blob_id string | repo_name string | path string | length_bytes int64 | score float64 | int_score int64 | text string | is_english bool |
|---|---|---|---|---|---|---|---|
7650bcd47d6f32188fca7b77d1dbfd7b9202cf37 | ankushjassal01/Python-Learning | /B.Input and output files/4.Appending data on files.py | 1,022 | 4.625 | 5 | # append mode
# we can write data to a file in append mode ('a') too
# with append mode we can write the data to the end of the file . it do not overwrite the data in a file like write
# rather then that it write the data and let previous data in the file
# append can also create the file if it not present in file dire... | true |
e7bf9509a8d0eb7869166293f985fd43215eed53 | ankushjassal01/Python-Learning | /C.functions & Methods/10.Parameter types.py | 1,525 | 4.28125 | 4 | # params
# keyword or positional params
# (var, name=var)
# var-positional
# (*args)
# var-keyword
# (**kwargs)
# keyword only: that can defined as keyword or *, it must be call with its defined keyword
# like if k or p then call it with k or p
# positional only :: that can be supplied only by position
# VAR-POSITIONA... | true |
f0b1a8a8ab982004a96e1019a5439a09a898a3cd | ankushjassal01/Python-Learning | /C.functions & Methods/2.Return & without Return.py | 2,209 | 4.125 | 4 | # %% returns values
def years(prompt):
while True:
temp = input(prompt)
if temp.isnumeric() and len(temp) == 4:
return int(temp)
else: # we can remove else and write code like line 35
print('-----that is not a year.. type again-----')
# print('-----that is no... | true |
30ca9eafa4f946755018b262d80a9b411f6f0c99 | dayananda30/Crack_Interviews | /Datastructure_Algorithms/LinkedList/SingleLinkedList/SinglyLinkedList-1.py | 1,823 | 4.40625 | 4 | #URL : https://www.youtube.com/watch?v=RhCGA4jlPmQ&list=PLzjoZGHG3J8vdUH75YPqmO7lbQl_M-xXo&index=2
# Create Nodes
# Create LinkedLists
# Add Nodes to LinkedLists
# Print Nodes
"""
Creating Nodes , LinkedLists and adding the Nodes to the Linked at the END. and displaying all the Node's Data
"""
class Node:
def... | true |
91dd4b374f49306c4054105aa9ab6c9763b13d9e | dayananda30/Crack_Interviews | /Datastructure_Algorithms/LinkedList/SingleLinkedList/SinglyLinkedList-4.py | 1,454 | 4.15625 | 4 | class Node:
def __init__(self,data):
self.data = data
self.next = None
class LinkedList:
def __init__(self):
self.head = None
def insertAtBeginning(self,newNode):
if self.head is None:
self.head = newNode
def insertAtEnd(self,newNode):
cur = self.... | true |
7831daa9c144f7adb41db02a0c55627b9de70d25 | dayananda30/Crack_Interviews | /Comprehensive Python Cheatsheet/File_Parser/XML/Parsing-4.py | 1,433 | 4.34375 | 4 | """
Modifying an XML file
ElementTree.write() provides a simple way to build XML documents and write them to files.
Once created, an Element object may be manipulated by directly changing its fileds(such as Element.text),
adding and modifying attributes(Element.set() method) as well as adding new children (eg: Elemen... | true |
9199b86100ff14ef01b3502ec8aeb89af8698e47 | nishant184/Python-Core-and-advanced | /inputoutput.py | 606 | 4.21875 | 4 | name="nishant"
marks=45.5
print("name is ",name,"marks are ",marks)
#anothe way is
print("Name is %s marks are %d"%(name,marks))
#another way is by placeholders
#print("name is {},marks are{}",format(name,marks))
#Input function
s=input()
print(s)
s1=input("Enter your name")
print(s1)
#Input function considers all the... | true |
1af8a51efe1515821b3477723e5323f509f142aa | nishant184/Python-Core-and-advanced | /breakcontinue.py | 703 | 4.21875 | 4 | #Break is used to break the loop if the condition ia true
lst=[3,1,2,5,6,2]
for i in lst:
if i==5:
break
print(i)
#In the above for loop the loop stop executing after the value of is 5
#It will not print the elements after 5
#Continue
#To print numbers from 1 to 20 but skip multiples of 3
x=0
while x<2... | true |
c0f6550cdbe70d83a3bc1e686e34f55eabc2ceab | nishant184/Python-Core-and-advanced | /dictionary.py | 418 | 4.375 | 4 | #Dicitonary is denoted by curly braces and it has key and values
d1={"nishant":22,"sumit":21}
print(d1)
#Items attribute will display all the elements in a dictionary
print(d1.items())
#Keys attribute will display all the keys
d2=d1.keys()
for i in d2:
print(i)
#Values attribute will display all the values
d3=... | true |
fef05b423bd91fb9b790c7473645383ca7810f52 | TheLukeRussell/6-1-number-guesser-game | /b.py | 1,009 | 4.15625 | 4 | print("\t\t Think you can outsmart a computer in 2020?")
print("\n\t The computer should have the upperhand...")
import random
numberOfGuesses = 0
name = input('\n What is your name? ')
number = input('\n Hello ' + name + '!' + ' What number would you like to select? ')
print('\n So ' + name + ',' + ' you chose the ... | true |
10304dddaa84a4305a418091fd6d02781d511261 | visajkapadia/data-structures-python | /SinglyLinkedList/reverse_iterative.py | 695 | 4.25 | 4 | def reverse_iterative(self):
# 0(n)
if self.head is None:
# if 0 elements
return
if self.head.next is None:
# if single element
return
if self.head.next.next is None:
# if two elements
ptr = self.head.next
ptr.next = self.head
self.head.n... | true |
2a3e59272afb26c611047c25d962bbb61f303b74 | sshalu12/Turtle-Race | /main.py | 1,057 | 4.15625 | 4 | from turtle import Turtle, Screen
import random
screen = Screen()
screen.setup(width=500, height=400)
user_input = screen.textinput(title="Make Your Bet", prompt="Which turtle will win the race?\nColors: red, blue, yellow, green, purple\nEnter a color:")
race_start = False
turtle_list = []
x = -230
y = -80
color = ["... | true |
633938a0de83d96f1da632697b1f6a6399f8ef2f | Chamillion1/Girls-Who-Code-Projects- | /Atom/Pythonfile2.py | 254 | 4.21875 | 4 | number = 3
tries = 0
guess = int(input("Guess a number"))
for tries in range (0, 2):
if number > guess:
guess = int(input("Guess higher"))
elif number < guess:
guess = int(input("Guess lower"))
print ("the correct number is 3")
| true |
479eb58bf59e1abcefbdc3f47d3b3f9a63d223d4 | michaelrizzo2/python_certification | /while_loops.py | 226 | 4.3125 | 4 | #while something is true do something.
