original_dataset_id stringlengths 32 32 | dataset_name stringclasses 1 value | table stringlengths 303 11.9k | table_title null | text stringclasses 10 values | question stringlengths 36 315 | answer stringlengths 1 63 |
|---|---|---|---|---|---|---|
e98478f17f738dd3bdd2ff3352d71381 | tablebench-tqa | {'columns': ['city / municipality', 'no of barangays', 'area (km square)', 'population (2010 census)', 'pop density (per km square)'], 'data': [['angono', '10', '26.22', '102407', '3905.68'], ['antipolo', '16', '306.1', '677741', '2214.12'], ['baras', '10', '84.93', '32609', '383.95'], ['binangonan', '40', '66.34', '249872', '3766.54'], ['cainta', '7', '42.99', '311845', '7253.9'], ['cardona', '18', '28.56', '47414', '1660.15'], ['jalajala', '11', '44.12', '30074', '681.64'], ['morong', '8', '37.58', '52194', '1388.88'], ['pililla', '9', '69.95', '59527', '850.99'], ['rodriguez', '11', '312.7', '280904', '898.32'], ['san mateo', '15', '55.09', '205255', '3725.81'], ['tanay', '19', '200.0', '98879', '494.3'], ['taytay', '5', '38.8', '288956', '7447.32']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many cities/municipalities have a population density of over 3000 per km square? | 5 |
5a02841251e9fe91955487687283aa3d | tablebench-tqa | {'columns': ['language', 'quillacollo municipality', 'sipe sipe municipality', 'tiquipaya municipality', 'vinto municipality', 'colcapirhua municipality'], 'data': [['quechua', '52399', '23819', '19308', '18630', '18050'], ['aymara', '7101', '1127', '2481', '2259', '2449'], ['guaranã\xad', '101', '24', '43', '38', '38'], ['another native', '82', '24', '36', '26', '46'], ['spanish', '93131', '23059', '32704', '26355', '38441'], ['foreign', '2087', '215', '1100', '403', '1136'], ['only native', '5756', '6544', '2972', '3332', '1365'], ['native and spanish', '50157', '17704', '17737', '16680', '18139']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many municipalities have a population of 40,000 or more people speaking Spanish? | 1 |
e3569f6407cc27dec6d090871fb8eba9 | tablebench-tqa | {'columns': ['Unnamed: 0', 'airdate', 'episode', 'rating', 'share', 'rating / share (1849)', 'viewers (millions)', 'rank (timeslot)', 'rank (night)'], 'data': [['1', 'february 14 , 2010', "nanna is kickin' your butt", '5.1', '8', '2.8 / 7', '9.07', '1', '1'], ['2', 'february 21 , 2010', 'when the cow kicked me in the head', '5.2', '8', '2.9 / 7', '9.11', '1', '1'], ['3', 'february 28 , 2010', 'run like scalded dogs!', '5.8', '9', '3.2 / 8', '10.24', '2', '4'], ['4', 'march 7 , 2010', 'we are no longer in the bible belt', '4.5', '7', '2.6 / 7', '8.05', '2', '4'], ['5', 'march 14 , 2010', "i think we 're fighting the germans , right", '5.8', '10', '3.0 / 9', '10.1', '1', '3'], ['6', 'march 21 , 2010', 'cathy drone', '6.9', '11', '3.8 / 9', '11.99', '1', '4'], ['7', 'march 28 , 2010', 'anonymous', '7.2', '11', '3.9 / 10', '12.73', '1', '3'], ['8', 'april 4 , 2010', "you 're like jason bourne , right", '5.2', '9', '2.7 / 8', '9.14', '1', '3'], ['9', 'april 11 , 2010', 'dumb did us in', '6.9', '11', '3.4 / 10', '11.88', '1', '3'], ['10', 'april 25 , 2010', "i feel like i'm in , like , sicily", '6.3', '10', '3.2 / 9', '10.69', '1', '3'], ['11', 'may 2 , 2010', "they don't even understand their own language", '6.0', '10', '3.0 / 9', '10.29', '1', '3']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many episodes had a rating of 5.3 or higher? | 7 |
3b25f146ef2692abc071056934ba47e7 | tablebench-tqa | {'columns': ['rank', 'country (or dependent territory)', 'july 1 , 2013 projection', '% of pop', 'average relative annual growth (%)', 'average absolute annual growth'], 'data': [['1', 'germany', '80640000.0', '15.99', '0.24', '196000'], ['2', 'united kingdom', '64231000.0', '12.73', '0.73', '465000'], ['3', 'france', '63820000.0', '12.65', '0.49', '309000'], ['4', 'italy', '59789000.0', '11.85', '0.35', '206000'], ['5', 'spain', '46958000.0', '9.31', '- 0.43', '- 205000'], ['6', 'poland', '38548000.0', '7.64', '0.08', '29000'], ['7', 'romania', '19858000.0', '3.94', '- 0.77', '- 155000'], ['8', 'netherlands', '16795000.0', '3.33', '0.33', '55000'], ['9', 'belgium', '11162000.0', '2.21', '0.66', '73000'], ['10', 'greece', '10758000.0', '2.13', '- 0.13', '- 14000'], ['11', 'portugal', '10609000.0', '2.1', '0.19', '20000'], ['12', 'czech republic', '10519000.0', '2.09', '0.23', '24000'], ['13', 'hungary', '9894000.0', '1.96', '- 0.25', '- 25000'], ['14', 'sweden', '9595000.0', '1.9', '0.76', '72000'], ['15', 'austria', '8477000.0', '1.68', '0.61', '51000'], ['16', 'bulgaria', '7261000.0', '1.44', '- 0.59', '- 43000'], ['17', 'denmark', '5612000.0', '1.11', '0.45', '25000'], ['18', 'finland', '5436000.0', '1.08', '0.44', '24000'], ['19', 'slovakia', '5413000.0', '1.07', '0.15', '8000'], ['20', 'ireland', '4662000.0', '0.92', '1.35', '62000'], ['21', 'croatia', '4258000.0', '0.84', '- 0.35', '- 15000'], ['22', 'lithuania', '2956000.0', '0.59', '- 1.30', '- 39000'], ['23', 'slovenia', '2062000.0', '0.41', '0.24', '5000'], ['24', 'latvia', '2011000.0', '0.4', '- 1.23', '- 25000'], ['25', 'estonia', '1283000.0', '0.25', '- 0.62', '- 8000'], ['26', 'cyprus', '888000.0', '0.18', '1.95', '17000'], ['27', 'luxembourg', '542000.0', '0.11', '1.88', '10000'], ['28', 'malta', '419000.0', '0.08', '0.48', '2000'], ['align = left|total', '504456000', '100.0', '0.22', '1124000', '311']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many countries have a population of over 50 million according to the 2013 projection? | 4 |
d4f2e8dcb5e636fd8ee662f635c1f588 | tablebench-tqa | {'columns': ['CCC', 'IEEE Conference on Computational Complexity', '1993', '1996', '1999', '-', '2007', '2011', '2015'], 'data': [['EC', 'ACM Conference on Electronic Commerce', '-', '-', '-', '2003', '2007', '2011', '2015'], ['ISCA', 'ACM/IEEE International Symposium on Computer Architecture', '1993', '1996', '1999', '2003', '2007', '2011', '2015'], ['LCTES', 'ACM SIGPLAN/SIGBED Conference on Languages, Compilers, and Tools for Embedded Systems', '-', '-', '1999', '2003', '2007', '-', '-'], ['METRICS', 'ACM SIGMETRICS International Conference on Measurement and Modeling of Computer Systems', '-', '1996', '1999', '2003', '2007', '-', '2015'], ['PLDI', 'ACM SIGPLAN Conference on Programming Language Design and Implementation', '-', '1996', '1999', '2003', '2007', '2011', '2015'], ['PODC', 'ACM Symposium on Principles of Distributed Computing', '-', '1996', '1999', '-', '-', '2011', '-'], ['PPoPP', 'ACM SIGPLAN Symposium on Principles and Practice of Parallel Programming', '1993', '-', '1999', '2003', '-', '-', '-'], ['SPAA', 'ACM Symposium on Parallelism in Algorithms and Architectures', '-', '-', '-', '2003', '2007', '2011', '2015'], ['SoCG', 'ACM Symposium on Computational Geometry', '1993', '1996', '-', '2003', '-', '-', '-'], ['STOC', 'ACM Symposium on Theory of Computing', '1993', '1996', '1999', '2003', '2007', '2011', '2015']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many conferences have occurrences in the year 1996? | 6 |
4f1d765413de5719e856a8856cbea802 | tablebench-tqa | {'columns': ['squad no', 'name', 'position', 'league apps', 'league goals', 'fa cup apps', 'fa cup goals', 'league cup apps', 'league cup goals', 'flt apps', 'flt goals', 'total apps', 'total goals'], 'data': [['2', 'andy holdsworth', 'df', '43 (1)', '3', '5', '0', '0', '0', '1', '0', '49 (1)', '3'], ['3', 'joe skarz', 'df', '22 (5)', '0', '2 (1)', '0', '1', '0', '1', '0', '26 (6)', '0'], ['4', 'michael collins', 'mf', '35 (6)', '2', '3 (2)', '1', '1', '0', '1', '1', '40 (8)', '4'], ['5', 'david mirfin', 'df', '23 (6)', '1', '3 (1)', '0', '1', '0', '0', '0', '27 (7)', '1'], ['6', 'nathan clarke', 'df', '44', '2', '4', '0', '1', '0', '1', '0', '50', '2'], ['7', 'chris brandon', 'mf', '25 (3)', '2', '2', '1', '1', '0', '1', '0', '29 (3)', '3'], ['8', 'jon worthington', 'mf', '19 (6)', '0', '1', '0', '1', '0', '0', '0', '21 (6)', '0'], ['9', 'danny cadamarteri', 'fw', '10 (2)', '3', '1 (1)', '0', '0', '0', '0', '0', '11 (3)', '3'], ['10', 'robbie williams', 'df', '24 (1)', '2', '3', '0', '0', '0', '0', '0', '27 (1)', '2'], ['11', 'danny schofield', 'mf', '19 (6)', '2', '4 (1)', '0', '1', '0', '1', '0', '25 (7)', '2'], ['12', 'tom clarke', 'df', '2 (1)', '0', '0', '0', '0', '0', '0 (1)', '0', '2 (2)', '0'], ['13', 'frank sinclair', 'df', '28 (1)', '0', '5', '0', '1', '0', '0', '0', '34 (1)', '0'], ['14', 'phil jevons', 'fw', '17 (4)', '7', '3 (1)', '2', '0', '0', '0', '0', '20 (5)', '9'], ['14', 'richard keogh', 'df', '9', '1', '0', '0', '0', '0', '1', '0', '10', '1'], ['15', 'malvin kamara', 'mf', '33 (10)', '3', '3 (2)', '2', '1', '0', '1', '0', '38 (12)', '5'], ['16', 'ronnie wallwork', 'mf', '16', '3', '2', '0', '0', '0', '0', '0', '18', '3'], ['17', 'matty young', 'mf', '4 (4)', '0', '0', '0', '0', '0', '0 (1)', '0', '4 (5)', '0'], ['18', 'luke beckett', 'fw', '25 (11)', '8', '3 (2)', '4', '1', '0', '1', '0', '30 (13)', '12'], ['19', 'aaron hardy', 'df', '5 (1)', '0', '0', '0', '0 (1)', '0', '1', '0', '6 (2)', '0'], ['20', 'danny racchi', 'df', '0 (3)', '0', '0', '0', '0', '0', '0', '0', '0 (3)', '0'], ['21', 'lucas akins', 'fw', '0 (3)', '0', '0', '0', '0', '0', '0 (1)', '0', '0 (4)', '0'], ['22', 'james berrett', 'mf', '10 (5)', '1', '2', '0', '0', '0', '0', '0', '12 (5)', '1'], ['23', 'andy booth', 'fw', '28 (10)', '9', '2 (1)', '0', '0 (1)', '0', '0', '0', '30 (12)', '9'], ['27', 'matt glennon', 'gk', '45', '0', '5', '0', '1', '0', '1', '0', '52', '0'], ['28', 'alex smithies', 'gk', '1 (1)', '0', '0', '0', '0', '0', '0', '0', '1 (1)', '0'], ['29', 'robert page', 'df', '18', '1', '2', '0', '0', '0', '0', '0', '20', '1'], ['31', 'shane killock', 'df', '1', '0', '0', '0', '0', '0', '0', '0', '1', '0'], ['32', 'daniel broadbent', 'fw', '0 (5)', '0', '0', '0', '0', '0', '0', '0', '0 (5)', '0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many players have scored more than 3 goals in total? | 5 |
6b91092d9b595b1b22ac8c1791a0f2b7 | tablebench-tqa | {'columns': ['Party', 'Votes', '%', 'Seats', '+/-'], 'data': [['Liberal Democratic Party', '24,563,199', '46.9', '271', '17'], ['Japan Socialist Party', '11,478,742', '21.9', '118', '+28'], ['Japanese Communist Party', '5,496,827', '10.5', '38', '+24'], ['Komeitō', '4,436,755', '8.5', '29', '18'], ['Democratic Socialist Party', '3,660,953', '7.0', '19', '12'], ['Other parties', '143,019', '0.3', '2', '+2'], ['Independents', '2,645,582', '5.0', '14', '2'], ['Total', '52,425,079', '100', '491', '+5'], ['Source: http://www.stat.go.jp/data/chouki/27.htm', 'Source: http://www.stat.go.jp/data/chouki/27.htm', 'Source: http://www.stat.go.jp/data/chouki/27.htm', 'Source: http://www.stat.go.jp/data/chouki/27.htm', 'Source: http://www.stat.go.jp/data/chouki/27.htm']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many parties have more than 10% of the total votes? | 3 |
c053c02d128201b79cbbd11c395f542a | tablebench-tqa | {'columns': ['institution', 'location', 'established', 'gained university status', 'vice - chancellor', 'total number of students', 'research funding (000)'], 'data': [['birkbeck , university of london', 'london', '1823', '1920', 'professor david latchman', '19020', '9985'], ['university of east anglia', 'norwich', '1963', '1963', 'professor edward acton', '19585', '16482'], ['university of essex', 'colchester', '1964', '1964', 'professor anthony forster', '11690', '9967'], ['goldsmiths , university of london', 'london', '1891', '1904', 'dr pat loughrey', '7615', '8539'], ['institute of education , university of london', 'london', '1902', '1932', 'professor chris husbands', '7215', '7734'], ['university of lancaster', 'lancaster', '1964', '1964', 'professor mark smith', '12695', '18640'], ['university of leicester', 'leicester', '1921', '1957', 'professor robert burgess', '16160', '22225'], ['loughborough university', 'loughborough', '1909', '1966', 'professor robert allison', '17825', '22398'], ['royal holloway , university of london', 'egham', '1849', '1900', 'professor paul layzell (principal)', '7620', '13699'], ['soas , university of london', 'london', '1916', '1916', 'professor paul webley', '4525', '7238']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many universities are located in London? | 4 |
fc54ee44f3ad6ef357adb7681ae26e35 | tablebench-tqa | {'columns': ['county', 'per capita income', 'median household income', 'median family income', 'population', 'number of households'], 'data': [['los alamos', '49474', '103643', '118993', '17950', '7663'], ['santa fe', '32188', '52696', '64041', '144170', '61963'], ['united states', '27334', '51914', '62982', '308745538', '116716292'], ['bernalillo', '26143', '47481', '59809', '662564', '266000'], ['sandoval', '25979', '57158', '65906', '131561', '47602'], ['eddy', '24587', '46583', '56646', '53829', '20411'], ['lincoln', '24290', '43750', '53871', '20497', '9219'], ['new mexico', '22966', '43820', '52565', '2059179', '791395'], ['taos', '22145', '35441', '43236', '32937', '14806'], ['mora', '22035', '37784', '42122', '4881', '2114'], ['grant', '21164', '36591', '44360', '29514', '12586'], ['colfax', '21047', '39216', '48450', '13750', '6011'], ['catron', '20895', '31914', '40906', '3725', '1787'], ['de baca', '20769', '30643', '36618', '2022', '912'], ['san juan', '20725', '46189', '53540', '130044', '44404'], ['valencia', '19955', '42044', '48767', '76569', '27500'], ['curry', '19925', '38090', '48933', '48376', '18015'], ['rio arriba', '19913', '41437', '47840', '40246', '15768'], ['lea', '19637', '43910', '48980', '64727', '22236'], ['otero', '19255', '39615', '46210', '63797', '24464'], ['union', '19228', '39975', '41687', '4549', '1695'], ['san miguel', '18508', '32213', '42888', '29393', '11978'], ['chaves', '18504', '37524', '43464', '65645', '23691'], ['doã±a ana', '18315', '36657', '43184', '209233', '75532'], ['quay', '18234', '28773', '41766', '9041', '4072'], ['socorro', '17801', '33284', '41964', '17866', '7014'], ['hidalgo', '17451', '36733', '41594', '4894', '1936'], ['torrance', '17278', '37117', '43914', '16383', '6264'], ['roosevelt', '16933', '37762', '43536', '19846', '7299'], ['sierra', '16667', '25583', '38641', '11988', '5917'], ['luna', '15687', '27997', '33312', '25095', '9593'], ['cibola', '14712', '37361', '41187', '27213', '8860'], ['harding', '14684', '33750', '56563', '695', '349'], ['guadalupe', '13710', '28488', '37535', '4687', '1766'], ['mckinley', '12932', '31335', '37345', '71492', '21968']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many counties have a per capita income between $18,000 and $27,000? | 22 |
7dcfc5012f532ebc8d16d2622ebdb2e6 | tablebench-tqa | {'columns': ['frequency (hz)', 'r (î / km)', 'l (mh / km)', 'g (î¼s / km)', 'c (nf / km)'], 'data': [['1', '172.24', '0.6129', '0.0', '51.57'], ['1k', '172.28', '0.6125', '0.072', '51.57'], ['10k', '172.7', '0.6099', '0.531', '51.57'], ['100k', '191.63', '0.5807', '3.327', '51.57'], ['1 m', '463.59', '0.5062', '29.111', '51.57'], ['2 m', '643.14', '0.4862', '53.205', '51.57']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many frequency measurements have a resistance value greater than 180? | 3 |
53b60df40c509bb2ad5b686fa130486c | tablebench-tqa | {'columns': ['Bank', 'Foundation', '# of Branches\nAs of 30 September 2012', 'Total Assets (million TL)\nAs of 30 September 2012'], 'data': [['Türkiye İş Bankası', '1924', '1,294', '210,535'], ['Ziraat Bankası', '1863', '1,510', '207,871'], ['Garanti Bank', '1946', '947', '154,550'], ['Akbank', '1948', '963', '150,241'], ['Yapı ve Kredi Bankası', '1944', '949', '160,309'], ['Halk Bankası', '1938', '807', '116,372'], ['VakıfBank', '1954', '741', '135,578'], ['Finansbank', '1987', '530', '49,902'], ['Türk Ekonomi Bankası', '1927', '510', '42,505'], ['Denizbank', '1997', '624', '40,457'], ['HSBC Bank', '1990', '331', '25,797'], ['ING Bank', '1984', '320', '23,184'], ['Türk Eximbank', '1987', '2', '14,724'], ['Şekerbank', '1953', '272', '14,656'], ['İller Bankası', '1933', '19', '12,309'], ['Türkiye Sınai Kalkınma Bankası', '1950', '4', '9,929'], ['Alternatif Bank', '1992', '63', '7,904'], ['Citibank', '1980', '37', '7,884'], ['Anadolubank', '1996', '88', '7,218'], ['Burgan Bank', '1992', '60', '4,275'], ['İMKB Takas ve Saklama Bankası', '1995', '1', '3,587'], ['Tekstilbank', '1986', '44', '3,502'], ['Deutsche Bank', '1988', '1', '3,426'], ['Fibabanka', '1984', '27', '3,120'], ['Aktif Yatırım Bankası', '1999', '7', '2,997'], ['The Royal Bank of Scotland', '1921', '3', '2,750'], ['Türkiye Kalkınma Bankası', '1975', '1', '2,651'], ['Turkland Bank', '1991', '27', '2,649'], ['Arap Türk Bankası', '1977', '7', '2,147'], ['Merrill Lynch', '1992', '1', '1,898'], ['BankPozitif', '1999', '1', '1,788'], ['Société Générale', '1989', '16', '1,457'], ['Turkish Bank', '1982', '20', '837'], ['JPMorgan Chase', '1984', '1', '830'], ['Birleşik Fon Bankası', '1958', '1', '801'], ['Bank Mellat', '1982', '3', '729'], ['Portigon', '1985', '1', '279'], ['Nurol Yatırım Bankası', '1999', '2', '227'], ['Diler Yatırım Bankası', '1998', '1', '108'], ['GSD Yatırım Bankası', '1998', '1', '108'], ['Habib Bank Limited', '1983', '1', '80'], ['Credit Agricole', '1990', '1', '72'], ['Adabank', '1985', '1', '51'], ['Taib Yatırım Bank', '1987', '1', '18']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many banks have total assets of more than 10,000 million TL? | 15 |
0a53ffc65168d29f6a0784ec6741ffb0 | tablebench-tqa | {'columns': ['Model', 'Fuel Type', 'mpg (US gallons)', 'L/100 km', 'NZ Rating\n(Stars)'], 'data': [['Volkswagen Polo 1.4 TDI BLUEMOTION', 'diesel', '62.0', '3.8', '5.5'], ['Volkswagen Polo 1.4 TDI 5M', 'diesel', '52.0', '4.5', '5.5'], ['Volkswagen Polo 1.4 MAN', 'petrol', '36.7', '6.4', '4.5'], ['Volkswagen Polo 1.4 6A', 'petrol', '34.0', '6.9', '4.5'], ['Fiat 500 1.3 JTD POP', 'diesel', '56.0', '4.2', '5.5'], ['Fiat 500 1.2 POP', 'petrol', '46.0', '5.1', '5.0'], ['Fiat 500 1.4 LOUNGE 3D', 'petrol', '37.3', '6.3', '4.5'], ['Fiat 500 1.4 POP', 'petrol', '37.3', '6.3', '4.5'], ['Fiat 500 1.4 SPORT', 'petrol', '37.3', '6.3', '4.5'], ['Mini Cooper HATCH 6M 2DR 1.5L Diesel', 'diesel', '53.0', '4.4', '5.5'], ['Mini Cooper COUPE 6M 3DR 1.6L Diesel', 'diesel', '52.0', '4.5', '5.5'], ['Mini Cooper COUPE 6A 3DR 1.6L Diesel', 'diesel', '43.5', '5.4', '5.0'], ['Mini Cooper HATCH 6M 2DR 1.6I', 'petrol', '40.5', '5.8', '5.0'], ['Mini Cooper COUPE 6M 3DR 1.6L', 'petrol', '39.2', '6.0', '5.0'], ['Mini Cooper HATCH 6M 2DR 1.5L', 'petrol', '35.0', '6.7', '4.5'], ['Mini Cooper COUPE 6A 3DR 1.6L', 'petrol', '34.6', '6.8', '4.5'], ['Citroen C4 1.6 HDI 6A EGS 5DR', 'diesel', '52.0', '4.5', '5.5'], ['Citroen C4 1.6 SX 5DR 5SP M D', 'diesel', '50.0', '4.7', '5.0'], ['Citroen C4 2.0 SX 5DR 6SP A D', 'diesel', '37.3', '6.3', '4.5'], ['Hyundai Getz 1.5D CRDI 5D M5', 'diesel', '52.0', '4.5', '5.5'], ['Hyundai Getz 1.4 5D M5', 'petrol', '38.5', '6.1', '4.5'], ['Kia Rio 1.5 DIESEL HATCH MAN', 'diesel', '52.0', '4.5', '5.5'], ['Kia Rio 1.5 DIESEL SEDAN MAN', 'diesel', '52.0', '4.5', '5.5'], ['Kia Rio 1.6 HATCH MANUAL', 'petrol', '34.6', '6.8', '4.5'], ['Volkswagen Golf 1.9 TDI BLUEMOTION', 'diesel', '52.0', '4.5', '5.5'], ['Volkswagen Golf 1.9 TDI 7DSG', 'diesel', '44.3', '5.3', '5.0'], ['Volkswagen Golf 90KW TSI 7DSG', 'petrol', '39.8', '5.9', '5.0'], ['Volkswagen Golf 1.9 TDI 6DSG', 'diesel', '39.2', '6.0', '5.0'], ['Volkswagen Golf 2.0 TDI 4 MOTION MAN', 'diesel', '39.2', '6.0', '5.0'], ['Volkswagen Golf 2.0 TDI DSG', 'diesel', '39.2', '6.0', '5.0'], ['Volkswagen Golf TDI 103KW 6DSG', 'diesel', '38.5', '6.1', '4.5'], ['Volkswagen Golf TDI 103KW 4MOTION', 'diesel', '37.3', '6.3', '4.5'], ['Fiat Grande Punto 1.3 JTD 5D 6SP', 'diesel', '51.0', '4.6', '5.0'], ['Fiat Grande Punto 1.3 JTD 5D DUALOGIC', 'diesel', '51.0', '4.6', '5.0'], ['Fiat Grande Punto 1.3 JTD DUAL LOGIC', 'diesel', '46.0', '5.1', '5.0'], ['Fiat Grande Punto 1.9 JTD SPORT 3D 6SP', 'diesel', '42.0', '5.6', '5.0'], ['Fiat Grande Punto 1.9 EMOTION 5DR 6SPD', 'diesel', '42.0', '5.6', '5.0'], ['Fiat Grande Punto 1.9 JTD 5D 6SPEED', 'diesel', '42.0', '5.6', '5.0'], ['Fiat Grande Punto 1.4 DYNAMIC 5 SPEED', 'petrol', '38.5', '6.1', '4.5'], ['Fiat Grande Punto 1.4 5D DUAL LOGIC', 'petrol', '35.0', '6.7', '4.5'], ['Honda Civic Hybrid', 'petrol', '51.0', '4.6', '5.0'], ['Hyundai Accent 1.5 CRDI 4D M5 SEDAN', 'diesel', '51.0', '4.6', '5.0'], ['Hyundai Accent 1.6 GLS 4D M5', 'petrol', '36.7', '6.4', '4.5'], ['Peugeot 308 HDI AT 1.6', 'diesel', '51.0', '4.6', '5.0'], ['Peugeot 308 XS MANUAL', 'petrol', '35.0', '6.7', '4.5'], ['Peugeot 308 HDI AUTO', 'diesel', '34.6', '6.8', '4.5'], ['Skoda Fabia 1.4 TDI', 'diesel', '51.0', '4.6', '5.0'], ['Skoda Fabia 1.9 TDI COMBI', 'diesel', '48.0', '4.9', '5.0'], ['Volkswagen Jetta 1.9 TDI 7DSG', 'diesel', '51.0', '4.6', '5.0'], ['Volkswagen Jetta 2.0 TDI DSG', 'diesel', '43.5', '5.4', '5.0'], ['Volkswagen Jetta TDI 103KW 6DSG', 'diesel', '37.9', '6.2', '4.5'], ['Hyundai i30 1.6 CRDI ELITE M5', 'diesel', '50.0', '4.7', '5.0'], ['Hyundai i30 1.6 CRDI 5D M5', 'diesel', '50.0', '4.7', '5.0'], ['Hyundai i30 1.6 CRDI ELITE A4', 'diesel', '39.2', '6.0', '5.0'], ['Hyundai i30 1.6 5D M5', 'petrol', '37.9', '6.2', '4.5'], ['Peugeot 207 HDI 1.6 5DR 5 SP M D', 'diesel', '49.0', '4.8', '5.0'], ['Peugeot 207 XS 1.4 5DR 