self) ( 'set' ident/name ( '=' ident/value $ options.set(name, value) | $ options.set(name, 'True') ) )* ; TOKENS/ts -> $ ts = [] ( TOKEN/t $ ts.append(t) )* ; TOKEN/$token_type(name, self.string_prefix, expr, code)$ -> ( 'separator' $ token_type = self.DefSeparator | 'token' $ token_type = self.DefToken ) ident/name ':'? @t string/expr $ self.re_check(expr, t) ( PY_EXPR/code ';'? | ';' $ code = None ) ; RULES/rs -> $ rs = self.Rules() ( RULE/r $ rs.append(r) )* ; RULE/$self.Rule(head, body)$ -> HEAD/head '->' OR_EXPR/body ';' ; HEAD/$self.Symbol(name, args, ret)$ -> ident/name OPT_ARGS/args RET<$self.PY_Ident(name)$>/ret ; OR_EXPR/$self.balance(or_expr)$ -> AND_EXPR/a $ or_expr = [a] ( check $ not or_expr[-1].empty() $ '\|' AND_EXPR/a $ or_expr.append(a) )* ; AND_EXPR/$and_expr$ -> $ and_expr = self.And() ( ATOM_EXPR/a REP<a>/a $ and_expr.append(a) )* ; ATOM_EXPR/a -> SYMBOL/a | INLINE_TOKEN/a | @t code/a $ self.code_check(a, t) | '\(' OR_EXPR/a '\)' | 'check' PY_EXPR/cond $ a = self.Check(cond) | 'error' PY_EXPR/msg $ a = self.Error(msg) | '@' PY_EXPR/mark $ a = self.Mark(mark) ; REP<a>/a -> ( '\*' $ a = self.Rep(a, 0, None) | '\+' $ a = self.Rep(a, 1, None) | '\?' $ a = self.Rep(a, 0, 1) | '\{' ( PY_EXPR/min | $ min = self.PY_Ident("0") $ ) ( ',' ( PY_EXPR/max | $ max = self.PY_Ident("None") $ ) | $ max = min $ ) '\}' $ a = self.Rep(a, min, max) )? ; SYMBOL/$self.Symbol(name, args, ret)$ -> ident/name OPT_ARGS/args RET<$self.PY_Ident(name)$>/ret ; INLINE_TOKEN/$self.InlineToken(expr, ret)$ -> @t string/expr $ self.re_check(expr, t) RET/ret ; OPT_ARGS/args -> ARGS/args | $ args = self.Args() $ ; ARGS/args -> '<' $ args = self.Args() ( ARG/arg $ args.append(arg) ( ',' ARG/arg $ args.append(arg) )* ','? )? '>' ; ARG/a -> ident/name '=' PY_EXPR/a $ a = self.PY_KeywordArgument(name, a) | PY_EXPR/a $ a = self.PY_PositionArgument(a) | '\*' ident/name $ a = self.PY_PositionArgumentList(name) | '\*\*' ident/name $ a = self.PY_KeywordArgumentList(name) ; RET<ret=None>/ret -> ( '/' PY_EXPR/ret )? ; PY_EXPR/expr -> ident/name $ expr = self.PY_Ident(name) | string/st $ expr = self.PY_Ident(st) | code/expr | ARGS/expr ; """ def init_lexer(self): lexer = tpg.NamedGroupLexer(True, tpg.re.VERBOSE) lexer.def_token('_tok_1', r'set') lexer.def_token('_tok_2', r'=') lexer.def_token('_tok_3', r'separator') lexer.def_token('_tok_4', r'token') lexer.def_token('_tok_5', r':') lexer.def_token('_tok_6', r';') lexer.def_token('_tok_7', r'->') lexer.def_token('_tok_8', r'\|') lexer.def_token('_tok_9', r'\(') lexer.def_token('_tok_10', r'\)') lexer.def_token('_tok_11', r'check') lexer.def_token('_tok_12', r'error') lexer.def_token('_tok_13', r'@') lexer.def_token('_tok_14', r'\+') lexer.def_token('_tok_15', r'\?') lexer.def_token('_tok_16', r',') lexer.def_token('_tok_17', r'<') lexer.def_token('_tok_18', r'>') lexer.def_token('_tok_19', r'/') lexer.def_separator('spaces', r'\s+') lexer.def_separator('comment', r'\#.*') lexer.def_token('string', r''' "{3} [^"\\]* (?: (?: \\. | "(?!"") ) [^"\\]* )* "{3} | " [^"\\\n]* (?: \\. [^"\\\n]* )* " | '{3} [^'\\]* (?: (?: \\. | '(?!'') ) [^'\\]* )* '{3} | ' [^'\\\n]* (?: \\. [^'\\\n]* )* ' ''') lexer.def_token('code', r''' \{\{ ( \}? [^\}]+ )* \}\} | \$ [^\$\n]* \$ | \$ .*\n ( [ \t]* \$ .