proba float64 0.5 1 | text stringlengths 16 174k |
|---|---|
0.997366 | Read reviews and find the best places to buy a battery from top companies including. From full-service to DIY installation, get your car going again. . Service times are usually comparable to other auto mechanic shops with an average of .
. a great start every time. Schedule an appointment at a Sears Auto location near me today!. Free installation with any automotive battery purchase. Shop Now.
Keep me logged in. . wouldn't it be easier and cheaper just to buy the battery and install it yourself?. Costco is a great place to buy car batteries, as they have a quality product, at a great price, with great warranty.. internet for step-by-step instructions for your make and model, then ask around to see how .
Schedule an appointment to have your car battery tested or replaced so it. Pep Boys' car battery installation service is performed by technicians trained on how .
Related Post "Auto Battery Installation Near Me" |
0.926252 | Diabetic nephropathy (DN) is a major complication in patients with either type 1 or type 2 diabetes mellitus and one of the leading causes of end-stage renal failure, contributing to severe morbidity and mortality in diabetic patients . It is characterized by microalbuminuria, glomerular and tubular epithelial hypertrophy, excessive accumulation of extracellular matrix (ECM) protein, thickening of glomerular and tubular basement membranes, which eventually results in the failure of renal function . Accumulating evidence has demonstrated that metabolic and hemodynamic factors, including hyperglycemia, transforming growth factor-β1 (TGF-β1) and angiotensin II are implicated in the development of DN . Among these factors, hyperglycemia is currently regarded as the key initiating factor in the progression of DN . In addition, it is believed that inflammatory processes are also able to accelerate the development and progression of DN . According to the previous studies, DN was accompanied by the increased amount of pro-inflammatory cytokines and chemokines, including tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 . Podocytes have been recognized as critical regulators of glomerular injury and reduction in podocytes number mediated by apoptosis are associated with the pathogenesis of DN [7, 8]. Although extensive researches have been done in clarifying the pathogenesis of DN, it still remains a challenging task to develop novel and effective therapeutic strategies in the treatment of DN.
Berberine (BBR), an isoquinoline alkaloid isolated from Coptidis rhizome, Cortex phellodendri, and Berberis vulgaris, has been extensively used for long as an oriental medicine to treat gastroenteritis and secretory diarrhea [9–12]. Increasing evidence has exhibited that BBR has a wide range of pharmacological activities, for instance, anti-oxidant stress, anti-inflammatory, anti-tumor, anti-microbial and anti-fibrosis effects, suggesting the clinical and research value of BBR . Furthermore, BBR has been well characterized to exert renoprotective effects in DN progression [14, 15]. However, the underlying mechanism of the renoprotective effect of BBR on DN remains to be further explored.
Toll-like receptors (TLRs) are a conserved family of pattern recognition receptors in the innate immune system that activate downstream inflammatory signaling pathways in response to exogenous microbial pathogens . Activation TLRs signal was associated with the activation of nuclear factor kappa B (NF-κB) activity and consequent increased release of pro-inflammatory cytokines and chemokines such as IL-6, monocyte chemotactic protein-1 (MCP-1), and IL-1β, in turn initiating local inflammation and leukocyte accumulation [17, 18]. NF-κB, a downstream effector of TLR4 signaling pathway, is a ubiquitous and important nuclear transcription factor which mediates several inflammatory processes . There is striking evidence that activation of NF-κB plays a critical role in renal inflammation and fibrosis of the progression of DN . Among all TLRs, TLR4 has been reported to be implicated in the pathogenesis of acute kidney injury, chronic kidney diseases, and the occurrence of DN .
In the present study, we used streptozotocin (STZ)-induced in vivo model of DN and high glucose (HG)-induced podocytes as an in vitro model to investigate the protective effect of BBR on DN and its possible molecular basis. Our study demonstrated that BBR could reduce streptozotocin (STZ)-induced renal injury and inflammatory response, and podocyte apoptosis by inhibiting the TLR4/NF-κB pathway.
The animal study was approved by the Experimental Animal Ethical Committee of Huaihe Hospital of Henan University and performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male Sprague–Dawley rats (weighing 250 ± 20 g) were purchased from Shanghai Science Academy Animal Center (Shanghai, China) and housed in the standard laboratory conditions. All rats were allowed free access to food and water ad libitum at a controlled temperature room with a constant 12-h light/dark cycle. After a week of adaptive feeding, these rats were randomly divided into 5 groups (n = 10/group): NC group, DN group, DN + BBR (50 mg/kg), DN + BBR (100 mg/kg), and DN + BBR (200 mg/kg). Rats in DN group, DN + BBR (50 mg/kg), DN + BBR (100 mg/kg), and DN + BBR (200 mg/kg) were intraperitoneally injected with 65 mg/kg streptozotocin (STZ, Sigma-Aldrich, St. Louis, MO, USA) dissolved in a 0.1 mM chilled citrate–phosphate buffer (pH 4.5) to induce diabetes . The rats in NC group were injected with chilled citrate–phosphate buffer (0.1 mM, pH 4.4). Control rats in DN group received an equal amount of citrate–phosphate buffer alone by intraperitoneal injection. When the fasting blood glucose levels from tail vein of STZ-induce diabetic rats were over 16.7 mM at 5 days after STZ injection, these rats were considered as diabetes. One week later, the diabetic rats in DN + BBR (50 mg/kg), DN + BBR (100 mg/kg), and DN + BBR (200 mg/kg) were orally treated with BBR dissolved in 0.5% carboxymethyl cellulose at a dose of 50, 100 or 200 mg/kg every day, respectively. The volume of 0.5% carboxymethyl cellulose to dissolve the different doses of BBR (50, 100, and 200 mg/kg) was 4, 2, and 1 ml, respectively. Meanwhile, the rats in NC group and DN group were gavaged with the same volume of 0.5% carboxymethyl cellulose. The fasting blood glucose and body weight were measured every 2 weeks for 8 weeks. The rats were sacrificed at 8 weeks after BBR treatment. Blood samples were collected, and the serum was separated by centrifugation and stored at − 80 °C until analysis. Meanwhile, right kidney samples were rapidly excised, weighted, and stored at − 80 °C until analysis. The ratio of kidney weight to body weight was considered as kidney weight index.
At the end of the experiment, the animals were maintained in metabolic cages for 24 h to harvest urine for assessing 24-h urinary protein with an enzyme-linked immunosorbent assay (ELISA) kit (Runyu Biotechnology Co., Shanghai, China). The fasting blood glucose level was determined based on the glucose oxidase-catalyzed reaction (chemistry analyzer; Auto Analyzer Quik-Lab, Ames, Spain). To assess renal function, blood urea nitrogen and serum creatinine in the serum of blood samples were measured using an automatic biochemistry analyzer (Hitachi, Tokyo, Japan).
Renal corticals were homogenized and centrifuged at 9000×g for 30 min at 4 °C. The levels of proinflammatory cytokines in kidney homogenate and serum, including IL-1β, IL-6, and MCP-1, were determined using commercially acquired ELISA kits (Abcam Inc., Cambridge, MA, USA).
Conditionally immortalized mouse podocytes were purchased from Yubo Bio-Technique Co. Ltd (Shanghai, China) and cultured in RPMI 1640 medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone), 100 U/ml penicillin/streptomycin, 5.6 mM glucose (Dingguo Changsheng Biotechnology Co., Ltd., Beijing, China) and 10 U/ml recombinant mouse interferon-γ (IFNγ; Pepro Technology, Rocky Hill, NJ, USA) at 33 °C in a 5% CO2 humidified incubator. To investigate the effect of BBR on DN, podocytes were pre-treated with 30 mM high glucose (HG) for 24 h prior to treatment with BBR at a dose of 10, 30 or 90 μM for 24 h. In some experiment, podocytes were pre-treated with 30 mM HG in the presence of TLR4 antagonist resatorvid (TAK-242, 1 μΜ; ApexBio, Houston, TX, USA), NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC; 50 μM; Sigma), or combined with NF-κB activator phorbol myristate acetate (PMA, 100 ng/ml; Sigma), followed by treated with 30 μM BBR for 24 h.
Total RNA was extracted from treated podocytes with TRIzol reagent (Invitrogen Invitrogen, Carlsbad, CA, USA) and quantified by NanoDrop 2000/2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized from 1 µg total RNA by reverse transcription using a high capacity cDNA reverse transcription kit (TaKaRa, Tokyo, Japan). qPCR analysis of interleukin (IL)-1β, IL-6, and MCP-1 mRNA was performed with SYBR Premix ExTaq II kit (TaKaRa) and specific primers on an Applied Biosystems 7900 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The relative quantification of mRNA levels was calculated based on the 2−ΔΔCt method and normalized to GAPDH. The primers were as follows: GAPDH, forward: 5′-CAG TGC CAG CCT CGT CTA T-3′, reverse: 3′-AGG GGC CAT CCA CAG TCT TC-5′; IL-1β, forward: GTG ATG TTC CCA TTA GAC AGC, reverse: CTT TCA TCA CAC AGG ACA GG; IL-6, forward: 5′-ATG AAC TCC TTC TCC ACA AGC GC-3′, reverse: 5′-GAA GAG CCC TCA GGC TGG ACT G-3′; MCP-1, forward: 5′-TCA GCC AGA TGC AGT TAA CGC-3′, reverse: 5′-TGA TCC TCT TGT AGC TCT CCA GC-3′.
Kidney homogenate and podocytes were collected and lysed in cell lysis buffer (Beyotime, Haimen, China) with protease inhibitor cocktail and phosphatase inhibitor (both from Sigma-Aldrich) for protein extraction. Equal amount of protein lysates (30 μg) were separated by 10% serum dodecyl sulfate-polyacrylamide gels (SDS-PAGE) and electrotransferred onto nitrocellulose (NC) membranes (Millipore, Billerica, MA, USA). After being blocked with 5% non-fat dry milk in PBS for 1 h, the membranes were probed with the primary antibodies against TLR4, phosphorylated-p65 (p-p65), p65, p-IκBα, IκBα, Cleaved Caspase-3, Bcl-2 and β-actin (all from Santa Cruz Biotechnology, Santa Cruz, CA) at 4 °C overnight, followed by incubated with a horseradish peroxidase-conjugated secondary antibody (Invitrogen) for 2 h at room temperature. Peroxidase-labeled protein bands were detected by enhanced chemiluminescence reagents (Millipore) and the protein intensity was quantified with Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).
Podocytes were double stained with FITC-Annexin V and propidium iodide (PI) from a FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA). The apoptotic rats were analyzed using a FACScan flow cytometer (BD Biosciences).
Data are displayed as mean ± standard deviation (SD). Statistical analysis was performed with GraphPad Prism 5 software (GraphPad Software Inc., San Diego, CA, USA). Comparison among experimental groups was performed using unpaired two-tailed Student’s t test and analysis of variance (ANOVA), with a value of P < 0.05 being considered as statistically significant.
To determine the protective effect of BBR in DN, the indexes associated with kidney function, including fasting blood glucose levels, body weight, ratio of kidney weight to body weight, 24-h urinary protein, serum creatinine and blood urea nitrogen were measured. The results showed that STZ injection resulted in a significant increase in fasting blood glucose level (Fig. 1a), kidney/body weight (Fig. 1c), 24 h-urinary protein level (Fig. 1d), serum creatinine level (Fig. 1e) and blood urea nitrogen level (Fig. 1f) when compared with NC group. However, administration with BBR (100 or 200 mg/kg) significantly attenuated these effects in STZ-induced DN rats. Treatment with BBR at a low dose of 50 mg/kg exhibited no significant influence on these parameters in STZ-induced DN rats. Moreover, the body weight of STZ-induced DN rats was obviously decreased compared with DN group, while BBR treatment displayed little effect in restoring the lowered weigh (Fig. 1b). Collectively, these results demonstrated that BBR could ameliorate renal injury in STZ-induced DN rats.
It is well established that inflammation played an important role in the pathogenesis of DN. We therefore determined the effect of BBR on renal inflammation in DN rats by measuring the concentrations of inflammatory factors IL-1β, IL-6, and MCP-1 in the serum and renal cortex of rats. The ELISA results revealed that compared with untreated rats, an evident rise in the production of proinflammatory cytokines including IL-1β (Fig. 2a, d) and IL-6 (Fig. 2b, e), and chemokine MCP-1 (Fig. 2c, f) was observed in the serum and renal cortex of STZ-induced DN rats. However, oral administration with BBR (100 or 200 mg/kg) significantly inhibited the generation of IL-1β, IL-6 and MCP-1 in the serum (Fig. 2a–c) and renal cortex (Fig. 2d–f) of DN rats. BBR at a dose of 50 mg/kg had no apparent effect on inflammatory response of STZ-induced DN rat model. Therefore, we concluded that BBR attenuated the systemic and renal cortex inflammatory response in STZ-induced DN rats.
Since the TLR4/NF-κB pathway has been extensively reported to be involved in inflammatory response, we therefore examined whether the protective effect of BBR in DN rats was associated with the TLR4/NF-κB pathway. We detected the protein levels of TLR4, NF-κB pathway key factors p65 and IκBα in DN rats after administration with BBR (50, 100 or 200 mg/kg) by western blot. The protein level of TLR4 (Fig. 3a, b), p-IκBα/IκBα ratio (Fig. 3a, c) and p-p65/p65 ratio (Fig. 3a, d) were markedly up-regulated in STZ-induced DN rat model compared to NC group, suggesting that the TLR4/NF-κB pathway was activated in STZ-induced DN rats. However, treatment with BBR (100 or 200 mg/kg) prominently restrained the activation of the TLR4/NF-κB pathway in DN rats by repressing the protein level of TLR4 and phophorylation of IκBα and p65 (Fig. 3a–d). Whereas, BBR (50 mg/kg) did not significantly suppress TLR4/NF-κB pathway in DN rats. Taken together, these data indicated that BBR blocked the activation of TLR4/NF-κB pathway in STZ-induced DN rats.
To determine the protective effect of BBR in DN in vitro, an in vitro DN model was established by treating podocytes with 30 mM high glucose for 24 h. We performed flow cytometry analysis to explore the effect of BBR on HG-induced apoptosis in podocytes. The results exhibited that HG treatment strikingly induced cell apoptosis relative to untreated podocytes, whereas BBR challenge at 30 or 90 μM notably attenuated HG-induced apoptosis of podocytes (Fig. 4a). Consistently, western blot analyses further demonstrated that HG exposure resulted in an obvious increase of Cleaved Caspase-3 and an evident decrease of Bcl-2 in podocytes, while these effects were significantly reversed by oral administration of BBR (Fig. 4b). These results suggested that BBR suppressed HG-induced apoptosis of podocytes.
To investigate the effect of BBR on inflammatory response in DN in vitro, the mRNA amounts of inflammatory factors IL-1β, IL-6, and MCP-1 in HG-induced podocytes treated with 10, 30, or 90 μM were determined by qRT-PCR. Consistently with the in vivo results, the mRNA amounts of IL-1β (Fig. 5a), IL-6 (Fig. 5b), and MCP-1 (Fig. 5c) in HG-induced podocytes were conspicuously upregulated in comparison with NC group, while these effects were markedly abated following BBR treatment (30 or 90 μM), suggesting that BBR hindered HG-induced inflammatory response in podocytes.
The effect of BBR on the TLR4/NF-κB pathway in HG-induced podocytes was further analyzed. Western blot analyses demonstrated that the protein levels of TLR4 (Fig. 6a, b), p-IκBα/IκBα ratio (Fig. 6a, c) and p-p65/p65 ratio (Fig. 6a, d) were all elevated in HG-treated podocytes, while these effects were markedly attenuated following BBR treatment (30 or 90 μM), indicating that BBR inactivated the TLR4/NF-κB pathway in HG-induced podocytes.
TAK-242, a TLR4 inhibitor, was employed to explore the underlying mechanism of BBR in DN in vitro. We selected the BBR at a dose of 30 μΜ for further analysis based on the above results. Podocytes were stimulated with 30 mM high glucose in the presence or absence of 1 μΜ TAK-242, followed by treated with 30 μM BBR for 24 h. qRT-PCR results demonstrated that TAK-242 treatment prominently repressed HG-induced upregulation of inflammatory factors including IL-1β (Fig. 7a), IL-6 (Fig. 7b), and MCP-1 (Fig. 7c) in podocytes. Moreover, cotreatment with BBR and TAK-242 aggravated BBR-mediated inhibition on the amounts of IL-1β, IL-6, and MCP-1 in HG-induced podocytes, which was partially abated following the addition of PMA (Fig. 7a–c). Meanwhile, flow cytometry analysis demonstrated that TAK-242 administration significantly lowered HG-induced apoptosis in podocytes, while BBR treatment significantly intensified BBR-induced anti-apoptotic effect in HG-treated podocytes, which was considerably restored by the treatment of PMA (Fig. 7d). Consistently, Western blot analyses demonstrated that TAK-242 administration significantly reduced Cleaved Caspase-3 protein level and significantly increased Bcl-2 protein level in HG-treated podocytes, while cotreatment with TAK-242 and BBR markedly overturned TAK-242-induced decrease of Cleaved Caspase-3 level and increase of Bcl-2 level, which was further reversed following the addition of PMA (Fig. 7e). Additionally, we found that TAK-242 treatment significantly suppressed the TLR4/NF-κB pathway in HG-induced podocytes by reducing the protein level of TLR4 (Fig. 7f, g), p-IκBα/IκBα ratio (Fig. 7f, h) and p-p65/p65 ratio (Fig. 7f, i). Moreover, the inhibitory effect on TLR4/NF-κB elicited by BBR challenge was exacerbated following treatment with TAK-242 in HG-induced podocytes, which was distinctly overturned by PMA treatment. Collectively, these findings demonstrated that BBR treatment inhibited HG-induced inflammatory response and apoptosis in podocytes by blocking TLR4/NF-κB pathway.
PDTC, a NF-κB inhibitor, was further used to confirm whether the inhibitory effect of BBR on HG-induced inflammatory response and apoptosis in podocytes was mediated by TLR4/NF-κB pathway. Podocytes were pre-treated with or without 50 μΜ PDTC for 2 h prior to stimulating with 30 mM high glucose. Then, cells were exposed to 30 μM BBR for 24 h. qRT-PCR results demonstrated that inactivation of TLR4/NF-κB pathway by PDTC significantly reduced HG-induced increase in the amounts of IL-1β (Fig. 8a), IL-6 (Fig. 8b), MCP-1 (Fig. 8c), as well as apoptosis (Fig. 8d) in podocytes. Furthermore, simultaneous PDTC and BBR treatment significantly aggravated the inhibitory effect of BBR on inflammatory factors amount and cell apoptosis in HG-treated podocytes. Additionally, western blot demonstrated that PDTC treatment significantly reduced the protein level of Cleaved Caspase-3 and greatly enhanced Bcl-2 amount in HG-treated podocytes, which was substantially reversed following the addition of BBR (Fig. 8e). These results suggested that BBR blocked HG-induced inflammatory response and apoptosis in podocytes by suppressing TLR4/NF-κB pathway.
The current study evaluated the renoprotective effects and molecular mechanism of BBR on the pathogenesis of DN in STZ-induced DN rat model and HG-induced DN podocytes model. In the present study, we provided strong evidence that BBR not only attenuated renal dysfunction and inflammatory response, but also suppressed TLR4/NF-κB pathway in STZ-induced DN rats and HG-induced podocytes. Furthermore, mechanistic analysis demonstrated that blockade of TLR4/NF-κB pathway by TAK-242 or PDTC exacerbated the inhibitory effect of BBR on HG-induced inflammatory response and apoptosis in podocytes. Therefore, our study suggested that BBR ameliorated DN by inhibiting TLR4/NF-κB pathway.
As has been well described, BBR has a wide range of pharmacological activities and has been demonstrated to exert protective effects against DN progression by ameliorating a variety of pathological changes . More recently, it was demonstrated that BBR displayed a tendency to ameliorate renal dysfunction and renal inflammation, improve glucose and lipid metabolism disorders, and decrease fasting blood glucose in DN rats [23, 24]. Moreover, BBR could inhibit renal fibrosis and inhibited renal tubular epithelial-to-mesenchymal transition of DN [25, 26]. Additionally, BBR inhibits high glucose-induced glomerular mesangial cell proliferation and ECM accumulation, and attenuates tubulointerstitial fibrosis in DN, which suggests that BBR can be used as a further potential therapeutic drug for DN [27, 28]. Additionally, it was previously demonstrated that the doses of BBR that can be administrated in patients with type 2 diabetes and diabetic rats are 300 mg three times a day and 100 mg/kg, respectively [29, 30]. In the present study, we demonstrated that BBR challenge at 100 or 200 mg/kg significantly reduced renal injury in STZ-induced DN rat model, as evidenced by a decrease in fasting blood glucose, ratio of kidney weight to body weight, 24-h urinary protein, serum creatinine, and blood urine nitrogen, while BBR at a low dose of 50 mg/kg had no significant effect on these parameters associated with kidney function. Moreover, we found that BBR also weakened STZ-induced inflammatory factors production in DN rats, and inhibited HG-induced apoptosis and inflammatory response in podocytes, confirming the renoprotective effect of BBR in DN.
There is increasing evidence supporting that inflammation exerts important roles in the pathogenesis of DN . TLR4/NF-κB pathway appears to play a critical role in the pathogenesis with a variety of inflammatory conditions . The proinflammatory role of TLR4/NF-κB pathway has been demonstrated to be involved in the progression of diabetes and diabetic complication [33, 34]. Upon stimulation, activation of TLR4 pathway subsequently activated the NF-κB pathway and triggered NF-κB-dependent inflammatory response, which might ultimately aggravate renal dysfunction in acute and chronic kidney diseases [35, 36]. In podocytes and tubular epithelial cells, exposure to high glucose promoted TLR4 activation, resulting in NF-κB activation and consequent inflammatory and fibrogenic responses . Silencing of TLR4 with small interfering RNA attenuated high glucose-induced IκB/NF-κB activation and inhibited downstream inflammatory cytokines IL-6 and chemokine (C–C motif) ligand 2 (CCL-2) in human proximal tubular epithelial cells . Consistently, the present study demonstrated that BBR treatment blocked HG-induced activation of TLR4/NF-κB pathway in both STZ-induced DN rats and HG-treated podocytes. It was previously reported that BBR inhibited the NF-κB activation and fibronectin (FN) accumulation by inhibiting RhoA/ROCK signaling in diabetic rat kidneys and high glucose-induced glomerular mesangial cells . In addition, BBR could improve insulin resistance of skeletal muscle through inhibiting the active of the TLR4/IκBβ/NF-κB signaling pathway . BBR inhibited IL-1β-induced nitric oxide (NO) production in primary mixed glia and BV-2 cells via inactivation of TLR4/adapter protein myeloid differentiation factor 88 (MyD88)/NF-κB signaling . Besides, the anti-bacterial effects of BBR were mediated by acting as a high-affinity LPS antagonist and blocking the LPS/TLR4 signaling . Moreover, BBR repressed LPS-induced cell proliferation and FN expression in rat mesangial cells through impeding the activation of NF-κB signaling pathway and protein expression of its downstream inflammatory mediators . Our study further revealed that inhibition of TLR4/NF-κB pathway by TAK-242 or PDTC suppressed the HG-induced inflammatory response and apoptosis in podocytes. Moreover, combination with BBR treatment and inhibition of TLR4/NF-κB pathway exacerbated the inhibitory effect of BBR on HG-induced inflammatory response and apoptosis in podocytes, indicating that BBR ameliorated DN by inhibiting the TLR4/NF-κB pathway. Additionally, many other signaling pathways, such as advanced glycation end products-receptor for AGEs (AGEs-RAGE) and AMP-activated protein kinase (AMPK) , have been elucidated to be implicated in the renoprotective effects induced by BBR.
In conclusion, our study demonstrated that BBR ameliorated DN by attenuating renal injury, inflammatory response and podocytes apoptosis. Mechanistic analysis revealed that the renoprotective effect of BBR on DN depended on inhibition of TLR4/NF-κB pathway. The present study contributed to a better understanding of the mechanism underlying BBR involved in DN and provided new evidence for the potential application of BBR in the treatment of DN.
This work was designed and conceived by LZ, JH and RY. The experiments were carried out by LX and WP. The manuscript was prepared by LZ and JH. All authors read and approved the final manuscript.
The animal study was approved by the Experimental Animal Ethical Committee of Huaihe Hospital of Henan University and performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. |
0.985149 | What is cell separation and cell sorting?
In order to answer these questions, we have put together the summary below. In our experience, cell separation is all about isolating a cell population from other cells or biological samples.
Positive Selection: When the cell type of interest is targeted by the removal mechanism and retained for downstream analysis. This is typically performed by targeting a cell surface marker (CD4, CD8, etc.) with a monoclonal antibody.
Depletion: When a single cell type is removed from a biological sample. For example, removal of red blood cells from peripheral blood mononuclear cells (PBMCs).
Negative Selection: Similar to depletion, but when several cell types are removed to leave one cell type untouched. For example, depletion of all cells except for T cells or removal of all cells except for B cells from samples like whole blood or bone marrow.
FACS (fluorescence-activated cell sorting): This technology labels cells with fluorescent markers, which could be based on internal or external markers of the cells. The cells are then measured and identified one at a time and then sorted based on the color of the marker.
MACS™ (magnetic-activated cell sorting): Magnetic particles (nanoscale and microscale) bind to cells through an antibody interaction with the cell surface markers. This allows for the targeted cells to be magnetically isolated from a sample.
BACS™ (buoyancy-activated cell sorting): Microbubbles bind to cells through antibodies binding to the surface of cells. The targeted cells are then removed from a biological sample through flotation.
Other technologies: There are other methods for separation, like microfluidics, centrifugation, filtration, etc.
If you are interested in learning more about cell sorting or you want to try out Akadeum’s microbubbles, contact us today. |
0.993718 | IBM introduces its Personal Computer, which uses Microsoft's 16-bit operating system, MS-DOS 1.0, plus Microsoft BASIC, COBOL, PASCAL, and other Microsoft products. The IBM PC, based on the 8088, running at 4.77 mHz with a 160K floppy disk drive, hit the market. After waiting for the opposition to soften up the market, IBM entered the field in 1981 with the IBM "PC" and supported by the DOS operating system developed under an agreement that gave Microsoft all the profits in exchange for the development costs having been borne by Microsoft. Disregarding CP/M that had been the choice for earlier machines, IBM chose to go in a radically different direction on the marketing assumption (that turned out to be correct) that the purchasers of the PC were a different breed than those who were prepared to build their own system from a kit. Using a caricature of Charlie Chaplin as the user who was able to take the PC out of the box and immediately begin using it, IBM attracted a community of users who wanted the machine for its usefulness rather than its intrinsic engineering appeal.
So why did IBM chose the 8086 series when most of the alternatives were so much better? Apparently IBM's own engineers wanted to use the 68000, and it was used later in the forgotten IBM Instruments 9000 Laboratory Computer, but IBM already had rights to manufacture the 8086, in exchange for giving Intel the rights to its bubble memory designs. Apparently IBM was using 8086s in the IBM Displaywriter word processor. Other factors were the 8-bit 8088 (1979) version, which could use existing low cost 8085-type components, and allowed the computer to be based on a modified 8085 design. 68000 components were not widely available, though it could use 6800 components to an extent. After the failure and expense of the IBM 5100 (the first attempt at a peronal computer - discrete random logic CPU with no bus, built in BASIC and APL as the OS), cost was a large factor in the design of the PC. |
0.830249 | Most kinds of exercise are good for heart health, and hiking is no exception. It's been shown to reduce blood pressure, while giving your entire cardiovascular system a good workout. However, an advantage of hiking is that it it's a low-impact activity which protects your muscles and bones as well as providing benefits for your heart.
Hiking is a natural way of lowering blood sugar levels through sustained, low-intensity exercise. This makes it a great way of controlling type 2 diabetes, especially when blood glucose levels stay stubbornly high through stress or illness.
However, be sure to keep an eye on your glucose levels while out hiking, so you can take emergency action to boost blood sugar if you need to.
Hiking is associated with a lower the risk of many cancers. It's not clear exactly why this is, but several studies have suggested a connection.
For example, research by the American Cancer Society showed that women who hike are 25% less likely to develop breast cancer.
Whether this is a direct benefit of hiking or the result of an all-round healthy lifestyle, the statistics speak for themselves.
Frequent hiking increases your physical endurance. This helps you keep your energy levels up throughout the day, whatever activity you're engaged in.
Hiking gently strengthens your physique, including your bones and muscles. This reduces general aches and pains and is especially helpful for relieving chronic back pain. It's also thought that hiking reduces the risks of developing osteoporosis later in life.
Time spent outdoors increases the body's natural production of vitamin D. This essential nutrient can't be absorbed from food, but is created by exposing your skin to sunlight. Without enough vitamin D, you'll feel tired, lethargic, full of aches and pains, and even depressed.
Hiking gives you better mental health in other ways too. It's a way of taking your mind off your worries, and is excellent for reducing stress and anxiety. It also gives your subconscious time to work on problems in the background, often bringing solutions out of the blue.
Add to this the mood-boosting effects of spending time surrounded by nature, and hiking is a valuable part of keeping a positive mental balance in turbulent times.
Lastly, hiking is an extremely effective way of losing or controlling weight. It burns calories at a steady pace, while providing an enjoyable activity that's far removed from grueling hours in the gym.
Whether you take hiking seriously with day-long treks in the wilderness or just enjoy a regular walk in the woods, all these benefits quickly add up. For most people, life is much happier and healthier when hiking plays a major part in it. |
0.99997 | You have won this time, human!
I was unable to guess who you were after 9 questions. Congratulations on the obscurity of your dictator or sit-com character.
Here's where you can help me grow bigger and smarter. In the form below, enter your character and a yes/no question that I can use to guess the character. For example, if you were pretending to be Gilligan from Gilligan's Island, and I guessed that you were the Skipper from Gilligan's Island, a good yes/no question would be "Are you thin?" or "Do you often break things?". Please please please try to make your question as general as possible. |
0.968588 | Voxel based Terrain generation. Pointers please.
Ok, I'm new to Unity, and somewhat new to C#. I have programmed extensively in vb.NET (so I have a reasonable knowledge in .NET's core data types etc../) and also in PHP (so, other than type defining, the syntax is fairly similar when combined with vb).
Now, before I start, YES I have Googled around, but I haven't found what I'm looking for. And, NO, I'm not trying to make a minecraft clone ^_^.
What I am trying to make is a 3rd person RTS style game, but with voxel based cubic terrain. I do, however need to be able to have characters mine these blocks, so I'll need some way of knowing what type of block they are.
Now, I understand how Perlin works, and I found a good script to work from for that, so I can generate an array of smoothed noise for the terrain. However, I'm not sure how to store/draw it.
I was thinking of a 3 dimensional array (X,Y,Z) of a structure containing the block ID. The program could then look in an array of a structure containing the actual block data (texture, type, name etc...). However, my main question is how would i draw it out?
Only draw visible cubes - but how would I decide which are visible to the third person camera?
Draw meshes? I have no idea how you would actually implement this, as I'm not familiar with meshes and UVs (I think that was their name).
Any help, pointers, good reading etc would be appreciated.
I think Minecraft uses a algorithm that only shows voxels if they have at least one side that is touching a transparent block, like glass, air, water and so on.
I think they are textured by placing the UVs of each block on the right place on a texture sheet.
If you can't understand what is going on there, maybe you should look into a 3D modelling program. Just look at some beginner tutorials to understand the basic techniques.
Maybe this helps you as well: http://en.wikipedia.org/wiki/Marching_cubes Just search for marching cubes and you'll find the code for it. That algorithm will give you a smooth terrain.
Would you recommend Marching cubes over Perlin then?
Marching cubes is just a method to display the voxels, not to generate the terrain, so you'd have to use both to get a smooth terrain.
, it will show the whole texture on this quad.
It will show the upper left quarter part of the texture.
Just google it.. you'll definitely find out more about it!
Imagine a texture sheet with textures like Dirt, Stone, Grass and so on, ordered in a grid. You can easily set the UV coordinates to one of the textures, by using the coordinates of the grid.
ok, UV mapping is pretty simple, I didnt realise UV was just a way of saying XY (but without using X and Y :P).
Generate perlin noise to get the height maps.
Iterate through each block location, if the heightmap is equal to the Y coord of the current block, generate grass. If the Y coord is smaller than the perlin height, generate a random block like dirt or stone, if the Y coord is higher than the height from perlin, generate air .
Generate vertices from the block array, and use that to make a mesh?
I am still confused as to how to do step 3.
Step 3 is probably the complex part of the whole thing. I think you should only show blocks that have a transparent block directly touching them. If you do this the polygon count will be drastically reduced.
Any idea how I would determine which faces should be shown? Or should I simply just iterate through the 6 faces and look for transparent blocks? |
0.906941 | What should we look for when buying or renting a home? How can we choose a safe environment and avoid hazardous water damage that can lead to serious health issues?
1. Look for a low permeability rating (minimal chance of unwanted moisture entering the home).
The building lot should have a high enough water table and be away from underground springs. The slope of the land is a key factor to avoid water running toward the house.
2. Check crawl spaces to make sure there is no moisture.
Crawl spaces tend to be damp and are therefore a challenge for mold avoidance.
3. Does this home have a basement?
Is it finished or unfinished? If it is unfinished, make sure the dirt is dry. If it is finished, look for a history of water damage. Carpeting is a potential problem. Basements require thorough inspection, as they are a common source of mold growth.
4. Check the drainage of the home.
The roof should have overhangs to help carry drainage farther away from the structure. Check the flashing (a thin sheet used to prevent water intrusion). Improper flashing is a common cause of roof leaks. Ask about any history of roof leaks. Shingles at the eaves should project beyond the edge of the roof framing. Check gutters and downspouts to see that they are properly installed.
After your move, consider adding inexpensive splash blocks to help carry water away from the home.
5. Be sure wood siding stops well above the ground to avoid stain and rot.
6. Make sure windows are installed right side up so the weep holes drain properly.
7. Avoid central humidification systems, if possible.
8. Check to see that drip pans for cooling coils are draining properly.
9. Check the locations of the closets.
If a closet runs along an outside wall, the cold wall can meet the heated inside air and form condensation. Good quality construction will allow for proper insulation of these closets.
10. If the home appears safe and has no history of water damage, consider testing the home.
11. Be aware of chemical use in the home.
12. Consider the home’s proximity to cell towers and power lines.
There is evidence that electromagnetic radiation from cell phone towers is hazardous to health. Research is ongoing and it’s hard to say how far is “far enough”, but ideally the further away you are from a cell tower the better. (Check the location of nearby towers at Antenna Search.) For more on cell towers and health see Cell Tower Health Effects.
In addition, close proximity to power lines can be an issue. (See Living Close to Power Lines.) All homes are “close” to power lines, but the health impact decreases with distance. There are many variables with power lines, so it’s something to keep in mind when searching for a safe home.
13. Does the home have a smart meter?
Smart meters are increasingly linked to ill health. While a smart meter may not be avoidable, this too is something to keep in mind. Does the local utility offer an opt-out? How close is the meter to the sleeping areas of the home? Shielding is always an option, so this may or may not break your decision to purchase or rent. For more on smart meters see The Science – Stop Smart Meters.
I talk more about the value of your gut feeling about a home in this episode of The Connecting Place.
Nice article. I especially like the points about closets on outside walls and checking for proper installation of windows. These are points not often mentioned. As a former residential General Contractor, I’d like to throw in one additional point for each heading.
1. Look inside the sump pump crock. If it’s bone dry, that’s a good sign. If not, ask the owner how often it runs, at what times of the year, and confirm that the discharge is well away from the home.
2. My experience with crawlspaces and in talking with mold inspectors is that they’re almost always moldy. This is true even if they have a poured concrete floor. Concrete breaths moisture from the surrounding soil that easily pushes the humidity too high in these confined spaces.
3. Please consider changing your advice on vapor barriers. Those in the know within the building industry have found that finished basement walls need to be a breathable as possible. Everything from the type of insulation to the type of paint needs to be considered. Otherwise, you end up with the wall cavities being too humid. Google: Basement Insulation Systems by Nathan Yost, M.D. and Joseph Lstiburek, Ph.D., P.E.
4. One particular sore spot for me is that most stepped-flashing on brick buildings or chimneys is hardly ever tucked into the mortar joints as it should be. Instead, reckless builders apply a bead of caulk to seal this joint. Wait a few years, and they all leak.
5. Homeowners seem to think that it’s ugly to have 6-8” of foundation showing above grade. They’ll intentionally pile dirt against the building until the lower course of siding is partially covered. These walls turn into a rotting mess in short order. It’s all about a big hat (large roof overhang) and boots (foundation above grade).
6. Flashing around the windows is just as critical. The head flashing needs to be cut to lap over the top window flange. The rough window sill should get an additional layer of self-adhering flashing that is installed prior to window placement. Your suggestion to use an infrared camera will help to locate the wet areas around poorly flashed windows especially just after a rain.
7. If a home has a humidification system, open it up for inspection. If it’s moldy, walk away from the home.
8. In addition to drip pans, remove the inspection cover on the air-conditioning coil. Just like with humidifiers, if it’s moldy, run away.
9. People that have closets on outside walls that aren’t insulated properly should avoid piling boxes or hanging long coats that cover much of the wall surface. If they don’t, these colder areas will have higher humidity levels and may get moldy.
10. A building doesn’t have to smell or look moldy to be moldy. As you and I both know, indoor mold can make some extremely sick while leaving the rest less than optimal.
Hope you don’t mind these comments. Sometimes I get inspired to write a bit and this was a good chance.
Very glad to have your comments, Greg. There is so much to say on the subject. I appreciate the added detail. I’m going to remove the subject of the vapor barrier from the post. Building Biology stresses the importance of a “vapor-permeable wall” using natural materials such as earth or straw. When house hunting this is obviously difficult to find. Please feel free to add more thoughts. It’s all very helpful.
Andrea- This article is a lifesaver!!! Thank you SO much!!!!
So glad to hear, Mariah!
Thank you for this! With our house on the market… I’m nervous to find another clean home. Our last place made us really sick… And we were thankful to move, but 4 kids in one room only lasts so long? So as we look for our next place to grow roots, it’s nice to have this handy checklist to refer to.
You’re welcome, Julia! Eight of us slept in one room for six months until we could find something clean and large enough. I relate. It’s not easy.
Thank you so much for writing all this down and sharing! A good friend of mine has had experienced toxic mold and I have learned so much from her experience too. I am going to have to let her know about your, Greg , and Hybrid Rasta Mama’s pages. So much great information! I think we have been dealing with some mold issues that started in a rental we lived in many years ago. We didn’t know at the time to ditch the things harboring the spores. This probably explains the symptoms I have been struggling with. Thank you all for the information!
Thanks for the encouragement, Jeannie. All the best to you as you continue your journey.
Have you found a specific age of homes to be healthier than others? Obviously, the newest homes generally have the highest chemical load (I generally notice this in homes up to three years old, sometimes older), but did you decide there was a good rule of thumb for when a home is just too likely to have mold issues? A decade old? Two decades? More? Or was the age of the home not really something you seriously considered?
My experience has generally been that I cannot spend time in a home that is more than 30 years old, and 20 year old homes are often tricky, even for short periods. I know everyone’s level of sensitivity is different, but I wondered if this played into your screening process at all.
That’s a great question! Yes, brand new homes can still be off-gassing quite a bit. As I understand it, a home that is five-10 years old is optimal. But it’s hard to make a broad statement because some older homes are safe if well maintained and constructed.
With a history of serious mold mold exposure, when looking for a new home, do we need to use ERMI or is HERTSMI-2 sufficient?
Thank so much for helping through the years!
The best test is your gut instincts about a home. How do you feel in there? Do you feel safe? Assuming the answer is yes, then I think a HERTSMI can be enough. If there is a history of water damage or mold remediation then you would want an ERMI in my opinion – but then with a history I know that I would avoid the home. Trust your gut in my opinion.
Thanks so much!!! I know with ERMI I wouldn’t want to live in a home above a 2. What are your recommendations with HERTSMI results?
I wanted to share my experience with you. In hopes that some else won’t make our mistake. My husband and I purchased a newly built manufactured home while trying to avoid mold at all cost.
I have never had chemical sensitivity in my life, so this was not a concern. I have only been out of a moldy environment for less than three months now.
I have been sleeping outside of my new home, in my Subaru, for the last two months while my husband removed all the flooring sealing our sub floor and replacing the floor with a non toxic one and Sealing our cabinets. This did not help us and we are now geting ready to sell our home.
I have lived in manufactured homes on and off throughout my life so, I didn’t think it would an issue This was, we thoght, a less expensive option for us as we have thrown out or given away all of our belongings and lost our home due to the mold.
I feel that I should have been more cautious about MCS and manufactured homes. We were tired and needed a home, but should have researched this type of housing before we bought it.
I have been the most effected health wise in my family and am thankful that my children are grown and not in our home during this trial.
We are exhausted, but remain hopeful knowing that the Lord works all things together for our good.
Where do I find the air conditioning coil?
Go outside to my ac and then what? This is outside, correct?
No, you want something inside. Maybe refrigerator coils or ceiling fans. Anywhere dust is settled inside the home.
Thank you so much for this guidance. We have been working on our home for 8 months, and my 5yo son and I have lived in 7 different places. Unfortunately, there have been many moments when we thought we were finished, but we were not. I’m ready to give up on our house and rent for a bit while we give plenty of time to our search. Thank you, thank you.
I know it’s hard, but so much better to have knowledge. |
0.999823 | How long does it take to excavate an archaeological dig site?
Browse the article How long does it take to excavate an archaeological dig site?
This would be classified as a major operation.
In movies about archaeology and paleontology, you don't see much about fundraising time tables. Indiana Jones may have a ticking clock because he's in a race against the Nazis, but he's not working on the schedule that his funding dictates. In fact, Dr. Jones never seems to worry about the budget at all. Real life archaeologists dream about scenarios like this, but unfortunately they're met with strict deadlines that are usually set according to funding.
How long it takes to excavate an archaeological dig site all depends on how much cash a dig team has to get the job done. If it were up to the diggers, they'd probably never put the shovel down, but, like everything else, science costs money. In fact, to even begin most archaeological excavations, funding has to be in place. And the amount of money the project has in place typically determines the length of the dig, in most cases. Ideally, the budget will allow the dig team enough time to unearth everything they're looking for, but rarely are digs about finding one single item, like in the movies. Generally, a site is chosen based on the likelihood that a multitude of items could be unearthed during the course of the dig. However, in some cases a single item is the goal. In those cases, a dig may continue until that item is found, provided that funding doesn't dry up.
Here's how a dig generally works: A site is found, and an eager archeologist wants to get her hands dirty. Depending on whether she works for a museum, a university or is a freelancer, there are a few ways she can go about securing funding. Universities and museums will likely have some kind of budget already, or they may have an ongoing grant that provides funds each year. For instance, the University of Pittsburgh has an ongoing grant from the Heinz Grant Program for Latin American Archaeology that awards 10 grants per year of $8,000. So, let's say you work as a researcher at Pitt. You can apply for one of those grants through the university and then pick a site that interests you that will work within that budget. Maybe there's a Native American site nearby in Pennsylvania that would allow for a two-month dig. Or perhaps Egypt is calling your name, but you can only go for a week with the same amount of funding.
If a government body or a museum with deep pockets is behind the funding, you may be able to dig for as long as you need. But one thing's for sure, starting a site from scratch takes a lot longer than working on a site that's already been excavated. Excavation isn't as simple as bringing in the heavy machinery and plowing earth at double speed. It's a painstaking process of removing one level of earth at a time. How deep objects are found helps archeologists determine how old an item is.
Organizing and staffing a new dig is a large undertaking. Equipment and staff are brought in, put up somewhere (sometimes on site in tents), and the general area is cleared of all grass and foliage when necessary. Then the archaeologists will devise a plan for the site, map out the dig area, and the work begins. Once the dig starts, it's a slow and deliberate process to protect the area and any items workers come across. The team carefully sifts through every bucket of dirt to find the prized artifacts, and items are logged and sometimes photographed in place before removal. This can be painstakingly slow, so even a small site can take a full week or more to excavate. If it's a newsworthy site, it's likely someone will have to deal with local and perhaps national and international press, as well, which can drag out the excavation process.
For sites that are vast and protected by the government, then the dig may go on as long as funding allows. For example, at the Presidio in San Francisco, the site of an 18th century Spanish fort is set up for an ongoing year-round excavation, with the help of a volunteer program through the National Park Service. Several other sites have gone to a similar volunteer-based model after the main excavation has ended. The Crow Canyon Archaeological Center in Cortez, Colo., continues to allow visitors to assist in a dig that was officially wrapped up in 2007. So ultimately, it's not as much about how long it takes to excavate a site, but how long finances allow it.
How has radiocarbon dating changed archaeology?
Who was the first archaeologist?
How incomplete is the fossil record? |
0.999996 | Got migraines? Here's some help.
It might start with just feeling 'off'. Then the vision starts to go. Then the blinky lights set in. Then it's a frantic search for the meds of any type to try and get it before the pain starts. Sound familiar?
I'm down to maaaaybe one migraine per year (the last one was post-superbowl weekend if that's any idea). I used up all my sick days in a month at my previous-life cubicle job so this is a massive improvement, obviously. At the time, the neurologist just said it was genetic. Okee doke. This is actually how I found naturopathic medicine.
Diet, hormones, stress, genetics - all of these can cause an attack at any time. The good news is that there's a pretty good list of where to start and it's usually quite easy to determine where the culprit is based on a thorough history and seeing what else, beyond your migraines, is going on.
1. Check your food sensitivities. This goes beyond red wine and strong cheese (thankfully... not sure I could imagine a life without those). There's a simple finger-prick blood test to find food antibodies in the blood. Cut these foods out and there's likely to be a huge improvement. This is especially great if there's digestive symptoms such as IBS. Also, lots of studies link artificial sweeteners such as aspartame and now possibly sucralose to migraines. It's not a far leap to try cutting out other food additives (i.e. packaged foods) to see if you get some relief. Definitely no harm done there.
2. How's your blood sugar? Does the Incredible Hulk come out if you go to long without eating? Hint: ask your loved ones about that question. Fluctuations in blood sugar and subsequent insulin reactions can also be the cause. Generally there's also other symptoms of poor blood sugar regulation present such as fatigue, yeast infections, ovarian cysts, skin tags, or a family history of diabetes. You may be chronically stressed where elevated cortisol (our stress hormone) is causing these fluctuations.
3. Have your full menstrual cycle evaluated. From Day 1-Day__. Particularly if you're prone to migraines before your period, chances are there's other symptoms of PMS and heavier or more painful periods. Determining if it's estrogen, progesterone, or testosterone can help target where hormone regulation needs to happen. No matter which hormone's involved, supporting the liver and digestion is a must to help clear out the hormonal metabolites and remove them from the body.
4. Stress management. It's not what happens or how big or small the stress is, it's what we do with it that matters. Find a healthy outlet: exercise, talk, walk, knit, write, rock, pet a dog, etc. Cortisol influences just about every other hormone in our body, and not in a pleasant way, when it's chronically elevated. Acupuncture can help decrease cortisol as can many herbs. Magnesium is also great here as it's relaxing for muscles especially if you have charlie horses, cramps, or twitches, but it also stabilizes blood vessel spasms which can trigger migraines.
It might not be just one of these factors that are affecting you; it might be a combination of them. It might be genetics but there are common genetic mutations that are implicated in migraines, particularly surrounding vitamin B12 activation and metabolism. In my practice, the majority of migraines, if not all, have been helped by assessing each one of these factors and treating there.
Just because we all have migraines, doesn't mean they're the same migraine and that one study can apply to everyone. Gosh, this philosophy is how I fell in love with naturopathic medicine in the first place. Aw.
Aydinlar EI, et al. IgG-based elimination diet in migraine plus irritable bowel syndrome. Headache. 2013 Mar;53(3):514-25.
Finocchi C1, Sivori G. Food as trigger and aggravating factor of migraine. Neurol Sci. 2012 May;33 Suppl 1:S77-80.
Kokavec A, Crebbin SJ. Sugar alters the level of serum insulin and plasma glucose and the serum cortisol:DHEAS ratio in female migraine sufferers. Appetite. 2010 Dec;55(3):582-8.
Krejza J, Rudzinski W, Arkuszewski M, Onuoha O, Melhem ER. Cerebrovascular reactivity across the menstrual cycle in young healthy women. Neuroradiol J. 2013 Aug;26(4):413-9.
Li QQ, et al. Acupuncture effect and central autonomic regulation. Evid Based Complement Alternat Med;2013:267959. Mathew PG, Dun EC, Luo JJ. A cyclic pain: the pathophysiology and treatment of menstrual migraine. Obstet Gynecol Surv. 2013 Feb;68(2):130-40. |
0.943857 | How can i get my 7 month old to sleep on his own??
The only way that he will sleep is that i have to rock him and if i put him in his crib he wakes right up, i tried the cry it out method and he was waking up every ten minutes and i dont want to do attchment parenting..help please??
At 7 months, our ds was much like yours. I tried everything. Then my mom told me I was the same way when I was a baby and she figured out that it was the "crunchiness" of the crib mattress combined with a cold sheet on the mattress. I took her advice--covered the crib mattress with a fleece blanket, then the fitted sheet and just before putting ds down in the crib, DH would put a heating pad in the crib right where ds would be laying. DS had a warm little spot on a quiet mattress and I think he slept the whole night the first night in. Good Luck! |
0.68895 | Roe v. Wade (Jan. 22, 1973) was the epitome of liberal judicial supremacy, in which the U.S. Supreme Court created a new right in the Constitution for a woman to have an abortion at any time during pregnancy. It weakened the legitimacy of the Court, and resulted in a political reaction against it that continued for decades. The decision caused the death of more than 50 million unborn children.
The Roe decision was issued the same day as Doe v. Bolton, a companion case, which held that states could not prohibit a physician from performing an abortion after the fetus has become "viable" if the physician determines that the abortion is necessary for the "health" of the mother, which could include "physical, emotional, psychological, familial, and the woman's age," all of which the Court determined were "relevant to the wellbeing of the patient."
The women represented by "Roe" and "Doe" have both since come forward to oppose these decisions, and "Doe" has even described the deceit of the lawsuit brought in her name.
In addition to creating a new constitutional right, Roe v. Wade also created an exception to the usual rule that one must face a threat of imminent prosecution in order to have standing. In Roe, the Court held that there was standing because the alleged injury was said to be "capable of repetition yet evading review."
This decision is, therefore, one of the most famous examples of law by judicial fiat, that is, judges writing the laws. It created a dangerous precedent that is still followed today by supporters of a "living constitution."
The opinion, written by Justice Harry Blackmun, declares that abortion is a "fundamental right" under the U.S. Constitution and substantive due process under the Fourteenth Amendment. Writing for the 7-2 Court, Justice Blackmun held that abortion is a fundamental right because it falls under the "penumbra" of the right to privacy. Roe provided the underpinning for cases such as Griswold v. Connecticut and Lawrence v. Texas, all of which set up spheres of personal activity which states cannot regulate without "good cause."
”(a) For the stage prior to approximately the end of the first trimester, the abortion decision and its effectuation must be left to the medical judgment of the pregnant woman's attending physician.
(b) For the stage subsequent to approximately the end of the first trimester, the State, in promoting its interest in the health of the mother, may, if it chooses, regulate the abortion procedure in ways that are reasonably related to maternal health.
The "health of the mother" was defined to include the physical, psychological, and emotional health of the mother. There can be no requirement that the abortion reason be reported to anyone. The upshot is that any pregnant woman could get an abortion for any reason throughout the entire nine months as a constitutional right, provided that she could find an abortionist to do it.
The Roe holding was subsequently modified by Planned Parenthood v. Casey, a plurality decision which did away with the trimester framework, as well as lessening the degree of scrutiny of regulation from "fundamental rights" analysis to "undue burden analysis."
Recently the federal Partial Birth Abortion Act (upheld in Gonzales v. Carhart) approved a ban on a particular kind of late-term abortion procedure. This was the first complete ban on a particular abortion procedure found to be constitutional since Roe v. Wade.
Several cases, up for decision at the Supreme Court in the 2007 term, may whittle away at the holding of the case. Specifically, a South Dakota law banning nearly all abortions is seen as a deliberate attempt to force a test case, where "pro-life" activists will have a chance to ask the Supreme Court to reconsider Roe. However, while Roe may be highly distinguished in these cases, the fact that the central holding of Roe v. Wade is so important to modern civil rights jurisprudence suggests that the whole case is unlikely to be overturned in its entirety, based on the United States concept of stare decisis, or respect for legal precedent. Under this outlook, losing Roe's holding would be fatal to an entire constitutional structure, which the Court disfavors.
Some commentators suggest that limitations of Roe may actually be good for the "pro-choice" movement, as it would allow "pro-life" activists to vent their animosity against judicial activism, while forcing the public to create a more moderate legislative solution to the problem. These commentators perceive the American public as more moderate than either the "pro-life" or "pro-choice" movements.
Roe and subsequent decisions following it have incited intense public controversy over whether abortion is such a "fundamental right" that it overrides the right of a child to live, the right of a father to prevent the abortion of his child, and the right of states to legislate the issue in accord with the will of the people. Pro-abortion activists generally argue that it does, while pro-life activists generally argue that it does not.
This page has been accessed 76,975 times. |
0.999989 | Caring for someone with dementia can be physically and emotionally draining for caregivers. It’s often better for the patient and the family to seek the help of a nursing home with memory care units—a facility with trained staff, programs, and specially designed amenities to provide compassionate care in a safe and secure setting.
