blob_id string | repo_name string | path string | length_bytes int64 | score float64 | int_score int64 | text string | is_english bool |
|---|---|---|---|---|---|---|---|
4efffd09c623ecf7c64ef4c4e1bac18dc2ec8af5 | harris44/PythonMaterial | /02_Advanced/algorithms_and_data_structures/01_Guessing_Game_with_Stupid_search.py | 1,272 | 4.25 | 4 | #!/usr/bin/python
# -*- coding: utf-8 -*-
from random import randrange
"""
Purpose: Stupid Search.
In a list of numbers, user guesses a number.
if it is correct, all is good. Else, next time, he/she will guess among the unguessed numbers.
"""
__author__ = "Udhay Prakash Pethakamsetty"
list_of_numbers = range(10,... | true |
854b44a67d155c0c901d010a3e7ed5fc3735761a | liboyue/BOOM | /examples/BioASQ/extra_modules/bioasq/Tiler.py | 671 | 4.3125 | 4 | import abc
from abc import abstractmethod
'''
@Author: Khyathi Raghavi Chandu
@Date: October 17 2017
This code contains the abstract class for Tiler.
'''
'''
This is an Abstract class that serves as a template for implementations for tiling sentences.
Currently there is only one technique implemented which is simpl... | true |
9c86c21e8546fd8bde9a8b41187fd54e6c25b538 | BumShubham/assignments-AcadView | /assignment8.py | 1,591 | 4.46875 | 4 | #Q1
#What is time tuple
'''
Many of Python's time functions handle time as a tuple of 9 numbers, as shown below −
Index Field Domain of Values
0 Year (4 digits) Ex.- 1995
1 Month 1 to 12
2 Day 1 to 31
3 Hour 0 to 23
4 Minute 0 to 59
5 Second 0 to 61 (60/61 are leap seconds)
6 Day of Week 0 to 6 (Monday to Sunday)
7 Day... | true |
8dfe63e954810cead138b81ef4c5fdf813cf224e | ShahrukhSharif/Applied_AI_Course | /Fundamental of Programming/python Intro/Prime_Number_Prg.py | 364 | 4.125 | 4 | # Wap to find Prime Number
'''
num = 10
10/2,3,4,5 ---> Number is not pN OW PN
'''
num = int(input("Input the Number"))
is_devisible = False
for i in range(2,num):
if(num%i==0):
is_devisible = True
break
if is_devisible is True:
print("Number is Not Prime {}".format(num))
else:
pri... | true |
612ace04b4af232ecc5408a2c92f06620e75a17b | kitsuyui/dict_zip | /dict_zip/__init__.py | 2,086 | 4.375 | 4 | """dict_zip
This module provides a function that concatenates dictionaries.
Like the zip function for lists, it concatenates dictionaries.
Example:
>>> from dict_zip import dict_zip
>>> dict_zip({'a': 1, 'b': 2}, {'a': 3, 'b': 4})
{'a': (1, 3), 'b': (2, 4)}
>>> from dict_zip import dict_zip_longest
... | true |
5afd548624578e174b04bec5374c778e1bbed79f | dbwebb-se/python-slides | /oopython/example_code/vt23/kmom04/a_module.py | 1,048 | 4.15625 | 4 | """
How to mock function in a module.
In a unit test we dont want to actually read a file so we will mock
the read_file_content() function. But still test get_number_of_line_in_file().
"""
def get_number_of_line_in_file():
"""
Return how many lines exist in a file
"""
content = read_file_content()
n... | true |
7bc58f3621d6e04206543d4b556929e56b1c3b0f | dbwebb-se/python-slides | /oopython/example_code/vt23/kmom03/get_post_ok/src/guess_game.py | 1,766 | 4.21875 | 4 | #!/usr/bin/env python3
"""
Main class for the guessing game
"""
import random
from src.guess import Guess
class GuessGame:
"""
Holds info for playing a guessing game
"""
def __init__(self, correct_value=None, guesses=None):
if correct_value is not None:
self._correct_value = correct... | true |
9902a96d8649184b27bafe7835742d13bcec0f07 | yyyuaaaan/python7th | /crk/8.4subsets.py | 1,655 | 4.25 | 4 | """__author__ = 'anyu'
9.4 Write a method to return all subsets of a set.
gives us 2" subsets.We will therefore not be able to do better than 0(2") in time or space complexity.
The subsets of {a^ a2, ..., an} are also called the powerset, P({aj, a2, ..., an}),or just P(n).
This solution will be 0(2n) in time and space,... | true |
c2ffda55f905b9d0bc11dd1cff64761490722eb0 | yyyuaaaan/python7th | /crk/4.4.py | 1,547 | 4.125 | 4 | """__author__ = 'anyu'
Implement a function to check if a tree is balanced.
For the purposes of this question, a balanced tree is defined
to be a tree such that the heights of the two subtrees of any # this is so called AVL-tree
node never differ by more than one.
"""
class Node(object):
def __init__(self):
... | true |
b5e756f9eec761edbd58127e9ad66d9d0ec3dae5 | tnguyenswe/CS20-Assignments | /Variables And Calculations (2)/Nguyen_Thomas_daylight.py | 1,071 | 4.28125 | 4 | '''
Name: Thomas Nguyen
Date: 1/6/20
Professor: Henry Estrada
Assignment: Variables and Calculations (2)
This program takes the latitude and day of the year and calculates the minutes of sunshine for the day.
'''
#Import math module
import math
#Gets input from user
latitude = float(input("Enter latitude in degrees: "... | true |
722b1e1ca439affec2aed8d27f674f281ebc36bb | gg/integer_encoding | /src/integer_encoding.py | 1,339 | 4.34375 | 4 | #!/usr/bin/env python
# coding: utf-8
from collections import deque
def encoder(alphabet):
"""
Returns an encoder that encodes a positive integer into
a base-`len(alphabet)` sequence of alphabet elements.
`alphabet`: a list of hashable elements used to encode an integer; i.e.
