text
stringlengths
38
1.54M
#!/usr/local/bin/python3 # -*- conding: UTF-8 -*- # Filename:primeNum.py # author by : Lexi # 质数判断 # 一个大于1的自然数,除了1和它本身外,不能被其他自然数(质数)整除(2, 3, 5, 7等),换句话说就是该数除了1和它本身以外不再有其他的因数。 while True: try: num = int(input('输入一个整数:')) except ValueError: print("输入的不是整数!") continue # 质数大于1 if num > 1: #查看因子 for i in range(2,num): if (num % i) == 0: print(num,"不是质数") print(i,"乘以",num//i,"是",num) break else: print(num,"是质数") # 如果输入的数字小于或等于1,不是质数 else: print(num,"不是质数") break
#!/usr/bin/env python from setuptools import find_packages, setup setup( name='drongo', version='1.2.0', description='A nano web-framework for python.', author='Sattvik Chakravarthy, Sagar Chakravarthy', author_email='sattvik@gmail.com', classifiers=[ 'Development Status :: 5 - Production/Stable', 'Environment :: Console', 'Environment :: Web Environment', 'Intended Audience :: Developers', 'License :: OSI Approved :: MIT License', 'Operating System :: MacOS :: MacOS X', 'Operating System :: Microsoft :: Windows', 'Operating System :: POSIX', 'Programming Language :: Python', 'Topic :: Internet :: WWW/HTTP', ], packages=find_packages(), url='https://github.com/drongo-framework/drongo', include_package_data=True, install_requires=[ 'six', ], zip_safe=False, )
#!/usr/bin/env python # # glvector_funcs.py - Functions used by glrgbvector_funcs and # gllinevector_funcs. # # Author: Paul McCarthy <pauldmccarthy@gmail.com> # """This module contains logic for managing vertex and fragment shader programs used for rendering :class:`.GLRGBVector` and :class:`.GLLineVector` instances. These functions are used by the :mod:`.gl14.glrgbvector_funcs` and :mod:`.gl14.gllinevector_funcs` modules. """ import numpy as np import fsleyes.gl.shaders as shaders import fsl.utils.transform as transform def destroy(self): """Destroys the vertex/fragment shader programs created in :func:`init`. """ self.shader.destroy() self.shader = None def compileShaders(self, vertShader): """Compiles the vertex/fragment shader programs (by creating a :class:`.GLSLShader` instance). If the :attr:`.VectorOpts.colourImage` property is set, the ``glvolume`` fragment shader is used. Otherwise, the ``glvector`` fragment shader is used. """ if self.shader is not None: self.shader.destroy() opts = self.opts useVolumeFragShader = opts.colourImage is not None if useVolumeFragShader: fragShader = 'glvolume' else: fragShader = 'glvector' vertSrc = shaders.getVertexShader( vertShader) fragSrc = shaders.getFragmentShader(fragShader) if useVolumeFragShader: textures = { 'clipTexture' : 1, 'imageTexture' : 2, 'colourTexture' : 3, 'negColourTexture' : 3 } else: textures = { 'modulateTexture' : 0, 'clipTexture' : 1, 'vectorTexture' : 4, } self.shader = shaders.ARBPShader(vertSrc, fragSrc, shaders.getShaderDir(), textures) def updateShaderState(self): """Updates the state of the vector vertex and fragment shaders - the fragment shader may may be either the ``glvolume`` or the ``glvector`` shader. """ opts = self.opts useVolumeFragShader = opts.colourImage is not None modLow, modHigh = self.getModulateRange() clipLow, clipHigh = self.getClippingRange() clipping = [clipLow, clipHigh, -1, -1] if np.isclose(modHigh, modLow): mod = [0, 0, 0, -1] else: mod = [modLow, modHigh, 1.0 / (modHigh - modLow), -1] # Inputs which are required by both the # glvolume and glvetor fragment shaders self.shader.setFragParam('clipping', clipping) clipCoordXform = self.getAuxTextureXform('clip') colourCoordXform = self.getAuxTextureXform('colour') modCoordXform = self.getAuxTextureXform('modulate') self.shader.setVertParam('clipCoordXform', clipCoordXform) self.shader.setVertParam('colourCoordXform', colourCoordXform) self.shader.setVertParam('modCoordXform', modCoordXform) if useVolumeFragShader: voxValXform = self.colourTexture.voxValXform cmapXform = self.cmapTexture.getCoordinateTransform() voxValXform = transform.concat(cmapXform, voxValXform) voxValXform = [voxValXform[0, 0], voxValXform[0, 3], 0, 0] self.shader.setFragParam('voxValXform', voxValXform) else: colours, colourXform = self.getVectorColours() voxValXform = self.imageTexture.voxValXform voxValXform = [voxValXform[0, 0], voxValXform[0, 3], 0, 0] self.shader.setFragParam('voxValXform', voxValXform) self.shader.setFragParam('mod', mod) self.shader.setFragParam('xColour', colours[0]) self.shader.setFragParam('yColour', colours[1]) self.shader.setFragParam('zColour', colours[2]) self.shader.setFragParam('colourXform', [colourXform[0, 0], colourXform[0, 3], 0, 0]) return True
A, B = map(int, input().split()) sum = A + B print(A, '+', B, '=', sum) """ Вычислить A+B, где A и B целые числа в диапазоне -1017<A,B<1017 Формат входных данных В первой строке входных данных даны два числа A и B –(-1017<A,B<1017) Формат выходных данных Cтрока содержащая сумму двух чисел. """
# 4. Write a Python program to get a single string from two given strings, separated # by a space and swap the first two characters of each string. # Sample String : 'abc', 'xyz' # Expected Result : 'xyc abz' word1 = input("Enter the first string : ") word2 = input ("Enter the second string : ") first = word1.replace(word1[:2], word2[:2]) second = word2.replace(word2[:2], word1[:2]) print (first + ' ' + second)
# -*- coding: utf-8 -*- """ Created on Tue May 29 17:20:30 2018 @author: likkhian """ import numpy as np import tensorflow as tf import os from random import shuffle tf.logging.set_verbosity(tf.logging.INFO) def cnn_model_fn(features,labels,mode): '''model function for cnn''' #input layer input_layer=tf.reshape(features['x'],[-1,84,168,1]) #convolutional layer 1, including namescopes. Examine conv2d vs Conv2d! #Conv2d is a class. conv2d is a function that uses the Conv2d class. #to get more info, look up programmers_guide/low_level_intro and layer Function shortcuts #Use the class to dig into layer detail. with tf.name_scope('lik_conv1'): conv1=tf.layers.conv2d( inputs=input_layer, filters=32, kernel_size=[5,5], padding='same', activation=tf.nn.relu, name='conv1') conv1_kernel=tf.get_collection(tf.GraphKeys.VARIABLES, 'conv1/kernel')[0] conv1_kernel_transposed=tf.transpose(conv1_kernel,[3,0,1,2]) conv1_bias = tf.get_collection(tf.GraphKeys.VARIABLES, 'conv1/bias')[0] convimg1=tf.reshape(conv1,[-1,84,168,32,1]) convimg2=tf.transpose(convimg1,[0,3,1,2,4]) #pooling layer 1 pool1=tf.layers.max_pooling2d(inputs=conv1,pool_size=[3,6],strides=[3,6]) #convolutional layer 2, and pooling layer 2 with tf.name_scope('lik_conv2'): conv2=tf.layers.conv2d( inputs=pool1, filters=64, kernel_size=[5,5], padding='same', activation=tf.nn.relu) pool2=tf.layers.max_pooling2d(inputs=conv2,pool_size=[4,4],strides=4) #dense layer pool2_flat=tf.reshape(pool2,[-1,7*7*64]) dense=tf.layers.dense(inputs=pool2_flat,units=1024,activation=tf.nn.relu) #extract weights and bias for tensorboard histogram weights = tf.get_default_graph().get_tensor_by_name(os.path.split(dense.name)[0] + '/kernel:0') bias = tf.get_default_graph().get_tensor_by_name(os.path.split(dense.name)[0] + '/bias:0') dropout=tf.layers.dropout(inputs=dense,rate=0.4, training=mode==tf.estimator.ModeKeys.TRAIN) #logits layer logits=tf.layers.dense(inputs=dropout,units=12) predictions={ #generate predictions (for PREDICT and EVAL mode) 'classes':tf.argmax(input=logits,axis=1), #Add softmax_tensor to the graph. used for predict and logging hook 'probabilities':tf.nn.softmax(logits,name='softmax_tensor')} if(mode==tf.estimator.ModeKeys.PREDICT): return tf.estimator.EstimatorSpec(mode=mode,predictions=predictions) #calculate loss loss=tf.losses.sparse_softmax_cross_entropy(labels=labels,logits=logits) #save loss as a scalar tf.summary.scalar('lik_loss',loss) tf.summary.image('lik_input',input_layer,4) tf.summary.image('conv1_filter',conv1_kernel_transposed,32) tf.summary.histogram('conv1_bias',conv1_bias) tf.summary.histogram('lik_denasa_wts',weights) tf.summary.histogram('lik_dense_bias',bias) tf.summary.image('lik_convimg',convimg2[0,:,:,:],32) #add evaluation metrics. Moved it here so accuracy will be in training too eval_metric_ops={ 'accuracy':tf.metrics.accuracy( labels=labels, predictions=predictions['classes'])} tf.summary.scalar('lik_acc',eval_metric_ops['accuracy'][1]) #print confusion matrix images confused=tf.confusion_matrix(labels=labels,predictions=predictions['classes'],dtype=tf.float16) confused1=tf.reshape(confused,[1,12,12,1]) tf.summary.image('confusion_mat',confused1) #cols are predictions, rows are labels #print misclassified images mislabeled=tf.not_equal(tf.cast(predictions['classes'],tf.int32),labels) wrong_input=tf.boolean_mask(predictions['classes'],mislabeled) actual_label=tf.boolean_mask(labels,mislabeled) mislabeled2=tf.Print(mislabeled,[wrong_input,actual_label],'printing mislabeled') mislabeled_images = tf.boolean_mask(input_layer, mislabeled2) tf.summary.image('mislabled',mislabeled_images,4) #configure training op if(mode==tf.estimator.ModeKeys.TRAIN): optimizer=tf.train.GradientDescentOptimizer(learning_rate=0.001) train_op=optimizer.minimize( loss=loss, global_step=tf.train.get_global_step()) return tf.estimator.EstimatorSpec(mode=mode,loss=loss,train_op=train_op) return tf.estimator.EstimatorSpec(mode=mode,loss=loss,eval_metric_ops=eval_metric_ops) def main(unused_argv): #load training and eval data trmm_data = np.load('./trmm_data.npy').astype(np.float32) trmm_labels = np.load('./trmm_label.npy').astype(np.int32) c = list(zip(trmm_data,trmm_labels)) shuffle(c) trmm_data_t,trmm_labels_t=zip(*c) trmm_data=np.array(trmm_data_t) trmm_labels=np.array(trmm_labels_t) train_data = trmm_data[:int(0.8*len(trmm_labels))] test_data = trmm_data[int(0.8*len(trmm_labels)):] # validate_data = trmm_data[int(0.8*len(trmm_labels)):] train_labels = trmm_labels[:int(0.8*len(trmm_labels))] test_labels = trmm_labels[int(0.8*len(trmm_labels)):] # validate_labels = trmm_labels[int(0.8*len(trmm_labels)):] # c = list(zip(train_data,train_labels)) # shuffle(c) # train_data_t,train_labels_t=zip(*c) # train_data=np.array(train_data_t) # train_labels=np.array(train_labels_t) # # c2 = list(zip(test_data,test_labels)) # shuffle(c2) # test_data_t,test_labels_t=zip(*c) # test_data=np.array(test_data_t) # test_labels=np.array(test_labels_t) assert train_data.shape[0] == train_labels.shape[0] dataset = tf.contrib.data.Dataset.from_tensors((train_data, train_labels)) print(dataset) #create the estimator mnist_classifier=tf.estimator.Estimator(model_fn=cnn_model_fn, model_dir='./trmm_convnet4') #set up logging tensors_to_log={'probabilities':'softmax_tensor'} logging_hook=tf.train.LoggingTensorHook(tensors=tensors_to_log, every_n_iter=100) # training time train_input_fn=tf.estimator.inputs.numpy_input_fn( x={'x':train_data}, y=train_labels, batch_size=100, num_epochs=None, shuffle=True) mnist_classifier.train( input_fn=train_input_fn,steps=20000,hooks=[logging_hook]) eval_input_fn=tf.estimator.inputs.numpy_input_fn( x={'x':test_data}, y=test_labels, num_epochs=1, shuffle=False) eval_results=mnist_classifier.evaluate(input_fn=eval_input_fn) print(eval_results) if __name__=='__main__': tf.app.run()
from getAngles_cffi import ffi,lib def getAngles(angleX, angleY, hauteur): # forcing variable to be doubles anglex = ffi.cast("double",float(angleX)) angley = ffi.cast("double",float(angleY)) hauteur = ffi.cast("double",float(hauteur)) anglesMoteurs = ffi.new("double[3]") # computing lib.getAngles(anglex, angley, hauteur, anglesMoteurs) # for i, angle in enumerate(anglesMoteurs): anglesMoteurs[i] = 312 - angle # returning array of 3 angles return anglesMoteurs
from myPackage import tools as tl from myPackage import preprocess from myPackage import minutiaeExtraction as minExtract from enhancementFP import image_enhance as img_e from os.path import basename, splitext, exists import time from numpy import mean, std import os from imutils import paths import numpy as np from keras.preprocessing.image import ImageDataGenerator from keras.optimizers import Adam from sklearn.model_selection import train_test_split import _pickle as cPickle import sklearn.ensemble from sklearn import metrics from sklearn.metrics import accuracy_score from keras.preprocessing.image import img_to_array from keras.utils import to_categorical from pyimagesearch.lenet import LeNet from imutils import paths import matplotlib.pyplot as plt import numpy as np import argparse import random import cv2 as cv2 import os if __name__ == '__main__': # ap = argparse.ArgumentParser() # ap.add_argument("-p", "--path", required=True, # help="-p Source path where the images are stored.") # ap.add_argument("-r", "--results", required= False, # help="-r Destiny path where the results will be stored.") # args = vars(ap.parse_args()) # Configuration EPOCHS = 100 INIT_LR = 1e-3 BS = 32 image_ext = '.tif' plot = False path = None dir_gam = "./Image" dir_res = "E:\IBE\GitHub\MinutiaeFingerprint\Result" # ratio = 0.2 # Create folders for results # -r ../Data/Results/fingerprints # if args.get("results") is not None: # if not exists(args["results"]): # tl.makeDir(args["results"]) # path = args["results"] path = dir_res dir = "E:\Aji Sapta Pramulen\Python\Kode Program\images\SI" # grab the image paths and randomly shuffle them imagePaths = sorted(list(paths.list_images(dir_gam))) # random.seed(42) # random.shuffle(imagePaths) # Extract names all_images = tl.natSort(imagePaths) data = [] labels = [] # Split train and test data # train_data, test_data = tl.split_train_test(all_images, ratio) print("\nAll_images size: {}\n".format(len(all_images))) all_times= [] for image in all_images: start = time.time() name = splitext(basename(image))[0] print("\nProcessing image '{}'".format(name)) cleaned_img = preprocess.blurrImage(image, name, plot) enhanced_img = img_e.image_enhance(cleaned_img, name, plot) cleaned_img = preprocess.cleanImage(enhanced_img, name, plot) # skeleton = preprocess.zhangSuen(cleaned_img, name, plot) skeleton = preprocess.thinImage(cleaned_img, name, plot) # minExtract.process(skeleton, name, plot, path) label = image.split(os.path.sep)[-2] temp = minExtract.process(skeleton, name, label) if label == "Accidental": label = 1 elif (label == "Central pocket loop"): label = 2 elif (label == "Leteral pocket loop"): label = 3 elif (label == "Plain Arch"): label = 4 elif (label == "Plain whorl"): label = 5 elif (label == "Radial loop"): label = 6 elif (label == "Tented arch"): label = 7 elif (label == "Twinted loop"): label = 8 elif (label == "Ulnair loop"): label = 9 labels.append(label) # temp = minExtract.process(skeleton, name,label) data.append(temp) all_times.append((time.time()-start)) print("[INFO] loading . ...") # data = np.array(data) # labels = np.array(labels) # # # from sklearn.model_selection import train_test_split # # X_train, X_test, y_train, y_test = train_test_split(data, labels, test_size=0.25, random_state=0) # # # Fitting Logistic Regression to the Training set # from sklearn.ensemble import RandomForestClassifier # # classifier = RandomForestClassifier(n_estimators=5000, criterion='entropy', random_state=0) # classifier.fit(X_train, y_train) # # # Predicting the Test set results # y_pred = classifier.predict(X_test) # # print('SkLearn : ', metrics.accuracy_score(y_test, y_pred)) # print("Train Accuracy :: ", accuracy_score(y_train, classifier.predict(X_train))) # mean = mean(all_times) # std = std(all_times) # print("\n\nAlgorithm takes {:2.3f} (+/-{:2.3f}) seconds per image".format(mean, std))
# -*- coding: UTF-8 -*- # author:yuliang import time from threading import RLock,Thread import serial #龙岗IO class LongGangIO(Thread): def __init__(self,COM): Thread.__init__(self) self.com = COM self.IN_STATUS = {} self.isRunning =False self.serialPortLock=RLock() self.initIO() def initIO(self): try: self.BoardSerial = serial.Serial(port=self.com,baudrate=9600,timeout=2) self.BoardSerial.setRTS(False) self.isRunning=True self.start() except: import traceback traceback.print_exc() def run(self): while self.isRunning: self.getSTATUS() def getSTATUS(self): self.serialPortLock.acquire() try: self.BoardSerial.write(bytearray([0x00,0x5A,0x56,0x00,0x07,0x00,0x00,0x00,0xB7])) res = self.BoardSerial.read(9) except Exception as e: print(e) finally: self.serialPortLock.release() if res=='':return if res[-1]!=self.checkSum(res[:-1]): print('CHECKSUM ERROR') return if res: stat=res[7] print(stat,type(stat),type(res),res) mask=0b00000001 for i in range(8): self.IN_STATUS[i]=bool(stat&mask) mask=mask<<1 print(self.IN_STATUS) def checkSum(self,fram): sum=0 for i in fram: if type(i)==str: sum+=ord(i) else: sum+=i return sum%256 def __getitem__(self, item): try: return self.IN_STATUS[item] if item in self.IN_STATUS else False finally: pass def __setitem__(self, key, value): CMD=[0x00,0x5A,0x56,0x00,None,None,0x00,0x00,None] CMD[4]= 0x01 if value else 0x02 CMD[5]=key+1 CMD[8]=self.checkSum(CMD[:-1]) self.serialPortLock.acquire() try: self.BoardSerial.write(bytearray(CMD)) self.BoardSerial.read(9) except Exception as e: print(e) finally: self.serialPortLock.release() if __name__ == '__main__': ser=LongGangIO('com3') time.sleep(1) while ser.isRunning: ser[4]=1 time.sleep(2) ser[4]=0 time.sleep(2)
from django.http import JsonResponse # Create your views here. def home(request): return JsonResponse({'message': 'Welcome to the E-commerce API'})
list1 = ['Google', 'Runoob', 'Taobao'] list1.insert(1, 'Baidu') print ('列表插入元素后为 : ', list1)
import os if __name__ == '__main__': print('当前进程(%s)启动...'%(os.getpid())) pid = os.fork() if pid < 0 : print('fork 出现错误') elif pid == 0: print('我是子进程(%s),父进程是(%s)'%(os.getpid(),os.getppid())) else: print('我(%s)创建了一个子进程(%s)'%(os.getpid,pid))
#global default = "hey" class color: # # Part one: To be used as : # from pylinux-colors import * # print color.red + "your-text" # default = '\033[39m' black = '\033[30m' red = '\033[31m' green = '\033[32m' yellow = '\033[33m' blue = '\033[34m' magenta = '\033[35m' cyan = '\033[36m' white = '\033[00m' # # Part two: To be used as : # from pylinux-colors import * # color.set(green) # def setc(self, colo): if colo == "default": print self.default elif colo == "black": print self.black elif colo == "red": print self.red elif colo == "green": print self.green elif colo == "yellow": print self.yellow elif colo == "blue": print self.blue elif colo == "magenta": print self.magenta elif colo == "cyan": print self.cyan elif colo == "white": print self.white else: print self.red
import struct, socket # Simple usage Example: WakeUp("AA:AA:AA:AA:AA:AA") def WakeUp(mac_address): addr_byte = mac_address.split(':') hw_addr = struct.pack('BBBBBB', int(addr_byte[0], 16), int(addr_byte[1], 16), int(addr_byte[2], 16), int(addr_byte[3], 16), int(addr_byte[4], 16), int(addr_byte[5], 16)) payload = '\xff' * 6 + hw_addr * 16 s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) s.setsockopt(socket.SOL_SOCKET, socket.SO_BROADCAST, 1) s.sendto(mac_address, ('<broadcast>', 9)) s.close()
# This Python file uses the following encoding: utf-8 # Copyright 2015 Tin Arm Engineering AB # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from . import parser, tools from ortools.constraint_solver import pywrapcp from ortools.constraint_solver import routing_enums_pb2 class CreateDistanceCallback(object): """Create callback to calculate distances and travel times between points.""" def __init__(self, locations, num): """Initialize distance array.""" self.num = num self.matrix = {} for from_node in range(num): self.matrix[from_node] = {} for to_node in range(num): x1 = locations[from_node][0] y1 = locations[from_node][1] x2 = locations[to_node][0] y2 = locations[to_node][1] self.matrix[from_node][to_node] = tools.distance(x1, y1, x2, y2) def Distance(self, from_node, to_node): return int(self.matrix[from_node][to_node]) class CreateDemandCallback(object): """Create callback to get demands at location node.""" def __init__(self, demands): self.matrix = demands def Demand(self, from_node, to_node): return self.matrix[from_node] class CreateTravelTimeCallback(object): """Create callback to get travel times between locations.""" def __init__(self, dist_callback, speed): self.dist_callback = dist_callback self.speed = speed def TravelTime(self, from_node, to_node): travel_time = self.dist_callback(from_node, to_node) * 3600 / self.speed return int(travel_time) class Stop: def __init__(self, id, addr, pickup, time_window, curr_load): """ Initializes a Stop object, which is the smallest data point in the RoutingCalculator :param id: The given ID of the Stop :param addr: The address that the stop will be at :param pickup: A boolean dictating whether the Stop is a pickup or dropoff :param time_window: A tuple of times in seconds that the driver can stop at this location :param curr_load: The current load of passengers of the vehicle when it reaches the stop """ self.id = id self.pickup = pickup self.addr = addr self.time_window = time_window self.curr_load = curr_load def __str__(self): return " {pickup_dropoff} at {addr}, Load({load}) Time({tmin}, {tmax})".format( # pickup_dropoff='Pickup' if self.pickup else 'Dropoff', addr=self.addr, load=self.curr_load, tmin=tools.seconds_to_time(self.time_window[0]), tmax=tools.seconds_to_time(self.time_window[1])) def __eq__(self, other): return self.__dict__ == other.__dict__ def to_dict(self): return {"Address": self.addr, "Type": "Pickup" if self.pickup else "Dropoff", "Load": self.curr_load, "Earliest": tools.seconds_to_time(self.time_window[0]), "Latest": tools.seconds_to_time(self.time_window[1])} class Route: def __init__(self): self.stops = [] def add_stop(self, stop): """ Adds a stop to this Route :param stop: A Stop :return: void -- changes the list to include the stop """ self.stops.append(stop) def __str__(self): return "Depot -> -> {0} -> Depot".format(" -> ".join([str(stop) for stop in self.stops])) def valid(self): """ Returns True if all corresponding dropoffs and pickups exist in the Route """ pickups = [stop.id for stop in self.stops if stop.pickup] dropoffs = {stop.id for stop in self.stops if not stop.pickup} return {p + 1 for p in pickups} == dropoffs def __eq__(self, other): return self.stops == other.stops class RoutingCalculator: def __init__(self): self.routes = [] def add_route(self, route): """ Adds a route to the calculator :param route: Route object """ self.routes.append(route) def __str__(self): return "\n\n".join(['Route {0}: {1}'.format(i + 1, str(route)) for i, route in enumerate(self.routes)]) def valid(self): """ Returns True if all Routes are valid """ return all(route.valid() for route in self.routes) def __eq__(self, other): return self.routes == other.routes def to_json_format(self): return [[stop.to_dict() for stop in route.stops] for route in self.routes] def main(in_dict, geo_file, failure_file, num_trips): """ The main Routing Calculator function, which calculates the routes given correct input :param in_dict: A record-like list of dictionaries which indicates all Trip objects that will be parsed :param geo_file: The path to a JSON file which maps all known addresses to geocodes :param failure_file: The path to a JSON file which lists all addresses that can't be geocoded :param num_trips: The number of trips to be included in the calculator :return: A RoutingCalculator object that contains all Routes and Stop values """ # Create the data. trip_data = parser.AllTrips(in_dict, geo_file, failure_file) print("Running...\n") data = [trip_data.locations, trip_data.demands, trip_data.starttimes, trip_data.endtimes] locations = data[0] demands = data[1] start_times = data[2] end_times = data[3] num_locations = min(num_trips * 2 + 1, len(locations)) depot = 0 num_vehicles = max(10, int(num_locations * 0.3)) # Create routing model. if num_locations > 0: routing = pywrapcp.RoutingModel(num_locations, num_vehicles, depot) search_parameters = pywrapcp.RoutingModel.DefaultSearchParameters() for i in range(2, num_locations, 2): routing.AddPickupAndDelivery(i - 1, i) # Setting first solution heuristic: the # method for finding a first solution to the problem. search_parameters.first_solution_strategy = ( routing_enums_pb2.FirstSolutionStrategy.PATH_CHEAPEST_ARC) # Callbacks to the distance function and travel time functions here. dist_between_locations = CreateDistanceCallback(locations, num_locations) dist_callback = dist_between_locations.Distance routing.SetArcCostEvaluatorOfAllVehicles(dist_callback) demands_at_locations = CreateDemandCallback(demands) demands_callback = demands_at_locations.Demand # Add a dimension for demand. slack_max = 0 vehicle_capacity = 8 # what is the max of the capacity? 8? fix_start_cumul_to_zero = True demand = "Demand" routing.AddDimension(demands_callback, slack_max, vehicle_capacity, fix_start_cumul_to_zero, demand) # Adding capacity dimension constraints. VehicleCapacity = 8 NullCapacitySlack = 0 fix_start_cumul_to_zero = True capacity = "Capacity" routing.AddDimension(demands_callback, NullCapacitySlack, VehicleCapacity, fix_start_cumul_to_zero, capacity) # Add time dimension. horizon = 24 * 3600 time = "Time" speed = 25 travel_times = CreateTravelTimeCallback(dist_callback, speed) travel_time_callback = travel_times.TravelTime routing.AddDimension(travel_time_callback, # total time function callback horizon, horizon, fix_start_cumul_to_zero, time) # Add time window constraints. time_dimension = routing.GetDimensionOrDie(time) for location in range(1, num_locations): start = start_times[location] end = end_times[location] time_dimension.CumulVar(location).SetRange(start, end) # Solve displays a solution if any. assignment = routing.SolveWithParameters(search_parameters) if assignment: # Solution cost. # Inspect solution. routes = RoutingCalculator() capacity_dimension = routing.GetDimensionOrDie(capacity) time_dimension = routing.GetDimensionOrDie(time) for vehicle_nbr in range(num_vehicles): if not routing.IsVehicleUsed(assignment, vehicle_nbr): continue route = Route() index = assignment.Value(routing.NextVar(routing.Start(vehicle_nbr))) while not routing.IsEnd(index): node_index = routing.IndexToNode(index) load_var = capacity_dimension.CumulVar(index) time_var = time_dimension.CumulVar(index) route.add_stop(Stop(node_index, trip_data.addresses[node_index], node_index % 2 == 1, (assignment.Min(time_var), assignment.Max(time_var)), assignment.Value(load_var))) index = assignment.Value(routing.NextVar(index)) routes.add_route(route) if routes.valid(): print(routes) return routes, trip_data.uber else: print("Invalid Routes") raise Exception("Invalid Routes") else: print('No solution found.') raise Exception("No solution could be found") else: print('Specify an instance greater than 0.') raise Exception("Specify an instance greater than 0.")