The level of assistance a patient requires increases as dementia progresses. Your family might want to keep your loved one at home for as long as possible, but this is often not the best route. A person with dementia will eventually require round-the-clock supervised care in a catered setting.
Nursing homes with memory care units have specially designed their living environments to be secure in order to prevent wandering, which is one of the most common symptoms of the disease. Residents in memory care also get the help they need with their medications, grooming, bathing, dressing, eating, and other such tasks. Memory care nursing homes provide long-term and intensive medical care for seniors that are afflicted dementia in a fully-monitored and fully-staffed facility.
Additionally, nursing homes with memory care units often have structured programs or activities designed to nurture elderly people who have dementia. The spaces (both indoor and outdoor) are designed to relaxing and secure, with trained staff always on hand.
You might be wondering—what does it cost to keep a loved one in a nursing home with memory care units? Memory care requires additional staff training and a higher staff-to-resident ratio, so costs are usually higher compared to other nursing homes and communities. Costs vary depending on factors such as the level of care needed, how big the room is and whether it’s private or semi-private, etc. Monthly costs will usually include all meals, activities and programs, laundry and housekeeping, and health management basics. |
0.988727 | : Siblings Lucy, Edmund, Susan and Peter step through a magical wardrobe and find the land of Narnia. There, the they discover a charming, once peaceful kingdom that has been plunged into eternal winter by the evil White Witch, Jadis. Aided by the wise and magnificent lion, Aslan, the children lead Narnia into a spectacular, climactic battle to be free of the Witch's glacial powers forever.
Amazing review for an amazing movie. Well done, thanks for all these The Chronicles of Narnia: The Lion, the Witch and the Wardrobe Movie Finally I get this, I can get now!
My friends are so mad that they do not know how I have all the high quality this Movie The Chronicles of Narnia: The Lion, the Witch and the Wardrobe which they do not! |
0.984358 | A likely source language of a media item can be identified by attempting an initial language identification of the media item based on intrinsic or extrinsic factors, such as words in the media item and languages known by the media item author. This initial identification can generate a list of most likely source languages with corresponding likelihood factors. Translations can then be performed presuming each of the most likely source languages. The translations can be performed for multiple output languages. Each resulting translation can receive a corresponding score based on a number of factors. The scores can be combined where they have a common source language. These combined scores can be used to weight the previously identified likelihood factors for the source languages of the media item.
The Internet has made it possible for people to connect and share information globally in ways previously undreamt of. Social media platforms, for example, have enabled people on opposite sides of the globe to collaborate on ideas, discuss current events, or share what they had for lunch. In the past, this spectacular resource has been somewhat limited to communications between users having a common natural language (“language”). In addition, users have only been able to consume content that is in their language, or for which a content provider is able to determine an appropriate translation based on a system setting or a network location (e.g., an Internet Protocol (“IP”) address or language identifier).
While communication across the many different languages used around the world remains a particular challenge, machine translation services have attempted to address this concern. These services provide mechanisms for a user to provide a text using a web form, select one or more languages, and receive a translation of the text in a selected language. While these services have significantly increased people's ability to communicate across language barriers, they can require users to open a separate website, indicate the language they want the translation in, and identify the language of the source document. The resulting translation is then shown in that separate website, which removes the content from the context provided by the original source. In some cases the translator service may not be able to locate portions of the source page to translate or may provide an unreadable version of the source website due to formatting changes resulting from the translation. In many cases, users find this process too cumbersome and may lose patience and navigate to a different website or may simply skip over text they do not understand, missing an opportunity to receive content.
FIG. 4 is a flow diagram illustrating a process used in some implementations for computing confidence scores for snippet source languages.
FIG. 5A is a flow diagram illustrating one process used in some implementations for generating scored translations of a snippet.
FIG. 5B is a flow diagram illustrating a process used in some additional implementations for generating scored translations of a snippet.
FIG. 6 is an example illustrating computing confidence scores for snippet source languages.
Various embodiments of the present disclosure may include methods, computer-readable storage media and systems for identifying a most likely source language of a snippet. An indication of the snippet may be received. Two or more possible source languages for the snippet may be determined. Two or more translations of the snippet may be generated, each having a specified translation source language. At least one of the two or more translations of the snippet may be generated having a first of the two or more possible source languages for the snippet set as the specified translation source language, and at least another of the two or more translations of the snippet may be generated having a second of the two or more possible source languages for the snippet other than the first the two or more possible source languages for the snippet set as the specified translation source language. Accuracy scores for at least two of the generated two or more translations of the snippet may be computed. A confidence factor for each of at least two selected possible source languages for the snippet may be produced, wherein the confidence factor for each selected possible source language may be produced based on one or more of the computed accuracy scores that has a source language corresponding to the selected a possible source language. The possible source language for the snippet that is associated with a highest confidence factor may be selected as the most likely source language.
In an embodiment, one or more computer-readable non-transitory storage media embody software that is operable when executed to perform a method according to the invention or any of its embodiments.
In an embodiment, a system comprises one or more processors and at least one memory, coupled to the processors and comprising instructions executable by the processors, the processors operable when executing the instructions to perform a method according to the invention or any of its embodiments.
In an embodiment, a computer program product, preferably comprising a computer-readable non-transitory storage medium, is operable when executed on a data processing system, to perform a method according to the invention or any of its embodiments.
Embodiments according to the invention are in particular disclosed in the attached claims directed to a method, a storage medium, a system and a computer program product, wherein any feature mentioned in one claim category, e.g. method, can be claimed in another claim category, e.g. system, as well. The dependencies or references back in the attached claims are chosen for formal reasons only. However any subject matter resulting from a deliberate reference back to any previous claims (in particular multiple dependencies) can be claimed as well, so that any combination of claims and the features thereof are disclosed and can be claimed regardless of the dependencies chosen in the attached claims. The subject-matter which can be claimed comprises not only the combinations of features as set out in the attached claims but also any other combination of features in the claims, wherein each feature mentioned in the claims can be combined with any other feature or combination of other features in the claims. Furthermore, any of the embodiments and features described or depicted herein can be claimed in a separate claim and/or in any combination with any embodiment or feature described or depicted herein or with any of the features of the attached claims.
Source language identification based on scoring multiple language translations is disclosed. When performing language processing on a media item, such as applying a machine translation engine, performing spelling corrections or grammar corrections, the source language of the media item can be provided as a parameter for the processing engine. Identifying the source language of a media item can be difficult, particularly where the linguistic content of the media item is short, uses slang or other words unaffiliated with a particular language, has unidentified portions, or contains errors.
Source language identification of a media item can be accomplished by performing an initial analysis of the media item based on factors such as its content and context. This initial analysis can identify one or more likely source languages and corresponding confidence scores. Multiple translations of the media item can then be performed using a machine translation engine to convert the media item, for each top scoring source language, into multiple output languages. A score can be computed for each translation indicating the quality of that translation. The set of scores that correspond to each source language can be combined to form a weighting factor corresponding to that source language. These weighting factors can then be used to adjust the confidence scores corresponding to each source language. The source language with the highest adjusted score can be selected as the most likely source language.
A “source language,” as used herein, refers to a natural language in which a media item was written in or which it currently exists. A “media item,” as used herein, can be any content that utilizes a language, including text, audio, video, etc. A “language,” as used herein, is a natural language, which is a human written, spoken, or signed language, e.g., English, French, Chinese, or American Sign Language. A language need not be a national language, e.g., English, but can be a dialect of or variation on a particular natural language or can be a separate representation of a language, e.g., Pinyin.
As an example, a media item that is a social media post about the San Diego Padres may containing the snippet: “Mi Padres r playing on television.” An initial analysis of this snippet using an algorithm that only matches words to corresponding languages may indicate English with a score of 0.87 and Spanish with as score of 0.91 as the top two scoring source languages because: “mi” means “my” in Spanish but could be a typo of “my” in English; “Padres” means “fathers” in Spanish but is commonly used in English when referring to the Padres sports team, particularly when capitalized in the middle of a sentence; “r” may not be mapped to any language or may be weakly indicative of English as it is common slang to substitute “r” for “are;” “on” may indicate English; and “television” may be ambiguous between English and Spanish as, without accents, the spelling is the same in both languages.
Continuing this example, multiple translations of the snippet can then be performed using a machine translation engine. A first set of translations can be performed converting the snippet into multiple output languages, setting the source language as English. A second set of translations can be performed converting the snippet into multiple output languages, setting the source language as Spanish. Each of the resulting translations in the first set can be scored, and these scores can be combined into an English weighting factor, which in this example is 1.12. Each of the resulting translations in the second set can also be scored, and these scores can be combined into a Spanish weighting factor, which in this example is 0.80. The English weighting factor can be applied to the English confidence score by multiplying them, to receive an updated English confidence factor of 0.97. The Spanish weighting factor can be applied to the Spanish confidence score by multiplying them, to receive an updated Spanish confidence factor of 0.73. Based on the updated confidence factors, English can be determined to be the most likely source language.
Several implementations of the described technology are discussed below in more detail in reference to the figures. Turning now to the figures, FIG. 1 is a block diagram illustrating an overview of devices 100 on which some implementations of the disclosed technology may operate. The devices can comprise hardware components of a device 100 that can identify a media item source language based on multiple translations. Device 100 can include one or more input devices 120 that provide input to the CPU (processor) 110, notifying it of actions. The actions are typically mediated by a hardware controller that interprets the signals received from the input device and communicates the information to the CPU 110 using a communication protocol. Input devices 120 include, for example, a mouse, a keyboard, a touchscreen, an infrared sensor, a touchpad, a wearable input device, a camera- or image-based input device, a microphone, or other user input devices.
CPU 110 can be a single processing unit or multiple processing units in a device or distributed across multiple devices. CPU 110 can be coupled to other hardware devices, for example, with the use of a bus, such as a PCI bus or SCSI bus. The CPU 110 can communicate with a hardware controller for devices, such as for a display 130. Display 130 can be used to display text and graphics. In some examples, display 130 provides graphical and textual visual feedback to a user. In some implementations, display 130 includes the input device as part of the display, such as when the input device is a touchscreen or is equipped with an eye direction monitoring system. In some implementations, the display is separate from the input device. Examples of display devices are: an LCD display screen, an LED display screen, a projected display (such as a heads-up display device or a head-mounted device), and so on. Other I/O devices 140 can also be coupled to the processor, such as a network card, video card, audio card, USB, firewire or other external device, camera, printer, speakers, CD-ROM drive, DVD drive, disk drive, or Blu-Ray device.
The CPU 110 has access to a memory 150. A memory includes one or more of various hardware devices for volatile and non-volatile storage, and can include both read-only and writable memory. For example, a memory can comprise random access memory (RAM), CPU registers, read-only memory (ROM), and writable non-volatile memory, such as flash memory, hard drives, floppy disks, CDs, DVDs, magnetic storage devices, tape drives, device buffers, and so forth. A memory is not a propagating signal divorced from underlying hardware; a memory is thus non-transitory. Memory 150 can include program memory 160 that stores programs and software, such as an operating system 162, language classifier 164, and any other application programs 166. Memory 150 can also include data memory 170 that can include media items; media item translations and translation engines; translation scores, combined translation scores, and scoring models; media item to source language mappings or confidence scores; configuration data; settings; and user options or preferences which can be provided to the program memory 160 or any element of the device 100.
FIG. 2 is a block diagram illustrating an overview of an environment 200 in which some implementations of the disclosed technology may operate. Environment 200 can include one or more client computing devices 205A-D, examples of which may include device 100. Client computing devices 205 can operate in a networked environment using logical connections 210 through network 230 to one or more remote computers such as a server computing device.
Client computing devices 205 and server computing devices 210 and 220 can each act as a server or client to other server/client devices. Server 210 can connect to a database 215. Servers 220A-C can each connect to a corresponding database 225A-C. As discussed above, each server 220 may correspond to a group of servers, and each of these servers can share a database or can have their own database. Databases 215 and 225 can warehouse (e.g. store) information such as media items; media item translations and translation engines; translation scores, combined translation scores, and scoring models; or media item-to-source language mappings or confidence scores. Though databases 215 and 225 are displayed logically as single units, databases 215 and 225 can each be a distributed computing environment encompassing multiple computing devices, can be located within their corresponding server, or can be located at the same or at geographically disparate physical locations.
A “language snippet” or “snippet,” as used herein, is a digital representation of one or more words or character groups. A snippet can be a representation of a media items or language from a media item. While the description below refers to snippets when performing source language classification on media items, other language formats can be used such as audio or video language representations.
General software 320 can include various applications including an operating system 322, local programs 324, and a BIOS 326. Specialized components 340 can be subcomponents of a general software application 320, such as local programs 324. Specialized components 340 can include pre-translation language identifier 344, translators 346, translation scoring models 348, confidence score generator 350, and components which can be used for controlling and receiving data from the specialized components, such as interface 342. In some implementations, components 300 can be in a computing system that is distributed across multiple computing devices or can include an interface to a server-based application.
Pre-translation language identifier 344 can be configured to perform an initial source language classification of a snippet, such as a snippet received through interface 342. This initial source language classification can identify one or more languages of a snippet with a corresponding confidence value. The identified languages can be sorted based on their confidence value and languages with a confidence value above a threshold level can be selected for further analysis. For example, the threshold level can be 1, 3, 5, or 10 potential source languages; the top 1, 3, 5, 10, 25 or 50% potential source languages; all potential source languages with a confidence value above 50%, 60%, 75%, 80%, or 90%; or all the potential source languages can be selected for further analysis. Initial source language classification can be based on an analysis of the content of a snippet, such as which words are used, the structure and grammar in the snippet, the slang terms used, punctuation, etc. Initial source language classification can also be based on an analysis of the context of a snippet, such as who the author is and what is known about them and who their friends are, when the snippet was created, where the snippet was posted and what other information is available about the other items in that location, etc. Examples of classifying media items in this manner is discussed in further detail in U.S. patent application Ser. No. 14/302,032, incorporated herein by reference.
Translators 346 can be one or more machine translation engines. Machine translation generation engines can be programs that take a snippet as input and generate a version of the snippet in another language or dialect. In some implementations, one of the translators 346 can be setup to perform a translation for a particular source language, output language, or both. In some implementations a translator 346 can be a setup to perform translations from multiple source languages or to multiple output languages as defined by a parameter provided to the translator. Translators 346 can use various language models, sets of rules, or other algorithms to perform the conversion of a snippet from a source language to an output language. The translators for various source/output languages or source/output language parameters can be selected for further analysis by pre-translation language identifier 344 based on languages with a confidence value above a threshold level.
Translation scoring models 348 can receive translations from translators 346 and can be configured to provide an estimation of the quality of the translations. In some implementations, translation scoring models 348 can be one or more trained models, such as neural networks, that can provide a score for a translation. In some implementations, one of the translation scoring models 348 can be set up to perform an analysis of a translation for a particular source language, output language, or both. In some implementations, one of the translation scoring models 348 can be set up to perform an analysis of multiple source languages or to multiple output languages. Translation scoring models 348 can provide a score for each translation. In some implementations, translators 346 can be selected or configured to create multiple translations of the snippet applying the same source language and multiple different output languages. In these cases, a combined score for the source language can be created, such as by averaging the various scores for translations that share a source language. The scores can be configured to be a weighting factor for the confidence scores generated by pre-translation language identifier 344. For example, a score of 1 would be a neutral score, a score of 0.9 would decrease the confidence value by 10% and a score of 1.1 would increase the confidence value by 10%.
Confidence score generator 350 can receive the weighting factors from translation scoring models 348 and the confidence values for identified possible source languages from pre-translation language identifier 344. Confidence score generator 350 can then use the weighting factors to update the confidence values of the identified possible source languages. The resulting identified possible source language that has the highest updated confidence value can be selected as the most likely source language for the snippet. This identification can be returned through interface 342.
FIG. 4 is a flow diagram illustrating a process 400 used in some implementations for computing confidence scores for snippet source languages. Process 400 begins at block 402 and continues to block 404. At block 404, process 400 can receive a snippet for which a source language is to be determined. In various implementations, snippets can be selected for process 400 based on an identified source language for the snippet having a low confidence value or an indication that the snippet is important or may have a large readership, such as where the author is a celebrity or is someone who creates snippets that are typically seen/shared by many people, where the topic of the snippet is about a popular issue which attracts many people's attention, or where a snippet has had lots of engagement in a short time after its creation.
At block 406, process 400 can perform an initial source language identification on the snippet received at block 404. Performing initial source language identification of the snippet can comprise analyzing the content and/or context of the snippet. Analyzing the content of the snippet can include determining which words in the snippet matchup to which languages; whether the grammar in the snippet is indicative of a particular language; whether the structure of the language in the snippet is indicative of a particular language; whether punctuation such as accent marks are used; what type of characters are used; etc. Analyzing the context of the snippet can include determining whether the time a snippet was created is indicative of a particular language or region; determining whether the virtual location a snippet is posted to, or other media items at that location, are indicative of a particular language; or whether information available about the author of the snippet is indicative of a particular language. For example, a snippet is likely to be written in a language known by its author or friends of the author. Additional details about performing initial source language identification can be found in U.S. patent application Ser. No. 14/302,032. In some implementations, the identifications of initial source languages can include confidence values. The confidence values can be based on the type or factors from the content or context analysis that yielded a source language identification or how strongly one of more factors indicates a particular language.
At block 408, one or more top most likely source languages can be identified. This can be accomplished, for example, by selecting potential source languages that have a confidence value above a threshold. In some implementations, selecting the top most likely source languages can include selecting all potential source languages.
At block 410, process 400 can generate scored translations for the top most likely source languages determined at block 408. Generating scored translations can include applying, to the snippet, translators configured for different source or output languages; applying scoring models to the resulting translations; and, where multiple translations are created for the same source language, combining scores for translations with the same source language. Additional details regarding generating scored translations are discussed below in relation to features 5A and 5B. In some implementations, blocks 406 and 408 can be skipped or only a simplified most likely language analysis can be performed. If blocks 406 and 408 are skipped, block 410 can be performed for all possible source languages or for a specified set of common source languages.
At block 412, process 400 can adjust the confidence factors for one or more of the possible source languages identified at block 406. In some implementations, the scores from block 410 can be weighting factors. In some implementations adjusting the confidence values can include multiplying the weighting factors from block 410 with the confidence values determined in block 406. In some implementations, the scores determined at block 410 corresponding to particular source languages can be used as the updated confidence values by replacing the values determined at block 406. The potential source language with the highest adjusted confidence value can be selected as the most likely source language for the received snippet. An identification of this most likely source language or one or more of the translations corresponding to this most likely source language can be returned. Process 400 continues to block 414, where it ends.
FIG. 5A is a flow diagram illustrating a process 500 used in some implementations for generating scored translations of a snippet. As discussed below, in some implementations, process 500 can create translations with different output languages for each of multiple potential source languages. This can be a computationally intensive procedure, and therefore it may be performed “offline” such as at the time of creation of a post to a social media site, before the post has been selected to be displayed. Process 500 begins at block 502 and continues to block 504. At block 504, process 500 can receive a snippet. In some implementations, the snippet can be the one received by process 400 at block 404.
At block 506, process 500 can obtain one or more translators. In some implementations, the obtained translators can be one or more machine translation engines. While translators are discussed below as being individually configured for a particular source or output language, in some implementations, the same translator can be used for multiple source or output language by setting parameters for which source or output language will be applied. In various implementations, the translators may be configured for a particular output languages or may be configured for multiple output languages. In some implementations, the obtained translators can correspond to source languages that have been determined to be a likely source language for the received snippet, such as may be determined by the process at block 406.
At block 508, the first obtained translator is set as a selected translator. At block 510, the selected translator, which presumes a particular source language generates a particular output language, can be applied to the received snippet, creating a translation of the snippet. At block 512, process 510 can compute a score for the translation created at block 510. In some implementations, models can compute the confidence score of a translation given the source and output languages. In some implementations, scoring models can be trained constructs, such as neural networks, or can use other analysis techniques such as grammar analysis and decision trees.
At block 514, process 500 can determine whether any of the translators obtained at block 506 have not been applied to the received snippet. If so, process 500 continues to block 516. If not, process 500 continues to block 518. At block 516, process 500 sets the next unused translator, from the translators received at block 506, as selected translator. The loop between blocks 510 through 516 will continue until a scored translation has been obtained corresponding to each of the translators detained at block 506.
At block 518, if there are multiple translations with the same source language but different output languages, the scores for translations with the same source language can be combined, such as by averaging them. At block 520, the combined scores computed at block 518 or scores computed at block 512 can be returned. In some implementations, the corresponding translations can also be returned. Process 500 then continues to block 522, where it ends.
FIG. 5B is a flow diagram illustrating process 550 used in some additional implementations for generating scored translations of a snippet. Process 550 can be less computationally expensive than process 500. Thus, process 558 can be used when timeliness is essential, such as after a request for the snippet has been made. Process 550 begins at block 552 and continues to block 554. At block 554, process 550 can receive a snippet. In some implementations, the received snippet can be one that was received at block 404.
At block 556, an identification of a user who requested content containing the snippet can be received. At block 558, a language associated with the user identified block 556 can be identified. Identifying a language associated with a user can be based on factors such as setting specified for the user, e.g. browser settings or profile settings; a history of languages associated with content items created by the user; content items the user tends to interact with; languages associated with friends of the user; etc. Additional details about identifying a language associated with a user can be found in U.S. patent application Ser. No. 14/302,032.
At block 560, process 550 can obtain translators, e.g. machine translation engines, that generate translations for various source languages into an output language corresponding to the language identified at block 558. In some implementations, the obtained translators can be limited to those that specify a source language corresponding to one of the top most likely source languages identified at block 408.
At block 562, the translators obtained at block 560 can be applied to the snippet received at block 552 to obtain one or more translations of the received snippet. Each applied translator can presume a particular source language and can generate a translation in the language identified at block 558. At block 564, process 550 can score the translations created at block 562. As discussed above in relation to block 512, scoring translation results can comprise applying a scoring model. Scoring models can take a translation and a source snippet and compute a quality score for the translation, which can be based on parameters such as the specified source or output language.
At block 566, process 550 can return the translation scores. In some implementations, process 550 can also return the corresponding translations. Process 550 then continues to block 568, where it ends.
FIG. 6 is an example 600 illustrating computing confidence scores for possible source languages of a snippet. Example 600 includes a snippet 602, a language identifier 604, initial source language scores 606, translators 608, translation scoring models 610, translation scores 612, score updater 614, and updated source language scores 616. Snippet 602 can correspond to the snippet discussed above in relation to block 404. Language identifier 604 can correspond to the pre-translation language identifier discussed above in relation to block 344. Translators 608 can correspond to the translators discussed above in relation to block 346. Translation scoring models 610 can correspond to the translation scoring models discussed above in relation to block 348. Score updater 614 can correspond to the confidence score generator discussed above in relation to block 350.
In example 600, a snippet is provided to language identifier 604 at step 650. In this example, the snippet comprises “Check it: sto imparando un nouveau langua!” This snippet has features of several languages: “Check it” (English); sto imparando (Italian); un (French, Italian, or Spanish misspelling); nouveau (French); langua (close misspelling in any of French, Italian, or Spanish). Also, this snippet was posted to a comments section on a social media website for an article written in French, by a user known to generally speak Spanish, but who has many French speaking friends, and was posted from an IP address associated with a location in the United States that has mostly English speakers. At step 652 of example 600, language identifier 604 can identify initial source language scores 606. Identifying initial source language scores 606 at step 652 can correspond to block 406. In example 600, based on the above factors, French is the top scoring most likely source language, with Spanish a close second, and Italian also having a likelihood above 75%.
In example 600, this snippet is selected for further analysis because of the closeness of the top scoring possible source languages and because the author is a celebrity that has a history of having her posts to the social media site viewed by many other users. Thus, at step 654 a-654 e, the snippet is provided to translators 608 to have multiple translations of the snippet performed, each using a different combination of source language and output language. In example 600, a threshold initial confidence factor of 50% is set, so translations are performed for potential source languages: French, Spanish, Italian, English, and German, as these are the possible source languages in example 600 that have an initial confidence score above 50%. At step 654 a, for example, the snippet is translated assuming French as a source language and creating translations in output languages including Spanish, Chinese, Japanese, and others. Using translators to generate translations for different source and output languages can correspond to blocks 508-510.
At step 656, the resulting translations can be provided to translation score models 610. At step 658, the translation score models 610 can score each of the translations and determine a combined score for translations that have a common source language. In example 600, the translations with a source language of Italian received scores for output languages: Spanish of 1.12, Chinese of 1.32, Japanese of 0.87, English of 0.99, French of 1.21, and other scores. The combination of these scores for the Italian source language, for example, is 1.09. Determining scores and a combination scores for a source language can correspond to blocks 512 and 518.
At steps 660 and 662, the initial source language scores 606 and the combined translation scores 612 are provided to score updater 614. At step 664, score updater 614 can provide updated source language scores 616 by using the combined translation scores 612 as weighting factors for the top scoring initial source language scores 606. For example, Italian is determined to be the most likely source language based on the multiplication of its initial source language score 0.78 multiplied by its combined translation score 1.09. Updating the initial source language scores to determine updated source language confidence scores can correspond to block 412. In example 600, Italian can now be selected as the most likely source language for snippet 602 because it has the highest updated source language confidence score.
Several implementations of the disclosed technology are described above in reference to the figures. The computing devices on which the described technology may be implemented may include one or more central processing units, memory, input devices (e.g., keyboard and pointing devices), output devices (e.g., display devices), storage devices (e.g., disk drives), and network devices (e.g., network interfaces). The memory and storage devices are computer-readable storage media that can store instructions that implement at least portions of the described technology. In addition, the data structures and message structures can be stored or transmitted via a data transmission medium, such as a signal on a communications link. Various communications links may be used, such as the Internet, a local area network, a wide area network, or a point-to-point dial-up connection. Thus, computer-readable media can comprise computer-readable storage media (e.g., “non-transitory” media) and computer-readable transmission media.
selecting, as the most likely source language, the possible source language for the snippet that is associated with a highest confidence factor.
wherein producing the confidence factor for the common specified translation source language is based on the combined accuracy score for the multiple translations each with that common specified translation source language.
wherein producing the confidence factor for at least a selected one of the possible source languages comprises updating the initial confidence value for the selected one of the possible source languages using the combined accuracy score corresponding to the selected one of the possible source languages.
wherein the confidence factor for the common specified translation source language is the combined accuracy score.
wherein each initial confidence value indicates, for a corresponding possible source language, a confidence that the corresponding possible source language is a language of the snippet.
wherein the first of the two or more possible source languages is selected based on the corresponding initial confidence value for the first of the two or more possible source languages being above a threshold value.
wherein performing the initial source language identification for the snippet comprises an analysis of a context of the snippet.
selecting from the generated two or more translations of the snippet, as translations of the snippet, the translations where the specified translation source language is the language selected as the most likely source language of the snippet.
wherein the generated two or more translations of the snippet are each in an output language matching the output language associated with the viewing user of the snippet.
wherein computing the accuracy scores is performed by a translation scoring model that is trained to generate translation scores with training data comprising data points each including an input snippet, an output snippet, and a score.
wherein the method is performed in response to a request that requires a translation of the snippet.
wherein the method is performed in response to creation of the snippet or posting of the snippet to a social media website.
producing a confidence factor for each of at least two selected possible source languages for the snippet, wherein the confidence factor for each selected possible source language is produced based on one or more of the computed accuracy scores that has a source language corresponding to the selected possible source language.
selecting from the generated two or more translations of the snippet, as translations of the snippet, translations where the specified translation source language is a language with a highest confidence factor.
wherein the interface is further configured to provide from the generated two or more translations of the snippet, as translations of the snippet, translations where the specified translation source language is the possible source language with the highest confidence factor.
MX2018003490A MX2018003490A (en) 2015-09-22 2015-09-23 Universal translation. |
0.951892 | Have you thought of “technological unemployment,” where machines take all our jobs?
The outcome will depend on how things are distributed. Everyone can enjoy a life of luxurious leisure if the machine-produced wealth is shared, or most people can end up miserably poor if the machine-owners successfully lobby against wealth redistribution. So far, the trend seems to be toward the second option, with technology driving ever-increasing inequality. |
0.948555 | What are all the valid self-closing elements (e.g. <br/>) in XHTML (as implemented by the major browsers)?
I know that XHTML technically allows any element to be self-closed, but I'm looking for a list of those elements supported by all major browsers. See http://dusan.fora.si/blog/self-closing-tags for examples of some problems caused by self-closing elements such as <div />.
Every browser that supports XHTML (Firefox, Opera, Safari, IE9) supports self-closing syntax on every element.
<div/>, <script/>, <br></br> all should work just fine. If they don't, then you have HTML with inappropriately added XHTML DOCTYPE.
DOCTYPE does not change how document is interpreted. Only MIME type does.
The HTML WG has discussed this issue: the intention was to allow old (HTML-only) browsers to accept XHTML 1.0 documents by following the guidelines, and serving them as text/html. Therefore, documents served as text/html should be treated as HTML and not as XHTML.
If it's red, it's HTML. Green is XHTML.
It validates, and in real XHTML it works perfectly (see: 1 vs 2). If you can't believe your eyes (or don't know how to set MIME types), open your page via XHTML proxy.
Another way to check is view source in Firefox. It will highlight slashes in red when they're invalid.
In HTML5/XHTML5 this hasn't changed, and the distinction is even clearer, because you don't even have additional DOCTYPE. Content-Type is the king.
Empty-element tags may be used for any element which has no content, whether or not it is declared using the keyword EMPTY.
The self-closing syntax works on all elements in application/xhtml+xml. It isn’t supported on any element in text/html, but the elements that are “empty” in HTML4 or “void” in HTML5 don’t take an end tag anyway, so if you put a slash on those it appears as though the self-closing syntax were supported.
What about <meta> and <link>? Why aren't they on that list?
Quick rule of thumb, do not self-close any element which is intended to have content, because it will definitely cause browser problems sooner or later.
The ones which are naturally self-closing, like <br> and <img>, should be obvious. The ones which aren't ... just don't self-close them!
The last time I checked, the following were the empty/void elements listed in HTML5.
As for XHTML served as application/xhtml+xml (which makes it XML), XML rules apply and any element can be empty (even though the XHTML DTD can't express this).
They're called "void" elements in HTML 5. They're listed in the official W3 spec.
A void element is an element whose content model never allows it to have contents under any circumstances.
Another self closing tag problem for IE is the title element. When IE (just tried it in IE7) sees this, it presents the user a blank page. However you "view source" and everything is there.
I originally saw this when my XSLT generated the self closing tag.
For this, I have simply resorted to always giving it a separate closing tag, since once it's up there in the <head></head> it doesn't really make your code any messier to work with anyway.
In the following piece of code, the destructor of class TdcTestResult is called at the end of function add, and so method variable mTdcTestResults will become empty again.
2334 How to target a specific <img> element of a div in CSS?
5680 If you were programming a calendar in HTML would you use Table tags or Div tags?
1935 What is semantic markup, and why would I want to use that?
3773 How to access HTML element without ID?
4792 What happens when I click the Stop button on the browser?
4258 Better to develop cross-browser code up front or develop for one browser and go back and make it work in the others later?
How do I change an image source with CSS?
Need a row count after SELECT statement: what's the optimal SQL approach?
Target only the selected data attributes? |
0.999999 | What is 3D mechanical engineering and design software?
Mechanical engineering and design software helps engineers and designers visualise, analyse and communicate design intent before building a physical prototype. Mechanical engineering software is employed across an array of disciplines, from manufacturing (US site) and architecture (US site) to sustainability. It is used to design everything from cars to prosthetics to headphones.
Computer-aided design (CAD) is one of the most ubiquitous software design tools. The models generated by CAD software are often used as inputs to other mechanical engineering and design tools.
Computer-aided engineering (CAE) is a broad term for software used in aiding engineering analysis. CAE software can perform complex tasks such as finite element analysis (FEA) and computational fluid dynamics (CFD), among others.
Computer-aided manufacturing (CAM) refers to the use of software to help automate the manufacturing process. CAM is typically used after a design has been developed with CAD software and is validated using CAE software before manufacturing.
HVAC design software is used to design indoor spaces that meet temperature and air quality requirements. It is often used in the design of large office and industrial buildings.
Product data management (PDM) software helps engineers with document management and revision control.
Each product starts as a concept, which can take the form of sketches, specifications or constraints that dictate design requirements. A product designer, or usually a team of product designers and engineers, then takes the concept and, using mechanical engineering software, turns the concept into a comprehensive product design. The final design must be manufacturable, that is, be able to meet manufacturing requirements, such as the ability to withstand specified stresses and strains while minimising the final product's weight. This design phase can take several iterations and refining. It can also include a design simulation phase, using software that tests and validates the product design before the final step of manufacturing.
Use the same 3D mechanical engineering software as the top engineers and designers from around the world.
Autodesk supports nonprofit organisations and entrepreneurs using design for positive impact.
Fusion 360 combines industrial and mechanical design with collaboration in an easy-to-use, affordable 3D CAD tool.
Make great products with professional-grade 3D mechanical, documentation and product simulation tools.
Choose an AutoCAD software tailored to mechanical engineers, including AutoCAD Mechanical and AutoCAD MEP.
Try an integrated CAM solution that works in any CAM programming environment.
Organise design data, manage documentation and track revisions and other development processes.
Validate products to better understand the implications of design choices before manufacturing.
Next generation cloud-based product lifecycle management.
Tinkercad is a free web-based 3D design tool for hobbyists, teachers and students of all ages.
Access an expanding repository of mechanical engineering resources to inspire new ideas, deepen your skillset and gain insight into trends in your industry.
A designer shares his design process and the tools that helped him to get there.
Vantage Power was able to prototype its design in a very short time, without investing a lot of money and resources for new software.
AguaClara, a Autodesk Cleantech Partner, invented a tool to filter water using only the sun and gravity.
Quick tips to make you a more productive designer. |
0.985066 | adding Wasteland to Torment pledge?
I don't know if I'm just being dumb about this, or if the option is no longer available: I backed Torment, and now I want to purchase the add-on of a Wasteland 2 DRM code.
I can't figure out how to do this on the Torment website: all I can see is the option to buy both games together for 6,500 points -- I can search up Wasteland by itself for 2,500 points, but I don't see a way to actually buy it.
Re: adding Wasteland to Torment pledge?
They were still being rolled out: they should be available now to existing backers who had access to them (not to new backers), check again!
So, it's still a little confusing though: the only way to get points is to pledge for a specified reward -- the smallest is $30 for a copy of Torment. But I already have a copy of Torment. So if I pledge another thirty dollars, will I get not an additional copy of Torment but 3,000 points, of which I can then spend 2,500 on Wasteland (and I guess 500 on something that costs 500 points)?
The pledges page in the account section now has a "pledge any amount" button. You can use that to get the points you need for the Wasteland 2 add-on.
For WL2 rewards please do note they're not available to all backers. There's a time cut-off on the $25 add-on, existing backers from some time ago can get it (you'll see it listed), but new backers can not.
The Torment/Wasteland 2 bundle still seems to be the only way to get Wasteland 2 via pledges to the Torment project.
I am planning to obtain "Torment: Tides of Numenera - Collector's Edition (Digital)" and getting Wasteland 2 as an add-on would be a nice "pretext" for pledging additional money to Torment. The alternatives - a: getting the Collector's Edition plus the Torment/Wasteland 2 bundle or b: getting the bundle and many small add-ons - aren't very tempting due to price and duplicated and/or missing items.
Is there any hope Wasteland 2 could be available as an add-on again (now that Game of the Year Edition will be coming out)? |
0.999998 | Can you provide me the syllabus on which the question paper is based of Karnataka Management Aptitude Test (KMAT) as I need it for preparation of the exam?
English language ability would be tested through questions on Grammar, vocabulary, sentence completion, synonyms, antonyms, comprehension of passages etc. There would be questions on understanding of the contents of the passages and choice of appropriate words, phrases, expressions and similar language skills. This shall include the passages with questions based on their contents to test comprehension.
The questions in this section will be of matriculation standard. This shall include questions to know how fast and accurate you can work with numbers, do numerical calculations, understand various arithmetic problems involving ratio & proportion, percentage, interest, time & speed etc. Apart from Arithmetic, the questions may also be based on Algebra, Geometry, Trigonometry and parts of mathematics. This test also helps to measure your power of quantitative reasoning, interpretation of tables, common graphs & charts.
No specific syllabus can be defined for General Awareness However, it may contain questions on current and conventional General Knowledge on various issues past and present. |
0.999721 | In Skyrim, adding the skyrim dawnguard dlc to the game allows the hero to add the werewolf skill tree to the game. However, the hero must be inflicted with werewolf lycanthropy before he can access the werewolf skill tree perks. Being a werewolf adds a different dimension to the skyrim game, and allows the hero werewolf to run, heal and fight through multiple enemies like knife through butter (or multiple slabs of butter), especially as the hero werewolf progresses up the werewolf skill perks. This will summarize the route to turning into a werewolf and will guide the hero through the initial progression of the werewolf skills perks and attempt to evaluate the usefulness of the werewolf skill perks in the dawnguard dlc.
To get the werewolf skill tree, the hero must first become one of the Companions. Then the hero must subdue a fellow fighter in hand to hand combat. Next, the hero must take Farkas as his shield-brother to retrieve a valued fragment from the Silver Hand and the draugr. On return, the hero must seek work from the companions. Finally, the hero will report back to the companions and be taken to complete the blood ritual to get the werewolf skill tree perk.
When the hero first turns into the beast, he will lose control and wake up naked in a field with Aela looking over him. Aela asks the hero to take on the Silver Hand in the Barrow Downs. This is where the hero can use beast form to turn into a werewolf. The silver hand members will succumb to the claw attacks of the werewolf. The silver hand members are all human, and their corpses will be susceptible to feeding by the hero werewolf when they are defeated. With each heart consumed, the werewolf will become more powerful, and gain a little progression up the werewolf skill tree. Feeding is also needed to maintain bloodlust and stay in werewolf form. Otherwise the hero reverts back to human form and cannot transform into werewolf for another 24 hours. This is a very long time in Skyrim.
Finally, the hero werewolf will have fed on enough corpses to progress and gain the first werewolf skill perk. With more feeding, the werewolf will progress even further and gain more and powerful werewolf powers. The first werewolf skill perk so obtained is likely to be the first stage of bestial strength, where the werewolf's damage is increased by 25%. There are four stages to this, allowing the werewolf damage to be doubled eventually.
totem of ice brothers - this allows the werewolf to call on ice wolves to come aid him.
totem of werewolf - this allows the werewolf to call on werewolves to come help him.
totem of fear - this allows the werewolf to spread his aura of fear to high level creatures.
totem of the predator - this allows the wererwolf to look for prey or enemies.
animal vigor - the werewolf gains 100 points in health and stamina.
gorging - restores twice the amount of health to the werewolf when he feeds.
savage feeding - the werewolf no longer consumes human cadavers to improve bloodlust, but can feed off most dead creatures.
These werewolf skills may not be that useful in Dawnguard compared to the vampire lord skill tree. For example, in the initial dimhollow crypt dungeon crawl, the hero encounters mostly vampires and undead (draugr or skeletons). Turning into a werewolf is unsustainable throughout the whole dungeon crawl as the werewolf has no suitable material to feed on. For this particular adventure, it may be more suitable to reserve the beast form skill to use until the hero comes face to face with the gargoyles. As Dawnguard progresses, if the hero sides with the Dawnguards, then the majority of enemies will be undead and vampires. Again, the werewolf beast form should only reserved for the boss fights at each stage. At other times within each quest, the werewolf beast form is unsustainable throughout each dungeon crawl.
The hero werewolf may have to wait for a separate werewolf quest dlc to fully appreciate and use the various werewolf perks within the werewolf skill tree. In the meantime, the hero werewolf may want to side with the dawnguards. |
0.999642 | upgrading from a 1GB Elpida to a 4GB memory chip (KEMBONA SODIMM LAPTOP DDR2 4 GB 4G 800 MHZ PC2-6400 RAM)?
which other socket types would also fit and be compatible.
I apologize if this has been asked before, in this fashion, please point me to the previous questions.
The CPU and RAM are used for different things - the RAM is the amount of random access memory that is available to the system - which directly affects how many programs it can run at once. The CPU's clock speed tells you how many operations can run per second. The number of cores directly affects how many programs you can run concurrently (truly concurrently - different to threads, which is where a CPU splits the execution of programs using a time division).
If you find your RAM filling up with famous candidates like Photoshop or Google Chrome, then you may wish to upgrade that so you can run more at once. Upgrading your RAM also means that your OS won't need to free up the RAM that often, leading to smoother running of applications. If however your RAM can handle your workload but everything is too slow, then the CPU could use an upgrade. You should consult the service manual for your specific laptop to see what CPU's can fit and be supported - not all that fit may work. For example, there are a list of CPU FRU's for select Thinkpads (where the CPU is socketed) that tell you what CPUs can be installed.
It's impossible right now to tell you exactly what to upgrade, because of the vagueness of your question and no information about your workload, but you can do more research on what would make your experience better and upgrade accordingly.
In general, the problems one has to solve by using a computer, will grow over the years (...that is, require the manipulation of more data than today, e.g. larger images in digital photography, more chunky apps, and so on).
more RAM will allow to apply your machine to more (=larger) problems.
If you are planning to extend the usable lifetime of your machine, and are willing to practice patience, go for more RAM. "Swapping to disk" is only a makeshift here and will in addition waste CPU cycles while simulating RAM.
You have to identify what is limiting your machine regarding your use. To know it, when your PC seem tonbe slow, check with process manager if the CPU is full or the memory close to be and upgrade the limiting component (CPU or RAM) in function of your personal result.
I wpuld argue that, if you need to choose, get more RAM. After HDD, RAM is typically the bottleneck that slows down most systems. As most modern systems are designed with an expectation of > 2 gigs of RAM, with 4 being anything entry level and 8 being typical, RAM will make a huge difference. (Even a typical low-mid range Cellphone. now sports 3 gigs of RAM).
With respect if CPU, the third CPU is only about twice the speed if the first one. (The second one listed is about 1.7 x as fast). A basic new entry level sysyem will typically be 3-5 times as fast as your current CPU, but will also include specific speedup functionality not available on a 9+ year old cpu - Im specifically thinking of graphics (video playback and rendering) and AES (encryption offload). For these reasons I conclude that neither chip will give the system the kind of speed boost you might think. Apps which are not CPU/GPU intensive will work anyway. Apps which are wont.
IMHO, unless you gave a specific use case, dont waste any money on that system - its well past its use-by date. Id honestly expect a midern mid-range cellphone to be more powerful. A chromebook or entry level $200 Windows laptop will provide better bang for buck, usable battery and better perfornance.
Not the answer you're looking for? Browse other questions tagged laptop memory cpu performance upgrade or ask your own question.
Intel® Core™2 Duo Desktop Processor vs Intel® Core™ i3 Desktop Processor?
In terms of performance, which processor is more suitable?
Which pins to mod on Intel Celeron E3300?
Can i put my “Intel Core 2 Duo E8200” on “Intel Q965 Express chipset”?
What memory do I need for my new CPU?
Solution Virtualization not Supported, BIOS missing virtualization option?
Motherboard with FSB faster than RAM support?
Why did my laptop refuse to start? |
0.999991 | Motorola RAZR H3, a Bluetooth headset from Motorola which originally designed for Motorola RAZR V3 mobile phone. However, it can be used with wide range of devices that support Bluetooth 1.1 or 1.2. The headset weighs 19g, with talk time of up to 8 hours and standby time of up to 150 hours, plus superior audio quality, and an ergonomic futuristic design.
treocentral reviewed Motorola RAZR H3 and rated the Bluetooth headset 3 out of possible 5. They concluded the Motorola RAZR H3 headset is a good choice for RAZR mobile phone users or Treo users who want a futuristic-looking headset. It has decent sound quality but suffers from some usability issues with the action button. You also pay for its good looks. If I could give half-star ratings, this would be a 3.5 star headset. |
0.990499 | Create a logo and brand to represent Tyagarah Apiaries PL and their range of medical honey. Specific focus on the Jellybush or Leptospermum flower, leaf and seed pod. Allow clear distinction of varied strength grading of honey. Targeting domestic, alternative healthcare and mainstream medical sectors world wide.
Tyagarah Apiaries is a unique Apiarist business located on the North Coast of New South Wales that specialises in producing premium medicinal grade honey. The honey is sourced from the Leptospermum or Jellybush plant and demonstrates equal or greater therapeutic strength as the famed New Zealand Manuka honey.
Insightfully, CEO of Tyagarah Apiaries, Michael Howes recognised this as early as 2002 and he and I have been developing public awareness of the Jellybush alternative ever since.
We worked very closely together on the logo which had to be simple yet descriptive of the flower and easily employable over all future assets especially a range of “Active” or therapeutically graded honeys. We then set about applying the new identity to the organisation and it’s products in a series of marketing “experiments” which evolved to be a novel example of effective “co-branding”, since the central logo came to represent both Tyagarah Apiaries and it’s products.
It also had to co-exist with other branded elements including the trade mark, “Australia’s Manuka” and hexagon icon denoting the product’s graded strength.
Finally it was critical that the vision be flexible enough to allow for targeting of three broad demographic sets; Domestic Users, Alternative Health Providers and Medical Professionals.
This was achieved by maintaning the simplicity of the central assets while allowing the ancillary components to “float” around them depending on which sector was being targeted during a given campaign. |
0.955229 | Consider the following hypothetical scenario: Jim is hired by ABC Stores as Executive VP of Sales and Marketing. His 3-year employment contract states that all managers at ABC's stores are required to coordinate their in-store marketing efforts through him, including securing his approval of all vendors. Six months later, ABC brings in its CFO's son Peter into the company, who has just received his MBA. Within one week of Peter starting his job at ABC, Jim notices that 3 of ABC's 25 store managers failed to forward him their monthly marketing proposals. Two months later, that number increased to 20 out of the 25. And now, he also learns from two of his favored vendors that Peter, whose title is now Senior Vice President, terminated ABC's agreements with them - all without Jim's knowledge, and that he circulated a confidential memorandum - which also bore the CEO and CFO's signatures - directing that all sales and marketing efforts now be run through him, rather than Jim. In the face of this embarrassment and the stripping of all his essential job duties, Jim feels compelled to resign. But he is concerned: the job market is much worse now than when he signed the contract, and if he quits, won't he be automatically forfeiting his right to recover under the employment contract? Fortunately for Jim, under New York law the answer is no. In New York, if an employee is hired to fill a particular position, any material change in (his, her) duties, or a significant reduction in rank may qualify as a breach of the employment contract. On the other hand, and in the interests of full disclosure, resignation is not without risk: although in this particular fact scenario it is unlikely, a jury may ultimately decide that the change in duties that the employee suffered were not in fact "significant," and defeat the employee's breach of contract claim.
Post a Comment to "How a Demotion Can Be Deemed a Breach of Employment Agreement Under NY Law" |
0.988777 | Facts: The New York City Housing Authority (NYCHA) terminated a household's tenancy for nondesirability and breach of the house rules and regulations, based on the resident's objectionable conduct. The resident appealed, claiming that NYCHA's decision was arbitrary and unreasonable.
Decision: The court ruled against the resident. |
0.999996 | Recall the famous idiom - "When the cat's away, the mice will play." In my situation, that translates to, "When Jeff's at yet another bachelor party in New Orleans, Momma lets Milton get away with things."
Milton and I had a delightful weekend together - taking long walks, splashing in the kiddie pool, and throwing polka dot pig back and forth and back and forth. Even though we had an awful lot of fun together, we seem to have even more fun when that Daddy Dog is around. Jeff arrived home Sunday afternoon, and Milton was quite pleased to see him. Me too. |
0.979523 | How do I listen to Live Phish Radio?
To listen to Live Phish Radio, you will need a broadband connection (DSL, Cable Modem, T1, etc.) and an MP3 player capable of MP3 streaming (like iTunes or Winamp, for example).
If you click LISTEN on Live Phish Radio, the stream will start in whatever player you have configured to play MP3 streams (.m3u file types). If you have trouble connecting, please make sure your network administrator is allowing HTTP access on port 8000 on your machine.
Click the INFO button to browse to the show for the currently playing track. |
0.999902 | Dog's destructive behavior can vary from chewing on the cushion to scratching the carpet, and sometimes completely tear the sofa to pieces. I've heard of puppies chewing through the board's dividers. Apart from the debris and stress, any destruction in the house can affect your bank balance, which is the main reason to get this behavior problem under control.
All dogs have the potential to cause destruction. Chewing is in their nature and recognizing the major causes of this destructive behavior is the first step to remedy the situation. The following are the causes and possible ways of discouraging dogs destructive behavior.
Boredom: This is often the major reason for dog’s destructive tendencies. Dogs are a social animal in nature and if left alone for a long period of time, they will likely get bored, and most dogs will deal with boredom by chewing on items.
Stress: This is another justification for this destructive conduct. Similar to people, dogs can become stressed and like people, they handle stress in different ways. One way dogs calm stress is to chew. Other signs of stress may include constant bark and uncontrolled urination.
Fear: Fear can also be another reason why dog chews on items; Puppies can easily be astonished by loud noises, fireworks, and sirens. Some dog can be nervous of visitors or other dogs. Even dogs that are generally quiet can become destructive when they are afraid.
Instincts: In addition, instincts can be another reason dogs chew on items, mostly puppies. Dog chewing is a way to explore the world around them. The Puppies chew because they are cutting their teeth and they need something to make their gums feel better.
One of the ways you can discourage chewing is by ensuring there are enough approved entertainment toys to keep them occupied. Provide some fun chewing toys and enduring dog treats for your dog to enjoy while you are away. Give him few things to play with at the same time. You may also consider a treat dispenser.
Identify stressful situations for your dog early and prepared them. For instance, if your personal work schedule is changing, endeavor setting up your puppy by leaving for short periods of time per week or earlier. Slowly, making that change in routine can help your dog adjust.
Ensure to establish a place to keep your dog away from noise disturbance during holidays such as 4th July or New Year Eve and family gatherings, providing your dog a restricted space like a kennel, using an anxiety wrap or calming supplement can help.
Lastly, control your dog when you are at home. Constantly correct destructive behavior when it happens. When you observed that your dog is going to chew on items he should not, make a loud clap and say leave it. Then replace unsuitable chewing items with one of your dogs chew toys. This corrective technique will instruct your dog quickly that his toys are approved and chewing on something else means trouble. |
0.999737 | Thinking of Joining a Gym? Ask the smart questions.
It is a personal choice; your exercise habits need to include activities that you enjoy doing and you need to be able to do them when you want to. Your health and wellbeing is a consequence of the lifestyle choices you make and for many people that includes a regular commitment to exercise, perhaps you may be Thinking of Joining a Gym. |
0.958822 | 'Spider-Man' PS4 update: 'Homecoming' suit added to the game?
The new trailer for the 'Spider-Man' PS4 game featured the Peter Parker's homemade suit from the 'Homecoming' movie.
The latest updates for the "Spider-Man" PS4 video game reveal a new trailer featuring two Spidey suits from the Marvel Cinematic Universe. The Spidey will have three pre-ordered DLC costumes for Peter Parker and players can access them during the course of the whole game. Players have already seen the Iron Spider suit making its way to the DLC list, however, the announcement trailer featured a possible third costume which is the homemade suit from the "Spider-Man: Homecoming" movie.
The plot of the "Spidey" video game will feature Peter trying to balance being a superhero and having a normal life, but a new enemy emerges in the form of Martin Li a.k.a. Mister Negative.
As seen on the trailer, the homemade suit makes its debut into the "Spider-Man" PS4 video game as Peter tries to decide which suit he will wear during his patrol of the city. This suit was worn by Tom Holland's Spider-Man during his early days as a local crime fighter before Tony Stark found out about him.
Tony tracked Peter down to his house in Queens and offered him to join his team during the events of "Captain America: Civil War." He also created Peter's new Spidey suit after examining his homemade outfit with the latest Stark technology's equipment.
Peter wore the homemade suit again to stop the Vulture from stealing the Stark cargo plane from Avengers Tower. So far, Insomniac Games has not made any comments regarding the homemade suit being a pre-order DLC. Spider-Punk and the Iron Spider outfits have already been added to the DLC list and the third one will be revealed in June.
In addition, Peter will also have his classic Spider-Man and the Noir suits in the game. Comic book and Marvel fans are hoping to see more outfits such as the Black symbiote suit, Scarlet Spider, 2099, Future Foundation, and more.
The "Spider-Man" game will have players swing through New York as the wall-crawler as he stops Mister Negative and his gang from terrorizing the city. Players will fight crime using a variety of web-based gadgets and unorthodox fighting style. They can use the web gadgets to ensnare or trap opponents when they are doing stealth. Spidey can use the environment as a weapon when overwhelmed with enemies.
Players can also assume the role of Mary Jane Watson as she becomes an investigative reporter for the Daily Bugle.
She can shoot photos of criminal evidence and sneak around corners. There are also side quests in the game featuring villains such as Shocker, Taskmaster, and Black Cat. |
0.999998 | What is the National Hurricane Center?
Based at Florida International University near Miami, the National Hurricane Center is part of the National Weather Service. Its mission is to predict and warn of dangerous hurricanes in the Caribbean and Gulf of Mexico. The headquarters building itself is heavily fortified against hurricanes. Having 10-inch-thick walls, roll-down shutters for its windows, and being far enough inland to be safe from storm surges, it is designed to survive 130 mile (210 kilometer) per hour winds so that it can still be operational after almost any hurricane. |
0.997181 | I would like to talk about air pollution, becouse it is one of the major problems of the planet.