`'0123456789'` is an... | true |
273d638b3c2b9ea9bc8e8b32e59f8c45e61e7ef5 | sassy27/DAY1 | /OOP/Class instance.py | 781 | 4.125 | 4 | class employees:
raised_amount = 1.04
num_emp = 0
def __init__(self,first,last,pay):
self.first = first
self.last = last
self.pay = pay
employees.num_emp += 1 # prints number of employees by adding after each emp created
def fullname(self):
return "{} {}". form... | true |
4589928fdb9ae81e9d9d23b509b30a61539ebd8e | rohitx/Zelle-Python-Solutions | /Chapter2/question1.py | 289 | 4.125 | 4 | print "This program takes Celsius temperature as user \
input and outputs temperature in Fahrenheit"
def main():
celsius = input("What is the Celsius temperature?")
fahrenheit = (9/5.) * celsius + 32
print "The temperature is", fahrenheit, "degrees Fahrenheit."
main() | true |
7bcdb4a3550071c4ff668aa0f7977a1aad65ad16 | rohitx/Zelle-Python-Solutions | /Chapter3/question1.py | 349 | 4.25 | 4 | import math
print "This program computes the Volume and Surface of a sphere\
for a user-specified radius."
def main():
radius = float(raw_input("Please enter a radius: "))
volume = (4/3.) * (math.pi * radius**3)
surface = 4 * math.pi * radius**2
print "The Volume is: ", volume
print "The S... | true |
ca20faf4e6b8365bcbffe5f3fe94ce0c1d07c239 | PeterParkSW/User-Logins | /UserLogins.py | 1,525 | 4.4375 | 4 | #dictionary containing paired usernames and passwords that have been created
#keys are usernames, values are passwords
credentials = {}
#asks user for a new username and password to sign up and put into credentials dictionary
def signup():
new_user = input('Please enter a username you would like to use: ')
whi... | true |
d5441ca9d8a467482c1341852a04c893850c10b5 | KhoobBabe/math-expression-calculator | /mathmatical expression calculator.py | 1,629 | 4.1875 | 4 | import warnings
print('Enter a mathematical expression to view its result')
#we put a while to cotinously prompt the yser to input expressions
cond = True
while cond is True:
#this ignores other warnings
warnings.simplefilter('ignore')
#input is taken here
a = input("\nEnter a mathematical... | true |
0a0e377ff207f57bafb2cd622c772080d4559fe4 | AvyanshKatiyar/megapython | /app4/app4_code/backend.py | 2,190 | 4.3125 | 4 | import sqlite3
def connect():
conn=sqlite3.connect("books.db")
cur=conn.cursor()
cur.execute("CREATE TABLE IF NOT EXISTS book (id INTEGER PRIMARY KEY, title text, author text, year integer, isbn integer)")
conn.commit()
conn.close()
#id checks how many entries
def insert(title, author, ye... | true |
eb740ea5b08d9f8b1cec289512d993ec5093ea42 | AvyanshKatiyar/megapython | /Not_app_code/the_basics/forloops.py | 889 | 4.1875 | 4 | monday_temperatures=[9.1, 9.7, 7.6]
#rounding
print(round(monday_temperatures[0]))
for temperature in monday_temperatures:
print(round(temperature))
#loop goes through all the variables
#looping through a dictionary
student_grades={"Marry": 9.1, "Sim": 8.8, "John": 7.5}
#chose what you want to iterate o... | true |
cecf188d0a3425dbc83dac4b9caf56f1f428b4d2 | meetashwin/python-play | /basic/countsetbits.py | 392 | 4.5 | 4 | # Program to count the set bits in an integer
# Examples:
# n=6, binary=110 => Set bits = 2 (number of 1's)
# n=12, binary=1100 => Set bits = 2
# n=7, binary=111 => Set bits = 3
def countsetbits(n):
count = 0
while(n):
count += n & 1
n >>= 1
return count
print("Enter the number to find set bits for:")
n = ... | true |
6b674887d7d590d12016e60aed03cce67d284b9d | remcous/Python-Crash-Course | /Ch04/squares.py | 452 | 4.5625 | 5 | #initialize an empty list to hold squared numbers
squares = []
for value in range(1,11):
# ** acts as exponent operator in python
square = value**2
# appends the square into the list of squares
squares.append(square)
print(squares)
# more concise approach
squares = []
for value in range(1,11):
squares.append(va... | true |
b9854e8781e6261b6919999f85e782205aab07d1 | BD20171998/holbertonschool-higher_level_programming | /0x0A-python-inheritance/2-is_same_class.py | 686 | 4.46875 | 4 | #!/usr/bin/python3
"""
This is an example of the is_same_class function
>>> a = 1
>>> if is_same_class(a, int):
... print("{} is an instance of the class {}".format(a, int.__name__))
>>> if is_same_class(a, float):
... print("{} is an instance of the class {}".format(a, float.__name__))
>>> if is_same_class(a, object... | true |
36bcd1fc0ec00f9ca1da87c053a7813973b4d23d | BD20171998/holbertonschool-higher_level_programming | /0x0B-python-input_output/4-append_write.py | 624 | 4.25 | 4 | #!/usr/bin/python3
"""This is an example of the append_write function
>>> append_write = __import__('4-append_write').append_write
>>> nb_characters_added = append_write("file_append.txt", "Holberton School \
... is so cool!\n")
>>> print(nb_characters_added)
29
"""
def append_write(filename="", text=""):
"""
... | true |
b024737c383e9990ea898a749ec09a2ef3a42320 | samaroo/PythonForBeginners | /Ch7_Exercise.py | 1,064 | 4.3125 | 4 | # Notes
# Functions in "Math" Library
# use "import math" to import math library
# abs(x) will return the absolutw calue of x
# "math.ceil(x)" will round x up to the nearest integer greater than it
# "math.floor(x)" will round x down to the nearest integer less than it
# "pow(x, y)" will return x^y
#
# Functio... | true |
a3b988261743a290910d8c3110733d393ef01512 | wolverinez/T_Mud | /dice.py | 1,099 | 4.15625 | 4 | """this module contains functions for rolling dice from a cointoss
to a one hundred sided dice the
funtions are named with the letter 'd' and then a number forinstance
the function to simulate a d20 is simply named d20(pluss=0) where the pluss argument
makes it possible to modify the roll
"""
import random as R
de... | true |
2b953aeab24e60b0a44915565b05b7cb3f1a4dd6 | kosskiev/University-of-Michigan | /turtle_and_color_figure.py | 873 | 4.46875 | 4 | #Write a program that asks the user for the number of sides, the length of the side, the color, and the fill color of a regular polygon.