import ADC0832 import space def init(): ADC0832.setup() def loop(): while True: res = ADC0832.getResult() - 80 if res < 0: res = 0 if res > 100: res = 100 print 'res = %d' %res time.sleep(0.2) if __name__ =='__main__': init() try: loop() except KeyboardInterrupt: ADC0832.destroy() prin'The End'
dict1 = {"a": "1", "b": "b", "c": "c"} dict2 = {"a": "2", "b": "b", "c": "c"} dict3 = {"a": "3", "b": "b", "c": "c"} list = [dict1, dict2, dict3] dada = [dict["b"] for dict in list if dict["a"] == "2"] print(dada)
import time from odoo import models, fields, api, _ from datetime import date,datetime,timedelta from odoo.exceptions import except_orm, Warning, RedirectWarning import math class Fees_Line(models.Model): """ Fees Lines """ _name = 'fees.line' _description = 'Fees Line' name = fields.Many2one('product.product','Name',required=True) sequence = fields.Integer('Priority') amount = fields.Float('Amount',required=True) reg_id = fields.Many2one('registration', string='Registrations', invisible=True) reg_form_id = fields.Many2one('registration', string='Registrations Form', invisible=True) type=fields.Selection([('required','Required'),('optional','optional')]) fees_id=fields.Many2one('fees.structure','Fees') fee_pay_type = fields.Many2one('fee.payment.type',string="Fee Payment Type") stud_id = fields.Many2one('res.partner','Student id') next_term = fields.Many2one('acd.term',string="Next Term") update_amount = fields.Float(string='Update Amount') discount = fields.Float(string="Discount(%)") discount_amount = fields.Float(string='Discount Amount') amount_from_percentage = fields.Float(string='Update Amount In Percentage(%)') @api.onchange('name') def on_addimition_fee(self): if self.name.is_admission_fee == True: one_type = self.env['fee.payment.type'].search([('name','=','one')]) if one_type.id: self.fee_pay_type = one_type.id @api.onchange('update_amount') def get_update_percentage(self): if self.update_amount > 0 and self.amount > 0 : self.amount_from_percentage = (self.update_amount/self.amount)*100 print 'hghfkkkkkkk' # @api.onchange('amount_from_percentage') # def get_update_amount(self): # # if self.amount_from_percentage >= 0 and self.amount_from_percentage <= 100: # if self.amount_from_percentage > 0: # self.update_amount = (self.amount*self.amount_from_percentage)/100 @api.onchange('amount_from_percentage') def get_update_amount(self): # if self.amount_from_percentage >= 0 and self.amount_from_percentage <= 100: if self.amount_from_percentage > 0: pass # self.update_amount = round((self.amount*(self.amount_from_percentage))/100) print "vhhgjghhhhhhh" # else: # raise except_orm(_('Warning!'),_("please enter valid Update Percentage(%).")) @api.onchange('discount') def onchange_discount(self): if self.discount > 100.0 or self.discount < 0.0: self.discount = 0.00 raise except_orm(_('Warning!'),_("please enter valid discount(%).")) @api.model def create(self,vals): if 'discount' in vals: if vals['discount'] > 100.0 or vals['discount'] < 0.0: raise except_orm(_('Warning!'),_("please enter valid discount(%).")) return super(Fees_Line, self).create(vals) @api.multi def write(self, vals): if 'update_amount' not in vals and 'amount' in vals: vals['amount'] = self.amount raise except_orm(_('Warning!'), _("You can not update amount directly from hear !, please use Update Amount and Update button")) # discount change then discount amount calculation if 'discount' in vals: if vals['discount'] > 100.0 or vals['discount'] < 0.0: raise except_orm(_('Warning!'),_("please enter valid discount(%).")) else: if self.amount > 0.0 and 'discount_amount' not in vals: vals['discount_amount'] = (self.amount * vals['discount'])/100 # discount amount change then discount calculation if 'discount_amount' in vals and vals['discount_amount'] >= 0.0: if self.amount > 0.0 and 'discount' not in vals: vals['discount'] = (vals['discount_amount']*100)/self.amount return super(Fees_Line, self).write(vals) @api.model def default_get(self, fields): """ this method is use for default set value when create new record. :param fields: :return: """ res = super(Fees_Line, self).default_get(fields) # record update only when student_id get from Context if 'student_id' in self._context and self._context['student_id']: res.update({'stud_id': self._context['student_id']}) return res @api.multi def unlink(self): """ This Method is call, when we delete record. ------------------------------------------ :return: """ # add validation for record delation time for each in self: if each.type=='required' and each.reg_form_id: raise except_orm(_('Warning!'), _("You cant delete the required fees lines!")) res=super(Fees_Line,self).unlink() return res @api.model def get_month_difference(self,start_date, date_today): """ """ years_diff = date_today.year - start_date.year months_diff = 0 if date_today.month >= start_date.month: months_diff = date_today.month - start_date.month else: years_diff -= 1 months_diff = 12 + (date_today.month - start_date.month) days_diff = 0 if date_today.day >= start_date.day: days_diff = date_today.day - start_date.day else: months_diff -= 1 days_diff = 31 + (date_today.day - start_date.day) if months_diff < 0: months_diff = 11 years_diff -= 1 age = years_diff month_dict = { 'years' : years_diff, 'months' : months_diff, 'days' : days_diff } return month_dict @api.model def months_between(self,start_date,end_date): months = [] month_year = [] cursor = start_date while cursor <= end_date: if cursor.month not in months: months.append(cursor.month) month_year.append((int(cursor.month),int(cursor.year))) cursor += timedelta(weeks=1) return month_year @api.multi def update_fee_amount(self): """ this method use to update student fee, --> update old fee amount with new fee amount, --> when fee update then generate history, --> update fee amount in student structure, --> update remaining fee amount in student fee paid detail, --> again calculation of fee as per new fee structure, -------------------------------------------------------- @param self : object pointer """ student_obj = self.env['res.partner'] if self.update_amount == 0.00: raise except_orm(_('Warning!'), _("please mention update amount value : (%s)") % (self.update_amount)) else: if self.amount == self.update_amount: raise except_orm(_('No Update!'), _("Fee amount %s and Update fee amount %s are same.") % (self.amount,self.update_amount)) # genarate fees history sequence = self.fees_id.fee_history_line.search_count([('fee_structure_id','=',self.fees_id.id)]) fee_history_line = { 'sequence': sequence + 1, 'name' : self.name.id, 'old_amount': self.amount, 'new_amount': self.update_amount, 'date': date.today(), 'fee_structure_id' : self.fees_id.id, } self.fees_id.fee_history_line = [(0, 0, fee_history_line)] # update student fee structure unpaid_diff = {} for stud_rec in student_obj.search([('is_parent', '=', False), ('course_id', '=', self.fees_id.course_id.id), ('batch_id', '=', self.fees_id.academic_year_id.id)]): if stud_rec.admission_date: joining_date = datetime.strptime(stud_rec.admission_date,"%Y-%m-%d").date() start_date = datetime.strptime(self.fees_id.academic_year_id.start_date,"%Y-%m-%d").date() # end_date= datetime.strptime(self.fees_id.academic_year_id.end_date,"%Y-%m-%d").date() # total_diff = self.get_month_difference(start_date,end_date) total_month = self.fees_id.academic_year_id.month_ids.search_count([('batch_id','=',self.fees_id.academic_year_id.id), ('leave_month','=',False)]) leave_month = [] for l_month in self.fees_id.academic_year_id.month_ids.search([('batch_id','=',self.fees_id.academic_year_id.id), ('leave_month','=',True)]): leave_month.append((int(l_month.name),int(l_month.year))) month_in_stj = self.months_between(start_date,joining_date) unpaid_diff = self.get_month_difference(start_date,joining_date) for fee_structure_rec in stud_rec.student_fee_line.search([('stud_id','=',stud_rec.id), ('name','=',self.name.id)],limit=1): new_amount = self.update_amount if fee_structure_rec.fee_pay_type.name not in ['one']: if unpaid_diff and (unpaid_diff.get('months') > 0 or unpaid_diff.get('days') > 0): unpaid_month = float(unpaid_diff.get('months')) # if unpaid_diff.get('days') > 0: # unpaid_month += 1 if len(month_in_stj) > 0 and len(leave_month) > 0: for leave_month_year in leave_month: if leave_month_year in month_in_stj: unpaid_month -= 1 if unpaid_month > 0.00 and total_month > 0.00: unpaid_amount = (new_amount * unpaid_month) / total_month new_amount -= unpaid_amount if fee_structure_rec.id: fee_structure_rec.write({'update_amount' : 0.00,'amount' : round(new_amount,2)}) for fee_detail in stud_rec.payble_fee_ids.search([('name','=',self.name.id), ('student_id','=',stud_rec.id)]): if fee_detail.id: fee_detail.total_amount = round(new_amount,2) stud_rec.update_fee_structure() # update on Fee master line val = { 'update_amount' : 0.00, 'amount_from_percentage':0.0, 'amount' : self.update_amount, } self.write(val) return True # @api.model # def create(self, vals): # if 'fees_id' in vals: # fees_id=vals['fees_id'] # fees_obj=self.env['fees.structure'].browse(fees_id) # start_date=fees_obj.academic_year_id.start_date # end_date=fees_obj.academic_year_id.end_date # # if vals['fee_pay_type']: # # type=self.env['fee.payment.type'].browse(vals['fee_pay_type']) # # if type.name=='term': # if ((type.start_date>=start_date) and (type.start_date<=end_date) and (type.end_date>=start_date) and (type.end_date<=end_date)): # else: # raise except_orm(_('Warning!'), # _("Term Start Date and End Date should be inbetween of Acadamic Year Start Date and End Date!")) # # return super(Fees_Line, self).create(vals) class Fees_Structure(models.Model): """ Fees structure """ _name = 'fees.structure' _description = 'Fees Structure' name = fields.Char('Name',required=True) code = fields.Char('Code',required=True) course_id= fields.Many2one('course', string='Class', required=True) academic_year_id=fields.Many2one('batch','Academic Year') fee_line_ids = fields.One2many('fees.line','fees_id','Fees Lines') type=fields.Selection([('reg','Registration'),('academic','Academic')]) fee_history_line = fields.One2many('fee.history.line','fee_structure_id',string="Fee History") _sql_constraints = [ ('code_uniq','unique(code)', 'The code of the Fees Structure must be unique !') ] @api.onchange('type','course_id','academic_year_id') def name_code_generate(self): name = '' if self.course_id and self.academic_year_id and self.type: name = self.type.upper() + '/' +\ self.course_id.name+ '/' + \ self.academic_year_id.name self.name = name self.code = name @api.model def create(self,vals): old_rec=self.search([('type','=',vals['type']),('course_id','=',vals['course_id']),('academic_year_id','=',vals['academic_year_id'])]) if len(old_rec) != 0: raise except_orm(_('Warning!'), _("Fee structute already exist")) return super(Fees_Structure,self).create(vals) @api.multi def write(self,vals): if ('type' in vals) or ('course_id' in vals) or ('academic_year_id' in vals): if ('type' in vals): type=vals['type'] else: type=self.type if ('course_id' in vals): course_id=vals['course_id'] else: course_id=self.course_id.id if ('academic_year_id' in vals): academic_year_id=vals['academic_year_id'] else: academic_year_id=self.academic_year_id.id old_rec=self.search([('type','=',type),('course_id','=',course_id),('academic_year_id','=',academic_year_id)]) if len(old_rec) != 0: raise except_orm(_('Warning!'), _("Fee structute already exist")) return super(Fees_Structure,self).write(vals) class fee_payment_type(models.Model): """ Fee Payment Type """ _name = 'fee.payment.type' _description = 'Fee Payment Type' name = fields.Selection([ ('month', 'Monthly'), ('alt_month', 'Alternate Month'), ('quater', 'Quarterly'), ('year', 'Yearly'), ('one', 'One Time'), ('half_year','Half Year'), ('term','Term'), ],string="Name") code = fields.Char('Code') @api.multi def name_get(self): res = [] def get_patment_type(type): val = { 'month' : 'Monthly', 'alt_month' : 'Alternate Month', 'quater' : 'Quarterly', 'year' : 'Yearly', 'one' : 'One Time', 'half_year' : 'Half Year', 'term' : 'Term', } if val[type]: return val[type] for record in self: name = get_patment_type(record.name) res.append((record.id, name)) return res @api.model def create(self,vals): vals['code']=vals['name'] if vals['name']: old_rec=self.search([('name','=',vals['name'])]) if len(old_rec) != 0: raise except_orm(_('Warning!'), _("Payment Type %s is already exist") % (vals['name'])) return super(fee_payment_type,self).create(vals) @api.multi def write(self,vals): if 'name' in vals: old_rec=self.search([('name','=',vals['name'])]) if len(old_rec) != 0: raise except_orm(_('Warning!'), _("Payment Type %s is already exist") % (vals['name'])) return super(fee_payment_type,self).write(vals)
# -*- coding: UTF-8 -*- #! /usr/bin/python import csv import sys reload(sys) sys.setdefaultencoding('utf8') import MySQLdb.connector from MySQLdb.connector.constants import ClientFlag from MySQLdb.connector.constants import SQLMode import MySQLdbdb MySQLdb_config = { 'host':'localhost', 'user':'sddivid', 'password':'22476103', 'port':3306, 'database':'python', 'charset':'utf8', 'client_flags':[ClientFlag.LOCAL_FILES], } def isset(v): try: type (eval(v)) except: return False else: return True def LoadFile(): try: cnn = MySQLdb.connector.connect(**MySQLdb_config) sql = "LOAD DATA LOCAL INFILE '/etc/workspace/NTBUtest.csv' REPLACE INTO TABLE test FIELDS TERMINATED BY ',' ENCLOSED BY '\"' LINES TERMINATED BY '\n'" cursor = cnn.cursor() cursor.execute(sql) cnn.commit() except MySQLdb.connector.Error as e: print('LoadFile sql fails {}'.format(e)) finally: if isset("cursor"): cursor.close() if isset("cnn"): cnn.close() def LoadFile2(): cnn = MySQLdbdb.connect(host="localhost", user="sddivid", passwd="22476103", db="python", charset="utf8") cursor = cnn.cursor() sql = "LOAD DATA LOCAL INFILE '/etc/workspace/NTBUtest.csv' REPLACE INTO TABLE test FIELDS TERMINATED BY ',' ENCLOSED BY '\"' LINES TERMINATED BY '\n'" cursor.execute(sql) cnn.commit() if __name__ == "__main__": # LoadFile() LoadFile2()
from conftest import driver from selenium import webdriver from pages.vacancies_page import VacanciesPage class TestVacation: def test_choose_region(self,driver): needed_region = 'Кубинка' vacancies_main_page = VacanciesPage(driver) vacancies_main_page.go_to_vacancies() vacancies_main_page.enter_region_for_keys(needed_region) vacancies_main_page.click_on_needed_region(needed_region) vacancies_main_page.click_on_search_button() result = vacancies_main_page.find_all_regions() for i in result: print("нашла") assert i.find(needed_region) or i == needed_region vacancies_main_page.click_on_show_contacts() assert vacancies_main_page.find_phone() def test_search(self, driver): # constants word = 'Центральный' vacancies_main_page = VacanciesPage(driver) vacancies_main_page.go_to_vacancies() vacancies_main_page.enter_word_in_company_names_input(word) vacancies_main_page.click_on_search_button() result = vacancies_main_page.find_all_company_names() for i in result: assert i.find(word) or i == word
# -*- coding: utf-8 -*- # Copyright 2017-TODAY LasLabs Inc. # License MIT (https://opensource.org/licenses/MIT). from .abstract_product_endpoint import AbstractProductEndpoint from ..models.extract import Extract class Extracts(AbstractProductEndpoint): """This represents the ``Extracts`` Endpoint. https://developers.cannabisreports.com/docs/extracts """ __object__ = Extract __endpoint__ = 'extracts'
# -------------------------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # -------------------------------------------------------------------------------------------- from knack.help_files import helps # pylint: disable=import-error helps['aks use-dev-spaces'] = """ type: command short-summary: (PREVIEW) Use Azure Dev Spaces with a managed Kubernetes cluster. parameters: - name: --name -n type: string short-summary: Name of the managed cluster. - name: --resource-group -g type: string short-summary: Name of resource group. You can configure the default group using 'az configure --defaults group=<name>'. - name: --space -s type: string short-summary: Name of the dev space to use. - name: --parent-space -p type: string short-summary: Name of a parent dev space to inherit from when creating a new dev space. By default, if there is already a single dev space with no parent, the new space inherits from this one. """ helps['aks remove-dev-spaces'] = """ type: command short-summary: (PREVIEW) Remove Azure Dev Spaces from a managed Kubernetes cluster. parameters: - name: --name -n type: string short-summary: Name of the managed cluster. - name: --resource-group -g type: string short-summary: Name of resource group. You can configure the default group using 'az configure --defaults group=<name>'. - name: --yes -y type: bool short-summary: Do not prompt for confirmation. """
# -*- coding: utf-8 -*- { 'name': "GeProMi Documentacion Digital", 'summary': """ La Documentacion Digital será soporte para el Expediente Digital. """, 'description': """ Este archivo tiene la funcion de brindar soporte para el expediente digital. Se destacan las siguientes funciones: * Soporte para documento adjunto, el cual debe mostrarse de alguna manera en el cuerpo del expediente. * Soporte para añadir archivo al documento adjunto. Para lo cual se deberan poder unir archivos PDF, sean firmados digitalmente o no. """, 'author': "Gis Minero Nacional", 'website': "http://www.gismineronacional.com", # Categories can be used to filter modules in modules listing # Check https://github.com/odoo/odoo/blob/master/odoo/addons/base/module/module_data.xml # for the full list 'category': 'Uncategorized', 'version': '0.1', # any module necessary for this one to work correctly 'depends': ['base', 'gepromi', 'expediente', 'hr', 'tarea_flujo_exp'], #, 'tarea_flujo_exp' # always loaded 'data': [ 'views/views_over.xml', 'views/views.xml', 'security/doc_digital.xml', 'security/ir.model.access.csv', ], # only loaded in demonstration mode 'demo': [ #'demo/demo.xml', ], 'application': True, 'auto_install': False, }
# Generated by Django 2.0.5 on 2018-09-04 07:59 from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Diagram', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(default='Illustration', max_length=50)), ('height', models.IntegerField()), ('width', models.IntegerField()), ], ), migrations.CreateModel( name='GraphArrow', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('X0', models.FloatField(blank=True, null=True)), ('Y0', models.FloatField(blank=True, null=True)), ('X1', models.FloatField(blank=True, null=True)), ('Y1', models.FloatField(blank=True, null=True)), ], ), migrations.CreateModel( name='GraphNode', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('radius', models.FloatField()), ('X', models.FloatField()), ('Y', models.FloatField()), ('diagram', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='nodes', to='graphs.Diagram')), ], ), migrations.CreateModel( name='Icon', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('title', models.CharField(blank=True, max_length=100)), ('source', models.CharField(blank=True, max_length=200)), ('picture', models.ImageField(blank=True, null=True, upload_to='graphs/icons/')), ('color', models.CharField(default='grey', max_length=50)), ('order', models.IntegerField(default=0)), ], ), migrations.CreateModel( name='Link', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('relative_share', models.FloatField(blank=True, default=None, null=True)), ('cause_description', models.CharField(blank=True, max_length=400)), ('consequence_description', models.CharField(blank=True, max_length=400)), ], ), migrations.CreateModel( name='Sector', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=100)), ('short_description', models.CharField(blank=True, max_length=400)), ('color', models.CharField(max_length=100)), ], ), migrations.CreateModel( name='Topic', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=100)), ('short_description', models.CharField(blank=True, max_length=400)), ('date_created', models.DateField(auto_now_add=True)), ('icon_picture', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, related_name='+', to='graphs.Icon')), ('sector', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='graphs.Sector')), ], ), migrations.AddField( model_name='link', name='cause', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='consequences', to='graphs.Topic'), ), migrations.AddField( model_name='link', name='consequence', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='causes', to='graphs.Topic'), ), migrations.AddField( model_name='graphnode', name='liens', field=models.ManyToManyField(blank=True, to='graphs.Link'), ), migrations.AddField( model_name='graphnode', name='sector', field=models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='graphs.Sector'), ), migrations.AddField( model_name='graphnode', name='topic', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='+', to='graphs.Topic'), ), migrations.AddField( model_name='grapharrow', name='cause', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='+', to='graphs.GraphNode'), ), migrations.AddField( model_name='grapharrow', name='consequence', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='+', to='graphs.GraphNode'), ), migrations.AddField( model_name='grapharrow', name='diagram', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='arrows', to='graphs.Diagram'), ), ]
from django import forms from . import models class createform(forms.ModelForm): class Meta: model = models.STATE fields = ('title', 'slug', 'body', 'image')
# Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from airflow.contrib.operators import spark_submit_operator from airflow.utils.trigger_rule import TriggerRule import xml.etree.ElementTree as ET from definitions import TPL_PATH from mappers.action_mapper import ActionMapper from utils import xml_utils, el_utils import jinja2 class SparkMapper(ActionMapper): def __init__(self, oozie_node, task_id, trigger_rule=TriggerRule.ALL_SUCCESS, params={}, template='spark.tpl'): ActionMapper.__init__(self, oozie_node, task_id, trigger_rule) self.template = template self.params = params self.task_id = task_id self.trigger_rule = trigger_rule self._parse_oozie_node(oozie_node) def _parse_oozie_node(self, oozie_node): """ Property values specified in the configuration element override values specified in the job-xml file. """ self.application = '' self.conf = {} self.conn_id = 'spark_default' self.files = None self.py_files = None self.driver_classpath = None self.jars = None self.java_class = None self.packages = None self.exclude_packages = None self.repositories = None self.total_executor_cores = None self.executor_cores = None self.executor_memory = None self.driver_memory = None self.keytab = None self.principal = None self.name = 'airflow-spark' self.num_executors = None self.application_args = [] self.env_vars = None self.verbose = False # Prepare nodes self.delete_paths = [] self.mkdir_paths = [] prepare_nodes = xml_utils.find_nodes_by_tag(oozie_node, 'prepare') if prepare_nodes: # If there exists a prepare node, there will only be one, according # to oozie xml schema self.delete_paths, self.mkdir_paths = self._parse_prepare_node( prepare_nodes[0]) # master url, deploy mode, self.application = self._test_and_set(oozie_node, 'jar', '\'\'', params=self.params, quote=True) self.name = self._test_and_set(oozie_node, 'name', '\'airflow-spark\'', params=self.params, quote=True) self.java_class = self._test_and_set(oozie_node, 'class', None, params=self.params, quote=True) config_node = xml_utils.find_nodes_by_tag(oozie_node, 'configuration') job_xml = xml_utils.find_nodes_by_tag(oozie_node, 'job-xml') for xml_file in job_xml: tree = ET.parse(xml_file.text) self.conf = {**self.conf, **self._parse_spark_config(tree.getroot())} if config_node: self.conf = {**self.conf, **self._parse_spark_config(config_node[0])} spark_opts = xml_utils.find_nodes_by_tag(oozie_node, 'spark-opts') if spark_opts: self._update_class_spark_opts(spark_opts[0]) app_args = xml_utils.find_nodes_by_tag(oozie_node, 'arg') for arg in app_args: self.application_args.append(el_utils.replace_el_with_var(arg.text, self.params, quote=False)) @staticmethod def _test_and_set(root, tag, default=None, params={}, quote=False): """ If a node exists in the oozie_node with the tag specified in tag, it will attempt to replace the EL (if it exists) with the corresponding variable. If no EL var is found, it just returns text. However, if the tag is not found under oozie_node, then return default. If there are more than one with the specified tag, it uses the first one found. """ var = xml_utils.find_nodes_by_tag(root, tag) if var: # Only check the first one return el_utils.replace_el_with_var(var[0].text, params=params, quote=quote) else: return default @staticmethod def _parse_spark_config(config_node): conf_dict = {} for prop in config_node: name = prop.find('name').text value = prop.find('value').text conf_dict[name] = value return conf_dict def _update_class_spark_opts(self, spark_opts_node): """ Some examples of the spark-opts element: '--conf key=value' '--conf key1=value1 value2' '--conf key1="value1 value2"' '--conf key1=value1 key2="value2 value3"' '--conf key=value --verbose --properties-file user.properties' """ spark_opts = spark_opts_node.text.split("--")[1:] clean_opts = [opt.strip() for opt in spark_opts] clean_opts_split = [opt.split(maxsplit=1) for opt in clean_opts] if ['verbose'] in clean_opts_split: self.__dict__['verbose'] = True clean_opts_split.remove(['verbose']) for spark_opt in clean_opts_split: # Can have multiple "--conf" in spark_opts if 'conf' == spark_opt[0]: # Splits key1=value1 into [key1, value1] conf_val = spark_opt[1].split("=", maxsplit=1) self.conf[conf_val[0]] = conf_val[1] else: self.__dict__[spark_opt[0]] = '\'' + ' '.join( spark_opt[1:]) + '\'' @staticmethod def _parse_prepare_node(prepare_node): """ <prepare> <delete path="[PATH]"/> ... <mkdir path="[PATH]"/> ... </prepare> """ delete_paths = [] mkdir_paths = [] for node in prepare_node: node_path = el_utils.convert_el_to_jinja(node.attrib['path'], quote=False) if node.tag == 'delete': delete_paths.append(node_path) else: mkdir_paths.append(node_path) return delete_paths, mkdir_paths def convert_to_text(self): template_loader = jinja2.FileSystemLoader(searchpath=TPL_PATH) template_env = jinja2.Environment(loader=template_loader) spark_template = template_env.get_template(self.template) prepare_template = template_env.get_template('prepare.tpl') # If we have found a prepare node, we must reorder nodes. if self.delete_paths or self.mkdir_paths: prep_text = prepare_template.render(task_id=self.task_id, trigger_rule=self.trigger_rule, delete_paths=self.delete_paths, mkdir_paths=self.mkdir_paths) # Don't want to change class variable op_dict = self.__dict__.copy() op_dict['task_id'] = self.task_id + '_reorder' op_text = spark_template.render(**op_dict) return op_text + prep_text else: return spark_template.render(**self.__dict__) def convert_to_airflow_op(self): """ Converts the class into a SparkSubmitOperator, this requires correct setup of the Airflow connection. """ return spark_submit_operator.SparkSubmitOperator( task_id=self.task_id, trigger_rule=self.trigger_rule, params=self.params, # Spark specific conn_id='spark_default', name=self.name, application=self.application, conf=self.conf, files=self.files, py_files=self.py_files, jars=self.jars, java_class=self.java_class, packages=self.packages, exclude_packages=self.exclude_packages, repositories=self.repositories, total_executor_cores=self.total_executor_cores, executor_cores=self.executor_cores, executor_memory=self.executor_memory, driver_memory=self.driver_memory, keytab=self.keytab, principal=self.principal, num_executors=self.num_executors, application_args=self.application_args, verbose=self.verbose, env_vars=self.env_vars, driver_classpath=self.driver_classpath ) @staticmethod def required_imports(): # Dummy and Bash are for the potential prepare statement return ['from airflow.contrib.operators import spark_submit_operator', 'from airflow.operators import bash_operator', 'from airflow.operators import dummy_operator'] def get_task_id(self): # If the prepare node has been parsed then we reconfigure the execution # path of Airflow by adding delete/mkdir bash nodes before the actual # spark node executes. if self.has_prepare(): return self.task_id + '_reorder' else: return self.task_id def has_prepare(self): return self.delete_paths or self.mkdir_paths
#!/usr/bin/env python3 """Shuffle data in two matrices in the same way""" import numpy as np def shuffle_data(X, Y): """Shuffle data in two matrices in the same way""" shufflidx = np.random.permutation(X.shape[0]) return X[shufflidx], Y[shufflidx]
from neuron import * from neuron import h as nrn from numpy import * from pylab import * soma = h.Section() soma.L = 25 soma.insert('hh') soma.nseg = 10 soma1 = h.Section() soma1.L = 25 soma1.insert('hh') soma1.nseg = 10 stimNc = h.NetStim() stimNc.noise = 1 stimNc.start = 5 stimNc.number = 1 stimNc.interval = 20 syn = h.ExpSyn (0.5, sec = soma) nc = h.NetCon(stimNc, syn) nc.weight[0] = 1 nc.record() # Test NC syn1 = h.ExpSyn (0.5, sec = soma1) soma.push() nc1 = h.NetCon( soma(0.5)._ref_v, syn1 ) nc1.delay = 10 nc1.weight[0] = -0.01 nc1.threshold = 10 # record vec = {} for var in 'v_1 ', 'v_2 ', 't ': vec[var] = h.Vector() vec['v_1 '].record(soma(0.5)._ref_v) vec['v_2 '].record(soma1(0.5)._ref_v) vec ['t '].record(h._ref_t) # run the simulation h.load_file("stdrun.hoc") h.init() h.tstop = 50.0 h.run() # plot the results figure() plot(vec['t '],vec['v_1 '], vec['t '], vec['v_2 ']) show() h.topology() a = min(vec['v_2 ']) print a+65
from staff.models import Staff, Employee, Driver from utils.models import TypeDocument from django.shortcuts import render_to_response, render from django.template import RequestContext from django.contrib.auth.decorators import login_required from django.conf import settings from django.core.paginator import Paginator, PageNotAnInteger, EmptyPage from django.db.utils import IntegrityError import xlrd import datetime import os.path import re @login_required def index(request): staff = Staff.objects.all() paginator = Paginator(staff, 10) page = request.GET.get('page') try: show_lines = paginator.page(page) except PageNotAnInteger: show_lines = paginator.page(1) except EmptyPage: show_lines = paginator.page(paginator.num_pages) return render_to_response('staff.html', {'staff_list': show_lines}, context_instance=RequestContext(request)) @login_required def uploadDriver(request): reader = xlrd.open_workbook(settings.MEDIA_ROOT + '/' + settings.UPLOAD_PATH + '/files/autos.xls', encoding_override="utf_8") sh = reader.sheet_by_name(u'custodios') for rownum in range(sh.nrows): #row = sh.row_values(rownum) datalist = [] for i, cell in enumerate(sh.row(rownum)): value = cell.value if cell.ctype == 3: value = datetime.datetime(*xlrd.xldate_as_tuple(value, reader.datemode)) datalist.append(value.date()) else: datalist.append(value) if len(datalist) == 5: createDrivers(datalist) return render(request, 'done.html') def createDrivers(datalist): try: item = int(datalist[1]) internal_number = int(datalist[0]) except ValueError: internal_number = datalist[0] print 'Item = ' + str(item) try: driver_license = int(datalist[2]) except ValueError: driver_license= datalist[2] try: employee = Employee.objects.get(item=item) except Exception, err: print item print err try: is_active = True if datalist[4]: expiration_date=datalist[4] if datetime.date.today() > datalist[4]: is_active = False else: is_active = False expiration_date=None #if len(driver_license) == 0: # driver_license = None try: if driver_license == '': driver_license = None driver = Driver(employee=employee, driver_license=driver_license, driver_category=datalist[3], expiration_date=expiration_date, is_active=is_active) driver.save() except IntegrityError: pass except Exception, err: print '----------------' print datalist print 'Error con item = ' + str(item) print 'driver_license: ' + str(driver_license) print 'category:' + str(datalist[3]) print 'expiration_date: ' + str(expiration_date) @login_required def uploadStaff(request): reader = xlrd.open_workbook(settings.MEDIA_ROOT + '/' + settings.UPLOAD_PATH + '/' + 'files/lista_1.xls', encoding_override="utf_8") sh = reader.sheet_by_name(u'todos') for rownum in range(sh.nrows): #row = sh.row_values(rownum) datalist = [] for i, cell in enumerate(sh.row(rownum)): value = cell.value if cell.ctype == 3: value = datetime.datetime(*xlrd.xldate_as_tuple(value, reader.datemode)) datalist.append(value.date()) else: datalist.append(value) if len(datalist) == 6: createStaff(datalist) return render(request, 'done.html') def createStaff(datalist): all_data_user = readAllDataUser(datalist[0], datalist[1], datalist[2], datalist[3], datalist[4], datalist[5]) loadStaff(all_data_user['staff'], all_data_user['employee']) def readAllDataUser(item, name, birth_date, ci, cargo, unidad): item = int(item) myList = name.split() size_name = len(myList) ci = ci.split() num_ci = ci[0] locale_ci = ci[1] try: last_name = myList[0] + " " + myList[1] if size_name > 3: first_name = myList[2] + " " + myList[3] else: first_name = myList[2] except IndexError: last_name = myList[0] first_name = myList[1] employee = {"item": item, "cargo": cargo, "unidad": unidad} path_avatar = settings.PROJECT_ROOT + settings.MEDIA_URL + settings.STAFF_AVATAR_PATH + "/" + str(item) + ".jpg" if os.path.exists(path_avatar): staff_user = {"first_name": first_name, "last_name": last_name, "ci": num_ci, "locale_issue": str(locale_ci).lower(), "birth_date": birth_date, "avatar": settings.STAFF_AVATAR_PATH + "/" + str(item) + ".jpg", "about": 'Trabajador de Comteco'} else: staff_user = {"first_name": first_name, "last_name": last_name, "ci": num_ci, "locale_issue": str(locale_ci).lower(), "birth_date": birth_date, "avatar": 'images/default_avatar.png', "about": 'Trabajador de Comteco'} return {"staff": staff_user, "employee": employee} def loadStaff(staff, employee): # cargo = createPosition(staff['cargo']) # unit = createWorkUnit(staff['unidad']) type_document = TypeDocument.objects.get(key='ci') try: s = Staff(photo=staff['avatar'], first_name=staff['first_name'], last_name=staff['last_name'], birth_date=staff['birth_date'], type_document=type_document, val_document=staff['ci'], locale_issue=staff['locale_issue'], date_joined=datetime.datetime.now(), is_active=True) s.save() except IntegrityError: print 'ERROR GARRAFAL EN USUARIO CON CI: ' + str(staff['ci']) + ' E ITEM: ' + str(employee['item']) try: e = Employee(staff=s, item=employee['item']) e.save() except IntegrityError: print 'ERROR AL CARGAR EL ITEM: ' + employee['item'] """ def createPosition(nameCargo): try: cargo = Position(name=nameCargo) cargo.save() except IntegrityError: cargo = Position.objects.get(name=nameCargo) return cargo def createWorkUnit(nameUnit): try: unit = WorkUnit(name=nameUnit) unit.save() except IntegrityError: unit = WorkUnit.objects.get(name=nameUnit) return unit """
import main import unittest class ComposeTest(unittest.TestCase): def testing(self): self.assertEqual(main.compose("byGt\nhTts\nRTFF\nCnnI", "jIRl\nViBu\nrWOb\nNkTB"), "bNkTB\nhTrWO\nRTFVi\nCnnIj") self.assertEqual(main.compose("HXxA\nTGBf\nIPhg\nuUMD", "Hcbj\nqteH\nGbMJ\ngYPW"), "HgYPW\nTGGbM\nIPhqt\nuUMDH") if __name__ == '__main__': unittest.main()
class MyClass: variable = "blah" def foo(self): print('Hello from MyClass') myObjX = MyClass() myObjY = MyClass() myObjY.variable = "Giggity goo" print(myObjX.variable) print(myObjY.variable)
import pytest import logging import yaml from asgi_lifespan import LifespanManager from httpx import AsyncClient from app.main import app from app import messages from tests import test_constants config = yaml.safe_load(open("config.yml")) logger = logging.getLogger(__name__) def pytest_generate_tests(metafunc): if "client" in metafunc.fixturenames: metafunc.parametrize( "client, cache_log_msg", [ ( pytest.lazy_fixture("httpxclient_with_cache"), messages.CACHE_AVAILABLE, ), ( pytest.lazy_fixture("httpxclient_without_cache"), messages.CACHE_UNAVAILABLE, ), ], ) @pytest.fixture() async def httpxclient_with_cache(caplog): async with LifespanManager(app): caplog.set_level(logging.DEBUG) async with AsyncClient(app=app, base_url="http://test") as ac: yield ac @pytest.fixture() async def httpxclient_without_cache(caplog, cache_log_msg): caplog.set_level(logging.DEBUG) async with AsyncClient(app=app, base_url="http://test") as ac: yield ac @pytest.mark.asyncio async def test_all_restaurants(client, cache_log_msg, caplog): response = await client.get(app.url_path_for("get_all_restaurants")) assert response.status_code == 200 assert response.json() assert test_constants.VALID_MANY_RESTAURANTS_STRING in response.text assert cache_log_msg in caplog.text @pytest.mark.asyncio async def test_single_valid_restaurant(client, cache_log_msg, caplog): response = await client.get( app.url_path_for( "get_single_restaurant", restaurant=test_constants.VALID_RESTAURANT_ID ) ) assert response.status_code == 200 assert response.json() assert test_constants.VALID_RESTAURANT_TITLE in response.text assert cache_log_msg in caplog.text @pytest.mark.asyncio async def test_single_invalid_restaurant(client, cache_log_msg, caplog): response = await client.get( app.url_path_for( "get_single_restaurant", restaurant=test_constants.INVALID_RESTAURANT_ID ) ) assert response.status_code == 404 assert cache_log_msg in caplog.text @pytest.mark.asyncio async def test_relay_anything_all_restaurants(client, cache_log_msg, caplog): response = await client.get( app.url_path_for("relay_anything", query=config["RESTAURANTS_PATH"]) ) assert response.status_code == 200 assert response.json() assert test_constants.VALID_MANY_RESTAURANTS_STRING in response.text assert cache_log_msg in caplog.text @pytest.mark.asyncio async def test_relay_anything_single_restaurants(client, cache_log_msg, caplog): response = await client.get( app.url_path_for( "relay_anything", query=f"{config['RESTAURANTS_PATH']}/{test_constants.VALID_RESTAURANT_ID}", ) ) assert response.status_code == 200 assert response.json() assert test_constants.VALID_RESTAURANT_TITLE in response.text assert cache_log_msg in caplog.text
while True: pass # Busy-wait for keyboard interrupt (Ctrl+C) class MyEmptyClass: pass def initlog(*args): pass # Remember to implement this!