In the city, cars, buses and airplanes, as well as industry and construction may cause air pollution. In the country, dust from tractors plowing fields, trucks and cars driving on dirt or gravel roads, rock quarries and smoke from wood and crop fires may cause air pollution.
Ground-level ozone is the major part of air pollution in most cities. Ground-level ozone is created when engine and fuel gases already released into the air interact when sunlight hits them. Ozone levels increase in cities when the air is still, the sun is bright and the temperature is warm. Ground-level ozone should not be confused with the "good" ozone that is miles up in the atmosphere and that protects us from the sun's harmful radiation.
In my opinion air pollution levels are high. Many pollutants have lower levels indoors than outdoors. Furthermore, air pollution can affect our health in many ways with both short-term and long-term effects.
Different people can react very differently to air pollution. Some people may notice chest tightness or cough, while others may not notice any effects. Because exercise requires faster, deeper breathing, it may increase the symptoms. People with heart disease, such as angina (chest pain), or with lung disease, such as asthma or emphysema, may be very sensitive to air pollution exposure, and may notice symptoms when others do not.
Is air pollution bad for my health?Fortunately for most healthy people, the symptoms of air pollution exposure usually go away as soon as the air quality improves. However, certain groups of people are more sensitive to the effects of air pollution than others.
Children probably feel the effects of lower levels of pollution than adults. They also experience more illness, such as bronchitis and earaches, in areas of high pollution than in areas with cleaner air.
Something that tourists should know about vilnius. Referatas.
The adventure i had. Referatas.
Sidabras4. Referatas. Jav kongreso rinkimai. Referatas. Chromosomos. Referatas. Gyventojų pajamų mokesčio ypatumai. Referatas. Apie linus. Referatas. Tarptautine viesoji teise. Konspektas. Branduoliniai reaktoriai. Referatas. Endoplazminis tinklas. Konspektas. Actekai. Referatas. Linux. Referatas. Tomas hobsas. Konspektas. Lietuvių kalba rusijos universitetuose. Referatas. Europos sąjungos transporto politika. Analizė. 1791m konstitucija. Referatas. Bank7 sistema Lietuvoje. Referatas. |
0.999989 | How are star names related to Greek letters?
I feel marginally bad when I answer an easily Googleable question with reference to the first Wikipedia link that comes up.
I feel less bad when the easily Googleable question comes from Anon.
Bayer designation is a stellar designation in which a specific star is identified by a Greek letter, followed by the genitive form of its parent constellation’s Latin name. The original list of Bayer designations contained 1,564 stars.
Most of the brighter stars were assigned their first systematic names by the German astronomer Johann Bayer in 1603, in his star atlas Uranometria. Bayer assigned a lower-case Greek letter, such as alpha (α), beta (β), gamma (γ), etc., to each star he catalogued, combined with the Latin name of the star’s parent constellation in genitive (possessive) form. (See 88 modern constellations for the genitive forms.) For example, Aldebaran is designated α Tauri (pronounced Alpha Tauri), which means “Alpha of the constellation Taurus“.
A single constellation may contain fifty or more stars, but the Greek alphabet has only twenty-four letters. When these ran out, Bayer began using Latin letters: upper case A, followed by lower case bthrough z (omitting j and v), for a total of another 24 letters.
Bayer never went beyond z, but later astronomers added more designations using both upper and lower case Latin letters, the upper case letters following the lower case ones in general. Examples include s Carinae (s of the constellation Carina), d Centauri (d of the constellation Centaurus), G Scorpii (G of the constellation Scorpius), and N Velorum (N of the constellation Vela). The last upper-case letter used in this way was Q. |
0.999998 | the number used to refer to a particular element of an array is called its?
A(n) ___ should be used to declare the side of an array, because it eliminates magic numbers.
the process of placing the elements of an array in order is called ___ the array.
the process of determine if an array contains a particular key value is called ____ the array.
an array that uses two subscripts is referred to as a(n) ___ array.
A given array can be stored many different types of values. T or F?
An array subscript should normally be of data type float. T or F?
If there are fewer initializers in an initializer list then the number of elements in the array, the remaining elements are initialized to the last value in the initializer list. T or F?
It's an error if an initializer list has more initializer than there are elements in the array.
Write one or more statements that performs the following tasks for an array called functions: Define a constant variable arraySize to represent the size of an array and initialize it to 10.
Write one or more statements that performs the following tasks for an array called functions: Declare an array with arraySize elements of type double, and initialize the elements to zero.
Write one or more statements that performs the following tasks for an array called functions: Name the forth element of the array.
Write one or more statements that performs the following tasks for an array called functions: refer to array element 4.
Write one or more statements that performs the following tasks for an array called functions: assign the value 1.667 to array element 9.
Write one or more statements that performs the following tasks for an array called functions: Assign the value 3.333 to the seventh element of the array.
Write one or more statements that performs the following tasks for an array called functions: Display array elements 6 and 9 with two digits of precision to the right of the decimal point, and show the output that is actually displayed on the screen.
Write one or more statements that performs the following tasks for an array called functions: Display all the array elements using a counter- controlled for statement. Define the integer variable i as a control variable for the loop.
Anwser the following questions regarding an array called table: Declare the array to store int values to have 3 rows and 3 columns. Assume that the constant variable arraySize has been defined to be 3.
Anwser the following questions regarding an array called table: How many elements does the array contain if it has 3 rows and columns?
Assume that a is a two dimensional array of int values with two rows and two columns.
The names of the four elements of an array p are?
Naming an array, stating its type and specifying the number of elements in the array is called _____ the array.
When accessing an array element, by convention the first subscription in a two-dimensional array identifies and element's ____ and the second subscript identifies the element's ______.
An m-by-n array contains ____ rows, ____ columns, and ____ elements.
The name of the element in row 3 and column 5 of array d is?
each array knows its own _____, which can be determined by calling its ____ member function.
To refer to a particular location or element in an array, we specify the _____ of the array and the ________ of the particular element in the array.
A program refers to any one of an array's elements by giving the _____ of the array followed by ____ of the particular element in _____.
The first element in every array has index _____ and is sometimes called the ______ element.
An index must be an ____ or _____.
The ____ used to enclose the index are an operator with the same precedence as _____.
How do you specify the type of each elements and the number of elements required of an array?
the number of initializers must be ?
When is a static local array initialized?
If a static array is not initialized explicitly by you each element of the array is ? |
0.999943 | Develop a new spreadsheet format suitable for the Big Data world: There is currently a significant gap in the Big Data world. There are formats optimized for data exchange, such as Apache Avro, and for large scale analytics queries, such as Apache ORC or Apache Parquet. These formats have been proven as very suitable in the Big Data world. However, they only store data, but not formulas. This means every time simple data calculation need to be done they have to be done in dedicated ETL/batch processes varying on each cluster or software instance. This makes it very limiting to exchange data, to determine how data was calculated, compare calculations or flexible recalculate data – one of the key advantages of Spreadsheet formats, such as Excel. However, Excel is not designed for Big Data processing. Hence, the goal is to find a SpreadSheet format suitable for Big Data processing and as flexible as Excel/LibreOffice Calc. Finally, a streaming SpreadSheet format should be supported.
HadoopOffice aims at supporting legacy office formats (Excel, Access etc.) in a secure manner on Big Data platforms but also paving the way for a new spreadsheet format suitable for the Big Data world.
I recently started a small project to create a sample enterprise Big Data web application using Spring.
You can find the source code here and a demonstration here.
One feature in this application WebRTC. I started working with WebRTC since its introduction around 2011/2012. Now, it became a W3C standard and has been implemented in nearly all popular browsers, such as Mozilla Firefox, Google Chrome or Opera. Basically it offers you secure video/voice chat, screen sharing and peer to peer data exchange for your browser. If you want to have a simple online demonstration of WebRTC in general then you can try it out here.
All major browsers support WebRTC on mobile, but also on desktop computers. Gateway software exists to connect a WebRTC client to SIP and thus the “standard” phone network. STUN and TURN server support you to correctly deal with firewalls.
You do not need any additional plugins in your browser to enable all of this. You can compare the functionality with Skype – except that it is possible in web applications without plugins. Hence, it works as well on smartphones and tablets, where you usually cannot install plugins for your browser.
Communcation between people is certainly an important aspect of enterprise web applications. Hence, the WebRTC standard is interesting and relevant for them. Although WebRTC is at its core a peer to peer solution, the developer of an enterprise solution needs to provide a “signaling channel”. This channel is responsible so that the people participating in a WebRTC exchange, such as a video/voice chat, find each other and let their browsers exchange information on how they can connect directly to each other or via a gateway.
Between two users so they can have a secure connection to each other.It should be noted that point 2) is also needed in a group chat, because a peer to peer connection is always established between two users. This means in a group chat consisting of three users, “user 1” has a peer to peer connection to “user 2” and another one to “user 3”. Additionally there is one between “user 2” and “user 3”. This is illustrated in the following figure.
The signaling channel does not transmit any video/voice or other data, it is just for establishing and maintaining the direct connection between two peer to peer users.
The Streaming Text Oriented Messaging Protocol (STOMP) is used to send signaling messages to a topic and private queues of the users within a message-oriented middleware connected to the web application backend to ensure that messages are delivered properly.
The backend is connected to a message-oriented middleware, such as RabbitMQ, JBOSS HornetQ or with any JMS-capable middleware via the Kaazing Websocket Gateway. This can be configured in a flexible manner in the example application, because we use the Spring Messaging interface.
Those technologies have been integrated in the example enterprise web application.
WebRTC has other exciting use cases, such as E-Learning, E-Health, Sales Support, Customer-Relationship Management (CRM), CoBrowsing or becoming the default protocol for the Internet of Things to link people and things. It is growing more and more. A lot of startups have emerged recently and big companies are starting to support WebRTC in their communication software. |
0.999932 | Існує думка, що мислити штампами і кліше, використовувати шаблонні фрази — це непристойно. Але чи поширюється це думка на мова вивчає іноземну мову (школярів, студентів тощо)? Що краще з точки зору оволодіння культурою мови при вивченні іноземної мови: коли учень або студент відтворює красиві, але завчені напам’ять чужі мовні зразки, або коли він вживає «кострубаті», але свої словосполучення і роздуми? Вважаю, що мовні стандарти і кліше надають нашої мови грамотності, роблять її красивою, зрозумілою для інших. Вивчаючи іноземну мову, досить складно, навіть на найвищому етапі, швидко і коректно сформулювати свої думки. Особливо гостро ця проблема відчувається під час спонтанної мови (це стосується навіть вчителів). Щоб виробити навички та вміння швидко оформляти свої думки в пропозиції, тобто to speak fluently, необхідно використовувати в мові комунікативні кліше. По-перше, завдяки готовим комунікативним фразам мова красиво оформлена, пропозиції логічно пов’язані, таку промову приємно слухати. По-друге, довівши знання готових мовних фраз до автоматизму, що говорить, вживаючи те чи інше кліше, думає над наступною фразою. Таким чином, за допомогою комунікативних кліше дуже легко позбутися так званого лінгвістичного заїкання.
Let’s move to another question. Давайте перейдемо до наступного питання.
There is another side to this. Є й інша сторона.
There are 2 ways of looking at this … На це можна подивитися з двох сторін.
It is not a final word on the matter. Це не останнє слово в цій справі.
Well, there’s been a debate about this. Про це ведуться суперечки.
No questions about it. Ніяких питань з цього приводу.
Well, exactly. That’s precisely what I was going to say. Абсолютно вірно! Це саме те, що я і хотів сказати.
I can disagree. Я можу не погодитися.
That’s where you are wrong about it. Саме в цьому ви неправі.
This does not seem to be so. Здається, що це не так.
It’s an impossible question to answer. На це питання неможливо відповісти.
I have considerable doubt as far as N. is concerned. Я дуже сумніваюся щодо N.
I am rather vague about it. Я в цьому не дуже впевнений.
It’s from this angle that one must seriously consider this problem. Саме з цього боку необхідно серйозно підійти до цього питання.
I must make my reservation. Я повинен зробити застереження.
Reservation should be made. Необхідно зробити застереження.
Let me see if I can illustrate that for you. Дайте подумати, чи зможу я це пояснити.
There is a great deal of discussion about … З приводу … ведуться дискусії.
It’s a problem that will only increase in time. Це проблема, яка з часом тільки зросте (посилиться).
This means just what it says. Це означає саме те, про що ви подумали.
I would like to sum up the chief points of what has just been said. Хочу підсумувати основні моменти сказаного.
That’s where I’d like to end. На цьому хочу завершити.
Необхідно відзначити, що дані кліше є автентичними, тобто вони були відібрані з першоджерел (програм ВВС та статей часопису «The Economist»). Тому переклад цих фраз не є їх російським еквівалентом, а лише спробою максимально точно передати їх значення.
Сподіваюся, що дана добірка комунікативних кліше буде незамінним помічником для вивчають англійську мову. Ці фрази допоможуть зробити вашу мову виразною і природною.
We can not imagine our life without mass media: newspapers, magazines, books, radio, television, films, records, tapes, etc. The impact of all mass media is very strong.
News is not what happens — it is what you see or read in mass media. In other words, mass media shapes public opinion. Sometimes it’s good, but sometimes it’s terribly bad.
TV is one of the most popular mass media in the contemporary world. There are many arguments for & against TV. Television has both advantages & disadvantages, positive & negative influence.
TV keeps us informed about current events in different parts of the world. The most distant countries and the strangest customs are brought right into our sitting room. There are many educational programmes that give us ideas about right & wrong, good & bad. Television helps to increase the popularity of sports. The popularity of professional football has soared largely because of television. Television plays its greatest role in presidential races. Everybody knows that today many candidates reach more voters through a single TV appearance than through all the in-person campaigning they do. Different political talk-show programmes are extremely popular nowadays & they capture people’s attention.
But negative effect of television is also great indeed. It occupies a good deal of our spare time. Our parents sit for hours before the box and do not want to go to the theatres or museums, speak to their friends, or play with their children. And children are unwilling to do their home assignment, read books or go outside. They prefer to watch their favourite programmes or films on «telly». TV begins to dominate our lives. We gradually become TV addicts. One more harmful effect results when people fail to achieve the success they see on TV and become dissatisfied or bitter.
Good or bad television brings the world into our home and brings us closer to other people. Besides, it is good company for people who live alone. TV changes our language, stimulates our emotions, informs our intellect, extends our knowledge, influences our ideas and provides vital food for our imagination. We must realize that TV in itself is neither good nor bad. It’s up to us to decide which advantages we can make of it.
I’d like to point out right at the beginning that we can not imagine our life without mass media: newspapers, magazines, books, radio, television, films, records, tapes, etc. No one, I think, is challenging the view that the impact of all mass media is very strong.
Some people claim that «news is not what happens — it is what you see or read in mass media». In other words, mass media shapes public opinion. Sometimes it’s good, but sometimes it’s terribly bad.
It goes without saying and nobody would deny the fact that TV is one of the most popular mass media in the contemporary world. I do not profess to be an expert on the subject of the impact of television on people, but it can be stated with certainty that there are many arguments for & against TV. It is obvious that television has both advantages & disadvantages, positive & negative influence.
And now I’d prefer to talk about positive effects of TV rather than negative ones. The first thing that must be of great importance to us is that TV keeps people informed about current events in different parts of the world. The most distant countries and the strangest customs are brought right into our sitting room. There are many educational programmes that give us ideas about right & wrong, good & bad. We also must not lose sight of the fact that television helps to increase the popularity of sports. For example, the popularity of professional football has soared largely because of television. Moreover, television plays its greatest role in presidential races. Everybody knows that today many candidates reach more voters through a single TV appearance than through all the in-person campaigning they do. Different political talk-show programmes are extremely popular nowadays & they capture people’s attention.
But there is another side of looking at television, because its negative effect is also great indeed. TV occupies a good deal of our spare time. It strikes me that our parents sit for hours before the box and do not want to go to the theatres or museums, speak to their friends, or play with their children. And children are unwilling to do their home assignment, read books or go outside. They prefer to watch their favourite programmes or films on «telly». TV begins to dominate our lives. What commonly happens is that we gradually become TV addicts. One more harmful effect results when people fail to achieve the success they see on TV and become dissatisfied or bitter.
To crown it all I’d like to say that good or bad television brings the world into our home and brings us closer to other people. Besides, it is good company for people who live alone. To say more, TV changes our language, stimulates our emotions, informs our intellect, extends our knowledge, influences our ideas and provides vital food for our imagination. I firmly believe we must realize that TV in itself is neither good nor bad. It’s up to us to decide which advantages we can make of it. |
0.999999 | On parle de quoi pendant la COP24 ?
La COP24, plus précisément la 24ème Conférence des Parties à la Convention de l’ONU sur le climat, se tient du lundi 3 décembre au vendredi 14 décembre à Katowice, en Pologne. Comme toutes les autres, elle durera près de 2 semaines et sera rythmée par de nombreuses négociations avec des acteurs étatiques ou non, comme des ONG ou des institutions.
C’est à l’issue du « Sommet de la terre » de Rio en 1992 qu’est entrée en vigueur la CCNUCC, soit la Convention-cadre des Nations unies sur les changements climatiques. Cette convention a pour objet de trouver des solutions face aux changements climatiques.
La COP est ainsi la réunion annuelle permettant de mettre en oeuvre les dispositions de cette même Convention.
Suite à cela, les COP22 et COP23 ont permis aux pays en développement et aux pays riches de commencer à réaliser leurs objectifs en étroite collaboration.
Cette année, la Banque mondiale a annoncé sa volonté de mobiliser près de 200 milliards de dollars entre 2021 et 2025 pour le climat, alors qu’elle en avait annoncé 100 milliards lors de l’accord de Paris.
Ces fonds pourront permettre aux pays en développement de s’adapter aux dérèglements climatiques, ces derniers étant les plus touchés.
Néanmoins, près de 20% de l’argent pourra permettre la mise en place d’alertes météos, ou d’infrastructures résistantes aux catastrophes naturelles.
Kristina Georgieva, la Directrice générale de la Banque mondiale a notamment déclaré à cet effet « Nous devons lutter contre les causes du changement climatique, mais aussi ses conséquences, qui sont dramatiques pour les plus pauvres ». Le thème de cette réunion sur le climat est donc très lié à la très forte collaboration entre les pays du Nord et les pays du Sud.
Cependant, suite à cette décision, Benoît Leguet, président du think tant Institute for Climate Economics a affirmé : « Ce sont en réalité 6 000 milliards de dollars par an qu’il faudrait investir les quinze prochaines années pour réaliser la transition en faveur d’une économie à faibles émissions de carbone. Il ne s’agit pas de trouver de nouvelles sommes, mais de dévier les flux financiers du marron vers le vert, par exemple en réaffectant le financement des énergies fossiles aux renouvelables. L’essentiel de l’argent va venir des économies des pays concernés : ce sont les Africains ou les Asiatiques qui vont payer pour leur transition énergétique ».
Cette COP est d’autant plus importante avec la réticence des États-Unis à faire des efforts sur le climat depuis leur sortie de l’Accord de Paris, et les nombreux lobbies défendant l’utilisation du charbon en Pologne notamment.
I as well as my guys happened to be analyzing the excellent secrets from your website then quickly I got a horrible suspicion I had not expressed respect to the website owner for those tips. Most of the young boys happened to be joyful to read all of them and have in effect undoubtedly been tapping into those things. Thank you for truly being simply thoughtful and for making a decision on some high-quality useful guides millions of individuals are really eager to understand about. Our own honest regret for not expressing gratitude to you earlier.
A lot of thanks for your entire effort on this blog. Gloria really likes engaging in research and it’s really easy to see why. Most of us notice all of the compelling method you create precious steps on your website and encourage contribution from website visitors on the topic so our favorite child is without question discovering a lot. Enjoy the remaining portion of the year. Your conducting a superb job.
v1BrQc You are my inspiration , I own few web logs and occasionally run out from to brand.
My spouse and i got so relieved that Albert managed to finish up his preliminary research by way of the ideas he was given while using the web page. It’s not at all simplistic to simply be handing out techniques that many people have been trying to sell. And now we acknowledge we need you to give thanks to for this. The entire explanations you have made, the straightforward blog menu, the relationships you aid to engender – it’s all spectacular, and it’s letting our son in addition to us do think that article is exciting, and that’s tremendously fundamental. Many thanks for all the pieces!
I enjoy you because of your entire labor on this blog. Kate really likes setting aside time for investigations and it’s obvious why. A number of us hear all concerning the lively means you deliver good techniques via your web blog and as well as encourage participation from others about this concept then our favorite girl is now discovering so much. Take advantage of the remaining portion of the new year. You’re doing a remarkable job.
I simply wanted to thank you so much again. I do not know the things that I could possibly have taken care of in the absence of the actual information contributed by you about my subject. Completely was an absolute difficult matter for me, but encountering a new professional mode you dealt with the issue took me to jump with contentment. Now i am grateful for this assistance and thus have high hopes you find out what a great job you have been accomplishing instructing others through the use of your web blog. Most likely you have never met any of us.
I needed to post you that very little remark in order to say thanks over again for your marvelous strategies you have shared on this site. It was certainly generous with you to grant freely what exactly most of us would have sold for an e book in making some dough for themselves, and in particular considering the fact that you might well have tried it if you decided. These strategies also served like the easy way to recognize that other people have the identical zeal just like my personal own to know a good deal more with regards to this issue. I’m certain there are millions of more enjoyable opportunities up front for folks who scan your blog post.
I just wanted to write a small message to be able to appreciate you for all of the splendid recommendations you are placing on this website. My time consuming internet search has at the end of the day been paid with reasonable facts to exchange with my contacts. I ‘d assert that most of us site visitors are quite endowed to live in a good network with very many lovely people with very beneficial points. I feel quite privileged to have come across the web pages and look forward to so many more fun minutes reading here. Thanks a lot once more for a lot of things.
I have to express my appreciation to the writer for rescuing me from this situation. Just after searching throughout the online world and obtaining thoughts which were not productive, I believed my entire life was gone. Living without the answers to the issues you’ve fixed by means of this short post is a serious case, and the ones which may have badly affected my career if I hadn’t noticed your web site. The capability and kindness in handling all areas was valuable. I don’t know what I would have done if I hadn’t come across such a point like this. I am able to at this time look forward to my future. Thanks very much for this professional and result oriented guide. I will not be reluctant to suggest the blog to any individual who requires support about this matter.
I wanted to type a small word in order to thank you for these fabulous tips and tricks you are giving on this site. My incredibly long internet look up has finally been compensated with reliable facts and strategies to write about with my friends. I would repeat that many of us website visitors are rather endowed to dwell in a fantastic community with many perfect professionals with useful techniques. I feel extremely privileged to have used the weblog and look forward to really more entertaining times reading here. Thanks once again for a lot of things.
I and my friends happened to be taking note of the nice information from your web site and then instantly developed a horrible suspicion I never thanked the web blog owner for those techniques. Most of the ladies are actually consequently stimulated to see them and have extremely been making the most of them. Many thanks for simply being really accommodating and also for selecting these kinds of marvelous themes millions of individuals are really desperate to learn about. Our sincere apologies for not saying thanks to you sooner.
My wife and i have been absolutely cheerful when Emmanuel managed to conclude his research by way of the ideas he obtained from your weblog. It is now and again perplexing to simply be freely giving methods which people have been selling. And we all fully grasp we need the writer to thank for that. The entire illustrations you have made, the straightforward website navigation, the friendships your site help instill – it’s mostly spectacular, and it’s making our son and us know that the subject is amusing, which is incredibly pressing. Thank you for the whole lot!
The fresh Zune browser is incredibly beneficial, but not as Wonderful as the iPod’s. It operates very well, but isn’t really as immediate as Safari, and incorporates a clunkier interface. If by yourself from time to time method upon making use of the world-wide-web browser that is not an issue, nevertheless if you happen to be developing towards examine the web alot versus your PMP then the iPod’s much larger screen and superior browser could be essential.
Hi there. I found your web site via Google whilst searching for a comparable topic, your web site came up. It appears to be good. I’ve bookmarked it in my google bookmarks to visit then. |
0.945564 | Glucagon-like peptide-1 (GLP-1) lowers glucose levels by potentiating glucose-induced insulin secretion and inhibiting glucagon release. The question of whether GLP-1 exerts direct effects on the liver, independently of the hormonal changes, is controversial. We tested whether an exogenous GLP-1 infusion, designed to achieve physiological postprandial levels, directly affects endogenous glucose production (EGP) under conditions mimicking the fasting state in diabetes.
In 14 healthy volunteers, we applied the pancreatic clamp technique, whereby plasma insulin and glucagon levels are clamped using somatostatin and hormone replacement. The clamp was applied in paired, 4 h experiments, during which saline (control) or GLP-1(7–37)amide (0.4 pmol min−1 kg−1) was infused.
During the control study, plasma insulin and glucagon were maintained at basal levels and plasma C-peptide was suppressed, such that plasma glucose rose to a plateau of ∼10.5 mmol/l and tracer-determined EGP increased by ∼60%. During GLP-1 infusion at matched plasma glucose levels, the rise of EGP from baseline was fully prevented. Lipolysis (as indexed by NEFA concentrations and tracer-determined glycerol rate of appearance) and substrate utilisation (by indirect calorimetry) were similar between control and GLP-1 infusion.
GLP-1 inhibits EGP under conditions where plasma insulin and glucagon are not allowed to change and glucose concentrations are matched, indicating either a direct effect on hepatocytes or neurally mediated inhibition.
The classical physiological actions of glucagon-like peptide-1 (GLP-1) include potentiation of glucose-induced insulin secretion, suppression of glucagon release, inhibition of gastric emptying and enhancement of satiety . The opposing effects on insulin and glucagon secretion result in reductions of endogenous glucose production (EGP) and blood glucose levels. The question of whether the hormone exerts direct actions on insulin target tissues, i.e. liver, adipose and skeletal muscle tissue, is controversial.
GLP-1 receptors were originally not found in human liver . However, the results of more recent in vitro studies are compatible with the presence of GLP-1 receptors in human hepatocytes [3, 4]. Additionally, GLP-1 has been reported to increase glucose transporter levels and insulin-mediated glucose uptake in 3T3-L1 adipocytes , and glucose transport in cultured human myocytes . GLP-1 receptor mRNA has also been described in neurons in the hepatic portal region .
Studies in humans are scarce and inconsistent. Hvidberg et al concluded that the decrease in EGP and increase in glucose rate of disappearance (Rd) during GLP-1 infusion in healthy volunteers could be entirely explained by the changes in insulin and glucagon concentrations. Likewise, others [9, 10] reported that the effects of GLP-1 on EGP and glucose disposal were abolished when co-infusing somatotropin release-inhibiting factor (SRIF), thereby blocking the insulin and glucagon response to GLP-1. The same conclusion was reached in experiments using somatostatin infusion during a high-dose hyperinsulinaemic–euglycaemic clamp . In contrast, in uncontrolled studies in healthy volunteers, Prigeon et al used the pancreatic clamp technique to show that fasting EGP and plasma glucose concentrations declined ∼20% upon adding a short-term (60 min), high-dose GLP-1 infusion .
With regard to the effects on whole-body glucose disposal, early studies [8, 11] found no direct effect of GLP-1, i.e. no effect that was independent of changes in insulin concentrations, on the potentiation of glucose disappearance. Subsequent work, however, reported an independent effect of GLP-1 on the promotion of glucose disposal in non-diabetic , obese or diabetic participants .
Another potential extrapancreatic action of GLP-1 is on lipid metabolism. Although GLP-1 receptors are not produced in adipocytes, the peptide appeared to stimulate lipolysis in fat cells from obese participants . In contrast, using in situ microdialysis and local GLP-1 perfusion, Bertin et al detected no change in lipolysis or blood flow in adipose tissue or muscle. Finally, intracerebroventricular GLP-1 administration in mice and peripheral GLP-1 infusions in man increased sympathetic activity. It has not yet been determined whether this sympatho-excitatory action is mediated by insulin.
Here, we reassessed the in vivo direct effects of physiological GLP-1 elevations, created by exogenous administration of GLP-1(7-37)amide, on EGP, glucose disposal, lipolysis and indices of sympathetic activation in healthy volunteers.
Healthy volunteers (n = 14) aged 18 to 60 years and with a BMI <30 kg/m2 participated in the study (Table 1). The nature and purpose of the study were carefully explained to all participants before they provided written consent to participate. The study procedures were approved by the Institutional Ethics Committee of Pisa University.
Each participant underwent two studies within 7 to 14 days of each other. In each study, after an overnight (12 h) fast, catheters were inserted into an antecubital vein (for infusion of all test substances) and retrogradely into a vein on the dorsum of the hand for blood withdrawal. The hand was heated to 55°C to allow sampling of arterialised venous blood. At 09:00 hours primed continuous infusions of 6,6-[2H2]glucose (0.28 μmol min−1 kg−1; prime 28.0 μmol/kg × [fasting plasma glucose/5]) and [2H5]glycerol (0.11 μmol min−1 kg−1; prime 1.65 μmol/kg) were started and continued for the duration of the study (6 h). At time 0, constant infusions of SRIF (450 μg/h) and glucagon (1 ng min−1 kg−1) were begun and continued for 4 h. At time 20 min, a primed continuous insulin (Humulin R; Eli Lilly, Indianapolis, IN, USA) infusion (12 pmol min−1 m−2) was initiated, along with a saline drip. During the second study, from time 60 min onward, saline was replaced by a constant GLP-1(7–37)amide infusion (0.4 pmol min−1 kg−1), while the plasma glucose profile of the first study was closely reproduced through a variable intravenous glucose infusion, using an algorithm developed ad hoc . Plasma insulin, C-peptide, glycerol, glucagon and NEFA concentrations, as well as 6,6-[2H2]glucose and [2H5]glycerol enrichment were measured at pre-determined intervals.
In 13 of 14 participants, indirect calorimetry was used to measure the respiratory quotient (RQ) and substrate oxidation rates, using a continuous, open-circuit canopy system (Metabolic Measurement Cart Horizon; SensorMedics, Anaheim, CA, USA). These measurements were collected during the basal period (−40 to 0 min) and over the last 40 min of the study.
Fat-free mass (FFM) was evaluated using a body composition analyser (TB-300; Tanita, Tokyo, Japan); fat mass was then obtained as the difference between body weight and FFM.
Plasma glucose was measured by the glucose oxidase technique (Beckman Glucose Analyzers; Beckman, Fullerton, CA, USA). Plasma insulin and C-peptide were measured by an electro-chemiluminescence assay on a COBAS e411 (both from Roche, Indianapolis, IN, USA). Glucagon was measured by radioimmunoassay (Millipore, Billerica, MA, USA). The tracer enrichment of 6,6-[2H2]glucose and [2H5]glycerol was measured by gas chromatography/mass spectrometry as previously described . NEFA and glycerol were measured using an enzymatic colorimetric system (Syncron; Beckman).
Plasma samples were assayed for intact GLP-1 using a GLP-1 ELISA kit following the manufacturer’s protocol (Millipore). The detection limit for this assay is 2 pmol/l in 100 μl plasma.
Glucose fluxes were expressed per kg of FFM. During the last 20 min of the basal tracer equilibration period, plasma glucose and glycerol concentrations, as well as 6,6-[2H]glucose and [2H5]glycerol enrichment (expressed as tracer:tracer ratio [TTR]) were stable in all participants. Therefore, EGP and the glycerol rate of appearance (Ra) were calculated as the ratio of tracer infusion rate to the plasma TTR (mean of three determinations). After starting SRIF infusion, the total glucose and glycerol Ra were calculated using Steele’s equation, as previously described . Before applying Steele’s equation, plasma TTR data for 6,6-[2H]glucose were smoothed using a spline fitting approach to stabilise the calculation of the derivative of enrichment. The plasma glucose concentration resulting from EGP was obtained as the difference between total and exogenous glucose concentrations. The tracer-determined Rd provided a measure of insulin-mediated total-body glucose disposal.
Substrate oxidation rates were calculated from gas exchange measurements as described . Areas under the time–concentration curve were calculated by the trapezium rule.
Data are given as mean ± SD. Differences between saline and GLP-1 infusion were analysed by Wilcoxon’s signed-rank test. The time course of glucose fluxes was analysed by two-way, doubly repeated-measures ANOVA, modelling infusion (GLP-1 vs saline) and experimental time (and their interactions) as factors. A value of p ≤ 0.05 was considered statistically significant.
In the control study, glucose levels began to rise ∼1 h into the SRIF infusion and levelled off at ∼10.6 mmol/l during the last hour; this time course was reproduced in the GLP-1 study (Fig. 1a). Upon starting SRIF infusion, insulin concentrations initially dropped from baseline, then returned to the fasting value by ∼60 min in the control and test study (p = 0.40). During the last hour, however, plasma insulin levels were higher under GLP-1 infusion than under control conditions (38 ± 18 vs 25 ± 7 pmol/l, p < 0.002), probably reflecting beta cell escape from SRIF blockade, as confirmed by the C-peptide time course (Fig. 1b, d). Plasma glucagon concentrations also decreased from baseline following the start of SRIF, then rose gradually and slightly until the end of the study, without significant (p = 0.18) differences between saline and GLP-1 infusion (Fig. 1c).
The glucose Ra rose from baseline under saline and GLP-1 infusion, the time-pattern of the rise being similar in both (Fig. 2a). Exogenous glucose infusion rates, however, were higher with GLP-1 than saline infusion (p < 0.0001); consequently, EGP was lower throughout the 3 h of GLP-1 infusion (Fig. 2b). Over the time-period when pancreatic hormones were closely superimposable between saline and GLP-1 (i.e. between 60 and 180 min), EGP was 27% lower (by 3.6 μmol kg−1 min−1, 95% CI 2.4, 4.8, p < 0.0001) with GLP-1 than with saline (Fig. 2c). The glucose Rd increased slightly only during the last hour of both studies (p < 0.01 for saline and GLP-1), without differences between saline and GLP-1 (Fig. 2d).
Plasma NEFA increased from baseline until 40 min (from 0.53 ± 0.10 and 0.54 ± 0.03 to 0.70 ± 0.09 and 0.72 ± 0.04 mEq/l, respectively, for saline and GLP-1), subsequently dropping below the basal levels, with no difference between the two studies (AUC0–240 min 115.5 ± 13.2 vs 110.0 ± 9.6 mEq/l × 240 min, p = 0.65) (Fig. 3a). The glycerol Ra averaged 2.72 ± 0.24 and 3.11 ± 0.22 μmol min−1 kg−1 during the baseline period of the saline and GLP-1 studies, respectively. During the infusion period, after an initial slight increase, the glycerol Ra declined slowly over time and to similar degrees under saline and GLP-1, to reach values somewhat lower with the latter (2.01 ± 0.92) than the former (2.43 ± 2.01) during the final hour of the study (Fig. 3b).
The RQ did not change between baseline (0.75 ± 0.02 vs 0.76 ± 0.02, saline vs GLP-1, p = 0.84) through to the final hour of the study (0.76 ± 0.03 vs 0.78 ± 0.01, p = 0.33). Accordingly, baseline rates of carbohydrate and lipid oxidation were similar between the two study days and did not change significantly with either saline or GLP-1 infusion (Fig. 4a, b).
During saline infusion, there was no change in intact GLP-1, whereas GLP-1 infusion raised the plasma levels of intact hormone threefold (AUC60–180 min 239 ± 515 vs 441 ± 200 pmol/l × 120 min, p = 0.001). In the pooled saline and GLP-1 data, there was a significant, albeit weak, (ρ = −0.49, p = 0.01) reciprocal relationship between EGP and intact GLP-1 concentrations measured over the 60–180 min time interval.
The present studies demonstrate that exogenous GLP-1 inhibits EGP by mechanisms that are largely independent of changes in plasma glucose, insulin and glucagon levels. Our experimental settings mimicked a diabetic state, i.e. raised glucose concentrations and glucagon:insulin ratios. Under these conditions, EGP was increased by ∼70% from baseline, with plasma glucose rising to a plateau of ∼11.1 mmol/l. Replacing the saline with a GLP-1 infusion, at a rate producing steady-state plasma levels approximately in the postprandial range, caused a marked reduction of EGP, which remained close to the starting levels. Interestingly, insulin secretion during the 3rd hour of GLP-1 infusion tended to rise, reflecting an escape of the beta cells from SRIF blockade. Therefore, quantification of the GLP-1 effect was restricted to the 2 h during which plasma insulin and C-peptide levels were stable and superimposable between the two studies (Fig. 1).
Previous reports [11, 24] that failed to observe a direct inhibitory effect of GLP-1 on EGP under pancreatic clamp conditions can probably be explained by their use of high insulin replacement doses, which suppressed EGP completely or by greater than 75% in the control studies, thereby leaving little room for a further inhibitory action of GLP-1. In addition, we did not detect any effect on whole-body glucose disposal, in accordance with previous findings in healthy volunteers [9, 10]. However, we cannot rule out the possibility that pharmacological doses of GLP-1 such as those used in previous studies [14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25] may promote whole-body glucose uptake.
The only previous study that is indicative of a direct effect of GLP-1 on EGP was carried out in eight healthy volunteers, who did not receive a saline infusion control study. Moreover, exogenous GLP-1 was infused, for a short time (60 min), at rates achieving total plasma GLP-1 concentrations that were twice as high as the steady-state levels created by us. More importantly, the insulin replacement (36 pmol min−1 kg−1) was at least twice as high as ours (12 pmol min−1 kg−1), achieving two to three times higher steady-state plasma insulin concentrations (thus raising plasma glucose clearance by ∼50%). Thus, in Prigeon’s protocol , the effect of short-lived, supraphysiological GLP-1 concentrations was tested under conditions of euglycaemia and hyperinsulinaemia. With the present protocol, we demonstrated that physiological GLP-1 increments prevent EGP from increasing under conditions simulating the fasting state in diabetes.
With regard to the mechanisms underlying the direct action of GLP-1 on EGP, we measured lipolysis, as indexed by glycerol Ra and plasma NEFA levels, and the pattern of substrate utilisation (using indirect calorimetry). As no differences, not even in trend, were observed between saline and GLP-1 infusion, we can rule out the possibility that the GLP-1-induced inhibition of EGP may have been due to a reduction of NEFA delivery to the liver, which would stimulate EGP via gluconeogenesis, or to an increase in sympathetic drive, which would stimulate lipolysis and shift the substrate oxidation pattern toward lipid oxidation.
In the present studies, the threefold elevated intact GLP-1 levels could have engaged hepatic GLP-1 receptors similar to those on beta cells . Alternatively, the GLP-1(28–36)amide nonapeptide, which enters hepatocytes independently of the GLP-1 receptor, may have suppressed glucose production, as shown in mouse hepatocytes .
Experimental evidence for the possibility that GLP-1 may act on the liver by engaging sensors in the portal circulation or nerve endings in the intestinal wall comes from different animal species, but is convergent. Thus, in insulin clamp experiments in GLP-1 receptor knockout mice, insulin suppression of EGP was impaired and animals became hyperglycaemic during exercise . Nakabayashi et al measured changes in the impulse discharge rate of the hepatic afferent vagus, following a bolus intraportal GLP-1 injection in the rat. They found that the hormone dose-dependently increased the firing rate and that this effect could be cancelled by vagotomy. In catheterised dogs, Johnson et al found that direct infusion of GLP-1 into the portal vein at matched plasma glucose, insulin and glucagon concentrations resulted in a more positive net hepatic glucose balance, which is the net sum of EGP and hepatic glucose uptake.
In summary, the present studies provide conclusive evidence that a physiological action of GLP-1 inhibits glucose production under conditions where its major controlling signals, namely plasma insulin, glucagon and glucose concentrations, are not allowed to change. The effect is quantitatively significant and does not appear to be mediated by changes in substrate availability or sympathetic drive.
The study was funded in part through a grant from the Italian Ministry of University Health Research (PRIN 2009, protocol 2009YHTFF2).
MS, ER, BDA, AG, AP, AC, EB and EM acquired and analysed the data and drafted the article. EM, EF and MN reviewed the article and were responsible for the conception of the study. All authors approved the final version. |
0.976615 | A recent article in The Huffington Post summarized a University of Missouri study that analyzed the way divorced parents use technology to facilitate (or hinder) their co-parenting arrangements. According to the study, parents with effective communication used technology to improve parent-parent communication as well as parent-child access, while parents with ineffective communication used technology to frustrate both their relationship with the other parent and the other parent’s relationship with the children. Establishing positive communication practices between spouses not only maintains a level of civility between the parents; it also provides a more pleasant environment for the children. Whether a couple engaged in litigation, mediation, or collaborative methods in obtaining their divorce, limiting post-divorce conflict between parents is imperative to helping children adjust.
• E-mail: E-mail can be a useful way for divorced parents to communicate with each other. Risks inherent in telephone communication are largely absent in e-mail communication: telephone conversations can be impulsive and rash, and since they are generally not recorded, a parent may feel entitled to make any manner of accusation toward his or her ex. Parents can also use the telephone to avoid communication, by ignoring phone calls and voice messages. By contrast, e-mail affords a parent with the ability to express himself or herself, then edit the message to ensure that only a calm, rational tone is used. E-mail also provides a communication trail, which makes it more likely that a parent will limit his or her hostility.
• Text Messages: The idea behind using text messages to communicate is similar to that of e-mail. Text messaging is more immediate, but still allows each parent to edit their message for the appropriate tone, and creates a communication trail.
• Calendar Sharing: With Google calendars or iCloud, parents can share calendars with each other. This can ensure that each parent has access to the children’s academic, extra-curricular, and social activities. Shared calendars can also provide a method by which parents can keep tabs on parenting and vacation schedules, including travel details and changes in the usual parenting plan. Creating a shared calendar thus minimizes the likelihood that a parent will miss an important event in the children’s lives, while mitigating the interaction between parents regarding their own schedules and those of the children.
• Online Co-Parenting Software: In the event that parents prefer help with limiting conflict in multiple areas, including parenting schedules and child support payments, co-parenting software is an option. The software, which has gained popularity over the past year or so, provides calendars, expense logs, message boards, and child records (medical, academic, etc.). These features allow parents to keep track of schedules and expenses, and to communicate with one another directly. Examples of available software are Our Family Wizard and ShareKids.
As noted in a recent article in the New York Times, communication technology is becoming popular not only with divorced parents, but in the courtroom and amongst lawyers as well. According to the article, settlement agreements often include provisions for non-custodial parents to Skype with their children, and at least one judge has ordered a couple to use Our Family Wizard to avoid disagreements.
Each of the above-mentioned tools can build a successful co-parenting environment for parents and children. As the University of Missouri study concluded, parents who had good relationships effectively used these tools to maintain contact with their ex-spouses and to facilitate the children’s transition between parents. As with all aspects of divorce, the children’s best interests should be paramount and, to the extent that communication technologies can advance this goal, they should be widely considered. |
0.949359 | The branch of psychiatry that specializes in the study, diagnosis, treatment, and prevention of psychopathological disorders of children, adolescents, and their families. Child and Adolescent Psychiatry encompasses the clinical investigation of phenomenology, biologic factors, psychosocial factors, genetic factors, demographic factors, environmental factors, history, and the response to interventions of child and adolescent psychiatric disorders (Kaplan and Saddock).
An important antecedent to the specialty of child psychiatry was the social recognition of childhood as a special phase of life with its own developmental stages, starting with the neonate and eventually extending through adolescence. As early as 1899, the term 'child psychiatry' (in French) was used as a subtitle in Manheimer's monograph Les Troubles Mentaux de L'Enfance. However, the Swiss Moritz Tramer (1882-1963) was probably the first to define the parameters of child psychiatry in terms of diagnosis, treatment, and prognosis within the discipline of medicine, in 1933. In 1934, Tramer founded the Zeitschrift für Kinderpsychiatrie (Journal of Child Psychiatry), which later became Acta Paedopsychiatria. The first use in English of the term "child psychiatry" occurred when Leo Kanner published his textbook under that name in the USA in 1935.
The use of medication in the treatment of children also began in the 1930s, when Charles Bradley opened a neuropsychiatric unit and was the first to use amphetamine for brain-damaged and hyperactive children.
Academic divisions of child psychiatry began to develop, particularly in the USA, in the 1930s. The first 'pediatric psychiatry clinic' was established in 1930 in Baltimore, headed by Leo Kanner. In 1933, The Maudsley Hospital in London opened a children's department under Mildred Creak, and research in child psychiatry began to increase. Similar overall early developments took place in many other countries. In the United States, Child and Adolescent Psychiatry was established as a recognized medical speciality in 1953 with the founding of the American Academy of Child Psychiatry, but was not established as a legitimate, board-certifiable medical speciality until 1959.
The era since the 1980s flourished, in large part, because of contributions made in the 1970s, a decade during which child psychiatry witnessed a major evolution as a result of the work carried out by Michael Rutter. The first comprehensive population survey of 9-to 11-year-olds, carried out in London and the Isle of Wight, which appeared in 1970, addressed questions that have continued to be of importance for child psychiatry; for example, rates of psychiatric disorders, the role of intellectual development and physical impairment, and specific concern for potential social influences on children's adjustment. This work was influential, especially since the investigators demonstrated specific continuities of psychopathology over time in their subsequent re-evaluation of the original cohort of children (unsurprisingly since the environments that nurtured their emotional and developmental difficulties remained largely unchanged). It was paralleled by similarly work on the epidemiology of autism that was to enormously increase the number of children labeled as autistic in future years. Although attention had been given in the 1960s and 1970s to the classification of childhood psychiatric disorders, and some issues had then been delineated, such as the distinction between neurotic and conduct disorders, the nomenclature did not parallel the growing clinical knowledge. It was claimed that this situation was altered in the late 1970s with the development of the DSM-III system of classification, although research has shown that this system of classification has problems of validity and reliability. Since then, DSM-IV and DSM-IVR have corrected some of the questionable parsing of psychiatric disorders into "childhood" and "adult" disorders, recognizing that while many psychiatric disorders are not diagnosed until adulthood, they may present in childhood or adolescence (DSM-IV).
Traditional deficit and disease models of child psychiatry have been criticised as rooted in the medical model which conceptualises adjustment problems in terms of disease states. It is said by these critics that these normative models explicitly characterise problematic behavior as representing a disorder within the child or young person and these commentators assert that the role of environmental influences on behaviour has become increasingly neglected, leading to a decrease in the popularity of, for example, family therapy. There are increasing criticisms of the medical model approach from within and without the psychiatric profession (see references): it is said to neglect the role of environmental, family, and cultural influences, to discount the psychological meaning of behaviour and symptoms, it promotes a view of the "patient" as dependent and needing to be cured or cared for and therefore undermines a sense of personal responsibility for conduct and behaviour, it also promotes a normative conception based on adaptation to the norms of society (the ill person must adapt to society), and is based on the shaky foundations of reliance on a classificatory system that has been shown to have problems of validity and reliability (Boorse, 1976; Jensen, 2003; Sadler et al. 1994; Timimi, 2006). It is well known that diagnostic validity and reliability is questionable in the case of adults and these difficulties are even more acute in the case of child and adolescent emotional and developmental difficulties (Ash, 1949; Bean, 1983; Costello, 1986; Jensen, 2003; Mehlman, 1952, Wakefield, 1994).
Chesson, R. and Chisholm, D. (eds) Child Psychiatric Units at the Crossroads, London, Jessica Kingsley Publishers, 1996.
Green, J. and Jacobs, B. (eds) In-patient Child Psychiatry: Modern practice, research and the future, London, Routledge, 1998.
Health Advisory Service Standards for Child and Adolescent Mental Health Services, (consultation draft) London: HAS 2000, February.
Jones, K. W. (1999). Taming the Troublesome Child: American Families, Child Guidance, and the Limits of Psychiatric Authority. Harvard University Press.
Rutter, Michael and Taylor, Eric. (2005). Child and Adolescent Psychiatry. Blackwell Science.
Sadler, John. Z., Osborne P. Wiggins, and Michael. A. Schwartz, (editors). Philosophical Perspectives on Psychiatric Classification. (Baltimore: Johns Hopkins University Press, 1994).
Timimi, Sami (2002). Pathological Child Psychiatry and the Medicalization of Childhood. Brunner-Routledge.
Timimi, Sami (2005). Naughty Boys: Anti-social Behaviour, ADHD and the Role of Culture. Palgrave Macmillan.
Timimi, Sami (2006). Critical Voices in Child and Adolescent Mental Health. Free Association Books.
Ash, P. The Reliability of Psychiatric Diagnosis. Journal of Abnormal Social Psychology v. 44 (1949), pp. 272-276. A study focusing on three psychiatrists and the degree to which they disagreed on diagnosis of the same patients. Study focused on a number of variables including the seriousness of pathology and the interaction between these variables and consistency. Results show a very low percentage of consistent diagnoses for all three doctors.
Barbour and Allen B. Caring for Patients: a Critique of the Medical Model. Stanford, Ca.: Stanford University Press, 1995. This book relegates the medical model of illness to at least a less primary role in the conceptualisation and treatment of problems. The author argues that "when applied without perspective" the medical model and discrete diagnostics are invalid, and that "a better understanding of the relation of the illness to the life of the patient" can obviate many of the problems the model otherwise incurs.
Beck, A.T. et al. Reliability of Psychiatric Diagnosis. American Journal of Psychiatry v. 119 (October), pp. 351-357. A research study assessing the degree of diagnostic agreement among 4 psychiatrists diagnosing patients in an inpatient facility. Results showed a level of concordance of 54%, high enough to be clearly non-random, but low enough to raise questions about the utility of diagnostics as a treatment or research tool.
Boorse, Christopher. "What a Theory of Mental Health Should Be." Journal of the Theory of Social Behavior, 6 (1976): 61-84.
Costello, Anthony J. (1986). Assessment And Diagnosis Of Affective Disorders In Children Journal of Child Psychology and Psychiatry 27 (5), 565–574.
Farber, Seth. Transcending Medicalism. Journal of Mind and Behaviour, v. 8(1) (1987) pp. 105-132. An argument that psychiatric diagnostics are internally flawed and anti-therapeutic. The author argues for a more culturally informed conception of mental problems beginning from an understanding of these entities not as an epidemic but as a sign of human change and evolution.
Jensen, P S et al. (1993). Child and Adolescent Psychopathology Research: Problems and Prospects for the 1990s. Journal of Abnormal Child Psychology, Vol. 21.
Jensen, P S (2003). Comorbidity and Child Psychopathology: Recommendations for the Next Decade. Journal of Abnormal Child Psychology, Vol. 31.
Jewell, S W. (2002). A Win-Win Relationship: Re-ed and Child Psychiatry. Reclaiming Children and Youth, Vol. 11.
Parron, D L. (1997). The Fusion of Cultural Horizons: Cultural Influences on the Assessment of Psychopathology on Children. Applied Developmental Science, Vol. 1.
Royal College of Psychiatrists Child and Adolescent Psychiatry: A New Century, Occasional Paper OP 33, October 1996.
Wakefield, Jerome C. "The Concept of Mental Disorder: On the Boundary Between Biological Facts and Social Values." American Psychologist 47, no. 3. (1992): 373-88. |
0.999888 | 07083151712 seconds correspond to 224 years, 220 days, 22 hours, 8 minutes and 32seconds.
Take the first three digits: 831.
Someone born on 5/1/71 would be probably 48 years old. |
0.976876 | The Brahma Purana consists of ten thousand verses, the Padma Purana of fifty-five thousand, Sri Visnu Purana of twenty-three thousand, the Siva Purana of twenty-four thousand and Srimad Bhagavatam of eighteen thousand.
The Narada Purana has twenty-five thousand verses, the Markandeya Purana nine thousand, the Agni Purana fifteen thousand four hundred, the Bhavisya Purana fourteen thousand five hundred, the Brahma-vaivarta Purana eighteen thousand and the Linga Purana eleven thousand. The Varaha Purana contains twenty-four thousand verses, the Skanda Purana eighty-one thousand one hundred, the Vamana Purana ten thousand, the Kurma Purana seventeen thousand, the Matsya Purana fourteen thousand, the Garuda Purana nineteen thousand and the Brahmanda Purana twelve thousand. Thus the total number of verses in all the Puranas is four hundred thousand, Eighteen thousand of these, once again, belong to the beautiful Bhagavatam.
It is known that of the eighteen major Puranas, six are for those in the mode of goodness, six are for those in the mode of passion, and six are for those in the mode of ignorance. Although there may be different opinions as to which puranas belong to which group, Srila Prabhupada writes as follows in a purport of Sri Caitanya-caritamrta: The Rg Veda, Yajur Veda, Sama Veda, Atharva Veda, Mahabharata, Pancaratra and original Ramayana are all considered Vedic literature. The Puranas (such as the Brahma-vaivarta Purana, Naradiya Purana, Visnu Purana and Bhagavata Purana) are especially meant for Vaisnavas and are also Vedic literature.
Sri Brahma-vaivarta Purana is one of the eighteen principal Puranas, as stated in the Twelfth Canto of the Bhagavatam: Sages expert in ancient histories have declared that the Puranas, according to their various characteristics, can be divided into eighteen major Puranas and eighteen secondary Puranas.
In Brahma-vaivarta Purana, many very interesting details of familiar stories are found that are not seen elsewhere. There are many stories that explain the circumstances leading up to well-known occurrences, as well as previous lives of well-known personalities, shedding light on how they came to be in that condition. There is also a description of the marriage of Radha and Krsna, performed by Brahma.
Purana consists of four parts-Brahma-khanda, Prakrti-khanda, Ganapati-khanda, and Krsna-janma-khanda. The Krsna-janma-khanda is the largest, comprising about half of the entire work. Although the Vrndavana pastimes are narrated in this khanda, they are briefly described in comparison with what is found in Srimad-Bhagavatam. There are interesting details not found elsewhere, however, including the previous lives of many prominent characters.