*\n )* ''', self.Code) lexer.def_token('ident', r'\w+') lexer.def_token('lcbra', r'\{') lexer.def_token('rcbra', r'\}') lexer.def_token('star2', r'\*\*') lexer.def_token('star', r'\*') return lexer def START(self, ): r""" ``START -> OPTIONS TOKENS RULES ;`` """ options = self.OPTIONS() tokens = self.TOKENS() rules = self.RULES() return self.gen(options, tokens, rules) def OPTIONS(self, ): r""" ``OPTIONS -> ('set' ident ('=' ident | ))* ;`` """ options = self.Options(self) while True: _p1 = self.lexer.token() try: self.eat('_tok_1') # 'set' name = self.eat('ident') _p2 = self.lexer.token() try: self.eat('_tok_2') # '=' value = self.eat('ident') options.set(name, value) except tpg.WrongToken: self.lexer.back(_p2) options.set(name, 'True') except tpg.WrongToken: self.lexer.back(_p1) break return options def TOKENS(self, ): r""" ``TOKENS -> (TOKEN)* ;`` """ ts = [] while True: _p1 = self.lexer.token() try: t = self.TOKEN() ts.append(t) except tpg.WrongToken: self.lexer.back(_p1) break return ts def TOKEN(self, ): r""" ``TOKEN -> ('separator' | 'token') ident ':'? string (PY_EXPR ';'? | ';') ;`` """ _p1 = self.lexer.token() try: self.eat('_tok_3') # 'separator' token_type = self.DefSeparator except tpg.WrongToken: self.lexer.back(_p1) self.eat('_tok_4') # 'token' token_type = self.DefToken name = self.eat('ident') _p2 = self.lexer.token() try: self.eat('_tok_5') # ':' except tpg.WrongToken: self.lexer.back(_p2) t = self.mark() expr = self.eat('string') self.re_check(expr, t) _p3 = self.lexer.token() try: code = self.PY_EXPR() _p4 = self.lexer.token() try: self.eat('_tok_6') # ';' except tpg.WrongToken: self.lexer.back(_p4) except tpg.WrongToken: self.lexer.back(_p3) self.eat('_tok_6') # ';' code = None return token_type(name, self.string_prefix, expr, code) def RULES(self, ): r""" ``RULES -> (RULE)* ;`` """ rs = self.Rules() while True: _p1 = self.lexer.token() try: r = self.RULE() rs.append(r) except tpg.WrongToken: self.lexer.back(_p1) break return rs def RULE(self, ): r""" ``RULE -> HEAD '->' OR_EXPR ';' ;`` """ head = self.HEAD() self.eat('_tok_7') # '->' body = self.OR_EXPR() self.eat('_tok_6') # ';' return self.Rule(head, body) def HEAD(self, ): r""" ``HEAD -> ident OPT_ARGS RET ;`` """ name = self.eat('ident') args = self.OPT_ARGS() ret = self.RET(self.PY_Ident(name)) return self.Symbol(name, args, ret) def OR_EXPR(self, ): r""" ``OR_EXPR -> AND_EXPR ('\|' AND_EXPR)* ;`` """ a = self.AND_EXPR() or_expr = [a] while True: _p1 = self.lexer.token() try: self.check(not or_expr[-1].empty()) self.eat('_tok_8') # '\|' a = self.AND_EXPR() or_expr.append(a) except tpg.WrongToken: self.lexer.back(_p1) break return self.balance(or_expr) def AND_EXPR(self, ): r""" ``AND_EXPR -> (ATOM_EXPR REP)* ;`` """ and_expr = self.And() while True: _p1 = self.lexer.token() try: a = self.ATOM_EXPR() a = self.REP(a) and_expr.append(a) except tpg.WrongToken: self.lexer.back(_p1) break return and_expr def ATOM_EXPR(self, ): r""" ``ATOM_EXPR -> SYMBOL | INLINE_TOKEN | code | '\(' OR_EXPR '\)' | 'check' PY_EXPR | 'error' PY_EXPR | '@' PY_EXPR ;`` """ _p1 = self.lexer.token() try: try: a = self.SYMBOL() except tpg.WrongToken: self.lexer.back(_p1) try: a = self.INLINE_TOKEN() except tpg.WrongToken: self.lexer.back(_p1) t = self.mark() a = self.eat('code') self.code_check(a, t) except tpg.WrongToken: self.lexer.back(_p1) try: try: self.eat('_tok_9') # '\(' a = self.OR_EXPR() self.eat('_tok_10') # '\)' except tpg.WrongToken: self.lexer.back(_p1) self.eat('_tok_11') # 'check' cond = self.PY_EXPR() a = self.Check(cond) except tpg.WrongToken: self.lexer.back(_p1) try: self.eat('_tok_12') # 'error' msg = self.PY_EXPR() a = self.Error(msg) except tpg.WrongToken: self.lexer.back(_p1) self.eat('_tok_13') # '@' mark = self.PY_EXPR() a = self.Mark(mark) return a def REP(self, a): r""" ``REP -> ('\*' | '\+' | '\?' | '\{' (PY_EXPR | ) (',' (PY_EXPR | ) | ) '\}')? ;`` """ _p1 = self.lexer.token() try: try: try: self.eat('star') # '\*' a = self.Rep(a, 0, None) except tpg.WrongToken: self.lexer.back(_p1) self.eat('_tok_14') # '\+' a = self.Rep(a, 1, None) except tpg.WrongToken: self.lexer.back(_p1) try: self.eat('_tok_15') # '\?' a = self.Rep(a, 0, 1) except tpg.WrongToken: self.lexer.back(_p1) self.eat('lcbra') # '\{' _p2 = self.lexer.token() try: min = self.PY_EXPR() except tpg.WrongToken: self.lexer.back(_p2) min = self.PY_Ident("0") _p3 = self.lexer.token() try: self.eat('_tok_16') # ',' _p4 = self.lexer.token() try: max = self.PY_EXPR() except tpg.WrongToken: self.lexer.back(_p4) max = self.PY_Ident("None") except tpg.WrongToken: self.lexer.back(_p3) max = min self.eat('rcbra') # '\}' a = self.Rep(a, min, max) except tpg.WrongToken: self.lexer.back(_p1) return a def SYMBOL(self, ): r""" ``SYMBOL -> ident OPT_ARGS RET ;`` """ name = self.eat('ident') args = self.OPT_ARGS() ret = self.RET(self.PY_Ident(name)) return self.Symbol(name, args, ret) def INLINE_TOKEN(self, ): r""" ``INLINE_TOKEN -> string RET ;`` """ t = self.mark() expr = self.eat('string') self.re_check(expr, t) ret = self.RET() return self.InlineToken(expr, ret) def OPT_ARGS(self, ): r""" ``OPT_ARGS -> ARGS | ;`` """ _p1 = self.lexer.token() try: args = self.ARGS() except tpg.WrongToken: self.lexer.back(_p1) args = self.Args() return args def ARGS(self, ): r""" ``ARGS -> '<' (ARG (',' ARG)* ','?)? '>' ;`` """ self.eat('_tok_17') # '<' args = self.Args() _p1 = self.lexer.token() try: arg = self.ARG() args.append(arg) while True: _p2 = self.lexer.token() try: self.eat('_tok_16') # ',' arg = self.ARG() args.append(arg) except tpg.WrongToken: self.lexer.back(_p2) break _p3 = self.lexer.token() try: self.eat('_tok_16') # ',' except tpg.WrongToken: self.lexer.back(_p3) except tpg.WrongToken: self.lexer.back(_p1) self.eat('_tok_18') # '>' return args def ARG(self, ): r""" ``ARG -> ident '=' PY_EXPR | PY_EXPR | '\*' ident | '\*\*' ident ;`` """ _p1 = self.lexer.token() try: try: name = self.eat('ident') self.eat('_tok_2') # '=' a = self.PY_EXPR() a = self.PY_KeywordArgument(name, a) except tpg.WrongToken: self.lexer.back(_p1) a = self.PY_EXPR() a = self.PY_PositionArgument(a) except tpg.WrongToken: self.lexer.back(_p1) try: self.eat('star') # '\*' name = self.eat('ident') a = self.PY_PositionArgumentList(name) except tpg.WrongToken: self.lexer.back(_p1) self.eat('star2') # '\*\*' name = self.eat('ident') a = self.PY_KeywordArgumentList(name) return a def RET(self, ret=None): r""" ``RET -> ('/' PY_EXPR)? ;`` """ _p1 = self.lexer.token() try: self.eat('_tok_19') # '/' ret = self.PY_EXPR() except tpg.WrongToken: self.lexer.back(_p1) return ret def PY_EXPR(self, ): r""" ``PY_EXPR -> ident | string | code | ARGS ;`` """ _p1 = self.lexer.token() try: try: name = self.eat('ident') expr = self.PY_Ident(name) except tpg.WrongToken: self.lexer.back(_p1) st = self.eat('string') expr = self.PY_Ident(st) except tpg.WrongToken: self.lexer.back(_p1) try: expr = self.eat('code') except tpg.WrongToken: self.lexer.back(_p1) expr = self.ARGS() return expr def __init__(self, _globals=None): Parser.