__author__ = 'k22li' ) import re import os #print callable(getattr(str, 'split')) # test functions of filter & map pat = re.compile('st$') availableChoice = ['a', 'b', 'c', 'test'] print filter(pat.search, availableChoice) testFunc = lambda x : os.path.splitext(x)[0] print map(testFunc, ['a', 'a.b', 'a.b.c', 'test']
# include <stdio.h> # include <conio.h> # define rafik main void rafik() { clrscr(); printf("Main function is not used here"); getch(); }
import colors as col import random # Source for algorithms: Kooi B. 'Yet another mastermind strategy', https://www.rug.nl/research/portal/files/9871441/icgamaster.pdf used on and before 19-02-2020 def evaluateColors(guessedColors: list,secretCode) -> dict: tempColors = secretCode[:] tempGuessedColors = guessedColors[:] pins = { 'black': 0, 'white': 0 } j = 0 for i in range(0, len(secretCode)): j +=1 if secretCode[i] == guessedColors[i]: pins['black'] += 1 j -=1 del tempColors[j] del tempGuessedColors[j] for guessedColor in tempGuessedColors: try: i = tempColors.index(guessedColor) if tempColors[i] == guessedColor: pins['white'] +=1 del tempColors[i] except ValueError: pass return pins def generateAllCombinations(): arr = [] for colorOne in col.all_colors: for colorTwo in col.all_colors: for colorThree in col.all_colors: for colorFour in col.all_colors: arr.append([colorOne,colorTwo,colorThree,colorFour]) print('populate for all') return arr def repopulateAllCombinations(): global allPossibleCombinations global mutableAllPossibleCombinations mutableAllPossibleCombinations = [*allPossibleCombinations] allPossibleCombinations = generateAllCombinations() mutableAllPossibleCombinations = [] repopulateAllCombinations() def generateSecret(amount=4): col.SECRET = [] for i in range(0,amount): col.SECRET.append(col.all_colors[random.randint(0,len(col.all_colors)-1)]) """ This algorithm is made as described in 'Yet another mastermind strategy'. It also function as described, with expected results around 4.6 tries on average. """ def simpleAlgorithm(turn,secret): if(turn == 0): currentGuesse = ['Red', 'Red', 'Green', 'Blue'] else: # currentGuesse = gePosibilityFromIndex(0) currentGuesse = gePosibilityFromIndex(int(len(mutableAllPossibleCombinations) /2)) masterPins = evaluateColors(currentGuesse,secret) filterPosibilityList(currentGuesse,masterPins) return masterPins """ This heuristic algorithm is made by me in a small effort to try and improve on the simple algorithm as described in 'Yet another mastermind strategy'. The strategy was to broaden the removed amount of items by chosing a guess from oppositeparts of the list each time. My changes have however little to no effect. """ def heuristicAlgorithm(turn,secret): if(turn == 0): currentGuess = ['Red', 'Green', 'Blue', 'Yellow'] elif turn % 2 == 0: currentGuess = gePosibilityFromIndex(int(len(mutableAllPossibleCombinations) /4)) else: currentGuess = gePosibilityFromIndex(int((len(mutableAllPossibleCombinations) /4)*3)) masterPins = evaluateColors(currentGuess,secret) filterPosibilityList(currentGuess,masterPins) return masterPins def gePosibilityFromIndex(index): item = mutableAllPossibleCombinations[index] mutableAllPossibleCombinations.remove(item) return item def filterPosibilityList(currentGuesse,masterPins): global mutableAllPossibleCombinations tmp = mutableAllPossibleCombinations[:] for possibility in mutableAllPossibleCombinations: pins = evaluateColors(currentGuesse,possibility) if(masterPins != pins): tmp.remove(possibility) mutableAllPossibleCombinations = tmp """ This funciton gathers all the combinations and assignes the amount that combinations has hit to each option in the list. This is done so we can asses the best guess in every worstcase situation. As you can imagne this will take a rather long time and is not much better than the simple sort. """ def partitionSize(): # This function makes me want to cry partitions = {} for possibility in mutableAllPossibleCombinations: key = ','.join(possibility) # the key is the combination it self. partitions[key] = {'4,0': 0, '3,0': 0, '2,0': 0, '1,0': 0, '2,2': 0, '1,2': 0, '0,2': 0, '2,1': 0, '1,1': 0, '0,1': 0, '0,0': 0, '1,3': 0, '0,3': 0, '0,4': 0} # with value all the hits on combinations for _possibility in mutableAllPossibleCombinations: # Compare all the combinations to one another and update the partitions dict with the hits. _pins = evaluateColors(possibility,_possibility) pinToStr = f"{_pins['black']},{_pins['white']}" partitions[key][pinToStr] +=1 highestPerPartition = {} for partitionKey in partitions: # Get the most likely scenario per possibility. highestKey = max(partitions[partitionKey], key=partitions[partitionKey].get) # Add all the posibilities to a dict with the key as the combination, the amount from the most likely outcome is its value. highestPerPartition[partitionKey] = partitions[partitionKey][highestKey] # From all the worst case scenario's get the best one. best = min(highestPerPartition, key=highestPerPartition.get) return best.split(',') # Make the guesse by decoding the key """ This algorithm uses the partition sizing that is mentiond in 'Yet another mastermind strategy'. For game state i calculate all the possible worstcase scenario's and get the best one for my next guess """ def consistentWorstCaseAlgorithm(turn:int,secret): global mutableAllPossibleCombinations if(turn == 0): currentGuesse = ['Red', 'Red', 'Green', 'Green'] else: currentGuesse = partitionSize() masterPins = evaluateColors(currentGuesse,secret) filterPosibilityList(currentGuesse,masterPins) return masterPins
import csv import requests import pandas as pd from zipfile import ZipFile from io import StringIO URL = 'https://www.quandl.com/api/v3/databases/%(dataset)s/codes' def dataset_url(dataset): return URL % {'dataset': dataset} def download_file(url): r = requests.get(url) if r.status_code == 200: return StringIO(r.text) def unzip(file_): d = unzip_files(file_) return d[list(d.keys())[0]] def unzip_files(file_): d = {} with ZipFile(file_, 'r') as zipfile: for filename in zipfile.namelist(): d[filename] = str(zipfile.read(filename)) return d def csv_rows(str): for row in csv.reader(StringIO(str)): yield row def csv_dicts(str, fieldnames=None): for d in csv.DictReader(StringIO(str), fieldnames=fieldnames): yield d def get_symbols_list(dataset): csv_ = unzip(download_file(dataset_url(dataset))) return map(lambda x: x[0].replace(dataset + '/', ''), csv_rows(csv_)) def get_symbols_dict(dataset): csv_ = unzip(download_file(dataset_url(dataset))) return dict(csv_rows(csv_)) def get_symbols_df(dataset): csv_ = unzip(download_file(dataset_url(dataset))) df = pd.read_csv(StringIO(csv_), header=None, names=['symbol', 'company']) df.symbol = df.symbols.map(lambda x: x.replace(dataset + '/', '')) df.company = df.company.map(lambda x: x.replace('Prices, Dividends, Splits and Trading Volume', '')) return df
# -*- coding: UTF-8 -*- # Copyright 2013-2016 by Luc Saffre. # License: BSD, see LICENSE for more details. """A library for `fabric <http://docs.fabfile.org>`__ with tasks I use to manage my Python projects. NOTE: This module is deprecated. Use :mod:`atelier.invlib` instead. .. contents:: :local: .. _fab_commands: ``fab`` commands ================ Documenting ----------- .. command:: fab blog Edit today's blog entry, create an empty file if it doesn't yet exist. .. command:: fab cd Output a reStructuredText formatted list of all commits in all projects today. .. command:: fab bd Converted to :cmd:`inv bd`. .. command:: fab pd Converted to :cmd:`inv pd`. .. command:: fab clean Converted to :cmd:`inv clean`. .. command:: fab readme Converted to :cmd:`inv readme`. .. command:: fab api No longer exists because we now use autosummary instead of sphinx-apidoc. Generate `.rst` files below `docs/api` by running `sphinx-apidoc <http://sphinx-doc.org/invocation.html#invocation-of-sphinx-apidoc>`_. This is no longer used by most of my projects, at least those which I converted to `sphinx.ext.autosummary`. .. command:: fab docs Has been replaced by :cmd:`inv bd`. .. command:: fab pub Has been replaced by :cmd:`inv pd`. Internationalization -------------------- .. command:: fab mm Converted to :cmd:`inv mm`. Deploy ------ .. command:: fab release Converted to :cmd:`inv release`. .. command:: fab sdist Converted to :cmd:`inv sdist`. .. command:: fab ci Converted to :cmd:`inv ci`. .. command:: fab reg Converted to :cmd:`inv reg`. Testing ------- .. command:: fab initdb Converted to :cmd:`inv initdb`. .. command:: fab test Converted to :cmd:`inv test`. .. command:: fab test_sdist Converted to :cmd:`inv test_sdist`. Miscellaneous ------------- .. command:: fab summary Converted to :cmd:`inv ls`. Installation ============ To be used by creating a :file:`fabfile.py` in your project's root directory with at least the following two lines:: from atelier.fablib import * setup_from_fabfile(globals()) See :func:`setup_from_fabfile` for more information. Configuration files =================== .. xfile:: fabfile.py In your :xfile:`fabfile.py` file you can specify project-specific configuration settings. Example content:: from atelier.fablib import * setup_from_fabfile(globals(), "foobar") env.languages = "de fr et nl".split() env.tolerate_sphinx_warnings = True add_demo_project('foobar.demo') .. xfile:: .fabricrc To specify certain default preferences for all your projects, you can create a file named :xfile:`.fabricrc` in your home directory with content like this:: user = luc blogger_project = lino docs_rsync_dest = luc@example.org:~/public_html/%s docs_rsync_dest = luc@example.org:~/public_html/{prj}_{docs} sdist_dir = /home/luc/projects/lino/docs/dl temp_dir = /home/luc/tmp Project settings ================ `fabric <http://docs.fabfile.org>`__ works with a global "environment" object named ``env``. The following section documents the possible attributes of this object as used by :mod:`atelier.fablib`. You usually define these in your :xfile:`fabfile.py`. For some of them (those who are simple strings) you can define user-specific default values in a :xfile:`.fabricrc` file. .. class:: env .. attribute:: locale_dir The name of the directory where `fab mm` et al should write their catalog files. .. attribute:: sdist_dir .. attribute:: editor_command A string with the command name of your text editor. Example:: editor_command = "emacsclient -n {0}" The ``{0}`` will be replaced by the filename. Note that this must be a *non waiting* command, i.e. which launches the editor on the specified file in a new window and then returns control to the command line without waiting for that new window to terminate. .. attribute:: docs_rsync_dest A Python template string which defines the rsync destination for publishing your projects documentation. Used by :cmd:`fab pub`. Example:: env.docs_rsync_dest = 'luc@example.org:~/public_html/{prj}_{docs}' The ``{prj}`` in this template will be replaced by the internal name of this project, and ``{{docs}}`` by the name of the doctree (taken from :attr:`doc_trees`). For backward compatibility the following (deprecated) template is also still allowed:: env.docs_rsync_dest = 'luc@example.org:~/public_html/%s' The ``%s`` in this template will be replaced by a name `xxx_yyy`, where `xxx` is the internal name of this project and `yyy` the name of the doctree (taken from :attr:`doc_trees`). .. attribute:: doc_trees A list of directory names (relative to your project directory) containing Sphinx document trees. Default value is ``['docs']`` If this project has a main package, then `env.doc_trees` will be replaced by `doc_trees` attribute of that module. .. attribute:: cleanable_files A list of wildcards to be cleaned by :cmd:`fab clean`. .. attribute:: use_dirhtml Whether `sphinx-build <http://sphinx-doc.org/invocation.html#invocation-of-sphinx-build>`__ should use ``dirhtml`` instead of the default ``html`` builder. .. attribute:: tolerate_sphinx_warnings Whether `sphinx-build` should tolerate warnings. .. attribute:: languages A list of language codes for which userdocs are being maintained. .. attribute:: apidoc_exclude_pathnames No longer used because we now use autosummary instead of sphinx-apidoc. a list of filenames (or directory names) to be excluded when you run :cmd:`fab api`. .. attribute:: revision_control_system The revision control system used by your project. Allowed values are `'git'`, `'hg'` or `None`. Used by :cmd:`fab ci`. .. attribute:: use_mercurial **No longer used.** Use :attr:`env.revision_control_system` instead.) .. attribute:: demo_projects The list of *Django demo projects* included in this project. Django demo projects are used by the test suite and the Sphinx documentation. Before running :command:`fab test` or :command:`fab bd`, they must have been initialized. To initialize them, run :command:`fab initdb`. It is not launched automatically by :command:`fab test` or :command:`fab bd` because it can take some time and is not always necessary. History ======= - 20141020 moved `doc_trees` project to :class:`atelier.Project`. - 20141001 added support for multiple doc trees per project (:attr:`env.doc_trees`). - 20140116 : added support for managing namespace packages TODO ==== - replace `env.blogger_project` by an attribute of the main module (like `intersphinx_urls`) (The rest of this page is automatically generated stuff.) """ import importlib import os import datetime import glob import sphinx from babel.dates import format_date from unipath import Path from atelier.utils import i2d from atelier import rstgen try: from fabric.api import env, local, task from fabric.utils import abort, puts from fabric.contrib.console import confirm from fabric.api import lcd except ImportError: def task(**kwargs): def d(f): return f return d # ignore it here so that Sphinx autodoc can import it even # if fabric is not installed. def get_current_date(today=None): """ """ if today is None: return datetime.date.today() return i2d(today) class RstFile(object): def __init__(self, local_root, url_root, parts): self.path = local_root.child(*parts) + '.rst' self.url = url_root + "/" + "/".join(parts) + '.html' # if parts[0] == 'docs': # self.url = url_root + "/" + "/".join(parts[1:]) + '.html' # else: # raise Exception("20131125") # self.url = url_root + "/" + "/".join(parts) + '.html' def add_demo_project(p): """Register the specified settings module as being a Django demo project. See also :attr:`env.demo_projects`. """ if p in env.demo_projects: return # raise Exception("Duplicate entry %r in demo_projects." % db) env.demo_projects.append(p) def setup_from_fabfile( globals_dict, main_package=None, settings_module_name=None): """To be called from within your project's :xfile:`fabfile.py`. Minimal example:: from atelier.fablib import * setup_from_fabfile(globals()) If this doctree is the main doctree of a Python project, then the minimal example should be:: from atelier.fablib import * setup_from_fabfile(globals(), "foobar") Where "foobar" is the Python name of your project's main package. """ if not '__file__' in globals_dict: raise Exception( "No '__file__' in %r. " "First parameter to must be `globals()`" % globals_dict) fabfile = Path(globals_dict['__file__']) if not fabfile.exists(): raise Exception("No such file: %s" % fabfile) env.root_dir = fabfile.parent.absolute() # print("20141027 %s %s " % (main_package, env.root_dir)) env.project_name = env.root_dir.name env.setdefault('build_dir_name', '.build') # but ablog needs '_build' env.setdefault('long_date_format', "%Y%m%d (%A, %d %B %Y)") # env.work_root = Path(env.work_root) env.setdefault('use_dirhtml', False) env.setdefault('blog_root', env.root_dir.child('docs')) env.setdefault('sdist_dir', None) env.setdefault('editor_command', None) if env.sdist_dir is not None: env.sdist_dir = Path(env.sdist_dir) env.main_package = main_package env.locale_dir = None env.tolerate_sphinx_warnings = False env.demo_projects = [] env.revision_control_system = None env.apidoc_exclude_pathnames = [] # env.blogger_url = "http://blog.example.com/" env.setdefault('languages', None) env.setdefault('blogger_project', None) env.setdefault('blogger_url', None) env.setdefault('cleanable_files', []) if isinstance(env.languages, basestring): env.languages = env.languages.split() # if env.main_package: # env.SETUP_INFO = get_setup_info(Path(env.root_dir)) # else: # env.SETUP_INFO = None if settings_module_name is not None: os.environ['DJANGO_SETTINGS_MODULE'] = settings_module_name from django.conf import settings # why was this? settings.SITE.startup() env.languages = [lng.name for lng in settings.SITE.languages] # env.demo_databases.append(settings_module_name) #~ env.userdocs_base_language = settings.SITE.languages[0].name # The following import will populate the projects from atelier.projects import get_project_info env.current_project = get_project_info(env.root_dir) env.doc_trees = env.current_project.doc_trees # env.SETUP_INFO = env.current_project.SETUP_INFO setup_from_project = setup_from_fabfile # backwards compat #~ def confirm(msg,default='y',others='n',**override_callbacks): #~ text = "%s [%s%s]" % (msg,default.upper(),others) #~ def y(): return True # ~ # def n(): abort("Missing user confirmation for:\n%s" % msg) #~ def n(): abort("Missing user confirmation") #~ callbacks = dict(y=y,n=n) #~ callbacks.update(override_callbacks) #~ while True: #~ answer = prompt(text) # ~ # answer = raw_input(prompt) #~ if not answer: #~ answer = default #~ answer = answer.lower() #~ if answer: #~ return callbacks.get(answer)() def must_confirm(*args, **kw): if not confirm(*args, **kw): abort("Dann eben nicht...") def must_exist(p): if not p.exists(): abort("No such file: %s" % p.absolute()) def rmtree_after_confirm(p): if not p.exists(): return if confirm("OK to remove %s and everything under it?" % p.absolute()): p.rmtree() def unused_get_locale_dir(): # replaced by env.locale_dir if not env.main_package: return None # abort("No main_package") args = env.main_package.split('.') args.append('locale') p = env.root_dir.child(*args) if not p.isdir(): return None # abort("Directory %s does not exist." % p) return p def cleanup_pyc(p): """Thanks to oddthinking on http://stackoverflow.com/questions/2528283 """ for root, dirs, files in os.walk(p): pyc_files = [filename for filename in files if filename.endswith(".pyc")] py_files = set([filename for filename in files if filename.endswith(".py")]) excess_pyc_files = [pyc_filename for pyc_filename in pyc_files if pyc_filename[:-1] not in py_files] for excess_pyc_file in excess_pyc_files: full_path = os.path.join(root, excess_pyc_file) must_confirm("Remove excess file %s:" % full_path) os.remove(full_path) @task(alias='unused_mm') def make_messages(): "Extract messages, then initialize and update all catalogs." extract_messages() init_catalog_code() update_catalog_code() if False: extract_messages_userdocs() setup_babel_userdocs('init_catalog') setup_babel_userdocs('update_catalog') def extract_messages(): """Extract messages from source files to `django.pot` file""" # locale_dir = get_locale_dir() locale_dir = env.locale_dir if locale_dir is None: return args = ["python", "setup.py"] args += ["extract_messages"] args += ["-o", Path(locale_dir).child("django.pot")] cmd = ' '.join(args) #~ must_confirm(cmd) local(cmd) def extract_messages_userdocs(): """ Run the Sphinx gettext builder on userdocs. """ userdocs = env.root_dir.child('userdocs') if not userdocs.isdir(): return # abort("Directory %s does not exist." % userdocs) args = ['sphinx-build', '-b', 'gettext'] #~ args += cmdline_args # ~ args += ['-a'] # all files, not only outdated # ~ args += ['-P'] # no postmortem # ~ args += ['-Q'] # no output #~ if not env.tolerate_sphinx_warnings: # ~ args += ['-W'] # consider warnings as errors #~ args += ['-w',env.DOCSDIR.child('warnings.txt')] args += [userdocs] args += [userdocs.child("translations")] cmd = ' '.join(args) local(cmd) @task(alias='rename') def rename_data_url_friendly(): data_dir = env.root_dir.child('docs', 'data') #~ print list(data_dir.listdir(names_only=True)) print(list(data_dir.walk())) def setup_babel_userdocs(babelcmd): """Create userdocs .po files if necessary.""" userdocs = env.root_dir.child('userdocs') if not userdocs.isdir(): return locale_dir = userdocs.child('translations') for domain in locale_dir.listdir('*.pot', names_only=True): domain = domain[:-4] for loc in env.languages: if loc != env.languages[0]: po_file = Path(locale_dir, loc, 'LC_MESSAGES', '%s.po' % domain) mo_file = Path(locale_dir, loc, 'LC_MESSAGES', '%s.mo' % domain) pot_file = Path(locale_dir, '%s.pot' % domain) if babelcmd == 'init_catalog' and po_file.exists(): print("Skip %s because file exists." % po_file) #~ elif babelcmd == 'compile_catalog' and not mo_file.needs_update(po_file): #~ print "Skip %s because newer than .po" % mo_file else: args = ["python", "setup.py"] args += [babelcmd] args += ["-l", loc] args += ["--domain", domain] args += ["-d", locale_dir] #~ args += [ "-o" , po_file ] #~ if babelcmd == 'init_catalog': if babelcmd == 'compile_catalog': args += ["-i", po_file] else: args += ["-i", pot_file] cmd = ' '.join(args) #~ must_confirm(cmd) local(cmd) @task(alias='cmu') def compile_catalog_userdocs(): setup_babel_userdocs('compile_catalog') def init_catalog_code(): """Create code .po files if necessary.""" from lino.core.site import to_locale locale_dir = env.locale_dir # locale_dir = get_locale_dir() if locale_dir is None: return locale_dir = Path(locale_dir) for loc in env.languages: if loc != 'en': f = locale_dir.child(loc, 'LC_MESSAGES', 'django.po') if f.exists(): print("Skip %s because file exists." % f) else: args = ["python", "setup.py"] args += ["init_catalog"] args += ["--domain django"] args += ["-l", to_locale(loc)] args += ["-d", locale_dir] #~ args += [ "-o" , f ] args += ["-i", locale_dir.child('django.pot')] cmd = ' '.join(args) must_confirm(cmd) local(cmd) def update_catalog_code(): """Update .po files from .pot file.""" from lino.core.site import to_locale locale_dir = env.locale_dir # locale_dir = get_locale_dir() if locale_dir is None: return locale_dir = Path(locale_dir) for loc in env.languages: if loc != env.languages[0]: args = ["python", "setup.py"] args += ["update_catalog"] args += ["--domain django"] #~ args += [ "-d" , locale_dir ] args += ["-o", locale_dir.child(loc, 'LC_MESSAGES', 'django.po')] args += ["-i", locale_dir.child("django.pot")] args += ["-l", to_locale(loc)] cmd = ' '.join(args) #~ must_confirm(cmd) local(cmd) @task(alias='cm') def compile_catalog(): """Compile .po files to .mo files.""" from lino.core.site import to_locale locale_dir = env.locale_dir # locale_dir = get_locale_dir() if locale_dir is None: return for loc in env.languages: if loc != env.languages[0]: args = ["python", "setup.py"] args += ["compile_catalog"] args += ["-i", locale_dir.child(loc, 'LC_MESSAGES', 'django.po')] args += ["-o", locale_dir.child(loc, 'LC_MESSAGES', 'django.mo')] args += ["--domain django"] #~ args += [ "-d" , locale_dir ] args += ["-l", to_locale(loc)] cmd = ' '.join(args) #~ must_confirm(cmd) local(cmd) @task(alias='mss') def makescreenshots(): """generate screenshot .jpg files to gen/screenshots.""" run_in_demo_projects('makescreenshots', '--traceback') @task(alias='sss') def syncscreenshots(): """synchronize gen/screenshots to userdocs/gen/screenshots.""" run_in_demo_projects('syncscreenshots', '--traceback', 'gen/screenshots', 'userdocs/gen/screenshots') def sphinx_build(builder, docs_dir, cmdline_args=[], language=None, build_dir_cmd=None): args = ['sphinx-build', '-b', builder] args += cmdline_args # ~ args += ['-a'] # all files, not only outdated # ~ args += ['-P'] # no postmortem # ~ args += ['-Q'] # no output # build_dir = docs_dir.child(env.build_dir_name) build_dir = Path(env.build_dir_name) if language is not None: args += ['-D', 'language=' + language] # needed in select_lang.html template args += ['-A', 'language=' + language] if language != env.languages[0]: build_dir = build_dir.child(language) #~ print 20130726, build_dir if env.tolerate_sphinx_warnings: args += ['-w', 'warnings_%s.txt' % builder] else: args += ['-W'] # consider warnings as errors # args += ['-vvv'] # increase verbosity #~ args += ['-w'+Path(env.root_dir,'sphinx_doctest_warnings.txt')] args += ['.', build_dir] cmd = ' '.join(args) with lcd(docs_dir): local(cmd) if build_dir_cmd is not None: with lcd(build_dir): local(build_dir_cmd) def sync_docs_data(docs_dir): build_dir = docs_dir.child(env.build_dir_name) for data in ('dl', 'data'): src = docs_dir.child(data).absolute() if src.isdir(): target = build_dir.child('dl') target.mkdir() cmd = 'cp -ur %s %s' % (src, target.parent) local(cmd) if False: # according to http://mathiasbynens.be/notes/rel-shortcut-icon for n in ['favicon.ico']: src = docs_dir.child(n).absolute() if src.exists(): target = build_dir.child(n) cmd = 'cp %s %s' % (src, target.parent) local(cmd) @task(alias='userdocs') def build_userdocs(*cmdline_args): """ Deprecated. sphinx-build the userdocs tree in all languages """ if env.languages is None: return docs_dir = env.root_dir.child('userdocs') if not docs_dir.exists(): return for lng in env.languages: sphinx_build('html', docs_dir, cmdline_args, lng) sync_docs_data(docs_dir) @task(alias='pdf') def build_userdocs_pdf(*cmdline_args): if env.languages is None: return docs_dir = env.root_dir.child('userdocs') if not docs_dir.exists(): return for lng in env.languages: sphinx_build('latex', docs_dir, cmdline_args, lng, build_dir_cmd='make all-pdf') sync_docs_data(docs_dir) @task(alias='linkcheck') def sphinx_build_linkcheck(*cmdline_args): """sphinxbuild -b linkcheck docs.""" docs_dir = env.root_dir.child('docs') if docs_dir.exists(): sphinx_build('linkcheck', docs_dir, cmdline_args) docs_dir = env.root_dir.child('userdocs') if docs_dir.exists(): lng = env.languages[0] #~ lng = env.userdocs_base_language sphinx_build('linkcheck', docs_dir, cmdline_args, lng) def get_doc_trees(): for rel_doc_tree in env.doc_trees: docs_dir = env.root_dir.child(rel_doc_tree) if not docs_dir.exists(): msg = "Directory %s does not exist." % docs_dir msg += "\nCheck your project's `doc_trees` setting." raise Exception(msg) yield docs_dir def run_in_demo_projects(admin_cmd, *more): """Run the given shell command in each demo project (see :attr:`env.demo_projects`). """ for mod in env.demo_projects: puts("-" * 80) puts("In demo project {0}:".format(mod)) from importlib import import_module m = import_module(mod) # p = Path(m.__file__).parent.absolute() p = m.SITE.cache_dir or m.SITE.project_dir with lcd(p): args = ["django-admin.py"] args += [admin_cmd] args += more #~ args += ["--noinput"] args += ["--settings=" + mod] #~ args += [" --pythonpath=%s" % p.absolute()] cmd = " ".join(args) local(cmd) @task(alias='ddt') def double_dump_test(): """ Perform a "double dump test" on every demo database. TODO: convert this to a Lino management command. """ raise Exception("Not yet converted after 20150129") if len(env.demo_databases) == 0: return a = Path(env.temp_dir, 'a') b = Path(env.temp_dir, 'b') rmtree_after_confirm(a) rmtree_after_confirm(b) #~ if not confirm("This will possibly break the demo databases. Are you sure?"): #~ return #~ a.mkdir() with lcd(env.temp_dir): for db in env.demo_databases: if a.exists(): a.rmtree() if b.exists(): b.rmtree() local("django-admin.py dump2py --settings=%s --traceback a" % db) local( "django-admin.py run --settings=%s --traceback a/restore.py" % db) local("django-admin.py dump2py --settings=%s --traceback b" % db) local("diff a b")
# Oppgave 6) #Lag et program som får brukeren til å skrive inn 2 navn med 2 tilhørende bursdager. #La så brukeren søke på navnet og tilhørende bursdag skrives ut. navn = "" #Lager variabelen navn som en tom string/"" index = 0 #Lager variabelen index som har verdien 0 liste = {} #Lager en ordbok som er lagret i variabelen liste for i in range(2): #Sier for-løkka skal ha en range på 2. Det vil si at for-løkka gjennomgås 2 ganger navn = input("Skriv inn navn: ") #SKriver ut et inputfelt hvor brukeren skal skrive inn et navn bursdag = input("Skriv inn bursdag: ") #Skriver ut et inputfelt hvor brukeren skal skrive inn en bursdag liste[navn] = bursdag #Legger til navn som nøkkelverdi i ordboken liste og bursdag som innholdsverdi for i in liste: #Går gjennom lista og skriver ut bursdag og dato ved å referere til innholds- og #nøkkelverdien i orboken liste print(str(i) + " har bursdag " + str(liste[i])) index = input("Søk på navn og finn bursdag ") #Ber brukeren skrive inn et navn som lagres i variabelen index if index in liste: #Om index, altså det brukeren har skrevet inn i siste inputfelt, finnes i liste vil #det skrives ut navn og innholdsverdien til navn i lista print (index + " har bursdag " + liste[index]) else: #Om ikke index stemmer i if-setningen skrives else-setningen ut print("Skriv in et gyldig navn")
def valid(s): s = s.lower() s = s.strip().split(' ') s = "".join(char for char in s if char.isalnum()) return s == s[::-1] print(valid("Race car")) print(valid("fat")) print(valid(":racecar"))