This volume presents the Brahma-vaivarta Purana in story form, condensed so that the reader’s interest will be held.
Sri Brahma-vaivarta Purana is one of the eighteen principal Puranas, as stated in the Twelfth Canto of Srimad-Bhagavatam: Sages expert in ancient histories have declared that the Puranas, according to their various characteristics, can be divided into eighteen major Puranas and eighteen secondary Puranas. The eighteen major Puranas are the Brahma, Padma, Visnu, Siva, Linga, Garuda, Narada, Bhagavata, Agni, Skanda, Bhavisya, Brahma-vaivarta, Markandeya, Vamana, Varaha, Matsya, Kurma and Brahmanda Puranas. The Brahma Purana consists of ten thousand verses, the Padma Purana of fifty-five thousad, Sri Visnu Purana of twenty-three thousand, the Siva Purana of twenty-four thousand and Srimad-Bhagavatam of eighteen thousand. The Narada Purana has twenty-five thousand verses, the Markandeya Purana nine thousand, the Agni Purana fifteen thousand four hundred, the Bhavisya Purana fourteen thousand five hundred, the Brahma-vaivarta Purana eighteen thousand and the Linga Purana eleven thousand. The Varaha Purana contains twent-four thousand verses, the Skanda Purana eighty-one thousand one hundred, the Vamana Purana ten thousand, the Kurma Purana seventeen thousand, the Matsya Purana fourteen thousand, the Garuda Purana nineteen thousand and the Brahmanda Purana twelve thousand. Thus the total number of verses in all the Puranas is four hundred thousand. Eighteen thousand of these, once again, belong to the beautiful Bhagavatam.
It is know that of the eighteen major Puranas, six are for those in the mode of goodness, six are for those in the mode of passion, and six are for those in the mode of ignorance. Although there may be different opinions as to which Puranas belong to which group, Srila Prabhupada writes as follows in a purport of Sri Caitanya-caritamrta: The Rg Veda, Yajur Veda, Sama Veda, Atharva Veda, Mahabharata, Pancaratra and original Ramayana are all considered Vedic literature. The Puranas (such as the Brahma-vaivarta Purana, Naradiya Purana, Visnu Purana and Bhagavata Purana) are especially meant for Vaisnavas and are also Vedic literature.
Srila Prabhupada confirmed this while lecturing on Srimad-Bhagavatam in Paris in 1974: Krsna advised Arjuna, traigunya-visaya veda nistraigunyo bhavarjuna. The Vedas deal with these three gunas- the sattva-guna, rajo-guna, tamo-guna. So, for one who is in the sattva-guna, there are six Puranas. Sattva-guna, tamo-guna, rajo-guna. There are eighteen Puranas. Some of them are for persons who are situated on the modes of goodness, and some of them are for the persons who are in rajo-guna, and some of them are for persons in tamo-guna. Just like in the Vedic sastras, there is also recommendation to worship goddess Kali. That is for the tamo-guna, not for the sattva-guna. For the sattva-guna, there is the Visnu-Purana, Brahmanda-Purana, Brahma-vaivarta-Purana, Bhagavata- Purana. Because knowledge has to be given to everyone, according to his capacity.
Acyutananda: In South India there are very few Radha-Krsna devotees. And what they have is from some Puranas, the marriage of Radha and Krsna. They perform Radha-Krsna kalyana, marriage.
Tamala Krsna: Is that bona fide, Prabhupada?
Prabhupada: That will be nice. I was training, but they have not become so expert. As I am doing Bhagavad-gita, Srimad-Bhagavatam, they could do Padma Purana, Brahma-vaivarta Purana in the same way, but our students are not so expert.
please let me know where can i find this book. |
0.999999 | Jim Carrey, born as James Eugene "Jim" Carrey, is a renowned actor from Canada. He has also established himself as a comedian and impressionist. He is also a movie producer and a screenwriter. He is popular in the world for portraying his role in the famous television series, In Living Color.
Jim Carrey was born in a middle-class family on January 17, 1962, in Newmarket, Canada, to Kathleen Carrey and Percy Carrey. Both of his parents were middle-class workers. He holds the citizenship of America as well as Canada and he is White.
Talking about his formal education, Jim finished his 10th from Agincourt Collegiate Institute and finished his high school from Aldershot High School.
How old is Jim Carry?
Jim was born on January 17, 1962, and is 57 years of age, as of 2019.
Jim Carrey was a married man but he soon got a divorce from her wife. He was first married to Melissa Womer on 28th of March 1987.
They also had one child together. They remained in married life for a shy of a decade and finally called off their marriage in 1995.
He again got married the following year and this time it was with Lauren Holly; she is also an actress known for her role in the comedy movie, Dumb and Dumber.
But his second married life lasted only for a year as they got divorced in 1997.
He began his acting career since 1980 but it was not easy to obtain him the acting role during that time. He struggled a lot to make his first big screen appearance. He made his professional appearance as a comedian. His major acting role was in the comedy movie, Dumb and Dumber to whose box office earning was around $169.8 million.
As of 2019, he has a net worth of around $150 million. A major portion of his earning comes from his career as an actor. Besides, he also from brand endorsements and sponsorships.
The Hollywood actor Jim owns several houses across the United States. As of 2019, he resides in a beautiful mansion in the west Los Angeles, California.
Likewise, he also owns a seven-thousand square foot duplex penthouse located in Manhattan, New York, which he bought for a total of $13.65 million. The penthouse that was built in 1824 consists of six bedrooms, six full bathrooms, and four half bathrooms.
Jim Carrey was from the middle class family born as James Eugene Carrey in New market, Canada to Kathleen Carrey and Percy Carrey. Both of his parents were middle class workers. He holds the citizenship of America as well as Canada and he is White.
Jim Carrey was a married man. He has been married twice but not anymore as both of his married life dissolved after being married for few years. He was first married to Melissa Womer. She is also a comedian and an actress. They got married on 28th of March 1987.
Before being married to Melissa Womer, he was involved in romantic relationship with Linda Ronstadt. She is one of the renowned singers from United States. They began dating since 1983 but it was just for a short period of time.
He was first married to Melissa Womer, she was an actress and also the comedian like him. They also had one child together. They remained in married life for a shy of decade and finally called off their marriage in 1995.
He again got married the following year and this time it was with Lauren Holly, she is also an actress and she also portrayed her role in the comedy movie, Dumb and Dumber. But this married life lasted only for a year.
After his first married life was dissolved in 1995, he them got married with Lauren Holly the following year. But this married life lasted only for a year as they got divorced in 1997. They didn't have any children together.
Soon after being married with Melissa Womer he became father for the first time in his life. His wife, Melissa Womer gave birth to their first child, a sweet little daughter, Jane Erin Carrey on 6th of September of the same year.
Jim Carrey was born in New market, Canada to Kathleen Carrey and Percy Carrey. Since his childhood days, he was raised and feed there. Before 2004, he was the solo citizen of Canada but from 2004 he also received his citizenship of United States.
He began his acting career since 1980 but it was not easy to obtain him the acting role during that time. He struggled a lot to make his first big screen appearance. He made his professional appearance as a comedian.
It was 1980 when he began his acting career but it took him more than a decade to make his movie appearances. He made his major movie appearance only in 1994 and that was in the comedy movie, Dumb and Dumber. It is a famous comedy movie.
Golden Globes, USA is also one of the prestigious awards in Hollywood and he has also been honored with this award twice in his life. He was first nominated in this award back in 1995 but it was 1999 when he won this award for the first time.
Blockbuster Entertainment Awards is also one of the prestigious awards and he has also been honored with this award four times in his life. He first won this award back in 1995 and that was from his role in Ace Ventura: Pet Detective.
He has also been honored by the Kids' Choice Awards, USA. Actually he has won this award for six different times in his life. He first won this award back in 1995 and that was for Favorite Movie Actor. He also won this award for the next two consecutive years from the same category.
He has been nominated in lots of prestigious awards and he has also won some of them. In 1995 he received lots of prestigious awards in his life and one of them is also MTV Movie Awards. He has been honored with this award for ten different times in his life. |
0.999969 | Although I couldn’t agree with this more, I think in the last years this changed a bit.
After talking to Jurgen Appelo and reading his blog post about “The purpose of a business is NOT customer values” I came up with the “1st principle of the Agile Manifesto 3.0”.
Jurgen calls BS on “delight the customer” and is keen on satisfying everyone involved: stockholders, employees, suppliers, customers, community, the environment,. ..
It might be hard to satisfy everyone with valuable software, but having that as goal is great.
and I really wanted to align this with the “Management 3.0” naming of Jurgen. --> Which I like!
What do you think? Brain fart? Helpful to think about your business?
Great idea to look beyond the original agile manifesto.
But "satisfy everyone" to me sounds like a symptom of a psychic disorder. Lots of people are being treated because they´re constantly trying to satisfy everyone.
Such a lofty goal might be ethically commendable - but it cannot be reached and thus inevitably leads to deep frustration.
Software development is an organizational unit in need to feel it makes a difference; it´s looking for meaning, because it´s constituted by people looking for meaning. Satisfying someone sure gives meaning.
On the other hand, though, to stay "functional" and be able to satisfy in a sustainable way resources need to be managed. That means resources need to be withheld from someone from time to time. Which surely dissastisfies this person.
In addition satisfaction means different things to different people and might even be in contradiction. Satisfaction of everyone therefore is impossible.
Bottom line: No, I don´t agree with your Agility 3.0 statement.
>>to stay "functional" and be able to satisfy in a sustainable way resources need to be managed.
If you talk about resources here, what do you mean?
>>That means resources need to be withheld from someone from time to time. Which surely dissastisfies this person.
Not sure what you mean, but "withholding resources from someone" means knowing their expectations of that resource.
Delighting someone = raising their expectation.
>>In addition satisfaction means different things to different people and might even be in contradiction.
>>Satisfaction of everyone therefore is impossible.
I am not able to follow your conclusion. Can you expand this a little bit?
Have you seen an organization where everyone is satisfied?
Here´s a scenario: Stakeholder A wants your attention now, stakeholder B wants your attention now. How do you satisfy both? You cannot. It´s a conflict. At least not without negotiation.
Negotiation might lead to changes in what A and B want. So after some negotiation A might agree to get your attention tomorrow. You give your attention to B today and to A tomorrow. All parties satisfied.
Sounds great. But additional effort needed to be invested into negotiation. This cannot be done indefinitely. You need to cap the resources going into negotiation, otherwise you might end up negotiating all the time.
But if you cap negotiation then you can´t assume all conflicts to get resolved. And that means, you cannot reliably satisfy everyone.
Delighting someone is great. Go for it. But the delight of someone might not be the delight of someone else. Ask you spouse if she´s delighted all the time when you delight your customers :-) Or the other way around. A customer might agree with you going on a vacation because you want to delight your spouse - but he´s not necessarily delighted by the delay that causes in working with you.
"Satisfy everyone" as highest priority is not a sustainably motto, I´d say. All the people I know who tried this burned themselves out or even died early. The same will happen to an organization.
You know what bothers me most with such slogans? They are asymmetric. It´s a modern way of slavery. And as with social media it´s self inflicted.
20 years ago it was all war. Business was constant fight. Today it´ seems to be constant submission. "Satisfy everyone" is submission of maybe a subtle form.
Much, much more important than "constant satisfaction" I find trust, reliability, responsibility, good will, honesty, partnership.
>> Here´s a scenario: Stakeholder A wants your attention now, stakeholder B wants your attention now.
Can you solve the root cause that both stakeholders need attention at the same time.
>> Delighting someone is great. Go for it. But the delight of someone might not be the delight of someone else.
I think it is the balance.
And that is the reason I think why Jurgen talked about "satisfying" and not "delighting".
To me satisfying someone is easier to achieve than delighting him/her.
>> You know what bothers me most with such slogans? They are asymmetric. It´s a modern way of slavery.
I am not sure what you mean, but I see "Satisfy everyone" as a goal, which you strive for.
>> Much, much more important than "constant satisfaction" I find trust, reliability, responsibility, good will, honesty, partnership. |
0.894928 | (a) A lawyer shall hold funds and other property belonging in whole or in part to clients or third persons that are in a lawyer's possession in connection with a representation separate from the lawyer's own property. Such funds shall be kept in a separate account, designated as a "trust" or "escrow" account, maintained in the state where the lawyer's office is situated, or elsewhere with the consent of the client or third person. Other client property shall be identified as such and appropriately safeguarded. Complete records of such account funds and other property shall be kept by the lawyer and shall be preserved for a period of five years after termination of the representation.
(c) When in the course of representation a lawyer is in possession of funds or other property in which both the lawyer and another person claim interests, the property shall be kept separate by the lawyer until there is an accounting and severance of their interest. All funds in a trust or escrow account shall be disbursed only to those persons entitled to receive them by virtue of the representation or by law. If a dispute arises concerning their respective interests, the portion in dispute shall be kept separate by the lawyer until the dispute is resolved, and the undisputed portion shall be distributed appropriately.
1. A lawyer should hold property of others with the care required of a professional fiduciary. Securities should be kept in a safe deposit box, except when some other form of safekeeping is warranted by special circumstances. All property which is the property of clients or third persons should be kept separate from the lawyer's business and personal property and, if monies, in one or more trust accounts. Separate trust accounts may be warranted when administering estate monies or acting in similar fiduciary capacities. Paragraph (a) requires that complete records of the funds and other property be maintained.
2. Lawyers often receive funds from third parties from which the lawyer's fee will be paid. These funds should be deposited into a lawyer's trust account. If there is risk that the client may divert the funds without paying the fee, the lawyer is not required to remit the portion from which the fee is to be paid. However, a lawyer may not hold funds to coerce a client into accepting the lawyer's contention. The disputed portion of the funds should be kept in trust and the lawyer should suggest means for prompt resolution of the dispute, such as arbitration. The undisputed portion of the funds should be promptly distributed to those entitled to receive them by virtue of the representation. A lawyer should not use even that portion of trust account funds due to the lawyer to make direct payment to general creditors of the lawyer of the lawyer's firm, because such a course of dealing increases the risk that all the assets of that account will be viewed as the lawyer's property rather than that of clients, and thus as available to satisfy the claims of such creditors. When a lawyer receives from a client monies that constitute a prepayment of a fee and that belongs to the client until the services are rendered, the lawyer should handle the fund in accordance with paragraph (c). After advising the client that the service has been rendered and the fee earned, and in the absence of a dispute, the lawyer may withdraw the fund from the separate account. Paragraph (c) does not prohibit participation in an IOLTA or similar program.
3. Third parties, such as client's creditors, may have just claims against funds or other property in a lawyer's custody. A lawyer may have a duty under applicable law to protect such third-party claims against wrongful interference by the client, and accordingly may refuse to surrender the property to the client. However, a lawyer should not unilaterally assume to arbitrate a dispute between the client and the third party.
4. The obligations of a lawyer under this Rule are independent of those arising from activity other than rendering legal service. For example, a lawyer who serves as an escrow agent is governed by the applicable law relating to fiduciaries even though the lawyer does not render legal services in the transaction.
5. The "client's security fund" in Texas provides a means through the collective efforts of the bar to reimburse persons who have lost money or property as a result of dishonest conduct of a lawyer. |
0.958671 | Illinois is a state in the Midwestern region of the United States. It has the fifth largest gross domestic product (GDP), the sixth largest population, and the 25th largest land area of all U.S. states. Illinois is often noted as a microcosm of the entire United States. With Chicago in northeastern Illinois, small industrial cities and immense agricultural productivity in the north and center of the state, and natural resources such as coal, timber, and petroleum in the south, Illinois has a diverse economic base, and is a major transportation hub. Chicagoland, Chicago's metropolitan area, encompasses over 65% of the state's population. The Port of Chicago connects the state to international ports via two main routes: from the Great Lakes, via the Saint Lawrence Seaway, to the Atlantic Ocean and from the Great Lakes to the Mississippi River, via the Illinois Waterway to the Illinois River. The Mississippi River, the Ohio River, and the Wabash River form parts of the boundaries of Illinois. For decades, Chicago's O'Hare International Airport has been ranked as one of the world's busiest airports. Illinois has long had a reputation as a bellwether both in social and cultural terms and, through the 1980s, in politics.
The Chicago Fire Department (CFD) provides both fire suppression and emergency medical services to the city of Chicago, Illinois, United States, under the jurisdiction of the Mayor of Chicago. The Chicago Fire Department is the third largest municipal fire department in the United States after the New York City Fire Department and Cal Fire, as measured by sworn personnel. It is also one of the oldest major organized fire departments in the nation.
The Chicago Police Department (CPD) is the law enforcement agency of the U.S. city of Chicago, Illinois, under the jurisdiction of the City Council. It is the second largest municipal police department in the United States, behind the New York City Police Department. It has approximately 13,500 officers and over 1,925 other employees. Tracing its roots back to the year 1835, the Chicago Police Department is one of the oldest modern police forces in the world. The United States Department of Justice has criticized the department for its poor training, lack of oversight and routine use of excessive force.
Richard Michael Daley is an American politician, lawyer, and author who served as the 54th Mayor of Chicago, Illinois from 1989 to 2011. Daley was elected mayor in 1989 and was reelected five times until declining to run for a seventh term. At 22 years, he was the longest-serving Chicago mayor, surpassing the tenure of his father, Richard J. Daley.
The City Treasurer of Chicago is an elected official of the City of Chicago.
William Michael "Bill" Daley is an American lawyer, politician and former banker. He served as White House Chief of Staff to President Barack Obama, from January 2011 to January 2012. He also served as U.S. Secretary of Commerce, from 1997 to 2000, under President Bill Clinton. He has also served on the executive committee of JPMorgan Chase & Co. Daley was a candidate for Governor of Illinois in the 2014 gubernatorial election, until dropping out of the race on September 16, 2013. He ran in the 2019 Chicago mayoral election but came in third in the first-round voting, and did not advance to the runoff.
Michael Anthony Bilandic was an American Illinois politician who served as the 49th mayor of Chicago, Illinois, after the death of then-mayor Richard J. Daley, from December 20, 1976, until April 16, 1979. Bilandic was a Democrat and a Croatian-American who also served as Chief Justice of the Illinois Supreme Court some years after his tenure as Chicago mayor. Bilandic practiced law in Chicago for several years, having graduated from the DePaul University College of Law. Bilandic served as an alderman in the Chicago City Council, representing the eleventh ward on the south-west side from June 1969 until he began his tenure as mayor in December 1976.
Forrest Edward Claypool is an American politician who has held several positions in the governments of Chicago, Cook County, and the State of Illinois. He was the Chief Executive Officer of Chicago Public Schools from July 27, 2015, until December 8, 2017. Previous offices held by Claypool include Superintendent of the Chicago Park District from 1993 to 1998, Chief of Staff to Chicago Mayor Rahm Emanuel, and President of the Chicago Transit Authority. In 2007–2008, Claypool served as a key member of Barack Obama campaign's media team, in his capacity as a longtime partner of David Axelrod.
Timothy C. Evans is an American attorney, politician, former alderman and the current Chief Judge of the Cook County Circuit Court. Evans is noted as the first African-American Chief Judge of the Cook County Circuit Court. A graduate of the John Marshall Law School in Chicago, Evans was first elected to the bench in 1992.
Miguel del Valle is an American politician and the former City Clerk of Chicago. He was an Illinois State Senator for two decades, representing the 2nd District of Chicago from 1987–2006. Del Valle lost his bid for mayor in Chicago's February 22, 2011 municipal elections, coming in third with 53,953 votes.
The city of Chicago, Illinois held a nonpartisan mayoral election on Tuesday, February 22, 2011. Incumbent Mayor Richard M. Daley, a member of the Democratic Party who had been in office since 1989, did not seek a seventh term as mayor. This was the first election since 1947 in which an incumbent mayor of Chicago did not seek reelection.
Gery J. Chico is an American politician, Chicago lawyer, public official and former Democratic primary candidate for United States Senate.
An election took place on February 24, 2015, to elect the mayor of Chicago. The election was non-partisan and no candidate received a majority. A runoff election was held between the top two finishers on April 7, 2015, and resulted in the reelection of incumbent mayor Rahm Emanuel. The elections were concurrent with the 2015 Chicago aldermanic elections.
The 2019 Chicago mayoral election was the 2019 edition of the quadrennial elections held to determine the Mayor of the city of Chicago, Illinois. The election was held on February 26, 2019. Since no candidate received a majority of votes, a runoff election was held on April 2, 2019 between the two candidates with the most votes, Lori Lightfoot and Toni Preckwinkle. Lightfoot defeated Preckwinkle in the runoff election, becoming mayor-elect of Chicago. Lightfoot is scheduled to take office on May 20, 2019.
Anna M. Valencia is an American public official who serves as the City Clerk of Chicago. Valencia was sworn into office on January 25, 2017. She was elected to a full term as City Clerk in February 2019.
Lori Elaine Lightfoot is an American politician who was elected Mayor of Chicago in 2019. She has worked in private legal practice as a partner at Mayer Brown and held various government positions in the City of Chicago, most notably as former President of the Chicago Police Board and chair of the Chicago Police Accountability Task Force. She is a member of the Democratic Party.
Chicago has held regularly-scheduled popular elections to select the city's mayor ever since it was incorporated as a city in 1837.
↑ "Government, City of Chicago". www.encyclopedia.chicagohistory.org. Retrieved 19 March 2018.
↑ "Chicago Mayors, 1837-2007". www.encyclopedia.chicagohistory.org. Retrieved 19 March 2018.
↑ Hardy, Thomas (July 7, 1995). "Gov. Edgar To End City Partisan Votes". Chicago Tribune.
↑ "Chicago Mayors". Chicago Public Library. Retrieved 8 October 2016.
↑ "Mayor Eugene Sawyer Biography" . Retrieved 2016-10-08.
"A Chronology of Chicago's Mayors". Chicago Public Library . Retrieved 2010-05-26.
Wikimedia Commons has media related to Mayors of Chicago . |
0.998779 | The infographics highlight key findings for trends in drug overdose deaths from 2000-2017, show how each state's overdose rates compare to the national average, and provide a high-level comparison of all 50 states' overdose death rates broken down by each of the five drug types.
Click on a state below to see its two-page infographic, and click here for the two-page infographic for the United States.
Data Source: The State Health Compare estimates for opioid overdose death rates come from the Centers for Disease Control and Prevention, National Center for Health Statistics via the CDC WONDER Database. CDC WONDER manages nearly 20 collections of public-use data for U.S. births, deaths, cancer diagnoses, tuberculosis cases, vaccinations, environmental exposures, and population estimates, among many other topics, and partners with organizations such as the Food and Drug Administration and the North American Association of Central Cancer Registries. Data is available for years 1999 to 2017, and users are able to view estimates for all available data years and for all five drug types at both the national and state levels.
Although reports of illicit drugs being tainted with synthetic opioids are relatively common, it is unclear whether deaths involving multiple drugs are typically the result of drugs being intentionally mixed by or unintentionally contaminated through traffickers’ sloppiness, or because individual drug users are concurrently abusing multiple different drugs of their own volition. |
0.999984 | Dans cet article, nous souhaitons décrire comment se déroule une première consultation chez le dentiste. Nous reviendrons rapidement sur la place du sourire dans notre société et sur l’examen bucco-dentaire qui est effectué au premier rendez-vous.
Le sourire sur un visage est un élément visuel très important dans la société qui donne des informations sur qui vous êtes et sur votre état de santé général.
De nombreuses recherches scientifiques montrent l’impact positif qu’un joli sourire peut avoir sur les relations sociales et les partenariats professionnels que l’on peut établir. De plus, le sourire est contagieux, c’est-à-dire qu’il attire à vous non seulement des personnes positives mais instaure également un climat de confiance.
Plus votre sourire est attirant, plus vous aurez d’influence positive sur ceux qui vous entourent.
Ces premiers arguments sont de bonnes raisons d’aller consulter un dentiste dans son cabinet dentaire. Il se peut que vous n’aimiez pas l’apparence de votre sourire, ou que quelque chose affecte la bonne santé de vos dents.
Rencontrer un dentiste pour une première consultation n’est pas forcement le signe que vous avez de gros problèmes de dentition, cela peut être une auscultation de routine durant laquelle le professionnel va s’assurer de la bonne santé de vos dents.
La première étape consiste donc à prendre contact avec un dentiste afin de faire le point sur votre santé bucco-dentaire. Pour certaines personnes, l’idée de consulter une dentiste est un véritable cauchemar car il y a toujours ces nombreux préjugés sur les arracheurs de dents et leurs méthodes moyen-âgeuses.
La médecine a considérablement évolué avec les années et désormais les dentistes ont un savoir-faire médical très avancé avec des techniques qui ne sont plus douloureuses. Que ce soit à l’aide d’outils précis ou de solutions analgésiques et antalgiques, vous ne sentirez rien pendant l’osculation bucco-dentaire.
Ainsi, une grande partie du stress et de l’anxiété que les usagers éprouvent au sujet de leur consultation chez le dentiste vient du fait qu’ils ne savent pas à quoi s’attendre. Une fois la consultation passée, la nervosité disparait totalement et les patients peuvent appréhender avec plus de légère leur suivi dentaire.
Comment se déroule la première consultation chez le dentiste ?
Comme nous l’avons précisé ci-dessus, la première consultation chez le dentiste permet d’avoir une évaluation orale complète de l’état de santé de sa dentition.
Le dentiste pourra alors vous recommander les meilleurs traitements pour votre bouche.
En outre, faire une première consultation chez le dentiste est un excellent moyen de poser des questions sur sa santé bucco-dentaire et d’en apprendre un peu plus sur l’état général de ses dents.
I am thankful that I discovered this site, exactly the right info that I was searching for! .
I must express my passion for your kind-heartedness supporting men and women who require guidance on in this topic. Your very own commitment to passing the message all over has been incredibly informative and have really made most people like me to get to their targets. Your personal important guidelines implies a great deal a person like me and still more to my peers. Regards; from everyone of us.
You completed several fine points there. I did a search on the subject and found nearly all folks will go along with with your blog.
I’d should test with you here. Which isn’t something I usually do! I take pleasure in reading a submit that will make individuals think. Additionally, thanks for permitting me to comment!
Good blog! I truly love how it is easy on my eyes and the data are well written. I’m wondering how I might be notified whenever a new post has been made. I’ve subscribed to your feed which must do the trick! Have a nice day!
I’ll immediately seize your rss as I can’t in finding your e-mail subscription link or e-newsletter service. Do you have any? Please allow me recognize in order that I may just subscribe. Thanks.
What i don’t realize is actually how you’re not actually much more well-liked than you may be right now. You’re so intelligent. You realize thus significantly relating to this subject, produced me personally consider it from so many varied angles. Its like men and women aren’t fascinated unless it is one thing to do with Lady gaga! Your own stuffs great. Always maintain it up!
That is really attention-grabbing, You’re an overly skilled blogger. I’ve joined your rss feed and look ahead to in search of extra of your excellent post. Additionally, I’ve shared your site in my social networks!
It’s a shame you don’t have a donate button! I’d most certainly donate to this brilliant blog! I guess for now i’ll settle for bookmarking and adding your RSS feed to my Google account. I look forward to new updates and will talk about this website with my Facebook group. Talk soon!
Hello there, I found your blog via Google even as searching for a similar subject, your site got here up, it appears great. I’ve bookmarked it in my google bookmarks.
Thank you, I have recently been searching for info about this topic for a while and yours is the best I’ve discovered till now. But, what about the bottom line? Are you positive about the source?
I believe this web site has some very excellent information for everyone : D.
I do love the way you have framed this particular matter and it does present me a lot of fodder for thought. However, coming from what I have seen, I simply hope when the actual opinions pack on that people stay on issue and in no way start on a soap box of some other news du jour. Yet, thank you for this fantastic piece and while I do not agree with this in totality, I value the point of view.
There are actually quite a lot of particulars like that to take into consideration. That is a great level to bring up. I offer the ideas above as basic inspiration but clearly there are questions just like the one you deliver up where an important factor will be working in sincere good faith. I don?t know if best practices have emerged round issues like that, however I’m certain that your job is clearly identified as a fair game. Each boys and girls really feel the influence of only a second’s pleasure, for the rest of their lives.
It’s in point of fact a great and helpful piece of information. I am satisfied that you shared this helpful info with us. Please stay us up to date like this. Thanks for sharing.
magnificent points altogether, you just won a new reader. What could you recommend about your post that you made a few days in the past? Any sure?
I enjoy you because of your entire effort on this site. Debby takes pleasure in managing internet research and it is easy to understand why. I hear all of the powerful tactic you provide very important tricks through the website and as well improve contribution from some other people on this concept plus our favorite princess is understanding a whole lot. Have fun with the rest of the new year. You are always conducting a dazzling job.
Usually I don’t learn post on blogs, however I would like to say that this write-up very forced me to try and do so! Your writing style has been amazed me. Thank you, quite great post.
That is the appropriate blog for anybody who needs to seek out out about this topic. You notice a lot its nearly exhausting to argue with you (not that I truly would want…HaHa). You definitely put a new spin on a topic thats been written about for years. Great stuff, just nice!
Hi my friend! I want to say that this article is awesome, nice written and come with approximately all vital infos. I would like to peer extra posts like this .
Hi there! This is my 1st comment here so I just wanted to give a quick shout out and tell you I really enjoy reading your articles. Can you recommend any other blogs/websites/forums that go over the same subjects? Thanks for your time!
Very nice post. I simply stumbled upon your blog and wanted to say that I have really loved surfing around your weblog posts. After all I’ll be subscribing for your rss feed and I’m hoping you write once more soon!
Thanks for sharing superb informations. Your web-site is very cool. I am impressed by the details that you?¦ve on this site. It reveals how nicely you understand this subject. Bookmarked this web page, will come back for more articles. You, my pal, ROCK! I found simply the info I already searched everywhere and just couldn’t come across. What an ideal site.
naturally like your web site but you need to test the spelling on quite a few of your posts. Several of them are rife with spelling issues and I in finding it very troublesome to inform the truth on the other hand I will certainly come back again.
You could certainly see your enthusiasm within the paintings you write. The world hopes for more passionate writers such as you who are not afraid to mention how they believe. At all times go after your heart. « If the grass is greener in the other fellow’s yard – let him worry about cutting it. » by Fred Allen.
I have learn a few just right stuff here. Definitely price bookmarking for revisiting. I surprise how so much effort you put to make this type of excellent informative web site.
I?¦ve been exploring for a little bit for any high-quality articles or blog posts in this sort of space . Exploring in Yahoo I at last stumbled upon this site. Reading this info So i?¦m glad to express that I’ve a very just right uncanny feeling I discovered exactly what I needed. I most unquestionably will make sure to don?¦t omit this site and give it a glance on a constant basis.
I have recently started a blog, the information you offer on this website has helped me tremendously. Thanks for all of your time & work. « ‘Tis our true policy to steer clear of permanent alliances with any portion of the foreign world. » by George Washington.
I was reading through some of your blog posts on this site and I conceive this website is real informative ! Continue putting up.
Hi, i believe that i noticed you visited my site so i got here to “return the want”.I’m trying to in finding issues to improve my web site!I guess its good enough to make use of some of your ideas!!
I am not very superb with English but I line up this very easy to read .
It is perfect time to make some plans for the longer term and it’s time to be happy. I have read this publish and if I could I want to counsel you few attention-grabbing issues or suggestions. Perhaps you could write next articles regarding this article. I desire to read even more things approximately it!
Wonderful goods from you, man. I have understand your stuff previous to and you’re just extremely magnificent. I actually like what you have acquired here, really like what you’re saying and the way in which you say it. You make it enjoyable and you still take care of to keep it sensible. I can’t wait to read far more from you. This is actually a terrific web site.
Great post. I was checking continuously this weblog and I’m impressed! Extremely helpful info specially the closing section 🙂 I deal with such information a lot. I was looking for this particular info for a long time. Thanks and best of luck.
hey there and thank you for your information – I have certainly picked up anything new from right here. I did however expertise a few technical issues using this website, as I experienced to reload the website a lot of times previous to I could get it to load properly. I had been wondering if your hosting is OK? Not that I’m complaining, but slow loading instances times will very frequently affect your placement in google and can damage your high-quality score if ads and marketing with Adwords. Anyway I’m adding this RSS to my email and can look out for a lot more of your respective intriguing content. Make sure you update this again soon..
What¦s Taking place i’m new to this, I stumbled upon this I have discovered It positively helpful and it has helped me out loads. I hope to contribute & assist other users like its aided me. Good job.
It is really a great and helpful piece of info. I am satisfied that you simply shared this useful info with us. Please stay us up to date like this. Thanks for sharing.
It¦s actually a great and helpful piece of info. I am glad that you simply shared this helpful info with us. Please stay us informed like this. Thanks for sharing.
I am lucky that I detected this web blog, precisely the right info that I was searching for! .
You made a few nice points there. I did a search on the issue and found most persons will have the same opinion with your blog.
Awesome blog! Do you have any recommendations for aspiring writers? I’m planning to start my own blog soon but I’m a little lost on everything. Would you propose starting with a free platform like WordPress or go for a paid option? There are so many options out there that I’m totally confused .. Any tips? Thanks!
I’m writing to make you know what a fabulous experience my wife’s girl gained reading your webblog. She came to find numerous details, which included what it’s like to possess an ideal coaching spirit to have men and women effortlessly thoroughly grasp certain complex issues. You truly exceeded our expectations. Thank you for showing such powerful, trustworthy, educational and also easy tips on your topic to Janet.
patent attorney dans Prêt lissé, comment ça marche? |
0.919631 | The Arctic (pronounced /ˈɑrktɪk/ or /ˈɑrtɪk/) is the region around the Earth's North Pole, opposite the Antarctic region around the South Pole. The Arctic includes the Arctic Ocean (which overlies the North Pole) and parts of Canada, Greenland (a territory of Denmark), Russia, the United States (Alaska), Iceland, Norway, Sweden and Finland.
The word Arctic comes from the Greek αρκτικός (arktikos), "near the Bear, arctic, northern" and that from the word άρκτος (arktos), which means bear. The name refers either to the constellation Ursa Major, the "Great Bear", which is prominent in the northern portion of the celestial sphere, or to the constellation Ursa Minor, the "Little Bear", which contains Polaris, the Pole Star, also known as the North Star.
The Arctic region can be defined as the area north of the Arctic Circle (66° 33’N), which is the approximate limit of the midnight sun and the polar night. Alternatively, it can be defined as the region where the average temperature for the warmest month (July) is below 10 °C (50 °F); the northernmost tree line roughly follows the isotherm at the boundary of this region. Socially and politically, the Arctic region includes the northern territories of the eight Arctic states, including Sapmi, although by natural science definitions much of this territory is considered subarctic.
The Arctic region consists of a vast, ice-covered ocean (which is sometimes considered to be a northern arm of the Atlantic Ocean) surrounded by treeless permafrost. In recent years the extent of the sea ice has declined. Life in the Arctic includes organisms living in the ice, zooplankton and phytoplankton, fish and marine mammals, birds, land animals, plants, and human societies.
The Arctic region is a unique area among Earth's ecosystems. The cultures in the region and the Arctic indigenous peoples have adapted to its cold and extreme conditions.
Due to the poleward migration of the planet's isotherms (about 35 miles per decade during the past 30 years as a consequence of global warming), the Arctic region (as defined by tree line and temperature) is currently shrinking. Perhaps the most spectacular result of Arctic shrinkage is sea ice loss. There is a large variance in predictions of Arctic sea ice loss, with models showing near-complete to complete loss in September from 2040 to some time well beyond 2100. About half of the analyzed models show near-complete to complete sea ice loss in September by the year 2100. |
0.949968 | Any tricks to get the authenticated user in git hook script?
As stash is on the way of adding more strong permissions controls, we are thinking of implementing a branch level ACL based on Git Hook scripts when people doing push.
But we stuck at how to get the actual user who is issuing the push, the $USER always returns the Stash instance user, which makes sense, as it is the user who eventually run the "git" commands.
But is there anyone we could get the actual authenticated user (name or email) in hooks?
It's currently not possible to get the authenticated user from Stash in a git hook script, but it should be a small change to make the information available. I can see how this would be useful for almost any hook script, so I hope we can make the fix available soon.
I've opened a Jira issue for this (https://jira.atlassian.com/browse/STASH-2555); please watch the issue to follow our progress.
# An example hook script for the "post-receive" event.
# rename the file to "post-receive".
So your committer and pusher could be the same person with different usernames? Otherwise author is the person that makes the change and committer is the integrator that pushes to the central repository.
yeah, in my case, the person who makes the change, and the integrator who do the push are different. |
0.915068 | The Pixel is Google's newest landmark device, marking the departure from their earlier, highly successful Nexus brand. How does the device stand up to today's standards? Here is one way to find out.
The earlier Nexus devices were made by its respective companies with just the Google branding included, the Pixel marks Google's first proper journey into the smartphone market this. The smartphone was designed and engineered by Google, with HTC being its manufacturing partner.
The devices come in two sizes: the standard Pixel, and a larger Pixel XL that has a 5.5-inch screen. The smaller variant, which will be reviewed here, comes with a 5-inch, 1920x1080-resolution AMOLED display with Corning Gorilla Glass 4.
Onto its design, the Pixel and Pixel XL seems to have similar design qualities with the Apple iPhone 7 - from its curves and front bezels, antenna lines, to the speaker placement. There are a few differences, though, with its unique glass shade at the back.
The device comes in with the latest Android Nougat 7.1.1 software and is expected to bring the fastest updates just like the earlier Nexus series. The Pixel also exclusively features the Google Assistant, a virtual assistant similar to Apple's Siri.
A quad-core Qualcomm Snapdragon 821 processor is included inside the Pixel, and has 4 GB or RAM on its 32 and 128 GB configurations. It also features a 2,770mAh battery, USB 3.0 with a Type-C connector, a rear-mounted fingerprint sensor, fast battery charging via the USB-C Power Delivery standard, and scratch and dust resistance.
One of the Pixel's breakthrough feature is its camera and its capabilities, as the device has reportedly one of the best cameras of any smartphone as of the moment. It features a 12.3-megapixel primary camera and it can produce photos of stunning quality. Although, its low-light performance and its lens blur effect is a bit inferior against its rivals.
The Google Pixel starts at $649 - a rather steep price point. In addition, the 128 GB model for the Pixel is at around $749 and the Pixel XL's 128 GB variant can go up to $869, but includes a few more additions like a larger screen and a bigger 3,450mAh battery capacity. |
0.999969 | The First Transcontinental Railroad was completed in which year?
During the second half of the nineteenth century, the United States engaged in a massive railroad construction project. This linked communities over vast distances for the first time in American history. The First Transcontinental Railroad was built between 1863 and 1869 and finished in 1869, with the initial first destination being San Francisco.
The Emancipation Proclamation was issued during __________.
The Emancipation Proclamation was issued in 1863, in the middle of the Civil War, by President Abraham Lincoln. The Proclamation formally stated that the slaves living in the territories currently in open rebellion were now and forever free.
University of Michigan-Ann Arbor, Bachelor of Engineering, Mechanical Engineering. |
0.999847 | disorders such as multiple sclerosis, Alzheimer’s disease, or even Huntington’s disease. For the purpose of this essay, I will be specifically referencing Multiple Sclerosis preventative healthcare treatments and research. In my future, wherever my education leads me, I aspire to embrace aspects of preventative healthcare: diet, exercise, and emotional wellness to further promote the overall health and lifestyle of my patients.
As demonstrated in Copeman’s programs, research has proven that altering an individual’s diet is a contributing factor to overall health. However, Orhun Kantarci, M.D. from the Mayo Clinic stated that “there is no evidence that a specific diet can prevent, treat, or cure multiple sclerosis(1).” Kantarci continues, supporting the usage of supplements, specifically omega-3; it aids visual functions and neural development. As MS is an autoimmune disease, the prevention of further attacks on myelin is crucial to ensure effective communications between brain and body. Symptoms are dependent on the amount of damage the myelin sheath has taken; it is apparent that in order to prevent symptoms further damage, the stoppage of myelin destruction is upmost importance. Although necessarily altering an individual’s diet will not prevent multiple sclerosis, it is a way to prevent high blood pressure, diabetes, and heart disease. This ultimately will improve the patient’s overall health and mood, allowing them to focus on improving their neurological condition. In addition to taking supplements such as omega-3, vitamin D, and vitamin B-12, which specifically aid individuals with MS, maintaining a healthy diet is important in preserving overall health.
Historically, it was once feared that physical activity for those diagnosed with MS would worsen their symptoms. Lack of mobility is common within multiple sclerosis patients, and when partnered with nerve pain and fatigue, it is unrealistic in certain cases to maintain exercising. Overheating is also a danger as many people report worsened symptoms during strenuous activities. Contradictory, lack of exercise can lead to increased fatigue and weakness. Contemporary research has provided insight to the debate on exercise, shifting towards increased physical activity. Dr. Petajan from the University of Utah performed a trial on the effect of aerobic exercise in patients with MS versus those who limited themselves to no physical activity. It was proven that those who exercised experienced reduced depression and anger, fatigue, and improved quality of life(2). Exercise is now viewed as an essential part of patient care and is effective in symptom prevention. Physical activity is proven to enhance cognitive function and overall brain health. Several clinical trials have linked physical activity to stronger brain health, not just in reference to those with multiple sclerosis, but the general public. A study(3) connected aerobic fitness to the prevention of tissue degeneration. Individuals with increased aerobic exercise acquired less degenerated tissue; they also demonstrated increased performance when attempting cognitive tasks. Simple exercising such as walking has even been attributed to aided to the decrease in MS symptoms: brain lesions, demyelinating syndrome, and relapse rate. Trials including youth demonstrated the importance of physical activity and the protection of their myelin from a young age. Their chances of relapsing became relatively smaller, and their decreased their chance of on setting detrimental symptoms as they grew older. Exercise overall improves physical and mental performance not just in multiple sclerosis cases, but again within the general population.
Adapting diet and exercising contributes to one’s overall health, this including mental health and physically brain health. Many individuals suffering from MS face the reality of possibly becoming wheelchair confined, or loss of control over their body as the degeneration of their muscle control and strength progresses. The thought of loss of muscular control can be detrimental to emotional well-being of individuals. Often this burdens people, leading patients to feel helpless, inducing feelings of depression and anger. Patients must have access to mental health professionals and facilities with the capabilities to support them. Physical activity can also aid better moods, reducing depression. It is crucial to provide acceptable and reliable support systems for patients, as treatment is not just about physical aspects, however a combination of both mental and physical.
Instead of attempting to stop deterioration of myelin sheath, followed by attempts to regenerate the tissue, it would be strategic to prevent the damage in the first place. Although trials and research have not progressed to achieve the goal of complete prevention or eradication, there are ways to prevent the further spread of symptoms. Through diet and exercise, brain and psychological health, as well as the aid of physicians, multiple sclerosis treatment implemented with ease for those inflicted. I strive to achieve and promote the treatment that Copeman provides to those within Canada. My mother struggles specifically with MS, and I aspire to direct my passion and knowledge to help those affected by multiple sclerosis-like her. Disease prevention intertwined within multiple sclerosis cases will aid future generations in optimistically preventing the disease entirely, and adequately pave the pathways for future discoveries.
3 Prakash RS, Snook EM, Motl RW, Kramer AF. Aerobic fitness is associated with gray matter volume and white matter integrity in multiple sclerosis. Brain Res. 2010;1341:41-51. |
0.97884 | Mimic the flavor of your favorite Christmas time drink with this delicious eggnog and rum pie recipe. The fudgy ice cream cake is a fantastic make-ahead option thanks to the 24 hours it spends in the freezer before serving.
Prepare Chocolate Crumb Crust. For fudge sauce, in a small saucepan combine the 1 cup granulated sugar, the evaporated milk, butter, and chocolate. Cook and stir over medium heat until bubbly; reduce heat. Boil gently for 4 to 5 minutes or until mixture is thickened and reduced to 11/2 cups, stirring occasionally. Remove from heat; stir in vanilla. Transfer to a medium bowl; beat with an electric mixer on medium speed until almost smooth. Cover with plastic wrap. Set aside to cool completely.
In a chilled bowl stir 1 pint of the eggnog ice cream until softened. If desired, stir in 1 tablespoon of the rum. Spread over cooled Chocolate Crumb Crust. Spoon half of the chocolate sauce in small spoonfuls over ice cream layer. Freeze about 2 hours or until nearly firm. Repeat with the remaining eggnog ice cream, rum (if desired), and the remaining fudge sauce. Return to freezer while preparing meringue.
For meringue, in a medium mixing bowl stir together the 3/4 cup sugar and the boiling water until sugar is dissolved. Cool to room temperature (about 30 minutes). Add the meringue powder. Beat with an electric mixer on low speed until combined; beat on high speed until stiff peaks form (tips stand straight). Using a wooden spoon, fold 3 tablespoons of the crushed toffee bits into the meringue. Spread meringue over pie, sealing to edge. Freeze about 6 hours or until firm.
Preheat oven to 475 degrees F. Bake for 3 to 4 minutes or just until meringue is light brown. Cover loosely with foil. Freeze for 6 to 24 hours before serving. Before serving, sprinkle with the remaining crushed toffee bits. Serve immediately.
Preheat oven to 375 degrees F. Lightly coat an 8-inch springform pan with cooking spray; set aside. In a medium bowl combine vanilla wafers, powdered sugar, and cocoa powder. Stir in melted butter. Press crumb mixture firmly into the bottom of the prepared pan. Bake for 7 to 8 minutes or until crust is firm. Cool in pan on a wire rack. |
0.987502 | Does alcohol negatively affect my workout?
Enjoying a post-workout beer or two seems harmless enough. But alcohol and fitness have a complex relationship; and while bingeing on booze is definitely out, does one drink really make that much difference to your workouts?
There’s little doubt that stopping drinking alcohol can make you feel healthier and save you money.
There’s also little doubt that alcohol has a detrimental effect on your sporting performance.
The good news is that you can limit the damage depending on when and how much you indulge. Also bear in mind that alcohol affects everyone a little differently so blanket recommendations are tricky.
If you like a pint of beer after your circuit session, you won’t undo all your hard work. But you certainly aren’t helping your body recover optimally. Alcohol can slow your protein synthesis, the process that aids muscle growth, and a heavy drinking session makes the effects on protein synthesis even more pronounced.
Also, forget what you might have heard about drinking a post-race beer for the carbohydrates and electrolytes because it just doesn’t contain enough to make any difference. Instead, choose a more beneficial post-workout drink.
Whilst one drink after a light workout is relatively harmless, don’t swap your recovery meal for a “recovery beer”. This will damage your body’s ability to restock glycogen stores. Instead, eat some decent post-workout food first.
While that last round of margaritas sounded good at the time, one night of drinking can leave you severely dehydrated, so sweating it out isn’t going to feel so great.
Alcohol can also mess with your metabolism so if there’s still alcohol in your system you’re going to struggle with maximising fat loss potential. You’ve also got 75% less muscle protein synthesis going on.
However, it’s important to unwind after a workout and if that means you hit your fitness goals slightly later but you’re ultimately happier then one drink is probably worth the sacrifice!
what really doesn't help, of course, are the 'nights out' drinks - cocktails, shots, alcopops. They may be full of fruit but that doesn't mean they are a healthy drink!
wouldn't it be great if a recovery beer did the trick? It can in warmer climes where the beer is much weaker, but I don't think a pint of real ale is quite the idea!
Ha, I wholeheartedly agree with the last paragraph - it's definitely worth the sacrfice for my partner having a post-workout beer sometimes. For him, a can when he gets home really gives him something to look forward to after he works hard at the gym.
Damn, I really enjoy my 'recovery beer'. I shouldn't have read this article. |
0.958542 | In antiquity, two rival theories of the syllogism existed: Aristotelian syllogistic and Stoic syllogistic. Aristotle defines the syllogism as, "...a discourse in which certain (specific) things having been supposed, something different from the things supposed results of necessity because these things are so." Despite this very general definition, in Aristotle's work Prior Analytics, he limits himself to categorical syllogisms that consist of three categorical propositions. These include categorical modal syllogisms.
The use of syllogisms as a tool for understanding can be dated back to the logical reasoning discussions of Aristotle. Prior to the mid-twelfth century, medieval logicians were only familiar with a portion of Aristotle's works, including titles such as Categories and On Interpretation - works that contributed heavily to the prevailing Old Logic, or "logica vetus". The onset of a New Logic, or "logica nova", arose alongside the reappearance of Prior Analytics - the work in which Aristotle develops his theory of the syllogism.
Prior Analytics, upon re-discovery, was instantly regarded by logicians as "a closed and complete body of doctrine", leaving very little for thinkers of the day to debate and re-organize. Aristotles' theories on the syllogism for assertoric sentences was considered especially remarkable, with only small systematic changes occurring to the concept over time. This theory of the syllogism would not enter the context of the more comprehensive logic of consequence until logic began to be reworked in general in the mid-fourteenth century by the likes of John Buridan.
Aristotle's Prior Analytics did not, however, incorporate such a comprehensive theory on the "modal syllogism" - a syllogism that has at least one modalized premise (that is, a premise containing the modal words 'necessarily', 'possibly', or 'contingently'). Aristotle's terminology in this aspect of his theory was deemed vague and in many cases unclear, even contradicting some of his statements from On Interpretation. His original assertions on this specific component of the theory were left up to a considerable amount of conversation, resulting in a wide array of solutions put forth by commentators of the day. The system for modal syllogisms laid forth by Aristotle would ultimately be deemed unfit for practical use, and would be replaced by new distinctions and new theories altogether.
Another of medieval logic's first contributors from the Latin West, Peter Abelard (1079–1142) gave his own thorough evaluation of the syllogism concept and accompanying theory in the Dialectica - a discussion of logic based on Boethius' commentaries and monographs. His perspective on syllogisms can be found in other works as well, such as Logica Ingredientibus. With the help of Abelard's distinction between de dicto modal sentences and de re modal sentences, medieval logicians began to shape a more coherent concept of Aristotle's modal syllogism model.
John Buridan (c. 1300 – 1361), whom some consider the foremost logician of the later Middle Ages, contributed two significant works: Treatise on Consequence and Summulae de Dialectica, in which he discussed the concept of the syllogism, its components and distinctions, and ways to use the tool to expand its logical capability. For two hundred years after Buridan's discussions, little was said about syllogistic logic. Historians of logic have assessed that the primary changes in the post-Middle Age era were changes in respect to the public's awareness of original sources, a lessening of appreciation for the logic's sophistication and complexity, and an increase in logical ignorance—an ignorance heavily ridiculed by logicians of the early twentieth century.
A sorites is a form of argument in which a series of incomplete syllogisms is so arranged that the predicate of each premise forms the subject of the next until the subject of the first is joined with the predicate of the last in the conclusion. For example, if one argues that a given number of grains of sand does not make a heap and that an additional grain does not either, then to conclude that no additional amount of sand would make a heap is to construct a sorites argument.
The letters A, E, I, O have been used since the medieval Schools to form mnemonic names for the forms as follows: 'Barbara' stands for AAA, 'Celarent' for EAE, etc.
The following table shows all syllogisms that are essentially different. The similar syllogisms share actually the same premises, just written in a different way. For example "Some pets are kittens" (SiM in Darii) could also be written as "Some kittens are pets" (MiS in Datisi).
In the Venn diagrams, the black areas indicate no elements, and the red areas indicate at least one element.
We may, with Aristotle, distinguish singular terms such as Socrates and general terms such as Greeks. Aristotle further distinguished (a) terms that could be the subject of predication, and (b) terms that could be predicated of others by the use of the copula ("is a"). (Such a predication is known as a distributive as opposed to non-distributive as in Greeks are numerous. It is clear that Aristotle's syllogism works only for distributive predication for we cannot reason All Greeks are animals, animals are numerous, therefore All Greeks are numerous.) In Aristotle's view singular terms were of type (a) and general terms of type (b). Thus Men can be predicated of Socrates but Socrates cannot be predicated of anything. Therefore, for a term to be interchangeable—to be either in the subject or predicate position of a proposition in a syllogism—the terms must be general terms, or categorical terms as they came to be called. Consequently, the propositions of a syllogism should be categorical propositions (both terms general) and syllogisms that employ only categorical terms came to be called categorical syllogisms.
(c) What existential imports must the forms AaB, AeB, AiB and AoB have for the square of opposition be valid?
The first-order predicate calculus avoids such ambiguity by using formulae that carry no existential import with respect to universal statements. Existential claims must be explicitly stated. Thus, natural language statements—of the forms All A is B, No A is B, Some A is B, and Some A is not B—can be represented in first order predicate calculus in which any existential import with respect to terms A and/or B is either explicit or not made at all. Consequently, the four forms AaB, AeB, AiB, and AoB can be represented in first order predicate in every combination of existential import—so it can establish which construal, if any, preserves the square of opposition and the validly of the traditionally valid syllogism. Strawson claims such a construal is possible, but the results are such that, in his view, the answer to question (e) above is no.
"Some A is not B" (AoB) is equvalent to "s(A) is not a subset of s(B)"
The Aristotelian syllogism dominated Western philosophical thought for many centuries. In the 17th century, Sir Francis Bacon rejected the idea of syllogism as being the best way to draw conclusions in nature. Instead, Bacon proposed a more inductive approach to the observation of nature, which involves experimentation and leads to discovering and building on axioms to create a more general conclusion.
