Update README.md
Browse files
README.md
CHANGED
|
@@ -24,43 +24,48 @@ EXAMPLE
|
|
| 24 |
To generate predictions with DeepBind, you need two things:
|
| 25 |
|
| 26 |
1) a list of model IDs, and
|
| 27 |
-
2)
|
|
|
|
| 28 |
|
| 29 |
The file example.ids contains 4 example model IDs, one
|
| 30 |
on each line, reproduced here:
|
| 31 |
|
| 32 |
-
D00210.001 # RBFOX1 (RNAcompete)
|
| 33 |
-
D00120.001 # MBNL1 (RNAcompete)
|
| 34 |
-
D00410.003 # GATA3 (SELEX)
|
| 35 |
-
D00328.003 # CTCF (SELEX)
|
| 36 |
|
| 37 |
The file example.seq contains 4 example sequences, which
|
| 38 |
were chosen such that the nth sequence scores highly for
|
| 39 |
the nth model. The file example.seq is reproduced here:
|
| 40 |
|
| 41 |
-
AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
|
| 42 |
-
AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
|
| 43 |
-
GAGGTTACGCGGCAAGATAA
|
| 44 |
-
TACCACTAGGGGGCGCCACC
|
| 45 |
|
| 46 |
To generate 16 predictions (4 models, 4 sequences), run
|
| 47 |
the deepbind executable as follows:
|
| 48 |
|
| 49 |
% deepbind example.ids < example.seq
|
| 50 |
-
|
| 51 |
-
|
| 52 |
-
|
| 53 |
-
-0.
|
| 54 |
-
-0.
|
|
|
|
|
|
|
| 55 |
|
| 56 |
To see details of each ID, use the --dump-info flag:
|
| 57 |
|
| 58 |
% deepbind --dump-info example.ids
|
| 59 |
-
|
| 60 |
-
|
| 61 |
-
|
| 62 |
-
|
| 63 |
-
|
|
|
|
|
|
|
| 64 |
|
| 65 |
|
| 66 |
|
|
|
|
| 24 |
To generate predictions with DeepBind, you need two things:
|
| 25 |
|
| 26 |
1) a list of model IDs, and
|
| 27 |
+
2)
|
| 28 |
+
3) a list of DNA/RNA sequences.
|
| 29 |
|
| 30 |
The file example.ids contains 4 example model IDs, one
|
| 31 |
on each line, reproduced here:
|
| 32 |
|
| 33 |
+
* D00210.001 # RBFOX1 (RNAcompete)
|
| 34 |
+
* D00120.001 # MBNL1 (RNAcompete)
|
| 35 |
+
* D00410.003 # GATA3 (SELEX)
|
| 36 |
+
* D00328.003 # CTCF (SELEX)
|
| 37 |
|
| 38 |
The file example.seq contains 4 example sequences, which
|
| 39 |
were chosen such that the nth sequence scores highly for
|
| 40 |
the nth model. The file example.seq is reproduced here:
|
| 41 |
|
| 42 |
+
* AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
|
| 43 |
+
* AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
|
| 44 |
+
* GAGGTTACGCGGCAAGATAA
|
| 45 |
+
* TACCACTAGGGGGCGCCACC
|
| 46 |
|
| 47 |
To generate 16 predictions (4 models, 4 sequences), run
|
| 48 |
the deepbind executable as follows:
|
| 49 |
|
| 50 |
% deepbind example.ids < example.seq
|
| 51 |
+
|
| 52 |
+
|D00210.001| D00120.001| D00410.003| D00328.003|
|
| 53 |
+
| :----:| :----: | :----: |:----: |
|
| 54 |
+
| 7.451420 | -0.166146 | -0.408751| -0.026180|
|
| 55 |
+
| -0.155398 | 4.113817 | 0.516956| -0.248167|
|
| 56 |
+
| -0.140683 | 0.181295 | 5.885349| -0.026180|
|
| 57 |
+
| -0.174985 | -0.152521 | -0.379695| 17.682623|
|
| 58 |
|
| 59 |
To see details of each ID, use the --dump-info flag:
|
| 60 |
|
| 61 |
% deepbind --dump-info example.ids
|
| 62 |
+
|
| 63 |
+
|ID | Protein | Type | Species | Family | Class Experiment |
|
| 64 |
+
| :----:| :----: | :----: |:----: | :----: | :----: |
|
| 65 |
+
| D00210.001 |RBFOX1 |RBP |Homo sapiens |RRM |RNAcompete |
|
| 66 |
+
| D00120.001 |MBNL1 |RBP |Homo sapiens |Znf |RNAcompete |
|
| 67 |
+
| D00410.003 |GATA3 |TF |Homo sapiens |GATA |SELEX |
|
| 68 |
+
| D00328.003 |CTCF |TF |Homo sapiens |C2H2 ZF |SELEX |
|
| 69 |
|
| 70 |
|
| 71 |
|