import numpy as np import pandas as pd from scipy.io.arff import loadarff # functions to prep dataset import sklearn.datasets as skdata from sklearn.datasets import fetch_openml from sklearn.model_selection import train_test_split from sklearn.experimental import enable_iterative_imputer from sklearn.impute import SimpleImputer, IterativeImputer import miceforest as mf # import tensorflow_datasets import os # define path locations relative to this file dir_path = os.path.dirname(os.path.realpath(__file__)) thoracic_path = os.path.join(dir_path, "ThoracicSurgery.arff") abalone_path = os.path.join(dir_path, "abalone.data") bank_path = os.path.join(dir_path, "bank-additional/bank-additional.csv") anneal_path_train = os.path.join(dir_path, "anneal.data") anneal_path_test = os.path.join(dir_path, "anneal.test") # convenience imputation functions def simple(train, valid, test, dtypes=None): if dtypes is None: imp = SimpleImputer(missing_values=np.nan, strategy='mean') imp.fit(train) train = imp.transform(train) if valid is not None: valid = imp.transform(valid) if test is not None: test = imp.transform(test) if dtypes is not None: cont = np.array(dtypes) == 0 cat = np.array(dtypes) == 1 imp1 = SimpleImputer(missing_values=np.nan, strategy='mean') imp2 = SimpleImputer(missing_values=np.nan, strategy='most_frequent') imp1.fit(train[:, cont]) imp2.fit(train[:, cat]) train[:, cont] = imp1.transform(train[:, cont]) train[:, cat] = imp2.transform(train[:, cat]) if valid is not None: valid[:, cont] = imp1.transform(valid[:, cont]) valid[:, cat] = imp2.transform(valid[:, cat]) if test is not None: test[:, cont] = imp1.transform(test[:, cont]) test[:, cat] = imp2.transform(test[:, cat]) return train, valid, test def iterative(train, rng_key, dtypes=None, valid=None, test=None): imp = IterativeImputer(max_iter=10, random_state=rng_key) imp.fit(train) train = imp.transform(train) if valid is not None: valid = imp.transform(valid) if test is not None: test = imp.transform(test) return train, valid, test def miceforest(train, rng_key, dtypes=None, valid=None, test=None): colnames = [str(i) for i in range(train.shape[1])] df = pd.DataFrame(train, columns=colnames) kernel = mf.MultipleImputedKernel( df, datasets=20, save_all_iterations=True, random_state=10, mean_match_candidates=0 ) kernel.mice(3) train = kernel.complete_data(0).values if valid is not None: valid_imp = kernel.impute_new_data( new_data=pd.DataFrame(valid, columns=colnames)) valid = valid_imp.complete_data(0).values if test is not None: test_imp = kernel.impute_new_data( new_data=pd.DataFrame(test, columns=colnames)) test = test_imp.complete_data(0).values return train, valid, test # dataset generating functions def spiral( N, missing=None, imputation=None, # one of none, simple, iterative, miceforest train_complete=False, test_complete=True, split=0.33, rng_key=0, p=0.5, cols_miss=1 ): rng = np.random.default_rng(rng_key) theta = np.sqrt(rng.uniform(0,1,N))*2*np.pi # np.linspace(0,2*pi,100) r_a = 2*theta + np.pi data_a = np.array([np.cos(theta)*r_a, np.sin(theta)*r_a]).T x_a = data_a + rng.standard_normal((N,2)) r_b = -2*theta - np.pi data_b = np.array([np.cos(theta)*r_b, np.sin(theta)*r_b]).T x_b = data_b + rng.standard_normal((N,2)) res_a = np.append(x_a, np.zeros((N,1)), axis=1) res_b = np.append(x_b, np.ones((N,1)), axis=1) res = np.append(res_a, res_b, axis=0) rng.shuffle(res) X_ = res[:, :2] y = res[:, 2] # create a noise column x3 and x4 transformation using x1, x2 x3 = rng.standard_normal((N*2,1)) * 5 x4 = (y).reshape((-1,1)) + rng.uniform(0,1,(N*2, 1)) # y with noise - should be highly informative... X_ = np.hstack([X_, x3, x4]) key = rng.integers(9999) if missing is None: train_complete = True test_complete = True if train_complete and test_complete: X = X_ X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=0.33, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=0.33, random_state=key) elif train_complete and not test_complete: # TRAIN COMPLETE IS TRUE AND TEST COMPLETE IS FALSE X_train, X, y_train, y_test = train_test_split(X_, y, test_size=0.33, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=0.33, random_state=key) elif not train_complete and test_complete: X, X_test, y_train, y_test = train_test_split(X_, y, test_size=0.33, random_state=key) elif not train_complete and not test_complete: X = X_ # create missingness mask cols = X.shape[1] if missing == "MAR": cols_miss = np.minimum(cols - 1, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols-1,)) corrections = [] for col in range(cols-1): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols - 1)) print(corrections.shape, X.shape) rand_arr = rng.uniform(0,1,(X.shape[0], cols - 1)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is shifted to the left, therefore MAR if missing == "MNAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols,)) corrections = [] for col in range(cols): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols)) rand_arr = rng.uniform(0,1,(X.shape[0], cols)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is not shifted to the left, therefore MNAR if type(missing) == float or missing == "MCAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing if type(missing) == float: p = missing rand_arr = rng.uniform(0,1,(X.shape[0], cols_miss)) nan_arr = np.where(rand_arr < p, np.nan, 1.0) X[:, -cols_miss:] *= nan_arr if type(missing) == tuple and missing[1] == "MNAR": correction1 = X[:,-1:] < np.quantile(X[:,-1:], 0.2, keepdims=True) # dependency on x4 MNAR correction2 = X[:,:1] < np.quantile(X[:,:1], 0.2, keepdims=True) # dependency on x1 MAR correction3 = X[:,1:2] < np.quantile(X[:,1:2], 0.5, keepdims=True) # dependency on x2 MAR correction = (correction1 | correction2) | correction3 correction = np.where(correction, 0.0, 1.0).reshape((-1,1)) # dependency on x4 rand_arr = rng.uniform(0,1,(X.shape[0], 1)) * correction # missingness is dependent on unobserved missing values nan_arr = np.where(rand_arr > (1 - missing[0]), np.nan, 1.0) X[:, -1:] *= nan_arr # generate train, validate, test datasets and impute training key = rng.integers(9999) if train_complete and test_complete: pass elif train_complete and not test_complete: X_test = X elif not train_complete and test_complete: X_train = X X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=0.33, random_state=key) elif not train_complete and not test_complete: X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=0.33, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=0.33, random_state=key) # missingness diagnostics # diagnostics = {"X_train":{}, "X_valid":{}, "X_test":{}} # diagnostics["X_train"]["cols"] = np.isnan(X_train).sum(0) / X_train.shape[0] # diagnostics["X_train"]["rows"] = np.any(np.isnan(X_train), axis=1).sum() / X_train.shape[0] # diagnostics["X_valid"]["cols"] = np.isnan(X_valid).sum(0) / X_valid.shape[0] # diagnostics["X_valid"]["rows"] = np.any(np.isnan(X_valid), axis=1).sum() / X_valid.shape[0] # diagnostics["X_test"]["cols"] = np.isnan(X_test).sum(0) / X_test.shape[0] # diagnostics["X_test"]["rows"] = np.any(np.isnan(X_test), axis=1).sum() / X_test.shape[0] # print(diagnostics) # perform desired imputation strategy if imputation == "simple" and missing is not None: X_train, X_valid, X_test = simple( X_train, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "iterative" and missing is not None: X_train, X_valid, X_test = iterative( X_train, key, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "miceforest" and missing is not None: if test_complete: test_input = None else: test_input = X_test X_train, X_valid, test_input = miceforest( X_train, int(key), dtypes=None, valid=X_valid, test=test_input) if test_complete: X_test = X_test else: X_test = test_input return X_train, X_valid, X_test, y_train, y_valid, y_test, (x_a, x_b), 2 def thoracic( missing="MAR", imputation=None, # one of none, simple, iterative, miceforest train_complete=False, test_complete=True, split=0.33, rng_key=0, p=0.5, cols_miss=1 ): # import data rng = np.random.default_rng(rng_key) data, meta = loadarff(thoracic_path) d = pd.DataFrame(data) # convert categorical variables to integer encoding cols = [] for name in meta.names(): m = meta[name] if m[0] == 'nominal': cols.append(1) l = list(m[1]) d[name] = [l.index(x.decode('UTF-8')) for x in d[name].values] else: cols.append(0) cols = cols[:-1] X_ = d.values[:, :-1] y = d.values[:, -1] if missing is None: train_complete = True test_complete = True if train_complete and test_complete: X = X_ key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif train_complete and not test_complete: # TRAIN COMPLETE IS TRUE AND TEST COMPLETE IS FALSE key = rng.integers(9999) X_train, X, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and test_complete: key = rng.integers(9999) X, X_test, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) elif not train_complete and not test_complete: X = X_ cols = X.shape[1] if missing == "MCAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing rand_arr = rng.uniform(0, 1, (X.shape[0], cols_miss)) nan_arr = np.where(rand_arr < p, np.nan, 1.0) X[:, -cols_miss:] *= nan_arr if missing == "MAR": cols_miss = np.minimum(cols - 1, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols-1,)) corrections = [] for col in range(cols-1): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols - 1)) print(corrections.shape, X.shape) rand_arr = rng.uniform(0,1,(X.shape[0], cols - 1)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is shifted to the left, therefore MAR if missing == "MNAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols,)) corrections = [] for col in range(cols): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols)) rand_arr = rng.uniform(0,1,(X.shape[0], cols)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is not shifted to the left, therefore MNAR # generate train, validate, test datasets and impute training if train_complete and test_complete: pass elif train_complete and not test_complete: X_test = X elif not train_complete and test_complete: X_train = X key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and not test_complete: key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) # missingness diagnostics # diagnostics = {"X_train":{}, "X_valid":{}, "X_test":{}} # diagnostics["X_train"]["cols"] = np.isnan(X_train).sum(0) / X_train.shape[0] # diagnostics["X_train"]["rows"] = np.any(np.isnan(X_train), axis=1).sum() / X_train.shape[0] # diagnostics["X_valid"]["cols"] = np.isnan(X_valid).sum(0) / X_valid.shape[0] # diagnostics["X_valid"]["rows"] = np.any(np.isnan(X_valid), axis=1).sum() / X_valid.shape[0] # diagnostics["X_test"]["cols"] = np.isnan(X_test).sum(0) / X_test.shape[0] # diagnostics["X_test"]["rows"] = np.any(np.isnan(X_test), axis=1).sum() / X_test.shape[0] # print(diagnostics) # perform desired imputation strategy if imputation == "simple" and missing is not None: X_train, X_valid, X_test = simple( X_train, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "iterative" and missing is not None: X_train, X_valid, X_test = iterative( X_train, key, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "miceforest" and missing is not None: if test_complete: test_input = None else: test_input = X_test X_train, X_valid, test_input = miceforest( X_train, int(key), dtypes=None, valid=X_valid, test=test_input) if test_complete: X_test = X_test else: X_test = test_input return X_train, X_valid, X_test, y_train, y_valid, y_test, 2 def abalone( missing="MAR", imputation=None, # one of none, simple, iterative, miceforest train_complete=False, test_complete=True, split=0.33, rng_key=0, p=0.5, cols_miss=1 ): rng = np.random.default_rng(rng_key) data = pd.read_csv(abalone_path, header=None) cat = list(data[0].unique()) data[0] = [cat.index(i) for i in data[0].values] X_ = data.values[:, :-1] y = data.values[:, -1] unique = list(np.unique(y)) y = np.array([unique.index(v) for v in y]) coltypes = [1] + [0 for i in range(X_.shape[1] - 1)] if missing is None: train_complete = True test_complete = True if train_complete and test_complete: X = X_ key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif train_complete and not test_complete: # TRAIN COMPLETE IS TRUE AND TEST COMPLETE IS FALSE key = rng.integers(9999) X_train, X, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and test_complete: key = rng.integers(9999) X, X_test, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) elif not train_complete and not test_complete: X = X_ cols = X.shape[1] if missing == "MCAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing rand_arr = rng.uniform(0, 1, (X.shape[0], cols_miss)) nan_arr = np.where(rand_arr < p, np.nan, 1.0) X[:, -cols_miss:] *= nan_arr if missing == "MAR": cols_miss = np.minimum(cols - 1, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols-1,)) corrections = [] for col in range(cols-1): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols - 1)) print(corrections.shape, X.shape) rand_arr = rng.uniform(0,1,(X.shape[0], cols - 1)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is shifted to the left, therefore MAR if missing == "MNAR": cols_miss = np.minimum(cols, cols_miss) # clip cols missing q = rng.uniform(0.3,0.7,(cols,)) corrections = [] for col in range(cols): correction = X[:,col] > np.quantile(X[:,col], q[col], keepdims=True) # dependency on each x corrections.append(correction) corrections = np.concatenate(corrections) corrections = np.where(corrections, 0.0, 1.0).reshape((-1,cols)) rand_arr = rng.uniform(0,1,(X.shape[0], cols)) * corrections nan_arr = np.where(rand_arr > (1-p), np.nan, 1.0) X[:, -cols_miss:] *= nan_arr[:, -cols_miss:] # dependency is not shifted to the left, therefore MNAR # generate train, validate, test datasets and impute training if train_complete and test_complete: pass elif train_complete and not test_complete: X_test = X elif not train_complete and test_complete: X_train = X key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and not test_complete: key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) # missingness diagnostics # diagnostics = {"X_train":{}, "X_valid":{}, "X_test":{}} # diagnostics["X_train"]["cols"] = np.isnan(X_train).sum(0) / X_train.shape[0] # diagnostics["X_train"]["rows"] = np.any(np.isnan(X_train), axis=1).sum() / X_train.shape[0] # diagnostics["X_valid"]["cols"] = np.isnan(X_valid).sum(0) / X_valid.shape[0] # diagnostics["X_valid"]["rows"] = np.any(np.isnan(X_valid), axis=1).sum() / X_valid.shape[0] # diagnostics["X_test"]["cols"] = np.isnan(X_test).sum(0) / X_test.shape[0] # diagnostics["X_test"]["rows"] = np.any(np.isnan(X_test), axis=1).sum() / X_test.shape[0] # print(diagnostics) # perform desired imputation strategy if imputation == "simple" and missing is not None: X_train, X_valid, X_test = simple( X_train, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "iterative" and missing is not None: X_train, X_valid, X_test = iterative( X_train, key, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "miceforest" and missing is not None: if test_complete: test_input = None else: test_input = X_test X_train, X_valid, test_input = miceforest( X_train, int(key), dtypes=None, valid=X_valid, test=test_input) if test_complete: X_test = X_test else: X_test = test_input return X_train, X_valid, X_test, y_train, y_valid, y_test, 1 def banking(imputation=None, split=0.33, rng_key=0): rng = np.random.default_rng(rng_key) data = pd.read_csv(bank_path, sep=";") cont = ['age', 'duration', 'campaign', 'pdays', 'previous', 'emp.var.rate', 'cons.price.idx', 'cons.conf.idx', 'euribor3m', 'nr.employed'] cat = ['job', 'marital', 'education', 'default', 'housing', 'loan', 'contact', 'month', 'day_of_week', 'poutcome', 'y'] def lab_2_num(array): unique_list = [l for l in list(np.unique(array)) if l != "unknown"] return np.array([unique_list.index(l) if l != "unknown" else np.nan for l in array]) for c in cat: data[c] = lab_2_num(data[c].values) data = data[cont + cat] coltype = [1 if i in cat else 0 for i in cont+cat] coltype = coltype[:-1] X = data.values[:, :-1] y = data.values[:, -1] # split data key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) # diagnostics = {"X_train":{}, "X_valid":{}, "X_test":{}} # diagnostics["X_train"]["cols"] = np.isnan(X_train).sum(0) / X_train.shape[0] # diagnostics["X_train"]["rows"] = np.any(np.isnan(X_train), axis=1).sum() / X_train.shape[0] # diagnostics["X_valid"]["cols"] = np.isnan(X_valid).sum(0) / X_valid.shape[0] # diagnostics["X_valid"]["rows"] = np.any(np.isnan(X_valid), axis=1).sum() / X_valid.shape[0] # diagnostics["X_test"]["cols"] = np.isnan(X_test).sum(0) / X_test.shape[0] # diagnostics["X_test"]["rows"] = np.any(np.isnan(X_test), axis=1).sum() / X_test.shape[0] # print(diagnostics) # perform desired imputation strategy rng = np.random.default_rng(rng_key) if imputation == "simple": X_train, _, X_test = simple( X_train, dtypes=coltype, valid=None, test=X_test) key = rng.integers(9999) if imputation == "iterative": X_train, _, X_test = iterative( X_train, int(key), valid=None, test=X_test) key = rng.integers(9999) if imputation == "miceforest": X_train, _, X_test = miceforest( X_train, int(key), valid=None, test=X_test) return X_train, X_valid, X_test, y_train, y_valid, y_test, 2 def anneal(imputation=None, split=0.33, rng_key=0): cont = [3,4,8,32,33,34] def prep_data(train, test): cols = [] for i in range(39): if i not in cont: d = train.values[:, i].astype(str) t = test.values[:, i].astype(str) vals = np.unique(np.concatenate([d[d != 'nan'], t[t != 'nan']])) vals = list(vals) dcoded = [np.nan if j == 'nan' else vals.index(j) for j in d] tcoded = [np.nan if j == 'nan' else vals.index(j) for j in t] if np.all(np.isnan(dcoded)): pass else: cols.append(i) train[i] = dcoded test[i] = tcoded else: d = train.values[:, i].astype(np.float64) t = test.values[:, i].astype(np.float64) train[i] = d test[i] = t if np.all(np.isnan(d)): pass else: cols.append(i) train[i] = dcoded test[i] = tcoded return train[cols].values, test[cols].values training = pd.read_csv(anneal_path_train, header=None, na_values=["?"]) testing = pd.read_csv(anneal_path_test, header=None, na_values=["?"]) training, testing = prep_data(training, testing) X_train, y_train = training[:,:-1], training[:,-1] X_test, y_test = testing[:,:-1], testing[:,-1] # perform desired imputation strategy rng = np.random.default_rng(rng_key) if imputation == "simple": X_train, _, X_test = simple( X_train, dtypes=[0 if i in cont else 1 for i in range(X_train.shape[1])], valid=None, test=X_test) key = rng.integers(9999) if imputation == "iterative": X_train, _, X_test = iterative( X_train, int(key), valid=None, test=X_test) key = rng.integers(9999) if imputation == "miceforest": X_train, _, X_test = miceforest( X_train, int(key), valid=None, test=X_test) # can't presplit before imputation as data is too sparse few X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=rng_key+1) return X_train, X_valid, X_test, y_train, y_valid, y_test, 6 def mnist( missing="MCAR", imputation=None, # one of none, simple, iterative, miceforest train_complete=False, test_complete=True, split=0.33, rng_key=0, p=0.5, ): rng = np.random.default_rng(rng_key) # X_, y = fetch_openml('mnist_784', version=1, return_X_y=True, as_frame=False) X_, y = skdata.load_digits(return_X_y=True) if missing is None: train_complete = True test_complete = True if train_complete and test_complete: X = X_ key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif train_complete and not test_complete: # TRAIN COMPLETE IS TRUE AND TEST COMPLETE IS FALSE key = rng.integers(9999) X_train, X, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and test_complete: key = rng.integers(9999) X, X_test, y_train, y_test = train_test_split(X_, y, test_size=split, random_state=key) elif not train_complete and not test_complete: X = X_ if missing == "MCAR": rand_arr = rng.uniform(0, 1, X.shape) nan_arr = np.where(rand_arr < p, np.nan, 1.0) X *= nan_arr elif missing == "MAR": # delete a square based on location. Not 'technically' MAR but less 'random' than MCAR implementation square = np.ones((1, 8, 8)) for xi in range(8): for yi in range(8): if (0 < xi <= 4) and (0 < yi <= 4): square[:, xi, yi] = np.nan X *= square.reshape((1, 64)) elif missing is not None: print("not implemented") # generate train, validate, test datasets and impute training if train_complete and test_complete: pass elif train_complete and not test_complete: X_test = X elif not train_complete and test_complete: X_train = X key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) elif not train_complete and not test_complete: key = rng.integers(9999) X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=split, random_state=key) key = rng.integers(9999) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=split, random_state=key) # missingness diagnostics # diagnostics = {"X_train":{}, "X_valid":{}, "X_test":{}} # diagnostics["X_train"]["cols"] = np.isnan(X_train).sum(0) / X_train.shape[0] # diagnostics["X_train"]["rows"] = np.any(np.isnan(X_train), axis=1).sum() / X_train.shape[0] # diagnostics["X_valid"]["cols"] = np.isnan(X_valid).sum(0) / X_valid.shape[0] # diagnostics["X_valid"]["rows"] = np.any(np.isnan(X_valid), axis=1).sum() / X_valid.shape[0] # diagnostics["X_test"]["cols"] = np.isnan(X_test).sum(0) / X_test.shape[0] # diagnostics["X_test"]["rows"] = np.any(np.isnan(X_test), axis=1).sum() / X_test.shape[0] # print(diagnostics) # perform desired imputation strategy if imputation == "simple" and missing is not None: X_train, X_valid, X_test = simple( X_train, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "iterative" and missing is not None: X_train, X_valid, X_test = iterative( X_train, key, dtypes=None, valid=X_valid, test=X_test) key = rng.integers(9999) if imputation == "miceforest" and missing is not None: if test_complete: test_input = None else: test_input = X_test X_train, X_valid, test_input = miceforest( X_train, int(key), dtypes=None, valid=X_valid, test=test_input) if test_complete: X_test = X_test else: X_test = test_input return X_train, X_valid, X_test, y_train.astype(int), y_valid.astype(int), y_test.astype(int), 10
import random p = random.randint(1, 6) print(p) # para saber o n correto antes r = int(input('N: ')) while not(r == p): print ('incorreto' if not(r == p) else 'correto') r = int(input('N: '))
class Hashtable: def __init__(self, lst=None): if lst: self._hashtable = self.hashing(lst) @classmethod def hashing(cls, lst): """" group's number count watched elements the group / / 20000: [{22341: True, ...}, 0] \ original value """ hashtable = {cls.group(x): [] for x in lst} for x in lst: hashtable[cls.group(x)].append(x) return hashtable @property def hashtable(self): return self._hashtable @classmethod def group(cls, x, c=10000): """ Hash-function. """ r = lambda x: x % c # remainder k = lambda x: int((x - r(x)) / c) # coefficient groups = lambda x: k(x) * c if x >= 0 else (k(x) + 1) * c return groups(x) if __name__ == "__main__": lst = [1, 20000, 12314241, -1, -10001, -15000] ht = Hashtable(lst) print(ht.hashtable)
#!/usr/bin/env python #_*_coding:utf-8_*_ #作者:Paul哥 import urllib2,cookielib,random,urllib,json,time,re,datetime import LoginAccount,TrainNumQuery,BookingSeat from PIL import Image from PIL import ImageFont from PIL import ImageDraw import ssl,sys ssl._create_default_https_context = ssl._create_unverified_context reload(sys) sys.setdefaultencoding('utf8') LoginRun=LoginAccount.Login() TrainQuery=TrainNumQuery.QueryTrain() SeatBooking=BookingSeat.Booking() from bs4 import BeautifulSoup class ShopTicket: def __init__(self): self.Imagesuffix=random.random() #验证码请求尾部随机数字 self.ImageUrl='https://kyfw.12306.cn/otn/passcodeNew/getPassCodeNew?module=login&rand=sjrand&'+str(self.Imagesuffix) #验证码请求URL self.checkcodeurl='https://kyfw.12306.cn/otn/passcodeNew/checkRandCodeAnsyn' #12306检测验证码对错的url self.checkloginurl='https://kyfw.12306.cn/otn/login/loginAysnSuggest'#12306检测用户名密码验证码对错的url self.loginurl='https://kyfw.12306.cn/otn/index/initMy12306' #12306正式登陆页面URL self.mainurl='https://kyfw.12306.cn/otn/'#请求12306前半部分链接 self.loginout='https://kyfw.12306.cn/otn/login/loginOut' self.accessHeaders={ 'Host': 'kyfw.12306.cn', 'Connection': 'keep-alive', 'Accept': 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8', 'Upgrade-Insecure-Requests': '1', 'User-Agent': 'Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/46.0.2490.71 Safari/537.36', 'Referer': 'https://kyfw.12306.cn/otn/init', #'Accept-Encoding': 'gzip, deflate, sdch', 'Accept-Language': 'zh-CN,zh;q=0.8' } #12306HTTP请求头 self.getpassengerHeaders={ 'Host': 'kyfw.12306.cn', 'Connection': 'keep-alive', 'Accept': 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8', 'Upgrade-Insecure-Requests': '1', 'User-Agent': 'Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/46.0.2490.71 Safari/537.36', 'Referer': 'https://kyfw.12306.cn/otn/confirmPassenger/initDc', #'Accept-Encoding': 'gzip, deflate, sdch', 'Accept-Language': 'zh-CN,zh;q=0.8' } self.checkRandCodeAnsyntheaders={ 'Host': 'kyfw.12306.cn', 'Connection': 'keep-alive', #'Content-Length': '446', 'Accept':'*/*', 'Origin': 'https://kyfw.12306.cn', 'X-Requested-With': 'XMLHttpRequest', 'User-Agent': 'Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/45.0.2454.93 Safari/537.36', 'Content-Type': 'application/x-www-form-urlencoded; charset=UTF-8', 'Referer': 'https://kyfw.12306.cn/otn/leftTicket/init', #'Accept-Encoding': 'gzip, deflate', 'Accept-Language': 'zh-CN,zh;q=0.8' } self.FullSeatTypeDict={'商务座':'9','二等座':'O','一等座':'M','特等座':'P','高级软卧':'6','软卧':'4','硬卧':'3','软座':'2','硬座':'1'} self.sixcodedict={'1':'40,75','2':'110,75','3':'180,75','4':'250,75','5':'40,150','6':'110,150','7':'180,150','8':'250,150'} self.eighteencodedict={'a':'25,30','b':'70,30','c':'120,30','d':'170,30','e':'220,30','f':'270,30','g':'25,80','h':'70,80','i':'120,80','j':'170,80','k':'220,80','l':'270,80','m':'25,130','n':'70,130','o':'120,130','p':'170,130','q':'220,130','r':'270,130'} #坐标对应数字 self.cookie=cookielib.CookieJar() #cookie制作器 self.cookieHandler=urllib2.HTTPCookieProcessor(self.cookie) self.opener=urllib2.build_opener(self.cookieHandler) urllib2.install_opener(self.opener) self.Imagesuffix=random.random() self.ImageUrl='https://kyfw.12306.cn/otn/passcodeNew/getPassCodeNew?module=login&rand=sjrand&'+str(self.Imagesuffix) self.BookingImageurl='https://kyfw.12306.cn/otn/passcodeNew/getPassCodeNew?module=passenger&rand=randp&'+str(self.Imagesuffix) def LoginOut(self): request=urllib2.Request(self.loginout,headers=self.accessHeaders) try: response=urllib2.urlopen(request,timeout=2) print '退出登录成功' except: print "退出失败" def inputuserandpasswd(self): username=raw_input('请输入您的用户名:') password=raw_input('请输入您的密码:') userpassdict={'user':username,'passwd':password} return userpassdict def login(self): ##请用户输入用户名密码登录 userpass=self.inputuserandpasswd() while True: for i in range(3): getimagestatus=LoginRun.GetCodeImage(self.accessHeaders,self.ImageUrl) if getimagestatus=='GetImageSuccess': break else: pass img=Image.open('code.jpg') font=ImageFont.truetype('arial.ttf',size=30) draw = ImageDraw.Draw(img) draw.text((55, 55),"1",(255,0,0),font=font) draw.text((125, 55),"2",(255,0,0),font=font) draw.text((200, 55),"3",(255,0,0),font=font) draw.text((270, 55),"4",(255,0,0),font=font) draw.text((55, 120),"5",(255,0,0),font=font) draw.text((125, 120),"6",(255,0,0),font=font) draw.text((200, 120),"7",(255,0,0),font=font) draw.text((270, 120),"8",(255,0,0),font=font) img.show() img.close() codestr='' Input=raw_input('请输入验证码数字:') # print "验证码类型:1.八码 2.十八码" # sixoreitht=raw_input('您输入的验证码类型是:') # if sixoreitht=='1': # codedict=self.sixcodedict # else: # codedict=self.eighteencodedict # font=ImageFont.truetype('arial.ttf',size=20) # img=Image.open('code.jpg') # draw = ImageDraw.Draw(img) # draw.text((45, 44),"a",(255,0,0),font=font) # draw.text((95, 44),"b",(255,0,0),font=font) # draw.text((140, 44),"c",(255,0,0),font=font) # draw.text((185, 44),"d",(255,0,0),font=font) # draw.text((235, 44),"e",(255,0,0),font=font) # draw.text((280, 44),"f",(255,0,0),font=font) # draw.text((44, 95),"g",(255,0,0),font=font) # draw.text((95, 95),"h",(255,0,0),font=font) # draw.text((140, 95),"i",(255,0,0),font=font) # draw.text((185, 95),"j",(255,0,0),font=font) # draw.text((235, 95),"k",(255,0,0),font=font) # draw.text((280, 95),"l",(255,0,0),font=font) # draw.text((44, 140),"m",(255,0,0),font=font) # draw.text((95, 140),"n",(255,0,0),font=font) # draw.text((140, 140),"o",(255,0,0),font=font) # draw.text((185, 140),"p",(255,0,0),font=font) # draw.text((235, 140),"q",(255,0,0),font=font) # draw.text((280, 140),"r",(255,0,0),font=font) # img.show() # img.close() for i in Input: codestr=codestr + self.sixcodedict[i]+',' coderesult=codestr[:-1] data={"randCode":str(coderesult),"rand":'sjrand'} data=urllib.urlencode(data) codestrcookies=LoginRun.PostLoginInfo(self.checkRandCodeAnsyntheaders,data) if codestrcookies!='checkcodeFalse': print '验证码输入正确' else: print "不好意思,验证码错误,请重试" continue data={"loginUserDTO.user_name":userpass['user'],"userDTO.password":userpass['passwd'],"randCode":coderesult} postdata=urllib.urlencode(data) request=urllib2.Request(self.checkloginurl,headers=self.accessHeaders,data=postdata) try: checkresponse=urllib2.urlopen(request) except: checkresponse=urllib2.urlopen(request) logincheck=json.loads(checkresponse.read()) if logincheck["data"].has_key("loginCheck") and logincheck["data"]["loginCheck"]=='Y': print '用户名及密码正确' break else: print "不好意思,您用户名密码输入有误,请重新输入,如果输错次数超过4次,用户将被锁定" userpass=self.inputuserandpasswd() continue request2=urllib2.Request(self.loginurl,headers=self.accessHeaders) loginresponse=urllib2.urlopen(request2) html=loginresponse.read() # file=open('login.html','wb') # file.write(html) # file.close() soup=BeautifulSoup(html,'lxml') loginstatus=str(soup.p) if loginstatus[3:18]=='欢迎您登录': return 'LoginSuccess' def Query(self,FromST,ToST,Startdate): checkqueryurl=TrainQuery.CreatecheckqueryUrl(FromST,ToST,Startdate) queryurl=TrainQuery.CreateUrl(FromST,ToST,Startdate) chechqueryresult=TrainQuery.GetTrainNumDate(checkqueryurl) #print chechqueryresult for i in range(3): trainnum=TrainQuery.GetTrainNumDate(queryurl) if trainnum!='GetError': trainnuminfo=TrainQuery.GetNumDict(trainnum)#查询车次信息,返回整个车次信息所有内容 return trainnuminfo else: print "网络慢,请稍等。。。" else: print "无法获取到车次信息" def PrintNumInfo(self,traininfo): #打印出车次信息,返回车次预订检测data print "预订号"+"|"+" 车次号 "+"|"+" 出发站 "+"|"+" 到达站 "+"|"+"出发时间"+"|"+"到达时间"+"|"+"商务座"+"|"+"特等座"+"|"+"一等座"+"|"+"二等座"+"|"+"高级软卧"+"|"+"软卧"+"|"+"硬卧"+"|"+"软座"+"|"+"硬座"+"|"+"无座"+"|"+"预定状态" count=0 TrainInfodict={} for Num in traininfo: count+=1 NumInfo=Num["queryLeftNewDTO"] secretStr=(Num["secretStr"]) TraNum=(NumInfo["station_train_code"]) From=(NumInfo["from_station_name"]) To=(NumInfo["to_station_name"]) starttime=(NumInfo["start_time"]) arrivetime=(NumInfo["arrive_time"]) swz=(NumInfo["swz_num"]) tz=(NumInfo["tz_num"]) zy=(NumInfo["zy_num"]) ze=(NumInfo["ze_num"]) gr=(NumInfo["gr_num"]) rw=(NumInfo["rw_num"]) yw=(NumInfo["yw_num"]) rz=(NumInfo["rz_num"]) yz=(NumInfo["yz_num"]) wz=(NumInfo["wz_num"]) startdate=str(NumInfo['start_train_date']) traindate=startdate[0:4]+'-'+startdate[4:6]+'-'+startdate[6:8] dateformat='%Y-%m-%d' backdate=time.strftime(dateformat, time.localtime()) #postdict={"secretStr":str(secretStr),"train_date":str(traindate),"back_train_date":str(backdate),"tour_flag":"dc","purpose_codes":"ADULT","query_from_station_name":From,"query_to_station_name":To,"undefined":""} #postdata=json.dumps(postdict) TrainInfodict[count]=Num #print (str(count)).ljust(5),'|',TraNum.ljust(6),'|',From.center(6),'|',To.center(6),'|',starttime.center(6),'|',arrivetime.center(6),'|',swz.center(4),'|',tz.center(4),'|',zy.center(4),'|',ze.center(4),'|',gr.center(6),'|',rw.center(2) print '-------------------------------------------------------------------------------------------' print "%-6d|%-8s|%-6s|%-7s|%-8s|%-8s|%-6s|%-6s|%-6s|%-6s|%-8s|%-4s|%-4s|%-4s|%-4s|%-4s|%-8s" % (count,TraNum,From,To,starttime,arrivetime,swz,tz,zy,ze,gr,rw,yw,rz,yz,wz,Num["buttonTextInfo"]) return TrainInfodict def GetSubmitorderdata(self,Num): NumInfo=Num["queryLeftNewDTO"] secretStr=(Num["secretStr"]) From=(NumInfo["from_station_name"]) To=(NumInfo["to_station_name"]) startdate=str(NumInfo['start_train_date']) traindate=startdate[0:4]+'-'+startdate[4:6]+'-'+startdate[6:8] dateformat='%Y-%m-%d' backdate=time.strftime(dateformat, time.localtime()) #postdict={"secretStr":str(secretStr),"train_date":str(traindate),"back_train_date":str(backdate),"tour_flag":"dc","purpose_codes":"ADULT","query_from_station_name":From,"query_to_station_name":To,"undefined":""} postdata="secretStr"+'='+str(secretStr)+'&'+"train_date"+'='+str(traindate)+'&'+"back_train_date"+'='+str(backdate)+"&"+"tour_flag"+"="+"dc"+"&"+"purpose_codes"+"="+"ADULT"+"&"+"query_from_station_name"+"="+str(From)+"&"+"query_to_station_name"+"="+str(To)+"&"+"undefined" #postdata=json.dumps(postdict) return postdata def GetRequToken(self,checkresult): token= re.search(r'var globalRepeatSubmitToken = \'(.