5SPD M P', 'petrol', '37.3', '6.3', '4.5'], ['Citroen C3 1.6 HDI 5DR 5SPD', 'diesel', '48.0', '4.9', '5.0'], ['Citroen C3 1.6 5DR 5SPD', 'petrol', '36.2', '6.5', '4.5'], ['Kia Cerato 1.6 DIESEL 5M SEDAN', 'diesel', '48.0', '4.9', '5.0'], ['Daihatsu Sirion 1.0 HATCH 5MT', 'petrol', '47.0', '5.0', '5.0'], ['Daihatsu Sirion 1.3P HATCH 5M', 'petrol', '40.5', '5.8', '5.0'], ['Daihatsu Sirion 1.3P HATCH 4A', 'petrol', '36.2', '6.5', '4.5'], ['Daihatsu Sirion 1.5P SX HATCH 4AT', 'petrol', '35.0', '6.7', '4.5'], ['Smart Fortwo CAB', 'petrol', '47.0', '5.0', '5.0'], ['Smart Fortwo COUPE', 'petrol', '47.0', '5.0', '5.0'], ['Toyota Corolla 1.4D HATCH5 5M', 'diesel', '47.0', '5.0', '5.0'], ['Toyota Corolla 2.0D HATCH5 6M', 'diesel', '43.5', '5.4', '5.0'], ['Toyota Corolla 1.5P WAGON 5DR 5M', 'petrol', '40.5', '5.8', '5.0'], ['Volkswagen Passat TDI BLUEMOTION SED', 'diesel', '46.0', '5.1', '5.0'], ['Volkswagen Passat TDI BLUEMOTION VAR', 'diesel', '44.3', '5.3', '5.0'], ['Volkswagen Passat 2.0 TDI DSG SEDAN', 'diesel', '38.5', '6.1', '4.5'], ['Volkswagen Passat 2.0 TDI DSG VARIANT', 'diesel', '37.9', '6.2', '4.5'], ['Volkswagen Passat TDI 125KW 6DSG SED', 'diesel', '36.2', '6.5', '4.5'], ['Volkswagen Passat TDI 125KW 6DSG VAR', 'diesel', '35.6', '6.6', '4.5'], ['Volkswagen Passat TDI 103KW 4M VAR', 'diesel', '35.0', '6.7', '4.5'], ['Kia Picanto 1.1 MANUAL', 'petrol', '45.2', '5.2', '5.0'], ['Kia Picanto 1.1 AUTO', 'petrol', '40.5', '5.8', '5.0'], ['Skoda Octavia 1.9 TDI MAN COMBI', 'diesel', '45.2', '5.2', '5.0'], ['Skoda Octavia RS 2.0 TDI SEDAN MAN', 'diesel', '41.2', '5.7', '5.0'], ['Skoda Octavia RS 2.0 TDI COMBI MAN', 'diesel', '40.5', '5.8', '5.0'], ['Skoda Octavia 1.9 TDI AUTO', 'diesel', '40.5', '5.8', '5.0'], ['Skoda Octavia 1.9 TDI COMBI AUTO', 'diesel', '40.5', '5.8', '5.0'], ['Skoda Octavia 4X4 2.0 TDI COMBI M', 'diesel', '37.9', '6.2', '4.5'], ['Skoda Octavia SCOUT 2.0 TDI', 'diesel', '36.7', '6.4', '4.5'], ['BMW 118D HATCH 6M 5DR 1.8L', 'diesel', '44.3', '5.3', '5.0'], ['BMW 118D HATCH 6A 5DR 1.8L', 'diesel', '39.2', '6.0', '5.0'], ['Ford Focus 1.8TD WAGON', 'diesel', '44.3', '5.3', '5.0'], ['Ford Focus 1.6 M HATCH', 'petrol', '35.0', '6.7', '4.5'], ['Ford Focus WAG 1.6 MAN', 'petrol', '35.0', '6.7', '4.5'], ['Mercedes Benz A 180 CDI CLASSIC', 'diesel', '44.3', '5.3', '5.0'], ['Mercedes Benz A 180 CDI ELEGANCE', 'diesel', '44.3', '5.3', '5.0'], ['Mercedes Benz A 180 CDI AVANTGARDE', 'diesel', '44.3', '5.3', '5.0'], ['Mercedes Benz A 200 CDI AVANTGARDE', 'diesel', '43.5', '5.4', '5.0'], ['Skoda Roomster 1.9 TDI COMFORT', 'diesel', '43.5', '5.4', '5.0'], ['Skoda Roomster 1.9 TDI STYLE', 'diesel', '43.5', '5.4', '5.0'], ['Audi A4 2.0 TDI MULTI SEDAN', 'diesel', '42.7', '5.5', '5.0'], ['Audi A4 2.0 TDI MULTI', 'diesel', '37.9', '6.2', '4.5'], ['Audi A4 2.0 TDI MULTI AVANT', 'diesel', '37.9', '6.2', '4.5'], ['Audi A4 2.7 TDI MULTI SEDAN', 'diesel', '35.6', '6.6', '4.5'], ['BMW 120D 5 DOOR M E87', 'diesel', '42.7', '5.5', '5.0'], ['BMW 120D 5 DOOR A E87', 'diesel', '38.5', '6.1', '4.5'], ['Fiat Bravo SPORT JTD 16V 5DR', 'diesel', '42.0', '5.6', '5.0'], ['Mitsubishi Colt 1.5P LS 5DR HATCH A', 'petrol', '42.0', '5.6', '5.0'], ['Mitsubishi Colt 1.5P VRX 5DR HATCH', 'petrol', '42.0', '5.6', '5.0'], ['Mitsubishi Colt 1.5P VRX 5DR HATCH A', 'petrol', '42.0', '5.6', '5.0'], ['Mitsubishi Colt 1.5P VRX 5DR HATCHA', 'petrol', '42.0', '5.6', '5.0'], ['Mitsubishi Colt 1.5P LS 5DR HATCH M', 'petrol', '39.8', '5.9', '5.0'], ['BMW 520D SEDAN 6A 4DR 2.0L', 'diesel', '41.2', '5.7', '5.0'], ['Holden Astra MY8.5 CDTI WAGON MAN', 'diesel', '41.2', '5.7', '5.0'], ['Holden Astra MY8.5 CDTI HATCH MAN', 'diesel', '41.2', '5.7', '5.0'], ['Holden Astra CDTI 5DR HATCH MT', 'diesel', '39.2', '6.0', '5.0'], ['Holden Astra CDTI 5DR MAN', 'diesel', '39.2', '6.0', '5.0'], ['Mini One HATCH 6M 2DR 1.4I', 'petrol', '41.2', '5.7', '5.0'], ['Mini One HATCH 6A 2DR 1.4I', 'petrol', '35.6', '6.6', '4.5'], ['Subaru Legacy WAGON 2.0 TD MANUAL', 'diesel', '41.2', '5.7', '5.0'], ['Audi A3 2.0 TDI S TRONIC', 'diesel', '40.5', '5.8', '5.0'], ['Audi A3 SPORTBACK 1.4T FSI', 'petrol', '40.5', '5.8', '5.0'], ['Audi A3 2.0 TDI SP A TRONIC', 'diesel', '38.5', '6.1', '4.5'], ['Subaru Outback WAGON 2.0 TD MANUAL', 'diesel', '40.5', '5.8', '5.0'], ['BMW 123D COUPE 6M 3DR 2.0L', 'diesel', '39.8', '5.9', '5.0'], ['BMW 123D Saloon 6M 5DR 2.3L', 'diesel', '39.8', '5.9', '5.0'], ['BMW 123D HATCH 6M 5DR 2.3L', 'diesel', '38.5', '6.1', '4.5'], ['BMW 123D 2.3L 6A 3DR COUPE', 'diesel', '38.5', '6.1', '4.5'], ['Daihatsu Charade 1.0P HATCH5 4A', 'petrol', '39.8', '5.9', '5.0'], ['Saab 9-3 Linear SPCOMBI1.9MT', 'diesel', '39.8', '5.9', '5.0'], ['Saab 9-3 Linear CONVERTIBLE 1.9TID M', 'diesel', '37.3', '6.3', '4.5'], ['Volkswagen Caddy DELIVERY 1.9TDI DSG', 'diesel', '39.8', '5.9', '5.0'], ['Volkswagen Caddy DELIVERY 1.9TDI MAN', 'diesel', '38.5', '6.1', '4.5'], ['Volkswagen Caddy LIFE 1.9 TDI DSG', 'diesel', '38.5', '6.1', '4.5'], ['Volkswagen Caddy LIFE 1.9 TDI MAN', 'diesel', '37.9', '6.2', '4.5'], ['Alfa Romeo 147 1.9 JTD 16V 5DR 6 SP', 'diesel', '39.2', '6.0', '5.0'], ['Alfa Romeo 159 1.9 JTD 4D 6SP SEDAN', 'diesel', '39.2', '6.0', '5.0'], ['Alfa Romeo 159 2.4 JTD 4D 6SP SEDAN', 'diesel', '34.6', '6.8', '4.5'], ['BMW 320D SEDAN 6A 4DR 2.0L', 'diesel', '39.2', '6.0', '5.0'], ['BMW 320D TOURING 6A 5DR 2.0L', 'diesel', '38.5', '6.1', '4.5'], ['Daihatsu Copen 1.3P COUPE CONV 5M', 'petrol', '39.2', '6.0', '5.0'], ['Hyundai Sonata 2.0 CRDI M6', 'diesel', '39.2', '6.0', '5.0'], ['Dodge Caliber SXT CRD', 'diesel', '38.5', '6.1', '4.5'], ['Honda Jazz SPORT', 'petrol', '38.5', '6.1', '4.5'], ['Holden Combo XC 1.4 MANUAL', 'petrol', '37.9', '6.2', '4.5'], ['Mercedes Benz B 200 CDI', 'diesel', '37.9', '6.2', '4.5'], ['Suzuki Swift GLX 1.5 5DR', 'petrol', '37.3', '6.3', '4.5'], ['Suzuki Swift GLXH 1.5 5DR', 'petrol', '37.3', '6.3', '4.5'], ['Suzuki Swift GLXH2 1.5 5DR', 'petrol', '37.3', '6.3', '4.5'], ['Suzuki Swift GLXA 1.5 5DR', 'petrol', '35.0', '6.7', '4.5'], ['Suzuki Swift GLXHA 1.5 5DR', 'petrol', '35.0', '6.7', '4.5'], ['Suzuki Swift GLXHA2 1.5 5DR', 'petrol', '35.0', '6.7', '4.5'], ['Fiat Multipla DYNAMIC 1.9 JTD 5D', 'diesel', '36.7', '6.4', '4.5'], ['Mazda Mazda2 CLASSIC 5DR 1.5 M5', 'petrol', '36.7', '6.4', '4.5'], ['Mazda Mazda2 SPORT 5 DR 1.5 M 5', 'petrol', '36.7', '6.4', '4.5'], ['Mazda Mazda2 SPORT 5 DR 1.5 4AT', 'petrol', '34.6', '6.8', '4.5'], ['Mazda Mazda2 CLASSIC 5DR 1.5 4AT', 'petrol', '34.6', '6.8', '4.5'], ['Mitsubishi Colt Plus 1.5P RALLIART TURBO', 'petrol', '36.7', '6.4', '4.5'], ['Peugeot 307 XS 1.6 5DR 4SPD A P', 'petrol', '36.7', '6.4', '4.5'], ['Peugeot 307 XSP 2.0 5DR 5SPD M P', 'petrol', '36.2', '6.5', '4.5'], ['Peugeot 307 HDI 2.0 5DR 6SPD A D', 'diesel', '35.0', '6.7', '4.5'], ['Peugeot 307 HDI 2.0 5DR 6SPD M D', 'diesel', '35.0', '6.7', '4.5'], ['Peugeot 607 HDI 2.2 5DR 6SPM P', 'diesel', '36.7', '6.4', '4.5'], ['BMW 330D SEDAN 6M 4DR 3.0L', 'diesel', '36.2', '6.5', '4.5'], ['Jeep Compass LTD 2.0L CRD', 'diesel', '36.2', '6.5', '4.5'], ['Ford Fiesta 5DR 1.6 M', 'petrol', '35.6', '6.6', '4.5'], ['Mitsubishi I-car 660P 5DR A', 'petrol', '39.8', '5.9', '4.5'], ['Toyota RAV4 2.2D WAGON 6M L1', 'diesel', '35.6', '6.6', '4.5'], ['BMW 118I 5 DOOR M E87', 'petrol', '35.0', '6.7', '4.5'], ['Jeep Patriot 2.0L CRD HIGH LINE', 'diesel', '35.0', '6.7', '4.5'], ['Renault Clio 1.6 3DR 4SP A P', 'petrol', '35.0', '6.7', '4.5'], ['Alfa Romeo Brera 2.4 JTD 3D 6 SPEED', 'diesel', '34.6', '6.8', '4.5'], ['Audi A6 2.7 TDI QUATTRO TIP', 'diesel', '34.6', '6.8', '4.5'], ['BMW 535D SEDAN 6A 4D 3.0L', 'diesel', '34.6', '6.8', '4.5'], ['Suzuki SX4 GLXF 1.6 5DR', 'petrol', '34.6', '6.8', '4.5'], ['Suzuki SX4 GLXH2 1.6 5DR', 'petrol', '34.6', '6.8', '4.5'], ['Volkswagen Crosstouran 103KW TDI 6DSG', 'diesel', '34.6', '6.8', '4.5'], ['Volkswagen Touran 103KW TDI 6DSG', 'diesel', '34.6', '6.8', '4.5'], ['Holden Barina 3DR HATCH MANUAL', 'petrol', '34.0', '6.9', '4.5'], ['Holden Barina 5DR HATCH MANUAL', 'petrol', '34.0', '6.9', '4.5']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many diesel cars are listed in the table? | 111 |
cf78a80569325500f2aa429285c98f5e | tablebench-tqa | {'columns': ['season', 'series', 'races', 'poles', 'wins', 'points', 'final placing'], 'data': [['2003', 'formula renault monza winter series', '2', '0', '0', '18', '8th'], ['2004', 'formula renault monza', '16', '3', '5', '375', '1st'], ['2004', 'formula junior 1600 spain', '9', '6', '4', '119', '1st'], ['2004', 'formula renault 1600 belgium', '4', '0', '1', '65', '11th'], ['2005', 'austrian fomula three championship', '7', '6', '3', '75', '1st'], ['2005', 'british formula three', '5', '0', '0', '0', 'nc'], ['2005', 'formula renault 2.0 italia', '0', '0', '0', '0', 'nc'], ['2005', 'recaro formel 3 cup', '3', '1', '0', '0', 'nc'], ['2006', 'formula three euroseries', '19', '0', '0', '12', '15th'], ['2006', 'british formula three', '2', '0', '0', '0', 'nc'], ['2006', 'masters of formula three', '1', '0', '0', 'n / a', '13th'], ['2007', 'formula renault 3.5 series', '14', '0', '0', '0', 'nc'], ['2007', 'formula three euroseries', '2', '0', '0', '0', 'nc'], ['2008', 'gp2 asia series', '8', '0', '0', '0', '23rd'], ['2008', 'gp2 series', '13', '0', '0', '0', '30th'], ['2008 - 09', 'gp2 asia series', '11', '0', '0', '0', '33rd'], ['2009', 'gp2 series', '20', '0', '0', '0', '23rd'], ['2009', 'formula renault 3.5 series', '6', '0', '0', '7', '23rd'], ['2009 - 10', 'gp2 asia series', '8', '0', '0', '7', '13th'], ['2010', 'gp2 series', '20', '0', '0', '12', '16th'], ['2011', 'gp2 asia series', '4', '0', '0', '9', '8th'], ['2011', 'gp2 series', '18', '0', '0', '1', '21st']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many racing series did the driver participate in during the 2004-2007 season? | 12 |
07f3911a00b6469405023dc34740b916 | tablebench-tqa | {'columns': ['year', 'indians admitted', 'pakistanis admitted', 'sri lankans admitted', 'bangladeshis admitted', 'nepalis admitted'], 'data': [['2000', '26122', '14201', '5849', '2715', '247'], ['2001', '27901', '15353', '5520', '3393', '273'], ['2002', '28838', '14173', '4968', '2615', '418'], ['2003', '24595', '12351', '4448', '1896', '440'], ['2004', '25573', '12793', '4134', '3374', '594'], ['2005', '22141', '13575', '4690', '3940', '714'], ['2006', '30746', '12329', '4490', '3838', '640'], ['2007', '26047', '9545', '3934', '2735', '564'], ['2008', '24548', '8051', '4508', '2716', '639'], ['2009', '26117', '6213', '4270', '4270', '627'], ['2010', '30252', '4986', '4181', '4364', '1502'], ['2011', '24965', '6073', '3104', '2449', '1249'], ['2012', '28943', '9931', '3152', '2449', '1311']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many years had more than 25000 Indians admitted? | 9 |
4cc489011d65d97a1a1c269bbcdd112d | tablebench-tqa | {'columns': ['hand', '1 credit', '2 credits', '3 credits', '4 credits', '5 credits'], 'data': [['royal flush', '250', '500', '750', '1000', '4000'], ['straight flush', '50', '100', '150', '200', '250'], ['four aces w / 2 , 3 , or 4', '400', '800', '1200', '1600', '2000'], ['four 2 , 3 , or 4 w / a - 4', '160', '320', '480', '640', '800'], ['four aces', '160', '320', '480', '640', '800'], ['four 2 , 3 , or 4', '80', '160', '240', '320', '400'], ['four 5 - k', '50', '100', '150', '200', '250'], ['full house', '10', '20', '30', '40', '50'], ['flush', '6', '12', '18', '24', '30'], ['straight', '4', '8', '12', '16', '20'], ['three of a kind', '3', '6', '9', '12', '15'], ['two pair', '1', '2', '3', '4', '5'], ['jacks or better', '1', '2', '3', '4', '5'], ['theoretical return', '98.9%', '98.9%', '98.9%', '98.9%', '100.1%']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many hand combinations have a payout of 100 or more for 1 credit? | 4 |
629103144efe26a2da56a953c77fa3f8 | tablebench-tqa | {'columns': ['Rank', 'Nation', 'Gold', 'Silver', 'Bronze', 'Total'], 'data': [['1.0', 'Great Britain (GBR)', '6', '3', '2', '11'], ['2.0', 'South Africa (RSA)', '1', '2', '1', '4'], ['3.0', 'Canada (CAN)', '1', '1', '0', '2'], ['4.0', 'Australia (AUS)', '0', '1', '1', '2'], [None, 'Hong Kong (HKG)', '0', '1', '1', '2'], ['6.0', 'Israel (ISR)', '0', '0', '2', '2'], ['7.0', 'South Korea (KOR)', '0', '0', '1', '1']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many nations have won at least one gold medal? | 3 |
f72902b09ecc9fc2500e114d8c7519c2 | tablebench-tqa | {'columns': ['year', 'number of tropical storms', 'number of hurricanes', 'number of major hurricanes', 'deaths', 'strongest storm'], 'data': [['1860', '1', '5', '1', '60 +', 'one'], ['1861', '2', '6', '0', '22 +', 'one and three'], ['1862', '3', '3', '0', '3', 'two and three'], ['1863', '4', '5', '0', '90', 'one , two , three & four'], ['1864', '2', '3', '0', 'none', 'one , three & five'], ['1865', '4', '3', '0', '326', 'four & seven'], ['1866', '1', '5', '1', '383', 'six'], ['1867', '2', '6', '0', '811', "'san narciso'"], ['1868', '1', '3', '0', '2', 'one , two & four']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many years had 3 or fewer hurricanes? | 4 |
240b0d45a41eb8f3b90989092af6da7b | tablebench-tqa | {'columns': ['agent', 'melting / boiling point', 'effectiveness as blood agent', 'persistence , open area', 'persistence , enclosed area', 'field stability', 'storage stability', 'toxicity as blood agent'], 'data': [['hydrogen cyanide', '- 13 / 26 degree', '10', '2', '9', '10', '8', '10'], ['cyanogen', '- 28 / - 21 degree', '9', '2', '9', '8', '7', '9'], ['cyanogen chloride', '- 6 / 14 degree', '8', '3', '9', '9', '9', '8'], ['cyanogen bromide', '52 / 62 degree', '9', '5', '8', '5', '6', '8'], ['arsine', '- 117 / - 62 degree', '9', '3', '8', '5', '9', '9'], ['vinyl arsine', '124 degree (boiling)', '7', '7', '9', '8', '9', '6'], ['phosgene', '- 118 / 8', '10', '6', '9', '5', '8', '6']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many agents have a melting point below 0 degrees? | 5 |
9fd3d8839e4a861d3caeef557dc78e70 | tablebench-tqa | {'columns': ['district', '2010 population (000)', '2008 gdp (usd bn) a', '2008 gdp per capita (usd) a', 'agri culture b', 'mining b', 'manufac turing b', 'services & cons truction b', 'exports (usd mn) 2011', 'median mo salary (usd) a e', 'vehicles (per 1000) d', 'income poverty f', 'structural poverty g'], 'data': [['city of buenos aires', '2890', '118.0', '40828', '0.3', '1.0', '12.9', '85.8', '426', '1618', '528', '7.3', '7.8'], ['buenos aires province', '15625', '161.0', '10303', '4.5', '0.1', '21.3', '74.1', '28134', '1364', '266', '16.2', '15.8'], ['catamarca', '368', '2.331', '6009', '3.6', '20.8', '12.1', '63.5', '1596', '1241', '162', '24.3', '21.5'], ['chaco', '1055', '2.12', '2015', '12.6', '0.0', '7.5', '79.9', '602', '1061', '137', '35.4', '33.0'], ['chubut', '509', '7.11', '15422', '6.9', '21.3', '10.0', '61.8', '3148', '2281', '400', '4.6', '15.5'], ['córdoba', '3309', '33.239', '10050', '10.6', '0.2', '14.0', '75.2', '10635', '1200', '328', '14.8', '13.0'], ['corrientes', '993', '4.053', '4001', '12.6', '0.0', '8.2', '79.2', '230', '1019', '168', '31.5', '28.5'], ['entre ríos', '1236', '7.137', '5682', '11.9', '0.3', '11.6', '76.2', '1908', '1063', '280', '13.0', '17.6'], ['formosa', '530', '1.555', '2879', '7.6', '1.5', '6.4', '84.5', '40', '1007', '107', '30.7', '33.6'], ['jujuy', '673', '2.553', '3755', '5.5', '0.7', '14.6', '79.2', '456', '1123', '153', '30.0', '28.8'], ['la pampa', '319', '2.0', '5987', '19.0', '3.7', '5.3', '72.0', '378', '1164', '364', '13.6', '10.3'], ['la rioja', '334', '1.419', '4162', '3.9', '0.1', '16.8', '79.2', '281', '1040', '172', '22.0', '20.4'], ['mendoza', '1739', '18.8', '10758', '5.4', '6.1', '17.5', '71.0', '1862', '1153', '313', '12.2', '15.4'], ['misiones', '1102', '4.044', '3751', '6.7', '0.0', '13.0', '80.3', '536', '971', '153', '32.6', '27.1'], ['neuquén', '551', '14.398', '26273', '0.7', '42.8', '2.9', '53.6', '353', '2211', '339', '11.2', '17.0'], ['río negro', '639', '4.924', '8247', '4.9', '8.4', '7.3', '79.4', '670', '1309', '285', '20.6', '17.9'], ['salta', '1214', '5.165', '4220', '8.1', '7.6', '10.4', '73.9', '1332', '1045', '139', '29.7', '31.6'], ['san juan', '681', '3.927', '5642', '8.1', '0.3', '15.9', '75.7', '2470', '1293', '216', '18.4', '17.4'], ['san luis', '432', '2.444', '5580', '4.9', '0.5', '42.4', '52.2', '735', '1288', '245', '22.0', '15.6'], ['santa cruz', '274', '6.892', '30496', '4.4', '47.1', '2.3', '46.2', '1857', '2646', '432', '3.6', '10.4'], ['santa fe', '3195', '37.5', '10670', '10.1', '0.0', '17.4', '72.5', '17804', '1265', '299', '18.2', '14.8'], ['santiago del estero', '874', '2.598', '3003', '11.5', '0.1', '6.2', '82.2', '1082', '945', '103', '31.0', '31.3'], ['tierra del fuego', '127', '2.606', '20682', '4.7', '18.5', '18.6', '58.2', '443', '2267', '478', '6.4', '14.1'], ['tucumán', '1448', '5.807', '3937', '6.0', '0.1', '12.6', '81.3', '1031', '973', '146', '27.7', '23.9']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many districts have a 2008 GDP per capita (USD) above 6700? | 10 |
50ba63ef02d5f99c08b8a106602b0d30 | tablebench-tqa | {'columns': ['name', 'martyred', 'place', 'beatified', 'canonised'], 'data': [['laurent - marie - joseph imbert / st imbert', '1839', 'korea', '1925', '1984'], ['jacques - honorã chastan / st chastan', '1839', 'korea', '1925', '1984'], ['philip minh van doan / st philip minh', '1853', 'annam', '1900', '1988'], ['peter quy cong doan / st peter quy', '1859', 'annam', '1909', '1988'], ['paul loc le van / st paul loc', '1859', 'annam', '1909', '1988'], ['john hoan trinh doan / st john hoan', '1861', 'annam', '1909', '1988'], ['joseph luu van nguyen / st joseph luu', '1861', 'annam', '1909', '1988']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many saints were martyred in the 19th century? | 7 |
d0a81a29b19bb9b01e0e01329ad80112 | tablebench-tqa | {'columns': ['jurisdiction', 'for prohibition', 'percent for', 'against prohibition', 'percent against'], 'data': [['alberta and saskatchewan', '6238', '68.8', '2824', '31.2'], ['british columbia', '5731', '54.6', '4756', '45.4'], ['manitoba', '12419', '80.6', '2978', '19.4'], ['new brunswick', '26919', '72.2', '9575', '27.7'], ['nova scotia', '34368', '87.2', '5370', '12.8'], ['ontario', '154498', '57.3', '115284', '42.7'], ['prince edward island', '9461', '89.2', '1146', '10.8'], ['quebec', '28436', '18.8', '122760', '81.2']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many jurisdictions had more than 70% of votes in favor of prohibition? | 4 |
cbcc7b1e8b1ce02508f3c40557e13e0c | tablebench-tqa | {'columns': ['region', 'capital', 'area (km square)', 'area (sq mi)', 'population'], 'data': [['abruzzo', "l'aquila", '10763', '4156', '1342177'], ['aosta valley', 'aosta', '3263', '1260', '128129'], ['apulia', 'bari', '19358', '7474', '4090577'], ['basilicata', 'potenza', '9995', '3859', '587680'], ['calabria', 'catanzaro', '15080', '5822', '2011537'], ['campania', 'naples', '13590', '5247', '5833131'], ['emilia - romagna', 'bologna', '22446', '8666', '4429766'], ['friuli - venezia giulia', 'trieste', '7858', '3034', '1235761'], ['lazio', 'rome', '17236', '6655', '5724365'], ['liguria', 'genoa', '5422', '2093', '1616993'], ['lombardy', 'milan', '23844', '9206', '9909348'], ['marche', 'ancona', '9366', '3616', '1564886'], ['molise', 'campobasso', '4438', '1713', '319834'], ['piedmont', 'turin', '25402', '9808', '4456532'], ['sardinia', 'cagliari', '24090', '9301', '1675286'], ['sicily', 'palermo', '25711', '9927', '5050486'], ['tuscany', 'florence', '22993', '8878', '3749074'], ['trentino - alto adige / südtirol', 'trento', '13607', '5254', '1036639'], ['umbria', 'perugia', '8456', '3265', '906675']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many regions in Italy have a population of more than 4 million? | 7 |