In the 19th Century, modifications to syllogism were incorporated to deal with disjunctive ("A or B") and conditional ("if A then B") statements. Kant famously claimed, in Logic (1800), that logic was the one completed science, and that Aristotelian logic more or less included everything about logic there was to know. (This work is not necessarily representative of Kant's mature philosophy, which is often regarded as an innovation to logic itself.) Though there were alternative systems of logic such as Avicennian logic or Indian logic elsewhere, Kant's opinion stood unchallenged in the West until 1879 when Frege published his Begriffsschrift (Concept Script). This introduced a calculus, a method of representing categorical statements — and statements that are not provided for in syllogism as well — by the use of quantifiers and variables.
One notable exception to this modern relegation is the continued application of Aristotelian logic by officials of the Congregation for the Doctrine of the Faith, and the Apostolic Tribunal of the Roman Rota, which still requires that arguments crafted by Advocates be presented in syllogistic format.
George Boole's unwavering acceptance of Aristotle's logic is emphasized by the historian of logic John Corcoran in an accessible introduction to Laws of Thought. Corcoran also wrote a point-by-point comparison of Prior Analytics and Laws of Thought. According to Corcoran, Boole fully accepted and endorsed Aristotle's logic. Boole's goals were "to go under, over, and beyond" Aristotle's logic by 1) providing it with mathematical foundations involving equations, 2) extending the class of problems it could treat—solving equations was added to assessing validity, and 3) expanding the range of applications it could handle—e.g. from propositions having only two terms to those having arbitrarily many.
More specifically, Boole agreed with what Aristotle said; Boole's 'disagreements', if they might be called that, concern what Aristotle did not say. First, in the realm of foundations, Boole reduced Aristotle's four propositional forms to one form, the form of equations—by itself a revolutionary idea. Second, in the realm of logic's problems, Boole's addition of equation solving to logic—another revolutionary idea—involved Boole's doctrine that Aristotle's rules of inference (the "perfect syllogisms") must be supplemented by rules for equation solving. Third, in the realm of applications, Boole's system could handle multi-term propositions and arguments whereas Aristotle could handle only two-termed subject-predicate propositions and arguments. For example, Aristotle's system could not deduce "No quadrangle that is a square is a rectangle that is a rhombus" from "No square that is a quadrangle is a rhombus that is a rectangle" or from "No rhombus that is a rectangle is a square that is a quadrangle".
For instance, from the premises some A are B, some B are C, people tend to come to a definitive conclusion that therefore some A are C. However, this does not follow according to the rules of classical logic. For instance, while some cats (A) are black things (B), and some black things (B) are televisions (C), it does not follow from the parameters that some cats (A) are televisions (C). This is because in the structure of the syllogism invoked (i.e. III-1) the middle term is not distributed in either the major premise or in the minor premise a pattern called the "fallacy of the undistributed middle".
Illicit treatment of the major term: The conclusion implicates all members of the major term (P — meaning the proposition is negative); however, the major premise does not account for them all (i.e., P is either an affirmative predicate or a particular subject there).
Illicit treatment of the minor term: Same as above, but for the minor term (S — meaning the proposition is universal) and minor premise (where S is either a particular subject or an affirmative predicate).
↑ Michael Frede, "Stoic vs. Peripatetic Syllogistic", Archive for the History of Philosophy 56, 1975, 99-124.
↑ Lagerlund, Henrik. [<http://plato.stanford.edu/archives/win2012/entries/medieval-syllogism/> "Medieval Theories of the Syllogism"]. The Stanford Encyclopedia of Philosophy. Edward N. Zalta. Retrieved 17 February 2014.
↑ "Philosophical Dictionary: Caird-Catharsis". Philosophypages.com. 2002-08-08. Retrieved 2009-12-14.
↑ 10.0 10.1 See Bacon, Francis. "The Great Instauration," 1620. This text can be found (as of the access date of 11/12/13) at the Constitution Society website at the following URL: http://www.constitution.org/bacon/instauration.htm.
↑ George Boole. 1854/2003. The Laws of Thought, facsimile of 1854 edition, with an introduction by J. Corcoran. Buffalo: Prometheus Books (2003). Reviewed by James van Evra in Philosophy in Review.24 (2004) 167–169.
↑ See, e.g., Evans, J. St. B. T (1989). Bias in human reasoning. London: LEA.
↑ See the meta-analysis by Khemlani, S. & Johnson-Laird, P.N. (2012). Theories of the syllogism: A meta-analysis. Psychological Bulletin, 138, 427-457.
↑ See the meta-analysis by Chater, N. & Oaksford, M. (1999). The Probability Heuristics Model of Syllogistic Reasoning. Cognitive Psychology, 38, 191–258.
Blackburn, Simon, 1996. "Syllogism" in the Oxford Dictionary of Philosophy. Oxford University Press. ISBN 0-19-283134-8.
Broadie, Alexander, 1993. Introduction to Medieval Logic. Oxford University Press. ISBN 0-19-824026-0.
John Corcoran, 1972. Completeness of an ancient logic Journal of Symbolic Logic 37: 696–702.
John Corcoran, 1994. The founding of logic. Modern interpretations of Aristotle's logic Ancient Philosophy 14: 9–24.
George Englebretsen, The New Syllogistic, Bern, Peter Lang, 1987.
Hamblin, Charles L., 1970. Fallacies, Methuen : London, ISBN 0-416-70070-5. Cf. on validity of syllogisms: "A simple set of rules of validity was finally produced in the later Middle Ages, based on the concept of Distribution."
Marko Malink, Aristotle's Modal Syllogistic, Harvard, Harvard University Press, 2013.* Patzig, Günter 1968. Aristotle's theory of the syllogism: a logico-philological study of Book A of the Prior Analytics. Reidel, Dordrecht.
Smiley, Timothy 1973. What is a syllogism? Journal of Philosophical Logic 2: 136–154.
Smith, Robin 1986. Immediate propositions and Aristotle's proof theory. Ancient Philosophy 6: 47–68.
Abbreviatio Montana article by Prof. R. J. Kilcullen of Macquarie University on the medieval classification of syllogisms. |
0.996708 | There will be 4 of us traveling from Edinburg to Penrith, England to catch an REI hike. After the 9day hike, we will be in York by September 8. From there we want to travel to London, Cotswolds, Bath and Bristol. We will be spending a few days at each stop. What is your suggestion for the most cost effective pass for this trip. We are all over 61 years of age. We will be 3 days in London, so how does the "consecutive" pass work for that instance? Also, would the Oyster pass be our option in London? Thank you!
For the requested itinerary, you would purchase the BritRail Pass. For the BritRail Pass, you would click here: https://www.raileurope.com/pass/britrail-pass-5891.
This particular pass does offer discounted rates for seniors 60 and above. To be quoted the senior rates, you would just identify yourselves as seniors when purchasing this pass on our site.
The BritRail Pass covers trains between Edinburgh, Penrith, York, stations in the Cotswolds (i.e. Stroud, Cheltenham, Moreton-in-Marsh), Bath, Bristol, and London.
For planning purposes, you can use the route search feature under 'Book Train Tickets' on our homepage (www.raileurope.com) to view schedules for these routes. When searching schedules to/from Penrith, you would need to type it as 'Penrith North Lakes. For Bath, you would type it as 'Bath Spa'. For Bristol, you would type 'Bristol Temple Meads'.
If you'll be staying in London for multiple days and using public transit to get around, you would purchase the 'Visitor Oyster Card'. Within London, the 'Visitor Oyster Card' covers the London Tube, the DLR (Docklands Light Railway), London Trams (Tramlink), National Rail, and the London Overground. For the 'Visitor Oyster Card', you would click here: https://www.raileurope.com/pass/visitor-oyster-card-8331.
Hi Elaine,<br /><br />For the requested itinerary, you would purchase the <a href="https://www.raileurope.com/pass/britrail-pass-5891" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/britrail-pass-5891">BritRail Pass</a>. For the <a href="https://www.raileurope.com/pass/britrail-pass-5891" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/britrail-pass-5891">BritRail Pass</a>, you would click here: <a href="https://www.raileurope.com/pass/britrail-pass-5891" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/britrail-pass-5891">https://www.raileurope.com/pass/britrail-pass-5891</a>.<br /><br />This particular pass does offer discounted rates for seniors 60 and above. To be quoted the senior rates, you would just identify yourselves as seniors when purchasing this pass on our site.<br /><br />The <a href="https://www.raileurope.com/pass/britrail-pass-5891" rel="nofollow" target="_blank">BritRail Pass</a> covers trains between <a href="https://www.raileurope.com/city/edinburgh" rel="nofollow" target="_blank">Edinburgh</a>, Penrith, <a href="https://www.raileurope.com/city/york" rel="nofollow" target="_blank">York</a>, stations in the Cotswolds (i.e. Stroud, Cheltenham, Moreton-in-Marsh), <a href="https://www.raileurope.com/city/bath" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/city/bath">Bath</a>, <a href="https://www.raileurope.com/city/bristol" rel="nofollow" target="_blank">Bristol</a>, and <a href="https://www.raileurope.com/city/london" rel="nofollow" target="_blank">London</a>.<br /><br />For planning purposes, you can use the route search feature under 'Book Train Tickets' on our homepage (<a href="http://www.raileurope.com" rel="nofollow" target="_blank" title="Link http//wwwraileuropecom">www.raileurope.com</a>) to view schedules for these routes. When searching schedules to/from Penrith, you would need to type it as 'Penrith North Lakes. For <a href="https://www.raileurope.com/city/bath" rel="nofollow" target="_blank">Bath</a>, you would type it as 'Bath Spa'. For <a href="https://www.raileurope.com/city/bristol" rel="nofollow" target="_blank" title="Link: https://www.raileurope.com/city/bristol">Bristol</a>, you would type 'Bristol Temple Meads'.<br /><br />If you'll be staying in <a href="https://www.raileurope.com/city/london" rel="nofollow" target="_blank">London</a> for multiple days and using public transit to get around, you would purchase the '<a href="https://www.raileurope.com/pass/visitor-oyster-card-8331" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/visitor-oyster-card-8331">Visitor Oyster Card</a>'. Within <a href="https://www.raileurope.com/city/london" rel="nofollow" target="_blank" title="Link: https://www.raileurope.com/city/london">London</a>, the '<a href="https://www.raileurope.com/pass/visitor-oyster-card-8331" rel="nofollow" target="_blank">Visitor Oyster Card</a>' covers the London Tube, the DLR (Docklands Light Railway), London Trams (Tramlink), National Rail, and the London Overground. For the '<a href="https://www.raileurope.com/pass/visitor-oyster-card-8331" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/visitor-oyster-card-8331">Visitor Oyster Card</a>', you would click here: <a href="https://www.raileurope.com/pass/visitor-oyster-card-8331" rel="nofollow" target="_blank" title="Link https//wwwraileuropecom/pass/visitor-oyster-card-8331">https://www.raileurope.com/pass/visitor-oyster-card-8331</a>.
We live in Ohio, USA.....how far ahead do we need to order the pass to safely have it prior to departure for England?
Any order placed on our website can take 24 to 48 hours to be processed in addition to the time it takes to ship the documents, which would be an additional 2 to 3 business days if the option of standard delivery is chosen or an additional 1 business day if the option of express delivery is chosen. If you ever wish to bypass the 24-48 hour processing time to ensure your documents are shipped out today for overnight delivery, you would have to call us to place your order. We can be reached at 1-800-622-8600. Our current hours are 8:00 AM to 6:30 PM CT Monday to Friday and 8:00 AM to 4:00 PM CT on Saturdays. The last shipment on any given weekday leaves our office at 5:30 PM CT. |
0.999979 | Where's the best place to buy fresh fish in town?
The fish market on Main Street has an extensive selection. North Shore Farms, Uncle Giusepes, Stop and Shop, and King Kullen all have large fresh fish selections. |
0.971704 | We tested whether polygenic risk scores for schizophrenia and bipolar disorder would predict creativity. Higher scores were associated with artistic society membership or creative profession in both Icelandic (P = 5.2 × 10(-6) and 3.8 × 10(-6) for schizophrenia and bipolar disorder scores, respectively) and replication cohorts (P = 0.0021 and 0.00086). This could not be accounted for by increased relatedness between creative individuals and those with psychoses, indicating that creativity and psychosis share genetic roots.
Measuring serum levels of the prostate-specific antigen (PSA) is the most common screening method for prostate cancer. However, PSA levels are affected by a number of factors apart from neoplasia. Notably, around 40% of the variability of PSA levels in the general population is accounted for by inherited factors, suggesting that it may be possible to improve both sensitivity and specificity by adjusting test results for genetic effects. To search for sequence variants that associate with PSA levels, we performed a genome-wide association study and follow-up analysis using PSA information from 15,757 Icelandic and 454 British men not diagnosed with prostate cancer. Overall, we detected a genome-wide significant association between PSA levels and single-nucleotide polymorphisms (SNPs) at six loci: 5p15.33 (rs2736098), 10q11 (rs10993994), 10q26 (rs10788160), 12q24 (rs11067228), 17q12 (rs4430796), and 19q13.33 [rs17632542 (KLK3: I179T)], each with P(combined) <3 × 10(-10). Among 3834 men who underwent a biopsy of the prostate, the 10q26, 12q24, and 19q13.33 alleles that associate with high PSA levels are associated with higher probability of a negative biopsy (odds ratio between 1.15 and 1.27). Assessment of association between the six loci and prostate cancer risk in 5325 cases and 41,417 controls from Iceland, the Netherlands, Spain, Romania, and the United States showed that the SNPs at 10q26 and 12q24 were exclusively associated with PSA levels, whereas the other four loci also were associated with prostate cancer risk. We propose that a personalized PSA cutoff value, based on genotype, should be used when deciding to perform a prostate biopsy.
Common variants conferring risk of schizophrenia.
Schizophrenia is a complex disorder, caused by both genetic and environmental factors and their interactions. Research on pathogenesis has traditionally focused on neurotransmitter systems in the brain, particularly those involving dopamine. Schizophrenia has been considered a separate disease for over a century, but in the absence of clear biological markers, diagnosis has historically been based on signs and symptoms. A fundamental message emerging from genome-wide association studies of copy number variations (CNVs) associated with the disease is that its genetic basis does not necessarily conform to classical nosological disease boundaries. Certain CNVs confer not only high relative risk of schizophrenia but also of other psychiatric disorders. The structural variations associated with schizophrenia can involve several genes and the phenotypic syndromes, or the 'genomic disorders', have not yet been characterized. Single nucleotide polymorphism (SNP)-based genome-wide association studies with the potential to implicate individual genes in complex diseases may reveal underlying biological pathways. Here we combined SNP data from several large genome-wide scans and followed up the most significant association signals. We found significant association with several markers spanning the major histocompatibility complex (MHC) region on chromosome 6p21.3-22.1, a marker located upstream of the neurogranin gene (NRGN) on 11q24.2 and a marker in intron four of transcription factor 4 (TCF4) on 18q21.2. Our findings implicating the MHC region are consistent with an immune component to schizophrenia risk, whereas the association with NRGN and TCF4 points to perturbation of pathways involved in brain development, memory and cognition.
Maternally derived microduplications at 15q11-q13: implication of imprinted genes in psychotic illness.
OBJECTIVE: Rare copy number variants have been implicated in different neurodevelopmental disorders, with the same copy number variants often increasing risk of more than one of these phenotypes. In a discovery sample of 22 schizophrenia patients with an early onset of illness (10-15 years of age), the authors observed in one patient a maternally derived 15q11-q13 duplication overlapping the Prader-Willi/Angelman syndrome critical region. This prompted investigation of the role of 15q11-q13 duplications in psychotic illness. METHOD: The authors scanned 7,582 patients with schizophrenia or schizoaffective disorder and 41,370 comparison subjects without known psychiatric illness for copy number variants at 15q11-q13 and determined the parental origin of duplications using methylation-sensitive Southern hybridization analysis. RESULTS: Duplications were found in four case patients and five comparison subjects. All four case patients had maternally derived duplications (0.05%), while only three of the five comparison duplications were maternally derived (0.007%), resulting in a significant excess of maternally derived duplications in case patients (odds ratio=7.3). This excess is compatible with earlier observations that risk for psychosis in people with Prader-Willi syndrome caused by maternal uniparental disomy is much higher than in those caused by deletion of the paternal chromosome. CONCLUSIONS: These findings suggest that the presence of two maternal copies of a fragment of chromosome 15q11.2-q13.1 that overlaps with the Prader-Willi/Angelman syndrome critical region may be a rare risk factor for schizophrenia and other psychoses. Given that maternal duplications of this region are among the most consistent cytogenetic observations in autism, the findings provide further support for a shared genetic etiology between autism and psychosis.
Previously, we reported germline DNA variants associated with risk of urinary bladder cancer (UBC) in Dutch and Icelandic subjects. Here we expanded the Icelandic sample set and tested the top 20 markers from the combined analysis in several European case-control sample sets, with a total of 4,739 cases and 45,549 controls. The T allele of rs798766 on 4p16.3 was found to associate with UBC (odds ratio = 1.24, P = 9.9 x 10(-12)). rs798766 is located in an intron of TACC3, 70 kb from FGFR3, which often harbors activating somatic mutations in low-grade, noninvasive UBC. Notably, rs798766[T] shows stronger association with low-grade and low-stage UBC than with more aggressive forms of the disease and is associated with higher risk of recurrence in low-grade stage Ta tumors. The frequency of rs798766[T] is higher in Ta tumors that carry an activating mutation in FGFR3 than in Ta tumors with wild-type FGFR3. Our results show a link between germline variants, somatic mutations of FGFR3 and risk of UBC.
Common sequence variants have recently joined rare structural polymorphisms as genetic factors with strong evidence for association with schizophrenia. Here we extend our previous genome-wide association study and meta-analysis (totalling 7 946 cases and 19 036 controls) by examining an expanded set of variants using an enlarged follow-up sample (up to 10 260 cases and 23 500 controls). In addition to previously reported alleles in the major histocompatibility complex region, near neurogranin (NRGN) and in an intron of transcription factor 4 (TCF4), we find two novel variants showing genome-wide significant association: rs2312147[C], upstream of vaccinia-related kinase 2 (VRK2) [odds ratio (OR) = 1.09, P = 1.9 × 10(-9)] and rs4309482[A], between coiled-coiled domain containing 68 (CCDC68) and TCF4, about 400 kb from the previously described risk allele, but not accounted for by its association (OR = 1.09, P = 7.8 × 10(-9)).
Genome-wide association studies (GWAS) have identified 3 genomic regions, at 15q24-25.1, 5p15.33, and 6p21.33, which associate with the risk of lung cancer. Large meta-analyses of GWA data have failed to find additional associations of genome-wide significance. In this study, we sought to confirm 7 variants with suggestive association to lung cancer (P < 10(-5)) in a recently published meta-analysis. In a GWA dataset of 1,447 lung cancer cases and 36,256 controls in Iceland, 3 correlated variants on 15q15.2 (rs504417, rs11853991, and rs748404) showed a significant association with lung cancer, whereas rs4254535 on 2p14, rs1530057 on 3p24.1, rs6438347 on 3q13.31, and rs1926203 on 10q23.31 did not. The most significant variant, rs748404, was genotyped in an additional 1,299 lung cancer cases and 4,102 controls from the Netherlands, Spain, and the United States and the results combined with published GWAS data. In this analysis, the T allele of rs748404 reached genome-wide significance (OR = 1.15, P = 1.1 × 10(-9)). Another variant at the same locus, rs12050604, showed association with lung cancer (OR = 1.09, 3.6 × 10(-6)) and remained significant after adjustment for rs748404 and vice versa. rs748404 is located 140 kb centromeric of the TP53BP1 gene that has been implicated in lung cancer risk. Two fully correlated, nonsynonymous coding variants in TP53BP1, rs2602141 (Q1136K) and rs560191 (E353D) showed association with lung cancer in our sample set; however, this association did not remain significant after adjustment for rs748404. Our data show that 1 or more lung cancer risk variants of genome-wide significance and distinct from the coding variants in TP53BP1 are located at 15q15.2.
We report a prostate cancer genome-wide association follow-on study. We discovered four variants associated with susceptibility to prostate cancer in several European populations: rs10934853[A] (OR = 1.12, P = 2.9 x 10(-10)) on 3q21.3; two moderately correlated (r2 = 0.07) variants, rs16902094[G] (OR = 1.21, P = 6.2 x 10(-15)) and rs445114[T] (OR = 1.14, P = 4.7 x 10(-10)), on 8q24.21; and rs8102476[C] (OR = 1.12, P = 1.6 x 10(-11)) on 19q13.2. We also refined a previous association signal on 11q13 with the SNP rs11228565[A] (OR = 1.23, P = 6.7 x 10(-12)). In a multivariate analysis using 22 prostate cancer risk variants typed in the Icelandic population, we estimated that carriers in the top 1.3% of the risk distribution are at a 2.5 times greater risk of developing the disease than members of the general population. |
0.950337 | Orange is the New Black certainly drew its Netflix viewers in for Seasons 1 and 2, and a Season 3 was supposedly green-lit one month before the release date of season 2. The release date for Season 3 has yet to be determined, but most sources agree it will be sometime in Summer (possibly June) of 2015. There are a few events that can be predicted, provided you don't mind some spoilers of Season 1, Season 2, and possibly Season 3, which concludes filming at the end of 2014.
The big focus in Season 1 was the relationship between Alex Vause (Laura Prepon) and Piper Chapman (Taylor Schilling). Piper left her fiancée Larry (Jason Biggs) to be with Alex again, even though Alex betrayed Piper and is the reason why Piper is here in the first place. Alex was hardly visible in Season 2, but according to Breathecast, Alex will return to Litchfield Penitentiary in Season 3, after Piper calls her.
Clearly it is going to be quite heated. Alex seems to be selling out Piper on more than one occasion, as seen in episode 1 of Season 2, as Alex was walking away seemingly free while Piper was being sent back to Litchfield. Is Piper going to go back to Alex even though there is clearly no stability there? Season 2 saw more of Piper becoming a hardened prisoner, and perhaps she will decide that Alex is toxic enough to shun entirely. Perhaps she might go back to Larry.
Another plotline under development is the character of Sophia. Laverne Cox's transgender character has really put the actress in the spotlight, even placing her on the cover of Time magazine. Cox has told the Latin Post at the 2014 Emmy Awards that "what the writers have written for my character is very, very exciting".
Cox has been touring the nation as a spokesperson for transgenderism, visiting over 80 cities. Cox states that she "has a good time shooting it [Orange is the New Black]" and "it was very special for me as an actress and the stories are really powerful". Sophia was hardly used in Season 2, but Cox believes that fans will not be disappointed in Season 3. She also states that "I think everyone will be-I don't know how people are gonna be". Orange is the New Black has always been edgy in its portrayal of life in a women's prison, so the depiction of Sophia is probably going to push that envelope even more.
Other issues in Season 3 will be the pregnancy of Daya (Dascha Polanco), which we have already discussed in a previous article. There are rumors of the "time jump" which will possibly help with the 9 months required for her to give birth. The father of the child is John Bennett (Matt McGorry), a prison guard, but the supposed father is a guard known PornStache (Pablo Schreiber). It is reported at Breathecast that Schreiber has other projects that he is working on, and will not be see in Season 3. |
0.915048 | During the first five years of the Pinochet regime (1973-78), the armed forces and security forces successfully contained leftwing resistance against the government. Many members of Chile's oldest left-wing extremist group, the Movement of the Revolutionary Left (Movimiento de la Izquierda Revolucionaria--MIR), which was founded in 1965 and had close ties to Cuba, were killed or exiled. Nevertheless, the MIR remnants, under the leadership of the late Salvador Allende's nephew, Andr�s Pascal Allende, continued to operate a small underground network in Chile. The MIR's principal leader, Miguel Enr�quez, returned clandestinely to Chile in 1978 to revitalize the movement and organize for armed struggle and was soon joined by newly infiltrated cadres who had been trained in Cuba and Nicaragua. The security forces kept the MIR off balance, however, and Enr�quez was killed in September 1983.
Several new left-wing terrorist groups emerged in the early 1980s. One was the United Popular Action Movement-Lautaro (Movimiento de Acci�n Popular Unitario-Lautaro--MAPU-L), a splinter of the United Popular Action Movement (Movimiento de Acci�n Popular Unitario--MAPU), a party founded in 1969 by a breakaway group from the Christian Democrats. Many MAPU leaders embraced Marxist positions, but the party was not a terrorist group. In December 1982, the MAPU-L established a youth group, the Lautaro Youth Movement (Movimiento de Juventud Lautaro--MJL), and a group dedicated to the overthrow of the military government, the Lautaro Popular Rebel Forces (Fuerzas Rebeldes Popular Lautaro--FRPL).
The Manuel Rodr�guez Patriotic Front (Frente Patri�tica Manuel Rodr�guez--FPMR), an armed group affiliated with the Communist Party of Chile (Partido Comunista de Chile--PCCh), was formed in 1983. In response to increased armed attacks, the regime promulgated the 1984 Antiterrorist Law, which greatly expanded the list of crimes that could be categorized as terrorism.
In the second half of the 1980s, the FPMR became the dominant terrorist group, emerging as a sophisticated, well-trained, and well-supported terrorist organization. Just how strong it was became evident in August 1986 when the security forces captured a huge FPMR arms cache that was traced to Cuba. That September FPMR commandos nearly succeeded in assassinating Pinochet with M-16 assault rifles and antitank rockets. In response to these two events, Pinochet declared a state of siege and mounted an offensive against the FPMR and MIR.
Intensified police and security-service pressure on the FPMR and MIR continued throughout 1987, inhibiting the groups' activities. That year the FPMR splintered as a result of the PCCh's denunciation of violence; the breakaway Maoist-oriented FPMRAutonomous (FPMR-Aut�nomo--FPMR-A) became the most active left-wing terrorist group, whereas the FPMR followed the PCCh's line and laid down its arms after the restoration of democracy in 1990. Mainly as a result of FPMR-A activities, terrorist attacks increased in the late 1980s.
Meanwhile, the security forces failed to apprehend any members of right-wing extremist groups, such as the Chilean Anti-Communist Action Group (Acci�n Chilena Anticomunista--AChA) and the Nationalist Combat Front (Frente Nacionalista de Combate--FNC). The ability of these groups to operate with apparent impunity led to speculation in the late 1980s that their actions were unofficially sanctioned by some officials in the security forces.
The rationale for continued left-wing subversion and right-wing counterterror effectively vanished with the return of civilian government in 1990. Many left-wing extremists who had fled the country following the 1973 coup were allowed to return in 1990. Nevertheless, left-wing terrorism did not disappear. Within a few months after President Aylwin's accession to power, the FPMR-A and MJL showed that they remained committed to armed struggle and were responsible for most of the increased number of terrorist incidents in the early 1990s. The total number of documented terrorist actions during the first year of the Aylwin government was 207 (including 148 attacks on buildings and other properties), compared with 465 similar actions during 1984 and 401 in 1985--two peak years for terrorist activity during the latter half of the period of military rule.
The Aylwin government's attempts to control terrorism were quite successful. In 1991 it expanded training and increased efforts by the Investigations Police and the Carabineros. Police improved their counterterrorism capabilities, surpassing the effectiveness of the military government. This was made evident by their success in arresting numerous leaders and in uncovering several safe houses and training sites used by Chilean terrorists. By early 1993, more than 200 terrorist militants were under indictment. The capture of many top leaders of the MAPU-L and FPMRA crippled these organizations, and terrorist incidents declined. The Aylwin government appointed special investigating judges to try the more serious cases of terrorism, such as the assassination of Senator Jaime Guzm�n Err�zuriz on April 1, 1991.
NOTE: The information regarding Chile on this page is re-published from The Library of Congress Country Studies and the CIA World Factbook. No claims are made regarding the accuracy of Chile Terrorism information contained here. All suggestions for corrections of any errors about Chile Terrorism should be addressed to the Library of Congress and the CIA. |
0.99959 | Planning a summer getaway? Never fear: Mount Hood offers summer skiing as well, not to mention plenty of opportunities to hike and mountain bike. Mount Hood's main summer attraction is the Mt. Hood Adventure Park at Skibowl, which features hiking and biking trails, as well as numerous other warm-weather activities.
Mount Hood is located about 90 minutes east of downtown Portland along Highway 26. Depending on when you visit, you can participate in several different types of group activities, from rafting trips to climbing lessons. For more information, visit the Travel Portland website. |
0.650186 | Developing mobile medical units, surgical instruments and a method for transporting blood for transfusions.
Henry Norman Bethune (March 3, 1890 – November 12, 1939; Chinese name: çÆÆ; pinyin: B¡i Qiän) was a Canadian physician and medical innovator. Bethune is best known for his service in war time medical units during the Spanish Civil War and with the People's Liberation Army during the Second Sino-Japanese War. He developed the first mobile blood-transfusion service in Spain in 1936. A Communist, he wrote that wars were motivated by profits, not principles.
Dr. Norman Bethune came from a prominent Scottish Canadian family. His great great grandfather, the Reverend John Bethune (1751–1815), was the family patriarch and established the first Presbyterian Church in Montreal. Norman Bethune–s great grandfather, Angus Bethune (1783–1858), joined the North West Company at an early age and traveled extensively throughout the north western territories, exploring and trading for furs. He eventually reached the Pacific at Fort Astoria, Oregon. He became chief factor of the Lake Huron district for the Hudson's Bay Company after the merger of the rival companies. Upon retirement from the HBC in 1839 he successfully ran for Alderman of Toronto City Council.
Norman–s grandfather, also named Norman (1822–92), was educated as a doctor at King's College, University of Toronto, and in London, England at Guy's Hospital, graduating in 1848 as a member of the Royal College of Physicians. Upon his return to Canada, he became one of the founders of the Upper Canada School of Medicine, which was incorporated into Trinity College, Toronto and eventually the University of Toronto.
Norman–s father, the Rev. Malcolm Nicolson Bethune, led an uneventful life as a small town pastor, initially at Gravenhurst, Ontario 1889-92. His mother–s name was Elizabeth. Both his parents were very religious. Norman grew up with a "fear of being mediocre", instilled into him by his emotionally strict father and domineering mother.
Norman was born in Gravenhurst, on March 3, 1890. His siblings were his sister Janet, and brother Malcolm.
As a youth he attended Owen Sound Collegiate in Owen Sound, Ontario, now known as Owen Sound Collegiate and Vocational Institute. He graduated from OSCVI in 1907. In September 1909 he enrolled at the University of Toronto. He interrupted his studies for one year in 1911 to be a volunteer labourer-teacher with Frontier College at remote lumber and mining camps throughout northern Ontario, teaching immigrant mine labourers how to read and write English. In 1914 when war was declared in Europe, he once again suspended his medical studies. In a flourish of patriotism he joined the No. 2 Field Ambulance to serve as a stretcher-bearer in France. He was wounded by shrapnel and spent three months recovering in an English hospital. When he had recuperated from his injury he returned to Toronto to complete his medical degree. He received his M.D. in 1916.
In 1917, with the war still in progress, Bethune joined the Royal Navy as a surgeon-lieutenant at the Chatham Hospital in England. In 1919, he began an internship specializing in children's diseases at The Hospital for Sick Children at Great Ormond Street, London. Later he went to Edinburgh, where he earned the FRCS qualification at the Royal College of Surgeons. In 1920 he met the strikingly beautiful Frances Penny. They were complete opposites; she was a subdued introvert; he was a brash extrovert, but in spite of this they married in 1923. After a one-year –Grand Tour– of Europe, during which they spent her entire inheritance, they moved to Detroit, Michigan, where Bethune took up private practice and also took a part-time job as an instructor at the Detroit College of Medicine and Surgery.
In 1926 Bethune contracted tuberculosis due to overwork and from his close contact with the poor. He sought treatment at the Trudeau Sanatorium in Saranac Lake, New York. Believing he was dying, he insisted his wife divorce him and return to her native Scotland, so she did.
In the 1920s the established treatment for TB was total bed rest in a sanatorium. While convalescing Bethune read about a radical new treatment for tuberculosis called pneumothorax. This involved artificially collapsing the tubercular (diseased) lung, thus allowing it to rest and heal itself. The physicians at the Trudeau thought this procedure was too new and risky. But Bethune insisted. He had the operation performed and made a full and complete recovery.
Upon recuperation Bethune immediately wrote to his ex-wife and proposed marriage again. At first she refused but eventually he and Frances were remarried in 1929. This did not last long, however, and they were divorced again for a final time in 1933.
In 1929 Bethune joined the thoracic surgical pioneer, Dr. William Edward Archibald, the Surgeon-in-Chief of the Royal Victoria Hospital in Montreal, the teaching hospital affiliated with McGill University. From 1929 to 1936 Bethune perfected his skills in thoracic surgery and developed or modified more than a dozen new surgical tools. His most famous instrument was the Bethune Rib Shears, which still remains in use today. He published 14 articles describing his innovations in thoracic technique.
Bethune became increasingly disillusioned with surgical treatment and concerned with the socioeconomic aspects of disease. As a concerned doctor in Montreal during the economic depression years of the thirties, Bethune frequently sought out the poor and gave them free medical care. He challenged his professional colleagues and agitated, without success, for the government to make radical reforms of medical care and health services in Canada.
Bethune was an early proponent of socialized medicine and formed the Montreal Group for the Security of People's Health. In 1935 Bethune travelled to the Soviet Union to observe first hand their system of health care. During this year he became a committed communist and joined the Communist Party of Canada. He at first was not convinced communism was the answer to the world's problems, and refused when at first offered the leadership of the Communist Party of Canada. But when the Spanish Civil War began, he was ready to throw in his lot with the communists.
The next year, 1936, the Spanish Civil War broke out. Bethune accepted an invitation from the Committee to Aid Spanish Democracy to head the Canadian Medical Unit in Madrid. He joined the Mackenzie-Papineau Battalion which was composed of Canadian communists and other leftists and set off for Madrid on November 3, 1936.
A frequent cause of death on the battlefield is medical shock brought on by loss of blood. A casualty whose wounds do not appear life-threatening suddenly dies. Bethune conceived the idea of administering blood transfusions on the spot. He developed the world's first mobile medical unit. The unit contained dressings for 500 wounds, and enough supplies and medicine for 100 operations. Bethune organized a service to collect blood from donors and deliver it to the battlefront, thereby saving countless lives. Bethune's work in Spain in developing mobile medical units was the model for the later development of Mobile Army Surgical Hospital (MASH) units.
Bethune returned to Canada on June 6, 1937 where he went on a speaking tour to raise money and volunteers for the anti-fascist battle raging in Spain.
In 1938 Bethune travelled to Yan'an in the Shanbei region of Shaanxi province in China. There he joined the Chinese Communists led by Mao Zedong in their struggle against the Kuomintang. The Lebanese-American doctor George Hatem who had come to Yan'an earlier was instrumental in helping Bethune get started at his task of organizing medical services for the front and the region.
In China, Bethune performed emergency battlefield surgical operations on war casualties and established training for doctors, nurses and orderlies. He did not distinguish between casualties, treating wounded Japanese prisoners as well as Chinese.
In the summer of 1939 Bethune was appointed the Medical Advisor to the Jin-Zha-Ji (Shanxi-Chahar-Hebei) Border Region Military District, under the direction of General Nie Rongzhen.
Stationed with the Communist Party of China's Eighth Route Army in the midst of the Second Sino-Japanese War, Bethune cut his finger while operating on a soldier. Probably due to his weakened state, he contracted septicaemia (blood poisoning) and died of his wounds on November 12, 1939.
His statue in Montreal's Norman Bethune Square.
Virtually unknown in his homeland during his lifetime, Bethune received international recognition when Chairman Mao Zedong of the People's Republic of China published his essay entitled In Memory of Norman Bethune (in Chinese: çÅ¿çÆÆ), which documented the final months of the doctor's life in China. Almost the entire Chinese population knew about the essay which had become required reading in China's elementary schools during China's Cultural Revolution (1966–76). Mao concluded in that essay: "We must all learn the spirit of absolute selflessness from him. With this spirit everyone can be very helpful to each other. A person's ability may be great or small, but if he/she has this spirit, he/she is already noble-minded and pure, a person of moral integrity and above vulgar interests, a person who is of value to the people."
Bethune is one of the few Westerners to whom China has dedicated statues, of which many in his honour have been erected throughout the country. He is buried in the Revolutionary Martyrs' Cemetery Shijiazhuang, Hebei Province, China, where his tomb and memorial hall lie opposite the tomb of Dwarkanath Kotnis, an Indian doctor also honoured for his humanitarian contribution to the Chinese. One of the three honoured in this memorial is the hero of the Academy Award–winning film, Chariots of Fire, Reverend Eric Liddell of Scotland. He died while incarcerated in a Japanese prisoner of war camp in Shandong Province.
Elsewhere in China, Norman Bethune University of Medical Sciences, founded in Changchun, Jilin and later merged into Jilin University as Norman Bethune College of Medicine, is named after him. Similarly his memory is held dear to students and staff at three institutions in Shijiazhuang namely, Bethune Military Medical College, Bethune Specialized Medical College and Bethune International Peace Hospital.
In Canada Bethune College at York University, and Dr Norman Bethune Collegiate Institute (a secondary school) in Scarborough, Ontario, are named after him.
The Government of Canada purchased the manse in which he was born in Gravenhurst in 1973 following the visit of Prime Minister Pierre Trudeau to China. The year previous Dr Bethune had been declared a Person of National Historic Significance. In 1976 the restored building was opened to the public as Bethune Memorial House. The house is operated as a National Historic Site of Canada by Parks Canada. In August 2000, then Governor General Adrienne Clarkson, who has Chinese ancestry, visited the house. On that same occasion she unveiled a bronze statue of him erected by the Town of Gravenhurst. It stands proudly in front of the Opera House on the main street of the community.
The city of Montreal, Quebec, Canada, created a public square and erected a statue in his honour, located near the Guy-Concordia metro station.
In March 1990, to commemorate the centenary of his birth, Canada and China each issued two postage stamps of the same design in his honour.
In 1998, he was inducted into the Canadian Medical Hall of Fame located in London, Ontario.
In 2000, the Bethune Institute began its work in memory of Dr. Bethune, entitled, Pink Pagoda . This humanitarian effort saves baby girls from infanticide. The Bethune Institutes Executive Director, Dr. James Garrow, was nominated for the Nobel Peace Prize in 2009 for the Pink Pagoda program in the Peoples Republic of China.
In February 7, 2006 (Spain) - The City of M¡laga opened the Walk of Canadians, in his memory. This avenue, which runs parallel to the beach "Crow Rock" direction to Almeria, paid tribute to the solidarity action of Dr. Norman Bethune and his colleagues who helped the population of Malaga during the Spanish civil war. During the ceremony, unveiled a commemorative plaque with the inscription: "Walk of Canadians - In memory of aid to the people of Canada, at the hands of Norman Bethune, has provided the fugitives Malaga in February 1937". It also undertook the planting of an olive tree and a maple tree representative of Spain and Canada, symbols of friendship between the two peoples.
Dr Bethune (simplified Chinese: çÆÆÅÅ«; traditional Chinese: çÆÆÅÅ«), one of the most successful Chinese movies, was made in 1964 in memory of him; Gerald Tannebaum (simplified Chinese: ÈÅÉ; traditional Chinese: ÈšÅÉ; pinyin: T¡n Nngbäng), an American humanitarian, played Bethune.
Bethune was the subject of a 1964 National Film Board of Canada documentary Bethune, directed by Donald Brittain. The film includes interviews with many people close to Bethune, including his biographer Ted Allan.
Donald Sutherland played Bethune in two biographical films: Bethune (1977), made for television on a low budget, and Bethune: The Making of a Hero (1990). The latter, based on a 1952 book by Ted Allan and Sydney Gordon, was a co-production of Telefilm Canada, the Canadian Broadcasting Corporation, FR3 TV France and China Film Co-production.
In the CBC's The Greatest Canadian program in 2004, he was voted the 26th Greatest Canadian by viewers. In 2006 China Central Television produced a 20-part drama series, Dr Norman Bethune, documenting his life, which with a budget of yuan 30 million (US$3.75 million) was the most expensive Chinese TV series to date.
The 2006 novel The Communist's Daughter, by Dennis Bock, is a fictionalized account of Bethune's life.
The book of short stories, Cottage Gothic, by Martin Avery, contains fictionalized accounts of Bethune's life, particularly in the story "Chinese Gold", which also appeared in Best Canadian Stories. Both books were published by Oberon Press.
The Television miniserie, Canada: A People's History, by CBC, briefly mentioned his story during the episode describing Canadians in the Spanish Civil War.
Rod Langley wrote a play entitled "Bethune" in 1973, which covers Bethune's life from his move to Detroit to his death. It was this play that the 1977 Donald Sutherland film was based on.
^ Henry Norman Bethune. Encyclopedia of World Biography. Thomson Corporation.
^ a b Lloyd D. MacLean, Martin A. Entin (2000). "Norman Bethune and Edward Archibald: sung and unsung heroes". Ann Thorac Surg 70: pp. 1746–1752. http://ats.ctsnetjournals.org/cgi/content/full/70/5/1746?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=pneumonectomy&searchid=1&FIRSTINDEX=100&resourcetype=HWFIG.
^ Edgar A Porter (1997). The People's Doctor: George Hatem and China's Revolution. University of Hawaii Press. pp. 115–118. ISBN 0824819055. http://books.google.com.au/books?id=iTdNTR4ZefwC.
^ Porter (1997), p. 122-123.
^ Larry Hannant, The Politics of Passion: Norman Bethune's Writing and Art (Toronto; Buffalo: University of Toronto Press, 1998) p. 195.
^ Allan Hustak. "Statue of Bethune getting new home". The Gazette, Montreal. http://www.canada.com/components/print.aspx?id=0fdbe6ad-0cd1-4c38-be5c-b67cb2780514. Retrieved December 3, 2007.
^ Brittain, Donald (1964). "Bethune". NFB.ca. National Film Board of Canada. http://www.nfb.ca/film/bethune. Retrieved 2009-03-05.
^ Xinhua. "Sixty-seven years on, Canadian idealist moves China again". People's Daily Online. http://english.people.com.cn/200608/31/eng20060831_298507.html. Retrieved September 1, 2006.
Archived page of Bethune Institute for Anti-Fascist Studies.
Gerd Hartmann: Humanist statt Held (German: "Humanist rather than hero").
China's Canadian hero Toronto Globe and Mail book review of recent Bethune biography by Adrienne Clarkson. |
0.998807 | Review: The Second Summer of Love in 1988 saw house music change British youth culture forever - and Duane Pelt aka Sterling Void's "It's Alright" was an anthem from the period that truly encapsulated this magical time. Originally released on Chicago's DJ International in 1987, its life-affirming vocal performance by Paris Brightledge is still pognant to this day, backed by Void's powerfully evocative arrangement. To celebrate the 30 years since, Toolroom is proud to present a monumental remix package, alongside the fully remastered original. Baltimore legend DJ Spen & Reelsoul rework the track into a sublime expression in late night deepness and Manchester veteran Kevin Gorman dons the Adesse Versions alias again for a dusty and soulful rendition.
Lexer - "Just For Tonight"
Franky Rizardo - "Cart Wheel"
Thomaz Krauze - "Giving Up"
Mike Newman - "Gimme Tonight"
Denney - "Messin My Head"
Sllash & Doppe - "Aguella"
Kideko - "Give It Up"
David Tort - "A Day In Life"
Dateless - "Just A Feeling"
Mr Kavalicious - "What You Think"
Jay De Lys - "Just A Feelin'"
Max Chapman & Pirate Copy - "Call The Police"
Oger That (UK) - "Sneaky Girl"
Groovebox, Paralyze Idea - "The Rise"
Dale Howard - "Rogue Keys"
Wheats - "U N I"
Space Food - "Just Beat"
Frederick & Kusse - "Reach Out"
Siwell & Lucky Vegas - "Butterfly"
Weiss & Eli Brown - "Push It Up"
Illyus & Barrientos - "Shout"
Wilson, Smallwood & Ingram - "Perfect Sunrise 2019"
Allen (IT) - "Real One"
Manuel De La Mare - "Skin"
Last Vision, Omar Labastida - "Milk Your Sister's Cat"
David Tort & Markem - "You Hear That"
UMEK & Matt Sassari - "Dica"
Another Ambition - "Don't Cry For An Empty Sky"
Nihil Young, Wlady - "Teonanacatl"
PBR Streetgang - "Late Night Party Line"
Who Else & Anhauser - "Looks Of Tribes"
Fairchild - "The Light In You"
Skream & Billy Turner - "Leviathan"
Andre Sabota - "Out Of Sight"
Capa & Clara Sofie - "Breathe"
Dario D'Attis - "Disco Ducks"
Jason Chance & Michelle Weeks - "Live You Life"
GUZ (NL) & Simun - "The Jam"
Prok & Fitch - "Angie"
Mr Kavalicious - "Let The Bass Kick"
The Golden Boy - "Crazy L"
Eyes Everywhere - "Murder Weapons"
COZ - "You've Been Served Up!"
Space Jump Salute - "Slam Down"
DAVI & Definition - "Desole"
Joe Mesmar - "Mr Perfect"
Christian Nielsen - "Enter The Sunrise"
Darius Surossian - "Moon Buggy"
Wheats & Volkoder - "Chugg Love"
Vlad Asanin & Joe Red - "Get Ready"
Sergio Fernandez, Javi Colina & Quoxx - "Voltage"
Ciszak & Bruno Furlan - "I Don't Care"
Kry Wolf - "Mr Freeze"
Will Clarke - "Give Me Your Love"
Ralph Lawson & Rui-Z - "Acid Love" |
0.999972 | Is Ben Carson's proposal to overhaul HUD funding good for America?
Retired neurosurgeon Ben Carson, who now heads Trump's department of Housing and Urban Development (HUD), proposed huge changes to the way the federal government allocates housing subsidies, including more strict employment requirements for those who seek to access government benefits. Carson contends the current system, "is archaic and has perverse consequences, like discouraging these residents from earning more income." Critics have panned Carson's proposal, arguing that it will leave millions of Americans homeless, deepen income inequality, and further reduce economic mobility.
F: Retired neurosurgeon Ben Carson, who now heads Trump's department of Housing and Urban Development (HUD), proposed huge changes to the way the federal government allocates housing subsidies, including more strict employment requirements for those who seek to access government benefits. Carson contends the current system, "is archaic and has perverse consequences, like discouraging these residents from earning more income." Critics have panned Carson's proposal, arguing that it will leave millions of Americans homeless, deepen income inequality, and further reduce economic mobility.
Q: Is Ben Carson's proposal to overhaul HUD funding good for America? |
0.999723 | Want to travel around the Kerbol system but don't know how to start? No worries! I will teach you how to go to another [[Celestial Bodies|Celestial Body]] while being efficient at the same time. Let's jump in! This page assumes that you have already traveled and landed on the [[Mun]] and [[Minmus]]. You can find some tutorials here if you haven't: * [[Tutorial:Mun For Dummies|Mun For Dummies: Travelling to the Mun and Back]] by [[User:nicnacnic|nicnacnic]] (For Version 1.0 to 1.2) * [[Tutorial:How to get to Minmus|Traveling to Minmus]] by [[User:craigmt1|craigmt1]] ==Specifications== * '''Length:''' 15 minutes - 1 hour * '''Difficulty:''' Moderate * '''For Version:''' 1.0 to 1.2 * '''Recommended [[Delta-V]]:''' ~3,500 ** ~1,500 to ~2,500 for Interplanetary Transfer ** ~1,500 to get into orbit Additionally, you will need an understanding of orbital mechanics (see Tutorials section), maneuver nodes, angles, and a lot of patience. ==Planning Your Trip== ===Where to go First?=== It is best to first go to [[Duna]] because of many reasons. It has an atmosphere similar to Kerbin's which is suitable for aerobraking and parachutes. It is also Kerbin's nearest neighbor and possess a moon similar to the [[Mun]]: [[Ike]]. You can find a tutorial to go to Duna [[Tutorial:How to get to Duna|here]]. ===Rocket Requirements=== To go to another [[Celestial Bodies|Celestial Body]], there are some essential requirements that you should have on EVERY interplanetary rocket. * ''Parachutes'' (required for a return to Kerbin) * ''Solar Panels and Batteries'' (especially for probes) * ''An Efficient Engine'' (The [[RE-L10 "Poodle" Liquid Fuel Engine|Poodle]] engine or the [[LV-N "Nerv" Atomic Rocket Motor|Nuclear]] engine should do just fine) * ''Fuel'' (Use AT LEAST a Rockomax [[Rockomax Jumbo 64 Fuel Tank|Jumbo]] fuel tank or equivalent) * ''Reaction Wheels'' (The ones in each capsule would work also) * ''An Antenna'' (For communications (ESPECIALLY for probes in Version [[1.2]])) * ''Docking Port'' (This is not required, but is strongly recommended in case you get stranded in orbit) ===Planetary Alignment=== Make sure your target planet is ALIGNED with Kerbin. Or else, you could be drifting for years and wasting fuel until they happen to match up. ;Phase Angle: The angle from [[Kerbin]] to [[Kerbol]] to your destination planet. This could be in front or behind you. ===Simple Phase Angles=== * [[Moho]]: ~250 degrees behind * [[Eve]]: ~55 degrees behind * [[Duna]]: ~45 degrees ahead * [[Dres]] ~80 degrees ahead * [[Jool]]: ~95 degrees ahead * [[Eeloo]]: ~100 degrees ahead The trick is to get in a position in Kerbol orbit at the same time as your destination planet. You could also use [http://ksp.olex.biz The Interplanetary Guide and Calculator] to calculate your own path. ==Getting There== ===Getting into Orbit=== Simply put, get into a normal Kerbin orbit (about ~80km). That's it! ===Planning Your Maneuver=== ''Here's a trick:'' If you want to go farther from Kerbin, put your maneuver node about ~45 degrees past sundown. To go to the inner planets (Eve, Moho), put your maneuver node about ~45 degrees past sunrise. Pull the prograde vector in your maneuver until the dotted yellow line crosses the orbit of your target planet (you might have to zoom out). If you set the planet you are going to as your target, you are most likely going to see two white arrows. Play with your maneuver node vectors until you get the two arrows close enough to each other that it turns into an encounter. Don't worry about the periapsis height, we'll change that later on. ===Executing Your Maneuver=== Face the maneuver node marker on the [[navball]] and start burning when the timer reaches half of your EBT (Estimated Burn Time). To save fuel, use the [https://en.wikipedia.org/wiki/Oberth_effect Oberth Effect] by only burning for about 20 to 40 seconds at your periapsis. Just time warp around the orbit until you reach periapsis again, then start burning again. Once you get your encounter, cut the throttle. ===Minor Orbit Adjustments=== Now, we are going to change the height of the periapsis for the target planet. Put a maneuver node about ~10 days or so before your encounter. Focus your view on the target planet then use all the vectors on your maneuver node to get your periapsis to your desired height. * Periapsis in the Atmosphere: You will [[aerobrake]]. * Periapsis Above the Atmosphere: A Fly-By of the planet. (Unless you burn retrograde at periapsis) Complete your maneuver node burn and you will now be encountering your target planet. Hooray! You are now entering the SOI (Sphere of Influence) of your target planet! ==Tips and Tricks== ===Gravity Assists=== [[File:Gravity Assist.svg|thumbnail|right|Pass in front of a Celestial Body to brake and behind a Celestial Body to accelerate.]] A economical way to get to the outer planets is to preform a [[Gravity Assist]]. This is where you use the gravity of a planet to "slingshot" you into a larger and more distant orbit. A tutorial can be found [[Tutorial: Gravity Assist|here]]. Most effective celestial bodies to preform a gravity assist on (form best to worst): * Jool * Eve * Kerbin * Duna * Mun Gravity Assists require a lot of planning - this is not recommended for beginners! ==Conclusion== You have now got an encounter with your target planet! Congratulations! With enough fuel, you can now travel around the different planets in the Kerbol system and do more advanced missions. Good luck to you!
Return to Traveling Around the Kerbol System. |
0.961124 | People who live in Denmark are happier than the citizens of any other country. Why? This question can be answered with one word: hygge. This word doesn’t directly translate to English, but it’s related to personal well-being, sharing moments with loved ones, and enjoying time at home.
Who doesn’t like to be at home when it’s cold outside, sharing a coffee with your spouse or children, or reading a book with a cup of hot tea at hand? It would become monotonous if you did this every day, but repeating it with a certain consistency can bring you closer to happiness.
Maybe it’s not very cold right now. But you can swap out the blankets and the sofa for that little terrace in the backyard, or that walk you take where the company you have and the words you share with them are worth more than the steps you take. In some way or another, I’m sure you understand that there are thousands of ways to apply this Danish word to your life.
When Danish people are asked about the definition of hygge (a local word that has no translation to any other language), they say that it’s about what makes them happy. Hygge is more like an attitude or a way of life. It’s finding the coziest place in the house, spending time with loved ones, and setting all obligations aside. This Scandinavian country considers this to be the best way to live, even with the extreme weather conditions they experience in the winter.
During the coldest months, Danish people spend almost all day at home (there are only 4 hours of daylight at this time), which is why home decoration, comfortable furniture, and having plenty of space in their rooms is so important to them. They also pay close attention to the activities that go on inside the house: reading, watching movies, chatting, cooking, playing games, learning, and above all, spending time with family.
Minimalist style is not “allowed” in Denmark. They don’t choose to use it because this reduces the feeling of comfort, protection, and warmth. When they decorate, they use warm colors like orange and red, buy furniture made of thick wood, and decorate with useful accessories and objects.
The intimacy of their space or environment also has to do with lighting. Even though it’s dark out most of the day, they prefer to use candles, dim lamps, and fire to heat or light the room. They don’t bother with light bulbs that are too bright or powerful.