*?)\'\;',checkresult,re.DOTALL) return token.group(1) def GetSeatType(self,checkresult): seat_type=re.search(r'var init_seatTypes\=\[\{(.*?)\}\]\;',checkresult,re.DOTALL) #print checkresult try: SeatTypeStr=seat_type.group(1) except: print '获取坐席失败' self.LoginOut() SeatTypelist=SeatTypeStr.split('},{') SeatTypeDict={} count=0 for seat in SeatTypelist: count+=1 seatjsonstr='{'+seat+'}' JsonStr = seatjsonstr.replace("'","\"") jsonstr1=JsonStr.replace("null","\"null\"") jsonstr=json.loads(jsonstr1) SeatTypeDict[str(count)]=jsonstr['value'] for k,v in SeatTypeDict.items(): print k,'.',v return SeatTypeDict def BookingCheckCode(self,token): while True: for i in range(3): getimagestatus=LoginRun.GetCodeImage(self.getpassengerHeaders,self.BookingImageurl) if getimagestatus=='GetImageSuccess': break else: pass img=Image.open('code.jpg') img.show() img.close() print "验证码类型:1.八码 2.十八码" sixoreitht=raw_input('您输入的验证码类型是:') if sixoreitht=='1': codedict=self.sixcodedict img=Image.open('code.jpg') font=ImageFont.truetype('arial.ttf',size=30) draw = ImageDraw.Draw(img) draw.text((55, 55),"1",(255,0,0),font=font) draw.text((125, 55),"2",(255,0,0),font=font) draw.text((200, 55),"3",(255,0,0),font=font) draw.text((270, 55),"4",(255,0,0),font=font) draw.text((55, 120),"5",(255,0,0),font=font) draw.text((125, 120),"6",(255,0,0),font=font) draw.text((200, 120),"7",(255,0,0),font=font) draw.text((270, 120),"8",(255,0,0),font=font) img.show() img.close() else: codedict=self.eighteencodedict font=ImageFont.truetype('arial.ttf',size=20) img=Image.open('code.jpg') draw = ImageDraw.Draw(img) draw.text((45, 44),"a",(255,0,0),font=font) draw.text((95, 44),"b",(255,0,0),font=font) draw.text((140, 44),"c",(255,0,0),font=font) draw.text((185, 44),"d",(255,0,0),font=font) draw.text((235, 44),"e",(255,0,0),font=font) draw.text((280, 44),"f",(255,0,0),font=font) draw.text((44, 95),"g",(255,0,0),font=font) draw.text((95, 95),"h",(255,0,0),font=font) draw.text((140, 95),"i",(255,0,0),font=font) draw.text((185, 95),"j",(255,0,0),font=font) draw.text((235, 95),"k",(255,0,0),font=font) draw.text((280, 95),"l",(255,0,0),font=font) draw.text((44, 140),"m",(255,0,0),font=font) draw.text((95, 140),"n",(255,0,0),font=font) draw.text((140, 140),"o",(255,0,0),font=font) draw.text((185, 140),"p",(255,0,0),font=font) draw.text((235, 140),"q",(255,0,0),font=font) draw.text((280, 140),"r",(255,0,0),font=font) img.show() img.close() codestr='' Input=raw_input('请输入验证码:') for i in Input: codestr=codestr + codedict[i]+',' coderesult=codestr[:-1] data={"randCode":str(coderesult),"rand":'randp',"REPEAT_SUBMIT_TOKEN":str(token),"_json_att":""} data=urllib.urlencode(data) codestrcookies=LoginRun.PostLoginInfo(self.getpassengerHeaders,data) if codestrcookies!='checkcodeFalse': print '验证码输入正确' print '接下来为您出票,可能需要一段时间,请稍等。。。。。' return coderesult else: print "不好意思,验证码错误,请重试" continue def GetCheckOrderINfo(self,PassengerData,bookincodestr,seatstr,token): PassengerName=PassengerData['passenger_name'] PassengerIdCode=PassengerData['passenger_id_type_code'] PassengerIdNum=PassengerData['passenger_id_no'] if PassengerData.has_key('mobile_no')==False: PassengerMobile='' else: PassengerMobile=PassengerData['mobile_no'] passengerTicketStr=seatstr+','+'0,1,'+PassengerName+','+PassengerIdCode+','+PassengerIdNum+','+PassengerMobile+',N' oldPassengerStr=PassengerName+','+PassengerIdCode+','+PassengerIdNum+',1_' cancel_flag='2' bed_level_order_num='000000000000000000000000000000' tour_flag='dc' data={"cancel_flag":cancel_flag,"bed_level_order_num":bed_level_order_num,"passengerTicketStr":passengerTicketStr,"oldPassengerStr":oldPassengerStr,"tour_flag":tour_flag,"randCode":bookincodestr,"REPEAT_SUBMIT_TOKEN":token,"_json_att":""} usedata=json.dumps(data) postdata=urllib.urlencode(data) postdatalist=[] postdatalist.append(usedata) postdatalist.append(postdata) return postdatalist def GetCheckQueueCountInfo(self,startdate,checkresult,token,seatstr): Weekdict={'1':"Mon",'2':"Tue","3":"Wed","4":"Thu","5":"Fri","6":"Sat","7":"Sun"} Monthdict={"01":"Jan","02":"Feb","03":"Mar","04":"Apr","05":"May","06":"Jun","07":"Jul","08":"Aug","09":"Sep","10":"Oct","11":"Nov","12":"Dec"} year=startdate[0:4] month=startdate[4:6] day=startdate[6:8] anyday=datetime.datetime(int(year),int(month),int(day)).strftime("%w") weekday=Weekdict[str(anyday)] monthstr=Monthdict[month] train_date=weekday+" "+monthstr+" "+day+" "+year+" "+"00:00:00 GMT+0800 (中国标准时间)" orderRequestDTO = re.search(r'var orderRequestDTO\=(.*?)\;',checkresult,re.DOTALL) orderRequeststr=orderRequestDTO.group(1) orderRequeststr = orderRequeststr.replace("'","\"") orderRequeststrjson=orderRequeststr.replace("null","\"null\"") orderRequestDTOdict=json.loads(orderRequeststrjson) train_num=orderRequestDTOdict['train_no'] stationTrainCode=orderRequestDTOdict['station_train_code'] fromStationTelecode=orderRequestDTOdict['from_station_telecode'] tostationtelecode=orderRequestDTOdict['to_station_telecode'] InfoForPassenger= re.search(r'var ticketInfoForPassengerForm\=(.*?)\;',checkresult,re.DOTALL) InfoForPassengerstr=InfoForPassenger.group(1) InfoForPassengerstr = InfoForPassengerstr.replace("'","\"") InfoForPassengerjson=InfoForPassengerstr.replace("null","\"null\"") InfoForPassengerdict=json.loads(InfoForPassengerjson) leftTicket=InfoForPassengerdict['leftTicketStr'] purpose_codes=InfoForPassengerdict['purpose_codes'] data={"train_date":train_date,"train_no":train_num,"stationTrainCode":stationTrainCode,"seatType":seatstr,"fromStationTelecode":fromStationTelecode,"toStationTelecode":tostationtelecode,"leftTicket":leftTicket,"purpose_codes":purpose_codes,"REPEAT_SUBMIT_TOKEN":token,"_json_att":""} #postdata=json.dumps(data) postdata=urllib.urlencode(data) return postdata def GetconfirmSingleinfo(self,CheckOrderINfo,checkresult,token): InfoForPassenger= re.search(r'var ticketInfoForPassengerForm\=(.*?)\;',checkresult,re.DOTALL) InfoForPassengerstr=InfoForPassenger.group(1) InfoForPassengerstr = InfoForPassengerstr.replace("'","\"") InfoForPassengerjson=InfoForPassengerstr.replace("null","\"null\"") InfoForPassengerdict=json.loads(InfoForPassengerjson) leftTicketstr=InfoForPassengerdict['leftTicketStr'] key_check_isChange=InfoForPassengerdict['key_check_isChange'] train_location=InfoForPassengerdict['train_location'] purpose_codes=InfoForPassengerdict['purpose_codes'] CheckOrderINfodict=json.loads(CheckOrderINfo[0]) passengerTicketStr=CheckOrderINfodict['passengerTicketStr'] oldPassengerStr=CheckOrderINfodict['oldPassengerStr'] randCode=CheckOrderINfodict['randCode'] roomType='00' dwAll='N' data={"passengerTicketStr":passengerTicketStr,"oldPassengerStr":oldPassengerStr,"randCode":randCode,"key_check_isChange":key_check_isChange,"leftTicketStr":leftTicketstr,"train_location":train_location,"roomType":roomType,"purpose_codes":purpose_codes,"REPEAT_SUBMIT_TOKEN":token,"dwAll":dwAll,"_json_att":""} #postdata=json.dumps(data) postdata=urllib.urlencode(data) return postdata def PrintOrderResult(self,resp): PayOrderInfostr= re.search(r'var parOrderDTOJson \= (.*?)\}\'\;',resp,re.DOTALL) PayOrderstr=PayOrderInfostr.group(1) PayOrderstr=PayOrderstr+"}'" PayOrderstr = PayOrderstr.replace("'","\"") PayOrderjson=str(PayOrderstr.replace("null","\"null\"")) infojson=json.loads(PayOrderjson) PayOrderInfo=json.loads(infojson) Payorderlist=PayOrderInfo['orders'][0] getticketnum=Payorderlist['sequence_no'] #取票号 totalprice=Payorderlist['ticket_total_price_page'] #票价 fromstation=(Payorderlist['tickets'][0])['stationTrainDTO']['from_station_name'] #出发站 tostation=(Payorderlist['tickets'][0])['stationTrainDTO']['to_station_name'] #到达站 trainnum=(Payorderlist['tickets'][0])['stationTrainDTO']['station_train_code'] #车次号 passengername=(Payorderlist['tickets'][0])['passengerDTO']['passenger_name'] #乘客姓名 traincoachnum=(Payorderlist['tickets'][0])['coach_name'] #车厢号 seatnum=(Payorderlist['tickets'][0])['seat_name'] #座位号 Seattype=(Payorderlist['tickets'][0])['seat_type_name'] #席别类型 lostpaytime=(Payorderlist['tickets'][0])['lose_time'] #支付截止时间 print '您好,恭喜您已成功为%s预订%s至%s的%s次列车,您的坐席为%s,坐席位置在%s号车厢%s座位,票价为%s元' % (passengername,fromstation,tostation,trainnum,Seattype,traincoachnum,seatnum,totalprice) print '请您在%s之前完成支付,过期作废,完成支付后您的取票号为%s,请牢记!' % (lostpaytime,getticketnum) def ShopRun(self): print "欢迎您来到Paul哥的火车票服务中心,请问您需要什么服务?" print "1.火车票服务 2.跟老刘去大保健 3.跟油哥学洞玄子三十六散手" ServiceNum=input('请输入服务数字:') if ServiceNum==1: Loginstatus=self.login() if Loginstatus=='LoginSuccess': print '恭喜您登陆成功,请选择您需要的服务:' print "1.车票预订 2.车次查询 3.余票查询 4.退票 5.改签 6.东莞直通车" service=raw_input('请输入服务数字:') if service=='1': FromST=raw_input('请输入您的出发站:') ToST=raw_input('请输入您的到达站:') Startdate=raw_input('请输入您的出发日期(8位数字):') queryinfo=self.Query(FromST,ToST,Startdate) bookingdata=self.PrintNumInfo(queryinfo) bookingnum=int(raw_input('请选择您要预订的车次:')) checkdatastr=bookingdata[bookingnum] checkdata=self.GetSubmitorderdata(checkdatastr) for i in range(3): checkresult=SeatBooking.BookingCheck(checkdata) if checkresult!='BookingCheckError': break else: continue else: print '连续三次都获取失败,不是我程序问题,是网络问题哦!' token=self.GetRequToken(checkresult) for i in range(3): Passinfo=SeatBooking.GetPassengerjson(token) if Passinfo!='GetPassengerError': break else: continue else: print '连续三次都获取失败,不是我程序问题,是网络问题哦!' passinfodict=SeatBooking.ChoicePassenger(Passinfo) choicePassenger=raw_input('请选择乘客:') PassengerData=passinfodict[choicePassenger] #乘客的信息 SeatTypedict=self.GetSeatType(checkresult) choiceSeatType=raw_input('请选择席别:') SeatType=SeatTypedict[str(choiceSeatType)] SeatTypeStr=self.FullSeatTypeDict[str(SeatType)] #座位编码 bookincodestr=self.BookingCheckCode(token) #扣位验证码字符 CheckOrderINfo=self.GetCheckOrderINfo(PassengerData,bookincodestr,SeatTypeStr,token) getQueueCountInfo=self.GetCheckQueueCountInfo(Startdate,checkresult,token,SeatTypeStr) confirmSingleInfo=self.GetconfirmSingleinfo(CheckOrderINfo,checkresult,token) checkorderresult=SeatBooking.CheckOrderInfo(CheckOrderINfo[1]) #print checkorderresult getQueueCountresult=SeatBooking.GetQueueCount(getQueueCountInfo) #print getQueueCountresult confirmSingleresult=SeatBooking.confirmSingleForQueue(confirmSingleInfo) #print confirmSingleresult for i in range(10): queryorderid=SeatBooking.GetqueryOrderWaitTime(token) if queryorderid==None or queryorderid=='orderIdnull' or queryorderid=='GetOrderIdError': time.sleep(1) continue else: break else: print '十次都没获取到orderid,我也没办法了,下次吧,拜拜!' self.LoginOut() resultdata={"orderSequence_no":queryorderid,"REPEAT_SUBMIT_TOKEN":token,"_json_att":""} resultorderdata=urllib.urlencode(resultdata) GetResultOrderStatus=SeatBooking.ResultOrder(resultorderdata) #print GetResultOrderStatus Payorderdata={"REPEAT_SUBMIT_TOKEN":token,"_json_att":""} if GetResultOrderStatus=='OrderRusultOK': PayOrderInfo=SeatBooking.PayOrder(Payorderdata) if PayOrderInfo!='GetPayOrderFailure': self.PrintOrderResult(PayOrderInfo) self.LoginOut() if __name__=="__main__": Service=ShopTicket() Service.ShopRun()
#!/usr/bin/env python """ wrapper for JSLint using Spidermonkey engine TODO: * support for JSLint options """ import os from subprocess import Popen, PIPE try: from json import loads as json except ImportError: from simplejson import loads as json try: from pkg_resources import resource_filename except ImportError: from jslint.util import resource_filename DEPENDENCIES = [resource_filename("jslint", filename) for filename in ["fulljslint.js", "json2.js", "lintwrapper.js"]] # XXX: JSON support built in from Spidermonkey 1.8 def lint(filepath): """ check given file using JSLint (via Spidermonkey) """ options = {} # TODO: read from argument command = ["js"] for filename in DEPENDENCIES: command.extend(["-f", filename]) source = open(filepath) errors = Popen(command, stdin=source, stdout=PIPE).communicate()[0] # XXX: errors incomplete (e.g. not reporting missing var)!? source.close() return json(errors) def format(errors, filepath): """ convert JSLint errors object into report using standard error format <filepath>:<line>:<column>:<message> """ lines = (":".join([ filepath, str(error["line"] + 1), str(error["character"] + 1), error["reason"] ]) for error in errors if error) # XXX: ignoring members id, evidence, raw, a, b, c, d return "\n".join(lines)
from django.urls import path from . import views urlpatterns = [ path('', views.products_view, name="products"), path('create_product/', views.product_create_view, name='create_product'), path('create_categorie/', views.categorie_create_view, name='create_categorie'), ]
import time from selenium import webdriver validateText = "Haroon" driver = webdriver.Chrome(executable_path="C:\\Users\\Haroon\\Downloads\\chromedriver.exe") driver.get("https://rahulshettyacademy.com/AutomationPractice/") driver.maximize_window() checkboxes = driver.find_elements_by_xpath("//input[@type='checkbox']") print(len(checkboxes)) for checkbox in checkboxes: if checkbox.get_attribute("value") == "option2": checkbox.click() assert checkbox.is_selected() if checkbox.get_attribute("value") == "option1": checkbox.click() assert checkbox.is_selected() radiobuttons = driver.find_elements_by_name("radioButton") radiobuttons[1].click() assert radiobuttons[1].is_selected() time.sleep(3) driver.find_element_by_xpath("//input[@id='name']").send_keys(validateText) driver.find_element_by_id("alertbtn").click() alert = driver.switch_to.alert alertText = alert.text assert validateText in alertText # print(alert.text) alert.accept() time.sleep(2) driver.find_element_by_id("confirmbtn").click() alert = driver.switch_to.alert alertText = alert.text alert.dismiss() time.sleep(2) assert driver.find_element_by_id("displayed-text").is_displayed() driver.find_element_by_id("hide-textbox").click() time.sleep(2) print(driver.find_element_by_id("displayed-text").is_displayed()) # return False time.sleep(3) print(driver.find_element_by_id("show-textbox").is_selected()) # return False time.sleep(3) driver.close()
#!/usr/bin/env python # -*- coding: utf-8 -*- __author__ = 'Bob' import os,sys,platform if platform.system() == 'Windows': BASE_DIR = '\\'.join(os.path.abspath(os.path.dirname(__file__)).split('\\')[:-1]) else: BASE_DIR = '/'.join(os.path.realpath(__file__).split('/')[:-2]) sys.path.append(BASE_DIR) from core import HouseStark if __name__ == '__main__': HouseStark.ArgvHandle(sys.argv)
class UserModel(Tower): @model_property def inference(self): # Create some wrappers for simplicity def conv2d(x, W, b, s, name, padding='SAME'): # Conv2D wrapper, with bias and relu activation x = tf.nn.conv2d(x, W, strides=[1, s, s, 1], padding=padding, name=name + '_conv2d') x = tf.nn.bias_add(x, b, name=name + 'bias_add') return tf.nn.relu(x) def maxpool2d(x, k, s, name, padding='VALID'): # MaxPool2D wrapper return tf.nn.max_pool(x, ksize=[1, k, k, 1], strides=[1, s, s, 1], padding=padding, name=name + '_maxpool2d') # Create model def conv_net(x, weights, biases): # scale (divide by MNIST std) x = x * 0.0125 # Convolution Layer conv1 = conv2d(x, weights['wc1'], biases['bc1'], s=1, name='CONV1', padding='VALID') # Max Pooling (down-sampling) conv1 = maxpool2d(conv1, k=2, s=2, name='CONV1', padding='VALID') # Convolution Layer conv2 = conv2d(conv1, weights['wc2'], biases['bc2'], s=1, name='CONV2', padding='VALID') # Max Pooling (down-sampling) conv2 = maxpool2d(conv2, k=2, s=2, name='CONV2', padding='VALID') # Fully connected layer # Reshape conv2 output to fit fully connected layer input fc1 = tf.reshape(conv2, [-1, weights['wd1'].get_shape().as_list()[0]], name="FC1_reshape") fc1 = tf.add(tf.matmul(fc1, weights['wd1'], name='FC1_multi'), biases['bd1'], name='FC1_add') fc1 = tf.nn.relu(fc1, name='FC1_relu') # Apply Dropout if self.is_training: fc1 = tf.nn.dropout(fc1, 0.5, name='FC1_drop') # Output, class prediction out = tf.add(tf.matmul(fc1, weights['out'], name='OUT_multi'), biases['out'], name='OUT_add') true_out = tf.add(tf.matmul(out, weights['true_out'], name='OUT_multi'), biases['true_out'], name='TRUE_OUT_add') return true_out # Store layers weight & bias weights = { # 5x5 conv, 1 input, 20 outputs 'wc1': tf.get_variable('wc1', [5, 5, self.input_shape[2], 20], initializer=tf.contrib.layers.xavier_initializer()), # 5x5 conv, 20 inputs, 50 outputs 'wc2': tf.get_variable('wc2', [5, 5, 20, 50], initializer=tf.contrib.layers.xavier_initializer()), # fully connected, 4*4*16=800 inputs, 500 outputs 'wd1': tf.get_variable('wd1', [4*4*50, 500], initializer=tf.contrib.layers.xavier_initializer()), # 500 inputs, 10 outputs (class prediction) 'out': tf.get_variable('wout_not_in_use', [500, 10], initializer=tf.contrib.layers.xavier_initializer()), # adjust from 10 classes to 2 output 'true_out': tf.get_variable('twout', [10, 2], initializer=tf.contrib.layers.xavier_initializer()) } self.weights = weights # Leave the intial biases zero biases = { 'bc1': tf.get_variable('bc1', [20], initializer=tf.constant_initializer(0.0)), 'bc2': tf.get_variable('bc2', [50], initializer=tf.constant_initializer(0.0)), 'bd1': tf.get_variable('bd1', [500], initializer=tf.constant_initializer(0.0)), 'out': tf.get_variable('bout_not_in_use', [10], initializer=tf.constant_initializer(0.0)), 'true_out': tf.get_variable('tbout', [2], initializer=tf.constant_initializer(0.0)) } self.biases = biases model = conv_net(self.x, weights, biases) return model  @model_property def loss(self): loss = digits.classification_loss(self.inference, self.y) accuracy = digits.classification_accuracy(self.inference, self.y) self.summaries.append(tf.summary.scalar(accuracy.op.name, accuracy)) return loss
from dazer_methods import Dazer from collections import OrderedDict from numpy import empty, random, median, percentile, array, linspace, zeros, std from scipy import stats from uncertainties import ufloat from uncertainties.unumpy import nominal_values, std_devs from lib.CodeTools.sigfig import round_sig from lib.Math_Libraries.bces_script import bces, bcesboot from pandas import DataFrame from lmfit import Model, Parameters from scipy.optimize import curve_fit from kapteyn import kmpfit import statsmodels.formula.api as smf def linear_model(x, m, n): return m*x+n def residuals_lin(p, c): x, y = c m, n = p return (y - linear_model(x, m, n)) def linear_model2(x, mA, mB, n): return mA*x[0] + mB*x[1] + n def linear_model3(x, mA, mB, mC, n): return mA*x[0] + mB*x[1] + mC*x[2] + n def residuals_lin2(p, c): x, y = c mA, mB, n = p return (y - linear_model2(x, mA, mB, n)) def residuals_lin3(p, c): x, y = c mA, mB, mC, n = p return (y - linear_model3(x, mA, mB, mC, n)) return mA*x[0] + mB*x[1] + mC*x[2] + n def latex_float(f): float_str = "{0:.2g}".format(f) if "e" in float_str: base, exponent = float_str.split("e") return r"10^{{{}}}".format(int(exponent)) else: return float_str #Create class object dz = Dazer() script_code = dz.get_script_code() #Define plot frame and colors size_dict = {'figure.figsize':(18, 8), 'axes.labelsize':38, 'legend.fontsize':28, 'font.family':'Times New Roman', 'mathtext.default':'regular', 'xtick.labelsize':34, 'ytick.labelsize':34} dz.FigConf(plotSize = size_dict) #Load catalogue dataframe catalogue_dict = dz.import_catalogue() catalogue_df = dz.load_excel_DF('/home/vital/Dropbox/Astrophysics/Data/WHT_observations/WHT_Galaxies_properties.xlsx') dz.quick_indexing(catalogue_df) #Regressions properties MC_iterations = 10000 WMAP_coordinates = array([ufloat(0.0, 0.0), ufloat(0.24709, 0.00025)]) #Generate the indeces Regresions_dict = OrderedDict() Regresions_dict['Regressions'] = ['Oxygen object abundance', 'Nitrogen object abundance', 'Sulfur object abundance'] Regresions_dict['metal x axis'] = ['OI_HI_emis2nd', 'NI_HI_emis2nd', 'SI_HI_emis2nd'] Regresions_dict['helium y axis'] = ['Ymass_O_emis2nd', 'Ymass_O_emis2nd', 'Ymass_S_emis2nd'] Regresions_dict['element'] = ['O', 'N', 'S'] Regresions_dict['factor'] = [1e5, 1e6, 1e6] Regresions_dict['title'] = ['Helium mass fraction versus oxygen abundance', 'Helium mass fraction versus nitrogen abundance', 'Helium mass fraction versus sulfur abundance'] Regresions_dict['x label'] = [r'$\frac{{O}}{{H}}$ $({})$'.format(latex_float(Regresions_dict['factor'][0])), r'$\frac{{N}}{{H}}$ $({})$'.format(latex_float(Regresions_dict['factor'][1])), r'$\frac{{S}}{{H}}$ $({})$'.format(latex_float(Regresions_dict['factor'][2]))] Regresions_dict['y label'] = [r'$Y_{\frac{O}{H}}$', r'$Y_{\frac{O}{H}}$', r'$Y_{\frac{S}{H}}$'] Regresions_dict['Colors'] = [dz.colorVector['green'], dz.colorVector['dark blue'], dz.colorVector['orangish']] Regresions_list = [['O', 'N'], ['O', 'S'], ['N', 'S'], ['O', 'N', 'S']] #Additional regression label regr_dict = {'0': ['y|x'], '3': ['Orthogonal']} lmod = Model(linear_model) #Dict with regression methods method_dict = {'lm2': linear_model2, 'lm3': linear_model3, 'rlm2': residuals_lin2, 'rlm3': residuals_lin3} p0 = array([0.005, 0.25]) p0_c = array([0.005, 0.005, 0.25]) #Folder to save the plots output_folder = '/home/vital/Dropbox/Astrophysics/Papers/Yp_AlternativeMethods/images/' #Dictionary to store the the data from the table (we are going to use kapteyn) regr_dict = OrderedDict() regr_dict['$Y_{P,\,O}$'] = [0,0,0] regr_dict['$Y_{P,\,N}$'] = [0,0,0] regr_dict['$Y_{P,\,S}$'] = [0,0,0] regr_dict['$Y_{P,\,O-N}$'] = [0,0,0] regr_dict['$Y_{P,\,O-S}$'] = [0,0,0] regr_dict['$Y_{P,\,N-S}$'] = [0,0,0] regr_dict['$Y_{P,\,O-N-S}$'] = [0,0,0] regr_dict['$Y_{P,\,O-N-S}$'] = [0,0,0] exter_regr_dict = OrderedDict() exter_regr_dict['$Y_{P,\,O}^{1}$'] = [0.2446,0.0029,'5'] #Peimbert exter_regr_dict['$Y_{P,\,O}^{2}$'] = [0.2449,0.0040,'15'] #Aver exter_regr_dict['$Y_{P,\,O}^{3}$'] = [0.2551,0.0022,'28'] #Izotov exter_regr_dict['$Y_{P,\,Planck BBN}^{4}$'] = [0.24467,0.00020,'-'] arguments_coords = {'xycoords':'data', 'textcoords':'data', 'arrowprops':dict(arrowstyle='->'), 'horizontalalignment':'right', 'verticalalignment':'top'} #Perform linear regressions with plots for i in range(len(Regresions_dict['Regressions'])): #Get right regression values properties element = Regresions_dict['element'][i] regression = Regresions_dict['Regressions'][i] metal_x = Regresions_dict['metal x axis'][i] helium_y = Regresions_dict['helium y axis'][i] reject_idx = catalogue_df[element + '_valid'].isnull() reject_objs = catalogue_df[element + '_valid'][~reject_idx].index.values #Get objects which meet regression conditions idces_metal = (catalogue_df[metal_x].notnull()) & (catalogue_df[helium_y].notnull()) & (~catalogue_df.index.isin(reject_objs)) objects = catalogue_df.loc[idces_metal].index.values x = catalogue_df.loc[idces_metal, metal_x].values * Regresions_dict['factor'][i] y = catalogue_df.loc[idces_metal, helium_y].values quick_ref = catalogue_df.loc[idces_metal].quick_index print 'Doing element', element for idx in range(len(x)): print objects[idx], x[idx].nominal_value, x[idx].std_dev, y[idx].nominal_value, y[idx].std_dev #Get the data for the excees N/O objects NO_excess_idcs = ((catalogue_df[element + '_valid'] == 'NO_excess') | (catalogue_df[element + '_valid'] == 'ignored')) & (catalogue_df[metal_x].notnull()) & (catalogue_df[helium_y].notnull()) x_NO = catalogue_df.loc[NO_excess_idcs, metal_x].values * Regresions_dict['factor'][i] y_NO = catalogue_df.loc[NO_excess_idcs, helium_y].values quickref_NO = catalogue_df.loc[NO_excess_idcs].quick_index print '--Doing regression', Regresions_dict['element'][i] print '--- Using these objs {}:'.format(len(objects)), ', '.join(list(objects)) print '--- Estos no me gustan {}:'.format(len(reject_objs)), ', '.join(list(reject_objs)) #Create containers metal_matrix = empty((len(objects), MC_iterations)) Y_matrix = empty((len(objects), MC_iterations)) m_vector, n_vector = empty(MC_iterations), empty(MC_iterations) m_vectorlmfit = empty(MC_iterations) n_vectorlmfit = empty(MC_iterations) lmfit_matrix = empty([2, MC_iterations]) lmfit_error = empty([2, MC_iterations]) curvefit_matrix = empty([2, MC_iterations]) kapteyn_matrix = empty([2, MC_iterations]) #Generate the distributions for j in range(len(objects)): metal_matrix[j,:] = random.normal(x[j].nominal_value, x[j].std_dev, size = MC_iterations) Y_matrix[j,:] = random.normal(y[j].nominal_value, y[j].std_dev, size = MC_iterations) #Run the fits for k in range(MC_iterations): x_i = metal_matrix[:,k] y_i = Y_matrix[:,k] m, n, r_value, p_value, std_err = stats.linregress(x_i, y_i) m_vector[k], n_vector[k] = m, n #Lmfit result_lmfit = lmod.fit(y_i, x=x_i, m=0.005, n=0.24709) lmfit_matrix[:,k] = array(result_lmfit.params.valuesdict().values()) lmfit_error[:,k] = array([result_lmfit.params['m'].stderr, result_lmfit.params['n'].stderr]) #Curvefit best_vals, covar = curve_fit(linear_model, x_i, y_i, p0=p0) curvefit_matrix[:,k] = best_vals #kapteyn fitobj = kmpfit.Fitter(residuals=residuals_lin, data= (x_i, y_i)) fitobj.fit(params0 = p0) kapteyn_matrix[:,k] = fitobj.params #Get fit mean values n_Median, n_16th, n_84th = median(n_vector), percentile(n_vector,16), percentile(n_vector,84) m_Median, m_16th, m_84th = median(m_vector), percentile(m_vector,16), percentile(m_vector,84) m_Median_lm, m_16th_lm, m_84th_lm = median(lmfit_matrix[0,:]), percentile(lmfit_matrix[0,:],16), percentile(lmfit_matrix[0,:],84) n_Median_lm, n_16th_lm, n_84th_lm = median(lmfit_matrix[1,:]), percentile(lmfit_matrix[1,:],16), percentile(lmfit_matrix[1,:],84) m_Median_lm_error, n_Median_lm_error = median(lmfit_error[0,:]), median(lmfit_error[1,:]) m_Median_cf, m_16th_cf, m_84th_cf = median(curvefit_matrix[0,:]), percentile(curvefit_matrix[0,:],16), percentile(curvefit_matrix[0,:],84) n_Median_cf, n_16th_cf, n_84th_cf = median(curvefit_matrix[1,:]), percentile(curvefit_matrix[1,:],16), percentile(curvefit_matrix[1,:],84) m_Median_kp, m_16th_kp, m_84th_kp = median(kapteyn_matrix[0,:]), percentile(kapteyn_matrix[0,:],16), percentile(kapteyn_matrix[0,:],84) n_Median_kp, n_16th_kp, n_84th_kp = median(kapteyn_matrix[1,:]), percentile(kapteyn_matrix[1,:],16), percentile(kapteyn_matrix[1,:],84) #Bootstrap BCES m, n, m_err, n_err, cov = bcesboot(nominal_values(x), std_devs(x), nominal_values(y), std_devs(y), cerr=zeros(len(x)), nsim=10000) print 'BCES y dependent' print 'n',n[0], n_err[0] #print 'm',m[0], m_err[0] print 'BCES Orthogonal' print 'n',n[3], n_err[3] #print 'm',m[3], m_err[3] print 'Stats lingress' print 'n', n_Median, n_Median-n_16th, n_84th-n_Median #print 'm', m_Median, m_Median-m_16th, m_84th-m_Median print 'Lmfit' print 'n', n_Median_lm, n_Median_lm-n_16th_lm, n_84th_lm-n_Median_lm #print 'm', m_Median_lm, m_Median_lm-m_16th_lm, m_84th_lm-m_Median_lm print 'curvefit' print 'n', n_Median_cf, n_Median_cf-n_16th_cf, n_84th_cf-n_Median_cf #print 'm', m_Median_cf, m_Median_cf-m_16th_cf, m_84th_cf-m_Median_cf print 'kapteyn' print 'n', n_Median_kp, n_Median_kp-n_16th_kp, n_84th_kp-n_Median_kp, '\n' #print 'm', m_Median_kp, m_Median_kp-m_16th_kp, m_84th_kp-m_Median_kp #Saving the data entry_key = r'$Y_{{P,\,{elem}}}$'.format(elem=element) regr_dict[entry_key][0] = median(kapteyn_matrix[1,:]) regr_dict[entry_key][1] = std(kapteyn_matrix[1,:]) regr_dict[entry_key][2] = len(objects) #Linear data x_regression_range = linspace(0.0, max(nominal_values(x)) * 1.10, 20) y_regression_range = m_Median_cf * x_regression_range + n_Median_cf label_regr = 'Linear fit' #label_regr = 'SCIPY bootstrap: $Y_{{P}} = {n}_{{-{lowerlimit}}}^{{+{upperlimit}}}$'.format(title = Regresions_dict['title'][i], n = round_sig(n_Median,4, scien_notation=False), lowerlimit = round_sig(n_Median-n_16th,2, scien_notation=False), upperlimit = round_sig(n_84th-n_Median,2, scien_notation=False)) #Plotting the data, label_regression = r'Plank prediction: $Y = 0.24709\pm0.00025$' dz.data_plot(nominal_values(x), nominal_values(y), color = Regresions_dict['Colors'][i], label='HII galaxies included', markerstyle='o', x_error=std_devs(x), y_error=std_devs(y)) dz.data_plot(x_regression_range, y_regression_range, label = label_regr, color = Regresions_dict['Colors'][i], linestyle = '--') #dz.plot_text(nominal_values(x), nominal_values(y), quick_ref) #Plotting NO objects dz.data_plot(nominal_values(x_NO), nominal_values(y_NO), color = Regresions_dict['Colors'][i], label='HII galaxies excluded', markerstyle='x', x_error=std_devs(x_NO), y_error=std_devs(y_NO), e_style=':') #dz.plot_text(nominal_values(x_NO), nominal_values(y_NO), quickref_NO, y_pad=1.05) # for ii in range(len(y_NO)): # x_coord, y_coord = nominal_values(x_NO)[ii], nominal_values(y_NO)[ii] # dz.Axis.annotate(s=quickref_NO[ii],xy=(x_coord, y_coord), xytext=(x_coord, y_coord*1.20), **arguments_coords) if element != 'S': for ii in range(len(y_NO)): x_coord, y_coord = nominal_values(x_NO)[ii], nominal_values(y_NO)[ii] dz.Axis.text(x_coord, y_coord, quickref_NO[ii], {'ha': 'left', 'va': 'bottom'}, rotation=65, fontsize=18) else: counter = 0 coords_sulfur = [3, 3.5, 3.25] arrows_sulfur = [3.1, 3.60, 3.35] for ii in range(len(y_NO)): if quickref_NO[ii] in ['SHOC592','SHOC220', 'SHOC036']: x_coord, y_coord = nominal_values(x_NO)[ii], nominal_values(y_NO)[ii] dz.Axis.text(x_coord, y_coord, quickref_NO[ii], {'ha': 'left', 'va': 'bottom'}, rotation=65, fontsize=18) elif quickref_NO[ii] in ['SHOC588', 'SHOC575', 'SHOC579']: x_coord, y_coord = nominal_values(x_NO)[ii], nominal_values(y_NO)[ii] # dz.Axis.annotate(quickref_NO[ii], xy=(x_coord, y_coord), xycoords='data', # xytext=(coords_sulfur[counter], 0.35), textcoords='data', # arrowprops=dict(arrowstyle="->", lw=1.5), rotation=65, fontsize=18) dz.Axis.annotate('', xy=(x_coord, y_coord), xycoords='data', xytext=(arrows_sulfur[counter], 0.308), textcoords='data', arrowprops=dict(arrowstyle="->", lw=1.5), fontsize=18) dz.Axis.annotate(quickref_NO[ii], xy=(x_coord, y_coord), xycoords='data', xytext=(coords_sulfur[counter], 0.35), textcoords='data', rotation=65, fontsize=18) counter += 1 #Plot WMAP prediction dz.data_plot(WMAP_coordinates[0].nominal_value, WMAP_coordinates[1].nominal_value, color = dz.colorVector['pink'], label='Planck prediction', markerstyle='o', x_error=WMAP_coordinates[0].std_dev, y_error=WMAP_coordinates[1].std_dev) #plotTitle = r'{title}: $Y_{{P}} = {n}_{{-{lowerlimit}}}^{{+{upperlimit}}}$'.format(title = Regresions_dict['title'][i], n = round_sig(n_Median,4, scien_notation=False), lowerlimit = round_sig(n_Median-n_16th,2, scien_notation=False), upperlimit = round_sig(n_84th-n_Median,2, scien_notation=False)) dz.Axis.set_ylim(0.1,0.4) dz.FigWording(Regresions_dict['x label'][i], Regresions_dict['y label'][i], '', loc='lower center', ncols_leg=2) output_pickle = '{objFolder}{element}_regression_2nd'.format(objFolder=output_folder, element = element) dz.save_manager(output_pickle, save_pickle = False) # Combined regressions for i in range(len(Regresions_list)): regr_group = Regresions_list[i] dim_group = len(regr_group) ext_method = str(dim_group) p0 = array([0.005] * dim_group + [0.25]) # Define lmfit model params = Parameters() for idx in range(dim_group): params.add('m' + str(idx), value=0.005) params.add('n', value=0.25) # Loop through the elements valid objects idcs = (catalogue_df['Ymass_O_emis2nd'].notnull()) for element in regr_group: abunCode = '{}I_HI_emis2nd'.format(element) valCode = '{}_valid'.format(element) idcs = idcs & (catalogue_df[abunCode].notnull()) & (catalogue_df[valCode].isnull()) # Get data data_dict = OrderedDict() objects = catalogue_df.loc[idcs].index.values data_dict['Y'] = catalogue_df.loc[idcs, 'Ymass_O_emis2nd'].values for element in regr_group: abunCode = '{}I_HI_emis2nd'.format(element) data_dict[element] = catalogue_df.loc[idcs, abunCode].values # Generate containers for the data metal_matrix = empty((dim_group, len(objects), MC_iterations)) Y_matrix = empty((len(objects), MC_iterations)) lmfit_matrix = empty([dim_group + 1, MC_iterations]) lmfit_error = empty([dim_group + 1, MC_iterations]) curvefit_matrix = empty([dim_group + 1, MC_iterations]) kapteyn_matrix = empty([dim_group + 1, MC_iterations]) stats_matrix = empty([dim_group + 1, MC_iterations]) # Generate the distributions for j in range(len(objects)): Y_matrix[j, :] = random.normal(data_dict['Y'][j].nominal_value, data_dict['Y'][j].std_dev, size=MC_iterations) for i_dim in range(dim_group): element = regr_group[i_dim] metal_matrix[i_dim, j, :] = random.normal(data_dict[element][j].nominal_value, data_dict[element][j].std_dev, size=MC_iterations) # Run the curvefit and kapteyn fit formula_label = 'Y ~ ' + ' + '.join(regr_group) for k in range(MC_iterations): # Dictionary to store the current iteration x_ith = metal_matrix[:, :, k] y_ith = Y_matrix[:, k] # Curvefit best_vals, covar = curve_fit(method_dict['lm' + ext_method], x_ith, y_ith, p0=p0) curvefit_matrix[:, k] = best_vals # kapteyn fitobj = kmpfit.Fitter(residuals=method_dict['rlm' + ext_method], data=(x_ith, y_ith)) fitobj.fit(params0=p0) kapteyn_matrix[:, k] = fitobj.params # Get fit mean values idx_n = dim_group n_median_lmerror = median(lmfit_matrix[idx_n, :]) n_Median_cf, n_16th_cf, n_84th_cf = median(curvefit_matrix[idx_n, :]), percentile(curvefit_matrix[idx_n, :],16), percentile(curvefit_matrix[idx_n, :], 84) n_Median_kp, n_16th_kp, n_84th_kp = median(kapteyn_matrix[idx_n, :]), percentile(kapteyn_matrix[idx_n, :],16), percentile(kapteyn_matrix[idx_n, :], 84) #Saving the data if dim_group == 2: entry_key = r'$Y_{{P,\,{elemA}-{elemB}}}$'.format(elemA=regr_group[0], elemB=regr_group[1]) regr_dict[entry_key][0] = median(kapteyn_matrix[idx_n, :]) regr_dict[entry_key][1] = std(kapteyn_matrix[idx_n, :]) regr_dict[entry_key][2] = int(len(objects)) elif dim_group == 3: entry_key = r'$Y_{{P,\,{elemA}-{elemB}-{elemC}}}$'.format(elemA=regr_group[0], elemB=regr_group[1], elemC=regr_group[2]) regr_dict[entry_key][0] = median(kapteyn_matrix[idx_n, :]) regr_dict[entry_key][1] = std(kapteyn_matrix[idx_n, :]) regr_dict[entry_key][2] = int(len(objects)) # Display results print '\n---Regression', Regresions_list[i], 'using {} objects'.format(len(objects)) print 'curvefit' print n_Median_cf, n_84th_cf - n_Median_cf, n_Median_cf - n_16th_cf print 'kapteyn' print n_Median_kp, n_84th_kp - n_Median_kp, n_Median_kp - n_16th_kp #Make the table pdf_address = '/home/vital/Dropbox/Astrophysics/Papers/Yp_AlternativeMethods/tables/yp_determinations' headers = ['Elemental regression', 'Magnitude', 'Number of objects'] dz.pdf_insert_table(headers) # pdf_address = '/home/vital/Dropbox/Astrophysics/Papers/Yp_AlternativeMethods/tables/yp_determinations.pdf' # dz.create_pdfDoc(pdf_address, pdf_type='table') # # headers = ['Elemental regression', 'Magnitude', 'Number of objects'] # dz.pdf_insert_table(headers) last_key = regr_dict.keys()[-1] for key in regr_dict: magnitude_entry = r'${}\pm{}$'.format(round_sig(regr_dict[key][0],3,scien_notation=False),round_sig(regr_dict[key][1],1,scien_notation=False)) row = [key, magnitude_entry, str(int(regr_dict[key][2]))] dz.addTableRow(row, last_row = False if last_key != last_key else True) dz.table.add_hline() for key in exter_regr_dict: magnitude_entry = r'${}\pm{}$'.format(exter_regr_dict[key][0],exter_regr_dict[key][1]) row = [key, magnitude_entry, exter_regr_dict[key][2]] dz.addTableRow(row, last_row = False if last_key != last_key else True) dz.generate_pdf(output_address=pdf_address) # dz.generate_pdf()
