text
stringlengths
38
1.54M
import _webiopi.GPIO import time GPIO = _webiopi.GPIO # GPIO, status, time data = [[num, 0, 0.0] for num in [17, 27, 22]] for n in data: print(n[0], n[1], n[2]) GPIO.setFunction(n[0], GPIO.IN) while True: for n in data: status = GPIO.digitalRead(n[0]) if n[1] == 0 and status: ...
# -*- coding: utf-8 -*- '''Low-level interface to libopus.''' from __future__ import unicode_literals, absolute_import __all__ = [ 'strerror', 'get_version_string', 'encoder_get_size', 'encoder_create', 'encoder_init', 'encode', 'encode_float', 'encode...
import simpleaudio from time import sleep class Instrument: def __init__(self, inst, octaves=[i for i in range(8)]) -> None: self.type = inst self.octaves = octaves self.notes = {} self.playing = {} notes = ['A', 'B', 'C', 'D', 'E', 'F', 'G'] for o in octav...
import argparse sample_dataset = ( "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" ) sample_output = "20 12 17 21" def count_nucleotides(dna_string): nucleotides = ["A", "C", "G", "T"] counts = [str(dna_string.count(nucleotide)) for nucleotide in nucleotides] return " ".join(...
#!/usr/bin/env python # -*- coding: utf-8 -*- # petla4.py def main(args): start = int(input("pobierz tą liczbę 1 helpppppp: ")) stop = int(input("podaj liczbę 2: ")) while start >= stop: print("za mała druga liczba: ") stop = int(input("pobierz ponownie drugą liczbę: ")) if...
# -*- coding: utf-8 -*- import trademarks.algorithm def metricOfWords(pattern, word, vFine = 50.0, cFine = 5.0): u''' @version: Version 1.1 from 16.04.2014 @author: Alex Kuzmin @return: double, the distance between input words u''' if pattern == u"" or word == "": return -1...
# -*- coding: utf-8 -*- """ Created on Wed Nov 7 18:42:57 2018 @author: Meron """ import pandas as pd import numpy as np import matplotlib.pyplot as plt from sklearn.cross_decomposition import PLSRegression import sklearn.datasets from sklearn.exceptions import NotFittedError from sklearn.linear_model i...
#!/usr/bin/python import itertools import sys __version__ = "1.0" # ------------------------------------------------------------- def generate_anagram(word): """ Generate all possible combination of the given string/word provided as parameter. @type word: [str] @rtype: [str] """ return_list = [...
import os import sys import re import requests """ For test run: python my_dl https://www.youtube.com/watch?v=wb0n-6LiXNc """ def qualtiy_show(vid_link): """shows all formats available to download :param vid_link: link of the youtube video :return: None """ try: print(os.s...
from experiment_test_base import ExperimentTestCase from pages.homepage import Homepage from test_utils import generate_timestamp import os from test_utils import * class TestEnsemble(ExperimentTestCase): def test_ensemble_SDM(self): homepage = Homepage(self.driver) login_page = homepage.click_lo...
import urllib import json langs = {'en': 'English', 'sv': 'Swedish', 'nl': 'Dutch', 'de': 'German', 'fr': 'French', 'war': 'Waray-Waray', 'ru': 'Russian', 'ceb': 'Cebuano', 'it': 'Italian', 'es': 'Spanish' } lang_codes = sorted(langs.ke...
""" This file defines the base agent class. """ import abc import copy import time from gps.agent.config import AGENT from gps.proto.gps_pb2 import ACTION from gps.sample.sample_list import SampleList class Agent(object): """ Agent superclass. The agent interacts with the environment to collect samples. ...
import time from datetime import datetime from django.http import Http404, HttpResponse from django.conf import settings from google.appengine.runtime import DeadlineExceededError from app.models import (Activity, Message, Vote, Thread, Role, Game, Profile, VoteSummary, role_vanillager) from ap...
def entity_tagging(nlp,txt): import re """This function will do the entity tagging and replace the characters and entities with proper names""" txt=txt.decode('utf8') doc=nlp(txt) txt="" for ent in doc: if len(ent.ent_type_)==0: txt=txt+ent.text+" " elif ent.text.uppe...
import paho.mqtt.client as mqtt import time import json import socket import yaml from datetime import datetime import shutil import sys import threading class communication: def start(self,config): raise NotImplementedError('users must define start(configuration) to use this base class') def s...
for i in range(1,8): print (i) # range l = ["Sujan",2,4,5] for item in l: print(item) else: print("Done") # for with else
import random import os import esp import gc import network import time from machine import unique_id, Pin, Signal try: import ubinascii as binascii except: import binascii try: import usocket as socket except: import socket try: import ure as re except: import re try: import ujson as js...