__init__(self) if _globals is not None: self.env = _globals else: self.env = {} def __call__(self, input, *args, **kws): """ parse a string starting from the default axiom The default axiom is START. Parameters: input : input string to parse *args : argument list to pass to START **kws : argument dictionnary to pass to START If a line ends with '::', it is considered as the end of the ReST part. The lines after are the grammar. """ docs = re.split(r"::[ \t]*$", input, maxsplit=1, flags=re.M) if len(docs) == 2: input = re.sub(".", " ", docs[0])+docs[1] return self.parse('START', input, *args, **kws) def re_check(self, expr, tok): try: sre_parse.parse(eval(self.string_prefix+expr)) except Exception: raise LexicalError((tok.line, tok.column), "Invalid regular expression: %s (%s)"%(expr, exc())) def code_check(self, code, tok): try: parser.suite(code.code) except Exception: erroneous_code = "\n".join([ "%2d: %s"%(i+1, l) for (i, l) in enumerate(code.code.splitlines()) ]) raise LexicalError((tok.line, tok.column), "Invalid Python code (%s): \n%s"%(exc, erroneous_code)) class Options: option_dict = { # Option name Accepted values Default value 'lexer': ({'NamedGroupLexer': NamedGroupLexer, 'Lexer': Lexer, 'CacheNamedGroupLexer': CacheNamedGroupLexer, 'CacheLexer': CacheLexer, 'ContextSensitiveLexer': ContextSensitiveLexer, }, 'NamedGroupLexer'), 'word_boundary': ({'True': True, 'False': False}, 'True'), #'indent': ({'True': True, 'False': False}, 'False'), 'lexer_ignorecase': ({'True': "IGNORECASE", 'False': False}, 'False'), 'lexer_locale': ({'True': "LOCALE", 'False': False}, 'False'), 'lexer_multiline': ({'True': "MULTILINE", 'False': False}, 'False'), 'lexer_dotall': ({'True': "DOTALL", 'False': False}, 'False'), 'lexer_verbose': ({'True': "VERBOSE", 'False': False}, 'False'), 'lexer_unicode': ({'True': "UNICODE", 'False': False}, 'False'), } def __init__(self, parser): self.parser = parser for name, (values, default) in TPGParser.Options.option_dict.items(): self.set(name, default) def set(self, name, value): try: options, default = TPGParser.Options.option_dict[name] except KeyError: opts = TPGParser.Options.option_dict.keys() self.parser.error("Unknown option (%s). Valid options are %s"%(name, ', '.join(sorted(opts)))) try: value = options[value] except KeyError: values = options.keys() self.parser.error("Unknown value (%s). Valid values for %s are %s"%(value, name, ', '.join(sorted(values)))) setattr(self, name, value) def lexer_compile_options(self): options = [ self.lexer_ignorecase, self.lexer_locale, self.lexer_multiline, self.lexer_dotall, self.lexer_verbose, self.lexer_unicode, ] return "+".join([ "tpg.re.%s"%opt for opt in options if opt ]) or 0 class Empty: def empty(self): return True class NotEmpty: def empty(self): return False class Code(NotEmpty): def __init__(self, code): if code.startswith('$'): if code.endswith('$'): lines = code[1:-1].splitlines() else: lines = [line.split('$', 1)[1] for line in code.splitlines()] elif code.startswith('{{') and code.endswith('}}'): lines = code[2:-2].splitlines() else: raise WrongToken while lines and blank_line_re.match(lines[0]): lines.pop(0) while lines and blank_line_re.match(lines[-1]): lines.pop(-1) if lines: indents = [len(indent_re.match(line).group(0)) for line in lines] indent = indents[0] if min(indents) < indent: # Indentation incorrecte raise WrongToken lines = [line[indent:] for line in lines] self.code = "".join([line+"\n" for line in lines]) def get_inline_tokens(self): return yield None def gen_code(self, indent=None, counters=None, pos=None): if indent is None: return self.code.strip() else: return [indent+line for line in self.code.splitlines()] def links_symbols_to_tokens(self, tokens): pass def gen_doc(self, parent): return "" class DefToken: def_method = "def_token" def __init__(self, name, string_prefix, expr, code=None): self.name = name self.string_prefix = string_prefix self.expr = expr if code is not None and code.gen_code().count('\n') > 1: raise WrongToken self.code = code def gen_def(self): expr = self.expr if self.code is None: return "lexer.