#!/usr/bin/env python import pprint import sys import yaml def get_yaml(file_name=None): """Basic function that returns a Python data structure from a YAML file. Parameters: File name of YAML file """ if file_name is None: raise ValueError("No YAML file passed to function!") try: return yaml.load_all(open(file_name)) except IOError: print('Oops! Check the name of the YAML file passed as an argument.') print('The file passed during execution does not appear to exist.') sys.exit() def main(): """Main method to iterate over data structures imported from YAML files. Parameters: None """ if len(sys.argv) != 2: print('Oops! Might want to check your syntax!') print('You should run this example like this:') print('python {f} <NAME OF YAML FILE>'.format(f=__file__)) sys.exit() else: _YAML_FILE = sys.argv[1] docs = get_yaml(_YAML_FILE) for doc in docs: print('Here is the Python data type:') print(type(doc)) print('Here is the data:') pprint.pprint(doc) if __name__ == '__main__': main()
from unittest import mock import pytest from antareslauncher.data_repo.idata_repo import IDataRepo from antareslauncher.remote_environnement.remote_environment_with_slurm import ( RemoteEnvironmentWithSlurm, ) from antareslauncher.remote_environnement.slurm_script_features import ( SlurmScriptFeatures, ) from antareslauncher.use_cases.check_remote_queue.check_queue_controller import ( CheckQueueController, ) from antareslauncher.use_cases.check_remote_queue.slurm_queue_show import SlurmQueueShow from antareslauncher.use_cases.retrieve.state_updater import StateUpdater class TestIntegrationCheckQueueController: def setup_method(self): self.connection_mock = mock.Mock() self.connection_mock.username = "username" self.connection_mock.execute_command = mock.Mock(return_value=("", "")) slurm_script_features = SlurmScriptFeatures() env_mock = RemoteEnvironmentWithSlurm( _connection=self.connection_mock, slurm_script_features=slurm_script_features, ) display_mock = mock.Mock() slurm_queue_show = SlurmQueueShow(env_mock, display_mock) state_updater = StateUpdater(env_mock, display_mock) repo = mock.MagicMock(spec=IDataRepo) self.check_queue_controller = CheckQueueController( slurm_queue_show, state_updater, repo ) @pytest.mark.integration_test def test_check_queue_controller_check_queue_calls_connection_execute_command(self): # when self.check_queue_controller.check_queue() # then self.connection_mock.execute_command.assert_called_once()
from components import time from tests import base import unittest class TestTime(base.TestBase): def setUp(self): super().setUp() self.time = time.Time(self.cfg['TIME']) def test_config(self): self.assertEqual(self.cfg['TIME']['format'], '%a %d/%m %R') def test_time(self): from datetime import datetime from locale import setlocale, LC_TIME setlocale(LC_TIME, 'uk_UA') self.assertEqual(datetime.now().strftime('%a %d/%m %R'), self.time.text) if __name__ == '__main__': unittest.main()
# -*- coding: utf-8 -*- """ Created on Tue May 16 17:37:45 2017 @author: Anuj """ import numpy as np def gauss_seidel(phi, phi_bdry, source, epsit, max_iters, omega, coeff, coeff_p, resid): nx = phi.shape[1] ny = phi.shape[0] iter_count = 0 iter_update = 10 * epsit conv_err = epsit while iter_count < max_iters and iter_update > conv_err: iter_count += 1 phi_max = 0 dphi_max = 0 #resid_max = 0 phi_old = np.copy(phi) for i in range(1, nx-1): for j in range(1, ny-1): phi[j, i] = ((omega * (source[j, i] + coeff*phi[j, i-1] + coeff*phi[j-1, i] + coeff*phi[j+1, i] + coeff*phi[j, i+1])/coeff_p) + (1-omega)*phi[j, i]) phi_max = max(phi_max, abs(phi[j,i])) dphi = abs(phi[j, i] - phi_old[j, i]) dphi_max = max(dphi_max, dphi) phi[phi < phi_bdry] = phi_bdry # for i in range(1, nx-1): # for j in range(1, ny-1): # resid[j, i] = (source[j, i] + coeff*phi[j, i-1] # + coeff*phi[j-1, i] + coeff*phi[j+1, i] # + coeff*phi[j, i+1] - coeff_p*phi[j, i]) resid[1:ny-1, 1:nx-1] = (source[1:ny-1, 1:nx-1] + coeff*phi[1:ny-1, 0:nx-2] + coeff*phi[0:ny-2, 1:nx-1] + coeff*phi[2:ny, 1:nx-1] + coeff*phi[1:ny-1, 2:nx] - coeff_p*phi[1:ny-1, 1:nx-1]) iter_update = dphi_max conv_err = epsit * phi_max return phi, phi_old, iter_count, iter_update, resid, dphi_max, conv_err
import math import logging import numpy as np from statsmodels.tsa.seasonal import seasonal_decompose def generate_linear_series_from_model(time_series_len, model): res = list() predict = np.poly1d(model) for i in range(time_series_len): res.append(predict(i)) return res def generate_arma_series_from_model(time_series_len, list): train_size = int(time_series_len*0.6) res = list() prediction = model.predict(train_size, time_series_len) logging.debug(prediction) return [round(val) for val in prediction] def generate_trend_from_decompose(series, period = 7): formatted_series = [d['count'] for d in series] data = seasonal_decompose(formatted_series, model='additive', period=period) return data.trend
#!/usr/bin/env python # -*- coding: utf-8 -*- import json from alipay.aop.api.constant.ParamConstants import * class AlipayMerchantWeikeBilltaxModifyModel(object): def __init__(self): self._actual_tax = None self._alipay_trans_serial_no = None self._bill_month = None self._bill_no = None self._bill_version = None self._expect_tax = None self._gmt_modified = None self._out_biz_no = None self._tax_rebate = None self._tax_rebate_gmt_pay = None self._tax_rebate_serial_no = None self._weike_user_id = None @property def actual_tax(self): return self._actual_tax @actual_tax.setter def actual_tax(self, value): self._actual_tax = value @property def alipay_trans_serial_no(self): return self._alipay_trans_serial_no @alipay_trans_serial_no.setter def alipay_trans_serial_no(self, value): self._alipay_trans_serial_no = value @property def bill_month(self): return self._bill_month @bill_month.setter def bill_month(self, value): self._bill_month = value @property def bill_no(self): return self._bill_no @bill_no.setter def bill_no(self, value): self._bill_no = value @property def bill_version(self): return self._bill_version @bill_version.setter def bill_version(self, value): self._bill_version = value @property def expect_tax(self): return self._expect_tax @expect_tax.setter def expect_tax(self, value): self._expect_tax = value @property def gmt_modified(self): return self._gmt_modified @gmt_modified.setter def gmt_modified(self, value): self._gmt_modified = value @property def out_biz_no(self): return self._out_biz_no @out_biz_no.setter def out_biz_no(self, value): self._out_biz_no = value @property def tax_rebate(self): return self._tax_rebate @tax_rebate.setter def tax_rebate(self, value): self._tax_rebate = value @property def tax_rebate_gmt_pay(self): return self._tax_rebate_gmt_pay @tax_rebate_gmt_pay.setter def tax_rebate_gmt_pay(self, value): self._tax_rebate_gmt_pay = value @property def tax_rebate_serial_no(self): return self._tax_rebate_serial_no @tax_rebate_serial_no.setter def tax_rebate_serial_no(self, value): self._tax_rebate_serial_no = value @property def weike_user_id(self): return self._weike_user_id @weike_user_id.setter def weike_user_id(self, value): self._weike_user_id = value def to_alipay_dict(self): params = dict() if self.actual_tax: if hasattr(self.actual_tax, 'to_alipay_dict'): params['actual_tax'] = self.actual_tax.to_alipay_dict() else: params['actual_tax'] = self.actual_tax if self.alipay_trans_serial_no: if hasattr(self.alipay_trans_serial_no, 'to_alipay_dict'): params['alipay_trans_serial_no'] = self.alipay_trans_serial_no.to_alipay_dict() else: params['alipay_trans_serial_no'] = self.alipay_trans_serial_no if self.bill_month: if hasattr(self.bill_month, 'to_alipay_dict'): params['bill_month'] = self.bill_month.to_alipay_dict() else: params['bill_month'] = self.bill_month if self.bill_no: if hasattr(self.bill_no, 'to_alipay_dict'): params['bill_no'] = self.bill_no.to_alipay_dict() else: params['bill_no'] = self.bill_no if self.bill_version: if hasattr(self.bill_version, 'to_alipay_dict'): params['bill_version'] = self.bill_version.to_alipay_dict() else: params['bill_version'] = self.bill_version if self.expect_tax: if hasattr(self.expect_tax, 'to_alipay_dict'): params['expect_tax'] = self.expect_tax.to_alipay_dict() else: params['expect_tax'] = self.expect_tax if self.gmt_modified: if hasattr(self.gmt_modified, 'to_alipay_dict'): params['gmt_modified'] = self.gmt_modified.to_alipay_dict() else: params['gmt_modified'] = self.gmt_modified if self.out_biz_no: if hasattr(self.out_biz_no, 'to_alipay_dict'): params['out_biz_no'] = self.out_biz_no.to_alipay_dict() else: params['out_biz_no'] = self.out_biz_no if self.tax_rebate: if hasattr(self.tax_rebate, 'to_alipay_dict'): params['tax_rebate'] = self.tax_rebate.to_alipay_dict() else: params['tax_rebate'] = self.tax_rebate if self.tax_rebate_gmt_pay: if hasattr(self.tax_rebate_gmt_pay, 'to_alipay_dict'): params['tax_rebate_gmt_pay'] = self.tax_rebate_gmt_pay.to_alipay_dict() else: params['tax_rebate_gmt_pay'] = self.tax_rebate_gmt_pay if self.tax_rebate_serial_no: if hasattr(self.tax_rebate_serial_no, 'to_alipay_dict'): params['tax_rebate_serial_no'] = self.tax_rebate_serial_no.to_alipay_dict() else: params['tax_rebate_serial_no'] = self.tax_rebate_serial_no if self.weike_user_id: if hasattr(self.weike_user_id, 'to_alipay_dict'): params['weike_user_id'] = self.weike_user_id.to_alipay_dict() else: params['weike_user_id'] = self.weike_user_id return params @staticmethod def from_alipay_dict(d): if not d: return None o = AlipayMerchantWeikeBilltaxModifyModel() if 'actual_tax' in d: o.actual_tax = d['actual_tax'] if 'alipay_trans_serial_no' in d: o.alipay_trans_serial_no = d['alipay_trans_serial_no'] if 'bill_month' in d: o.bill_month = d['bill_month'] if 'bill_no' in d: o.bill_no = d['bill_no'] if 'bill_version' in d: o.bill_version = d['bill_version'] if 'expect_tax' in d: o.expect_tax = d['expect_tax'] if 'gmt_modified' in d: o.gmt_modified = d['gmt_modified'] if 'out_biz_no' in d: o.out_biz_no = d['out_biz_no'] if 'tax_rebate' in d: o.tax_rebate = d['tax_rebate'] if 'tax_rebate_gmt_pay' in d: o.tax_rebate_gmt_pay = d['tax_rebate_gmt_pay'] if 'tax_rebate_serial_no' in d: o.tax_rebate_serial_no = d['tax_rebate_serial_no'] if 'weike_user_id' in d: o.weike_user_id = d['weike_user_id'] return o
import time import json import random import requests tournament_dict = { "identifier": "4nidzmunvpvxk1ir9b6m8mpay", "tournamentName": "Ukrainian Football League", "location": "Ukraine", "stadium": "Dynamo", "league": "Ukrainian Football", "startDate": "2016-07-11 19:00:00 GMT-0000", "sportName": "football", "providerName": "perform" } def update_tournament(): """Update fields in tournament dictionary. :return:dict """ tournament_dict['identifier'] = 'r56f0430409b488e99880c4e1fd22cd5' tournament_dict['startDate'] = time.strftime("%Y-%m-%d %H:%M:%S GMT-0000") return tournament_dict def load_events(): """Load json file with events and update events field. :return:dict """ tournament = update_tournament() # event_id = int(time.time() * 1000) event_id = 1502303120430 with open('./event_details.json') as events_file: data = json.load(events_file) data['id'] = event_id data['matchId'] = event_id data['rbid'] = event_id data['homeTeam'] = 'Dnipro' data['homeTeamAbbr'] = 'DNP' data['awayTeam'] = 'Shachtar' data['awayTeamAbbr'] = 'SHC' data['name'] = data['homeTeam'] + ' vs ' + data['awayTeam'] data['tournamentID'] = tournament['identifier'] data['leagueUuid'] = tournament['identifier'] data['stadium'] = tournament['stadium'] data['league'] = tournament['league'] data['country'] = 'Ukraine' data['uuid'] = '4poiu4cdfh0v0679mndd9vyb6' data['date'] = time.strftime("%Y-%m-%d %H:%M:%S") data['startTime'] = time.strftime("%Y-%m-%d %H:%M:%S") data['startDate'] = time.strftime("%a %b %d %Y %H:%M:%S GMT+0000 (UTC)") return data def load_incidents(): """Load json file with incidents and update incident fields. :return:dict """ events = load_events() with open('./incident_events.json') as incident_file: data_incident = json.load(incident_file) for incident in data_incident['incidents']: incident['eventId'] = events['id'] for field in incident['payload']: incident['payload']['eventId'] = events['id'] incident['payload']['ID'] = events['id'] incident['payload']['UUID'] = events['uuid'] return data_incident['incidents'] data_tournament = update_tournament() data_events = load_events() body_tournament = json.dumps(data_tournament, indent=2) body_events = json.dumps(data_events, indent=2) vis_rtc_url = 'https://vis-tst2-coral.symphony-solutions.eu' sport = 'football' provider = 'perform' content_type_headers = {"Content-Type": "application/json"} post_tournament = requests.post(url=vis_rtc_url + '/storeTournament/%s/%s' % (sport, provider), headers=content_type_headers, data=body_tournament, verify=False) post_events = requests.post(url=vis_rtc_url + '/matchDetails/%s/%s' % (sport, provider), headers=content_type_headers, data=body_events, verify=False) openBetID = random.randint(1, 9999999) data_mapping = { "openbetId": openBetID, "id": data_events['id'], "type": 'auto' } body_mapping = json.dumps(data_mapping) post_mapping = requests.post(url=vis_rtc_url + '/addMapping/%s/%s' % (sport, provider), headers=content_type_headers, data=body_mapping, verify=False) data_incident = load_incidents() # for incident in data_incident['incidents']: for incident in data_incident[:]: body_incident = json.dumps(incident['payload'], indent=2) # print body_incident post_incident = requests.post(url=vis_rtc_url + '/storeIncident/%s/%s' % (sport, provider), headers=content_type_headers, data=body_incident, verify=False) print '*** Post incidents details: Response code is %s, content %s' % (post_incident.status_code, post_incident.content) print '*** Post tournament details: Response code is %s, content %s' % (post_tournament.status_code, post_tournament.content) print '*** Post event details: Response code is %s, content %s' % (post_events.status_code, post_events.content) print '*** Post mapping details: Response code is %s, content %s' % (post_mapping.status_code, post_mapping.content)
# Generated by Django 2.0 on 2018-12-03 15:15 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ ('home', '0005_remove_expenses_test'), ] operations = [ migrations.AlterField( model_name='splittransactions', name='spentby', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='split_spentby', to=settings.AUTH_USER_MODEL), ), migrations.AlterField( model_name='splittransactions', name='spentfor', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='split_spentfor', to=settings.AUTH_USER_MODEL), ), ]
#!/usr/bin/env python #-*-coding:utf-8-*- US=[4,1,5,3,6,9,2,8] def heap_sort(lst): for start in range((len(lst)-2)/2,-1,-1): sift_down(lst,start,len(lst)-1) print lst for end in range(len(lst)-1,0,-1): lst[0],lst[end] = lst[end],lst[0] sift_down(lst,0,end-1) print lst def sift_down(lst,start,end): root = start while True: child = 2*root + 1 if child > end:break if child+1 <= end and lst[child] < lst[child+1]: child += 1 if lst[root] < lst[child]: lst[root],lst[child] = lst[child],lst[root] root = child else: break if __name__ == "__main__": heap_sort(US)
#!usr/bin/env python3.6 """Write a file of trees without extremely low branch lengths. The idea is that these are the trees that orthofinder estimated incorrectly. """ import re import sys import my_module as mod def get_args(): """Get user arguments.""" if len(sys.argv) == 4: return sys.argv[1:] else: print("\nUSAGE python exclude_shite_trees.py treedir nodes_file outfile\n") def extract_branch_lengths(tree): """Get all the branch lengths on a tree. Returns only a list of the lengths - not ordered or anything fancy.""" lengths = re.findall(r':[0-9\.e\-]+', tree) float_lengths = [] for length in lengths: float_lengths.append(float(length[1:])) return float_lengths def main(): """Do the above.""" treedir, node_file, outfile = get_args() nodelines = mod.get_file_data(node_file) i = 0 while i < 578: flag = 1 if "full_" + str(i) + ".rooted" in nodelines: try: tree_string = mod.get_file_data(treedir + "/full_" + str(i) + ".rooted")[0] except: i += 1 continue branch_lengths = extract_branch_lengths(tree_string) for bl in branch_lengths: if bl < 0.01: flag = 0 break if flag == 1: out = open(outfile, "a") out.write("full_" + str(i) + ".rooted" + "\n") out.close() i += 1 if __name__ == "__main__": main()
#!/usr/bin/env python3 # -*- coding: utf-8 -*- from neodroid.environments.droid_environment import SingleUnityEnvironment from neodroid.utilities.exceptions.exceptions import SensorNotAvailableException from neodroid.utilities.snapshot_extraction.camera_extraction import ( extract_camera_observation, extract_from_cameras, ) __author__ = "Christian Heider Nielsen" class CameraObservationWrapper(SingleUnityEnvironment): def __init__(self, auto_reset=True, **kwargs): super().__init__(**kwargs) self._auto_reset = auto_reset self.reset() def __next__(self): if not self._is_connected_to_server: return return self.fetch_new_frame(None) def sensor(self, key: str): if self._last_snapshots: state_env_0 = list(self._last_snapshots.values())[0] return extract_camera_observation(state_env_0, key) raise SensorNotAvailableException def update(self): return super().react() def fetch_new_frame(self, *args, **kwargs): message = super().react(*args, **kwargs) if message.terminated and self._auto_reset: super().reset() message = self.fetch_new_frame() if message: return extract_from_cameras(message) return None
#!/usr/bin/env python import numpy as np from scipy.linalg import expm from lab3_header import * """ Use 'expm' for matrix exponential. Angles are in radian, distance are in meters. """ def Get_MS(): # =================== Your code starts here ====================# # Fill in the correct values for S1~6, as well as the M matrix M = np.eye(4) S = np.zeros((6,6)) w = np.zeros((6, 3)) q = np.zeros((6, 3)) w[0] = [0, 0, 1] w[1] = [0, 1, 0] w[2] = [0, 1, 0] w[3] = [0, 1, 0] w[4] = [1, 0, 0] w[5] = [0, 1, 0] offset = [-.150, .150, 0.01] q[0] = [0, 0, 0] q[1] = [0, .120, .152] q[2] = [.244, .120, .152] q[3] = [.244 + .213, .120-.093, .152] q[4] = [.244 + .213, .120 - .093 + .083, .152] q[5] = [.540, .120 - .093 + .083, .152] for i in range(len(q)): q[i] += offset for i in range(len(S)): S[i] = np.concatenate([w[i], np.cross(-w[i], q[i])]) # print(S) M[0] = [0, -1, 0, .540 - .15] M[1] = [0, 0, -1, .120 - .093 + .083 + .082 + .059 + 0.15] M[2] = [1, 0, 0, .152 + .0535 + 0.01] M[3] = [0, 0, 0, 1] # print(M) # ==============================================================# return M, S """ Function that calculates encoder numbers for each motor """ def lab_fk(theta1, theta2, theta3, theta4, theta5, theta6): def skew_sym(screw): m = np.zeros((4,4)) [w1, w2, w3, v1, v2, v3] = [element for element in screw] m[0] = [0, -w3, w2, v1] m[1] = [w3, 0, -w1, v2] m[2] = [-w2, w1, 0, v3] m[3] = [0, 0, 0, 0] return m # Initialize the return_value return_value = [None, None, None, None, None, None] # =========== Implement joint angle to encoder expressions here =========== print("Foward kinematics calculated:\n") # =================== Your code starts here ====================# theta = np.array([theta1,theta2,theta3,theta4,theta5,theta6]) T = np.eye(4) M, S = Get_MS() for i in range(len(S)): T = np.dot(T, expm(skew_sym(S[i])*theta[i])) T = np.dot(T, M) # ==============================================================# print(str(T) + "\n") return_value[0] = theta1 + PI return_value[1] = theta2 return_value[2] = theta3 return_value[3] = theta4 - (0.5*PI) return_value[4] = theta5 return_value[5] = theta6 return return_value Get_MS()
import pandas as pd import matplotlib.pyplot as plt import seaborn as sns import streamlit as st # @st.cache class plot: # @st.cache(suppress_st_warning=False) def Count_Record(self,data): sns.set(font_scale=1.5) st.header("Overview of dataset.") st.write(data.head(10)) fig, ax = plt.subplots(figsize=(15,10)) region_count = sns.countplot(data=data, x="region") region_count.set_xticklabels(region_count.get_xticklabels(), rotation=20) st.pyplot(fig) # @st.cache(suppress_st_warning=False) def General_Overview(self,data): sns.set(font_scale=1.0) fig, ax = plt.subplots(5, 1, figsize=(30, 40), ) col = ['fertility', 'life', 'population', 'child_mortality', 'gdp'] for index, col1 in enumerate(col): print(index, col1) mean1 = data.groupby("Year")[col1].mean() mean_plt = sns.barplot(x=mean1.index, y=mean1.values, ax=ax[int(index)]) mean_plt.set(xlabel="Year") mean_plt.set_ylabel(col1, fontsize=50) mean_plt.set_yticklabels(mean_plt.get_ylabel(),size = 10) plt.setp(mean_plt.get_xticklabels(), rotation=45) fig.tight_layout(pad=2.0) print("") st.pyplot(fig) # @st.cache(suppress_st_warning=False) def Region_vs_All(self,data,Name=None): sns.set(font_scale=1) if Name==None: fig, ax = plt.subplots(5, 1, figsize=(25, 35)) col = ['fertility', 'life', 'population', 'child_mortality', 'gdp'] for index, col1 in enumerate(col): print(index, col1) mean1 = data.groupby("region")[col1].mean() mean_plt = sns.barplot(x=mean1.index, y=mean1.values, ax=ax[int(index)]) mean_plt.set_ylabel(col1, fontsize=50) plt.setp(mean_plt.get_xticklabels(), rotation=10) fig.tight_layout(pad=2.0) st.pyplot(fig) else: sub_data = data.loc[data.region == Name] fig, ax = plt.subplots(5, 1, figsize=(30, 40)) col = ['fertility', 'life', 'population', 'child_mortality', 'gdp'] for index, col1 in enumerate(col): print(index, col1) mean1 = sub_data.groupby("Year")[col1].mean() mean_plt = sns.barplot(x=mean1.index, y=mean1.values, ax=ax[int(index)]) mean_plt.set_ylabel(col1, fontsize=50) plt.setp(mean_plt.get_xticklabels(), rotation=45) fig.tight_layout(pad=2.0) st.pyplot(fig) def Region_vs_Box(self,data): print("Provide some indication of the data's symmetry and skewness." + "Unlike many other methods of data display.\nBoxplots show outliers") col = ['fertility', 'life', 'population', 'child_mortality', 'gdp'] fig, ax = plt.subplots(5, 1, figsize=(15, 25)) for index, col1 in enumerate(col): sns.boxplot(data=data, x="region", y=col1, orient="v", ax=ax[index]) # @st.cache(suppress_st_warning=False) def County_wise_Analysis(self,data, Name): # sns.set(font=30) sns.set(font_scale=3) sub_data = data.loc[data.Country == Name] if sub_data.shape[0] == 0: return st.write("Please check the spelling of country..") fig, ax = plt.subplots(3, 2, figsize=(30, 35)) sns.lineplot(data=sub_data, x="Year", y="fertility", ax=ax[0][0]) sns.lineplot(data=sub_data, x="Year", y="life", ax=ax[0][1]) sns.lineplot(data=sub_data, x="Year", y="population", ax=ax[1][0]) sns.lineplot(data=sub_data, x="Year", y="child_mortality", ax=ax[1][1]) sns.lineplot(data=sub_data, x="Year", y="gdp", ax=ax[2][0]) print("In Country...") st.pyplot(fig) # sns.set(font_scale=None) # @st.cache(suppress_st_warning=False) class main_class: def main(self,data,input1=None,input2=None): try: obj=plot() if input1=="Select": return obj.Count_Record(data) if input1=="General Overview": return obj.General_Overview(data) elif input1 == "region wise": return obj.Region_vs_All(data,input2) elif input1 == "Based On Country": return obj.County_wise_Analysis(data,input2) except Exception as e: st.write("Exception",e)