#The program should draw the polygon and then fill it in.
import turtle
number_side = int(input('How many sides would you like?(Сколько сторон у вашей фигуры?) '))
angle = 360 / nu... | true |
429a1d0562b5385edfa9a443c0732272e82bef4d | hutor04/UiO | /in1000/oblig_3/ordbok.py | 1,197 | 4.34375 | 4 | # The program initiates a dictionary with product names as keys and their prices as values. It then prints out the list
# Then the program asks the user to input a new product and its price two times.
# It ads new products to the dictionary and then prints a new dictionary.
# We create a dictionary that holds product ... | true |
215b78a3a4ae410b55ea532938f4d337b338ee1f | hutor04/UiO | /in1000/oblig_1/hei_student.py | 361 | 4.21875 | 4 | # The following program prints salutation, asks the user to input its name.
# Then it prints out salutation and the name that was provided by the
# user.
# Prints to screen the first salutation
print('Hei Student!')
# Asks to input the name of the user
navn = input('Scriv navnet ditt nå: ')
# Prints to screen new salu... | true |
e4279841462864909d41865df0c27e91b156831d | CharlieHuang95/Algorithms | /Sorting/quick_sort.py | 1,188 | 4.25 | 4 | # Quicksort works by randomly selecting an element to be its pivot, and shifting
# smaller elements to its left side, and larger elements to its right side.
# At the end of all the shifting, the pivot should ultimately be in the correct
# location.
import random
def quick_sort_helper(array, left, right):
if left ... | true |
fd2a94cec38175d7ff35a93814bc5815df69dcd0 | MeenaRepo/augustH2K | /DictionaryTest.py | 1,285 | 4.1875 | 4 | sampleDictionary = {
"Warm":"Red",
"Cold":"Baige",
"Nuetral":"Grey",
"Common":"Black",
}
print(sampleDictionary)
print(sampleDictionary["Cold"])
print(sampleDictionary.get("Warm"))
# Add - replaces the old value
sampleDictionary["Warm"] = "Blue"
print(sampleDictionary)
# Membership
if... | true |
10cd5c0f8f3bf6fae6e03e1e740a115f505a1aba | duthaho/python-design-patterns | /creational/builder.py | 2,288 | 4.15625 | 4 | from abc import abstractmethod
from typing import Optional
class Car:
def __init__(self):
self.seat = 0
self.engine = ""
self.trip_computer = False
self.gps = False
def info(self):
print(f"Car: {self.seat} - {self.engine} - {self.trip_computer} - {self.gps}")
class B... | true |
259d53c7b2581e146cc8b1c5c9d75da5f04ee845 | joelbd/CSC110 | /convertmiles.py | 244 | 4.3125 | 4 | # File: convertmiles.py
# This program converts distance in miles to distance in kilometers
# Day
def main():
miles = eval(input("Enter the distance in miles:"))
kilometers = miles * 1.60934
print("The distance is:",kilometers,"km")
main() | true |
a80ddf31a4e28b238ebd83d30c80ef432bd25a16 | Raktacharitra/TrueCaller-search | /truecaller.py | 1,022 | 4.125 | 4 | from sys import argv
choice = input("Tell us if you want to 'search' a particular contact or 'add' a contact (s / a): ")
if choice.lower() == "s" or choice.lower() == "search":
with open(argv[1], "r") as phone_book:
search_type = input("search by name or number: ")
try:
a = int(search_t... | true |
1f527d83890651daeebb1874a70225fa013d07e4 | louisbranch/hello-py | /ProblemSet3/ps3_newton.py | 1,757 | 4.21875 | 4 | # 6.00x Problem Set 3
#
# Successive Approximation: Newton's Method
#
# Problem 1: Polynomials
def evaluatePoly(poly, x):
'''
Computes the value of a polynomial function at given value x. Returns that
value as a float.
poly: list of numbers, length > 0
x: number
returns: float
'''
s =... | true |
ae069876ea6409ad4a9ff29f1fb23a915d707e01 | priyankagoma/learningpython | /src/python_scripts/print_examples/printexamples.py | 290 | 4.15625 | 4 | #below are few examples that how we can print numbers.
print(2 + 8)
print(3 * 5)
print(6 - 3)
#Example of a string.
print("The end", "it should be nice", "we will able to make it")
#Exapme of integers.
print(1, 2, 3, 4, 5)
#Example of words.
print("one two three four five cat dog") | true |
df53ec293bedda6a6954334daca394536dc0e02b | Junhee-Kim1/RandomNumber | /RandomNumberGuesser.py | 442 | 4.15625 | 4 | import random
print("number Guessing Game!")
number=random.randint(1,9)
chance=0
print("guess number")
while chance<5:
guess=int(input("enter your guess!: "))
if guess == number:
print("you win!")
break
elif guess<number:
print("your number is too low")
else:
... | true |
2c4da32e1420daae3f9401ca78d4be75b6af5f9d | prathmesh2606/DSA_LU | /a1q1.py | 344 | 4.4375 | 4 | # Assignment 1 - Q1