%s('%s', %s%s)"%(self.def_method, self.name, self.string_prefix, expr) else: code = self.code.gen_code().strip() return "lexer.%s('%s', %s%s, %s)"%(self.def_method, self.name, self.string_prefix, expr, code) class DefSeparator(DefToken): def_method = "def_separator" class Rules(list): def get_inline_tokens(self): for rule in self: for token in rule.get_inline_tokens(): yield token def links_symbols_to_tokens(self, tokens): for rule in self: rule.links_symbols_to_tokens(tokens) def gen_code(self): for rule in self: yield rule.gen_code() class Rule: class Counters(dict): def __call__(self, name): n = self.get(name, 1) self[name] = n+1 return "_%s%s"%(name, n) def __init__(self, head, body): self.head = head self.body = body def get_inline_tokens(self): for token in self.body.get_inline_tokens(): yield token def links_symbols_to_tokens(self, tokens): if self.head.name in tokens: raise SemanticError("%s is both a token and a symbol"%self.head.name) else: self.body.links_symbols_to_tokens(tokens) def gen_code(self): counters = self.Counters() return self.head.name, [ self.head.gen_def(), tab + 'r""" ``%s -> %s ;`` """'%(self.head.gen_doc(self), self.body.gen_doc(self)), self.head.gen_init_ret(tab), self.body.gen_code(tab, counters, None), self.head.gen_ret(tab), ] class Symbol(NotEmpty): def __init__(self, name, args, ret): self.name = name self.args = args self.ret = ret def get_inline_tokens(self): return yield None def links_symbols_to_tokens(self, tokens): self.token = tokens.get(self.name, None) if self.token is not None and self.args: raise SemanticError("Token %s can not have arguments"%self.name) def gen_def(self): return "def %s(self, %s):"%(self.name, self.args.gen_code()) def gen_init_ret(self, indent): return self.ret.gen_code() == self.name and indent + "%s = None"%(self.name) or () def gen_ret(self, indent): return self.ret and indent + "return %s"%self.ret.gen_code() or () def gen_code(self, indent, counters, pos): if self.token is not None: if self.ret is not None: return indent + "%s = self.eat('%s')"%(self.ret.gen_code(), self.token.name) else: return indent + "self.eat('%s')"%(self.token.name) else: if self.ret is not None: return indent + "%s = self.%s(%s)"%(self.ret.gen_code(), self.name, self.args.gen_code()) else: return indent + "self.%s(%s)"%(self.name, self.args.gen_code()) def gen_doc(self, parent): return self.name class InlineToken(NotEmpty): def __init__(self, expr, ret): self.expr = expr self.ret = ret def get_inline_tokens(self): yield self def set_explicit_token(self, token): self.explicit_token = token def gen_def(self): return self.explicit_token.gen_def() def links_symbols_to_tokens(self, tokens): pass def gen_code(self, indent, counters, pos): if self.ret is not None: return indent + "%s = self.eat('%s') # %s"%(self.ret.gen_code(), self.explicit_token.name, self.expr) else: return indent + "self.eat('%s') # %s"%(self.explicit_token.name, self.expr) def gen_doc(self, parent): return self.expr class Args(list): def gen_code(self): return ", ".join([a.gen_code() for a in self]) class PY_PositionArgument: def __init__(self, arg): self.arg = arg def gen_code(self): return