import matplotlib.pyplot as plt from math import sqrt from typing import Tuple, List import numpy def load_data() -> Tuple[List[int], List[int], List[float]]: """Carrega o arquivo data2.txt e prepara os dados para serem utilizados. Returns: Dados definindo o tamanho da casa o número de quartos e o preço da casa. """ file_path = 'files/data2.txt' house_length: List[int] = [] rooms_number: List[int] = [] houses_price: List[float] = [] with open(file_path) as file: lines = file.readlines() for line in lines: h_l, r_n, h_p = line.split(',') house_length.append(int(h_l)) rooms_number.append(int(r_n)) houses_price.append(float(h_p)) return house_length, rooms_number, houses_price def standard_deviation(samples: List[int], mean: float) -> float: """Calcula o desvio padrão de uma amostra. Args: samples: Amostra. mean: Média. Returns: Desvio padrão. """ sample_length: float = len(samples) summation: float = 0 for sample in samples: summation += pow(sample - mean, 2) return sqrt(summation/sample_length) def sub_task_2_1(house_length: List[int], rooms_number: List[int]) -> Tuple[List[float], List[float]]: """Realiza a normalização dos valores da feature. Args: house_length: Tamanho da casa. rooms_number: Número de quartos. Returns: Features normalizadas. """ h_l_mean: float = 0 r_n_mean: float = 0 features_length = len(house_length) # iterando para descobrimos os valores médios for i in range(features_length): h_l_mean += house_length[i] r_n_mean += rooms_number[i] # calculando as médias h_l_mean = h_l_mean / features_length r_n_mean = r_n_mean / features_length # cálculo do desvio padrão h_l_standard_d = standard_deviation(house_length, h_l_mean) r_n_standard_d = standard_deviation(rooms_number, r_n_mean) # ajuste das amostras house_length = [round((element - h_l_mean)/h_l_standard_d, 2) for element in house_length] rooms_number = [round((element - r_n_mean)/r_n_standard_d, 2) for element in rooms_number] return house_length, rooms_number def h_theta(theta_0: float, theta_1: float, theta_2: float, feat_x_0: float, feat_x_1: float) -> float: """H de theta dado um valor x irá gerar um valor y estimado. Equação do plano C + Bx_1 + Cx_2. Args: theta_0: C da equação. theta_1: B da equação. theta_2: A da equação. feat_x_0: Valor da primeira feat. feat_x_1: Valor da segunda feat. Returns: Y gerado pelo plano. """ return theta_0 + (theta_1 * feat_x_0) + (theta_2 * feat_x_1) def cost_function(theta_0: float, theta_1: float, theta_2: float, x_0_sample: List[float], x_1_sample: List[float], y_sample: List[int], sample_size: int) -> float: """Função custo J. Args: theta_0: Theta 0. theta_1: Theta 1. theta_2: Theta 2. x_0_sample: X_0 da amostra. x_1_sample: X_1 da amostra. y_sample: Y da amostra. sample_size: Tamanho da amostra. Returns: Valor da função custo. """ summation: float = 0 for i in range(sample_size): summation += pow(h_theta(theta_0, theta_1, theta_2, x_0_sample[i], x_1_sample[i]) - y_sample[i], 2) return summation / (2 * sample_size) def derivate_cost_function_theta_0(theta_0: float, theta_1: float, theta_2: float, x_0_sample: List[float], x_1_sample: List[float], y_sample: List[float], sample_size: int) -> float: """Derivada da função custo em relação a theta_0. Args: theta_0: Theta 0. theta_1: Theta 1. theta_2: Theta 2. x_0_sample: X_0 da amostra. x_1_sample: X_1 da amostra. y_sample: Y da amostra. sample_size: Tamanho da amostra. Returns: Valor da derivada da função custo em relação a theta 0. """ summation: float = 0 for i in range(sample_size): summation += (h_theta(theta_0, theta_1, theta_2, x_0_sample[i], x_1_sample[i]) - y_sample[i]) return summation / sample_size def derivate_cost_function_theta_1(theta_0: float, theta_1: float, theta_2: float, x_0_sample: List[float], x_1_sample: List[float], y_sample: List[float], sample_size: int) -> float: """Derivada da função custo em relação a theta_1. Args: theta_0: Theta 0. theta_1: Theta 1. theta_2: Theta 2. x_0_sample: X da amostra. x_1_sample: X da amostra. y_sample: Y da amostra. sample_size: Tamanho da amostra. Returns: Valor da derivada da função custo em relação a theta 1. """ summation: float = 0 for i in range(sample_size): summation += ((h_theta(theta_0, theta_1, theta_2, x_0_sample[i], x_1_sample[i]) - y_sample[i]) * x_0_sample[i]) return summation / sample_size def derivate_cost_function_theta_2(theta_0: float, theta_1: float, theta_2: float, x_0_sample: List[float], x_1_sample: List[float], y_sample: List[float], sample_size: int) -> float: """Derivada da função custo em relação a theta_1. Args: theta_0: Theta 0. theta_1: Theta 1. theta_2: Theta 2. x_0_sample: X da amostra. x_1_sample: X da amostra. y_sample: Y da amostra. sample_size: Tamanho da amostra. Returns: Valor da derivada da função custo em relação a theta 1. """ summation: float = 0 for i in range(sample_size): summation += ((h_theta(theta_0, theta_1, theta_2, x_0_sample[i], x_1_sample[i]) - y_sample[i]) * x_1_sample[i]) return summation / sample_size # gradiente descendente def sub_task_2_2(epoch: int, alpha: float = 0.01) -> Tuple[List[float], float, float, float]: """ Faz a execução da regressão linear utilizando o gradiente descendente. Args: epoch: Épocas executando o algoritmo. alpha: Taxa de aprendizado do algoritmo. Returns: None """ # valores iniciais de theta da regressão theta_0: float = 1 theta_1: float = 1 theta_2: float = 1 x_0_sample, x_1_sample, y_sample = load_data() x_0_sample, x_1_sample = sub_task_2_1(x_0_sample, x_1_sample) sample_size = len(x_0_sample) cost_values: List[float] = [] for _ in range(epoch): temp_0 = theta_0 - (alpha * derivate_cost_function_theta_0(theta_0, theta_1, theta_2, x_0_sample, x_1_sample, y_sample, sample_size)) temp_1 = theta_1 - (alpha * derivate_cost_function_theta_1(theta_0, theta_1, theta_2, x_0_sample, x_1_sample, y_sample, sample_size)) temp_2 = theta_2 - (alpha * derivate_cost_function_theta_2(theta_0, theta_1, theta_2, x_0_sample, x_1_sample, y_sample, sample_size)) theta_0 = temp_0 theta_1 = temp_1 theta_2 = temp_2 cost_values.append(cost_function(theta_0, theta_1, theta_2, x_0_sample, x_1_sample, y_sample, sample_size)) # pegando o último ajuste return cost_values, theta_0, theta_1, theta_2 def task_3() -> None: """Calcula os valores usando a equação normal. Returns: None. """ # inicializando para montarmos as matrizes x_1_sample, x_2_sample, y_sample = load_data() # transformando as listas em matrizes X = [] for index, _ in enumerate(x_1_sample): X.append([1, x_1_sample[index], x_2_sample[index]]) # montando a matriz X X = numpy.asmatrix(X) y_sample = numpy.array(y_sample).reshape(len(y_sample), 1) # operando first_factor = numpy.linalg.inv(numpy.matmul(X.T, X)) second_factor = numpy.matmul(first_factor, X.T) theta = numpy.matmul(second_factor, y_sample) return theta thetas = task_3() # Exibindo o erro por época cost_values, theta_0, theta_1, theta_2 = sub_task_2_2(1000) print(theta_0, theta_1, theta_2) print(thetas[0][0], thetas[1][0], thetas[2][0]) # epochs = [i for i in range(1, 1000+1)] # plt.plot(epochs, cost_values) # plt.title('Função custo em relação a quantidade de épocas. Alpha = 0.1') # plt.show()
#MenuTitle: Delete guidelines # -*- coding: utf-8 -*- __doc__=""" Delete all local guidelines in selected glyphs. """ import GlyphsApp selectedLayers = Glyphs.font.selectedLayers def process( thisLayer ): thisLayer.guideLines = [] for thisLayer in selectedLayers: thisGlyph = thisLayer.parent print "Deleting guidelines in:", thisGlyph.name thisGlyph.beginUndo() process( thisLayer ) thisGlyph.endUndo()
from random import * import eval def generate_quiz(): # Hint: Return [x, y, op, result] x = randint(1,10) y = randint(1,10) a_list = ["+", "-", "*", "/"] op = choice(a_list) res = eval.cal(x, y, op) error = [-1, 0, 0, 1] ran_er = choice(error) result = res + ran_er return [x, y, op , result] def check_answer(x, y, op, result, user_choice): boo = True res = eval.cal(x, y, op) if result == res : if user_choice == True: boo = True elif user_choice == False: boo = False else: if user_choice == False: boo = True elif user_choice == True: boo = False return boo # sound
import os from django.contrib.gis.utils import LayerMapping from . models import CadastralCommunity, cadastralcommunity_mapping cc_shps = os.path.abspath( os.path.join( os.path.dirname(__file__), 'data', 'iad', 'AT.shp') ) def import_shapes(verbose=True): lm = LayerMapping( CadastralCommunity, cc_shps, cadastralcommunity_mapping, transform=True, encoding='utf-8', ) lm.save(strict=True, verbose=verbose)
from django.contrib import admin from commanderie.models import Bureau, Chevalier, Commanderie # Register your models here. admin.site.register(Commanderie) admin.site.register(Chevalier) admin.site.register(Bureau)
#!/usr/bin/python3 # tests evaluation of expressions in ranges x = 5 for i in range((x//2)+1,x*2): print(i)
perg = 'S' cont = soma = media = 0 while perg == 'S': num = int(input('Digite um número: ')) perg = str(input('Deseja continuar? [S/N]: ')).upper().strip() soma += num cont += 1 if cont == 1: maior = menor = num else: if num > maior: maior = num if num < menor: menor = num media = soma / cont print('Foram digitados {} números e a média é {:.2f}'.format(cont, media)) print('O maior valor digitado foi {} e o menor é {}'.format(maior, menor))
import os from urllib.parse import urlparse import pytest import factory from demo_app import factories, models from tests.utils import init_postgresql_database, drop_postgresql_database class AppConfigTest(factories.AppConfig): DEBUG = False TESTING = True SQLALCHEMY_DATABASE_URI = os.environ.get('DB_URI', 'postgres://flask:flask@localhost/flask_test') SQLALCHEMY_TRACK_MODIFICATIONS = False @pytest.fixture(scope='session') def app(request): app_ = factories.create_app(AppConfigTest) db_uri = urlparse(app_.config['SQLALCHEMY_DATABASE_URI']) pg_host = db_uri.hostname pg_port = db_uri.port pg_user = db_uri.username pg_password = db_uri.password pg_db = db_uri.path[1:] init_postgresql_database(pg_user, pg_password, pg_host, pg_port, pg_db) factories.configure_db(app_) models.db.create_all() @request.addfinalizer def drop_database(): drop_postgresql_database(pg_user, pg_password, pg_host, pg_port, pg_db) return app_ @pytest.fixture(scope='session') def _db(app): """ Provide the transactional fixtures with access to the database via a Flask-SQLAlchemy database connection. """ return models.db @pytest.fixture(scope='function') def base_factory(db_session): class BaseFactory(factory.alchemy.SQLAlchemyModelFactory): """Base model factory.""" class Meta: abstract = True sqlalchemy_session = db_session sqlalchemy_session_persistence = 'flush' return BaseFactory @pytest.fixture(scope='function') def category_factory(base_factory): class CategoryFactory(base_factory): class Meta: model = models.Category name = factory.Sequence(lambda n: u'Category %d' % n) return CategoryFactory @pytest.fixture(scope='function') def post_factory(base_factory, category_factory): class PostFactory(base_factory): class Meta: model = models.Post title = factory.Sequence(lambda n: u'Post Title %d' % n) body = factory.Sequence(lambda n: u'Post Body %d' % n) category = factory.SubFactory(category_factory) return PostFactory
#Going to use Flask, going to upload through heroku # Text is done through HTML, # Embedding is done through Trinket.io # Bootstrap 4 should make it look nice #To activate virtual env, type virtual/Scripts/activate # # https://virtual-tic-tac-toe.herokuapp.com/ | https://git.heroku.com/virtual-tic-tac-toe.git # # To deactivate virtual environment, simply type deactivate in the console from flask import Flask, render_template from flask import Flask app = Flask(__name__) @app.route("/") def home(): return render_template("home.html") @app.route("/about") def about(): return render_template("about.html") @app.route("/game") def game(): return render_template("game.html") #Each one of these routes is to a separate part of the page if __name__ == "__main__": app.run(debug=True)
from functools import partial import logging import os from kaon.parsers import KaonLECParser from pion.parsing.lec import PionLECParser from su2.models import PionLECSU2, KaonLECSU2 log = logging.getLogger(__name__) def parse_pion_lecs_from_folder(folder): all_data = PionLECParser().get_from_folder(folder) bulk_list = [PionLECSU2(**d) for d in all_data] PionLECSU2.objects.insert(bulk_list) get_24c_pion_lecs_su2 = partial(parse_pion_lecs_from_folder, os.path.join('data', '24c', 'lec', 'pion_lecs', 'su2')) def parse_kaon_lecs_from_folder(folder, m_s): all_data = KaonLECParser().get_from_folder(folder) for d in all_data: d['m_s'] = m_s bulk_list = [KaonLECSU2(**d) for d in all_data] KaonLECSU2.objects.insert(bulk_list) get_24c_kaon_lecs_su2_02 = partial(parse_kaon_lecs_from_folder, os.path.join('data', '24c', 'lec', 'kaon_lecs', 'su2', '0.02'), 0.02) get_24c_kaon_lecs_su2_03 = partial(parse_kaon_lecs_from_folder, os.path.join('data', '24c', 'lec', 'kaon_lecs', 'su2', '0.03'), 0.03) parsers = [ { 'name': '24c SU2 Pion LECS', 'parser': get_24c_pion_lecs_su2, 'enabled': False, }, { 'name': '24c SU2 Kaon LECS 0.02', 'parser': get_24c_kaon_lecs_su2_02, }, { 'name': '24c SU2 Kaon LECS 0.03', 'parser': get_24c_kaon_lecs_su2_03, }, ]
#!/usr/bin/env python3 import collections import json import os from urllib import parse from flask import (Flask, render_template, request) import redis url = parse.urlparse(os.environ.get('REDISCLOUD_URL', "redis://localhost:6379/0")) db = redis.Redis(host=url.hostname, port=url.port, password=url.password) app = Flask(__name__) DEBUG = True HOST = '0.0.0.0' PORT = 5000 # Keep no more than 1000 records per device, for now: CAPPED_SIZE = 1000 devices_key = "devices" metrics_template = "metrics:%s" # TODO Add a decorator that 403s non-http (X-Forwarded-Proto != https) # requests to tell the user to retry the request on HTTPS. @app.route("/") def hello(): context = {} return render_template("index.html", **context) @app.route("/metrics", methods=["GET"]) def metrics(deviceid="device1"): data = { "moisture": [], "temperature": [], "light": [], } metrics_key = metrics_template % (deviceid,) metrics = db.lrange(metrics_key, 0, 20) for row in metrics: m, t, l = row.decode("utf-8").split(",") data['moisture'].append(int(m)) data['temperature'].append(float(t)) data['light'].append(int(l)) return app.response_class( json.dumps(data), status=200, mimetype='application/json' ) @app.route("/metrics", methods=["POST"]) def new_metric(deviceid="device1"): moisture = request.args.get('m', -1) if moisture: moisture = int(moisture) temperature = request.args.get('t', -100.0) if temperature: temperature = float(temperature) light = request.args.get('l', -1) if light: light = int(light) metrics_key = metrics_template % (deviceid,) db.sadd(devices_key, deviceid) db.rpush(metrics_key, "%i,%f,%i"%(moisture, temperature, light)) db.ltrim(metrics_key, 0, CAPPED_SIZE) print(f"received metric: moisture {moisture}, temperature {temperature}, light {light}") return "OK", 200 if __name__=="__main__": app.run(HOST, PORT, debug=DEBUG)
from flask import Flask, render_template, request, redirect, url_for, flash from config import app from model import Contacts, db @app.route('/') @app.route('/index.html') def index(): return render_template("index.html") @app.route('/about_me.html') def about_me(): return render_template("about_me.html") @app.route('/message_send.html') def done(): return render_template("message_send.html") @app.route('/contact_me.html', methods=['POST', 'GET']) def contact_me(): if request.method == 'POST': if not request.form['name'] or not request.form['surname'] or not request.form['message']: flash("Please enter all required data", 'error') else: new_message = Contacts( request.form['name'], request.form['surname'], request.form['message']) db.session.add(new_message) db.session.commit() flash("Message successfully send.") return render_template("/message_send.html") return render_template("/contact_me.html") if __name__ == "__main__": db.create_all() app.run(debug=True)
#!/usr/bin/env python from sys import argv from parsers import parse_fasta, LongFastaID from writers import write_fasta if __name__ == "__main__": fasta = argv[1] out_file = argv[2] fasta_dict = parse_fasta(fasta) prot_id_to_seq = {} for fasta_id, sequence in fasta_dict.items(): fasta_id = LongFastaID(fasta_id) prot_id = fasta_id.protein_id assert prot_id not in prot_id_to_seq prot_id_to_seq[prot_id] = sequence write_fasta(prot_id_to_seq, out_file)
import json import Queue import settings import time import threading import yaml import commands import serial import sys import spidev import RPi.GPIO as GPIO #from thirtybirds.Logs.main import Exception_Collector from thirtybirds.Network.manager import init as network_init def network_status_handler(msg): print "network_status_handler", msg def network_message_handler(msg): try: #print "network_message_handler", msg topic = msg[0] host, sensor, data = yaml.safe_load(msg[1]) # print "Exception Received:", ex except Exception as e: print "exception in network_message_handler", e network = None def init(HOSTNAME): global network network = network_init( hostname=HOSTNAME, role="client", discovery_multicastGroup=settings.discovery_multicastGroup, discovery_multicastPort=settings.discovery_multicastPort, discovery_responsePort=settings.discovery_responsePort, pubsub_pubPort=settings.pubsub_pubPort, message_callback=network_message_handler, status_callback=network_status_handler ) network.subscribe_to_topic("system") # subscribe to all system messages network.subscribe_to_topic("exceptions") network.subscribe_to_topic("Eyeballs") ######## MOTOR CONTROL ########## class Controller(): def __init__(self, deviceId=0): self.deviceId = deviceId self.open = False self.devicePath = "/dev/ttyUSB" + str(deviceId) try: self.serial = serial.Serial( port=self.devicePath, baudrate=115200, bytesize=serial.EIGHTBITS, #startbits=serial.STARTBITS_ONE, stopbits=serial.STOPBITS_ONE, parity=serial.PARITY_NONE, ) #self.serial.open() self.open = True print "Serial connected at ", self.devicePath except: self.open = False print("could not open device at ", self.devicePath) def setSpeed(self, channel, rpm): if self.open: cmd = '!G ' + str(channel) + ' '+str(rpm)+'\r' print cmd self.serial.write(cmd) else: print 'Serial not connected' pass controller = Controller() ######## ABSOLUTE ENCODER ########### class AMT203(): def __init__(self, bus=0, deviceId=0, pin=3): self.deviceId = deviceId self.bus = bus self.pin = pin GPIO.setmode(GPIO.BCM) GPIO.setup(self.pin, GPIO.OUT) GPIO.output(self.pin, GPIO.HIGH) try: self.spi = spidev.SpiDev() self.spi.open(self.bus,self.deviceId) self.open = True print "SPI connected. Device id: ", self.deviceId except: self.open = False print "Could not connect to SPI device" def clean_buffer(self): first_result = self.spi.xfer([0x00],0,20) while first_result[0] != 165: first_result = self.spi.xfer([0x00],0,20) print "Buffer empty" def get_position(self): first_result = self.spi.xfer([0x10],0,20) while first_result[0] != 16: first_result = self.spi.xfer([0x00],0,20) msb_result = self.spi.xfer([0x00],0,20) lsb_result = self.spi.xfer([0x00],0,20) print "MSB: %s | LSB: %s " % (msb_result, lsb_result) # msb_bin = bin(msb_result[0]<<8)[2:] # lsb_bin = bin(lsb_result[0])[2:] final_result = (msb_result[0]<<8 | lsb_result[0]) print "Final: ", final_result self.clean_buffer() def set_zero(self): first_result = self.spi.xfer([0x70],0,20) while first_result[0] != 128: first_result = self.spi.xfer([0x00],0,20) print "Zero set was successful and the new position offset is stored in EEPROM" self.clean_buffer() GPIO.output(self.pin, GPIO.LOW) time.sleep(0.1) GPIO.output(self.pin, GPIO.HIGH) amt = AMT203()
#!/usr/bin/python3 # -*- coding: utf-8 -*- import numpy as np import sympy as sp import matplotlib.pyplot as plt from collections import Counter from prettytable import PrettyTable def create_sample(n, a, b): X = [] Y = [] Xi = np.random.uniform(0, 1, n) for i in range(n): X.append(round(Xi[i] * (b - a) + a, 3)) Y.append(round(y_function(X[i]), 3)) return X, Y def empirical_func(sample): #print(sample) n = sum(sample.values()) k = sorted(sample.keys()) p = 0 plt.plot([0, k[0]], [0, 0], marker='.') for i in range(1, len(c)): p += c.get(k[i - 1]) / n plt.plot([k[i - 1], k[i]], [p, p], marker='.') # plt.plot([k[len(c)-1], k[len(c)-1] + 2], [1, 1], marker='o') plt.grid(True) #theoretical_func(0.1, 36.0) #plt.show() def theoretical_func(a, b): x = np.arange(a, b, 0.1) #y = (x * ((np.log(x) + 5) / 12) / x) y = np.arange(a, b, 0.1) for i in range(len(x)): y[i] = (np.log(x[i]) + 5) / 12 plt.plot(x, y, color='r') plt.grid(True) #plt.show() n = int(input('Input n: ')) x = sp.symbols('x') expression = sp.exp(x) y_function = sp.lambdify(x, expression, 'numpy') a = -5 b = 7 a_x = np.exp(-5) b_x = np.exp(7) X, Y = create_sample(n, a, b) table = PrettyTable() table.field_names = ['x', 'y'] for i in range(len(X)): table.add_row([X[i], Y[i]]) print(table) c = Counter(Y) print('Вариационный ряд:') print(sorted(Y)) empirical_func(c) plt.show() theoretical_func(a_x, b_x) plt.show() empirical_func(c) theoretical_func(a_x, b_x) plt.show()
import pymongo def mongo_connect(): try: connection = pymongo.MongoClient() print "MongoDB is connected!" return connection except pymongo.errors.ConnectionFailure, e: print "Could not connect to MongoDB: %s" % e connection = mongo_connect() db = connection['twitter_stream'] coll = db.my_collection doc = {"name": "David", "surname": "Gunner", "twitter": "@gunnerjnr84"} coll.insert(doc) result = coll.find_one() print result # {u'twitter': u'@gunnerjnr84', u'_id': ObjectId('5629264db1bae125ac446ba5'), u'surname': u'Gunner', u'name': u'Dave'}
#!/usr/bin/python3 """Lockboxes. Given a box full of boxes full of keys to open other boxes, determine if all boxes can be opened. """ def canUnlockAll(boxes): """canUnlockAll. Determine if all boxes inside boxes can be opened. Arguments: -- boxes: A box full of boxes, which may contain keys. Return: True if all boxes can be opened; False otherwise. """ keychain = set([]) boxStack = [] currentBox = boxes[0] key = None done = False if len(boxes) > 0: keychain.add(0) while(not done): if len(currentBox) > 0: key = currentBox.pop(0) if key not in keychain and key < len(boxes): keychain.add(key) boxStack.append(currentBox) currentBox = boxes[key] else: if len(boxStack) > 0: currentBox = boxStack.pop() else: done = True return len(keychain) == len(boxes)
# Write a class to hold player information, e.g. what room they are in # currently. class Player: def __init__(self,name,location,items=[]): self.name=name self.location=location self.items=items def change_location(self,direction): if direction =='w': self.location=self.location.n_to elif direction=='s': self.location=self.location.s_to elif direction=='a': self.location=self.location.w_to elif direction =='d': self.location=self.location.e_to def action(self,action,item): self.location.take_or_drop_items(action,item) if action=='take': if not item in self.items: self.items.append(item) item.pick_up=True item.is_taken(item) else: print(f'You have picked up {item.name} already') elif action == 'drop': if not item in self.items: print(f'You don\'t have that item') else: item.pick_up=False item.is_taken(item) self.items.remove(item) def show_items(self): for i in range(len(self.items)): print(f'You have {self.items[i].name}') if len(self.items)==0: print('You don\'t have anything')
"""Run an example script to quickly test any SimpliSafe system.""" # pylint: disable=protected-access import asyncio from aiohttp import ClientSession from pikrellcam_python import PiKrellCam from aiohttp.client_exceptions import ClientError, ClientResponseError async def exercise_client( host: str, port: str, user: str, password: str, websession: ClientSession) -> None: """Test a SimpliSafe client (regardless of version).""" print('User:{0} @ {1}'.format(user, host)) print('========================') try: camera = await PiKrellCam.login(host,port,user, password, websession) await camera.update() value = await camera.is_motion_enabled() print('Motion Enable is:{0}'.format(value)) value = await camera.is_recording() print('Recording State is:%s' % value) except (ClientError, ClientResponseError) as ex: print('Unable to connect to PiKrellCam:{0}'.format(str(ex))) async def main() -> None: """Create the aiohttp session and run the example.""" async with ClientSession() as websession: print() await exercise_client('10.0.1.4', '8080', 'pi', 'darius', websession) asyncio.get_event_loop().run_until_complete(main())
import base64 import json import os from datetime import datetime import babel import numpy as np import pandas as pd import pytz from dateutil.relativedelta import relativedelta from odoo import api, fields, models, tools, _ from odoo.exceptions import ValidationError, UserError from odoo.tools import config from statsmodels.tsa.ar_model import AutoReg from statsmodels.tsa.arima_model import ARIMA from statsmodels.tsa.arima_model import ARMA class KsSalesForecast(models.Model): _name = 'ks.sales.forecast' _inherit = ['mail.thread', 'mail.activity.mixin'] _rec_name = 'ks_name' _order = 'id desc' _description = 'This model is to predict sales on the bases of historical data with trending and seasonal factor' ks_name = fields.Char('Name', tracking=True, default=lambda self: _('New'), readonly=True) ks_is_file = fields.Boolean(default=False, tracking=True) ks_file_type = fields.Selection([('csv', 'CSV'), ('xlx', 'Excel')], string=_('File Type'), default='csv', tracking=True) ks_import_file = fields.Binary(string=_('File'), tracking=True) ks_file_name = fields.Char(string=_('File Name'), tracking=True) ks_is_method_change = fields.Boolean(default=False, tracking=True) ks_forecast_method = fields.Selection([ ('ar', 'Autoregression (AR)'), ('ma', 'Moving Average (MA)'), ('arma', 'Autoregressive Moving Average (ARMA)'), ('arima', 'Autoregressive Integrated Moving Average (ARIMA)'), ], tracking=True) ks_default_forecast_method = fields.Char(compute='ks_default_forecast_method_value', store=True) ks_model = fields.Many2one('ir.model', 'Model', default=lambda self: self.env.ref("sale.model_sale_order"), readonly=True, invisible=True, tracking=True) ks_start_date = fields.Datetime(string=_('Start Date'), required=True, tracking=True) ks_end_date = fields.Datetime(string=_('End Date'), required=True, tracking=True) ks_forecast_base = fields.Selection([('all', 'All Products'), ('product', 'Specific Products')], string=_('Forecast Base'), default='product', tracking=True) ks_product_ids = fields.Many2many('product.product', invisible=True, tracking=True) ks_p = fields.Integer(string=_('P Coefficient (Auto Regressive)')) ks_d = fields.Integer(string=_('D Coefficient (Integrated)')) ks_q = fields.Integer(string=_('Q Coefficient (Moving Average)')) ks_forecast_unit = fields.Integer(string=_('Forecast Unit'), tracking=True, required=True, default=1) ks_forecast_period = fields.Selection([('day', 'Day'), ('month', 'Month'), ('year', 'Year')], string=_('Forecast Period'), default='month', tracking=True, required=True) ks_is_predicted = fields.Boolean() ks_chart_data = fields.Text(default=0) ks_graph_view = fields.Integer(default=1) @api.depends('ks_forecast_unit') @api.onchange('ks_forecast_unit') def ks_forecast_unit_method(self): if self.ks_forecast_unit < 1: raise ValidationError(_('Please Enter a positive non-zero number.')) @api.model def create(self, values): if 'ks_name' not in values or values['ks_name'] == _('New'): values['ks_name'] = self.env['ir.sequence'].next_by_code('ks.sales.forecast') or _('New') if not values.get('ks_is_method_change'): values.update( {'ks_default_forecast_method': self.env['ir.config_parameter'].sudo().get_param('ks_forecast_method')}) elif values.get('ks_forecast_method'): values.update({'ks_default_forecast_method': values.get('ks_forecast_method')}) return super(KsSalesForecast, self).create(values) def write(self, values): if values.get('ks_forecast_method'): values.update({'ks_default_forecast_method': values.get('ks_forecast_method')}) return super(KsSalesForecast, self).write(values) @api.onchange('ks_start_date', 'ks_end_date') def ks_onchange_dates(self): if self.ks_start_date and self.ks_end_date: if not self.ks_start_date < self.ks_end_date: raise ValidationError('Start Date should be less then End Date') @api.onchange('ks_forecast_method', 'ks_is_method_change') def ks_default_forecast_method_value(self): for rec in self: if not rec.ks_is_method_change: rec.ks_default_forecast_method = self.env['ir.config_parameter'].sudo().get_param('ks_forecast_method') elif rec.ks_forecast_method: rec.ks_default_forecast_method = rec.ks_forecast_method def ks_predict_sales(self): vals = [] if self.ks_is_file: temp_path = os.path.join(config.get('data_dir'), "temp") if not os.path.exists(temp_path): os.makedirs(temp_path) file_name = self.ks_file_name file_path = temp_path + '/' + file_name temp_file = open(file_path, 'wb') temp_file.write(base64.b64decode(self.ks_import_file)) temp_file.close() previous_data = pd.read_csv(temp_file.name, index_col=['Date', 'Sales']) product_groups = previous_data.groupby(previous_data.Product).groups products = product_groups.keys() for product in products: sales_list = [] product_id = self.env['product.product'].search([('name', '=', product)], limit=1) file_datas = product_groups[product].values for file_data in file_datas: sales_list.append(float(file_data[1])) sale_data = { 'ks_forecast_id': self.id, 'ks_date': datetime.strptime(file_data[0], tools.DEFAULT_SERVER_DATE_FORMAT), 'ks_value': float(file_data[1]), 'ks_product_id': product_id.id } vals.append(sale_data) sales_data = pd.read_csv(temp_file.name, index_col='Date', usecols=['Sales', 'Date']) forecast_method = self.env['ir.config_parameter'].sudo().get_param('ks_forecast_method') if self.ks_is_method_change: forecast_method = self.ks_forecast_method data_frame = pd.DataFrame(sales_list) if forecast_method: forecast_method_name = 'ks_%s_method' % forecast_method if hasattr(self, forecast_method_name): method = getattr(self, forecast_method_name) results = method(product_groups[product]) # print(results) for value, month in zip(results, results.index): ks_date = datetime.strftime(month, tools.DEFAULT_SERVER_DATE_FORMAT) forecast_data = { 'ks_forecast_id': self.id, 'ks_date': datetime.strptime(ks_date, tools.DEFAULT_SERVER_DATE_FORMAT), 'ks_value': value, 'ks_product_id': product_id.id } vals.append(forecast_data) self.env['ks.sales.forecast.result'].create(vals) # print(sales_data) else: end_date = self.ks_end_date query = """ select date_trunc(%(unit)s, so.date_order) as date, sum(sol.price_subtotal), sol.product_id from sale_order_line as sol inner join sale_order as so on sol.order_id = so.id where date_order >= %(start_date)s and date_order <= %(end_date)s and sol.product_id in %(product_condition)s group by date, sol.product_id order by date """ product_condition = tuple(self.env['product.product'].search([]).ids) if self.ks_forecast_base == 'product': product_condition = tuple(self.ks_product_ids.ids) if self.ks_forecast_period == 'month': if end_date.day > 15: end_date = end_date + relativedelta(day=31) else: end_date = end_date + relativedelta(day=1) self.env.cr.execute(query, { 'unit': self.ks_forecast_period, 'start_date': self.ks_start_date, 'end_date': end_date, 'product_condition': product_condition }) result = self.env.cr.fetchall() # print(result) if len(result) == 0: raise UserError(_("Sales data is not available for these products")) data_dict = {} for data in result: keys = data_dict.keys() sale_data = { 'ks_forecast_id': self.id, 'ks_date': data[0], 'ks_value': float(data[1]), 'ks_product_id': data[2] } vals.append(sale_data) if data[2] in keys: data_dict[data[2]]['date'].append(data[0]) data_dict[data[2]]['sales'].append(data[1]) data_dict[data[2]]['forecast_sales'].append(0.0) else: data_dict[data[2]] = {'date': [], 'sales': [], 'forecast_sales': []} data_dict[data[2]]['date'].append(data[0]) data_dict[data[2]]['sales'].append(data[1]) data_dict[data[2]]['forecast_sales'].append(0.0) product_keys = data_dict.keys() for product in product_keys: product_id = self.env['product.product'].browse(product) product_sales_data = data_dict[product] sales_list = product_sales_data.get('sales') forecast_method = self.env['ir.config_parameter'].sudo().get_param('ks_forecast_method') if self.ks_is_method_change: forecast_method = self.ks_forecast_method data_frame = np.array(sales_list) if forecast_method and len(data_frame) > 8: results = 0 try: forecast_method_name = 'ks_%s_method' % forecast_method if hasattr(self, forecast_method_name): p = self.ks_p q = self.ks_q d = self.ks_d method = getattr(self, forecast_method_name) results = method(data_frame, p, q, d) except Exception as e: return self.env['ks.message.wizard'].ks_pop_up_message(names='Error', message=e) for (i, value) in zip(range(0, len(results)), results): i = i + 1 if self.ks_forecast_period == 'day': ks_date = end_date + relativedelta(days=i) elif self.ks_forecast_period == 'month': ks_date = end_date + relativedelta(months=i) else: ks_date = end_date + relativedelta(years=i) forecast_data = { 'ks_forecast_id': self.id, 'ks_date': ks_date, 'ks_value': value, 'ks_product_id': product_id.id } data_dict[product_id.id]['date'].append(ks_date) data_dict[product_id.id]['sales'].append(0.0) data_dict[product_id.id]['forecast_sales'].append(value) vals.append(forecast_data) elif not len(data_frame) > 8: raise UserError( _('You do not have sufficient data for "%s" product. We need minimum 9 "%ss" data') % ( product_id.name, self.ks_forecast_period)) else: raise UserError(_('Please select a forecast method')) keys = data_dict.keys() final_dict = {} dict_data = {} if keys: dates = [] for product in keys: dates.extend(data_dict[product]['date']) dates = list(set(dates)) dates.sort() labels = [self.format_label(values) for values in dates] final_dict.update({ 'labels': labels, 'datasets': [] }) product_keys = data_dict.keys() for product in product_keys: dict_data[product] = { 'sales': {}, 'forecast_sales': {}, } for final_date in dates: if final_date in data_dict[product]['date']: data_index = data_dict[product]['date'].index(final_date) dict_data[product]['sales'][final_date] = data_dict[product]['sales'][data_index] dict_data[product]['forecast_sales'][final_date] = data_dict[product]['forecast_sales'][ data_index] else: dict_data[product]['sales'][final_date] = 0.0 dict_data[product]['forecast_sales'][final_date] = 0.0 if dict_data: product_keys = data_dict.keys() for product in product_keys: product_id = self.env['product.product'].browse(product) product_name = product_id.code + ' ' + product_id.name if product_id.code else product_id.name final_dict['datasets'] = final_dict['datasets'] + [{ 'data': list(dict_data[product]['sales'].values()), 'label': product_name + '/Previous', }, { 'data': list(dict_data[product]['forecast_sales'].values()), 'label': product_name + '/Forecast' }] self.ks_chart_data = json.dumps(final_dict) forecast_result = self.env['ks.sales.forecast.result'] forecast_records = forecast_result.search([('ks_forecast_id', '=', self.id)]) if forecast_records.ids: for forecast_record in forecast_records: forecast_record.unlink() forecast_result.create(vals) else: forecast_result.create(vals) self.ks_is_predicted = True @api.model def format_label(self, value, ftype='datetime', display_format='MMMM yyyy'): if self.ks_forecast_period == 'day': display_format = 'dd MMMM yyyy' elif self.ks_forecast_period == 'year': display_format = 'yyyy' tz_convert = self._context.get('tz') locale = self._context.get('lang') or 'en_US' tzinfo = None if ftype == 'datetime': if tz_convert: value = pytz.timezone(self._context['tz']).localize(value) tzinfo = value.tzinfo return babel.dates.format_datetime(value, format=display_format, tzinfo=tzinfo, locale=locale) else: if tz_convert: value = pytz.timezone(self._context['tz']).localize(value) tzinfo = value.tzinfo return babel.dates.format_date(value, format=display_format, locale=locale) def ks_ar_method(self, data_frame, p=False, d=False, q=False): ks_ar_model = AutoReg(data_frame, lags=1) ks_fit_model = ks_ar_model.fit() forecast_period = self.ks_forecast_unit - 1 forecast_value = ks_fit_model.predict(len(data_frame), len(data_frame) + forecast_period) return forecast_value def ks_ma_method(self, data_frame, p=False, d=False, q=False): ks_ma_model = ARMA(data_frame, order=(0, q)) ks_fit_model = ks_ma_model.fit(disp=False) forecast_period = self.ks_forecast_unit - 1 forecast_value = ks_fit_model.predict(len(data_frame), len(data_frame) + forecast_period) return forecast_value def ks_arma_method(self, data_frame, p=False, d=False, q=False): ks_arma_model = ARMA(data_frame, order=(p, q)) ks_fit_model = ks_arma_model.fit(disp=False) forecast_period = self.ks_forecast_unit - 1 forecast_value = ks_fit_model.predict(len(data_frame), len(data_frame) + forecast_period) return forecast_value def ks_arima_method(self, data_frame, p=False, d=False, q=False): ks_arima_model = ARIMA(data_frame, order=(p, d, q)) ks_fit_model = ks_arima_model.fit(disp=False) forecast_period = self.ks_forecast_unit - 1 forecast_value = ks_fit_model.predict(len(data_frame), len(data_frame) + forecast_period) return forecast_value def ks_auto_arima_method(self, data_frame, p=False, d=False, q=False): ks_arima_model = ARMA(data_frame, order=(2, 1)) ks_fit_model = ks_arima_model.fit(disp=False) forecast_period = self.ks_forecast_unit - 1 forecast_value = ks_fit_model.predict(len(data_frame), len(data_frame) + forecast_period) return forecast_value
