text
stringlengths
38
1.54M
import aocread import numpy as np box_strings = aocread.read_file('input03') class Box: def __init__(self, id, left, top, width, height): self.id = int(id) - 1 self.left = int(left) self.top = int(top) self.width = int(width) self.height = int(height) self.right = self.left + self.width - 1 self.bottom = self.top + self.height - 1 def parse(box_string): id = box_string.split('@')[0].strip().lstrip('#') origin = box_string.split('@')[1].split(':')[0].strip() dimension = box_string.split('@')[1].split(':')[1].strip() left = origin.split(',')[0] top = origin.split(',')[1] width = dimension.split('x')[0] height = dimension.split('x')[1] return Box(id, left, top, width, height) boxes = [] for box_string in box_strings: box = parse(box_string) boxes.append(box) num_boxes = len(boxes) overlaps = [0] * num_boxes def is_overlap(boxa, boxb): if boxa.left > boxb.right: return False if boxa.right < boxb.left: return False if boxa.top > boxb.bottom: return False if boxa.bottom < boxb.top: return False return True for boxa in xrange(num_boxes): for boxb in xrange(boxa + 1, num_boxes): if is_overlap(boxes[boxa], boxes[boxb]): overlaps[boxa] += 1 overlaps[boxb] += 1 for x in xrange(num_boxes): if overlaps[x] == 0: print(x + 1) break
# -*- coding: utf-8 -*- """ Created on Mon Mar 9 2015 @author: Oliver Lemke """ import numpy as np import numpy.matlib as M from numpy.matlib import rand,zeros,ones,empty,eye import time import sys import argparse import pickle import os # Define ismember function def ismember(a, b): bi = {} for i, el in enumerate(b): if el not in bi: bi[el] = i return [bi.get(itm, -1) for itm in a] # Read Input from command line with options try: parser=argparse.ArgumentParser() parser.add_argument('-Cut', '--Cutoff', type=float, help='Cutoff criterion (R)') parser.add_argument('-Sim', '--Similarity', type=int, help='Criterion of similarity (N)') parser.add_argument('-In', '--Input', type=str, help='Input: distance matrix (default=dist.npy)', default='dist.npy') parser.add_argument('-Nl', '--Clustersize', type=int, help='Minimal Clustersize (M)(default=2)', default=2) parser.add_argument('-Out', '--Output', type=str, help='Output: Summary-file (default=Summary.txt)', default='Summary.txt') parser.add_argument('-Clf', '--Clusterfile', type=str, help='Output: Cluster-file (.p-file) (default=Cluster.p)', default='Cluster.p') parser.add_argument('-Csf', '--Clustersizefile', type=str, help='Output: Clustersize-file (.p-file) (default=Clustersize.p)', default='Clustersize.p' ) parser.add_argument('-Spt', '--Softwarepath', type=str, help='Input: Software path (default=.)', default='.' ) parser.add_argument('-Screen', '--Screen', type=str, help='Clustering Screen (YES or NO) (default=NO)', default='NO' ) parser.add_argument('-Ntr', '--NumberTra', type=int, help='Number of trajectories (replica) (default=1)', default=1) args=parser.parse_args() except: print ('Error: False number or type of input arguments') sys.exit(1) Algo='CNN' Var='Yes' try: Auto = str(args.Screen) except: print ('Error: Auto missing or type of Auto incorrect') sys.exit(1) try: Ntr = int(args.NumberTra) except: print ('Error: Similatiry criterion missing or type of similarity criterion incorrect') sys.exit(1) try: rc = float(args.Cutoff) except: print ('Error: Cutoff missing or type of cutoff incorrect') sys.exit(1) try: nnnc = int(args.Similarity) except: print ('Error: Similatiry criterion missing or type of similarity criterion incorrect') sys.exit(1) # Check for errors if Auto!='YES' and Auto!='NO': print ('Error: Choice of Auto mode incorrect') sys.exit(1) if Ntr <= 0: print ('Error: Number of trajectories must be at least 1') sys.exit(1) if rc <=0: print ('Error: Definition of the cutoff incorrect') sys.exit(1) if nnnc <= 0: print ('Error: Definition of the nnnc incorrect') sys.exit(1) try: Nl=int(args.Clustersize) except: print ('Error: Clustersize number must be an integer') path=str(os.path.dirname(os.path.realpath(__file__))) # Run cluster algorithm try: exec(open(path+'/Algorithms_large/CNN_yes.py').read()) except: print ('Error: Algorithm-file not found or no distance matrix found') sys.exit(1) Software=str(args.Softwarepath) print ('Clustering finished') # Stop clustering time II ende=time.clock() # Time calculation timet=ende-start #timepp=endepp-startpp timel=endel-startl #timecp=timet+timepp timetot=timet+timel print ('Time for the clustering process: %.2f s' %(timet)) # Determine number of clusters and clustersize Cs=np.zeros((2,N)) for a in range(0,N): Ca=Clust[a] if np.int_(np.shape(Ca)) > 1: Cs[0,a]=np.int_(np.shape(Ca)) Cs[1,a]=a (a1,Nc)=np.int_(np.shape(np.nonzero(Cs[0]))) Cmax=np.int_(np.max(Cs[0])) Ncl= np.count_nonzero(np.extract(Cs[0,:]>=Nl,Cs)) # Percentage of the largest cluster Pc=float(Cmax)/float(N) # Determine number of noise points Nn=float(N)-np.sum(Cs[0,:]) Pcn= 1-(np.sum(Cs[0,:])/float(N)) # Print Outcome Ab='Parameters: rc = %.2f, nnnc = %d' %(rc, nnnc) #print Ab print ('%d Cluster(s) found' %(Nc)) print ('%d Cluster(s) found that have at least %d Members' %(Ncl, Nl)) print ('Largest cluster found: %d (Percentage: %.2f)' %(Cmax, Pc)) print ('Number of datapoints declared as noise: %d (Percentage: %.2f)' %(Nn, Pcn)) # Write output-files summsave=str(args.Output) Clf=str(args.Clusterfile) Csf=str(args.Clustersizefile) pickle.dump(Clust, open(Clf, 'wb')) # Clusterlist pickle.dump(Cs, open(Csf, 'wb')) # Clustersize output=open(summsave,'w') output.write('Summary:\n\n') output.write('**********************\n\n') output.write('Settings:\n\n') output.write('Algorithm used: %s\n' %(Algo)) if Algo=='CNN' or Algo=='JP': output.write('Special criterium: %s\n' %(Var)) output.write('Number of datapoints %d\n' %(N)) output.write('%s\n\n' %(Ab)) output.write('**********************\n\n') output.write('Results:\n\n') output.write('Time for the loading of the distance matrix: %.2f s\n' %(timel)) output.write('Time for the clustering process: %.2f s\n' %(timet)) output.write('Total time: %.2f s\n' %(timetot)) output.write('%d Cluster(s) found\n' %(Nc)) output.write('%d Cluster(s) found that have at least %d Members\n' %(Ncl, Nl)) output.write('largest cluster found: %d (Percentage: %.2f)\n' %(Cmax, Pc)) output.write('Number of datapoints declared as noise: %d (Percentage: %.2f)\n\n' %(Nn, Pcn)) output.write('**********************\n\n') output.close() output=open('02_Isolate.sh','w') output.write('#!/bin/bash \n') output.write('\n') output.write('# Input \n') output.write('\n') output.write('Path=. \n') output.write('Software=%s \n' %Software) output.write('Input=${Path} \n') output.write('Output=${Path} \n') output.write('\n') output.write('Inc=%s \n' %Clf) output.write('Ins=%s \n' %Csf) output.write('Nci=%d \n' %Ncl) output.write('Out=frames.ndx \n') output.write('\n') output.write('Plo=NO \n') output.write('Ind=%s \n' %distload) output.write('\n') output.write('# Execution') output.write('\n') output.write('python ${Software}/02_Isolate_cluster.py -Inc ${Input}/${Inc} -Ins ${Input}/${Ins} -Nci ${Nci} -Out ${Output}/${Out} -Plo ${Plo} -Ind ${Ind}') output.close() output=open('04_Merge_all.sh','w') output.write('#!/bin/bash \n') output.write('\n') output.write('# Input \n') output.write('\n') output.write('Path=. \n') output.write('Software=%s \n' %Software) output.write('Input=${Path} \n') if Auto == "YES": output.write('Input2=${Path}/../../.. \n') if Auto == "NO": output.write('Input2=${Path} \n') output.write('Output=${Path} \n') output.write('\n') output.write('Cut=%.6f \n' %rc) output.write('Sim=%d \n' %nnnc) output.write('Nc=%d \n' %Ncl) output.write('\n') output.write('Fra=frames.ndx\n') output.write('\n') output.write('# Execution\n') output.write('\n') output.write('for i in {0..%d}\n' %(Ntr-1)) output.write('do\n') output.write('\tOut=Trace_${i}.npy\n') output.write('\tMap=dist_comp${i}.npy\n') output.write('\tpython ${Software}/04_Merge.py -Nc ${Nc} -Cut ${Cut} -Sim ${Sim} -Fra ${Input}/${Fra} -Map ${Input2}/${Map} -Out ${Output}/${Out}\n') output.write('done') output.close() output=open('04_Distmat.sh','w') output.write('#!/bin/bash \n') output.write('\n') output.write('# Input \n') output.write('\n') output.write('Path=. \n') output.write('Software=%s \n' %Software) output.write('Input=${Path} \n') if Auto == "YES": output.write('Input2=${Path}/../../.. \n') if Auto == "NO": output.write('Input2=${Path} \n') output.write('Output=${Path} \n') output.write('\n') output.write('Inc=%s \n' %Clf) output.write('Ins=%s \n' %Csf) output.write('Nci=1 \n') output.write('\n') output.write('Ind=dist.npy \n') output.write('\n') output.write('Out=dist \n') output.write('\n') output.write('# Execution') output.write('\n') output.write('python ${Software}/04_Isolate_distmat.py -Inc ${Input}/${Inc} -Ins ${Input}/${Ins} -Nci ${Nci} -Ind ${Input2}/${Ind} -Out ${Output}/${Out} \n') output.close() output=open('02_Translate.sh','w') output.write('#!/bin/bash \n') output.write('\n') output.write('# Input \n') output.write('\n') output.write('Path=. \n') output.write('Software=%s \n' %Software) output.write('Input=${Path} \n') output.write('Input2=${Path} \n') output.write('Output=${Path} \n') output.write('\n') output.write('Fra= # Otimized Cluster\n') output.write('Inf= # Name of new frame-File \n') output.write('Inr=frames.ndx \n') output.write('\n') output.write('Out= # Name of translated File \n') output.write('\n') output.write('# Execution') output.write('\n') output.write('python ${Software}/02_Translate_Hierarchical.py -Fra ${Fra} -Inf ${Input}/${Inf} -Inr ${Input2}/${Inr} -Out ${Output}/${Out}\n') output.close() output=open('03_Evaluate_2D.sh','w') output.write('#!/bin/bash \n') output.write('\n') output.write('# Input \n') output.write('\n') output.write('Path=. \n') output.write('Software=%s \n' %Software) output.write('Input=${Path} \n') if Auto == "YES": output.write('Input2=${Path}/../../.. \n') if Auto == "NO": output.write('Input2=${Path} \n') output.write('Output=${Path} \n') output.write('\n') output.write('Inf=frames.ndx \n') output.write('Ref=reduced_data.npy \n') output.write('\n') output.write('Fig=Scatter.png \n') output.write('Cln=50 \n') output.write('\n') output.write('# Execution') output.write('\n') output.write('python ${Software}/03_Evaluate_cluster_2D.py -Inf ${Input}/${Inf} -Ref ${Input2}/${Ref} -Fig ${Output}/${Fig} -Cln ${Cln}\n') output.close() print ('Output-files written')
from django.contrib import admin from django.core.urlresolvers import reverse from django import forms from django.utils.safestring import mark_safe from utils import utils import models class MyThumbnailWidget(forms.TextInput): def render(self, name, value, attrs=None): return mark_safe(u'<h1>blah</h1>') class PhotoAdmin(admin.ModelAdmin): list_display = ('photo_filename', 'photo_size') list_filter = ('moderation_status', 'region', 'organization', 'taken_season') readonly_fields = ('photo', 'thumbnail') def formfield_for_dbfield(self, db_field, **kwargs): #TODO #fix thumbnail and photo to show images if db_field.name == 'thumbnail_url': kwargs['widget'] = MyThumbnailWidget return super(PhotoAdmin,self).formfield_for_dbfield(db_field,**kwargs) admin.site.register(models.Organization) admin.site.register(models.Region) admin.site.register(models.Photo, PhotoAdmin) admin.site.register(models.UserProfile)
# -*- coding: utf-8 -*- from abc import ABCMeta, abstractmethod class Heater(object): __metaclass__ = ABCMeta @abstractmethod def on(self): pass @abstractmethod def off(self): pass @abstractmethod def is_hot(self): pass
import json import redis import requests from pymongo import MongoClient import pymongo class Data: def __init__(self, account_name): self.url = "https://proxy.eosnode.tools/v1/{}" # self.url = "https://api-kylin.eosasia.one/v1/{}" self.s = requests.Session() self.s.headers = { "user-agent": "Mozilla/5.0 (Macintosh; Intel Mac OS X 10_14_0) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/69.0.3497.100 Safari/537.36" } self.account_name = account_name self.m = db = MongoClient()["jacks"] def getAction(self, pos=0, offset=500): print("get ", pos) data = self.postData( self.url.format("history/get_actions"), data={"pos": pos, "offset": offset, "account_name": self.account_name}, ) if data.get("actions"): return data return {"actions": []} def getdata(self, lastPos=0, offset=100): while True: _data = self.getAction(pos=lastPos, offset=offset)["actions"] if not _data: return _lastPos = _data[-1]["account_action_seq"] + 1 if _lastPos < lastPos + offset: # lastPos是上一次的,_lastPos是拿到数据最后的一条 self.mongoclient.insert_many(_data) return else: self.mongoclient.insert_many(_data) lastPos = _lastPos def postData(self, url, data): return self.s.post(url, json=data).json() def pickleData(self, kname, data): self.r.set(kname, json.dumps(data)) def run(self, dbclean=False, offset=100, lastpos=0): kname = "{}_alldata".format(self.account_name) d = self.m[kname] self.mongoclient = d a = ( self.mongoclient.find({}, {"account_action_seq": 1}) .sort("account_action_seq", pymongo.DESCENDING) .limit(1) ) if a.count(): lastpos = a[0]["account_action_seq"] else: lastpos = 0 self.getdata(offset=offset, lastPos=lastpos) import os, sys, time def main(): print("AutoRes is starting") c = Data("gaojin.game") c.run(offset=500) executable = sys.executable args = sys.argv[:] print(args) args.insert(0, sys.executable) time.sleep(1) print("Respawning") os.execvp(executable, args) if __name__ == "__main__": # main()
from django.shortcuts import get_object_or_404,render from django.http import HttpResponse, HttpResponseNotFound, HttpResponseRedirect from django.urls import reverse from django.db.models import Q, ProtectedError from .models import Ingredient, MeasurementUnit from .forms import IngredientForm def index(request): return render(request, 'ingredient/index.html', {'ingredient_list': Ingredient.objects.order_by('article_number')}) def filter(request): strfilter = request.GET['ingredient-filter'] try: strfilter = int(strfilter) filtered = Ingredient.objects.filter( Q(ingredient_name__icontains=strfilter) | Q(article_number__exact=strfilter) ) except Exception: filtered = Ingredient.objects.filter(ingredient_name__icontains=strfilter).order_by('article_number') return render(request, 'ingredient/index.html', {'ingredient_list': filtered, 'ingredient_filter': strfilter}) def edit(request, article_number): try: ingredient = Ingredient.objects.get(pk=article_number) except Ingredient.DoesNotExist: ingredient = Ingredient() form = IngredientForm(instance=ingredient) return render(request, 'ingredient/edit.html', {'article_number': article_number, 'form':form }) def delete(request, article_number): try: Ingredient.objects.get(pk=article_number).delete() except ProtectedError: return render(request, 'ingredient/index.html', { 'ingredient_list': Ingredient.objects.order_by('article_number'), 'error_message': 'This ingredient is currently being used, try deleting the recipes first!' }) return HttpResponseRedirect(reverse('ingredient:index', args=())) def save(request, article_number): try: form = IngredientForm(request.POST) if form.is_valid(): formvalue = form.save(commit=False) if article_number != 0: ingredient = formvalue ingredient.article_number = article_number else: ingredient = Ingredient( ingredient_name= formvalue.ingredient_name, unit = formvalue.unit, cost_per_unit = formvalue.cost_per_unit, cost_amount = formvalue.cost_amount) ingredient.save() except Exception as e: return render(request, 'ingredient/edit.html', { 'article_number': article_number, 'form': form, 'error_message': e, }) else: return HttpResponseRedirect(reverse('ingredient:index', args=()))
# Homework Lesson 3 # 1 - 1 favorieten = ["Alison Wonderland"] print(favorieten) # Output = ['Alison Wonderland'] # 1 - 2 favorieten.append("Lido") print(favorieten) # Output = ['Alison Wonderland', 'Lido'] # 1 - 3 favorieten[1] = "Boris Brejcha" print(favorieten) # Output = ['Alison Wonderland', 'Boris Brejcha'] # 2 - 1 numberlist1 = [3, 7, -2, 12] numberlist2 = [54, -32, 3, -88, 66] print( abs( min(numberlist1) - max(numberlist1) ) ) # Output = 14 print( abs( min(numberlist2) - max(numberlist2) ) ) # Output = 154 # 3 - 1 letters = ('A', 'C', 'B', 'B', 'C', 'A', 'C', 'C', 'B') lettersOccurrence = [letters.count("A"), letters.count("B"), letters.count("C")] print(lettersOccurrence)
from PyQt5.QtCore import QSize, QSizeF, Qt from PyQt5.QtGui import QImage, QPainter, QTransform from PyQt5.QtWidgets import QWidget from QPanda3D.QPanda3D_Keys_Translation import QPanda3D_Key_translation from QPanda3D.QPanda3D_Modifiers_Translation import QPanda3D_Modifier_translation, QTimer from direct.showbase.MessengerGlobal import messenger from direct.task.TaskManagerGlobal import taskMgr from panda3d.core import Texture from utils.parsers import sceneGraphAnalyzerMeterParser class QPanda3DSynchronizer(QTimer): def __init__(self, qPanda3DWidget, FPS=60): QTimer.__init__(self) self.qPanda3DWidget = qPanda3DWidget dt = 1000 / FPS self.setInterval(dt) self.timeout.connect(self.tick) def tick(self): taskMgr.step() self.qPanda3DWidget.update() def get_panda_key_modifiers(evt): panda_mods = [] qt_mods = evt.modifiers() for qt_mod, panda_mod in QPanda3D_Modifier_translation.items(): if (qt_mods & qt_mod) == qt_mod: panda_mods.append(panda_mod) return panda_mods def get_panda_key_modifiers_prefix(evt): # join all modifiers (except NoModifier, which is None) with '-' prefix = "-".join([mod for mod in get_panda_key_modifiers(evt) if mod is not None]) # if the prefix is not empty, append a '-' if prefix: prefix += '-' return prefix class PandaWidget(QWidget): def __init__(self, panda3DWorld, label_info, parent=None, FPS=60, debug=False): QWidget.__init__(self, parent) # set fixed geometry self.panda3DWorld = panda3DWorld self.panda3DWorld.set_parent(self) self.label_info = label_info self.setFocusPolicy(Qt.StrongFocus) self.paintSurface = QPainter() self.rotate = QTransform() self.rotate.rotate(180) self.out_image = QImage() size = self.panda3DWorld.cam.node().get_lens().get_film_size() self.initial_film_size = QSizeF(size.x, size.y) self.initial_size = self.size() self.synchronizer = QPanda3DSynchronizer(self, FPS) self.synchronizer.start() self.debug = debug self.update_sgam() def get_scene_graph_analyzer_meter(self): return self.panda3DWorld.get_scene_graph_analyzer_meter() def update_sgam(self): text = sceneGraphAnalyzerMeterParser(self.get_scene_graph_analyzer_meter()).toText() self.label_info.setText(text) def mousePressEvent(self, event): self.panda3DWorld.camera_controller.mouse_press(event.button(), event.x(), event.y()) def mouseReleaseEvent(self, event): self.panda3DWorld.camera_controller.mouse_release(event.button(), event.x(), event.y()) def mouseMoveEvent(self, event): self.panda3DWorld.camera_controller.mouse_move(event.button(), event.x(), event.y()) def wheelEvent(self, evt): delta = -evt.angleDelta().y() self.panda3DWorld.camera_controller.zoom_event(delta) def keyPressEvent(self, evt): key = evt.key() try: k = "{}{}".format(get_panda_key_modifiers_prefix(evt), QPanda3D_Key_translation[key]) if self.debug: print(k) messenger.send(k) except: print("Unimplemented key. Please send an issue on github to fix this problem") def keyReleaseEvent(self, evt): key = evt.key() try: k = "{}{}-up".format(get_panda_key_modifiers_prefix(evt), QPanda3D_Key_translation[key]) if self.debug: print(k) messenger.send(k) except: print("Unimplemented key. Please send an issue on github to fix this problem") def resizeEvent(self, evt): lens = self.panda3DWorld.cam.node().get_lens() lens.set_film_size(self.initial_film_size.width() * evt.size().width() / self.initial_size.width(), self.initial_film_size.height() * evt.size().height() / self.initial_size.height()) self.panda3DWorld.buff.setSize(evt.size().width(), evt.size().height()) def minimumSizeHint(self): return QSize(400, 300) # Use the paint event to pull the contents of the panda texture to the widget def paintEvent(self, event): if self.panda3DWorld.screenTexture.mightHaveRamImage(): self.panda3DWorld.screenTexture.setFormat(Texture.FRgba32) data = self.panda3DWorld.screenTexture.getRamImage().getData() img = QImage(data, self.panda3DWorld.screenTexture.getXSize(), self.panda3DWorld.screenTexture.getYSize(), QImage.Format_ARGB32).mirrored() self.paintSurface.begin(self) self.paintSurface.drawImage(0, 0, img) self.paintSurface.end() def rotateX(self, value): self.panda3DWorld.camera_controller.rotateTheta(value) def rotateY(self, value): self.panda3DWorld.camera_controller.rotatePhi(value)
from flask import Flask app = Flask(__name__) @app.route('/aaa/<bbs_id>') @app.route('/aaa', defaults={ 'bbs_id': 100 }) def aaa(bbs_id): return "aaa의 {}번 글 입니다.".format(bbs_id) if __name__ == '__main__': app.run()
import xlrd from datetime import datetime from .models import * def get_or_none(classmodel, **kwargs): """ the function will get the from the Model if exist other wise will return none @author : Arun Gopi @date : 3/4/2016 """ try: return classmodel.objects.get(**kwargs) except classmodel.DoesNotExist: return None def date_from_excel(d, dm): """ return date from excel file @author : Arun Gopi @date : 6/4/2016 """ if d: try: if isinstance(d, float) or isinstance(d, int): year, month, day, hour, minute, sec = xlrd.xldate_as_tuple( d, dm) d = "%04d-%02d-%02d" % (year, month, day) elif isinstance(d, str) or isinstance(d, unicode): d = datetime.strptime(d, '%d-%m-%Y %I:%M') else: print ("ERROR : Unknown datatype", type(d)) except ValueError: d = None else: d = None return d def create_project_info(data): """ the function will create a new record in project_info Table @author : Arun Gopi @date : 7/4/2016 """ project = ProjectInfo() project.name = data['name'] project.description = data['description'] project.start_date = data['start_date'] project.end_date = data['end_date'] project.save() print ('Inserted') return True def update_project_info(data): """ the function will update ProjectInfo table if you pass PK @author : Arun Gopi @date : 7/4/2016 """ if 'pk' in data: if data['pk'] is not None: project = get_or_none(ProjectInfo, pk=data['pk']) if project: project.name = data['name'] project.description = data['description'] project.start_date = data['start_date'] project.end_date = data['end_date'] project.save() print ('Updated') return True else: return False else: return False else: print ("please provide pk for updating") return False def insertcolx(): """ Excel row/colum style for excel @Author : Arun Gopi @date : 3/4/2016 """ style = xlwt.XFStyle() borders = xlwt.Borders() borders.bottom = borders.top = borders.left\ = borders.right = xlwt.Borders.THIN borders.top = xlwt.Borders.THIN style.borders = borders style.pattern.pattern = 26 style.pattern.pattern_fore_colour = 0x16 style.protection.cell_locked = False style.protection.formula_hidden = False return style