# -*- coding: utf-8 -*- """ Created on Fri Feb 12 13:31:36 2021 @author: LocalAdmin """ import pyvisa import time import numpy as np class MagnetSupply(pyvisa.resources.GPIBInstrument): """ This is a child class of the pyvisa GPIB instrument class. it contains a series of methods and functons to connect ...
#Import the modules import requests import json # Get the feed r = requests.get("http://gdata.youtube.com/feeds/api/standardfeeds/top_rated?v=2&alt=jsonc") r.text # Convert it to a Python dictionary data = json.loads(r.text) # Loop through the result. for item in data['data']['items']: print "Video Title: %s" %...
"""Defines the greylist table. """ from sqlalchemy import * from sqlalchemy.orm import * from spamfilter.model import meta greylist_table = Table( 'greylist', meta, Column('id', Integer, Sequence('greylist_id_seq'), primary_key=True), Column('classc', String(11), nullable=False), Column('mail_from', S...
from Crypto.PublicKey import RSA from Crypto.Cipher import PKCS1_OAEP from Crypto.Signature import PKCS1_v1_5 from Crypto.Hash import SHA256 from Crypto import Random from base64 import b64encode, b64decode from Crypto.Cipher import AES def genNonce(): return RNG.new().read(AES.block_size) def genKey(...
# # __ _,--="=--,_ __ # / \." .-. "./ \ # / ,/ _ : : _ \/` \ # \ `| /o\ :_: /o\ |\__/ # `-'| :="~` _ `~"=: | # \` (_) `/ # .-"-. \ | / .-"-. # .-----{ }--| /,.-'-.,\ |--{ ...
# Intorduction to Programming # Author: Shane Gilsenan # Date: 8/29/17 def main(): print("Hello, instructor!") print ("Good-Bye!) main()
#!/usr/bin/python import rospy # import pickle import message_filters from sensor_msgs.msg import Joy, Image from nav_msgs.msg import Odometry from viewer import Viewer_class from detect_obj import Detect_class from timeit import default_timer as timer coco_class = [ 'BG', 'person', 'bicycle', 'car', 'motorcycl...
# -*-coding:Utf-8 -* from threading import Thread import re import requests import urllib.request import os from bs4 import BeautifulSoup class ScrapCategory(Thread): """Thread used to get all books data in one category and create the correspondent csv file""" def __init__(self, url_list, category_name, tar...
import cv2 face_cascade = cv2.CascadeClassifier(r"haarcascade_frontalface_default.xml") eye_cascade = cv2.CascadeClassifier(r"haarcascade_eye_tree_eyeglasses.xml") cap = cv2.VideoCapture(0) #To capture video from webcam. while True: _, img = cap.read() #Read the frame gray = cv2.cvtColor(img,...
# encoding: utf-8 class Solution: def removeElement(self, nums, val): """ :type nums: List[int] :type val: int :rtype: int """ left = 0 right = len(nums) - 1 while left <= right: if nums[right] == val: right -= 1 ...
# import openpyxl module import openpyxl # Call a Workbook() function of openpyxl # to create a new blank Workbook object wb = openpyxl.Workbook() # Get workbook active sheet # from the active attribute. sheet = wb.active # writing to the cell of an excel sheet sheet['A1'] = 'SAMPLE CALCULATION...
# Soltn of t-dependent Sch Eqt fro HO with animation from visual import * dx = 0.04; dx2 = dx*dx; k0 = 5.5*pi; dt = dx2/20.0; xmax = 6.0 xs = arange(-xmax,xmax+dx/2,dx) g = display(width=500, height=250, title='Wave packet in HO Well') PlotObj = curve(x=xs, color=color.yellow, radius=0.1) ...
import datetime import json import time from flask import request, jsonify from app import app from . import client from .. import db from ..lib.tencent_api import search_face from ..models import Teacher, Course, StuCourse, Student @client.after_request def cors(environ): environ.headers['Access-Control-Allow-...