# Write a python program that takes two numbers as the input such as X and Y and print the result
# of X^Y(X to the power of Y).
# Taking input
x,y = [int(i) for i in input("Enter base value and then power value by giving space between them (eg: 2 3 ans: 8): ").split()]
print(f"{x} to the pow... | true |
b1b7f0de711f5d40447d83553dc3e8c4bbe3209f | charliettaylor/CSA231 | /Projects/4/project4.py | 2,286 | 4.28125 | 4 | # Turtle Project by Charlie Taylor
from turtle import *
import random as rand
SCALE = "Enter the size of the spiral (recommend 1-10): "
LOW = "Enter low bound of shake (rec. negative or 0): "
HIGH = "Enter high bound of shake (rec. positive or 0): "
def draw_c(t) -> None:
'''
draws letter C
'''
t.do... | true |
101cedb9b67c9004b1a4a5af955197ed7b71a4b9 | yingl910/MongoDB | /Basics/mdb_update.py | 1,899 | 4.25 | 4 |
'''These are examples of MongoDB example codes of save and update, two methods for updating'''
'''update method one: save'''
# a method on collection objects
# find_one just returns the first document it finds
city = db.cities.find_one({'name':"munchen",'country':'Germany'})
city['isoCountryCode'] = 'DEU'
db.cities.s... | true |
cd890912e0574154ac18385ac92f43fdd68f430d | PrabhudevMishra/PRO-97 | /numberGuessingGame.py | 497 | 4.15625 | 4 | import random
number = random.randint(0,10)
chances = 0
while chances < 5 :
guess = int(input("Enter your guess"))
chances = chances + 1
if guess < number:
print('Your guess is too low')
if guess > number:
print('Your guess is too high')
if guess == number:
brea... | true |
c43c7f51aff65b851a591bf7d00c96a0d8a160be | shivesh01/Python-Basics | /Project&problems/Example_30.py | 425 | 4.28125 | 4 | # Shuffle Deck of cards
import random
# In the program, we used the product() function in itertools module to create a deck of cards. This function performs the Cartesian product of the two sequences.
from itertools import product
deck = list(product(range(1, 14), ["Spade", "Heart", "Club", "Diamond"]))
random.sh... | true |
65e62f4761054c0cf0ac8911e1715c5537608c7c | shivesh01/Python-Basics | /Project&problems/Example_10.py | 233 | 4.375 | 4 | # check number +,- or 0
num = float(input("Enter number"))
if num == 0:
print("your entered number is zero")
elif num > 0:
print("You have entered a positive number")
else:
print("You have entered a negative number")
| true |
dd701404bbf09b357bdd5faec5512de7093ca871 | lmjim/year1 | /cs210/p61_testfunc_key.py | 1,584 | 4.21875 | 4 | """
CIS210 Project 6-1 Fall 2017
Author: [Solution]
Credits: N/A
Implement a function to test the string
reverse functions from project 5
(iterative and recursive).
Practice:
-- user-defined test functions
-- functions as parameters
"""
import p52_stringreverse_key as p5
def test_reverse(f):
'''(fun... | true |
826fb885f233ea03edffde38cb2342bda0236dea | dudulydesign/python_web_pratice | /webserver/py_though/bubble sort.py | 747 | 4.15625 | 4 | #Bubble Sort
sampleList = [6,5,4,3,2,1]
def bubbleSort(sourceBubbleSortList):
#how long the list
listLength = len(sourceBubbleSortList)
i = 0
# the i here to count how many value not in
while i < listLength-1:
j = listLength - 1
# here to compare two value
while j > i:
print(" sourceBubble... | true |
62f8410ff45e2352f7ac48cf8327c35a62371895 | geraldfan/Automate-The-Boring-Stuff | /Chapter_9_Organizing_Files/selectiveCopy.py | 699 | 4.25 | 4 | #! python3
# selectiveCopy.py - Walks through a folder tree, then searches and copies for files with a particular extension (i.e. .jpg)
import shutil, os
folder = input('Enter the absolute filepath of'
' the directory you wish to copy from: ')
extension = input("Enter the extension you'd like to copy:... | true |
578494d75a99a79091946b96a93a13fc485c6c50 | Szkeller/TDD_lab | /FizzBuzz.py | 867 | 4.125 | 4 | class FizzBuzz:
'''
This is for TDD sample
Author: Keller Zhang
create date: 04/27
description: FizzBuzz Quiz
When given number just can be divided by 3, then return 'Fizz';
When given number just can be divided by 5, then return 'Buzz';
Whe... | true |
383c7b66d2e6c025f09270cf1e547d64556954aa | Shilinana/LearnPythonTheHardWayPractices | /ex18.py | 633 | 4.3125 | 4 | """
@Author:ShiLiNa
@Brief:The exercise18 for Learn python the hard way
@CreatedTime:28/7/2016
"""
# this one is like your scripts with argv
def print_two(*args):
arg1, arg2 = args
print "arg1:%r, arg2:%r" % (arg1, arg2)
# ok, that *arg is actually pointless, we can just do this
def print_two_again(ar... | true |
89768748cf4abc99b56f383e025fe37a851579f8 | justinelai/Sorting | /src/iterative_sorting/iterative_sorting.py | 2,598 | 4.5625 | 5 | def insertion_sort(list):
for i in range(1, len(list)):
# copy item at that index into a temp variable
temp = list[i]
# iterate to the left until reaching correct .
# shift items to the right
j = i
while j > 0 and temp < list[j-1]:
list[j] = list[j-1]
... | true |
2851a656bd9f2bdc1b7877c587dd09a17e0fe219 | Tech-Amol5278/Python_Basics | /c5 - list/c5_more_methods_to_add_data.py | 626 | 4.15625 | 4 | # count
# sort method
# sorted function
# reverse
# clear
# copy
# Count: Counts the string available in list
fruits = ['apple','orange','banana','grapes','apple','apple','guava']
print(fruits.count('apple'))
# Sort: sort the list contains in alphabetical/numeric order
fruits.sort()
print(fruits)
numbers = [3,51,8... | true |
43bce6c540aa4ad249c33ab9650e4e1b739a73cb | Tech-Amol5278/Python_Basics | /c5 - list/c5e4.py | 522 | 4.4375 | 4 | # define a function which returns a lists inside list, inner lists are odd and even numbers
# for example
# input : [1,2,3,4,5,6,7,8]
# returns : [[1,3,5,7],[2,4,6,8]]
####### Sol ###############################################
num1 = [1,2,3,4,5,6,7,8]
def separate_odd_even(list1):
sep_list = []
odd = []
... | true |
f383537b4da9f340610aaa7e4ee2e1fbf5b73147 | Tech-Amol5278/Python_Basics | /c2 - strings methods/c2e2.py | 218 | 4.21875 | 4 | # ask username and print back username in reverse order
# note: try to maje your program in 2 lines using string formatting
#### Sol ##########################3
u_name = input("Enter your name: ")
print(u_name[::-1])
| true |
4e09df38fd41bfaa63801dffa2f1a822878deab4 | Tech-Amol5278/Python_Basics | /c17 - debugging and exceptions/else and finally.py | 675 | 4.28125 | 4 | # Else and fianlly
while True: ## Loop to accept input til true comes
try:
age = int(input("Enter a number: "))
except ValueError: # valueerror : optional only if we know the error which can come
print("Please enter age only in integer ")
except: # when error is unpredicta... | true |
e3a71a4f1447e3fc0e6bf03654df9c63e1af56f2 | Tech-Amol5278/Python_Basics | /c16 - oops/property and setter decorator.py | 2,526 | 4.21875 | 4 | # property and setter decorator