x=1
while x<=10:
x+=1#We need this to prevent an infinite loop.
if x==6:
continue#This will skip over 6
print(f"The value of x is {x}")
else:
print("Out of loop") | true |
0532b742fe12455ba56408f5d124afa3679c9f3c | michaelrizzo2/python_certification | /Section_04/assignment_02.py | 826 | 4.5 | 4 | # Assignment 2
"""
Create a method called pay_extra that accepts 2 parameters:
working, and hour. This method will be used to decide whether
an employee will receive extra pay or not. If an employee is working
during the hrs of 8pm until 8am in the morning, that means they
should be paid extra. In that situation t... | true |
9b27e80a2a3e2762772a70f03e5046e15ef12485 | pcmac77/fs-python-interview | /simple_transposition.py | 676 | 4.5 | 4 | #Simple transposition is a basic and simple cryptography #technique. We make 2 rows and put first a letter in the #Row 1, the second in the Row 2, third in Row 1 and so on #until the end. Then we put the text from Row 2 next to #the Row 1 text and thats it.
#Complete the function that recieves a string and encrypt #it... | true |
1b1f4aa51520ca3079fc33e023a52cc2f764cb8e | hayleylandsberg/Python-Orientation-Exercises | /lists/planets.py | 1,478 | 4.75 | 5 | # 1. Use append() to add Jupiter and Saturn at the end of the list.
# 2. Use the extend() method to add another list of the last two planets in our solar system to the end of the list.
# 3. Use insert() to add Earth, and Venus in the correct order.
# 4. Use append() again to add Pluto to the end of the list.
# 5. Now t... | true |
57f49eb14dd0bba22ba4f9ea1f7c6aaab8abe158 | hyonschu/learnpython | /gattaca.py | 1,212 | 4.15625 | 4 | """
Given a file in the following format:
GATAGGAGTAGTGAGT
GTAGTAGAGTATGATAGTGTA
GATTAGATGATGATG
GATATATAGATATATTAGAT
GATAGATAGT
GATTAAGATATGATAGTAG
GATTAGATAGTAGTAGT
GTATAGATAGTAGTAGTGATGA
GTAGATGATGATAGTAGTAGT
GAAGTAGTGATGAGTAG
For every position in the string, find the breakdown (in percentage) for each symbol enc... | true |
6cfadff80a9fec98062f721bb5c285278d7e2758 | Neelavdeep/Incubyte | /Incubyte_Assignment.py | 1,437 | 4.1875 | 4 | import pandas as pd
import sqlite3
def create_connection(db_file):
""" create a database connection to the SQLite database
specified by db_file
:param db_file: database file
:return: Connection object or None
"""
conn = None
try:
conn = sqlite3.connect(db_file)
... | true |
d3e7d3e0069156a380ffe62c06bdbd1a147b28f6 | ds-ga-1007/assignment7 | /jub205/assignment7.py | 1,008 | 4.1875 | 4 | from interval.interval import interval, insert
def startProgram():
'''Function runs the program to take list of intervals and then new interval
each time from the user and inserts the new interval to the list of intervals
and merges if overlapping or adjacent then returns the new list of intervals.
Pro... | true |
78729217896cd9043c4e073c5a3c8e38fe162a0b | suburban-daredevil/100DaysOfCode | /Day 4/search.py | 1,000 | 4.125 | 4 | # returns the row and column of the target element, if target is found
# returns -1,-1 if target is not found
def search(mat, target):
# we keep decrementing the search space until the target is found
# n represents the maximum column value
n = len(mat[0])
# row takes the minimum row value
row = ... | true |
bf75a93a8dde161215dd4e88f9ae6cdf0cf9c24a | flannerychristopher/MIT_online_problem_sets | /6.0001/ps4/ps4a.py | 2,100 | 4.28125 | 4 | # Problem Set 4A
# Name: <your name here>
# Collaborators:
# Time Spent: x:xx
def get_permutations(s, i=0):
'''
Enumerate all permutations of a given string
sequence (string): an arbitrary string to permute. Assume that it is a
non-empty string.
You MUST use recursion for this part.... | true |
ef382b4a480d13f62cdd24f7d42be9ff2800f459 | stephenmcnicholas/PythonExamples | /progs/CaesarCipherEnhanced.py | 521 | 4.21875 | 4 | # Caesar cipher.
text = input("Enter your message: ")
shift = int(input("How many characters do you want to shift? "))
cipher = ''
for char in text:
if not char.isalpha():
cipher += char
continue
if char.isupper():
code = ord(char) + shift
if code > ord('Z'):
... | true |
02efbb866401941fead9c61a79f29031f3736102 | JanDitzen/python-boot-camp | /think-python/chapter-17/Time.py | 2,905 | 4.5625 | 5 | import datetime
import copy
class Time(object):
"""Represents the time of day."""
def __init__(self, hour=0, minute=0, second=0):
"""Initializes a Time object with the following attributes:
hour: (int)
minute: (int)
second: (int)
... | true |
f585ad505d895bba3754ccbf795a086a443c806d | JanDitzen/python-boot-camp | /think-python/chapter-17/Point.py | 1,175 | 4.53125 | 5 | import math
class Point(object):
"""Represents a point in 2D space."""