#!/usr/bin/python -S """Unit test utils for experiment.py.""" import logging import os import shutil import tempfile import experiment logger = logging.getLogger(__name__) def enable(name): """Enable an experiment. For unit tests only.""" open(os.path.join(experiment.EXPERIMENTS_TMP_DIR, name + '.available')...
from Include.work_json import remember_data, get_remember_data # pach_file_train_dataset = "data/traindataset.json" pach_file_remember = "data/memory.json" def remember_data_write(pach_file_remember = pach_file_remember, **kwargs): del kwargs['arr_text_input'][0] str = kwargs['arr_text_input'][0] + ' ' + kw...
from django.db import models from django.urls import reverse from django.utils.translation import pgettext_lazy from mptt.managers import TreeManager from mptt.models import MPTTModel from versatileimagefield.fields import VersatileImageField from saleor.core.permissions import MODELS_PERMISSIONS from saleor.seo.mod...
"""empty message Revision ID: a2aeb71e3351 Revises: Create Date: 2020-08-15 19:07:35.552634 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = 'a2aeb71e3351' down_revision = None branch_labels = None depends_on = None def upgrade(): # ### commands auto gene...
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Wed Jul 29 22:39:29 2020 @author: simransetia This program is used to calculate the network parameters of all the merged networks. """ import networkx as nx from union_graph import Hu,Huw from union_graph1 import Hud,H1 from xlwt import Workbook import num...
from django.urls import path,re_path from . import views app_name = 'cme' urlpatterns = [ path('', views.index, name='index'), path('<slug:urlshortOrganization>/events/', views.events, name='events'), path('events/<slug:urlshortEvents>', views.event_sessions, name='event_sessions'), path('event_Evalua...
# Laba lists numlist=[1, 2, 3, 4, 5, 6, 7] print (numlist) numlist.append("Python") print (numlist) print(numlist[0]) print(numlist[len(numlist)-1]) print(numlist[1:4]) print(numlist[1:4]) print(len (numlist)) print(numlist.index(6)) numlist.remove('Python') #Laba Dictionaries catalog_weather = { "city": "Moscow", "...
from django.db import models from product.models import Product # Create your models here. class Bug(models.Model): Product = models.ForeignKey('product.Product',on_delete = models.CASCADE,null = True) bugname = models.CharField('Bug名称',max_length = 64)#bug名称 bugdetail = models.CharField('Bug详情',max_length...
# To add a new cell, type '# %%' # To add a new markdown cell, type '# %% [markdown]' # %% import math import random # creating a base plater classs class Player: # self is a parameter used to access the current instance of the class, passing itself. def __init__(self, letter): # letter is either x or ...
import asyncio import pytest import time from promise import Promise @pytest.mark.asyncio @asyncio.coroutine def test_await(): yield from Promise.resolve(True) @pytest.mark.asyncio @asyncio.coroutine def test_await_time(): def resolve_or_reject(resolve, reject): time.sleep(.1) resolve(True) ...
# Generated by Django 3.0.5 on 2020-04-16 21:33 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('contact_form', '0001_initial'), ] operations = [ migrations.AlterField( model_name='contactrequest', name='message',...
import pandas as pd train=pd.read_csv('train.csv',index_col=0) test=pd.read_csv('test.csv',index_col=0) #print(train['Attrition'].value_counts()) # 处理Attrition字段 train['Attrition']=train['Attrition'].map(lambda x:1 if x=='Yes' else 0) from sklearn.preprocessing import LabelEncoder # 查看数据是否有空值 #print(train.isn...
import sys epgService = '/ds/epg/service.asmx' server = 'ivsmedia.iptv-distribution.net' ContentService = '/ContentService.svc/soap' sid = '/ClientService.svc/soap' siteId = '5' appName = 'XBMC Plugin (' + sys.platform + ')' streamService = '/ds/cas/streams/generic/stream.a...