# the below code from last slide it has below problems
# 1. this accepts the negative amount for price
# sol: write a validation not to accept negative numbers
# using getter(),setter()
# 2. After changing the price , complete specification shows the old price.
... | true |
1990af0b8f76c76eaa907f985d091f44a32cad62 | Tech-Amol5278/Python_Basics | /c5 - list/c5_list_intro.py | 649 | 4.5 | 4 | # Data Structures
# List
# List is ordered collection of items
# We can store anything in lits like int, float, string
numbers = [1,2,3,4]
print(numbers)
## to print 2 from list
print(numbers[1])
## to access only and 1 and 2
print(numbers[:2])
## to reverse the elements in list
print(numbers[::-1])
## to access only... | true |
9fe26472b3e65060b858040cdacc132387283fbd | mansi135/mansi_prep | /practice/new_problems.py | 2,850 | 4.1875 | 4 | # Given two sorted lists, return the interesection (ie the common elements b/w the two sorted lists)
# For example given l1 = [1, 2, 3] and l2 = [2, 3, 5, 10] (they can be different sizes)
# return [2, 3]
# LINEAR TIME
# 4
def get_intersection(l1, l2):
pass
# given two sorted lists l1 and l2, merge them such that ... | true |
bf5541aff5d60357f0a736f7689cfeb3aa8b46e7 | snidarian/Algorithms | /factorial_recursion.py | 429 | 4.46875 | 4 | #! /usr/bin/python3
# Factorial recursive algorithm
import argparse
parser = argparse.ArgumentParser(description="Returns factorial of given integer argument")
args = parser.add_argument("intarg", help="Int to be factored", type=int)
args = parser.parse_args()
def factorial_recursive(n):
if n == 1:
r... | true |
aa952649de3e87a99472f6cc2b92e7b2b8bf57ea | Factumpro/HackerRank | /Python/Practice/Sets/intersection.py | 535 | 4.15625 | 4 | '''
Set .intersection() Operation
https://www.hackerrank.com/challenges/py-set-intersection-operation/problem
'''
'''
The .intersection() operator returns the intersection of a set and the set of elements in an iterable.
Sometimes, the & operator is used in place of the .intersection() operator, but it only operate... | true |
9cd9cb9efd74fd3e3ff798b3865ace2590249fa4 | Factumpro/HackerRank | /Python/Practice/Sets/union.py | 481 | 4.1875 | 4 | '''
Set .union() Operation
https://www.hackerrank.com/challenges/py-set-union/problem
'''
'''
The .union() operator returns the union of a set and the set of elements in an iterable.
Sometimes, the | operator is used in place of .union() operator, but it operates only on the set of elements in set.
Set is immutable... | true |
42d6fba978a62e664aad1dbb1aa10fe161d51fab | Epic-R-R/Round-robin-tournament | /main.py | 1,536 | 4.125 | 4 | from pprint import pprint as pp
def make_day(num_teams, day):
# using circle algorithm, https://en.wikipedia.org/wiki/Round-robin_tournament#Scheduling_algorithm
assert not num_teams % 2, "Number of teams must be even!"
# generate list of teams
lst = list(range(1, num_teams + 1))
# rotate
day ... | true |
9f815235eb7c74e01c17cd19ef5622bd843c8f1d | Elsie0312/pycharm_code | /two_truths-lie.py | 584 | 4.15625 | 4 | print('Welcome to Two Truths and a Lie! /n One of the following statements is a lie...you need to identify which one!')
print('1. I have a donkey living in my backyard.')
print('2. I have three fur babies')
print('3. I speak 4 languages')
truth_or_lie = input('Now put in the number of the statement you think is the li... | true |
2492520b1fc91cf095c964e1b178c483046766b6 | besslwalker/algo-coding-practice | /4.1 Quicksort/quicksort.py | 1,534 | 4.125 | 4 | # Quicksort
# Bess L. Walker
# 2-21-12
import random
def quicksort(unsorted):
real_quicksort(unsorted, 0, len(unsorted))
def real_quicksort(unsorted, low, high):
if high - low <= 1:
return
pivot_index = partition(unsorted, low, high)
real_quicksort(unsorted, low, pivot_index)
real_quicksort(unsorted, pivot_i... | true |
c7c008011e3694dae55fa8a676721bd8e9f5e78b | jaypsingh/PyRecipes | /String_n_Text/Str_n_Txt_07.py | 710 | 4.4375 | 4 | '''
This program demonstrates how can we specify a regular expression to search shortest possible match.
By Default regular expression gives the longest possible match.
'''
import re
myStr = 'My heart says "no." but mind says "yes."'
# Problem demonstration
'''
Here we ar etrying to match a text inside a quote.