# solution to exercise 2
def __init__(self, x=0.0, y=0.0):
"""Initializes a Point object with the following attributes:
x: (float) x-coordinate of the point.
y: (float) y-coordinate of the p... | true |
6f46236c25eebe013fc54d5e1693989d41b63ccd | padawan66/Exploring-Numpy | /numpy_basics/numpy_basics.py | 2,494 | 4.28125 | 4 | import numpy as np
# ndarray in numpy is an n dimensional array which contains homogenous element ( of same datatype).
array = np.array([[2,3],[4,5]],np.int32) # This is a two dimensional array with two rows and two columns
array = np.array([[7,5,4,3,5],[4,5,7,8,2],[1,4,3,5,6]]) # this is a two dimensional array wi... | true |
8f717d1c8af82864b479f4c2e6f33ed8d27be203 | MaryBeth8/Stand-alone-docs | /loops-max-num.py | 272 | 4.375 | 4 | """This function named takes a list of numbers named nums as a parameter.
It returns the largest number in nums.
"""
def max_num(nums):
largest = nums[0]
for num in nums:
if largest < num:
largest = num
return largest
print(max_num([50, -10, 0, 75, 20])) | true |
b482a0038263c301267f33c355085a92053ac95f | MaryBeth8/Stand-alone-docs | /list-append-sum-last-two.py | 363 | 4.3125 | 4 | """This function adds the last two elements of lst together and appends the result to lst.
It does this process three times and then return lst.
"""
def append_sum(lst):
new_lst = lst
count = 3
while count != 0:
last1 = new_lst[-1]
last2 = new_lst[-2]
new_lst.append(last1 + last2)
count -= 1
r... | true |
b2becc47b07aae17b58c49799e5f28d33da96fa2 | AssafHMor/intro2cs-python | /intro2cs-python/ex10/PathScanner.py | 2,534 | 4.4375 | 4 | class PathIterator:
"""
An iterator which iterates over all the directories and files
in a given path (note - in the path only, not in the
full depth). There is no importance to the order of iteration.
"""
pass
def path_iterator(path):
"""
Returns an iterator to the current path's file... | true |
c7b82285e70a33d5f53242f1689e017b8acbb571 | AssafHMor/intro2cs-python | /intro2cs-python/ex3/findSecondSmallest.py | 1,125 | 4.15625 | 4 | ###############################################################################
#FILE: findSecondSmallest.py
#WRITER: Assaf_Mor + assafm04 + 036539096
#EXCERSICE: intro2cs ex3 2014-2015
#DESCRIPTION:
#a program which calculates the second smallest value entered by the user
##############################################... | true |
34ebb326eaa3445af03ac0f4fa0d5a3d0f910251 | AssafHMor/intro2cs-python | /intro2cs-python/ex3/findLargest.py | 898 | 4.4375 | 4 | ###############################################################################
#FILE: findLargest.py
#WRITER: Assaf_Mor + assafm04 + 036539096
#EXCERSICE: intro2cs ex3 2014-2015
#DESCRIPTION:
#this code finds the largest number inserted by the user, while the user
#restricts himself with the numbers he is able to ente... | true |
a0df03fb0ec1e744a3b7f026a91f306a82e8aaf0 | Billoncho/CircleSpiralInput | /CircleSpiralInput.py | 1,123 | 4.65625 | 5 | # CircleSpiralInput.py
# Billy Ridgeway
# Draws a colorful circle spiral with the number of sides input by the user.
import turtle # Imports turtle graphics.
t = turtle.Pen() # Creates a new turtle called t.
t.speed(0) # Sets the pen's speed to fast.
turtle.bgcolor("bla... | true |
9f5e96b50c4df2ebbe3c32bbc8af04ee684c3470 | hoalexander44/PreviousWorks | /unit_conversion.py | 1,192 | 4.71875 | 5 | #This is a unit converter
# intro text that introduces the user what this program does and how to use it
print('Welcome to the length conversion wizard')
print('This program can convert between any of the following lengths.')
print('inches\nfeet\nyards\nmiles\nleagues\ncentimeters\ndecimeters\nmeters\ndecameters\nhect... | true |
cfda2ffcc392b008ad4c502d12e5ae49db3d78c4 | jwmcgettigan/project-euler-solutions | /solutions/001/solution.py | 229 | 4.15625 | 4 | def multiple_of(num, multiple):
return num % multiple == 0
def sum_of_multiples(limit):
return sum(x for x in range(limit) if multiple_of(x, 3) or multiple_of(x, 5))
if __name__ == "__main__":
print(sum_of_multiples(1000)) | true |
ec2ee99c8b762cd2ee2b6cb8ea9930396dc3f82d | stavernatalia95/Lesson-7.2-Assignment | /Lesson7.2Exercise #1.py | 317 | 4.34375 | 4 | # Create a program that will output everything in lowercase whatever the user will input. The program should run until the client enters the word “STOP”.
user_input=""
print("My hobbies are: ")
while user_input !="STOP":
user_input=input("What are your hobbies? ")
print(user_input.lower())
| true |
1d36ba99a9b75829ac66cb44f17dfdb0cd1c9c31 | sahiljethani/Sorting-Searching-Algorithms | /Algorithms in Python/bubble-sort.py | 1,077 | 4.34375 | 4 |
# Sorting function
def bubbleSort(arr):
size = len(arr)
for i in range(size - 1):
for j in range (0, size - i - 1):
if arr[j] > arr[j + 1]:
arr[j], arr[j + 1] = arr[j + 1], arr[j]
return arr
n = int(input("Enter size : "))
arr = list()
print("Enter elements : ")
fo... | true |
7831ef64119affc0e088997bc7afe8a7e8fc1c88 | asimkaleem/LPTHW | /ex16.py | 1,180 | 4.125 | 4 | # -*- encoding: UTF-8 -*-#
"""
close — Closes the file. Like File->Save.. in your editor.
read—Reads the contents of the fi le. You can assign the result to a variable.
readline—Reads just one line of a text fi le.