# -*- coding: utf-8 -*- """ Created on Tue Nov 03 11:50:01 2015 @author: Yang """ import pandas as pd stock_data=pd.read_csv('D:/Wind/data/000001.SZ.marketDay.csv',parse_dates=[9]) stock_data.sort('TIME', inplace=True) print stock_data ma_list = [5, 20, 60] for ma in ma_list: stock_data['MA_' + str(ma)] = pd.roll...
ASSET_FIELDS = ("author_payout_scr_value", "author_payout_sp_value", "beneficiary_payout_scr_value", "beneficiary_payout_sp_value", "curator_payout_scr_value", "curator_payout_sp_value", "from_children_payout_scr_value", ...
# -*- coding: utf-8 -*- import codecs # Extract ehownet Specific domain terms! class Extract: def __init__(self): self.ehownet = codecs.open('resultSimple.csv', 'r', encoding = 'utf-8') self.location_set = set() self.location = ["世界", "省", "區", "市", "國都", "縣", "縣", "居民區", "鄉", "ChinaTown", "大陸", "非洲", "美洲", "亞洲"...
# -*- coding: utf-8 -*- ############################################################################### # Copyright (c), The AiiDA-CP2K authors. # # SPDX-License-Identifier: MIT # # AiiDA-CP2K is hosted on GitHub at https://github.com/c...
numbers = range(1,50) print ("'y' is odd numbers and 'x' is even numbers") x = [n for n in numbers if n%2 != 0] y = [n for n in numbers if n%2 == 0] print("y =", y) print("x =", x)
import numpy as np import pandas as pd from tensorflow import keras # from sklearn.externals import joblib import joblib class PrintDot(keras.callbacks.Callback): def on_epoch_end(self, epoch, logs): if epoch % 100 == 0: print('') print('.', end='') class Model(object): def __init__(self): ...
# francois auxietre conversion analogique en python 3 pour la lecture d'un anémometre # pip install pyserial # The anemometer is designed to output voltage between 0.4V and 2V. # A value of 0.4V represents no wind and 2V represents a wind speed of 32.4 m/s. # The relationship between voltage and wind speed is linear,...
# -*- coding: utf-8 -*- """ Created on Fri Nov 10 13:15:28 2017 @author: Saicharan.S """ import pandas as pd df = pd.DataFrame({'id':[1,2,3], 'fare':[13, 15.7, 25]}) type(df) df.shape df.info() df['fare'] df.iloc[0:2]
import unittest from zserio.bitfield import (getBitFieldLowerBound, getBitFieldUpperBound, getSignedBitFieldLowerBound, getSignedBitFieldUpperBound) from zserio.exception import PythonRuntimeException class BitFieldTest(unittest.TestCase): def testGetBitFieldLowerBound(self): ...
#!/usr/bin/env python # coding: utf-8 # # Práctica 1 Vectorización # ## Calculo de integrales mediante el metodo de Monte Carlo # Importamos las librerias que nos harán falta: # + matplotlib para hacer gráficas <br> # + numpy para generar números aleatorios y operaciones con arrays <br> # + time para calcular el tiem...
import pytest from oidcendpoint.endpoint_context import EndpointContext from oidcendpoint.user_authn.authn_context import INTERNETPROTOCOLPASSWORD from oidcmsg.key_jar import init_key_jar from oidcop.cookie import CookieDealer KEYDEFS = [ {"type": "RSA", "key": '', "use": ["sig"]}, {"type": "EC", "crv": "P-25...
#!/usr/bin/env python3 """ MIT License Copyright (c) 2020 Paul G Crumley Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy,...
#-*- coding:utf-8; mode:python; indent-tabs-mode: nil; c-basic-offset: 2; tab-width: 2 -*- from bes.system.log import logger from .string_lexer import string_lexer, string_lexer_options class string_list_parser(object): _log = logger('string_list_parser') def __init__(self, options = 0): self._options = o...
from sklearn import linear_model from sklearn import datasets from sklearn.preprocessing import PolynomialFeatures import numpy as np import pandas as pd import csv import matplotlib.pyplot as plt import pylab import random ''' algorithms laplace ''' train_data_Y = [ x**2 + random.randrange(-2,2) for x in range(-10,...