# coding: utf-8 """ Загрузчик шаблонов (темплейтов) для генерации пользовательского интерфейса для m3_ext_demo.ui. Необходимость данного шаблона обусловлена спецификой реализации template-loaders в django. Для корректной работы загрузчика в settings.py прикладного приложения необходимо добавить строку 'm3_ext_demo.ui.js_template_loader.load_template_source' в tuple TEMPLATE_LOADERS """ import os import sys from django.conf import settings from django.template import TemplateDoesNotExist from django.utils._os import safe_join from django.core.exceptions import SuspiciousOperation from m3_django_compat import BaseLoader # At compile time, cache the directories to search. fs_encoding = sys.getfilesystemencoding() or sys.getdefaultencoding() template_dir_ext = os.path.join( os.path.dirname(__file__), 'templates') template_dir_gears = os.path.join( os.path.dirname(__file__), '../gears/templates') app_template_dirs = ( template_dir_ext.decode(fs_encoding), template_dir_gears.decode(fs_encoding), ) def get_template_sources(template_name, template_dirs=None): """ Returns the absolute paths to "template_name", when appended to each directory in "template_dirs". Any paths that don't lie inside one of the template dirs are excluded from the result set, for security reasons. """ if not template_dirs: template_dirs = app_template_dirs for template_dir in template_dirs: try: yield safe_join(template_dir, template_name) except UnicodeDecodeError: # The template dir name was a bytestring that wasn't valid UTF-8. raise # В Django <1.8.X safe_join выбрасывает ValueError # В Django >=1.8.X safe_join выбрасывает SuspiciousOperation except (SuspiciousOperation, ValueError): # The joined path was located outside of template_dir. pass class Loader(BaseLoader): is_usable = True def load_template_source(self, template_name, template_dirs=None): return load_template_source(template_name, template_dirs) def load_template_source(template_name, template_dirs=None): for filepath in get_template_sources(template_name, template_dirs): try: return ( open(filepath).read().decode(settings.FILE_CHARSET), filepath ) except IOError: pass raise TemplateDoesNotExist(template_name) load_template_source.is_usable = True
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # pylint: disable=missing-docstring """Bot for Webex Teams - Define decorator for bot - Show/Create/Delete webhook for Webex Teams Links: - user account: https://developer.webex.com/ - webhook api: https://developer.webex.com/docs/api/v1/webhooks - buttons and cards: https://developer.webex.com/docs/api/guides/cards """ import json import logging import os import sys import requests requests.packages.urllib3.disable_warnings() from requests_toolbelt.multipart.encoder import MultipartEncoder logger = logging.getLogger(__name__) class Bot: TIMEOUT = (10.0, 30.0) # (connect timeout, read timeout) def __init__(self, bot_name=None): bot_name = os.getenv('bot_name') if bot_name is None else bot_name if bot_name is None or bot_name.strip() == '': sys.exit("please set environment variable 'bot_name' before run this script") self.bot_name = bot_name self._bot_id = None # get_bot_id() set this value and returns it self.auth_token = self.get_auth_token(bot_name=bot_name) if self.auth_token is None: sys.exit("failed to get authentication token for {}".format(bot_name)) self.headers = { 'Authorization': "Bearer {}".format(self.auth_token), 'content-type': "application/json" } # functions with decorator will be stored in this dict object self.on_message_functions = {} self.on_command_functions = {} def on_message(self, message_text): """Decorator for the on_message Arguments: message_text {str} -- the message text correspond to the function Returns: [func] -- decorator function """ def decorator(func): self.on_message_functions[message_text] = func return decorator def on_command(self, command=None): """Decorator for the on_command Arguments: command {str} -- the command text correspond to the function plugin Returns: [func] -- decorator function """ def decorator(func): self.on_command_functions[command] = func return decorator @staticmethod def get_auth_token(bot_name=None): """Get authentication token by bot name. first, try to get token from environment variable, then read from file ~/.{{ bot name }} Keyword Arguments: bot_name {str} -- name of the bot (default: {None}) Returns: str -- authentication token if found else None """ # 1st get token from environment: bot_token token = os.getenv('bot_token') if token: return token # 2nd get from ~/.{{ bot_name }} file_name = '~/.{}'.format(bot_name) file_path = os.path.expanduser(file_name) if not os.path.isfile(file_path): logger.info('%s is not found', file_name) return None try: with open(file_path, mode='r') as f: return f.read().strip() except IOError as e: logger.exception(e) return None def _requests_get_as_json(self, api_path=None): """Send get method to api_path and return json data Arguments: api_path {str} -- api path, fqdn Returns: dict -- json data, or None """ get_result = None try: get_result = requests.get(api_path, headers=self.headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if get_result is None: return None if get_result.ok: logger.info("get success: %s", api_path) return get_result.json() logger.error("failed to get: %s", api_path) logger.error(get_result.text) return None def _requests_get_pagination_as_items(self, api_path=None, params=None): """Get all items with pagination pagination is not tested well. see, https://developer.webex.com/docs/api/basics/pagination in requests module, 'next' url could be retrieved easily response.links['next']['url'] Arguments: api_path {str} -- api path fqdn Keyword Arguments: params {dict} -- get request params (default: {None}) Returns: list -- a list contains all items """ result_list = [] get_result = None try: get_result = requests.get(api_path, headers=self.headers, params=params, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if get_result is None: return [] if not get_result.ok: logger.error("failed to get: %s", api_path) logger.error(get_result.text) return [] logger.info("get success: %s", api_path) items = get_result.json().get('items') if items: result_list.extend(items) else: return [] while 'next' in get_result.links.keys(): get_result = None try: get_result = requests.get(api_path, headers=self.headers, params=params, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if get_result is None: return [] if get_result.ok: logger.info("get success: %s", api_path) items = get_result.json().get('items') if items: result_list.extend(items) else: logger.error("failed to get: %s", api_path) logger.error(get_result.text) return [] return result_list def _requests_delete_as_bool(self, api_path=None): """Send delete method to api_path and return True if success Arguments: api_path {str} -- api path, fqdn Returns: bool -- True if success """ delete_result = None try: delete_result = requests.delete(api_path, headers=self.headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if delete_result is None: return False if delete_result.ok: logger.info("delete success: %s", api_path) return True logger.error("failed to delete: %s", api_path) logger.error(delete_result.text) return False def _requests_post_as_json(self, api_path=None, payload=None): post_result = None try: post_result = requests.post(api_path, json=payload, headers=self.headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if post_result is None: return None if post_result.ok: logger.info("post success: %s", api_path) return post_result.json() logger.error("failed to post: %s", api_path) logger.error(post_result.text) return None def get_me(self): """Get my own details GET /v1/people/me https://developer.webex.com/docs/api/v1/people/get-my-own-details Returns: dict -- information about this bot obtained from rest api, or None """ api_path = 'https://api.ciscospark.com/v1/people/me' return self._requests_get_as_json(api_path=api_path) def get_bot_id(self): """Get a identifier for this bot Returns: str -- a unique identifier for this bot """ if self._bot_id: return self._bot_id me = self.get_me() if not me: return None self._bot_id = me.get('id') return self._bot_id def get_people_by_email(self, email=None): """Get people in your organization by email attribute GET /v1/people https://developer.webex.com/docs/api/v1/people/list-people Keyword Arguments: email {str} -- get people with this email address (default: {None}) Returns: list -- list of person objects """ if email is None: return [] api_path = 'https://api.ciscospark.com/v1/people' params = { "email": email } return self._requests_get_pagination_as_items(api_path=api_path, params=params) def get_person_details(self, person_id=None): """Get details for a person by person_id GET /v1/people/{personId} https://developer.webex.com/docs/api/v1/people/get-person-details Keyword Arguments: person_id {str} -- a unique identifier for the person (default: {None}) Returns: dict -- object for the person, or None """ if person_id is None: return None api_path = 'https://api.ciscospark.com/v1/people/{}'.format(person_id) return self._requests_get_as_json(api_path=api_path) def get_rooms(self): """Get rooms to which the authenticated user belongs GET /v1/rooms https://developer.webex.com/docs/api/v1/rooms/list-rooms Returns: list -- list of the rooms """ api_path = 'https://api.ciscospark.com/v1/rooms' return self._requests_get_pagination_as_items(api_path=api_path) def get_room_details(self, room_id=None): """Get room details GET /v1/rooms/{roomId} https://developer.webex.com/docs/api/v1/rooms/get-room-details Keyword Arguments: room_id {str} -- The unique identifier for the room (default: {None}) Returns: dict -- a object for the room """ if room_id is None: return None api_path = 'https://api.ciscospark.com/v1/rooms/{}'.format(room_id) return self._requests_get_as_json(api_path=api_path) def delete_room(self, room_id=None): """Deletes a room, by ID DELETE /v1/rooms/{roomId} https://developer.webex.com/docs/api/v1/rooms/delete-a-room Keyword Arguments: room_id {str} -- The unique identifier for the room. (default: {None}) Returns: bool -- True if success """ if room_id is None: return False api_path = 'https://api.ciscospark.com/v1/rooms/{}'.format(room_id) return self._requests_delete_as_bool(api_path=api_path) def get_message_detail(self, message_id=None): """Get details for a message, by message_id. GET /v1/messages/{messageId} https://developer.webex.com/docs/api/v1/messages/get-message-details Keyword Arguments: message_id {str} -- the unique identifier for the message (default: {None}) Returns: dict -- the object for the message """ if message_id is None: return None api_path = 'https://api.ciscospark.com/v1/messages/{}'.format(message_id) return self._requests_get_as_json(api_path=api_path) def get_message_text(self, message_id=None): """Same as get_message_detail() but returns text only Keyword Arguments: message_id {str} -- the unique identifier for the message (default: {None}) Returns: str -- the message text """ json_data = self.get_message_detail(message_id=message_id) if json_data is None: return None return json_data.get('text') def send_message(self, text=None, room_id=None, to_person_id=None, to_person_email=None, attachments=None): """Create a message POST /v1/messages https://developer.webex.com/docs/api/v1/messages/create-a-message Keyword Arguments: text {str} -- The message, in plain text (default: {None}) room_id {str} -- The room ID of the message (default: {None}) to_person_id {str} -- The person ID of the recipient when sending a private 1:1 message. (default: {None}) to_person_email {str} -- The email address of the recipient when sending a private 1:1 message. (default: {None}) attachments {list} -- Content attachments to attach to the message. (default: {None}) Returns: dict -- post response, or None """ if not any([room_id, to_person_id, to_person_email]): return None payload = { 'text': text or "message" } if room_id is not None: payload.update({'roomId': room_id}) if to_person_id is not None: payload.update({'toPersonId': to_person_id}) if to_person_email is not None: payload.update({'toPersonEmail': to_person_email}) if attachments is not None and isinstance(attachments, list): payload.update({'attachments': attachments}) api_path = 'https://api.ciscospark.com/v1/messages/' return self._requests_post_as_json(api_path=api_path, payload=payload) def send_image(self, text=None, room_id=None, to_person_id=None, to_person_email=None, image_filename=None): """Create a message with image SEE https://developer.webex.com/docs/api/basics/message-attachments Keyword Arguments: text {str} -- The message, in plain text (default: {None}) room_id {str} -- The room ID of the message (default: {None}) to_person_id {str} -- The person ID of the recipient when sending a private 1:1 message. (default: {None}) to_person_email {str} -- The email address of the recipient when sending a private 1:1 message. (default: {None}) image_filename {str} -- The filename of the image. (default: {None}) Returns: dict -- post response, or None """ if not any([room_id, to_person_id, to_person_email]): return None if image_filename is None: return None payload = { 'text': text or "image" } if room_id is not None: payload.update({'roomId': room_id}) if to_person_id is not None: payload.update({'toPersonId': to_person_id}) if to_person_email is not None: payload.update({'toPersonEmail': to_person_email}) payload.update( { 'files': (image_filename, open(image_filename, 'rb'), 'image/png') } ) m = MultipartEncoder(payload) headers = { 'Authorization': "Bearer {}".format(self.auth_token), 'content-type': m.content_type } logger.info(m.content_type) api_path = 'https://api.ciscospark.com/v1/messages' post_result = None try: post_result = requests.post(api_path, data=m, headers=headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if post_result is None: return None if post_result.ok: logger.info("post success: %s", api_path) return post_result.json() logger.error("failed to post: %s", api_path) logger.error(post_result.text) def get_attachment(self, attachment_id=None): """Get attachment action details GET /v1/attachment/actions/{id} https://developer.webex.com/docs/api/v1/attachment-actions/get-attachment-action-details Keyword Arguments: attachment_id {str} -- a unique identifier for the attachment action (default: {None}) Returns: dict -- a object for the attachment """ if attachment_id is None: return None api_path = 'https://api.ciscospark.com/v1/attachment/actions/{}'.format(attachment_id) return self._requests_get_as_json(api_path=api_path) def get_webhooks(self, webhook_name=None): # GET /v1/webhooks # https://developer.webex.com/docs/api/v1/webhooks/list-webhooks name = webhook_name if name is None: name = self.bot_name api_path = 'https://api.ciscospark.com/v1/webhooks' get_result = None try: get_result = requests.get(api_path, headers=self.headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if get_result is None: return [] if get_result.ok: data = get_result.json() webhooks = data.get('items') if data else [] if name is None: return webhooks return list(filter(lambda x: x.get('name') == name, webhooks)) logger.error("failed to get: %s", api_path) logger.error(get_result.text) return [] def has_webhooks(self, webhook_name=None): name = webhook_name if name is None: name = self.bot_name webhooks = self.get_webhooks(name) if webhooks is None: return False if len(webhooks) > 0: return True return False def show_webhooks(self, webhook_name=None): name = webhook_name if name is None: name = self.bot_name webhooks = self.get_webhooks(webhook_name=name) for w in webhooks: print(json.dumps(w, ensure_ascii=False, indent=2)) def delete_webhook(self, webhook_id=None): """Delete webhook by id DELETE /v1/webhooks/{webhookId} https://developer.webex.com/docs/api/v1/webhooks/delete-a-webhook Keyword Arguments: webhook_id {str} -- id to be deleted (default: {None}) Returns: bool -- True if successfully deleted """ if not id: return False api_path = 'https://api.ciscospark.com/v1/webhooks/{}'.format(webhook_id) return self._requests_delete_as_bool(api_path=api_path) def delete_webhooks(self): self.delete_webhooks_by_name(webhook_name=self.bot_name) def delete_webhooks_by_name(self, webhook_name=None): name = webhook_name if name is None: name = self.bot_name webhooks = self.get_webhooks(webhook_name=name) for webhook_id in [w.get('id') for w in webhooks]: self.delete_webhook(webhook_id=webhook_id) def regist_webhook(self, webhook_name=None, target_url=None): # POST /v1/webhooks # https://developer.webex.com/docs/api/v1/webhooks/create-a-webhook name = webhook_name if name is None: name = self.bot_name # delete same name webhooks, if any self.delete_webhooks_by_name(webhook_name=name) api_path = 'https://api.ciscospark.com/v1/webhooks' payload = { 'resource': "messages", 'event': "all", 'targetUrl': target_url, 'name': name } post_result = self._requests_post_as_json(api_path=api_path, payload=payload) if post_result is None: logger.error('Failed to regist webhook for message') return logger.info('Success to regist webhook for message') # regist one more webhook for attachment payload = { 'resource': "attachmentActions", 'event': "all", 'targetUrl': target_url, 'name': name } post_result = self._requests_post_as_json(api_path=api_path, payload=payload) if post_result is None: logger.error('Failed to regist webhook for attachment action') return logger.info('Success to regist webhook for attachment action') def update_webhook(self, webhook_id=None, webhook_name=None, target_url=None): # PUT /v1/webhooks/{webhookId} # https://developer.webex.com/docs/api/v1/webhooks/update-a-webhook api_path = 'https://api.ciscospark.com/v1/webhooks/{}'.format(webhook_id) payload = { 'name': webhook_name, 'targetUrl': target_url, 'status': 'active' } put_result = None try: put_result = requests.put(api_path, json=payload, headers=self.headers, timeout=self.TIMEOUT, verify=False) except requests.exceptions.RequestException as e: logger.exception(e) if put_result is None: return None if put_result.ok: logger.info('Webhook update successfuly') return put_result.json() logger.error("failed to put: %s", api_path) logger.error(put_result.text) return None if __name__ == '__main__': import argparse logging.basicConfig(level=logging.INFO) def test_decorator(): # pylint: disable=unused-variable bot = Bot() @bot.on_message('hi') def on_message_hi(room_id=None): print('My room_id is {}'.format(room_id)) @bot.on_message('*') def on_message_default(room_id=None): print(room_id) # Python起動時にデコレータが付与されている関数は回収されて辞書型に格納される # 上の2つの関数は辞書型に格納されているはず print(bot.on_message_functions.keys()) # その辞書型を使えば任意のタイミングでデコレータの付いた関数を実行できる message = 'hi' if message in bot.on_message_functions: func = bot.on_message_functions.get('hi') func(room_id="1") return 0 # sys.exit(test_decorator()) def main(): parser = argparse.ArgumentParser(description='webex teams bot related operations.') parser.add_argument('bot_name', help='name of the bot') parser.add_argument('-d', '--delete', action='store_true', default=False, help='Delete all webhooks') parser.add_argument('-l', '--list', action='store_true', default=False, help='List all webhooks') parser.add_argument('-r', '--room', action='store_true', default=False, help='List rooms') parser.add_argument('-m', '--me', action='store_true', default=False, help='show my info') args = parser.parse_args() bot = Bot(bot_name=args.bot_name) if args.list: bot.show_webhooks() elif args.delete: webhooks = bot.get_webhooks() for webhook_id in [w.get('id') for w in webhooks]: result = bot.delete_webhook(webhook_id=webhook_id) if result is not None and result.ok: print("{} : {}".format(webhook_id, "successfuly deleted")) else: print("{} : {}".format(webhook_id, "delete failed")) elif args.room: rooms = bot.get_rooms() print(json.dumps(rooms, ensure_ascii=False, indent=2)) elif args.me: me = bot.get_me() print(json.dumps(me, ensure_ascii=False, indent=2)) return 0 sys.exit(main())
import turtle import random for i in range(3): col = random.randint(0, 2) sel = random.randint(0, 1) if(col == 0): turtle.pencolor('yellow') elif (col == 1): turtle.pencolor('blue') elif(col == 2): turtle.pencolor('red') if(sel == 0): turtle.forward(100) elif (sel == 1): turtle.circle(50) turtle.right(45)
def get_csv_and_pred(i=42): elements = ['Pr', 'Ni', 'Ru', 'Ne', 'Rb', 'Pt', 'La', 'Na', 'Nb', 'Nd', 'Mg', 'Li', 'Pb', 'Re', 'Tl', 'Lu', 'Pd', 'Ti', 'Te', 'Rh', 'Tc', 'Sr', 'Ta', 'Be', 'Ba', 'Tb', 'Yb', 'Si', 'Bi', 'W', 'Gd', 'Fe', 'Br', 'Dy', 'Hf', 'Hg', 'Y', 'He', 'C', 'B', 'P', 'F', 'I', 'H', 'K', 'Mn', 'O', 'N', 'Kr', 'S', 'U', 'Sn', 'Sm', 'V', 'Sc', 'Sb', 'Mo', 'Os', 'Se', 'Th', 'Zn', 'Co', 'Ge', 'Ag', 'Cl', 'Ca', 'Ir', 'Al', 'Ce', 'Cd', 'Ho', 'As', 'Ar', 'Au', 'Zr', 'Ga', 'In', 'Cs', 'Cr', 'Tm', 'Cu', 'Er'] np.random.seed(seed=i) elem_rnd_chem = {} size=1200 for elem in elements: elem_rnd_chem[elem] = np.random.normal(size=size) df_rnd_chem = pd.DataFrame(elem_rnd_chem).T csv_name = 'random_{:0.0f}.csv'.format(size) df_rnd_chem.to_csv(csv_name, index_label='element') if __name__ == '__main__': get_csv_and_pred(i=42)
import time class PID: def __init__(self, Kp=0, Ki=0, Kd=0, sat=1023): #Initialise gains self.Kp = Kp self.Ki = Ki self.Kd = Kd self.sat = sat #Initialise delta variables self.cur_time = time.time() self.prev_time = self.cur_time self.prev_error = 0 #Result variables (absolute coefficients, after gains applied) self.Cp = 0 self.Ci = 0 self.Cd = 0 self.output = 0 def SetKp(self, Kp): self.Kp = Kp def SetKi(self, Ki): self.Ki = Ki def SetKd(self, Kd): self.Kd = Kd #Set saturation value, outside of which output will be clipped def SetSat(self, sat): self.sat = sat #Clip the output to be inside the saturation range def Clip(self,value): return min(max(value,-self.sat),self.sat) #Calculate another interation of the PID Loop def Control_Output(self, error): self.cur_time = time.time() dt = self.cur_time - self.prev_time de = error - self.prev_error self.Cp = self.Clip(error * self.Kp) if dt > 0: self.Cd = self.Clip(self.Kd*de/dt) else: self.Cd = 0 self.output = self.Clip(self.Cp + self.Ci + self.Cd) #Use integral term only if output is within controllable region to prevent integral windup if self.output < self.sat and self.output > -self.sat: self.Ci += self.Ki*error*dt #Because we assume only passive cooling, we also want to prevent any negative integral terms if self.Ci < 0: self.Ci = 0 self.output = self.Clip(self.Cp + self.Ci + self.Cd) self.prev_time = self.cur_time self.prev_error = error return self.output
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # 第一行注释为了告诉Linux/OS X系统,这是一个Python可执行程序,Windows系统会忽略这个注释 # 第二行注释是为了告诉Python解释器,按照UTF-8编码读取源代码,否则,你在源代码中写的中文输出可能会有乱码。 n = 32 f = 4325.564 s1 = 'hello, world' s2 = 'hello, \'Jin\'' s3 = r'hello, "Jin"' s4 = r'''hello, Jin! das''' print(n) print(f) print(s1) print(s2) print(s3) print(s4) print("你好啊") print('%2d-%02d' % (3, 1)) print('%.2f' % 3.1415926)
#1 print('Task 1') for x in range(0, 13): print(x, 'Results') for y in range(0, 13): z = y * x print(x, '*', y, '=', z)
from PIL.ExifTags import TAGS from PIL import Image def testForExif(imgFileName): try: exifData = {} imgFile = Image.open(imgFileName) info = imgFile._getexif() # Extrae metadatos de una imagen if info: for (tag,value) in info.items(): decoded = TAGS.get(tag,tag) exifData[decoded] = value exifGPS = exifData['GPSInfo'] if exifGPS: print '[+] ' + imgFileName + ' GPS Data: ' + exifGPS except: pass testForExif('<RUta de la imagen>')
# https://leetcode.com/problems/n-th-tribonacci-number/ """ The Tribonacci sequence Tn is defined as follows: T0 = 0, T1 = 1, T2 = 1, and Tn+3 = Tn + Tn+1 + Tn+2 for n >= 0. Given n, return the value of Tn. Example 1: Input: n = 4 Output: 4 Explanation: T_3 = 0 + 1 + 1 = 2 T_4 = 1 + 1 + 2 = 4 Example 2: Input: n = 25 Output: 1389537 Constraints: 0 <= n <= 37 The answer is guaranteed to fit within a 32-bit integer, ie. answer <= 2^31 - 1. """ from functools import cache @cache def tribonacci(n: int) -> int: if n == 0: return 0 elif n == 1: return 1 elif n == 2: return 1 return tribonacci(n - 1) + tribonacci(n - 2) + tribonacci(n - 3) def tribonacci(n: int) -> int: dp = dict(zip([0, 1, 2], [0, 1, 1])) for v in range(3, n + 1): dp[v] = dp[v - 1] + dp[v - 2] + dp[v - 3] return dp[n] def tribonacci(n: int) -> int: def helper(a, b, c, n): if n == 0: return a a, b, c = b, c, a + b + c return helper(a, b, c, n - 1) return helper(0, 1, 1, n)
#!/usr/bin/env python # encoding: utf-8 from pyroute2 import IPDB import time class RtTable(): def __init__(self): """ rip_entry = [ {'dst': '172.16.1.0/24', 'metric': 1, #1-16 'gateway': '172.16.1.2', 'interface': 4, 'timer': 0, } ] """ self.rip_table = [] self.direct_table = [] self.ipdb = IPDB() self.get_direct_table() def get_direct_table(self): self.direct_table = [ x for x in self.ipdb.routes if x['family'] == 2 if x['prefsrc']] def apply_rip_route(self, route): """ route = {'dst': '172.16.1.0/24', 'oif': 4, 'gateway': '172.16.1.2', } """ self.ipdb.routes.add(route).commit() def remove_rip_route(self, route): r = {'dst': route['dst'], 'oif': route['interface'], 'gateway': route['gateway']} self.ipdb.routes.remove(r).commit() def get_route(self, route): for r in self.rip_table: if r['dst'] == route['dst']: return r def add_route(self, route): self.rip_table.append(route) def update_route(self, route): self.remove_route(route) self.add_route(route) def remove_route(self, route): for r in self.rip_table: if r['dst'] == route['dst']: self.rip_table.remove(r) def get_all_route(self): return self.rip_table def update_route_time(self, route): for r in self.rip_table: if r['dst'] == route['dst']: r['timer'] = time.time()
from World import Narrative from World.Types.Log import Message from Grammar.tree import Node from Grammar.actions import Terminals as T from Grammar.plot import export_grammar_plot from copy import copy class Progress: quest: Node = None semantics_indices = {} semantics_parsed_for_branches = [] current_node: Node = None completed_indices = [] def __init__(self, quest: Node): local_quest = copy(quest) # local_quest.clean_nulls() local_quest.set_indices() self.quest = local_quest self.semantics_indices = {} self.semantics_parsed_for_branches = [] self.current_node = local_quest self.completed_indices = [] export_grammar_plot(local_quest) self.semantics_indices[0] = [] self.get_narratives(root=local_quest, pre_semantics=[]) def get_narratives(self, root: Node, pre_semantics: list): """ Run narration functions for Non-terminal nodes that weren't parsed already :param root: :param pre_semantics: :return: """ if root.index in self.semantics_parsed_for_branches: return if root.branches: # Parse only Non-terminals children_pre_semantics = Narrative.find(root)(*pre_semantics) for i, branch in enumerate(root.branches): if branch.action == T.null: continue self.semantics_indices[branch.index] = children_pre_semantics[i] self.semantics_parsed_for_branches.append(root.index) def get_current_semantics(self): if self.current_node and self.current_node.index in self.semantics_indices: return self.semantics_indices[self.current_node.index] return [] def print_progress(self, full: bool=False): Message.debug("level: %i, current-node: %s" % (self.current_node.index, self.current_node.action)) if full: Message.debug("semantics: %s" % self.semantics_indices) else: Message.debug("semantics: %s" % self.get_current_semantics()) def find_next_active_level(self, node: Node=None): if node is None: node = self.current_node if node.index not in self.completed_indices and node.action != T.null: if node.branches: # go down the tree, player should first complete parent's branches for branch in node.branches: if branch.index not in self.completed_indices: # if completed skip if branch.index not in self.semantics_parsed_for_branches: # don't parse branches which already parsed self.update_active_level(branch) if not self.find_next_active_level(branch): return False else: # terminal waiting to be completed return False self.completed_indices.append(node.index) return True def update_active_level(self, new_node: Node): # using previous node # only non-terminal actions self.get_narratives(self.current_node, pre_semantics=self.get_current_semantics()) # update active level self.current_node = new_node def check_action_proceed(self, action: T, args: list) -> bool: if action == self.current_node.action and args == self.get_current_semantics(): self.completed_indices.append(self.current_node.index) self.find_next_active_level(self.quest) return True self.find_next_active_level() return False
import datetime as dt import matplotlib.pyplot as plt from matplotlib import style import pandas_datareader.data as web import pandas as pd df = web.DataReader('TSLA', 'yahoo', '2018-01-01', '2018-01-05') exit(df)