65aadc9add4b1a42f5b5071d6a16cfd6 | tablebench-tqa | {'columns': ['Year', 'Number', 'Name', 'Year.1', 'Number.1', 'Name.1', 'Year.2', 'Number.2', 'Name.2'], 'data': [['1884–1885', '7', 'Lukin Homphrey Irving (first)', '1886–1887', '18', 'Duncan MacPherson', '1888', '4', 'William Mahlon Davis'], ['1889–1890', '6', 'Septimus Julius Augustus Denison', '1891', '10', 'Victor Brereton Rivers', '1892', '86', 'Reuben Wells Leonard'], ['1893–1894', '37', 'E.H. Drury', '1895–1896', '15', 'Francis Joseph Dixon', '1897', '48', 'A.K. Kirkpatrick'], ['1898', '57', 'H.S. Greenwood', '1899', '14', 'John Bray Cochrane', '1900', '41', 'Robert Cartwright'], ['1901', '154', 'F.M. Gaudet', '1902', '47', 'Ernest Frederick Wurtele', '1903', '21', 'A.E. Doucet'], ['1904', '82', 'Wallace Bruce Matthews Carruthers', '1905', '188', 'W.A.H. Kerr', '1906', '186', 'V.A.S. Williams'], ['1907', '139', 'C.R.F. Coutlee', '1908', '232', 'John Houlison', '1909', '91', 'J.D. Gibson'], ['1910', '63', 'George Hooper', '1911', '255', 'H.A. Panet', '1912', '246', 'Major-General Sir Henry Edward Burstall'], ['1913', '268', 'Henry Robert Visart de Bury et de Bocarmé', '1914; 1919', '299', 'Col. Harry J. Lamb DSO, VD', '1920', '293', 'C.J. Armstrong'], ['1920–1922', '392', 'W.B. Kingsmill', '1923', '377', 'A.C. Caldwell', '1924', '140', 'G.S. Cartwright'], ['1925', '499', 'Edouard de B. Panet', '1926', '631', 'A.B. Gillies', '1927', '623', 'S.B. Coristine'], ['1928', '555', 'R.R. Carr-Harris', '1929', '667', 'E.G. Hanson', '1929–1930', 'SUO', 'G.D. de S. Wotherspoon'], ['1930–1931', '1119', 'J.H. Price', '1932', '472', 'A.R. Chipman', '1933–1934', '805', 'Colin W. G. Gibson'], ['1935', '727', 'D.A. White', '1936–1937', '877', 'G.L. Magann', '1938–1939', '1003', 'A.M. Mitchell'], ['1940–1941', '803', 'J.V. Young', '1942–1943', '1141', "W.H. O'Reilly", '1944', '698', 'Everett Bristol'], ['1945', '982', 'D.W. MacKeen', '1946', '1841', 'D.G. Cunningham', '1947', '1230', 'S.H. Dobell'], ['1948', '1855', 'Ian S. Johnston', '1949', '1625', 'J.D. Watt', '1950', '1542', 'E.W. Crowe'], ['1951', '1860', 'Nicol Kingsmill', '1952', '1828', 'Ted G.E. Beament', '1953', '1620', 'R.R. Labatt'], ['1954', '1766', 'Ken H. Tremain', '1955', '1474', 'de L.H.M Panet', '1956', '2034', 'Paul Y. Davoud'], ['1957', '1954', 'W.P. Carr', '1960', '1379', 'H.A. Mackenzie', '1961', '2157', 'J.H.R. Gagnon'], ['1962', '2183', 'James E. Pepall', '1963', '2336', 'J.H. Moore', '1964', '2351', 'Guy Savard'], ['1965', '2749', 'James B. Cronyn', '1966', '2601', 'J. Fergus Maclaren', '1967', '2791', 'Jean P.W. Ostiguy'], ['1968–1969', 'RCNC90', 'John F. Frank', '1975–1976', '3661', 'Terry Yates', '1976–1977', '5533', 'Glenn Allen'], ['1977–1978', '3172', 'Marshall Soule', '1980–1981', '3251', 'Jim Tremain', '1981–1982', '2897', 'Herb Pitts'], ['1986–1987', '5604', 'Ken Smee', '1987–1988', '3010', 'Peter McLoughlin', '1992–1993', 'H3356', 'Robin Cumine'], ['1993–1994', '5244', 'Tony Downs', '1994–1995', 'H7543', 'Senator Joseph A. Day', '1995–1996', '5739', 'Andre Costin'], ['1996–1997', '3550', 'Murray Johnston', '1997–1998', '8813', 'John D. Gibson', '1998–1999', 'G0055', 'Valerie Keyes (first female)'], ['1999–2000', '8833', 'John Leggat', '2000–2001', '5758', 'Michael Morres', '2001–2002', '16461', 'Ian MacKinnon'], ['2002–2003', '6777', 'Michel Charron', '2003–2004', '7776', 'Chris Lythgo', '2004–2005', '7943', 'J. William K. Lye'], ['2005–2006', '10080', 'Robert Booth', '2007–2008', '6776', 'Tim Sparling', '2008–2009', '15988', 'Jeff Kearns'], ['2010', '16412', 'Gord Clarke', '2011', '19307', 'David Benoit', '2012', '9889', 'Robert Benn'], ['2013', 'M0058', 'Marc Drolet (first UTPNCM)', None, None, None, None, None, None]]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many individuals have a 'Number' value greater than 1500? | 14 |
2883b5cdde8c423fe83ae9741807b51a | tablebench-tqa | {'columns': ['name', 'latitude', 'longitude', 'diameter (km)', 'named after'], 'data': [['caccini', '17.4', '170.4', '38.1', 'francesca caccini , italian composer'], ['caitlin', '- 65.3', '12.0', '14.7', 'irish first name'], ['caiwenji', '- 12.4', '287.6', '22.6', 'cai wenji , chinese poet'], ['caldwell', '23.6', '112.4', '51.0', 'taylor caldwell , american author'], ['callas', '2.4', '27.0', '33.8', 'maria callas , american singer'], ['callirhoe', '21.2', '140.7', '33.8', 'callirhoe , greek sculptor'], ['caroline', '6.9', '306.3', '18.0', 'french first name'], ['carr', '- 24', '295.7', '31.9', 'emily carr , canadian artist'], ['carreno', '- 3.9', '16.1', '57.0', 'teresa carreño , n venezuela pianist'], ['carson', '- 24.2', '344.1', '38.8', 'rachel carson , american biologist'], ['carter', '5.3', '67.3', '17.5', 'maybelle carter , american singer'], ['castro', '3.4', '233.9', '22.9', 'rosalía de castro , galician poet'], ['cather', '47.1', '107.0', '24.6', 'willa cather , american novelist'], ['centlivre', '19.1', '290.4', '28.8', 'susanna centlivre , english actress'], ['chapelle', '6.4', '103.8', '22.0', 'georgette chapelle , american journalist'], ['chechek', '- 2.6', '272.3', '7.2', 'tuvan first name'], ['chiyojo', '- 47.8', '95.7', '40.2', 'chiyojo , japanese poet'], ['chloe', '- 7.4', '98.6', '18.6', 'greek first name'], ['cholpon', '40', '290.0', '6.3', 'kyrgyz first name'], ['christie', '28.3', '72.7', '23.3', 'agatha christie , english author'], ['chubado', '45.3', '5.6', '7.0', 'fulbe first name'], ['clara', '- 37.5', '235.3', '3.2', 'latin first name'], ['clementina', '35.9', '208.6', '4.0', 'portuguese form of clementine , french first name'], ['cleopatra', '65.8', '7.1', '105.0', 'cleopatra , egyptian queen'], ['cline', '- 21.8', '317.1', '38.0', 'patsy cline , american singer'], ['clio', '6.3', '333.5', '11.4', 'greek first name'], ['cochran', '51.9', '143.4', '100.0', 'jacqueline cochran , american aviator'], ['cohn', '- 33.3', '208.1', '18.3', 'carola cohn , australian artist'], ['colleen', '- 60.8', '162.2', '13.5', 'irish first name'], ['comnena', '1.2', '343.7', '19.5', 'anna comnena , byzantine princess and writer'], ['conway', '48.3', '39.0', '49.3', 'lady anne finch conway , english natural scientist'], ['cori', '25.4', '72.9', '56.1', 'gerty cori , czech biochemist'], ['corinna', '22.9', '40.6', '19.2', 'corinna , greek poet'], ['corpman', '0.3', '151.8', '46.0', 'elizabeth koopman hevelius , astronomer'], ['cortese', '- 11.4', '218.4', '27.7', 'isabella cortese , italian physician'], ['cotton', '70.8', '300.2', '48.1', 'eugénie cotton , french physicist'], ['cunitz', '14.5', '350.9', '48.6', 'maria cunitz , silesian astronomer'], ['cynthia', '- 16.7', '347.5', '15.9', 'greek first name']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many craters are there with a diameter (km) larger than 33? | 15 |
ebcf933b385594298b3d52a00d7d9682 | tablebench-tqa | {'columns': ['rank', 'country / territory', 'manhunt international', '1st runner - up', '2nd runner - up', '3rd runner - up', '4th runner - up', 'semifinalists', 'total'], 'data': [['1', 'china', '2', '1', '1', '1', '0', '5', '10'], ['2', 'india', '1', '2', '0', '0', '3', '5', '11'], ['3', 'sweden', '1', '2', '0', '0', '0', '3', '6'], ['4', 'venezuela', '1', '1', '1', '1', '1', '6', '11'], ['5', 'turkey', '1', '1', '1', '1', '0', '3', '7'], ['6', 'australia', '1', '1', '0', '1', '0', '4', '7'], ['7', 'germany', '1', '1', '0', '0', '0', '1', '3'], ['8', 'usa', '1', '0', '3', '1', '0', '3', '8'], ['9', 'philippines', '1', '0', '1', '1', '0', '3', '6'], ['10', 'greece', '1', '0', '1', '0', '0', '3', '5'], ['11', 'south africa', '1', '0', '0', '0', '1', '3', '5'], ['12', 'slovakia', '1', '0', '0', '0', '1', '0', '2'], ['13', 'france', '1', '0', '0', '0', '0', '2', '3'], ['14', 'morocco', '1', '0', '0', '0', '0', '0', '1']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many countries have at least one semifinalist? | 12 |
5a6a21f05be43637076dc55fd0420587 | tablebench-tqa | {'columns': ['peak', 'country', 'elevation (m)', 'prominence (m)', 'col (m)'], 'data': [['mount kilimanjaro', 'tanzania', '5895', '5885', '10'], ['mount kenya', 'kenya', '5199', '3825', '1374'], ['mount meru', 'tanzania', '4565', '3170', '1395'], ['mount elgon', 'uganda', '4321', '2458', '1863'], ['mulanje massif', 'malawi', '3002', '2319', '683'], ['kimhandu', 'tanzania', '2653', '2121', '532'], ['mount satima', 'kenya', '4001', '2081', '1920'], ['mount hanang', 'tanzania', '3420', '2050', '1370'], ['loolmalassin', 'tanzania', '3682', '2040', '1642'], ['gelai peak', 'tanzania', '2948', '1930', '1018'], ['mount moroto', 'uganda', '3083', '1818', '1265'], ['kitumbeine hill', 'tanzania', '2858', '1770', '1088'], ['chepunyal hills', 'kenya', '3334', '1759', '1575'], ['mount namuli', 'mozambique', '2419', '1757', '662'], ['shengena', 'tanzania', '2464', '1750', '714'], ['sungwi', 'tanzania', '2300', '1730', '570'], ['mount kadam', 'uganda', '3063', '1690', '1373'], ['mtorwi', 'tanzania', '2980', '1688', '1292'], ['mount kulal', 'kenya', '2285', '1542', '743'], ['karenga', 'tanzania', '2279', '1529', '750'], ["mount ng'iro", 'kenya', '2848', '1501', '1347']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many mountains in Tanzania have an elevation above 3000 meters and a prominence less than 3000? | 2 |
79c7100e623e490d4aabd5361cd50c5b | tablebench-tqa | {'columns': ['brno', 'name', 'builder', 'whenbuilt', 'withdrawn'], 'data': [['34071', '601 squadron', 'brighton', '1948', '1967'], ['34072', '257 squadron', 'brighton', '1948', '1964'], ['34073', '249 squadron', 'brighton', '1948', '1964'], ['34074', '46 squadron', 'brighton', '1948', '1963'], ['34075', '264 squadron', 'brighton', '1948', '1964'], ['34076', '41 squadron', 'brighton', '1948', '1966'], ['34077', '603 squadron', 'brighton', '1948', '1967'], ['34078', '222 squadron', 'brighton', '1948', '1964'], ['34079', '141 squadron', 'brighton', '1948', '1966'], ['34080', '74 squadron', 'brighton', '1948', '1964'], ['34081', '92 squadron', 'brighton', '1948', '1964'], ['34082', '615 squadron', 'brighton', '1948', '1966'], ['34083', '605 squadron', 'brighton', '1948', '1964'], ['34084', '253 squadron', 'brighton', '1948', '1965'], ['34085', '501 squadron', 'eastleigh', '1948', '1965'], ['34086', '219 squadron', 'brighton', '1948', '1966'], ['34087', '145 squadron', 'eastleigh', '1948', '1967'], ['34088', '213 squadron', 'brighton', '1948', '1967'], ['34089', '602 squadron', 'eastleigh', '1948', '1967'], ['34090', 'sir eustace missenden , southern railway', 'brighton', '1949', '1967'], ['34091', 'weymouth', 'brighton', '1949', '1964'], ['34092', 'city of wells', 'brighton', '1949', '1964'], ['34093', 'saunton', 'brighton', '1949', '1967'], ['34094', 'mortehoe', 'brighton', '1949', '1964'], ['34095', 'brentor', 'eastleigh', '1949', '1967'], ['34096', 'trevone', 'brighton', '1949', '1964'], ['34097', 'holsworthy', 'brighton', '1949', '1967'], ['34098', 'templecombe', 'brighton', '1949', '1967'], ['34099', 'lynmouth', 'brighton', '1949', '1964'], ['34100', 'appledore', 'brighton', '1949', '1967'], ['34101', 'hartland', 'eastleigh', '1950', '1966'], ['34102', 'lapford', 'eastleigh', '1950', '1967'], ['34103', 'calstock', 'brighton', '1950', '1965'], ['34104', 'bere alston', 'eastleigh', '1950', '1967'], ['34105', 'swanage', 'brighton', '1950', '1964'], ['34106', 'lydford', 'brighton', 'march 1950', 'september 1964'], ['34107', 'blandford forum', 'brighton', 'april 1950', 'september 1964'], ['34108', 'wincanton', 'brighton', 'april 1950', 'june 1967'], ['34109', 'sir trafford leigh - mallory', 'brighton', 'may 1950', 'september 1964'], ['34110', '66 squadron', 'brighton', 'january 1951', 'november 1963']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many squadrons were built by 'brighton' in 1948? | 16 |
a5de47ae8731889ae862729fb82127b2 | tablebench-tqa | {'columns': ['Row Header', 'Year Ended December 31, 2018 (In cents, except percentage changes)', 'Year Ended December 31, 2017 (In cents, except percentage changes)', 'Percent Increase (Decrease) (In cents, except percentage changes)'], 'data': [['Total CASM: Aircraft fuel and related taxes', '2.86', '2.22', '28.8'], ['Total CASM: Salaries, wages and benefits', '4.34', '4.32', '0.5'], ['Total CASM: Maintenance, materials and repairs', '0.73', '0.71', '2.6'], ['Total CASM: Other rent and landing fees', '0.67', '0.65', '3.1'], ['Total CASM: Aircraft rent', '0.45', '0.43', '3.5'], ['Total CASM: Selling expenses', '0.54', '0.53', '0.9'], ['Total CASM: Depreciation and amortization', '0.65', '0.62', '5.9'], ['Total CASM: Special items, net', '0.28', '0.26', '8.3'], ['Total CASM: Other', '1.80', '1.78', '1.6'], ['Regional expenses: Aircraft fuel and related taxes', '0.65', '0.50', '30.7'], ['Regional expenses: Other', '1.88', '1.87', '0.4'], ['Regional expenses: Total CASM', '14.85', '13.88', '6.9'], ['Special items, net: Special items, net', '(0.28)', '(0.26)', '8.3'], ['Special items, net: Regional operating special items, net', '—', '(0.01)', 'nm (1)'], ['Aircraft fuel and related taxes Aircraft fuel and related taxes - mainline', '(2.86)', '(2.22)', '28.8'], ['Aircraft fuel and related taxes Aircraft fuel and related taxes - regional', '(0.65)', '(0.50)', '30.7'], ['Aircraft fuel and related taxes Total CASM, excluding special items and fuel', '11.06', '10.90', '1.4']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many cost categories have a percentage increase greater than 5% from 2017 to 2018? | 8 |
101130aa9241715f197257e7a2821303 | tablebench-tqa | {'columns': ['Club', 'Season', 'League', 'League', 'League', 'National Cup', 'National Cup', 'League Cup', 'League Cup', 'Europe', 'Europe', 'Total', 'Total'], 'data': [['Club', 'Season', 'Division', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals'], ['Liverpool', '1990–91', 'First Division', '2', '0', '1', '0', '0', '0', '0', '0', '3', '0'], ['Liverpool', '1991–92', 'First Division', '30', '5', '8', '3', '5', '3', '8', '0', '51', '11'], ['Liverpool', '1992–93', 'Premier League', '31', '4', '1', '0', '5', '2', '3', '1', '40', '7'], ['Liverpool', '1993–94', 'Premier League', '30', '2', '2', '0', '2', '0', '0', '0', '34', '2'], ['Liverpool', '1994–95', 'Premier League', '40', '7', '7', '0', '8', '2', '0', '0', '55', '9'], ['Liverpool', '1995–96', 'Premier League', '38', '6', '7', '2', '4', '1', '4', '1', '53', '10'], ['Liverpool', '1996–97', 'Premier League', '37', '7', '2', '0', '4', '2', '8', '1', '51', '10'], ['Liverpool', '1997–98', 'Premier League', '36', '11', '1', '0', '5', '0', '4', '1', '46', '12'], ['Liverpool', '1998–99', 'Premier League', '28', '4', '0', '0', '0', '0', '3', '1', '31', '5'], ['Liverpool', 'Liverpool Total', 'Liverpool Total', '272', '46', '29', '5', '33', '10', '30', '5', '364', '66'], ['Real Madrid', '1999–2000', 'La Liga', '30', '3', '10', '0', '0', '0', '7', '1', '47', '4'], ['Real Madrid', '2000–01', 'La Liga', '26', '2', '6', '0', '0', '0', '10', '0', '42', '2'], ['Real Madrid', '2001–02', 'La Liga', '23', '2', '2', '0', '0', '0', '13', '2', '38', '4'], ['Real Madrid', '2002–03', 'La Liga', '15', '1', '4', '1', '0', '0', '6', '2', '25', '4'], ['Real Madrid', 'Real Madrid Total', 'Real Madrid Total', '94', '8', '22', '1', '0', '0', '36', '5', '152', '14'], ['Manchester City', '2003–04', 'Premier League', '22', '0', '3', '0', '1', '0', '4', '0', '30', '0'], ['Manchester City', '2004–05', 'Premier League', '13', '0', '1', '0', '0', '0', '0', '0', '14', '0'], ['Manchester City', 'Manchester City Total', 'Manchester City Total', '35', '0', '4', '0', '1', '0', '4', '0', '44', '0'], ['Career Total', 'Career Total', 'Career Total', '401', '54', '52', '6', '37', '10', '70', '10', '560', '80']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many seasons did Liverpool play in the Premier League? | 7 |
cb663d0399df511cd8a624ea0c85c8f0 | tablebench-tqa | {'columns': ['no', 'peak', 'location', 'elevation (m)', 'prominence (m)', 'col height (m)', 'col location', 'parent'], 'data': [['1', 'mont blanc', 'france / italy', '4810', '4697', '113', 'near lake kubenskoye', 'everest'], ['2', 'großglockner', 'austria', '3798', '2423', '1375', 'brenner pass', 'mont blanc'], ['3', 'finsteraarhorn', 'switzerland', '4274', '2280', '1994', 'near simplon pass', 'mont blanc'], ['4', 'wildspitze', 'austria', '3768', '2261', '1507', 'reschen pass', 'finsteraarhorn 1 / mb 2'], ['5', 'piz bernina', 'switzerland', '4049', '2234', '1815', 'maloja pass', 'finsteraarhorn 1 / mb 2'], ['6', 'hochkönig', 'austria', '2941', '2181', '760', 'near maishofen', 'großglockner 1 / mb 2'], ['7', 'monte rosa', 'switzerland', '4634', '2165', '2469', 'great st bernard pass', 'mont blanc'], ['8', 'hoher dachstein', 'austria', '2995', '2136', '859', 'eben im pongau', 'großglockner 1 / mb 2'], ['9', 'marmolada', 'italy', '3343', '2131', '1212', 'toblach', 'großglockner 1 / mb 2'], ['10', 'monte viso', 'italy', '3841', '2062', '1779', 'le mauvais pass', 'mont blanc'], ['11', 'triglav', 'slovenia', '2864', '2052', '812', 'camporosso pass', 'marmolada 1 / mb 2'], ['12', 'barre des écrins', 'france', '4102', '2045', '2057', 'col du lautaret', 'mont blanc'], ['13', 'säntis', 'switzerland', '2503', '2021', '482', 'heiligkreuz bei mels', 'finsteraarhorn 1 / mb 2'], ['14', 'ortler', 'italy', '3905', '1953', '1952', 'fraele pass in the livigno alps', 'piz bernina'], ['15', 'monte baldo / cima valdritta', 'italy', '2218', '1950', '268', 'near san giovanni pass in nago - torbole', 'ortler 1 / mb 2'], ['16', 'gran paradiso', 'italy', '4061', '1891', '2170', 'near little st bernard pass', 'mont blanc'], ['17', 'pizzo di coca', 'italy', '3050', '1878', '1172', 'aprica', 'ortler 1 / mb 2'], ['18', 'cima dodici', 'italy', '2336', '1874', '462', 'pergine valsugana', 'marmolada 1 / mb 2'], ['19', 'dents du midi', 'switzerland', '3257', '1796', '1461', 'col des montets', 'mont blanc'], ['20', 'chamechaude', 'france', '2082', '1771', '311', 'chambéry', 'mont blanc'], ['21', 'zugspitze', 'germany / austria', '2962', '1746', '1216', 'near fern pass', 'finsteraarhorn 1 / mb 2'], ['22', 'monte antelao', 'italy', '3264', '1735', '1529', 'passo cimabanche', 'marmolada'], ['23', 'arcalod', 'france', '2217', '1713', '504', 'viuz in faverges', 'mont blanc'], ['24', 'grintovec', 'slovenia', '2558', '1706', '852', 'rateče', 'triglav'], ['25', 'großer priel', 'austria', '2515', '1700', '810', 'near pichl - kainisch', 'hoher dachstein 1 / mb 2'], ['26', 'grigna settentrionale', 'italy', '2409', '1686', '723', 'balisio in ballabio', 'pizzo di coca 1 / mb 2'], ['27', 'monte bondone', 'italy', '2180', '1679', '501', 'near cadine in trento', 'ortler 1 / mb 2'], ['28', 'presanella', 'italy', '3558', '1676', '1882', 'tonale pass', 'ortler'], ['29', 'birnhorn', 'austria', '2634', '1665', '969', 'hochfilzen', 'großglockner 1 / mb 2'], ['30', 'col nudo', 'italy', '2471', '1644', '827', "passo di sant'osvaldo", 'antelao 1 / mb 2'], ['31', 'pointe percée', 'france', '2750', '1643', '1107', "near pont d'arbon near megève", 'mont blanc'], ['32', 'jôf di montasio', 'italy', '2753', '1597', '1156', 'predil pass', 'triglav'], ['33', 'mölltaler polinik', 'austria', '2784', '1579', '1205', 'iselsberg pass', 'großglockner 1 / mb 2'], ['34', 'tödi', 'switzerland', '3614', '1570', '2044', 'oberalp pass', 'finsteraarhorn'], ['35', 'birkkarspitze', 'austria', '2749', '1569', '1180', 'seefeld in tirol', 'zugspitze 1 / mb 2'], ['36', 'ellmauer halt', 'austria', '2344', '1551', '793', 'near ellmau', 'großglockner 1 / mb 2'], ['37', "grande tête de l'obiou", 'france', '2790', '1542', '1248', 'col bayard', 'barre des écrins 1 / mb 2'], ['38', 'cima tosa', 'italy', '3173', '1521', '1652', 'near campo carlo magno', 'presanella 1 / mb 2'], ['39', 'hochtor', 'austria', '2369', '1520', '849', 'schober pass', 'großglockner 1 / mb 2'], ['40', 'grimming', 'austria', '2351', '1518', '833', 'near schrödis near tauplitz', 'großer priel'], ['41', 'grand combin', 'switzerland', '4314', '1517', '2797', 'fenêtre de durand', 'monte rosa'], ['42', 'la tournette', 'france', '2351', '1514', '837', 'col du marais', 'pointe percée 1 / mb 2'], ['43', 'zirbitzkogel', 'austria', '2396', '1502', '894', 'neumarkter sattel', 'großglockner 1 / mb 2']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many mountains are located in Austria? | 12 |
1aad7f91605843765c973d07d7f8c341 | tablebench-tqa | {'columns': ['draw', 'language', 'artist', 'song', 'place', 'points'], 'data': [['1', 'icelandic', 'beathoven', 'þú og þeir (sókrates)', '16', '20'], ['2', 'swedish', 'tommy körberg', 'stad i ljus', '12', '52'], ['3', 'finnish', 'boulevard', 'nauravat silmät muistetaan', '20', '3'], ['4', 'english', 'scott fitzgerald', 'go', '2', '136'], ['5', 'turkish', 'mfö', 'sufi', '15', '37'], ['6', 'spanish', 'la década prodigiosa', 'la chica que yo quiero (made in spain)', '11', '58'], ['7', 'dutch', 'gerard joling', 'shangri - la', '9', '70'], ['8', 'hebrew', 'yardena arazi', 'ben adam (בן אדם)', '7', '85'], ['9', 'french', 'céline dion', 'ne partez pas sans moi', '1', '137'], ['10', 'english', 'jump the gun', 'take him home', '8', '79'], ['11', 'german', 'maxi & chris garden', 'lied für einen freund', '14', '48'], ['12', 'german', 'wilfried', 'lisa mona lisa', '21', '0'], ['13', 'danish', 'hot eyes', "ka' du se hva' jeg sa'", '3', '92'], ['14', 'greek', 'afroditi frida', 'clown (κλόουν)', '17', '10'], ['15', 'norwegian', 'karoline krüger', 'for vår jord', '5', '88'], ['16', 'french', 'reynaert', 'laissez briller le soleil', '18', '5'], ['17', 'french', 'lara fabian', 'croire', '4', '90'], ['18', 'italian', 'luca barbarossa', 'vivo (ti scrivo)', '12', '52'], ['19', 'french', 'gérard lenorman', 'chanteur de charme', '10', '64'], ['20', 'portuguese', 'dora', 'voltarei', '18', '5'], ['21', 'croatian', 'srebrna krila', 'mangup', '6', '87']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many songs are in the French language? | 4 |