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2017-07-14 06:29 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Version',...
from turbofats.Base import Base from turbofats import lomb import numpy as np class PeriodLS_v2(Base): def __init__(self, shared_data, ofac=6.0): super().__init__(shared_data) self.Data = ['magnitude', 'time', 'error'] self.ofac = ofac def fit(self, data): magnitude = data[0] ...
#!/usr/bin/env python #coding:utf-8 # Author: LPP --<lpp1985@hotmail.com> # Purpose: # Created: 2011/4/19 import multiprocessing from lpp import * all_file = glob.glob( '*.corr' ) def check( e_f ): RAW = fasta_check(open( e_f,'rU' ) ) cache_hash = {} for t,s in RAW: cache_hash[ t[1:-1].split( )[0] ] = '' EN...
__author__ = 'tamar' class Crowdmap(object): def __init__(self, init_list): self.list = init_list self.location_service = LocationService() def get_all_posts_for(self, name): return [post for post in self.list if post.find(name) != -1] def is_location_for_name(self, name): name_posts = self.get_all_posts_...
from __future__ import absolute_import import logging from eth_utils import ( pad_right, ) from evm.constants import ( BLOCK_REWARD, NEPHEW_REWARD, UNCLE_DEPTH_PENALTY_FACTOR, ) from evm.exceptions import ( ValidationError, ) from evm.logic.invalid import ( InvalidOpcode, ) from evm.state imp...
from keras.layers import Input, Dense from keras.models import Model import numpy as np from keras.layers import LSTM, TimeDistributed, Activation from keras.optimizers import RMSprop from keras.preprocessing import sequence from keras.utils import to_categorical from keras.callbacks import Callback from keras.callback...
import csv import string from multiprocessing.pool import ThreadPool from requests.exceptions import ConnectTimeout, ConnectionError, ProxyError from settings import * from utils.utils import * class CrawlError(Exception): ... def crawl(writer, page=1): print(f'Starting fetch Page {page}') callback_st...
def matchtyper(li): import json import collections as cl data = cl.OrderedDict() data[li[0]] = li[1] ys = cl.OrderedDict() d = ys[li[0]] = data return d #もしjsonファイルに書き出す場合。↓の処理 #fw = open('test.json','w') #json.dump(ys,fw,indent=4) if __name__ == '__main__': li = ["Kodai",[1...
class Solution: def combinationSum(self, candidates, target): """ :type candidates: List[int] :type target: int :rtype: List[List[int]] """ res, tmp = [], [] self.collector_combination(candidates, target, tmp, res) return res def collector_combina...
#!/Users/hanzhang/Documents/GitHub/learning_log_django/ll_env/bin/python3 from django.core import management if __name__ == "__main__": management.execute_from_command_line()
from a10sdk.common.A10BaseClass import A10BaseClass class Partition(A10BaseClass): """Class Description:: Create/unload a Network partition. Class partition supports CRUD Operations and inherits from `common/A10BaseClass`. This class is the `"PARENT"` class for this module.` :param partitio...
import requests import json with open('token.json', 'r') as file: data = json.load(file) TOKEN = data[0]['token'] class Group: def __init__(self, id): self.id = id def get_params(self): return { 'group_id': self.id, 'fields': 'members_count', 'acces...
''' 145 is a curious number, as 1! + 4! + 5! = 1 + 24 + 120 = 145. Find the sum of all numbers which are equal to the sum of the factorial of their digits. Note: as 1! = 1 and 2! = 2 are not sums they are not included. ''' from _functools import reduce from time import time def is_curious(num,pro_dict): tmp=num ...
import os import sys import uuid import configuration import json import pandas as pd from forecaster.forecaster_factory import ForecasterFactory from forecaster.datamanager import DataManager from argparse import ArgumentParser """ This module loads and ARIMA model and outputs a forecast. """ class Predict(): ...