truncate—Empties the fi le. Watch out if you care about the fi le.
write(stuff)—Writes stuff to the file... | true |
8b3f5fcce6468ad5da112373ec295aed80f78f11 | marmarmar/know_your_neighborhood | /ui.py | 1,227 | 4.3125 | 4 |
def printing(content):
"""Prints output"""
print(content)
def get_input(inputs):
"""Takes input from user."""
return input(inputs)
def display_menu():
"""Prints menu"""
print("""\nWhat would you like to do?:
(1) List statistics
(2) Display 3 citie... | true |
7959ea358e20ae2a5c633a8f2ca0fa3fdfaef473 | gokul22-rg/Interview_Task | /5th-Qus.py | 740 | 4.28125 | 4 |
#5 - Write a function that will take a file name fname and a string s as input. It will return whether s occurs
#inside the file. It's possible that the file is extremely large so it cannot be read into memory in one shot.
def read_in_chunks(file_object, chunk_size=1024):
while True:
data = fil... | true |
73141680e4c891d84e91da9c3b7b4161d62210f2 | approximata/exam-python-2016-06-27 | /first.py | 586 | 4.21875 | 4 | # Create a function that takes a list as a parameter,
# and returns a new list with every second element from the orignal list
# It should raise an error if the parameter is not a list
# example: [1, 2, 3, 4, 5] should produce [2, 4]
def get_secound_elements(raw_list):
if type(raw_list) != list:
raise Valu... | true |
e59b229696de195d762a3f2e1e2d9f914fea3e4a | Adityavj19/WeekendAssignment1 | /Question3.py | 629 | 4.28125 | 4 | #Question-3 Define a function that can accept two strings as input and print the string with maximum length in console.
#If two strings have the same length, then the function should print al l strings line by line.
string1 = raw_input("Enter first String:")
string2 = raw_input("Enter second String:")
def CompareStr... | true |
1817a166473c58efc6fb4527c684653e0b69d05a | dinnguyen1495/daily-coding | /DC25.py | 1,517 | 4.4375 | 4 | # Daily Coding 25
# Implement regular expression matching with the following special characters:
# . (period) which matches any single character
# * (asterisk) which matches zero or more of the preceding element
# That is, implement a function that takes in a string and a valid regular expression and returns whethe... | true |
83c880d94fc21250fc36be1b2a3c0b29b7348a73 | dinnguyen1495/daily-coding | /DC04.py | 830 | 4.15625 | 4 | # Daily Coding 0
# Given an array of integers, find the first missing positive integer in linear time and constant space.
# In other words, find the lowest positive integer that does not exist in the array. The array can
# contain duplicates and negative numbers
# For example, the input [3, 4, -1, 1] should give 2. Th... | true |
4fcf2c108cbafd67cfdb0b302e9a1ed0d888db98 | Voloshiraptor/Python-Learning | /Lesson 3/PigLatin.py | 806 | 4.34375 | 4 | # Pig Latin is a language game, where you move the first letter of the word to the end and add "ay."
# So "Python" becomes "ythonpay." To write a Pig Latin translator in Python, here are the steps we'll need to take:
# Ask the user to input a word in English.
# Make sure the user entered a valid word.
# Convert the wo... | true |
27f5d99f06351a228c7dba4cb605fd6adb4c8244 | 31337Anika/study | /Projects/Decision_maker_3.0.py | 2,031 | 4.125 | 4 | values = []
parameters = []
number_of_values = int(input("enter number of values:"))
count_of_values = 0
number_of_parameters = int(input("enter number of parameters:"))
count_of_parameters = 0
while count_of_values < number_of_values:
value_name = input("enter value's name:")
values.append(value_name)
... | true |
4fcd2cab3d1a3c86f65bb09151d69eaffbccc224 | v1ctorf/dsap | /1_python_primer/01_23_C.py | 793 | 4.125 | 4 | print("""
Give an example of a Python code fragment that attempts to write an element to a list
based on an index that may be out of bounds. If that index
is out of bounds, the program should catch the exception that results, and
print the following error message: “Don’t try buffer overflow attacks in Python!”
""")
f... | true |
012384a51364f19aaa8f7de325c07cd2c130cb41 | omarakamal/Teaching-Python | /String Methods.py | 336 | 4.3125 | 4 | #string method
# .strip() strips the spaces before and aftet the string
# len() gives you the length of the characters in the string. its a function
# .split() creates a list out of the string you give it
#.upper makes the letters uppercase
#lower (makes the letters lowercase)
text = input("input something: ")
print(t... | true |
632783afebb9b0852e0455cb6cc07eaa74767845 | narcisolobo/march_python_lectures | /lectures/w1d2_am_loops.py | 1,749 | 4.25 | 4 | # Python Stack - Day 2
# Loops (Deeper Dive)
# for-in loops with range() function
# for-in loops over lists with range() function
# colors = ['blue', 'yellow', 'green', 'red']
# for i in range(len(colors)):
# print(colors[i])
# # for-in loops over lists without range() function
# for color in colors:
# prin... | true |
ee9e4c88b5f60319d7f4fa9e4533f34f25dd6753 | akanimax/toxic-comment-identification-tensorflow | /Models/common/Pickler.py | 1,597 | 4.1875 | 4 | """ The module for helping the pickling process
"""
import pickle # for pickling the data
import os # for path related operations
# Simple function to perform pickling of the given object. This function may fail if the size of the object
# exceeds
# the max size of the pickling protocol used. Although this is high... | true |
dfc36b59a8e9506676330c6a347ea3254257d44c | MelaniPrathibha/Guess-the-word | /Guess_the_word.py | 1,668 | 4.25 | 4 | #Guess the word
import random
def introduction():
global letter_count
global turns
#introduction
print("\nLet's play Guess the Word")
print(f"You have {turns} turns to guess the word!")