# -*- coding: utf-8 -*- from django.test.client import Client from networkapi.test.test_case import NetworkApiTestCase from networkapi.util.geral import mount_url class RouteMapPostSuccessTestCase(NetworkApiTestCase): route_map_uri = '/api/v4/route-map/' fixtures = [ 'networkapi/config/fixtures/initial_config.json', 'networkapi/system/fixtures/initial_variables.json', 'networkapi/usuario/fixtures/initial_usuario.json', 'networkapi/grupo/fixtures/initial_ugrupo.json', 'networkapi/usuario/fixtures/initial_usuariogrupo.json', 'networkapi/api_ogp/fixtures/initial_objecttype.json', 'networkapi/api_ogp/fixtures/initial_objectgrouppermissiongeneral.json', 'networkapi/grupo/fixtures/initial_permissions.json', 'networkapi/grupo/fixtures/initial_permissoes_administrativas.json', ] json_path = 'api_route_map/v4/tests/route_map/sanity/json/post/{}' def setUp(self): self.client = Client() self.authorization = self.get_http_authorization('test') self.content_type = 'application/json' self.fields = ['name'] def tearDown(self): pass def test_post_route_maps(self): """Test POST RouteMaps.""" route_maps_path = self.json_path.\ format('two_route_maps.json') response = self.client.post( self.route_map_uri, data=self.load_json(route_maps_path), content_type=self.content_type, HTTP_AUTHORIZATION=self.authorization) self.compare_status(201, response.status_code) get_ids = [data['id'] for data in response.data] uri = mount_url(self.route_map_uri, get_ids, kind=['basic'], fields=self.fields) response = self.client.get( uri, HTTP_AUTHORIZATION=self.authorization ) self.compare_status(200, response.status_code) self.compare_json(route_maps_path, response.data)
import os import subprocess as sp print("Hello, what is your name: ",end='') name=input() print("{}, which software service you need: ".format(name),end='') sw=input() if sw=='firefox': cmd= "ssh -X -l root 172.17.0.2 firefox" sp.getoutput(cmd) elif sw=='atom': cmd= "ssh -X -l root 172.17.0.2 atom" sp.getoutput(cmd) elif sw=='gedit': cmd= "ssh -X -l root 172.17.0.2 gedit" sp.getoutput(cmd) elif sw=='vlc': cmd= "ssh -X -l root 172.17.0.2 vlc" sp.getoutput(cmd)
import ex3 import point_cloud import numpy as np from matplotlib import pyplot from matplotlib import patches # # an attempt at constructing the # boundary operators of the graph # from the given threshold in ex3.py. # # SCRATCH THAT # First, just try to manually visualize # all 2-simplices # (complete graphs on 3 vertices). # node_list = {j:list( ex3.pairs[ex3.pairs[:,0]==j,1] ) for j in np.unique(ex3.pairs[:,0])} loops = [] for k,v in node_list.items(): for i in range(len(v)): for j in range(i+1,len(v)): if (v[i] in node_list.keys()) and (v[j] in node_list[v[i]]): loops.append([k,v[i],v[j]]) # if __name__=="__main__": ex3.pc.visualize() ex3.pc.draw_ball(ex3.which, ex3.thresh/2., c=[0.5,0,0.5]) for j,o in enumerate(ex3.D2.order[:len(ex3.pairs)]): iijj = ex3.D2.coords[o] xxyy = ex3.X[iijj] middle = np.mean(xxyy, axis=0) ex3.pc.ax.plot(xxyy[:,0], xxyy[:,1], c=pyplot.cm.tab10(j%10), lw=2) # loop_coords = [ex3.X[l] for l in loops] polys = [] for lc in loop_coords: triangle = patches.Polygon(lc, facecolor=[0,0,0,0.5], edgecolor='k') tripatch = ex3.pc.ax.add_patch(triangle) polys.append(tripatch) # if False: for j,o in enumerate(ex3.D2.order[:len(ex3.pairs)]): iijj = ex3.D2.coords[o] xxyy = ex3.X[iijj] middle = np.mean(xxyy, axis=0) ex3.pc.ax.text(middle[0],middle[1], '%.2f'%ex3.D2.distances[o], c='w', fontsize=11, ha='center', va='center') for j,co in enumerate(ex3.pc.pts): ex3.pc.ax.text(co[0], co[1], j, c='w', fontsize=10, ha='center', va='center', bbox={'facecolor':'r', 'alpha':0.5}) ex3.pc.ax.set_title('Threshold %.2f'%ex3.thresh, c='k', fontsize=18) ex3.pc.fig.tight_layout() ex3.pc.fig.subplots_adjust(top=0.9) # ex3.pc.ax.axis('square') pyplot.ion()
from core.base.parser import StaticParser from core.utils import parse_hexstring from core.base.parser import STR_TEMPLATE class SetProgressStatusParser(StaticParser): name = 'MSG_Set_Progress_Status' event_code = '1003' def _make_str(self, container): data = parse_hexstring(container.src_data.data) context = container.src_data._asdict() context['message'] = '{}({})'.format(self.name, data[0]) return STR_TEMPLATE.format(**context)
from core.models.Employee import Employee from django.db.utils import IntegrityError import pytest @pytest.mark.django_db class TestEmployee: """Test for employee models.""" def test_register_employee(self): """test registering employee.""" employee = Employee.objects.create( name = 'Test', email = 'test2@email.com', department = 'M' ) assert Employee.objects.get(email='test2@email.com') == employee
import numpy as np import pytest import tensorflow as tf from sklearn.metrics import mean_squared_error from ml_intuition.evaluation.performance_metrics import overall_rms_abundance_angle_distance, \ cnn_rmse, per_class_rmse, dcae_rmse, average_angle_spectral_mapper sess = tf.Session() def softmax(x: np.ndarray) -> np.ndarray: exp_x = np.exp(x) norm_factor = np.sum(exp_x, axis=1) result = exp_x / norm_factor[:, None] np.testing.assert_array_equal(np.around(result.sum(axis=1), 5).astype(int), np.ones(shape=(result.shape[0])).astype(int)) return result class TestRMSAbundanceAngleDistance: @pytest.mark.parametrize( 'y_true, y_pred', [ (np.random.uniform(0, 1, (10, 10)), np.random.uniform(0, 1, (10, 10))), (np.random.uniform(0, 1, (10, 2)), np.random.uniform(0, 1, (10, 2))), (np.random.uniform(0, 1, (10, 1)), np.random.uniform(0, 1, (10, 1))) ]) def test_rmsaad_with_external_implementation(self, y_true: np.ndarray, y_pred: np.ndarray): y_true, y_pred = softmax(y_true), softmax(y_pred) tf_y_true, tf_y_pred = tf.convert_to_tensor(y_true), tf.convert_to_tensor(y_pred) tf_error = overall_rms_abundance_angle_distance(y_true=tf_y_true, y_pred=tf_y_pred).eval(session=sess) error = 0 for i in range(y_true.shape[0]): error += (np.arccos(np.dot(y_true[i], y_pred[i]) / (np.linalg.norm(y_true[i]) * np.linalg.norm(y_pred[i])))) ** 2 error /= y_true.shape[0] error = np.sqrt(error) assert round(tf_error, 3) == round(error, 3) class TestRMSE: @pytest.mark.parametrize( 'y_true, y_pred', [ (np.random.uniform(0, 1, (10, 10)), np.random.uniform(0, 1, (10, 10))), (np.random.uniform(0, 1, (10, 2)), np.random.uniform(0, 1, (10, 2))), (np.random.uniform(0, 1, (10, 1)), np.random.uniform(0, 1, (10, 1))) ]) def test_cnn_rmse_with_external_implementations(self, y_true: np.ndarray, y_pred: np.ndarray): y_true, y_pred = softmax(y_true), softmax(y_pred) tf_y_true, tf_y_pred = tf.convert_to_tensor(y_true), tf.convert_to_tensor(y_pred) tf_overall_error = cnn_rmse(y_true=tf_y_true, y_pred=tf_y_pred).eval(session=sess) error = np.sqrt(np.mean((y_true - y_pred) ** 2)) assert round(tf_overall_error, 3) == round(error, 3) == \ round(np.sqrt(mean_squared_error(y_true=y_true, y_pred=y_pred)), 3) tf_per_class_error = per_class_rmse(y_true=tf_y_true, y_pred=tf_y_pred).eval(session=sess) per_class_error = np.sqrt(np.mean((y_true - y_pred) ** 2, axis=0)) assert np.array_equal(np.round(tf_per_class_error, 3), np.round(per_class_error, 3)) @pytest.mark.parametrize( 'y_true, y_pred', [ (np.random.uniform(0, 1, (10, 10)), np.random.uniform(0, 1, (10, 10))), (np.random.uniform(0, 1, (10, 2)), np.random.uniform(0, 1, (10, 2))), (np.random.uniform(0, 1, (10, 1)), np.random.uniform(0, 1, (10, 1))) ]) def test_dcae_rmse_with_external_implementations(self, y_true: np.ndarray, y_pred: np.ndarray): y_true, y_pred = softmax(y_true), softmax(y_pred) tf_y_true, tf_y_pred = tf.convert_to_tensor(y_true), tf.convert_to_tensor(y_pred) tf_overall_error = dcae_rmse(y_true=tf_y_true, y_pred=tf_y_pred).eval(session=sess) error = np.mean(np.sqrt(np.mean(np.square(y_pred - y_true), axis=1))) assert round(tf_overall_error, 3) == round(error, 3) class TestAverageAngleSpectralMapper: @pytest.mark.parametrize( 'y_true, y_pred', [ (np.random.uniform(0, 1, (10, 10)), np.random.uniform(0, 1, (10, 10))), (np.random.uniform(0, 1, (10, 2)), np.random.uniform(0, 1, (10, 2))), (np.random.uniform(0, 1, (10, 1)), np.random.uniform(0, 1, (10, 1))) ]) def test_aSAM_with_external_implementations(self, y_true: np.ndarray, y_pred: np.ndarray): y_true, y_pred = softmax(y_true), softmax(y_pred) tf_y_true, tf_y_pred = tf.convert_to_tensor(y_true), tf.convert_to_tensor(y_pred) tf_error = average_angle_spectral_mapper(y_true=tf_y_true, y_pred=tf_y_pred).eval(session=sess) error = 0 for i in range(y_true.shape[0]): error += np.arccos(np.dot(y_true[i], y_pred[i]) / (np.linalg.norm(y_true[i]) * np.linalg.norm(y_pred[i]))) error /= y_true.shape[0] assert round(tf_error, 3) == round(error, 3)
from socket import * serverSocket = socket(AF_INET,SOCK_STREAM) serverSocket.bind(("",8899)) serverSocket.listen(5) clientSocket,clientInfo = serverSocket.accept() recvData = clientSocket.recv(1024) print ("%s:%s"%(str(clientInfo),recvData)) clientSocket.close() serverSocket.close()
"""Data manipulation tools for cognate detection.""" import numpy as np import itertools as it import collections import csv import lingpy from . import distances from . import ipa2asjp def clean_word(w): """Clean a string to reduce non-IPA noise.""" w = w.replace("-", "") w = w.replace(" ", "") w = w.replace("%", "") w = w.replace("~", "") w = w.replace("*", "") w = w.replace("$", "") w = w.replace("\"", "") w = w.replace("|", "") w = w.replace(".", "") w = w.replace("+", "") w = w.replace("·", "") w = w.replace("?", "") w = w.replace("’", "") w = w.replace("]", "") w = w.replace("[", "") w = w.replace("=", "") w = w.replace("_", "") w = w.replace("<", "") w = w.replace(">", "") w = w.replace("‐", "") w = w.replace("ᶢ", "") w = w.replace("C", "c") w = w.replace("K", "k") w = w.replace("L", "l") w = w.replace("W", "w") w = w.replace("T", "t") w = w.replace('dʒ͡', 'd͡ʒ') w = w.replace('ʤ', 'd͡ʒ') w = w.replace('Ɂ', 'Ɂ') return w def read_data_ielex_type(datafile, char_list=set(), cogids_are_cross_semantically_unique=False, data='ASJP'): """Read an IELex style TSV file.""" line_id = 0 data_dict = collections.defaultdict(lambda: collections.defaultdict()) cogid_dict = {} words_dict = collections.defaultdict(lambda: collections.defaultdict(list)) langs_list = [] # Ignore the header line of the data file. datafile.readline() for line in datafile: line = line.strip() arr = line.split("\t") lang = arr[0] concept = arr[2] cogid = arr[6] cogid = cogid.replace("-", "") cogid = cogid.replace("?", "") if data == 'ASJP': asjp_word = clean_word(arr[5].split(", ")[0]) else: raise NotImplementedError for ch in asjp_word: if ch not in char_list: char_list.add(ch) if len(asjp_word) < 1: continue data_dict[concept][line_id, lang] = asjp_word cogid_dict.setdefault(cogid if cogids_are_cross_semantically_unique else (cogid, concept), set()).add( (lang, concept, asjp_word)) words_dict[concept][lang].append(asjp_word) if lang not in langs_list: langs_list.append(lang) line_id += 1 return (data_dict, list(cogid_dict.values()), words_dict, langs_list, char_list) def read_data_cldf(datafile, sep="\t", char_list=set(), cogids_are_cross_semantically_unique=True, data='ASJP'): """Read a CLDF file in TSV or CSV format.""" reader = csv.DictReader( datafile, dialect='excel' if sep == ', ' else 'excel-tab') langs = set() data_dict = collections.defaultdict(lambda: collections.defaultdict()) cogid_dict = collections.defaultdict(lambda: collections.defaultdict()) words_dict = collections.defaultdict(lambda: collections.defaultdict(list)) for line, row in enumerate(reader): lang = row["Language ID"] langs.add(lang) if data == 'ASJP': try: asjp_word = clean_word(row["ASJP"]) except KeyError: asjp_word = ipa2asjp.ipa2asjp(row["IPA"]) elif data == 'IPA': asjp_word = tuple( lingpy.ipa2tokens(row["IPA"], merge_vowels=False)) else: asjp_word = row[data] if not asjp_word: continue for ch in asjp_word: if ch not in char_list: char_list.add(ch) concept = row["Feature ID"] cogid = row["Cognate Class"] data_dict[concept][line, lang] = asjp_word cogid_dict.setdefault(cogid if cogids_are_cross_semantically_unique else (cogid, concept), set()).add( (lang, concept, asjp_word)) words_dict[concept].setdefault(lang, []).append(asjp_word) return (data_dict, list(cogid_dict.values()), words_dict, list(langs), char_list) def read_data_lingpy(datafile, sep="\t", char_list=set(), cogids_are_cross_semantically_unique=True, data='ASJP'): """Read a Lingpy file in TSV or CSV format.""" reader = csv.DictReader( datafile, dialect='excel' if sep == ', ' else 'excel-tab') langs = set() data_dict = collections.defaultdict(collections.defaultdict) cogid_dict = {} words_dict = collections.defaultdict(lambda: collections.defaultdict(list)) for line, row in enumerate(reader): lang = row.get("DOCULECT_ID", row["DOCULECT"]) langs.add(lang) if data == 'ASJP': try: asjp_word = clean_word(row["ASJP"]) except KeyError: asjp_word = ipa2asjp.ipa2asjp(row["IPA"]) elif data == 'IPA': asjp_word = tuple(ipa2asjp.tokenize_word_reversibly( clean_word(row["IPA"]))) else: asjp_word = row[data] if not asjp_word: continue for ch in asjp_word: if ch not in char_list: char_list.add(ch) concept = row["CONCEPT"] cogid = row["COGID"] data_dict[concept][line, lang] = asjp_word cogid_dict.setdefault(cogid if cogids_are_cross_semantically_unique else (cogid, concept), set()).add( (lang, concept, asjp_word)) words_dict[concept].setdefault(lang, []).append(asjp_word) return (data_dict, list(cogid_dict.values()), words_dict, list(langs), char_list) def calc_pmi(alignments, scores=None): """Calculate a pointwise mutual information dictionary from alignments. Given a sequence of pairwaise alignments and their relative weights, calculate the logarithmic pairwise mutual information encoded for the character pairs in the alignments. """ if scores is None: scores = it.cycle([1]) sound_dict = collections.defaultdict(float) count_dict = collections.defaultdict(float) for alignment, score in zip(alignments, scores): for a1, a2 in alignment: if a1 == "" or a2 == "": continue count_dict[a1, a2] += 1.0*score count_dict[a2, a1] += 1.0*score sound_dict[a1] += 2.0*score sound_dict[a2] += 2.0*score log_weight = 2 * np.log(sum(list( sound_dict.values()))) - np.log(sum(list( count_dict.values()))) for (c1, c2) in count_dict.keys(): m = count_dict[c1, c2] #assert m > 0 num = np.log(m) denom = np.log(sound_dict[c1]) + np.log(sound_dict[c2]) val = num - denom + log_weight count_dict[c1, c2] = val return count_dict class OnlinePMITrainer: """Train a PMI scorer step-by-step on always improving alignments.""" def __init__(self, margin=1.0, alpha=0.75, gop=-2.5, gep=-1.75): """Create a persistent aligner object. margin: scaling factor for scores alpha: Decay in update weight (must be between 0.5 and 1) gop, gep: Gap opening and extending penalty. gop=None uses character-dependent penalties. """ self.margin = margin self.alpha = alpha self.n_updates = 0 self.pmidict = collections.defaultdict(float) self.gep = gep self.gop = gop def align_pairs(self, word_pairs, local=False): """Align a list of word pairs, removing those that align badly.""" algn_list, scores = [], [] n_zero = 0 for w in range(len(word_pairs)-1, -1, -1): ((c1, l1, w1), (c2, l2, w2)) = word_pairs[w] s, alg = distances.needleman_wunsch( w1, w2, gop=self.gop, gep=self.gep, lodict=self.pmidict, local=local) if s <= self.margin: n_zero += 1 word_pairs.pop(w) continue algn_list.append(alg) scores.append(s) self.update_pmi_dict(algn_list, scores=scores) return algn_list, n_zero def update_pmi_dict(self, algn_list, scores=None): eta = (self.n_updates + 2) ** (-self.alpha) for k, v in calc_pmi(algn_list, scores).items(): pmidict_val = self.pmidict.get(k, 0.0) self.pmidict[k] = (eta * v) + ((1.0 - eta) * pmidict_val) self.n_updates += 1 class MaxPairDict(dict): """A maximum-of-pairs lookup dictionary. Multiple options must be given in a tuple, for historical reasons. (A set would be much nice, because it only contains hashables but isn't itself hashable, so there would be no danger of confusion. >>> m = MaxPairDict({(1, 1): 2, (1, 0): 1, (0, 0): 0}) >>> m[(1, 1)] 2 >>> m[((0, 1), 0)] 1 >>> m[((0, 1), (0, 1))] Traceback (most recent call last): ... KeyError: (0, 1) """ def __getitem__(self, key): """Return the maximum value among all pairs given. x.__getitem__(y) <=> x[y] """ key1, key2 = key max_val = -float('inf') if type(key1) != tuple: key1 = [key1] if type(key2) != tuple: key2 = [key2] for k1 in key1: for k2 in key2: v = dict.__getitem__(self, (k1, k2)) if v > max_val: max_val = v return max_val def get(self, key, default=None): """Return m[k] if k in m, otherwise default (None). Ideally, at some point, this will work: >>> m = MaxPairDict({(1, 1): 2, (1, 0): 1, (0, 0): 0}) >>> m.get(((0, 1), (0, 1))) 2 Currently, this returns None, because one of the values cannot be found. """ try: return self[key] except KeyError: return default def multi_align( similarity_sets, guide_tree, pairwise=distances.needleman_wunsch, **kwargs): """Align multiple sequences according to a give guide tree.""" languages = {leaf.name: leaf for leaf in guide_tree.get_leaves()} for s, similarityset in enumerate(similarity_sets): for (language, concept, form) in similarityset: try: leaf = languages[language] except KeyError: continue try: leaf.forms except AttributeError: leaf.forms = {} leaf.forms.setdefault(s, []).append( ((language, ), (concept, ), tuple((x, ) for x in form))) for node in guide_tree.walk('postorder'): print(node.name) try: entries_by_group = node.forms except AttributeError: entries_by_group = {} for child in node.descendants: try: for group, alignment in child.alignment.items(): entries_by_group.setdefault(group, []).append(alignment) except AttributeError: pass aligned_groups = {} for group in entries_by_group: forms = entries_by_group[group] already_aligned = None for (new_languages, new_concepts, new_alignment) in forms: if not already_aligned: languages = new_languages concepts = new_concepts already_aligned = new_alignment else: gap1 = ('', ) * len(languages) gap2 = ('', ) * len(new_alignment[0]) languages += new_languages concepts += new_concepts print("Aligning:") print(already_aligned) print(new_alignment) s, combined_alignment = pairwise( already_aligned, new_alignment, **kwargs) print(combined_alignment) already_aligned = tuple( (x if x else gap1) + (y if y else gap2) for x, y in combined_alignment) print(already_aligned) aligned_groups[group] = languages, concepts, already_aligned node.alignment = aligned_groups return node.alignment
# Generated by Django 2.0 on 2018-07-30 19:26 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('blog', '0003_remove_post_image'), ] operations = [ migrations.AddField( model_name='post', name='image', field=models.ImageField(default=1, upload_to='img'), preserve_default=False, ), ]
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'enter_ques.ui' # # Created by: PyQt4 UI code generator 4.11.4 # # WARNING! All changes made in this file will be lost! from PyQt4 import QtCore, QtGui from st_entry import Ui_MainWindowStent import urllib2 import urllib try: _fromUtf8 = QtCore.QString.fromUtf8 except AttributeError: def _fromUtf8(s): return s try: _encoding = QtGui.QApplication.UnicodeUTF8 def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig, _encoding) except AttributeError: def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig) class Ui_MainWindowEques(object): ##############################init enter ques############################### def setdta(self,oid,opas,tid,ques,typ): self.oid = oid self.opas = opas self.tid = tid self.ques = ques self.qno =1 self.typ=typ ########################################################################## ################################enter questions########################### def entques(self): ques = self.textEdit.toPlainText() op1 = self.textEdit_2.toPlainText() op2 = self.textEdit_3.toPlainText() op3 = self.textEdit_4.toPlainText() op4 = self.textEdit_5.toPlainText() mrks = self.spinBox.value() ans = self.spinBox_2.value() tid = self.tid if self.qno<=self.ques: url = 'http://localhost/quiz/enterques.php' values = {'tid':tid, 'qno':self.qno, 'ques':ques, 'op1':op1, 'op2':op2, 'op3':op3, 'op4':op4, 'ans':ans, 'mrks':mrks} data = urllib.urlencode(values) req = urllib2.Request(url,data) x = urllib2.urlopen(req) print "Saved Question",self.qno self.qno+=1 else : print "Questions completed" styp = self.typ if self.typ==0: print "enter students" url = 'http://localhost/quiz/createtable.php' values = {'tid':tid, 'ques':self.ques} data = urllib.urlencode(values) req = urllib2.Request(url,data) x = urllib2.urlopen(req) print x.read() app = QtGui.QApplication.instance() app.closeAllWindows() self.stwin = QtGui.QMainWindow() self.ui = Ui_MainWindowStent() self.ui.setupUiStent(self.stwin) self.ui.ldta(tid,styp) self.stwin.show() else: url = 'http://localhost/quiz/createtable.php' values = {'tid':tid, 'ques':ques} data = urllib.urlencode(values) req = urllib2.Request(url,data) x = urllib2.urlopen(req) print x.read() app = QtGui.QApplication.instance() app.closeAllWindows() ########################################################################## def setupUiEques(self, MainWindow): MainWindow.setObjectName(_fromUtf8("MainWindow")) MainWindow.resize(800, 500) MainWindow.setMinimumSize(QtCore.QSize(800, 500)) MainWindow.setMaximumSize(QtCore.QSize(800, 500)) self.centralwidget = QtGui.QWidget(MainWindow) self.centralwidget.setObjectName(_fromUtf8("centralwidget")) self.label = QtGui.QLabel(self.centralwidget) self.label.setGeometry(QtCore.QRect(350, 110, 191, 21)) font = QtGui.QFont() font.setPointSize(12) font.setBold(True) font.setWeight(75) self.label.setFont(font) self.label.setObjectName(_fromUtf8("label")) self.label_5 = QtGui.QLabel(self.centralwidget) self.label_5.setGeometry(QtCore.QRect(10, 10, 781, 91)) self.label_5.setText(_fromUtf8("")) self.label_5.setPixmap(QtGui.QPixmap(_fromUtf8("logo.png"))) self.label_5.setObjectName(_fromUtf8("label_5")) self.label_2 = QtGui.QLabel(self.centralwidget) self.label_2.setGeometry(QtCore.QRect(20, 170, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_2.setFont(font) self.label_2.setObjectName(_fromUtf8("label_2")) self.label_3 = QtGui.QLabel(self.centralwidget) self.label_3.setGeometry(QtCore.QRect(20, 260, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_3.setFont(font) self.label_3.setObjectName(_fromUtf8("label_3")) self.label_4 = QtGui.QLabel(self.centralwidget) self.label_4.setGeometry(QtCore.QRect(410, 260, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_4.setFont(font) self.label_4.setObjectName(_fromUtf8("label_4")) self.label_6 = QtGui.QLabel(self.centralwidget) self.label_6.setGeometry(QtCore.QRect(20, 330, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_6.setFont(font) self.label_6.setObjectName(_fromUtf8("label_6")) self.label_7 = QtGui.QLabel(self.centralwidget) self.label_7.setGeometry(QtCore.QRect(410, 330, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_7.setFont(font) self.label_7.setObjectName(_fromUtf8("label_7")) self.label_8 = QtGui.QLabel(self.centralwidget) self.label_8.setGeometry(QtCore.QRect(20, 400, 81, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_8.setFont(font) self.label_8.setObjectName(_fromUtf8("label_8")) self.label_9 = QtGui.QLabel(self.centralwidget) self.label_9.setGeometry(QtCore.QRect(410, 400, 101, 21)) font = QtGui.QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.label_9.setFont(font) self.label_9.setObjectName(_fromUtf8("label_9")) self.pushButton = QtGui.QPushButton(self.centralwidget) self.pushButton.setGeometry(QtCore.QRect(370, 430, 75, 23)) self.pushButton.setObjectName(_fromUtf8("pushButton")) ###########################save ques################################## self.pushButton.clicked.connect(self.entques) ###################################################################### self.textEdit = QtGui.QTextEdit(self.centralwidget) self.textEdit.setGeometry(QtCore.QRect(90, 150, 681, 81)) self.textEdit.setObjectName(_fromUtf8("textEdit")) self.textEdit_2 = QtGui.QTextEdit(self.centralwidget) self.textEdit_2.setGeometry(QtCore.QRect(90, 250, 301, 51)) self.textEdit_2.setObjectName(_fromUtf8("textEdit_2")) self.textEdit_3 = QtGui.QTextEdit(self.centralwidget) self.textEdit_3.setGeometry(QtCore.QRect(470, 250, 301, 51)) self.textEdit_3.setObjectName(_fromUtf8("textEdit_3")) self.textEdit_4 = QtGui.QTextEdit(self.centralwidget) self.textEdit_4.setGeometry(QtCore.QRect(90, 320, 301, 51)) self.textEdit_4.setObjectName(_fromUtf8("textEdit_4")) self.textEdit_5 = QtGui.QTextEdit(self.centralwidget) self.textEdit_5.setGeometry(QtCore.QRect(470, 320, 301, 51)) self.textEdit_5.setObjectName(_fromUtf8("textEdit_5")) self.spinBox = QtGui.QSpinBox(self.centralwidget) self.spinBox.setGeometry(QtCore.QRect(90, 400, 42, 22)) self.spinBox.setObjectName(_fromUtf8("spinBox")) self.spinBox_2 = QtGui.QSpinBox(self.centralwidget) self.spinBox_2.setGeometry(QtCore.QRect(530, 400, 42, 22)) self.spinBox_2.setObjectName(_fromUtf8("spinBox_2")) MainWindow.setCentralWidget(self.centralwidget) self.menubar = QtGui.QMenuBar(MainWindow) self.menubar.setGeometry(QtCore.QRect(0, 0, 800, 21)) self.menubar.setObjectName(_fromUtf8("menubar")) MainWindow.setMenuBar(self.menubar) self.statusbar = QtGui.QStatusBar(MainWindow) self.statusbar.setObjectName(_fromUtf8("statusbar")) MainWindow.setStatusBar(self.statusbar) self.retranslateUi(MainWindow) QtCore.QMetaObject.connectSlotsByName(MainWindow) def retranslateUi(self, MainWindow): MainWindow.setWindowTitle(_translate("MainWindow", "Vision - Enter Questions", None)) self.label.setText(_translate("MainWindow", "Enter Questions", None)) self.label_2.setText(_translate("MainWindow", "Question", None)) self.label_3.setText(_translate("MainWindow", "Option 1", None)) self.label_4.setText(_translate("MainWindow", "Option 2", None)) self.label_6.setText(_translate("MainWindow", "Option 3", None)) self.label_7.setText(_translate("MainWindow", "Option 4", None)) self.label_8.setText(_translate("MainWindow", "Marks", None)) self.label_9.setText(_translate("MainWindow", "Correct Option", None)) self.pushButton.setText(_translate("MainWindow", "Next", None)) if __name__ == "__main__": import sys app = QtGui.QApplication(sys.argv) MainWindow = QtGui.QMainWindow() ui = Ui_MainWindow() ui.setupUi(MainWindow) MainWindow.show() sys.exit(app.exec_())
import pandas as pd import matplotlib.pyplot as plt import seaborn as sns sns.set() import statsmodels.api as sm import warnings warnings.filterwarnings('ignore') df = pd.read_csv('../csv_files/1.03. Dummies.csv') # print(df.drop(['Attendance'], axis=1)) f = lambda x: 1 if x == 'Yes' else 0 # df['Attendance_dummy'] = df['Attendance'].apply(f) df['Attendance_dummy'] = df['Attendance'].map({'Yes': 1, 'No': 0}) print(df) # print(df.describe()) print(df.columns) y = df.loc[:, 'GPA'] x1 = df.loc[:, ['SAT', 'Attendance_dummy']] x = sm.add_constant(x1) results = sm.OLS(y, x).fit().summary() print(results) plt.scatter(df['SAT'], y, c=df['Attendance_dummy'], cmap='jet') scatter = sns.regplot(df['SAT'], y, scatter=False) print([scatter.get_children()[3]]) # print(plt.gca().patches) yhat_yes = 0.8665 + 0.0014 * df['SAT'] yhat_no = 0.6439 + 0.0014 * df['SAT'] plt.plot(df['SAT'], yhat_yes, c='green') plt.plot(df['SAT'], yhat_no, c='red') plt.xlabel('SAT') plt.ylabel('GPA') plt.show()