#!/usr/bin/python import difflib import sys try: textfile1=sys.argv[1] textfile2=sys.argv[2] except Exception,e: print "Error:"+str(e) print "Usage: simple3.py filename1 filename2" sys.exit() def readfile(filename): #文件读取分隔函数 try: fileHandle = open (filename, 'rb' ) text=f...
import cv2 import matplotlib.pyplot as plt import numpy as np def display_img(img, cmap=None): fig = plt.figure(figsize=(12, 6)) ax = fig.add_subplot(111) ax.imshow(img, cmap) # Open and display the giraffes.jpg img = cv2.imread('../DATA/giraffes.jpg') img_color_rgb = cv2.cvtColor(img, cv2.COLOR_BGR2RGB...
# Example 1: Using negative indexing my_list = ['a', 'b', 'c', 'd', 'e', 'f'] # print the last element print(my_list[-1])
class FoxAndClassroom: def ableTo(self, n, m): s, i, j = set(), 0, 0 while (i, j) not in s: s.add((i, j)) i, j = (i+1)%n, (j+1)%m return 'Possible' if len(s) == n*m else 'Impossible'
import requests import math from pyquaternion import Quaternion as quat url = "https://t-solvies.herokuapp.com/fetch.php" req = requests.get(url) tri = req.text.split("|") ''' signx = -1 switchx = False signy = -1 switchy = False signz = -1 switchz = False ax = [] ay = [] az = [] gx = [] gy = [] gz = [] for i in...
__author__ = 'Kamil Koziara & Taiyeb Zahir' import cProfile import numpy from utils import generate_pop, HexGrid, draw_hex_grid from stops_ import Stops2 secretion = numpy.array([0, 5]) reception = numpy.array([3, 4]) receptors = numpy.array([-1,-1]) bound=numpy.array([1,1,1,1,1,1]) base1=numpy.array([0,0,1,0,0,0])...
import serial import sys import time import serial.tools.list_ports serPort = "" totalPorts = 0 count = 0 eggComPort = "" eggCount = 0 eggNotFound = True while eggNotFound: # Find Live Ports ports = list(serial.tools.list_ports.comports()) totalPorts = len(ports) print "there are " + str(totalPorts)...
import itertools import numpy as np import copy as cp from collections import OrderedDict import matplotlib.pyplot as plt import topology INF = 9999 NODECNT = 0 avBranch = [[0, 2], [0, 3], [1, 2], [1, 3]] avBranch2 = [[0, 3], [0, 4], [0, 5], [1, 3], [1, 4], [1, 5], [2, 3], [2, 4], [2, 5]] def f_undire...
# -*- coding: utf-8 -*- import logging from zope.publisher.browser import BrowserView # from operator import attrgetter # from plone import api logger = logging.getLogger('bebest') class bebestPageView(BrowserView): def __init__(self, context, request): self.context = context self.request = req...
# Wykonaj funkcję dodawania obu macierzy zapisanych wcześniej do zmiennych a i b. import zadanie_5 import zadanie_6 print(zadanie_5.a + zadanie_6.b)
import numpy as np # numpy - manipulate the packet data returned by depthai import cv2 # opencv - display the video stream import depthai # access the camera and its data packets import consts.resource_paths # load paths to depthai resources import os device = depthai.Device("", False) # Create the pipeline using...
from mpi4py import MPI comm = MPI.COMM_WORLD sendmsg = [comm.rank]*3 right = (comm.rank + 1) % comm.size left = (comm.rank - 1) % comm.size req1 = comm.isend(sendmsg, dest=right) req2 = comm.isend(sendmsg, dest=left) lmsg = comm.recv(source=left) rmsg = comm.recv(source=right) MPI.Request.waitall([req1, req2]) asse...
import requests import json def connect(number, token): s = requests.Session() s.headers['authorization'] = 'Bearer ' + token parameters = {'rows': '50'} h = s.get('https://edge.qiwi.com/payment-history/v1/persons/' + number + '/payments', params=parameters) req = json.loads(h.text) return req...
import time import datetime import ephem import random #GPIO.setmode(GPIO.BOARD) #GPIO.setup(10, GPIO.OUT) # make sure "off_minutes" has a value off_minutes = 1 while 1: print('in the loop') now = datetime.datetime.now() now_hours = time.localtime(time.time())[3] now_minutes = time.localtime(time.time())[4] #...