#to show length of the word
print(" _ "*letter_count)
def main():
global turns
global guesses
... | true |
3f1015c131e1e8e27e31c54d94f84c95815cd973 | frazentropy/DSP | /NumPyTuts/numpy_slicing.py | 751 | 4.21875 | 4 | import numpy as np
a = np.arange(10)
s = slice(2,7,2)
print(a[s])
b = a[2:7:2]
print(b)
b = a[5]
print(b)
# slice items starting from index
print(a[2:])
# slice items between indices
print(a[2:5])
# slice items starting from index
a = np.array([[1,2,3],[3,4,5],[4,5,6]])
print('Now we will slice the array from the ... | true |
b82ea7cee9a20a5785b3df708ac8ba0e44f3819a | tryan19/375_cs | /chapter02/average_calculator.py | 370 | 4.125 | 4 | #average_calculator.py
#test scores to test average
#by: Tom Ryan
def main():
score=input("whats the score?")
total=0
scores=0
while score!="":
print(score)
total = total + eval(score)
score = input("whats the next score?")
scores = scores +1
averages = total / scor... | true |
331d3d8a175fef3caa6325705c5ceb55e1b370f2 | AkhilReddykasu/Lists | /25_selecting_item_randomly.py | 426 | 4.125 | 4 | """selecting item randomly and print index and values"""
li = []
n = int(input("enter the length:"))
for i in range(0,n):
ele = int(input("enter an element:"))
li.append(ele)
i = int(input("enter the value you want search for:"))
if i in li:
print("searched element is available")
print("ind... | true |
c8f73d012a4b3238ecb79ac8e310fb3433e79ebe | taylorcavazos/hw1-Sorting | /example/algs.py | 2,156 | 4.25 | 4 | import numpy as np
def pointless_sort(x):
"""
This function always returns the same values to show how testing
works, check out the `test/test_alg.py` file to see.
"""
return np.array([1,2,3])
def bubblesort(x):
"""
Sort array by looping through array, swapping unordered
adjacent elem... | true |
83c39ad37b13554ae684070d58ed2c5dfb92b04f | brittanyvamvakias/Programming-Lab-3 | /q2.py | 2,055 | 4.4375 | 4 | # File: q2.py
# Author: Brittany Vamvakias
# Date: 02/11/2020
# Section: 501
# E-mail: brittvam@tamu.edu
# Description: This code prompts the user to input the height for a triangle and two symbols to use for the triangle. The code then runs a while loop producing the correct amount of symbols in each row, starting fro... | true |
7b275d2427955b4a7eafcd1552f4a3e71807188b | sorin-66/Hackathon_V1 | /Hackathon_16.py | 960 | 4.25 | 4 | """
16 - Write a program that can take two strings as an input. The program should swap around
every other letter in each string, and return both as an output. For instance, if the input is
“Osamu” and “Dazai”, the output should be “Oaaau” and “Dszmi”. If the two input strings are not
the same length, the outputs s... | true |
577ce6979381bfd85fc34f1d56794975b3db1e4c | sorin-66/Hackathon_V1 | /Hackathon_6.py | 675 | 4.21875 | 4 | '''
6 - Write a function that will round a float in reverse.
If the input has a decimal greater than or
equal to .5 then in should round down. If the decimal is less than .5 it should round up.
'''
number_2 = 1.2345
number_1 = 9.8765
# transform the float in a string
num1_str = str(number_1)
# find the index... | true |
b8a833b65f66845341d41b551c922b4c1c9895f3 | skhan55/Notes_330_Part2 | /helpful non-project code/write_note.py | 1,348 | 4.28125 | 4 | import os
import pickle
#An extremely simple and bare minimum for writing and reading in user created notes
#using python and the pickle library.
#make sure to create a folder named note_library in the same directory so the program can actually save the notes
class Note(object):
def __init__ (self, pbody, author,... | true |
6072d7eadf78132a2eb340ca4ffb1b89f400dd99 | brcsomnath/competitive-programming | /leetcode/snake-game.py | 1,355 | 4.5 | 4 | '''
353. Design Snake Game
Design a Snake game that is played on a device with screen size = width x height.
Play the game online if you are not familiar with the game.
The snake is initially positioned at the top left corner (0,0) with length = 1 unit.
You are given a list of food's positions in row-column order. Wh... | true |
b7aa899f973e596410b4fa357d366e8df8f5a9ac | Jmw150/Computational-Science | /old-code/newtonsMethod.py | 2,744 | 4.15625 | 4 | #!/usr/bin/env python
# Newton's method
# made by: Jordan Winkler
# finds an approximation of a root using Newton's Method
# This program is weak against injection attacks.
# option -f for fractions, default floating point
# -d for debugging or verbose mode
# -i [number] for iterations of function
# ... | true |
7ccc974fd865094b5094ffbaddf53283e913d5a2 | gautamgitspace/interview-cake | /reverse-words.py | 448 | 4.65625 | 5 | #In Python, strings are immutable. Changing a string does not
#modify the string. It creates a new one. Hence no point of doing
#it in place.
#APPROACH : def reverse_words: split the string to get a list. Perform
#in place list reversal by extended slice
def reverse_words(input):
result = " ".join(input.split()[::... | true |
fc6eb00864a7e07c1828e517f7c47b2cb5c222de | gautamgitspace/interview-cake | /highest-product_negative_integers.py | 1,282 | 4.5625 | 5 | """
Keep track of the highest_product_of_2 and lowest_product_of_2(could be a low negative number).
If the current number times one of those is higher than the current highest_product_of_three,
we have a new highest_product_of_three!
So at each iteration we're keeping track of and updating:
highest_product_of_three
h... | true |
3ccd3ad1bc9c5ea77ff7b89864eeb9feb44521aa | lpdonofrio/D06 | /HW06_ch09_ex05.py | 1,274 | 4.28125 | 4 | #!/usr/bin/env python3
# HW06_ch09_ex05.py
# (1)
# Write a function named uses_all that takes a word and a string of required
# letters, and that returns True if the word uses all the required letters at
# least once.
# - write uses_all
# (2)
# How many words are there that use all the vowels aeiou? How about
# aeio... | true |
129cd69aba7ec0cdd91342f8971a7f4bbb0755f6 | wakafengfan/Leetcode | /hard/longest_valid_parentheses.py | 753 | 4.1875 | 4 | """
Given a string containing just the characters '(' and ')', find the length of the longest valid (well-formed) parentheses substring.