import p44_random_tools as RT reload(RT) Nx = 100 k = np.arange(Nx,dtype='complex') x = np.arange(0,1,1./Nx) Ak = np.zeros(Nx,dtype='complex') odds = k.real%2 == 1 # -Nx keeps the normalization right, so F(x) = 1,0 # 1/np.pi is for the actual series. # 1j makes it a sign series. # Ak[0]=50 keeps the zero-point right (otherwise it's +- 1/2) Ak[odds] = -Nx/np.pi/k[odds]*1j #1/2 + 2./np.pi/k[odds] Ak[0] += 50 Ak = RT.symmetric(Ak) ax = np.fft.ifft(Ak) #tp = np.abs(ax) plt.clf() dumb_plt(plt,None,ax.real,'x','square','p44_square_test.pdf',c='r') dumb_plt(plt,None,ax.imag,'x','square','p44_square_test.pdf',c='g') #should be zero. Ak_phase = Ak*np.exp((np.pi/2+np.random.random(Nx))*1j) Ak_phase = RT.symmetric(Ak_phase) ax_phase = np.fft.ifft(Ak_phase) plt.clf() dumb_plt(plt,None,ax_phase.real,'x','square','p44_square_test_phase.pdf',c='r') dumb_plt(plt,None,ax_phase.imag,'x','square','p44_square_test_phase.pdf',c='g') #should be zero. plt.clf() plt.hist(ax.real,histtype='step',color='r') plt.hist(ax_phase.real,histtype='step',color='g') outname='p44_square_test_hist.pdf' plt.savefig(outname) print(outname) plt.clf() dumb_plt(plt,None,np.abs(Ak_phase[odds]),'k','Ampl(r)angle(g)','p44_square_test_phase_ampl.pdf',c='r') dumb_plt(plt,None,np.angle(Ak_phase[odds]),'k','Ampl(r)angle(g)','p44_square_test_phase_ampl.pdf',c='g')
from time import sleep def analisar(* val): mai = 'nenhum' print('~'*40) print('Analisando os valores passados...') for i, v in enumerate(val): print(v, end=' ') if i == 0 or v > mai: mai = v sleep(0.3) print(f'- Foram informados {len(val)} valores ao todo') print(f'O maior valor informado foi {mai}') input('Aperte enter para continuar') # Main analisar(2, 9, 4, 5, 7, 1) analisar(4, 7, 0) analisar(1, 2) analisar(6) analisar()
#!/usr/bin/env python from setuptools import setup # Lets makes ure we have the correct modules installed before continuing. # OpenSSL is required. def readme(): with open('README.rst') as f: return f.read() setup( name="pykeytool", version="0.2", description="pykeytool - IoT SC PKI Tool for Generating Keys and submitting csr's to IoT SC", long_description=readme(), url='http://github.com/wilsonstuart/pykeytool', packages=['pykeytool', ], zip_safe=False, install_requires=['pyopenssl', 'argparse', 'pyyaml', 'Crypto', 'PyKCS11', 'cryptography', 'asn1crypto', 'requests', 'pycryptodomex', 'cython'], classifiers=[ 'Development Status :: 3 - Alpha', 'Programming Language :: Python :: 3.6', 'Environment :: Console' 'Topic :: PKI', ], scripts=['scripts/generatekeyandcsr', 'scripts/generatepkcs12', 'scripts/generatecert'], data_files=[('config', ['config/config.ini', 'config/logging.ini']), ('raapi', []), ] )
import datetime import logging import time from urllib.parse import quote import uuid import requests from django.core.cache import cache from django.shortcuts import render, redirect from django.conf import settings from django.http import HttpResponse, HttpResponseRedirect from django.utils.encoding import force_text from django.utils.http import urlsafe_base64_decode from django.contrib.auth import login, logout, get_user_model, authenticate from django.contrib.auth.decorators import login_required from django.contrib import messages from django.urls import reverse from django.views import View from accounts.token_creator import TokenGenerator from .models import User from .forms import EditUserForm, UserRegistrationForm, UserAuthForm, UserPasswordSetupForm from .tasks import send_confirmation_email @login_required def personal_information(request): user = request.user context = { 'user': user } return render(request, 'accounts/personal_information.html', context) @login_required def edit_personal_information(request): user = request.user email = user.email if request.method == 'POST': form = EditUserForm(instance=user, data=request.POST, files=request.FILES) if form.is_valid(): form.save() if email == user.email: messages.success(request, "Information were successfully updated") else: # send_confirmation_email.delay(user.id) send_confirmation_email(user.id) messages.warning(request, "Information were successfully updated. Please confirm your email address " "to complete your registration. It's easy " "- just check your email and click on the confirmation link.") return redirect(reverse('personal_information')) else: form = EditUserForm(instance=user) context = { 'form': form } return render(request, 'accounts/edit_personal_information.html', context) def login_view(request): redirect_to = request.POST.get('next', request.GET.get('next', '')) do_redirect = False if request.user.is_authenticated: if redirect_to == request.path: raise ValueError('Redirection loop for authenticated user detected.') return redirect(reverse('homepage')) elif request.method == 'POST': login_form = UserAuthForm(request, data=request.POST) if login_form.is_valid(): login(request, login_form.get_user()) return redirect(reverse('homepage')) else: login_form = UserAuthForm(request) register_form = UserRegistrationForm() context = { 'register_form': register_form, 'login_form': login_form } return render(request, 'accounts/login.html', context) def register(request): from .forms import UserRegistrationForm if request.user.is_authenticated: return redirect(reverse('homepage')) if request.method == 'POST': register_form = UserRegistrationForm(request.POST) if register_form.is_valid(): user = register_form.save() user.backend = 'django.contrib.auth.backends.ModelBackend' login(request, user) # send_confirmation_email.delay(user.id) send_confirmation_email(user.id) messages.warning(request, "Thanks for joining Smart Contract! Please confirm your email address to complete your " "registration. It's easy - just check your email and click on the confirmation " "link.") return redirect(reverse('homepage')) else: register_form = UserRegistrationForm() login_form = UserAuthForm(request) context = { 'register_form': register_form, 'login_form': login_form } return render(request, 'accounts/login.html', context) @login_required def create_password(request): if request.method == 'POST': password_form = UserPasswordSetupForm(request.POST) if password_form.is_valid(): user = User.objects.get(pk=request.user.id) user.set_password(password_form.cleaned_data['password1']) messages.success(request, "Password was successfully set. Please, log in again") user.save() return redirect(reverse('personal_information')) else: password_form = UserPasswordSetupForm() context = { 'form': password_form } return render(request, 'accounts/password_create_form.html', context) def logout_view(request): _next = request.GET.get('next') logout(request) return redirect(_next if _next else settings.LOGOUT_REDIRECT_URL) def activate_view(request, uidb64, token): UserModel = get_user_model() try: uid = force_text(urlsafe_base64_decode(uidb64)) user = UserModel.objects.get(pk=uid) except(TypeError, ValueError, OverflowError, UserModel.DoesNotExist): user = None if user is not None and TokenGenerator().check_token(user, token): user.is_verified = True user.save() messages.success(request, "Thank you for confirming your email!") return redirect(reverse('index')) return HttpResponse('Activation link is invalid!')
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations class Migration(migrations.Migration): dependencies = [ ('profiles', '0012_auto_20141030_2158'), ] operations = [ migrations.CreateModel( name='message', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('sent_at', models.DateTimeField(auto_now_add=True)), ('seen', models.NullBooleanField(default=False)), ('recipient', models.ForeignKey(related_name=b'recieved_messages', verbose_name=b'Reciever', to='profiles.GlideProfile')), ('sender', models.ForeignKey(related_name=b'sent_messages', verbose_name=b'Sender', to='profiles.GlideProfile')), ], options={ }, bases=(models.Model,), ), ]
import tarfile import os for filename in os.listdir(): if filename.endswith(".tar.gz"): tar=tarfile.open(filename) name = tar.getnames() if os.path.isdir(file_name): pass else: os.mkdir(file_name) tar.extract(name, file_name + "_files/") # for root,dir,files in os.walk('/path/to/dir/'): # for file in files: # fullpath=os.path.join(root,file) # tar.add(fullpath,arcname=file) # tar.close() # t = tarfile.open("/path/to/your.tar", "r:") # t.extractall(path = '/path/to/extractdir/') # t.close() # def un_tar(file_name): # """untar zip file""" # tar = tarfile.open(file_name) # names = tar.getnames() # # 后面新建文件夹,先判断是否存在. # if os.path.isdir(file_name + "_files"): # pass # else: # os.mkdir(file_name + "_files") # #由于解压后是许多文件,预先建立同名文件夹 # for name in names: # tar.extract(name, file_name + "_files/") # tar.close() # # print(os.path.join(directory, filename))
#!/usr/bin/env python3 import sys import random VOCABFILE = 'hogwarts-houses-vocab.tsv' houses = {} with open(VOCABFILE) as vf: for line in vf: uri, name = line.strip().split('\t') houses[uri] = name namedata = [] for uri, house_name in houses.items(): housefn = house_name.lower() + ".txt" with open(housefn) as names: for name in names: namedata.append("{}\t{}".format(name.strip(), uri)) random.shuffle(namedata) for nameline in namedata: print(nameline)
import selenium.webdriver as webdriver from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.support import expected_conditions as EC from selenium.webdriver.common.by import By class taobao_infos: # 对象初始化 def __init__(self): self.url = "https://login.taobao.com/member/login.jhtml" options = webdriver.ChromeOptions() options.add_experimental_option("prefs", {"profile.managed_default_content_settings.images":2})#不加载图片,加快访问速度 options.add_experimental_option("excludeSwitches", ['enable-automation'])# 设置开发者模式,防止被各大网站识别出来使用了Selenium chrome_driver = r'/home/huizi/chromedriver' self.browser = webdriver.Chrome(executable_path=chrome_driver,options=options) self.wait = WebDriverWait(self.browser, 10) # 登录淘宝 def login(self): self.browser.get(self.url) print(self.browser.page_source) # filePath = r'/home/huizi/文档/weibo.html' # file = open(filePath,'w') # file.write(self.browser.page_source) # file.close() weibo_login = self.wait.until(EC.presence_of_element_located(( By.CSS_SELECTOR, '.weibo-login') )) weibo_login.click() weibo_username = self.wait.until(EC.presence_of_element_located( (By.NAME, 'username') )) weibo_username.send_keys(weibo_user) weibo_password = self.wait.until(EC.presence_of_element_located( (By.NAME, 'password') )) weibo_password.send_keys(weibo_pwd) weibo_success = self.wait.until(EC.presence_of_element_located( (By.CSS_SELECTOR, '.W_btn_g>span') )) weibo_success.click() # 由于淘宝的安全账户,导致无法登录,所以接下来无法操作 if __name__ == '__main__': weibo_user = '15668095291' weibo_pwd = 'youzi123' a = taobao_infos() a.login()
#!/usr/bin/python import copy import sys sys.setrecursionlimit(1000000) def check(word, arrs, count): warr = list(word) karrs = copy.copy(arrs) for c in warr: if c not in arrs: arrs[c] = 0 karrs[c] = 0 if karrs[c] == 0: return count karrs[c] = karrs[c] -1 arrs = copy.copy(karrs) return check(word, arrs, count+1) f = open('sample.txt', 'r') tc = int(f.readline()) #print tc for index in range(tc): result = "" strs = f.readline().rstrip() arr = list(strs) arrs = {} for c in arr: if c not in arrs: arrs[c] = 0 arrs[c] += 1 cnt = check("ZERO", arrs, 0) for k in range(cnt): result += "0" for c in list("ZERO"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("TWO", arrs, 0) for k in range(cnt): result += "2" for c in list("TWO"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("FOUR", arrs, 0) for k in range(cnt): result += "4" for c in list("FOUR"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("SIX", arrs, 0) for k in range(cnt): result += "6" for c in list("SIX"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("EIGHT", arrs, 0) for k in range(cnt): result += "8" for c in list("EIGHT"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("THREE", arrs, 0) for k in range(cnt): result += "3" for c in list("THREE"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("FIVE", arrs, 0) for k in range(cnt): result += "5" for c in list("FIVE"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("ONE", arrs, 0) for k in range(cnt): result += "1" for c in list("ONE"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("SEVEN", arrs, 0) for k in range(cnt): result += "7" for c in list("SEVEN"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 cnt = check("NINE", arrs, 0) for k in range(cnt): result += "9" for c in list("NINE"): if c in arrs and arrs[c] > 0: arrs[c] = arrs[c] -1 res = list(result) res.sort() result = ''.join(res) print "CASE #" + str(index+1) + ": " + result
# Generated by Django 2.2 on 2019-04-10 12:41 from django.db import migrations, models import django.db.models.deletion import phonenumber_field.modelfields class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='User', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('password', models.CharField(max_length=128, verbose_name='password')), ('last_login', models.DateTimeField(blank=True, null=True, verbose_name='last login')), ('email', models.EmailField(max_length=255, unique=True)), ('active', models.BooleanField(default=True)), ('officer', models.BooleanField(default=False)), ('admin', models.BooleanField(default=False)), ], options={ 'abstract': False, }, ), migrations.CreateModel( name='District', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=200)), ], ), migrations.CreateModel( name='Parish', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=200)), ], ), migrations.CreateModel( name='Session', fields=[ ('session_id', models.AutoField(choices=[('2018A', '2018A'), ('2018B', '2018B'), ('2018C', '2018C')], primary_key=True, serialize=False)), ('area', models.IntegerField(verbose_name='eg 2ac')), ('harvest', models.IntegerField(verbose_name='eg 5000kg')), ], ), migrations.CreateModel( name='Village', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(help_text='village name', max_length=40)), ('parish', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.Parish')), ], ), migrations.CreateModel( name='Subcounty', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=200)), ('district', models.ForeignKey(null=True, on_delete=django.db.models.deletion.CASCADE, to='accounts.District')), ], ), migrations.CreateModel( name='Report', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('farm_area', models.CharField(choices=[('2.0 AC', '1-5 AC'), ('2.0 AC', '2.0 AC')], max_length=20)), ('rice_type', models.CharField(choices=[('K', 'Kaiso'), ('S', 'Super'), ('T', 'Tilda')], max_length=1)), ('sowing_type', models.CharField(max_length=100)), ('planting_type', models.CharField(max_length=100)), ('levelling', models.CharField(choices=[('B', 'Bad'), ('F', 'Fair'), ('G', 'Good')], max_length=1)), ('rigde', models.CharField(choices=[('B', 'Bad'), ('F', 'Fair'), ('G', 'Good')], max_length=1)), ('watercourse_state', models.CharField(choices=[('B', 'Bad'), ('F', 'Fair'), ('G', 'Good')], max_length=1)), ('fertilizer', models.BooleanField(choices=[(True, 'Yes'), (False, 'No')])), ('fertilizer_1_type', models.CharField(max_length=80)), ('fertilizer_1_amount', models.IntegerField()), ('fertilizer_2_type', models.CharField(max_length=80)), ('fertilizer_2_amount', models.IntegerField()), ('weed_condition', models.CharField(choices=[('B', 'Bad'), ('F', 'Fair'), ('G', 'Good')], max_length=1)), ('harvest_date', models.DateField()), ('session_id', models.ForeignKey(choices=[('2018A', '2018A'), ('2018B', '2018B'), ('2018C', '2018C')], on_delete=django.db.models.deletion.CASCADE, to='accounts.Session')), ], ), migrations.AddField( model_name='parish', name='sub_county', field=models.ForeignKey(null=True, on_delete=django.db.models.deletion.CASCADE, to='accounts.Subcounty'), ), migrations.CreateModel( name='Officer', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(help_text='Enter your full name', max_length=40)), ('login_id', models.CharField(help_text='Unique ID for every officer', max_length=255, unique=True)), ('password', models.CharField(max_length=8)), ('phone_number', phonenumber_field.modelfields.PhoneNumberField(max_length=128, region=None, unique=True)), ('district_id', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.District')), ('subcounty_id', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.Subcounty')), ], ), migrations.CreateModel( name='Farmer', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(help_text='enter your full name', max_length=40)), ('gender', models.CharField(choices=[('M', 'Male'), ('F', 'Female')], max_length=1)), ('birth_year', models.DateField(help_text='date of birth')), ('marriage', models.CharField(blank=True, choices=[('M', 'Married'), ('S', 'Single'), ('D', 'Divorced')], max_length=1)), ('language', models.CharField(blank=True, choices=[('LUGANDA', 'Luganda'), ('LUSOGA', 'Lusoga'), ('ACHOLI', 'Acholi'), ('RUNYANKOLE', 'Runyankole')], max_length=50)), ('phone_number', phonenumber_field.modelfields.PhoneNumberField(max_length=128, region=None, unique=True)), ('photo', models.FileField(upload_to='images/')), ('community_status', models.CharField(blank=True, choices=[('MOBILIZER', 'Mobilizer'), ('CHAIRMAN', 'Chairman'), ('OTHER_ROLES', 'Other_roles')], max_length=60)), ('instructor_possibility', models.BooleanField(choices=[(True, 'Yes'), (False, 'No')])), ('crop_type', models.CharField(choices=[('POTATO', 'Potato'), ('MAIZE', 'Maize'), ('BEANS', 'Bean'), ('RICE', 'Rice')], max_length=40)), ('district_id', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.District')), ('parish', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.Parish')), ('subcounty_id', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.Subcounty')), ('village', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='accounts.Village')), ], ), ]
from abc import ABC, abstractmethod class SpikeElement(ABC): # Abstract methods @staticmethod @abstractmethod def get_installed_spif_cls_list(): pass @staticmethod @abstractmethod def get_display_name_from_spif_class(spif_class): pass @abstractmethod def run(self, payload, next_elem): pass @property @abstractmethod def display_name(self): pass @property @abstractmethod def display_icon(self): pass # Concrete base class methods def __init__(self, spif_class): self._spif_class = spif_class self._param_list = None @property def spif_class(self): return self._spif_class @property def param_list(self): return self._param_list @param_list.setter def param_list(self, param_list): self._param_list = param_list
#!/usr/bin/python # coding:utf-8 import os import cv2 import random import numpy as np from ctools.basic_func import get_all_files for j, left_right in enumerate(["left", "right"]): for area in range(5): # area = 0 # image_dir = "/media/cobot/5C8B2D882D247B561/project_data/screw_miss/1217" # image_dir = "/media/cobot/94584AF0584AD0A2/data/_0normal_images/" + left_right + "/20190309" # image_dir = "/home/cobot/Desktop/_3miss_screw/" + left_right + "" image_dir = "/home/cobot/Desktop/temp/" + left_right + "" output_dir = "/home/cobot/Desktop/temp" # get rois roi_length = 128 rois = [] mask = cv2.imread( "/home/cobot/caid2.0/data/deploy/mobile_phone_screw/templates/miss_screw/masks_" + left_right + "/mask" + str( area) + ".bmp", 0) bool_img = cv2.threshold(mask, 254, 255, cv2.THRESH_BINARY) # _, labels, stats, centroids = cv2.connectedComponentsWithStats(bool_img[1]) _, labels, stats, centroids = cv2.connectedComponentsWithStatsWithAlgorithm(bool_img[1], 8, cv2.CV_16U, cv2.CCL_WU) batch = len(centroids) for centers, stat in zip(centroids, stats): if stat[4] < 500000: rois = rois + [centers[::-1] - roi_length / 2] # rois = rois + [centers[::-1]] # # # if True: # for k, centers in enumerate(rois): # cv2.circle(mask, (centers[1].astype(np.int), centers[0].astype(np.int)), 100, (255, 255, 255), 10) # # cv2.putText(mask, "xx" + str(k), (centers[1].astype(np.int), centers[0].astype(np.int)), # # cv2.FONT_HERSHEY_SIMPLEX, 20.0, (255, 255, 255), # # lineType=cv2.LINE_AA) # # cv2.imwrite("xxx.png", mask) files = get_all_files(image_dir) random.shuffle(files) files = files[0:50] for k, file_name in enumerate(files): print(str(k) + ":" + file_name) image = cv2.imread(os.path.join(image_dir, file_name))[:, (4 - area) * 1550:((4 - area) * 1550 + 1520), :] # for k, centers in enumerate(rois): # cv2.circle(image, (centers[1].astype(np.int), centers[0].astype(np.int)), 100, (255, 255, 255), 10) # # cv2.putText(mask, "xx" + str(k), (centers[1].astype(np.int), centers[0].astype(np.int)), # # cv2.FONT_HERSHEY_SIMPLEX, 20.0, (255, 255, 255), # # lineType=cv2.LINE_AA) # cv2.imshow("xx", image) # cv2.waitKey(); # image, M = image_correct(template, image) for k, roi in enumerate(rois): roi = roi.astype(np.int) patch = image[roi[0]:roi[0] + roi_length, roi[1]:roi[1] + roi_length] full_path = os.path.join(output_dir, str(j) + str(area) + "_" + str(k) + os.sep + file_name.split(os.sep)[-1]) if not os.path.exists(os.path.dirname(full_path)): os.mkdir(os.path.dirname(full_path)) cv2.imwrite(full_path, patch)
#!/usr/bin/env python # coding: utf-8 # In[17]: import numpy as np import pandas as pd import matplotlib.pyplot as plt import seaborn as sns get_ipython().run_line_magic('matplotlib', 'inline') # In[25]: df = pd.read_csv('student-mat.csv') df.head() # In[20]: sns.set(style = 'white') g = sns.lmplot(y='Walc', x='age', hue='sex', data = df) g.set_ylabels('Weekly Alcohol Consumption') g.set_xlabels('Age') plt.show() # In[27]: sns.set(style = 'dark') g = sns.catplot(x = 'age', y = 'Walc', hue = 'sex', data = df, kind= 'bar') plt.show() # In[32]: sns.set(style = 'darkgrid') g = sns.boxplot(x = 'age', y = 'Walc', hue = 'sex', data = df) sns.despine(offset=10, trim=True) plt.show() # In[33]: sns.set(style="whitegrid") g = sns.pointplot(x="age", y="Walc", hue="sex", data=df, kind="strip", palette="pastel",ci=95,dodge=True,join=False) plt.show() # In[ ]:
""" Features 1. if title contain special 2. if title contain number (usually phone number) 3. """ from digoie.domain.docs.parser import doc_url from digoie.domain.docs.parser import doc_title from digoie.domain.docs.parser import doc_body class Doc(object): # URL = None; # TITLE = None; # BODY = None; def __init__(self, url, title, body): self.url = url self.title = title self.body = body # self. content needed for further process self.initialize() def initialize(self): """ initialize main conent of doc """ # doc_url.parse(self.url) doc_title.parse(self.title) # if self.body: # words, tags = doc_body.parse(self.body) def parse_title(self, title): pass def parse_body(self, body): pass
import uuid from rest_framework import status from rest_framework.decorators import api_view, parser_classes from rest_framework.response import Response from rest_framework.parsers import FormParser, MultiPartParser from .models import products, attributes from .serializers import productsSerializers, attributesSerializers from django.core.cache import cache @api_view(['GET']) def overview(request): api_urls = { 'List': 'products/list/', 'Detail View': 'products/detail/<str:pk>/', 'Create': 'products/create/', 'Create From List': 'products/create_list/', 'Update': 'products/update/<str:pk>/', 'Delete': 'products/delete/<str:pk>/', } return Response(api_urls) @api_view(['GET']) def get(request): product = products.objects.all() searlizer = productsSerializers(product, many=True) return Response(searlizer.data) @api_view(['GET']) def get_one(request, key): product = products.objects.get(id=key) searlizer = productsSerializers(product, many=False) return Response(searlizer.data) @api_view(['POST']) def post(request): sObj = products.if_not_exists().create(id=uuid.uuid4(), attributes=request.data) return Response(sObj, status=status.HTTP_201_CREATED) @api_view(['POST']) def post_list(request): if len(request.data) > 0: _products = [] for data in request.data: uid = str(uuid.uuid4()) tup = (uid, data) _products.append(tup) sObj = products.if_not_exists().create(id=uuid.uuid4(), attributes=dict(_products)) return Response(sObj, status=status.HTTP_201_CREATED) else: return Response("Empty List Noy Allowed", status=status.HTTP_204_NO_CONTENT) @api_view(['POST']) def update(request, key): sObj = products.objects(id=key).if_exists().update(attributes=request.data) return Response(sObj, status=status.HTTP_201_CREATED) @api_view(['DELETE']) def delete(request, key): res = products.objects.get(id=key) res.delete() return Response('Item succsesfully delete!') @api_view(['GET']) def attributes_overview(request): api_urls = { 'List': 'attributes/list/', 'Detail View': 'attributes/detail/<str:pk>/', 'Create': 'attributes/create/', 'Update': 'attributes/update/<str:pk>/', 'Delete': 'attributes/delete/<str:pk>/', } return Response(api_urls) @api_view(['GET']) def attributes_get(request): attribute = attributes.objects.all() searlizer = attributesSerializers(attribute, many=True) return Response(searlizer.data) @api_view(['GET']) def attributes_get_one(request, key): print(cache.get(key)) # Here is How you can get cache. attribute = attributes.objects.get(id=key) searlizer = attributesSerializers(attribute, many=False) return Response(searlizer.data) @api_view(['POST']) @parser_classes([FormParser, MultiPartParser]) def attributes_post(request): sObj = attributes.if_not_exists().create(id=uuid.uuid4(), name=request.data['name']) cache.set(sObj.id, sObj.name) # Setting Cache return Response(sObj, status=status.HTTP_201_CREATED) @api_view(['POST']) @parser_classes([FormParser, MultiPartParser]) def attributes_update(request, key): sObj = attributes.objects(id=key).if_exists().update(name=request.data['name']) cache.set(key, request.data['name']) # Updating Cache return Response('Updated', status=status.HTTP_202_ACCEPTED) @api_view(['DELETE']) def attributes_delete(request, key): res = attributes.objects.get(id=key) res.delete() return Response('Item Succsesfully Deleteted!')