So i e... | true |
f8d563e8c1ce87996fe1f0df6ebe05e65ff8a543 | jaypsingh/PyRecipes | /String_n_Text/Str_n_Txt_05.py | 445 | 4.1875 | 4 | '''
This function demonstrates how can we search and replace strings
'''
import re
myStr = "Today is 03/09/2016. Game of Thrones starts 21/07/2017"
# Simple replace using str.replace()
print (myStr.replace('Today', 'Tomorrow'))
# Replace using re.sub() - Approach 1
print(re.sub(r'(\d+)/(\d+)/(\d+)', r'\3\-2\-1', my... | true |
c8913860b13c4619cd5119cacdce93fce0e6bcb7 | DHSZ/programming-challenge-2 | /seven-seg-words.py | 300 | 4.40625 | 4 | def longest_word():
longest_word = ""
## Write your Python3 code inside this function.
## Remember to find words that only use the following letters:
## A, B, C, E, F, H, I, J, L, N, O, P, S, U, Y
## Good luck!!
return longest_word
print(longest_word())
| true |
5f4313bc5806a145daf721c578f7120dd2755c01 | HarrisonPierce/Python-Class | /pierce-assignment2.py | 1,258 | 4.28125 | 4 | ##Harrison Pierce
##This program calculates the factorial of a user defined number
##Set factorial variable to 1
factorial = 1
k = int(input('Enter a postitive integer: '))
##Ask user for an integer and set equal to the variable k
for k in range(1,k + 1):
##start for loop for k. while between 1 and the n... | true |
a9f0b22836ca6ae81e7d60383386fffdc7ef8011 | Rayansh14/Term-1-Project | /rock paper scissors.py | 2,289 | 4.25 | 4 | import random
score = 0
def generate_random():
return random.choice(["rock", "paper", "scissors"])
def is_valid(user_move):
if user_move in ["rock", "paper", "scissors", "r", "p", "s"]:
return True
return False
def result(comp_move, user_move):
if comp_move == user_move:
return "ti... | true |
1bd93d500350c63fca4ba7e6a8ed3e1fb80bd1fe | UnKn0wn27/PyhonLearning-2.7.13 | /ex11.py | 505 | 4.21875 | 4 | #raw_input() presents a prompt to the user(the optional arg of raw_intput([arg])
#gets input from the user and returns the data input by the user in a string.
#Exemple:
# name = raw_input("What is your name?")
# print "Hello, %s." % name
#raw_input was renamed input() in Python 3
print "How old are you?",
age = raw_in... | true |
4d7eb9d814d4cd5db77400c7a96e1c18900eb00f | cantayma/web-caesar | /caesar.py | 1,197 | 4.21875 | 4 | import string
def alphabet_position(letter):
"""
receives a letter, returns 0-based numerical position in the alphabet;
case-sensitive; assumes letters only input
"""
if letter in string.ascii_uppercase:
position = string.ascii_uppercase.find(letter)
elif letter in string.ascii_lowerc... | true |
36d1432db82c986858bf650aa2c8281d494e01ac | tlananthu/python-learning | /00_simple_examples/06_maths.py | 336 | 4.1875 | 4 | number1=int(input('Please input a number'))
number2=int(input('Please input another number'))
operation=input('Please input an operation. +-/*')
if operation=='+':
print(number1+number2)
elif operation=='-':
print(number2-number2)
elif operation=='/':
print(number2/number2)
elif operation=='*':
print(... | true |
90094aafd436e093d00d2300a8278938caa788c1 | Shwebs/Python-practice | /BasicConcepts/3.strings/string-multiplication.py | 567 | 4.15625 | 4 | #Strings can also be multiplied by integers. This produces a repeated version of the original string.
# The order of the string and the integer doesn't matter, but the string usually comes first.
print("spam" * 3) #O/p:spamspamspam
print (4 * '2') #O/p: 2222
#Strings can't be multiplied by other strings.
#Strings ... | true |
28b923b625a0d8e716f3a85b98cfea1ac81d285b | Shwebs/Python-practice | /ControlStructure/List/List-method-count.py | 305 | 4.125 | 4 | #list.count(obj): Returns a count of how many times an item occurs in a list
letters = ['p', 'q', 'r', 's', 'p', 'u']
print(letters.count('r')) #O/P:-1
print(letters.count('p')) #O/P:-2 # index method finds the "first occurrence" of a list item and returns its index
print(letters.count('z')) #O/P:-0 | true |
2fd82e086ef9fd6b383c2055f70ced123c94963d | Shwebs/Python-practice | /BasicConcepts/3.strings/string-methods/split.py | 489 | 4.21875 | 4 | #Splits string according to delimiter string, returns list of substrings.
#Default delimiter is ' ' .
str='Test My Skill'
output=str.split()
print(output) #o/p:- ['Test', 'My', 'Skill']
for x in output:
print(x) #o/p:-Test
# My
# Skill
#Delimiter can be change... | true |
e21cba589f4928a7ad09bd7ad84d786b5a4fb73c | Shwebs/Python-practice | /ControlStructure/range/basic-range.py | 727 | 4.75 | 5 | #The range function creates a sequential list of numbers.
#The call to list is necessary because range by itself creates a range object,
# and this must be converted to a list if you want to use it as one.
#If range is called with one argument, it produces an object with values from 0 to that argument.
numbers = li... | true |
909325fdb03654071ecb54104d622e35e96a3497 | Shwebs/Python-practice | /python-fundamentals-by-pluralsight/Object_Reference.py | 1,065 | 4.25 | 4 | #Pass by Object Reference
#The value of the reference is copied , not the value of the object
# Helpful Link https://robertheaton.com/2014/02/09/pythons-pass-by-object-reference-as-explained-by-philip-k-dick/
m = [9, 15, 24]
def modify(k):
"""Appending a value to function.
Args:
A any literal can be added.
R... | true |
79699f6e7d3ab0c9ad08ad75dcf510fae492166d | Shwebs/Python-practice | /ControlStructure/List/List-operation.py | 1,186 | 4.53125 | 5 | #The item at a certain index in a list can be reassigned.
#In the below example , we are re-assigned List[2] to "Bull"
nums = [7, 8, 9, 10, "spring"]
nums[2] = "Bull"
print(nums)
print("===================================")
#What is the result of this code?
nums = [1, 2, 3, 4, 5]
nums[3] = nums[1] # We are re-as... | true |
18f795a10eb2da066a1599fd909069e2d00216fc | Shwebs/Python-practice | /ControlStructure/List/List-method-insert.py | 797 | 4.25 | 4 | #The insert method is similar to append,
#except that it allows you to insert a new item at any position in the list,
#as opposed to just at the end.
words = ["Python", "fun"]
index = 1
words.insert(index, "is")
print (words)
print("================================")
nums = [1,2,3,5,6,7]
index = 3
nums.insert(index,... | true |
fba81294a158815848dded2ca40206fb46b6ccd5 | Shwebs/Python-practice | /BasicConcepts/3.strings/string-methods/string-is-check.py | 1,386 | 4.21875 | 4 | str=input("Enter a String: ")
#isalnum()
#Returns true if string has at least 1 character and all characters are alphanumeric and false otherwise.
print('Checking If it is an alphanumeric :-',str.isalnum())
#isalpha()
#Returns true if string has at least 1 character and all characters are alphabetic and false otherwis... | true |
9539c945b6063ffdcd398710f03d371056ec52f7 | IlyaTroshchynskyi/python_education_troshchynskyi | /algoritms/algoritms.py | 2,512 | 4.125 | 4 | # -*- coding: utf-8 -*-
"""calc
Implements algorithms:
- Binary search
- Quick sort (iterative)
- Recursive factorial
"""
def factorial(number):
"""
Define factorial certain number.