Example 1:
Input: "(()"
Output: 2
Explanation: The longest valid parentheses substring is "()"
Example 2:
Input: ")()())"
Output: 4
Explanation: The longest valid parentheses subst... | true |
103a52662137cb93c60a199db26aa2b256a2a3a2 | wakafengfan/Leetcode | /medium/greedy__merge_intervals.py | 789 | 4.28125 | 4 | """
Given a collection of intervals, merge all overlapping intervals.
Example 1:
Input: [[1,3],[2,6],[8,10],[15,18]]
Output: [[1,6],[8,10],[15,18]]
Explanation: Since intervals [1,3] and [2,6] overlaps, merge them into [1,6].
Example 2:
Input: [[1,4],[4,5]]
Output: [[1,5]]
Explanation: Intervals [1,4] and [4,5] are ... | true |
8d00f42d9336d01a6ad68cb9815f9a1b7e35cda9 | wakafengfan/Leetcode | /tree/invert_binary_tree.py | 960 | 4.15625 | 4 | """
Invert a binary tree.
Example:
Input:
4
/ \
2 7
/ \ / \
1 3 6 9
Output:
4
/ \
7 2
/ \ / \
9 6 3 1
Trivia:
This problem was inspired by this original tweet by Max Howell:
Google: 90% of our engineers use the software you wrote (Homebrew), but you can’t invert a bina... | true |
bf2647b15d32824d644f7133d1e69647f4db6ce5 | wakafengfan/Leetcode | /medium/greedy__non_overlapping_intervals.py | 1,141 | 4.3125 | 4 | """
Given a collection of intervals, find the minimum number of intervals you need to remove to make the rest of the intervals non-overlapping.
Example 1:
Input: [[1,2],[2,3],[3,4],[1,3]]
Output: 1
Explanation: [1,3] can be removed and the rest of intervals are non-overlapping.
Example 2:
Input: [[1,2],[1,2],[1,2]... | true |
6329deb1d8df152e67d676dd2cc56328b5ce3b82 | fatcam84/monitor-beach | /selectiveCopy.py | 456 | 4.21875 | 4 | """
This program will search a given directory for files with desired suffix and move them all to a different directory.
In this example, I am searching my 'Downlaods' folder and moving all the .zip files to a folder called 'zip_files'.
"""
import os, shutil
os.chdir('C:\\Users\\Camer\\Downloads')
for... | true |
239050fcc091665d00c757cd7ca79a2936052063 | g2des/taco4ways | /hackerrank/primeorder.py | 1,407 | 4.15625 | 4 | #!/bin/python3
import math
import os
import random
import re
import sys
#
# Complete the 'sortOrders' function below.
#
# The function is expected to return a STRING_ARRAY.
# The function accepts STRING_ARRAY orderList as parameter.
#
def sortOrders(orderList):
# Write your code here
primeOrders = []
... | true |
9bbb55df3f385c362604017dd71b02e2fdaa5d68 | Jamshid93/TypeConversations | /type.py | 450 | 4.21875 | 4 | name=input("What is your name?")
print(type(name))
birth_day=input("Pleace tell me your brithday?")
print(type(birth_day))
age=2019-int(birth_day)
favourite_color=input("What is your favourite color?")
print(type(favourite_color))
print(name +" born at the "+ birth_day +" nowadays his age is " +str(age) + " his likes ... | true |
d8fe61aa1db2924aceeb30761254f85e4a89b7bc | jrprotzman/Module2.4 | /main/camper_age_input.py | 1,297 | 4.21875 | 4 | """
Program: TDD First Program.py
Author: Justin Protzman
Last date modified: 06/03/2020
Program specifications: The program will have will prompt for the age of one infant (age 1-5 years) who is attending camp and convert the age in months to years via a function call then print the result.
Write a program camper_a... | true |
21505d1ce1b739c596561254149f124ac69e5821 | reco92/pychallenges | /june20.py | 2,102 | 4.3125 | 4 |
def bishops_can_attack(bishops, size):
"""
On our special chessboard, two bishops attack each other if they share the same diagonal. This includes bishops that have another bishop located between them, i.e. bishops can attack through pieces.
You are given N bishops, represented as (row, column) tuples on a... | true |
618ab6b27deffdef3aaa89977eea5d43186fe014 | dave738/calculator | /infix_calculator.py | 2,915 | 4.46875 | 4 | def precedence(op):
'''
Function to find precedence of operators.
'''
if op == '+' or op == '-':
return 1
if op == '*' or op == '/':
return 2
return 0
def apply_op(a, b, op):
'''Function to perform arithmetic operations.'''
if op == '+': return a + b
if op == '-'... | true |
a8c1e4c439b5691ac1ccf4c9a682657eeedc32d7 | adinath10/Python-Apps | /Unit-5 Dictionaries/Thesaurus_App.py | 1,117 | 4.15625 | 4 | #Python Challenge 21 Thesaurus App
import random
print("Welcome to the Thesaurus App!")
print("\nChoose a word from the thesaurus and I will give you a synonym.")