import chess import encode import copy import util import numpy as np import scoring # wrapper for chess board class Game: def __init__(self, board=None): if board is None: self.board = chess.Board() else: self.board = board self.key = None self.encoded = None self.valid_moves = None self.canon_val = None self.state = None self.state_map = {'*': 2, '1-0': 1, '0-1': -1, '1/2-1/2': 0} def get_encoded(self): if self.encoded is None: self.encoded = encode.encode_board(self.board) return self.encoded def get_key(self): if self.key is None: self.key = self.get_encoded().tobytes() return self.key def get_valid_moves(self): if self.valid_moves is None: self.valid_moves = set(map(lambda x: x.uci(), self.board.legal_moves)) return self.valid_moves def get_full_moves(self): return self.board.fullmove_number def get_mask(self): return encode.get_prob_mask(self.get_valid_moves()) def get_canon_val(self): if self.canon_val is None: self.canon_val = scoring.eval_board(self.board) return self.canon_val def reset_params(self): self.encoded = None self.state = None self.valid_moves = None self.key = None self.canon_val = None def make_move(self, uci): self.reset_params() self.board.push_uci(uci) def make_san_move(self, san): self.reset_params() self.board.push_san(san) def coord_to_move(self, ind): tup = np.unravel_index(ind, (8, 8, 76)) starting = (tup[0], tup[1]) starting_alg = encode.get_alg(starting) plane = tup[2] diff = encode.decode_dir(plane) if util.represents_int(diff[1]): final_char = '' diff1 = diff[0] diff2 = diff[1] else: final_char = diff[1] diff1 = 1 if self.board.turn else -1 diff2 = diff[0] ending = (tup[0] + diff1, tup[1] + diff2) ending_alg = encode.get_alg(ending) return starting_alg + ending_alg + final_char def get_game_state(self, cd=True): if self.state is None: self.state = self.state_map[self.board.result(claim_draw=cd)] return self.state def copy_game(self): return copy.deepcopy(self) def normalize(self): if not self.board.turn: return Game(self.board.mirror()) return self def move_and_normalize(self, uci): game = self.copy_game() game.make_move(uci) game = game.normalize() return game def copy_and_normalize(self): return self.copy_game().normalize() def early_rollout(self, value=None): if value is None: value = self.get_canon_val() player = 1 if self.board.turn else -1 if abs(value) < 0.01: return 0 elif value >= 0.01: return player else: return -player def check_resign(self, value=None, thresh=-0.8): if value is None: value = self.get_canon_val() player = 1 if self.board.turn else -1 if value < thresh: return -player else: return None
#!/usr/bin/env python3 """ Advent of Code 2017: Day # """ import os from shared.readdayinput import readdayinput def first_half(d): """ first half solver: """ d = d.split(',') away = 0 vert = 0 horzl = 0 horzr = 0 for step in d: if step == 'n': vert += 1 elif step == 's': vert -= 1 elif step == 'ne': horzr += 1 elif step == 'sw': horzr -= 1 elif step == 'nw': horzl += 1 elif step == 'se': horzl -= 1 temp = vert + horzr if temp > away: away = temp print(away) print("vert, horzr, horzl", vert, horzr, horzl) ''' ne = d.count('ne') n = d.count('n') s = d.count('s') nw = d.count('nw') se = d.count('se') sw = d.count('sw') vert = n - s horzr = ne - sw horzl = nw - se ''' print("vert, horzr, horzl", vert, horzr, horzl) result = None return result def second_half(dayinput): """ second half solver: """ lines = dayinput.split('\n') result = None return result def app(): """ runs day application """ dayinput = readdayinput() half_one = first_half(dayinput) half_two = second_half(dayinput) print(half_one, half_two) if __name__ == "__main__": """ MAIN APP """ app()
from django.contrib import admin from .models import User, Profile, Review, UserRecommendation # Register your models here. class UserAdmin(admin.ModelAdmin): readonly_fields = ('slug',) class ProfileAdmin(admin.ModelAdmin): readonly_fields = ('user',) class ReviewAdmin(admin.ModelAdmin): # fields = ('author',) readonly_fields = ('slug',) admin.site.register(User, UserAdmin) admin.site.register(Profile, ProfileAdmin) admin.site.register(Review, ReviewAdmin) admin.site.register(UserRecommendation)
import os import omise def create_token(): omise.api_public = os.getenv("OMISE_PKEY") token = omise.Token.create( name="Somchai Prasert", number="4242424242424242", expiration_month=10, expiration_year=2022, # city="Bangkok", # postal_code="10320", # security_code=123, ) return token if __name__ == '__main__': print create_token()
# Version 8.1.1 # ############################################################################ # OVERVIEW ############################################################################ # This file contains descriptions of the settings that you can use to # configure te alert action for PagerDuty. The TA writes to the PagerDuty # events API (v2). Details for values passed are described in # https://developer.pagerduty.com/docs/events-api-v2/trigger-events/ # Note that the TA will use the values passed: # first as tags to extract from the message # then as static values # and finally if niether yield a result it will fall back to the values # defined in the alert_actions.conf [pagerduty_events] param.pd_url = <string> * (Optional) The url called by the TA. To execute an update/resolve specify ...v2/change/enqueue * Default: https://events.pagerduty.com/v2/enqueue param.pd_key = <string> * (Required) The integration key for either the service or the the * account wide value. Default behaviour is to create suppressed alert * when the account wide key is used * Default: pd_key param.pd_dedup_key = <string> * (Optional) Used to deduplicate on the PagerDuty side. Repeated * alerts carrying this value will not create new incidents * Default: pd_dedup_key param.pd_source = <string> * (Required) The object about which this alert is being raised * * Default: pd_source param.pd_summary = <string> * (Required) The short description of the problem, < 1024 chars * * Default: pd_summary param.pd_severity = <string> * (Required) One of the ket PagerDuty values * critical, error, warning or info * * Default: pd_severity param.pd_link_text = <string> * (Optional) Ordered list of names for the link hrefs supplied * These will be displayed as hyperlinks in PagerDuty * Must match the number * Default: pd_link_text param.pd_link_href = <string> * (Optional) Ordered list of hyperlinks for this event * See link_text * Default: pd_link_href param.pd_class = <string> * (Optional) Class of the event * Default: pd_class param.pd_component = <string> * (Optional) Component is the parameter, eg CPU on host X * CPU is the component to the source 'host X' * Default: pd_component param.pd_group = <string> * (Optional) Major grouping, ie application/service * Default: pd_group
from configs import * import speech_recognition as sr from random import choice import pyttsx3 import datetime import sys from time import sleep as wait import webbrowser as wb def intro(): print('=============================================================================================') print('= version: ' + version, ' ' + name, 'assistant' ' made by' + creator, ' =') print('=============================================================================================') frase_intro = ('{} assistente, versão {} feito por {}'.format(name_to_talk, version, creator_to_talk) ) say(frase_intro) start() def restart(): print('.') wait(0.2) start() def desligar(): sys.exit() def reboot(): wait(0.2) intro() def say(tosay): engine = pyttsx3.init() engine.say(tosay) engine.runAndWait() def start(): while True: r = sr.Recognizer() with sr.Microphone() as fonte: print('ouvindo...') audio = r.listen(fonte) textc = r.recognize_google(audio, language='pt-br') text = textc.lower() print(text) try: engine = pyttsx3.init() #função boas vindas if text == str(name): #esse ouve o próprio nome dela e responde com um bom dia ou algo do tipo msg_boas_vindas = choice(l_boas_vindas) say(msg_boas_vindas) #função tocar música elif 'playlist' in text:#abre a playlist de muscia do usuário, pre definida em "configs" wb.open(playlist, new=2) #função dia elif 'dia' in text: #fala o dia print(dia) say(dia) #função horas elif 'horas' in text: #fala as horas print(hr) say(hr) #função piadas elif 'piada' in text: # lança a braba joke = (choice(l_piadas)) joke = choice(l_piadas) print (joke) say(joke) #função desligar elif 'desligar' in text: #desliga o sistema desligando = str('desligando em 3, 2, 1') print (desligando) engine.say(desligando) engine.runAndWait() desligar() #função reiniciar elif 'reiniciar' in text: #reinicia o sistema reiniciando = str('reiniciando em 3, 2, 1') print (reiniciando) engine.say(reiniciando) engine.runAndWait() reboot() elif 'fale' in text: texto_falar = text.replace('fale', '') say(texto_falar) elif 'pesquis' in text: site_pesquisar = text.replace('pesquis', '') say('pesquisando ' + site_pesquisar) wb.open('https://www.google.com/search?client=opera-gx&hs=5GZ&sxsrf=ALeKk02LWQxX_lhfnlTF6lCi_LYm0x5kqg%3A1601686367378&ei=X8t3X_LeFpPA5OUP0e6-WA&q={}&oq={}&gs_lcp=CgZwc3ktYWIQAzIHCAAQChDLATIECAAQHjoHCCMQ6gIQJzoECCMQJzoFCAAQsQM6CAguELEDEIMBOgIIADoFCC4QsQM6BAgAEAo6BggAEAoQHlD_EVjVH2COImgBcAB4AIABsgKIAdMJkgEHMC41LjAuMZgBAKABAaoBB2d3cy13aXqwAQrAAQE&sclient=psy-ab&ved=0ahUKEwiyiuDXmpfsAhUTILkGHVG3DwsQ4dUDCAw&uact=5'.format(site_pesquisar, site_pesquisar), new=2) elif text not in comandos: restart() except: restart() intro()
n = int(input()) if n in [1,3,5,7,8,10,12]: print(31) elif n in [4,6,9,11]: print(30) else: print(28)
from __future__ import print_function import os import sys import time import boto from boto.s3.key import Key from pymongo import MongoClient from pymongo.cursor import Cursor from pymongo.errors import AutoReconnect # Monkey-patch PyMongo to avoid throwing AutoReconnect # errors. We try to reconnect a couple times before giving up. def reconnect(f): # https://gist.github.com/aliang/1393029 def f_retry(*args, **kwargs): N_RECONNECT_TRIALS = 3 for i in range(N_RECONNECT_TRIALS): try: return f(*args, **kwargs) except AutoReconnect as e: print('Fail to execute %s [%s] (attempt %d/%d)' % ( f.__name__, e, i, N_RECONNECT_TRIALS), file=sys.stderr) time.sleep(1) raise RuntimeError('AutoReconnect failed. Fail to ' 'execute %s [%s]' % (f.__name__, e)) return f_retry Cursor._Cursor__send_message = reconnect(Cursor._Cursor__send_message) MongoClient._send_message = reconnect(MongoClient._send_message) MongoClient._send_message_with_response = reconnect(MongoClient._send_message_with_response) MongoClient._MongoClient__try_node = reconnect(MongoClient._MongoClient__try_node) def connect_mongo(): uri = 'mongodb://%s:%s@%s' % (os.environ['MONGO_USER'], os.environ['MONGO_PASSWORD'], os.environ['MONGO_URL']) client = MongoClient(uri, safe=True) cursor = getattr(client, os.environ['MONGO_DATABASE']) collection = getattr(cursor, os.environ['MONGO_COLLECTION']) return collection def upload_s3(prefix, filenames): conn = boto.connect_s3(os.environ['AWS_ACCESS_KEY_ID'], os.environ['AWS_SECRET_ACCESS_KEY']) bucket = conn.get_bucket(os.environ['AWS_S3_BUCKET_NAME']) for filename in filenames: if os.path.exists(filename): k = Key(bucket) k.key = os.path.join(prefix, filename) k.set_contents_from_filename(filename) else: print('%s does not exist!' % filename)
from ledger import messaging import coloredlogs, logging from errors.errors import ApiBadRequest, ApiInternalError coloredlogs.install() from addressing import addresser from protocompiled import payload_pb2 from transactions.common import make_header_and_batch async def send_float_account(**in_data): """ txn_key(sawtooth_signing.Signer): signer created from user zeroth public key batch_key(sawtooth_signing.Signer): signer created from QCI mnemonic zero private key, pancard(str): pancard of the user , phone_number(str): phone_number of the user, email(str): email of the user, claimed(bool): If this float account is claimed or not, claimed_by(str): Public key of the user for whom this float_acc transaction, create_asset_index(int): random key index at which the first asset was created, parent_pub(str): public key of the parent , parent_idx(str): Required to be appened to parent accoutn flt_key_inds, key_index, time=time.time(); indian_time=indian_time_stamp(), claimed_on(str): Date on which this flt account was claimed and converted to create account) """ inputs = [addresser.create_organization_account_address( account_id=in_data["parent_zero_pub"], index=0), addresser.float_account_address( account_id=in_data["txn_key"].get_public_key().as_hex(), index=in_data["parent_idx"] ) ] logging.info(f"THe account address for the parent on blockchain {inputs[0]}") logging.info(f"THe float account address for the user {inputs[1]}") outputs = [addresser.create_organization_account_address( account_id=in_data["parent_zero_pub"], index=0), addresser.float_account_address( account_id=in_data["txn_key"].get_public_key().as_hex(), index=in_data["parent_idx"] ) ] if in_data["child_zero_pub"]: child_address = addresser.child_account_address( account_id=in_data["child_zero_pub"], index=0 ) logging.info(f"CHILD address is {child_address}") inputs.append(child_address) outputs.append(child_address) logging.info(f"INPUTS ADDRESSES --<{inputs}>--") logging.info(f"OUTPUTS ADDRESSES --<{outputs}>--") float_account = payload_pb2.CreateFloatAccount( claimed_on=in_data["claimed_on"], org_name=in_data["org_name"], pancard=in_data["pancard"], gst_number=in_data["gst_number"], tan_number=in_data["tan_number"], phone_number=in_data["phone_number"], email=in_data["email"], claimed=in_data["claimed"], claimed_by=in_data["claimed_by"], create_asset_idxs=in_data["create_asset_idxs"], parent_idx=in_data["parent_idx"], time=in_data["time"], indian_time=in_data["indian_time"], parent_role=in_data["parent_role"], role=in_data["role"], parent_zero_pub=in_data["parent_zero_pub"], nonce=in_data["nonce"], nonce_hash=in_data["nonce_hash"], signed_nonce=in_data["signed_nonce"], child_zero_pub=in_data["child_zero_pub"] ) logging.info(float_account) logging.info(f"THe serialized protobuf for float_account is {float_account}") payload = payload_pb2.TransactionPayload( payload_type=payload_pb2.TransactionPayload.CREATE_FLOAT_ACCOUNT, create_float_account=float_account) transaction_ids, batches, batch_id, batch_list_bytes= make_header_and_batch( payload=payload, inputs=inputs, outputs=outputs, txn_key=in_data["txn_key"], batch_key=in_data["batch_key"]) logging.info(f"This is the batch_id {batch_id}") rest_api_response = await messaging.send( batch_list_bytes, in_data["config"]) try: result = await messaging.wait_for_status(batch_id, in_data["config"]) except (ApiBadRequest, ApiInternalError) as err: #await auth_query.remove_auth_entry(request.app.config.DB_CONN, request.json.get('email')) raise err return False, False return transaction_ids, batch_id
''' Created on 24/03/2013 @author: artavares This scripts writes a .csv file with the average values of user-selected fields from a sequence of SUMO output files. Example: duaIterate.py generated 100 tripinfo files: tripinfo_000.xml to tripinfo_099.xml, and the user wants to know the average travel time of each iteration ''' import xml.etree.ElementTree as ET import sys import os import csv from optparse import OptionParser import collections def average_results(options): ''' Averages the results of the given attributes of a xml file. The options object is configured according to parse_args() ''' if not options.iterations: print 'parameter -i/--iterations required.' exit() #data = collections.defaultdict(dict) #print options sep = options.separator.decode('string-escape') #opens output file and writes header outfile = open(options.output, 'w') fields = options.fields.split(',') #adds the first column (iteration) to the fields fields = ['it'] + fields outfile.write('#' + sep.join(fields) + '\n') for i in range(options.iterations): sys.stdout.write('Generating averages for iteration %d' % (i + 1) ) tripinfo_file = '%s%s.xml' % (options.prefix, str(i).zfill(3)) #parses the i-th tripinfo file tree = ET.parse(tripinfo_file) #initializes average data and sets the iteration number data = {f:0 for f in fields} data['it'] = i + 1 ftrips = full_trips_in_window(options.begin, options.end, tripinfo_file) print ': %d full trips in window (%d,%d)' % (len(ftrips), options.begin, options.end) #traverses the xml file, averaging the values of the fields parsed_elements = 0 for element in tree.getroot(): #skips vehicles who haven't completed trips within the time window if element.get('id') not in ftrips: continue #print element.attrib for f in fields[1:]: #print type(data[f]), type(element.get(f)), type(parsed_elements) data[f] = new_average(data[f], element.get(f), parsed_elements) parsed_elements += 1 #writes one line in the output places = ['%s' for f in fields] variables = [data[f] for f in fields] outfile.write((sep.join(places) + '\n') % tuple(variables)) print "Output file '%s' written." % options.output def new_average(old_avg, new_value, stepnum): #if old_avg == {}: # return new_value #old_avg = float(old_avg) #print new_value, old_avg, stepnum return ( (float(new_value) - float(old_avg)) / (stepnum + 1)) + old_avg def full_trips_in_window(begin, finish, tripinfo_file): ''' Returns a list with the ID of the drivers that made a full trip between begin and finish ''' if finish == 0: finish = sys.maxint rinfo_tree = ET.parse(tripinfo_file) fulltrips = [] #handles edge case: if finish == 0: finish = sys.maxint for vdata in rinfo_tree.getroot(): try: if float(vdata.get('depart')) >= begin and float(vdata.get('arrival')) <= finish: fulltrips.append(vdata.get('id')) except ValueError: print 'Warning: %s has no depart or arrival in %s, skipping...' % (vdata.get('id'), tripinfo_file) return fulltrips def parse_args(): parser = OptionParser() parser.add_option( '-o', '--output', type=str, default='avgresults.csv', help = 'output file' ) parser.add_option( '-b', '--begin', help='the start time of the time window', type=int, default=0 ) parser.add_option( '-e', '--end', help='the end time of the time window, 0=unlimited', type=int, default=0 ) parser.add_option( "-f", "--fields", default=None, type='str', help="the fields you want to output in the .csv file (field1,field2,field3,...)." ) parser.add_option( '-p', '--prefix', help='the prefix for the SUMO result files: [prefix]i.xml, where i is the iteration', type=str, default=None ) parser.add_option( '-i', '--iterations', help='the number of iterations to be read from inputs', type=int ) parser.add_option( '-s', '--separator', help='the separator for the output file', type=str, default=',' ) return parser.parse_args(sys.argv) if __name__ == '__main__': (options, args) = parse_args() average_results(options)
import requests # Para tipos de peliculas respuesta = requests.get(url='http://127.0.0.1:5000/type/all') if respuesta.ok: print(respuesta.json()) else: print('No hay respuesta') # Para tener lista de actores respuesta = requests.get(url='http://127.0.0.1:5000/actors/all') if respuesta.ok: print(respuesta.json()) else: print('No hay respuesta')
# Some utility methods for sets and dictionaries. In a better world these # could all be replaced by fold(). import copy import itertools def iterlen(iterator): return sum(1 for i in iterator) def intersection(sets): if len(sets) == 0: return set() base = copy.copy(sets[0]) for s in itertools.islice(sets, 1, None): base &= s return base def intersection_update(sets): if len(sets) == 0: return set() base = sets[0] for s in itertools.islice(sets, 1, None): base &= s return base def union(sets): base = set() for s in sets: base |= s return base def union_update(sets): if len(sets) == 0: return set() base = sets[0] for s in itertools.islice(sets, 1, None): base |= s return base def addAll(dicts): if len(dicts) == 0: return {} base = {} for d in dicts: base.update(d) return base def addAll_update(dicts): if len(dicts) == 0: return {} base = dicts[0] for d in itertools.islice(dicts, 1, None): base.update(d) return base
from scisoftpy.dictutils import DataHolder from scisoftpy.nexus.nxclasses import NXroot import scisoftpy as dnp import logging logger = logging.getLogger(__name__) def determineScannableContainingField(targetFieldname, scannables): for scn in scannables: fieldnames = list(scn.getInputNames()) + list(scn.getExtraNames()) if targetFieldname in fieldnames: return scn abbrevtarget = ".".join(targetFieldname.split(".")[1:]) for scn in scannables: fieldnames = list(scn.getInputNames()) + list(scn.getExtraNames()) if abbrevtarget in fieldnames: return scn for scn in scannables: if list(scn.getInputNames()) == [u'value'] and targetFieldname in scn.getName(): return scn raise KeyError('Neither targetFieldname "%s" nor abbrevtarget "%s" found in scannables: %s' % (targetFieldname, abbrevtarget, ['%r:%r+%r' % (scn.getName(), list(scn.getInputNames()), list(scn.getExtraNames())) for scn in scannables])) def getDatasetFromLoadedFile(loadedFile, fieldName, scanDataPointCache=None): ''' Gets a dataset called fieldName from an already loaded file see loadScanFile(scanOb) returns dataset ''' logger.debug('Getting data for %s, from %s (with cache=%s)', fieldName, loadedFile, scanDataPointCache) # Check if the field names are the full local names if so get just the last part of # the field names as this should be the node name. Keep original fieldname, it might # be useful later if '.' in fieldName: # with scnname.fieldname strip off scnname strippedFieldName = fieldName.split('.')[-1] else: # fieldname doesn't require stripping strippedFieldName = fieldName # If we have a scanDataPointCache use it for performance if(scanDataPointCache): positionsDataset = scanDataPointCache.getPositionsFor(strippedFieldName) if None in positionsDataset: raise KeyError("positionsDataset for field {} contains None/null entries".format(strippedFieldName)) return dnp.asarray(positionsDataset) # Check if its a NeXus file if isinstance(loadedFile, NXroot): # Note: Using first node returned, this might fail if there are multiple nodes with the same name! # Might be possible to disambiguate this using the original fieldname? loadedNodes = loadedFile.getnodes(strippedFieldName, group=False, data=True) if len(loadedNodes) == 0: raise KeyError("%s not found in data file" % strippedFieldName) # Find nodes which have a local_name probableNodes = [loadedNodes[_n] for _n in xrange(len(loadedNodes)) if 'local_name' in loadedNodes[_n].attrs] # Use the first local_name which matches the fieldName or fall back on using the first node for node in probableNodes: if node.attrs['local_name'] == fieldName: lazyDataset = node break else: lazyDataset = loadedNodes[0] # Use slicing to load the whole lazy dataset into a array i.e. non-lazy dataset dataset = lazyDataset[...] return dataset elif isinstance(loadedFile, DataHolder): datasetList = loadedFile[strippedFieldName] # Convert the dataset as a list into the array dataset = dnp.asarray(datasetList) return dataset # Not a supported file type else: print "The file format is not supported" print loadedFile.__class__ class Struct(object): def __init__(self): self.attrnames = [] def addAttribute(self, attrname, value): self.__dict__[attrname]=value self.attrnames.append(attrname) def __repr__(self): result = '' for attrname in self.attrnames: result += attrname + ' = ' + `self.__dict__[attrname]` + '\n' return result def __str__(self): return self.__repr__() def __getitem__(self, key): return self.