63359e8db2964276d15c92a05ec20ffb | tablebench-tqa | {'columns': ['rank', 'rank fortune 500', 'name', 'headquarters', 'revenue (millions)', 'profit (millions)', 'employees', 'industry'], 'data': [['1', '17', 'sinopec', 'beijing', '131636.0', '3703.1', '681900', 'oil'], ['2', '24', 'china national petroleum', 'beijing', '110520.2', '13265.3', '1086966', 'oil'], ['3', '29', 'state grid corporation', 'beijing', '107185.5', '2237.7', '1504000', 'utilities'], ['4', '170', 'industrial and commercial bank of china', 'beijing', '36832.9', '6179.2', '351448', 'banking'], ['5', '180', 'china mobile limited', 'beijing', '35913.7', '6259.7', '130637', 'telecommunications'], ['6', '192', 'china life insurance', 'beijing', '33711.5', '173.9', '77660', 'insurance'], ['7', '215', 'bank of china', 'beijing', '30750.8', '5372.3', '232632', 'banking'], ['8', '230', 'china construction bank', 'beijing', '28532.3', '5810.3', '297506', 'banking'], ['9', '237', 'china southern power grid', 'guangzhou', '27966.1', '1074.1', '178053', 'utilities'], ['10', '275', 'china telecom', 'beijing', '24791.3', '2279.7', '400299', 'telecommunications'], ['11', '277', 'agricultural bank of china', 'beijing', '24475.5', '728.4', '452464', 'banking'], ['12', '290', 'hutchison whampoa', 'hong kong', '23661.0', '2578.3', '220000', 'various sectors'], ['13', '299', 'sinochem corporation', 'beijing', '23109.2', '344.7', '20343', 'various sectors'], ['14', '307', 'baosteel', 'shanghai', '22663.4', '1622.2', '91308', 'steel'], ['15', '342', 'china railway engineering', 'beijing', '20520.4', '142.6', '275866', 'railway'], ['16', '384', 'china railway construction', 'beijing', '18735.7', '70.2', '245540', 'railway'], ['17', '385', 'first automotive works', 'changchun', '18710.7', '70.0', '136010', 'automobile'], ['18', '396', 'china state construction', 'beijing', '18163.2', '281.3', '294309', 'construction'], ['19', '402', 'saic motor', 'shanghai', '18010.1', '89.7', '72416', 'automobile'], ['20', '405', 'cofco limited', 'beijing', '17953.2', '281.0', '82481', 'various sectors'], ['21', '435', 'china minmetals', 'beijing', '16902.2', '154.4', '32594', 'metal trading'], ['22', '457', 'jardine matheson', 'hong kong / hamilton', '16281.0', '1348.0', '240000', 'various sectors'], ['23', '469', 'china national offshore oil', 'beijing', '16038.9', '3007.1', '44000', 'oil'], ['24', '488', 'china ocean shipping', 'beijing', '15413.5', '1092.9', '79616', 'shipping']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many companies in the banking industry are listed in the table? | 4 |
014370ad3782b15438323d1134044f19 | tablebench-tqa | {'columns': ['rank', 'peak', 'country', 'island', 'elevation (m)', 'prominence (m)', 'col (m)'], 'data': [['1', 'finisterre range high point', 'papua new guinea', 'new guinea', '4175', '3734', '441'], ['2', 'mount suckling', 'papua new guinea', 'new guinea', '3676', '2976', '700'], ['3', 'mount wilhelm', 'papua new guinea', 'new guinea', '4509', '2969', '1540'], ['4', 'mount victoria', 'papua new guinea', 'new guinea', '4038', '2738', '1300'], ['5', 'mount balbi', 'papua new guinea', 'bougainville island', '2715', '2715', '0'], ['6', 'mount oiautukekea', 'papua new guinea', 'goodenough island', '2536', '2536', '0'], ['7', 'mount giluwe', 'papua new guinea', 'new guinea', '4367', '2507', '1860'], ['8', 'new ireland high point', 'papua new guinea', 'new ireland', '2340', '2340', '0'], ['9', 'mount ulawun', 'papua new guinea', 'new britain', '2334', '2334', '0'], ['10', 'mount kabangama', 'papua new guinea', 'new guinea', '4104', '2284', '1820'], ['11', 'nakanai mountains high point', 'papua new guinea', 'new britain', '2316', '2056', '260'], ['12', 'mount kilkerran', 'papua new guinea', 'fergusson island', '1947', '1947', '0'], ['13', 'mount piora', 'papua new guinea', 'new guinea', '3557', '1897', '1660'], ['14', 'mount bosavi', 'papua new guinea', 'new guinea', '2507', '1887', '620'], ['15', 'mount karoma', 'papua new guinea', 'new guinea', '3623', '1883', '1740'], ['16', 'mount simpson', 'papua new guinea', 'new guinea', '2883', '1863', '1020'], ['17', 'mount kunugui', 'papua new guinea', 'karkar island', '1833', '1833', '0'], ['18', 'mount victory', 'papua new guinea', 'new guinea', '1891', '1831', '60'], ['19', 'manam high point', 'papua new guinea', 'manam', '1807', '1807', '0'], ['20', 'mount michael', 'papua new guinea', 'new guinea', '3647', '1787', '1860'], ['21', 'mount talawe', 'papua new guinea', 'new britain', '1824', '1773', '51'], ['22', 'barurumea ridge', 'papua new guinea', 'new britain', '2063', '1723', '340'], ['23', 'mount sarawaget', 'papua new guinea', 'new guinea', '4121', '1701', '2420'], ['24', 'bewani mountains high point', 'papua new guinea', 'new guinea', '1980', '1664', '316'], ['25', 'mount bel', 'papua new guinea', 'umboi island', '1658', '1658', '0'], ['26', 'unnamed summit', 'papua new guinea', 'new britain', '1951', '1651', '300'], ['27', 'mount maybole', 'papua new guinea', 'fergusson island', '1665', '1597', '68'], ['28', 'adelbert range high point', 'papua new guinea', 'new guinea', '1716', '1576', '140'], ['29', 'sibium mountains high point', 'papua new guinea', 'new guinea', '2295', '1555', '740'], ['30', 'mount shungol', 'papua new guinea', 'new guinea', '2752', '1518', '1234']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many mountains in Papua New Guinea have an elevation of 3000 meters or more? | 10 |
66ea61b936831554ebaa4423d2600550 | tablebench-tqa | {'columns': ['election', 'dã¡il', 'share of votes', 'seats', 'total seats'], 'data': [['1927 (jun)', '5th', '26.2%', '44', '153'], ['1927 (sep)', '6th', '35.2%', '57', '153'], ['1932', '7th', '44.5%', '72', '153'], ['1933', '8th', '49.7%', '76', '153'], ['1937', '9th', '45.2%', '68', '138'], ['1938', '10th', '51.9%', '76', '138'], ['1943', '11th', '41.8%', '66', '138'], ['1944', '12th', '48.9%', '75', '138'], ['1948', '13th', '41.9%', '67', '147'], ['1951', '14th', '46.3%', '68', '147'], ['1954', '15th', '43.4%', '65', '147'], ['1957', '16th', '48.3%', '78', '147'], ['1961', '17th', '43.8%', '70', '144'], ['1965', '18th', '47.7%', '72', '144'], ['1969', '19th', '44.6%', '74', '144'], ['1973', '20th', '46.2%', '68', '144'], ['1977', '21st', '50.6%', '84', '148'], ['1981', '22nd', '45.3%', '77', '166'], ['1982 (feb)', '23rd', '47.3%', '81', '166'], ['1982 (nov)', '24th', '45.2%', '75', '166'], ['1987', '25th', '44.2%', '81', '166'], ['1989', '26th', '44.2%', '77', '166'], ['1992', '27th', '39.1%', '68', '166'], ['1997', '28th', '39.3%', '77', '166'], ['2002', '29th', '41.5%', '81', '166'], ['2007', '30th', '41.6%', '77', '166'], ['2011', '31st', '17.4%', '20', '166']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many elections did the party win75 or more seats? | 13 |
1b9948ab23157ac39233152f4b88fba6 | tablebench-tqa | {'columns': ['Unnamed: 0', 'Average population (x 1000)', 'Live births', 'Deaths', 'Natural change', 'Crude birth rate (per 1000)', 'Crude death rate (per 1000)', 'Natural change (per 1000)'], 'data': [['1970', '38', '761', '299', '462', '20.0', '7.9', '12.2'], ['1975', '42', '857', '317', '540', '20.4', '7.5', '12.9'], ['1980', '46', '996', '333', '663', '21.7', '7.2', '14.4'], ['1985', '51', '1 104', '370', '734', '21.6', '7.3', '14.4'], ['1990', '51', '842', '360', '482', '16.4', '7.0', '9.4'], ['1991', '50', '789', '335', '454', '15.8', '6.7', '9.1'], ['1992', '48', '692', '401', '291', '14.4', '8.3', '6.0'], ['1993', '46', '617', '448', '169', '13.4', '9.7', '3.7'], ['1994', '44', '585', '518', '67', '13.3', '11.8', '1.5'], ['1995', '43', '537', '501', '36', '12.6', '11.8', '0.8'], ['1996', '42', '486', '441', '45', '11.7', '10.6', '1.1'], ['1997', '41', '483', '374', '109', '11.9', '9.2', '2.7'], ['1998', '40', '498', '368', '130', '12.6', '9.3', '3.3'], ['1999', '39', '448', '376', '72', '11.6', '9.7', '1.9'], ['2000', '38', '460', '438', '22', '12.0', '11.4', '0.6'], ['2001', '39', '562', '438', '124', '14.5', '11.3', '3.2'], ['2002', '39', '608', '397', '211', '15.5', '10.1', '5.4'], ['2003', '39', '625', '386', '239', '15.9', '9.8', '6.1'], ['2004', '39', '637', '345', '292', '16.5', '8.9', '7.6'], ['2005', '38', '548', '369', '179', '14.5', '9.7', '4.7'], ['2006', '37', '540', '347', '193', '14.5', '9.3', '5.2']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many years had a natural change of more than 150 and death of less than 350? | 6 |
b08634d7cd884455337211051bbfc115 | tablebench-tqa | {'columns': ['crime', 'reported offenses', 'killeen rate', 'texas rate', 'us rate'], 'data': [['murder', '10', '8.6', '5.6', '5.6'], ['rape', '66', '56.9', '32.9', '29.4'], ['robbery', '216', '186.4', '155.2', '154.0'], ['aggravated assault', '593', '511.6', '314.4', '281.6'], ['violent crime', '885', '763.5', '508.2', '470.6'], ['burglary', '1711', '1476.2', '946.5', '743.4'], ['larceny - theft', '2877', '2482.2', '2688.9', '2200.1'], ['motor vehicle theft', '169', '145.8', '351.1', '330.5'], ['non - violent crime', '4757', '4104.2', '3986.6', '3274.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many types of violent crimes are reported in the table? | 4 |
66ba5aa71ed35406e5bb3d31a2a25ef1 | tablebench-tqa | {'columns': ['Name', 'Season', 'Month', 'Max. sustained winds', 'Max. sustained winds', 'Max. sustained winds', 'Minimum pressure'], 'data': [['Name', 'Season', 'Month', '(Knots)', '(km/h)', '(mph)', '(mbar)'], ['Hurricane Ella', '1978', 'August, September', '120', '220', '140', '956'], ['Hurricane Greta', '1978', 'September', '115', '215', '130', '947'], ['Hurricane Frederic', '1979', 'August, September', '115', '215', '130', '943'], ['Hurricane Harvey', '1981', 'September', '115', '215', '130', '946'], ['Hurricane Debby', '1982', 'September', '115', '215', '130', '950'], ['Hurricane Diana', '1984', 'September', '115', '215', '130', '949'], ['Hurricane Gloria', '1985', 'September, October', '125', '230', '145', '919'], ['Hurricane Helene', '1988', 'September', '125', '230', '145', '938'], ['Hurricane Joan', '1988', 'October, November', '125', '230', '145', '932'], ['Hurricane Gabrielle', '1989', 'August, September', '125', '230', '145', '935'], ['Hurricane Claudette', '1991', 'September', '115', '215', '130', '943'], ['Hurricane Felix', '1995', 'August', '120', '220', '140', '929'], ['Hurricane Luis', '1995', 'August, September', '120', '220', '140', '935'], ['Hurricane Opal', '1995', 'September, October', '130', '240', '150', '916'], ['Hurricane Edouard', '1996', 'August, September', '125', '230', '145', '933'], ['Hurricane Hortense', '1996', 'September', '120', '220', '140', '935'], ['Hurricane Georges', '1998', 'September, October', '135', '250', '155', '937'], ['Hurricane Bret', '1999', 'August', '125', '230', '145', '944'], ['Hurricane Cindy', '1999', 'August', '120', '220', '140', '942'], ['Hurricane Floyd', '1999', 'September', '135', '250', '155', '921'], ['Hurricane Gert', '1999', 'September', '130', '240', '150', '930'], ['Hurricane Lenny', '1999', 'November', '135', '250', '155', '933'], ['Hurricane Isaac', '2000', 'September, October', '120', '220', '140', '943'], ['Hurricane Keith', '2000', 'September, October', '120', '220', '140', '939'], ['Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012', 'Sources: Atlantic Hurricane Best Track File 1851–2012']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many hurricanes occurred in the month of September? | 19 |
03ef349b3920a798e7c9e3b44589d702 | tablebench-tqa | {'columns': ['team', 'wins', 'losses', 'ties', 'win pct'], 'data': [['arizona cardinals', '2', '1', '0', '0.667'], ['atlanta falcons', '3', '1', '1', '0.7'], ['baltimore ravens', '13', '9', '0', '0.591'], ['buffalo bills', '5', '2', '0', '0.714'], ['carolina panthers', '3', '1', '0', '0.75'], ['chicago bears', '3', '1', '0', '0.75'], ['cincinnati bengals', '21', '9', '0', '0.7'], ['cleveland browns', '19', '5', '0', '0.792'], ['dallas cowboys', '1', '2', '0', '0.333'], ['denver broncos', '1', '3', '0', '0.25'], ['detroit lions', '4', '1', '0', '0.8'], ['green bay packers', '2', '2', '0', '0.5'], ['houston texans', '1', '1', '0', '0.5'], ['indianapolis colts', '4', '1', '0', '0.8'], ['jacksonville jaguars', '8', '10', '0', '0.444'], ['kansas city chiefs', '5', '3', '0', '0.625'], ['miami dolphins', '5', '2', '0', '0.714'], ['minnesota vikings', '2', '2', '0', '0.5'], ['new england patriots', '4', '3', '0', '0.571'], ['new orleans saints', '2', '1', '0', '0.667'], ['new york giants', '2', '1', '0', '0.667'], ['new york jets', '4', '1', '0', '0.8'], ['oakland raiders', '5', '2', '0', '0.714'], ['philadelphia eagles', '2', '2', '0', '0.5'], ['st louis rams', '1', '2', '0', '0.333'], ['san diego chargers', '7', '2', '0', '0.778'], ['san francisco 49ers', '1', '3', '0', '0.25'], ['seattle seahawks', '2', '4', '0', '0.333'], ['tampa bay buccaneers', '3', '1', '0', '0.75'], ['tennessee titans', '11', '12', '0', '0.478'], ['washington redskins', '3', '0', '0', '1.0'], ['totals :', '149', '90', '1', '0.623']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many teams have a win percentage of 0.7 or higher? | 14 |
d35caf05d6485bf3aee4d01cd36bdc7b | tablebench-tqa | {'columns': ['june 10 - 11', 'march 27 - 29', 'january 15 - 16', 'november 3', 'august 21 - 22'], 'data': [['june 10 , 1964', 'march 28 , 1968', 'january 16 , 1972', 'november 3 , 1975', 'august 22 , 1979'], ['127', '129', '131', '133', '135'], ['june 11 , 1983', 'march 29 , 1987', 'january 15 , 1991', 'november 3 , 1994', 'august 22 , 1998'], ['137', '139', '141', '143', '145'], ['june 10 , 2002', 'march 29 , 2006', 'january 15 , 2010', 'november 3 , 2013', 'august 21 , 2017'], ['147', '149', '151', '153', '155']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many dates in the table fall in the year 1990 or later? | 8 |
01cc27d3caf4e8c915554b92786ff40f | tablebench-tqa | {'columns': ['Rank', 'Death toll', 'Magnitude', 'Location', 'Depth (km)', 'Date'], 'data': [['1', '60,000', '7.5', 'Pakistan Baluchistan, Pakistan', '25.0', 'May 30'], ['2', '3,276', '7.0', 'Taiwan Taichung City, Taiwan', '15.0', 'April 20'], ['3', '2,746', '6.5', 'Taiwan Miaoli County, Taiwan', '30.0', 'July 16'], ['4', '690', '6.4', 'Iran Mazandaran Province, Iran', '15.0', 'April 11'], ['5', '540', '6.0', 'Turkey Agri Province, Turkey', '35.0', 'May 1'], ['6', '100', '6.0', 'China Sichuan Province, China', '35.0', 'December 18'], ['7', '60', '6.0', 'Iran Mazandaran Province, Iran', '35.0', 'March 5'], ['8', '51', '6.8', 'Greece southern Aegean Sea, Greece', '80.0', 'February 25']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many earthquakes have a magnitude of 6.5 or higher? | 4 |
6f416284e0b161716e479a0f4b3e6772 | tablebench-tqa | {'columns': ['year', 'theme', 'artist', 'composition', 'mintage', 'issue price'], 'data': [['2000', 'year of the dragon', 'harvey chan', '75% gold , 25% silver', '8874', '388.88'], ['2001', 'year of the snake', 'harvey chan', '75% gold , 25% silver', '6571', '388.88'], ['2002', 'year of the horse', 'harvey chan', '75% gold , 25% silver', '6843', '388.88'], ['2003', 'year of the goat', 'harvey chan', '75% gold , 25% silver', '3927', '398.88'], ['2004', 'year of the monkey', 'harvey chan', '75% gold , 25% silver', '3318', '398.88'], ['2005', 'year of the rooster', 'harvey chan', '75% gold , 25% silver', '4888', '398.88'], ['2006', 'year of the dog', 'harvey chan', '75% gold , 25% silver', '4888', '448.88'], ['2007', 'year of the pig', 'harvey chan', '75% gold , 25% silver', '4888', '498.95'], ['2008', 'year of the rat', 'harvey chan', '75% gold , 25% silver', '4888', '508.95'], ['2009', 'year of the ox', 'harvey chan', '75% gold , 25% silver', '4888', '638.88'], ['2010', 'year of the tiger', 'harvey chan', '75% gold , 25% silver', '4888', '555.55'], ['2011', 'year of the rabbit', 'harvey chan', '75% gold , 25% silver', '4888', '638.88']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many coins were issued between 2000 and 2005? | 6 |
cf9dd52a762be9733bb8d507360547ed | tablebench-tqa | {'columns': ['party', 'seats contested', 'seats won', 'no of votes', '% of votes', '% in seats contested', 'seats forfeited', '2003 seats'], 'data': [['bharatiya janata party', '49', '0', '28102', '1.49%', '1.79%', '49', '0'], ['communist party of india', '2', '1', '27891', '1.48%', '48.65%', '0', '1'], ['communist party of india (marxist)', '56', '46', '903009', '48.01%', '51.21%', '0', '38'], ['indian national congress', '48', '10', '684207', '36.38%', '44.38%', '1', '13'], ['nationalist congress party', '5', '0', '1882', '0.10%', '0.92%', '5', '0'], ['all india forward bloc', '12', '0', '2961', '0.16%', '0.74%', '12', '0'], ['all india trinamool congress', '22', '0', '6620', '0.35%', '0.92%', '22', '0'], ['indigenous nationalist party of twipra', '11', '1', '116761', '6.21%', '38.23%', '2', '6'], ['janata dal (united)', '2', '0', '1081', '0.06%', '1.74%', '2', '0'], ['lok janshakti party', '8', '0', '2738', '0.15%', '1.07%', '8', '0'], ['revolutionary socialist party', '2', '2', '31717', '1.69%', '52.58%', '0', '2'], ['amra bangalee', '19', '0', '5532', '0.29%', '0.96%', '19', '0'], ['party of democratic socialism', '1', '0', '2062', '0.11%', '6.13%', '1', '0'], ['independents', '62', '0', '61010', '3.24%', '4.94%', '58', '0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many parties have won 10 or fewer seats in the election? | 13 |
a6bf1a5c7ab44c8674bb88b508865392 | tablebench-tqa | {'columns': ['city (utility)', 'residential monthly usage : 1000 kwh', 'small power power demand : 40 kw , consumption 10000 kwh , load factor : 35%', 'medium power power demand : 1000 kw , consumption : 400000 kwh , load factor : 56 %', 'large power power demand : 50000 kw , consumption : 30600000 kwh , load factor : 85%'], 'data': [["st john 's ( newfoundland power / nl hydro )", '11.8', '11.83', '9.05', '3.98'], ['charlottetown ( maritime electric )', '14.51', '15.18', '12.68', '8.36'], ['halifax ( nova scotia power )', '15.01', '14.25', '11.99', '9.0'], ['moncton ( nb power )', '11.82', '12.46', '10.98', '6.86'], ['montreal ( hydro - quãbec )', '6.76', '8.85', '7.19', '4.51'], ['ottawa ( hydro ottawa )', '13.14', '12.94', '11.42', '10.58'], ['toronto ( toronto hydro )', '13.57', '13.41', '11.43', '10.46'], ['winnipeg ( manitoba hydro )', '7.46', '7.29', '5.62', '3.69'], ['regina ( saskpower )', '12.54', '10.31', '9.08', '5.67'], ['edmonton ( epcor )', '12.9', '12.41', '11.07', '6.97'], ['calgary ( enmax )', '13.89', '11.24', '9.53', '8.28']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many cities have a residential monthly usage of 1000 kwh above 12? | 7 |
6bf0106b75631feb6f504e4d48bb895c | tablebench-tqa | {'columns': ['No.', 'SWV', 'Title', 'English', 'Source', 'Details'], 'data': [['1', '257', 'Paratum cor meum, Deus', 'My heart is ready, O God', 'Psalms 108:1–3', '257'], ['2', '258', 'Exultavit cor meum in Domino', 'My heart rejoiceth in the Lord', '1 Samuel 2:1–2', '258'], ['3', '259', 'In te, Domine, speravi', 'I will extol thee, O Lord', 'Psalms 30:1–2,1', '259'], ['4', '260', 'Cantabo domino in vita mea', 'I will sing unto the Lord as long as I live', 'Psalms 104:33', '260'], ['5', '261', 'Venite ad me omnes qui laboratis', 'Come unto me, all ye that labour', 'Matthew 11:28–30', '261'], ['6', '262', 'Jubilate Deo omnis terra', 'Make a joyful noise unto the Lord', 'Psalms 100', '262'], ['7', '263', 'Anima mea liquefacta est', 'My soul melted when my beloved spoke', 'Song of Solomon 5:6; 2:14; 5:13; 5:8', '263'], ['8', '264', 'Adjuro vos, filiae Jerusalem', 'I adjure you, daughters of Jerusalem', 'Song of Solomon 5:6; 2:14; 5:13; 5:8', '264'], ['9', '265', 'O quam tu pulchra es, amica mea', 'How beautiful you are, my love', 'Song of Solomon 4:1-5,8', '265'], ['10', '266', 'Veni de Libano, veni, amica mea', 'Advance from Lebanon, my spouse', 'Song of Solomon 4:1-5,8', '266'], ['11', '267', 'Benedicam Dominum in omni tempore', 'I will bless the Lord at all times', 'Psalms 34:1–2', '267'], ['12', '268', 'Exquisivi Dominum et exaudivit me', 'I sought the Lord, and he heard me', 'Psalms 34:4–6', '268'], ['13', '269', 'Fili mi, Absalon', 'My son, Absalon', '2 Samuel 18:32', '269'], ['14', '270', 'Attendite, popule meus', 'Give ear, O my people', 'Psalms 78:1–3', '270'], ['15', '271', 'Domine, labia mea aperies', 'O Lord, open thou my lips', 'Psalms 51:15', '271'], ['16', '272', 'In lectulo per noctes', 'On my bed, throughout the night', 'Song of Solomon 3:1-2,4', '272'], ['17', '273', 'Invenerunt me costudes civitatis', 'The watchers who guard the city found me', 'Song of Solomon 3:1-2,4', '273'], ['18', '274', 'Veni, dilecte mi, in hortum meum', 'May my beloved enter into his garden', 'Song of Solomon 5:1', '274'], ['19', '275', 'Buccinate in neomenia tuba', 'Blow the trumpet when the moon is new', 'Psalms 81:3,1; 98:6', '275'], ['20', '276', 'Jubilate Deo in chordis', 'Let us rejoice in God with strings and organ', 'Psalms 150:4; Psalms 98:4', '276']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many songs or hymns in the table have a source from the book of Psalms? | 10 |
bdfcc7e1bb6dc5eef09456c8ba56f46d | tablebench-tqa | {'columns': ['canton', 'years of kindergarten', 'years of kindergarten provided', 'years of kindergarten legally required', 'length of primary school', 'length of mandatory secondary school', 'separate secondary schools', 'cooperative secondary schools', 'integrated secondary schools'], 'data': [['zurich', '2', '2', '2', '6', '3', 'yes', 'no', 'no'], ['bern', '1', '1', '0', '6', '3', 'yes', 'yes', 'yes'], ['lucerne', '1', '1', '1', '6', '3', 'yes', 'yes', 'yes'], ['uri', '1', '1', '0', '6', '3', 'no', 'no', 'yes'], ['schwyz', '1', '1', '1', '6', '3', 'no', 'no', 'yes'], ['obwalden', '1', '1', '1', '6', '3', 'no', 'no', 'yes'], ['nidwalden', '2', '2', '1', '6', '3', 'no', 'no', 'yes'], ['glarus', '2', '2', '1', '6', '3', 'yes', 'yes', 'yes'], ['zug', '2', '1', '1', '6', '3', 'no', 'no', 'yes'], ['fribourg', '2', '1 or 2', '0 or 2', '6', '3', 'yes', 'no', 'yes'], ['solothurn', '2', '2', '0', '6', '3', 'yes', 'yes', 'yes'], ['basel - stadt', '2', '2', '2', '4', '5', 'yes', 'no', 'no'], ['basel - landschaft', '2', '2', '1', '5', '4', 'yes', 'no', 'no'], ['schaffhausen', '2', '2', '1', '6', '3', 'no', 'no', 'yes'], ['appenzell ausserrhoden', '2', '2', '1', '6', '3', 'yes', 'yes', 'yes'], ['appenzell innerrhoden', '2', '2', '1', '6', '3', 'yes', 'yes', 'yes'], ['st gallen', '2', '2', '2', '6', '3', 'no', 'no', 'yes'], ['graubã¼nden', '1', '1', '0', '6', '3', 'yes', 'no', 'no'], ['aargau', '1', '1', '0', '5', '4', 'yes', 'no', 'no'], ['thurgau', '2', '2', '2', '6', '3', 'yes', 'no', 'no'], ['ticino', '3', '3', '0', '5', '4', 'yes', 'no', 'no'], ['vaud', '2', '2', '0', '4', '5', 'yes', 'no', 'no'], ['valais', '1', '0', '0', '6', '3', 'yes', 'no', 'no'], ['neuchãtel', '2', '2', '0', '5', '4', 'yes', 'no', 'no'], ['geneva', '2', '2', '0', '6', '3', 'yes', 'no', 'no']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many cantons have 'yes' in the 'separate secondary schools' column? | 18 |