synonyms = {
'Hot' : ['balmy', 'summery', 'tropical', 'boiling', 'scorching'],
'Cold' : ['chilly', 'cool','freezing','frigid','polar'],
'Happy' : ['co... | true |
45417e66c82444dafeca5664eb4c3d9d048822a3 | adinath10/Python-Apps | /Unit-5 Dictionaries/Frequency_Analysis_App.py | 2,029 | 4.40625 | 4 | #Python Challenge 24 Frequency Analysis App
from collections import Counter
print("Welcome to the Frequency Analysis App")
non_letters = ['1','2','3','4','5','6','7','8','9',' ','.','?','!',',','"',"'",':',';','(',')','%','$','&','#','\n','\t']
key_phrase_1 = input("\nEnter a word or phrase to count the occurrence o... | true |
43520c741d0e8be1ae3c7b09dca3fe9735bc3168 | Gayatri3achugatla/learning | /even_odd.py | 230 | 4.34375 | 4 | # program to get even and odd numbers using list comprehension
#This will print only even or odd not the numbers
list1 = [1,34,33,77,98,76,23,21,65,79]
even_odd = ['even' if num%2 ==0 else 'odd' for num in list1]
print(even_odd)
| true |
0ae0cadf7888b51c70c3e5a3d4b78a23b2d0eeb3 | bdebo236/edit-distance | /edit-distance-recursion.py | 1,656 | 4.28125 | 4 | def editDistance(s1, s2):
## If one of the string is empty then the edit distance will be equal to the length of the other because in that case we just have to
## insert all the letters in that string to duplicate it or remove all from the other to make it empty like the other
if len(s1) == 0:
retur... | true |
a1333895e7fe6e745e9c9459fd2a80ddbe768815 | tushartripathi1998/Python_programs | /BeerSong.py | 371 | 4.21875 | 4 | word="bottles"
for beer_num in range(3,0,-1):
print(beer_num,word,"of beer left")
print(beer_num,word,"of beer")
print("take one down")
print("pass it around")
if beer_num==1 :
print("no more beer left")
else :
new_num=beer_num-1
if new_num==1 :
word="bottle"
... | true |
465168242cebf1ad140455f919c947df09986b39 | ManishSkr/Traversal-of-BST | /PythonApplication18.py | 1,210 | 4.1875 | 4 | #All traversals
class node:
def __init__(self,val):
self.val=val
self.right=None
self.left=None
def insert(root,node):
if root is None:
root=node
elif(root.val<node.val):
if root.right is None:
root.right=node
else:
ins... | true |
3c9667cabafa4f7e95e6936f5637952bb59e9f4e | ewolyror/pythonexercises | /e2.py | 559 | 4.125 | 4 | """9/24/2019
e2.py
The second exercise of the python exercise series
Question:
Write a program which can compute the factorial of a given numbers.
The results should be printed in a comma-separated sequence on a single line.
Suppose the following input is supplied to the program:
8
Then, the output should be:
40320
H... | true |
4a05dc442be55fff6b8afcb61dbd6cef33a7db35 | srinathsubbaraman/python_assignments | /problem set 1/volume.py | 363 | 4.3125 | 4 | '''
Name :volume.py
Date :04/12/2017
Author :srinath.subbaraman
Question:Practice using the Python interpreter as a calculator:
a) The volume of a sphere with radius r is 4/3pr3. What is the volume of a sphere with radius 5?
Hint: 392.7 is wrong!?
'''
r = int(raw_input("Enter the radius:"))
v = (4*(3.14)*(r**3))/3... | true |
275102cf78abfc4899fc0b5ef40da54949f33731 | srinathsubbaraman/python_assignments | /problem set 1/right_justify.py | 546 | 4.1875 | 4 | '''
Name :right_justify.py
Date :04/12/2017
Author :srinath.subbaraman
Question:Python provides a built-in function called len that returns the length of a string, so the value of len('Cigna')
is 5. Write a function named right_justify that takes a string named s as a parameter and prints the string with enough
lead... | true |
be8cba690fe473b85a685cf2e867b4de9d56d2d1 | prai05/ProFun | /Assignment 4/Assignment 4.8.py | 1,080 | 4.21875 | 4 | # Assignment 4
# 010123102 Computer Programming Fundamental
#
# Assignment 4.8
# We want make a package of goal kilos of chocolate.
# We have small bars (1 kilo each) and big bars (5 kilos each).
# Return the number of small bars to use, assuming we always use big bars before small bars. Return -1 if it can't be done
#... | true |
1e41d5a5055562bd2f4a5cac8442079f9dcc882c | prai05/ProFun | /Assignment 3/Assignment 3.1.py | 1,148 | 4.46875 | 4 | # Assignment 3
# 010123102 Computer Programming Fundamental
#
# Assignment 3.1
# 1. You are driving a little too fast, and a police officer stops you. Write code to compute the result, encoded as an int value:
# 0=no ticket, 1=small ticket, 2=big ticket. If speed is 60 or less, the result is 0. If speed is between 61 a... | true |
0da0eda24546daf956d5c441d0034e582060dfa0 | prai05/ProFun | /Assignment 4/Assignment 4.6.py | 953 | 4.125 | 4 | # Assignment 4
# 010123102 Computer Programming Fundamental
#
# Assignment 4.6
# For this problem, we'll round an int value up to the next multiple of 10 if its rightmost digit is 5 or more, so 15 rounds up to 20.
# Alternately, round down to the previous multiple of 10 if its rightmost digit is less than 5, so 12 roun... | true |
124e654889603a1b3b2dc88340c1b55477e4d8b0 | prai05/ProFun | /Assignment 3/Assignment 3.3.py | 687 | 4.15625 | 4 | # Assignment 3
# 010123102 Computer Programming Fundamental
#
# Assignment 3.3
# Given a number n, return True if n is in the range 1..10, inclusive.
# Unless "outsideMode" is True, in which case return True if the number is less or equal to 1, or greater or equal to 10.
#
# Phattharanat Khunakornophat
# ID 59010126100... | true |
25990767469e6f860da810e42a5923b203a23bcc | megactrl/algo | /src/algo/Recursive and Algo/factorial.py | 348 | 4.40625 | 4 | # Recursive Function for calculating factorial of a number
def fact(num):
print(" Function called with num = " + str(num))
if num == 1:
return 1
else:
ans = num * fact(num - 1)
print("Intermediate result for", num, "* fact(" ,num - 1, ") :", ans)
return ans
print... | true |
e8f994c22d4724f318c464a61fefc0ac4be7ecea | vishrutkmr7/DailyPracticeProblemsDIP | /2023/04 April/db04202023.py | 1,050 | 4.15625 | 4 | """
Given a positive integer, N, return all flippable numbers between one and N inclusive.