__dict__[key] class ScanDataProcessorResult(object): """When viewed as a string this returns nice wordy results, otherwise it is a structure of the from: processor.abscissa = 'x' processor.ordinate = 'e1' processor.scn.x = 1 processor.scn.mie: i1, e1 = 3, 4 processor.field.x = 1 processor.field.i1 = 3 processor.field.e1 = 4 processor.result.fwhm = 2 processor.result.peak = 1 """ log = logger.getChild('ScanDataProcessorResult') def __init__(self, dataSetResult, lastScanFile, allscannables, xfieldname, yfieldname, scanDataPointCache=None): self.name = dataSetResult.processorName self.labelValuePairs = dataSetResult.resultsDict self.datasetProcessorReport = dataSetResult.report self.scanDataPointCache = scanDataPointCache xvalue = self.labelValuePairs[dataSetResult.keyxlabel] self.scn = Struct() self.field = Struct() self.result = Struct() # Give up here if there was a problem with the processor for val in self.labelValuePairs.values(): if val is None: self.scannableValues = None self.report = self.datasetProcessorReport self.str = self.datasetProcessorReport return # generate short report and determine scannable values at feature self.scannableValues = self.determineScannableValuesAtFeature(allscannables, lastScanFile, xfieldname, xvalue) self.str = '' # for __str__ and __repr__ # abscissa and ordinate fields: self.abscissa = xfieldname self.ordinate = yfieldname self.str += ' ' + self.name + ".abscissa = '%s'\n" % self.abscissa self.str += ' ' + self.name + ".ordinate = '%s'\n" % self.ordinate # abscissa and ordinate scannables: self.abscissa_scannable = determineScannableContainingField(xfieldname, allscannables) self.ordinate_scannable = determineScannableContainingField(yfieldname, allscannables) # feature location by scannable: for scn, value in self.scannableValues.items(): self.scn.addAttribute(scn.getName(), value) for scn in allscannables: try: self.str += ' ' + self.name + ".scn." + self.reportScannablePositionAtFeature(scn) + '\n' except: pass # feature location by field for scn, value in self.scannableValues.items(): fieldnames = list(scn.getInputNames()) + list(scn.getExtraNames()) scnpos = self.getScannableValueAtFeature(scn) try: scnpos = list(scnpos) except TypeError: # not a list scnpos = [scnpos] for fieldname, pos, format in zip(fieldnames, scnpos, scn.getOutputFormat()): self.field.addAttribute(fieldname, pos) formattedpos = 'None' if pos == None else format%pos self.str += ' ' + self.name + ".field." + fieldname + " = " + formattedpos + '\n' # results for label in dataSetResult.labelList: val = dataSetResult.resultsDict[label] self.result.addAttribute(label, val) self.str += ' ' + self.name + ".result." + label + " = " + str(val) + '\n' self.report = self.generateShortReport(dataSetResult) def generateShortReport(self, dataSetResult): # input names only on purpose! scn = self.abscissa_scannable if len(scn.getInputNames())==1: scnlabel = scn.getName() pos = self.scannableValues[scn] elif len(scn.getInputNames())>1: scnlabel = scn.getName() + "(" pos="(" for fieldname, fieldval in zip(scn.getInputNames(), self.scannableValues[scn]): scnlabel += fieldname + "," pos += str(fieldval) + "," scnlabel = scnlabel[:-1] + ")" pos = pos[:-1] + ")" valuesString = "" for label, value in self.labelValuePairs.items(): if label != dataSetResult.keyxlabel: valuesString += label + " = " + str(value) + ", " valuesString = valuesString[:-2] return "At %s = %s (%s), %s %s. " % (scnlabel, pos, dataSetResult.keyxlabel, self.ordinate, valuesString) def reportScannablePositionAtFeature(self, scn): result = scn.name fieldnames = list(scn.getInputNames()) + list(scn.getExtraNames()) # Get scannable position as a list scnpos = self.getScannableValueAtFeature(scn) try: scnpos = list(scnpos) except TypeError: # not a list scnpos = [scnpos] # if single fieldname matches scannable name, format is "processor.scn = value" if len(fieldnames)==1: if fieldnames[0]==scn.name: return result + ' = ' + scn.getOutputFormat()[0] % scnpos[0] # Otherwise format is "processor.scn: f1, f2 = v1, v2" result += ': ' for name in fieldnames: result += name + ', ' result = result[:-2] result += ' = ' for format, pos in zip(scn.getOutputFormat(),scnpos): result += 'None' if pos==None else format%pos + ', ' result = result[:-2] return result def go(self): scn = self.abscissa_scannable val = self.getScannableValueAtFeature(scn) try: len(val) except TypeError: val = [val] val = val[:len(scn.getInputNames())] if len(val)==0: raise Exception("The scannable %s has no input fields"%scn.getName()) if len(val)==1: val = val[0] print "Moving %s to %s" % (scn.getName(), `val`) scn.moveTo(val) def __findValueInDataSet(self, value, dataset): return list(dataset.doubleArray()).index(value) def determineScannableValuesAtFeature(self, scannables, lastScanFile, xname, xvalue): ''' This find the values of all scannables at the position given by xvalue. It uses linear interpolation to find the return values. ''' self.log.debug('Determining scannable (%s) values at %s', xname, xvalue) # Get the x dataset from the file dsx = getDatasetFromLoadedFile(lastScanFile, xname, self.scanDataPointCache) decreasing = dsx[0] > dsx[-1] #dnp.interp only works on increasing datasets dsx = dnp.array(dsx[::-1,...]) if decreasing else dsx # Check if the x value is inside the x range of the scan feature_inside_scan_data = dsx.min() <= xvalue <= dsx.max() result = {} for scn in scannables: try: pos = [] fieldnames = list(scn.getInputNames()) + list(scn.getExtraNames()) for fieldname, format in zip(fieldnames, scn.getOutputFormat()): scn_fieldname = scn.name + '.' + fieldname if format == '%s': # Cannot get filenames from SRS files! value = float('nan') else: dsfield = getDatasetFromLoadedFile(lastScanFile, scn_fieldname, self.scanDataPointCache) if feature_inside_scan_data: # Find the value of the scannable by interpolation (only valid if feature is inside scan!). # xvalue is the position of the feature against the x scannable # dsx is the array of the x values # dsfield is the array of the other scannable positions if decreasing: dsfield = dsfield[::-1,...] value = dnp.interp(xvalue, dsx, dsfield) else: # feature not inside scan if scn_fieldname == xname: value = xvalue else: # Trick case. Return start or end value for field if xvalue <= dsx.min: value = dsfield[0] else: # xvalue >= dsx.min value = dsfield[-1] pos.append(value) if len(pos)==1: result[scn] = pos[0] else: result[scn] = pos except: pass return result def getScannableValueAtFeature(self, scn): return self.scannableValues[scn] def __repr__(self): return self.str def __str__(self): return self.__repr__()
# Standard library from argparse import ArgumentParser # Third party import climate_learn as cl import pytorch_lightning as pl from pytorch_lightning.callbacks import ( EarlyStopping, ModelCheckpoint, RichModelSummary, RichProgressBar, ) from pytorch_lightning.loggers.tensorboard import TensorBoardLogger parser = ArgumentParser() parser.add_argument("climatebench_dir") parser.add_argument("model", choices=["resnet", "unet", "vit"]) parser.add_argument( "variable", choices=["tas", "diurnal_temperature_range", "pr", "pr90"], help="The variable to predict.", ) parser.add_argument("--summary_depth", type=int, default=1) parser.add_argument("--max_epochs", type=int, default=50) parser.add_argument("--patience", type=int, default=10) parser.add_argument("--gpu", type=int, default=-1) parser.add_argument("--checkpoint", default=None) args = parser.parse_args() # Set up data variables = ["CO2", "SO2", "CH4", "BC"] out_variables = args.variable dm = cl.data.ClimateBenchDataModule( args.climatebench_dir, variables=variables, out_variables=out_variables, train_ratio=0.9, history=10, batch_size=16, num_workers=1, ) # Set up deep learning model if args.model == "resnet": model_kwargs = { # override some of the defaults "in_channels": 4, "out_channels": 1, "history": 10, "n_blocks": 28, } elif args.model == "unet": model_kwargs = { # override some of the defaults "in_channels": 4, "out_channels": 1, "history": 10, "ch_mults": (1, 2, 2), "is_attn": (False, False, False), } elif args.model == "vit": model_kwargs = { # override some of the defaults "img_size": (32, 64), "in_channels": 4, "out_channels": 1, "history": 10, "patch_size": 2, "embed_dim": 128, "depth": 8, "decoder_depth": 2, "learn_pos_emb": True, "num_heads": 4, } optim_kwargs = {"lr": 5e-4, "weight_decay": 1e-5, "betas": (0.9, 0.99)} sched_kwargs = { "warmup_epochs": 5, "max_epochs": 50, "warmup_start_lr": 1e-8, "eta_min": 1e-8, } model = cl.load_climatebench_module( data_module=dm, model=args.model, model_kwargs=model_kwargs, optim="adamw", optim_kwargs=optim_kwargs, sched="linear-warmup-cosine-annealing", sched_kwargs=sched_kwargs, ) # Set up trainer pl.seed_everything(0) default_root_dir = f"{args.model}_climatebench_{args.variable}" logger = TensorBoardLogger(save_dir=f"{default_root_dir}/logs") early_stopping = "val/mse:aggregate" callbacks = [ RichProgressBar(), RichModelSummary(max_depth=args.summary_depth), EarlyStopping(monitor=early_stopping, patience=args.patience), ModelCheckpoint( dirpath=f"{default_root_dir}/checkpoints", monitor=early_stopping, filename="epoch_{epoch:03d}", auto_insert_metric_name=False, ), ] trainer = pl.Trainer( logger=logger, callbacks=callbacks, default_root_dir=default_root_dir, accelerator="gpu" if args.gpu != -1 else None, devices=[args.gpu] if args.gpu != -1 else None, max_epochs=args.max_epochs, strategy="ddp", precision="16", log_every_n_steps=1, ) # Train and evaluate model from scratch if args.checkpoint is None: trainer.fit(model, datamodule=dm) trainer.test(model, datamodule=dm, ckpt_path="best") # Evaluate saved model checkpoint else: model = cl.LitModule.load_from_checkpoint( args.checkpoint, net=model.net, optimizer=model.optimizer, lr_scheduler=None, train_loss=None, val_loss=None, test_loss=model.test_loss, test_target_transforms=model.test_target_transforms, ) trainer.test(model, datamodule=dm)
# -*- coding: utf-8 -*- ''' # Copyright (c) Microsoft Corporation. All Rights Reserved. Licensed under the MIT License. See License in the project root for license information. # # This file was generated and any changes will be overwritten. ''' from __future__ import unicode_literals from ..model.education_contact_relationship import EducationContactRelationship from ..one_drive_object_base import OneDriveObjectBase class EducationRelatedContact(OneDriveObjectBase): def __init__(self, prop_dict={}): self._prop_dict = prop_dict @property def id(self): """Gets and sets the id Returns: str: The id """ if "id" in self._prop_dict: return self._prop_dict["id"] else: return None @id.setter def id(self, val): self._prop_dict["id"] = val @property def display_name(self): """Gets and sets the displayName Returns: str: The displayName """ if "displayName" in self._prop_dict: return self._prop_dict["displayName"] else: return None @display_name.setter def display_name(self, val): self._prop_dict["displayName"] = val @property def email_address(self): """Gets and sets the emailAddress Returns: str: The emailAddress """ if "emailAddress" in self._prop_dict: return self._prop_dict["emailAddress"] else: return None @email_address.setter def email_address(self, val): self._prop_dict["emailAddress"] = val @property def mobile_phone(self): """Gets and sets the mobilePhone Returns: str: The mobilePhone """ if "mobilePhone" in self._prop_dict: return self._prop_dict["mobilePhone"] else: return None @mobile_phone.setter def mobile_phone(self, val): self._prop_dict["mobilePhone"] = val @property def relationship(self): """ Gets and sets the relationship Returns: :class:`EducationContactRelationship<onedrivesdk.model.education_contact_relationship.EducationContactRelationship>`: The relationship """ if "relationship" in self._prop_dict: if isinstance(self._prop_dict["relationship"], OneDriveObjectBase): return self._prop_dict["relationship"] else : self._prop_dict["relationship"] = EducationContactRelationship(self._prop_dict["relationship"]) return self._prop_dict["relationship"] return None @relationship.setter def relationship(self, val): self._prop_dict["relationship"] = val @property def access_consent(self): """Gets and sets the accessConsent Returns: bool: The accessConsent """ if "accessConsent" in self._prop_dict: return self._prop_dict["accessConsent"] else: return None @access_consent.setter def access_consent(self, val): self._prop_dict["accessConsent"] = val
import time from selenium import webdriver from selenium.webdriver.common.keys import Keys #variables gmail gmail = "nahoj1992@gmail.com" contrasena = "dragonball2010" gmailAulavirtual = "jcalderonva@unsa.edu.pe" #"creamos una instancia de chrome hacia el aulavirtual" driver = webdriver.Chrome("C:\Python\Lib\site-packages\selenium\webdriver\chrome\chromedriver.exe") print("Iniciando bot") #ingreso al gmail driver.get("https://docs.google.com/spreadsheets/d/1ADLUu_4Jz1OxYdBRcZfBi3lUS0DjK0F_nFE21-NCGBo/edit#gid=986616540") email = driver.find_element_by_id('identifierId') email.send_keys(gmail) driver.find_element_by_id('identifierNext').click() time.sleep(5) contra = driver.find_element_by_xpath("//*[@id='password']/div[1]/div/div[1]/input") contra.send_keys("dragonball2010") driver.find_element_by_id('passwordNext').click() time.sleep(5) print("Ingresando al aula virtual") #ingreso al aulavirtual driver.get("http://dutic.unsa.edu.pe/aulavirtual/login/index.php") #"nos logeamos" login_form_sesion_dutic = driver.find_element_by_id('login') username = driver.find_element_by_id('username') password = driver.find_element_by_id('password') username.send_keys("dutic") password.send_keys("Qwert18*") driver.find_element_by_id("loginbtn").click() time.sleep(5) #"adminastracion de usuarios" driver.get("http://dutic.unsa.edu.pe/aulavirtual/admin/user.php") driver.find_element_by_class_name("moreless-toggler").click() email_usuario = driver.find_element_by_id('id_email') email_usuario.send_keys(gmailAulavirtual) time.sleep(5) driver.find_element_by_id("id_addfilter").click() driver.find_element_by_id("//*[@id='yui_3_17_2_1_1554146167123_524']").click()
from django.contrib import admin from pelicula.models import Cliente, Genero, Pelicula, Prestamo admin.site.register(Cliente) admin.site.register(Genero) admin.site.register(Pelicula) admin.site.register(Prestamo)
# Generated by Django 2.2.9 on 2020-01-25 15:36 from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ ('humans', '0001_initial'), ] operations = [ migrations.AlterField( model_name='group', name='curratt', field=models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, to='humans.Teacher'), ), migrations.AlterField( model_name='group', name='headman', field=models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, to='humans.Student'), ), ]
#coding: utf-8 from django import forms from UserManagement.models import Person from django.contrib.auth.models import User from django.contrib.auth.forms import UserCreationForm class UploadFileForm(forms.Form): title = forms.CharField(max_length=50) file = forms.FileField() class MyRegistrationForm(forms.ModelForm): username = forms.CharField(max_length=32, widget=forms.TextInput(attrs={"type": "text", "class": "form-control", "placeholder": "Username"})) last_name = forms.CharField(max_length=32, widget=forms.TextInput(attrs={"type": "text", "class": "form-control", "placeholder": "Фамилия"})) first_name = forms.CharField(max_length=32, widget=forms.TextInput(attrs={"type": "text", "class": "form-control", "placeholder": "Имя"})) login = forms.CharField(max_length=32, widget=forms.TextInput(attrs={"type": "text", "class": "form-control", "placeholder": "логин"})) password = forms.CharField(max_length=32, widget=forms.PasswordInput(attrs={"type": "password", "class": "form-control", "placeholder": "пароль"})) confirmpassword = forms.CharField(max_length=32, widget=forms.PasswordInput(attrs={"type": "password", "class": "form-control", "placeholder": "Пожалуйста, подтвердите..."})) email = forms.CharField(max_length=32, widget=forms.EmailInput(attrs={"type": "email", "class": "form-control", "placeholder": "e-mail"})) phone_number = forms.CharField(max_length=32, widget=forms.NumberInput(attrs={"type": "number", "class": "form-control", "placeholder": "phone_number"})) birthdate = forms.CharField(widget=forms.DateInput(attrs={"type": "date", "id": "birthdate", "class": "form-control"})) status = forms.CharField(widget=forms.Select(attrs={"id": "status", "class": "form-control"})) photo = forms.FileField(widget=forms.ImageField()) # {"value_from_datadict": ""} rules = forms.BooleanField(widget=forms.CheckboxInput(attrs={"type": "checkbox"})) class Meta: model = Person fields = ('__all__') exclude = ('rules',) class UserForm(forms.ModelForm): class Meta: model = User fields = ('__all__') exclude = ('rules',) class UserChangeForm(forms.ModelForm): """ Форма для обновления данных пользователей. Нужна только для того, чтобы не видеть постоянных ошибок "Не заполнено поле password" при обновлении данных пользователя. """ class Meta: model = Person fields = ('__all__') exclude = ('rules',)
import numpy as np from operator import itemgetter from sklearn.svm import LinearSVC from sklearn.model_selection import cross_val_score import csv # training and cross validation with open('data/processed_tfidf/ALLYEARS/SPARSE2016.dat') as f: content = f.readlines() data = [] for line in content: y = int(line.split()[0]) # get spam spam_classification wtemp = line.split()[1:] # get word counts w = [] for i in range(0, len(wtemp)): w.append((wtemp[i].split(":")[0], wtemp[i].split(":")[1])) data.append((y, w)) X = np.zeros((len(data), 16244)) # matrix indexed by cmat[di-1][wj] Y = np.zeros(len(data)) for i in range(0, len(data)): Y[i] = data[i][0] for feat, fval in data[i][1]: X[i-1][int(feat)] = float(fval) print np.array(Y).shape print np.matrix(X).shape svm_sm = LinearSVC(C=0.5, random_state=42, loss='hinge') svm_sm.fit(X, Y) scores = cross_val_score(svm_sm, X, Y, cv=5) print scores.mean() # testing with open('data/processed_tfidf/ALLYEARS/SPARSE2008.dat') as f: content = f.readlines() data = [] for line in content: y = int(line.split()[0]) # get spam spam_classification wtemp = line.split()[1:] # get word counts w = [] for i in range(0, len(wtemp)): w.append((wtemp[i].split(":")[0], wtemp[i].split(":")[1])) data.append((y, w)) Xtest = np.zeros((len(data), 16244)) # matrix indexed by cmat[di-1][wj] Ytest = np.zeros(len(data)) for i in range(0, len(data)): Ytest[i] = data[i][0] for feat, fval in data[i][1]: Xtest[i-1][int(feat)] = float(fval) print np.array(Ytest).shape print np.matrix(Xtest).shape feature_predict = svm_sm.predict(Xtest) ncorrect = 0 for i in range(0, len(Ytest)): if (Ytest[i] == feature_predict[i]): ncorrect += 1 accuracy = float(ncorrect)/len(Ytest) print accuracy
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from stestr.commands.failing import failing as failing_command from stestr.commands.history import history_list as history_list_command from stestr.commands.history import history_remove as history_remove_command from stestr.commands.history import history_show as history_show_command from stestr.commands.init import init as init_command from stestr.commands.last import last as last_command from stestr.commands.list import list_command from stestr.commands.load import load as load_command from stestr.commands.run import run_command from stestr.commands.slowest import slowest as slowest_command __all__ = [ "failing_command", "init_command", "last_command", "list_command", "load_command", "run_command", "slowest_command", "history_show_command", "history_list_command", "history_remove_command", ]
from datetime import datetime from ward import test from repository import BookRepository @test('test find by author should return list of books') def _(): books = [ { 'name': 'The Gatuk book', 'author': 'Gatuk' }, { 'name': 'The Human book', 'author': 'Human' } ] repository = BookRepository(books) actual = repository.find_by_author(name='Gatuk') assert 1 == len(actual) assert 'Gatuk' == actual[0]['author'] @test('test find by hardest should return list of books') def _(): books = [ { 'name': 'The Gatuk book', 'length': 300 }, { 'name': 'The Human book', 'length': 280 } ] repository = BookRepository(books) actual = repository.find_by_hardest(length=300) assert 1 == len(actual) assert 300 == actual[0]['length'] @test('test find by recent should return list of books') def _(): books = [ { 'name': 'The Gatuk book', 'publication_date': datetime(2020, 10, 25).date() }, { 'name': 'The Human book', 'publication_date': datetime(2017, 10, 25).date() } ] repository = BookRepository(books) actual = repository.find_by_recent(year=2) assert 1 == len(actual) assert datetime(2020, 10, 25).date() == actual[0]['publication_date']
import re def read_passports(): passports = [] combo = "" # For sexy oneliner later with open('day04/input') as f: for line in f: if line == '\n': # break between passports passports.append({x.split(':')[0]: x.split(':')[1] for x in combo.split()}) combo = "" else: # Build up combo = ' '.join([combo, line]) # Don't lose the last passport passports.append({x.split(':')[0]: x.split(':')[1] for x in combo.split()}) return passports def part1(): passports = read_passports() valid = 0 for pp in passports: if len(pp) == 8: # all fields valid += 1 elif len(pp) == 7: # doesn't need cid if "cid" not in pp.keys(): valid += 1 print(f'Part 1 answer: {valid}') def valid_pp(pp): if len(pp) < 7 or (len(pp) == 7 and 'cid' in pp.keys()): return False x = int(pp['byr']) if x < 1920 or x > 2002: return False x = int(pp['iyr']) if x < 2010 or x > 2020: return False x = int(pp['eyr']) if x < 2020 or x > 2030: return False x = pp['ecl'] if x not in ['amb', 'blu', 'brn', 'gry', 'grn', 'hzl', 'oth']: return False x = pp['pid'] if len(x) != 9: return False # The gross one that made me lookup regex again m = re.search(r'(\d+)(\w+)', pp['hgt']) x = int(m.group(1)) if m.group(2) == 'in': if x < 59 or x > 76: return False elif m.group(2) == 'cm': if x < 150 or x > 193: return False else: return False # Forgot hair color, must use regex now :( # For future Kat: the hair color must be the pound sign # followed by exactly six hex digits, so that's what the # regex matches. if not re.match(r'[#](\d|[a-f]){6}', pp['hcl']): return False # If we passed all conditions return True def part2(): valid = sum((valid_pp(x) for x in read_passports())) print(f'Part 2 answer: {valid}') if __name__ == '__main__': part1() part2()
"""youtubeの操作を行う""" import json import traceback from datetime import datetime from datetime import timedelta import requests from bs4 import BeautifulSoup def get_video_info(conn, api_key, video_id): """動画情報の取得""" conn_str = '/youtube/v3/videos?id={0}&key={1}&fields=items(id,snippet(channelId,title,categoryId,publishedAt),statistics)&part=snippet,statistics'.format(video_id, api_key) conn.request('GET', conn_str) res = conn.getresponse() if res.status != 200: raise Exception(res.status, res.reason) data = res.read().decode("utf-8") return json.loads(data) def get_channel_video_list(conn, api_key, channel_id, published_before=None, published_after=None): """チャンネル中の動画一覧取得""" # 参考資料 # https://developers.google.com/youtube/v3/docs/search/list?hl=ja # https://support.google.com/youtube/forum/AAAAiuErobU8A1V4NqExIE/?hl=en&gpf=%23!topic%2Fyoutube%2F8A1V4NqExIE # https://qiita.com/yuji_saito/items/8f472dcd785c1fadf666 result = [] conn_str = '/youtube/v3/search?part=snippet&channelId={0}&key={1}&maxResults=50&order=date&kind=video'.format(channel_id, api_key) print (conn_str) if published_before: conn_str = conn_str + '&publishedBefore=' + published_before if published_after: conn_str = conn_str + '&publishedAfter=' + published_after conn.request('GET', conn_str) res = conn.getresponse() if res.status != 200: raise Exception(res.status, res.reason) data = res.read().decode("utf-8") data = json.loads(data) for item in data['items']: if item['id']['kind'] == 'youtube#video': result.append({'videoId' : item['id']['videoId'], 'title':item['snippet']['title'], 'publishedAt':item['snippet']['publishedAt']}) return result def convert_string_to_datetime(str_dt): """文字を日付時刻型に変換""" date_time = datetime.strptime(str_dt, '%Y-%m-%dT%H:%M:%S.000Z') return date_time def convert_datetime_to_string(date_time): """日付時刻型を文字に変換""" return date_time.strftime('%Y-%m-%dT%H:%M:%S.000Z') def get_all_channel_video_list(conn, api_key, channel_id, published_after=None): """チャンネル中の動画をすべて取得""" tmp_result = [] result = get_channel_video_list(conn, api_key, channel_id, None, published_after) if not result: return result while 1: tmp_dt = convert_string_to_datetime(result[len(result)-1]['publishedAt']) tmp_dt = tmp_dt - timedelta(seconds=1) published_before = convert_datetime_to_string(tmp_dt) tmp_result = get_channel_video_list(conn, api_key, channel_id, published_before, published_after) if not tmp_result: return result result.extend(tmp_result) def get_message_data(video_id, item): """["continuationContents"]["liveChatContinuation"]["actions"][1:]以下を解析""" message = '' purchase_amount = '' data = None # たぶん、全パターンの網羅はできていない if 'addLiveChatTickerItemAction' in item["replayChatItemAction"]["actions"][0]: if 'liveChatTextMessageRenderer' in item["replayChatItemAction"]["actions"][0]['addLiveChatTickerItemAction']['item']: data = item["replayChatItemAction"]["actions"][0]['addLiveChatTickerItemAction']['item']['liveChatTickerPaidMessageItemRenderer']['showItemEndpoint']['showLiveChatItemEndpoint']['renderer'] if 'liveChatTickerPaidMessageItemRenderer' in item["replayChatItemAction"]["actions"][0]['addLiveChatTickerItemAction']['item']: data = item["replayChatItemAction"]["actions"][0]['addLiveChatTickerItemAction']['item']['liveChatTickerPaidMessageItemRenderer']['showItemEndpoint']['showLiveChatItemEndpoint']['renderer']['liveChatPaidMessageRenderer'] purchase_amount = data['purchaseAmountText']['simpleText'] if 'liveChatPlaceholderItemRenderer' in item["replayChatItemAction"]["actions"][0]['addLiveChatTickerItemAction']['item']: print(item) return None if 'addChatItemAction' in item["replayChatItemAction"]["actions"][0]: if 'liveChatTextMessageRenderer' in item["replayChatItemAction"]["actions"][0]['addChatItemAction']['item']: data = item["replayChatItemAction"]["actions"][0]['addChatItemAction']['item']['liveChatTextMessageRenderer'] if 'liveChatPaidMessageRenderer' in item["replayChatItemAction"]["actions"][0]['addChatItemAction']['item']: data = item["replayChatItemAction"]["actions"][0]['addChatItemAction']['item']['liveChatPaidMessageRenderer'] purchase_amount = data['purchaseAmountText']['simpleText'] if 'liveChatPlaceholderItemRenderer' in item["replayChatItemAction"]["actions"][0]['addChatItemAction']['item']: print(item) return None if data is None: print(item) return None if 'message' in data: for msg in data['message']['runs']: if 'text' in msg: # emojiが来る可能性がある message = message + msg['text'] else: print(data) author = data['authorName']['simpleText'] offset_time_msec = item["replayChatItemAction"]["videoOffsetTimeMsec"] return {'video_id': video_id, 'message': message, 'author': author, 'offset_time_msec': offset_time_msec, 'purchase_amount': purchase_amount} def get_archive_live_chat(video_id, callback): """アーカイブのライブチャットの取得""" target_url = 'https://www.youtube.com/watch?v=' + video_id result = [] session = requests.Session() headers = {'user-agent': 'Mozilla/5.0 (Windows NT 6.1; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/69.0.3497.100 Safari/537.36'} # まず動画ページにrequestsを実行しhtmlソースを手に入れてlive_chat_replayの先頭のurlを入手 html = requests.get(target_url) soup = BeautifulSoup(html.text, "html.parser") item = None next_url = None for iframe in soup.find_all("iframe"): if "live_chat_replay" in iframe["src"]: next_url = iframe["src"] if next_url is None: # ライブチャットの再生が無効になっている場合など. # 例:JRfVSFJhcLw 配信失敗により、アンジュがただただ病むだけ。 print ('iframe src not found.') return while 1: try: html = session.get(next_url, headers=headers) soup = BeautifulSoup(html.text, "lxml") # 次に飛ぶurlのデータがある部分をfind_allで探してsplitで整形 for scrp in soup.find_all("script"): if "window[\"ytInitialData\"]" in scrp.text: dict_str = scrp.text.split(" = ")[1] # 辞書形式と認識すると簡単にデータを取得できるが, 末尾に邪魔なのがあるので消しておく(「空白2つ + \n + ;」を消す) dict_str = dict_str.rstrip(" \n;") dics = json.loads(dict_str) if not 'liveChatReplayContinuationData' in dics["continuationContents"]["liveChatContinuation"]["continuations"][0]: # 次のデータが存在しない return # "https://www.youtube.com/live_chat_replay?continuation=" + continue_url が次のlive_chat_replayのurl continue_url = dics["continuationContents"]["liveChatContinuation"]["continuations"][0]["liveChatReplayContinuationData"]["continuation"] next_url = "https://www.youtube.com/live_chat_replay?continuation=" + continue_url # dics["continuationContents"]["liveChatContinuation"]["actions"]がコメントデータのリスト。先頭はノイズデータなので[1:]で保存 for item in dics["continuationContents"]["liveChatContinuation"]["actions"][1:]: rec = get_message_data(video_id, item) if not rec is None: result.append(rec) # next_urlが入手できなくなったら終わり except: traceback.print_exc() print(item) break callback(result) result = []