self.arg.gen_code() class PY_KeywordArgument: def __init__(self, name, arg): self.name = name self.arg = arg def gen_code(self): return "%s=%s"%(self.name, self.arg.gen_code()) class PY_PositionArgumentList: def __init__(self, name): self.name = name def gen_code(self): return "*%s"%self.name class PY_KeywordArgumentList: def __init__(self, name): self.name = name def gen_code(self): return "**%s"%self.name class And(list): def empty(self): for a in self: if not a.empty(): return False return True def get_inline_tokens(self): for a in self: for token in a.get_inline_tokens(): yield token def links_symbols_to_tokens(self, tokens): for a in self: a.links_symbols_to_tokens(tokens) def gen_code(self, indent, counters, pos): return self and [ self[0].gen_code(indent, counters, pos), [a.gen_code(indent, counters, None) for a in self[1:]], ] def gen_doc(self, parent): docs = [] for a in self: doc = a.gen_doc(self) if doc: docs.append(doc) return " ".join(docs) class Or(NotEmpty): def __init__(self, a, b): self.a = a self.b = b def get_inline_tokens(self): for token in self.a.get_inline_tokens(): yield token for token in self.b.get_inline_tokens(): yield token def links_symbols_to_tokens(self, tokens): self.a.links_symbols_to_tokens(tokens) self.b.links_symbols_to_tokens(tokens) def gen_code(self, indent, counters, pos): p = pos or counters("p") return [ pos is None and indent + "%s = self.lexer.token()"%p or (), indent + "try:", self.a.gen_code(indent+tab, counters, p), indent + "except tpg.WrongToken:", indent + tab + "self.lexer.back(%s)"%p, self.b.gen_code(indent+tab, counters, p), ] def gen_doc(self, parent): doc = "%s | %s"%(self.a.gen_doc(self), self.b.gen_doc(self)) if isinstance(parent, TPGParser.And) and len(parent) > 1: doc = "(%s)"%doc return doc def balance(self, xs): if len(xs) == 1: return xs[0] else: m = len(xs)//2 return self.Or(self.balance(xs[:m]), self.balance(xs[m:])) class Rep(NotEmpty): def __init__(self, a, min, max): self.a = a self.min = min self.max = max def get_inline_tokens(self): for token in self.a.get_inline_tokens(): yield token def links_symbols_to_tokens(self, tokens): self.a.links_symbols_to_tokens(tokens) def gen_code(self, indent, counters, pos): # A? if (self.min, self.max) == (0, 1): p = pos or counters("p") return [ pos is None and indent + "%s = self.lexer.token()"%p or (), indent + "try:", self.a.gen_code(indent+tab, counters, p), indent + "except tpg.WrongToken:", indent + tab + "self.lexer.back(%s)"%p, ] # A* elif (self.min, self.max) == (0, None): p = pos or counters("p") return [ indent + "while True:", indent + tab + "%s = self.lexer.token()"%p, indent + tab + "try:", self.a.gen_code(indent+tab+tab, counters, p), indent + tab + "except tpg.WrongToken:", indent + tab + tab + "self.lexer.back(%s)"%p, indent + tab + tab + "break", ] # A+ elif (self.min, self.max) == (1, None): p = pos or counters("p") n = counters("n") return [ indent + "%s = 0"%n, indent + "while True:", indent + tab + "%s = self.lexer.token()"%p, indent + tab + "try:", self.a.gen_code(indent+tab+tab, counters, p), indent + tab + tab + "%s += 1"%n, indent + tab + "except tpg.WrongToken:", indent + tab + tab + "if %s < 1: raise"%n, indent + tab + tab + "self.lexer.back(%s)"%p, indent + tab + tab + "break", ] # A{min, max} else: p = pos or counters("p") n = counters("n") min = self.min.gen_code() max = self.max.gen_code() return [ indent + "%s = 0"%n, indent + "while %s:"%(max=="None" and "True" or "%s < %s"%(n, max)), indent + tab + "%s = self.lexer.token()"%p, indent + tab + "try:", self.a.gen_code(indent+tab+tab, counters, p), indent + tab + tab + "%s += 1"%n, indent + tab + "except tpg.WrongToken:", indent + tab + tab + "if %s < %s: raise"%(n, min), indent + tab + tab + "self.lexer.back(%s)"%p, indent + tab + tab + "break", ] def gen_doc(self, parent): doc = self.a.gen_doc(self) if isinstance(self.a, (TPGParser.And, TPGParser.Or)): doc = "(%s)"%doc if (self.min, self.max) == (0, 1): rep = "?" elif (self.min, self.max) == (0, None): rep = "*" elif (self.min, self.max) == (1, None): rep = "+" else: min = self.min.gen_code() max = self.max.gen_code() if min == max: rep = "{%s}"%min else: if min == "0": min = "" if max == "None": max = "" rep = "{%s,%s}"%(min, max) return "%s%s"%(doc, rep) class Check(NotEmpty): def __init__(self, cond): self.cond = cond def get_inline_tokens(self): return yield None def links_symbols_to_tokens(self, tokens): pass def gen_doc(self, parent): return "" def gen_code(self, indent, counters, pos): return indent + "self.check(%s)"%self.cond.gen_code() class Error(NotEmpty): def __init__(self, msg): self.msg = msg def get_inline_tokens(self): return yield None def links_symbols_to_tokens(self, tokens): pass def gen_doc(self, parent): return "" def gen_code(self, indent, counters, pos): return indent + "self.error(%s)"%self.msg.gen_code() class Mark(NotEmpty): def __init__(self, mark): self.mark = mark def get_inline_tokens(self): return yield None def links_symbols_to_tokens(self, tokens): pass def gen_doc(self, parent): return "" def gen_code(self, indent, counters, pos): return indent + "%s = self.mark()"%self.mark.gen_code() class PY_Ident(str): def gen_code(self): return str(self) def flatten_nl(self, *lines): for sublines in lines: if isinstance(sublines, (list, tuple)): for line in self.flatten_nl(*sublines): yield line else: yield sublines + "\n" def make_code(self, attribute, *source): source = "".join(self.flatten_nl(*source)) local_namespace = {} exec(source, self.env, local_namespace) code = local_namespace[attribute] return attribute, source, code def gen(self, options, tokens, rules): # building the lexer lexer = options.lexer word_bounded = options.word_boundary lexer_options = options.lexer_compile_options() explicit_tokens = {} for token in tokens: explicit_tokens[token.expr[1:-1]] = token token_number = 0 inline_tokens = [] for token in rules.get_inline_tokens(): try: # If the token was already defined just link it to the first definition token.set_explicit_token(explicit_tokens[token.expr[1:-1]]) except KeyError: # Otherwise create an explicit definition for the new inline token token_number += 1 token.set_explicit_token(self.DefToken("_tok_%s"%token_number, self.string_prefix, token.expr)) explicit_tokens[token.expr[1:-1]] = token.explicit_token inline_tokens.append(token) yield self.make_code("init_lexer", "def init_lexer(self):", lexer is ContextSensitiveLexer and [tab + "self.eat = self.eatCSL"] or (), tab + "lexer = tpg.%s(%s, %s)"%(lexer.__name__, word_bounded, lexer_options), [ tab + tok.gen_def() for tok in inline_tokens ], [ tab + tok.gen_def() for tok in tokens ], tab + "return lexer", ) # building the parser tokens_from_name = {} for token in inline_tokens: tokens_from_name[token.explicit_token.name] = token for token in tokens: tokens_from_name[token.name] = token rules.links_symbols_to_tokens(tokens_from_name) for name, code in rules.gen_code(): yield self.make_code(name, *code)
alanqthomas/seawolf-lang
tpg.py
Python
gpl-3.0
81,869