0e1001d55ac9d8f38aa594007e13070e | tablebench-tqa | {'columns': ['0', 'pōlô', 'Unnamed: 2', 'Unnamed: 3', 'Unnamed: 4', 'Unnamed: 5', 'Unnamed: 6', 'Unnamed: 7', 'Unnamed: 8', 'Unnamed: 9', 'Unnamed: 10', 'Unnamed: 11', 'Unnamed: 12', 'Unnamed: 13', 'Unnamed: 14', 'Unnamed: 15', 'Unnamed: 16', 'Unnamed: 17', 'Unnamed: 18', 'Unnamed: 19'], 'data': [['1', 'əsad', '11', 'samsad', '21', 'darwamsad', '31', 'tolomsad', '41', 'pamsad', '51', 'limamsad', '61', 'nəmsad', '71', 'pitomsad', '81', 'walomsad', '91', 'yamsad'], ['2', 'darwā', '12', 'samdarwā', '22', 'darwamdarwā', '32', 'tolomdarwā', '42', 'pamdarwā', '52', 'limamdarwā', '62', 'nəmdarwā', '72', 'pitomdarwā', '82', 'walomdarwā', '92', 'yamdarwā'], ['3', 'tolō', '13', 'samtolō', '23', 'darwamtolō', '33', 'tolomtolō', '43', 'pamtolō', '53', 'limamtolō', '63', 'nəmtolō', '73', 'pitomtolō', '83', 'walomtolō', '93', 'yamtolō'], ['4', 'əpat', '14', 'sampat', '24', 'darwampat', '34', 'tolompat', '44', 'pampat', '54', 'limampat', '64', 'nəmpat', '74', 'pitompat', '84', 'walompat', '94', 'yampat'], ['5', 'limā', '15', 'samlimā', '25', 'darwamlimā', '35', 'tolomlimā', '45', 'pamlimā', '55', 'limamlimā', '65', 'nəmlimā', '75', 'pitomlimā', '85', 'walomlimā', '95', 'yamlimā'], ['6', 'ənəm', '16', 'samnəm', '26', 'darwamnəm', '36', 'tolomnəm', '46', 'pamnəm', '56', 'limamnəm', '66', 'nəmnəm', '76', 'pitomnəm', '86', 'walomnəm', '96', 'yamnəm'], ['7', 'pitō', '17', 'sampitō', '27', 'darwampitō', '37', 'tolompitō', '47', 'pampitō', '57', 'limampitō', '67', 'nəmpitō', '77', 'pitompitō', '87', 'walompitō', '97', 'yampitō'], ['8', 'walō', '18', 'samwalō', '28', 'darwamwalō', '38', 'tolomwalō', '48', 'pamwalō', '58', 'limamwalō', '68', 'nəmwalō', '78', 'pitomwalō', '88', 'walomwalō', '98', 'yamwalō'], ['9', 'siyam', '19', 'samsiyam', '29', 'darwamsiyam', '39', 'tolomsiyam', '49', 'pamsiyam', '59', 'limamsiyam', '69', 'nəmsiyam', '79', 'pitomsiyam', '89', 'walomsiyam', '99', 'yamsiyam'], ['10', 'sampōlô', '20', 'darwampōlô', '30', 'tolompōlô', '40', 'pampōlô', '50', 'limampōlô', '60', 'nəmpōlô', '70', 'pitompōlô', '80', 'walompōlô', '90', 'yampōlô', '100', 'saŋgatos']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many rows have a value in the 'pōlô' column that starts with the letter 'ə'? | 3 |
663af775c49891f680893517237e7158 | tablebench-tqa | {'columns': ['detailed family information', 'from', 'to', 'anchor', 'orientation', 'conserved in mus musculus', 'matrix sim', 'sequence', 'occurrence'], 'data': [['cell cycle regulators : cell cycle homology element', '137', '149', '143', '+ strand', 'conserved', '0.943', 'ggacttgaattca', '1'], ['gata binding factors', '172', '184', '178', '+ strand', 'conserved', '0.946', 'taaagatttgagg', '1'], ['vertebrate tata binding protein factor', '193', '209', '201', '+ strand', 'conserved', '0.983', 'tcctataaaatttggat', '1'], ['heat schock factors', '291', '315', '303', '+ strand', 'conserved', '0.992', 'cacagaaacgttagaagcatctctt', '4'], ['human and murine ets1 factors', '512', '532', '522', '+ strand', 'conserved', '0.984', 'taagccccggaagtacttgtt', '3'], ['zinc finger transcription factor ru49 , zipro1', '522', '528', '525', '+ strand', 'conserved', '0.989', 'aagtact', '2'], ['krueppel like transcription factors', '618', '634', '626', '+ strand', 'conserved', '0.925', 'tggaggggcagacaccc', '1']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Counting'} | How many transcription factors have an occurrence count greater than 1? | 3 |
381b3da7c2758e821a32852d99d1ef92 | tablebench-tqa | {'columns': ['number', 'symbol', 'name', '21st', '22nd', '23rd', '24th', '25th', '26th', '27th', '28th', '29th', '30th'], 'data': [['21', 'Sc', 'scandium', '582163', None, None, None, None, None, None, None, None, None], ['22', 'Ti', 'titanium', '602930', '639294.0', None, None, None, None, None, None, None, None], ['23', 'V', 'vanadium', '151440', '661050.0', '699144.0', None, None, None, None, None, None, None], ['24', 'Cr', 'chromium', '157700', '166090.0', '721870.0', '761733.0', None, None, None, None, None, None], ['25', 'Mn', 'manganese', '158600', '172500.0', '181380.0', '785450.0', '827067.0', None, None, None, None, None], ['26', 'Fe', 'iron', '163000', '173600.0', '188100.0', '195200.0', '851800.0', '895161.0', None, None, None, None], ['27', 'Co', 'cobalt', '167400', '178100.0', '189300.0', '204500.0', '214100.0', '920870.0', '966023.0', None, None, None], ['28', 'Ni', 'nickel', '169400', '182700.0', '194000.0', '205600.0', '221400.0', '231490.0', '992718.0', '1039668.0', None, None], ['29', 'Cu', 'copper', '174100', '184900.0', '198800.0', '210500.0', '222700.0', '239100.0', '249660.0', '1067358.0', '1116105.0', None], ['30', 'Zn', 'zinc', '179100', None, None, None, None, None, None, None, None, None], ['36', 'Kr', 'krypton', '85300', '90400.0', '96300.0', '101400.0', '111100.0', '116290.0', '282500.0', '296200.0', '311400.0', '326200.0'], ['42', 'Mo', 'molybdenum', '87000', '93400.0', '98420.0', '104400.0', '121900.0', '127700.0', '133800.0', '139800.0', '148100.0', '154500.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of atomic energy levels, Ionization Energy (IE) represents the energy required to remove an electron from an atom. Based on the provided data, in which period did the Ionization Energy of an element first exceed 700000, if at all? | 23rd |
894156fdcc6661fd7ec5038fb090c32a | tablebench-tqa | {'columns': ['date', 'total usaaf', 'tot officers', 'tot enlisted', 'overseas', 'officers o / s', 'enlisted o / s'], 'data': [['31 july 1939', '24724', '2636', '22088', '3991', '272', '3719'], ['31 december 1939', '43118', '3006', '40112', '7007', '351', '6656'], ['31 december 1940', '101227', '6437', '94790', '16070', '612', '15458'], ['31 december 1941', '354161', '24521', '329640', '25884', '2479', '23405'], ['31 december 1942', '1597049', '127267', '1469782', '242021', '26792', '215229'], ['31 december 1943', '2373882', '274347', '2099535', '735666', '81072', '654594'], ['31 march 1944 (peak size)', '2411294', '306889', '2104405', '906335', '104864', '801471'], ['31 december 1944', '2359456', '375973', '1983483', '1164136', '153545', '1010591'], ['30 april 1945 (peak overseas)', '2329534', '388278', '1941256', '1224006', '163886', '1060120']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of USAAF personnel statistics, the "Overseas Rate" is calculated as the total number of personnel overseas divided by the total USAAF personnel, multiplied by 100, indicating the percentage of personnel deployed overseas. On which date did the USAAF have the highest Overseas Rate? | 30 April 1945 |
c8223578cf6dbfd367df3afbb270a180 | tablebench-tqa | {'columns': ['Round', 'Václav Klaus', 'Václav Klaus', 'Jaroslava Moserová', 'Jaroslava Moserová', 'Miloš Zeman', 'Miloš Zeman'], 'data': [['Round', 'Deputies', 'Senators', 'Deputies', 'Senators', 'Deputies', 'Senators'], ['1st', '89', '32', '25', '43', '78', '5'], ['1st', '121', '121', '68', '68', '83', '83'], ['2nd', '85', '33', '32', '42', '-', '-'], ['2nd', '118', '118', '74', '74', '-', '-'], ['3rd', '95', '32', '26', '39', '-', '-'], ['3rd', '127', '127', '65', '65', '-', '-']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of election data, a "majority win" is defined as a candidate receiving more than 50% of the total deputies and senators in a round. Based on the provided data, in which round did Miloš Zeman achieve his first majority win, if at all? | None |
dcee3efa18d9eb2b672f632300e2df53 | tablebench-tqa | {'columns': ['males rank', 'females rank', 'state', 'hiv awareness (males%)', 'females (%)'], 'data': [['1', '2', 'kerala', '99', '95'], ['2', '1', 'manipur', '99', '99'], ['3', '3', 'tamil nadu', '98', '94'], ['4', '3', 'mizoram', '96', '94'], ['5', '10', 'andhra pradesh', '93', '74'], ['6', '5', 'goa', '92', '83'], ['6', '7', 'himachal pradesh', '92', '79'], ['6', '12', 'punjab', '92', '70'], ['9', '15', 'nagaland', '91', '81'], ['10', '8', 'uttarakhand', '90', '79'], ['11', '7', 'maharashtra', '87', '82'], ['12', '9', 'sikkim', '89', '75'], ['12', '11', 'tripura', '89', '73'], ['14', '17', 'jammu and kashmir', '88', '61'], ['15', '18', 'haryana', '87', '60'], ['16', '13', 'karnataka', '85', '66'], ['17', '23', 'gujarat', '80', '49'], ['17', '19', 'whole india', '80', '57'], ['19', '13', 'arunachal pradesh', '75', '66'], ['19', '21', 'assam', '75', '53'], ['21', '28', 'west bengal', '74', '50'], ['21', '26', 'uttar pradesh', '74', '40'], ['21', '22', 'rajasthan', '74', '34'], ['24', '16', 'odisha', '73', '62'], ['25', '27', 'bihar', '70', '35'], ['26', '24', 'madhya pradesh', '68', '45'], ['27', '25', 'chattisgarh', '67', '41'], ['28', '19', 'meghalaya', '63', '57'], ['29', '29', 'jharkhand', '53', '29']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | HIV Awareness Rate is calculated as the percentage of people in a state who are aware of HIV. Among the states with a males' rank higher than 10, which state has the highest HIV Awareness Rate for females? | manipur |
6237bbbb18e2f1614656f1730f37f02a | tablebench-tqa | {'columns': ['Row Header', 'Total', 'Owned', 'Leased', 'Seats in Standard Configuration', 'Average Age (In Years)'], 'data': [['777-300ER', '14', '14', '—', '366', '0.7'], ['777-200ER', '55', '40', '15', '267-269', '17.8'], ['777-200', '19', '19', '—', '364', '20.5'], ['787-9', '21', '21', '—', '252', '2.1'], ['787-8', '12', '12', '—', '219', '4.5'], ['767-400ER', '16', '14', '2', '242', '16.3'], ['767-300ER', '35', '22', '13', '183-214', '22.5'], ['757-300', '21', '9', '12', '213', '15.3'], ['757-200', '56', '50', '6', '142-169', '21.7'], ['737-900ER', '136', '136', '—', '179', '5.0'], ['737-900', '12', '8', '4', '179', '16.3'], ['737-800', '141', '77', '64', '154-166', '13.8'], ['737-700', '40', '20', '20', '118-126', '18.8'], ['A320-200', '99', '66', '33', '150', '19.3'], ['A319-100', '67', '50', '17', '128', '16.7'], ['Total mainline', '744', '558', '186', '', '14.3']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Average Seat Density is calculated as the total number of seats divided by the total number of aircraft. Based on this definition, which aircraft type has the highest average seat density in the airline's fleet? | 777-300ER |
27f4204a35777e335600e3f00a4cd9fe | tablebench-tqa | {'columns': ['rank', 'location', 'total passengers', 'annual change', 'capacity', 'capacity in use'], 'data': [['1', 'são paulo', '32777330', '9.24%', '26000000', '126 , 06%'], ['2', 'rio de janeiro', '17495737', '17.00%', '18000000', '97 , 19%'], ['3', 'são paulo', '16775770', '0.11%', '12000000', '139 , 79%'], ['4', 'brasília', '15891530', '3.20%', '10000000', '158 , 91%'], ['5', 'belo horizonte', '10398296', '9.05%', '5000000', '207 , 96%'], ['6', 'rio de janeiro', '9002863', '5.73%', '6000000', '150 , 04%'], ['7', 'campinas', '8858380', '17.04%', '3500000', '253 , 09%'], ['8', 'salvador', '8811540', '4.96%', '6000000', '146 , 85%'], ['9', 'porto alegre', '8261355', '5.45%', '6100000', '135 , 43%'], ['10', 'curitiba', '6828334', '2.03%', '6000000', '113 , 80%'], ['11', 'recife', '6433410', '0.78%', '9000000', '71 , 48%'], ['12', 'fortaleza', '5964308', '5.61%', '3000000', '198 , 80%'], ['13', 'vitória', '3642842', '14.46%', '560000', '650 , 50%'], ['14', 'belém', '3342771', '11.56%', '2700000', '123 , 80%'], ['15', 'florianópolis', '3395256', '8.75%', '1100000', '308 , 65%'], ['16', 'manaus', '3131150', '3.70%', '1800000', '173 , 95%'], ['17', 'goinia', '3076858', '9.80%', '600000', '512 , 80%'], ['18', 'cuiabá', '2761588', '8.25%', '1600000', '172 , 59%'], ['19', 'natal', '2660864', '2.88%', '1500000', '177 , 39%'], ['20', 'são luís', '1991099', '8.01%', '1010000', '197 , 13%'], ['21', 'foz do iguaçu', '1741526', '2.96%', '1500000', '116 , 10%'], ['22', 'maceió', '1719979', '11.02%', '1200000', '143 , 31%'], ['23', 'campo grande', '1655073', '9.20%', '900000', '183 , 89%'], ['24', 'aracaju', '1373401', '25.63%', '1300000', '105 , 64%'], ['25', 'navegantes', '1277486', '9.38%', '600000', '212 , 91%'], ['26', 'joão pessoa', '1252559', '9.64%', '860000', '145 , 62%'], ['27', 'londrina', '1098848', '14.23%', '800000', '137 , 35%'], ['28', 'ribeirão preto', '1077010', '3.35%', '480000', '224 , 37%'], ['29', 'porto velho', '1050682', '6.79%', '920000', '114 , 20%'], ['30', 'teresina', '1044865', '2.86%', '450000', '232 , 19%'], ['31', 'uberlndia', '1011490', '11.48%', '600000', '168 , 58%'], ['32', 'são josé do rio preto', '770569', '15.13%', '270000', '285 , 39%'], ['33', 'belo horizonte', '774881', '2.33%', '1200000', '64 , 57%'], ['34', 'maringá', '757719', '13.61%', '430000', '176 , 21%'], ['35', 'palmas', '579395', '15.09%', '370000', '156 , 59%'], ['36', 'macapá', '573560', '2.36%', '170000', '337 , 38%'], ['37', 'ilhéus', '532130', '3.70%', '300000', '177 , 37%'], ['38', 'santarém', '487168', '5.62%', '225000', '216 , 51%'], ['39', 'petrolina', '458588', '23.25%', '150000', '305 , 72%'], ['40', 'juazeiro do norte', '451087', '31.51%', '100000', '451 , 08%']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Airport Capacity Utilization Rate is defined as the percentage of the total airport capacity that is currently in use. Based on this definition, which airport has the highest Airport Capacity Utilization Rate? | belo horizonte |
56fb46be47a462ccb8af7c501404ce76 | tablebench-tqa | {'columns': ['building', 'height', 'floors', 'built', 'city', 'architect'], 'data': [["eaton 's department store", '46', '9', '1904', 'winnipeg', 'john woodman'], ['union bank tower', '48', '10', '1904', 'winnipeg', 'darling and pearson'], ['lindsay building', '44', '11', '1911', 'winnipeg', 'woodman and carey'], ['confederation building', '46', '12', '1911', 'winnipeg', 'j wilson gray'], ['national bank building', '50', '13', '1911', 'winnipeg', 'john d atchison'], ['electric railway chambers', '45', '12', '1912', 'winnipeg', 'pratt and ross , charles s frost'], ['hotel fort garry', '59', '14', '1913', 'winnipeg', 'ross and macfarlane'], ['marlbourgh hotel', '42', '10', '1913', 'winnipeg', 'j chisholm & son'], ['paris building', '42', '11', '1915', 'winnipeg', 'woodman and carey'], ['bank of hamilton building', '45', '10', '1916', 'winnipeg', 'john d atchison'], ['manitoba legislative building', '79', '5', '1920', 'winnipeg', 'simon and boddington']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of architecture, the Floor-to-Height Ratio is calculated as the total number of floors divided by the height of the building, indicating the building's density. Among the buildings in Winnipeg, which one has the highest Floor-to-Height Ratio? | electric railway chambers |
4c147e78894f919ff89514f23c84bc12 | tablebench-tqa | {'columns': ['round', 'pick', 'overall', 'name', 'position', 'college'], 'data': [['1', '13', '13', 'brian orakpo', 'de', 'texas'], ['3', '16', '80', 'kevin barnes', 'cb', 'maryland'], ['5', '22', '158', 'cody glenn', 'lb', 'nebraska'], ['6', '13', '186', 'robert henson', 'lb', 'texas christian'], ['7', '12', '221', 'eddie williams', 'te', 'idaho'], ['7', '34', '243', 'marko mitchell', 'wr', 'nevada']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Draft Position Improvement is defined as the difference between the overall pick number and the pick number in a specific round. What is the Draft Position Improvement for players drafted in the 7th round? | 209 |
ce2930301220686e3acbc890a52ba84d | tablebench-tqa | {'columns': ['metropolitan ring', 'localities', 'total', 'jews and others 1', 'thereof : jews', 'arabs', 'population density (per km square)', 'annual population growth rate'], 'data': [['core 2', '1', '264800', '237800', '214200', '27100', '3838.2', '0.0%'], ['inner ring 3', '30', '271200', '241700', '224500', '29500', '1046.8', '0.5%'], ['northern section', '3', '112400', '112300', '101900', '100', '5591.7', '- 0.2%'], ['eastern section', '16', '84000', '80100', '76000', '4000', '1014.9', '1.0%'], ['southern section', '11', '74800', '49300', '46700', '25500', '481.4', '1.0%'], ['outer ring 4', '98', '484900', '240100', '223000', '244900', '678.8', '1.8%'], ['northern section', '57', '362800', '147300', '134500', '215600', '948.1', '1.6%'], ['eastern section', '23', '82300', '64300', '60800', '18000', '534.5', '1.7%'], ['southern section', '18', '39800', '28500', '27800', '11300', '224.0', '3.7%']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Based on the definition of the Arab demographic proportion as the percentage of Arabs in the total population, which metropolitan ring exhibits the highest Arab demographic proportion? | northern section |
1fec869ba7e574c14ff02cefcb4b3f83 | tablebench-tqa | {'columns': ['Club', 'Season', 'League', 'League', 'League', 'National Cup', 'National Cup', 'League Cup', 'League Cup', 'Europe', 'Europe', 'Total', 'Total'], 'data': [['Club', 'Season', 'Division', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals'], ['Liverpool', '1990–91', 'First Division', '2', '0', '1', '0', '0', '0', '0', '0', '3', '0'], ['Liverpool', '1991–92', 'First Division', '30', '5', '8', '3', '5', '3', '8', '0', '51', '11'], ['Liverpool', '1992–93', 'Premier League', '31', '4', '1', '0', '5', '2', '3', '1', '40', '7'], ['Liverpool', '1993–94', 'Premier League', '30', '2', '2', '0', '2', '0', '0', '0', '34', '2'], ['Liverpool', '1994–95', 'Premier League', '40', '7', '7', '0', '8', '2', '0', '0', '55', '9'], ['Liverpool', '1995–96', 'Premier League', '38', '6', '7', '2', '4', '1', '4', '1', '53', '10'], ['Liverpool', '1996–97', 'Premier League', '37', '7', '2', '0', '4', '2', '8', '1', '51', '10'], ['Liverpool', '1997–98', 'Premier League', '36', '11', '1', '0', '5', '0', '4', '1', '46', '12'], ['Liverpool', '1998–99', 'Premier League', '28', '4', '0', '0', '0', '0', '3', '1', '31', '5'], ['Liverpool', 'Liverpool Total', 'Liverpool Total', '272', '46', '29', '5', '33', '10', '30', '5', '364', '66'], ['Real Madrid', '1999–2000', 'La Liga', '30', '3', '10', '0', '0', '0', '7', '1', '47', '4'], ['Real Madrid', '2000–01', 'La Liga', '26', '2', '6', '0', '0', '0', '10', '0', '42', '2'], ['Real Madrid', '2001–02', 'La Liga', '23', '2', '2', '0', '0', '0', '13', '2', '38', '4'], ['Real Madrid', '2002–03', 'La Liga', '15', '1', '4', '1', '0', '0', '6', '2', '25', '4'], ['Real Madrid', 'Real Madrid Total', 'Real Madrid Total', '94', '8', '22', '1', '0', '0', '36', '5', '152', '14'], ['Manchester City', '2003–04', 'Premier League', '22', '0', '3', '0', '1', '0', '4', '0', '30', '0'], ['Manchester City', '2004–05', 'Premier League', '13', '0', '1', '0', '0', '0', '0', '0', '14', '0'], ['Manchester City', 'Manchester City Total', 'Manchester City Total', '35', '0', '4', '0', '1', '0', '4', '0', '44', '0'], ['Career Total', 'Career Total', 'Career Total', '401', '54', '52', '6', '37', '10', '70', '10', '560', '80']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Goal Percentage is defined as the ratio of goals scored to the total number of appearances made by a player or a team in a specific season or overall career. What is the Goal Percentage of Liverpool in the 1995-1996 season? | 18.87% |
f23997671da61c46c93fdc184c8f06ef | tablebench-tqa | {'columns': ['Rank', 'Magnitude', 'Death toll', 'Location', 'Depth (km)', 'MMI', 'Date'], 'data': [['1', '8.3', '0', 'Russia Russia', '608.9', 'V', 'May 24'], ['2', '8.0', '13', 'Solomon Islands Solomon Islands', '29', 'VIII', 'February 7'], ['3', '7.7', '35', 'Iran Iran', '82', 'VII', 'April 16'], ['3', '7.7', '825', 'Pakistan Pakistan', '20.0', 'IX', 'September 24'], ['3', '7.7', '0', 'Antarctica Coronation Island, Antarctica', '10', 'VII', 'November 17'], ['6', '7.5', '0', 'United States United States', '9.9', 'VI', 'January 5'], ['7', '7.4', '0', 'Tonga Tonga', '171.4', 'V', 'May 23'], ['8', '7.3', '0', 'Papua New Guinea Papua New Guinea', '386.3', 'IV', 'July 7'], ['8', '7.3', '0', 'South Georgia and the South Sandwich Islands South Georgia and the South Sandwich Islands', '31.3', 'VI', 'July 15'], ['10', '7.2', '0', 'Russia Russia', '123.3', 'VII', 'April 19'], ['11', '7.1', '0', 'Solomon Islands Solomon Islands', '10.1', 'VI', 'February 6'], ['11', '7.1', '0', 'Solomon Islands Santa Cruz Islands', '21', 'VII', 'February 8'], ['11', '7.1', '3', 'Peru Peru', '40', 'VIII', 'September 25'], ['11', '7.1', '222', 'Philippines Philippines', '20.0', 'IX', 'October 15'], ['11', '7.1', '0', 'Japan Japan', '26.1', 'III', 'October 25'], ['16', '7.0', '0', 'Solomon Islands Solomon Islands', '10.1', 'VII', 'February 6'], ['16', '7.0', '0', 'Indonesia Indonesia', '66', 'VI', 'April 6'], ['16', '7.0', '0', 'United States United States', '33.5', 'VI', 'August 30'], ['16', '7.0', '0', 'Falkland Islands Falkland Islands', '10', 'I', 'November 25']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of seismology, the Magnitude of an earthquake is a measure of its size, with higher magnitudes indicating more powerful earthquakes. What is the average Magnitude of the top 5 earthquakes in the table, ranked by their Death toll? | 7.52 |