import numpy as np from itertools import chain class Lattice: def __init__(self, N, conc): self.matrix_size = N self.spin = np.random.choice([1, -1], p = [conc, 1-conc], size = (N, N)) self.decision_times = [] self.last_changed = np.zeros((N, N)) self.time = 0 self.vert = lambda x,y : [((x,y),(x%N, (y-1)%N)), ((x,y),(x%N, (y+2)%N))] self.hori = lambda x,y : [((x,y),((x-1)%N, y%N)), ((x,y),((x+2)%N, y%N))] def stauffer_2d_step(self, media, up, down): states = [np.copy(self.spin)] N = self.matrix_size for spin_update in range(self.matrix_size*self.matrix_size): # select random site x = np.random.choice(np.arange(0, self.matrix_size-1)) y = np.random.choice(np.arange(0, self.matrix_size-1)) rows = np.arange(x-1, x+3)%self.matrix_size cols = np.arange(y-1, y+3)%self.matrix_size M = self.spin[np.ix_(rows, cols)] # mini matrix of 4x4 array_list = [M[1, :], M[2, :], M[:, 1], M[:, 2]] old_spins = np.copy(self.spin) small_m = M[np.ix_([1, 2], [1, 2])] # mini matrix of 2x2 if(small_m[0,0]==small_m[0,1]==small_m[1,0]==small_m[1,1]): for array in array_list: assert(len(array)==4) array[0] = array[1] array[3] = array[1] # effect of media on neighboring 8 positions else: for array in array_list: assert(len(array)==4) array[0] = np.random.choice([1, -1, array[0]], p = [media*up, media*down, 1-media]) array[3] = np.random.choice([1, -1, array[3]], p = [media*up, media*down, 1-media]) self.spin[np.ix_(rows, cols)] = M changed = self.spin != old_spins self.decision_times.append(list(self.time - self.last_changed[changed])) self.last_changed[changed] = self.time self.time = self.time + 1 return changed, states def stauffer_2d_step_modified(self, method_version, media, up, down): N = self.matrix_size # states = [np.copy(self.spin)] for spin_update in range(self.matrix_size*self.matrix_size): # select random site x = np.random.choice(np.arange(0, self.matrix_size-1)) y = np.random.choice(np.arange(0, self.matrix_size-1)) rows = np.arange(x-1, x+3)%self.matrix_size cols = np.arange(y-1, y+3)%self.matrix_size M = self.spin[np.ix_(rows, cols)] array_list = [M[1, :], M[2, :], M[:, 1], M[:, 2]] old_spins = np.copy(self.spin) small_m = M[np.ix_([1, 2], [1, 2])] if(small_m[0,0]==small_m[0,1]==small_m[1,0]==small_m[1,1]): for array in array_list: assert(len(array)==4) array[0] = array[1] array[3] = array[1] else: for array in array_list: assert(len(array)==4) if(method_version==0): # modified : take neighbor's neighbor's position array[0] = np.random.choice([1, -1, array[2]], p = [media*up, media*down, 1-media]) array[3] = np.random.choice([1, -1, array[1]], p = [media*up, media*down, 1-media]) else: # modified : take neighbor's position array[0] = np.random.choice([1, -1, array[1]], p = [media*up, media*down, 1-media]) array[3] = np.random.choice([1, -1, array[2]], p = [media*up, media*down, 1-media]) self.spin[np.ix_(rows, cols)] = M changed = self.spin != old_spins self.decision_times.append(list(self.time - self.last_changed[changed])) self.last_changed[changed] = self.time self.time = self.time + 1 return changed # Sweep over lattice until steady state is reached def metropolis(self, media = 0, up = 1, down = 0, method = "default", display = False): self.time = 0 tmax = 500 epsilon = 0.001 # time_of_last_change = 0 threshold = self.matrix_size total = self.matrix_size*self.matrix_size states = [np.copy(self.spin)] while(self.time < tmax*total): if(method == "default"): changed = self.stauffer_2d_step(media, up, down) elif(method == "modified1"): changed = self.stauffer_2d_step_modified(0, media, up, down) elif(method == "modified2"): changed = self.stauffer_2d_step_modified(1, media, up, down) m = self.magnetization() staggered_m = self.staggered_magnetization() states.append(np.copy(self.spin)) # steady state consensus --> exit if(abs(m) == 1 or 1-abs(m) <= epsilon): break # steady state stalemate elif(staggered_m == 1): break return m, self.time, self.decision_times, states def magnetization(self): return np.mean(self.spin) def staggered_magnetization(self): # returns 1 for stalemate mask = np.zeros((self.matrix_size, self.matrix_size)) mask[0::2, 0::2] = 1 mask[1::2, 1::2] = 1 M_plus = np.mean(self.spin[np.where(mask==1)]) M_minus = np.mean(self.spin[np.where(mask==0)]) return abs(0.5*(M_plus - M_minus)) def display(self): fig, ax = plt.subplots(figsize=(3,3)) img = ax.imshow(self.spin, cmap='Greys') plt.colorbar(img) plt.show()
import sys import os abs_file_path = os.path.abspath(os.path.dirname(__file__)) sys.path.append(os.path.join(abs_file_path, "..", "..")) # add path import torch import torch.nn as nn import collections from torch.utils.serialization import load_lua from model import SCNN model1 = load_lua('experiments/vgg_SCNN_DULR_w9/vgg_SCNN_DULR_w9.t7', unknown_classes=True) model2 = collections.OrderedDict() model2['backbone.0.weight'] = model1.modules[0].weight model2['backbone.1.weight'] = model1.modules[1].weight model2['backbone.1.bias'] = model1.modules[1].bias model2['backbone.1.running_mean'] = model1.modules[1].running_mean model2['backbone.1.running_var'] = model1.modules[1].running_var model2['backbone.3.weight'] = model1.modules[3].weight model2['backbone.4.weight'] = model1.modules[4].weight model2['backbone.4.bias'] = model1.modules[4].bias model2['backbone.4.running_mean'] = model1.modules[4].running_mean model2['backbone.4.running_var'] = model1.modules[4].running_var model2['backbone.7.weight'] = model1.modules[7].weight model2['backbone.8.weight'] = model1.modules[8].weight model2['backbone.8.bias'] = model1.modules[8].bias model2['backbone.8.running_mean'] = model1.modules[8].running_mean model2['backbone.8.running_var'] = model1.modules[8].running_var model2['backbone.10.weight'] = model1.modules[10].weight model2['backbone.11.weight'] = model1.modules[11].weight model2['backbone.11.bias'] = model1.modules[11].bias model2['backbone.11.running_mean'] = model1.modules[11].running_mean model2['backbone.11.running_var'] = model1.modules[11].running_var model2['backbone.14.weight'] = model1.modules[14].weight model2['backbone.15.weight'] = model1.modules[15].weight model2['backbone.15.bias'] = model1.modules[15].bias model2['backbone.15.running_mean'] = model1.modules[15].running_mean model2['backbone.15.running_var'] = model1.modules[15].running_var model2['backbone.17.weight'] = model1.modules[17].weight model2['backbone.18.weight'] = model1.modules[18].weight model2['backbone.18.bias'] = model1.modules[18].bias model2['backbone.18.running_mean'] = model1.modules[18].running_mean model2['backbone.18.running_var'] = model1.modules[18].running_var model2['backbone.20.weight'] = model1.modules[20].weight model2['backbone.21.weight'] = model1.modules[21].weight model2['backbone.21.bias'] = model1.modules[21].bias model2['backbone.21.running_mean'] = model1.modules[21].running_mean model2['backbone.21.running_var'] = model1.modules[21].running_var model2['backbone.24.weight'] = model1.modules[24].weight model2['backbone.25.weight'] = model1.modules[25].weight model2['backbone.25.bias'] = model1.modules[25].bias model2['backbone.25.running_mean'] = model1.modules[25].running_mean model2['backbone.25.running_var'] = model1.modules[25].running_var model2['backbone.27.weight'] = model1.modules[27].weight model2['backbone.28.weight'] = model1.modules[28].weight model2['backbone.28.bias'] = model1.modules[28].bias model2['backbone.28.running_mean'] = model1.modules[28].running_mean model2['backbone.28.running_var'] = model1.modules[28].running_var model2['backbone.30.weight'] = model1.modules[30].weight model2['backbone.31.weight'] = model1.modules[31].weight model2['backbone.31.bias'] = model1.modules[31].bias model2['backbone.31.running_mean'] = model1.modules[31].running_mean model2['backbone.31.running_var'] = model1.modules[31].running_var model2['backbone.34.weight'] = model1.modules[33].weight model2['backbone.35.weight'] = model1.modules[34].weight model2['backbone.35.bias'] = model1.modules[34].bias model2['backbone.35.running_mean'] = model1.modules[34].running_mean model2['backbone.35.running_var'] = model1.modules[34].running_var model2['backbone.37.weight'] = model1.modules[36].weight model2['backbone.38.weight'] = model1.modules[37].weight model2['backbone.38.bias'] = model1.modules[37].bias model2['backbone.38.running_mean'] = model1.modules[37].running_mean model2['backbone.38.running_var'] = model1.modules[37].running_var model2['backbone.40.weight'] = model1.modules[39].weight model2['backbone.41.weight'] = model1.modules[40].weight model2['backbone.41.bias'] = model1.modules[40].bias model2['backbone.41.running_mean'] = model1.modules[40].running_mean model2['backbone.41.running_var'] = model1.modules[40].running_var model2['layer1.0.weight'] = model1.modules[42].modules[0].weight model2['layer1.1.weight'] = model1.modules[42].modules[1].weight model2['layer1.1.bias'] = model1.modules[42].modules[1].bias model2['layer1.1.running_mean'] = model1.modules[42].modules[1].running_mean model2['layer1.1.running_var'] = model1.modules[42].modules[1].running_var model2['layer1.3.weight'] = model1.modules[42].modules[3].weight model2['layer1.4.weight'] = model1.modules[42].modules[4].weight model2['layer1.4.bias'] = model1.modules[42].modules[4].bias model2['layer1.4.running_mean'] = model1.modules[42].modules[4].running_mean model2['layer1.4.running_var'] = model1.modules[42].modules[4].running_var model2['message_passing.up_down.weight'] = model1.modules[42].modules[6].modules[0].modules[0].modules[2].modules[0].modules[1].modules[1].modules[0].weight model2['message_passing.down_up.weight'] = model1.modules[42].modules[6].modules[0].modules[0].modules[140].modules[1].modules[2].modules[0].modules[0].weight model2['message_passing.left_right.weight'] = model1.modules[42].modules[6].modules[1].modules[0].modules[2].modules[0].modules[1].modules[1].modules[0].weight model2['message_passing.right_left.weight'] = model1.modules[42].modules[6].modules[1].modules[0].modules[396].modules[1].modules[2].modules[0].modules[0].weight model2['layer2.1.weight'] = model1.modules[42].modules[8].weight model2['layer2.1.bias'] = model1.modules[42].modules[8].bias model2['fc.0.weight'] = model1.modules[43].modules[1].modules[3].weight model2['fc.0.bias'] = model1.modules[43].modules[1].modules[3].bias model2['fc.2.weight'] = model1.modules[43].modules[1].modules[5].weight model2['fc.2.bias'] = model1.modules[43].modules[1].modules[5].bias save_name = os.path.join('experiments', 'vgg_SCNN_DULR_w9', 'vgg_SCNN_DULR_w9.pth') torch.save(model2, save_name) # load and save again net = SCNN(input_size=(800, 288), pretrained=False) d = torch.load(save_name) net.load_state_dict(d, strict=False) for m in net.backbone.modules(): if isinstance(m, nn.Conv2d): if m.bias is not None: m.bias.data.zero_() save_dict = { "epoch": 0, "net": net.state_dict(), "optim": None, "lr_scheduler": None } if not os.path.exists(os.path.join('experiments', 'vgg_SCNN_DULR_w9')): os.makedirs(os.path.join('experiments', 'vgg_SCNN_DULR_w9'), exist_ok=True) torch.save(save_dict, save_name)
from django.contrib import admin from django.contrib.auth.admin import UserAdmin as BaseUserAdmin from django.contrib.auth.models import User from blog.models import Post, Comment, BlogUser # Register your models here. class BlogUserInline(admin.StackedInline): model = BlogUser can_delete = False verbose_name_plural = 'blog_users' class UserAdmin(BaseUserAdmin): inlines = (BlogUserInline, ) admin.site.unregister(User) admin.site.register(User, UserAdmin) admin.site.register(Post) admin.site.register(Comment)
from multiprocessing import Process import time def f(name): time.sleep(2) print("hello, {0}".format(name)) if __name__ == '__main__': p = Process(target=f, args=["zys",]) p1 = Process(target=f, args=["zys",]) p.start() p1.start()
""" This script is used for trimming SGS data """ #!/usr/bin/python # -*- coding: <encoding name> -*- import argparse from processores.file_processor import FilePorcessor from processores.cmd_processor import CmdProcessor def fozu(): print(" _ooOoo_ ") print(" o8888888o ") print(" 88 . 88 ") print(" (| -_- |) ") print(" O\\ = /O ") print(" ____/`---'\\____ ") print(" . ' \\| |// `. ") print(" / \\||| : |||// \\ ") print(" / _||||| -:- |||||- \\ ") print(" | | \\\\\\ - /// | | ") print(" | \\_| ''\\---/'' | | ") print(" \\ .-\\__ `-` ___/-. / ") print(" ___`. .' /--.--\\ `. . __ ") print(" ."" '< `.___\\_<|>_/___.' >'"". ") print(" | | : `- \\`.;`\\ _ /`;.`/ - ` : | | ") print(" \\ \\ `-. \\_ __\\ /__ _/ .-` / / ") print(" ======`-.____`-.___\\_____/___.-`____.-'====== ") print(" `=---=' ") print(" ") print(" ............................................. ") print(" Prey for no bug ") print(" Zen of python: ") print(" Beautiful is better than ugly.; ") print(" Explicit is better than implicit. ") print(" Simple is better than complex. ") print(" Complex is better than complicated. ") print(" Flat is better than nested. ") print(" Sparse is better than dense. ") print(" Readability counts. ") print(" Now is better than never. ") def main(): fozu() parser = argparse.ArgumentParser(description="Trim the sequencing data in the directory.") parser.add_argument('-d', '--directory', help='The directory where you put the sequencing files.', default='') parser.add_argument('-p', '--program', help='chose the program you wang to use (btrim or fqtrim, default is btrim)', default='btrim') parser.add_argument('-g', '--is_genome', help='"T" for sequencing data without poly A (genome sequencing data, default),\ "F" for sequencing data with poly A (transcriptome sequencing data).\ This option is only useful if you use fqtrim.', default='T') args = parser.parse_args() f_proc = FilePorcessor() f_proc = f_proc.fit(args.directory) paired_seq_files = f_proc.get_paired_seq_fpaths() cmd_proc = CmdProcessor() cmd_proc.fit(paired_seq_files, args.is_genome) if args.program.lower() == 'btrim': cmd_proc.cmd_btrim() elif args.program.lower() == 'fqtrim': cmd_proc.cmd_fqtrim() else: print("Wrong program, please choose 'btrim', or 'fqtrim'.") if __name__ == '__main__': main()
from Crypto.Cipher import AES from collections import OrderedDict def pad(data): pad_length = 16 - len(data) % 16 return data + bytearray(pad_length * [pad_length]) def unpad(data): pad_length = data[-1] if pad_length < 16: data = data[:-pad_length] return data def parse(qs): result = OrderedDict() pairs = qs.split('&') for pair in pairs: key, value = pair.split('=') result[key] = value return result def escape(value): return value.replace('&', 'and').replace('=', 'is') def unparse(values): pairs = [] for key, value in values.items(): pairs.append(escape(key) + '=' + escape(str(value))) return '&'.join(pairs) def profile_for(email): return unparse(OrderedDict([ ('email', email), ('user_id', 10), ('role', 'user') ])) def encrypted_profile_for(email): return encrypt(profile_for(email)) def encrypt(data): data = bytearray(data, 'utf-8') with open('key.txt', 'rb') as fp: key = fp.read() assert len(key) == 16 padded = pad(data) return AES.new(key, AES.MODE_ECB).encrypt(bytes(padded)) def decrypt(data): with open('key.txt', 'rb') as fp: key = fp.read() assert len(key) == 16 return unpad(AES.new(key, AES.MODE_ECB).decrypt(data)) def decrypt_profile(encrypted): return parse(decrypt(encrypted).decode('utf-8', 'ignore')) qs = 'foo=bar&baz=qux&zap=zazzle' print(parse(qs)) print(profile_for("foo@bar.com")) print(profile_for("foo@bar.com&admin=yes")) print(decrypt_profile(encrypted_profile_for('test@foo.com'))) print(profile_for('hello@world.com')) # email=h@old.com&user_id=10&role=user # ================================ ends_in_role_is = encrypted_profile_for('h@old.com')[0:32] # email=foofoofoofadmin&user_id=10&role=user # ================ has_admin = encrypted_profile_for('foofoofoofadmin')[16:32] print(decrypt_profile(ends_in_role_is + has_admin))
# -*- coding: utf-8 -*- import scrapy from scrapy import Request from recruitment.items import TongchengItem class TongchengSpider(scrapy.Spider): handle_httpstatus_list = [301, 302] name = 'tongcheng' allowed_domains = ['58.com'] #一期数据爬取 didian_list={'bj','cd','cq','cs','cc','dl','dg','fz'} #二期数据爬取 didian_list2 = {'fs','gz', 'gy','gl','hz','hz','heb','hf','hhht','hk','jn','km', 'lz','ls','nj','nb','nn','nc','qd','sh','sz', 'sy','sjz','sz','tj','ty','wh','wx','wlmq','wh', 'xa','xm','xn','yc','yc','yt','zz','zh'} # tongcheng_url='http://jn.58.com/tech/pn1/?utm_source=market&spm=b-31580022738699-me-f-824.bdpz_biaoti&PGTID=0d303655-0010-915b-ca53-cb17de8b2ef6&ClickID=3' tongcheng_url='http://{dd}.58.com/tech/' num = 0 def start_requests(self): for didian in self.didian_list: yield Request(self.tongcheng_url.format(dd=didian), self.parse_per_page) def parse_per_page(self, response): url_list = response.css('.main .leftbar .infolist dt a::attr(href)').extract() if not url_list: url_list = response.css('.main .leftCon li .job_name a::attr(href)').extract() if not url_list: print('url list 为空') for tongcheng_per_message_url in url_list: yield Request(url=tongcheng_per_message_url, callback=self.parse_per_message) #下一界面的链接 tongcheng_next_page = response.css('.main .leftbar .pagerout .next::attr(href) ').extract_first() if not tongcheng_next_page: tongcheng_next_page = response.css('.con .main .leftCon .pagesout .next::attr(href) ').extract_first() if tongcheng_next_page: yield Request(url=tongcheng_next_page, callback=self.parse_per_page) def parse_per_message(self, response): if response.css('.con'): #公司地点 gsdd = response.css('.con .leftCon .pos_info .pos-area .pos_area_item::text ').extract_first().strip() #公司名称 gsmc= response.css('.con .rightCon .item_con .company_baseInfo .comp_baseInfo_title .baseInfo_link a::text').extract_first().strip() #岗位描述 gwms_arr=response.css('.con .leftCon .item_con .pos_description .posDes .des::text').extract() gwms= ''.join(gwms_arr).strip().replace('/t', '') #职位类别 zwlb = response.css('.con .leftCon .item_con .pos_base_info .pos_title::text').extract_first().strip() #职位月薪 zwyx = response.css('.con .leftCon .item_con .pos_base_info .pos_salary::text').extract_first().strip() # 职位名称 zwmc = response.css('.con .leftCon .item_con .pos_name::text').extract_first().strip() condition = response.css('.con .leftCon .item_con .pos_base_condition .item_condition::text').extract() #招聘人数 zprs = condition[0].strip() #学历要求 xlyq = condition[1].strip() #经验要求 jyyq = condition[2].strip() item=TongchengItem() item['gsmc'] = gsmc item['zwmc'] = zwmc item['zprs'] = zprs item['zwyx'] = zwyx item['gsdd'] = gsdd item['xlyq'] = xlyq item['jyyq'] = jyyq item['gwms'] = gwms item['zwlb'] = zwlb item['xxly'] = '58同城' yield item
import matplotlib.pyplot as plt import numpy as np from scipy.interpolate import make_interp_spline as spline U = np.array([0, 0.15, 0.24, 0.3, 0.41, 0.51, 0.6, 0.7, 0.75, 0.76, 0.78]) I = np.array([0, 0, 0, 0, 0, 0.02, 1.9, 13.9, 46.7, 59.1, 98.1]) # U_smooth = np.linspace(U.min(), I.max(), 300) # I_smooth = spline(U, I)(U_smooth) plt.plot(U, I, '--', U, I, 'r.', label = "V/A") plt.title("Diode's Positive V/A", fontsize = 18) plt.xlabel("Voltage/V", fontsize = 16) plt.ylabel("Current/mA", fontsize = 16) plt.legend() # for u, i in zip(U, Iv): # plt.text(u, i, (u,i), ha='right', va='bottom', fontsize = 5) plt.grid(True) plt.xticks(np.arange(0, 0.9, 0.1)) plt.yticks(np.arange(0, 105, 5)) plt.show()
repo = { r"profiles/[\w-]+" : Profile, r"[^/]+" : Category, r"[^/]+/[^/]+" : CatPkg, r"[^/]+/[^/]+/[^_]+" : PkgAtom, } disk = { r"[^/]+" : Category, r"[^/]+/[^/]+" : CatPkg, r"[^/]+/[^/]+/[^_]+" : PkgAtom, class Root(object): def __init__(self,path): self.path = path def __hash__(self): return hash(path) def __eq__(self,other): return self.path == other.path class Path(object): def __init__(self,root,path): self.root = root self.path = path def __hash__(self): return hash(self.fullpath) def adjpath(self,change): # This returns a new path - # foo.adjpath("..") would return the previous directory. # foo.adjpath("foo") would return a path to the current path plus "/foo" # foo.adjpath("/foo") would return an absolute path "/foo. # The path root for the new path is the same as this path. if os.path.isabs(change): return Path(root=self.root,path=change) else: return Path(root=self.root,path=os.path.normpath(os.path.join(self.path, change))) def contents(self): objs = set() for file in os.path.listdir(self.fullpath): objs.add(self.adjpath(file)) return objs @property def fullpath(self): return os.path.join(self.root.path,self.path) def exists(self): return os.path.exists(self.fullpath) def open(self,mode): return open(self.fullpath,mode) class PortageRepository(Path): def contents(self): cats = set(os.path.listdir(self.fullpath) & valid objs = set() for cat in cats: objs.add(Category(root=self.root,path=cat)) return objs @property def valid(self): return set(self.path.adjpath("profiles/categories").grabfile()) class Category(Path): def contents(self): objs = set() for catpkg in os.path.listdir(self.fullpath): objs.add(CatPkg(root=self.root,path="%s/%s" % (self.path, catpkg))) return objs class CatPkg(Path): def contents(self): objs = set() for pkgatom in os.path.listdir(self.fullpath): if pkgatom[-7:] != ".ebuild": continue vers = pkgatom[len(self.path):-7] objs.add(PkgAtom(root=self.root,path="%s/%s" % (self.path, vers))) return objs class PkgAtom(Path): def exists(self): class GitPortageRoot(Root): class ProfileRoot(Root):
# coding: utf-8 from django.views.generic import FormView from .classes import Keeper from .forms import PaymentForm from .mixins import AjaxFormMixin from .models import AppUser class HomepageView(AjaxFormMixin, FormView): template_name = 'homepage.html' form_class = PaymentForm @staticmethod def get_class_children(): for i in xrange(1, 4): Keeper() return Keeper.get_instances() def get_context_data(self, **kwargs): context = super(HomepageView, self).get_context_data(**kwargs) context['class_children'] = self.get_class_children() return context def process_data(self, data): user, receivers, amount = data['user'], data['receivers'], data['amount'] if receivers: part = amount / float(len(receivers)) user.change_balance(-amount) receivers = AppUser.objects.filter(inn__in=receivers) for receiver in receivers: receiver.change_balance(part)
#!/usr/bin/python env # coding: utf-8 from helper.model import DBConnection from config import finance_dict import time """" mysql数据库迁移 """ if __name__ == "__main__": # model = Model() # model.select(select_param=["id", "name", "gender"], where_param={"name = ": "jack", "gender = ": "M"}) # model.order_by(["name desc", "gender desc"]) # model.limit(1, 4) # result = model.execute() # print result # model.insert(result) # 配置 print finance_dict # 迁移数据库 model = DBConnection(**finance_dict) # 要迁移的数据库表 CpcFinanceDetail model.table_name = "CpcFinanceDetail" model_v2 = DBConnection(**finance_dict) # 迁移的数据迁移到 CpcFinanceDetail1 model_v2.table_name = "CpcFinanceDetail1" # 从线下库中找到上次同步的id model_v2.select(select_param=["max(id) as max_id"]) mid = model_v2.execute() max_id = mid[0]["max_id"] if max_id is None: max_id = 0 # 同步操作 status = True # while status: model.select(select_param=["*"], where_param={"id > ": max_id}) model.limit(0, 1000) item_list = model.execute() print item_list # item_list = model.execute() # if not item_list: # status = False # break # count = len(item_list) # max_id = item_list[count - 1]["id"] # # print "正在向表 " + table + " 表中插入" + str(count) + " 条数据 当前id为 " + str(max_id) # # 插入到广告线下数据库 # model_v2.insert(item_list) # model_v2.exe() # model_v2.commit() # # 停留0.1 s # time.sleep(0.1)
import os from flask import Flask, render_template app = Flask(__name__) # disable caching app.config['SEND_FILE_MAX_AGE_DEFAULT'] = 0 @app.route("/") @app.route("/index") def show_image(): image_path = os.sep.join(["static", "co2.png"]) return render_template("index.html", co2_graph_path=image_path)
#!/usr/bin/env python # # test_state.py - # # Author: Paul McCarthy <pauldmccarthy@gmail.com> # import os.path as op from fsl.data.image import Image from fsl.data.vtk import VTKMesh import fsleyes.state as state from fsleyes.views.orthopanel import OrthoPanel from fsleyes.views.histogrampanel import HistogramPanel from . import run_with_fsleyes, realYield datadir = op.join(op.dirname(__file__), 'testdata') def _test_state(frame, overlayList, displayCtx): rfile = op.join(datadir, 'mesh_ref.nii.gz') mfile = op.join(datadir, 'mesh_l_thal.vtk') overlayList.append(Image( rfile)) overlayList.append(VTKMesh(mfile)) ref, mesh = overlayList ropts = displayCtx.getOpts(ref) mopts = displayCtx.getOpts(mesh) ropts.cmap = 'hot' mopts.refImage = ref mopts.outline = True frame.addViewPanel(OrthoPanel) frame.addViewPanel(HistogramPanel) oopts = frame.viewPanels[0].sceneOpts oopts.showXCanvas = False oopts.zzoom = 2000 frame.viewPanels[1].smooth = True frame.viewPanels[1].histType = 'count' realYield(200) st = state.getState(frame) frame.removeAllViewPanels() del overlayList[:] realYield(200) state.setState(frame, st) realYield(200) ortho, hist = frame.viewPanels assert isinstance(ortho, OrthoPanel) assert isinstance(hist, HistogramPanel) assert not ortho.sceneOpts.showXCanvas assert ortho.sceneOpts.zzoom == 2000 assert hist.smooth assert hist.histType == 'count' ref, mesh = overlayList assert isinstance(ref, Image) assert isinstance(mesh, VTKMesh) ropts = displayCtx.getOpts(ref) mopts = displayCtx.getOpts(mesh) assert ropts.cmap.name == 'hot' assert mopts.refImage is ref assert mopts.outline def test_state(): run_with_fsleyes(_test_state)