#!/usr/bin/python3 # -*- coding: utf-8 -*- """ generate_alignments.py: Code used for creating alignments for mammalian genomes, which will be used for developing consensus sequence score thresholds and for the Hood-Price adjudication project. Contains variety of util functions for: - separating consensus sequences in...
from tensorflow_io.bigquery import BigQueryClient from tensorflow_io.bigquery import BigQueryReadSession import tensorflow as tf from tensorflow.python.framework import dtypes from tensorflow import feature_column import os training_data_uri = os.environ["AIP_TRAINING_DATA_URI"] validation_data_uri = os.environ["AIP_V...
import os import threading import time import urllib2 import socket ##### import Helper ##### class ForgePacket(threading.Thread): def __init__(self, url, packetHeaders): threading.Thread.__init__(self) self.url = url self.packetHeaders = packetHeaders self.disconnectionError = False self.exception = Fal...
# Generated by Django 3.2.6 on 2021-08-28 17:37 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('ecom', '0032_hijab_treasure'), ] operations = [ migrations.AlterField( model_name='hijab', name='category', ...
import functools from tensorflow import keras import numpy as np IMAGE_SHAPE = (48, 48, 1) TRAIN_SIZE = 28709 VALIDATION_SIZE = 3589 TEST_SIZE = 3589 CLASSES = 7 RANDOM_ROTATION_CONFIG = { 'rotation_range': 30, # Random rotations from -30 deg to 30 deg 'width_shift_range': 0.1, 'height_shift_range'...
import csv import pandas as pd import numpy as np import natsort import os import moviepy from moviepy.editor import VideoFileClip from skimage.measure import compare_ssim as ssim from scipy import spatial import subprocess from PIL import Image #USE this command in TERMINAL TO REMOVE .DS_Store file ''' import glob, ...
# -*- coding: utf-8 -*- ################################################################################# # Author : Acespritech Solutions Pvt. Ltd. (<www.acespritech.com>) # Copyright(c): 2012-Present Acespritech Solutions Pvt. Ltd. # All Rights Reserved. # # This program is copyright property of the author menti...
# -*- coding: utf-8 -*- """ Created on Thu Aug 29 10:53:05 2019 @author: Minimol """ #Using the keys(), values(), and items() methods, a for loop can iterate over the keys, values, #or key-value pairs in a dictionary, respectively. spam = {'color': 'red', 'age': 42 , 'size' : 'big' , 'efficiency' : 'high'} print()...
from django.contrib import admin from .models import Post, PostCategories from django import forms from django.db import models class PostAdmin(admin.ModelAdmin): list_display = ('title', 'slug', 'status','created') list_filter = ("status",) search_fields = ['title', 'content'] prepopulated_fields = ...
def pattern_search_multiple(data_series, pattern_width, threshold): data_series_length = len(data_series) # suppose pattern width is 4, we can't find the pattern in the data_series # if lenght of data_series is less than 9 (due to given conditions). if data_series_length < 2 * pattern_width + 1: ...
# -*- coding: utf-8 -*- from __future__ import unicode_literals from random import randint from flask import url_for from jinja2 import Markup from wtforms.widgets import Input, HTMLString class CaptchaWidget(object): def __call__(self, field, **kwargs): rand = randint(0, 0xffffffff) html = HTM...
from django.db import models class MainMenu(models.Model): name = models.CharField(max_length=50, null=True) class Meta: db_table='main_menus' class ProductCategory(models.Model): menu = models.ForeignKey('MainMenu', on_delete=models.CASCADE, null=True) name = models.CharField(max_length=50, ...
# Copyright (c) 2020, NVIDIA CORPORATION. All rights reserved. # # NVIDIA CORPORATION and its licensors retain all intellectual property # and proprietary rights in and to this software, related documentation # and any modifications thereto. Any use, reproduction, disclosure or # distribution of this software and rel...
from contactos import views from django.conf.urls import patterns, url urlpatterns = patterns('', url(r'^$', views.index, name='index') )
# -*- coding: utf-8 -*- import pytest """ Test paste 1 ligne : contenu + délai Test paste 1 cellule : contenu + délai Test affichage URL 1 ligne dans NB : récupération output ? Test affichage URL 1 cellule dans NB : idem ? Test get (avec une URL de test forever ?) """ import requests import dpaste_magic def test_...