"""
if number <= 0:
return 1
return number * factorial(number-1)
print(factorial(50))
tes... | true |
e4b018aa44483d0eeed003818634cd3d785c2714 | Zahidsqldba07/python_exercises-1 | /exercise_7.py | 348 | 4.4375 | 4 | '''
Write a Python program to accept a filename from the user and print the extension of that. Go to the editor
Sample filename : abc.java
Output: java
'''
file_name = input('Enter file name with extension, example: abc.java')
if file_name == '':
file_name = 'abc.java'
name = file_name.split('.')[0]
ext = file_name... | true |
31e0794ad9981a270497e4cd91c2b9dbe52ea0f3 | tohungsze/Python | /other_python/palindrome.py | 869 | 4.1875 | 4 | '''
check if a given word is a palindrome
'''
def main():
input = ['abcba', 'abc1cba', 'abcba ', 'abc1cba1']
for word in input:
if is_palindrome(word):
print('\'%s\' is a palindrome'%word)
else:
print('\'%s\' is a NOT palindrome'%word)
def is_palindrome(input): #... | true |
9ce0cec8b92e20b92a39e6e5d1af707c3db4fb27 | tohungsze/Python | /other_python/fibonacci.py | 1,139 | 4.28125 | 4 | # demonstrate fibonacci with and without caching
'''
# this is really slow, can't handle more than 30 ish numbers
def fibonacci_n(n):
if n == 0 or n ==1:
return 1
else:
return fibonacci_n(n-1) + fibonacci_n(n-2)
for i in range(1, 11):
print("fibonacci(", i, ") is:", fibonacci_n(i))
'''
''... | true |
ff7c0a83280f5080fcef88e288d96fbeda29289e | prashantkgajjar/Machine-Learning-Essentials | /16. Hierarchical Clustering.py | 2,929 | 4.15625 | 4 | # Hierarchical Clustering
'''
1. Agglomerative Hierarchical Clustering (Many single clusters to one single cluster)
1. Make each data point as a single point Cluster.
2. Take the two closest datapoints, and make them one cluster.
3. Take to closest clusters, and make them one cluster.
4. Repeat STEP 3 ... | true |
5f4d01e512104db3e264784891663d304937ed96 | HsiaoT/Python-Tutorial | /data_structure/Sorting/Selection_sort.py | 802 | 4.28125 | 4 |
# The selection sort algorithm sorts an array by repeatedly finding the
# minimum element (considering ascending order) from unsorted part and
# putting it at the beginning. The algorithm maintains two subarrays in a given array.
# Time complexity (average): O(n^2)
# Time complexit (best): O(n^2) (list already sor... | true |
d9bc14d8ae35cb2475bb92bcc8d99446694bc590 | sunDalik/Information-Security-Labs | /lab1/frequency_analysis.py | 2,879 | 4.3125 | 4 | import argparse
# Relative letter frequencies in the English language texts
# Data taken from https://en.wikipedia.org/wiki/Letter_frequency
theory_frequencies = {'A': 8.2, 'B': 1.5, 'C': 2.8, 'D': 4.3, 'E': 13.0, 'F': 2.2, 'G': 2.0, 'H': 6.1, 'I': 7.0,
'J': 0.15, 'K': 0.77, 'L': 4.0, 'M': 2... | true |
50d5314cda34ce36b4af6d37acdc81b3a87a17f8 | luckychummy/practice | /queueUsingStack.py | 1,222 | 4.28125 | 4 | from queue import LifoQueue
class MyQueue(object):
def __init__(self):
"""
Initialize your data structure here.
"""
self.q1=LifoQueue()
self.q2=LifoQueue()
def push(self, x):
"""
Push element x to the back of queue.
:type x: int
... | true |
34f84a9883b3d57911b30aea2ab4470efa57e482 | AsharGit/Python-ICP | /Source/ICP-3/Employee.py | 1,137 | 4.28125 | 4 | class Employee:
num_employees = 0
total_salary = 0
def __init__(self, name, family, salary, department):
self.emp_name = name
self.emp_family = family
self.emp_salary = salary
self.emp_dept = department
self.increment(salary)
# Increment num_employees and total_... | true |
e50d45dda524f0471a01371f202cb2f7384ca07f | stompingBubble/Asteroids | /shape.py | 2,492 | 4.15625 | 4 | # -*- coding: utf-8 -*-
"""
Gruppuppgift: Asteroids - Objektorienterad Programmering
Nackademin IOT 17
Medverkande:
Isa Sand
Felix Edenborgh
Christopher Bryant
Stomme källkod:
Mark Dixon
"""
from abc import ABC, abstractmethod
import math
from point import Point
class Shape(ABC):
def __init__( self, x=0, y=0,... | true |
ffd1c6706c107f8fa4ca74bf33d36650046d0608 | thechemist54/PYth0n-and-JaVa | /Area calculation.py | 1,663 | 4.4375 | 4 |
#printing the options
print("Options:")
print("-"*8)
print("1. Area of Rectangle")
print("2. Area of Triangle")
print("3. Area of Circle")
print("4. Quit")
#assigning a value to flag
flag = False
#analyzing responses and displaying the respective information
#looping statement
while f... | true |
a948e2106b7150b3a41ae7486415a8dc17842292 | AndrejLehmann/my_pfn_2019 | /Vorlesung/src/Basic/example4_2.py | 769 | 4.65625 | 5 | #!/usr/bin/env python3
# Example 4-2 Concatenating DNA
# store two DNA sequences into two variables called dna1 and dna2
dna1 = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'
dna2 = 'ATAGTGCCGTGAGAGTGATGTAGTA'
# print the DNA onto the screen
print('Here are the original two DNA sequences:')
print(dna1)
print(dna2)
# concaten... | true |
e2802f46eeb773f497cab112e4a74fe96b763f8f | pravalikavis/Python-Mrnd-Exercises | /finaltest_problem3.py | 2,052 | 4.34375 | 4 | __author__ = 'Kalyan'
max_marks = 25
problem_notes = '''
For this problem you have to implement a staircase jumble as described below.