import unittest #from django.http import HttpResponse #from django.test.client import RequestFactory from django.test import Client from django.contrib.auth.models import User from pip._vendor.requests import session class MyTestCase(unittest.TestCase): def test_FactoryUserStatus(self): # Running from views import FactoryUserStatus self.assertEquals("receptionist", FactoryUserStatus("rachel")) def test_get_boolean(self): from views import get_boolean self.assertEqual(get_boolean("yes"), True) def test_sign_up_success(self): from views import signup_page from django.test import Client c = Client() response = c.post('/register/',{'username':'Monika','password':'123456','confirm_password':'123456','fname':'testName', 'lname':'testLastName','gender':'Female','dob':'testDate','insurance':'yes', 'mobileno':'testmobno','address':'testAddress','zipcode':'dfgdgd','state':'testState'}) #print response.status_code self.assertIsNotNone(response.content) def test_sign_up_fail(self): from views import signup_page from django.test import Client c = Client() response = c.post('/register/', {'username': 'rachel', 'password': '123456', 'confirm_password': '123456', 'fname': 'testName', 'lname': 'testLastName', 'gender': 'Female', 'dob': 'testDate', 'insurance': 'yes', 'mobileno': 'testmobno', 'address': 'testAddress', 'zipcode': 'dfgdgd', 'state': 'testState'}) #self.assertIsNotNone(response.url) #self.assertTemplateUsed(response,'register.html') #self.assertContains(response, 'This username is already being taken!') def test_getDoctors(self): from views import show_doctors from django.http import HttpRequest get_req = HttpRequest() names = show_doctors(get_req) self.assertIsNotNone(names) #print names.content def test_checkBeds(self): from django.http import HttpRequest from views import check_beds get_req = HttpRequest() get_req.user=User() get_req.user.username="aferguson0" get_req.user.password="1234567890" from django.test import Client c = Client() response= c.post('/check_beds/') self.assertIsNotNone(check_beds(get_req,'aferguson0')) def test_check_login_page_POST(self): import requests from views import admit_patient import json headers = {'content-type': 'application/json'} url = 'http://127.0.0.1:8000/login/' data = {"data": {"username": "dcole0","password":"1234567890"}} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) # Test that ShowDoctors does not return None def test_show_doctors(self): from django.http import HttpRequest from views import show_doctors testrequest = HttpRequest() self.assertIsNotNone(show_doctors(testrequest)) # View appointments for Doctors def test_view_appointments_doctors(self): from django.http import HttpRequest from views import view_appointments_doctors testrequest = HttpRequest() testuser = User() testuser.username='dcole0' testuser.password='1234567890' testuser.is_active = True testrequest.user = testuser self.assertIsNotNone(view_appointments_doctors(testrequest,testrequest.user.username)) # View appointments for Patients def test_view_appointments_patients(self): from django.http import HttpRequest from views import view_appointments_patients testrequest = HttpRequest() testuser = User() testuser.username = 'sscott0' testuser.password = '1234567890' testuser.is_active = True testrequest.user = testuser self.assertIsNotNone(view_appointments_patients(testrequest, testrequest.user.username)) # View Time for patients def test_view_time(self): from django.http import HttpRequest from views import view_time testrequest = HttpRequest() testuser = User() testuser.username = 'dcole0' testuser.password = '1234567890' testuser.is_active = True testrequest.user = testuser self.assertIsNotNone(view_time(testrequest, testrequest.user.username)) # Test Admit Patient def test_admit_patient(self): import requests from views import admit_patient import json headers = {'content-type': 'application/json'} url = 'http://127.0.0.1:8000/admit/aferguson0/' data = {"data": {"patientID": None}} params = {'sessionKey': '9ebbd0b25760557393a43064a92bae539d962103', 'format': 'xml', 'platformId': 1} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) # Test Add Doctors def test_doctor_add(self): from views import doctor_add import requests import json url = 'http://127.0.0.1:8000/doctoradd/aferguson0/' data = {"data": {"patientID": None}} params = {'sessionKey': '9ebbd0b25760557393a43064a92bae539d962103', 'format': 'xml', 'platformId': 1} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) def test_patient_discharge(self): import requests from views import admit_patient import json headers = {'content-type': 'application/json'} url = 'http://127.0.0.1:8000/discharge/aferguson0/' data = {"data": {"patientID": None}} params = {'sessionKey': '9ebbd0b25760557393a43064a92bae539d962103', 'format': 'xml', 'platformId': 1} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) def test_set_office_hours(self): import requests from views import set_office_hours import json headers = {'content-type': 'application/json'} url = 'http://127.0.0.1:8000/timings/dcole0/monday' data = {"data": {"starttime": '2.30pm',"endtime": '3.30pm','starttime2':'5.30pm', 'endtime2':'8.30pm'}} params = {'sessionKey': '9ebbd0b25760557393a43064a92bae539d962103', 'format': 'xml', 'platformId': 1} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) def test_option_maker(self): from views import option_maker retVal = option_maker('holiday', "dcole0", "Sunday") for i in retVal: print i self.assertIsNotNone(retVal) def test_get_clean_timings_array(self): from views import get_clean_timings_array retVal = get_clean_timings_array('holiday') self.assertIsNotNone(retVal) def test_transfer_patient(self): import requests import json url = 'http://127.0.0.1:8000/transfer/rachel/sscott0' data = {"data": {"doctorID": 'dcole0', "description": 'Needs eye surgery'}} self.assertIsNotNone(requests.post(url, params={}, data=json.dumps(data), headers=None)) def test_view_transfer_consents(self): import requests url = 'http://127.0.0.1:8000/tconsent/dcole0' self.assertIsNotNone(requests.post(url, params={}, headers=None)) def test_approve_transfer_consent(self): from django.http import HttpRequest from views import approve_transfer_consent testrequest = HttpRequest() testuser = User() testuser.username = 'dcole0' testuser.password = '123456789' testuser.is_active = True testrequest.user = testuser self.assertIsNotNone(approve_transfer_consent(testrequest, testrequest.user.username, "sscott0")) import requests url = 'http://127.0.0.1:8000/transferapprove/dcole0/sscott0' self.assertIsNotNone(requests.post(url, params={}, headers=None)) def test_reject_transfer_consent(self): from django.http import HttpRequest from views import reject_transfer_consent testrequest = HttpRequest() testuser = User() testuser.username = 'dcole0' testuser.password = '1234567890' testuser.is_active = True testrequest.user = testuser self.assertIsNotNone(reject_transfer_consent(testrequest, testrequest.user.username, "sscott0")) import requests url = 'http://127.0.0.1:8000/transferreject/dcole0/sscott0' self.assertIsNotNone(requests.post(url, params={}, headers=None)) if __name__ == '__main__': unittest.main()
# filename : jutil.py # author : Jinho D. Choi # last update: 4/19/2010 import math # Converts 'i' into 'n' binary bits # i: integer # n: number of bits: integer def bits(i, n): return tuple((0,1)[i>>j & 1] for j in range(n-1,-1,-1)) # Returns sublist of 'L' indicated by 't'. # L: list # t: binary tuple def getSub(L, t): ls = list() for i in range(0, len(L)): if t[i] == 1: ls.append(L[i]) return ls # Returns the permutation of 'L'. # L: list def permutations(L): ls = list() size = len(L) for i in range(1, int(math.pow(2, size))): ls.append(getSub(L, bits(i, size))) return ls
file = open('PersonalData.txt','w') file.write("Sebastian Bętkowski\n") file.write("Uniwersytet Ekonomiczny\n") file.write("Informatyka Stosowana") file.close()
#!/usr/bin/env python # encoding: utf-8 """ Created by Nick DeVeaux on 2014-08-07. to run: python counting_nucleotides.py < dna.txt Sample Dataset AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC Sample Output 20 12 17 21 """ import sys import os import utils import fileinput def nucleiotide_incidence(seq): incidence = [] for bp in ('A', 'C', 'G', 'T'): incidence.append(seq.count(bp)) return incidence def main(): args = [] for line in fileinput.input(): args.append(line.rstrip()) input = args[0] utils.print_array(nucleiotide_incidence(input)) if __name__ == '__main__': main()
from sys import argv, exit script, sstfile, imgName = argv import matplotlib matplotlib.use('Agg') #import pandas as pd import numpy as np from netCDF4 import Dataset, num2date import datetime #from itertools import compress import matplotlib.pyplot as plt import cartopy.crs as ccrs import cartopy.feature as cfeature from mpl_toolkits.axes_grid1 import make_axes_locatable sstnc=Dataset(sstfile,'r') lon=sstnc.variables['lon'][:] lat=sstnc.variables['lat'][:] sst=np.squeeze(sstnc.variables['sst'][:]) sst[sst==-999]=np.nan sstt=sstnc.variables['time'] t=num2date(sstt[0],units=sstt.units,calendar=sstt.calendar) LAND = cfeature.NaturalEarthFeature( 'physical', 'land', '10m', edgecolor='face', facecolor='tan') state_lines = cfeature.NaturalEarthFeature( category='cultural', name='admin_1_states_provinces_lines', scale='50m', facecolor='none') def plotMap(figname,figtitle,data): plt.close('all') fig, ax = plt.subplots(figsize=(11, 8),subplot_kw=dict(projection=ccrs.PlateCarree())) gl = ax.gridlines(crs=ccrs.PlateCarree(), draw_labels=True, linewidth=2, color='gray', alpha=0.5, linestyle='--') gl.xlabels_top = False gl.ylabels_right = False plt.title(figtitle) divider = make_axes_locatable(ax) cax = divider.new_horizontal(size='5%', pad=0.05, axes_class=plt.Axes) fig.add_axes(cax) ax.set_extent([np.min(lon),np.max(lon),np.min(lat),np.max(lat)]) ax.add_feature(LAND, zorder=0, edgecolor='black') ax.add_feature(cfeature.LAKES, facecolor='white') ax.add_feature(cfeature.BORDERS) ax.add_feature(state_lines, edgecolor='black') h=ax.pcolor(lon,lat,data,vmin=0,vmax=30,cmap='jet') cb=plt.colorbar(h,cax=cax) plt.savefig(figname, dpi=300) plotMap(imgName,'1-day Coldest Pixel AVHRR Composite '+t.strftime('%Y-%m-%d'),sst) plt.close('all') exit()
from django_cron import cronScheduler, Job from ioestu.endofday import * class CheckMail(Job): """ Cron Job that checks the lgr users mailbox and adds any approved senders' attachments to the db """ # run every 300 seconds (5 minutes) run_every = 300 def job(self): backupDatabase() cronScheduler.register(CheckMail)
s=input() if str(s).isdigit() and str(s).isupper() or str(s).islower(): print("yes") else: print("no")
# -*- coding: utf-8 -*- # Generated by Django 1.10.5 on 2019-07-04 09:52 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('main_app', '0008_auto_20190628_1447'), ] operations = [ migrations.AlterField( model_name='restraunt', name='closing_hour', field=models.TimeField(blank=True, null=True), ), migrations.AlterField( model_name='restraunt', name='opening_hour', field=models.TimeField(blank=True, null=True), ), ]
# Bioinformatics # Normalize raw dataset using MEAN or MEDIAN value # Spike-in control normalization # 4/7/2018, Bongsoo Park, Johns Hopkins import operator import numpy as np f = open("raw_data_before_normalization.txt","r") line_cnt = 0 id_list = [] norm_factor_mean = [] norm_factor_median = [] mirna_dataset = {} for line in f: line = line.strip() data = line.split("\t") #print len(data) # treatment of header if line_cnt == 0: cnt = 0 for ele in data: if cnt > 1: id_list.append(ele) cnt += 1 else: tmp = [] cnt = 0 for ele in data: if cnt > 1: tmp.append(ele) cnt += 1 mirna_dataset.update({data[0]:tmp}) # calculate normalization factors (Spike-in control) if data[0] == "UniSp6 CP": #print data x = [] cnt = 0 for ele in data: if cnt > 1: x.append(float(ele)) cnt += 1 x = np.array(x) y = np.mean(x) z = np.median(x) print "MEAN:", np.mean(x) print "MEDIAN:", np.median(x) cnt = 0 for ele in data: if cnt > 1: norm_factor_mean.append(float(ele)/y) norm_factor_median.append(float(ele)/z) cnt += 1 print "processing normalized factor for MEAN and MEDIAN..." line_cnt += 1 f.close() #print len(id_list) #print len(norm_factor_mean) #print len(norm_factor_median) normalized_mirna_dataset = {} for the_key, the_value in sorted(mirna_dataset.items(), key=operator.itemgetter(0)): norm_array = "" cnt = 0 for ele in mirna_dataset[the_key]: try: norm_array += "\t" + str(float(ele)/norm_factor_mean[cnt]) except: norm_array += "\t" + "ND" cnt += 1 print the_key+norm_array
""" .. module:: verzamelend.tests :platform: Unix :synopsis: .. moduleauthor:: Pedro Salgado <steenzout@ymail.com> """ import os import verzamelend.config import verzamelend.logging import logging import unittest LOGGING_CONFIG_FILE = '%s/tests/logging.conf' % os.curdir PACKAGE_CONFIG_FILE = '%s/tests/verzamelend.cfg' % os.curdir class Basic(object): """ Basic functionality to enhance test cases. """ def setup_configuration(self): """ Setup test configuration. It will also load (once) the test configuration. """ logging.getLogger('%s.%s' % (__name__, 'Basic')).info('setup_configuration()') verzamelend.config.reset() verzamelend.config.load_configuration(PACKAGE_CONFIG_FILE) self.configuration = verzamelend.config.get() def setup_logger(self): """ Setup test logger. It will also load (once) the test logging configuration. """ logging.getLogger('%s.%s' % (__name__, 'Basic')).info('setup_logger()') verzamelend.logging.load_configuration(LOGGING_CONFIG_FILE) self.logger = logging.getLogger('%s.%s' % (__name__, self.__class__.__name__)) class BaseTestCase(unittest.TestCase, Basic): """ Base test case. """ __slots__ = ('configuration', 'logger') def __init__(self, methodName): """ Initializes a BaseTestCase instance. :param methodName: the test method to be executed. :type methodName: str """ super(BaseTestCase, self).__init__(methodName) self.setup_logger() self.setup_configuration() def setUp(self): """ Setup test resources. """ self.logger.info('setUp()') def tearDown(self): """ Tear down test resources. """ self.logger.info('tearDown()') class MockConfig(object): """ Mock object for the collectd configuration. """ def __init__(self, children): """ Initializes a MockConfig object. :param children: list of configuration items. :type children: list """ self.children = children
#!/usr/bin/env python """ A simple echo server """ import socket host = '' port = 12345 backlog = 5 size = 1024 s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.bind((host,port)) s.listen(backlog) while 1: client, address = s.accept() amountsent = 0 while True: try: data = client.recv(size) except Exception, e: print 'recv',e data = '' amountsent = amountsent + len(data) if data: try: client.send(data) except Exception, e: print 'send',e data = '' if not data: print "closing with", amountsent client.close() break
from django.urls import path from . import views app_name = 'my_admin' urlpatterns = [ path('/index', views.index, name='index'), path('/manage', views.ManageUser, name='manage'), path('<int:id>/info', views.Info, name='info'), path('<int:id>/change', views.Change, name='change'), path('/saveinfo', views.SaveInfo, name='saveinfo'), path('<int:id>/delete', views.Delete, name='delete') ]
import numpy as np import struct import sys import pdb np.set_printoptions(threshold=np.inf) import scipy.misc caffe_root = '/home/mjhuria/caffe/' # this file is expected to be in {caffe_root}/examples sys.path.insert(0, caffe_root + 'python') import caffe import matplotlib.pyplot as plt # %matplotlib inline caffe.set_mode_cpu() model_def = '/media/mjhuria/New Volume/Vikram/EC551/Final/27-04/Test.prototxt' # model_def = '/home/mjhuria/caffe/to_train/caffe_alexnet_train_iter_10000.caffemodel' model_weights = '/media/mjhuria/New Volume/Vikram/EC551/Final/27-04/solver_iter_1785.caffemodel' model_weights_new = '/media/mjhuria/New Volume/Vikram/EC551/Final/27-04/solver_iter_50000.caffemodel' net = caffe.Net(model_def, # defines the structure of the model model_weights, # contains the trained weights caffe.TEST) # use test mode (e.g., don't perfor new_net = caffe.Net(model_def, # defines the structure of the model model_weights_new, # contains the trained weights caffe.TEST) # use test mode (e.g., don't perfor # print [(k, v.data.shape) for k, v in net.blobs.items()] # print [(k, v[0].data.shape, v[0].data.min(), v[0].data.max()) for k, v in net.params.items()] conv1_f = net.params['conv1'][0].data # conv kernels conv1_fb = net.params['conv1'][1].data # conv bias conv2_f = net.params['conv2'][0].data # conv kernels conv2_fb = net.params['conv2'][1].data # conv bias ip1_f = net.params['fc6'][0].data # inner product weights ip1_fb = net.params['fc6'][1].data # inner product bias ip2_f = net.params['fc8'][0].data # inner product weights ip2_fb = net.params['fc8'][1].data # inner product bias ip2_fb_new = new_net.params['fc8'][1].data # inner product bias print("conv1") print(conv1_f) print("conv1_bias") print(conv1_fb) print("conv2") print(new_net.params['conv1'][0].data) print("conv1_bias") print(new_net.params['conv1'][1].data)
import os import platform import hashlib def clear(): return os.system('cls') if(platform.system() == "Windows") else os.system('clear') def hashmd5(password): return hashlib.md5(password.encode('utf-8')).hexdigest()
import math import os from random import randint from collections import deque import pygame from pygame.locals import * # Constants fps = 60 # frequency rate Animation_speed = 0.2 # horizontal flying speed window_width = 284*2 # the width of the window window_height = 512 # the height of the window class Bird(pygame.sprite.Sprite): bird_image_width = bird_image_height = 50 speed_up = 0.3 speed_down = 0.15 flying_duration_time = 300 def __init__(self,x,y,ms_to_climb,images): # construct function super(Bird,self).__init__() # pass the Bird class to its inherited class and initialize self.x, self.y = x, y self.ms_to_climb = ms_to_climb # construct at the level of Bird class self._image_wingup, self._image_wingdown = images # construct at the level of the father class self._mask_wingup = pygame.mask.from_surface(self._image_wingup) # mask for later collision detection self._mask_wingdown = pygame.mask.from_surface(self._image_wingdown) def update(self, delta_frame = 1): # update the bird's position, delat_frame indicates the number of frames # since this method was last called if self.ms_to_climb > 0 : # if the bird is flying up percentage_motion_done = 1 - self.ms_to_climb/Bird.flying_duration_time # percentage of the whole flying up motion self.y -= (Bird.speed_up * frame_to_ms(delta_frame) * (1 - math.cos(percentage_motion_done * math.pi))) # updating the bird position with the defined consine function self.ms_to_climb -= frame_to_ms(delta_frame) # update the ms_to_climb accordingly else: self.y += Bird.speed_down * frame_to_ms(delta_frame) # if the bird is flying down, just appling speed_down @property def image(self): # deciding when to show wing_up or wing_down if pygame.time.get_ticks() % 300>=150: # returns ms after pygame init() return self._image_wingdown else: return self._image_wingup @property def mask(self): # for detecting the collision if pygame.time.get_ticks() % 300>=150: return self._mask_wingdown else: return self._mask_wingup @property # return Rect object for pygame to store and manipulate rectangle ares def rect(self): return Rect(self.x,self.y,Bird.bird_image_width,Bird.bird_image_height) class Pipe(pygame.sprite.Sprite): pipe_width = 80 # width and height of a pipe body, same size with the image of pipe body pipe_height = 32 interval_generating_pipe = 2000 # time interval adding new pipes, in ms def __init__(self, pipe_end_img, pipe_body_img): self.x = float(window_width - 1) # new pipe will be added self.score_counted = False self.image = pygame.Surface((Pipe.pipe_width,window_height), SRCALPHA) # create a new image object, the pixel format will include a per-pixel alpha self.image.convert() self.image.fill((0,0,0,0)) # calculate the number of pipe body need to use for construct a pipe total_num_pipe_body = int((window_height - 3 * Bird.bird_image_height - 3 * Pipe.pipe_height)/Pipe.pipe_height) # randomly generate number of top and bottom pipes in pair self.num_pipe_bottom = randint(1, total_num_pipe_body) self.num_pipe_top = total_num_pipe_body - self.num_pipe_bottom # for bottom pipe for i in range(1, self.num_pipe_bottom+1): # calculate the position of the bottom pipe pos = (0, window_height - i * Pipe.pipe_height) # show the constructed image for pipes with the pipe body image and number of that self.image.blit(pipe_body_img, pos) # calculate the end position of the pipe without end part bottom_end_y = window_height - self.bottom_height_x # decide the position of the pipe_end bottom_end_piece_pos = (0, bottom_end_y - Pipe.pipe_height) # constructed image self.image.blit(pipe_end_img, bottom_end_piece_pos) # for top pipe for i in range(self.num_pipe_top): self.image.blit(pipe_body_img,(0, i * Pipe.pipe_height)) top_end_y = self.top_height_x self.image.blit(pipe_end_img, (0, top_end_y)) # compensate for added end pieces self.num_pipe_top += 1 self.num_pipe_bottom += 1 # for collision detection self.mask = pygame.mask.from_surface(self.image) # get the top and bottom pipe's height in pixels @property def top_height_x(self): return self.num_pipe_top * Pipe.pipe_height @property def bottom_height_x(self): return self.num_pipe_bottom * Pipe.pipe_height # determine whether such pipe will be visible to user @property def visible(self): return -Pipe.pipe_width < self.x < window_width # construct Rect object for pygame to store and manipulate @property def rect(self): return Rect(self.x, 0, Pipe.pipe_width, Pipe.pipe_height) # update the pipes' position. def update(self, delta_frames=1): # delta_frames: The number of frames elapsed since this method was last called. self.x -= Animation_speed * frame_to_ms(delta_frames) # check collision def collides_with(self, bird): return pygame.sprite.collide_mask(self, bird) def load_images(): def load_image(image_name): filename = os.path.join('.','images',image_name) image = pygame.image.load(filename) image.convert() return image return { 'background': load_image('background.png'), 'pipe-end': load_image('pipe_end.png'), 'pipe-body': load_image('pipe_body.png'), # images for animating the flapping bird -- animated GIFs are # not supported in pygame 'bird-wingup': load_image('bird_wing_up.png'), 'bird-wingdown': load_image('bird_wing_down.png') } # convert frames to milliseconds at the specified framerate def frame_to_ms(frame,fps=fps): return 1000.0*frame/fps # convert milliseconds to frames at the specified framerate def ms_to_frame(ms,fps=fps): return ms*fps/1000.0 def main(): # initialize the game. pygame.init() # set the size of the window and caption of the game display_game = pygame.display.set_mode((window_width,window_height)) pygame.display.set_caption('Flappy Bird') # track the amount of time clock = pygame.time.Clock() score_font = pygame.font.SysFont('arial',64,bold=True) images = load_images() bird_instance = Bird(50,int(window_height/2-Bird.bird_image_height/2),1,(images['bird-wingup'],images['bird-wingdown'])) pipes = deque() score = 0 frame_clock = 0 done = False while not done: # update the clock clock.tick(fps) # if game is running, generating pipes for game if not frame_clock % ms_to_frame(Pipe.interval_generating_pipe): pp = Pipe(images['pipe-end'], images['pipe-body']) pipes.append(pp) # get the event, decide reactions with respect to each event for event in pygame.event.get(): if event.type == QUIT or (event.type == KEYUP and event.key == K_ESCAPE): done = True break elif event.type == KEYUP and event.key == K_SPACE: bird_instance.ms_to_climb = Bird.flying_duration_time pipe_collision = any(p.collides_with(bird_instance) for p in pipes) # checking for the edge collision if pipe_collision or 0 >= bird_instance.y or bird_instance.y >= window_width - Bird.bird_image_height: done = True # showing the background image for x in (0, window_width / 2): display_game.blit(images['background'], (x, 0)) # showing the expected pipes to user while pipes and not pipes[0].visible: pipes.popleft() # updating the pipes for p in pipes: p.update() display_game.blit(p.image, p.rect) # updating the bird bird_instance.update() display_game.blit(bird_instance.image, bird_instance.rect) # update and display score for p in pipes: if p.x + Pipe.pipe_width < bird_instance.x and not p.score_counted: score += 1 p.score_counted = True # showing the score score_surface = score_font.render(str(score), True, (255, 255, 255)) score_x = window_width / 2 - score_surface.get_width() / 2 display_game.blit(score_surface, (score_x, Pipe.pipe_height)) # update the full display surface to the screen pygame.display.flip() frame_clock += 1 print('Game over! Score: %i' % score) pygame.quit() if __name__ == '__main__': main()