import boto3 import hashlib import moto import os.path import qarnot from pathlib import Path from qarnot.bucket import Bucket from unittest import TestCase from unittest.mock import patch, Mock def mock_connection_base(mock_s3buckets=None): mock_connection = Mock({'other.side_effect': KeyError}) mock_connection.s3client = Mock() mock_connection.s3resource = Mock() mock_connection.s3resource.Bucket.return_value = mock_s3buckets mock_connection._sanitize_bucket_paths = True mock_connection._show_bucket_warnings = True return mock_connection class TestBucketPublicMethods(TestCase): def test_init_bucket(self): mock_connection = mock_connection_base() bucket = Bucket(mock_connection, "name", True) mock_connection.s3client.create_bucket.assert_called_once() @patch("qarnot.bucket.Bucket.add_file") def test_bucket_add_string(self, add_file): bucket = qarnot.bucket.Bucket(mock_connection_base(), "bucket_name", False) string_to_send = "Test string to be send" remote_path = "path/to/go" bucket.add_string(string_to_send, remote_path) add_file.assert_called_once() args = add_file.call_args[0] assert args[0].read() == string_to_send.encode('utf-8') assert args[1] == remote_path # ================================== Utils functions ================================== def write_in(path, text): os.makedirs(path.parent, exist_ok=True) with open(path, 'w+') as the_file: the_file.write(text) def compute_etag(path): hash_md5 = hashlib.md5() with open(path, "rb") as f: for chunk in iter(lambda: f.read(4096), b""): hash_md5.update(chunk) return '%s' % hash_md5.hexdigest() # Returns a set containing the couple (filename, etag) for every file in a given folder def list_local_files(path): set_of_filenames = set() for root, _, files in os.walk(path): for file_name in files: relative_file_path = Path(os.path.join(root, file_name)).relative_to(path).as_posix() set_of_filenames.add((relative_file_path, compute_etag(os.path.join(root, file_name)))) return set_of_filenames # This is just to keep track of how many times the copy_file method was called class BucketWithCopyCounter(Bucket): def __init__(self, connection, name, create=True): super().__init__(connection, name, create) self._nbr_of_copies = 0 def copy_file(self, source, dest): self._nbr_of_copies += 1 super().copy_file(source, dest) # ================================== Tests using Moto ================================== class TestBucketPublicMethodsMoto: @moto.mock_s3 def test_sync_files_avoid_unnecessary_copies(self, tmp_path): # cf QNET-5274 bucket_name = "dolly" # Mock S3 client and resource q_conn = mock_connection_base() q_conn.s3client = boto3.client("s3") q_conn.s3resource = boto3.resource('s3') # Add 2 identical files in the bucket by our own way bucket = BucketWithCopyCounter(q_conn, bucket_name, True) bucket.add_string("Tu ne copieras point sur ton voisin", "remote1") bucket.add_string("Tu ne copieras point sur ton voisin", "remote2") # Write some files with identical content in a temporary folder write_in(tmp_path / "local1", 'Tu ne copieras point sur ton voisin') write_in(tmp_path / "local2", 'Tu ne copieras point sur ton voisin') # Synchronize the content of this folder with the bucket bucket.sync_directory(tmp_path.as_posix()) # Check that it's indeed synchronized local_files = list_local_files(tmp_path) bucket_files = set() for file in bucket.list_files(): bucket_files.add((file.key, file.e_tag.strip('"'))) assert local_files == bucket_files, "Bucket and local folder have different content whereas they should be " \ "identical " # Check that there were no unnecessary copies performed assert bucket._nbr_of_copies == 2, "The copy method should have been called only twice\ ({} calls here)".format(bucket._nbr_of_copies)
import operator ttL = [ ('토마스', 5), ('헨리', 8), ('에드워드', 9), ('토마스', 12), ('에드워드',1)] tD = {} tL = [] tR, cR = 1,1 for tmpTup in ttL: tName = tmpTup[0] tWeight = tmpTup[1] if tName in tD: tD[tName] += tWeight else: tD[tName] = tWeight print(list(tD.items())) tL = sorted(tD.items(), key=operator.itemgetter(1), reverse=True) # sorted 함수에서 key=operator.itemgetter(1) 해주면 1번째 놈을 기준으로 sort하겠다는 뜻 rank = 1 print(tL) print("-----------------") print("기차","\t","총수송량","\t","순위") print("-----------------") for train in tL: print(train[0],"\t",train[1],"\t",rank) rank += 1
from rest_framework.routers import DefaultRouter from . import views router = DefaultRouter() router.register(r'tags', views.SkillTagsViewSet, basename='tags') router.register(r'skills', views.SkillViewSet, basename='skills') router.register(r'projects', views.ProjectViewSet, basename='projects') router.register(r'workplaces', views.WorkViewSet, basename='workplaces') urlpatterns = router.urls
""" Inorder Traversal of a tree """ class Node: def __init__(self, val): self.data = val self.left = None self.right = None def printInorder(root): if root: printInorder(root.left) print(root.data, end = " ") printInorder(root.right) root = Node(4) root.left = Node(5) root.right = Node(6) root.left.left = Node(8) root.right.left = Node(2) root.right.left.left = Node(1) root.right.left.right = Node(12) root.right.right = Node(7) printInorder(root)
#!/usr/bin/env python # -*- coding: utf-8 -*- def search_a_2d_matrix_ii(matrix, target): """ 给定一个m*n的矩阵,请在该矩阵中找到一个目标数值,请注意,该矩阵有如下特性: 1.每行中的整数从左到右是依次增大的 2.每列中的整数从上到下是依次增大的 :param matrix: List[List[int]] :param target: int :return: bool """ if not matrix: return False row = len(matrix) col = len(matrix[0]) i, j = row - 1, 0 while i >= 0 and j <= col - 1: if matrix[i][j] < target: j += 1 elif matrix[i][j] > target: i -= 1 else: return True return False # def binary_search(nums, target): # start, end = 0, len(nums)-1 # while start + 1 < end: # mid = int((start + end) / 2) # if nums[mid] < target: # start = mid # elif nums[mid] > target: # end = mid # else: # return True # if nums[start] == target: # return True # if nums[end] == target: # return True # return False # # for nums in matrix: # if binary_search(nums, target): # return True # return False if __name__ == "__main__": nums = [ [1, 4, 7, 11, 15], [2, 5, 8, 12, 19], [3, 6, 9, 16, 22], [10, 13, 14, 17, 24], [18, 21, 23, 26, 30] ] target = 20 print(search_a_2d_matrix_ii(nums, target))
from distutils.core import setup from distutils.extension import Extension import sys import numpy #Determine whether to use Cython if '--cythonize' in sys.argv: cythonize_switch = True del sys.argv[sys.argv.index('--cythonize')] else: cythonize_switch = False #Find all includes numpy_include = numpy.get_include() #Set up the ext_modules for Cython or not, depending if cythonize_switch: from Cython.Distutils import build_ext from Cython.Build import cythonize ext_modules = cythonize([Extension("parallel.parallel", ["parallel/parallel.pyx"],include_dirs = [numpy_include], extra_compile_args=['-fopenmp'], extra_link_args=['-fopenmp'])]) else: ext_modules = [Extension("parallel.parallel", ["parallel/parallel.c"],include_dirs = [numpy_include], extra_compile_args=['-fopenmp'], extra_link_args=['-fopenmp'])] #Create a dictionary of arguments for setup setup_args = {'name':'parallel-test', 'version':'0.1.0', 'author':'Jason Rudy', 'author_email':'jcrudy@gmail.com', 'packages':['parallel',], 'license':'LICENSE.txt', 'description':'Let\'s try some parallel programming in Cython', 'long_description':open('README.md','r').read(), 'py_modules' : [], 'ext_modules' : ext_modules, 'classifiers' : ['Development Status :: 3 - Alpha'], 'requires':[]} #Add the build_ext command only if cythonizing if cythonize_switch: setup_args['cmdclass'] = {'build_ext': build_ext} #Finally setup(**setup_args)
''' Convert image to grayscale ''' import tensorflow as tf import matplotlib.image as mpimg import matplotlib.pyplot as plt filename = "../lesson3/MarshOrchid.jpg" raw_image_data = mpimg.imread(filename) image = tf.placeholder(tf.int32, [None, None, 3]) # Reduce axis 2 by mean (= color) # i.e. image = [[[r,g,b], ...]] # out = [[[ grayvalue ], ... ]] where grayvalue = mean(r, g, b) out = tf.reduce_mean(image, 2, keep_dims=True) # Associate r,g,b to the same mean value = concat mean on axis 2. # out = [[[ grayvalu, grayvalue, grayvalue], ...]] out = tf.concat([out, out, out], 2) out = tf.cast(out, tf.uint8) with tf.Session() as session: result = session.run(out, feed_dict={image: raw_image_data}) print(result.shape) plt.imshow(result) plt.show()
from typing import Generic, TypeVar, Callable T = TypeVar("T") class JSONStorageItem(Generic[T]): def __init__(self, _key: str, _default: Callable[[], T], /): ... def get(self) -> T: ... def set(self, value: T) -> None: ... def invalidate_cache(self) -> None: ...
import torch import numpy as np class MyQuantize(torch.autograd.Function): @staticmethod def forward(ctx, inputs,args): ctx.args = args x_lim_abs = args.enc_value_limit x_lim_range = 2.0 * x_lim_abs x_input_norm = torch.clamp(inputs, -x_lim_abs, x_lim_abs) if args.quantize == 2: outputs_int = torch.sign(x_input_norm) else: outputs_int = torch.round((x_input_norm +x_lim_abs) * ((args.quantize - 1.0)/x_lim_range)) * x_lim_range/(args.quantize - 1.0) - x_lim_abs return outputs_int @staticmethod def backward(ctx, grad_output): # STE implementations if ctx.args.enc_clipping in ['inputs', 'both']: input, = ctx.saved_tensors grad_output[input>1.0]=0 grad_output[input<-1.0]=0 if ctx.args.enc_clipping in ['gradient', 'both']: grad_output = torch.clamp(grad_output, -ctx.args.enc_grad_limit, ctx.args.enc_grad_limit) #print torch.min(grad_output), torch.max(grad_output) grad_input = grad_output.clone() return grad_input, None def quantizer(imgs, args): myquantize = MyQuantize.apply encoded = myquantize(imgs, args) encoded_imgs = encoded return encoded_imgs def add_qr(imgs): # add some things # add item for up left. new_imgs = imgs new_imgs[:, :, :7, :7] = -1.0 new_imgs[:, :, 1, 1:6] = +1.0 new_imgs[:, :, 5, 1:6] = +1.0 new_imgs[:, :, 1:6, 1] = +1.0 new_imgs[:, :, 1:6, 5] = +1.0 new_imgs[:, :, 7, :8] = +1.0 new_imgs[:, :, :8, 7] = +1.0 # add item for left down. new_imgs[:, :, -7:, :7] = -1.0 new_imgs[:, :, -2, 1:6] = +1.0 new_imgs[:, :, -6, 1:6] = +1.0 new_imgs[:, :, -6:-2, 1] = +1.0 new_imgs[:, :, -6:-2, 5] = +1.0 new_imgs[:, :, -8, :8] = +1.0 new_imgs[:, :, -8:, 7] = +1.0 # add item for right up new_imgs[:, :, :7, -7:] = -1.0 new_imgs[:, :, 1, -6:-2] = +1.0 new_imgs[:, :, 5, -6:-2] = +1.0 new_imgs[:, :, 1:6, -2] = +1.0 new_imgs[:, :, 1:6, -6] = +1.0 new_imgs[:, :, 7, -7:] = +1.0 new_imgs[:, :, :8, -8] = +1.0 return new_imgs def bsc(imgs, bsc_p, device): fwd_noise = torch.from_numpy(np.random.choice([-1.0, 1.0], imgs.shape, p=[bsc_p, 1 - bsc_p])).type(torch.FloatTensor).to(device) imgs = imgs*fwd_noise return imgs
from django.contrib import messages from django.contrib.auth import get_user_model from django.contrib.auth.decorators import login_required from django.db.models import Q from django.shortcuts import render, redirect, get_object_or_404 from feed.models import Post from .forms import UserRegisterForm, ProfileUpdateForm from .models import Profile, Relationship # Create your views here. User = get_user_model() def register(request): if request.method == 'POST': form = UserRegisterForm(request.POST) if form.is_valid(): form.save() messages.success(request, 'Registration successful Please Login') return redirect('home') else: form = UserRegisterForm() return render(request, 'account/register.html', {'form': form}) @login_required(login_url='/account/login/') def my_profile(request): profile = Profile.objects.select_related("user").prefetch_related( 'friends').get(user=request.user) user_post = Post.objects.select_related('user_name').filter( user_name=request.user).order_by('-date_posted') context = {'profile': profile, 'user_post': user_post} return render(request, 'account/my_profile.html', context) @login_required(login_url='/account/login/') def update_profile(request): if request.method == 'POST': form = ProfileUpdateForm(request.POST, request.FILES, instance=request.user.profile) if form.is_valid(): form.save() return redirect('my_profile') else: form = ProfileUpdateForm(instance=request.user.profile) context = { 'form': form } return render(request, 'account/edit_profile.html', context) @login_required(login_url='/account/login/') def friend_list(request): friends = request.user.profile.friends.select_related('profile') context = { 'friends': friends } return render(request, "account/friend_list.html", context) @login_required(login_url='/account/login/') def invites_received(request): profile = Profile.objects.select_related("user").get(user=request.user) qs = Relationship.objects.filter(receiver=profile, status='send').select_related( 'sender__user', 'receiver__user') results = list(map(lambda x: x.sender, qs)) is_empty = False if len(results) == 0: is_empty = True context = { 'qs': results, 'is_empty': is_empty, } return render(request, 'account/my_invites.html', context) @login_required(login_url='/account/login/') def accept_invitation(request): if request.method == "POST": pk = request.POST.get('profile_pk') sender = Profile.objects.get(pk=pk) receiver = Profile.objects.get(user=request.user) rel = get_object_or_404(Relationship, sender=sender, receiver=receiver) if rel.status == 'send': rel.status = "accepted" rel.save() return redirect('my_invites_view') @login_required(login_url='/account/login/') def reject_invitation(request): if request.method == "POST": pk = request.POST.get('profile_pk') sender = Profile.objects.get(pk=pk) receiver = Profile.objects.get(user=request.user) rel = get_object_or_404(Relationship, sender=sender, receiver=receiver) rel.delete() return redirect('my_invites_view') @login_required(login_url='/account/login/') def profile_list(request): # import pdb; # pdb.set_trace() all_profile = Profile.objects.select_related('user').prefetch_related( 'friends').exclude(user=request.user) profile = Profile.objects.select_related("user").get(user=request.user) all_relations = Relationship.objects.filter( Q(sender=profile) | Q(receiver=profile)).select_related( 'sender__user', 'receiver__user') receivers = [] senders = [] for item in all_relations: senders.append(item.sender.user) receivers.append(item.receiver.user) is_empty = False if not all_profile: is_empty = False context = { 'all_profile': all_profile, 'rel_receiver': receivers, 'rel_sender': senders, 'is_empty': is_empty } return render(request, 'account/profile_list.html', context) @login_required(login_url='/account/login/') def add_friend(request): if request.method == "POST": pk = request.POST.get('profile_pk') user = request.user # sender = Profile.objects.get(user=user) receiver = Profile.objects.get(pk=pk) rel = Relationship.objects.create(sender=user.profile, receiver=receiver, status='send') return redirect(request.META.get('HTTP_REFERER')) return redirect('my_profile') @login_required(login_url='/account/login/') def remove_friend(request): if request.method == "POST": pk = request.POST.get('profile_pk') user = request.user # sender = Profile.objects.get(user=user) receiver = Profile.objects.get(pk=pk) rel = Relationship.objects.get( (Q(sender=user.profile) & Q(receiver=receiver)) | ( Q(sender=receiver) & Q(receiver=user.profile))) rel.delete() return redirect(request.META.get('HTTP_REFERER')) return redirect('my_profile') @login_required(login_url='/account/login/') def search_users(request): query = request.GET.get('q') object_list = Profile.objects.select_related('user').prefetch_related( 'friends').exclude(user=request.user).filter( user__username__icontains=query) profile = Profile.objects.select_related("user").get(user=request.user) all_relations = Relationship.objects.filter( Q(sender=profile) | Q(receiver=profile)).select_related( 'sender__user', 'receiver__user') receivers = [] senders = [] for item in all_relations: senders.append(item.sender.user) receivers.append(item.receiver.user) is_empty = False if not object_list: is_empty = False context = { 'all_profile': object_list, 'rel_receiver': receivers, 'rel_sender': senders, 'is_empty': is_empty } # context = { # 'users': object_list # } return render(request, "account/search_users.html", context) @login_required(login_url='/account/login/') def user_profile(request): if request.method == "POST": pk = request.POST.get('profile_pk') print(pk) profile = Profile.objects.select_related("user").prefetch_related( 'friends').get(pk=pk) user_post = Post.objects.select_related('user_name').filter( user_name=profile.user).order_by('-date_posted') context = {'profile': profile, 'user_post': user_post} return render(request, 'account/user_profile.html', context) return redirect(request.META.get('HTTP_REFERER'))
print('{} DESAFIO 9 {}'.format('='*10, '='*10)) n = int(input('Digite um número: ')) print('\n\033[31mTABUADA DO {}\033[m'.format(n)) print('{} X {:2} = {:2}'.format(n, 0, n * 0)) print('{} X {:2} = {:2}'.format(n, 1, n * 1)) print('{} X {:2} = {:2}'.format(n, 2, n * 2)) print('{} X {:2} = {:2}'.format(n, 3, n * 3)) print('{} X {:2} = {:2}'.format(n, 4, n * 4)) print('{} X {:2} = {:2}'.format(n, 5, n * 5)) print('{} X {:2} = {:2}'.format(n, 6, n * 6)) print('{} X {:2} = {:2}'.format(n, 7, n * 7)) print('{} X {:2} = {:2}'.format(n, 8, n * 8)) print('{} X {:2} = {:2}'.format(n, 9, n * 9)) print('{} X {:2} = {:2}'.format(n, 10, n * 10))
__author__ = 'mike' import numpy as np import matplotlib.pyplot as plt def scatter_xy(ax, m_obj, x_dtype, y_dtype, x_component, y_component, **plt_opt): pass def generate_plots(n=3, xsize=5., ysize=5., tight_layout=False): """ Generates a number of subplots that are organized i a way to fit on a landscape plot. Parameter --------- n: int number of plots to be generated xsize: float size along x for each plot ysize: float size along y for each plot tight_layout: bool using tight_layout (True) or not (False) Returns ------- fig matplotlib figure instance """ a = np.floor(n ** 0.5).astype(int) b = np.ceil(1. * n / a).astype(int) # print "a\t=\t%d\nb\t=\t%d\na*b\t=\t%d\nn\t=\t%d" % (a,b,a*b,n) fig = plt.figure(figsize=(xsize * b, ysize * a)) for i in range(1, n + 1): ax = fig.add_subplot(a, b, i) fig.set_tight_layout(tight_layout) return fig def get_subplot(fig, i): """ Returns the axis object i from the figure that has been created with generate_plots :param fig: :param i: :return: """ n = len(fig.axes) a = np.floor(n ** 0.5).astype(int) b = np.ceil(1. * n / a).astype(int) ax = fig.add_subplot(a, b, i + 1) return ax def get_min_max_all_ax(fig): """ gets the minimim and maximum for xlim and of ylim """ xout = [] yout = [] #get xlimits for ax in fig.axes: xout.append(ax.get_xlim()) yout.append(ax.get_ylim()) xout = np.array(xout) yout = np.array(yout) return [np.min(xout), np.max(xout)], [np.min(yout), np.max(yout)] def set_lim_all_ax(fig, xlim=None, ylim=None): """ Sets the ylimits for all plots of the specified figure Parameters ---------- """ for ax in fig.axes: if xlim: ax.set_xlim(xlim) if ylim: ax.set_ylim(ylim) def create_heat_color_map(value_list, reverse=False): """ takes a list of values and creates a list of colors from blue to red (or reversed if reverse = True) :param value_list: :param reverse: :return: """ r = np.linspace(0, 255, len(value_list)).astype('int') r = [hex(i)[2:-1].zfill(2) for i in r] # r = [i.encode('hex') for i in r] b = r[::-1] out = ['#%2s' % r[i] + '00' + '%2s' % b[i] for i in range(len(value_list))] if reverse: out = out[::-1] return out
from lib.message.base_message import base_message from lib.util.error import DiscordError from lib.util.parameter import parameter class list_tags(base_message): length = { 'min': 0, 'max': 0 } def run(self, client): self.assert_length() p = parameter.getInstance() cfg = p.__config__ if not self.message.server.id in cfg.sections(): cfg.add_section(self.message.server.id) tags = [] for section in cfg.sections(): if section.endswith(':' + self.message.server.id): tags.append(section.split(':')[0]) if len(tags) == 0: raise DiscordError('No servers configured!') yield from client.send_message(self.message.channel, 'Currently the following tags are configured:' + self.format_list(tags)) def format_list(self,parts): return '\n\u2022 ' + ('\n\u2022 ').join(parts)
class Workset(WorksetPreview,IDisposable): """ Represents a workset in the document. """ @staticmethod def Create(document,name): """ Create(document: Document,name: str) -> Workset Creates a new workset. document: The document in which the new instance is created. name: The workset name. Returns: Returns the newly created workset. """ pass def Dispose(self): """ Dispose(self: WorksetPreview,A_0: bool) """ pass def ReleaseUnmanagedResources(self,*args): """ ReleaseUnmanagedResources(self: WorksetPreview,disposing: bool) """ pass def __enter__(self,*args): """ __enter__(self: IDisposable) -> object """ pass def __exit__(self,*args): """ __exit__(self: IDisposable,exc_type: object,exc_value: object,exc_back: object) """ pass def __init__(self,*args): """ x.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signature """ pass IsEditable=property(lambda self: object(),lambda self,v: None,lambda self: None) """Whether the workset is editable. Get: IsEditable(self: Workset) -> bool """ IsOpen=property(lambda self: object(),lambda self,v: None,lambda self: None) """Whether the workset is open (rather than closed). Get: IsOpen(self: Workset) -> bool """ IsVisibleByDefault=property(lambda self: object(),lambda self,v: None,lambda self: None) """Whether the workset is visible by default. Get: IsVisibleByDefault(self: Workset) -> bool """ Kind=property(lambda self: object(),lambda self,v: None,lambda self: None) """Kind of the workset. Get: Kind(self: Workset) -> WorksetKind """
from django.shortcuts import render from .models import SiteLoc, User from math import ceil from django.core.mail import send_mail # Create your views here. from django.http import HttpResponse def index(request): # products = Site.objects.all() # print(products) # n = len(products) # nSlides = n//4 + ceil((n/4)-(n//4)) allPlaces = [] catplaces = SiteLoc.objects.values('country', 'id') cats = {item['country'] for item in catplaces} for cat in cats: prod = SiteLoc.objects.filter(country=cat) n = len(prod) nSlides = n // 4 + ceil((n / 4) - (n // 4)) allPlaces.append([prod, range(1, nSlides), nSlides]) # params = {'no_of_slides':nSlides, 'range': range(1,nSlides),'product': products} # allProds = [[products, range(1, nSlides), nSlides], # [products, range(1, nSlides), nSlides]] params = {'allPlaces':allPlaces} return render(request, 'blog/index.html', params) def about(request): return render(request, 'blog/about.html') def home(request): return render(request, 'blog/home.html') def contact(request): return render(request, 'blog/contact.html') def siteView(request, myid): # Fetch the product using the id site = SiteLoc.objects.filter(id=myid) return render(request, 'blog/siteView.html', {'site':site[0]}) def addContact(request): if request.method == "POST": name = request.POST.get('name') email = request.POST.get('email') # print(name) # print(email) send_mail('Welcome to JourneyWithDeva', 'Thanks for being a part of this exciting journey. We will notify you with recent updates.', 'akshayraikar94@gmail.com', [email], fail_silently=False) usr = User(user_name=name, user_email=email) usr.save() return render(request, 'blog/about.html')
import dna import unittest class Test(unittest.TestCase): def test_dna(self): d = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC' actual = dna.count_nucleotides(d) self.assertEqual([20, 12, 17, 21], actual) if __name__ == "__main__": unittest.main()
from util import * from copy import deepcopy class Instance: def __init__(self, coord, datum): self.coord = coord self.datum = datum self.unknown = False def Coord(self): return [self.coord.x, self.coord.y, self.klass()] def klass(self): return self.datum[-1] class InstanceCollection: def __init__(self, data_collection): self.instances = [] self.max_x = 0 self.max_y = 0 self.datums = data_collection.datums east, west = data_collection.exhaustive_find_poles() #east, west = data_collection.find_poles() d = distance(east, west) #for i in range(30): # n_east, n_west = data_collection.find_poles() # if distance(n_east, n_west) > d: # east = n_east # west = n_west # d = distance(east, west) # self.east = east self.west = west count = 0 while not self.finish_instances(): count += 1 #print "COUNT,", count def finish_instances(self): completed = True base_d = distance(self.east, self.west) for datum in self.datums: a = distance(self.west, datum) b = distance(self.east, datum) if distance(self.east, datum) > distance(self.east, self.west) or distance(self.west,datum) > distance(self.east, self.west): if distance(self.east,datum) > distance(self.west, datum): self.datums.append(self.west) self.west = datum self.datums.remove(datum) else: self.datums.append(self.east) self.east = datum self.datums.remove(datum) completed = False self.instances = [] break x = (b**2 - base_d**2 - a**2) / (-2 * base_d) if x > self.max_x: self.max_x = x try: y = math.sqrt(a**2 - x**2) except ValueError: y = 0 if y > self.max_y: self.max_y = y self.instances.append(Instance(DataCoordinate(x,y), datum)) return completed def normalize_coordinates(self): for instance in self.instances: instance.coord.x = instance.coord.x / self.max_x instance.coord.y = instance.coord.y / self.max_y def log_x_coordinates(self): for instance in self.instances: instance.coord.x = math.log(instance.coord.x + 0.0001) def log_y_coordinates(self): for instance in self.instances: instance.coord.y = math.log(instance.coord.y + 0.0001) def klasses(self): return [ inst.klass for inst in self.instances ] def coords(self): return [ inst.coord for inst in self.instances ] def datums(self): return [ inst.datum for inst in self.instances ] def k_fold_stratified_cross_val(self, k=10): bins = [] bin_count = [] random.shuffle(self.instances,random.random) if not isnumeric(self.instances[0].klass()): data = sort_by_class(self.instances) for i in range(k): bins.append([]) bin_count.append(0) for instance in self.instances: try: index = bin_count.index(0) bins[index].append(instance) bin_count[index] = 1 except: for i in range(k): bin_count[i]=0 index = bin_count.index(0) bins[index].append(instance) bin_count[index] = 1 return bins def stratified_cross_val(self, option): random.shuffle(self.instances, random.random) if not isnumeric(self.instances[0].klass()): data = sort_by_class(self.instances) train_count = 0 test_count = 0 train = [] test = [] for instance in self.instances: if train_count < option[0]: train_count = train_count + 1 train.append(instance) elif test_count < option[1]: test_count = test_count + 1 test.append(instance) if train_count == option[0] and test_count == option[1]: train_count = 0 test_count = 0 return train, test def two_bins(self): random.shuffle(self.instances, random.random) g1 = self.instances[0:len(self.instances)/2] g2 = self.instances[(len(self.instances)/2)+1:-1] return g1, g2 def shuffle(self): random.shuffle(self.instances, random.random) class DataCoordinate: def __init__(self, x, y): self.x = x self.y = y class DataCollection: def __init__(self, datums): self.datums = datums self.backup = deepcopy(datums) def add_datum(self, datum): datums.append(datum) def find_poles(self): this = random_element(self.datums) self.datums.remove(this) east = farthest_from(this, self.datums) self.datums.remove(east) self.datums.append(this) west = farthest_from(east, self.datums) self.datums.append(east) self.datums.append(west) return east, west def exhaustive_find_poles(self): d = [-1, None] for datum in self.datums: for other_datum in self.datums: if distance(datum, other_datum) > d[0]: d[0] = distance(datum, other_datum) d[1] = (datum, other_datum) return d[1][0], d[1][1]