1. You have n stairs numbered 1 to n. You are given some text to jumble.
2. You repeatedly climb down and up the stairs and on each step k you add/append starting k chars fr... | true |
2873efc5e996028da3dbe1d1a3a70e8046511c65 | pankajdahilkar/python_codes | /prime.py | 268 | 4.1875 | 4 | def isPrime(a=0):
i=2
if a==0 :
return 0
while(i<a):
if a%i==0:
return 0
i=i+1
return 1
x=int(input("Enter The number : "))
if(isPrime(x)):
print(x, "is Prime number ")
else :
print(x," is not Prime number")
| true |
44894e050247f38dc88e2184ed65b8e7fc3e868e | pravishbajpai06/Projects | /6.py | 1,483 | 4.1875 | 4 |
#6-Change Return Program - The user enters a cost and then the amount of money given. The program will figure out the change and the number of quarters, dimes, nickels, pennies needed for the change.
import math
cent=0.01
penny=0.01
nickel=0.05
dime=0.1
quarter=0.25
do=1
cost=float(input("Enter the costt"))
amount=flo... | true |
b2b10777497bf79f6353bd04ac19ddb0d69fc281 | 0x0all/coding-challenge-practices | /python-good-questions/reverse_vowels.py | 542 | 4.28125 | 4 | """
The Problem:
Write a function to reverse the vowels in a given string
Example:
input -> output
"hello elephant" -> "halle elophent"
"abcde" -> "ebcda"
"abc" -> "abc"
"""
def reverse_vowels(s):
vowels = 'aeiou'
res = list(s)
pos = [index for index, char in enumerate(s) if char in vowels]
... | true |
6736443ed68910ee2e4d2d665da47667024e19c3 | vasanth9/10weeksofcp | /basics/classesandobjects.py | 1,491 | 4.21875 | 4 | #classes and objects
"""
Python is an object oriented programming language.
Almost everything in Python is an object, with its properties and methods.
A Class is like an object constructor, or a "blueprint" for creating objects.
"""
class myclass:
x=5
p1=myclass()
print(p1.x)
"""
All classes have a function cal... | true |
6bc780d508f837ca9c0428fa160e72932b2060c8 | futurice/PythonInBrowser | /examples/session1/square.py | 837 | 4.5625 | 5 | # Let's draw a square on the canvas
import turtle
##### INFO #####
# Your goal is to make the turtle to walk a square on the
# screen. Let's go through again turtle commands.
# this line creates a turtle to screen
t = turtle.Turtle()
# this line tells that we want to see a turtle shape
t.shape("turtle")
# this lin... | true |
14207390dc1852453b97d8922b1f8b3607f26e64 | futurice/PythonInBrowser | /examples/session1/wall.py | 998 | 4.46875 | 4 | # Goal: help the turtle to find a hole in the wall
# We need to remember to import a turtle every time we want
# to use it.
import turtle
##### INFO #####
# The following code draws the wall and the target. You can
# look at the code but to get to the actual exercise, scroll
# down.
# Here we create a wall to the m... | true |
5f66bea9207f8a7149844204245dc09345a636aa | futurice/PythonInBrowser | /examples/session3/function.py | 2,912 | 4.8125 | 5 | # Computing with functions
import turtle
t = turtle.Turtle()
##### INFO #####
# Fucntions can be used for computing things.
#
# As an example, let's consider computing an area of a
# circle. You may remember form a math class that the area
# of a circle is computed by multiplying the radius of the
# circle by itself ... | true |
35c92a9c66af8bcf6ee2eeec1eb9f3743e375091 | ShaneKoNaung/Python-practice | /stack-and-queue/linked_list_queue.py | 1,222 | 4.25 | 4 | ''' implementing queue using linked-list'''
class LinkedListQueue(object):
class Node(object):
def __init__(self, data, next=None):
self._data = data
self._next = next
def __init__(self):
self._head = None
self._tail = None
self._size = 0
def __len... | true |
2f9976e9ae634c5d370e0a45e4484a9c63e7d363 | ShaneKoNaung/Python-practice | /stack-and-queue/linked_list_stack.py | 1,171 | 4.125 | 4 | ''' Implementation of stack using singly linked list '''
class LinkedListStack(object):
class Node(object):
def __init__(self, data, next=None):
self._data = data
self._next = next
def __init__(self):
''' create an empty stack '''
self._head = None
sel... | true |
5151cfe22c6ba893660c49ba006b512c77a74e6b | Suryashish14/Suryashish-Programs | /SpecialCalculator 1.py | 2,115 | 4.25 | 4 | print('::::::::::::::::::::::::::: MENU ::::::::::::::::::::::::::::::::::')
print('Press 1 To Check For Armstrong Number')
print('Press 2 To Check For Duck Number')
print('Press 3 To Check For Perfect Number')
print('\t\t\t\t Instructions')
print('''1.Provide Only Positive Numbers
2.For Using The Menu Use Only 1... | true |
034c084055637a5c567c8c6b25e6ccd6c25a302e | u101022119/NTHU10220PHYS290000 | /student/100021216/myclass.py | 734 | 4.125 | 4 | import copy
import math
class point(object):
'''Represents a point in 2-D space.'''
class rectangle(object):
"""
Represents a rectangle.
attributes: width, height, corner.
"""
a=point()
a.x=0.0
a.y=0.0
b=point()
b.x=3.0
b.y=4.0
box=rectangle()
box.width=100.0
box.height=200.0
box.corner=point()... | true |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.