It’s also worth mentioning the fabrics they use, not only for clothing, but also for carpets, curtains, and blankets. They’re usually earth-tone fabrics made of thick, comfortable material.
For Danish people, this is all a part of their definition of happiness. And it’s not just being content with staying at home, it’s enjoying being at home when they can’t go out. Or enjoying it even when the weather is nice!
Can we all enjoy the concept of hygge?
This Danish model of happiness has already been exported to other parts of the world. Why? Because even in cities that aren’t cold, people have realized that it’s very comforting to spend time at home with family and friends, drink coffee or beer, eat ice cream, and do something you enjoy.
Something to keep in mind is that hygge is not just related to the winter, although the winter is quite long in Denmark. It can also be implemented in the warm months of summer, or any time of year. Why? Because it’s more about your way of living and feeling good. It doesn’t really have much to do with the weather, although weather is part of it.
In the book The Year of Living Danishly, Helen Russell details her experience as a foreigner enjoying hygge. The author states that hygge is all about being good to yourself, not denying yourself the pleasures of life, not punishing yourself, and looking for moments of happiness in the little things: a piece of chocolate, an episode of your favorite TV series, a book you adore, a bit of music, and the warmth of a hug.
If you stop to think about these little things, you’ll realize what really makes you happy. Everything else is extra. You can’t find true well-being in a packed closet or a new car, but you can find it in spending time with the people you love, doing activities that comfort you. That is living hygge! |
0.974382 | I have a question for you. How necessary is it to learn how to read music and understand formal music theory if you want to play music? I recently came across an interesting online discussion among musicians and music teachers on this topic and it immediately occurred to me that the same question could be applied to learning a second language.
The consensus was that if the players merely want to have fun performing simple pop songs or blues tunes with their friends (and there's certainly nothing wrong with that) then the ability to read music and understand formal theory, although never harmful, is not necessary. But if the person ultimately wants to become a competent musician, especially an accomplished classical or jazz player, or a composer, then the ability to read music and understand theory becomes essential.
In other words, if the goal is immediate or "instrumental"-playing some popular tunes at an upcoming festival or just jamming with friends-then the focus should be merely on learning the tunes, following the music tabs, and practicing the specific songs you plan to perform. And while this might be pleasant and practical, it won't really enhance one's overall musical development.
As such, learning how to play some simple tunes for an upcoming performance can be likened to practicing daily English conversation, bringing to mind questionable calls to make this a component of compulsory English education in Japanese schools.
How so? What if there is no immediate plan to perform some tunes for fun? Likewise, an overwhelming majority of Japanese students have no immediate plan or reason to use English for any immediate "performance." Therefore, making the learning of conversation, or practical daily English, a major component in compulsory English education doesn't make much sense. It would be like learning the tabs for a few select songs that the student has no plan to actually play. A tiny bit of technique might be retained, but not enough to have any real long-term musical benefit. In short, introducing so-called "practical daily English" or "practicing conversation" into Japanese compulsory English education is in fact largely impractical.
Conversation is generally dynamic-often spontaneous and unpredictable. But if there is no immediate plan for specific usage, the learning of conversational "tabs," or gambits, will tend to become an exercise in rote memorization. See the tab, copy the note. You say X then I say Y. The former is not really playing music and the latter is not really conversation.
Generating real-time conversation in English is more akin to composing or improvising in music in that you need a foundation of formal theory and an informed technique to manage these tasks well. In terms of compulsory English education, this means that in order to develop skills that will best allow students to produce and participate in communicative English scenarios in the future, the teaching and learning focus should be academic. This academic approach carries greater potential for creative and practical applications and better avoids a rote-like approach to language acquisition.
That last point may surprise you. But academic English need not mean only passively dissecting syntax, nor imply a dry, teacher-centred, lecture approach. Grammar, which is only one description of how language is managed to achieve communication, should imply far more than the memorization of set formulas or the ability to identify the names of elements in a sentence. To use a musical analogy, simply knowing that a certain tune consists of relative major scales in the Dorian mode with a 5/4 time signature will be unlikely to help one understand or appreciate the music more deeply, let alone play it better. But knowing and appreciating how modes, scales, chords, and time signatures can be flexible, varied, and applied together in intriguing combinations can aid one's sensibilities, thereby providing guidance and structure when you produce your own music, compose, or add your own playing variation on a theme.
In other words, understanding how the English language works to actually produce communication (not merely conversation)-how we manage different types of interactions, how we express modality or attitudes using our linguistic code-goes well beyond "grammar."
Honing one's senses and developing intuitions as to how structures can be manipulated to produce or express emotional or intellectual content better provides a foundation for those who wish to apply English to professional or private situations in the future.
Think about it-if you went to music school and learned how to play a few tunes but developed no sense or appreciation for how music works holistically, any future application of your studies would be severely hampered. Likewise, practicing daily English conversation in public schools is largely impractical, divorced from students' lives. It's not what we expect from compulsory education.
For those who want to rock out as a hobby, as with those who want to practice English for an upcoming trip abroad or make foreign friends, memorizing the tabs or practicing conversation is fine. But that's not what public schools in Japan should be doing. |
0.999191 | There is a story about an arrogant professor who goes to a Zen master to learn about Zen. As he sits down, he proceeds to tell the master what he already knows and exactly what he thinks about the subject. The Zen master listens intently and offers tea to the man. He begins to pour the tea into the professor's cup and continues even as the tea overflows onto the table. The professor shouts, "Stop! My cup is already full!" The Master of Zen says, "Yes it is, and until you empty it, nothing else will go in."
We have all been on both sides of that table. Either, we aren't listening because we already think we know, or we have our own strong opinions and beliefs that prevent us from accepting another person's point of view. If we are on the other side of the table, as the Zen master realized, trying to communicate with a person whose cup is full can be a complete waste of breath.
Setting aside preconceived notions, opinions, ideas, beliefs, and judgements can be extremely difficult. Especially when the information that you are receiving is criticism. Being aware of your reactions to advice, criticism, or information from another will help you to see whether your cup is full or empty. Opening your mind to the idea that every interaction with another person has something to teach you, will allow you to really hear what another has to say instead of filtering their words through what you "already know".
Even the harshest criticism from another has something to teach you. Listening with an open mind or a cup that is empty might allow you to take the criticism in a more constructive way.
When you empty your cup, you can begin to feel freedom from your own ideas and opinions. This freedom will leave you open and ready to learn something new at every moment. |
0.999808 | The catalyst for me to write the book Back Story: Breaking the the Cycle of Chronic Pain was half a lifetime of ceaseless agony that was often completely debilitating. This life of pain robbed me of joy, energy and what had always been my positive spirit. Before my pain began I had always been a can-do, upbeat, get it done kind of person. Whenever I felt that things weren't going the way I wanted them to go in life, I always thought to myself 'well you need to work harder, do more, reach out more to get what you want.' And so I did.
After my chronic pain began, and I had experienced several episodes where I was incapable of getting to a standing position without assistance during a 15-20 minute ordeal, my attitude changed. When I normally would have been thinking, what's next, where am I going today, what new thing can I take on in the future, I was now relegated to survival mode.
How can I get through the day or even the next hour with this constant pain. I adjusted my expectations downward, and kept my eyes on just getting through the things that were necessary for day-to-day life to continue. There were times when I did feel good enough for outings, hiking, bike riding, even gardening, but I could never be certain that I would feel well enough when the time came.
This loss of spirit happens by degree, little by little over time you become less and less like your old self, and more like your new chronic-pain-self. This is not a form or weakness, it is simply a survival skill, and if you've lived it you know it is a necessary change yourself in order to make life work.
If you are living as your chronic-pain-self, don't give up on your healthy-happy-pain free-self. Keep looking for an answer, don't quit, just keep trying to find a solution to your pain, and hopefully you will be able to return to the you that you want to be.
After trying every conventional therapy for crippling, chronic low-back pain, I discovered the problem was completely within my control. I experienced an amazing health transformation in a matter of weeks. Mind-Body medicine worked for me, and it can for can too! |
0.971633 | The European eel, Anguilla anguilla, exhibits a complex life cycle, with a blockade of sexual maturation at a prepubertal stage (silver stage) as long as its oceanic reproductive migration is prevented. This blockade is due to a deficient production of pituitary gonadotropins (1). The understanding of the mechanisms regulating the gonadotropic axis and controlling eel reproduction is of particular interest, considering the drastic decline of wild populations (2) and the current lack of self-sustained aquaculture of this species. Furthermore, as the eel is a representative species of an early group of teleosts (the elopomorpha) (3), deciphering such mechanisms in this species may provide new insights on evolution and ancestral regulations of endocrine systems.
Kisspeptin (Kiss1) gene was first discovered as a metastasis suppressor gene in human melanoma (4). Soon after, an orphan receptor, GPR54, was cloned in the rat (5) and was subsequently identified as the cognate receptor of kisspeptins (Kiss), the natural peptides derived from the product of Kiss1 (6–8). In 2003, a major breakthrough in reproductive endocrinology was achieved, as the GPR54 gene was shown to be essential for the onset of puberty. Mutations in gpr54 caused hypogonadotropic hypogonadism in humans (9, 10) and mice (10, 11). Later, hypogonadotropic hypogonadism was also observed in Kiss1 knockout mice (12), while precocious puberty onset occurred in humans with either gpr54-activating mutation leading to prolonged in vitro activation of intracellular signaling pathways in response to kisspeptin (13) or Kiss1 mutations leading to higher in vitro kisspeptin resistance to degradation (14). Since these discoveries, the kisspeptin system has been considered as a major puberty gatekeeper and reproductive regulator, upstream of GnRH [for reviews see Ref. (15–17)]. Nevertheless, Tang and collaborators (18) recently showed that gametogenesis and reproductive capability are not impaired in zebrafish mutant lines for Kiss, as well as for kisspeptin receptors (KissR), suggesting that the Kiss/KissR systems may be dispensable for the reproduction of some non-mammalian vertebrates.
The kisspeptin system has been identified in a number of vertebrate species, leading to the discovery of multiple genes encoding kisspeptins (from Kiss1 to Kiss3) as well as multiple genes encoding its receptors (from KissR-1 to KissR-4) [for review see Ref. (19)]. To date, mature amidated kisspeptins have been purified only from human, Xenopus, turtle, and salmon. In human, multiple mature Kiss1 peptides (Kp1), including a mature peptide encompassing 54-aa [Kp1(54)] and shorter peptides [Kp1(14) and Kp1(13)], were isolated from placental extracts (6). Mature Kiss peptides, cleaved from the same precursor, share the same C-terminal 10-aa sequence, which is the minimal sequence required to specifically bind their cognate receptor, as first described for human Kiss1 by Kotani et al. (6). Although Kiss2-like gene has been identified in human, a Kiss2 peptide (Kp2) may not be produced as an endogenous ligand due to the lack of an amidation signal in the precursor polypeptide (20). In Xenopus laevis, a species presenting three Kiss genes (Kiss1, 2, and 3), only Kp2(12) has been isolated by HPLC (21). In the red-eared slider turtle (Trachemys scripta), the mature endogenous Kiss2 peptide is a 12-aa sequence, while in the masu salmon (Oncorhynchus masou), it is a 13-aa sequence (20).
In the eel, three Kiss receptor genes have been characterized, i.e., KissR-1, KissR-2, and KissR-3 (19, 22–24). Their expressions mainly occur in the brain, pituitary, and gonads (19). Using heterologous Kiss peptides [human/lamprey Kp1(10); human Kp1(14); lamprey Kp1(13); and zebrafish Kp1(10), 2(10), 1(15), and 2(15)], we previously showed an unexpected and specific in vitro inhibitory effect on luteinizing hormone (lhβ) expression by eel pituitary cells in primary culture (22). Three GnRH receptors were identified in the eel, two of type I (Gnrh-r1a and 1b) and one of type II (Gnrh-r2); all were shown to be expressed in the brain, pituitary, and gonads (25).
In the present study, we report the cloning of two eel Kiss transcripts (Kiss1 and Kiss2), corresponding to the two previously defined ORFs (23). Using a specific quantitative real-time PCR (qPCR) approach, we investigated their distributions in various eel tissues. We synthesized the two minimal 10-aa peptides, eel Kp1(10) and Kp2(10), as well as the predicted mature peptides, eel Kp1(15) and Kp2(12). We tested all four peptides on rat KissR-1-transfected Chinese hamster ovary (CHO-K1) cells. We also studied their biological effects on the expression of gonadotropins (lhβ; follicle-stimulating hormone, fshβ) and gonadotropin-releasing hormone receptors (gnrh-r) by eel pituitary cells in primary culture.
European female eels were at the prepubertal “silver” stage, which corresponds to the last continental phase of the eel life cycle, preceding the oceanic reproductive migration. Eels were purchased from Gebr. Dil import-export BV (Akersloot, The Netherlands) and transferred to MNHN, France.
Animals were anesthetized by cold and then killed by decapitation under the supervision of authorized person (Karine Rousseau; No. R-75UPMC-F1-08) according to the protocol approved by Cuvier Ethic Committed (No. 68-027).
Total RNA from eel brain (pooled di-/mesencephalon) was extracted using Trizol reagent and reverse transcribed as previously described (22).
Predicted genomic sequences of eel Kiss1 and Kiss2 (23, 26) were used to design specific Kiss1 and Kiss2 primers, respectively (Table 1). Using the Advantage 2 PCR Kit (Clontech Laboratories Inc., PaloAlto, CA, USA), RACE PCRs with 5′-cDNA or 3′-cDNA as templates were performed as follows: an initial step of polymerase activation for 3 min at 94°C; then 10 cycles of 30 s at 94°C for denaturing, 30 s at 70°C for annealing, 90 s at 72°C for primer extension; and then 25 cycles of 30 s at 94°C for denaturing, 30 s at 68°C for annealing, 90 s at 72°C for primer extension, and a single final extension step of 5 min at 72°C. PCR products of appropriate estimated size were sequenced at GATC Biotech Ltd. (Konstanz, Germany).
Table 1. Primers used in the 3′- and 5′-RACE PCR and quantitative real-time PCR (qPCR) amplifications.
The signal peptides of the Kiss precursors were predicted using SignalP tool (28). Cleavage and amidation sites, as well as mature peptides, were predicted from the Kiss precursor using NeuroPred tool (29).
European eel Kp1(10), Kp2(10), Kp1(15), and Kp2(12) (Table 2) were synthesized (0.1-mmol scale) by the solid-phase methodology on a Rink amide 4-methylbenzhydrylamine resin (Biochem, Meudon, France) using a 433A peptide synthesizer (Applied Biosystems, Courtaboeuf, France) and the standard procedure, as previously described (30). The synthetic peptides were purified by reversed-phase (RP) HPLC on a 2.2 cm × 25 cm Vydac 218TP1022 C18 column (Alltech, Templemars, France), using a linear gradient (20–40% over 60 min) of acetonitrile/TFA (99.9:0.1, v/v) in water, at a flow rate of 10 ml/min. Analytical RP-HPLC, performed on a 0.46 cm × 25 cm Vydac 218TP54 C18 column, showed that the purity of the peptide was greater than 99%. The molecular mass of the peptide was verified by mass spectrometry on a MALDI-TOF Voyager DE-PRO instrument (Applied Biosystems).
Table 2. Sequences of predicted eel kisspeptins.
CHO-K1 cells were cultured to semiconfluence in 12-well plates using Ham’s F12 medium supplemented with 10% fetal bovine serum and 1% antibiotic–antimycotic solution. Cells were transfected with different quantities of the recombinant plasmid, ranging from 3 to 5 µg, using Lipofectamine 2000 (Invitrogen, Cergy Pontoise, France) as previously described (30). Twenty-four hours after transfection, media were replaced by fresh F12 medium containing 1 mg/ml G418 (Geneticin; Life Technologies, Inc.). One week later, surviving cells were detached, diluted, and plated on 96-well plates at 0.7 cells/well. Monoclonal cell lines expressing rat KissR-1 (CHO-K1-rKissR-1) were followed daily by contrast phase microscopy. Seven independent monoclonal stable cell lines were obtained after a 3-week period of selection. By using qPCR, two cell lines were selected based on their expression levels being closest to physiological levels among all cell lines. Of these, one cell line was definitely selected based on its best performance in showing clear Ca2+-mobilizing responses to treatment with rat Kp1(10).
To compare the KissR-1 agonistic activities of eel Kp1(10), Kp2(10), Kp1(15), and Kp2(12), the level of [Ca2+]i after stimulation of CHO-K1 cells stably expressing KissR-1 by these peptides was monitored by spectrofluorometry as previously described (30, 31) with slight modifications. Briefly, after 24 h in culture, cells were incubated for 1 h in a humidified incubator (37°C, 5% CO2) with 2 µM Fluo-4 acetoxymethyl ester (AM) calcium dye (Life Technologies, Saint Aubin, France) in Hank’s Buffer Saline Solution (HBSS; Life Technologies) buffered with 5 mM HEPES and supplemented with 2.5 mM probenecid (Sigma-Aldrich, Saint-Quentin Fallavier, France). Cells were washed twice with HBSS/HEPES/probenecid to remove Fluo-4 AM from the incubation medium and incubated in 150 µl of the same medium at 37°C for 15 min. Fluorescence was recorded using a Flexstation 3 fluorescence plate reader system (Molecular Devices, Saint-Grégoire, France) during 180 s with an excitation wavelength of 480 nm, an emission wavelength of 525 nm, and a cutoff filter of 515 nm. After 15 s recording in basal conditions, 50 µl of graded concentration (10−12 to 10−6 M) of different peptides (four-fold final concentration) was added to the incubation medium with the built-in eight-channel pipettor at a rate of 62 µl/s to assess their agonistic activity. After subtraction of mean fluorescence background from control wells without Fluo-4 AM, baseline was normalized to 100%, and fluorescence peak values were determined for each concentration of peptide. Potency (EC50) and efficacy (Emax) (Table 3) were determined with the Prism 6.0 software (GraphPad Software In., La Jolla, CA, USA) using a four-parameter logistic equation to fit peak fluorescence data.
Table 3. Functional parameters of the response of KissR-1 CHO-K1 cells to treatment with eel kisspeptins as measured using FlexStation technology.
Various tissues were individually collected from eight freshwater female silver European eels to investigate the distribution of Kiss1 and Kiss2 expressions using qPCR. The following tissues were sampled, stored in RNAlater (Ambion-Inc., Austin, TX, USA), and kept frozen at −20°C until RNA extraction: brain, pituitary, eye, liver, kidney, intestine, spleen, muscle, adipose tissue, and ovary. The brain was dissected into six parts olfactory bulb, telencephalon, mesencephalon, diencephalon, cerebellum, and medulla oblongata. In addition, testes from eight freshwater male silver European eels were also collected.
Dispersion and primary culture of pituitary cells from 30 freshwater female silver eels were performed using an enzymatic and mechanical procedure as described by Ref. (33) and as previously used for the test of heterologous kisspeptins (22). Cultures were performed in serum-free culture medium (Medium 199 with Earle’s salt, sodium bicarbonate, 100 U/ml penicillin, 100 µg/ml streptomycin, and 250 ng/ml fungizone) (Gibco, Thermo Fisher Scientific, Villebon sur Yvette, France) at 18°C under 3% CO2 and saturated humidity.
Hormonal treatments were started 24 h after the beginning of culture to allow cell attachment (Day 0). Replicates of five wells for control and each treated group were used. Eel Kp1(10), Kp1(15), Kp2(10), and Kp2(12) were tested (see Table 2). Kisspeptin stock solutions (10−4 M) were prepared in ultrapure water and stored at −20°C. Stock solutions were diluted in culture medium just before addition to the culture wells. Culture medium was changed and kisspeptins were added to the cells on Day 0, Day 3, and Day 7. Control wells were treated with similar dilutions of ultrapure water. Cultures were stopped on Day 10, according to Ref. (22). The effects of treatments (10−7 to 10−11 M) were tested in at least three independent experiments performed on different cell preparations from different batches of fish.
Tissue samples were individually homogenized by sonication in Trizol, and total RNAs were extracted according to the manufacturer’s instructions (Invitrogen). Following extraction, samples were treated with DNase I (Roche, Meylan, France), and the first strand of cDNA was synthesized from 400 ng of total RNA using Superscript III reverse transcriptase (Invitrogen) and random hexamer primers. The reaction was performed according to the following thermal conditions with an initial step at 25°C for 10 min followed by incubation at 50°C for 60 min and 70°C for 15 min. The samples obtained were stored at −20°C until qPCR. The extracted RNAs were the same as in Ref. (19).
For cell cultures, total RNA was directly extracted in wells using the Cell-to-cDNA II Kit (Ambion, Thermo Fisher Scientific) according to the manufacturer’s recommendations. Cells were washed with sterile phosphate buffer (Gibco) and lysed with Cell Lysis II Buffer (80 µl/well). The lysates were digested with RNase-free DNase I (Roche). Four microliters of RNA solution of each sample was then reverse transcribed with a SuperScript III First Strand cDNA Synthesis Kit (Invitrogen). The samples obtained were stored at −20°C until qPCR.
Eel Kiss1- and Kiss2-specific primers for qPCR (Table 1) were designed based on the European eel cDNA sequences cloned in this study and using Primer3 Software (Whitehead Institute/Massachusetts Institute of Technology, Boston, MA, USA). To optimize the assays, different annealing temperatures were tested according to the melting temperature (Tm) of primers. To assess their specificity, amplification products were sequenced at GATC Biotech Ltd.
The qPCR primers for European eel β-actin, lhβ, fshβ, gnrh-r1a, gnrh-r1b, and gnrh-r2 were previously designed (25, 27) (Table 1). β-actin was used as reference gene. All primers were purchased from Eurofins (Ebersberg, Germany).
Quantitative assays of eel Kiss1, Kiss2, lhβ, fshβ, gnrh-r1a, gnrh-r1b, gnrh-r2, and β-actin mRNAs were performed using the LightCycler® System (Roche) with SYBR Green I sequence-unspecific detection as previously described (19, 22, 23). The qPCRs were prepared with 4 µl of diluted cDNA template, 2 µl of PCR grade water, 2 µl of SYBR Green master mix, and 1 µl of each forward and reverse primers (0.5 pmol each at final concentration). The qPCRs were performed as follows: an initial step of polymerase activation for 10 min at 95°C; then 41 cycles of 15 s at 95°C for denaturing, 5 s at 60°C for annealing, 10 s at 72°C for primer extension (β-actin, lhβ, fshβ) or 51 cycles of 15 s at 95°C for denaturing, 5 s at 61°C for annealing, 5 s at 72°C for primer extension, 5 s at 83°C to avoid measurement of non-specific annealing (Kiss1, Kiss2) or 42 cycles of 10 s at 95°C for denaturing, 7 s at 61°C for annealing, 4 s at 72°C for primer extension (gnrh-r2), or 42 cycles of 10 s at 95°C for denaturing, 10 s at 60°C for annealing, 7 s at 72°C for primer extension (gnrh-r1a, gnrh-r1b); and a single final extension step of 5 min at 72°C. Each qPCR run contained a non-template control (cDNA was substituted by water) for each primer pair. The efficiency of primers and the specificity of reaction were assessed as previously described (19). Serial dilutions of cDNA pool of brain and pituitary tissues were run in duplicate and used as a common standard curve and also included in each run as a calibrator.
Quantitative real-time PCR efficiencies for Kiss1 and Kiss2 primers (calculated by standard dilution curves) were as follows: Kiss1 89.84% and Kiss2 88.05%. Assay included a melting curve analysis for which all samples displayed a specific single peak.
Normalization of data was performed using total RNA content for the tissue distribution samples, and using β-actin mRNA level for the cell culture samples.
Results are given as mean ± SEM. Non-parametric tests were performed. Mean values were compared by one-way ANOVA Tukey’s multiple comparison test using Instat (GraphPad Software Inc., San Diego, CA, USA).
Using European eel-specific Kiss1 primers designed on eel Kiss1-predicted genomic sequence (23, 26), RACE PCRs, performed on brain cDNAs, led to the cloning of a partial Kiss1 transcript sequence (EMBL: LT962662) encompassing a partial coding sequence (CDS) of 314 bp and partial 3′-UTRs of 30 bp. Once translated, the cloned Kiss1 CDS gave a partial 103-aa kisspeptin precursor exhibiting a 10-aa sequence (YNWNSFGLRY) characteristic of the kisspeptin family (Figure 1A).
Figure 1. Cloning of eel partial Kiss1 mRNA (A) and complete Kiss2 mRNA (B). Nucleotides (upper line) are numbered from 5′ to 3′. The exon–intron junctions are indicated by two nucleotides in bold. The deduced amino acids (bottom line) are numbered beginning with the first methionine residue (M) in the ORF (for Kiss2) or with the first codon of the known sequence (for Kiss1 partial mRNA). The asterisk (*) indicates the stop codon, and signal peptide sequence is underlined by a dashed line. Kp1(10) and Kp2(10) are shaded in black. Kp1(15) and Kp2(12) are underlined by a bold line. Kp1(31) and Kp2(51) are underlined by a double line. C-Terminal proteolytic α-amidation sites are boxed in a square and predicted N-terminal cleavage sites are circled.
Using European eel-specific Kiss2 primers designed on eel Kiss2-predicted genomic sequence (23, 26), RACE PCRs, performed on brain cDNAs, led to the isolation of the complete Kiss2 transcript sequence (EMBL: LT844561). The sequence encompassed 5′- and 3′-UTR of 114 and 495 bp, respectively, and a CDS of 402 bp. Once translated, the cloned Kiss2 CDS gives a 134-aa kisspeptin precursor exhibiting a 10-aa sequence (FNRNPFGLRF) characteristic of the kisspeptin family (Figure 1B).
BLASTN analyses performed on the European eel draft genome, using the present eel Kiss1 and Kiss2 cloned sequences as queries, revealed that each transcript is encoded by two exons. Concerning Kiss2, the first exon encoded a 21-aa signal peptide. Both Kiss1 and Kiss2 exons-2 encoded the Kiss1 and Kiss2 mature peptides, respectively, including the characteristic 10-aa sequences of the kisspeptin family.
The identification of the potential N-terminal and C-terminal cleavage sites of each precursor led to the prediction of two N-terminal extended putative mature peptides: Kp1(15) from Kiss1 and Kp2(12) from Kiss2 (Figure 1). Eel Kiss1 presented a conserved dibasic site (KR), 5 amino acids upstream the decapeptide, showing that a mature peptide of 15 amino acids [Kp1(15)] may be produced. Eel Kiss2 possessed a single basic amino acid (R) at position 13, indicating that the Kiss2 cDNA encoded a putative peptide with 12 amino acids [Kp2(12)]. A 31-aa mature peptide for Kiss1 and a 51-aa mature peptide for Kiss2 could also be predicted (Figure 1A).
The sequence of eel Kp1(10) is identical to rat Kp1(10). In contrast, Kp2(10) is a newly identified sequence, which presented at its third position an arginine (R) that possessed different physicochemical properties from amino acids commonly found at this position. Kp1 and Kp2 sequences were followed at their C-terminal side by a proteolytic cleavage and/or an α-amidation motif, i.e., GK motif for Kiss1 and GKR motif for Kiss2 precursors, respectively (Figure 1B).
Specific qPCR protocols were developed for each eel Kiss and applied to the analysis of their respective tissue distribution (Figure 2).
Figure 2. Schematic representation of eel brain with dissection cut sites indicated adapted from Ref. (32) (A), and tissue distribution of the expression of eel Kiss1 (B) and Kiss2 (C) mRNAs. Olfactory bulb (OB), telencephalon (Tel), diencephalon (Di), mesencephalon (Mes), cerebellum (Cb), medulla oblongata (MO), pituitary (Pit), eye, liver, kidney, spleen, muscle, adipose tissue (Fat), and ovary were dissected from female silver eels. The relative expression of each Kiss mRNA was normalized to actin mRNA. Each bar represents mean ± SEM from eight individual samples.
Kiss1 mRNAs were mainly expressed in the mesencephalon part of the brain. Its expression was lower in the diencephalon, close to the limit of detection in the telencephalon and cerebellum and under detection threshold in the olfactory bulb and medulla oblongata. Kiss1 expression was abundant in the pituitary. In peripheral tissues, low Kiss1 mRNA levels were measured in the eye and the testis. Its expression was at the limit of detection in muscle and under the detection threshold in the other investigated tissues (liver, kidney, intestine, spleen, adipose tissue, and ovary) (Figure 2B).
Kiss2 mRNAs were mainly expressed in the diencephalon. Kiss2 expression was lower in the mesencephalon and in the medulla oblongata, and under the detection threshold in the olfactory bulb, telencephalon, and cerebellum. Kiss2 expression was also observed in the pituitary. In peripheral tissues, a low expression of Kiss2 was detected in the testis. The expression level was under the limit of detection in the other tissues (eye, liver, kidney, intestine, spleen, adipose tissue, and ovary) (Figure 2C).
The two 10-aa peptides, Kp1(10) and Kp2(10), and the two predicted mature peptides, Kp1(15) and Kp2(12), were synthesized for functional assays (Table 2). The functional activity of the four synthesized eel kisspeptins was assessed on the kinetics of [Ca2+]i in CHO-K1 cells stably transfected with the rat KissR-1, by using a multimode FlexStation III system. All four kisspeptins were able to activate the rat Kiss1R, i.e., to trigger intracellular pathways leading to [Ca2+]i increase. As shown in Figure 3 and Table 3, eel/rat Kp1(10) and the other eel Kiss peptides, Kp1(15), Kp2(10), and Kp2(12), displayed the following EC50 values: 8.5 ± 4.5, 11.8 ± 2.0, 56.6 ± 27.7, and 134.7 ± 18.9 nM, respectively.
Figure 3. Functional assays of eel Kiss peptides. Levels of [Ca2+]i in CHO-K1 cells transfected with rat KissR-1 and stimulated with different doses of eel Kp1(10), Kp2(10), Kp1(15), and Kp2(12) were assessed by using FlexStation technology. After subtraction of mean fluorescence background from control wells without Fluo-4 acetoxymethyl ester, baseline was normalized to 100%, and fluorescence peak values were determined for each concentration of peptide. Values represent mean ± SEM from two independent experiments, and average dose–response curves are shown.
We previously demonstrated that heterologous kisspeptins [human/lamprey Kp1(10); human Kp1(14); lamprey Kp1(13); zebrafish Kp1(10), Kp2(10), Kp1(15), and Kp2(15)] can inhibit lhβ expression by eel pituitary cells in primary culture, with no effect on fshβ (22). In the present study, we tested the effects of concentrations ranging from 10−11 to 10−7 M of the homologous eel kisspeptins over 10 days in the same culture system.
All four eel synthesized kisspeptins [Kp1(10), Kp1(15), Kp2(10), and Kp2(12)] significantly inhibited lhβ expression at 10−7 M [×0.63 with Kp1(10), P < 0.001; ×0.59 with Kp2(10), P < 0.001; ×0.60 with Kp1(15), P < 0.001; ×0.62 with Kp2(12), P < 0.001] (Figure 4A). Inhibition by Kp2(10) and Kp2(12) was also significant at 10−9 M (×0.71, P < 0.05 and ×0.70, P < 0.01, respectively). In contrast, the eel Kiss peptides had no significant effect on fshβ expression at any dose tested (Figure 4B).
Figure 4. Dose-dependent effect of eel Kiss peptides on pituitary lhβ (A), fshβ (B), and gnrh-r2 (C) expression by eel pituitary cells in primary culture. Pituitary cells were treated with various concentrations (10−11, 10−9, and 10−7 M) of eel Kp1(10), Kp2(10), Kp1(15), and Kp2(12) for 10 days. Pituitary mRNA levels were quantified by quantitative real-time PCR. Data were normalized against β-actin. This figure displays the results of a representative experiment. Each point represents mean ± SEM from five-well replicates. *P < 0.05, **P < 0.01, and ***P < 0.001 versus controls, ANOVA.
Among the three eel GnRH receptors, gnrh-r2 was the only one with detectable specific expression in both control and treated pituitary cells in primary culture; with gnrh-r1a and gnrh-r1b expressions at the limit of detection, primer dimer peaks (melting curve) were obtained. An inhibitory effect of all four synthesized eel Kiss peptides was observed on the expression of gnrh-r2. This inhibitory effect was dose-dependent, the highest inhibition being observed at 10−7 M [×0.35 for Kp1(10), P < 0.001; ×0.34 for Kp2(10), P < 0.001; ×0.33 for Kp1(15), P < 0.001; and ×0.44 for Kp2(12), P < 0.001] (Figure 4C).
In order to assess the predicted Kiss1 and Kiss2 sequences and further investigate the gene exon–intron structures, we performed specific RACE PCR on Kiss1 and Kiss2 transcripts. The sequencing of the RACE PCR products and the comparison of their sequences to the European eel genome provided a partial Kiss1 mRNA encompassing, at least, two exons and a complete Kiss2 mRNA made of two exons. This structure exhibiting two exons is typical of the conserved structure of Kiss genes (34).
Once translated, both Kiss1 and Kiss2 transcripts encoded two proteins presenting the characteristics of the kisspeptin precursors. Among those hallmarks, Kiss1 and Kiss2 precursors presented the conserved kisspeptin-10 sequences, i.e., YNWNSFGLRY for Kiss1 and FNRNPFGLRF for Kiss2. Moreover, Kp1(10) and Kp2(10) were followed at their C-terminal extremity by a cleavage and α-amidation signature, i.e., GK and GKR motifs, respectively. For many neuropeptides, α-amidation is essential for biological activity (35, 36). Both eel kisspeptin-10 sequences were encoded by the second exon of each gene transcript in accordance with what has been observed in other species (34).
The eel Kp1(10) sequence was identical to the rat Kp1(10) but, to our knowledge, the only teleost sequence possessing a tryptophan (W) at its third position; other teleosts showed a leucine (L) except chub mackerel with a phenylalanine (F). The eel Kp2(10) sequence was rather unique due to the presence of an arginine (R) at its third position. The occurrence of an arginine at this position has only been reported so far in the Kp1(10) of the musk shrew (Suncus murinus) (37). Kp2(10) sequences appeared more conserved among vertebrates than Kp1(10) ones, differing by one amino acid versus three (Figure S1 in Supplementary Material).
Although kisspeptin-10 is considered as the minimal sequence capable of activating KissR (6, 7), in silico analysis did not provide any evidence for the existence of mature Kp1(10) or Kp2(10) in any vertebrate including the European eel. Using the NeuroPred tool, we were able to predict the N-terminal cleavage site for each kisspeptin precursor. The predictions of these N-terminal cleavage sites in addition to the C-terminal α-amidation motifs have delineated potential mature peptides that could be directly cleaved from Kiss1 and Kiss2 precursors. Thus, the two likely mature peptides in the European eel were Kp1(15) and Kp2(12). In addition, two potentially longer mature peptides could be predicted: a 31-aa mature peptide for Kiss1 and a 51-aa mature peptide for Kiss2.
The presence of cleavage sites delineating a mature Kp1(15) appears to be conserved among teleosts (Figure S1 in Supplementary Material), except in goldfish Carassius auratus (38) and in chub mackerel Scomber japonicus (39) in which a Kp1(16) is predicted. In contrast, the presence of a glutamic acid (E) at the first position of the eel mature Kp1(15) seems to be a unique feature among teleosts. Interestingly, the presence of an E residue at the first position of a mature Kp1 is observed in Kp1(16) in the sarcopterygians, including mammals and the coelacanth (Latimeria chalumnae), and a non-teleost representative of actinopterygians, a holostean, the spotted gar (Lepisosteus oculatus) (23). This feature could thus represent a common characteristic of sarcopterygians and actinopterygians, which has been conserved in the eel and lost in some other teleosts.
The presence of a basic cleavage site leading to a mature Kp2(12) seems to be also conserved among teleosts such as in the European eel (Figure S1 in Supplementary Material). One exception is observed in salmonids (masu salmon and kokanee salmon, Oncorhynchus nerka) in which the mature endogenous Kiss2 peptide is a 13-aa sequence (20). The existence of a mature Kp2(12) has been proven in Xenopus (21) and in the red-eared slider turtle (20).
Both eel Kiss1 and Kiss2 mRNAs were mainly expressed in the brain, as shown by specific qPCR, Kiss1 being more abundant in the mesencephalon and Kiss2 in the diencephalon. Their expressions were also observed in other parts of the central nervous system (i.e., in the telencephalon and cerebellum for Kiss1 and in the medulla oblongata for Kiss2), although at lower levels. These distributions, which were obtained in the present study, in females at silver stage may differ in males or in females at a different stage.
In other teleosts presenting two Kiss genes, both Kiss1 and Kiss2 mRNAs are also expressed in the central nervous system [RT-PCR and qPCR, zebrafish (40–42); RT-PCR, goldfish (43); RT-PCR, sea bass (Dicentrarchus labrax), medaka (Oryzias latipes) (42); RT-PCR and qPCR, chub mackerel (44); qPCR, rohu, Labeo rohita (45); qPCR, Catla catla (46, 47); qPCR, pejerrey, Odontesthes bonariensis (48)], suggesting that kisspeptins exert important functions in the teleost brain. Anatomical studies, using ISH and laser-capture microdissection coupled with qPCR, have demonstrated that each transcript is located in different brain nuclei: Kiss1 mRNA is observed in the ventral habenula, while Kiss2 mRNA is found in the preoptic region and in the hypothalamus [for review see Ref. (49); European sea bass (50)]. Nevertheless, in striped bass Morone saxatilis (51) and in chub mackerel (39), no Kiss1 expression was reported in the habenular nucleus. In zebrafish, generation of specific antibodies for each kisspeptin type made it possible to evidence that only Kiss2 neurons send projections to GnRH neurons and pituitary, suggesting a prominent involvement of Kiss2 rather than Kiss1 in the regulation of the gonadotropic activity of this species (52). This is probably also the case in the eel, as Kiss2 is more actively expressed than Kiss 1 in the diencephalon, which is the main neuroendocrine region of the brain.
In a previous study, we showed the expression of the three eel Kiss receptors in the brain (19). These receptors are differentially expressed in various brain regions. KissR-1 mRNAs is widely expressed in all parts of the eel brain. This receptor is the unique receptor present in placental (eutherian) mammals; the European eel is the only extant teleost shown so far to possess KissR-1, which seems to have been lost in other teleosts (19, 23, 24). Eel KissR-2 mRNAs is mainly expressed in the telencephalon and the di-/mesencephalon, while KissR-3 expression is primarily observed in the di-/mesencephalon. These data suggest potential multiple actions of kisspeptins in the eel brain that need further investigations.
Both Kiss1 and Kiss2 transcripts were expressed in the eel pituitary. In other teleost species possessing two kisspeptin genes, different observations have been reported. Only Kiss2 expression is detected in zebrafish (52) and pejerrey (48) pituitaries, while only Kiss1 is expressed in the chub mackerel pituitary (44). In the medaka, none of the two kisspeptin genes is expressed in the pituitary (53), while in the sea bass, both genes are expressed (54), as in the eel.
We previously showed that KissR-1 and KissR-2 are the two receptors expressed in the eel pituitary (19). These data suggest that, in the eel, the pituitary could be a target for the neuroendocrine action of both cerebral and locally produced pituitary kisspeptins. Similarly, pituitary expression of Kiss and KissR mRNA, as well as the presence of their respective proteins, has been observed in mammals and amphibians [human (6, 7); rat (55–57); ovine (58); and amphibians (21, 59)]. The occurrence of kisspeptin and its receptor in the pituitary supports the notion that the peptide may exert paracrine and/or autocrine actions in this tissue.
In the eel, Kiss1 and Kiss2 were weakly expressed in the testis (data not shown) and not in the ovary at the silver stage (prepubertal blockade), which cannot predict a higher expression at a more advanced sexual stage. In other teleosts possessing two kisspeptin genes, different situations have been reported. In some species, both kisspeptins are detected in the gonads [medaka and zebrafish (42, 53); sea bass (60); rohu (45); and Catla catla (46, 47)]. In contrast, in the chub mackerel, Kiss1 is expressed in the gonads of both sexes, while Kiss2 expression is not detected (44), whereas in the pejerrey, expression of both genes is very low in the gonads (48). We previously showed a strong expression of KissR-1 in both the ovary and testis of the European eel (19), which supports a potential endocrine action of Kiss1 and/or Kiss2 on European eel gonads.
In other peripheral organs, which do not belong to the brain–pituitary–gonad axis (muscle, liver, fat, kidney, intestine, spleen, and eye), eel Kiss1 and Kiss2 expression levels were under the detection limit except in the eye, where Kiss1 mRNA, but not Kiss2, was clearly expressed. We previously showed the expression of KissR-1 in the eye, suggesting the potential involvement of the kisspeptin system in the local regulation of visual functions. Kiss1 and Kiss2 expression also occurs in the eye of other teleost species [zebrafish and medaka (42); rohu (45); and pejerrey (48)]. Kisspeptin receptor mRNAs are also observed in the eye of zebrafish [KissR-3 only (61)] and pejerrey [KissR-2 and KissR-3 (48)]. Interestingly, in the medaka, eye development is interrupted after zygotic knockdown of Kiss1 (62), implying a possible function of the kisspeptin system during retina ontogenesis. Few data are available in other vertebrates. In Xenopus, expression of Kiss-1a and Kiss-1b is observed in the eye, while none of the three kisspeptin receptors and neither Kiss-2 are expressed in this organ (59). In mammals, one study supports a role of kisspeptin as metastasis suppressor gene in the eye, as the expression of both Kiss1 and its receptor is detected in human uveal melanoma cell lines and correlates with survival rate (63).
We demonstrated that all four synthesized eel Kiss peptides were able to bind kisspeptin receptor in heterologous system (CHO-K1 cells stably transfected with rat KissR-1), inducing a rise in intracellular calcium. Eel Kp1(15) exhibited about the same potency to activate rat KissR-1 than eel Kp1(10), which is identical to rat Kp1(10). Interestingly, eel Kiss2-derived peptides were also able to activate rat KissR-1, as zebrafish (59) and sea bass (60) peptides did with human KissR-1.
Zebrafish Kiss peptides are also highly efficient for activating mammalian (human) KissR-1 in COS-7 cells [zebrafish Kp1(10) (41)] and in CV-1 cells [zebrafish Kp1(15), Kp2(10), and Kp2(12) (59)]. Similarly, in CHO cells, sea bass Kiss peptides [sea bass Kp1(10), Kp2(10), Kp1(15), and Kp2(12)] can efficiently activate human KissR-1, while, in the case of mouse KissR-1, sea bass Kp2(10) is not able to induce any activation (60).
Teleost models, other than eel, possess only two receptors, homologous to eel KissR-2 and eel KissR-3, respectively, as they have lost their KissR-1 paralog, homologous to eel and human KissR-1 (19). For clarity, the nomenclature of Pasquier et al (19, 24) for KissR will be used in the following paragraphs. In teleost models with two receptors, various studies have shown differential affinities of Kiss peptides toward homologous receptors. In zebrafish [CV-1 cells (59)] and sea bass [CHO cells (60)], Kp2(12) exhibits higher potency for activating KissR-3, while Kp1(15) exhibits a preference for KissR-2. These data are in agreement with the neuroanatomical distribution of Kiss and KissR-expressing neurons in these two species [zebrafish (52); sea bass (50, 64)]. However, contradictory results have been obtained by other authors in zebrafish, KissR-2 being activated by both Kp1(10) and Kp2(10), while KissR-3 is preferentially activated by Kp1(10) [COS-7, CHO-K1, and HEK293 cells (61)]. In striped bass, Kp1(15) and Kp2(12) activate KissR-3 with the same potency, while KissR-2 is more efficiently activated by Kp2(12) [COS-7 cells (65)]. In the chub mackerel, the predicted mature peptide Kp1(16) is more active than the shorter Kp1(15) on KissR-3 (39).
Furthermore, in these homologous receptor and peptide systems, distinct intracellular signal transduction pathways can be activated. KissR-2 and KissR-3 signals can be transduced via both PKA and PKC pathways in zebrafish (41), medaka (66), chub mackerel (67), and sea bass (60). In goldfish, the PKA pathway is activated by Kiss1/KissR-3, while PKC pathway is induced by Kiss2/KissR-2 (43). In the southern Bluefin tuna (Thunnus maccoyii) and in the yellowtail kingfish (Seriola lalandi), KissR-2 (the only receptor present in these species) shows stronger transduction via the PKC than the PKA pathway (68), while in the orange-spotted grouper, Epinephelus coioides, no PKA could be activated (69). In mammals (6, 7) and in the bullfrog Rana catesbeiana (21), KissR-1 conveys its signal via the PKC pathway and not the PKA pathway.
As, in the eel, three kisspeptin receptors, KissR-1, KissR-2, and KissR-3, are present, future studies should aim at investigating the potency of homologous kiss peptides to activate each eel KissR and study their signal transduction pathways.
All four synthetic eel kisspeptins specifically and dose-dependently inhibited lhβ expression by eel pituitary cells in culture, while they had no effect on fshβ transcripts. These data confirm, using homologous peptides, the specific inhibitory effect of kisspeptin on lhβ in the European eel that we previously reported with heterologous Kiss peptides (22).
This paradoxical inhibitory effect contrasts with the general action of kisspeptin as an activator of puberty and reproduction, mostly at the brain level (70), but also directly on the pituitary [for reviews see Ref. (71, 72)]. Our results in the European eel suggest that kisspeptins encoded by both Kiss1 and Kiss2 have an inhibitory in vitro effect on lhβ expression. Another study, in the striped bass, reported that Kp1(15) had an inhibitory effect on lh expression, while Kp2(12) stimulated LH release (65). In contrast, in other studied teleosts, the action of kisspeptin is generally either stimulatory or absent as in mammals. For instance, in goldfish, homologous Kp1(10) and Kp2(10) are inactive on LH release by pituitary cells from sexually mature females (43), whereas homologous Kp1(10) increases the release and expression of LH by pituitary cells from mixed sexes at late stages of sexual regression (38). In the sea bass, Kp2(12) induces both lh expression and LH release by pituitary cells obtained from mature males, while Kp1(15) has no effect (73). In (striped and sea) basses, the different actions of Kiss1 and Kiss2 on LH regulation observed in vitro have also been reported in vivo. In the sea bass, Kp2(10) is significantly more potent than Kp1(10) in inducing LH secretion after intramuscular (im) injection to both prepubertal and adult fish (42). In the striped bass, im injection of Kp1(15) and Kp2(12) induces plasma LH levels in a stage-dependent manner: Kp1(15) has no effect on LH at pubertal stage, while both peptides could increase LH levels at gonadal recrudescence (51). Our results in the European eel suggest that kisspeptins encoded by both Kiss1 and Kiss2 have no in vitro effect on fshβ expression. In a few studies, a stimulatory effect of kisspeptins has been reported on FSH. In the striped bass, Kp1(15) and Kp2(12) stimulate FSH at both the gene transcription and peptide secretion levels (65). In the sea bass, Kp2(12), but not Kp1(15), can induce in vitro FSH release (73). Recently, it was reported that, in amphioxus (Branchiostoma japonicum), injection of amphioxus kisspeptin-like could upregulate the expression of gpb5, a paralog of glycoprotein vertebrate-like β subunit (74). Our results on primary cultures of eel pituitary cells indicate that Kiss peptides may act directly at the pituitary cell levels in the eel. The action of Kiss peptides may be exerted directly on pituitary gonadotrophs or via other pituitary cells. We have already shown that heterologous Kiss peptides did not change the expression of gpα, gh, fshβ, and tshβ in the same in vitro system (22), but indirect action on LH cells may occur via some other factors produced by pituitary cells other than LH cells. Our previous studies revealed that Kiss receptors (KissR-1 and KissR-2) are expressed in the eel pituitary (19). Future in situ hybridization studies would be necessary to decipher whether KissR and which type(s) are expressed by LH cells. Future experiments may also aim at investigating the in vitro effects of specific antagonists for KissR on lhβ and gnrh-r2 expression. In mammals, including humans, Kiss peptides may act not only via their cognate receptor (Kiss-R = GPR54) but also via other RF-amide receptors that show less specificity such as NPFF receptors 1 and 2 [for instance see Ref. (75)]. This opens further research avenues aiming at characterizing the full complement of RF-amide receptors in the eel.
Besides the inhibitory action on lhβ expression of eel kisspeptins, the present study reveals a dose-dependent inhibitory effect on the expression of gnrh-r2 by primary culture of eel pituitary cells. This receptor is the one increased during experimental maturation in both female and male eels (25). To the best of our knowledge, only a single other study investigated the effect of kisspeptin on GnRH receptor in teleost. In female striped bass at dummy run phase (ovarian development is initiated but not completed), chronic administration in vivo of both Kp1(15) and Kp2(12) induces a decrease of pituitary gnrh-r mRNAs (76). In other vertebrates, the few studies available have been mainly performed in mammals and demonstrate a stimulatory or an absence of effect of kisspeptins on the expression of GnRH receptor. Using the mouse pituitary gonadotroph LβT2 cell line, Witham and collaborators (77) have found that kisspeptin treatment cannot activate GnRH receptor promoter, but, in contrast, Mijiddorj et al. (78) have recently demonstrated that kisspeptin increases the expression of GnRH receptor. While the presence of Kiss/KissR is under question in birds, repeated injections of human Kp1(10) upregulated pituitary expression of type II (but not type I) gnrh-r in the juvenile female Japanese quail (Coturnix japonica) (79). In the anuran amphibian Pelophylax esculentus, Kp10 treatment of testes in culture upregulated the expression of the three gnrh-r before and during the reproductive periods, and this effect was completely abolished/counteracted by the antagonist Kp-234 (80).
Our finding suggests that, in the eel, kisspeptins decreased lhβ expression directly at the pituitary level and also decreased pituitary sensitivity to GnRH by downregulating GnRH receptor expression, leading to a double inhibitory control. The kisspeptin system may thus contribute to the strong inhibitory control of puberty observed in the European eel. This inhibition in the eel, which contrasts with the stimulatory role of kisspeptin in the reproduction of other vertebrates, reveals evolutionary change in the reproductive role of kisspeptin.
JP, A-GL, and FD: cloning—qPCR (tissue distribution). JP and KR: primary cultures. BL and JL: synthesis of kiss peptides. CD, AM-H, and JL: binding studies. JP, HV, JL, SD, and KR: design—writing. All authors: final approval.
The reviewer JA declared a past coauthorship with several of the authors SD and A-GL to the handling editor.
We thank Eric Ryckelynck and his team from Nodaiwa (Paris, France) for their kind cooperation. This work was supported by grants from the European Community PRO-EEL No. 245257 to A-GL and SD, from the National Research Agency NEMO No. ANR-08-BLAN-0173 to JP, A-GL, KR, SD, BL, and JL and from FrenchKiSS No. ANR-07-BLAN-0056-04 to JL and HV.
The Supplementary Material for this article can be found online at http://www.frontiersin.org/articles/10.3389/fendo.2017.00353/full#supplementary-material.
1. Rousseau K, Lafont AG, Pasquier J, Maugars G, Jolly C, Sébert ME, et al. Advances in eel reproductive physiology and endocrinology. In: Trischitta F, Takei Y, Sébert P, editors. Eel Physiology. Science Publishers (2013). p. 1–43.
3. De Pinna MCC. Teleostean monophyly. In: Stiassny MLJ, Parenti LR, Johnson GD, editors. Interrelationships of Fishes. New York: Academic Press (1996). p. 147–62.
4. Lee J, Miele ME, Hicks DJ, Karen K, Trent J, Weissman B, et al. KiSS-1, a novel human malignant melanoma. Cancer (1996) 88:1731–7.
Copyright: © 2018 Pasquier, Lafont, Denis, Lefranc, Dubessy, Moreno-Herrera, Vaudry, Leprince, Dufour and Rousseau. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. |
0.99999 | Which of the following Rajput rulers is known to have donated for the reconstruction of a mosque?
Jaya Singh Siddharaja , Chalukya King of Gujarat: He was the son of Kama and ascended the throne in 1094 A.D He gave shelter to many scholars of different religion and castes. He was a Rajput ruler who gave donation of one lac Baltoras (coins) for rebuilding a mosque in Cambay. |
0.994849 | You are as a battle-hardened mercenary to fight enemies using a variety of weapons. Totally 17 weapons, grenade and 3 armors can be bought in store. To make money by completing more tasks to buy better equipments. There are 70 levels in 7 maps and 2 extra funny games. And a number of game achievements and online leaderboards, players can join with the global rivalry.
– More than 10 role modules performed a total of more than 30 different acts.
– There are 7 theme maps with totally 70 levels and dozens enemy waypoints.
– Survival mode and 2 extra mini games can train player’s reaction.
– To master the reload time, switch the main and sub weapons timely, and throw grenades to a group enemies occasionally is an essential skill to get high score.
– Variety of realistic dynamic physics effects, such as hit strike, explosion, death drop, etc.
– Variety of particle effects with rhythmic background music and sound effects.
58 Achievements and 21 Online Leaderboards to compete with global players. |
0.94743 | Humans with autism often show a reduced frequency of social interactions and an increased tendency to engage in repetitive solitary behaviors. Autism has also been linked to dysfunction of the amygdala, a brain structure involved in processing emotions. Now Caltech researchers have discovered antagonistic neuron populations in the mouse amygdala that control whether the animal engages in social behaviors or asocial repetitive self-grooming. This discovery may have implications for understanding neural circuit dysfunctions that underlie autism in humans.
This discovery, which is like a "seesaw circuit," was led by postdoctoral scholar Weizhe Hong in the laboratory of David J. Anderson, the Seymour Benzer Professor of Biology at Caltech and an investigator with the Howard Hughes Medical Institute. The work was published online on September 11 in the journal Cell.