d75d41fe0b3044f14eb902b0b88b3d35 | tablebench-tqa | {'columns': ['number', 'symbol', 'name', '21st', '22nd', '23rd', '24th', '25th', '26th', '27th', '28th', '29th', '30th'], 'data': [['21', 'Sc', 'scandium', '582163', None, None, None, None, None, None, None, None, None], ['22', 'Ti', 'titanium', '602930', '639294.0', None, None, None, None, None, None, None, None], ['23', 'V', 'vanadium', '151440', '661050.0', '699144.0', None, None, None, None, None, None, None], ['24', 'Cr', 'chromium', '157700', '166090.0', '721870.0', '761733.0', None, None, None, None, None, None], ['25', 'Mn', 'manganese', '158600', '172500.0', '181380.0', '785450.0', '827067.0', None, None, None, None, None], ['26', 'Fe', 'iron', '163000', '173600.0', '188100.0', '195200.0', '851800.0', '895161.0', None, None, None, None], ['27', 'Co', 'cobalt', '167400', '178100.0', '189300.0', '204500.0', '214100.0', '920870.0', '966023.0', None, None, None], ['28', 'Ni', 'nickel', '169400', '182700.0', '194000.0', '205600.0', '221400.0', '231490.0', '992718.0', '1039668.0', None, None], ['29', 'Cu', 'copper', '174100', '184900.0', '198800.0', '210500.0', '222700.0', '239100.0', '249660.0', '1067358.0', '1116105.0', None], ['30', 'Zn', 'zinc', '179100', None, None, None, None, None, None, None, None, None], ['36', 'Kr', 'krypton', '85300', '90400.0', '96300.0', '101400.0', '111100.0', '116290.0', '282500.0', '296200.0', '311400.0', '326200.0'], ['42', 'Mo', 'molybdenum', '87000', '93400.0', '98420.0', '104400.0', '121900.0', '127700.0', '133800.0', '139800.0', '148100.0', '154500.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Ionization Energy Ratio is defined as the ratio of the ionization energy of an element at a specific level to its ionization energy at a lower level. Among the elements with available ionization energy data, which element has the highest Ionization Energy Ratio from the 21st to the 22nd level? | V |
106f3d501745fe92f5e6b513acff4a61 | tablebench-tqa | {'columns': ['year', 'property taxes', 'investment earnings', 'other local sources', 'state & federal', 'total revenue'], 'data': [['2005', '24384901', '255041', '2670060', '13581968', '40891700'], ['2004', '21099214', '181103', '2624131', '13999169', '37903617'], ['2003', '17199210', '509862', '2309087', '12794922', '32539572'], ['2002', '14359199', '879398', '2168096', '15132879', '32539572'], ['2001', '11631227', '1949885', '1987436', '12929489', '28498037'], ['2000', '10608734', '493839', '2127480', '8549565', '21779618']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of local government finance, "Revenue Growth Rate" is defined as the percentage change in total revenue from one year to the next. What was the revenue growth rate from 2001 to 2002, based on the provided data? | 14.18% |
f4292e392fff8cf611cbe76e12ffa8eb | tablebench-tqa | {'columns': ['pilot', 'organization', 'total flights', 'usaf space flights', 'fai space flights', 'max mach', 'max speed (mph)', 'max altitude (miles)'], 'data': [['michael j adams', 'us air force', '7', '1', '0', '5.59', '3822', '50.3'], ['neil armstrong', 'nasa', '7', '0', '0', '5.74', '3989', '39.2'], ['scott crossfield', 'north american aviation', '14', '0', '0', '2.97', '1959', '15.3'], ['william h dana', 'nasa', '16', '2', '0', '5.53', '3897', '58.1'], ['joseph h engle', 'us air force', '16', '3', '0', '5.71', '3887', '53.1'], ['william j pete knight', 'us air force', '16', '1', '0', '6.7', '4519', '53.1'], ['john b mckay', 'nasa', '29', '1', '0', '5.65', '3863', '55.9'], ['forrest s petersen', 'us navy', '5', '0', '0', '5.3', '3600', '19.2'], ['robert a rushworth', 'us air force', '34', '1', '0', '6.06', '4017', '53.9'], ['milton o thompson', 'nasa', '14', '0', '0', '5.48', '3723', '40.5'], ['joseph a walker', 'nasa', '25', '3', '2', '5.92', '4104', '67.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Mach Number Threshold is defined as the maximum speed of an aircraft in terms of Mach number. Based on this definition, how many pilots in the table have exceeded a Mach Number Threshold of 5.5 during their flights? | 8 |
446d154f4598fc77bc4835e5b9c1b831 | tablebench-tqa | {'columns': ['city / municipality', 'no of barangays', 'area (km square)', 'population (2010 census)', 'pop density (per km square)'], 'data': [['angono', '10', '26.22', '102407', '3905.68'], ['antipolo', '16', '306.1', '677741', '2214.12'], ['baras', '10', '84.93', '32609', '383.95'], ['binangonan', '40', '66.34', '249872', '3766.54'], ['cainta', '7', '42.99', '311845', '7253.9'], ['cardona', '18', '28.56', '47414', '1660.15'], ['jalajala', '11', '44.12', '30074', '681.64'], ['morong', '8', '37.58', '52194', '1388.88'], ['pililla', '9', '69.95', '59527', '850.99'], ['rodriguez', '11', '312.7', '280904', '898.32'], ['san mateo', '15', '55.09', '205255', '3725.81'], ['tanay', '19', '200.0', '98879', '494.3'], ['taytay', '5', '38.8', '288956', '7447.32']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Barangay Density is calculated as the number of barangays divided by the area in square kilometers. Which city/municipality has the highest barangay density? | cardona |
ef1ef44158bf1967bb2671216a01b4a9 | tablebench-tqa | {'columns': ['year', 'number of tropical storms', 'number of hurricanes', 'number of major hurricanes', 'deaths', 'strongest storm'], 'data': [['1860', '1', '5', '1', '60 +', 'one'], ['1861', '2', '6', '0', '22 +', 'one and three'], ['1862', '3', '3', '0', '3', 'two and three'], ['1863', '4', '5', '0', '90', 'one , two , three & four'], ['1864', '2', '3', '0', 'none', 'one , three & five'], ['1865', '4', '3', '0', '326', 'four & seven'], ['1866', '1', '5', '1', '383', 'six'], ['1867', '2', '6', '0', '811', "'san narciso'"], ['1868', '1', '3', '0', '2', 'one , two & four']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of tropical storms, the Hurricane Severity Index (HSI) is calculated as the sum of the number of hurricanes and major hurricanes, divided by the total number of tropical storms, indicating the severity of the storm season. What year had the highest Hurricane Severity Index? | 1860, 1866 |
bfd01fc5df36aeb446fb12aca8470a6b | tablebench-tqa | {'columns': ['School', 'Location', 'Outright Titles', 'Shared Titles', 'Runners-Up', 'Total Finals', 'Last Title', 'Last Final'], 'data': [['Methodist College Belfast', 'Belfast', '35', '2', '25', '62', '2014.0', '2014'], ['Royal Belfast Academical Institution', 'Belfast', '29', '4', '21', '54', '2007.0', '2013'], ['Campbell College', 'Belfast', '23', '4', '12', '39', '2011.0', '2011'], ['Coleraine Academical Institution', 'Coleraine', '9', '0', '24', '33', '1992.0', '1998'], ['The Royal School, Armagh', 'Armagh', '9', '0', '3', '12', '2004.0', '2004'], ['Portora Royal School', 'Enniskillen', '6', '1', '5', '12', '1942.0', '1942'], ['Bangor Grammar School', 'Bangor', '5', '0', '4', '9', '1988.0', '1995'], ['Ballymena Academy', 'Ballymena', '3', '0', '6', '9', '2010.0', '2010'], ['Rainey Endowed School', 'Magherafelt', '2', '1', '2', '5', '1982.0', '1982'], ['Foyle College', 'Londonderry', '2', '0', '4', '6', '1915.0', '1915'], ['Belfast Royal Academy', 'Belfast', '1', '3', '5', '9', '1997.0', '2010'], ['Regent House Grammar School', 'Newtownards', '1', '1', '2', '4', '1996.0', '2008'], ['Royal School Dungannon', 'Dungannon', '1', '0', '4', '5', '1907.0', '1975'], ['Annadale Grammar School (now Wellington College)', 'Belfast', '1', '0', '1', '2', '1958.0', '1978'], ['Ballyclare High School', 'Ballyclare', '1', '0', '1', '2', '1973.0', '2012'], ["Belfast Boys' Model School", 'Belfast', '1', '0', '0', '1', '1971.0', '1971'], ['Grosvenor High School', 'Belfast', '1', '0', '0', '1', '1983.0', '1983'], ['Wallace High School', 'Lisburn', '0', '0', '4', '4', None, '2007'], ['Derry Academy', 'Derry', '0', '0', '2', '2', None, '1896'], ['Dalriada School', 'Ballymoney', '0', '0', '1', '1', None, '1993'], ['Galway Grammar School', 'Galway', '0', '0', '1', '1', None, '1887'], ['Lurgan College', 'Lurgan', '0', '0', '1', '1', None, '1934'], ['Omagh Academy', 'Omagh', '0', '0', '1', '1', None, '1985'], ['Sullivan Upper School', 'Holywood', '0', '0', '1', '1', None, '2014']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of schools competing in a tournament, the Title Winning Percentage is calculated as the number of Outright Titles won divided by the Total Finals reached, multiplied by 100, indicating a school's success rate in winning titles. Which school has the highest Title Winning Percentage? | Belfast Boys' Model School, Grosvenor High School |
6bc66e615a997f940cbf90d8fd3c4936 | tablebench-tqa | {'columns': ['year', 'competition', 'location', 'event', 'final - rank', 'final - score', 'qualifying rank', 'qualifying score'], 'data': [['2008', '2008 summer olympics', 'beijing', 'team', '2', '186.525', '2', '246.8'], ['2008', '2008 summer olympics', 'beijing', 'uneven bars', 'dnq', 'n / a', '23', '14.8'], ['2008', 'olympic trials', 'philadelphia', 'all around', '4', '61.850', '4', '61.4'], ['2008', 'olympic trials', 'philadelphia', 'balance beam', '4', '15.550', '4', '15.8'], ['2008', 'olympic trials', 'philadelphia', 'floor exercise', '2', '15.500', '3', '15.65'], ['2008', 'olympic trials', 'philadelphia', 'uneven bars', '6', '15.200', '5', '15.3'], ['2008', 'olympic trials', 'philadelphia', 'vault', '4', '15.150', '3', '15.1'], ['2008', 'us championships', 'boston', 'all around', '4', '61.250', '4', '60.75'], ['2008', 'us championships', 'boston', 'balance beam', '5', '16.000', '5', '15.4'], ['2008', 'us championships', 'boston', 'floor exercise', '10', '14.750', '4', '15.2'], ['2008', 'us championships', 'boston', 'uneven bars', '6', '15.550', '6', '15.15']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In gymnastics, the Event Score Average is calculated as the average of the final score and qualifying score for a given event. What is the event with the highest Event Score Average in the 2008 Olympic Trials? | all around |
e336ac7f52f83faceebebcb4dc2d1cc6 | tablebench-tqa | {'columns': ['jurisdiction', 'for prohibition', 'percent for', 'against prohibition', 'percent against'], 'data': [['alberta and saskatchewan', '6238', '68.8', '2824', '31.2'], ['british columbia', '5731', '54.6', '4756', '45.4'], ['manitoba', '12419', '80.6', '2978', '19.4'], ['new brunswick', '26919', '72.2', '9575', '27.7'], ['nova scotia', '34368', '87.2', '5370', '12.8'], ['ontario', '154498', '57.3', '115284', '42.7'], ['prince edward island', '9461', '89.2', '1146', '10.8'], ['quebec', '28436', '18.8', '122760', '81.2']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Prohibition Support Rate is defined as the percentage of people in a jurisdiction who are in favor of prohibition. Based on this definition, which jurisdiction has the highest Prohibition Support Rate? | prince edward island |
decc298deb2a1a9e15c9b0ee355acc96 | tablebench-tqa | {'columns': ['season', 'series', 'races', 'poles', 'wins', 'points', 'final placing'], 'data': [['2003', 'formula renault monza winter series', '2', '0', '0', '18', '8th'], ['2004', 'formula renault monza', '16', '3', '5', '375', '1st'], ['2004', 'formula junior 1600 spain', '9', '6', '4', '119', '1st'], ['2004', 'formula renault 1600 belgium', '4', '0', '1', '65', '11th'], ['2005', 'austrian fomula three championship', '7', '6', '3', '75', '1st'], ['2005', 'british formula three', '5', '0', '0', '0', 'nc'], ['2005', 'formula renault 2.0 italia', '0', '0', '0', '0', 'nc'], ['2005', 'recaro formel 3 cup', '3', '1', '0', '0', 'nc'], ['2006', 'formula three euroseries', '19', '0', '0', '12', '15th'], ['2006', 'british formula three', '2', '0', '0', '0', 'nc'], ['2006', 'masters of formula three', '1', '0', '0', 'n / a', '13th'], ['2007', 'formula renault 3.5 series', '14', '0', '0', '0', 'nc'], ['2007', 'formula three euroseries', '2', '0', '0', '0', 'nc'], ['2008', 'gp2 asia series', '8', '0', '0', '0', '23rd'], ['2008', 'gp2 series', '13', '0', '0', '0', '30th'], ['2008 - 09', 'gp2 asia series', '11', '0', '0', '0', '33rd'], ['2009', 'gp2 series', '20', '0', '0', '0', '23rd'], ['2009', 'formula renault 3.5 series', '6', '0', '0', '7', '23rd'], ['2009 - 10', 'gp2 asia series', '8', '0', '0', '7', '13th'], ['2010', 'gp2 series', '20', '0', '0', '12', '16th'], ['2011', 'gp2 asia series', '4', '0', '0', '9', '8th'], ['2011', 'gp2 series', '18', '0', '0', '1', '21st']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of racing, Win Rate is calculated as the total number of wins divided by the total number of races, multiplied by 100, indicating a driver's ability to win races. In which series the dirver has the highest Win Rate? | formula junior 1600 spain |
8963b2bbf83a74ac3f2e64e267e36a64 | tablebench-tqa | {'columns': ['draw', 'language', 'artist', 'song', 'place', 'points'], 'data': [['1', 'icelandic', 'beathoven', 'þú og þeir (sókrates)', '16', '20'], ['2', 'swedish', 'tommy körberg', 'stad i ljus', '12', '52'], ['3', 'finnish', 'boulevard', 'nauravat silmät muistetaan', '20', '3'], ['4', 'english', 'scott fitzgerald', 'go', '2', '136'], ['5', 'turkish', 'mfö', 'sufi', '15', '37'], ['6', 'spanish', 'la década prodigiosa', 'la chica que yo quiero (made in spain)', '11', '58'], ['7', 'dutch', 'gerard joling', 'shangri - la', '9', '70'], ['8', 'hebrew', 'yardena arazi', 'ben adam (בן אדם)', '7', '85'], ['9', 'french', 'céline dion', 'ne partez pas sans moi', '1', '137'], ['10', 'english', 'jump the gun', 'take him home', '8', '79'], ['11', 'german', 'maxi & chris garden', 'lied für einen freund', '14', '48'], ['12', 'german', 'wilfried', 'lisa mona lisa', '21', '0'], ['13', 'danish', 'hot eyes', "ka' du se hva' jeg sa'", '3', '92'], ['14', 'greek', 'afroditi frida', 'clown (κλόουν)', '17', '10'], ['15', 'norwegian', 'karoline krüger', 'for vår jord', '5', '88'], ['16', 'french', 'reynaert', 'laissez briller le soleil', '18', '5'], ['17', 'french', 'lara fabian', 'croire', '4', '90'], ['18', 'italian', 'luca barbarossa', 'vivo (ti scrivo)', '12', '52'], ['19', 'french', 'gérard lenorman', 'chanteur de charme', '10', '64'], ['20', 'portuguese', 'dora', 'voltarei', '18', '5'], ['21', 'croatian', 'srebrna krila', 'mangup', '6', '87']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Eurovision Song Contest Points Average is defined as the average number of points received by a country's entry in the contest. What is the Eurovision Song Contest Points Average for countries whose language is not English? | 52.79 |
8cf0ed38375271dc4e7e1b2c750a206f | tablebench-tqa | {'columns': ['rank by average', 'place', 'couple', 'total points', 'number of dances', 'average'], 'data': [['1', '1', 'brooke & derek', '433', '16', '27.1'], ['2', '2', 'warren & kym', '397', '16', '24.8'], ['3', '3', 'lance & lacey', '392', '16', '24.5'], ['4', '5', 'maurice & cheryl', '252', '11', '22.9'], ['5', '4', 'cody & julianne', '292', '13', '22.5'], ['6', '8', 'toni b & alec', '134', '6', '22.3'], ['7', '6', 'susan & tony d', '192', '9', '21.3'], ['8', '10', 'misty & maksim', '63', '3', '21.0'], ['9', '12', 'ted & inna', '37', '2', '18.5'], ['10', '11', 'kim k & mark', '54', '3', '18.0'], ['11', '9', 'rocco & karina', '89', '5', '17.8'], ['12', '7', 'cloris & corky', '121', '7', '17.3']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of dance competitions, the "Dance Efficiency" metric is defined as the total points earned by a couple divided by the number of dances they performed. Based on this definition, which couple has the highest Dance Efficiency in this competition? | brooke & derek |
3b8eafab24cc0cc641819cebe50d9764 | tablebench-tqa | {'columns': ['Canal', 'Length (miles)', 'Locks', 'Max length (ft)', 'Width (ft)', 'Year opened', 'Year abandoned', 'Year restored'], 'data': [['Aberdeenshire Canal', '18.0', '18.0', None, None, '1805.0', '1854.0', None], ['Buchan Canal', None, None, None, None, None, None, None], ['Caledonian Canal', '62.0', '29.0', '150.0', '35.0', '1822.0', None, None], ['Crinan Canal', '9.0', '15.0', '86.75', '19.65', '1817.0', None, None], ['Dingwall Canal', '1.1', '0.0', None, None, '1816.0', '1840.0', None], ['Forth and Clyde Canal', '35.0', '38.0', '68.58', '19.75', '1790.0', '1963.0', '2002.0'], ['Glasgow, Paisley and Johnstone Canal', '11.0', '0.0', None, None, '1811.0', '1881.0', None], ['Monkland Canal', '12.25', '18.0', '71.0', '14.0', '1794.0', '1942.0', None], ['Stevenston Canal', '2.25', '0.0', None, '13.0', '1772.0', '1830.0', None], ['Union Canal', '31.5', '3.0', '63.0', '12.5', '1822.0', '1930.0', '2000.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Canal Lock Density is calculated as the total number of locks divided by the length of the canal in miles. Based on this definition, which canal has the highest lock density? | Crinan Canal |
f8d592d15f1611f0aa015d7ee3d75a23 | tablebench-tqa | {'columns': ['country', 'year', 'total', 'hydroelectricity', 'wind power', 'biomass and waste', 'solar'], 'data': [['china', '2011', '797.4', '687.1', '73.2', '34', '3.0'], ['european union', '2010', '699.3', '397.7', '149.1', '123.3', '23.1'], ['united states', '2011', '520.1', '325.1', '119.7', '56.7', '1.81'], ['brazil', '2011', '459.2', '424.3', '2.71', '32.2', '0.0002'], ['canada', '2011', '399.1', '372.6', '19.7', '6.4', '0.43'], ['russia', '2010', '166.6', '163.3', '0.004', '2.8', '0.0'], ['india', '2011', '162.0', '131.0', '26.0', '4', '1.0'], ['germany', '2012', '136.1', '21.2', '45.3', '40.9', '28.0'], ['norway', '2011', '121.4', '119.6', '1.29', '0.48', '0.02'], ['japan', '2011', '116.4', '82.5', '4.35', '23.1', '3.8'], ['italy', '2012', '89.759', '43.256', '13.333', '9.281 (2010)', '18.637']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Wind Energy Share is calculated as the wind powe divided by the total energy production. Based on this definition, which country has the highest Renewable Energy Share in 2011? | united states |
22ca06f97417eaae94a58549e8bfd1d4 | tablebench-tqa | {'columns': ['driver', 'points', 'races', 'wins', 'second', 'third'], 'data': [['gunther gooverts', '182', '27', '2', '-', '3'], ['gunther gooverts', '135', '18', '1', '2', '1'], ['gunther gooverts', '27', '8', '-', '-', '1'], ['gunther gooverts', '155', '16', '-', '3', '2'], ['gert devoldere', '3', '2', '-', '-', '-'], ['daniël willemsen', '40', '2', '2', '-', '-'], ['martin gölz', '90', '20', '-', '-', '-'], ['gerton kops', '17', '2', '-', '-', '-'], ['peter steegmans', '16', '2', '-', '-', '-'], ['daniël willemsen', '320', '22', '5', '4', '7'], ['daniël willemsen', '377', '22', '8', '5', '3'], ['are kaurit', '268', '16', '-', '3', '2'], ['daniël willemsen', '88', '4', '-', '4', '-'], ['kristers serģis', '501', '26', '12', '7', '1'], ['kristers serģis', '246', '12', '6', '1', '2'], ['frank hofman', '22', '2', '-', '-', '-'], ['daniël willemsen', '478', '22', '15', '4', '-'], ['daniël willemsen', '341', '16', '13', '-', '-'], ['nicky pulinx', '22', '4', '-', '-', '-'], ['jarno van den boomen', '8', '2', '-', '-', '-'], ['gerrit van werven', '6', '2', '-', '-', '-'], ['daniël willemsen', '341', '17', '11', '-', '-'], ['peter steegmans', '212', '20', '-', '1', '1'], ['daniël willemsen', '437', '21', '14', '3', '-'], ['ben adriaenssen', '385', '22', '-', '-', '6'], ['overall 1993 - 2012', '4717', '327', '89', '37', '29']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of racing, a "podium finish" is defined as a driver finishing in the top three positions (first, second, or third) in a race. Based on the provided data, which driver has achieved the most podium finishes in their career? | daniël willemsen |
b23a9876b3db50bf256522a0342f666d | tablebench-tqa | {'columns': ['round', 'pick', 'overall', 'name', 'position', 'college'], 'data': [['1', '10', '10', 'forest evashevski', 'rb', 'michigan'], ['3', '10', '25', 'fred davis', 'ot', 'alabama'], ['5', '10', '40', 'jim stuart', 'ot', 'oregon'], ['6', '10', '50', 'ed cifers', 'e', 'tennessee'], ['7', '10', '60', 'al krueger', 'e', 'southern california'], ['8', '10', '70', 'henry wilder', 'rb', 'iowa state'], ['9', '10', '80', 'bill grimmett', 'e', 'tulsa'], ['10', '10', '90', 'ed hickerson', 'g', 'alabama'], ['11', '10', '100', 'joe aguirre', 'e', "st mary 's (cal)"], ['12', '10', '110', 'jack banta', 'hb', 'southern california'], ['13', '10', '120', 'roy conn', 'ot', 'arizona'], ['14', '10', '130', 'deward tornell', 'rb', 'san josé state'], ['15', '10', '140', 'morris buckingham', 'c', 'san josé state'], ['16', '10', '150', 'ken dow', 'fb', 'oregon state'], ['17', '10', '160', 'stan mcrae', 'e', 'michigan state'], ['18', '10', '170', 'joe osmanski', 'fb', 'holy cross'], ['19', '10', '180', 'earl fullilove', 'ot', 'georgetown'], ['20', '10', '190', 'ed hiestand', 'e', 'vanderbilt'], ['21', '5', '195', 'tom riggs', 'ot', 'illinois'], ['22', '5', '200', 'lee gentry', 'hb', 'tulsa']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of the NFL draft, the "pick efficiency" of a college is calculated as the total number of players drafted from that college divided by the total number of players drafted in the round. Based on this definition, which college has the highest pick efficiency in the first 10 rounds of the draft? | alabama |