Note: A flippable number is a number whose digits can be rotated 180 degrees to form a
different number. Digits 0, 1, 6, 8, and 9 become 0, 1, 9, 8, and 6 respectively when
rotated. Digits 2, 3, 4, 5, and 7 are invalid when rotat... | true |
f51a6f1fa176258eb6da647e8d2d22f3a71d0e02 | vishrutkmr7/DailyPracticeProblemsDIP | /2022/08 August/db08162022.py | 737 | 4.5 | 4 | """
This question is asked by Microsoft.
Implement a trie class that supports insertion and search functionalities.
Note: You may assume only lowercase alphabetical characters will added to your trie.
Ex: Given the following operations on your trie…
Trie trie = new Trie()
trie.insert("programming");
trie.search("comp... | true |
e06420a730416924a3c1af556bc35294c190c43a | vishrutkmr7/DailyPracticeProblemsDIP | /2022/08 August/db08182022.py | 880 | 4.125 | 4 | """
This question is asked by Google.
Given a positive integer N, return the number of prime numbers less than N.
Ex: Given the following N…
N = 3, return 1.
2 is the only prime number less than 3.
Ex: Given the following N…
N = 7, return 3.
2, 3, and 5 are the only prime numbers less than 7.
"""
class Solution:
... | true |
b2040c6a443ed0b63c49465325a47bee1bf8059e | vishrutkmr7/DailyPracticeProblemsDIP | /2022/11 November/db11072022.py | 1,604 | 4.15625 | 4 | """
You are given a list of values and a list of labels. The ith element in labels represents
the label of the ith element. Similarly, the ith element in values represents
the value associated with the ith element (i.e. together, an “item” could be thought of
as a label and a price). Given a list of values, a list of l... | true |
d1b881a1ec946d2acafab85e20181ed19dd07591 | vishrutkmr7/DailyPracticeProblemsDIP | /2019/11 November/dp11232019.py | 549 | 4.125 | 4 | # This problem was recently asked by Apple:
# A fixed point in a list is where the value is equal to its index.
# So for example the list [-5, 1, 3, 4], 1 is a fixed point in the list since the index and value is the same.
# Find a fixed point (there can be many, just return 1) in a sorted list of distinct elements, o... | true |
160b7920eb9f6dd4d403b679efa43237ac50b91b | vishrutkmr7/DailyPracticeProblemsDIP | /2022/08 August/db08262022.py | 1,581 | 4.125 | 4 | """
Given a 2D array containing only the following values: -1, 0, 1 where -1 represents an obstacle,
0 represents a rabbit hole, and 1 represents a rabbit, update every cell containing a rabbit with the
distance to its closest rabbit hole.
Note: multiple rabbit may occupy a single rabbit hole and you may assume every ... | true |
38e6a43cbb584dd8680f95d5808b9aefc26c804e | vishrutkmr7/DailyPracticeProblemsDIP | /2022/08 August/db08032022.py | 1,641 | 4.15625 | 4 | """
A frog is attempting to cross a river to reach the other side.
Within the river, there are stones located at different positions given by a stones array
(this array is in sorted order). Starting on the first stone
(i.e. stones[0]), the frog makes a jump of size one potentially landing on the next stone.
If the frog... | true |
5a3bbc0e16b428978efad7fc30823dcc017d946a | vishrutkmr7/DailyPracticeProblemsDIP | /2023/02 February/db02132023.py | 767 | 4.28125 | 4 | """You are typing on a computer when all of a sudden you realize you’ve been typing with caps lock on. Given a string s,
return a new string containing all of its alphabetical character transformed to lowercase.
Note: Do you not use an built in library functions.
Ex: Given the following string s…
s = "ABC", return "... | true |
3a318c63afc7ca864f1d23e8b5ac1a1197875968 | vishrutkmr7/DailyPracticeProblemsDIP | /2020/02 February/dp02072020.py | 808 | 4.28125 | 4 | # This problem was recently asked by LinkedIn:
# Given a binary tree, find the minimum depth of the binary tree. The minimum depth is the shortest distance from the root to a leaf.
class Node:
def __init__(self, value, left=None, right=None):
self.value = value
self.left = left
self.right... | true |
d735af2075cee3c654745539685f00c90f417851 | vishrutkmr7/DailyPracticeProblemsDIP | /2023/04 April/db04062023.py | 1,202 | 4.3125 | 4 | """
Given the reference to the root of a binary tree, and a target value,
remove all the leaf nodes that contain the target and return the modified tree.
Note: If you remove a leaf node that contains the target value and the parent node
now becomes a leaf with a value of target, you must remove the parent as well.
Ex... | true |
cc41f1a2b12cc20afec3a95ed0b3823a4213c7aa | vishrutkmr7/DailyPracticeProblemsDIP | /2023/04 April/db04212023.py | 998 | 4.28125 | 4 | """
You are given two integer arrays, nums1 and nums2, and asked to sort them in a
particular order. The elements in nums2 are distinct and all occur within nums1.
Sort the elements of nums1 such that the relative ordering of values are the same
as nums2. All elements that don’t appear in nums2 should appear at the end... | true |
bafc079043e1c785f0336dc90498bffdec68f61c | vishrutkmr7/DailyPracticeProblemsDIP | /2022/06 June/db06102022.py | 1,685 | 4.125 | 4 | """
This question is asked by Apple.
Given two sorted linked lists,
merge them together in ascending order and return a reference to the merged list.
Ex: Given the following lists...
list1 = 1->2->3, list2 = 4->5->6->null, return 1->2->3->4->5->6->null
list1 = 1->3->5, list2 = 2->4->6->null, return 1->2->3->4->5->6->... | true |
cfe2415395d595d0005340f8a1eb415b0e3f2bb2 | vishrutkmr7/DailyPracticeProblemsDIP | /2023/01 January/db01282023.py | 1,073 | 4.25 | 4 | """
Given a binary tree, invert it and return the resulting tree.
Ex: Given the following binary tree…
1
/ \
2 3, return...
1
/ \
3 2
Ex: Given the following binary tree…
1
/ \
2 3
/ \ / \
4 5 6 7, return...
1
... | true |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.