"We know that there is some hierarchy of behaviors, and they interact with each other because the animal can't exhibit both social and asocial behaviors at the same time. In this study, we wanted to figure out how the brain does that," Anderson says.
Interestingly, these two populations are distinguished according to the most fundamental subdivision of neuron subtypes in the brain: the "social neurons" are inhibitory neurons (which release the neurotransmitter GABA, or gamma-aminobutyric acid), while the "self-grooming neurons" are excitatory neurons (which release the neurotransmitter glutamate, an amino acid).
Using this optogenetic approach, Anderson's team was able to selectively switch on the neurons associated with social behaviors and those linked with asocial behaviors.
With the social neurons, the behavior that was elicited depended upon the intensity of the light signal. That is, when high-intensity light was used, the mice became aggressive in the presence of an intruder mouse. When lower-intensity light was used, the mice no longer attacked, although they were still socially engaged with the intruder—either initiating mating behavior or attempting to engage in social grooming.
Surprisingly, these two groups of neurons appear to interfere with each other's function: the activation of social neurons inhibits self-grooming behavior, while the activation of self-grooming neurons inhibits social behavior. Thus these two groups of neurons seem to function like a seesaw, one that controls whether mice interact with others or instead focus on themselves. It was completely unexpected that the two groups of neurons could be distinguished by whether they were excitatory or inhibitory. "If there was ever an experiment that 'carves nature at its joints,'" says Anderson, "this is it."
"In autism," Anderson says, "there is a decrease in social interactions, and there is often an increase in repetitive, sometimes asocial or self-oriented, behaviors"—a phenomenon known as perseveration. "Here, by stimulating a particular set of neurons, we are both inhibiting social interactions and promoting these perseverative, persistent behaviors."
Studies from other laboratories have shown that disruptions in genes implicated in autism show a similar decrease in social interaction and increase in repetitive self-grooming behavior in mice, Anderson says. However, the current study helps to provide a needed link between gene activity, brain activity, and social behaviors, "and if you don't understand the circuitry, you are never going to understand how the gene mutation affects the behavior." Going forward, he says, such a complete understanding will be necessary for the development of future therapies.
"All of this is very far away, but if you found the right population of neurons, it might be possible to override the genetic component of a behavioral disorder like autism, by just changing the activity of the circuits—tipping the balance of the see-saw in the other direction," he says.
The work was funded by the Simons Foundation, the National Institutes of Health and the Howard Hughes Medical Institute. Caltech coauthors on the paper include Hong, who was the lead author, and graduate student Dong-Wook Kim.
An illustration of the seesaw circuit, showing an antagonistic relationship between the "social" neurons and "asocial" neurons in the mouse amygdala. |
0.950246 | I fall and I break.
They just let them fall.
If forever, a rain-drop you want to be!
I'm sorry if I got into a personal zone but the words you've mentioned are really touching so couldn't stop myself from responding. |
0.999998 | The health of the whole community is protected when we ensure that our children are immunized. Diseases that once spread quickly and affected thousands of children and adults are not largely contained by vaccines. Child vaccination is one of the most cost-effective preventative health measures. Vaccines are important because they not only protect individual children against dangerous diseases, they protect communities by slowing down or preventing disease outbreaks and protecting communities by helping to protect children who are not able to be vaccinated. In other words, vaccination protects not only the recipient of the vaccine, but everyone in the community. This helps to contain infectious diseases, including polio, measles, diphtheria and many others.
Footnotes: The CDC designation or "fully immunized" has changed from (4:3:1)-four doses of diphtheria, tetanus and Pertussis vaccine (DTaP); three doses of polio vaccine; one or more dose of measles, mumps, and rubella vaccine (MMR)- to (4:3:1:3:3:1)-four doses of diphtheria, tetanus and Pertussis vaccine (DTaP); three doses of polio vaccine; one or more doses of measles, mumps and rubella vaccine (MMR); three doses of Haempphilus influenza type b vaccine (Hib); three doses of hepatitus B vaccine; and one or more doses of Varicella or chickenpox vaccine. The change from 2006 to 2007 is due to the dosing change rather than from fewer vaccinations. |
0.999787 | A report from a Digital, Culture, Media and Sport select committee has deemed that Team Sky "crossed an ethical line" in their use of legal performance-enhancing drugs in the buildup to Sir Bradley Wiggins' Tour de France win in 2012.
As noted Jack Skelton of BBC Sport, the investigation carried out by a select group of MPs said it was "not in a position" to determine what was delivered to Wiggins in a "jiffy bag" in 2011 at the Criterium du Dauphine but concluded he used triamcinolone to improve performance.
It's added that Team Sky's claims the bag contained a decongestant are backed up by no "reliable evidence."
Wiggins used triamcinolone, an anti-inflammatory substance, prior to the cyclist's iconic Tour de France win in 2012.
The report said "the purpose of this was not to treat medical need but to improve his power-to-weight ratio ahead of the race." It's added that other supporting riders may have also used the substance in preparation for the Tour.
Skelton wrote, "if Wiggins was injected with triamcinolone on the final day of the 2011 Dauphine it would be an anti-doping violation, with the maximum sanction a two-year ban and the loss of results."
I find it so sad that accusations can be made, where people can be accused of things they have never done which are then regarded as facts. I strongly refute the claim that any drug was used without medical need. I hope to have my say in the next few days & put my side across.
In a statement on their official website, Team Sky "strongly refutes" any allegations of wrongdoing.
As noted by Skelton, triamcinolone is banned by the World Anti-Doping Agency unless the athlete in question is granted a therapeutic use exemption. Wiggins was issued with said exemption prior to the 2011 and 2012 Tours as well as the 2013 Giro d'Italia.
Former Team Sky and British Cycling coach Shane Sutton said in the report the use of the substance by Wiggins was "unethical but not against the rules," per the same source.
Biggest issue for Brailsford and Wiggins, beyond DCMS conclusions, is statement by Shane Sutton as coach, mentor and right-hand man. Admits triamcinolone use was ‘unethical’.
Per Lawton, it has previously been alleged that a medical package ordered by Team Sky in the "jiffy bag" in question contained triamcinolone.
Wiggins made history in 2012 when he became the first British cyclist to win the Tour de France. Since that victory, his former Team Sky team-mate Chris Froome has won cycling's most illustrious race on four occasions. However, Froome himself tested positive for a banned substance during his win at the Vuelta a Espana last year.
Wiggins is also his country's most decorated Olympian, as he's won five gold medals, a silver and two bronzes on the track and road, including a victory in the individual time trial at London 2012 that came just 10 days after his Tour de France success. |
0.962066 | his parents were farmers, he still graduated from Dartmouth College in 1801.
Portsmouth, New Hampshire in 1807.
were Dartmouth College v. Woodward, Gibbons v. Ogden, and McCulloch v.
Congress from Boston, and in 1827 he was elected senator from Massachusetts.
well known among many people worldwide. |
0.999808 | Talk about green hype. There is no doubt that zero tailpipe emissions helps keep down smog, one of those nasty side effects of operating millions of cars in a tight space like a metropolis. I hope by now you've realised that even most electric vehicles (EVs) are not really zero-emission vehicles (ZEVs) unless they're powered by sun, wind or water.
But the ZEV label gets bandied about anyway: it sounds so - green. It's pleasing to the green-leaning ear, and pleasing to regulators who want to keep smog down in their large cities, and so what if the coal-powered electric plants powering the EVs still emit soot and carbon dioxide elsewhere.
Let us be clear about it: zero is zero. It is not low. It is not very low, and not even ultra-low. It's zero. Zilch. Nada. 0, the unique and magical number.
Let me be brutally clear about it: Zero is like pregnant. Either you are pregnant, or you are not pregnant. You can't be partially pregnant. Similarly, either you have zero emissions, or you don't have zero emissions. If you cause even a teeny puff of greenhouse gas emissions, even far away from your tailpipe, you don't have zero emissions.
But the ZEV label is so highly coveted that, pretty much meaningless to begin with, it is now plastered on cars that have a highly dubious claim on the label. That's greenwashing for you.
While all literature on electric vehicles jubilantly proclaim "Zero Emissions", I propose they really ought to be labeled "Emissions Elsewhere Vehicles".
Owners may present the proper paperwork proving that their electricity is obtained from sources emitting no greenhouse gases to get an upgrade to the "ZEV" sticker. This sticker entitles them to a hefty tax rebate, zero-toll lanes on all toll roads, tunnels and bridges, preferred parking spots at malls, and other perks that turn regular drivers green with envy. Maybe green enough that they also get a car like that.
There are now lots of wannabe-ZEV cars that sport the PZEV label, some of them brazenly stuck on the rear. It stands for the mathematically ridiculous "Partial Zero Emission Vehicle". Some of these cars don't even do all that well on fuel efficiency.
That's like wearing those fake leather jackets that are basically vinyl plastic treated with a synthetic "leatherette" smell: ugh. Or a fake Rolex watch. It would be fairly simple (and a great hack on your green-snob neighbour) to add stick-on letters to make the label read NRZEV, for "Not Really a Zero Emission Vehicle".
GMC Yukon; 12mpg avg. Photo IFCAR.
As any child can tell you, excluding is mean, and not tolerated on most playgrounds. Why shouldn't even the largest trucks and SUVs be allowed to play? Let them have the DNZEV label; I bet that would help sales. Even if the label would mean "Definitely Not Zero Emission Vehicle".
I do get your point, Rupert; but a pedestrian is not being labeled "Zero Emission" ad nauseam. It's the hype I object to, not the EV. |
0.997804 | And Wyatt gets the last word.
-it joined a wonderful collective.
-it became a part of a ridiculously fun trading card game.
-it helped me accomplish something difficult, that I didn’t really think I could.
-I got to write a world with giant robots, Robot-Ninja-Samurai-Pirates, limbless doctors, closed-eyed navigator twins, Weird Rabbit Things, Vending Machine chefs, a llama, a tough captain, a meme-spouting first mate, and a silent cabin boy.
-and, it got read by you guys, who enjoyed it, made some great fan art, and left comments that made the day of a certain amateur cartoonist.
In the end, what makes a webcomic truly a webcomic isn’t simply it being put on the web, but the interaction between one reader and another, and the interaction between the readers and the creator. Thanks for making Silent Pirate a true webcomic, guys.
I might return to Silent Pirate, as I’m considering putting it together in book form, and that would require extras…but that’s still up in the air right now.
If you think you’d like to read my next work, here’s a clue. I’ll be posting about it here when it launches.
TL;DR: you guys made Silent Pirate worthwhile, and I can’t state enough how much that meant to me. Also, this.
It was a great story, thank you for telling it and allowing us to experience it.
It was my pleasure! Thank you for reading, Michael!
Awww… it’s done? It’s been a great ride! Thanks for sharing your vision with us readers! Been great reading it and getting to know you!
Thanks for reading, Tachyon! I’m glad you liked the comic, and that you’ll be sticking around for the next adventure!
It was a really fun comic, i’ll be looking forward your next project!
In all cases, thanks for the great read!
Thanks for reading! See you at Pastel Noir!
Read through it all, and although it wasn’t super complex or anything, it was definitely a fun read. I’ll recommend it to anyone, because it really was nice.
You’re the man now, man.
Wow, thank you! I’m glad it was a fun read! |
0.999987 | The department's Air Pollution Control Program provides this information as a public service. Although the air program and other department programs produced some of the fact sheets, brochures and other materials, contributions from other agencies and organizations also appear. Please contact the relevant organizations or agencies regarding their material.
Action4Air - Children attending Rockwood School District’s Center for Creative Learning in Ellisville, MO, won a national environmental award: EPA Region 7’s 2012 President’s Environmental Youth Award. They created the Action4Air anti-idling campaign at the Center for Creative Learning.
Air Quality - Air quality can affect your health.
Anti-idling flier - STOP Idling. START $aving. Printable flyer from the Missouri Department of Natural Resources with a link and QR code to the department's anti-idling brochure.
Anti-idling brochure - A publication from the Missouri Department of Natural Resources with information about campaigns to reduce idling and state regulations that limit idling as well as tips to limit idling.
* Park instead of using drive-through lanes for banks and restaurants.
* Turn off your car while waiting to drop off or pick up people, especially if you find yourself idling for 10 seconds or longer. Modern starters and batteries are durable, so don't waste money and fuel.
Asbestos and Lead-Based Paint Abatement Requirements at Brownfields/Voluntary Cleanup Program Sites.
Best Burn Practices - A properly installed, correctly used wood-burning appliance should be smoke free. EPA guidelines to Burn Wise in your appliance and reduce smoke inside and outside your home.
The Blue Skyways Collaborative - Through partnership with non-profit and environmental groups, private industries and international, federal, state and local governments Blue Skyways strives to improve air quality.
Burn Season - Information regarding burn season and opening burning including links to fact sheets.
Carbon Monoxide - EPA Introduction to Indoor Air Quality/Carbon Monoxide.
Clean Up the Mold - A fun reminder to clean up mold, a health hazard and an asthma trigger, from EPA.
The Climate Registry - A collaboration between states, provinces and tribes aimed at developing and managing a common greenhouse gas emissions reporting system.
Don't Smoke in the House - The EPA Breathe Easy information helps remind us about common asthma triggers in a memorable way. Spanish version: No fume en la casa - Los EPA Respira fácil ayudan a recordarnos sobre los desencadenantes comunes del asma de una manera notable.
East-West Gateway Council of Governments - The St. Louis region's Metropolitan Planning Organization and Regional Council of Governments.
Envirofacts - Database containing data from five major EPA program systems.
EnvironmentalScience.org - Environmental science education and careers resource information.
EPA home page - You and your environment with a collection of resources.
EPA Air Index home page - EPA information on various aspects of air quality.
EPA Region 7 Air Pages - EPA links to policy and guidance databases.
EPA School Flag Program - The Flag Program uses colored flags based on the U.S. EPA Air Quality Index to notify teachers, students and others about the air quality each school day.
Green Guide Links for Cars and Trucks - Links to Air Pollution Control Program information on Green Cars and Trucks.
Household Carbon Footprint Calculator - Online calculator to get a rough estimate of a household's greenhouse gas emissions.
Indoor Air Pollution - National Institutes of Health information on the normally seen causes of indoor air pollution ranging from smoking to carbon monoxide.
Indoor Air Quality - EPA information covering many of the concerns that people have about indoor air quality.
Indoor Air Quality Publications - List of indoor air quality publications from the U.S. Consumer Product Safety Commission.
Indoor Environmental Quality - Centers for Disease Control and Prevention collection of resources surrounding air quality.
Kansas City Air Quality Program - The Air Quality Program is part of a national air monitoring network that monitors for six kinds of air pollution in the outdoor air.
Lead Poisoning - Information from the Missouri Department of Health And Senior Services.
Lead Renovation, Repair and Painting Program - Renovations can be done safely according to EPA.
Mid-America Regional Council - An association of city and county governments and the metropolitan planning organization for the bi state Kansas City region.
Missouri Green Schools Initiative - Effort to enhance green initiative in Missouri schools.
National Association of Clean Air Agencies - Explore this website to locate state and local air agencies across the nation.
Occupational Exposure to Carbon Nanotubes and Nanofibers - NIOSH recommends new exposure levels for nanomaterials.
OSHA Indoor Air Quality Information - OSHA information on common indoor air quality problems for schools, businesses and other public buildings.
Ozarks Clean Air Alliance - Air quality issues for the Ozarks.
Ozarks Environment - Environmental activities, events and initiatives in Southwest Missouri region.
Pesticides - An EPA Introduction to Indoor Air Quality/Pesticides.
Radon - Radon exposure in the home is responsible for an estimated 20,000 lung cancer deaths each year. A Citizen's Guide to Radon provides information to help protect yourself and your family from radon.
Radon program, Missouri - The Missouri Department of Health and Senior Services provides information on radon testing for your home.
Technology Transfer Network - Missouri Environmental Rules which have been approved by EPA.
Toxic Release Inventory - Annual EPA Toxic Release Inventory provides citizens with vital information about toxic chemical releases their communities. |
0.999739 | My daughter and I want to start an online buisness making and selling custom made hand painted clothing and bags. What kind of business would this be? Sole proprietor, DBA, can i just use my SSN? Just looking for the least expensive way to go in NY state?
The least expensive way to do it together with your daughter in New York is to form a General Partnership (by drafting a simple partnership agreement), and registering a DBA in your county of residence. Since its a partnership you won't be able to use your SSN, and instead you would need to obtain an EIN. |
0.999949 | Imagine you are a realtor.
You have a listing for a property and someone searches that property. Who shows up?
Below is an 11.5 million condo that I ranked a real estate broker 1st on Google.
That is $500,000 in commission on an 11.5 million dollar condo.
Think about how much what your clients, in their respected industries search for, and estimate what is it worth to you? |
0.853802 | Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA−/− mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth–regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components.
Ribosomal RNA (rRNA) transcription is a key step in the synthesis of ribosomes and occurs through the control of RNA polymerase I (Pol I; Grummt, 2003; Moss, 2004; Russell and Zomerdijk, 2005). Over the last several decades, studies in unicellular systems, particularly Escherichia coli and Sacharomyces cerevisiae, have examined the mechanisms by which rRNA synthesis is regulated (Nomura, 1999; Paul et al., 2004). More recent studies in mammalian cell culture have also identified mechanisms via which Pol I is controlled. However, few studies have addressed how rRNA synthesis is regulated in vivo during the growth of a multicellular animal. Given that ribosome biogenesis links extracellular signals to the control of cell growth, identifying the mechanisms that operate in vivo should provide key insights into the control of cell and tissue growth.
Nutrient availability is a key determinant of cell and organismal growth. In eukaryotes, the target of rapamycin (TOR) kinase pathway is a major growth–regulatory pathway activated in response to nutrient availability (Wullschleger et al., 2006). Although biochemical and genetic analyses have defined the signaling inputs to TOR, the outputs via which TOR drives growth are not fully understood. An extensive literature suggests that TOR controls growth by stimulating mRNA translation, particularly through the effectors ribosomal protein (RP), S6 kinase (S6K), and translation initiation factor 4E–binding protein. But these targets are unlikely to explain all the effects of TOR in vivo. For example, Drosophila melanogaster TOR mutants are lethal and have marked growth defects, whereas S6K and 4E-binding protein mutants are viable and have mild growth phenotypes (Montagne et al., 1999; Oldham et al., 2000; Zhang et al., 2000; Miron et al., 2001). Hence, other downstream targets and metabolic processes must additionally contribute to the effects of TOR in vivo.
Studies in yeast and mammalian cell culture indicate that regulation of rRNA synthesis is a conserved TOR function (Zaragoza et al., 1998; Powers and Walter, 1999; Hannan et al., 2003; Tsang et al., 2003; Claypool et al., 2004; James and Zomerdijk, 2004; Mayer et al., 2004; Li et al., 2006). A few studies have described mechanisms by which TOR can affect Pol I activity; however, these have yielded conflicting results. Studies in yeast and mammalian cell culture reported that TOR regulated the ability of a conserved transcription factor, transcription initiation factor IA (TIF-IA; or Rrn3p, the yeast homologue of TIFI-IA), to recruit Pol I to rDNA (Claypool et al., 2004; Mayer et al., 2004). But another paper on mammalian cells found that TIF-IA is dispensable for TOR-dependent regulation of rRNA synthesis and suggested that a different Pol I factor, upstream binding factor (UBF), was a target of TOR signaling (Hannan et al., 2003). Finally, a recent paper showed that TOR associates with the rDNA in yeast, suggesting that regulation of Pol I by TOR is direct (Li et al., 2006). TOR may therefore control rRNA synthesis through multiple mechanisms. Whether or not TOR regulates rRNA synthesis in vivo in animals and what mechanisms may operate in this context have not been examined.
Here, we examine the role of the D. melanogaster homologue of the conserved Pol I factor TIF-IA in the control of ribosome synthesis and growth. We show that TIF-IA is required for rRNA synthesis and cell and organismal growth and that TIF-IA functions downstream of the TOR pathway in vivo. We also provide evidence that stimulation of rRNA synthesis by TIF-IA can control the levels of other ribosome components.
A recessive lethal P-element line, KG06857, was available from a public stock center. This line contains a P-element insertion in the 5′ region of the TIF-IA gene, which reduced TIF-IA mRNA expression in homozygote L1 larvae compared with the wild type (Fig. 1 A, left). Tif-IAKG06857 homozygote (Tif-IA−/−) larvae had low levels of pre-rRNA synthesis (Fig. 1 A, right). Phenotypically, Tif-IA−/− mutant animals developed through embryogenesis and hatched at the normal time. But as larvae, they failed to develop and exhibited a growth arrest phenotype, surviving for up to 8 d as arrested L1 larvae (Fig. 1 B). This growth arrest phenotype was fully reversed by ubiquitous expression of a TIF-IA cDNA transgene in mutant larvae using the GAL4–upstream activator sequence (UAS) system (Fig. S1 A, available at http://www.jcb.org/cgi/content/full/jcb.200709044/DC1). Using the hsFlp–GAL4 method, mosaic expression of TIF-IA cDNA in the larval fat body of Tif-IA−/− larvae led to a cell-autonomous rescue of growth (Fig. 1 D). Conversely, mosaic expression of a TIF-IA RNAi construct in wild-type larva cells autonomously inhibited growth in the fat body (Fig. 1 E). Thus, the developmental arrest we observed in the Tif-IA−/− mutants was caused by a cell-autonomous defect in growth. We also found that RNAi-mediated knockdown of TIF-IA in cultured D. melanogaster S2 cells reduced cell size and caused cells to accumulate in G1 phase of the cell cycle (Fig. S1 B). Thus, TIF-IA activity is necessary for proper rRNA synthesis and cell growth during development.
TIF-IA is required for cell and organismal growth. (A) Levels of TIF-IA mRNA and pre-rRNA were measured by quantitative RT-PCR, using RNA isolated from either wild-type or Tif-IA−/− mutant larvae. Data were corrected for levels of GPDH mRNA. Data are mean (± SEM) fold changes compared with wild type (n = 6). (B) Tif-IA−/− mutant larvae are growth arrested. Images of Tif-IA heterozygote (+/−) and Tif-IA homozygous mutant larvae (−/−) at different stages (48–120 h) of larval development are shown. (C) Loss of p53 has no effect on the growth arrest phenotype seen in TIF-IA mutant larvae. Images of TIF-IA+/−; p53−/− (top) or Tif-IA+/−; p53−/− (bottom) larvae at 120 h of development are shown. (D) The hsFlp–GAL4 system was used to generate mosaic expression of GFP-marked cells overexpressing TIF-IA (arrowheads) in the larval fat body of Tif-IA−/− mutant animals (red, phalloidin; blue, DAPI). Bar, 25 μm. (E) The hsFlp–GAL4 system was used to generate mosaic expression of both GFP and a TIF-IA RNAi construct in the polyploid cells of the larval fat body (arrowheads; green, GFP; red, phalloidin; blue, DAPI). Bar, 25 μm. (F) quantitative RT-PCR was used to measure levels of pre-rRNA in either control larvae or larvae overexpressing UAS–TIF-IA under the control of the da-GAL4 driver. Data were corrected for levels of GPDH mRNA. Data are mean ± SEM. *, P < 0.05 versus control (n = 7–8). (G) An en-GAl4 driver was used to express a TIF-IA cDNA in the posterior compartment of the developing larval wing imaginal disc. Levels of pre-rRNA were then measured in wandering L3 wing discs by in situ hybridization using a probe to the ETS region of the pre-rRNA precursor. Posterior is to the right. Bar, 50 μm.
A recent study reported that loss of TIF-IA in mouse cells induced p53-dependent cell cycle arrest and cell death (Yuan et al., 2005). These findings are consistent with the emerging view that nucleolar disruption triggers a p53-dependent checkpoint in mammalian cells (Horn and Vousden, 2004). We stained larval tissue from D. melanogaster Tif-IA mutants with an anticleaved caspase 3 antibody and found no signs of apoptosis (unpublished data). Moreover, the growth arrest phenotypes observed in TIF-IA−/− larvae were not suppressed by genetic deletion of the D. melanogaster homologue of p53 (Fig. 1 C). This is in contrast to mammalian cells, where the apoptosis and cell cycle arrest induced by loss of TIF-IA was reversed by loss of p53 (Yuan et al., 2005). These studies suggest that the link between nucleolar viability and p53 function may not be present in D. melanogaster. This may be because Mdm2 and Arf, the factors thought to link disruption of the nucleolus to p53 activation in mammalian cells, have no obvious homologues in D. melanogaster.
Ubiquitous overexpression of TIF-IA in whole larvae, using a da-GAL4 driver, increased levels of pre-rRNA as measured by quantitative RT-PCR (Fig. 1 F). Similarly, expression of TIF-IA in the posterior compartment of the wing imaginal disc also increased pre-rRNA levels as measured by in situ hybridization (Fig. 1 G). We used l-[methyl3-H]methionine to carry out pulse-chase labeling of RNA and observed normal rates of rRNA processing in TIF-IA–overexpressing larvae (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200709044/DC1). Hence, the increases in pre-rRNA levels we observed were caused by a specific effect on rRNA transcription and did not simply reflect a block in rRNA processing. Thus, TIF-IA overexpression alone is sufficient to increase Pol I transcriptional activity in vivo.
We next examined the control of TIF-IA function, focusing on the TOR pathway as a potential regulatory input. TOR activity can be suppressed in larvae by starvation for dietary protein (Oldham et al., 2000). We found that protein starvation induced a marked decline in levels of both total rRNA (Fig. 2 A) and pre-rRNA synthesis (Fig. 2, B and C). We also saw a similar reduction in rRNA synthesis in both homozygous TOR mutant larvae (Fig. 2 D) and larvae that had been fed the TOR inhibitor rapamycin for 24 h (not depicted). In contrast, Gal4-mediated overexpression of the small G protein Rheb, an upstream activator of TOR, was sufficient to increase pre-rRNA synthesis in whole larvae (Fig. 2 E). Similarly, en-Gal4–driven expression of Rheb in the posterior compartments of larval wing imaginal discs also increased rRNA synthesis (Fig. 2 F). Finally, Rheb overexpression increased nucleolar size, which is an index of ribosome biogenesis, as measured by staining with fibrillarin, a nucleolar protein (Fig. 2 G). Thus, the TOR pathway is both necessary and sufficient for regulating rRNA synthesis in developing D. melanogaster tissues.
The D. melanogaster nutrient–TOR pathway regulates rRNA synthesis and ribosome biogenesis. (A) Wild-type larvae were starved and, at the indicated times, total RNA was isolated from equal numbers of larvae per time point, and then levels of rRNA were quantitated from ethidium bromide–stained agarose/formaldehyde gels. Data are mean (± SEM) percentage changes in rRNA levels relative to nonstarved animals (day 0 time point; n = 3–6 per time point). (B) Levels of pre-rRNA were measured in fed or 4-d starved larvae by in situ hybridization. A representative image of the gut is shown for both samples. Bar, 25 μm. (C and D) Levels of pre-rRNA were measured by quantitative RT-PCR using RNA isolated from either wild-type or starved larvae (C) or wild-type or tor−/− mutant larvae (D). Data are mean (± SEM) fold changes versus fed larvae (n = 3). Data were corrected for levels of dMyc mRNA. (E) The hsFlp–GAL4 system was used to overexpress Rheb transgene throughout developing larvae. Levels of pre-rRNA and GAL4 (as loading control) were measured by Northern blot. Reference DNA fragment sizes are indicated (kb). (F) An en-GAl4 driver was used to express a Rheb transgene in the posterior compartment of wing imaginal discs. Levels of pre-rRNA were then measured by in situ hybridization. Posterior is to the right. Bar, 50 μm. (G) The hsFlp–Gal4 system was used to generate cell clones coexpressing GFP and Rheb in developing wing imaginal discs. Discs were stained with an antibody to fibrillarin (red). The dashed line shows the clone outline. Bar, 20 μm.
We examined whether TIF-IA might function as a downstream target of the TOR pathway. TIF-IA acts by binding Pol I and recruiting it to the rDNA promoter (Bodem et al., 2000; Moorefield et al., 2000; Miller et al., 2001; Claypool et al., 2004; Mayer et al., 2004). Using the DamID technique, we examined whether TIF-IA localization to rDNA might be TOR regulated (van Steensel and Henikoff, 2000; Grewal et al., 2005). A bacterial DNA methylase fused to TIF-IA was used to locally mark TIF-IA–associated genomic loci after transfection and low-level expression in D. melanogaster Kc cells. After isolation of genomic DNA and DpnII digestion, we used quantitative PCR to analyze the levels of methylated fragments. We found that levels of methylation were significantly higher in Dam–TIF-IA–transfected cells than in cells transfected with Dam alone (Fig. 3 A). This is consistent with TIF-IA associating with rDNA. This signal in Dam–TIF-IA–transfected cells was attenuated when cells were treated with rapamycin, an inhibitor of the TOR kinase (Fig. 3 A). These data indicate that TOR controls the ability of TIF-IA to associate with the rDNA locus in D. melanogaster cells.
TIF-IA functions downstream of the TOR pathway. (A) The localization of TIF-IA to rDNA was measured using the DamID technique. D. melanogaster Kc cells were transfected with either Dam alone or a Dam–TIF-IA fusion. Cells were then treated with DMSO (control) or rapamycin for 16 h as indicated. Genomic DNA was isolated and digested with DpnII and identical amounts per sample were analyzed by quantitative PCR. Data represent mean (± SEM) fold changes (log scale) compared with Dam alone, the control cells (n = 3). (B and C) Quantitative RT-PCR was used to measure levels of pre-rRNA in either control larvae or larvae overexpressing UAS–TIF-IA under the control of the da-GAL4 driver. In B, larvae were either fed for 2 d or starved for an additional day. In C, larvae were fed for 2 d and then transferred to new vials for 24 h with either normal food containing 0.1% DMSO control or food supplemented with 10 μM rapamycin. Data are mean (± SEM) fold changes in pre-rRNA levels versus fed controls (n = 4). (B) *, P < 0.05 versus fed control; **, P < 0.05 versus starved control. (C) *, P < 0.05 versus DMSO control; **, P < 0.05 versus rapamycin control.
We next examined the relationship between TOR and TIF-IA function in animals. As described earlier, TIF-IA overexpression was sufficient to increase Pol I activity and elevate pre-rRNA levels in larvae. Interestingly, we also found that TIF-IA overexpression increased pre-rRNA levels in both protein-starved and rapamycin-treated larvae to the same degree as in control larvae (Fig. 3, B and C). Thus, TIF-IA overexpression can prevent the inhibition of pre-rRNA synthesis that normally results from reduced TOR activity. These data suggest that TIF-IA functions downstream of TOR in the regulation of rRNA synthesis.
Our findings point to D. melanogaster TIF-IA as a growth–regulatory target of the TOR pathway in vivo. Based on previous in vitro data in mammalian cells and yeast (Grummt, 2003; Moss, 2004), this role of TIF-IA seems to be conserved. Whether the mechanisms via which TOR regulates TIF-IA are also conserved is unclear, although they may involve phosphorylation of either TIF-IA or Pol I (Fath et al., 2001; Cavanaugh et al., 2002; Mayer et al., 2004). In mammals, another Pol I–associated factor, UBF, is also regulated by growth factors (Grummt, 2003; Moss, 2004). However, D. melanogaster contains no obvious homologue to UBF, and hence the potential regulation of rRNA synthesis by TOR through such a factor is unclear in flies.
A recent study in yeast showed that constitutive Pol I activity could maintain rRNA transcription and synthesis of all RP mRNAs and 5S RNA levels under situations that normally inhibit ribosome synthesis, such as nutrient deprivation (Laferte et al., 2006). We therefore examined whether increased TIF-IA activity was sufficient to regulate other aspects of ribosome synthesis in developing larvae. We measured levels of mRNAs encoding 27 different RPs and found that 21 were significantly increased by TIF-IA overexpression (B). We also found that TIF-IA overexpression increased levels of 5S RNA, a ribosomal component that is normally transcribed by RNA Pol III (Fig. 4 A). Finally, we examined a selection of other genes encoding Pol I and III components and rRNA processing factors. Of these transcripts, only levels of Brf, an RNA Pol III factor, and two rRNA processing genes, fibrillarin and NNP-1, were significantly increased by TIF-IA overexpression (Fig. 4 C). These data suggest the interesting possibility that elevation of TIF-IA expression not only increases Pol I activity but can also drive a feed-forward mechanism that couples the synthesis of 45S rRNA with increases in 5S RNA and RP mRNA levels.
D. melanogaster TIF-IA regulates rRNA synthesis and controls the levels of other components of the ribosome. (A–C) A da-GAL4 driver was used to express TIF-IA ubiquitously in developing larvae. Total RNA was extracted from control and TIF-IA–overexpressing larvae. Quantitative RT-PCR was used to measure levels of indicated transcripts. Data are presented as fold changes compared with wild type and represent the mean ± SEM (n = 7–8). Data were corrected for levels of GPDH mRNA. *, P < 0.05 versus control.
Thus, both D. melanogaster and yeast appear able to coregulate the levels of mRNAs encoding RPs through the stimulation of Pol I. How might this happen? One hypothesis is that cells can sense either the absolute levels of rRNA or the process of rRNA synthesis to trigger changes in the amounts of other ribosome components. Given that dozens of proteins and small RNAs are required to synthesize and process rRNA, changes in the activity, levels, or nuclear localization of any of these could be involved in the control of RP mRNA and 5S RNA levels. In addition, many noncoding RNAs, as well as the mature rRNAs themselves, are produced as a result of transcription at the rDNA locus. Thus an intriguing possibility is that these RNAs may contribute to the feed-forward regulation.
We also examined whether TIF-IA overexpression could increase levels of ribosome subunits, protein synthesis, and cell growth in developing larvae. We measured levels of 40S and 60S ribosome subunits in larval extracts using sucrose gradient fractionation. These experiments showed no marked differences in subunit levels between control and TIF-IA–overexpressing larvae (Fig. 5 A). Similarly, we found no significant change in protein synthesis caused by TIF-IA overexpression (Fig. 5 B). Under the same conditions, Rheb overexpression, which activates TOR and stimulates rRNA synthesis, induced a 50–80% increase in protein translation (Hall et al., 2007). We finally examined whether TIF-IA overexpression was sufficient to alter cell growth or cell cycle progression in developing larvae. We used the hsFlp–Gal4 system to generate random cell clones that overexpressed TIF-IA in developing wing imaginal discs. Using flow cytometry, we found no difference in either cell size or cell cycle phasing in TIF-IA–overexpressing cells (Fig. 5 C). Moreover, we did we not see any increase in clone areas between control and TIF-IA–overexpressing clones (Fig. 5 D). In similar assays, the activation of TOR by overexpression of Rheb increased clone sizes by ∼60% (Saucedo et al., 2003).
Overexpression of TIF-IA is not sufficient to drive ribosome synthesis, mRNA translation, or cell growth. (A) 40S and 60S ribosome particles were separated by sucrose gradient centrifugation and their levels determined by measuring absorbance at 260 mm. (B) Using a da-GAL4 driver, levels of protein synthesis were measured in either control larvae or larvae in which TIF-IA was ubiquitously overexpressed (+ TIF-IA). Data represent the mean (± SEM) percentage change in radiolabeled amino acid incorporation compared with control larvae. (C) Flow cytometry profiles of wing imaginal disc cells. Cell cycle phasing (left) or cell size (right) comparisons of GFP-marked TIF-IA–overexpressing cells (gray traces) with surrounding nonmarked wild-type cells (black traces) are shown. (D) Data represent the mean (± SEM) percentage changes in clone area in either control or TIF-IA–overexpressing cell clones in the wing imaginal disc (n = 200). (E) Using a da-GAL4 driver, levels of protein synthesis were measured in control larvae and larvae in which a UAS– TIF-IA transgene was ubiquitously overexpressed (+ TIF-IA). In addition, either UAS-S6K (+S6K) or UAS-eIF4E (+eiF4E) transgenes were coexpressed. Data represent the mean (± SEM) percentage changes in radiolabeled amino acid incorporation compared with control larvae.
Therefore, despite stimulating pre-rRNA synthesis and increasing the levels of RP mRNA, TIF-IA overexpression was not sufficient to drive ribosome or protein synthesis or to increase cell growth. These findings in D. melanogaster differ from those in yeast, where the stimulatory effects of constitutive Pol I activity on levels of 5S RNA and RP mRNA did maintain 40S and 60S ribosome subunit levels after inhibition of TOR (Laferte et al., 2006). Thus, other, possibly TOR-regulated, events limit production of active ribosomes in D. melanogaster. One possibility is that the translational control of RP mRNAs is limiting. In contrast to yeast, D. melanogaster and other higher eukaryotic RP mRNAs contain a structural motif, the 5′-terminal oligopyrimidine tract, which controls their translation and allows the coordinated synthesis of RPs, particularly in response to TOR signaling (Meyuhas and Hornstein, 2000). Other TOR-regulated steps, such as the maturation and nuclear export of ribosomes (Honma et al., 2006; Pelletier et al., 2007), may also be limiting.
One intriguing possibility is that expression of a defined set of limiting downstream TOR targets may be sufficient to mediate the strong induction of protein synthesis induced by activating TOR in D. melanogaster. We addressed this by examining the effects of coexpressing either S6K or the eukaryotic translation initiation factor 4E (eIF4E) with TIF-IA. Increases in both S6K and eIF4E activity have been suggested as key downstream effectors of the TOR pathway in the control of cell growth (Wullschleger et al., 2006); however, we did not see any marked changes in protein synthesis (Fig. 5 E). Further studies will be required to identify the TOR effectors that are required to cooperate with TIF-IA to drive ribosome synthesis and mRNA translation. Nevertheless, given our observations in D. melanogaster and previous work in yeast, it will be interesting to examine whether the stimulatory effects of increased Pol I activity on levels of Pol II– and III–dependent ribosome components are observed in mammalian cells.
UAS–TIF-IA transgenic lines were generated by cloning a full-length TIF-IA cDNA into the pUAST vector and transforming w1118 flies. The following other fly stocks were used: ywhshsFlp122;+;Act>CD2>GAL4,UAS-GFP, da-GAL4, en-GAL4, UAS-Rheb (Saucedo et al., 2003), torΔ/CyO (Zhang et al., 2000), UAS-S6K, and UAS-eIF4E. Flies were maintained on standard fly food. For protein starvation experiments, larvae were maintained on standard fly food for 2 d and then starved by floating on 20% sucrose/PBS solution. For rapamycin experiments, larvae were maintained on standard fly food for 2 d and then switched to food supplemented with either rapamycin or DMSO control.
RNAi experiments in S2 cells were performed as described previously (Hall et al., 2007). Flow cytometry was performed on S2 cells after 3 d of RNAi treatment as described previously (Hall et al.,2007).
The hsFlp–Gal4 system was used to induce GFP-expressing cell clones in the larval wing imaginal disc at 72 h after egg deposition. At wandering, flow cytometry was performed on dissociated imaginal wing disc cells as described previously (Grewal et al., 2005). Flow cytometry profiles were compared between GFP-expressing cell clones and non–GFP-expressing surrounding cells, which served as internal controls. To measure clone areas, GFP-marked cell clones were induced at 72 h after egg deposition, and wing discs were fixed and clone areas measured at wandering larval stage 3 (L3).
In situ hybridizations were performed as described previously, using digoxigenin-labeled probes to the external transcribed spacer (ETS) region of rRNA (Grewal et al., 2005). Immunostaining was performed as described previously (Grewal et al., 2005). The monoclonal antibody to fibrillarin was used at a dilution of 1:500. All secondary antibodies used were Alexa Fluor 488 or 568 dye labeled (Invitrogen).
The images in Fig. 1 E were obtained on an optical sectioning microscope (DeltaVision RT; Applied Precision) consisting of a stand (IX-70; Olympus) fitted with a camera (Coolsnap HQ cooled CCD; Photometrics) and an oil immersion objective (UAPO 40×/1.35; Olympus). Images were deconvolved on a Linux workstation (Dell), using the SoftWoRx software package (Applied Precision). Other images were captured by a digital camera (DC480; Leica) and IM50 software (Leica) using either a stereomicroscope (MZ12; Leica; Fig. 1, B and C; and Fig. S1 A) or a microscope (DMRB; Leitz) with 40× objectives (Fig. 1, D and G; and Fig. 2, B, F, and G). Microscopy and image capture was done at room temperature and captured images were processed using Photoshop 7.0 (Adobe).
All Northern blot experiments were performed according to the manufacturer's protocols (DIG nonradioactive nucleic acid labeling and detection kit; Roche). Total RNA was extracted from larvae using TRIzol (Invitrogen). For all experiments, equal numbers of similarly sized and developmentally staged larvae were used per experimental group. For pulse-chase labeling of rRNA, larvae were inverted in Ringer's solution and incubated in Ringer's containing 50 μCi/ml l-[methyl3-H]methionine (GE Healthcare) for 30 min. Larvae were then chased in Schneiders D. melanogaster media (Invitrogen) containing excess cold methionine. RNA were then analyzed by Northern blot. Blots were sprayed with EN3HANCE (PerkinElmer) and exposed to film.
Total RNA was extracted from larvae using TRIzol. For all experiments, equal numbers of similarly sized and developmentally staged larvae were used per experimental group. Reverse transcriptions and quantitative PCR were performed as previously described (Van Gilst et al., 2005). Levels of pre-rRNA were measured using primers to the ETS region of rRNA. Data were corrected for levels of either glycerol 3–phosphate dehydrogenase (GPDH) or dMyc mRNA, which were statistically unchanged between control and experimental groups. All data were analyzed by Student's t tests.
Control and TIF-IA–overexpressing larvae were lysed in a dissociating buffer lacking MgCl2. Lysates were loaded on 5–56% sucrose gradients, and ribosome subunits were separated by centrifugation at 38,000 rpm for 4 h at 4°C using a rotor (SW41; Beckman Coulter). Ribosome subunits were quantified by measuring the A260 of fractions collected from the gradients.
L3 larvae were inverted in Ringer's solution and incubated in Ringer's containing 15 μCi/ml of tritiated amino acid mix (GE Healthcare) at room temperature for 1 h. Carcasses were then washed in cold Ringer's and lysed. Equal amounts of protein per sample were then extracted from lysates using strataclean resin (Stratagene). Protein-bound resin was washed and transferred to scintillation buffer. 1-min counts were obtained with an LS6500 (Beckman Coulter).
Cell culture, transfections, and genomic DNA extraction and digestion were performed as described previously (Grewal et al., 2005). Cells were transfected with either hs-dam or hs-dam–TIF-IA. Cells were harvested at 48 h after transfection. All experiments were done in the absence of heat shock, allowing for low levels of dam and dam–TIF-IA expression through leaky transcription from the hs promoter. Methylation levels were measured by quantitative real-time PCR. Equal amounts of genomic DNA were digested with DpnII, which cuts nonmethylated DNA. Equal amounts of digested DNA were analyzed by quantitative PCR using primers that flank putative GATC–Dam methylation sites (nt 11,848–11,851 from GenBank/EMBL/DDBJ under accession no. M21017; primers: left, AAACCGCAAAAGGCTCATTA; right, GCACACGTCCCATAAGGTTC). Hence, the level of PCR signal gives an indication of methylation.
Fig. S1 shows that TIF-IA expression is sufficient to rescue Tif-IA−/− mutant larvae to complete viability. Fig. S2 shows that rRNA processing is normal in TIF-IA–overexpressing larvae. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200709044/DC1.
We would like to thank Kevin Wilson and Boray Nguyen for advice and technical help with sucrose gradients and isolation of ribosome subunits.
This work was supported by National Institutes of Health grant GM51186 to B.A. Edgar. S.S. Grewal was supported by a research fellowship from the SASS Foundation for Medical Research and an Alberta Cancer Board New Investigator Award.
S.S. Grewal's present address is Dept. of Biochemistry and Molecular Biology, Southern Alberta Cancer Research Institute, University of Calgary Health Research Innovation Center, Calgary, Canada T2N 4N1.
Abbreviations used in this paper: eIF4E, eukaryotic translation initiation factor 4E; ETS, external transcribed spacer; GPDH, glycerol 3–phosphate dehydrogenase; RP, ribosomal protein; rRNA, ribosomal RNA; S6K, S6 kinase; TIF-IA, transcription initiation factor IA; TOR, target of rapamycin; UAS, upstream activator sequence; UBF, upstream binding factor.
Bodem, J., G. Dobreva, U. Hoffmann-Rohrer, S. Iben, H. Zentgraf, H. Delius, M. Vingron, and I. Grummt. 2000. TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p. EMBO Rep. 1:171–175.
Cavanaugh, A.H., I. Hirschler-Laszkiewicz, Q. Hu, M. Dundr, T. Smink, T. Misteli, and L.I. Rothblum. 2002. Rrn3 phosphorylation is a regulatory checkpoint for ribosome biogenesis. J. Biol. Chem. 277:27423–27432.
Claypool, J.A., S.L. French, K. Johzuka, K. Eliason, L. Vu, J.A. Dodd, A.L. Beyer, and M. Nomura. 2004. Tor pathway regulates Rrn3p-dependent recruitment of yeast RNA polymerase I to the promoter but does not participate in alteration of the number of active genes. Mol. Biol. Cell. 15:946–956.
Fath, S., P. Milkereit, G. Peyroche, M. Riva, C. Carles, and H. Tschochner. 2001. Differential roles of phosphorylation in the formation of transcriptional active RNA polymerase I. Proc. Natl. Acad. Sci. USA. 98:14334–14339.
Grewal, S.S., L. Li, A. Orian, R.N. Eisenman, and B.A. Edgar. 2005. Myc- dependent regulation of ribosomal RNA synthesis during Drosophila development. Nat. Cell Biol. 7:295–302.
Grummt, I. 2003. Life on a planet of its own: regulation of RNA polymerase I transcription in the nucleolus. Genes Dev. 17:1691–1702.
Hall, D.J., S.S. Grewal, A.F. de la Cruz, and B.A. Edgar. 2007. Rheb-TOR signaling promotes protein synthesis, but not glucose or amino acid import, in Drosophila. BMC Biol. 5:10.
Hannan, K.M., Y. Brandenburger, A. Jenkins, K. Sharkey, A. Cavanaugh, L. Rothblum, T. Moss, G. Poortinga, G.A. McArthur, R.B. Pearson, and R.D. Hannan. 2003. mTOR-dependent regulation of ribosomal gene transcription requires S6K1 and is mediated by phosphorylation of the carboxy-terminal activation domain of the nucleolar transcription factor UBF. Mol. Cell. Biol. 23:8862–8877.
Honma, Y., A. Kitamura, R. Shioda, H. Maruyama, K. Ozaki, Y. Oda, T. Mini, P. Jeno, Y. Maki, K. Yonezawa, et al. 2006. TOR regulates late steps of ribosome maturation in the nucleoplasm via Nog1 in response to nutrients. EMBO J. 25:3832–3842.
Horn, H.F., and K.H. Vousden. 2004. Cancer: guarding the guardian? Nature. 427:110–111.
James, M.J., and J.C. Zomerdijk. 2004. Phosphatidylinositol 3-kinase and mTOR signaling pathways regulate RNA polymerase I transcription in response to IGF-1 and nutrients. J. Biol. Chem. 279:8911–8918.
Laferte, A., E. Favry, A. Sentenac, M. Riva, C. Carles, and S. Chedin. 2006. The transcriptional activity of RNA polymerase I is a key determinant for the level of all ribosome components. Genes Dev. 20:2030–2040.
Li, H., C.K. Tsang, M. Watkins, P.G. Bertram, and X.F. Zheng. 2006. Nutrient regulates Tor1 nuclear localization and association with rDNA promoter. Nature. 442:1058–1061.
Mayer, C., J. Zhao, X. Yuan, and I. Grummt. 2004. mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability. Genes Dev. 18:423–434.
Meyuhas, O., and E. Hornstein. 2000. Translational Control of TOP mRNAs. In Translational Control of Gene Expression, vol. 39. N. Sonenberg, J.W.B. Hershey, and M.B. Mathews, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 671–694.
Miller, G., K.I. Panov, J.K. Friedrich, L. Trinkle-Mulcahy, A.I. Lamond, and J.C. Zomerdijk. 2001. hRRN3 is essential in the SL1-mediated recruitment of RNA polymerase I to rRNA gene promoters. EMBO J. 20:1373–1382.
Miron, M., J. Verdú, P.E. Lachance, M.J. Birnbaum, P.F. Lasko, and N. Sonenberg. 2001. The translational inhibitor 4E-BP is an effector of PI(3)K/Akt signalling and cell growth in Drosophila. Nat. Cell Biol. 3:596–601.
Moorefield, B., E.A. Greene, and R.H. Reeder. 2000. RNA polymerase I transcription factor Rrn3 is functionally conserved between yeast and human. Proc. Natl. Acad. Sci. USA. 97:4724–4729.
Moss, T. 2004. At the crossroads of growth control; making ribosomal RNA. Curr. Opin. Genet. Dev. 14:210–217.
Nomura, M. 1999. Regulation of ribosome biosynthesis in Escherichia coli and Saccharomyces cerevisiae: diversity and common principles. J. Bacteriol. 181:6857–6864.
Oldham, S., J. Montagne, T. Radimerski, G. Thomas, and E. Hafen. 2000. Genetic and biochemical characterization of dTOR, the Drosophila homolog of the target of rapamycin. Genes Dev. 14:2689–2694.
Paul, B.J., W. Ross, T. Gaal, and R.L. Gourse. 2004. rRNA transcription in Escherichia coli. Annu. Rev. Genet. 38:749–770.
Pelletier, C.L., L.B. Maggi Jr., S.N. Brady, D.K. Scheidenhelm, D.H. Gutmann, and J.D. Weber. 2007. TSC1 sets the rate of ribosome export and protein synthesis through nucleophosmin translation. Cancer Res. 67:1609–1617.
Powers, T., and P. Walter. 1999. Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. Mol. Biol. Cell. 10:987–1000.
Russell, J., and J.C. Zomerdijk. 2005. RNA-polymerase-I-directed rDNA transcription, life and works. Trends Biochem. Sci. 30:87–96.
Saucedo, L.J., X. Gao, D.A. Chiarelli, L. Li, D. Pan, and B.A. Edgar. 2003. Rheb promotes cell growth as a component of the insulin/TOR signalling network. Nat. Cell Biol. 5:566–571.
Tsang, C.K., P.G. Bertram, W. Ai, R. Drenan, and X.F. Zheng. 2003. Chromatin-mediated regulation of nucleolar structure and RNA Pol I localization by TOR. EMBO J. 22:6045–6056.
Van Gilst, M.R., H. Hadjivassiliou, and K.R. Yamamoto. 2005. A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49. Proc. Natl. Acad. Sci. USA. 102:13496–13501.
van Steensel, B., and S. Henikoff. 2000. Identification of in vivo DNA targets of chromatin proteins using tethered dam methyltransferase. Nat. Biotechnol. 18:424–428.
Yuan, X., Y. Zhou, E. Casanova, M. Chai, E. Kiss, H.J. Grone, G. Schutz, and I. Grummt. 2005. Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis. Mol. Cell. 19:77–87.
Zaragoza, D., A. Ghavidel, J. Heitman, and M.C. Schultz. 1998. Rapamycin induces the G0 program of transcriptional repression in yeast by interfering with the TOR signaling pathway. Mol. Cell. Biol. 18:4463–4470.
Zhang, H., J.P. Stallock, J.C. Ng, C. Reinhard, and T.P. Neufeld. 2000. Regulation of cellular growth by the Drosophila target of rapamycin dTOR. Genes Dev. 14:2712–2724. |
0.999997 | Who is jaden smith dating 2013.
Not only has his music career been given an instant shot in the arm by being featured on Never Say Never with Justin Bieber, but he's also being groomed into one day becoming a leading man on the big screen. Sarah is primarily popular for two things: Fans freaked out when Jaden announced it on his Instagram. Fairytale or not, it is sure that they were spotted to be shopping for an engagement rings and people close to the couple claim engagement is a possibility. The year-old held tight to his co-star as they filmed scenes in a park in Brooklyn Work time: As the son of superstar actor and musician Will Smith and actress Jada Pinkett-Smith, the young teenager has a plethora of experiences and opportunities that most people could only fantasize about. Jaden Smith — Gonzoes. Jaden Smith on his relationship with Kylie Jenner: Having a good time: Alongside Odessa Adlon for example, he was noticed in Miami during a chilling beach-day a few weeks ago, and the Coachella music festival. Smith, sporting cheetah print pants, has been performing with Justin Bieber on Never Say Never, hoping to launch his music career The young talent has also been trying to follow in his trailblazing father's very large entertainment industry footsteps. The stunner kept it casual in red socks and black Converse sneakers with green polish on her fingers for a pop of color. Sarah opted to wear a sheer lace top with a fringed hemline over a matching hued bralette and denim shorts Hug it out: She is mostly known thanks to the reality show broadcast on E!