13268aef491b17ad2d89c67d8bfa336d | tablebench-tqa | {'columns': ['locomotive', 'type', 'builder', "builder 's no", 'built', 'entered service', 'withdrawn'], 'data': [['2', '0 - 6 - 0st', 'beyer peacock & co', '2575', '1884', '1884', '1938'], ['3', '0 - 6 - 0st', 'beyer peacock & co', '4558', '1903', '1903', '1920'], ['62xx', '0 - 6 - 0', 'robert stephenson and company', '2195', '1874', '1903', '1927'], ['2020', '2 - 6 - 4t', 'beyer peacock & co', '3206', '1891', '1834', '1955'], ['2017', '2 - 6 - 4t', 'beyer peacock & co', '3289', '1891', '1939', '1956'], ['1', '2 - 6 - 2t', 'robert stephenson and hawthorns', 'e7841', '1955', '1955', '1967'], ['j & a brown 26', '2 - 6 - 4t', 'beyer peacock & co', '2567', '1885', '1967', '1967'], ['3013', '4 - 6 - 4t', 'beyer peacock & co', '4456', '1903', '1967', '1976']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Locomotive Service Life is defined as the duration between the 'entered service' and 'withdrawn' dates for a locomotive. Based on this definition, what was the longest Locomotive Service Life of the locomotive? | 121 |
5876f5eaa7677055acaf8f89e1215cd8 | tablebench-tqa | {'columns': ['country', 'orphans as % of all children', 'aids orphans as % of orphans', 'total orphans (total)', 'total orphans (aids related)', 'maternal (total)', 'maternal (aids related)', 'paternal (total)', 'paternal (aids related)', 'double (total)', 'double (aids related)'], 'data': [['botswana (1990)', '5.9', '3.0', '34000', '1000', '14000', '< 100', '23000', '1000', '2000', '< 100'], ['botswana (1995)', '8.3', '33.7', '52000', '18000', '19000', '7000', '37000', '13000', '5000', '3000'], ['botswana (2001)', '15.1', '70.5', '98000', '69000', '69000', '58000', '91000', '69000', '62000', '61000'], ['lesotho (1990)', '10.6', '2.9', '73000', '< 100', '31000', '< 100', '49000', '< 100', '8000', '< 100'], ['lesotho (1995)', '10.3', '5.5', '77000', '4000', '31000', '1000', '52000', '4000', '7000', '1000'], ['lesotho (2001)', '17.0', '53.5', '137000', '73000', '66000', '38000', '108000', '63000', '37000', '32000'], ['malawi (1990)', '11.8', '5.7', '524000', '30000', '233000', '11000', '346000', '23000', '55000', '6000'], ['malawi (1995)', '14.2', '24.6', '664000', '163000', '305000', '78000', '442000', '115000', '83000', '41000'], ['malawi (2001)', '17.5', '49.9', '937000', '468000', '506000', '282000', '624000', '315000', '194000', '159000'], ['uganda (1990)', '12.2', '17.4', '1015000', '177000', '437000', '72000', '700000', '138000', '122000', '44000'], ['uganda (1995)', '14.9', '42.4', '1456000', '617000', '720000', '341000', '1019000', '450000', '282000', '211000'], ['uganda (2001)', '14.6', '51.1', '1731000', '884000', '902000', '517000', '1144000', '581000', '315000', '257000']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of orphan demographics, "AIDS-related orphans" refers to the number of orphans who have lost one or both parents due to AIDS. Based on the provided data, which year has most of AIDS-related orphans among all orphans? | 2001 |
0fcf648a69eb1c7ae276d17e9f65e1e3 | tablebench-tqa | {'columns': ['country', 'un budget', 'international trade (millions of usd) 2011', 'gdp (nominal) (millions of usd) 2011', 'gdp (ppp) (millions of usd) 2011', 'population'], 'data': [['italy', '4.999%', '1050100', '2198730', '1846950', '60849247'], ['canada', '3.207%', '910200', '1736869', '1396131', '34953100'], ['spain', '3.177%', '715200', '1493513', '1413468', '46163116'], ['mexico', '2.356%', '678200', '1154784', '1661640', '112336538'], ['south korea', '2.260%', '1084000', '1116247', '1554149', '50004441'], ['turkey', '0.617%', '373800', '778089', '1073565', '74724269'], ['argentina', '0.287%', '136300', '447644', '716419', '40117096'], ['indonesia', '0.238%', '335100', '845680', '1124649', '237641326'], ['colombia', '0.144%', '92760', '327626', '471890', '46748000'], ['pakistan', '0.082%', '58000', '210566', '488580', '180991000'], ['costa rica', '0.034%', '24460', '40947', '55020', '4301712'], ['malta', '0.017%', '9200', '8896', '10757', '417617'], ['san marino', '0.003%', '6201', '2048', '1136', '32404']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | GDP per capita is calculated as the nominal GDP divided by the population. Which country has the highest GDP per capita? | san marino |
6b1d72a62b98d5e4cc0ab30df170fe0d | tablebench-tqa | {'columns': ['rank', 'airline / holding', 'passenger fleet', 'current destinations', 'alliance / association'], 'data': [['1', 'lufthansa group', '627', '283', 'star alliance'], ['2', 'ryanair', '305', '176', 'elfaa'], ['3', 'air france - klm', '621', '246', 'skyteam'], ['4', 'international airlines group', '435', '207', 'oneworld'], ['5', 'easyjet', '194', '126', 'elfaa'], ['6', 'turkish airlines', '222', '245', 'star alliance'], ['7', 'air berlin group', '153', '145', 'oneworld'], ['8', 'aeroflot group', '239', '189', 'skyteam'], ['9', 'sas group', '173', '157', 'star alliance'], ['10', 'alitalia', '143', '101', 'skyteam'], ['11', 'norwegian air shuttle asa', '79', '120', 'elfaa'], ['12', 'pegasus airlines', '42', '70', 'n / a'], ['13', 'wizz air', '45', '83', 'elfaa'], ['14', 'transaero', '93', '113', 'n / a'], ['15', 'tap portugal', '71', '80', 'star alliance'], ['16', 'aer lingus', '46', '75', 'n / a'], ['17', 'finnair', '44', '65', 'oneworld'], ['18', 's7', '52', '90', 'oneworld'], ['19', 'air europa', '40', '54', 'skyteam'], ['20', 'utair aviation', '108', '117', 'n / a'], ['21', 'sunexpress', '23', '48', 'n / a'], ['22', 'flybe', '68', '56', 'elfaa'], ['23', 'brussels airlines', '45', '67', 'star alliance'], ['24', 'aegean airlines', '29', '40', 'star alliance'], ['25', 'monarch airlines', '39', '30', 'n / a'], ['26', 'virgin atlantic', '41', '37', 'n / a'], ['27', 'atlasjet', '15', '15', 'n / a'], ['28', 'lot polish airlines', '40', '54', 'star alliance'], ['29', 'jet2.com', '49', '59', 'elfaa'], ['30', 'meridiana fly', '18', '40', 'n / a'], ['31', 'ural airlines', '29', '66', 'n / a'], ['32', 'czech airlines', '25', '49', 'skyteam'], ['33', 'airbaltic', '28', '60', 'n / a'], ['34', 'onur air', '29', '21', 'n / a'], ['35', 'ukraine international airlines', '40', '54', 'n / a'], ['36', 'olympic air', '16', '37', 'n / a'], ['37', 'tarom', '23', '48', 'skyteam'], ['38', 'icelandair', '27', '36', 'n / a'], ['39', 'croatia airlines', '13', '40', 'star alliance'], ['40', 'air serbia', '13', '34', 'n / a'], ['41', 'belavia', '23', '40', 'n / a'], ['42', 'cyprus airways', '9', '18', 'n / a'], ['43', 'bulgaria air', '11', '22', 'n / a'], ['44', 'adria airways', '12', '37', 'star alliance']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Fleet Utilization Rate is defined as the number of current destinations served by an airline divided by its passenger fleet size. According to this definition of Fleet Utilization Rate, which airline has the highest fleet utilization rate? | adria airways |
223b47a687dda4049cbd996cc8e111be | tablebench-tqa | {'columns': ['rank', 'airport', 'city', 'code (iata / icao)', '2008', '2009', '2010'], 'data': [['1', 'henri coandă international airport', 'bucharest', 'otp / lrop', '5063555', '4480765', '4802510'], ['2', 'traian vuia international airport', 'timișoara', 'tsr / lrtr', '886083', '991737', '1136064'], ['3', 'cluj - napoca international airport', 'cluj - napoca', 'clj / lrcl', '752181', '834400', '1028907'], ['4', 'aurel vlaicu international airport', 'bucharest', 'bbu / lrob', '1724633', '1974337', '1881509'], ['5', 'george enescu international airport', 'bacău', 'bcm / lrbc', '116492', '195772', '240735'], ['6', 'trgu mureș transilvania airport', 'trgu mureș', 'tgm / lrtm', '69945', '84062', '74353'], ['7', 'sibiu international airport', 'sibiu', 'sbz / lrsb', '141032', '148527', '198753'], ['8', 'iași international airport', 'iași', 'ias / lria', '144043', '148538', '159615'], ['9', 'mihail kogălniceanu international airport', 'constanța', 'cnd / lrck', '60477', '68690', '74587'], ['10', 'oradea airport', 'oradea', 'omr / lrod', '38843', '41692', '36477'], ['11', 'craiova international airport', 'craiova', 'cra / lrcv', '12988', '15130', '23629'], ['12', 'suceava ștefan cel mare airport', 'suceava', 'scv / lrsv', '23398', '32561', '34437'], ['13', 'satu mare international airport', 'satu mare', 'suj / lrsm', '7298', '11101', '18859'], ['14', 'baia mare airport', 'baia mare', 'bay / lrbm', '22307', '23818', '19020'], ['15', 'arad international airport', 'arad', 'arw / lrar', '78047', '44743', '8359'], ['16', 'tulcea danube delta airport', 'tulcea', 'tce / lrtc', '788', '854', '427']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Airport Traffic Growth Rate is defined as the percentage change in the number of passengers handled by an airport from one year to another. Based on this definition, which airport has the largest Airport Traffic Growth Rate from 2008 to 2009? | george enescu international airport |
86f27f6eb9945a8e587457aca56b0309 | tablebench-tqa | {'columns': ['Club', 'Season', 'League', 'League', 'League', 'FA Cup', 'FA Cup', 'League Cup', 'League Cup', 'Other', 'Other', 'Total', 'Total'], 'data': [['Club', 'Season', 'Division', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals', 'Apps', 'Goals'], ['Stoke City', '1998–99', 'Second Division', '4', '0', '0', '0', '0', '0', '1', '0', '5', '0'], ['Stoke City', '1999–2000', 'Second Division', '42', '5', '1', '0', '3', '0', '9', '3', '55', '8'], ['Stoke City', '2000–01', 'Second Division', '44', '8', '1', '0', '5', '2', '4', '0', '54', '10'], ['Stoke City', '2001–02', 'Second Division', '43', '2', '4', '0', '0', '0', '3', '1', '50', '3'], ['Stoke City', '2002–03', 'First Division', '43', '0', '3', '0', '1', '0', '0', '0', '47', '0'], ['Stoke City', 'Total', 'Total', '176', '16', '9', '0', '9', '2', '17', '4', '211', '22'], ['West Bromwich Albion', '2003–04', 'First Division', '30', '0', '1', '0', '5', '0', '0', '0', '36', '0'], ['West Bromwich Albion', '2004–05', 'Premier League', '0', '0', '1', '0', '1', '0', '0', '0', '2', '0'], ['West Bromwich Albion', 'Total', 'Total', '30', '0', '2', '0', '6', '0', '0', '0', '38', '0'], ['Burnley', '2004–05', 'Championship', '21', '2', '1', '0', '1', '0', '0', '0', '23', '2'], ['Burnley', '2005–06', 'Championship', '45', '3', '1', '0', '3', '0', '0', '0', '49', '3'], ['Burnley', '2006–07', 'Championship', '42', '3', '1', '0', '1', '0', '0', '0', '44', '3'], ['Burnley', '2007–08', 'Championship', '29', '3', '1', '0', '3', '0', '0', '0', '33', '3'], ['Burnley', 'Total', 'Total', '137', '11', '4', '0', '8', '0', '0', '0', '149', '11'], ['Sheffield Wednesday', '2008–09', 'Championship', '41', '0', '1', '0', '1', '0', '0', '0', '43', '0'], ['Sheffield Wednesday', '2009–10', 'Championship', '44', '3', '1', '0', '1', '0', '0', '0', '46', '3'], ['Sheffield Wednesday', '2010–11', 'League One', '36', '2', '4', '0', '2', '0', '3', '2', '45', '4'], ['Sheffield Wednesday', '2011–12', 'League One', '18', '1', '1', '0', '2', '0', '1', '0', '22', '1'], ['Sheffield Wednesday', 'Total', 'Total', '139', '6', '7', '0', '6', '0', '4', '2', '156', '8'], ['Career Total', 'Career Total', 'Career Total', '482', '33', '22', '0', '29', '2', '21', '6', '554', '41']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Goal-to-Game Ratio is defined as a player's total goals scored divided by the total number of games played. According to this definition of Goal-to-Game Ratio, which club has the highest goal-to-game ratio in their career? | Stoke City |
195f4751f33beb034c12cad860c293c0 | tablebench-tqa | {'columns': ['driver', 'car', 'make', 'points', 'laps', 'winnings'], 'data': [['kasey kahne', '9', 'dodge', '185', '334', '530164'], ['matt kenseth', '17', 'ford', '175', '334', '362491'], ['tony stewart', '20', 'chevrolet', '175', '334', '286386'], ['denny hamlin', '11', 'chevrolet', '165', '334', '208500'], ['kevin harvick', '29', 'chevrolet', '160', '334', '204511'], ['jeff burton', '31', 'chevrolet', '150', '334', '172220'], ['scott riggs', '10', 'dodge', '146', '334', '133850'], ['martin truex jr', '1', 'chevrolet', '147', '334', '156608'], ['mark martin', '6', 'ford', '143', '334', '151850'], ['bobby labonte', '43', 'dodge', '134', '334', '164211'], ['jimmie johnson', '48', 'chevrolet', '130', '334', '165161'], ['dale earnhardt jr', '8', 'chevrolet', '127', '334', '154816'], ['reed sorenson', '41', 'dodge', '124', '334', '126675'], ['casey mears', '42', 'dodge', '121', '334', '150233'], ['kyle busch', '5', 'chevrolet', '118', '334', '129725'], ['ken schrader', '21', 'ford', '115', '334', '140089'], ['dale jarrett', '88', 'ford', '112', '334', '143350'], ['jeff green', '66', 'chevrolet', '114', '334', '133833'], ['clint bowyer', '7', 'chevrolet', '106', '333', '116075'], ['robby gordon', '7', 'chevrolet', '103', '333', '109275'], ['david stremme', '40', 'dodge', '100', '333', '127033'], ['jeff gordon', '24', 'chevrolet', '97', '332', '148411'], ['joe nemechek', '1', 'chevrolet', '94', '332', '129070'], ['tony raines', '96', 'chevrolet', '91', '332', '97075'], ['terry labonte', '44', 'chevrolet', '88', '332', '95975'], ['michael waltrip', '55', 'dodge', '85', '331', '108833'], ['travis kvapil', '32', 'chevrolet', '82', '331', '105122'], ['scott wimmer', '4', 'chevrolet', '79', '330', '94075'], ['dave blaney', '22', 'dodge', '76', '330', '92475'], ['sterling marlin', '14', 'chevrolet', '73', '329', '89325'], ['jeremy mayfield', '19', 'dodge', '70', '328', '116891'], ['kevin lepage', '61', 'ford', '67', '328', '85800'], ['elliott sadler', '38', 'ford', '69', '286', '113558'], ['kurt busch', '2', 'dodge', '61', '286', '124633'], ['jj yeley', '18', 'chevrolet', '63', '270', '118075'], ['carl edwards', '99', 'ford', '60', '256', '101175'], ['jamie mcmurray', '26', 'ford', '52', '254', '127100'], ['mike garvey', '151', 'chevrolet', '49', '251', '79125'], ['kyle petty', '45', 'dodge', '46', '248', '87000'], ['ryan newman', '12', 'dodge', '43', '200', '124283'], ['derrike cope', '74', 'dodge', 'pe', '169', '78760'], ['greg biffle', '16', 'ford', '42', '81', '98860'], ['brian vickers', '25', 'chevrolet', '34', '24', '86847']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of NASCAR racing, "Points Per Lap" is defined as the total points earned by a driver divided by the total number of laps completed. Which driver has the highest Points Per Lap in this dataset? | brian vickers |
e5309753c35c2748bbaaab0ab2655983 | tablebench-tqa | {'columns': ['place', 'code', 'area (km 2 )', 'population', 'most spoken language'], 'data': [['addo elephant national park', '20602', '1.08', '90', 'xhosa'], ['addo', '20601', '3.21', '1752', 'afrikaans'], ['barsheba', '20603', '0.61', '517', 'xhosa'], ['bontrug', '20604', '2.33', '6806', 'xhosa'], ['enon', '20605', '0.4', '782', 'afrikaans'], ['kirkwood', '20606', '3.07', '2749', 'afrikaans'], ['kwazenzele', '20607', '3.62', '3733', 'xhosa'], ['nomathamsanqa', '20608', '1.53', '9266', 'xhosa'], ['paterson', '20609', '0.22', '671', 'afrikaans'], ['remainder of the municipality', '20610', '3491.83', '15218', 'xhosa']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Population Density is calculated as the total population of a place divided by its area in square kilometers. Based on this definition, which place in the table has the lowest population density? | remainder of the municipality |
5493c5c3be6eea36c6ff32cce6255f8c | tablebench-tqa | {'columns': ['aircraft', 'introduced', 'retired', 'seating', 'notes'], 'data': [['airbus a319 - 100', '2004', '-', '156', 'in service'], ['airbus a320 - 200', '2008', '-', '180', 'in service'], ['airbus a321 - 200', '2008', '2010', '220', 'inherited from gb airways'], ['boeing 737 - 204', '1995', '1996', '115', 'replaced by 737 - 300s'], ['boeing 737 - 300', '1996', '2007', '148 / 9', 'replaced by a319s'], ['boeing 737 - 700', '2000', '2011', '149', 'replaced by a319s and a320s']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Aircraft Fleet Capacity Change is defined as the variation in the total seating capacity of an airline's fleet over a specified period. Based on this definition, how did the total seating capacity of the airline's fleet change from 2004 to 2008? | 244 |
955db57fe1895a7e2d1e08c2105c8dc3 | tablebench-tqa | {'columns': ['township', 'county', 'pop (2010)', 'land ( sqmi )', 'water (sqmi)', 'latitude', 'longitude', 'geo id', 'ansi code'], 'data': [['oak creek', 'bottineau', '24', '35.445', '0.0', '48.675399', '- 100.471642', '3800958700', '1759286'], ['oak valley', 'bottineau', '52', '36.016', '0.087', '48.777318', '- 100.511814', '3800958860', '1759287'], ['oakhill', 'barnes', '51', '35.414', '0.081', '46.679076', '- 98.017963', '3800358780', '1036402'], ['oakland', 'mountrail', '26', '35.167', '0.785', '48.157497', '- 102.109269', '3806158820', '1036997'], ['oakville', 'grand forks', '200', '35.059', '0.047', '47.883391', '- 97.305536', '3803558900', '1036604'], ['oakwood', 'walsh', '228', '33.526', '0.0', '48.412107', '- 97.339101', '3809958980', '1036534'], ['oberon', 'benson', '67', '57.388', '0.522', '47.925443', '- 99.244476', '3800559060', '2397849'], ['odessa', 'hettinger', '16', '35.766', '0.06', '46.583226', '- 102.104455', '3804159100', '1759459'], ['odessa', 'ramsey', '49', '37.897', '8.314', '47.968754', '- 98.587529', '3807159140', '1759587'], ['odin', 'mchenry', '46', '34.424', '1.722', '47.986751', '- 100.637016', '3804959180', '1759507'], ['oliver', 'williams', '8', '35.987', '0.024', '48.423293', '- 103.320183', '3810559260', '1037033'], ['olivia', 'mchenry', '40', '35.874', '0.035', '47.900358', '- 100.769959', '3804959300', '1759508'], ['olson', 'towner', '19', '35.033', '0.954', '48.505811', '- 99.287008', '3809559380', '1759659'], ['ontario', 'ramsey', '72', '33.923', '1.99', '48.163172', '- 98.601321', '3807159460', '1759588'], ['ops', 'walsh', '63', '36.015', '0.0', '48.238231', '- 97.578927', '3809959540', '1036518'], ['ora', 'nelson', '69', '34.414', '0.697', '47.722982', '- 97.946877', '3806359580', '1036557'], ['orange', 'adams', '22', '35.802', '0.133', '46.012558', '- 102.053893', '3800159620', '1037214'], ['oriska', 'barnes', '65', '35.082', '0.087', '46.935397', '- 97.752733', '3800359700', '1036418'], ['orlien', 'ward', '47', '35.645', '0.72', '47.985154', '- 101.796936', '3810159740', '1036954'], ['orthell', 'williams', '12', '35.894', '0.034', '48.495353', '- 103.728983', '3810559860', '1759732'], ['osago', 'nelson', '31', '35.4', '0.198', '47.800898', '- 98.328474', '3806359900', '1036565'], ['osborn', 'mountrail', '285', '30.296', '4.988', '47.987208', '- 102.429987', '3806159940', '1034001'], ['osford', 'cavalier', '47', '35.803', '0.052', '48.585234', '- 98.115821', '3801959980', '1759377'], ['oshkosh', 'wells', '56', '34.747', '0.065', '47.623026', '- 99.576942', '3810360020', '1759708'], ['osloe', 'mountrail', '41', '35.077', '0.903', '48.146259', '- 101.976499', '3806160060', '1036937'], ['osnabrock', 'cavalier', '36', '35.505', '0.439', '48.594234', '- 98.241946', '3801960140', '2397851'], ['ostby', 'bottineau', '45', '35.452', '0.027', '48.581052', '- 100.352948', '3800960180', '1759288'], ['otis', 'mclean', '41', '35.152', '0.656', '47.799001', '- 100.896513', '3805560260', '1759541'], ['overland', 'ramsey', '14', '35.602', '0.4', '48.406215', '- 98.644574', '3807160340', '1759589'], ['ovid', 'lamoure', '46', '35.328', '0.505', '46.318992', '- 98.107769', '3804560420', '1036886'], ['owego', 'ransom', '21', '36.034', '0.029', '46.50933', '- 97.319286', '3807360460', '1036866']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Population Density is calculated as the population of a township divided by its land area in square miles. Which township has the highest population density? | osborn |
c56b85419c6abec8753dcc96be88024f | tablebench-tqa | {'columns': ['ensemble', 'gold medals', 'silver medals', 'bronze medals', 'total medals'], 'data': [['amador valley hs', '0', '1', '0', '1'], ['ayala high school', '4', '2', '1', '7'], ['baldwinsville hs', '2', '0', '0', '2'], ['claremont hs', '1', '1', '0', '2'], ['downers grove hs', '0', '0', '1', '1'], ['father ryan hs', '0', '1', '0', '1'], ['fort mill hs', '2', '1', '2', '5'], ['franklin central hs', '6', '0', '0', '6'], ['gateway high school', '2', '1', '1', '4'], ['goshen hs', '0', '2', '1', '3'], ['harrison central paragon hs', '0', '0', '1', '1'], ['james logan high school', '1', '1', '0', '2'], ['john overton hs', '0', '1', '2', '3'], ['king philip high school', '0', '1', '0', '1'], ['mansfield hs', '0', '1', '0', '1'], ['mission viejo high school', '0', '1', '0', '1'], ['muscle shoals hs', '1', '1', '2', '4'], ['new philadelphia hs', '0', '1', '0', '1'], ['northglenn hs', '0', '0', '1', '1'], ['rangeview hs', '0', '1', '0', '1'], ['roland hayes school', '0', '0', '1', '1'], ['tarpon springs hs', '0', '1', '0', '1'], ['tunstall hs', '0', '3', '4', '7'], ['warsaw community hs', '0', '0', '1', '1'], ['woodbridge hs', '1', '0', '0', '1']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Medal Ratio is calculated as the number of gold medals divided by the total number of medals. Based on this definition, which high school has the highest medal ratio? | baldwinsville hs, franklin central hs, woodbridge hs |
07ff6fa731c9061bf28789d3352ccd5c | tablebench-tqa | {'columns': ['producer', 'product', 'samples taken', 'samples failed', 'melamine content (mg / kg)'], 'data': [['shijiazhuang sanlu group', '三鹿牌嬰幼兒配方乳粉', '11', '11', '2563.0'], ['shanghai panda dairy', '熊貓可寶牌嬰幼兒配方乳粉', '5', '3', '619.0'], ['qingdao shengyuan dairy', '聖元牌嬰幼兒配方乳粉', '17', '8', '150.0'], ['shanxi gu cheng dairy', '古城牌嬰幼兒配方乳粉', '13', '4', '141.6'], ['jiangxi guangming yingxiong dairy', '英雄牌嬰幼兒配方乳粉', '2', '2', '98.6'], ['baoji huimin dairy', '惠民牌嬰幼兒配方乳粉', '1', '1', '79.17'], ['inner mongolia mengniu dairy', '蒙牛牌嬰幼兒配方乳粉', '28', '3', '68.2'], ['torador dairy industry (tianjin)', '可淇牌嬰幼兒配方乳粉', '1', '1', '67.94'], ['guangdong yashili group', '雅士利牌嬰幼兒配方乳粉', '30', '8', '53.4'], ['hunan peiyi dairy', '南山倍益牌嬰幼兒配方乳粉', '3', '1', '53.4'], ['heilongjiang qilin dairy', '嬰幼兒配方乳粉2段基粉', '1', '1', '31.74'], ['shanxi yashili dairy', '雅士利牌嬰幼兒配方乳粉', '4', '2', '26.3'], ['shenzhen jinbishi milk', '金必氏牌嬰幼兒配方乳粉', '2', '2', '18.0'], ['scient (guangzhou) infant nutrition', '施恩牌嬰幼兒配方乳粉', '20', '14', '17.0'], ['guangzhou jinding dairy products factory', '金鼎牌嬰幼兒配方乳粉', '3', '1', '16.2'], ['inner mongolia yili industrial group', '伊利牌兒童配方乳粉', '35', '1', '12.0'], ['yantai ausmeadow nutriment', '澳美多牌嬰幼兒配方乳粉', '16', '6', '10.7'], ['qingdao suncare nutritional technology', '愛可丁牌嬰幼兒配方乳粉', '3', '1', '4.8'], ["xi'an baiyue dairy", '御寶牌嬰幼兒配方乳粉', '3', '1', '3.73'], ['yantai leilei dairy', '磊磊牌嬰幼兒配方乳粉', '3', '3', '1.2'], ['shanghai baoanli dairy', '寶安力牌嬰幼兒配方乳粉', '1', '1', '0.21'], ['fuding chenguan dairy', '聰爾壯牌嬰幼兒配方乳粉', '1', '1', '0.09']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the dairy industry, the Failure Rate is defined as the number of samples failed divided by the total number of samples taken. Based on this definition, which dairy producer has the lowest Failure Rate? | inner mongolia yili industrial group |
8c3668697e8601047edef065555855fc | tablebench-tqa | {'columns': ['Party', 'First Duma', 'Second Duma', 'Third Duma', 'Fourth Duma'], 'data': [['Russian Social Democratic Party', '18 (Mensheviks)', '47 (Mensheviks)', '19 (Bolsheviks)', '15 (Bolsheviks)'], ['Socialist-Revolutionary Party', '–', '37', '–', '–'], ['Labour group', '136', '104', '13', '10'], ['Progressist Party', '27', '28', '28', '41'], ['Constitutional Democratic Party (Kadets)', '179', '92', '52', '57'], ['Non-Russian National Groups', '121', '–', '26', '21'], ['Centre Party', '–', '–', '–', '33'], ['Octobrist Party', '17', '42', '154', '95'], ['Nationalists', '60', '93', '26', '22'], ['Rightists', '8', '10', '147', '154'], ['TOTAL', '566', '453', '465', '448']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Duma Seat Share Change is defined as the variation in the percentage of seats held by each political party in the Russian Duma from one legislative period to another. Based on this definition, what is the Duma Seat Share Change of the Constitutional Democratic Party (Kadets) from the First Duma to the Second Duma? | -87 |
d277ebc4a7a4c1aec7fd73a98ae56d13 | tablebench-tqa | {'columns': ['episode', 'date', 'official itv rating (millions)', 'weekly rank', 'share (%)', 'official itv hd rating (millions)', 'total itv viewers (millions)'], 'data': [['auditions 1', '13 april', '9.58', '1', '36.9', '1.15', '10.73'], ['auditions 2', '20 april', '9.72', '1', '43.9', '1.43', '11.15'], ['auditions 3', '27 april', '9.17', '1', '43.9', '1.31', '10.48'], ['auditions 4', '4 may', '9.6', '1', '45.0', '1.31', '10.91'], ['auditions 5', '11 may', '10.24', '1', '45.2', '1.71', '11.95'], ['auditions 6', '18 may', '9.11', '1', '38.1', '1.25', '10.36'], ['auditions 7', '26 may', '8.09', '3', '38.0', '1.13', '9.22'], ['semi - final 1', '27 may', '9.52', '1', '41.5', '1.46', '10.98'], ['semi - final 1 results', '27 may', '7.6', '10', '31.4', '1.14', '8.74'], ['semi - final 2', '28 may', '8.54', '6', '36.5', '1.21', '9.75'], ['semi - final 2 results', '28 may', '7.13', '14', '28.5', 'n / a', '7.13'], ['semi - final 3', '30 may', '8.17', '8', '37.5', '1.27', '9.44'], ['semi - final 3 results', '30 may', '7.18', '13', '32.3', 'n / a', '7.18'], ['semi - final 4', '31 may', '8.28', '7', '37.5', '1.12', '9.4'], ['semi - final 4 results', '31 may', '7.29', '12', '32.7', 'n / a', '7.29'], ['semi - final 5', '1 june', '8.02', '9', '41.9', '1.20', '9.22'], ['semi - final 5 results', '1 june', '7.46', '11', '32.8', '1.07', '8.53'], ['live final', '8 june', '10.43', '1', '48.9', '1.80', '12.23']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of TV ratings, the "audience share" is defined as the percentage of viewers watching a particular channel out of the total number of viewers watching TV at a given time. Based on this definition, which episode of the show had the highest audience share? | live final |
39987999e1badc7cd1a6f52f52b106cc | tablebench-tqa | {'columns': ['rank', 'centre', 'country', 'rating', 'change'], 'data': [['41', 'isle of man ( cd )', 'isle of man ( cd )', '638', '7'], ['42', 'abu dhabi', 'united arab emirates', '637', '12'], ['43', 'wellington', 'new zealand', '636', '10'], ['44', 'istanbul', 'turkey', '633', '7'], ['45', 'amsterdam', 'netherlands', '629', '26'], ['46', 'buenos aires', 'argentina', '628', '5'], ['47', 'riyadh', 'saudi arabia', '627', '29'], ['48', 'british virgin islands ( bot )', 'british virgin islands ( bot )', '626', '14'], ['49', 'copenhagen', 'denmark', '625', '18'], ['50', 'taipei', 'taiwan', '619', '34'], ['51', 'milan', 'italy', '618', '34'], ['52', 'bahrain', 'bahrain', '610', '3'], ['53', 'malta', 'malta', '608', '13'], ['54', 'madrid', 'spain', '607', '28'], ['55', 'jakarta', 'indonesia', '606', '14'], ['56', 'dublin', 'ireland', '605', '22'], ['57', 'helsinki', 'finland', '604', '30'], ['58', 'bangkok', 'thailand', '600', '19'], ['59', 'beijing', 'china', '598', '24'], ['60', 'brussels', 'belgium', '597', '44'], ['61', 'johannesburg', 'south africa', '592', '18'], ['62', 'edinburgh', 'united kingdom', '590', '42'], ['63', 'panama city', 'panama', '589', '8'], ['64', 'manila', 'philippines', '587', '1'], ['65', 'glasgow', 'united kingdom', '586', '50'], ['66', 'mexico city', 'mexico', '584', '44'], ['67', 'the bahamas', 'the bahamas', '583', '4'], ['68', 'mauritius', 'mauritius', '581', '9'], ['69', 'moscow', 'russia', '580', '26'], ['70', 'gibraltar ( bot )', 'gibraltar ( bot )', '572', '43'], ['71', 'warsaw', 'poland', '571', '37'], ['72', 'mumbai', 'india', '570', '35'], ['73', 'prague', 'czech republic', '565', '46'], ['74', 'cyprus', 'cyprus', '536', '40'], ['75', 'lisbon', 'portugal', '535', '17'], ['76', 'saint petersburg', 'russia', '522', '63'], ['77', 'budapest', 'hungary', '515', '26'], ['78', 'tallinn', 'estonia', '495', '94'], ['79', 'reykjavik', 'iceland', '479', '67'], ['80', 'athens', 'greece', '469', '4']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Rating Growth is defined as the change in rating divided by the current rating, expressed as a percentage. According to this definition of Rating Growth, which centre has the highest rating growth? | tallinn |
8065c33205330460aa2d2afbc1da62b2 | tablebench-tqa | {'columns': ['rank', 'team name', 'basic elements', 'tumbling', 'stunts', 'tosses / pyramids', 'deductions', 'total'], 'data': [['1', 'school of saint anthony ssa seagulls', '61.5', '66.5', '67.5', '69.5', '(13)', '252.0'], ['2', 'school of the holy spirit shs pep squad', '64.5', '63.0', '66.0', '64.5', '(15)', '243.0'], ['5', 'pcc pep squad', '55.0', '49.0', '65.0', '64.0', '(26)', '207.0'], ['6', 'assumption college ac hardcourt', '59.0', '53.0', '62.0', '48.5', '(37)', '185.5'], ['8', 'the cmic fighting vanguards', '47.0', '36.5', '57.5', '56.5', '(35)', '162.5'], ['9', 'de la salle zobel dlsz pep squad and cheerdancers', '46.5', '44.5', '54.0', '44.0', '(27)', '162.0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of cheerleading competitions, the "Average Skill Score" is calculated as the average of the scores in the basic elements, tumbling, stunts, and tosses/pyramids categories. Which team has the highest Average Skill Score? | school of saint anthony ssa seagulls |
3c1bac47a547c64ecfe68424b779173c | tablebench-tqa | {'columns': ['Name', 'Position', 'Length\n[km]', 'Drainage basin area\n[km2]', 'Confluence\n[by Lahn-km]', 'Mouth elevation\n[m above MSL]'], 'data': [['Feudinge (Rüppersbach)', 'left', '6.3', '21.2', '9.8', '388'], ['Ilse', 'right', '8.4', '11.8', '10.5', '382'], ['Banfe', 'right', '11.5', '38.9', '18.5', '326'], ['Laasphe', 'left', '8.3', '19.6', '19.4', '324'], ['Perf', 'right', '20.0', '113.1', '24.7', '285'], ['Dautphe', 'left', '8.8', '41.8', '37.5', '245'], ['Wetschaft', 'left', '29.0', '196.2', '56.3', '192'], ['Ohm', 'left', '59.7', '983.8', '58.7', '188'], ['Allna', 'right', '19.1', '92.0', '77.1', '172'], ['Zwester Ohm', 'left', '20.0', '69.5', '84.0', '165'], ['Salzböde', 'right', '27.6', '137.8', '87.4', '164'], ['Lumda', 'left', '30.0', '131.5', '93.6', '160'], ['Wieseck', 'left', '24.3', '119.6', '102.2', '155'], ['Bieber', 'right', '13.6', '34.7', '105.1', '151'], ['Kleebach', 'left', '26.9', '164.6', '106.2', '150'], ['Wetzbach', 'left', '11.7', '32.9', '119.6', '147'], ['Dill', 'right', '55.0', '717.7', '120.4', '147'], ['Solmsbach', 'left', '24.6', '112.5', '128.1', '141'], ['Iserbach (Möttbach)', 'left', '19.2', '31.2', '131.4', '139'], ['Ulmbach', 'right', '22.9', '60.9', '138.2', '135'], ['Kallenbach', 'right', '14.6', '84.7', '141.3', '132'], ['Weil', 'left', '46.6', '247.9', '149.4', '130'], ['Kerkerbach', 'right', '20.7', '70.2', '176.0', '112'], ['Emsbach', 'left', '39.1', '321.8', '181.0', '110'], ['Elbbach', 'right', '40.7', '323.7', None, '109'], ['Aar', 'left', '49.7', '312.6', None, '103'], ['Dörsbach', 'left', '32.0', '114.0', None, '94'], ['Gelbach (Aubach)', 'right', '39.7', '221.2', None, '93'], ['Mühlbach', 'left', '32.1', '171.9', None, '85'], ['Emsbach', 'right', '11.5', '29.4', None, '75']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of hydrology, the "confluence" of two rivers refers to the point where they meet. Based on the provided data, what is the average length of the rivers that converge with the Lahn river at a confluence point below 100 km? | 20.73 |
50a1c817a7b50bcd7d9972f1f2ddeff9 | tablebench-tqa | {'columns': ['SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'Measure unit', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)', 'POPULATION (by age group in 2002)'], 'data': [['SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'SPECIFICATION', 'Measure unit', 'TOTAL', '0-9', '10-19', '20-29', '30-39', '40-49', '50-59', '60-69', '70-79', '80 +'], ['I.', 'TOTAL', 'TOTAL', 'TOTAL', 'TOTAL', 'person', '287', '41', '45', '47', '27', '38', '31', '20', '24', '14'], ['I.', '—', 'of which in', 'of which in', 'of which in', '%', '100', '14.3', '15.7', '16.4', '9.4', '13.2', '10.8', '7', '8.4', '4.9'], ['I.', '1.', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX', 'BY SEX'], ['I.', '1.', 'A.', 'Males', 'Males', 'person', '145', '23', '23', '25', '13', '20', '16', '11', '11', '3'], ['I.', '1.', 'A.', '—', 'of which in', '%', '50.5', '8', '8', '8.7', '4.5', '7', '5.6', '3.8', '3.8', '1'], ['I.', '1.', 'B.', 'Females', 'Females', 'person', '142', '18', '22', '22', '14', '18', '15', '9', '13', '11'], ['I.', '1.', 'B.', '—', 'of which in', '%', '49.5', '6.3', '7.7', '7.7', '4.9', '6.3', '5.2', '3.1', '4.5', '3.8']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of demographics, the population dependency ratio is defined as the ratio of the population aged 0-10 and 60+ to the population aged 11-59. Based on the provided data, what is the approximate population dependency ratio in 2002? | 52.66% |
f07268ae170e01fb4f8bb1bd2e7ed14b | tablebench-tqa | {'columns': ['member countries', 'population', 'area (km square)', 'gdp (billion us)', 'gdp per capita (us)'], 'data': [['denmark', '5021861', '43094', '70.032', '59928'], ['ireland', '3073200', '70273', '21.103', '39638'], ['united kingdom', '56210000', '244820', '675.941', '36728'], ['accession countries', '64305061', '358187', '767.076', '11929'], ['existing members (1973)', '192457106', '1299536', '2381396', '12374'], ['ec9 (1973)', '256762167 ( + 33.41%)', '1657723 ( + 25.44%)', '3148.472 ( + 32.21%)', '12262 (0.91%)']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | GDP per Square Kilometer is calculated as the total GDP of a country divided by its area in square kilometers. Based on this definition, which country has the highest GDP per Square Kilometer? | united kingdom |
a44c1a6d08cd0dac4f0d91df912f222c | tablebench-tqa | {'columns': ['name', 'area (km square)', 'pop', 'pop / area (1 / km square)', 'no p', 'no c / no t', 'subregion'], 'data': [['águeda', '335.3', '47729', '148', '20', '1', 'baixo vouga'], ['albergaria - a - velha', '155.4', '25497', '164', '8', '0', 'baixo vouga'], ['anadia', '216.6', '31671', '146', '15', '1', 'baixo vouga'], ['arouca', '329.1', '24019', '73', '20', '0', 'entre douro e vouga'], ['aveiro', '199.9', '73626', '368', '14', '1', 'baixo vouga'], ['castelo de paiva', '115.0', '17089', '149', '9', '0 / 2', 'tmega'], ['espinho', '21.1', '31703', '1503', '5', '1 / 1', 'grande porto'], ['estarreja', '108.4', '28279', '261', '7', '1 / 3', 'baixo vouga'], ['ílhavo', '73.5', '39247', '534', '4', '2', 'baixo vouga'], ['mealhada', '110.7', '20496', '194', '8', '1', 'baixo vouga'], ['murtosa', '73.3', '9657', '132', '4', '0 / 1', 'baixo vouga'], ['oliveira de azeméis', '163.5', '71243', '436', '19', '1 / 9', 'entre douro e vouga'], ['oliveira do bairro', '87.3', '22365', '256', '6', '1', 'baixo vouga'], ['ovar', '147.4', '56715', '385', '8', '2 / 3', 'baixo vouga'], ['santa maria da feira', '215.1', '142295', '662', '31', '3 / 13', 'entre douro e vouga'], ['são joão da madeira', '7.9', '21538', '2726', '1', '1 / 0', 'entre douro e vouga'], ['sever do vouga', '129.6', '12940', '100', '9', '0', 'baixo vouga'], ['vagos', '169.9', '23205', '137', '11', '0 / 2', 'baixo vouga'], ['vale de cambra', '146.5', '22864', '169', '9', '1', 'entre douro e vouga']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Population Density is calculated as the population (pop) divided by the area (km square), indicating the number of people per square kilometer. Which subregion has the highest average population density? | são joão da madeira |
9906ab8178857b83190810e410ce4ea2 | tablebench-tqa | {'columns': ['draw', 'artist', 'song', 'jury votes', 'televotes', 'total votes', 'result'], 'data': [['1', 'diqesi', 'subiré', '5', '4', '9', 'out'], ['2', 'roel', 'y ahora dices', '6', '3', '9', 'out'], ['3', 'salva ortega', 'lujuria', '7', '7', '14', 'second chance >final'], ['4', 'soraya', 'la noche es para mí', '12', '12', '24', 'final'], ['5', 'virginia', 'true love', '10', '10', '20', 'final'], ['6', 'calipop', 'burbuja', '2', '2', '4', 'out'], ['7', 'ángeles vela', 'vístete de primavera', '4', '5', '9', 'out'], ['8', 'jorge gonzález', 'si yo vengo a enamorarte', '8', '8', '16', 'final'], ['9', 'electronikboy', 'mon petit oiseau', '1', '1', '2', 'out']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | In the context of music competitions, the “Tele Efficiency" of an artist is defined as the ratio of total votes received to the televotes. Based on this definition, which artist had the highest Tele Efficiency in this competition? | ángeles vela |
539b17209d5b8f10a98c96fe1029c2dc | tablebench-tqa | {'columns': ['year (january)', 'population (000)', 'rural , %', 'urban , %', 'source'], 'data': [['1939', '6081', '72', '28', 'census'], ['1959', '9295', '56', '44', 'census'], ['1970', '13001', '50', '50', 'census'], ['1979', '14685', '46', '54', 'census'], ['1989', '16537', '43', '57', 'census'], ['1999', '14953', '43', '57', 'census'], ['2002', '14851', '43', '57', 'estimate'], ['2005', '15075', '43', '57', 'estimate'], ['2008', '15572', '47', '53', 'estimate']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Urbanization Rate is defined as the percentage of the population living in urban areas. Based on this definition, in which year did the urbanization rate surpass 50% for the first time? | 1979 |
0d30032f9b5ffaf48989a02191dbb9c9 | tablebench-tqa | {'columns': ['rank', 'nation', 'gold', 'silver', 'bronze', 'total'], 'data': [['1', 'soviet union', '7', '6', '0', '13'], ['2', 'hungary', '2', '2', '1', '5'], ['3', 'japan', '2', '0', '3', '5'], ['4', 'romania', '1', '3', '1', '5'], ['5', 'iran', '1', '0', '1', '2'], ['6', 'turkey', '1', '0', '1', '2'], ['7', 'finland', '1', '0', '0', '1'], ['7', 'france', '1', '0', '0', '1'], ['9', 'bulgaria', '0', '2', '2', '4'], ['10', 'united states', '0', '1', '2', '3'], ['11', 'east germany', '0', '1', '0', '1'], ['11', 'india', '0', '1', '0', '1'], ['13', 'czechoslovakia', '0', '0', '1', '1'], ['13', 'mongolia', '0', '0', '1', '1'], ['13', 'poland', '0', '0', '1', '1'], ['13', 'south korea', '0', '0', '1', '1'], ['13', 'sweden', '0', '0', '1', '1'], ['total', 'total', '16', '16', '16', '48']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Domain-Specific'} | Medal Efficiency is calculated as the total number of gold medals won by a nation divided by its total number of medals won. Based on this definition, which nation has the highest medal efficiency? | soviet union |
19f5fcd6b29df032293fab57a9cd5e91 | tablebench-tqa | {'columns': ['year', 'births (000s)', 'deaths', 'natural growth', 'total fertility rate'], 'data': [['1990', '0.7', '0.4', '0.3', '1.58'], ['1991', '2.4', '1.85', '0.55', '1.31'], ['1992', '3.4', '2.7', '0.7', '1.33'], ['1993', '4.6', '3.3', '1.3', '1.52'], ['1994', '5.8', '4.0', '1.8', '1.65'], ['1995', '6.75', '4.6', '2.15', '1.72'], ['1996', '7.5', '5.0', '2.5', '1.70'], ['1997', '8.2', '5.4', '2.8', '1.71'], ['1998', '8.9', '5.9', '3.0', '1.71'], ['1999', '9.3', '6.3', '3.0', '1.63'], ['2000', '10.1', '6.7', '3.4', '1.62'], ['2001', '10.3', '6.9', '3.4', '1.56'], ['2002', '10.6', '7.2', '3.4', '1.55'], ['2003', '11.1', '7.25', '3.85', '1.60'], ['2004', '10.9', '7.4', '3.5', '1.55'], ['2005', '11.0', '7.6', '3.4', '1.55'], ['2006', '11.2', '7.6', '3.6', 'na'], ['2007', '10.3', '7.8', '2.5', 'na'], ['2008', '11.6', '7.8', '3.8', 'na'], ['2009', '11.7', '7.6', '4.1', 'na'], ['1990 - 2009', '166.4', '113.3', '53.1', 'na']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Time-basedCalculation'} | In which year was the natural growth rate significantly different from the average natural growth rate between 1990 and 2000? | 1990 |
74a141ffb44ab78e143b3824b352eee2 | tablebench-tqa | {'columns': ['year', 'class', 'team', 'points', 'rank', 'wins'], 'data': [['1994', '125cc', 'honda', '24', '20th', '0'], ['1995', '125cc', 'honda', '102', '8th', '0'], ['1996', '125cc', 'honda', '167', '3rd', '1'], ['1997', '125cc', 'honda', '190', '3rd', '0'], ['1998', '125cc', 'honda', '217', '2nd', '5'], ['1999', '250cc', 'yamaha', '52', '15th', '0']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Time-basedCalculation'} | What is the average annual increase in points from 1994 to 1998 for the 'honda' team in the '125cc' class? | 48.25 |
6ba14be153d5a11f0caeebe3e441125d | tablebench-tqa | {'columns': ['year', 'builder', 'motors', 'trailers', 'control trailers'], 'data': [['1923', 'brcw', '-', '1', '-'], ['1923', 'clco', '-', '1', '-'], ['1923', 'grcw', '-', '1', '1'], ['1923', 'leeds', '-', '1', '-'], ['1923', 'mcwf', '-', '1', '-'], ['1923', 'brcw', '-', '35', '-'], ['1923', 'clco', '41', '40', '-'], ['1923', 'mcwf', '40', '-', '35'], ['1924', 'brcw', '-', '50', '-'], ['1924', 'clco', '-', '-', '25'], ['1924', 'mcwf', '52', '-', '-'], ['1925', 'clco', '48', '-', '-'], ['1925', 'mcwf', '-', '5', '67'], ['1926', 'mcwf', '64', '48', '-'], ['1927', 'mcwf', '110', '160', '36'], ['1927', 'ucc', '77', '37', '68'], ['1929', 'ucc', '18', '17', '18'], ['1930', 'mccw', '22', '20', '20'], ['1930', 'ucc', '2', '4', '-'], ['1931', 'brcw', '-', '90', '-'], ['1931', 'grcw', '-', '40', '-'], ['1931', 'mccw', '145', '-', '-'], ['1934', 'mccw', '26', '-', '-'], ['totals', '1466', '645', '551', '270']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Time-basedCalculation'} | What is the percentage increase in the total number of trailers from 1923 to 1927? | 146.25% |
3c12603df3f93729c1be1358706a887f | tablebench-tqa | {'columns': ['year', 'design', 'issue', 'artist', 'mintage', 'issue price'], 'data': [['2003', 'niagara falls', 'hologram', 'gary corcoran', '29967', '79.95'], ['2003', 'rocky mountains', 'colorized', 'josé osio', '28793', '69.95'], ['2004', 'iceberg', 'hologram', 'josé osio', '24879', '69.95'], ['2004', 'northern lights', 'double image hologram', 'gary corcoran', '34135', '79.95'], ['2004', 'hopewell rocks', 'selectively gold plated', 'josé osio', '16918', '69.95'], ['2005', 'diamonds', 'double image hologram', 'josé osio', '35000', '69.95']]} | null | {'qtype': 'NumericalReasoning', 'qsubtype': 'Time-basedCalculation'} | What is the total mintage of coins issued in 2004? | 75932 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.