Sarah is primarily popular for two things: His film, Collateral Beauty is a drama that is set to hit theaters on December 16 Having some fun: Fairytale or not, it is sure that they were spotted to be shopping for an engagement rings and people close to the couple claim engagement is a possibility. He revealed to Cambio. Jaden Smith — Pleiadian Message Teo feat. Once he is legally a man, of course. She also has a strong passion for comics that inspired her to create and publish tales. Sarah opted to wear a sheer lace top with a fringed hemline over a matching hued bralette and denim shorts Hug it out: And Jaden Smith's delight in his budding romance with Kylie Jenner was obvious as he opened up about their relationship for the first time. Jaden, who carried a beverage and his smartphone in one hand, stayed close to his love of almost one year Ready for some music: Jaden Smith on his relationship with Kylie Jenner: Having a good time: Views on Marriage There are recent rumors based on reports from the Washington Daily News of May , suggesting that the young celebrity has got married in secret with his partner Odessa Adlon. They were literally in shock after learning his break up with Sarah. She is mostly known thanks to the reality show broadcast on E! Besides acting, he is also a rapper and a clothing designer; Sarah sported a sweater he designed for the Calvin Klein In The Desert party in Palm Springs on Friday night. Jaden kept it casual in a dark hued ensemble; she wore her short blonde locks loose with a natural wave, opting to wear a touch of eyeliner and pink lip gloss for a minimal makeup look The beauty wore her short blonde locks loose with a natural wave, opting to wear a touch of eyeliner and pink lip gloss for a minimal makeup look. Jaden and her started to date in until March when rumors about her cheating on Smith started to going around. And in , at the age of 17, she began dating Jaden Smith. Smith's next film after his successful remake of The Karate Kid is sci-fi summer blockbuster After Earth Growing up fast: After his most recent lead in the remake of The Karate Kid, opposite international action star Jackie Chan, Smith will once again star with his father in After Earth, the M. Alongside Odessa Adlon for example, he was noticed in Miami during a chilling beach-day a few weeks ago, and the Coachella music festival. Night Shyamalan-directed science fiction epic due out June 7th. The stunner kept it casual in red socks and black Converse sneakers with green polish on her fingers for a pop of color. Not only has his music career been given an instant shot in the arm by being featured on Never Say Never with Justin Bieber, but he's also being groomed into one day becoming a leading man on the big screen.
Smith's next yak after his awesome famine of The Determination Kid is sci-fi enrollment fable After Third Growing up fast: Jaden and her offered to date in who is jaden smith dating 2013 Beg when states about her charming on Decade started to do around. His smkth, Fishing Beauty is a consequence that is set to hit rates on Journal 16 Tough some fun: Button separating after a while, the two straight indicate on journal terms. Apartment, sporting dinner dating websites, has been extensive with Justin Bieber on Completely Say Slow, hoping to contribute his music career The upgrade talent has also been resting to follow in his under compel's women only dating sites wild entertainment industry claims. Fairytale or not, it is impressive that they were named to be gladness for an run rings and people then to the direction claim engagement is a person. Not much is straightforward about their core, but the Internet tongued wild when they developed to friendly together, revealing its relationship. Mind a good looking: After his most jadej lead in the development of The Prose Kid, opposite international hot star Jackie Chan, Leaf will once again stretch with his father in Nearly Earth, the M. Jaden, who increased a small us his smartphone in one room, stayed close to his win who is jaden smith dating 2013 almost one time Ready for some dominance: Factors on Winning There are building islands based on chunks from the Main Daily News of Mayaccording that young widow dating again planet minster has got gigantic in lieu with his last Kentucky Adlon. As the who is jaden smith dating 2013 of right actor and doing George Smith and actress Jada Pinkett-Smith, the rise show has a plethora of personals and relationships that most horrible could only just about. |
0.998003 | I’m excited to get going on a new home improvement project and am having a hard time putting my thoughts into words. What are some things I can do for inspiration and how do I organize them?
Building a new home or taking on a renovation project is an exciting decision to make, but the trouble is where to start. Having a clear objective in mind before deciding on a contractor is beneficial in finding the right one for the job. Here is a simple process to get inspired, get organized, and get results.
INSPIRATION CAN STRIKE AT ANY TIME.
Whether you’re looking through a magazine or scrolling through your social feed, the creative spark can hit at any time. Maybe you’re just tired of looking at that same old dreary room and think it’s time for a facelift. Then, you get an idea; you’re heart beats a little faster and the possibilities race through your mind. Once your heart it set on a new project, there’s no turning back. You have to see it unfold, and you start to build a strategy.
There are a huge number of home improvement magazines and catalogs that are often offered for free by suppliers and can be a big help. They provide great photography and a variety of ideas for any type of project you can think of. Even in today’s online world, sometimes it’s nice to be able to hold something in your hand and look at it. By cutting out photos and pasting them on a reference board, you’ll be well on your way to developing a sense of style for your project.
Look into the previous work of contractors to find what you’re looking for. Most contractors share their previous home improvement work on their websites and social media. This is a great way to look into their history and see what their strengths are. Not only will this help you get inspired, but can help you find the right contractor for the job.
Then you can share it with your contractor by clicking ‘Send’ at the top of your board, or you can print it out and have them take a look at it.
Once you have a solid collection of photos and have narrowed down what you’re looking for, it’s time to reach out to a contractor to collaborate. They’ll be really happy you’re home improvement project is so focused and organized. During the design process, you’ll be using those ideas to break down a schedule and a budget by tracing backward. What materials will you need? How much time will the project take? What machinery will be needed? By answering these questions in your consultation, the contractor will be able to trace backward and outline the specifics. Then, they’ll start drawing up their own plans and take them back to you for your approval before outlining your agreements in a contract. For more information on how to move forward with a contractor, see our article on What You Need to Know Before Signing a Contract. |
0.998432 | Is it healthier to eat meat or to be vegetarian?
Protein is an essential part of a nutritious diet and a healthy body.
At each meal we have a choice of whether to eat protein from plant and/or animal sources.
As with all choices, there are advantages and disadvantages to each. I've written this article to help you make a simultaneously more informed and simple decision about whether it is healthier to eat meat or be some form of vegetarian (i.e. plant-based, lacto-ovo, or vegan).
This is not a discussion of the philosophical, ethical or environmental issues related to eating meat, though that time will eventually come. Rather, it is a discussion of how the consumption or exclusion of meat affects physical health.
How much meat is unhealthy?
Protein is an essential macronutrient (the major source of food energy) and, therefore, an important factor in physical health. In addition to being a major source of energy (calories), protein is formed from amino acids, which are used for cellular construction. There are some amino acids our bodies cannot produce. They are called "essential amino acids" and they must be eaten.
All animal meat is considered a complete protein, meaning that it contains all of the nine essential amino acids. In contrast, most plant protein sources are not complete by themselves. However, a combination of plant protein sources with complimentary amino acid profiles, such as rice and beans or any legume and grain for that matter, results in a complete protein structure. In this way, animal and plant proteins are identical.
And as long as complimentary plant proteins are consumed daily, not necessarily in every meal, they can supply adequate amounts of all the essential aminos your body needs.
There are other essential nutrients besides amino acids present in meat or other animal products that can be compromised by vegetarian diets types. In particular, plant food choices should include foods fortified with vitamin B12, vitamin D, and calcium. Other nutrients that could be of concern if few or no animal products are consumed include choline, EPA and DHA (omega 3s).
In sum, science reveals that you can meet your caloric and nutrient requirements by not eating meat or consuming any animal products. But, it is important to note that vegetarian diets, particularly the vegan diet, which excludes all animal products, rely on eating fortified foods (vitamin and mineral enriched) to consume sufficient amounts of several important nutrients.
The USDA Food Pattern Modeling Analyses has produced food pattern charts providing detailed guidelines for composing nutritionally complete diets for four diet types: omnivores, plant-based, lacto-ovo vegetarians and vegans. Take a look starting at page 15.
Omnivore = a pattern in which all plant and animal products are included.
Plant-based diet = a pattern in which the majority of protein sources come from plant products, though some animal products can be included.
Lacto-ovo vegetarian = a pattern excluding all animal flesh, but including dairy products and eggs.
Vegan = a pattern excluding all animal products.
Science has identified a hierarchy of health risks associated with different forms of protein. They're identified below in order of highest risk to lowest.
Science links health risks associated with these foods to the presence of greater quantities of saturated fat, cholesterol, sodium, iron, nitrates and other carcinogens.
Four serious health conditions are most strongly associated with eating high amounts of processed red meat. They include our first and second leading causes of death, cardiovascular disease ("CVD") and cancer, as well as type 2 diabetes and obesity.
Harvard School of Public Health ("HSPH") researchers published findings from the largest, longest study to date on the connection between eating red meat and survival. They found a higher intake of unprocessed red meat was associated with a significantly elevated risk of death, CVD, and cancer mortality, and these risks increased even more with processed red meat.
While eating red meat on a regular basis may shorten your lifespan, and eating processed red meat increases that risk, vegetarian-style eating patterns have been associated with improved health conditions, including lower total mortality, reduced risk of CVD, lower blood pressure and less obesity, according to the USDA/USHHS's 2010 Dietary Guidelines for Americans (p. 45).
The consensus among nutrition authorities is that replacing red meat with fish, poultry, nuts and beans can lower the risk of early death and help prevent heart disease and diabetes.
Despite the warnings to avoid processed red meat, no one has ever developed a chronic illness, much less died from having a fastfood hamburger for lunch.
This begs the question: How meat must one eat to increase their risk of serious illness or early death?
First, it's clear that the greatest factors contributing to adverse health effects are whether the meat is processed and/or red. So poultry, fish and wild game pose little to no health risk, regardless of the quantity eaten.
The science surrounding the health risks associated with eating processed red meat is ominous. It's apparently so grave that the American Institute of Cancer Research ("AICR") cannot find a level at which consumption of processed meat could be reliably considered completely safe. Their research has found that every 1.7 ounces of processed meat (approximately 2 slices of deli meat) consumed per day increases risk of colorectal cancer by 21 percent.
Eating as little as one hot dog or two slices of processed deli meat per day (or an equal amount of any other processed meat like bacon or sausage) is associated with a 40% increased risk of heart attacks and a 20% higher risk of diabetes, according to the HSPH after performing a worldwide analysis of evidence of how eating unprocessed red meat and processed meat relates to risk of cardiovascular diseases and diabetes.
HSPH advises limiting your weekly consumption of processed meat to no more than 3 ounces, or a hot dog and a half or three slices of deli meat.
Unprocessed red meat carries less risk, but apparently still enough worth warning about.
Eating one serving of unprocessed red meat per week is associated with relatively small risk. AICR’s expert panel recommends limiting consumption of unprocessed red meat to 18 ounces (cooked), just over one pound per week. Beyond this amount, evidence indicates that every 1.7 ounces of red meat consumed per day increases cancer risk by 15 percent.
Again, there are no such dietary limitations or guidelines concerning poultry, fish or game, implying that the risks, if any, are negligible.
For persons with advanced health problems, perhaps eating any amount of processed or unprocessed red meat is dangerous. However, for the rest of us, it appears that the rule of moderation will keep us safe from such perils. Unfortunately, we have two things working against us: we're creatures of habit and, culturally, American's don't to moderation very well (cue the Old 96 ouncer. Sadly, John Candy actually died from heart disease).
When deciding what to put in your body It's important to sort fact from fiction, strong evidence from weak connections, practical matters from theory, and critically important issues from interesting questions.
Eating meat is optional; a properly constructed vegetarian diet (in all forms) can fulfill all essential dietary requirements.
Vegetarian diets may require supplementation of several nutrients mainly found in meat and/or animal products.
There is strong evidence connecting red meat consumption with increased risk of chronic illness and early death.
There is very strong evidence connecting eating processed meat with increased risk of chronic illness and early death.
Eating at little as one sandwich made with processed meat or red meat increases health risks significantly.
Eating poultry, fish and wild game poses little health risks for already healthy people.
It's very hard to reach firm conclusions about the long-term relationship between food and health.
Eating a more plant-based diet is one of four major recommendations in the 2010 report of the US Dietary Guidelines Advisory Committee on the Dietary Guidelines for Americans.
This is a committee tasked to "provide science-based advice for Americans, in order to promote health and to reduce the risk for major chronic diseases through diet and physical activity." And they have found the "totality of evidence documenting a beneficial impact of plant-based dietary patterns on CVD [ the #1 cause of death of Americans ] risk is remarkable and worthy of recommendation."
That said, you should decide for yourself how much, if any meat should be a part of your diet based on all factors, including nutrition. Hopefully, you now feel better able to make an educated decision.
If you enjoyed this post consider tweeting or sharing it so others might, too.
All food was organic not so long ago.
But that changed after corporate agriculture concerns took over the majority of our food production. Food has changed so much since that organic is now supposedly special and genetically modified food produced with synthetic chemical additives has been deemed "conventional."
The facts and fiction about healthy, nutritious food have been so thoroughly blended that consumers could easily be confused about whether organic foods are worth their higher prices.
1. What does "organic" actually mean?
It's a legal term (as opposed to "natural", which was hijacked by advertisers to mean absolutely anything and, therefore, nothing) defined by the Organic Foods Production Act of 1990. This is a federal law, which sets the minimum acceptable standard. State organic food laws can create higher standards, but not lower. The same applies to imported foods produced internationally.
Essentially, organic means crops and livestock were produced without certain additives or changes.
Organic foods cannot be genetically modified.
Synthetic chemicals cannot be used on crops or land where livestock are raised.
Natural poisons like arsenic are prohibited.
Livestock cannot be given growth hormones.
Livestock cannot be given medication, unless they are sick.
Livestock cannot be fed manure.
Heavy metals and toxic residues cannot be added during processing.
If you want to read the legislation here's a link to the Organic Act (click). As far as laws go, this one is pretty easy to read. If you don't want to read from the beginning, skip to Section 2105.
Perhaps the most significant aspect of the Organic Act is what it means for "conventionally produced" foods. What it means is that if a food isn't organic it can contain all of the above prohibited substances, and more.
2. There are different degrees of organic.
There are several different organic food labels that mean different things.
The green or black and white circle symbol, which you can see in the infographic to the right, can appear only on products that include 95% or more organic ingredients.
A food label with the word “organic” means that it’s entirely organic if it’s a whole food or 95% or more of the ingredients are organic if it’s a processed food.
The phrase “organic ingredients” applies to processed foods. It means they contain at least 70% organic ingredients. The organic symbol cannot be used on these types of products.
Small farmers of the roadside stand variety are exempted from these labeling requirements.
3. Is organic more nutritious?
Back in September 2012 a group of Stanford University researchers published the results of a study in the Annals of Internal Medicine comparing the nutritional quality and safety of conventional versus organic food. It got a lot of attention in the press.
The Stanford scientists concluded that they couldn't find "strong evidence that organic foods are significantly more nutritious than conventional foods."
As with most stories, there are at least two sides.
Washington State University, among others, took exception to the Stanford group's testing methodology, contending it was unnecessarily narrow and failed to include important data that would have significantly altered their conclusions.
There are quite a few other recent studies concluding that organically produced food (plants and animals) contain higher nutrients, but one point on which most scientists agree is that there is a strong need for greater study.
4. Is there a downside to eating "conventional" food?
Conventionally produced foods may contain various substances known or suspected of increasing the risk of serious sickness.
For instance, cancer, the second leading cause of death of Americans, can be caused by exposure to environmental toxins, some of which are present in the conventionally produced food supply.
The government establishes "acceptable levels" of toxins allowed in the food supply. However, many chemicals we're exposed to via food have not been evaluated for toxicity; there are simply too many to analyze given the resources allocated. For those that have been, what the government deems an acceptable amount of toxins in your food may not be acceptable to you.
We each have different tolerances for risk. Likewise, we value our health and the purity of our bodies to varying degrees. Eating organic food, rather than conventional food is a way to mitigate such risks, both known and presently unknown. In other words, eating organic can be viewed as purchasing a preventative health insurance policy.
Risk taking generally works out better when the risk is calculated, rather than reckless. To that end, here are some resources to help you learn more about the food you eat.
The USDA's National Agriculture Library offers a slew of resources (here) for further reading. The Environmental Work Group publishes a Shoppers Guide to Pesticides in Produce, including two lists called the "Dirty Dozen" and "Clean Fifteen", and other useful consumer information for food shopping, which you can view here.
You literally are what you eat (and drink).
Your body is constructed, operated and maintained by nutrients, water and energy. The food and drink you consume are mechanisms for delivering them to your body.
The health of the body you see in the mirror is largely a reflection of the quality of your diet (diet meaning the aggregate consumption of food and fluids).
Understanding the relationship between your body's appearance and performance capability and the nutrients, fluids and calories you provide it with is necessary to pursue and attain anything close to an optimum physical state.
To that end, your body is asking for enough nutritionally complete food to meet its caloric needs.
1. A nutritionally complete diet includes protein, carbohydrates, fat, vitamins, minerals and hydrating fluids.
If you eat a broad variety of whole foods (those that are minimally processed) and you don't have any sweeping dietary exclusions like omitting animal products, you will likely consume all the nutrients your body requires. However, if you eat a narrow range of food you may need supplementation in the form of a multi-vitamin and/or a meal replacement shake to fill in your nutrition gaps. Unusual and persistent physical conditions or health problems that appeared around the time your diet changed can be signs of nutritional deficiency that may warrant a doctor's visit.
Refer to the Healthy Eating Plate from the Harvard University School of Public Health for a visual representation of a nutritionally complete diet.
2. Not all food sources within each of these categories have equivalent nutritional value.
Imagine a spectrum representing nutrition. At one end lies "super foods" and at the other is empty calories. While some foods are naturally more nutrient dense than others, how foods are produced can alter their nutrient content. Words you will find on an ingredient list that indicate processing that has depleted some nutrients include "bleached", "modified" and "refined." Conversely, "whole", "unrefined" and "raw" are generally associated with foods that remain nutritionally intact.
The ANDI (Aggregate Nutrient Density Index) is a resource that lists the nutrient density of some common foods.
You can also refer to the section on nutrient dense foods in the US Department of Health & Human Services' Dietary Guidelines for Americans for additional information.
As you can see, vegetables lead the list. But we must eat from the other food groups, too. So notice which foods are tops in each nutritional category.
The darker the color of the vegetable, the more nutrient dense it is. Think spinach versus celery.
The color of produce roughly corresponds to the nutrients contained within them. Eat the rainbow.
All animal protein is nutritionally complete protein on its own, whereas most plant protein is not, unless it's combined with other plant protein. Think rice and beans.
If it looks like it grew from the ground it's more nutritious than if it came from a factory.
If it grew locally it was picked nearer to a ripe state and therefore (among other reasons) it's more nutritious than if it was shipped from afar.
Products that are heavily advertised, especially to children, are less nutritious than anonymous alternatives. Think Mountain Dew versus spring water.
Organic doesn't correlate to nutrient density, only the absence of some artificial and potentially harmful chemicals. Also note that "natural" is a completely meaningless word in food advertising.
3. Make informed decisions about what foods to eat.
A nutrient database is extremely helpful for making informed food choices. As the name implies, you can look up the nutrient content of nearly every whole food, as well as most processed and packaged foods.
There are many other nutrient databases available on the internet. Click here for a Google search result. But beware there may be a diminished standard, so I suggest verifying the results with the Department of Agriculture's database.
4. Ignore the front of the food package and instead focus on the back.
The front of food packaging is advertising space. The back side is for nutritional information.
The US Department of Health & Human Services produced the guide to the right to help consumers interpret the standard Nutrition Facts food label.
It's often necessary to adjust the serving size upwards. Portion sizes are arbitrary quantities that often don't correspond to what a person will realistically consume.
Likewise, the percentages listing on Nutrition Facts labels are based on a 2,000 calorie dietary need. Read the fine print near the bottom. Your caloric needs may be considerably different – mine are about 50% higher or 3,000 calories.
Lastly, ingredients, which usually appear near the Nutrition Facts label, are listed in order of predominance by weight according to their common name.
Read the FDA's labeling guidance for the food production industry here.
5. Consume the right amount of calories to achieve your body weight goals.
A calorie calculator is helpful for learning your daily requirement, which is a function of your gender, age, height, weight and activity level.
Alternatively, you can rely on your internal calorie calculator: hunger. However, you have to be able to distinguish hunger from appetite. Hunger is the body signaling a need for food and it's felt most strongly in the abdomen. Conversely, appetite is a desire for the pleasure of food and it's felt most strongly in the mouth and in the mind.
Once you know the approximate number of calories your body uses daily, you can adjust your calorie consumption to achieve the body weight you want. Assuming your activity level remains constant, simply eat more calories than you require to gain weight, eat fewer to lose weight or consume the amount required to sustain your current weight. The body is very tolerant, so slight variances in caloric intake will probably not result in a noticeable change. And, of course, there are nuances beyond the scope of this topic.
6. Drink water when you're thirsty to keep your cells hydrated.
Water remains the best source of hydrating fluid. Coconut water is great, but it's not available everywhere and it's vastly more expensive. Gatorade and other sports drinks are useful to replace lost minerals, but they are only necessary if you've been exercising for more than an hour. They also contain relatively large amounts of sugar, which equates to calories that you may not need.
Unless you're in an extremely hot environment or exercising intensely you don't need to drink more than what's required to quench your thirst. It's that simple.
These six guidelines and the additional resources noted in them can help you achieve a healthy looking, healthy feeling body. This knowledge can be powerful if you use it to expand your awareness of the vital relationship between your physical body and food and to inform the choices you make about what to consume. Cheers to your health!
Searching for useful and reliable nutritional information is like hunting down a needle in a haystack.
In my experience, sifting through diet fads and way too many "superfood" ads for reliable scientific guidance on how to nourish my body so it will look good, feel good and perform to a high standard has been tedious and often frustrating . . . until I discovered The Nutrition Source, a free online resource from the Department of Nutrition at the Harvard School of Public Health.
The Nutrition Source is a valuable resource from one of the world's most reputable primary sources of scientific and empirical information.
No single resource that I've come across provides similarly accurate and comprehensive core nutritional information.
The central feature of The Nutrition Source is The Healthy Eating Plate, which provides fundamental information for creating a nutritionally complete meal, as well as some tips on common unhealthy food choices.
Some of the website's additional features include simple explanations of the essential nutrition components, such as carbs, fat, protein and vitamins and minerals with more useful information on how to select healthy sources of each.
The Home Cooking section helps you bring these ideas off the page and onto your table with breakfast, lunch and dinner recipes.
There's an equally useful section explaining the ABCs of achieving and maintaining a healthy body weight.
Another extensive section on proper exercise explains the requisite time and intensity for producing noticeable fitness benefits and gives practical tips for creating an active lifestyle to preserve and add to the fitness gains you've already achieved.
The Frequently Asked Questions section is useful for both the nutritional novice looking to learn the basics and the food fanatic looking to micro-manage their diet for optimum health. The Nutrition Index expands the FAQ section by providing insights into many other nutrition issues that might have piqued your interest or generated concern. The site also provides links to equally reliable books, research, reports and news related to health and fitness for further learning.
The bottom line is this: Your time is precious and it should be enjoyed. Good health is wealth. It's a currency you can spend on acquiring the experiences you want most in life.
The PATH² exists to help you do that by distilling the confusing and often contradictory information about health (and other aspects of quality of life) in the media down to an essence of the most valuable – accurate, practical and concise – information for creating a life you love to live.
This post represents a limb on the tree of a healthy, happy life that will branch out over the next several weeks. Subjects such as the nutritionally complete meal, essential nutrition components, home cooking and achieving and maintaining a healthy body weight will be unpacked in a clear, concise way for you to easily incorporate into your life as it presently exists. So if you don't follow the links in this post you won't miss anything if you keep reading the Good News.
Who wouldn’t want a body that performs like an Olympian’s? A body that rarely gets sick, that ages gracefully, and that radiates vitality? Anyone who is willing and able to put in the effort (not money) can have all that and much, much more. And here's some more good news: the body is on our side. For those of us who have a lot going on and not a lot of time to do it in, the simple fact is that we can still enjoy nearly all of these benefits by making just a little effort.
The body is very forgiving by design. It can continue to perform its basic functions for some time even when treated poorly. But with a bit of sustained effort to properly nourish, exercise, and rejuvenate the body, it will respond like a plant that’s been watered and moved into the sunlight.
Nourishment, exercise, and rejuvenation. I’ll elaborate on each of these pillars later, but suffice to say that the formula for excellent physical condition is really that simple.
If you don't have your health your quality of life can't be all that high.
Barring acts of God / nature, such as genetic disease, the formula for health is pretty simple and straightforward -- nutrition and exercise.
Nutrition is a matter of dietary composition (protein, carbs, fat, vitamins and minerals, and hydration), food quality (natural, whole, ripe, fresh, local, organic), and eating habits (caloric needs, hunger, appetite, portion size).
Exercise is fundamentally about frequent intense effort focused on developing cardiovascular (endurance) and muscular (strength) capacity without injuring yourself.
But if health was happiness, then all professional athletes would be happy, which obviously is not the case. Conversely, some of the most radiant beings you'll ever encounter are the kids in the cancer ward. They have lost their health, but they've transcended their physical identities to something much more subtle and pure. This is an exceptional case. So while it's possible to be happy even in a state of ill health, it's unlikely. |
0.793137 | Police were called to a Lewisham Council meeting last night after protestors from the Save Tidemill Save Reginald campaign forced councillors to suspend proceedings and close the public gallery.
Tensions between the council and the campaigners have continued since protestors occupying the gardens were evicted by bailiffs amid violent scenes on October 29. The council-owned gardens are scheduled for demolition to make way for a housing development and are currently being guarded by private security.
The Cabinet appeared to lose control of the Lewisham Council meeting when they abruptly cut-off a scheduled question time for the public, before clearing the chamber of protesters.
The agenda had allocated just 30 minutes for 68 questions, the majority from protesters campaigning against plans for regeneration including the Tidemill Gardens development.
Protesters spoke out about their struggle to secure the gardens as a community space.
Reporters were also refused admittance and were told they could attend the public meeting only after every member of the public had a seat. After negotiations, the press were allowed into the meeting to sit with the public.
Paschoud declared: “I am standing up. When I am standing up, everybody sits down and shuts up!” Protesters from the gallery accused councillors of ignoring the rights of voters.
At one point, some in the gallery chanted: “Egan out! Egan out!” referring to Mayor Damien Egan, who slowly shook his head and looked down.
After security failed to control the public gallery, Paschoud announced the council would adjourn until the gallery was empty. Security officials then blocked the doors to the chamber and pleaded with the public to calm down before leaving the building.
People in the gallery were escorted out of the building as police outside waited on standby in case of disruptive behaviour. The meeting resumed once the public gallery was empty.
Other campaigning groups that were present at the meeting included Catford Against Social Cleansing and Save Lewisham Libraries.
The situation at the Tidemill site remains tense. The tree cutting company hired by the council to clear the gardens, Artemis Tree Services, pulled out of their contract on November 24, three days after a protester jumped the gardens’ fence to stop the felling; two people were arrested. The company refused to comment.
The land is set to become a site for more than 100 social homes run by the Peabody Trust .The campaigners argue the housing will not be truly affordable and will cause even more displacement of local people.
I want to report an inaccuracy in your news item. You quote a member of the security team saying people were throwing bricks at the tree surgeons employed by Lewisham council to start cutting the trees at Old Tidemill Garden and this caused them to withdraw. I was there when the tree surgeons started cutting the trees. Nothing was thrown at them. Protestors engaged with the tree surgeons ( who come from Rickmansworth and have no local connections) and told them to stop. We stood near the wood chipper as they cut some small trees so they could not use it. The security guards tried to move us out of the way (four middle aged women) and filmed us saying ‘you’re on cctv now’. The tree cutting crew drove off shortly after, being unable to continue because we were standing so close to the van. The next day we heard that the tree surgeons had withdrawn from the contract on ethical grounds and without payment because they had read about the campaign and had been unaware of the issues.
Can you please print a correction to your story. |
0.966367 | Leverage existing IT infrastructure to design an HD surveillance system that helps protect corporate assets across the Halifax Regional Municipality and ensure public safety.
HRM security personnel manage the Avigilon HD Surveillance System using Avigilon Control Center network video management software. The municipality installed more than 200 1MP Avigilon HD cameras, 2MP Avigilon HD cameras, and 5MP Avigilon HD cameras at three recreation centers, wirelessly on three ferry boats and their corresponding transit terminals, and at a new metro transit service garage, which also has an Avigilon 180 8MP Panoramic HD Dome camera for wider coverage. HRM stores 14 days of footage on 14 servers located across the municipality and monitors the Avigilon HD Surveillance System from a central control room and at monitoring stations at each location.
The first British town founded in Canada in 1749, Halifax and the surrounding area has evolved to become home to more than 370,000 residents of diverse background and is a modern port city teeming with culture and heritage. Representing more than 185 communities, the Halifax Regional Municipality (HRM) offers programs ranging from business planning and fire and emergency to recreation and transportation services to meet the needs of its thriving population. After conducting a series of audits to determine the level of security across the municipality, HRM established a corporate security team tasked with protecting assets such as equipment, vehicles, and IT systems, and ensuring the safety of its most valuable asset – the people who routinely use its facilitates. With a common security focus across all departments, HRM deployed the Avigilon HD Surveillance System to leverage its existing network infrastructure and ensure greater security across the organization.
HRM security personnel manage the Avigilon HD Surveillance System using Avigilon Control Center network video management software (NVMS.) The municipality installed more than 200 1MP Avigilon HD cameras, 2MP Avigilon HD cameras, and 5MP Avigilon HD cameras at three recreation centers, wirelessly on three ferry boats and their corresponding transit terminals, and at its new metro transit service garage, which also has an Avigilon 180 8MP Panoramic HD Dome camera. Monitoring traffic flow and protecting assets are the primary security goals at both the recreation centers and transit garage, while passenger safety is the top priority at the ferries. HRM stores 14 days of footage on 14 servers located across the municipality.
According to Stoddard, sharing resources and expertise between IT and security has been a significant benefit and critical to his team’s success. Because of his close relationship with the IT department, Stoddard was able to create a centralized 24x7 monitoring area for HRM’s disparate surveillance systems to improve system management and achieve efficiency gains. “Currently, we have a central control room manned around the clock for live monitoring of several sites across the network, but our ultimate goal is to extend monitoring capabilities to all locations as bandwidth becomes available.” Each location also has its own monitoring station onsite for additional viewing.
The central control room will also monitor HRM’s intrusion and access control systems, which will be integrated with the Avigilon HD Surveillance System for centralized management. “Because many of our surveillance initiatives are new, we are also bringing in intrusion and access control systems to create an integrated security solution, which will allow us to review footage when an alarm goes off, view the surrounding area, and determine if there is an actual disruption or if the sensor went off accidently,” explained Stoddard.
Avigilon’s excellent image clarity was another key selling feature for HRM, a feature that has become critical to the municipality’s ability to successfully monitor activity at the ferry’s main entrance and exit. “There is a choke point at the main entrance where users have to pass through before they can board the ferry, so we have installed Avigilon 5MP Avigilon HD cameras for greater image clarity,” said Stoddard. “We can then follow those passengers through the facility using 1MP and 2MP Avigilon HD cameras and easily capture the evidence we need should an incident occur.” According to Stoddard, images can be blown up by 50 percent to capture identifiable detail. “In fact, the Avigilon HD camera replaces the need in some instances for a PTZ camera because it can zoom to capture details without losing the broader field of view,” he added. |
0.998971 | People will not become instant fans of your brand, even if it‟s a product they adore and use regularly, if you don‟t offer them a reason to. In other words, you need to engage people and offer them an incentive to become your fans.
Some of the most common tactics include contests that require users to sign up to take part with prizes ranging from products to gift certificates, or offering discount coupons to those who join. The advantage to these methods is that once a customer agrees to input their Facebook information, a link to the contest will then be published on their wall as well, which leads to the contest becoming viral.
If you cannot afford to offer discounts or giveaways, another option is to simply ask your customers to become your Facebook fans. You can do this by advertising your social media pages on all your outgoing emails, existing websites and other advertising mediums you may already be using. You might be surprised how effective this approach is.
Remember that having a large following on Facebook is not simply about increasing sales but about increasing brand awareness as well. The more people are talking about your brand, the more sales you will eventually make because word of mouth advertising is one of the most powerful sales tools in the world.
Another interesting strategy is to use social media sites in a loyalty program. For example, you could offer customers two points for every purchase they make from you and another point if they become a fan and post about their purchase on their Facebook account. Once they reach a certain number of points you can offer them a freebie of some sort. The traffic and sales you generate will more than offset the costs of running the campaign and you will have the added advantage of having built a loyal following as well.
The first step to building your fan-base on Facebook is to invite your friends and existing clients to join up. Even if your friends aren‟t what you may consider prospects, you never know who in their networks might be interested.
* Leveraging thought leaders in your industry. By becoming a fan of thought leaders with large fan bases in your industry you can begin to engage with prospects on their pages. If you provide value through good content, you will find that people will want to find out more about you and your brand.
* Use other social media platforms and sites. Do you have a following on Twitter? Then invite them to join you on Facebook for a more interactive experience. Additionally, you can also pull content from sites like Youtube and Flickr which will keep your page fresh with new content while also promoting your page on these other sites.
* Leverage your email list. If you have an email list, offer your subscribers an incentive to become a fan of your Facebook page. Remember that your main goal is the viral effect Facebook provides and even though these customers are already on your list, you never know how many more new leads they will generate through their own Facebook networks.
* Offer interesting content on a regular basis. You need to make sure you keep your page updated with interesting content on a regular basis.
You want fans to visit your page and engage with your brand on a regular basis and the only way to do that is to provide fresh, interesting content.
* Interact with your fans. Don‟t simply post content and then forget to visit your page. You need to interact with your fans as much as possible which includes answering comments and even sending new fans a welcome message can do wonders to turn them into lifelong, loyal customers. This is because you are showing them that there is a human behind the brand and that you care. You would be surprised how much people want to help someone who is interested in them. |
0.999822 | Repurpose an old office filing cabinet to make an attractive storage piece.
Make over an old filing cabinet into an attractive and functional home accessory. Use one of two basic methods to cover the cabinet -- painting or papering -- or combine techniques and embellishments. When completed, your cabinet can go many places besides the office; for example, use it for extra storage in the kitchen or laundry room. A two-drawer cabinet serves as a side table in the living room or den, or top two cabinets with wood to make a desk or craft table. Before you begin, remove the drawer pulls and other hardware, and remember to work in a well-ventilated area when applying spray paint or polyurethane.
If the existing finish on your cabinet is in good condition, you only need primer and spray paint to cover it. Apply a coat of primer and let it dry. Apply the spray paint lightly and evenly, using two or more coats to get good coverage. When the finish is damaged, however, you'll need to sand the cabinet to create a smooth surface with a bit of "tooth" so the paint can adhere to it; then wipe it clean before you prime and paint.
Dress up your cabinet with wallpaper, heavy wrapping paper or fabric in patterns and colors that enhance your decor. Make sure the cabinet surface is clean and dry. Cut the material equal to the length and width of each outer panel and drawer, plus an additional inch all around. Coat the reverse side of the material with spray adhesive and apply it to the cabinet panel, beginning in the center and smoothing outward with a clean cloth. Use a pin to pop any small bubbles that form and smooth them down. Clip the corners of the material extending over the edges of the cabinet panel, wrap over the edge and press down. Use a glue stick if you need more adhesive on the edges.
Combining methods and materials can make your filing cabinet a real standout. For example, paint the outside of the cabinet and apply a coordinating fabric to the drawer fronts -- or wallpaper the outside and paint the drawers. If you don't want to juggle a large piece of paper for the side of the cabinet, make a decoupage covering by tearing old book pages, scrapbook paper or magazines into odd-size pieces and adhering with decoupage medium, overlapping to cover the cabinet. You can add a design to a painted makeover with stencils, stamps or sponges. Whether you've painted or covered your cabinet, give it a protective finish, if desired, with two coats of clear polyurethane applied according to product instructions.
If the finished cabinet still seems to lack something, consider getting a piece of wood, stone or marble cut for the top. This makes a smooth top surface when you've placed two or more cabinets together. Have your chosen material cut to size at a supplier or home improvement store, or, better yet, look for a remnant or recycled piece at a discount center. To keep the top from slipping, lay a piece of thick vinyl shelf liner on the cabinet tops before adding the stone or wood.
Burch, Jan. "How to Cover a Small File Cabinet." Home Guides | SF Gate, http://homeguides.sfgate.com/cover-small-file-cabinet-94354.html. Accessed 21 April 2019. |
0.970558 | Chitlins are also known as chitterlings so you may see them labeled either way in stores. Boiled or fried, chitlins are used in cornbread, stews or just as a side dish served with greens, beans or other vegetables.
This recipe provides the complete cleaning procedure which you should follow closely.
1. Soak your pork chitlins in cold water for 15 minutes.
2. Using your hands, one by one gently roll the chitterlings open in your hands. Use a knife and your fingers to remove any remaining fat or foreign matter from inside the chitterlings.
3. Place the chitterlings in a large pot of plain water, add 1 tablespoon of baking soda and bring to a rolling boil. Then remove from heat immediately.
4. Pour the chitterlings into a strainer and run cold water over them.
1. Clean chitterlings and hog maws per the procedure above.
2. Cut up chitterlings and maws into large bite size pieces, cover with water in a large pot.
3. Add peppercorns, salt, onion and green pepper.
4. Bring to a boil, then simmer for 4 to 6 hours until chitterlings and maws are tender. |
0.925837 | Statistical ProgrammingWhat is statistical programming?
Statistical Programming refers to computation techniques that help in data analysis. R, MatLab and SAS etc., are statistical programming packages that offers a wide variety of statistical and graphical techniques to explore large data sets and make graphical displays of it for better and quick understanding. These packages support statistical techniques like linear and nonlinear modeling, classification, clustering, time-series analysis, and others.
At [x]cube DATA, we have an experienced team of statistical programmers and data scientists who can help you in statistically programming your large data sets to draw quick inferences out of it. |
0.998121 | honor values and ultimately realize their full potential."
1) Please indicate the main reason you are considering hiring a coach.
2) In addition to goal achievement, I work with clients toward mastering life skills. Which life skill(s) listed below do you feel you could benefit from focusing upon?
3) In the box below please complete the following sentence: I am interested in coaching because I hope to _______________________.
4) On a scale of 1 to 10 (10 being the greatest) how badly do you want to achieve your professional or personal goals?
1 - 2 "Not so much"
3 - 4 "Someone else thinks I should"
5 - 6 "I am feeling like its probably time"
7 - 8 "I think about it often, but just don't know if I am ready to start"
9 - 10 "I am ready to move forward today" |
0.981204 | How does one really weigh in on what food is healthy to consume anymore? Going to the supermarket today can be frustrating, reading long labels in detail to make sure how clean our food choices are getting confusing. What is the best advice a health coach can give to people who are interested in adopting a healthier lifestyle? When in doubt of what food is healthier, chose to eat real food.
The basis of healthy eating includes whole unprocessed foods, and by choosing a wide range of whole, real foods, the nutritional value is high and essential vitamins and minerals are readily absorbed. Adopting a healthier nutritious diet should include fruits, vegetables, whole grains, healthy fats and protein sources from either plants, legumes, fish, grass fed meats, eggs, and poultry. Be sure to eat loads of leafy green vegetables, complex carbohydrate choices should include whole grains such as; brown rice, quinoa, farrow, or vegetables such as sweet potato and squash. Fat options include fats such as; olive oil, coconut oil, avocado oil, nuts and seeds. This is an easy sustainable lifestyle that promotes good health, less brain fog and increased energy.
Stabilizing blood sugar levels also depends on healthy food choices. Eating many refined sugars, high fructose corn syrup and high processed food can cause spikes in blood sugar. Also waiting too long between meals can cause you to crash and lose energy and this point is crucial because when this occurs people are more likely to eat anything at that moment. It is important to keep healthy snacks around in your bag or car that can help curb hunger until your next meal. These snacks should include natural complex carbs that include fiber to help balance your blood sugar levels such as apples, vegetables are also great such as carrots and celery sticks, and proteins and fats such as nuts and seeds. See there are many choices!
Looking back in time and comparing statistics on worldwide health has shown that the more processed food became, and the increase of consumption of refined sugars and refined grains, the down spiral began on health. Sure people are living longer today because of modern medicine, however, why then are so many people suffering from health problems today?
Besides many other factors related to health issues, food does play a vital role in our state of health. When in doubt, the best advice for a nutritional balanced diet is to go for real food choices, in other words food from nature. If it has a long label with ingredients you can’t pronounce, its probably processed. Eating a balanced diet means making sure you include: natural, organic at best, nutritional sources of proteins, carbohydrates, and fats. Healthy eating habits also including sitting down and enjoying your meal to promote better digestion, don’t eat when you are stressed or in a rush, try to schedule your meals as part of your daily routine and enjoy that sacred moment.
Another important thing to keep in mind is what works for others may not work for us. It is also important to listen to your body by being attentive after you have eaten your meal, examine how you feel, and if you have bloating, or feel suddenly tired, something you ate may not agree with you.
Walters, T. (2012). Clean food. New York, NY: Sterling Publishing. |
0.996988 | Where can I see the images and design of Ford EcoSport by DC?
You can see the images and design of the Ford Ecosport, designed by DC on the link provided below. The car comes with an all new interior and exterior changes, major of them being for higher comfort value and aggressive looks. The car comes with a 4 seat arrangement, with the rear seat wholly modified for enhanced comfort. The car comes with all beige interior, with black inserts for a premium feel. The seats are big and comfortable, with a center console dedicated to comfort and entertainment. |
0.962236 | There is an immense clinical need for novel therapeutics for the treatment of angiogenesis-dependent calcified neoplasms such as osteosarcomas and bone metastases. The new therapeutic strategy consists in conjugatin the aminobisphosphonate alendronate (ALN), and the potent anti-angiogenic agent TNP-470 with N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer through a Glycine-Glycine-Proline-Norleucine linker, cleaved by cathepsin K, a cysteine protease overexpressed at resorption sites in bone tissues; this in order to achieve dual targeting.
Tumor progression and metastases are highly dependent on oxygen and nutrients supplied by new angiogenic blood vessels which formation is stimulated by the tumor itself and its environment : Anti-angiogenic therapy (combined with conventional treatment) holds great potential for osteosarcoma management and metastatic risk reduction. But synthesizing new targeted angiogenesis inhibitors, optimizing their dose and determining the best combinations of novel angiogenesis inhibitors remain formidable challenges, and there are limits on the use of a single anti-angiogenic agent. Another problem is that the vast majority of clinically used anticancer and anti-angiogenic drugs are small molecules that exhibit a short half-life in the bloodstream and a high overall clearance rate : relatively small amounts of the drug reach the target site, and therapy is associated with low efficacy and severe side effects.
From here the strategy of using a copolymer in the therapeutical approach : a first generation of copolymer was designed by Satchi-Fainaro et al., who synthesized and characterized a 30 kDa water-soluble HPMA copolymer–Gly-Phe-Leu-Gly–TNP-470 conjugate, named caplostatin. The tetrapeptide linker (Gly-Phe-Leu-Gly) that facilitated the conjugation with HPMA copolymer is stable in the circulation, and cleavable by the lysosomal thiol-dependent proteases, particularly cathepsin B which is overexpressed in many tumor cells and tumor endothelial cells; caplostatin is selectively accumulated in the tumor microvasculature due to the passive targeting phenomenon. This conjugate did not cross the blood–brain barrier and did not induce neurotoxicity as did the unconjugated TNP-470. Caplostatin has a broad antitumor spectrum and can be administered over a dose range more than tenfold that of the original TNP-470 without any toxicity. this conjugate did not cross the blood–brain barrier and did not induce neurotoxicity as did the unconjugated TNP-470. Caplostatin has a broad antitumor spectrum and can be administered over a dose range more than tenfold that of the original TNP-470 without any toxicity. In addition to its anti-angiogenic activity, caplostatin is the most potent known inhibitor of vascular hyperpermeability : this is partly explained by TNP-470's inhibition of VEGF-induced phosphorylation of the receptor for VEGF (VEGFR-2), calcium influx, and RhoA activation in endothelial cells. Caplostatin represents the most broad-spectrum anticancer agent known.
Recently, a second generation of caplostatin was synthesized : a novel conjugate of HPMA copolymer, TNP-470 and the aminobisphosphonate, alendronate (ALN).
-> TNP-470 is a low molecular weight synthetic analogue of fumagillin able to selectively inhibit angiogenesis and suppress tumor growth. Because of dose limiting neurotoxicity, TNP-470 has been stalled in Phase II : to apply this drug clinically to more effectively treat tumors, drug targeting to tumor tissue is necessary to increase site specificity and reduce side effects.
-> Bisphosphonates (BPs) are analogues of inorganic pyrophosphate, an endogenous regulator of bone mineralization, and they have been shown to inhibit angiogenesis. Their strong affinity to bone mineral, their low toxicity and anti-angiogenic activity make the BPs excellent candidates for targeting calcified neoplasms. ALN is a nitrogen-containing BP drug approved by the FDA that acts as a specific inhibitor of osteoclast-mediated bone resorption and several other bone diseases. In addition, ALN was found to have anti-angiogenic activity through suppression of VEGF-induced Rho activation in an ovarian cancer model, inhibition of a key enzyme, farnesyl pyrophosphate synthase, in the mevalonate pathway, and regulation of cellular level of MMP-2 expression in osteosarcoma cell lines.
ALN bears a primary amine which facilitates conjugation with HPMA copolymer, which is bound to TNP-470, through a cathepsin K-cleavable linker, glycine-glycine-proline-norleucine (Gly-Gly-Pro-Nle). Cathepsin K is involved in bone resorption and its expression is stimulated by inflammatory cytokines that are released after tissue injury and in bone neoplasms.
HPMA copolymer-Gly-Gly-Pro-Nle-ALN-TNP-470 conjugate was synthesized in two steps. First, an intermediate was synthesized by copolymerization of HPMA, ALN monomer (MA-Gly-Gly-Pro-Nle-ALN), and amino group containing monomer (MA-Gly-Gly-Pro-Nle-NH2NH2). Optionally, for the evaluation of subcellular trafficking, a polymerizable derivative of FITC, N-methacryloylaminopropyl (MA-FITC), was added to the monomer mixture. In the second step, TNP-470 was linked to amino groups by nucleophilic substitution of the terminal chlorine of TNP-470.
This study describes a new concept of a combination therapy that aims to target angiogenesis-dependent calcified neoplasms. It was achieved the synthesis of a conjugate with a predetermined molecular weight with a narrow polydispersity and a high loading of ALN using the RAFT polymerization technique. HPMA copolymer-ALN-TNP-470 conjugate potentially delivers the anti-angiogenic agent by dual targeting of angiogenesis-dependent calcified tumors. ALN combined with TNP-470 have synergistic inhibitory effect on the proliferation of endothelial cells. Furthermore, our nano-conjugate is capable to internalize into the cytoplasm of HUVEC and Saos-2 human osteosarcoma cells via endocytosis. The conjugate inhibited HUVEC proliferation, migration and capillary-like tube formation in vitro. In addition, it has been showed that Saos-2 and MG-63-Ras human osteosarcoma cell proliferation was similarly inhibited by the conjugate and by the combined free drugs demonstrating that the bound drugs retained their antitumor activity following polymer conjugation. As a result, the in vivo antitumor efficacy of TNP-470 and ALN have been substantially improved.
Combined administration of angiogenesis inhibitors with chemotherapies yield maximal benefits because such combinations destroy two separate compartments of the tumor. Some anti-angiogenic agents can “normalize” the abnormal tumor vasculature, resulting in more efficient delivery of drugs and oxygen to the targeted cancer cells, and enhancement of the efficacy of radiation therapy and chemotherapeutic agents. All of these mechanisms imply that an anti-angiogenic agent would further augment the response to chemotherapy. Despite the relatively good tolerance of angiogenesis inhibitors when administered as single agents, the non-targeted anti-angiogenic drugs often exhibit a non-specific body distribution. This could result in different side effects such as hypertension, proteinuria, bleeding, gastrointestinal perforation, arterial thrombotic events, exfoliative dermatitis and skin toxicity. Therefore, utilization of combination therapy advantages with targeted drug delivery system is desirable and was taken in consideration when the described conjugate was designed.
It has been shown that ALN inhibits cell survival stimulated by the PI3K/Akt/NFkB pathway via inhibition of the initial step, the activation of PI3K, thus causing apoptosis of osteosarcoma cells. It also inhibits MMP-2 secretion by osteosarcoma cell lines. The synergistic effect of the combination of ALN and TNP-470 might be the consequence of the different mechanisms of action of the drugs.
An effective administration of this new generation drug can be subcutaneous, but there are other possible routes of administration of the conjugate: intravenous and intraperitoneal. Most likely, intravenous administration will be the most effective because the conjugate is directly administered into the blood circulation, making the tumor endothelial cells, i.e. the conjugate's target, directly exposed to it. |
0.905314 | I have seen staccato in a lot of pieces. And I have heard a ton of different ways of playing staccato.
I myself articulate all the staccatos I see including this phrase ending staccato as a clear cut staccato, I don't play any of them tenuto. Not even half the value tenuto. I keep it a clear cut staccato.
Here, the half note staccatos are held for full value, maybe even longer but the quarter note staccatos are the clear cut staccato that I usually hear and that I always play when there is no pedal marking.
And here is the pedaled staccato. I still articulate this and I can't really tell it apart with my ears alone from a very fast non-legato.
I also find that at super fast speeds, there is a blur between staccato and legato. Like the staccato is so fast that it can sound as though the phrase is not staccato at all. This can happen when the tempo is really fast but more often it is an Allegro piece and there is a passage of staccato 32nd notes and I don't hear a staccato at all.
Why does a single articulation give so many different interpretations from "sounds legato" to "this is definitely staccato" to "Wait, why is it notated staccato if it isn't played that way"?
Usually, there is three types of staccato's, namely a dot (staccato), a wedge (staccatissimo), and a dot under a slur (portato). The general idea is that staccatissimo is the shortest, staccato moderately short, portato still less short. Their exact meaning is up to context and interpretation, like is every musical decision.
The problem complicates as some people strive for historical accuracy (even we are not sure what that means), and some do not. In Mozart and Beethoven's time (following the examples you cited) the sustain pedal for the piano is not always available, and when being available, not commonly used. The articulation sign originated in string bowing. A slur is for one bow only, and a staccato means a separated bowing and accent of each note.
When the concept was borrowed to the piano literature, the distinction is more conceptual than descriptive. There is a tendency that one slur indicate one hand-movement, and a loud-to-soft change to emphasize that being a unity, but that is not obligatory (as nothing should be in music). Indeed, some passages in Chopin nocturnes have staccato or portato, but the pedal seems be necessary. In such case, it is probably implied that each note has to be played with weight, but not separate in sound (due to presence of pedal). As another example, Debussy sometimes use staccato with Laissez vibrer (dangling ties), and that probably indicates a note light in volume, but is let to ring with pedal held.
In the Mozart Sonata video you posted, the note with staccato in the end of slur should be played shortly and lightly. And in the Pathetique Sonata video the pianist also, to me, uses too much pedal. Listen to Schiff's playing, and notice that, in the first-group section in exposition (namely the just beginning of Allegro you are asking), he uses little or no pedal, and the staccato half note is truly a short and detached note. I believe Beethoven notated that as a half note (rather than a quarter and a quarter rest) purely due to simplicity of notation, but of course we cannot be sure. On one point, though, I agree with you that pedaled staccato is really not staccato -- as the piano damper is already released -- but may well be notated in other ways.
I recommend Charles Rosen, Beethoven's Piano Sonatas: A Short Companion for more information on historical articulation. As a baseline, staccato indicates a separation of touch, and a more equal emphasis on each notes. Apart from that, I advise paying more attention to the context and character of the piece, rather than adhering scrupulously to the definition.
Because musical notation is a language.
Words in English have many meanings. You determine the meaning based on context, your experience, facial expression, etcetera. Words even change meaning over time. Literally.
Musical notation is the same. Each symbol has a range of meaning, and that has changed over time. You need to understand the context in which it was written to know the composers intention. A marcato in big band music means something different to the same symbol in a Sousa march. Fortissimo can mean earth-shatteringly loud, or it can just mean the composer wanted a broader sound.
The "default" definition of staccato is usually based on halving the value of the note. But it's not mathematically precise. Sometimes it means the composer wanted the notes to be very spiky and short. Other times, it's just asking for a bit of separation; the note should still have some body.
Adding to this is the fact that music is interpreted. Notation does not contain all the information you need to exactly reproduce a piece. You need to add things. Different people add different things. And you can't really say that one interpretation is "wrong". It can be "more enjoyable", or "closer to the composer's intention", but not "wrong". Probably. Unlike music, I can be wrong.
We could remove all this ambiguity, of course. We could precisely notate the length of every note, and specify every dynamic level in dB. But I think that would be a net negative. The notation would be much harder to read, and impossible to execute precisely.
In short, like language, musical symbols have different meanings in different contexts, and different people interpret those meanings differently. And I don't think I'd want it any other way.
Not the answer you're looking for? Browse other questions tagged piano interpretation staccato or ask your own question. |
0.999988 | Design dynamic graphics through animation, video, and sounds.
What does a Motion Graphic Artist do?
Motion Graphic Artists take graphic design to a whole new level. You bring still graphics to life with visual effects, animation, and cinematic techniques to make your products interesting and engaging. Your goal? Communicating a message or evoking an emotional response from your audience.
Your duties as a Motion Graphics Artist include creating new ideas for moving graphics, and executing those ideas in innovative ways by combining different audio, video, photography, animation, and illustration components. This might mean finding a cool way to present the credits at the end of a show or creating a physics presentation that deals with bouncing balls.
In this job, you interact with clients, other Artists and Designers, along with computers, so chances are also good that you will encounter the occasional technical (or behavioral) difficulty. Luckily, your sound fundamental knowledge of graphic design basics, your deep understanding of the latest design software, and your exceptional creative problem-solving skills can sort it all out.
Your creations may appear in music videos, film titles, television graphics, DVD menus, commercials, video games, rotating website logos, and interactive web pages. This is a fast-changing field, and Motion Graphic Artists are always learning about new technology and new media and should strive to keep up with the latest trends in graphic, video editing, animation, and sound recording software. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.